Science.gov

Sample records for elements alpha hib

  1. Hib Photos

    MedlinePlus

    ... fluid culture positive for Haemophilus influenzae , type b (Gram stain) www.vaccineinformation.org/photos/hib_aap001.jpg ... Pediatrics Inferior view of a brain infected with gram-negative Haemophilus influenzae bacteria www.vaccineinformation.org/photos/ ...

  2. Haemophilus influenzae type b (Hib) Vaccine

    MedlinePlus

    ... influenzae type b (Hib) disease is a serious disease caused by bacteria. It usually affects children under 5 years old. It can also affect adults with certain medical conditions.Your child can get Hib disease by being around other children or adults who ...

  3. Facts about Hib Disease. ARC Facts.

    ERIC Educational Resources Information Center

    Association for Retarded Citizens, Arlington, TX.

    The fact sheet provides basic information about Hib Disease in young children, which may involve a bacterial meningitis causing mental retardation, hearing loss, partial blindness, speech disorders, partial paralysis, behavioral problems, or seizures. Stressed is prevention of Hib Disease through immunization. The question and answer format…

  4. Hib Disease (Haemophilus Influenzae Type b)

    MedlinePlus

    ... Making a Change – Your Personal Plan Hot Topics Meningitis Choosing Your Mood Prescription Drug Abuse Healthy School ... to more serious problems like blood infections or meningitis. Hib disease usually isn't a big worry ...

  5. {alpha} decay of even-even superheavy elements

    SciTech Connect

    Denisov, V. Yu.; Khudenko, A. A.

    2010-03-15

    The {alpha}-decay half-lives of even-even superheavy elements within the range of proton number 104<=Z<=126, which can be formed by possible cold and hot fusion reactions, are calculated in the framework of various approaches for {alpha}-decay half-life evaluation and by using the Q values of {alpha} transitions obtained within different approximations for atomic masses. The dependencies of {alpha}-decay half-lives of superheavy elements on model approaches for both the Q values and half-life calculations are discussed in detail.

  6. Hib Vaccines: Past, Present, and Future Perspectives.

    PubMed

    Zarei, Adi Essam; Almehdar, Hussein A; Redwan, Elrashdy M

    2016-01-01

    Haemophilus influenzae type b (Hib) causes many severe diseases, including epiglottitis, pneumonia, sepsis, and meningitis. In developed countries, the annual incidence of meningitis caused by bacteria is approximately 5-10 cases per population of 100,000. The Hib conjugate vaccine is considered protective and safe. Adjuvants, molecules that can enhance and/or regulate the fundamental immunogenicity of an antigen, comprise a wide range of diverse compounds. While earlier developments of adjuvants created effective products, there is still a need to create new generations, rationally designed based on recent discoveries in immunology, mainly in innate immunity. Many factors may play a role in the immunogenicity of Hib conjugate vaccines, such as the polysaccharides and proteins carrier used in vaccine construction, as well as the method of conjugation. A Hib conjugate vaccine has been constructed via chemical synthesis of a Hib saccharide antigen. Two models of carbohydrate-protein conjugate have been established, the single ended model (terminal amination-single method) and cross-linked lattice matrix (dual amination method). Increased knowledge in the fields of immunology, molecular biology, glycobiology, glycoimmunology, and the biology of infectious microorganisms has led to a dramatic increase in vaccine efficacy. PMID:26904695

  7. Hib Vaccines: Past, Present, and Future Perspectives

    PubMed Central

    Zarei, Adi Essam; Almehdar, Hussein A.; Redwan, Elrashdy M.

    2016-01-01

    Haemophilus influenzae type b (Hib) causes many severe diseases, including epiglottitis, pneumonia, sepsis, and meningitis. In developed countries, the annual incidence of meningitis caused by bacteria is approximately 5–10 cases per population of 100,000. The Hib conjugate vaccine is considered protective and safe. Adjuvants, molecules that can enhance and/or regulate the fundamental immunogenicity of an antigen, comprise a wide range of diverse compounds. While earlier developments of adjuvants created effective products, there is still a need to create new generations, rationally designed based on recent discoveries in immunology, mainly in innate immunity. Many factors may play a role in the immunogenicity of Hib conjugate vaccines, such as the polysaccharides and proteins carrier used in vaccine construction, as well as the method of conjugation. A Hib conjugate vaccine has been constructed via chemical synthesis of a Hib saccharide antigen. Two models of carbohydrate-protein conjugate have been established, the single ended model (terminal amination-single method) and cross-linked lattice matrix (dual amination method). Increased knowledge in the fields of immunology, molecular biology, glycobiology, glycoimmunology, and the biology of infectious microorganisms has led to a dramatic increase in vaccine efficacy. PMID:26904695

  8. Haemophilus influenzae Disease (Including Hib) Diagnosis and Treatment

    MedlinePlus

    ... Multimedia Related Links Global Hib Vaccination Hib Vaccination Meningitis Pneumonia Sepsis Diagnosis, Treatment, and Complications Recommend on ... the bacteria. For example, if H. influenzae cause meningitis (infection of the covering of the brain and ...

  9. Haemophilus influenzae Disease (Including Hib) Complications

    MedlinePlus

    ... Z Index MENU CDC A-Z SEARCH A B C D E F G H I J K L M N O P Q R S T U V W X Y Z # Start of Search Controls Search Form Controls Search The CDC Cancel Submit Search The CDC Haemophilus influenzae Disease (Including Hib) Note: Javascript is disabled or ...

  10. Protect Your Child against Hib Disease

    MedlinePlus

    ... 722 KB] View the Hib Vaccine Information Statement ( English ) or other languages ) Call 1-800-232-4636 (1-800-CDC- ... this? Submit What's this? Submit Button Past Emails Language: English Español (Spanish) File Formats Help: How do I ...

  11. Stability against {alpha} decay of some recently observed superheavy elements

    SciTech Connect

    Roy Chowdhury, Partha; Gangopadhyay, G.; Bhattacharyya, Abhijit

    2011-02-15

    The probability of {alpha}-particle emission for some recently observed superheavy nuclei (SHN) are investigated. The {alpha}-decay half-lives of SHN are calculated in a quantum tunneling model with density-dependent M3Y (DDM3Y) effective nuclear interaction using theoretical and measured Q{sub {alpha}} values. We determine the density distribution of {alpha} and daughter nuclei from the relativistic mean-field (RMF) theory using FSUGold force, NL3, and TM1 parameter sets. The double-folded nuclear potential is numerically calculated in a more microscopic manner using these density distributions. The estimated values of {alpha}-decay half-lives are in good agreement with the recent data. We compare our results with recently detected {alpha}-decay chains from a new element with atomic number Z=117 reported by the Joint Institute for Nuclear Research, Dubna. Finally, we determine the half-lives of superheavy elements with Z=108-120 and neutron number N=152-190 to explore the long-standing predictions of the existence of an 'island of stability' due to possible spherical proton (Z{approx}114) and neutron (N{approx}184) shell closures.

  12. Sandia Higher Order Elements (SHOE) v 0.5 alpha

    SciTech Connect

    2013-09-24

    SHOE is research code for characterizing and visualizing higher-order finite elements; it contains a framework for defining classes of interpolation techniques and element shapes; methods for interpolating triangular, quadrilateral, tetrahedral, and hexahedral cells using Lagrange and Legendre polynomial bases of arbitrary order; methods to decompose each element into domains of constant gradient flow (using a polynomial solver to identify critical points); and an isocontouring technique that uses this decomposition to guarantee topological correctness. Please note that this is an alpha release of research software and that some time has passed since it was actively developed; build- and run-time issues likely exist.

  13. Sandia Higher Order Elements (SHOE) v 0.5 alpha

    Energy Science and Technology Software Center (ESTSC)

    2013-09-24

    SHOE is research code for characterizing and visualizing higher-order finite elements; it contains a framework for defining classes of interpolation techniques and element shapes; methods for interpolating triangular, quadrilateral, tetrahedral, and hexahedral cells using Lagrange and Legendre polynomial bases of arbitrary order; methods to decompose each element into domains of constant gradient flow (using a polynomial solver to identify critical points); and an isocontouring technique that uses this decomposition to guarantee topological correctness. Please notemore » that this is an alpha release of research software and that some time has passed since it was actively developed; build- and run-time issues likely exist.« less

  14. H. influenzae type b (Hib) vaccine--controversies.

    PubMed

    Shah, Nitin K

    2003-06-01

    Hib vaccine is the 8th vaccine knocking at the door to be included in the EPI the world over. However there are some controversies that need to be addressed, especially when it comes to use of this vaccine in India. It is difficult to culture Hib unless one uses sheep blood enriched media for culture. There is a lack of good community based data on Hib burden in India. This makes many feel that Hib is rare in India. However this is not true. There are many studies that have looked at this closely. Hib is a common cause of meningitis and pneumonitis in children less than 5 years old in India. There is wide spread problem of multi-drug resistance by Hib in India. Mortality of meningitis is as high as 100% if third generation cephalosporins are not used in time. Of the survivors of meningitis, 60% develop long-term sequelae. Hib vaccine is very effective and can lead to 99% reduction with mass vaccination in just 2-3 years. It is also a very safe vaccine. Of the conjugated vaccines available in India all are equally effective and safe and there is nothing to choose one over the other. There is a need to give a booster dose at 15-18 months of age. Even UK, which never gave the booster dose, is seriously thinking of changing their practice and give a booster dose. Lastly the combination vaccines of Hib with IPV, DPwT/DPaT, and Hepatitis B are safe and effective and should be encouraged to improve the compliance. The use of Hib vaccine is recommended in India, for those who can afford the vaccine. PMID:12921318

  15. Haemophilus Influenzae Type B (Hib): Questions and Answers

    MedlinePlus

    ... five cases of invasive Hib disease in children younger than 5 years from 2008, the largest number ... the leading cause of bacterial meningitis among children younger than age five years in the United States. ...

  16. Alpha Virginis: line-profile variations and orbital elements

    NASA Astrophysics Data System (ADS)

    Harrington, David; Koenigsberger, Gloria; Olguín, Enrique; Ilyin, Ilya; Berdyugina, Svetlana V.; Lara, Bruno; Moreno, Edmundo

    2016-05-01

    Context. Alpha Virginis (Spica) is a B-type binary system whose proximity and brightness allow detailed investigations of the internal structure and evolution of stars undergoing time-variable tidal interactions. Previous studies have led to the conclusion that the internal structure of Spica's primary star may be more centrally condensed than predicted by theoretical models of single stars, raising the possibility that the interactions could lead to effects that are currently neglected in structure and evolution calculations. The key parameters in confirming this result are the values of the orbital eccentricity e, the apsidal period U, and the primary star's radius, R1. Aims: The aim of this paper is to analyze the impact that Spica's line profile variability has on the derivation of its orbital elements and to explore the use of the variability for constraining R1. Methods: We use high signal-to-noise and high spectral resolution observations obtained in 2000, 2008, and 2013 to derive the orbital elements from fits to the radial velocity curves. We produce synthetic line profiles using an ab initio tidal interaction model. Results: The general variations in the line profiles can be understood in terms of the tidal flows, whose large-scale structure is relatively fixed in the rotating binary system reference frame. Fits to the radial velocity curves yield e = 0.108 ± 0.014. However, the analogous RV curves from theoretical line profiles indicate that the distortion in the lines causes the fitted value of e to depend on the argument of periastron; i.e., on the epoch of observation. As a result, the actual value of e may be as high as 0.125. We find that U = 117.9 ± 1.8, which is in agreement with previous determinations. Using the value R1 = 6.8 R⊙ derived by Palate et al. (2013) the value of the observational internal structure constant k2,obs is consistent with theory. We confirm the presence of variability in the line profiles of the secondary star. RV

  17. Stability of HIB-Cul3 E3 ligase adaptor HIB Is Regulated by Self-degradation and Availability of Its Substrates

    PubMed Central

    Zhou, Zizhang; Xu, Congyu; Chen, Ping; Liu, Chen; Pang, Shu; Yao, Xia; Zhang, Qing

    2015-01-01

    The HIB-Cul3 complex E3 ligase regulates physiological homeostasis through regulating its substrate stability and its activity can be modulated by changing HIB abundance. However, regulation of HIB remains elusive. Here we provide evidence that HIB is degraded through the proteasome by Cul3-mediated polyubiquitination in K48 manner in Drosophila. Strikingly, HIB is targeted for degradation by itself. We further identify that three degrons (52LKSS56T, 76LDEE80S and 117MESQ121R) and K185 and K198 of HIB are essential for its auto-degradation. Finally, we demonstrate that HIB-Cul3 substrates, Ci and Puc, can effectively protect HIB from HIB-Cul3-mediated degradation. Taken together, our study indicates that there is an exquisite equilibrium between the adaptor and targets to achieve the tight control of the HIB, which is essential for maintaining suitable Hh and JNK signaling. And the mechanism of adaptor self-degradation and reciprocal control of the abundance between adaptor and its substrates is also applied to BTB-Cul3 E3 ligase adaptor dKeap1, dDiablo and dKLHL18. PMID:26263855

  18. Children with Haemophilus influenzae type b (Hib) vaccine failure have long-term bactericidal antibodies against virulent Hib strains with multiple capsular loci.

    PubMed

    Townsend-Payne, Kelly; Ladhani, Shamez N; Findlow, Helen; Slack, Mary; Borrow, Ray

    2016-07-25

    Children who develop invasive Haemophilus influenzae serotype b (Hib) disease after immunisation with a highly-effective conjugate vaccine are more likely to have been infected with Hib strains possessing multiple copies of the capsulation locus. Using a recently-validated serum bactericidal antibody (SBA) assay, we tested convalescent sera from 127 Hib vaccine failure cases against clinical Hib strains expressing 1-5 copies of the capsulation locus. SBA titres correlated weakly with anti-capsular IgG antibody concentrations and there was no association between SBA geometric mean titres and number of capsulation locus copies. After infection, children with Hib vaccine failure were equally protected against Hib strains with 1-5 copies of the capsulation locus. PMID:27317452

  19. New and effective multi-element alpha-hematite systems for reduction of trichloroethylene.

    PubMed

    Ghorpade, Praveen A; Kim, Jung-Hwan; Choi, Won-Ho; Park, Joo-Yang

    2014-01-01

    The reactivity of different alpha-hematite (alpha-Fe203) systems for dechlorination of trichloroethylene (TCE) in the presence of Fe(II) and CaO was investigated. Initially different experiments were conducted to investigate the reactivity of pure and doped alpha-Fe203. It was found that the presence of elements such as Si, Cu, and Mn in alpha-Fe203 had a significant effect on TCE reduction potential of alpha-Fe203; however, the reduction potential was less than that of alpha-Fe203 (Bayferrox- 110 M, used in a previous study). Further studies were carried out and alpha-Fe203 was synthesized in a manner similar to that of Bayferrox-110 M. This synthetic alpha-Fe203 showed improved reactivity and was found to follow pseudo-first-order kinetics when used in TCE reduction experiments. The preliminary end products analysis showed that TCE degradation was probably via beta-elimination pathway. Detailed investigations ofa-Fe203 systems were carried out using X-ray diffraction, X-ray fluorescence, and scanning electron microscopy with energy-dispersive spectrometry. The results demonstrated that the TCE reduction capacity of alpha-Fe203 was strongly dependent on the other elements present in iron powder used to synthesize alpha-Fe203. It was suspected that these multi-elements in alpha-Fe203 helped to improve its conduction property. Current findings suggest that alpha-Fe203 not in the pure but combined with other elements could be thought as a potential system for TCE reduction. PMID:24600837

  20. The distribution of alpha elements in Andromeda dwarf galaxies

    SciTech Connect

    Vargas, Luis C.; Geha, Marla C.; Tollerud, Erik J.

    2014-07-20

    We present alpha to iron abundance ratios for 226 individual red giant branch stars in nine dwarf galaxies of the Andromeda (M31) satellite system. The abundances are measured from the combined signal of Mg, Si, Ca, and Ti lines in Keck/DEIMOS medium-resolution spectra. This constitutes the first large sample of alpha abundance ratios measured in the M31 satellite system. The dwarf galaxies in our sample exhibit a variety of alpha abundance ratios, with the average values in each galaxy ranging from approximately solar ([α/Fe] ∼ + 0.0) to alpha-enhanced ([α/Fe] ∼ + 0.5). These variations do not show a correlation with internal kinematics, environment, or stellar density. We confirm radial gradients in the iron abundance of two galaxies out of the five with sufficient data (NGC 185 and And II). There is only tentative evidence for an alpha abundance radial gradient in NGC 185. We homogeneously compare our results to the Milky Way classical dwarf spheroidals, finding evidence for wider variation in average alpha abundance. In the absence of chemical abundances for the M31 stellar halo, we compare to the Milky Way stellar halo. A stellar halo comprised of disrupted M31 satellites is too metal-rich and inconsistent with the Milky Way halo alpha abundance distribution even if considering only satellites with predominantly old stellar populations. The M31 satellite population provides a second system in which to study chemical abundances of dwarf galaxies and reveals a wider variety of abundance patterns than the Milky Way.

  1. The generalized liquid drop model alpha-decay formula: Predictability analysis and superheavy element alpha half-lives

    SciTech Connect

    Dasgupta-Schubert, N. Reyes, M.A.

    2007-11-15

    The predictive accuracy of the generalized liquid drop model (GLDM) formula for alpha-decay half-lives has been investigated in a detailed manner and a variant of the formula with improved coefficients is proposed. The method employs the experimental alpha half-lives of the well-known alpha standards to obtain the coefficients of the analytical formula using the experimental Q{sub {alpha}} values (the DSR-E formula), as well as the finite range droplet model (FRDM) derived Q{sub {alpha}} values (the FRDM-FRDM formula). The predictive accuracy of these formulae was checked against the experimental alpha half-lives of an independent set of nuclei (TEST) that span approximately the same Z, A region as the standards and possess reliable alpha spectroscopic data, and were found to yield good results for the DSR-E formula but not for the FRDM-FRDM formula. The two formulae were used to obtain the alpha half-lives of superheavy elements (SHE) and heavy nuclides where the relative accuracy was found to be markedly improved for the FRDM-FRDM formula, which corroborates the appropriateness of the FRDM masses and the GLDM prescription for high Z, A nuclides. Further improvement resulted, especially for the FRDM-FRDM formula, after a simple linear optimization over the calculated and experimental half-lives of TEST was used to re-calculate the half-lives of the SHE and heavy nuclides. The advantage of this optimization was that it required no re-calculation of the coefficients of the basic DSR-E or FRDM-FRDM formulae. The half-lives for 324 medium-mass to superheavy alpha decaying nuclides, calculated using these formulae and the comparison with experimental half-lives, are presented.

  2. Heavy element abundances in Ap stars from ultraviolet data. I - The bright reference stars Alpha Lyrae and Alpha Canis Majoris A

    NASA Technical Reports Server (NTRS)

    Boiarchuk, A. A.; Snow, T. P., Jr.

    1978-01-01

    Curve-of-growth analysis is used to derive chemical abundances in Alpha Lyr and Alpha CMa, based on ultraviolet spectra obtained with Copernicus. This analysis is part of a program to study the abundances of the heavy elements mercury and platinum and the short-lived element technetium in the atmospheres of Ap and Am stars. Ultraviolet Fe II lines are used to establish the curves of growth for Alpha Lyr and Alpha CMa A; abundances of a variety of elements, along with upper limits on Hg, Pt, and Tc, are derived. In cases where previous studies based on visual spectra have included elements in common with the present analysis, the agreement is good within the known uncertainties. One new element, cadmium, is observed for these two stars. The upper limits on Pt and Hg, as well as Tc, show that these elements are probably not enhanced in Alpha CMa A by more than about one order of magnitude.

  3. Neutron-capture element and Sc abundances in low- and high-alpha Galactic halo stars

    NASA Astrophysics Data System (ADS)

    Yong, David; Fishlock, Cherie; Karakas, Amanda

    2015-08-01

    Nissen & Schuster (2010) identified two samples of Galactic halo stars with distinct kinematic and chemical properties. The "high-alpha" population is associated with the dissipative monolithic collapse of a proto-Galactic gas cloud while the "low-alpha" population was likely accreted from dwarf galaxies having experienced slower star formation rates. For a subset of these stars, we measured precise abundances of Sc, Zr, La, Ce, Nd and Eu. We find differences in the abundance ratios of [Sc/Fe], [Zr/Fe], and [La/Zr] between the low- and high-alpha groups. The most intriguing result is that the low-alpha stars appear to have higher [Eu/Fe] ratios than the high-alpha stars, in contrast to the expectation that Eu should follow the alpha elements. These data challenge the hypothesis that the high-alpha stars formed in regions only enriched by massive stars and that the low-alpha received additional enrichment from SNeIa and low-mass AGB stars. This work has three main consequences for galaxy halos: 1. The new Eu data could be explained by different IMFs for the two halo populations; 2. The low [alpha/Fe] ratios in some, and perhaps all, dwarf galaxies may be driven (in part of in whole) by different IMFs rather than SNeIa contributions; 3. These data may provide important new constraints on the origin of Eu.

  4. Hedgehog signaling downregulates suppressor of fused through the HIB/SPOP-Crn axis in Drosophila.

    PubMed

    Liu, Chen; Zhou, Zizhang; Yao, Xia; Chen, Ping; Sun, Man; Su, Miya; Chang, Cunjie; Yan, Jun; Jiang, Jin; Zhang, Qing

    2014-05-01

    Hedgehog (Hh) signaling plays vital roles in animal development and tissue homeostasis, and its misregulation causes congenital diseases and several types of cancer. Suppressor of Fused (Su(fu)) is a conserved inhibitory component of the Hh signaling pathway, but how it is regulated remains poorly understood. Here we demonstrate that in Drosophila Hh signaling promotes downregulation of Su(fu) through its target protein HIB (Hh-induced BTB protein). Interestingly, although HIB-mediated downregulation of Su(fu) depends on the E3 ubiquitin ligase Cul3, HIB does not directly regulate Su(fu) protein stability. Through an RNAi-based candidate gene screen, we identify the spliceosome factor Crooked neck (Crn) as a regulator of Su(fu) level. Epistasis analysis indicates that HIB downregulates Su(fu) through Crn. Furthermore, we provide evidence that HIB retains Crn in the nucleus, leading to reduced Su(fu) protein level. Finally, we show that SPOP, the mammalian homologue of HIB, can substitute HIB to downregulate Su(fu) level in Drosophila. Our study suggests that Hh regulates both Ci and Su(fu) levels through its target HIB, thus uncovering a novel feedback mechanism that regulates Hh signal transduction. The dual function of HIB may provide a buffering mechanism to fine-tune Hh pathway activity. PMID:24603360

  5. Application of alpha spectrometry to the discovery of new elements by heavy-ion-beam bombardment

    SciTech Connect

    Nitschke, J.M.

    1983-05-01

    Starting with polonium in 1898, ..cap alpha..-spectrometry has played a decisive role in the discovery of new, heavy elements. For even-even nuclei, ..cap alpha..-spectra have proved simple to interpret and exhibit systematic trends that allow extrapolation to unknown isotopes. The early discovery of the natural ..cap alpha..-decay series led to the very powerful method of genetically linking the decay of new elements to the well-established ..cap alpha..-emission of daughter and granddaughter nuclei. This technique has been used for all recent discoveries of new elements including Z = 109. Up to mendelevium (Z = 101), thin samples suitable for ..cap alpha..-spectrometry were prepared by chemical methods. With the advent of heavy-ion accelerators new sample preparation methods emerged. These were based on the large momentum transfer associated with heavy-ion reactions, which produced energetic target recoils that, when ejected from the target, could be thermalized in He gas. Subsequent electrical deposition or a He-jet technique yielded samples that were not only thin enough for ..cap alpha..-spectroscopy, but also for ..cap alpha..- and ..beta..-recoil experiments. Many variations of these methods have been developed and are discussed. For the synthesis of element 106 an aerosol-based recoil transport technique was devised. In the most recent experiments, ..cap alpha..-spectrometry has been coupled with the magnetic analysis of the recoils. The time from production to analysis of an isotope has thereby been reduced to 10/sup -6/ s; while it was 10/sup -1/ to 10/sup 0/ s for He-jets and 10/sup 1/ to 10/sup 3/ s for rapid chemical separations. Experiments are now in progress to synthesize super heavy elements (SHE) and to analyze them with these latest techniques. Again, ..cap alpha..-spectrometry will play a major role since the expected signature for the decay of a SHE is a sequence of ..cap alpha..-decays followed by spontaneous fission.

  6. Naturally Acquired and Conjugate Vaccine-Induced Antibody to Haemophilus influenzae Type b (Hib) Polysaccharide in Malian Children: Serological Assessment of the Hib Immunization Program in Mali

    PubMed Central

    Hutter, Julia; Pasetti, Marcela F.; Sanogo, Doh; Tapia, Milagritos D.; Sow, Samba O.; Levine, Myron M.

    2012-01-01

    Haemophilus influenzae type b (Hib) conjugate vaccine for infants (6, 10, and 14 weeks of age) was introduced into the Malian Expanded Program on Immunization in July 2005, to diminish invasive Hib disease in young children. Antibodies to Hib capsular polysaccharide (PRP) were measured in infants and toddlers from an area already served by the Hib immunization program (Bamako) and in unimmunized children of the same age in a district (Kangaba) where Hib immunization had not yet begun. Among vaccinated Bamako children 6–23 months of age, 77–93% exhibited PRP titers ≥ 1.0 μg/mL, indicating long-term protection, versus only 10–23% of Kangaba children of that age. High PRP antibody titers in immunized children persisted through 2 years of age. Moreover, ∼50% of Bamako children exhibited anti-PRP titers ≥ 5.0 μg/mL; a level that impedes Hib upper respiratory carriage, and may thereby diminish the Hib transmission to the unimmunized susceptible population (i.e., providing indirect protection). PMID:22665612

  7. Alpha-element enhancement in a lambda-CDM Universe

    NASA Astrophysics Data System (ADS)

    Gargiulo, I. D.; Muñoz Arancibia, A. M.; Cora, S. A.; Padilla, N.

    We study the chemical enrichment of elliptical galaxies using a semi-analytic model of galaxy formation combined with a cosmological N-body simula- tion of dark matter particles. In particular, we study the a-element abun- dances with respect to the iron content of galaxies. The main modification to the previous models (Cora 2006; Lagos et al. 2008; Tecce et al. 2010) was the implementation of a top heavy variable initial mass function with a theoretical basis (Weidner & Kroupa 2004, 2005, 2006; Weidner et al. 2011). We find that with a single initial mass function at all epochs the observed trend of [a/Fe] with the stellar mass of elliptical galaxies can be hardly reproduced. We propound that a top heavy integrated galactic mass function can be a plausible solution for this problem. FULL TEXT IN SPANISH

  8. Implications of private sector Hib vaccine coverage for the introduction of public sector Hib-containing pentavalent vaccine in India: evidence from retrospective time series data

    PubMed Central

    Sharma, Abhishek; Kaplan, Warren A; Chokshi, Maulik; Hasan Farooqui, Habib; Zodpey, Sanjay P

    2015-01-01

    Objective Haemophilus influenzae type b (Hib) vaccine has been available in India's private sector market since 1997. It was not until 14 December 2011 that the Government of India initiated the phased public sector introduction of a Hib (and DPT, diphtheria, pertussis, tetanus)-containing pentavalent vaccine. Our objective was to investigate the state-specific coverage and behaviour of Hib vaccine in India when it was available only in the private sector market but not in the public sector. This baseline information can act as a guide to determine how much coverage the public sector rollout of pentavalent vaccine (scheduled April 2015) will need to bear in order to achieve complete coverage. Setting 16 of 29 states in India, 2009–2012. Design Retrospective descriptive secondary data analysis. Data (1) Annual sales of Hib vaccines, by volume, from private sector hospitals and retail pharmacies collected by IMS Health and (2) national household surveys. Outcome measures State-specific Hib vaccine coverage (%) and its associations with state-specific socioeconomic status. Results The overall private sector Hib vaccine coverage among the 2009–2012 birth cohort was low (4%) and varied widely among the studied Indian states (minimum 0.3%; maximum 4.6%). We found that private sector Hib vaccine coverage depends on urban areas with good access to the private sector, parent's purchasing capacity and private paediatricians’ prescribing practices. Per capita gross domestic product is a key explanatory variable. The annual Hib vaccine uptake and the 2009–2012 coverage levels were several times higher in the capital/metropolitan cities than the rest of the state, suggesting inequity in access to Hib vaccine delivered by the private sector. Conclusions If India has to achieve high and equitable Hib vaccine coverage levels, nationwide public sector introduction of the pentavalent vaccine is needed. However, the role of private sector in universal Hib vaccine coverage is

  9. Haemophilus influenzae Type b (Hib) vaccine - what you need to know

    MedlinePlus

    ... influenzae type b (Hib) disease is a serious disease caused by bacteria. It usually affects children under 5 years old. It can also affect adults with certain medical conditions. Your child can get Hib disease by being around other children or adults who ...

  10. Haemophilus Influenzae Type b (Hib) Vaccine: What You Need to Know

    MedlinePlus

    ... influenzae type b (Hib) disease is a serious disease caused by bacteria. It usually affects children under 5 years old. It can also affect adults with certain medical conditions. Your child can get Hib disease by being around other children or adults who ...

  11. Localisation of cis elements in the promoter of a wheat alpha-Amy2 gene.

    PubMed

    Huttly, A K; Phillips, A L; Tregear, J W

    1992-09-01

    A functional analysis of the promoter from the wheat alpha-amylase gene alpha-Amy2/54 is described. Mutant alpha-Amy2/54 promoters containing replacements or deletions were constructed and their ability to direct expression of the reporter gene beta-glucuronidase (GUS) in gibberellin-responsive oat aleurone protoplasts analysed. Chimaeric promoters using regions of the cauliflower mosaic virus (CaMV) 35S and alpha-Amy2/54 promoters were also analysed. The results suggest that at least three regions within the alpha-Amy2/54 promoter contain cis elements that are necessary for high-level gibberellin-regulated transcription. Fusion of 1.8 kb of promoter sequence upstream from -117 bp to a minimal (-55 CaMV 35S) promoter gave rise to hormone-independent expression implying that the region 3' to -117 bp contains an element which represses transcription in the absence of gibberellin or presence of abscisic acid. PMID:1511136

  12. Retinoic acid activates human inducible nitric oxide synthase gene through binding of RAR{alpha}/RXR{alpha} heterodimer to a novel retinoic acid response element in the promoter

    SciTech Connect

    Zou Fang; Liu Yan; Liu Li; Wu Kailang; Wei Wei; Zhu Ying . E-mail: yingzhu@whu.edu.cn; Wu Jianguo . E-mail: wu9988@vip.sina.com

    2007-04-06

    Human inducible nitric oxide synthase (hiNOS) catalyzes nitric oxide (NO) which has a significant effect on tumor suppression and cancer therapy. Here we revealed the detailed molecular mechanism involved in the regulation of hiNOS expression induced by retinoic acid (RA). We showed that RAR{alpha}/RXR{alpha} heterodimer was important in hiNOS promoter activation, hiNOS protein expression, and NO production. Serial deletion and site-directed mutation analysis revealed two half-sites of retinoic acid response element (RARE) spaced by 5 bp located at -172 to -156 in the hiNOS promoter. EMSA and ChIP assays demonstrated that RAR{alpha}/RXR{alpha} directly bound to this RARE of hiNOS promoter. Our results suggested the identification of a novel RARE in the hiNOS promoter and the roles of the nuclear receptors (RAR{alpha}/RXR{alpha}) in the induction of hiNOS by RA.

  13. The {alpha}-induced thick-target {gamma}-ray yield from light elements

    SciTech Connect

    Heaton, R.K. |

    1994-10-01

    The {alpha}-induced thick-target {gamma}-ray yield from light elements has been measured in the energy range 5.6 MeV {le} E{sub {alpha}} {le} 10 MeV. The {gamma}-ray yield for > 2.1 MeV from thick targets of beryllium, boron nitride, sodium fluoride, magnesium, aluminum and silicon were measured using the {alpha}-particle beam from the Lawrence Berkeley Laboratories 88 in. cyclotron. The elemental yields from this experiment were used to construct the {alpha}-induced direct production {gamma}-ray spectrum from materials in the SNO detector, a large volume ultra-low background neutrino detector located in the Creighton mine near Sudbury, Canada. This background source was an order of magnitude lower than predicted by previous calculations. These measurements are in good agreement with theoretical calculations of this spectrum based on a statistical nuclear model of the reaction, with the gross high energy spectrum structure being reproduced to within a factor of two. Detailed comparison of experimental and theoretical excitation population distribution of several residual nuclei indicate the same level of agreement within experimental uncertainties.

  14. The relationship between structural stability and electrochemical performance of multi-element doped alpha nickel hydroxide

    NASA Astrophysics Data System (ADS)

    Miao, Chengcheng; Zhu, Yanjuan; Huang, Liangguo; Zhao, Tengqi

    2015-01-01

    The multi-element doped alpha nickel hydroxide has been prepared by supersonic co-precipitation method. Three kinds of samples A, B and C are prepared by chemically coprecipitating Ni/Al, Ni/Al/Mn and Ni/Al/Mn/Yb, respectively. Inductively coupled plasma atomic emission spectroscopy (ICP-AES), Particle size distribution (PSD) measurement, X-ray diffraction (XRD), scanning electron microscope (SEM) and Fourier transform infrared spectroscopy (FT-IR) are used to characterize the physical properties of the synthesized α-Ni(OH)2 samples, such as chemical composition, morphology, structural stability of the crystal. The results show that all samples are nano-sized materials and the interlayer spacing becomes larger and the structural stability becomes better with the increase of doped elements and doped ratio. The prepared alpha nickel hydroxide samples are added into micro-sized beta nickel hydroxide to form biphase electrode materials for Ni-MH battery. The electrochemical characterization of the biphase electrodes, including cyclic voltammetry (CV) and charge/discharge test, are also performed. The results demonstrate that the biphase electrode with sample C exhibits better electrochemical reversibility and cyclic stability, higher charge efficient and discharge potential, larger proton diffusion coefficient (5.81 × 10-12 cm2 s-1) and discharge capacity (309.0 mAh g-1). Hence, it indicates that all doped elements can produce the synergic effect and further improve the electrochemical properties of the alpha nickel hydroxide.

  15. MULTI-ELEMENT ABUNDANCE MEASUREMENTS FROM MEDIUM-RESOLUTION SPECTRA. IV. ALPHA ELEMENT DISTRIBUTIONS IN MILKY WAY SATELLITE GALAXIES

    SciTech Connect

    Kirby, Evan N.; Cohen, Judith G.; Smith, Graeme H.; Guhathakurta, Puragra; Sohn, Sangmo Tony

    2011-02-01

    We derive the star formation histories of eight dwarf spheroidal (dSph) Milky Way satellite galaxies from their alpha element abundance patterns. Nearly 3000 stars from our previously published catalog comprise our data set. The average [{alpha}/Fe] ratios for all dSphs follow roughly the same path with increasing [Fe/H]. We do not observe the predicted knees in the [{alpha}/Fe] versus [Fe/H] diagram, corresponding to the metallicity at which Type Ia supernovae begin to explode. Instead, we find that Type Ia supernova ejecta contribute to the abundances of all but the most metal-poor ([Fe/H] < -2.5) stars. We have also developed a chemical evolution model that tracks the star formation rate, Types II and Ia supernova explosions, and supernova feedback. Without metal enhancement in the supernova blowout, massive amounts of gas loss define the history of all dSphs except Fornax, the most luminous in our sample. All six of the best-fit model parameters correlate with dSph luminosity but not with velocity dispersion, half-light radius, or Galactocentric distance.

  16. ALPHA ELEMENT ABUNDANCES IN A LARGE SAMPLE OF GALACTIC PLANETARY NEBULAE

    SciTech Connect

    Milingo, J. B.; Kwitter, K. B.; Souza, S. P.; Henry, R. B. C. E-mail: kkwitter@williams.ed E-mail: henry@mail.nhn.ou.ed

    2010-03-10

    In this paper, we present emission line strengths, abundances, and element ratios (X/O for Ne, S, Cl, and Ar) for a sample of 38 Galactic disk planetary nebulae (PNe) consisting primarily of Peimbert classification Type I. Spectrophotometry for these PNe incorporates an extended optical/near-IR range of lambdalambda3600-9600 A including the [S III] lines at 9069 A and 9532 A, setting this relatively large sample apart from typical spectral coverage. We have utilized Emission Line Spectrum Analyzer, a five-level atom abundance routine, to determine T{sub e} , N{sub e} , ionization correction factors, and total element abundances, thereby continuing our work toward a uniformly processed set of data. With a compilation of data from >120 Milky Way PNe, we present results from our most recent analysis of abundance patterns in Galactic disk PNe. With a wide range of metallicities, galactocentric distances, and both Type I and non-Type I objects, we have examined the alpha elements against H II regions and blue compact galaxies (H2BCGs) to discern signatures of depletion or enhancement in PNe progenitor stars, particularly the destruction or production of O and Ne. We present evidence that many PNe have higher Ne/O and lower Ar/Ne ratios compared to H2BCGs within the range of 8.5-9.0 for 12 + log(O/H). This suggests that Ne is being synthesized in the low- and intermediate-mass progenitors. Sulfur abundances in PNe continue to show great scatter and are systematically lower than those found in H2BCG at a given metallicity. Although we find that PNe do show some distinction in alpha elements when compared to H2BCG, within the Peimbert classification types studied, PNe do not show significant differences in alpha elements amongst themselves, at least to an extent that would distinguish in situ nucleosynthesis from the observed dispersion in abundance ratios.

  17. Individual alpha elements, C, N, and Ba in early-type galaxies

    SciTech Connect

    Worthey, Guy; Tang, Baitian; Serven, Jedidiah

    2014-03-01

    Spectral data on early-type galaxies are analyzed for chemical abundance with an emphasis on obtaining detailed abundances for the elements O and Si in addition to C, N, Na, Mg, Ca, Fe, and Ba. The abundance trends with velocity dispersion fit preconceptions based upon previous Mg conclusions, namely, that larger galaxies have a higher alpha element to iron peak ratio indicative of a higher ratio of Type II to Type Ia supernova products. The heaviest alpha elements, Ca and Ti, do not participate in this trend, although this fact does not necessarily alter the basic picture given the uncertainties in nucleosynthetic yields. Elements that likely have significant contributions from intermediate-mass stars, namely, C, N, and Ba, also gain ground relative to Fe in massive galaxies at a modest level, with the Ba conclusion uncertain from our data alone. After the velocity dispersion trend is subtracted, [M/H], [N/Fe], [Na/Fe], [Mg/Fe], and [Ca/Fe] probably have cosmic scatter, and no quantity can be shown to not have cosmic scatter.

  18. Impact of conjugate Haemophilus influenzae type b (Hib) vaccine introduction in South Africa.

    PubMed Central

    von Gottberg, A.; de Gouveia, L.; Madhi, S. A.; du Plessis, M.; Quan, V.; Soma, K.; Huebner, R.; Flannery, B.; Schuchat, A.; Klugman, Kp

    2006-01-01

    OBJECTIVE: To analyse trends in reported invasive Haemophilus influenzae disease in South Africa within the first five years of introduction of conjugate Haemophilus influenzae type b (Hib) vaccine in the routine child immunization schedule. METHODS: We used national laboratory-based surveillance data to identify cases of invasive H. influenzae disease between July 1999 and June 2004, and submitted isolates for serotyping and antimicrobial susceptibility testing. FINDINGS: The absolute number of Hib cases (reported to the national surveillance system) among children below one year of age decreased by 65%, from 55 cases in 1999-2000 to 19 cases in 2003-04. Enhanced surveillance initiated in 2003, identified human immunodeficiency virus (HIV)-infection and incomplete vaccination as contributing factors for Hib transmission. The total number of laboratory-confirmed cases of H. influenzae remained unchanged because non-type b disease was being increasingly reported to the surveillance system concomitant with system enhancements. Children with non-typable disease were more likely to be HIV-positive (32 of 34, 94%) than children with Hib disease (10 of 14, 71%), P = 0.051. Recent Hib isolates were more likely to be multidrug resistant (2% in 1999-2000 versus 19% in 2003-04, P = 0.001). CONCLUSION: Data from a newly established national laboratory-based surveillance system showed a decrease in Hib disease burden among South African children following conjugate vaccine introduction and identified cases of non-typable disease associated with HIV infection. PMID:17128361

  19. Theoretical and experimental {alpha} decay half-lives of the heaviest odd-Z elements and general predictions

    SciTech Connect

    Zhang, H. F.; Royer, G.

    2007-10-15

    Theoretical {alpha} decay half-lives of the heaviest odd-Z nuclei are calculated using the experimental Q{sub {alpha}} value. The barriers in the quasimolecular shape path are determined within a Generalized Liquid Drop Model (GLDM) and the WKB approximation is used. The results are compared with calculations using the Density-Dependent M3Y (DDM3Y) effective interaction and the Viola-Seaborg-Sobiczewski (VSS) formulas. The calculations provide consistent estimates for the half-lives of the {alpha} decay chains of these superheavy elements. The experimental data stand between the GLDM calculations and VSS ones in the most time. Predictions are provided for the {alpha} decay half-lives of other superheavy nuclei within the GLDM and VSS approaches using the recent extrapolated Q{sub {alpha}} of Audi, Wapstra, and Thibault [Nucl. Phys. A729, 337 (2003)], which may be used for future experimental assignment and identification.

  20. The Immunogenicity and Safety of a Combined DTaP-IPV//Hib Vaccine Compared with Individual DTaP-IPV and Hib (PRP~T) Vaccines: a Randomized Clinical Trial in South Korean Infants.

    PubMed

    Kang, Jin Han; Lee, Hoan Jong; Kim, Kyung Hyo; Oh, Sung Hee; Cha, Sung Ho; Lee, Jin; Kim, Nam Hee; Eun, Byung Wook; Kim, Chang Hwi; Hong, Young Jin; Kim, Hyun Hee; Lee, Kyung Yil; Kim, Yae Jean; Cho, Eun Young; Kim, Hee Soo; Guitton, Fabrice; Ortiz, Esteban

    2016-09-01

    Recommended infant vaccination in Korea includes DTaP-IPV and Hib vaccines administered as separate injections. In this randomized, open, controlled study we assessed the non-inferiority of immunogenicity of DTaP-IPV//Hib pentavalent combination vaccine (Pentaxim™) compared with licensed DTaP-IPV and Hib (PRP~T) vaccines. We enrolled 418 healthy Korean infants to receive either separate DTaP-IPV and Hib vaccines (n = 206) or the pentavalent DTaP-IPV//Hib (n = 208) vaccine at 2, 4, 6 months of age. Antibodies to all components were measured before the first vaccination and one month after the third, and safety was assessed after each vaccination including recording of reactions by parents. We confirmed the non-inferiority of DTaP-IPV//Hib compared with DTaP-IPV and Hib vaccines; 100% of both groups achieved seroprotection against D, T, IPV and PRP~T, and 97.5%-99.0% demonstrated seroresponses to pertussis antigens. Antibody levels were similar in both groups, except for those to the Hib component, PRP~T. In separate and combined groups geometric mean concentrations of anti-PRP~T antibodies were 23.9 and 11.0 μg/mL, respectively, but 98.3% and 97.4% had titers ≥ 1 μg/mL, indicative of long-term protection. All vaccines were well tolerated, with no vaccine-related serious adverse event. Both groups had similar safety profiles, but the combined vaccine group had fewer injection site reactions. The immunological non-inferiority and similar safety profile of DTaP-IPV//Hib vaccine to separate DTaP-IPV and Hib vaccines, with the advantage of fewer injections and injection site reactions, supports the licensure and incorporation of DTaP-IPV//Hib into the Korean national vaccination schedule (Clinical trial registry, NCT01214889). PMID:27510380

  1. The Immunogenicity and Safety of a Combined DTaP-IPV//Hib Vaccine Compared with Individual DTaP-IPV and Hib (PRP~T) Vaccines: a Randomized Clinical Trial in South Korean Infants

    PubMed Central

    2016-01-01

    Recommended infant vaccination in Korea includes DTaP-IPV and Hib vaccines administered as separate injections. In this randomized, open, controlled study we assessed the non-inferiority of immunogenicity of DTaP-IPV//Hib pentavalent combination vaccine (Pentaxim™) compared with licensed DTaP-IPV and Hib (PRP~T) vaccines. We enrolled 418 healthy Korean infants to receive either separate DTaP-IPV and Hib vaccines (n = 206) or the pentavalent DTaP-IPV//Hib (n = 208) vaccine at 2, 4, 6 months of age. Antibodies to all components were measured before the first vaccination and one month after the third, and safety was assessed after each vaccination including recording of reactions by parents. We confirmed the non-inferiority of DTaP-IPV//Hib compared with DTaP-IPV and Hib vaccines; 100% of both groups achieved seroprotection against D, T, IPV and PRP~T, and 97.5%–99.0% demonstrated seroresponses to pertussis antigens. Antibody levels were similar in both groups, except for those to the Hib component, PRP~T. In separate and combined groups geometric mean concentrations of anti-PRP~T antibodies were 23.9 and 11.0 µg/mL, respectively, but 98.3% and 97.4% had titers ≥ 1 µg/mL, indicative of long-term protection. All vaccines were well tolerated, with no vaccine-related serious adverse event. Both groups had similar safety profiles, but the combined vaccine group had fewer injection site reactions. The immunological non-inferiority and similar safety profile of DTaP-IPV//Hib vaccine to separate DTaP-IPV and Hib vaccines, with the advantage of fewer injections and injection site reactions, supports the licensure and incorporation of DTaP-IPV//Hib into the Korean national vaccination schedule (Clinical trial registry, NCT01214889). PMID:27510380

  2. PGC-1alpha induces dynamic protein interactions on the ERRalpha gene multi-hormone response element nucleosome in kidney cells.

    PubMed

    Wang, Liangli; Li, Yin; Hu, Peng; Teng, Christina T

    2008-12-15

    ERR (oestrogen-related receptor)-alpha modulates the oestrogen signalling pathway and regulates genes participating in the physiological energy balance programme. Oestrogen and PGC-1alpha (peroxisome proliferator-activated receptor-gamma coactivator-1alpha), the master regulator of the energy homoeostasis programme, both regulate the expression of ERRalpha through the MHRE (multi-hormone response element) of the ERRalpha gene. Although the molecular mechanism of oestrogen action on ERRalpha regulation is well characterized, the mechanism of PGC-1alpha induction is unclear. In this study, we examine chromatin structural changes and protein interactions at the MHRE nucleosome in response to PGC-1alpha expression in HK2 human kidney cells. We mapped the nucleosome positions of the ERRalpha gene promoter and examined the changes of histone acetylation in response to PGC-1alpha expression. The interactions of DNA-binding proteins, ERRalpha and ERRgamma, co-activators {CBP [CREB (cAMP-response-element-binding protein)-binding protein], p300, PCAF (p300/CBP-associated factor)}, co-repressor [RIP140 (receptor-interacting protein of 140 kDa)] and RNA polymerase II at the MHRE nucleosome region were investigated over time before and after PGC-1alpha expression in the HK2 cells. We found a dynamic cyclic interaction of these proteins shortly after PGC-1alpha expression and a slower cycling interaction, with fewer proteins involved, 20 h later. By using the siRNA (small interfering RNA) knockdown approach, we discovered that ERRgamma was involved in the initial phase, but not in the later phase, of PGC-1alpha-induced ERRalpha expression. PMID:18673300

  3. alpha-decay half-lives of superheavy elements with the Dirac-Brueckner-Hartree-Fock (DBHF) nucleon effective interaction

    SciTech Connect

    Zhang Dida; Ma Zhongyu; Chen Baoqiu; Shen Shuifa

    2010-04-15

    The nucleon effective interaction is calculated in the framework of the Dirac-Brueckner-Hartree-Fock approach, which has been illustrated to reproduce well the ground-state properties and the experimental data of proton and alpha particle scattering off nuclei. The nuclear potential of the alpha-nucleus is obtained by doubly folding the nucleon effective interaction with respect to the density distributions of both the alpha particle and daughter nucleus. We apply this new nuclear potential of the alpha-nucleus to investigate the alpha-decay half-lives of superheavy elements in the preformed cluster model along with the experimental decay energies Q{sub exp}. Good agreement with the experimental data is achieved. We also systematically calculate the alpha-decay half-lives for 19 isotope chains (Z=102-120) in this framework using the theoretical alpha-decay energies Q{sub th} extracted from the Moeller-Nix-Kratz mass table. The predicted results are compared with those obtained by using the same Q{sub th} but the nuclear potentials evaluated with M3Y effective interaction and also with the results calculated in the empirical formulas of the Viola-Seaberg-Sobiczewski formula.

  4. Aleurone nuclear proteins bind to similar elements in the promoter regions of two gibberellin-regulated alpha-amylase genes.

    PubMed

    Rushton, P J; Hooley, R; Lazarus, C M

    1992-09-01

    Binding of nuclear proteins from wild oat aleurone protoplasts to the promoter regions of two gibberellin-regulated wheat alpha-amylase genes (alpha-Amy1/18 and alpha-Amy2/54) has been studied by gel retardation and DNase 1 footprinting. Gel retardation studies using 300-430 bp fragments of the promoters showed similar binding characteristics with nuclear extracts from both gibberellin A1-treated and untreated protoplasts. DNase 1 footprints localised binding of nuclear proteins from gibberellin A1-treated aleurone protoplasts to regions in both promoters. Similar sequence elements in the promoter regions of both genes were protected from digestion although the location and number of footprints in each promoter region were different. Each footprint contained either a sequence similar to the cAMP and/or phorbol ester response elements, or a hyphenated palindrome sequence. The presence of cAMP and/or phorbol ester response element-like sequences in the footprints suggests that transcription factors of the bZIP type may be involved in the expression of alpha-amylase genes in aleurone cells. Footprints containing hyphenated palindrome sequences, found in the promoter regions of both genes, suggest the possible involvement of other classes of transcription factor. The conserved alpha-amylase promoter sequence TAA-CAGA was also shown to bind nuclear protein in the alpha-Amy2/54 promoter. These observations are discussed in relation to alpha-amylase gene expression in aleurone and to functional data concerning these genes. PMID:1511135

  5. IRON AND {alpha}-ELEMENT PRODUCTION IN THE FIRST ONE BILLION YEARS AFTER THE BIG BANG

    SciTech Connect

    Becker, George D.; Carswell, Robert F.; Sargent, Wallace L. W.; Rauch, Michael E-mail: acalver@ast.cam.ac.uk E-mail: mr@obs.carnegiescience.edu

    2012-01-10

    We present measurements of carbon, oxygen, silicon, and iron in quasar absorption systems existing when the universe was roughly one billion years old. We measure column densities in nine low-ionization systems at 4.7 < z < 6.3 using Keck, Magellan, and Very Large Telescope optical and near-infrared spectra with moderate to high resolution. The column density ratios among C II, O I, Si II, and Fe II are nearly identical to sub-damped Ly{alpha} systems (sub-DLAs) and metal-poor ([M/H] {<=} -1) DLAs at lower redshifts, with no significant evolution over 2 {approx}< z {approx}< 6. The estimated intrinsic scatter in the ratio of any two elements is also small, with a typical rms deviation of {approx}< 0.1 dex. These facts suggest that dust depletion and ionization effects are minimal in our z > 4.7 systems, as in the lower-redshift DLAs, and that the column density ratios are close to the intrinsic relative element abundances. The abundances in our z > 4.7 systems are therefore likely to represent the typical integrated yields from stellar populations within the first gigayear of cosmic history. Due to the time limit imposed by the age of the universe at these redshifts, our measurements thus place direct constraints on the metal production of massive stars, including iron yields of prompt supernovae. The lack of redshift evolution further suggests that the metal inventories of most metal-poor absorption systems at z {approx}> 2 are also dominated by massive stars, with minimal contributions from delayed Type Ia supernovae or winds from asymptotic giant branch stars. The relative abundances in our systems broadly agree with those in very metal-poor, non-carbon-enhanced Galactic halo stars. This is consistent with the picture in which present-day metal-poor stars were potentially formed as early as one billion years after the big bang.

  6. Haemophilus influenzae serotype B (Hib) seroprevalence in England and Wales in 2009.

    PubMed

    Ladhani, Sn; Ramsay, Me; Flood, Js; Campbell, H; Slack, Mp; Pebody, R; Findlow, J; Newton, E; Wilding, M; Warrington, R; Crawford, H; Min, Sy; Gray, K; Martin, S; Frankland, S; Bokuvha, N; Laher, G; Borrow, R

    2012-01-01

    A national seroprevalence study was performed to determine the prevalence of Haemophilus influenzae type b (Hib) antibodies in England and Wales in 2009, when Hib disease incidence was the lowest ever recorded. A total of 2,693 anonymised residual sera from routine diagnostic testing submitted by participating National Health Service hospital laboratories were tested for Hib anti-polyribosyl-ribitol phosphate (PRP) IgG antibodies using a fluorescent bead assay. Median anti-PRP IgG concentrations were highest in toddlers aged 1–4 years (2.65 μg/ml), followed by children aged 5–9 years (1.95 μg/ml). Antibody concentrations were significantly lower after this age, but were still significantly higher among 10–19 year-olds (0.54 μg/ml) compared with adults aged >20 years (0.16 μg/ ml; p<0.0001). Half of the adults (51%) did not have Hib antibody concentrations ≥0.15 μg/ml, the level considered to confer short-term protection. Thus, the current excellent Hib control appears to be the result of high anti-PRP antibody concentrations in children aged up to 10 years, achieved through the various childhood vaccination campaigns offering booster immunisation. The lack of seroprotection in adults emphasises the importance of maintaining control of the disease and, most probably carriage, in children, therefore raising the question as to whether long-term routine boosting of either pre-school children or adolescents may be required. PMID:23171823

  7. Catalytic oxidation of elemental mercury over the modified catalyst Mn/alpha-Al2O3 at lower temperatures.

    PubMed

    Li, Jianfeng; Yan, Naiqiang; Qu, Zan; Qiao, Shaohua; Yang, Shijian; Guo, Yongfu; Liu, Ping; Jia, Jinping

    2010-01-01

    In order to facilitate the removal of elemental mercury (Hg(0)) from coal-fired flue gas, catalytic oxidation of Hg(0) with manganese oxides supported on inert alumina (alpha-Al2O3) was investigated at lower temperatures (373-473 K). To improve the catalytic activity and the sulfur-tolerance of the catalysts at lower temperatures, several metal elements were employed as dopants to modify the catalyst of Mn/alpha-Al2O3. The best performance among the tested elements was achieved with molybdenum (Mo) as the dopant in the catalysts. It can work even better than the noble metal catalyst Pd/alpha-Al2O3. Additionally, the Mo doped catalyst displayed excellent sulfur-tolerance performance at lower temperatures, and the catalytic oxidation efficiency for Mo(0.03)-Mn/alpha-Al2O3 was over 95% in the presence of 500 ppm SO2 versus only about 48% for the unmodified catalyst. The apparent catalytic reaction rate constant increased by approximately 5.5 times at 423 K. In addition, the possible mechanisms involved in Hg(0) oxidation and the reaction with the Mo modified catalyst have been discussed. PMID:19950921

  8. Global reduction of Hib disease: what are the next steps? Proceedings of the meeting Scottsdale, Arizona, September 22-25, 2002.

    PubMed

    Watt, James P; Levine, Orin S; Santosham, Mathuram

    2003-12-01

    On September 22 to 25, 2002, a group of infectious disease specialists, public health officials, and vaccine experts from 33 countries gathered in Scottsdale, Arizona, to discuss the epidemiology and control of disease caused by Haemophilus influenzae type b (Hib) in the era of Hib conjugate vaccines. This supplement is a synthesis of the major themes and key lessons identified at the meeting. The objectives of the conference were to review the 10-year experience with Hib conjugate vaccines, discuss strategies to reduce Hib disease rates to lowest possible levels in industrialized countries, review impediments to the introduction of Hib vaccine in developing countries, and discuss strategies for disseminating lessons learned from countries using to those not using Hib conjugate vaccines. Over 10 years of international experience with Hib conjugate vaccines has demonstrated that they are safe and effective. Routine use of Hib conjugate vaccine has consistently led to decreases in the incidence of invasive Hib disease of 90% or more across a wide range of epidemiologic situations in industrialized countries. In some countries, the vaccine has caused a near-disappearance of invasive Hib disease through a combination of direct protection and herd immunity. Developing countries that have implemented routine vaccination (eg, The Gambia, Chile) have also had substantial disease reduction. In countries where Hib conjugate vaccine is being used, reducing Hib disease incidence to the lowest possible level will depend on maintaining high vaccine coverage levels, conducting surveillance for Hib disease, and investigating Hib disease cases. The optimal Hib vaccination strategy will depend on many factors, including local epidemiology and programmatic considerations. In countries that are not using Hib conjugate vaccine, information on the local burden of Hib disease will be essential for leaders considering vaccine introduction. Where disease burden is high, a multifaceted

  9. Regulatory elements in the first intron contribute to transcriptional control of the human. cap alpha. 1(I) collagen gene

    SciTech Connect

    Bornstein, P.; McKay, J.; Morishima, J.K.; Devarayalu, S.; Gelinas, R.E.

    1987-12-01

    Several lines of evidence have suggested that the regulation of type I collagen gene transcription is complex and that important regulatory elements reside 5' to, and within, the first intron of the ..cap alpha..1(I) gene. The authors therefore sequenced a 2.3-kilobase HindIII fragment that encompasses 804 base pairs of 5' flanking sequence, the first exon, and most of the first intron of the ..cap alpha..1(I) human collagen gene. A 274-base-pair intronic sequence, flanked by Ava I sites (A274), contained a sequence identical to a high-affinity decanucleotide binding site for transcription factor Sp1 and a viral core enhancer sequence. DNase I protection experiments indicated zones of protection that corresponded to these motifs. When A274 was cloned 5' to the chloramphenicol acetyltransferase (CAT) gene, driven by an ..cap alpha..1(I) collagen promoter sequence, and expression was assessed by transfection, significant orientation-specific inhibition of CAT activity was observed. This effect was most apparent in chicken tendon fibroblasts, which modulate their level of collagen synthesis in culture. They propose that normal regulation of ..cap alpha..1(I) collagen gene transcription results from an interplay of positive and negative elements present in the promoter region and within the first intron.

  10. Immunological persistence in 5 y olds previously vaccinated with hexavalent DTPa-HBV-IPV/Hib at 3, 5, and 11 months of age.

    PubMed

    Silfverdal, Sven A; Assudani, Deepak; Kuriyakose, Sherine; Van Der Meeren, Olivier

    2014-01-01

    The combined diphtheria-tetanus-acellular pertussis-hepatitis B-poliomyelitis/Haemophilus influenza vaccine (DTPa-HBV-IPV/Hib: Infanrix™ hexa, GlaxoSmithKline Vaccines) is used for primary vaccination of infants in a range of schedules world-wide. Antibody persistence after 4 DTPa-HBV-IPV/Hib doses in the first 2 y of life has been documented, but long-term persistence data following the 3, 5, 11-12 months (3-5-11) infant vaccination schedule, employed for example in Nordic countries, are limited. We assessed antibody persistence in 57 5-year-old children who had received either DTPa-HBV-IPV/Hib or DTPa-IPV/Hib (Infanrix™-IPV/Hib, GlaxoSmithKline Vaccines) in the 3-5-11 schedule. Among DTPa-HBV-IPV/Hib recipients, 7/12 retained seroprotective antibody concentrations for diphtheria, 10/12 for tetanus, 5/12 for hepatitis and 10/12 for Hib. Detectable antibodies were observed for 0/12 children for pertussis toxin (PT), 12/12 for filamentous haemagglutinin (FHA) and 8/12 for pertactin (PRN). Among DTPa-IPV/Hib recipients, 28/45 retained seroprotective anti-diphtheria concentrations, 34/44 for tetanus and 40/45 for Hib. Detectable antibodies were observed for 9/45 children for PT, 41/45 for FHA and 34/45 for PRN. Antibody persistence in DTPa-HBV-IPV/Hib and DTPa-IPV/Hib-vaccinees appeared similar in 5 y olds to that previously observed in children of a similar age who had received 4 prior doses of DTPa-HBV-IPV/Hib (or DTPa-IPV/Hib). As in subjects primed with 4 prior doses, we observed that antibodies markedly declined by 5 y of age, calling for the administration of a pre-school booster dose in order to ensure continued protection against pertussis. PMID:25483640

  11. Influence of a cap site element on tissue-restricted expression of the glycoprotein hormone alpha-subunit gene.

    PubMed

    Cox, G S; Xiong, W

    1999-07-14

    Little is known of the transcriptional regulators important for expression of the glycoprotein hormone alpha-subunit (GPHalpha) gene in nonendocrine tumors, which secrete free alpha-subunit at an incidence of 25-80%. Consequently, attempts were made to define cis-regulatory elements and their cognate trans-acting factors that modulate promoter activity in epithelial cell types that do not normally express the glycoprotein hormones. DNA-mediated transient expression of promoter-reporter constructs was used to identify a novel negative regulatory element located at the GPHalpha gene transcription start site. Mutagenesis of this element produced a 2- to 10-fold increase in promoter activity, depending on the particular mutation and the transfected tumor cell line. Electrophoretic mobility shift analysis detected a protein that binds specifically to a DNA motif encompassing the cap site. It was present at different levels in a variety of cell types. Significantly, the degree to which activity of the wild-type promoter was suppressed relative to that of the mutant promoter was proportional to the level of cap site binding protein in the collection of cell lines examined. These results indicate that a negative regulatory element centered at the GPHalpha gene cap site and its cognate DNA-binding protein make a significant contribution to the production of alpha-subunit in a variety of tumor tissues. A detailed understanding of this cis/trans pair may further suggest a mechanism to explain, at least in part, how this gene becomes activated in nonendocrine tumors. PMID:10403838

  12. Anti-lymphoproliferative activity of alpha-2-macroglobulin in the plasma of hibernating 13-lined ground squirrels and woodchucks.

    PubMed

    Sieckmann, Donna G; Jaffe, Howard; Golech, Susanne; Cai, DeCheng; Hallenbeck, John M; McCarron, Richard M

    2014-09-15

    Plasma from hibernating (HIB) woodchucks (Marmota monax) or 13-lined ground squirrels (Ictidomys tridecemlineatus) suppressed (3)H-thymidine uptake in mouse spleen cell cultures stimulated with Concanavalin A (ConA); plasma from non-hibernating animals were only slightly inhibitory. Maximum inhibition occurred when HIB plasma was added to the cultures prior to ConA. After HPLC size exclusion chromatography of the HIB ground squirrel plasma, a single fraction (fraction-14) demonstrated inhibitory activity. Assay of fraction-14 from 8 HIB squirrels showed inhibition ranging from 13 to 95%; inhibition was correlated to the time the squirrels were exposed to cold prior to hibernation. Western blot analysis showed the factor to be a large molecular weight protein (>300 kDa), and mass spectrometry identified sequences that were 100% homologous with alpha-2-macroglobulin from humans and other species. These findings indicate a hibernation-related protein that may be responsible for immune system down regulation. PMID:25113962

  13. A delta T-cell receptor deleting element transgenic reporter construct is rearranged in alpha beta but not gamma delta T-cell lineages.

    PubMed Central

    Shutter, J; Cain, J A; Ledbetter, S; Rogers, M D; Hockett, R D

    1995-01-01

    T cells can be divided into two groups on the basis of the expression of either alpha beta or gamma delta T-cell receptors (TCRs). Because the TCR delta chain locus lies within the larger TCR alpha chain locus, control of the utilization of these two receptors is important in T-cell development, specifically for determination of T-cell type: rearrangement of the alpha locus results in deletion of the delta coding segments and commitment to the alpha beta lineage. In the developing thymus, a relative site-specific recombination occurs by which the TCR delta chain gene segments are deleted. This deletion removes all D delta, J delta, and C delta genes and occurs on both alleles. This delta deletional mechanism is evolutionarily conserved between mice and humans. Transgenic mice which contain the human delta deleting elements and as much internal TCR delta chain coding sequence as possible without allowing the formation of a complete delta chain gene were developed. Several transgenic lines showing recombinations between deleting elements within the transgene were developed. These lines demonstrate that utilization of the delta deleting elements occurs in alpha beta T cells of the spleen and thymus. These recombinations are rare in the gamma delta population, indicating that the machinery for utilization of delta deleting elements is functional in alpha beta T cells but absent in gamma delta T cells. Furthermore, a discrete population of early thymocytes containing delta deleting element recombinations but not V alpha-to-J alpha rearrangements has been identified. These data are consistent with a model in which delta deletion contributes to the implementation of a signal by which the TCR alpha chain locus is rearranged and expressed and thus becomes an alpha beta T cell. PMID:8524269

  14. Development of an alpha scattering instrument for heavy element detection in surface materials

    NASA Technical Reports Server (NTRS)

    Turkevich, A. L.; Economou, T.; Blume, E.; Anderson, W.

    1974-01-01

    The development and characteristics of a portable instrument for detecting and measuring the amounts of lead in painted surfaces are discussed. The instrument is based on the ones used with the alpha scattering experiment on the Surveyor lunar missions. The principles underlying the instrument are described. It is stated that the performance tests of the instrument were satisfactory.

  15. THE DISTRIBUTION OF ALPHA ELEMENTS IN ULTRA-FAINT DWARF GALAXIES

    SciTech Connect

    Vargas, Luis C.; Geha, Marla; Kirby, Evan N.; Simon, Joshua D.

    2013-04-20

    The Milky Way ultra-faint dwarf (UFD) galaxies contain some of the oldest, most metal-poor stars in the universe. We present [Mg/Fe], [Si/Fe], [Ca/Fe], [Ti/Fe], and mean [{alpha}/Fe] abundance ratios for 61 individual red giant branch stars across eight UFDs. This is the largest sample of alpha abundances published to date in galaxies with absolute magnitudes M{sub V} > -8, including the first measurements for Segue 1, Canes Venatici II, Ursa Major I, and Leo T. Abundances were determined via medium-resolution Keck/DEIMOS spectroscopy and spectral synthesis. The sample spans the metallicity range -3.4 <[Fe/H] < -1.1. With the possible exception of Segue 1 and Ursa Major II, the individual UFDs show on average lower [{alpha}/Fe] at higher metallicities, consistent with enrichment from Type Ia supernovae. Thus, even the faintest galaxies have undergone at least a limited level of chemical self-enrichment. Together with recent photometric studies, this suggests that star formation in the UFDs was not a single burst, but instead lasted at least as much as the minimum time delay of the onset of Type Ia supernovae ({approx}100 Myr) and less than {approx}2 Gyr. We further show that the combined population of UFDs has an [{alpha}/Fe] abundance pattern that is inconsistent with a flat, Galactic halo-like alpha abundance trend, and is also qualitatively different from that of the more luminous CVn I dSph, which does show a hint of a plateau at very low [Fe/H].

  16. ''Magic'' Energies for Detecting Light Elements with Resonant Alpha Particle Backscattering

    SciTech Connect

    Wetteland, C.J.; Maggiore, C.J.; Tesmer, J.R.; He, X-M.; Lee, D-H.

    1998-11-04

    Resonant backscattering is widely used to improve the detection limit of the light elements such as B, C, N and O. One disadvantage, however, is that several incident energies are normally needed if the sample contains a number of the light elements. There are ''magic'' energies at which several light elements can be detected simultaneously with suitable sensitivities. When these energies are used along with the elastic recoil detection of hydrogen, multiple elements can be detected without changing the beam energy, and the analysis time is greatly reduced. These reactions along with examples will be discussed.

  17. Enhancer and promoter elements directing activation and glucocorticoid repression of the. cap alpha. /sub 1/-fetoprotein gene in hepatocytes

    SciTech Connect

    Guertin, M.; La Rue, H.; Bernier, D.; Wrange, O.; Chevrette, M.; Gingras, M.C.; Belanger, L.

    1988-04-01

    Mutations were introduced in 7 kilobases of 5'-flanking rat ..cap alpha../sub 1/-fetoprotein (AFP) genomic DNA, linked to the chloramphenicol acetyltransferase gene. AFP promoter activity and its repression by a glucocorticoid hormone were assessed by stable and transient expression assays. Stable transfection assays were more sensitive and accurate than transient expression assays in a Morris 7777 rat hepatoma recipient (Hepa7.6), selected for its strong AFP repression by dexamethasone. The segment of DNA encompassing a hepatocyte-constitutive chromatin DNase I-hypersensitive site at -3.7 kilobases and a liver developmental stage-specific site at -2.5 kilobases contains interacting enhancer elements sufficient for high AFP promoter activity in Hepa7.6 or HepG2 cells. Deletions and point mutations define an upstream promoter domain of AFP gene activation, operating with at least three distinct promoter-activating elements, PEI at -65 base pairs, PEII at -120 base pairs, and DE at -160 base pairs. PEI and PEII share homologies with albumin promoter sequences, PEII is a near-consensus nuclear factor I recognition sequence, and DE overlaps a glucocorticoid receptor recognition sequence. An element conferring glucocorticoid repression of AFP gene activity is located in the upstream AFP promoter domain. Receptor-binding assays indicate that this element is the glucocorticoid receptor recognition sequence which overlaps with promoter-activating element DE.

  18. Concomitant use of VAQTA with PedvaxHIB and Infanrix in 12 to 17 month old children.

    PubMed

    Petrecz, Maria; Ramsey, Keith P; Stek, Jon E; Martin, Jason C; Klopfer, Stephanie O; Kuter, Barbara; Schödel, Florian P; Lee, Andrew W

    2016-01-01

    Open-label, multicenter, randomized study (NCT00289913) evaluated immunogenicity, safety, and tolerability of Vaqta (hepatitis A vaccine) administered with PedvaxHIB (Haemophilus b conjugate vaccine [Meningococcal protein conjugate]) & Infanrix (diphtheria/tetanus/acellular pertussis vaccine) in healthy, 15-month-old children. Five groups were evaluated: Group 1 received Vaqta/Infanrix PedvaxHIB on Day-1 and Vaqta at Week-24; Group 2 received Infanrix PedvaxHIB on Day-1, Vaqta at Week-4, and Vaqta at Week-28; Group 3 received Vaqta/PedvaxHIB on Day-1 and Vaqta Week-24; Group 4 received PedvaxHIB on Day-1, Vaqta at Week-4, and Vaqta at Week-28; and Group 5 (safety only) received Vaqta on Day-1 and Vaqta at Week-24. Hepatitis A seropositivity rate (SPR: ≥10 mIU/mL), Hib capsular polyribosylribitol phosphate (PRP) antibody response (>1.0 μg/mL), and geometric mean titers (GMT) to pertussis toxin (PT), pertussis filamentous hemagglutinin antibody (FHA), and pertactin were examined. Non-inferiority statistical criteria required a difference >10% in Hepatitis A SPR, PRP >1.0 μg/mL, and a GMT ratio of >0.67 for pertussis antigens. Injection-site and systemic adverse events (AEs) and daily temperatures were collected. Hepatitis A SPRs were 100% for Groups 1-4, regardless of initial serostatus. Anti-PRP titers were comparable (98.1% - 97.0%) for Groups 1-4. GMT and mean fold-rise were comparable for all 3 pertussis antigen components between concomitant and nonconcomitant groups. Criteria for non-inferiority of immune responses for concomitant vs nonconcomitant administration were met for Hepatitis A, Hib, and pertussis antigens. No statistically significant incidence differences of individual AEs were found between concomitant and nonconcomitant groups. No serious vaccine-related AEs or deaths were reported; no subject discontinued due to an AE. Immune responses to Vaqta, PedvaxHIB, and Infanrix given concomitantly were non-inferior to nonconcomitant responses. Vaqta

  19. Use of 4.7 MeV alpha particles in elemental analysis and fusion reactor materials studies

    NASA Astrophysics Data System (ADS)

    Constantinescu, B.; Dima, S.; Florescu, V.; Ivanov, E. A.; Ploştinaru, D.; Sârbu, C.

    1986-07-01

    The possibilities for using 4.7 MeV alpha particles produced at the U-120 CIP Cyclotron for charged particle induced X- and gamma-ray emission applications (PIXE and PIGE, respectively) and for fast neutron radiation damage simulation are presented. The combined analysis using PIGE and PIXE methods either separately or simultaneously is an excellent means of determining the relative abundances of lighter elements with gamma-ray spectra and of heavier elements ( Z ⩾ 16) with X-ray spectra. Some aspects of surface deformation effects by neutrons were simulated by means of medium-energy helium ions. An investigation of three types of commercial stainless steel (Romanian W 4016, Soviet 12KH18N10T and Japanese W 4541) was started using 3.0 [1], 4.7 and 6.8 MeV helium ions. The main post-irradiation effects observed are discussed.

  20. Characterization of a novel positive transcription regulatory element that differentially regulates the alpha-2-macroglobulin gene in replicative senescence.

    PubMed

    Li, Renzhong; Ma, Liwei; Huang, Yu; Zhang, Zongyu; Tong, Tanjun

    2011-12-01

    Alpha-2-macroglobulin (α2M), a protease inhibitor, is implicated in Alzheimer's disease, atherosclerosis, and other age-related diseases. The elevated level of α2M mRNA has been described in replicative senescence and it could be used as a biomarker of the aging cells. However, the mechanism responsible for the up-regulation of its expression is still unclear. This report identified a novel transcriptional regulatory element, the α2M transcription enhancement element (ATEE), within the α2M promoter. This element differentially activates α2M expression in senescent versus young fibroblasts. Electrophoretic mobility shift assays revealed abundant complexes in senescent cell nuclear extracts compared with young cell nuclear extracts. The DNase I footprint revealed the protein-binding core sequence through which the protein binds the ATEE. Mutation within ATEE selectively abolished α2M promoter activity in senescent (but not young) cells. These results indicated the ATEE, as a positive transcription regulatory element, contributes to the up-regulation of α2M during replicative senescence. PMID:21541797

  1. A comparative clinical study to assess safety and reactogenicity of a DTwP-HepB+Hib vaccine

    PubMed Central

    Dalvi, Shashank; Kulkarni, Prasad S; Phadke, MA; More, SS; Lalwani, Sanjay K; Jain, Dipty; Manglani, Mamta; Garg, BS; Doibale, Mohan K; Deshmukh, CT; Author Group, SIIL DTwP-HepB+Hib

    2015-01-01

    Hepatitis B and Haemophilus influenzae type b (Hib) infections are major public health problems in developing countries, including India. Hence, combination vaccines containing DTwP, recombinant hepatitis B and Hib conjugate vaccines have been developed. Here, we report a Phase IV study which assessed safety and reactogenicity of a new DTwP-HepB+Hib vaccine. Three doses of DTwP-HepB+Hib vaccine (Pentavac, Serum Institute of India Ltd) or Tritanrix-HB+Hib (GlaxoSmithKline Beecham) were administered to infants at 6, 10 and 14 weeks of age in 2:1 ratio. The subjects were followed till one month after the third dose for safety assessment. Adverse events were captured in structured diaries and physical examinations were performed on each visit. The study was conducted in 1510 infants. Both vaccines caused injection site local and systemic reactions and the incidence was similar in both the groups. The incidence of local solicited reactions was: tenderness 35.9 %–33.6 %; redness 18.1 %–17.2 %; swelling 23.7 %–22.4 %; induration 12.8 % –13.7 %. The percentage of systemic solicited reactions were: diarrhea 2.2 %–2.2 %; drowsiness 3.3 %–3.4 %; fever 14.0 %–11.2 %; irritability 28.1 %–25.4 %; loss of appetite 6.6 %–5.6 %; persistent crying 17.7 %–15.7 %; vomiting 3.5 %–3.0 %. No serious adverse event was caused by the vaccines. The new DTwP-HepB+Hib combination vaccine showed similar safety profile to that of an imported vaccine in Indian infants. PMID:25933183

  2. Evaluation of Haemophilus influenzae type b carrier status among children 10 years after the introduction of Hib vaccine in Brazil.

    PubMed

    Zanella, Rosemeire Cobo; Brandileone, Maria Cristina de Cunto; Andrade, Ana Lúcia; Ogassavara, Cinthya Terumi; Fiório, Cleiton Eduardo; Brandão, Angela Pires; Almeida, Samanta Cristine Grassi; Lemos, Ana Paula Silva; Gorla, Maria Cecília; Carvalhanas, Telma Regina; Sato, Helena; Liphaus, Bernadete; Nerger, Maria Lígia; Conde, Monica; Ribeiro, Ana Freitas

    2015-09-01

    The aim of the present study was to assess the prevalence of Haemophilus influenzae type b (Hib) nasopharyngeal (NP) colonisation among healthy children where Hib vaccination using a 3p+0 dosing schedule has been routinely administered for 10 years with sustained coverage (> 90%). NP swabs were collected from 2,558 children who had received the Hib vaccine, of whom 1,379 were 12-< 24 months (m) old and 1,179 were 48-< 60 m old. Hi strains were identified by molecular methods. Hi carriage prevalence was 45.1% (1,153/2,558) and the prevalence in the 12-< 24 m and 48-< 60 m age groups were 37.5% (517/1,379) and 53.9% (636/1,179), respectively. Hib was identified in 0.6% (16/2,558) of all children in the study, being 0.8% (11/1,379) and 0.4% (5/1,179) among the 12-< 24 m and 48-< 60 m age groups, respectively. The nonencapsulate Hi colonisation was 43% (n = 1,099) and was significantly more frequent at 48-< 60 m of age (51.6%, n = 608) compared with that at 12-< 24 m of age (35.6%, n = 491). The overall resistance rates to ampicillin and chloramphenicol were 16.5% and 3.7%, respectively; the co-resistance was detected in 2.6%. Our findings showed that the Hib carrier rate in healthy children under five years was very low after 10 years of the introduction of the Hib vaccine. PMID:26517654

  3. Expression of the glycoprotein hormone alpha-subunit gene in the placenta requires a functional cyclic AMP response element, whereas a different cis-acting element mediates pituitary-specific expression.

    PubMed Central

    Bokar, J A; Keri, R A; Farmerie, T A; Fenstermaker, R A; Andersen, B; Hamernik, D L; Yun, J; Wagner, T; Nilson, J H

    1989-01-01

    The single-copy gene encoding the alpha subunit of glycoprotein hormones is expressed in the pituitaries of all mammals and in the placentas of only primates and horses. We have systematically analyzed the promoter-regulatory elements of the human and bovine alpha-subunit genes to elucidate the molecular mechanisms underlying their divergent patterns of tissue-specific expression. This analysis entailed the use of transient expression assays in a chorionic gonadotropin-secreting human choriocarcinoma cell line, protein-DNA binding assays, and expression of chimeric forms of human or bovine alpha subunit genes in transgenic mice. From the results, we conclude that placental expression of the human alpha-subunit gene requires a functional cyclic AMP response element (CRE) that is present as a tandem repeat in the promoter-regulatory region. In contrast, the promoter-regulatory region of the bovine alpha-subunit gene, as well as of the rat and mouse genes, was found to contain a single CRE homolog that differed from its human counterpart by a single nucleotide. This difference substantially reduced the binding affinity of the bovine CRE homolog for the nuclear protein that bound to the human alpha CRE and thereby rendered the bovine alpha-subunit promoter inactive in human choriocarcinoma cells. However, conversion of the bovine alpha CRE homolog to an authentic alpha CRE restored activity to the bovine alpha-subunit promoter in choriocarcinoma cells. Similarly, a human but not a bovine alpha transgene was expressed in placenta in transgenic mice. Thus, placenta-specific expression of the human alpha-subunit gene may be the consequence of the recent evolution of a functional CRE. Expression of the human alpha transgene in mouse placenta further suggests that evolution of placenta-specific trans-acting factors preceded the appearance of this element. Finally, in contrast to their divergent patterns of placental expression, both the human and bovine alpha

  4. The Detailed Chemical Properties of M31 Star Clusters. I. Fe, Alpha and Light Elements

    NASA Astrophysics Data System (ADS)

    Colucci, Janet E.; Bernstein, Rebecca A.; Cohen, Judith G.

    2014-12-01

    We present ages, [Fe/H] and abundances of the α elements Ca I, Si I, Ti I, Ti II, and light elements Mg I, Na I, and Al I for 31 globular clusters (GCs) in M31, which were obtained from high-resolution, high signal-to-noise ratio >60 echelle spectra of their integrated light (IL). All abundances and ages are obtained using our original technique for high-resolution IL abundance analysis of GCs. This sample provides a never before seen picture of the chemical history of M31. The GCs are dispersed throughout the inner and outer halo, from 2.5 kpc < R M31 < 117 kpc. We find a range of [Fe/H] within 20 kpc of the center of M31, and a constant [Fe/H] ~ - 1.6 for the outer halo clusters. We find evidence for at least one massive GC in M31 with an age between 1 and 5 Gyr. The α-element ratios are generally similar to the Milky Way GC and field star ratios. We also find chemical evidence for a late-time accretion origin for at least one cluster, which has a different abundance pattern than other clusters at similar metallicity. We find evidence for star-to-star abundance variations in Mg, Na, and Al in the GCs in our sample, and find correlations of Ca, Mg, Na, and possibly Al abundance ratios with cluster luminosity and velocity dispersion, which can potentially be used to constrain GC self-enrichment scenarios. Data presented here were obtained with the HIRES echelle spectrograph on the Keck I telescope. The data presented herein were obtained at the W. M. Keck Observatory, which is operated as a scientific partnership among the California Institute of Technology, the University of California and the National Aeronautics and Space Administration. The Observatory was made possible by the generous financial support of the W. M. Keck Foundation.

  5. THE DETAILED CHEMICAL PROPERTIES OF M31 STAR CLUSTERS. I. Fe, ALPHA AND LIGHT ELEMENTS

    SciTech Connect

    Colucci, Janet E.; Bernstein, Rebecca A.; Cohen, Judith G.

    2014-12-20

    We present ages, [Fe/H] and abundances of the α elements Ca I, Si I, Ti I, Ti II, and light elements Mg I, Na I, and Al I for 31 globular clusters (GCs) in M31, which were obtained from high-resolution, high signal-to-noise ratio >60 echelle spectra of their integrated light (IL). All abundances and ages are obtained using our original technique for high-resolution IL abundance analysis of GCs. This sample provides a never before seen picture of the chemical history of M31. The GCs are dispersed throughout the inner and outer halo, from 2.5 kpc < R {sub M31} < 117 kpc. We find a range of [Fe/H] within 20 kpc of the center of M31, and a constant [Fe/H] ∼ – 1.6 for the outer halo clusters. We find evidence for at least one massive GC in M31 with an age between 1 and 5 Gyr. The α-element ratios are generally similar to the Milky Way GC and field star ratios. We also find chemical evidence for a late-time accretion origin for at least one cluster, which has a different abundance pattern than other clusters at similar metallicity. We find evidence for star-to-star abundance variations in Mg, Na, and Al in the GCs in our sample, and find correlations of Ca, Mg, Na, and possibly Al abundance ratios with cluster luminosity and velocity dispersion, which can potentially be used to constrain GC self-enrichment scenarios. Data presented here were obtained with the HIRES echelle spectrograph on the Keck I telescope.

  6. Light, alpha, and Fe-peak element abundances in the galactic bulge

    SciTech Connect

    Johnson, Christian I.; Rich, R. Michael; Kobayashi, Chiaki; Kunder, Andrea; Koch, Andreas E-mail: rmr@astro.ucla.edu E-mail: akunder@aip.de

    2014-10-01

    We present radial velocities and chemical abundances of O, Na, Mg, Al, Si, Ca, Cr, Fe, Co, Ni, and Cu for a sample of 156 red giant branch stars in two Galactic bulge fields centered near (l, b) = (+5.25,–3.02) and (0,–12). The (+5.25,–3.02) field also includes observations of the bulge globular cluster NGC 6553. The results are based on high-resolution (R ∼ 20,000), high signal-to-noise ration (S/N ≳ 70) FLAMES-GIRAFFE spectra obtained through the European Southern Observatory archive. However, we only selected a subset of the original observations that included spectra with both high S/N and that did not show strong TiO absorption bands. This work extends previous analyses of this data set beyond Fe and the α-elements Mg, Si, Ca, and Ti. While we find reasonable agreement with past work, the data presented here indicate that the bulge may exhibit a different chemical composition than the local thick disk, especially at [Fe/H] ≳ –0.5. In particular, the bulge [α/Fe] ratios may remain enhanced to a slightly higher [Fe/H] than the thick disk, and the Fe-peak elements Co, Ni, and Cu appear enhanced compared to the disk. There is also some evidence that the [Na/Fe] (but not [Al/Fe]) trends between the bulge and local disk may be different at low and high metallicity. We also find that the velocity dispersion decreases as a function of increasing [Fe/H] for both fields, and do not detect any significant cold, high-velocity populations. A comparison with chemical enrichment models indicates that a significant fraction of hypernovae may be required to explain the bulge abundance trends, and that initial mass functions that are steep, top-heavy (and do not include strong outflow), or truncated to avoid including contributions from stars >40 M {sub ☉} are ruled out, in particular because of disagreement with the Fe-peak abundance data. For most elements, the NGC 6553 stars exhibit abundance trends nearly identical to comparable metallicity bulge field

  7. Light, Alpha, and Fe-peak Element Abundances in the Galactic Bulge

    NASA Astrophysics Data System (ADS)

    Johnson, Christian I.; Rich, R. Michael; Kobayashi, Chiaki; Kunder, Andrea; Koch, Andreas

    2014-10-01

    We present radial velocities and chemical abundances of O, Na, Mg, Al, Si, Ca, Cr, Fe, Co, Ni, and Cu for a sample of 156 red giant branch stars in two Galactic bulge fields centered near (l, b) = (+5.25,-3.02) and (0,-12). The (+5.25,-3.02) field also includes observations of the bulge globular cluster NGC 6553. The results are based on high-resolution (R ~ 20,000), high signal-to-noise ration (S/N >~ 70) FLAMES-GIRAFFE spectra obtained through the European Southern Observatory archive. However, we only selected a subset of the original observations that included spectra with both high S/N and that did not show strong TiO absorption bands. This work extends previous analyses of this data set beyond Fe and the α-elements Mg, Si, Ca, and Ti. While we find reasonable agreement with past work, the data presented here indicate that the bulge may exhibit a different chemical composition than the local thick disk, especially at [Fe/H] >~ -0.5. In particular, the bulge [α/Fe] ratios may remain enhanced to a slightly higher [Fe/H] than the thick disk, and the Fe-peak elements Co, Ni, and Cu appear enhanced compared to the disk. There is also some evidence that the [Na/Fe] (but not [Al/Fe]) trends between the bulge and local disk may be different at low and high metallicity. We also find that the velocity dispersion decreases as a function of increasing [Fe/H] for both fields, and do not detect any significant cold, high-velocity populations. A comparison with chemical enrichment models indicates that a significant fraction of hypernovae may be required to explain the bulge abundance trends, and that initial mass functions that are steep, top-heavy (and do not include strong outflow), or truncated to avoid including contributions from stars >40 M ⊙ are ruled out, in particular because of disagreement with the Fe-peak abundance data. For most elements, the NGC 6553 stars exhibit abundance trends nearly identical to comparable metallicity bulge field stars. However, the

  8. Cyclic AMP regulation of the human glycoprotein hormone. cap alpha. -subunit gene is mediated by an 18-base-pair element

    SciTech Connect

    Silver, B.J.; Bokar, J.A.; Virgin, J.B.; Vallen, E.A.; Milsted, A.; Nilson, J.H.

    1987-04-01

    cAMP regulates transcription of the gene encoding the ..cap alpha..-subunit of human chorionic gonadotropin (hCG) in the choriocarcinoma cells (BeWo). To define the sequences required for regulation by cAMP, the authors inserted fragments from the 5' flanking region of the ..cap alpha..-subunit gene into a test vector containing the simian virus 40 early promoter (devoid of its enhancer) linked to the bacterial chloramphenicol acetyltransferase (CAT) gene. Results from transient expression assays in BeWo cells indicated that a 1500-base-pair (bp) fragment conferred cAMP responsiveness on the CAT gene regardless of position or orientation of the insert relative to the viral promoter. A subfragment extending from position -169 to position -100 had the same effect on cAMP-induced expression. Furthermore, the entire stimulatory effect could be achieved with an 18-bp synthetic oligodeoxynucleotide corresponding to a direct repeat between position -146 and -111. In the absence of cAMP, the ..cap alpha..-subunit 5' flanking sequence also enhanced transcription from the simian virus 40 early promoter. They localized this enhancer activity to the same -169/-100 fragment containing the cAMP response element. The 18-bp element alone, however, had no effect on basal expression. Thus, this short DNA sequence serves as a cAMP response element and also functions independently of other promoter-regulatory elements located in the 5' flanking sequence of the ..cap alpha..-subunit gene.

  9. The SEGUE Stellar Parameter Pipeline and the alpha elements of stars in the Milky Way

    NASA Astrophysics Data System (ADS)

    Lee, Young Sun

    comparison of the color-magnitude diagrams with stellar evolution models; satisfactory agreement (s( T eff ) < 200 K and s(logg) <= 0.4 dex) is found. >From the above considerations it is concluded that the SSPP is able to determine radial velocities and atmospheric parameters for stars (in the range 4500 K <= T eff <= 7500 K) with sufficient accuracy and precision to enable detailed explorations of the chemical compositions and kinematics of the disk and halo populations of the Galaxy. A method for determining the abundance ratio of the a-elements (O, Mg, Si, Ca, Ti) with respect to Fe (collectively parameterized as "[a/Fe]") is also explored. Results of a comparison with the ELODIE spectral library and from a noise injection experiment suggest that an accuracy in [a/Fe] of about 0.1 dex for spectra with S/N > 20/1 is achievable. This technique is used to estimate [a/Fe] for a total of 39,167 spectrophotometric and telluric calibration stars from the most recent public release (DR-6; Adelman-McCarthy et al. 2008), in order to study the a-abundance patterns in stars of the Galactic halo. Local space velocities ( U, V, W ) and orbital parameters (such as Z max , R apo , R peri , V [straight phi] , and eccentricity) were calculated for this sample, and a total of 7590 potential halo stars were selected by applying cuts of V [straight phi] <= 80 km s -1 , Z max > 1 kpc, and [Fe/H] <= -1.0. Furthermore, the sample was divided into two groups: a "dissipative component (or inner halo)" with stars having 40 <= V [straight phi] <= 80 km s -1 and R apo< 16 kpc and an "accreted component (or outer halo)" with stars having V [straight phi] < 40 km s -1 or R apo >= 16 kpc, or both. Results for the comparison of these two samples are presented as a first step toward understanding the assembly history of the halos of the Galaxy.

  10. Regulated tissue-specific alternative splicing of enhanced green fluorescent protein transgenes conferred by alpha-tropomyosin regulatory elements in transgenic mice.

    PubMed

    Ellis, Peter D; Smith, Christopher W J; Kemp, Paul

    2004-08-27

    The mutually exclusive exons 2 and 3 of alpha-tropomyosin (alphaTM) have been used as a model system for strictly regulated alternative splicing. Exon 2 inclusion is only observed at high levels in smooth muscle (SM) tissues, whereas striated muscle and non-muscle cells use predominantly exon 3. Experiments in cell culture have shown that exon 2 selection results from repression of exon 3 and that this repression is mediated by regulatory elements flanking exon 3. We have now tested the cell culture-derived model in transgenic mice. We show that by harnessing the intronic splicing regulatory elements, expression of an enhanced green fluorescent protein transgene with a constitutively active promoter can be restricted to SM cells. Splicing of both endogenous alphaTM and a series of transgenes carrying regulatory element mutations was analyzed by reverse transcriptasePCR. These studies indicated that although SM-rich tissues are equipped to regulate splicing of high levels of endogenous or transgene alphaTM RNA, other non-SM tissues such as spleen, which express lower amounts of alphaTM, also splice significant proportions of exon 2, and this splicing pattern can be recapitulated by transgenes expressed at low levels. We confirm the importance in vivo of the negatively acting regulatory elements for regulated skipping of exon 3. Moreover, we provide evidence that some of the regulatory factors responsible for exon 3 skipping appear to be titratable, with loss of regulated splicing sometimes being associated with high transgene expression levels. PMID:15194683

  11. Fully liquid DTaP-IPV-Hib pediatric combination vaccine (Pediacel): a review of 18 years of clinical experience.

    PubMed

    Reynolds, Donna L; Vidor, Emmanuel

    2014-08-01

    Safe and effective combination pediatric vaccines are necessary to simplify complex immunization schedules and to improve coverage and protection for children worldwide. We provide an overview of the 18 years of clinical and worldwide experience with DTaP-IPV-Hib (Pediacel(®)), a unique fully liquid pentavalent vaccine (diphtheria [D], tetanus [T], acellular pertussis, inactivated poliovirus [IPV], Haemophilus influenzae type b [Hib]). Pediacel has demonstrated good and lasting immunogenicity in many populations, with differing primary series and booster schedules, and with a variety of coadministered vaccines. The acellular pertussis antigens have proven efficacy and real-world effectiveness. Clinical and post-marketing studies confirm the safety of Pediacel. Pediacel can be used for primary series and toddler booster doses, as well as in mixed pediatric vaccine schedules. PMID:24985159

  12. {alpha}-decay properties of superheavy elements Z=113-125 in the relativistic mean-field theory with vector self-coupling of {omega} meson

    SciTech Connect

    Sharma, M.M.; Farhan, A.R.; Muenzenberg, G.

    2005-05-01

    We have investigated properties of {alpha}-decay chains of recently produced superheavy elements Z=115 and Z=113 using the new Lagrangian model NL-SV1 with inclusion of the vector self-coupling of the {omega} meson in the framework of relativistic mean-field theory. It is shown that the experimentally observed {alpha}-decay energies and half-lives are reproduced well by this Lagrangian model. Further calculations for the heavier elements with Z=117-125 show that these nuclei are superdeformed with a prolate shape in the ground state. A superdeformed shell closure at Z=118 lends an additional binding and an extra stability to nuclei in this region. Consequently, it is predicted that the corresponding Q{sub {alpha}} values provide {alpha}-decay half-lives for heavier superheavy nuclei within experimentally feasible conditions. The results are compared with those of macroscopic-microscopic approaches. A perspective of the difference in shell effects among various approaches is presented and its consequences for superheavy nuclei are discussed.

  13. K{beta}/K{alpha} X-Ray Transition-Probability Ratios for 8 Elements in the range 69 {<=} Z {<=} 76

    SciTech Connect

    Kaya, N.; Tirasoglu, E.; Aylikci, V.; Cengiz, E.

    2007-04-23

    K{beta}/K{alpha} X-ray transition-probabilitiy ratios for 8 elements in the range 69 {<=} Z {<=} 76 were measured with an Ultra-LEGe solid state detector with a resolution of 150 eV at 5.9 keV. The characteristic K X-rays were produced by a 25 mCi 57Co annular source. Experimental results have been compared with theoretically calculated values and other available experimental results.

  14. Elemental Analysis of the Surface of Comet 67p/Churyumov-Gerasimenko with the Alpha Particle X-Ray Spectrometer APXS on the Rosetta Lander Philae: Preliminary Results

    NASA Astrophysics Data System (ADS)

    Klingelhoefer, G.; Schmanke, D.; Girones-Lopez, J.; Brueckner, J.; d'Uston, C.; Economou, T.; Gellert, R.; Markovski, C.

    2014-12-01

    After a 10 years cruise the Rosetta probe has reached its final target, the comet 67P/Churyumov-Gerasimenko. The main objectives of the mission are to gain more knowledge of the composition, the origin and formation of comets and the solar system. After extensive remote exploration of the comet the lander Philae will be separated to land on the comet surface, starting immediately examining its landing site with its scientific payload. Part of this payload is the APXS (Alpha Particle X-Ray Spectrometer). It will measure in situ the chemical composition of the comet's surface and it's changes during the journey of the comet towards the sun. APXS is a combination of two spectrometers in one single instrument. It will irradiate the comet surface using Curium 244 sources, which are emitting alpha-particle and X-rays. In the alpha-mode the instrument uses alpha backscattering spectroscopy to detect lower Z elements like C, N and O and groups of elements with higher Z. In the X-ray mode alpha particle / X-ray induced X-ray spectroscopy (XRF) will allow the detection of most of the higher Z elements from Na up to Ni and above. Both modes will be always run in parallel allowing to determine lower and higher Z elements simultaneously. For 3 years the solar powered Rosetta probe had to pass a hibernation phase because of a long passage far away to the sun. After wakeup in January 2014 an extensive test phase of all instruments and subsystems has been performed, including the APXS. After landing on the comet an intense initial measurement phase of all instruments is planned, the First Science Sequence (FSS). It will be followed by a long term science phase (LTS). As long as possible APXS and the other instruments will continue to measure and monitor the changes and increasing activity of the comet during its journey towards the inner region of the solar system.The project is funded by the German Space Agency DLR under contracts 50 QP 0404 and 50 QP 0902. References: G

  15. Ovarian Sertoli-Leydig cell tumor with heterologous elements of gastrointestinal type associated with elevated serum alpha-fetoprotein level: an unusual case and literature review

    PubMed Central

    Horta, Mariana; Cunha, Teresa Margarida; Marques, Rita Canas; Félix, Ana

    2014-01-01

    Here we describe the case of a 19-year-old woman with a poorly differentiated ovarian Sertoli-Leydig cell tumor and an elevated serum alpha-fetoprotein level. The patient presented with diffuse abdominal pain and bloating. Physical examination, ultrasound, and magnetic resonance imaging revealed a right ovarian tumor that was histopathologically diagnosed as a poorly differentiated Sertoli-Leydig cell tumor with heterologous elements. Her alpha-fetoprotein serum level was undetectable after tumor resection. Sertoli-Leydig cell tumors are rare sex cord-stromal tumors that account for 0.5% of all ovarian neoplasms. Sertoli-Leydig cell tumors tend to be unilateral and occur in women under 30 years of age. Although they are the most common virilizing tumor of the ovary, about 60% are endocrine-inactive tumors. Elevated serum levels of alpha-fetoprotein are rarely associated with Sertoli-Leydig cell tumors, with only approximately 30 such cases previously reported in the literature. The differential diagnosis should include common alpha-fetoprotein-producing ovarian entities such as germ cell tumors, as well as other non-germ cell tumors that have been rarely reported to produce this tumor marker. PMID:25926909

  16. In Vitro Selection of Single-Stranded DNA Molecular Recognition Elements against S. aureus Alpha Toxin and Sensitive Detection in Human Serum

    PubMed Central

    Hong, Ka L.; Battistella, Luisa; Salva, Alysia D.; Williams, Ryan M.; Sooter, Letha J.

    2015-01-01

    Alpha toxin is one of the major virulence factors secreted by Staphylococcus aureus, a bacterium that is responsible for a wide variety of infections in both community and hospital settings. Due to the prevalence of S. aureus related infections and the emergence of methicillin-resistant S. aureus, rapid and accurate diagnosis of S. aureus infections is crucial in benefiting patient health outcomes. In this study, a rigorous Systematic Evolution of Ligands by Exponential Enrichment (SELEX) variant previously developed by our laboratory was utilized to select a single-stranded DNA molecular recognition element (MRE) targeting alpha toxin with high affinity and specificity. At the end of the 12-round selection, the selected MRE had an equilibrium dissociation constant (Kd) of 93.7 ± 7.0 nM. Additionally, a modified sandwich enzyme-linked immunosorbent assay (ELISA) was developed by using the selected ssDNA MRE as the toxin-capturing element and a sensitive detection of 200 nM alpha toxin in undiluted human serum samples was achieved. PMID:25633102

  17. Production of inflammatory cytokines in response to diphtheria-pertussis-tetanus (DPT), haemophilus influenzae type b (Hib), and 7-valent pneumococcal (PCV7) vaccines

    PubMed Central

    Kashiwagi, Yasuyo; Miyata, Akiko; Kumagai, Takuji; Maehara, Kouji; Suzuki, Eitarou; Nagai, Takao; Ozaki, Takao; Nishimura, Naoko; Okada, Kenji; Kawashima, Hisashi; Nakayama, Tetsuo

    2014-01-01

    Haemophilus influenzae type b (Hib) and 7-valent pneumococcal (PCV7) vaccines both became recommended in Japan in 2010. In this study, cytokine production was investigated in peripheral blood mononuclear cells (PBMCs) cultures stimulated with diphtheria and tetanus toxoids combined with acellular pertussis vaccine (DPT), Hib, and PCV7 separately or concurrent different combinations, all as final off-the-shelf vaccines without the individual vaccine components as controls. Higher IL-1β levels were produced when cultures were stimulated with PCV than with DPT or Hib, and the concurrent stimulation including PCV7 enhanced the production of IL-1β. Although Hib induced higher levels of IL-6, no significant difference was observed in IL-6 production with the concurrent stimulation. The concurrent stimulation with Hib/PCV7 and DPT/Hib/PCV7 produced higher levels of TNF-α and human G-CSF. Cytokine profiles were examined in serum samples obtained from 61 vaccine recipients with febrile reactions and 18 recipients without febrile illness within 24 h of vaccination. No significant difference was observed in cytokine levels of IL-1β, IL-4, IL-6, IL-10, IL-12, IFN-γ, MIP-1, TNF-α, and prostaglandin E2 (PGE2) in sera between the two groups. However, significantly higher levels of human G-CSF were observed in recipients with febrile illness than in those without febrile reactions. Further investigations of the significance of elevated serum G-CSF levels are required in vaccine recipients with febrile illness. PMID:24589970

  18. Cis and trans-acting elements involved in the activation of Arabidopsis thaliana A1 gene encoding the translation elongation factor EF-1 alpha.

    PubMed

    Curie, C; Liboz, T; Bardet, C; Gander, E; Médale, C; Axelos, M; Lescure, B

    1991-03-25

    In A. thaliana the translation elongation factor EF-1 alpha is encoded by a small multigenic family of four members (A1-A4). The A1 gene promoter has been dissected and examined in a transient expression system using the GUS reporter gene. Deletion analysis has shown that several elements are involved in the activation process. One cis-acting domain, the TEF 1 box, has been accurately mapped 100 bp upstream of the transcription initiation site. This domain is the target for trans-acting factors identified in nuclear extracts prepared from A. thaliana. Homologies are found between the TEF 1 box and sequences present at the same location within the A2, A3 and A4 promoters. This observation, together with those obtained from gel retardation assays performed using DNA fragments from the A4 promoter, suggest that the activation process mediated by the TEF 1 element is conserved among the A. thaliana EF-1 alpha genes. Analysis of nearly full length cDNA clones has shown that in addition to a single intron located within the coding region, the A1 gene contains a second intron located within the 5' non coding region. Such an intron is also present within the A2, A3 and A4 genes. This 5' intervening sequence appears to be essential to obtain a maximum GUS activity driven by the A1 gene promoter. PMID:1840652

  19. Cis and trans-acting elements involved in the activation of Arabidopsis thaliana A1 gene encoding the translation elongation factor EF-1 alpha.

    PubMed Central

    Curie, C; Liboz, T; Bardet, C; Gander, E; Médale, C; Axelos, M; Lescure, B

    1991-01-01

    In A. thaliana the translation elongation factor EF-1 alpha is encoded by a small multigenic family of four members (A1-A4). The A1 gene promoter has been dissected and examined in a transient expression system using the GUS reporter gene. Deletion analysis has shown that several elements are involved in the activation process. One cis-acting domain, the TEF 1 box, has been accurately mapped 100 bp upstream of the transcription initiation site. This domain is the target for trans-acting factors identified in nuclear extracts prepared from A. thaliana. Homologies are found between the TEF 1 box and sequences present at the same location within the A2, A3 and A4 promoters. This observation, together with those obtained from gel retardation assays performed using DNA fragments from the A4 promoter, suggest that the activation process mediated by the TEF 1 element is conserved among the A. thaliana EF-1 alpha genes. Analysis of nearly full length cDNA clones has shown that in addition to a single intron located within the coding region, the A1 gene contains a second intron located within the 5' non coding region. Such an intron is also present within the A2, A3 and A4 genes. This 5' intervening sequence appears to be essential to obtain a maximum GUS activity driven by the A1 gene promoter. Images PMID:1840652

  20. TFII-I down-regulates a subset of estrogen-responsive genes through its interaction with an initiator element and estrogen receptor alpha.

    PubMed

    Ogura, Yuji; Azuma, Motoki; Tsuboi, Yasunori; Kabe, Yasuaki; Yamaguchi, Yuki; Wada, Tadashi; Watanabe, Hajime; Handa, Hiroshi

    2006-04-01

    TFII-I was initially identified as the general transcription factor that binds to initiator (Inr) elements in vitro. Subsequent studies have shown that TFII-I activates transcription of various genes either through Inr elements or through other upstream elements in vivo. Since, however, most studies so far on TFII-I have been limited to over-expression and reporter gene assays, we reevaluated the role of TFII-I in vivo by using stable knockdown with siRNA and by examining the expression of endogenous genes. Contrary to the widely accepted view, here we show that TFII-I is not important for cell viability in general but rather inhibits the growth of MCF-7 human breast cancer cells. MCF-7 cells are known to proliferate in an estrogen-dependent manner. Through analysis of TFII-I's cell-type specific growth inhibitory effect, we show evidence that TFII-I down-regulates a subset of estrogen-responsive genes, only those containing Inr elements, by recruiting estrogen receptor (ER) alpha and corepressors to these promoters. Thus, this study has revealed an unexpected new role of TFII-I as a negative regulator of transcription and cell proliferation. PMID:16611241

  1. Refinement of the Compton-Rayleigh scatter ratio method for use on the Mars Science Laboratory alpha particle X-ray spectrometer: II - Extraction of invisible element content

    NASA Astrophysics Data System (ADS)

    Perrett, Glynis M.; Campbell, John L.; Gellert, Ralf; King, Penelope L.; Nield, Emily; O'Meara, Joanne M.; Pradler, Irina

    2016-02-01

    The intensity ratio C/R between Compton and Rayleigh scatter peaks of the exciting Pu L X-rays in the alpha particle X-ray spectrometer (APXS) is strongly affected by the presence of very light elements such as oxygen which cannot be detected directly by the APXS. C/R values are determined along with element concentrations by fitting APXS spectra of geochemical reference materials (GRMs) with the GUAPX code. A quantity K is defined as the ratio between the C/R value determined by Monte Carlo simulation based on the measured element concentrations and the fitted C/R value from the spectrum. To ensure optimally accurate K values, the choice of appropriate GRMs is explored in detail, with attention paid to Rb and Sr, whose characteristic Kα X-ray peaks overlap the Pu Lα scatter peaks. The resulting relationship between the ratio K and the overall oxygen fraction is linear. This provides a calibration from which the concentration of additional light invisible constituents (ALICs) such as water may be estimated in unknown rock and conglomerate samples. Several GRMs are used as 'unknowns' in order to evaluate the accuracy of ALIC concentrations derived in this manner.

  2. Estrogen response element and the promoter context of the human and mouse lactoferrin genes influence estrogen receptor alpha-mediated transactivation activity in mammary gland cells.

    PubMed

    Stokes, Kenya; Alston-Mills, Brenda; Teng, Christina

    2004-10-01

    A critical step in estrogen action is the recognition of estrogen responsive elements (EREs) by liganded estrogen receptor. Our current studies were designed to determine whether an extended estrogen response element half-site (ERRE) contributes to the differential estrogen responses of the human and mouse lactoferrin overlapping chicken ovalbumin upstream promoter/ERE sequences (estrogen response modules, ERMs) in the context of their natural promoters. Transient transfections of MCF-7 cells show that liganded estrogen receptor alpha (ERalpha) activates transcription of the human lactoferrin ERM fourfold higher than the mouse lactoferrin ERM in the context of their natural promoters. Since the ERRE of the human lactoferrin gene naturally occurs 18 bp upstream from the ERM and is absent in the mouse lactoferrin gene promoter, we created a chimeric mouse lactoferrin CAT reporter, which now encodes the ERRE in the identical location as in the human lactoferrin gene. The addition of the ERRE in the mouse lactoferrin gene rendered this reporter extremely responsive to estrogen stimulation. Using limited protease digestions and electrophoretic mobility shift assays, we showed that the binding and protease sensitivity of ERalpha bound to the mouse ERM with or without the ERRE, differed. Importantly, occupancy of additional nuclear receptors at the ERRE may contribute to ERalpha binding and activation. Furthermore, the presence of ERRE influences the selectivity of coactivators in liganded ERalpha-mediated transcriptional activity. When the receptor is bound to human and mouse plus genes, which contain the ERRE, steroid receptor coactivator (SRC)-2 was preferred, while SRC-1 and SRC-3 coactivators selectively enhanced the mouse lactoferrin gene activity. Moreover, peroxisome proliferator activated receptor-gamma coactivator-1 (PGC-1alpha) and PGC-1-related estrogen receptor coactivator (PERC) robustly increase the transcriptional function of ERalpha in the presence of the

  3. Role of an inhibitory pyrimidine element and polypyrimidine tract binding protein in repression of a regulated alpha-tropomyosin exon.

    PubMed

    Gooding, C; Roberts, G C; Smith, C W

    1998-01-01

    Splicing of exons 2 and 3 of a-tropomyosin (TM) involves mutually exclusive selection of either exon 3, which occurs in most cells, or of exon 2 in smooth muscle (SM) cells. The SM-specific selection of exon 2 results from the inhibition of exon 3. At least two essential cis-acting elements are required for exon 3 inhibition, the upstream and downstream regulatory elements (URE and DRE). These elements are essential for repression of TM exon 3 in SM cells, and also mediate a low level of repression of exon 3 in an in vitro 5' splice site competition assay in HeLa extracts. Here, we show that the DRE consists of at least two discrete components, a short region containing a number of UGC motifs, and an essential pyrimidine-rich tract (DY). We show that the specific sequence of the DY element is important and that DY is able to bind to factors in HeLa nuclear extracts that mediate a low background level of exon 3 skipping. Deletion of a sequence within DY identified as an optimal binding site for PTB impairs (1) regulation of splicing in vivo, (2) skipping of exon 3 in an in vitro 5' splice site competition, (3) the ability of DY competitors to affect the 5' splice site competition in vitro, and (4) binding of PTB to DY. Addition of recombinant PTB to in vitro splicing reactions is able to partially reverse the effects of the DY competitor RNA. The data are consistent with a model for regulation of TM splicing that involves the participation of both tissue-specific and general inhibitory factors and in which PTB plays a role in repressing both splice sites of exon 3. PMID:9436911

  4. Single-stranded DNA-binding proteins PURalpha and PURbeta bind to a purine-rich negative regulatory element of the alpha-myosin heavy chain gene and control transcriptional and translational regulation of the gene expression. Implications in the repression of alpha-myosin heavy chain during heart failure.

    PubMed

    Gupta, Madhu; Sueblinvong, Viranuj; Raman, Jai; Jeevanandam, Valluvan; Gupta, Mahesh P

    2003-11-01

    The alpha-myosin heavy chain is a principal molecule of the thick filament of the sarcomere, expressed primarily in cardiac myocytes. The mechanism for its cardiac-restricted expression is not yet fully understood. We previously identified a purine-rich negative regulatory (PNR) element in the first intron of the gene, which is essential for its cardiac-specific expression (Gupta, M., Zak, R., Libermann, T. A., and Gupta, M. P. (1998) Mol. Cell. Biol. 18, 7243-7258). In this study we cloned and characterized muscle and non-muscle factors that bind to this element. We show that two single-stranded DNA-binding proteins of the PUR family, PURalpha and PURbeta, which are derived from cardiac myocytes, bind to the plus strand of the PNR element. In functional assays, PURalpha and PURbeta repressed alpha-myosin heavy chain (alpha-MHC) gene expression in the presence of upstream regulatory sequences of the gene. However, from HeLa cells an Ets family of protein, Ets-related protein (ERP), binds to double-stranded PNR element. The ERP.PNR complex inhibited the activity of the basal transcription complex from homologous as well as heterologous promoters in a PNR position-independent manner, suggesting that ERP acts as a silencer of alpha-MHC gene expression in non-muscle cells. We also show that PUR proteins are capable of binding to alpha-MHC mRNA and attenuate its translational efficiency. Furthermore, we show robust expression of PUR proteins in failing hearts where alpha-MHC mRNA levels are suppressed. Together, these results reveal that (i) PUR proteins participate in transcriptional as well as translational regulation of alpha-MHC expression in cardiac myocytes and (ii) ERP may be involved in cardiac-restricted expression of the alpha-MHC gene by preventing its expression in non-muscle cells. PMID:12933792

  5. Competition between alpha-decay and spontaneous fission at isotopes of superheavy elements Rf, Db, and Sg

    SciTech Connect

    Anghel, Claudia Ioana; Silisteanu, Andrei Octavian

    2015-12-07

    The most important decay modes for heavy and superheavy nuclei are their α-decay and spontaneous fission. This work investigates the evolution and the competition of these decay modes in long isotopic sequences. The partial half-lives are given by minimal sets of parameters extracted from the fit of experimental data and theoretical results. A summary of the experimental and calculated α-decay and spontaneous fission half-lives of the isotopes of elements Rf, Db, and Sg is presented. Some half-life extrapolations for nuclides not yet known are also obtained.

  6. Primary structure determination of five sialylated oligosaccharides derived from bronchial mucus glycoproteins of patients suffering from cystic fibrosis. The occurrence of the NeuAc alpha(2----3)Gal beta(1----4)[Fuc alpha(1----3)] GlcNAc beta(1----.) structural element revealed by 500-MHz 1H NMR spectroscopy.

    PubMed

    Lamblin, G; Boersma, A; Klein, A; Roussel, P; van Halbeek, H; Vliegenthart, J F

    1984-07-25

    The structure of sialylated carbohydrate units of bronchial mucins obtained from cystic fibrosis patients was investigated by 500-MHz 1H NMR spectroscopy in conjunction with sugar analysis. After subjecting the mucins to alkaline borohydride degradation, sialylated oligosaccharide-alditols were isolated by anion-exchange chromatography and fractionated by high performance liquid chromatography. Five compounds could be obtained in a rather pure state; their structures were established as the following: A-1, NeuAc alpha(2----3)Gal beta(1----4) [Fuc alpha(1----3)]GlcNAc beta(1----3)Gal-NAc-ol; A-2, NeuAc alpha(2----3)Gal beta(1----4)GlcNAc beta(1----6)-[GlcNAc beta (1----3)]GalNAc-o1; A-3, NeuAc alpha(2----3)Gal beta-(1----4)[Fuc alpha(1----3)]GlcNAc beta(1----3)Gal beta(1----3) GalNAc-o1; A-4, NeuAc alpha(2----3)Gal beta(1----4)[Fuc alpha(1----3)]Glc-NAc NAc beta(1----6)[GlcNAc beta(1----3)]GalNAc-o1; A-6,NeuAc alpha-(2----3) Gal beta(1----4)[Fuc alpha(1----3)]GlcNAc beta(1----6)[Gal beta-(1----4) GlcNAc beta(1----3)]GalNAc-o1. The simultaneous presence of sialic acid in alpha(2----3)-linkage to Gal and fucose in alpha(1----3)-linkage to GlcNAc of the same N-acetyllactosamine unit could be adequately proved by high resolution 1H NMR spectroscopy. This sequence constitutes a novel structural element for mucins. PMID:6746638

  7. Members of a new family of DNA-binding proteins bind to a conserved cis-element in the promoters of alpha-Amy2 genes.

    PubMed

    Rushton, P J; Macdonald, H; Huttly, A K; Lazarus, C M; Hooley, R

    1995-11-01

    The promoters of wheat, barley and wild oat alpha-Amy2 genes contain a number of conserved cis-acting elements that bind nuclear protein, we report here the isolation of two cDNAs encoding proteins (ABF1 and ABF2) that bind specifically to one of these elements, Box 2 (ATTGACTTGACCGTCATCGG). The two proteins are unrelated to each other except for a conserved region of 56-58 amino acids that consists of 25 highly conserved amino acids followed by a putative zinc finger motif, C-X4-5-C-X22-23-H-X1-H. ABF1 contains two such conserved regions, whereas ABF2 possesses only one but also contains a potential leucine zipper motif, suggesting that it could form homo- or heterodimers. ABF1 and ABF2 expressed in Escherichia coli bound specifically to Box 2 probes in gel retardation experiments; this binding was abolished by the transition-metal-chelating agent, 1,10-o-phenanthroline and by EDTA. We propose that ABF1 and ABF2 are representatives of two classes of a new family of plant sequence-specific DNA-binding proteins. PMID:8541496

  8. Measurement of the L. beta. to L. cap alpha. intensity ratio through a selective excitation of L/sub III/ subshell in elements of Zgreater than or equal to70

    SciTech Connect

    Murty, G.S.K.; Chandrasekhar Rao, M.V.S.; Raghavaiah, C.V.; Reddy, S.B.; Satyanarayana, G.; Sastry, D.L.

    1989-02-01

    The intensity ratio of L..beta../sub 2/+L..beta../sub 5/+L..beta../sub 6/ to L..cap alpha../sub 1/+L..cap alpha../sub 2/ was measured in seven elements (Zgreater than or equal to70) through a selective excitation of the L/sub III/ subshell using an x-ray tube. A high-resolution Si(Li) detector system coupled to a computer controlled multichannel analyzer was used in these measurements. The results show that the relative transition probabilities L..beta.. and L..cap alpha.. agree with the relativistic Hartree-Fock-Slater calculations in the case of Yb and U, while a discrepancy of 3.1--8.7 % between experiment and theory is found for the other elements.

  9. Regulation of steroid 5-{alpha} reductase type 2 (Srd5a2) by sterol regulatory element binding proteins and statin

    SciTech Connect

    Seo, Young-Kyo; Zhu, Bing; Jeon, Tae-Il; Osborne, Timothy F.

    2009-11-01

    In this study, we show that sterol regulatory element binding proteins (SREBPs) regulate expression of Srd5a2, an enzyme that catalyzes the irreversible conversion of testosterone to dihydroxytestosterone in the male reproductive tract and is highly expressed in androgen-sensitive tissues such as the prostate and skin. We show that Srd5a2 is induced in livers and prostate from mice fed a chow diet supplemented with lovastatin plus ezitimibe (L/E), which increases the activity of nuclear SREBP-2. The three fold increase in Srd5a2 mRNA mediated by L/E treatment was accompanied by the induction of SREBP-2 binding to the Srd5a2 promoter detected by a ChIP-chip assay in liver. We identified a SREBP-2 responsive region within the first 300 upstream bases of the mouse Srd5a2 promoter by co-transfection assays which contain a site that bound SREBP-2 in vitro by an EMSA. Srd5a2 protein was also induced in cells over-expressing SREBP-2 in culture. The induction of Srd5a2 through SREBP-2 provides a mechanistic explanation for why even though statin therapy is effective in reducing cholesterol levels in treating hypercholesterolemia it does not compromise androgen production in clinical studies.

  10. The GIRAFFE Inner Bulge Survey (GIBS). II. Metallicity distributions and alpha element abundances at fixed Galactic latitude

    NASA Astrophysics Data System (ADS)

    Gonzalez, O. A.; Zoccali, M.; Vasquez, S.; Hill, V.; Rejkuba, M.; Valenti, E.; Rojas-Arriagada, A.; Renzini, A.; Babusiaux, C.; Minniti, D.; Brown, T. M.

    2015-12-01

    Aims: We investigate metallicity and α-element abundance gradients along a Galactic longitude strip, at latitude b ~ -4°, with the aim of providing observational constraints for the structure and origin of the Milky Way bulge. Methods: High-resolution (R ~ 22 500) spectra for 400 K giants, in four fields within -4.8° ≲ b ≲ -3.4° and -10° ≲ l ≲ +10°, were obtained within the GIRAFFE Inner Bulge Survey (GIBS) project. To this sample we added another ~400 stars in Baade's Window at (l,b) = (1°,-4°), observed with the identical instrumental configuration: FLAMES GIRAFFE in Medusa mode with HR13 setup. All target stars lie within the red clump of the bulge colour-magnitude diagram, thus minimising contamination from the disc or halo stars. The spectroscopic stellar surface parameters were derived with an automatic method based on the GALA code, while the [Ca/Fe] and [Mg/Fe] abundances as a function of [Fe/H] were derived through a comparison with the synthetic spectra using MOOG. We constructed the metallicity distributions for the entire sample, and for each field individually, in order to investigate the presence of gradients or field-to-field variations in the shape of the distributions. Results: The metallicity distributions in the five fields are consistent with being drawn from a single parent population, indicating the absence of a gradient along the major axis of the Galactic bar. The global metallicity distribution is nicely fitted by two Gaussians. The metal-poor component is rather broad, with a mean at ⟨ [Fe/H] ⟩ = -0.31 dex and σ = 0.31 dex. The metal-rich component is narrower, with mean ⟨ [Fe/H] ⟩ = + 0.26 and σ = 0.2 dex. The [Mg/Fe] ratio follows a tight trend with [Fe/H], with enhancement with respect to solar in the metal-poor regime similar to the value observed for giant stars in the local thick disc. [Ca/Fe] abundances follow a similar trend, but with a considerably larger scatter than [Mg/Fe]. A decrease in [Mg/Fe] is

  11. In silico selection of an aptamer to estrogen receptor alpha using computational docking employing estrogen response elements as aptamer-alike molecules

    PubMed Central

    Ahirwar, Rajesh; Nahar, Smita; Aggarwal, Shikha; Ramachandran, Srinivasan; Maiti, Souvik; Nahar, Pradip

    2016-01-01

    Aptamers, the chemical-antibody substitute to conventional antibodies, are primarily discovered through SELEX technology involving multi-round selections and enrichment. Circumventing conventional methodology, here we report an in silico selection of aptamers to estrogen receptor alpha (ERα) using RNA analogs of human estrogen response elements (EREs). The inverted repeat nature of ERE and the ability to form stable hairpins were used as criteria to obtain aptamer-alike sequences. Near-native RNA analogs of selected single stranded EREs were modelled and their likelihood to emerge as ERα aptamer was examined using AutoDock Vina, HADDOCK and PatchDock docking. These in silico predictions were validated by measuring the thermodynamic parameters of ERα -RNA interactions using isothermal titration calorimetry. Based on the in silico and in vitro results, we selected a candidate RNA (ERaptR4; 5′-GGGGUCAAGGUGACCCC-3′) having a binding constant (Ka) of 1.02 ± 0.1 × 108 M−1 as an ERα-aptamer. Target-specificity of the selected ERaptR4 aptamer was confirmed through cytochemistry and solid-phase immunoassays. Furthermore, stability analyses identified ERaptR4 resistant to serum and RNase A degradation in presence of ERα. Taken together, an efficient ERα-RNA aptamer is identified using a non-SELEX procedure of aptamer selection. The high-affinity and specificity can be utilized in detection of ERα in breast cancer and related diseases. PMID:26899418

  12. Transcriptional regulation of the human glycoprotein hormone common alpha subunit gene by cAMP-response-element-binding protein (CREB)-binding protein (CBP)/p300 and p53.

    PubMed Central

    Zhang, Xian; Grand, Roger J A; McCabe, Christopher J; Franklyn, Jayne A; Gallimore, Phillip H; Turnell, Andrew S

    2002-01-01

    We have investigated the functional interactions between adenovirus early region 1A (AdE1A) protein, the co-activators cAMP-response-element-binding protein (CREB)-binding protein (CBP)/p300 and SUG1, and the transcriptional repressor retinoblastoma (Rb) in mediating T3-dependent repression. Utilizing the human glycoprotein hormone common alpha-subunit (alpha-subunit) promoter and AdE1A mutants with selective binding capacity to these molecules we have determined an essential role for CBP/p300. In normal circumstances, wild-type 12 S AdE1A inhibited alpha-subunit activity. In contrast, adenovirus mutants that retain both the SUG1- and Rb-binding sites, but lack the CBP/p300-binding site, were unable to repress promoter activity. We have also identified a role for the tumour-suppressor gene product p53 in regulation of the alpha-subunit promoter. Akin to 12 S AdE1A, exogenous p53 expression repressed alpha-subunit activity. This function resided in the ability of p53 to interact with CBP/p300; an N-terminal mutant incapable of interacting with CBP/p300 did not inhibit alpha-subunit activity. Stabilization of endogenous p53 by UV irradiation also correlated positively with reduced alpha-subunit activity. Intriguingly, T3 stimulated endogenous p53 transcriptional activity, implicating p53 in T3-dependent signalling pathways. These data indicate that CBP/p300 and p53 are key regulators of alpha-subunit activity. PMID:12164786

  13. GLOBULAR CLUSTER ABUNDANCES FROM HIGH-RESOLUTION, INTEGRATED-LIGHT SPECTROSCOPY. IV. THE LARGE MAGELLANIC CLOUD: {alpha}, Fe-PEAK, LIGHT, AND HEAVY ELEMENTS

    SciTech Connect

    Colucci, Janet E.; Bernstein, Rebecca A.; McWilliam, Andrew E-mail: rab@ucolick.org E-mail: andy@ociw.edu

    2012-02-10

    We present detailed chemical abundances in eight clusters in the Large Magellanic Cloud (LMC). We measure abundances of 22 elements for clusters spanning a range in age of 0.05-12 Gyr, providing a comprehensive picture of the chemical enrichment and star formation history of the LMC. The abundances were obtained from individual absorption lines using a new method for analysis of high-resolution (R {approx} 25,000), integrated-light (IL) spectra of star clusters. This method was developed and presented in Papers I, II, and III of this series. In this paper, we develop an additional IL {chi}{sup 2}-minimization spectral synthesis technique to facilitate measurement of weak ({approx}15 mA) spectral lines and abundances in low signal-to-noise ratio data (S/N {approx} 30). Additionally, we supplement the IL abundance measurements with detailed abundances that we measure for individual stars in the youngest clusters (age < 2 Gyr) in our sample. In both the IL and stellar abundances we find evolution of [{alpha}/Fe] with [Fe/H] and age. Fe-peak abundance ratios are similar to those in the Milky Way (MW), with the exception of [Cu/Fe] and [Mn/Fe], which are sub-solar at high metallicities. The heavy elements Ba, La, Nd, Sm, and Eu are significantly enhanced in the youngest clusters. Also, the heavy to light s-process ratio is elevated relative to the MW ([Ba/Y] >+0.5) and increases with decreasing age, indicating a strong contribution of low-metallicity asymptotic giant branch star ejecta to the interstellar medium throughout the later history of the LMC. We also find a correlation of IL Na and Al abundances with cluster mass in the sense that more massive, older clusters are enriched in the light elements Na and Al with respect to Fe, which implies that these clusters harbor star-to-star abundance variations as is common in the MW. Lower mass, intermediate-age, and young clusters have Na and Al abundances that are lower and more consistent with LMC field stars. Our

  14. Food and Drug Administration Approval for Use of Hiberix as a 3-Dose Primary Haemophilus influenzae Type b (Hib) Vaccination Series.

    PubMed

    Briere, Elizabeth C

    2016-01-01

    On January 14, 2016, GlaxoSmithKline Biologicals (Research Triangle Park, North Carolina) received approval from the Food and Drug Administration (FDA) to expand use of Hiberix (Haemophilus b Conjugate Vaccine [Tetanus Toxoid Conjugate]) for a 3-dose infant primary vaccination series at ages 2, 4, and 6 months. Hiberix was first licensed in the United States in August 2009 for use as a booster dose in children aged 15 months through 4 years under the Accelerated Approval Regulations, in response to a Haemophilus influenzae type b (Hib) vaccine shortage that lasted from December 2007 to July 2009 (1). Expanding the age indication to include infants provides another vaccine option in addition to other currently licensed monovalent or combination Hib vaccines recommended for the primary vaccination series.* Hiberix contains 10 μg purified capsular polyribosyl ribitolphosphate (PRP) conjugated to 25 μg tetanus toxoid (PRP-T) and is supplied as a single-dose vial of lyophilized vaccine to be reconstituted with saline diluent. For the 3-dose primary series, a single (0.5 mL) dose should be given by intramuscular injection at ages 2, 4, and 6 months; the first dose may be given as early as age 6 weeks. The recommended catch-up schedule for PRP-T vaccines (http://www.cdc.gov/vaccines/schedules/hcp/child-adolescent.html) should be followed. As previously recommended, a single booster dose should be administered to children aged 15 months through 18 months; to facilitate timely booster vaccination, Hiberix can be administered as early as age 12 months, in accordance with Hib vaccination schedules for routine and catch-up immunization (1-3). PMID:27124887

  15. The Ages, Metallicities, and Alpha Element Enhancements of Globular Clusters in the Elliptical NGC 5128: A Homogeneous Spectroscopic Study with Gemini/Gemini Multi-Object Spectrograph

    NASA Astrophysics Data System (ADS)

    Woodley, Kristin A.; Harris, William E.; Puzia, Thomas H.; Gómez, Matías; Harris, Gretchen L. H.; Geisler, Doug

    2010-01-01

    We present new integrated light spectroscopy of globular clusters (GCs) in NGC 5128, a nearby giant elliptical galaxy less than 4 Mpc away, in order to measure radial velocities and derive ages, metallicities, and alpha-element abundance ratios. Using the Gemini South 8 meter telescope with the instrument Gemini Multi-Object Spectrograph, we obtained spectroscopy in the range of ~3400-5700 Å for 72 GCs with a signal-to-noise ratio greater than 30 Å-1 and we have also discovered 35 new GCs within NGC 5128 from our radial velocity measurements. We measured and compared the Lick indices from Hδ A through Fe5406 with the single stellar population models of Thomas et al. in order to derive age, metallicity, and [α/Fe] values. We also measure Lick indices for 41 Milky Way GCs from Puzia et al. and Schiavon et al. with the same methodology for direct comparison. Our results show that 68% of the NGC 5128 GCs have old ages (>8 Gyr), 14% have intermediate ages (5-8 Gyr), and 18% have young ages (<5 Gyr). However, when we look at the metallicity of the GCs as a function of age, we find 92% of metal-poor GCs and 56% of metal-rich GCs in NGC 5128 have ages >8 Gyr, indicating that the majority of both metallicity subpopulations of GCs formed earlier, with a significant population of young and metal-rich GCs forming later. Our metallicity distribution function generated directly from spectroscopic Lick indices is clearly bimodal, as is the color distribution of the same set of GCs. Thus, the metallicity bimodality is real and not an artifact of the color to metallicity conversion. However, the metallicity distribution function obtained from comparison with the single stellar population models is consistent with a unimodal, bimodal, or multimodal shape. The [α/Fe] values are supersolar with a mean value of 0.14 ± 0.04, indicating a fast formation timescale. However, the GCs in NGC 5128 are not as [α/Fe] enhanced as the Milky Way GCs also examined in this study. Our measured

  16. Safety and reactogenicity of the combined diphtheria-tetanus-acellular pertussis-inactivated poliovirus-Haemophilus influenzae type b (DTPa-IPV/Hib) vaccine in healthy Vietnamese toddlers: An open-label, phase III study

    PubMed Central

    Anh, Dang Duc; Van Der Meeren, Olivier; Karkada, Naveen; Assudani, Deepak; Yu, Ta-Wen; Han, Htay Htay

    2016-01-01

    abstract The introduction of combination vaccines plays a significant role in increasing vaccine acceptance and widening vaccine coverage. Primary vaccination against diphtheria, tetanus, pertussis, poliomyelitis and Haemophilus influenza type b (Hib) diseases has been implemented in Vietnam. In this study we evaluated the safety and reactogenicity of combined diphtheria-tetanus-pertussis-inactivated polio (DTPa-IPV)/Hib vaccine when administered as a booster dose in 300 healthy Vietnamese children <2 years of age (mean age: 15.8 months). During the 4-day follow-up period, pain (31.7%) and redness (27.3%) were the most frequent solicited local symptoms. Pain (2%) was also the most frequent grade 3 local symptom. One subject reported 2 serious adverse events that were not causally related to the study vaccine. DTPa-IPV/Hib conjugate vaccine was well tolerated as a booster dose in healthy Vietnamese children aged <2 years. PMID:26337197

  17. Safety and reactogenicity of the combined diphtheria-tetanus-acellular pertussis-inactivated poliovirus-Haemophilus influenzae type b (DTPa-IPV/Hib) vaccine in healthy Vietnamese toddlers: An open-label, phase III study.

    PubMed

    Anh, Dang Duc; Van Der Meeren, Olivier; Karkada, Naveen; Assudani, Deepak; Yu, Ta-Wen; Han, Htay Htay

    2016-03-01

    The introduction of combination vaccines plays a significant role in increasing vaccine acceptance and widening vaccine coverage. Primary vaccination against diphtheria, tetanus, pertussis, poliomyelitis and Haemophilus influenza type b (Hib) diseases has been implemented in Vietnam. In this study we evaluated the safety and reactogenicity of combined diphtheria-tetanus-pertussis-inactivated polio (DTPa-IPV)/Hib vaccine when administered as a booster dose in 300 healthy Vietnamese children <2 years of age (mean age: 15.8 months). During the 4-day follow-up period, pain (31.7%) and redness (27.3%) were the most frequent solicited local symptoms. Pain (2%) was also the most frequent grade 3 local symptom. One subject reported 2 serious adverse events that were not causally related to the study vaccine. DTPa-IPV/Hib conjugate vaccine was well tolerated as a booster dose in healthy Vietnamese children aged <2 years. PMID:26337197

  18. Alpha Particle

    NASA Astrophysics Data System (ADS)

    Murdin, P.

    2000-11-01

    Term that is sometimes used to describe a helium nucleus, a positively charged particle that consists of two protons and two neutrons, bound together. Alpha particles, which were discovered by Ernest Rutherford (1871-1937) in 1898, are emitted by atomic nuclei that are undergoing alpha radioactivity. During this process, an unstable heavy nucleus spontaneously emits an alpha particle and transmut...

  19. THE SEGUE STELLAR PARAMETER PIPELINE. V. ESTIMATION OF ALPHA-ELEMENT ABUNDANCE RATIOS FROM LOW-RESOLUTION SDSS/SEGUE STELLAR SPECTRA

    SciTech Connect

    Lee, Young Sun; Beers, Timothy C.; Prieto, Carlos Allende; Lai, David K.; Rockosi, Constance M.; Johnson, Jennifer A.; An, Deokkeun; Sivarani, Thirupathi; Yanny, Brian E-mail: beers@pa.msu.edu E-mail: david@ucolick.org E-mail: heather@vegemite.case.edu E-mail: deokkeun@ewha.ac.kr E-mail: yanny@fnal.gov

    2011-03-15

    We present a method for the determination of [{alpha}/Fe] ratios from low-resolution (R = 2000) SDSS/SEGUE stellar spectra. By means of a star-by-star comparison with degraded spectra from the ELODIE spectral library and with a set of moderately high-resolution (R = 15, 000) and medium-resolution (R = 6000) spectra of SDSS/SEGUE stars, we demonstrate that we are able to measure [{alpha}/Fe] from SDSS/SEGUE spectra (with S/N>20/1) to a precision of better than 0.1 dex, for stars with atmospheric parameters in the range T{sub eff} = [4500, 7000] K, log g = [1.5, 5.0], and [Fe/H] = [-1.4, +0.3], over the range [{alpha}/Fe] = [-0.1, +0.6]. For stars with [Fe/H] <-1.4, our method requires spectra with slightly higher signal-to-noise to achieve this precision (S/N>25/1). Over the full temperature range considered, the lowest metallicity star for which a confident estimate of [{alpha}/Fe] can be obtained from our approach is [Fe/H] {approx}-2.5; preliminary tests indicate that a metallicity limit as low as [Fe/H] {approx}-3.0 may apply to cooler stars. As a further validation of this approach, weighted averages of [{alpha}/Fe] obtained for SEGUE spectra of likely member stars of Galactic globular clusters (M15, M13, and M71) and open clusters (NGC 2420, M67, and NGC 6791) exhibit good agreement with the values of [{alpha}/Fe] from previous studies. The results of the comparison with NGC 6791 imply that the metallicity range for the method may extend to {approx}+0.5.

  20. An element in the alpha1-tubulin promoter is necessary for retinal expression during optic nerve regeneration but not after eye injury in the adult zebrafish.

    PubMed

    Senut, Marie-Claude; Gulati-Leekha, Abhilasha; Goldman, Daniel

    2004-09-01

    We have shown previously that a 1.696 kb upstream fragment of the goldfish alpha1-tubulin promoter was capable of driving green fluorescent protein (GFP) expression in the developing and regenerating zebrafish CNS in a pattern closely mimicking the endogenous alpha1-tubulin gene. Comparison of fish and rat alpha1-tubulin promoters identified a 64 bp region with a conserved repetitive homeodomain (HD) consensus sequence core (TAAT) and a nearby basic helix-loop-helix binding E-box sequence (CANNTG), which led us to speculate that it could be of importance for regulating alpha1-tubulin gene transcription. To address this issue, we examined the ability of deletion mutants of the 1.696 kb promoter to drive expression of GFP in zebrafish retinal cells under normal conditions and after injury. Interestingly, although wild-type 1.696 kb and mutant promoters, lacking the E-box and/or HD sequences, exhibited rather similar patterns of GFP expression in the developing retina, significant differences were noticed in the mature retina. First, although the 1.696 kb promoter directed transgene expression to retinal neurons and progenitor cells, the activity of mutant promoters was drastically reduced. Second, we found that the E-box and HD sequences were necessary for transgene reinduction during optic nerve regeneration, but were not as important for transgene expression in regenerating retinal neurons after eye injury. In this latter lesion model, remarkably, both 1.696 kb and mutant promoters targeted GFP expression to Müller glia-like cells, some of which re-entered the cell cycle. These new findings will be useful for identifying the molecular signals necessary for successful CNS regeneration. PMID:15342733

  1. Human Infant Memory B Cell and CD4+ T Cell Responses to HibMenCY-TT Glyco-Conjugate Vaccine

    PubMed Central

    Fuery, Angela; Richmond, Peter C.; Currie, Andrew J.

    2015-01-01

    Carrier-specific T cell and polysaccharide-specific B cell memory responses are not well characterised in infants following glyco-conjugate vaccination. We aimed to determine if the number of Meningococcal (Men) C- and Y- specific memory B cells and; number and quality of Tetanus Toxoid (TT) carrier-specific memory CD4+ T cells are associated with polysaccharide-specific IgG post HibMenCY-TT vaccination. Healthy infants received HibMenCY-TT vaccine at 2, 4 and 6 months with a booster at 12 months. Peripheral blood mononuclear cells were isolated and polysaccharide-specific memory B cells enumerated using ELISpot. TT-specific memory CD4+ T cells were detected and phenotyped based on CD154 expression and intracellular TNF-α, IL-2 and IFN-γ expression following stimulation. Functional polysaccharide-specific IgG titres were measured using the serum bactericidal activity (SBA) assay. Polysaccharide-specific Men C- but not Men Y- specific memory B cell frequencies pre-boost (12 months) were significantly associated with post-boost (13 months) SBA titres. Regression analysis showed no association between memory B cell frequencies post-priming (at 6 or 7 months) and SBA at 12 months or 13 months. TT-specific CD4+ T cells were detected at frequencies between 0.001 and 0.112 as a percentage of CD3+ T cells, but their numbers were not associated with SBA titres. There were significant negative associations between SBA titres at M13 and cytokine expression at M7 and M12. Conclusion: Induction of persistent polysaccharide-specific memory B cells prior to boosting is an important determinant of secondary IgG responses in infants. However, polysaccharide-specific functional IgG responses appear to be independent of the number and quality of circulating carrier-specific CD4+ T cells after priming. PMID:26191794

  2. Alpha Thalassemia

    MedlinePlus

    ... an apparently normal individual has a child with hemoglobin H disease or alpha thalassemia minor. It can ... gene on one chromosome 25% 25% 25% 25% hemoglobin H disease there is a 25% chance with ...

  3. Alpha proton x ray spectrometer

    NASA Technical Reports Server (NTRS)

    Rieder, Rudi; Waeke, H.; Economou, T.

    1994-01-01

    Mars Pathfinder will carry an alpha-proton x ray spectrometer (APX) for the determination of the elemental chemical composition of Martian rocks and soils. The instrument will measure the concentration of all major and some minor elements, including C, N, and O at levels above typically 1 percent.

  4. Expression of the standard scorpion alpha-toxin AaH II and AaH II mutants leading to the identification of some key bioactive elements.

    PubMed

    Legros, Christian; Céard, Brigitte; Vacher, Hélène; Marchot, Pascale; Bougis, Pierre E; Martin-Eauclaire, Marie-France

    2005-05-25

    The AaH II toxin from the scorpion Androctonus australis Hector is considered to be the standard alpha-toxin because it selectively binds with the highest known affinity to site 3 of mammalian voltage-activated Na+ channels (Na(v)) on rat brain synaptosomes but does not bind to insect synaptosomes. We generated two different constructs in pMALp allowing us to produce AaH II fused with the maltose-binding protein (MBP) in E. coli. We obtained reasonable amounts of recombinant AaH II after cleavage by enterokinase at the site DDDDK. We show that the introduction of a net negative charge at the C-terminus by the suppression of H64 amidation and the addition of an extra residue to the C-terminus (G65) led to fully active AaH II mutants, exhibiting exactly the same affinity as the native toxin for its target on rat brain synaptosomes. In contrast, the mutation of residue K58 into V, I or E residues drastically reduced toxin activity. PMID:15725394

  5. Alpha-1 Antitrypsin Deficiency

    MedlinePlus

    ... Liver Disease Information > Alpha-1 Antitrypsin Deficiency Alpha-1 Antitrypsin Deficiency Explore this section to learn more about alpha-1 antitrypsin deficiency, including a description of the disorder ...

  6. Nuclear-structure dependence of O (. alpha. ) corrections to Fermi decays and the value of the Kobayashi-Maskawa matrix element V sub ud

    SciTech Connect

    Jaus, W.; Rasche, G. )

    1990-01-01

    We calculate nuclear-structure corrections to the {ital ft} values of the eight accurately measured superallowed {beta}{sup +} decays. The statistical fit for the average {ital ft} value is very good. The resulting new value for the matrix element of the Kobayashi-Maskawa (KM) matrix is {vert bar}{ital V}{sub {ital ud}}{vert bar}=0.9735(5). The error in {vert bar}{ital V}{sub {ital ud}}{vert bar} has thus been reduced by 50%. Combining this value for {vert bar}{ital V}{sub {ital ud}}{vert bar} with the presently accepted results from kaon-, hyperon-, and {ital B}-decay constraints, the unitarity of the KM matrix for three generations of quarks seems to be violated.

  7. Finite Element Method (FEM) Calculations of Stress-Strain Behavior of Alpha-Beta Ti-Mn Alloys: Part I. Stress-Strain Relations

    NASA Astrophysics Data System (ADS)

    Ankem, Sreeramamurthy; Margolin, Harold

    1982-04-01

    By use of a NASTRAN18 Computer Program, the Finite Element Method (FEM) has been employed to calculate the effect of particle size, matrix, and volume fraction on the stress-strain relations of α -β titanium alloys. It was found that for a given volume fraction, the calculated stress-strain curve was higher for a finer particle size than for a coarse particle size within the range of the strains considered, and this behavior was seen for all the different volume fraction alloys considered. For a 50:50 vol pct α -β alloy, the stress-strain curve with β, the stronger phase, as the matrix was higher than that with α, the softer phase, as the matrix. The calculated stress-strain curves for four different vol pct α alloys were compared with their corresponding experimental curves, and in general, good agreement was found. Whenever there were discrepancies, they were discussed by comparing the morphology of the mesh used in the calculations with the morphology of the actual materials.

  8. The HIF1alpha-inducible pro-cell death gene BNIP3 is a novel target of SIM2s repression through cross-talk on the hypoxia response element.

    PubMed

    Farrall, A L; Whitelaw, M L

    2009-10-15

    The short isoform of single-minded 2 (SIM2s), a basic helix-loop-helix/PAS (bHLH/PAS) transcription factor, is upregulated in pancreatic and prostate tumours; however, a mechanistic role for SIM2s in these cancers is unknown. Microarray studies in prostate DU145 cells identified the pro-cell death gene, BNIP3 (Bcl-2/adenovirus E1B 19 kDa interacting protein 3), as a novel putative target of SIM2s repression. Further validation showed BNIP3 repression in several prostate and pancreatic carcinoma-derived cell lines with ectopic expression of human SIM2s. BNIP3 levels are enhanced in prostate carcinoma cells upon short interfering (si)RNA-mediated knockdown of endogenous SIM2s. Chromatin immunoprecipitation and promoter studies show that SIM2s represses BNIP3 through its activities at the proximal promoter hypoxia response element (HRE), the site through which the bHLH/PAS family member, hypoxia-inducible factor 1alpha (HIF1alpha), induces BNIP3. SIM2s attenuates BNIP3 hypoxic induction via the HRE, and increased hypoxic induction of BNIP3 occurs with siRNA knockdown of endogenous SIM2s in prostate PC3AR+ cells. BNIP3 is implicated in hypoxia-induced cell death processes. Prolonged treatment of PC3AR+ cells with hypoxia mimetics, DP and DMOG, confers hypoxia-induced autophagy, measured by enhanced LC3-II levels and SQSTM1/p62 turnover. We show that PC3AR+ cells expressing ectopic SIM2s have enhanced survival in these conditions. Induction of LC3-II and turnover of SQSTM1/p62 are attenuated in PC3AR+/SIM2s DMOG and hypoxia-treated cells, suggesting that SIM2s may attenuate autophagic cell death processes, perhaps through BNIP3 repression. These data show, for the first time, SIM2s cross-talk on an endogenous HRE. SIM2s' functional interference with HIF1alpha activities on BNIP3 may indicate a novel role for SIM2s in promoting tumourigenesis. PMID:19668230

  9. Protein and DNA elements involved in transactivation of the promoter of the bovine herpesvirus (BHV) 1 IE-1 transcription unit by the BHV alpha gene trans-inducing factor.

    PubMed Central

    Misra, V; Bratanich, A C; Carpenter, D; O'Hare, P

    1994-01-01

    In herpes simplex virus (HSV)-infected cells, the transcription of immediate-early (alpha) genes is regulated by a virion component, the alpha gene trans-inducing factor (alpha TIF). This protein forms a complex with cellular factors and TAATGARAT motifs present in one or more copies in the promoters of all alpha genes. We have characterized the bovine herpesvirus 1 (BHV-1) homolog of this protein. Like its HSV counterpart, the BHV alpha TIF was synthesized in the later stages of infection and could be demonstrated to be a component of purified virions. In transient expression assays, BHV alpha TIF was a strong transactivator and stimulated the activity of IE-1, the major BHV-1 alpha gene promoter, with an efficiency comparable to that of HSV alpha TIF. This stimulation was largely dependent on a TAATGAGCT sequence present in a single copy in IE-1, and BHV alpha TIF, in conjunction with cellular factors, formed a complex with oligonucleotides containing this sequence. Despite these similarities between the two alpha TIFs, our preliminary observations suggest that the proteins may activate transcription by different mechanisms. Although BHV alpha TIF strongly transactivated IE-1, it differed from its HSV counterpart in that the carboxyl terminus of BHV alpha TIF, when fused to the DNA-binding domain of GAL4, was a relatively poor stimulator of a promoter containing GAL4-binding sites. Also unlike HSV alpha TIF, removal of the carboxyl terminus of BHV alpha TIF reduced but did not eliminate the ability of the protein to transactivate IE-1. These results are discussed in view of the structural similarities and differences among the alpha TIFs of alphaherpes-viruses. Images PMID:8035488

  10. Safety, immune lot-to-lot consistency and non-inferiority of a fully liquid pentavalent DTwp-HepB-Hib vaccine in healthy Indian toddlers and infants

    PubMed Central

    Gandhi, Dulari J.; Dhaded, Sangappa M.; Ravi, Mandyam D.; Dubey, Anand P.; Kundu, Ritabrata; Lalwani, Sanjay K.; Chhatwal, Jugesh; Mathew, Leni G.; Gupta, Madhu; Sharma, Shiv D.; Bavdekar, Sandeep B.; Jayanth, Midde V.; Ravinuthala, Suresh; Sil, Arijit; Dhingra, Mandeep S.

    2016-01-01

    ABSTRACT Pentavalent combination vaccines are important tools to strengthen the immunization programs in numerous countries throughout the world. A large number of countries have recognized the value of combination vaccines and have introduced whole cell pentavalent vaccines into their immunization programs. A phase III, multi-center, randomized, single blinded study of a fully liquid pentavalent DTwP-HepB-Hib investigational vaccine (Shan5™) was conducted across India in 2 cohorts: 15 toddlers were evaluated for safety and immunogenicity following a single booster dose (Cohort 1) followed by 1085 infants (Cohort 2) evaluated for immunogenicity and safety following 3-dose primary immunization of the investigational vaccine or a locally licensed comparator vaccine (Pentavac SD). Immune consistency analysis among 3 lots of the investigational vaccine, and immune non-inferiority analysis of pooled (3 lots) data of investigational vaccine vs. comparator vaccine were carried out in cohort 2. The vaccines demonstrated comparable safety and immune responses in cohort 1. In cohort 2, equivalent immune consistency among 3 lots was observed for all antigens except whole cell pertussis antigens, where a marginal variation was observed which was linked to the low power of the test and concluded to not have any clinical significance. Immune non-inferiority against the comparator vaccine was demonstrated for all 5 antigens. Safety results were comparable between vaccine groups. This investigational, fully-liquid, whole-cell pertussis (wP) containing new pentavalent vaccine was found to be safe and immunologically non-inferior to the licensed comparator vaccine. PMID:26580093

  11. Safety, immune lot-to-lot consistency and non-inferiority of a fully liquid pentavalent DTwp-HepB-Hib vaccine in healthy Indian toddlers and infants.

    PubMed

    Gandhi, Dulari J; Dhaded, Sangappa M; Ravi, Mandyam D; Dubey, Anand P; Kundu, Ritabrata; Lalwani, Sanjay K; Chhatwal, Jugesh; Mathew, Leni G; Gupta, Madhu; Sharma, Shiv D; Bavdekar, Sandeep B; Jayanth, Midde V; Ravinuthala, Suresh; Sil, Arijit; Dhingra, Mandeep S

    2016-04-01

    Pentavalent combination vaccines are important tools to strengthen the immunization programs in numerous countries throughout the world. A large number of countries have recognized the value of combination vaccines and have introduced whole cell pentavalent vaccines into their immunization programs. A phase III, multi-center, randomized, single blinded study of a fully liquid pentavalent DTwP-HepB-Hib investigational vaccine (Shan5™) was conducted across India in 2 cohorts: 15 toddlers were evaluated for safety and immunogenicity following a single booster dose (Cohort 1) followed by 1085 infants (Cohort 2) evaluated for immunogenicity and safety following 3-dose primary immunization of the investigational vaccine or a locally licensed comparator vaccine (Pentavac SD). Immune consistency analysis among 3 lots of the investigational vaccine, and immune non-inferiority analysis of pooled (3 lots) data of investigational vaccine vs. comparator vaccine were carried out in cohort 2. The vaccines demonstrated comparable safety and immune responses in cohort 1. In cohort 2, equivalent immune consistency among 3 lots was observed for all antigens except whole cell pertussis antigens, where a marginal variation was observed which was linked to the low power of the test and concluded to not have any clinical significance. Immune non-inferiority against the comparator vaccine was demonstrated for all 5 antigens. Safety results were comparable between vaccine groups. This investigational, fully-liquid, whole-cell pertussis (wP) containing new pentavalent vaccine was found to be safe and immunologically non-inferior to the licensed comparator vaccine. PMID:26580093

  12. Alpha-1 Antitrypsin Deficiency

    MedlinePlus

    ... from the NHLBI on Twitter. What Is Alpha-1 Antitrypsin Deficiency? Alpha-1 antitrypsin (an-tee-TRIP-sin) deficiency, or AAT ... as it relates to lung disease. Overview Alpha-1 antitrypsin, also called AAT, is a protein made ...

  13. Bezafibrate at clinically relevant doses decreases serum/liver triglycerides via down-regulation of sterol regulatory element-binding protein-1c in mice: a novel peroxisome proliferator-activated receptor alpha-independent mechanism.

    PubMed

    Nakajima, Takero; Tanaka, Naoki; Kanbe, Hiroki; Hara, Atsushi; Kamijo, Yuji; Zhang, Xiaowei; Gonzalez, Frank J; Aoyama, Toshifumi

    2009-04-01

    The triglyceride-lowering effect of bezafibrate in humans has been attributed to peroxisome proliferator-activated receptor (PPAR) alpha activation based on results from rodent studies. However, the bezafibrate dosages used in conventional rodent experiments are typically higher than those in clinical use (> or =50 versus < or =10 mg/kg/day), and thus it remains unclear whether such data can be translated to humans. Furthermore, because bezafibrate is a pan-PPAR activator, the actual contribution of PPARalpha to its triglyceride-lowering properties remains undetermined. To address these issues, bezafibrate at clinically relevant doses (10 mg/kg/day; low) was administered to wild-type and Ppara-null mice, and its effects were compared with those from conventionally used doses (100 mg/kg/day; high). Pharmacokinetic analyses showed that maximum plasma concentration and area under the concentration-time curve in bezafibrate-treated mice were similar to those in humans at low doses, but not at high doses. Low-dose bezafibrate decreased serum/liver triglycerides in a PPARalpha-independent manner by attenuation of hepatic lipogenesis and triglyceride secretion. It is noteworthy that instead of PPAR activation, down-regulation of sterol regulatory element-binding protein (SREBP)-1c was observed in mice undergoing low-dose treatment. High-dose bezafibrate decreased serum/liver triglycerides by enhancement of hepatic fatty acid uptake and beta-oxidation via PPARalpha activation, as expected. In conclusion, clinically relevant doses of bezafibrate exert a triglyceride-lowering effect by suppression of the SREBP-1c-regulated pathway in mice and not by PPARalpha activation. Our results may provide novel information about the pharmacological mechanism of bezafibrate action and new insights into the treatment of disorders involving SREBP-1c. PMID:19124612

  14. p53-independent activation of the hdm2-P2 promoter through multiple transcription factor response elements results in elevated hdm2 expression in estrogen receptor alpha-positive breast cancer cells.

    PubMed

    Phelps, Monika; Darley, Matthew; Primrose, John N; Blaydes, Jeremy P

    2003-05-15

    The negative-regulatory feedback loop between p53 and hdm2 forms part of a finely balanced regulatory network of proteins that controls cell cycle progression and commitment to apoptosis. Expression of hdm2, and its mouse orthologue mdm2, is known to be induced by p53, but recent evidence has demonstrated mdm2 expression can also be regulated via p53-independent pathways. However the p53 independent mechanisms that control transcription of the human hdm2 gene have not been studied. Differential levels of hdm2 mRNA and protein expression have been reported in several types of human malignancy, including breast cancers in which hdm2 expression correlates with positive estrogen receptor alpha (ERalpha) status. Experimental models have demonstrated that hdm2 overexpression can promote breast cancer development. Here, we show that the elevated level of hdm2 protein in ERalpha(+ve) breast cancer cell lines such as MCF-7 and T47D is because of transcription from the p53-inducible P2 promoter of hdm2. The P2 promoter is inactive in ERalpha(-ve) cell lines such as SKBr3. Hdm2-P2 promoter activity in T47D cells is independent of p53, as well as of known regulators of the mouse mdm2-P2 promoter, including ERalpha and ras-raf-mitogen-activated protein/extracellular signal-regulated kinase (MEK) mitogen-activated protein kinase (MAPK) signaling. We show that hdm2-P2 activity in T47D cells is dependent on the integrity of both an evolutionarily conserved composite binding site for AP1 and ETS family transcription factors (AP1-ETS) and a nonconserved upstream (nnGGGGC)(5) repeat sequence. Lack of hdm2-P2 activity in ERalpha(-ve) cells is shown to be a consequence of reduced transcriptional activation through the AP1-ETS element. Overexpression of ETS2 in SKBr3 cells reconstitutes AP1-ETS element-dependent hdm2-P2 promoter activity, resulting in increased levels of hdm2 protein in the cells. Our findings support the hypothesis that the elevated levels of hdm2 expression reported

  15. Space Station alpha joint bearing

    NASA Technical Reports Server (NTRS)

    Everman, Michael R.; Jones, P. Alan; Spencer, Porter A.

    1987-01-01

    Perhaps the most critical structural system aboard the Space Station is the Solar Alpha Rotary Joint which helps align the power generation system with the sun. The joint must provide structural support and controlled rotation to the outboard transverse booms as well as power and data transfer across the joint. The Solar Alpha Rotary Joint is composed of two transition sections and an integral, large diameter bearing. Alpha joint bearing design presents a particularly interesting problem because of its large size and need for high reliability, stiffness, and on orbit maintability. The discrete roller bearing developed is a novel refinement to cam follower technology. It offers thermal compensation and ease of on-orbit maintenance that are not found in conventional rolling element bearings. How the bearing design evolved is summarized. Driving requirements are reviewed, alternative concepts assessed, and the selected design is described.

  16. A Rainbow of Martian Elements

    NASA Technical Reports Server (NTRS)

    2004-01-01

    This graph or spectrum taken by the alpha particle X-ray spectrometer onboard the Mars Exploration Rover Spirit shows the variety of elements present in the soil at the rover's landing site. In agreement with past missions to Mars, iron and silicon make up the majority of the martian soil. Sulfur and chlorine were also observed as expected. Trace elements detected for the first time include zinc and nickel. These latter observations demonstrate the power of the alpha particle X-ray spectrometer to pick up the signatures of elements too faint to be seen before. The alpha particle X-ray spectrometer uses alpha particles and X-rays to measure the presence and abundance of all major rock-forming elements except hydrogen.

  17. Beteigeuze (Alpha Orionis) und Mintaka (Delta Orionis)

    NASA Astrophysics Data System (ADS)

    Vollmann, Wolfgang

    2013-02-01

    Magnitude measures transformed to Johnson V of Alpha Orionis (Betelgeuse) and Delta Orionis with a wide-angle lens and DSLR are presented and discussed. Alpha Orionis light changes are shown clearly. The primary and secondary eclipses of Delta Orionis with amplitudes of 0.12 and 0.05 mag respectively are clearly recorded. They occur near phase 0.00 and 0.50 respectively of current elements from VSX (2).

  18. Ab initio alpha-alpha scattering

    NASA Astrophysics Data System (ADS)

    Elhatisari, Serdar; Lee, Dean; Rupak, Gautam; Epelbaum, Evgeny; Krebs, Hermann; Lähde, Timo A.; Luu, Thomas; Meißner, Ulf-G.

    2015-12-01

    Processes such as the scattering of alpha particles (4He), the triple-alpha reaction, and alpha capture play a major role in stellar nucleosynthesis. In particular, alpha capture on carbon determines the ratio of carbon to oxygen during helium burning, and affects subsequent carbon, neon, oxygen, and silicon burning stages. It also substantially affects models of thermonuclear type Ia supernovae, owing to carbon detonation in accreting carbon-oxygen white-dwarf stars. In these reactions, the accurate calculation of the elastic scattering of alpha particles and alpha-like nuclei—nuclei with even and equal numbers of protons and neutrons—is important for understanding background and resonant scattering contributions. First-principles calculations of processes involving alpha particles and alpha-like nuclei have so far been impractical, owing to the exponential growth of the number of computational operations with the number of particles. Here we describe an ab initio calculation of alpha-alpha scattering that uses lattice Monte Carlo simulations. We use lattice effective field theory to describe the low-energy interactions of protons and neutrons, and apply a technique called the ‘adiabatic projection method’ to reduce the eight-body system to a two-cluster system. We take advantage of the computational efficiency and the more favourable scaling with system size of auxiliary-field Monte Carlo simulations to compute an ab initio effective Hamiltonian for the two clusters. We find promising agreement between lattice results and experimental phase shifts for s-wave and d-wave scattering. The approximately quadratic scaling of computational operations with particle number suggests that it should be possible to compute alpha scattering and capture on carbon and oxygen in the near future. The methods described here can be applied to ultracold atomic few-body systems as well as to hadronic systems using lattice quantum chromodynamics to describe the interactions of

  19. Ab initio alpha-alpha scattering.

    PubMed

    Elhatisari, Serdar; Lee, Dean; Rupak, Gautam; Epelbaum, Evgeny; Krebs, Hermann; Lähde, Timo A; Luu, Thomas; Meißner, Ulf-G

    2015-12-01

    Processes such as the scattering of alpha particles ((4)He), the triple-alpha reaction, and alpha capture play a major role in stellar nucleosynthesis. In particular, alpha capture on carbon determines the ratio of carbon to oxygen during helium burning, and affects subsequent carbon, neon, oxygen, and silicon burning stages. It also substantially affects models of thermonuclear type Ia supernovae, owing to carbon detonation in accreting carbon-oxygen white-dwarf stars. In these reactions, the accurate calculation of the elastic scattering of alpha particles and alpha-like nuclei--nuclei with even and equal numbers of protons and neutrons--is important for understanding background and resonant scattering contributions. First-principles calculations of processes involving alpha particles and alpha-like nuclei have so far been impractical, owing to the exponential growth of the number of computational operations with the number of particles. Here we describe an ab initio calculation of alpha-alpha scattering that uses lattice Monte Carlo simulations. We use lattice effective field theory to describe the low-energy interactions of protons and neutrons, and apply a technique called the 'adiabatic projection method' to reduce the eight-body system to a two-cluster system. We take advantage of the computational efficiency and the more favourable scaling with system size of auxiliary-field Monte Carlo simulations to compute an ab initio effective Hamiltonian for the two clusters. We find promising agreement between lattice results and experimental phase shifts for s-wave and d-wave scattering. The approximately quadratic scaling of computational operations with particle number suggests that it should be possible to compute alpha scattering and capture on carbon and oxygen in the near future. The methods described here can be applied to ultracold atomic few-body systems as well as to hadronic systems using lattice quantum chromodynamics to describe the interactions of

  20. alpha-Hexachlorocyclohexane (alpha-HCH)

    Integrated Risk Information System (IRIS)

    alpha - Hexachlorocyclohexane ( alpha - HCH ) ; CASRN 319 - 84 - 6 Human health assessment information on a chemical substance is included in the IRIS database only after a comprehensive review of toxicity data , as outlined in the IRIS assessment development process . Sections I ( Health Hazard Ass

  1. Alpha-1 antitrypsin test

    MedlinePlus

    ... page: //medlineplus.gov/ency/article/003715.htm Alpha-1 antitrypsin test To use the sharing features on this page, please enable JavaScript. Alpha-1 antitrypsin is a laboratory test to measure the ...

  2. Alpha-1 Antitrypsin Test

    MedlinePlus

    ... measures the level of the protein AAT in blood. Alpha-1 antitrypsin phenotype testing evaluates the amount and type of AAT being produced and compares it to normal patterns. Alpha-1 antitrypsin genotype testing ( DNA testing) can ...

  3. The Alpha Centauri System.

    ERIC Educational Resources Information Center

    Soderblom, David R.

    1987-01-01

    Describes the Alpha Centauri star system, which is the closest star system to the sun. Discusses the difficulties associated with measurements involving Alpha Centauri, along with some of the recent advances in stellar seismology. Raises questions about the possibilities of planets around Alpha Centauri. (TW)

  4. Discovery of element 112

    SciTech Connect

    Hofmann, S.

    1996-12-31

    The new elements 110, 111, and 112 were synthesized and unambiguously identified in experiments at SHIP. Due to strong shell effects the dominant decay mode is not fission, but emission of alpha particles. Theoretical investigations predict that maximum shell effects should exist in nuclei near proton number 114 and neutron number 184. Measurements give hope that isotopes of element 114 close to the island of spherical Superheavy Elements could be produced by fusion reactions using {sup 118}Pb as target. systematic studies of the reaction cross-sections indicate that transfer of nucleons is the important process to initiate the fusion.

  5. Calibration issues in delta alpha /alpha .

    NASA Astrophysics Data System (ADS)

    Molaro, Paolo; Centurión, Miriam; Levshakov, Sergei

    Laser Comb Wavelength calibration shows that the ThAr one is locally unreliable with possible deviations of up to 100 {m s}-1 within one order range, while delivering an overall 1 {m s}-1 accuracy (Wilken et al 2009). Such deviation corresponds to delta alpha /alpha ≈ 7* 10-6 for a Fe II-Mg II pair. Comparison of line shifts among the 5 Fe II lines, with almost identical sensitivity to fine structure constant changes, offers a clean way to directly test the presence of possible local wavelength calibration errors of whatever origin. We analyzed 5 absorption systems, with zabs ranging from 1.15 to 2.19 towards 3 bright QSOs. The results show that while some lines are aligned within 20 {m s}-1, others reveal large deviations reaching 200 {m s}-1 or higher and corresponding to a delta alpha /alpha > 10-5 level. The origin of these deviations is not clearly identified but could be related to the adaptation of wavelength calibration to CCD manufacturing irregularities. These results suggest that to draw conclusions from delta alpha /alpha analysis based on one or only few lines must be done with extreme care.

  6. alpha-decay half-lives and Q{sub a}lpha values of superheavy nuclei

    SciTech Connect

    Dong Jianmin; Zuo Wei; Gu Jianzhong; Wang Yanzhao; Peng Bangbao

    2010-06-15

    The alpha-decay half-lives of recently synthesized superheavy nuclei (SHN) are investigated by employing a unified fission model (UFM) where a new method to calculate the assault frequency of alpha emission is used. The excellent agreement with the experimental data indicates the UFM is a useful tool to investigate these alpha decays. It is found that the alpha-decay half-lives become more and more insensitive to the Q{sub a}lpha values as the atomic number increases on the whole, which is favorable for us to predict the half-lives of SHN. In addition, a formula is proposed to compute the Q{sub a}lpha values for the nuclei with Z>=92 and N>=140 with a good accuracy, according to which the long-lived SHN should be neutron rich. Several weeks ago, two isotopes of a new element with atomic number Z=117 were synthesized and their alpha-decay chains have been observed. The Q{sub a}lpha formula is found to work well for these nuclei, confirming its predictive power. The experimental half-lives are well reproduced by employing the UFM with the experimental Q{sub a}lpha values. This fact that the experimental half-lives are compatible with experimental Q{sub a}lpha values supports the synthesis of a new element 117 and the experimental measurements to a certain extent.

  7. [Alpha1-adrenoceptor subtypes and alpha1-adrenoceptor antagonists].

    PubMed

    Muramatsu, Ikunobu; Suzuki, Fumiko; Tanaka, Takashi; Yamamoto, Hatsumi; Morishima, Shigeru

    2006-03-01

    Alpha(1)-adrenoceptors are widely distributed in the human body and play important physiologic roles. Three alpha(1)-adrenoceptor subtypes (alpha(1A), alpha(1B) and alpha(1D)) have been cloned and show different pharmacologic profiles. In addition, a putative alpha(1)-adrenoceptor (alpha(1L) subtype) has also been proposed. Recently, three drugs (tamsulosin, naftopidil, and silodosin) have been developed in Japan for the treatment of urinary obstruction in patients with benign prostatic hyperplasia. In this review, we describe recent alpha(1)-adrenoceptor subclassifications and the pharmacologic characteristics (subtype selectivity and clinical relevance) of alpha(1)-adrenoceptor antagonists. PMID:16518082

  8. Molecular cloning and characterization of the Xenopus hypoxia-inducible factor 1alpha (xHIF1alpha).

    PubMed

    de Beaucourt, Arnaud; Coumailleau, Pascal

    2007-12-15

    We report the molecular cloning and the characterization of the Xenopus homolog of mammalian hypoxia-inducible factor 1alpha (HIF1alpha), a member of the bHLH/PAS transcription factor family. Searches in Xenopus genome sequences and phylogenetic analysis reveal the existence of HIF1alpha and HIF2alpha paralogs in the Xenopus laevis species. Sequence data analyses indicate that the organization of protein domains in Xenopus HIF1alpha (xHIF1alpha) is strongly conserved. We also show that xHIF1alpha heterodimerizes with the Xenopus Arnt1 protein (xArnt1) with the proteic complex being mediated by the HLH and PAS domains. Subcellular analysis in a Xenopus XTC cell line using chimeric GFP constructs show that over-expression of xHIF1alpha and xArnt1 allows us to detect the xHIF1alpha/xArnt1 complex in the nucleus, but only in the presence of both partners. Further analyses in XTC cell line show that over-producing xHIF1alpha and xArnt1 mediates trans-activation of the hypoxia response element (HRE) reporter. The trans-activation level can be increased in hypoxia conditions. Interestingly such trans-activation properties can be also observed when human Arnt1 is used together with the xHIF1alpha. PMID:17471499

  9. Alternate Alpha Induced Reactions for NIF Radiochemistry

    SciTech Connect

    Shaughnessy, D A; Moody, K J; Bernstein, L A

    2010-02-26

    Radiochemical analysis of NIF capsule residues has been identified as a potential diagnostic of NIF capsule performance. In particular, alpha-induced nuclear reactions that occur on tracer elements added to the NIF capsule have been shown through simulation to be a very sensitive diagnostic for mix. The short range of the alpha particles makes them representative of the hot spot where they are created through the fusion of deuterium and tritium. Reactions on elements doped into the innermost part of the capsule ablator would therefore be sensitive to material that had mixed into the hot spot. Radiochemical determinations of activated detector elements may perhaps be the only true measure of mix that occurs in a NIF capsule, particularly in cases when the capsule fails.

  10. Alpha-particle diagnostics

    SciTech Connect

    Young, K.M.

    1991-01-01

    This paper will focus on the state of development of diagnostics which are expected to provide the information needed for {alpha}- physics studies in the future. Conventional measurement of detailed temporal and spatial profiles of background plasma properties in DT will be essential for such aspects as determining heating effectiveness, shaping of the plasma profiles and effects of MHD, but will not be addressed here. This paper will address (1) the measurement of the neutron source, and hence {alpha}-particle birth profile, (2) measurement of the escaping {alpha}-particles and (3) measurement of the confined {alpha}-particles over their full energy range. There will also be a brief discussion of (4) the concerns about instabilities being generated by {alpha}-particles and the methods necessary for measuring these effects. 51 refs., 10 figs.

  11. Event counting alpha detector

    DOEpatents

    Bolton, Richard D.; MacArthur, Duncan W.

    1996-01-01

    An electrostatic detector for atmospheric radon or other weak sources of alpha radiation. In one embodiment, nested enclosures are insulated from one another, open at the top, and have a high voltage pin inside and insulated from the inside enclosure. An electric field is produced between the pin and the inside enclosure. Air ions produced by collision with alpha particles inside the decay volume defined by the inside enclosure are attracted to the pin and the inner enclosure. With low alpha concentrations, individual alpha events can be measured to indicate the presence of radon or other alpha radiation. In another embodiment, an electrical field is produced between parallel plates which are insulated from a single decay cavity enclosure.

  12. Imaging alpha particle detector

    DOEpatents

    Anderson, D.F.

    1980-10-29

    A method and apparatus for detecting and imaging alpha particles sources is described. A dielectric coated high voltage electrode and a tungsten wire grid constitute a diode configuration discharge generator for electrons dislodged from atoms or molecules located in between these electrodes when struck by alpha particles from a source to be quantitatively or qualitatively analyzed. A thin polyester film window allows the alpha particles to pass into the gas enclosure and the combination of the glass electrode, grid and window is light transparent such that the details of the source which is imaged with high resolution and sensitivity by the sparks produced can be observed visually as well. The source can be viewed directly, electronically counted or integrated over time using photographic methods. A significant increase in sensitivity over other alpha particle detectors is observed, and the device has very low sensitivity to gamma or beta emissions which might otherwise appear as noise on the alpha particle signal.

  13. Imaging alpha particle detector

    DOEpatents

    Anderson, David F.

    1985-01-01

    A method and apparatus for detecting and imaging alpha particles sources is described. A conducting coated high voltage electrode (1) and a tungsten wire grid (2) constitute a diode configuration discharge generator for electrons dislodged from atoms or molecules located in between these electrodes when struck by alpha particles from a source (3) to be quantitatively or qualitatively analyzed. A thin polyester film window (4) allows the alpha particles to pass into the gas enclosure and the combination of the glass electrode, grid and window is light transparent such that the details of the source which is imaged with high resolution and sensitivity by the sparks produced can be observed visually as well. The source can be viewed directly, electronically counted or integrated over time using photographic methods. A significant increase in sensitivity over other alpha particle detectors is observed, and the device has very low sensitivity to gamma or beta emissions which might otherwise appear as noise on the alpha particle signal.

  14. Event counting alpha detector

    DOEpatents

    Bolton, R.D.; MacArthur, D.W.

    1996-08-27

    An electrostatic detector is disclosed for atmospheric radon or other weak sources of alpha radiation. In one embodiment, nested enclosures are insulated from one another, open at the top, and have a high voltage pin inside and insulated from the inside enclosure. An electric field is produced between the pin and the inside enclosure. Air ions produced by collision with alpha particles inside the decay volume defined by the inside enclosure are attracted to the pin and the inner enclosure. With low alpha concentrations, individual alpha events can be measured to indicate the presence of radon or other alpha radiation. In another embodiment, an electrical field is produced between parallel plates which are insulated from a single decay cavity enclosure. 6 figs.

  15. Nuclear localization signal receptor importin alpha associates with the cytoskeleton.

    PubMed Central

    Smith, H M; Raikhel, N V

    1998-01-01

    Importin alpha is the nuclear localization signal (NLS) receptor that is involved in the nuclear import of proteins containing basic NLSs. Using importin alpha as a tool, we were interested in determining whether the cytoskeleton could function in the transport of NLS-containing proteins from the cytoplasm to the nucleus. Double-labeling immunofluorescence studies showed that most of the cytoplasmic importin alpha coaligned with microtubules and microfilaments in tobacco protoplasts. Treatment of tobacco protoplasts with microtubule- or microfilament-depolymerizing agents disrupted the strands of importin alpha in the cytoplasm, whereas a microtubule-stabilizing agent had no effect. Biochemical analysis showed that importin alpha associated with microtubules and microfilaments in vitro in an NLS-dependent manner. The interaction of importin alpha with the cytoskeleton could be an essential element of protein transport from the cytoplasm to the nucleus in vivo. PMID:9811789

  16. The alpha channeling effect

    SciTech Connect

    Fisch, N. J.

    2015-12-10

    Alpha particles born through fusion reactions in a tokamak reactor tend to slow down on electrons, but that could take up to hundreds of milliseconds. Before that happens, the energy in these alpha particles can destabilize on collisionless timescales toroidal Alfven modes and other waves, in a way deleterious to energy confinement. However, it has been speculated that this energy might be instead be channeled into useful energy, so as to heat fuel ions or to drive current. Such a channeling needs to be catalyzed by waves Waves can produce diffusion in energy of the alpha particles in a way that is strictly coupled to diffusion in space. If these diffusion paths in energy-position space point from high energy in the center to low energy on the periphery, then alpha particles will be cooled while forced to the periphery. The energy from the alpha particles is absorbed by the wave. The amplified wave can then heat ions or drive current. This process or paradigm for extracting alpha particle energy collisionlessly has been called alpha channeling. While the effect is speculative, the upside potential for economical fusion is immense. The paradigm also operates more generally in other contexts of magnetically confined plasma.

  17. ON THE ORIGINS OF THE DIFFUSE H{alpha} EMISSION: IONIZED GAS OR DUST-SCATTERED H{alpha} HALOS?

    SciTech Connect

    Seon, Kwang-Il; Witt, Adolf N.

    2012-10-20

    It is known that the diffuse H{alpha} emission outside of bright H II regions not only are very extended, but also can occur in distinct patches or filaments far from H II regions, and the line ratios of [S II] {lambda}6716/H{alpha} and [N II] {lambda}6583/H{alpha} observed far from bright H II regions are generally higher than those in the H II regions. These observations have been regarded as evidence against the dust-scattering origin of the diffuse H{alpha} emission (including other optical lines), and the effect of dust scattering has been neglected in studies on the diffuse H{alpha} emission. In this paper, we reexamine the arguments against dust scattering and find that the dust-scattering origin of the diffuse H{alpha} emission cannot be ruled out. As opposed to the previous contention, the expected dust-scattered H{alpha} halos surrounding H II regions are, in fact, in good agreement with the observed H{alpha} morphology. We calculate an extensive set of photoionization models by varying elemental abundances, ionizing stellar types, and clumpiness of the interstellar medium (ISM) and find that the observed line ratios of [S II]/H{alpha}, [N II]/H{alpha}, and He I {lambda}5876/H{alpha} in the diffuse ISM accord well with the dust-scattered halos around H II regions, which are photoionized by late O- and/or early B-type stars. We also demonstrate that the H{alpha} absorption feature in the underlying continuum from the dust-scattered starlight ({sup d}iffuse galactic light{sup )} and unresolved stars is able to substantially increase the [S II]/H{alpha} and [N II]/H{alpha} line ratios in the diffuse ISM.

  18. Alpha-thalassaemia.

    PubMed

    Harteveld, Cornelis L; Higgs, Douglas R

    2010-01-01

    Alpha-thalassaemia is inherited as an autosomal recessive disorder characterised by a microcytic hypochromic anaemia, and a clinical phenotype varying from almost asymptomatic to a lethal haemolytic anaemia.It is probably the most common monogenic gene disorder in the world and is especially frequent in Mediterranean countries, South-East Asia, Africa, the Middle East and in the Indian subcontinent. During the last few decades the incidence of alpha thalassaemia in North-European countries and Northern America has increased because of demographic changes. Compound heterozygotes and some homozygotes have a moderate to severe form of alpha thalassaemia called HbH disease. Hb Bart's hydrops foetalis is a lethal form in which no alpha-globin is synthesized. Alpha thalassaemia most frequently results from deletion of one or both alpha genes from the chromosome and can be classified according to its genotype/phenotype correlation. The normal complement of four functional alpha-globin genes may be decreased by 1, 2, 3 or all 4 copies of the genes, explaining the clinical variation and increasing severity of the disease. All affected individuals have a variable degree of anaemia (low Hb), reduced mean corpuscular haemoglobin (MCH/pg), reduced mean corpuscular volume (MCV/fl) and a normal/slightly reduced level of HbA2. Molecular analysis is usually required to confirm the haematological observations (especially in silent alpha-thalassaemia and alpha-thalassaemia trait). The predominant features in HbH disease are anaemia with variable amounts of HbH (0.8-40%). The type of mutation influences the clinical severity of HbH disease. The distinguishing features of the haemoglobin Bart's hydrops foetalis syndrome are the presence of Hb Bart's and the total absence of HbF. The mode of transmission of alpha thalassaemia is autosomal recessive. Genetic counselling is offered to couples at risk for HbH disease or haemoglobin Bart's Hydrops Foetalis Syndrome. Carriers of alpha+- or

  19. Cobalt inhibits the interaction between hypoxia-inducible factor-alpha and von Hippel-Lindau protein by direct binding to hypoxia-inducible factor-alpha.

    PubMed

    Yuan, Yong; Hilliard, George; Ferguson, Tsuneo; Millhorn, David E

    2003-05-01

    The hypoxia-inducible factor (HIF) activates the expression of genes that contain a hypoxia response element. The alpha-subunits of the HIF transcription factors are degraded by proteasomal pathways during normoxia but are stabilized under hypoxic conditions. The von Hippel-Lindau protein (pVHL) mediates the ubiquitination and rapid degradation of HIF-alpha (including HIF-1alpha and HIF-2alpha). Post-translational hydroxylation of a proline residue in the oxygen-dependent degradation (ODD) domain of HIF-alpha is required for the interaction between HIF and VHL. It has previously been established that cobalt mimics hypoxia and causes accumulation of HIF-1alpha and HIF-2alpha. However, little is known about the mechanism by which this occurs. In an earlier study, we demonstrated that cobalt binds directly to the ODD domain of HIF-2alpha. Here we provide the first evidence that cobalt inhibits pVHL binding to HIF-alpha even when HIF-alpha is hydroxylated. Deletion of 17 amino acids within the ODD domain of HIF-2alpha that are required for pVHL binding prevented the binding of cobalt and stabilized HIF-2alpha during normoxia. These findings show that cobalt mimics hypoxia, at least in part, by occupying the VHL-binding domain of HIF-alpha and thereby preventing the degradation of HIF-alpha. PMID:12606543

  20. Direct correlation between a negative autoregulatory response element at the cap site of the herpes simplex virus type 1 IE175 (alpha 4) promoter and a specific binding site for the IE175 (ICP4) protein.

    PubMed Central

    Roberts, M S; Boundy, A; O'Hare, P; Pizzorno, M C; Ciufo, D M; Hayward, G S

    1988-01-01

    In transient-expression assays, the IE175 (alpha 4) promoter region of herpes simple virus is down-regulated after cotransfection with DNA encoding its own protein product (IE175 or ICP4). The inhibition by IE175 proved to be highly specific for its own promoter region and did not act on either the herpes simplex virus type 1 IE110 (alpha 0) or human cytomegalovirus major immediate-early promoters. Furthermore, the inhibition was still exhibited by IE175 effector plasmids driven by strong heterologous promoters and therefore must be a direct autoregulatory response that cannot be explained by promoter competition effects. In gel mobility retardation assays with infected-cell nuclear extracts, a prominent and specific DNA-protein complex was formed with DNA fragments containing sequences from -108 to +30 in the IE175 promoter region. This activity was not present in mock-infected samples. Even stronger binding occurred with a fragment containing sequences from -128 to +120 in the IE110 promoter, but this second locus was not associated with any detectable response phenotype in cotransfection assays. Supershift experiments with an anti-IE175 monoclonal antibody confirmed the presence of the IE175 protein in both DNA-protein complexes. In the IE175 promoter, specific binding correlated closely with the presence of an intact autoregulatory signal near the cap site as judged by the loss of both activities in a 3'-deleted promoter fragment lacking sequences from -7 to +30. Insertion of a cloned 30-mer synthetic oligonucleotide sequence from positions -8 to +18 in IE175 restored both IE175 binding activity and the down-regulation phenotype. Direct shift-up assays with a similar 30-base-pair (bp) oligonucleotide containing 21 bp from positions -75 to -55 of IE110 (which encompasses a consensus ATCGTC motif) also produced a specific DNA-protein complex containing the IE175 protein. This ATCGTC motif proved to be a necessary component of both the IE110 and IE175 binding

  1. An alpha particle instrument with alpha, proton, and X-ray modes for planetary chemical analyses

    NASA Technical Reports Server (NTRS)

    Economou, T. E.; Turkevich, A. L.

    1976-01-01

    The interaction of alpha particles with matter is employed in a compact instrument that could provide rather complete in-situ chemical analyses of surfaces and thin atmospheres of extraterrestrial bodies. The instrument is a miniaturized and improved version of the Surveyor lunar instrument. The backscattering of alpha particles and (alpha, p) reactions provide analytical data on the light elements (carbon-iron). An X-ray mode that detects the photons produced by the alpha sources provides sensitivity and resolution for the chemical elements heavier than about silicon. The X-rays are detected by semiconductor detectors having a resolution between 150 and 250 eV at 5.9 keV. Such an instrument can identify and determine with good accuracy 99 percent of the atoms (except hydrogen) in rocks. For many trace elements, the detecting sensitivity is a few ppm. Auxiliary sources could be used to enhance the sensitivities for elements of special interest. The instrument could probably withstand the acceleration involved in semi-hard landings.

  2. Proceedings of transuranium elements

    SciTech Connect

    Not Available

    1992-01-01

    The identification of the first synthetic elements was established by chemical evidence. Conclusive proof of the synthesis of the first artificial element, technetium, was published in 1937 by Perrier and Segre. An essential aspect of their achievement was the prediction of the chemical properties of element 43, which had been missing from the periodic table and which was expected to have properties similar to those of manganese and rhenium. The discovery of other artificial elements, astatine and francium, was facilitated in 1939-1940 by the prediction of their chemical properties. A little more than 50 years ago, in the spring of 1940, Edwin McMillan and Philip Abelson synthesized element 93, neptunium, and confirmed its uniqueness by chemical means. On August 30, 1940, Glenn Seaborg, Arthur Wahl, and the late Joseph Kennedy began their neutron irradiations of uranium nitrate hexahydrate. A few months later they synthesized element 94, later named plutonium, by observing the alpha particles emitted from uranium oxide targets that had been bombarded with deuterons. Shortly thereafter they proved that is was the second transuranium element by establishing its unique oxidation-reduction behavior. The symposium honored the scientists and engineers whose vision and dedication led to the discovery of the transuranium elements and to the understanding of the influence of 5f electrons on their electronic structure and bonding. This volume represents a record of papers presented at the symposium.

  3. Alpha Particle Diagnostic

    SciTech Connect

    Fisher, Ray, K.

    2009-05-13

    The study of burning plasmas is the next frontier in fusion energy research, and will be a major objective of the U.S. fusion program through U.S. collaboration with our international partners on the ITER Project. For DT magnetic fusion to be useful for energy production, it is essential that the energetic alpha particles produced by the fusion reactions be confined long enough to deposit a significant fraction of their initial ~3.5 MeV energy in the plasma before they are lost. Development of diagnostics to study the behavior of energetic confined alpha particles is a very important if not essential part of burning plasma research. Despite the clear need for these measurements, development of diagnostics to study confined the fast confined alphas to date has proven extremely difficult, and the available techniques remain for the most part unproven and with significant uncertainties. Research under this grant had the goal of developing diagnostics of fast confined alphas, primarily based on measurements of the neutron and ion tails resulting from alpha particle knock-on collisions with the plasma deuterium and tritium fuel ions. One of the strengths of this approach is the ability to measure the alphas in the hot plasma core where the interesting ignition physics will occur.

  4. In situ trace element microanalysis

    NASA Technical Reports Server (NTRS)

    Burnett, D. S.; Woolum, D. S.

    1983-01-01

    The use of particle-track-radiography and X-ray- fluorescence techniques in the in situ measurement of trace (less than 1000 ppm) elements in single mineral phases of polished sections is surveyed, and examples of their application to ordinary, carbonaceous and enstatite chondrites are provided. Radiographic methods surveyed include fission-track radiography (for U, Th, and Pu-244), alpha radiography using nuclear reactions (for Li and B), alpha autoradiography (for Bi and Pb), and beta autoradiography (for several elements in synthetic or biological samples). Two X-ray-fluorescence methods are compared: (1) photon-induced X-ray emission (PIXE), and (2) the potential use of synchrotron radiation. The latter is shown to allow much greater sensitivity than current PIXE technology and a much broader range of elements than particle-track radiography: the ppm analysis of 10-micron grains for all elements heavier than Na. These advantages are seen as balancing the high cost of accelerator use.

  5. Cancer radioimmunotherapy with alpha-emitting nuclides.

    PubMed

    Couturier, Olivier; Supiot, Stéphane; Degraef-Mougin, Marie; Faivre-Chauvet, Alain; Carlier, Thomas; Chatal, Jean-François; Davodeau, François; Cherel, Michel

    2005-05-01

    In lymphoid malignancies and in certain solid cancers such as medullary thyroid carcinoma, somewhat mixed success has been achieved when applying radioimmunotherapy (RIT) with beta-emitters for the treatment of refractory cases. The development of novel RIT with alpha-emitters has created new opportunities and theoretical advantages due to the high linear energy transfer (LET) and the short path length in biological tissue of alpha-particles. These physical properties offer the prospect of achieving selective tumoural cell killing. Thus, RIT with alpha-emitters appears particularly suited for the elimination of circulating single cells or cell clusters or for the treatment of micrometastases at an early stage. However, to avoid non-specific irradiation of healthy tissues, it is necessary to identify accessible tumoural targets easily and rapidly. For this purpose, a small number of alpha-emitters have been investigated, among which only a few have been used for in vivo preclinical studies. Another problem is the availability and cost of these radionuclides; for instance, the low cost and the development of a reliable actinium-225/bismuth-213 generator were probably determining elements in the choice of bismuth-213 in the only human trial of RIT with an alpha-emitter. This article reviews the literature concerning monoclonal antibodies radiolabelled with alpha-emitters that have been developed for possible RIT in cancer patients. The principal radio-immunoconjugates are considered, starting with physical and chemical properties of alpha-emitters, their mode of production, the possibilities and difficulties of labelling, in vitro studies and finally, when available, in vivo preclinical and clinical studies. PMID:15841373

  6. Summary of alpha-neutron sources in GADRAS.

    SciTech Connect

    Mitchell, Dean James; Thoreson, Gregory G.; Harding, Lee T.

    2012-05-01

    A common source of neutrons for calibration and testing is alpha-neutron material, named for the alpha-neutron nuclear reaction that occurs within. This material contains a long-lived alpha-emitter and a lighter target element. When the alpha particle from the emitter is absorbed by the target, neutrons and gamma rays are released. Gamma Detector Response and Analysis Software (GADRAS) includes built-in alpha-neutron source definitions for AcC, AmB, AmBe, AmF, AmLi, CmC, and PuC. In addition, GADRAS users may create their own alpha-neutron sources by placing valid alpha-emitters and target elements in materials within their one-dimensional models (1DModel). GADRAS has the ability to use pre-built alpha-neutron sources for plotting or as trace-sources in 1D models. In addition, if any material (existing or user-defined) specified in a 1D model contains both an alpha emitter in conjunction with a target nuclide, or there is an interface between such materials, then the appropriate neutron-emission rate from the alpha-neutron reaction will be computed. The gamma-emissions from these sources are also computed, but are limited to a subset of nine target nuclides. If a user has experimental data to contribute to the alpha-neutron gamma emission database, it may be added directly or submitted to the GADRAS developers for inclusion. The gadras.exe.config file will be replaced when GADRAS updates are installed, so sending the information to the GADRAS developers is the preferred method for updating the database. This is also preferable because it enables other users to benefit from your efforts.

  7. International Space Station (ISS) Alpha Concept

    NASA Technical Reports Server (NTRS)

    1995-01-01

    An artist's concept of what the International Space Station (ISS)Alpha will look like in its completed and fully operational state. All the elements of the Station are shown - the United States, European, Japanese, and Russian. The artist also included the Space Shuttle in the docked position. Sixteen countries are cooperating to provide a multidisciplinary laboratory, technology test bed, and observatory that will provide an unprecedented undertaking in scientific, technological, and international experimentation.

  8. ALPHA MIS: Reference manual

    SciTech Connect

    Lovin, J.K.; Haese, R.L.; Heatherly, R.D.; Hughes, S.E.; Ishee, J.S.; Pratt, S.M.; Smith, D.W.

    1992-02-01

    ALPHA is a powerful and versatile management information system (MIS) initiated and sponsored and by the Finance and Business Management Division of Oak Ridge National Laboratory, who maintain and develop it in concert with the Business Systems Division for its Information Center. A general-purpose MIS, ALPHA allows users to access System 1022 and System 1032 databases to obtain and manage information. From a personal computer or a data terminal, Energy Systems employees can use ALPHA to control their own report reprocessing. Using four general commands (Database, Select, Sort, and Report) they can (1) choose a mainframe database, (2) define subsets within it, (3) sequentially order a subset by one or more variables, and (4) generate a report with their own or a canned format.

  9. Biological activity profiles of 1alpha,25-dihydroxyvitamin D2, D3, D4, D7, and 24-epi-1alpha,25-dihydroxyvitamin D2.

    PubMed

    Tsugawa, N; Nakagawa, K; Kawamoto, Y; Tachibana, Y; Hayashi, T; Ozono, K; Okano, T

    1999-04-01

    We have synthesized several 1alpha,25-dihydroxyvitamin D [1alpha,25(OH)2D] derivatives and evaluated their biological activity in terms of their binding affinity for the vitamin D receptor (VDR) and vitamin D-binding protein (DBP), antiproliferative or differentiation-inducing effects on human promyelocytic leukemic HL-60 cells, and transcriptional activity on a rat 25-hydroxyvitamin D3-24-hydroxylase gene promoter, including two vitamin D-responsive elements (VDREs), and human osteocalcin gene promoter, including a VDRE in transfected human osteosarcoma MG-63 cells. Furthermore, human VDR- or retinoic acid X receptor alpha (RXR alpha)-mediated luciferase activities of the derivatives were also measured by a one-hybrid system in human epitheloid carcinoma, cervix HeLa cells and African green monkey kidney CV-1 cells. Binding affinity for VDR, bone-resorbing activity, antiproliferative and cell-differentiating effects, transactivation potencies on target genes and VDR- or RXR alpha-mediated gene regulations of 1alpha,25(OH)2D2 and 1alpha,25(OH)2D4 were almost comparable to the effects of 1alpha,25(OH)2D3 while 24-epi-1alpha,25(OH)2D2 and 1alpha,25(OH)2D7 were much less active than 1alpha,25(OH)2D3 in these respects. This is the first report concerning biological assessment of 1alpha,25(OH)2D2, 1alpha,25(OH)2D3, 1alpha,25(OH)2D4, 24-epi-1alpha,25(OH)2D2 and 1alpha,25(OH)2D7 at the molecular level, especially with regards to the structural differences at the 24R- or 24S-methyl group and a double bond between carbons 22 and 23 in the side chain of 1alpha,25(OH)2D derivatives. PMID:10328556

  10. Functional specificity of two hormone response elements present on the human apoA-II promoter that bind retinoid X receptor alpha/thyroid receptor beta heterodimers for retinoids and thyroids: synergistic interactions between thyroid receptor beta and upstream stimulatory factor 2a.

    PubMed Central

    Hatzivassiliou, Eudoxia; Koukos, George; Ribeiro, Agnes; Zannis, Vassilis; Kardassis, Dimitris

    2003-01-01

    DNA binding and mutagenesis in vitro established that the -67/-55 region of the apoA-II (apolipoprotein A-II) promoter contains a thyroid HRE (hormone response element), which strongly binds RXRalpha (retinoid X receptor alpha)/T(3)Rbeta (thyroid receptor beta) heterodimers and weakly T(3)Rbeta homodimers, but does not bind other homo- or heterodimers of RXRalpha or orphan nuclear receptors. Transactivation was abolished by point mutations in the thyroid HRE. In co-transfection experiments of HEK-293 (human embryonic kidney 293) cells, the -911/+29 human apoA-II promoter was transactivated strongly by RXRalpha/T(3)Rbeta heterodimers in the presence of RA (9- cis retinoic acid) or T(3) (tri-iodothyronine). Homopolymeric promoters containing either three copies of the -73/-40 (element AIIAB) or four copies of the -738/-712 (element AIIJ) apoA-II promoter could be transactivated by RXRalpha/T(3)Rbeta heterodimers in COS-7 cells only in the presence of T(3) or RA respectively. RXRalpha/T(3)Rbeta heterodimers and USF2a (upstream stimulatory factor 2a) synergistically transactivated the -911/+29 apoA-II promoter in the presence of T(3). USF2a also enhanced the activity of a GAL4-T(3)Rbeta fusion protein in the presence of T(3) and suppressed the activity of a GAL4-RXRalpha fusion protein in the presence of RA. These findings suggest a functional specificity of the two HREs of the apoA-II promoter for retinoids and thyroids, which is modulated by synergistic or antagonistic interactions between RXRalpha/T(3)Rbeta heterodimers and the ubiquitous transcription factor USF2a. PMID:12959642

  11. The Apollo Alpha Spectrometer.

    NASA Technical Reports Server (NTRS)

    Jagoda, N.; Kubierschky, K.; Frank, R.; Carroll, J.

    1973-01-01

    Located in the Science Instrument Module of Apollo 15 and 16, the Alpha Particle Spectrometer was designed to detect and measure the energy of alpha particles emitted by the radon isotopes and their daughter products. The spectrometer sensor consisted of an array of totally depleted silicon surface barrier detectors. Biased amplifier and linear gate techniques were utilized to reduce resolution degradation, thereby permitting the use of a single 512 channel PHA. Sensor identification and in-flight radioactive calibration were incorporated to enhance data reduction.

  12. The Lyman alpha coronagraph

    NASA Technical Reports Server (NTRS)

    Kohl, J. L.; Reeves, E. M.; Kirkham, B.

    1977-01-01

    The rocket-borne Lyman alpha coronagraph (RLAC) is to be used in the absence of a natural solar eclipse to determine coronal temperatures from measurements of the line width of Lyman-alpha and to determine neutral hydrogen densities of coronal material from the absolute intensity. The coronagraph consists of a 75-cm Fastie-Ebert scanning spectrometer with an AMR 641 photoelectric detection system, an off-axis parabolic primary mirror, and an occulting system. A special optical arrangement achieves rejection of radiation from the solar disk.

  13. It's elemental

    NASA Astrophysics Data System (ADS)

    The Periodic Table of the elements will now have to be updated. An international team of researchers has added element 110 to the Earth's armory of elements. Though short-lived—of the order of microseconds, element 110 bottoms out the list as the heaviest known element on the planet. Scientists at the Heavy Ion Research Center in Darmstadt, Germany, made the 110-proton element by colliding a lead isotope with nickel atoms. The element, which is yet to be named, has an atomic mass of 269.

  14. [alpha]-Oxocarboxylic Acids

    ERIC Educational Resources Information Center

    Kerber, Robert C.; Fernando, Marian S.

    2010-01-01

    Several [alpha]-oxocarboxylic acids play key roles in metabolism in plants and animals. However, there are inconsistencies between the structures as commonly portrayed and the reported acid ionization constants, which result because the acids are predominantly hydrated in aqueous solution; that is, the predominant form is RC(OH)[subscript 2]COOH…

  15. From Alpha to Omega

    ERIC Educational Resources Information Center

    Czaja, Paul Clement

    2006-01-01

    The Alpha point of the authors' life as a Montessori educator began in 1959, when he was a graduate student studying philosophy at Fordham University in the Bronx, New York. While studying the works of the great American philosopher William James, the author came across the writings of Maria Montessori and immediately became captivated by her…

  16. Alpha particle losses from Tokamak Fusion Test Reactor deuterium-tritium plasmas

    SciTech Connect

    Darrow, D.S.; Zweben, S.J.; Batha, S.

    1996-01-01

    Because alpha particle losses can have a significant influence on tokamak reactor viability, the loss of deuterium-tritium alpha particles from the Tokamak Fusion Test Reactor (TFTR) has been measured under a wide range of conditions. In TFTR, first orbit loss and stochastic toroidal field ripple diffusion are always present. Other losses can arise due to magnetohydrodynamic instabilities or due to waves in the ion cyclotron range of frequencies. No alpha particle losses have yet been seen due to collective instabilities driven by alphas. Ion Bernstein waves can drive large losses of fast ions from TFTR, and details of those losses support one element of the alpha energy channeling scenario.

  17. Summary of Alpha Particle Transport

    SciTech Connect

    Medley, S.S.; White, R.B.; Zweben, S.J.

    1998-08-19

    This paper summarizes the talks on alpha particle transport which were presented at the 5th International Atomic Energy Agency's Technical Committee Meeting on "Alpha Particles in Fusion Research" held at the Joint European Torus, England in September 1997.

  18. Alpha Condensates in Atomic Nuclei

    SciTech Connect

    Suzuki, Y.; Matsumura, H.

    2005-11-21

    Recent issues on Bose-Einstein condensation (BEC) of {alpha}-particles in nuclei are reviewed. A candidate of condensates is discussed for some states in 12C and 16O by defining the amount of {alpha} condensation.

  19. Development and identification of monoclonal antibodies against meso-Tetra (alpha,alpha,alpha,alpha,-O-phenylacetamide benzene) porphyrin.

    PubMed

    Wang, Fengyang; Huang, Xueying; Du, Li; Li, Weiguo; Qi, Chao

    2007-04-01

    The small molecule meso-Tetra (alpha,alpha,alpha,alpha-o-phenylacetamide benzene) porphyrin was synthesized through the condensation of o-nitrobenzaldehyde and pyrrole followed by reduction of the meso-tetra (o-nitrophenyl) porphyrin. The small molecule, without carrier, was used as complete antigen to immunize BALB/ C mice. Spleen cells producing high titer antibody were removed and fused with myeloma cells of SP2/0 origin. Using a conventional immunization protocol, stable murine monoclonal antibodies (MAbs) producing cell lines to meso-Tetra (alpha,alpha,alpha,alpha-o-phenylacetamide benzene) porphyrin 1F2 were obtained. Subclass determination showed that the clones produce IgG2a types of MAbs. The analytical results of HPLC and MALDI/TOFMS suggest that the purity of MAb 1F2 is 100%, and MAb 1F2 has a relative molecular weight of 156678.8 Da. Our results demonstrated that small molecule meso-Tetra (alpha,alpha,alpha,alpha-o-phenylacetamide benzene) porphyrin, as semiantigen without carrier, can elicit the formation of MAbs. PMID:17451352

  20. Superheavy Elements - Achievements and Challenges

    SciTech Connect

    Ackermann, Dieter

    2009-03-04

    The search for superheavy elements (SHE) has yielded exciting results for both the 'cold fusion' approach with reactions employing Pb and Bi targets and the ''hot fusion'' reactions with {sup 48}Ca beams on actinide targets. The most recent activities at GSI were the successful production of a more neutron rich isotope of element 112 in the reaction {sup 48}Ca+{sup 238}U confirming earlier result from FLNR, and the attempt to synthesize an isotope with Z 120 in the reaction {sup 64}Ni+{sup 238}U. Apart from the synthesis of new elements, advanced nuclear structure studies for heavy and super heavy elements promise a detailed insight in the properties of nuclear matter under the extreme conditions of high Z and A. The means are evaporation residue(ER)-{alpha}-{alpha} and -{alpha}-{gamma} coincidence techniques applied after separation of the reaction products from the beam. Recent examples of interesting physics to be discovered in this region of the chart of nuclides are the investigation of K-isomers observed for {sup 252,254}No and indicated for {sup 270}Ds. Fast chemistry and precision mass measurements deliver in addition valuable information on the fundamental properties of the SHE.

  1. New elements produced at GSI

    SciTech Connect

    Hofmann, Sigurd

    1998-12-21

    In two series of experiments at SHIP, six new elements (Z=107-112) were synthesized via fusion reactions using lead or bismuth targets and 1n-deexcitation channels. The isotopes were unambiguously identified by means of {alpha}-{alpha} correlations. Not fission, but alpha decay is the dominant decay mode. Cross-sections decrease by two orders of magnitude from bohrium (Z=107) to element 112, for which a cross-section of 1 pb was measured. Based on our results, it is likely that the production of isotopes of element 114 close to the island of spherical SuperHeavy Elements (SHE) could be achieved by fusion reactions using {sup 208}Pb targets. Systematic studies of the reaction cross-sections indicate that the transfer of nucleons is an important process for the initiation of fusion. The data allow for the fixing of a narrow energy window for the production of SHE using 1n-emission channels. The likelihood of broadening the energy window by investigation of radiative capture reactions, use of neutron deficient projectile isotopes and use of actinide targets is discussed.

  2. Haemophilus influenzae Disease (Including Hib) Symptoms

    MedlinePlus

    ... is considered invasive. Symptoms of pneumonia usually include: Fever and chills Cough Shortness of breath or difficulty breathing Sweating ... the blood. It can cause symptoms such as: Fever and chills Excessive tiredness Pain in the belly Nausea with ...

  3. New elements - approaching ?

    NASA Astrophysics Data System (ADS)

    Hofmann, S.

    1998-06-01

    The search for new elements is part of the broader field of investigations of nuclei at the limits of stability. In two series of experiments at SHIP, six new elements 0034-4885/61/6/002/img2 were synthesized via fusion reactions using 1n-deexcitation channels and lead or bismuth targets. The isotopes were unambiguously identified by means of 0034-4885/61/6/002/img3 correlations. Alpha decay, not fission, is the dominant decay mode. The collected decay data establish a means of comparison with theoretical data. This aids in the selection of appropriate models that describe the properties of known nuclei. Predictions based on these models are useful in the preparation of the next generation of experiments. Cross sections decrease by two orders of magnitude from bohrium (Z = 107) to element 112, for which a cross section of 1 pb was measured. The development of intense beam currents and sensitive detection methods is essential for the production and identification of still heavier elements and new isotopes of already known elements, as well as the measurement of small 0034-4885/61/6/002/img4-, 0034-4885/61/6/002/img5- and fission-branching ratios. An equally sensitive set-up is needed for the measurement of excitation functions at low cross sections. Based on our results, it is likely that the production of isotopes of element 114 close to the island of spherical superheavy elements (SHEs) could be achieved by fusion reactions using 0034-4885/61/6/002/img6 targets. Systematic studies of the reaction cross sections indicate that the transfer of nucleons is an important process for the initiation of fusion. The data allow for the fixing of a narrow energy window for the production of SHEs using 1n-emission channels. The likelihood of broadening the energy window by investigation of radiative capture reactions, use of neutron deficient projectile isotopes and use of actinide targets is discussed.

  4. Alpha-globin loci in homozygous beta-thalassemia intermedia.

    PubMed

    Triadou, P; Lapoumeroulie, C; Girot, R; Labie, D

    1983-01-01

    Homozygous beta-thalassemia intermediate (TI) differs from thalassemia major (TM) in being less severe clinically. Associated alpha-thalassemia could account for the TI phenotype by reducing the alpha/non-alpha chain imbalance. We have analyzed the alpha loci of 9 TI and 11 TM patients by restriction endonuclease mapping. All the TM and 7 of the TI patients have the normal complement of four alpha-globin genes (alpha alpha/alpha alpha). One TI patient has three alpha-globin genes (alpha alpha/-alpha), and another TI patient has five alpha genes (alpha alpha/alpha alpha alpha). PMID:6305827

  5. Superheavy Element Synthesis And Nuclear Structure

    SciTech Connect

    Ackermann, D.; Block, M.; Burkhard, H.-G.; Heinz, S.; Hessberger, F. P.; Khuyagbaatar, J.; Kojouharov, I.; Mann, R.; Maurer, J.; Antalic, S.; Saro, S.; Venhart, M.; Hofmann, S.; Leino, M.; Uusitalo, J.; Nishio, K.; Popeko, A. G.; Yeremin, A. V.

    2009-08-26

    After the successful progress in experiments to synthesize superheavy elements (SHE) throughout the last decades, advanced nuclear structure studies in that region have become feasible in recent years thanks to improved accelerator, separation and detection technology. The means are evaporation residue(ER)-alpha-alpha and ER-alpha-gamma coincidence techniques complemented by conversion electron (CE) studies, applied after a separator. Recent examples of interesting physics to be discovered in this region of the chart of nuclides are the studies of K-isomers observed in {sup 252,254}No and in {sup 270}Ds.

  6. A search for Lyman-alpha emission in beta Lyrae from Copernicus

    NASA Technical Reports Server (NTRS)

    Kondo, Y.; Mccluskey, G. E., Jr.

    1974-01-01

    High-resolution (0.2 A) spectrophotometric observations of the complex eclipsing binary beta Lyrae were obtained with the Princeton Telescope Spectrometer on the Copernicus satellite. We discuss the search for L-alpha emission in beta Lyrae and compare the Copernicus results with the OAO-2 observations of the same binary system. The possible L-alpha emission features observed from OAO-2 are identified as blends of the emission lines of other elements in the vicinity of L-alpha.

  7. Contemporary Issues in Ultra-Low Alpha Particle Counting

    NASA Astrophysics Data System (ADS)

    Gordon, Michael

    Single-Event Upsets (SEU) in CMOS devices are caused by the passage of ionizing radiation either from terrestrial neutrons or from the natural alpha particle radiation within the materials surrounding the transistors. Interactions of the neutrons with the silicon cause spallation reactions which emit energetic highly ionizing elements. Alpha particles, on the other hand, can upset the devices through direct ionization rather than through a nuclear reaction as in the case of the neutrons. In order to minimize the alpha-particle component of SEU, the radiation from the materials within a distance 100 μm of the transistors, currently needs to have an alpha particle emissivity of less than 2 alpha particles per khr per square centimeter. Many alpha particle detectors have background levels that are larger than this, which can make these measurements inaccurate and time consuming. This talk will discuss what is involved in making alpha particle emissivity measurements of materials used in the semiconductor industry using an ultra-low background commercially-available ionization detector. Detector calibration and efficiency, radon adsorption on the samples, and the effect of surface charge on electrically insulating samples will be discussed.

  8. IGFBP-3, hypoxia and TNF-{alpha} inhibit adiponectin transcription

    SciTech Connect

    Zappala, Giovanna; Rechler, Matthew M.

    2009-05-15

    The thiazolidinedione rosiglitazone, an agonist ligand for the nuclear receptor PPAR-{gamma}, improves insulin sensitivity in part by stimulating transcription of the insulin-sensitizing adipokine adiponectin. It activates PPAR-{gamma}-RXR-{alpha} heterodimers bound to PPAR-{gamma} response elements in the adiponectin promoter. Rosiglitazone-stimulated adiponectin protein synthesis in 3T3-L1 mouse adipocytes has been shown to be inhibited by IGFBP-3, which can be induced by hypoxia and the proinflammatory cytokine, TNF-{alpha}, two inhibitors of adiponectin transcription. The present study demonstrates that IGFBP-3, the hypoxia-mimetic agent cobalt chloride, and TNF-{alpha} inhibit rosiglitazone-induced adiponectin transcription in mouse embryo fibroblasts that stably express PPAR-{gamma}2. Native IGFBP-3 can bind RXR-{alpha} and inhibited rosiglitazone stimulated promoter activity, whereas an IGFBP-3 mutant that does not bind RXR-{alpha} did not. These results suggest that IGFBP-3 may mediate the inhibition of adiponectin transcription by hypoxia and TNF-{alpha}, and that IGFBP-3 binding to RXR-{alpha} may be required for the observed inhibition.

  9. Chemical characterization of element 112.

    PubMed

    Eichler, R; Aksenov, N V; Belozerov, A V; Bozhikov, G A; Chepigin, V I; Dmitriev, S N; Dressler, R; Gäggeler, H W; Gorshkov, V A; Haenssler, F; Itkis, M G; Laube, A; Lebedev, V Ya; Malyshev, O N; Oganessian, Yu Ts; Petrushkin, O V; Piguet, D; Rasmussen, P; Shishkin, S V; Shutov, A V; Svirikhin, A I; Tereshatov, E E; Vostokin, G K; Wegrzecki, M; Yeremin, A V

    2007-05-01

    The heaviest elements to have been chemically characterized are seaborgium (element 106), bohrium (element 107) and hassium (element 108). All three behave according to their respective positions in groups 6, 7 and 8 of the periodic table, which arranges elements according to their outermost electrons and hence their chemical properties. However, the chemical characterization results are not trivial: relativistic effects on the electronic structure of the heaviest elements can strongly influence chemical properties. The next heavy element targeted for chemical characterization is element 112; its closed-shell electronic structure with a filled outer s orbital suggests that it may be particularly susceptible to strong deviations from the chemical property trends expected within group 12. Indeed, first experiments concluded that element 112 does not behave like its lighter homologue mercury. However, the production and identification methods used cast doubt on the validity of this result. Here we report a more reliable chemical characterization of element 112, involving the production of two atoms of (283)112 through the alpha decay of the short-lived (287)114 (which itself forms in the nuclear fusion reaction of 48Ca with 242Pu) and the adsorption of the two atoms on a gold surface. By directly comparing the adsorption characteristics of (283)112 to that of mercury and the noble gas radon, we find that element 112 is very volatile and, unlike radon, reveals a metallic interaction with the gold surface. These adsorption characteristics establish element 112 as a typical element of group 12, and its successful production unambiguously establishes the approach to the island of stability of superheavy elements through 48Ca-induced nuclear fusion reactions with actinides. PMID:17476264

  10. Chemical characterization of element 112

    NASA Astrophysics Data System (ADS)

    Eichler, R.; Aksenov, N. V.; Belozerov, A. V.; Bozhikov, G. A.; Chepigin, V. I.; Dmitriev, S. N.; Dressler, R.; Gäggeler, H. W.; Gorshkov, V. A.; Haenssler, F.; Itkis, M. G.; Laube, A.; Lebedev, V. Ya.; Malyshev, O. N.; Oganessian, Yu. Ts.; Petrushkin, O. V.; Piguet, D.; Rasmussen, P.; Shishkin, S. V.; Shutov, A. V.; Svirikhin, A. I.; Tereshatov, E. E.; Vostokin, G. K.; Wegrzecki, M.; Yeremin, A. V.

    2007-05-01

    The heaviest elements to have been chemically characterized are seaborgium (element 106), bohrium (element 107) and hassium (element 108). All three behave according to their respective positions in groups 6, 7 and 8 of the periodic table, which arranges elements according to their outermost electrons and hence their chemical properties. However, the chemical characterization results are not trivial: relativistic effects on the electronic structure of the heaviest elements can strongly influence chemical properties. The next heavy element targeted for chemical characterization is element 112; its closed-shell electronic structure with a filled outer s orbital suggests that it may be particularly susceptible to strong deviations from the chemical property trends expected within group 12. Indeed, first experiments concluded that element 112 does not behave like its lighter homologue mercury. However, the production and identification methods used cast doubt on the validity of this result. Here we report a more reliable chemical characterization of element 112, involving the production of two atoms of 283112 through the alpha decay of the short-lived 287114 (which itself forms in the nuclear fusion reaction of 48Ca with 242Pu) and the adsorption of the two atoms on a gold surface. By directly comparing the adsorption characteristics of 283112 to that of mercury and the noble gas radon, we find that element 112 is very volatile and, unlike radon, reveals a metallic interaction with the gold surface. These adsorption characteristics establish element 112 as a typical element of group 12, and its successful production unambiguously establishes the approach to the island of stability of superheavy elements through 48Ca-induced nuclear fusion reactions with actinides.

  11. DNA Repair, Redox Regulation and Modulation of Estrogen Receptor Alpha Mediated Transcription

    ERIC Educational Resources Information Center

    Curtis-Ducey, Carol Dianne

    2009-01-01

    Interaction of estrogen receptor [alpha] (ER[alpha]) with 17[beta]-estradiol (E[subscript 2]) facilitates binding of the receptor to estrogen response elements (EREs) in target genes, which in turn leads to recruitment of coregulatory proteins. To better understand how estrogen-responsive genes are regulated, our laboratory identified a number of…

  12. A Comparison of Type I Error Rates of Alpha-Max with Established Multiple Comparison Procedures.

    ERIC Educational Resources Information Center

    Barnette, J. Jackson; McLean, James E.

    J. Barnette and J. McLean (1996) proposed a method of controlling Type I error in pairwise multiple comparisons after a significant omnibus F test. This procedure, called Alpha-Max, is based on a sequential cumulative probability accounting procedure in line with Bonferroni inequality. A missing element in the discussion of Alpha-Max was the…

  13. Hepatocyte nuclear factor-3 alpha (HNF-3{alpha}) negatively regulates androgen receptor transactivation in prostate cancer cells

    SciTech Connect

    Lee, Hyun Joo; Hwang, Miok; Chattopadhyay, Soma; Choi, Hueng-Sik; Lee, Keesook

    2008-03-07

    The androgen receptor (AR) is involved in the development and progression of prostate cancers. However, the mechanisms by which this occurs remain incompletely understood. In previous reports, hepatocyte nuclear factor-3{alpha} (HNF-3{alpha}) has been shown to be expressed in the epithelia of the prostate gland, and has been determined to regulate the transcription of prostate-specific genes. In this study, we report that HNF-3{alpha} functions as a novel corepressor of AR in prostatic cells. HNF-3{alpha} represses AR transactivation on target promoters containing the androgen response element (ARE) in a dose-dependent manner. HNF-3{alpha} interacts physically with AR, and negatively regulates AR transactivation via competition with AR coactivators, including GRIP1. Furthermore, HNF-3{alpha} overexpression reduces the androgen-induced expression of prostate-specific antigen (PSA) in LNCaP cells. Taken together, our findings indicate that HNF-3{alpha} is a novel corepressor of AR, and predict its effects on the proliferation of prostate cancer cells.

  14. The Alpha Centauri binary system. Atmospheric parameters and element abundances

    NASA Astrophysics Data System (ADS)

    Porto de Mello, G. F.; Lyra, W.; Keller, G. R.

    2008-09-01

    Context: The α Centauri binary system, owing to its duplicity, proximity and brightness, and its components' likeness to the Sun, is a fundamental calibrating object for the theory of stellar structure and evolution and the determination of stellar atmospheric parameters. This role, however, is hindered by a considerable disagreement in the published analyses of its atmospheric parameters and abundances. Aims: We report a new spectroscopic analysis of both components of the α Centauri system, compare published analyses of the system, and attempt to quantify the discrepancies still extant in the determinations of the atmospheric parameters and abundances of these stars. Methods: The analysis is differential with respect to the Sun, based on spectra with R = 35 000 and signal-to-noise ratio ≥1000, and employed spectroscopic and photometric methods to obtain as many independent T_eff determinations as possible. We also check the atmospheric parameters for consistency against the results of the dynamical analysis and the positions of the components in a theoretical HR diagram. Results: The spectroscopic atmospheric parameters of the system are found to be T_eff = (5847 ± 27) K, [Fe/H] = +0.24 ± 0.03, log g = 4.34 ± 0.12, and ξt = 1.46 ± 0.03 km s-1, for α Cen A, and T_eff = (5316 ± 28) K, [Fe/H] = +0.25 ± 0.04, log g = 4.44 ± 0.15, and ξt = 1.28 ± 0.15 km s^-1 for α Cen B. The parameters were derived from the simultaneous excitation & ionization equilibria of Fe I and Fe II lines. T_effs were also obtained by fitting theoretical profiles to the Hα line and from photometric calibrations. Conclusions: We reached good agreement between the three criteria for α Cen A. For α Cen B the spectroscopic T_eff is ~140 K higher than the other two determinations. We discuss possible origins of this inconsistency, concluding that the presence of non-local thermodynamic equilibrium effects is a probable candidate, but we note that there is as yet no consensus on the existence and cause of an offset between the spectroscopic and photometric T_eff scales of cool dwarfs. The spectroscopic surface gravities also agree with those derived from directly measured masses and radii. An average of three independent T_eff criteria leads to T_eff (A) = (5824 ± 26) K and T_eff (B) = (5223 ± 62) K. The abundances of Na, Mg, Si, Mn, Co, and Ni and, possibly, Cu are significantly enriched in the system, which also seems to be deficient in Y and Ba. This abundance pattern can be deemed normal in the context of recent data on metal-rich stars. The position of α Cen A in an up-to-date theoretical evolutionary diagram yields a good match of the evolutionary mass and age (in the 4.5 to 5.3 Gyr range) with those from the dynamical solution and seismology, but only marginal agreement for α Cen B, taking into account its more uncertain T_eff. Based on observations collected at Observatório do Pico dos Dias (OPD), operated by the Laboratório Nacional de Astrofísica, CNPq, Brazil. Table 2 is only available in electronic form at http://www.aanda.org

  15. Alpha-mannosidosis

    PubMed Central

    Malm, Dag; Nilssen, Øivind

    2008-01-01

    Alpha-mannosidosis is an inherited lysosomal storage disorder characterized by immune deficiency, facial and skeletal abnormalities, hearing impairment, and intellectual disability. It occurs in approximately 1 of 500,000 live births. The children are often born apparently normal, and their condition worsens progressively. Some children are born with ankle equinus or develop hydrocephalus in the first year of life. Main features are immune deficiency (manifested by recurrent infections, especially in the first decade of life), skeletal abnormalities (mild-to-moderate dysostosis multiplex, scoliosis and deformation of the sternum), hearing impairment (moderate-to-severe sensorineural hearing loss), gradual impairment of mental functions and speech, and often, periods of psychosis. Associated motor function disturbances include muscular weakness, joint abnormalities and ataxia. The facial trait include large head with prominent forehead, rounded eyebrows, flattened nasal bridge, macroglossia, widely spaced teeth, and prognathism. Slight strabismus is common. The clinical variability is significant, representing a continuum in severity. The disorder is caused by lysosomal alpha-mannosidase deficiency. Alpha-mannosidosis is inherited in an autosomal recessive fashion and is caused by mutations in the MAN2B1 gene located on chromosome 19 (19 p13.2-q12). Diagnosis is made by measuring acid alpha-mannosidase activity in leukocytes or other nucleated cells and can be confirmed by genetic testing. Elevated urinary secretion of mannose-rich oligosaccharides is suggestive, but not diagnostic. Differential diagnoses are mainly the other lysosomal storage diseases like the mucopolysaccharidoses. Genetic counseling should be given to explain the nature of the disease and to detect carriers. Antenatal diagnosis is possible, based on both biochemical and genetic methods. The management should be pro-active, preventing complications and treating manifestations. Infections must be

  16. Background canceling surface alpha detector

    DOEpatents

    MacArthur, Duncan W.; Allander, Krag S.; Bounds, John A.

    1996-01-01

    A background canceling long range alpha detector which is capable of providing output proportional to both the alpha radiation emitted from a surface and to radioactive gas emanating from the surface. The detector operates by using an electrical field between first and second signal planes, an enclosure and the surface or substance to be monitored for alpha radiation. The first and second signal planes are maintained at the same voltage with respect to the electrically conductive enclosure, reducing leakage currents. In the presence of alpha radiation and radioactive gas decay, the signal from the first signal plane is proportional to both the surface alpha radiation and to the airborne radioactive gas, while the signal from the second signal plane is proportional only to the airborne radioactive gas. The difference between these two signals is proportional to the surface alpha radiation alone.

  17. Background canceling surface alpha detector

    DOEpatents

    MacArthur, D.W.; Allander, K.S.; Bounds, J.A.

    1996-06-11

    A background canceling long range alpha detector which is capable of providing output proportional to both the alpha radiation emitted from a surface and to radioactive gas emanating from the surface. The detector operates by using an electrical field between first and second signal planes, an enclosure and the surface or substance to be monitored for alpha radiation. The first and second signal planes are maintained at the same voltage with respect to the electrically conductive enclosure, reducing leakage currents. In the presence of alpha radiation and radioactive gas decay, the signal from the first signal plane is proportional to both the surface alpha radiation and to the airborne radioactive gas, while the signal from the second signal plane is proportional only to the airborne radioactive gas. The difference between these two signals is proportional to the surface alpha radiation alone. 5 figs.

  18. Proteinaceous alpha-amylase inhibitors.

    PubMed

    Svensson, Birte; Fukuda, Kenji; Nielsen, Peter K; Bønsager, Birgit C

    2004-02-12

    Proteins that inhibit alpha-amylases have been isolated from plants and microorganisms. These inhibitors can have natural roles in the control of endogenous alpha-amylase activity or in defence against pathogens and pests; certain inhibitors are reported to be antinutritional factors. The alpha-amylase inhibitors belong to seven different protein structural families, most of which also contain evolutionary related proteins without inhibitory activity. Two families include bifunctional inhibitors acting both on alpha-amylases and proteases. High-resolution structures are available of target alpha-amylases in complex with inhibitors from five families. These structures indicate major diversity but also some similarity in the structural basis of alpha-amylase inhibition. Mutational analysis of the mechanism of inhibition was performed in a few cases and various protein engineering and biotechnological approaches have been outlined for exploitation of the inhibitory function. PMID:14871655

  19. Elemental health

    SciTech Connect

    Tonneson, L.C.

    1997-01-01

    Trace elements used in nutritional supplements and vitamins are discussed in the article. Relevant studies are briefly cited regarding the health effects of selenium, chromium, germanium, silicon, zinc, magnesium, silver, manganese, ruthenium, lithium, and vanadium. The toxicity and food sources are listed for some of the elements. A brief summary is also provided of the nutritional supplements market.

  20. Murine laminin alpha3A and alpha3B isoform chains are generated by usage of two promoters and alternative splicing.

    PubMed

    Ferrigno, O; Virolle, T; Galliano, M F; Chauvin, N; Ortonne, J P; Meneguzzi, G; Aberdam, D

    1997-08-15

    We already identified two distinct laminin alpha3A and alpha3B chain isoforms which differ in their amino-terminal ends and display different tissue-specific expression patterns. In this study we have investigated whether these two different isoforms are products of the same laminin alpha3 (lama3) gene and transcribed from one or two separate promoters. Genomic clones were isolated that encompass the sequences upstream to the 5' ends of both the alpha3A and the alpha3B cDNAs. Sequence analysis of the region upstream to the alpha3A open reading frame revealed the presence of a TATA box and potential binding sites for responsive elements. By primer extension analysis, the transcription start site of the alpha3B mRNA isoform was defined. The sequences upstream to the alpha3B mRNA transcription start site do not contain a TATA box near the transcription initiation sites, but AP-1, AP-2, and Sp1 consensus binding site sequences were identified. The genomic regions located immediately upstream of the alpha3A and alpha3B transcription start sites were shown to possess promoter activities in transfection experiments. In the promoter regions, response elements for the acute phase reactant signal and NF-interleukin 6 were found, and their possible relevance in the context of inflammation and wound healing is discussed. Our results demonstrate that the lama3 gene produces the two polypeptides by alternative splicing and contains two promoters, which regulate the production of the two isoforms alpha3A and alpha3B. PMID:9252362

  1. Cooperative interaction of hypoxia-inducible factor-2alpha (HIF-2alpha ) and Ets-1 in the transcriptional activation of vascular endothelial growth factor receptor-2 (Flk-1).

    PubMed

    Elvert, Gerd; Kappel, Andreas; Heidenreich, Regina; Englmeier, Ursula; Lanz, Stephan; Acker, Till; Rauter, Manuel; Plate, Karl; Sieweke, Michael; Breier, Georg; Flamme, Ingo

    2003-02-28

    Interactions between Ets family members and a variety of other transcription factors serve important functions during development and differentiation processes, e.g. in the hematopoietic system. Here we show that the endothelial basic helix-loop-helix PAS domain transcription factor, hypoxia-inducible factor-2alpha (HIF-2alpha) (but not its close relative HIF-1alpha), cooperates with Ets-1 in activating transcription of the vascular endothelial growth factor receptor-2 (VEGF-2) gene (Flk-1). The receptor tyrosine kinase Flk-1 is indispensable for angiogenesis, and its expression is closely regulated during development. Consistent with the hypothesis that HIF-2alpha controls the expression of Flk-1 in vivo, we show here that HIF-2alpha and Flk-1 are co-regulated in postnatal mouse brain capillaries. A tandem HIF-2alpha/Ets binding site was identified within the Flk-1 promoter that acted as a strong enhancer element. Based on the analysis of transgenic mouse embryos, these motifs are essential for endothelial cell-specific reporter gene expression. A single HIF-2alpha/Ets element conferred strong cooperative induction by HIF-2alpha and Ets-1 when fused to a heterologous promoter and was most active in endothelial cells. The physical interaction of HIF-2alpha with Ets-1 was demonstrated and localized to the HIF-2alpha carboxyl terminus and the autoinhibitory exon VII domain of Ets-1, respectively. The deletion of the DNA binding and carboxyl-terminal transactivation domains of HIF-2alpha, respectively, created dominant negative mutants that suppressed transactivation by the wild type protein and failed to synergize with Ets-1. These results suggest that the interaction between HIF-2alpha and endothelial Ets factors is required for the full transcriptional activation of Flk-1 in endothelial cells and may therefore represent a future target for the manipulation of angiogenesis. PMID:12464608

  2. Long range alpha particle detector

    DOEpatents

    MacArthur, Duncan W.; Wolf, Michael A.; McAtee, James L.; Unruh, Wesley P.; Cucchiara, Alfred L.; Huchton, Roger L.

    1993-01-01

    An alpha particle detector capable of detecting alpha radiation from distant sources. In one embodiment, a high voltage is generated in a first electrically conductive mesh while a fan draws air containing air molecules ionized by alpha particles through an air passage and across a second electrically conductive mesh. The current in the second electrically conductive mesh can be detected and used for measurement or alarm. The detector can be used for area, personnel and equipment monitoring.

  3. Long range alpha particle detector

    DOEpatents

    MacArthur, D.W.; Wolf, M.A.; McAtee, J.L.; Unruh, W.P.; Cucchiara, A.L.; Huchton, R.L.

    1993-02-02

    An alpha particle detector capable of detecting alpha radiation from distant sources. In one embodiment, a high voltage is generated in a first electrically conductive mesh while a fan draws air containing air molecules ionized by alpha particles through an air passage and across a second electrically conductive mesh. The current in the second electrically conductive mesh can be detected and used for measurement or alarm. The detector can be used for area, personnel and equipment monitoring.

  4. Modeling Solar Lyman Alpha Irradiance

    NASA Technical Reports Server (NTRS)

    Pap, J.; Hudson, H. S.; Rottman, G. J.; Willson, R. C.; Donnelly, R. F.; London, J.

    1990-01-01

    Solar Lyman alpha irradiance is estimated from various solar indices using linear regression analyses. Models developed with multiple linear regression analysis, including daily values and 81-day running means of solar indices, predict reasonably well both the short- and long-term variations observed in Lyman alpha. It is shown that the full disk equivalent width of the He line at 1083 nm offers the best proxy for Lyman alpha, and that the total irradiance corrected for sunspot effect also has a high correlation with Lyman alpha.

  5. ISS Update: Alpha Magnetic Spectrometer

    NASA Video Gallery

    NASA Public Affairs Officer Kelly Humphries interviews Trent Martin, Johnson Space Center project manager for the Alpha Magnetic Spectrometer (AMS) aboard the International Space Station. Questions...

  6. Alpha Kappa Alpha Sorority's Reading Improvement Program for Minorities.

    ERIC Educational Resources Information Center

    Marable, June Morehead

    This document discusses the founding and establishment of Alpha Kappa Alpha Sorority's reading experience pilot project. The efforts of this project were aligned with those of Right to Read and Reading Is Fundamental (RIF). Because of the response from parents and children, plans are being made to increase present operations within the next…

  7. Microscopic cluster model of {alpha}+n, {alpha}+p, {alpha}+ {sup 3}He, and {alpha}+{alpha} elastic scattering from a realistic effective nuclear interaction

    SciTech Connect

    Dohet-Eraly, J.; Baye, D.

    2011-07-15

    An effective nucleon-nucleon interaction adapted to cluster-model calculations of collisions is derived from the realistic Argonne potential AV18 with the unitary correlation operator method. The unitary correlation is determined from the {alpha}+{alpha} elastic phase shifts calculated in a cluster approach by the generator coordinate method coupled with the microscopic R-matrix method. With this interaction, the elastic phase shifts for the {alpha}+n, {alpha}+p, and {alpha}+{sup 3}He collisions are calculated within the same model. Without further adjustment, a good agreement with experimental data is obtained with a small model space.

  8. Alpha glucosidase inhibitors.

    PubMed

    Kalra, Sanjay

    2014-04-01

    Alpha glucosidase inhibitors (AGIs) are a unique class of anti-diabetic drugs. Derived from bacteria, these oral drugs are enzyme inhibitors which do not have a pancreato -centred mechanism of action. Working to delay carbohydrate absorption in the gastrointestinal tract, they control postprandial hyperglycaemia and provide unquestioned cardiovascular benefit. Specially suited for a traditional Pakistani carbohydrate-rich diet, AGIs have been termed the 'untapped diamonds' of diabetology. The use of these oral antidiabetic drugs (OADs) that target pathophysiology in the early stages of type 2 diabetes, notably to reduce postprandial hyperglycaemia and hyperinsulinaemia will inevitably increase with time. This review describes the history of their development, mechanism of action, basic and clinical pharmacology, and suggests practical, evidence-based guidance for their optimal use. PMID:24864650

  9. Elemental Education.

    ERIC Educational Resources Information Center

    Daniel, Esther Gnanamalar Sarojini; Saat, Rohaida Mohd.

    2001-01-01

    Introduces a learning module integrating three disciplines--physics, chemistry, and biology--and based on four elements: carbon, oxygen, hydrogen, and silicon. Includes atomic model and silicon-based life activities. (YDS)

  10. Superheavy Elements

    ERIC Educational Resources Information Center

    Tsang, Chin Fu

    1975-01-01

    Discusses the possibility of creating elements with an atomic number of around 114. Describes the underlying physics responsible for the limited extent of the periodic table and enumerates problems that must be overcome in creating a superheavy nucleus. (GS)

  11. DFT CONFORMATIONAL STUDIES OF ALPHA-MALTOTRIOSE

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Recent DFT optimization studies on alpha-maltose improved our understanding of the preferred conformations of alpha-maltose and the present study extends these studies to alpha-maltotriose with three alpha-D-glucopyranose residues linked by two alpha-[1-4] bridges, denoted herein as DP-3's. Combina...

  12. Alpha Solarco`s Photovoltaic Concentrator Development program

    SciTech Connect

    Anderson, A.; Bailor, B.; Carroll, D.

    1995-10-01

    This report details the work done under Sandia`s Photovoltaic Concentrator Development contract, funded jointly by Alpha Solarco and the US Department of Energy. It discusses improvements made to the cell assembly and module design of Alpha Solarco`s point-focus, high-concentration photovoltaic module. The goals of this effort were to increase the module efficiency, reduce the manufacturing cost of the cell assembly, and increase product reliability. Redesign of the secondary optical element achieved a 4 percent increase in efficiency due to better cell fill factors and offtrack performance. New, lower cost materials were identified for the secondary optical element, the optical couple between the secondary optical element and the cell, and the cell assembly electrical insulator. Manufacturing process improvements and test equipment are also discussed.

  13. Alpha self-irradiation effects in ternary oxides of actinides elements: The zircon-like phases Am{sup III}VO{sub 4} and A{sup II}Np{sup IV}(VO{sub 4}){sub 2} (A=Sr, Pb)

    SciTech Connect

    Goubard, F. . E-mail: fabrice.goubard@chim.u-cergy.fr; Griesmar, P.; Tabuteau, A.

    2005-06-15

    We report the experimental studies of irradiation damage from alpha decay in neptunium and americium vanadates versus cumulative dose. The isotopes used were the transuranium {alpha}-emitter {sup 237}Np and the {alpha},{gamma}-emitter {sup 241}Am. Neptunium and americium vanadates self-irradiation was studied by X-ray diffraction method (XRD). The comparison of the powder diffraction patterns reveal that the irradiation has no apparent effect on the neptunium phases while the americium vanadate swells and becomes metamict as a function of cumulative dose.

  14. Prothymosin alpha in human blood.

    PubMed Central

    Panneerselvam, C; Haritos, A A; Caldarella, J; Horecker, B L

    1987-01-01

    The major cross-reacting peptide in human plasma detected with a radioimmunoassay (RIA) for thymosin alpha 1 was identified as prothymosin alpha, based on its elution properties in gel-filtration chromatography and its amino acid composition after purification by HPLC. A small quantity (less than 10%) of the total cross-reacting material was recovered in fractions corresponding to lower molecular weight thymosin alpha 1-like peptides. The total quantity of cross-reacting material detected in human blood, expressed as thymosin alpha 1 equivalents, was 11-14 pmol/ml (approximately 90% was recovered in the leukocyte fraction, approximately 10% was in the plasma fraction, and 1-2% was in the erythrocyte fraction). The peptide present in leukocytes was also identified as prothymosin alpha. After correction for the 5-times lower molar reactivity of prothymosin alpha in the thymosin alpha 1 RIA employed in these experiments, we estimate that the content of prothymosin alpha in human blood is 55-70 pmol/ml (0.6-0.8 microgram/ml). The relatively small quantities recovered in the erythrocyte and plasma fractions may be attributed to contamination of the former by leukocytes or to leakage from leukocytes into the plasma. PMID:3474615

  15. Alpha particle emitters in medicine

    SciTech Connect

    Fisher, D.R.

    1989-09-01

    Radiation-induced cancer of bone, liver and lung has been a prominent harmful side-effect of medical applications of alpha emitters. In recent years, however, the potential use of antibodies labeled with alpha emitting radionuclides against cancer has seemed promising because alpha particles are highly effective in cell killing. High dose rates at high LET, effectiveness under hypoxic conditions, and minimal expectancy of repair are additional advantages of alpha emitters over antibodies labeled with beta emitting radionuclides for cancer therapy. Cyclotron-produced astatine-211 ({sup 211}At) and natural bismuth-212 ({sup 212}Bi) have been proposed and are under extensive study in the United States and Europe. Radium-223 ({sup 223}Ra) also has favorable properties as a potential alpha emitting label, including a short-lived daughter chain with four alpha emissions. The radiation dosimetry of internal alpha emitters is complex due to nonuniformly distributed sources, short particle tracks, and high relative specific ionization. The variations in dose at the cellular level may be extreme. Alpha-particle radiation dosimetry, therefore, must involve analysis of statistical energy deposition probabilities for cellular level targets. It must also account fully for nonuniform distributions of sources in tissues, source-target geometries, and particle-track physics. 18 refs., 4 figs.

  16. EEG Alpha Power and Intelligence.

    ERIC Educational Resources Information Center

    Doppelmayr, M.; Klimesch, W.; Stadler, W.; Pollhuber, D.; Heine, C.

    2002-01-01

    Tested whether alpha power in different sub-bands is selectively related to intelligence. For 74 Austrian subjects, the EEG was recorded during a resting session and 2 different intelligence tests were performed. Findings show a strong positive correlation between intelligence and alpha power. (SLD)

  17. Alpha Schottky junction energy source

    NASA Astrophysics Data System (ADS)

    Litz, Marc S.; Fan, Zhaoyang; Carroll, James J.; Bayne, Stephen

    2012-06-01

    Isotope batteries offer solutions for long-lived low-power sensor requirements. Alpha emitting isotopes have energy per decay 103 times that of beta emitters. Alpha particles are absorbed within 20 μm of most materials reducing shielding mitigation. However, damage to materials from the alphas limits their practical use. A Schottky Barrier Diode (SBD) geometry is considered with an alpha emitting contact-layer on a diamond-like crystal semiconductor region. The radiation tolerance of diamond, the safety of alpha particles, combined with the internal field of the SBD is expected to generate current useful for low-power electronic devices over decades. Device design parameters and calculations of the expected current are described.

  18. Superconducting calorimetric alpha particle sensors for nuclear nonproliferation applications

    SciTech Connect

    Horansky, Robert D.; Ullom, Joel N.; Beall, James A.; Hilton, Gene C.; Irwin, Kent D.; Dry, Donald E.; Hastings, Elizabeth P.; Lamont, Stephen P.; Rudy, Clifford R.; Rabin, Michael W.

    2008-09-22

    Identification of trace nuclear materials is usually accomplished by alpha spectrometry. Current detectors cannot distinguish critical elements and isotopes. We have developed a detector called a microcalorimeter, which achieves a resolution of 1.06 keV for 5.3 MeV alphas, the highest resolving power of any energy dispersive measurement. With this exquisite resolution, we can unambiguously identify the {sup 240}Pu/{sup 239}Pu ratio in Pu, a critical measurement for ascertaining the intended use of nuclear material. Furthermore, we have made a direct measurement of the {sup 209}Po ground state decay.

  19. Genetics Home Reference: alpha-mannosidosis

    MedlinePlus

    ... Me Understand Genetics Home Health Conditions alpha-mannosidosis alpha-mannosidosis Enable Javascript to view the expand/collapse boxes. Download PDF Open All Close All Description Alpha-mannosidosis is a rare inherited disorder that causes ...

  20. FUEL ELEMENT

    DOEpatents

    Bean, R.W.

    1963-11-19

    A ceramic fuel element for a nuclear reactor that has improved structural stability as well as improved cooling and fission product retention characteristics is presented. The fuel element includes a plurality of stacked hollow ceramic moderator blocks arranged along a tubular raetallic shroud that encloses a series of axially apertured moderator cylinders spaced inwardly of the shroud. A plurality of ceramic nuclear fuel rods are arranged in the annular space between the shroud and cylinders of moderator and appropriate support means and means for directing gas coolant through the annular space are also provided. (AEC)

  1. Alpha-particle spectrometer experiment

    NASA Technical Reports Server (NTRS)

    Gorenstein, P.; Bjorkholm, P.

    1972-01-01

    Mapping the radon emanation of the moon was studied to find potential areas of high activity by detection of radon isotopes and their daughter products. It was felt that based on observation of regions overflown by Apollo spacecraft and within the field of view of the alpha-particle spectrometer, a radon map could be constructed, identifying and locating lunar areas of outgassing. The basic theory of radon migration from natural concentrations of uranium and thorium is discussed in terms of radon decay and the production of alpha particles. The preliminary analysis of the results indicates no significant alpha emission.

  2. Mercury, elemental

    Integrated Risk Information System (IRIS)

    Mercury , elemental ; CASRN 7439 - 97 - 6 Human health assessment information on a chemical substance is included in the IRIS database only after a comprehensive review of toxicity data , as outlined in the IRIS assessment development process . Sections I ( Health Hazard Assessments for Noncarcinoge

  3. Element Research.

    ERIC Educational Resources Information Center

    Herald, Christine

    2001-01-01

    Describes a research assignment for 8th grade students on the elements of the periodic table. Students use web-based resources and a chemistry handbook to gather information, construct concept maps, and present the findings to the full class using the mode of their choice: a humorous story, a slideshow or gameboard, a brochure, a song, or skit.…

  4. Indirect Measurements for (p,{alpha}) Reactions Involving Boron Isotopes

    SciTech Connect

    Lamia, L.; Spitaleri, C.; Romano, S.; Cherubini, S.; Crucilla, V.; Gulino, M.; La Cognata, M.; Pizzone, R. G.; Puglia, S. M. R.; Sergi, M. L.; Tudisco, S.; Tumino, A.; Carlin, N.; Szanto, M. G. del; Liguori Neto, R.; Moura, M. M. de; Munhoz, M. G.; Souza, F. A.; Suaide, A. A. P.; Szanto, E.

    2008-04-06

    Light elements lithium, beryllium and boron (LiBeB) were used in the last years as 'possible probe' for a deeper understanding of some extra-mixing phenomena occurring in young Main-Sequence stars. They are mainly destroyed by (p,{alpha}) reactions and cross section measurements for such channels are then needed. The Trojan Horse Method (THM) allows one to extract the astrophysical S(E)-factor without the experience of tunneling through the Coulomb barrier. In this work a resume of the recent results about the {sup 11}B(p,{alpha}{sub 0}){sup 8}Be and {sup 10}B(p,{alpha}){sup 7}Be reactions is shown.

  5. Superheavy Elements

    NASA Astrophysics Data System (ADS)

    Hofmann, S.

    The nuclear shell model predicts that the next doubly magic shell closure beyond 208Pb is at a proton number Z=114, 120, or 126 and at a neutron number N=172 or 184. The outstanding aim of experimental investigations is the exploration of this region of spherical `SuperHeavy Elements' (SHEs). Experimental methods have been developed which allowed for the identification of new elements at production rates of one atom per month. Using cold fusion reactions which are based on lead and bismuth targets, relatively neutron-deficient isotopes of the elements from 107 to 113 were synthesized at GSI in Darmstadt, Germany, and/or at RIKEN in Wako, Japan. In hot fusion reactions of 48Ca projectiles with actinide targets more neutron-rich isotopes of the elements from 112 to 116 and even 118 were produced at the Flerov Laboratory of Nuclear Reactions (FLNR) at the Joint Institute for Nuclear Research (JINR) in Dubna, Russia. Recently, part of these data which represent the first identification of nuclei located on the predicted island of SHEs were confirmed in two independent experiments. The decay data reveal that for the heaviest elements, the dominant decay mode is α emission rather than fission. Decay properties as well as reaction cross-sections are compared with results of theoretical studies. Finally, plans are presented for the further development of the experimental set-up and the application of new techniques. At a higher sensitivity, the detailed exploration of the region of spherical SHEs will be in the center of interest of future experimental work. New data will certainly challenge theoretical studies on the mechanism of the synthesis, on the nuclear decay properties, and on the chemical behavior of these heaviest atoms at the limit of stability.

  6. Binding of tumor necrosis factor alpha to activated forms of human plasma alpha 2 macroglobulin.

    PubMed Central

    Wollenberg, G. K.; LaMarre, J.; Rosendal, S.; Gonias, S. L.; Hayes, M. A.

    1991-01-01

    We tested the hypothesis that human plasma alpha 2 macroglobulin (alpha 2M) is a latent binding glycoprotein for human tumor necrosis factor alpha (TNF-alpha). Human recombinant 125I-TNF-alpha was incubated for 2 hours (37 degrees C) with purified native alpha 2M and with alpha 2M that was modified by reaction with methylamine or various proteinases. 125I-TNF-alpha/alpha 2M complexes were detected by nondenaturing polyacrylamide gel electrophoresis after autoradiography or by liquid chromatography on Superose-6. 125I-TNF-alpha bound strongly but noncovalently to alpha 2M-plasmin and alpha 2M-methylamine. There was minimal binding of 125I-TNF-alpha to native alpha 2M, alpha 2M-trypsin, or alpha 2M-thrombin. A 10(6) molar excess of porcine heparin did not reduce the binding of 125I-TNF-alpha to alpha 2M-methylamine or alpha 2M-plasmin. alpha 2M-plasmin or alpha 2M-methylamine added to human plasma or serum preferentially bound 125I-TNF-alpha in the presence of native alpha 2M. 125I-TNF-alpha also bound to 'fast' alpha-macroglobulins in methylamine-reacted human, rat, mouse, swine, equine, and bovine plasma. However, TNF-alpha, preincubated with either alpha 2M-plasmin or alpha 2M-methylamine, remained a potent necrogen for cultured L929 cells. Purified 125I-TNF-alpha/alpha 2M-plasmin complex injected intravenously in CD-1 mice rapidly cleared from the circulation, unless the alpha 2M-receptor pathway was blocked by coinjection of excess alpha 2M-trypsin. These findings demonstrate that alpha 2M is a latent plasmin-activated binding glycoprotein for TNF-alpha and that TNF-alpha/alpha 2M-plasmin complexes can be removed from the circulation by the alpha 2M-receptor pathway. This suggests that alpha 2M may be an important regulator of the activity and distribution of TNF-alpha in vivo. Images Figure 1 Figure 3 PMID:1704186

  7. Genetics Home Reference: alpha thalassemia

    MedlinePlus

    ... in each cell. Each copy is called an allele. For each gene, one allele is inherited from a person's father, and the ... person's mother. As a result, there are four alleles that produce alpha-globin. The different types of ...

  8. Alpha Magnetic Spectrometer (AMS) Overview

    NASA Video Gallery

    The Alpha Magnetic Spectrometer (AMS) is flying to the station on STS-134. The AMS experiment is a state-of-the-art particle physics detector being operated by an international team composed of 60 ...

  9. International Space Station (ISS) Alpha

    NASA Technical Reports Server (NTRS)

    1994-01-01

    An artist's concept of a fully deployed International Space Station (ISS) Alpha. The ISS-A is a multidisciplinary laboratory, technology test bed, and observatory that will provide an unprecedented undertaking in scientific, technological, and international experiments.

  10. Detecting Alpha-1 Antitrypsin Deficiency.

    PubMed

    Stoller, James K

    2016-08-01

    Alpha-1 antitrypsin deficiency is a widely underrecognized condition, with evidence of persisting long diagnostic delays and patients' frequent need to see multiple physicians before initial diagnosis. Reasons for underrecognition include inadequate understanding of alpha-1 antitrypsin deficiency by physicians and allied health care providers; failure to implement available, guideline-based practice recommendations; and the belief that effective therapy is unavailable. Multiple studies have described both the results of screening and targeted detection of individuals with alpha-1 antitrypsin deficiency, with both varying strategies employed to identify at-risk individuals and varying results of testing. Also, various strategies to enhance detection of affected individuals have been examined, including use of the electronic medical record to prompt testing and empowerment of allied health providers, especially respiratory therapists, to promote testing for alpha-1 antitrypsin deficiency. Such efforts are likely to enhance detection with the expected result that the harmful effects of delayed diagnosis can be mitigated. PMID:27564667

  11. Alpha decay in electron surrounding

    SciTech Connect

    Igashov, S. Yu.; Tchuvil’sky, Yu. M.

    2013-12-15

    The influence of atomic electron shells on the constant of alpha decay of heavy and mediummass nuclei was considered in detail. A method for simultaneously taking into account the change in the potential-barrier shape and the effect of reflection of a diverging Coulomb wave in the classically allowed region was developed. The ratios of decay probabilities per unit time for a bare nucleus and the respective neutral atom were found for some alpha-decaying isotopes.

  12. FUEL ELEMENT

    DOEpatents

    Fortescue, P.; Zumwalt, L.R.

    1961-11-28

    A fuel element was developed for a gas cooled nuclear reactor. The element is constructed in the form of a compacted fuel slug including carbides of fissionable material in some cases with a breeder material carbide and a moderator which slug is disposed in a canning jacket of relatively impermeable moderator material. Such canned fuel slugs are disposed in an elongated shell of moderator having greater gas permeability than the canning material wherefore application of reduced pressure to the space therebetween causes gas diffusing through the exterior shell to sweep fission products from the system. Integral fission product traps and/or exterior traps as well as a fission product monitoring system may be employed therewith. (AEC)

  13. Elemental evidence

    NASA Astrophysics Data System (ADS)

    Carlowicz, Michael

    He set out to prove that ocean sediments contain elevated levels of the rare element iridium because of the natural weathering of the continents. Instead, what Ariel Anbar found was new evidence that a meteorite may have had a role in the mass extinctions that marked the end of the Cretaceous era.By studying the geochemical properties of iridium, Anbar, a professor of earth and environmental sciences and chemistry at the University of Rochester, found that the residence time—a measure of the rate at which an element settles out of water into sediments—of iridium in ocean water is 2000 to 20,000 years. That finding suggests that a large deposit of iridium could have lingered in the world's oceans long enough to explain the thickness of the iridium-rich sediment layers at the K-T boundary.

  14. Expression of the mRNA encoding truncated PPAR alpha does not correlate with hepatic insensitivity to peroxisome proliferators.

    PubMed

    Hanselman, J C; Vartanian, M A; Koester, B P; Gray, S A; Essenburg, A D; Rea, T J; Bisgaier, C L; Pape, M E

    2001-01-01

    Two alternatively spliced forms of human PPAR alpha mRNA, PPAR alpha1 and PPAR alpha2, have been identified. PPAR alpha1 mRNA gives rise to an active PPAR alpha protein while PPAR alpha2 mRNA gives rise to a form of PPAR which lacks the ligand-binding domain. PPAR alpha2 is unable to activate a peroxisome proliferator response element (PPRE) reporter gene construct in transient transfection assays. Both PPAR alpha1 and PPAR alpha2 mRNA are present in human liver, kidney, testes, heart, small intestine, and smooth muscle. In human liver, PPAR alpha2 mRNA abundance is approximately half that of PPAR alpha1 mRNA; a correlation analysis of PPAR alpha1 and PPAR alpha2 mRNA mass revealed an r-value of 0.75 (n = 18). Additional studies with intact liver from various species, showed that the PPAR alpha2/PPAR alpha1 mRNA ratios in rat, rabbit, and mouse liver were less than 0.10; significantly lower than the 0.3 and 0.5 ratios observed in monkey and human livers, respectively. To determine if a high PPAR alpha2/PPAR alpha1 mRNA ratio was associated with insensitivity to peroxisome proliferators, we treated human, rat, and rabbit hepatocytes with WY14643, a potent PPAR alpha activator, and measured acyl CoA oxidase (ACO) mRNA levels. Rat ACO mRNA levels increased markedly in response to WY14643 while human and rabbit hepatocytes were unresponsive. Thus, although the PPAR alpha2/PPAR alpha1 mRNA ratio is low in rabbits, this species is not responsive to peroxisome proliferators. Further studies with male and female rats, which vary significantly in their response to peroxisome proliferators, showed little difference in the ratio of PPAR alpha2/PPAR alpha1 mRNA. These data suggest that selective PPAR alpha2 mRNA expression is not the basis for differential species or gender responses to peroxisome proliferators. PMID:11269670

  15. An Alpha-p-x Analytical Instrument for Lunar Resource Investigations

    NASA Technical Reports Server (NTRS)

    Economou, T. E.; Turkevich, A. L.

    1992-01-01

    An instrument using alpha backscattering, alpha-proton nuclear reactions, and x-ray production by alpha particles and other auxiliary sources can be used on lunar landers to provide detailed analytical information concerning the lunar surface material. This information is important scientifically and can be the basis for utilizing efficiently lunar resources to build lunar colonies in the future. This alpha particle instrument uses radioactive isotopes, silicon detectors for the alpha and proton modes, and mercuric iodide detectors operating at room temperature for the x-ray mode. The alpha and proton modes of the instrument can provide an analysis for all elements (except hydrogen) present in amounts greater than about 1 percent by atom. These modes have excellent sensitivity and accuracy for the lighter elements, in particular, directly determining the amount of oxygen in the lunar soil. This is an element of paramount significance for the lunar resource mission. The x-ray mode makes possible a determination of Ti, Fe, and other important metals with even greater accuracy. In general, the x-ray mode provides increased sensitivity for heavier elements, in many cases achieving a sensitivity of several hundred ppm.

  16. 21 CFR 882.1610 - Alpha monitor.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Alpha monitor. 882.1610 Section 882.1610 Food and... NEUROLOGICAL DEVICES Neurological Diagnostic Devices § 882.1610 Alpha monitor. (a) Identification. An alpha... electroencephalogram which is referred to as the alpha wave. (b) Classification. Class II (performance standards)....

  17. 21 CFR 882.1610 - Alpha monitor.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 21 Food and Drugs 8 2012-04-01 2012-04-01 false Alpha monitor. 882.1610 Section 882.1610 Food and... NEUROLOGICAL DEVICES Neurological Diagnostic Devices § 882.1610 Alpha monitor. (a) Identification. An alpha... electroencephalogram which is referred to as the alpha wave. (b) Classification. Class II (performance standards)....

  18. 21 CFR 882.1610 - Alpha monitor.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 21 Food and Drugs 8 2013-04-01 2013-04-01 false Alpha monitor. 882.1610 Section 882.1610 Food and... NEUROLOGICAL DEVICES Neurological Diagnostic Devices § 882.1610 Alpha monitor. (a) Identification. An alpha... electroencephalogram which is referred to as the alpha wave. (b) Classification. Class II (performance standards)....

  19. 21 CFR 882.1610 - Alpha monitor.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 21 Food and Drugs 8 2014-04-01 2014-04-01 false Alpha monitor. 882.1610 Section 882.1610 Food and... NEUROLOGICAL DEVICES Neurological Diagnostic Devices § 882.1610 Alpha monitor. (a) Identification. An alpha... electroencephalogram which is referred to as the alpha wave. (b) Classification. Class II (performance standards)....

  20. 21 CFR 882.1610 - Alpha monitor.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 21 Food and Drugs 8 2011-04-01 2011-04-01 false Alpha monitor. 882.1610 Section 882.1610 Food and... NEUROLOGICAL DEVICES Neurological Diagnostic Devices § 882.1610 Alpha monitor. (a) Identification. An alpha... electroencephalogram which is referred to as the alpha wave. (b) Classification. Class II (performance standards)....

  1. Binding of actin to lens alpha crystallins

    NASA Technical Reports Server (NTRS)

    Gopalakrishnan, S.; Takemoto, L.; Spooner, B. S. (Principal Investigator)

    1992-01-01

    Actin has been coupled to a cyanogen bromide-activated Sepharose 4B column, then tested for binding to alpha, beta, and gamma crystallin preparations from the bovine lens. Alpha, but not beta or gamma, crystallins bound to the actin affinity column in a time dependent and saturable manner. Subfractionation of the alpha crystallin preparation into the alpha-A and alpha-B species, followed by incubation with the affinity column, demonstrated that both species bound approximately the same. Together, these studies demonstrate a specific and saturable binding of lens alpha-A and alpha-B with actin.

  2. Analytical expressions for vibrational matrix elements of Morse oscillators

    SciTech Connect

    Zuniga, J.; Hidalgo, A.; Frances, J.M.; Requena, A.; Lopez Pineiro, A.; Olivares del Valle, F.J.

    1988-10-15

    Several exact recursion relations connecting different Morse oscillator matrix elements associated with the operators q/sup ..cap alpha../e/sup -//sup ..beta..//sup aq/ and q/sup ..cap alpha../e/sup -//sup ..beta..//sup aq/(d/dr) are derived. Matrix elements of the other useful operators may then be obtained easily. In particular, analytical expressions for (y/sup k/d/dr) and (y/sup k/d/dr+(d/dr)y/sup k/), matrix elements of interest in the study of the internuclear motion in polyatomic molecules, are obtained.

  3. A nuclear pathway for alpha 1-adrenergic receptor signaling in cardiac cells.

    PubMed Central

    Ardati, A; Nemer, M

    1993-01-01

    alpha 1-Adrenergic agonists and antagonists constitute an important class of therapeutic agents commonly used for the treatment of various cardiovascular diseases like hypertension, congestive heart failure and supraventricular tachycardia. At the heart level, activation of alpha 1-adrenergic receptors is associated with marked morphological and genetic changes. These include enhancement of contractility, myocardial growth (hypertrophy) and release of the heart major secretory product, atrial natriuretic factor (ANF). However, the signal transduction pathways which link extracellular activation of the receptors to cellular and genetic changes are not well understood. Using primary cardiocyte cultures from neonate rat hearts, an alpha 1-adrenergic regulatory sequence has been identified in the 5' flanking region of the ANF gene. This sequence, which is necessary and sufficient for transcriptional activation in response to the alpha 1-specific agonist phenylephrine, interacts with novel zinc-dependent proteins which are induced by alpha 1-adrenergic stimulation. Consistent with a conserved regulatory mechanism, the alpha 1 response element is highly conserved between rodent, bovine and human ANF genes, and is also present in the promoter region of other alpha 1-responsive cardiac genes. The identification of a nuclear pathway for alpha 1-receptor signaling will be useful for elucidating the intracellular effectors of alpha 1-adrenergic receptors. Images PMID:8262057

  4. Hypoxia-inducible factor 2alpha binds to cobalt in vitro.

    PubMed

    Yuan, Y; Beitner-Johnson, D; Millhorn, D E

    2001-11-01

    The hypoxia-inducible factor (HIF) activates the expression of genes that contain a hypoxia response element (HRE). The alpha subunit of the HIF transcription factors is degraded by proteasome pathways during normoxia, but stabilized under hypoxic conditions. It has previously been established that cobalt causes accumulation of HIF-2alpha and HIF-1alpha. However, little is known about the mechanism by which cobalt mimics hypoxia and stabilizes these transcription factors. We show here that cobalt binds directly to HIF-2alpha in vitro with a high affinity and in an oxygen-dependent manner. We found that HIF-2alpha, which had been stabilized with a proteasome inhibitor, could bind to cobalt, whereas hypoxia-stabilized HIF-2alpha could not. Mutations within the oxygen-dependent degradation domain of HIF-2alpha prevented cobalt binding and led to accumulation of HIF-2alpha during normoxia. This suggests that transition metal such as iron may play a role in regulation of HIF-2alpha in vivo. PMID:11688986

  5. Mechanism of alpha-tocopheryl-phosphate (alpha-TP) transport across the cell membrane

    Technology Transfer Automated Retrieval System (TEKTRAN)

    We have reported that alpha-TP is synthesized and hydrolyzed in animal cells and tissues; it modulates also several cell functions (FRBM 39:970, and UBMB Life, 57:23, 2005). While it is similar to alpha-tocopherol (alpha-T), alpha-TP appears to be more potent than alpha-T in inhibiting cell prolifer...

  6. Modulation of gene expression by alpha-tocopherol and alpha-tocopheryl phosphate

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The naturally occurring vitamin E analogue, alpha-tocopheryl phosphate (alphaTP), has been reported to be more potent in reducing cell proliferation and the expression of the CD36 scavenger receptor than the un-phosphorylated alpha-tocopherol (alpha T). We have now assessed the effects of alpha T an...

  7. FUEL ELEMENT

    DOEpatents

    Howard, R.C.; Bokros, J.C.

    1962-03-01

    A fueled matrlx eontnwinlng uncomblned carbon is deslgned for use in graphlte-moderated gas-cooled reactors designed for operatlon at temperatures (about 1500 deg F) at which conventional metallic cladding would ordlnarily undergo undesired carburization or physical degeneratlon. - The invention comprlses, broadly a fuel body containlng uncombined earbon, clad with a nickel alloy contalning over about 28 percent by' weight copper in the preferred embodlment. Thls element ls supporirted in the passageways in close tolerance with the walls of unclad graphite moderator materlal. (AEC)

  8. Workshop on Precision Measurements of $\\alpha_s$

    SciTech Connect

    Bethke, Siegfried; Hoang, Andre H.; Kluth, Stefan; Schieck, Jochen; Stewart, Iain W.; Aoki, S.; Beneke, M.; Bethke, S.; Blumlein, J.; Brambilla, N.; Brodsky, S.; /MIT, LNS

    2011-10-01

    These are the proceedings of the Workshop on Precision Measurements of {alpha}{sub s} held at the Max-Planck-Institute for Physics, Munich, February 9-11, 2011. The workshop explored in depth the determination of {alpha}{sub s}(m{sub Z}) in the {ovr MS} scheme from the key categories where high precision measurements are currently being made, including DIS and global PDF fits, {tau}-decays, electro-weak precision observables and Z-decays, event-shapes, and lattice QCD. These proceedings contain a short summary contribution from the speakers, as well as the lists of authors, conveners, participants, and talks.

  9. Immunodiagnosis of alpha chain disease.

    PubMed Central

    Doe, W F; Danon, F; Seligmann, M

    1979-01-01

    Since the early diagnosis of alpha chain disease (alphaCD)) is essential to successful treatment and to epidemiological studies, the available immunodiagnostic techniques were compared for their sensitivity, specificity and ease of performance on a panel of sixteen sera, comprising ten alphaCD sera and six control sera containing either IgA myeloma protein or high levels of polyclonal IgA. Immunoselection by immunoelectrophoresis into gel containing a specially developed anti-Fabalpha antiserum provided the most sensitive and specific detection system for alphaCD protein. The same technique using anti-light chain antiserum for immunoselection was also highly sensitive, but proved less specific, being prone to false positives with difficult IgA myeloma proteins. Somewhat less sensitive, but specific and simple to perform, was immunoelectrophoresis using an antiserum recognizing the conformational specificities of Fabalpha as well as those of the constant region of alpha chains. Immunoselection using the Ouchterlony or rocket techniques proved to be less sensitive and prone to false positives when some IgA myeloma sera were tested. Images FIG. 1 FIG. 2 FIG. 3 FIG. 4 FIG. 5 FIG. 6 FIG. 7 PMID:113152

  10. Interstitial solubility in {gamma} and {alpha}{sub 2} phases of TiAl-based alloys

    SciTech Connect

    Menand, A.; Huguet, A.; Nerac-Partaix, A.

    1996-12-01

    Measurements of interstitial concentrations were performed on ({alpha}{sub 2} + {gamma}) two-phase TiAl alloys and on {gamma} single-phase TiAl alloys. This study allowed the determination of the maximum solubility of oxygen and carbon in the {gamma} phase. The influence on this solubility of various parameters such as temperature, {alpha}{sub 2} and {gamma} phase stoichiometry and the alloying addition of a third element will be discussed. This paper also presents an explanation for the higher solubility of oxygen in {alpha}{sub 2} phase compared to {gamma} phase. From the results it is shown unambiguously that the better ductility of ({alpha}{sub 2} + {gamma}) two-phase alloys can no longer fit with the widespread idea of a scavenging effect of the {alpha}{sub 2} phase which would lower in that way the interstitial level in {gamma} phase.

  11. Heavy Elements and Cool Stars

    NASA Technical Reports Server (NTRS)

    Wahlgren, Glenn M.; Carpenter, Kenneth G.; Norris, Ryan P.

    2008-01-01

    We report on progress in the analysis of high-resolution near-IR spectra of alpha Orionis (M2 Iab) and other cool, luminous stars. Using synthetic spectrum techniques, we search for atomic absorption lines in the stellar spectra and evaluate the available line parameter data for use in our abundance analyses. Our study concentrates on the post iron-group elements copper through zirconium as a means of investigating the slow neutron-capture process of nucleosynthesis in massive stars and the mechanisms that transport recently processed material up into the photospheric region. We discuss problems with the atomic data and model atmospheres that need to be addressed before theoretically derived elemental abundances from pre-supernova nucleosynthesis calculations can be tested by comparison with abundances determined from observations of cool, massive stars.

  12. alpha-Thalassemia caused by an unstable alpha-globin mutant.

    PubMed Central

    Liebhaber, S A; Kan, Y W

    1983-01-01

    In a previous study, molecular cloning of the alpha-globin genes from a patient with nondeletion Hb-H disease (genotype--/alpha alpha) showed that a single nucleotide mutation (CTG to CCG) in one of the genes resulted in a leucine to proline substitution. This paper describes the approach we used to detect the abnormal alpha-globin chain. The chain was identified using a cell-free translation system. It turned over rapidly both in vitro and in vivo in the patient's reticulocytes. The unusual feature of this unstable alpha-globin is that the alpha-globin deficiency causes alpha-thalassemia. Simple heterozygotes for this lesion (alpha Pro alpha/alpha alpha) resemble alpha-thalassemia carriers and do not exhibit the hemolytic anemia usually associated with unstable hemoglobins. Images PMID:6826718

  13. Bremsstrahlung in {alpha} Decay Reexamined

    SciTech Connect

    Boie, H.; Scheit, H.; Jentschura, U. D.; Koeck, F.; Lauer, M.; Schwalm, D.; Milstein, A. I.; Terekhov, I. S.

    2007-07-13

    A high-statistics measurement of bremsstrahlung emitted in the {alpha} decay of {sup 210}Po has been performed, which allows us to follow the photon spectra up to energies of {approx}500 keV. The measured differential emission probability is in good agreement with our theoretical results obtained within the quasiclassical approximation as well as with the exact quantum mechanical calculation. It is shown that, due to the small effective electric dipole charge of the radiating system, a significant interference between the electric dipole and quadrupole contributions occurs, which is altering substantially the angular correlation between the {alpha} particle and the emitted photon.

  14. NACA Physicist Studying Alpha Rays

    NASA Technical Reports Server (NTRS)

    1957-01-01

    NACA Physicits studying Alpha Rays in a continuous cloud chamber. A cloud chamber is used by Lewis scientists to obtain information aimed at minimizing undesirable effects of radiation on nuclear-powered aircraft components. Here, alpha particles from a polonium source emit in a flower-like pattern at the cloud chamber's center. The particles are made visible by means of alcohol vapor diffusing from an area at room temperature to an area at minus -78 deg. Centigrade. Nuclear-powered aircraft were never developed and aircraft nuclear propulsion systems were canceled in the early 1960s.

  15. Test chamber for alpha spectrometry

    DOEpatents

    Larsen, Robert P.

    1977-01-01

    Alpha emitters for low-level radiochemical analysis by measurement of alpha spectra are positioned precisely with respect to the location of a surface-barrier detector by means of a chamber having a removable threaded planchet holder. A pedestal on the planchet holder holds a specimen in fixed engagement close to the detector. Insertion of the planchet holder establishes an O-ring seal that permits the chamber to be pumped to a desired vacuum. The detector is protected against accidental contact and resulting damage.

  16. Structural Basis of Natural Promoter Recognition by a Unique Nuclear Receptor, HNF4[alpha

    SciTech Connect

    Lu, Peng; Rha, Geun Bae; Melikishvili, Manana; Wu, Guangteng; Adkins, Brandon C.; Fried, Michael G.; Chi, Young-In

    2010-11-09

    HNF4{alpha} (hepatocyte nuclear factor 4{alpha}) plays an essential role in the development and function of vertebrate organs, including hepatocytes and pancreatic {beta}-cells by regulating expression of multiple genes involved in organ development, nutrient transport, and diverse metabolic pathways. As such, HNF4{alpha} is a culprit gene product for a monogenic and dominantly inherited form of diabetes, known as maturity onset diabetes of the young (MODY). As a unique member of the nuclear receptor superfamily, HNF4{alpha} recognizes target genes containing two hexanucleotide direct repeat DNA-response elements separated by one base pair (DR1) by exclusively forming a cooperative homodimer. We describe here the 2.0 {angstrom} crystal structure of human HNF4{alpha} DNA binding domain in complex with a high affinity promoter element of another MODY gene, HNF1{alpha}, which reveals the molecular basis of unique target gene selection/recognition, DNA binding cooperativity, and dysfunction caused by diabetes-causing mutations. The predicted effects of MODY mutations have been tested by a set of biochemical and functional studies, which show that, in contrast to other MODY gene products, the subtle disruption of HNF4{alpha} molecular function can cause significant effects in afflicted MODY patients.

  17. Thiazolidinediones inhibit REG I{alpha} gene transcription in gastrointestinal cancer cells

    SciTech Connect

    Yamauchi, Akiyo; Takahashi, Iwao; Takasawa, Shin; Nata, Koji; Noguchi, Naoya; Ikeda, Takayuki; Yoshikawa, Takeo; Shervani, Nausheen J.; Suzuki, Iwao; Uruno, Akira; Unno, Michiaki; Okamoto, Hiroshi Sugawara, Akira

    2009-02-13

    REG (Regenerating gene) I{alpha} protein functions as a growth factor for gastrointestinal cancer cells, and its mRNA expression is strongly associated with a poor prognosis in gastrointestinal cancer patients. We here demonstrated that PPAR{gamma}-agonist thiazolidinediones (TZDs) inhibited cell proliferation and REG I{alpha} protein/mRNA expression in gastrointestinal cancer cells. TZDs inhibited the REG I{alpha} gene promoter activity, via its cis-acting element which lacked PPAR response element and could not bind to PPAR{gamma}, in PPAR{gamma}-expressing gastrointestinal cancer cells. The inhibition was reversed by co-treatment with a specific PPAR{gamma}-antagonist GW9662. Although TZDs did not inhibit the REG I{alpha} gene promoter activity in PPAR{gamma}-non-expressing cells, PPAR{gamma} overexpression in the cells recovered their inhibitory effect. Taken together, TZDs inhibit REG I{alpha} gene transcription through a PPAR{gamma}-dependent pathway. The TZD-induced REG I{alpha} mRNA reduction was abolished by cycloheximide, indicating the necessity of novel protein(s) synthesis. TZDs may therefore be a candidate for novel anti-cancer drugs for patients with gastrointestinal cancer expressing both REG I{alpha} and PPAR{gamma}.

  18. Application of the space-time conservation element and solution element method to two-dimensional advection-diffusion problems

    NASA Technical Reports Server (NTRS)

    Wang, Xiao-Yen; Chow, Chuen-Yen; Chang, Sin-Chung

    1995-01-01

    The existing 2-D alpha-mu scheme and alpha-epsilon scheme based on the method of space-time conservation element and solution element, which were constructed for solving the linear 2-D unsteady advection-diffusion equation and unsteady advection equation, respectively, are tested. Also, the alpha-epsilon scheme is modified to become the V-E scheme for solving the nonlinear 2-D inviscid Burgers equation. Numerical solutions of six test problems are presented in comparison with their exact solutions or numerical solutions obtained by traditional finite-difference or finite-element methods. It is demonstrated that the 2-D alpha-mu, alpha-epsilon, and nu-epsilon schemes can be used to obtain numerical results which are more accurate than those based on some of the traditional methods but without using any artificial tuning in the computation. Similar to the previous 1-D test problems, the high accuracy and simplicity features of the space-time conservation element and solution element method have been revealed again in the present 2-D test results.

  19. Alpha Testing Escape from Diab

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Alpha testing was conducted of sessions 2 and 3 from Diab to assess whether the activities worked as expected, and whether children in the target ages enjoyed it. Data include both RA observations of child performance while playing the games and cognitive interview responses from the players after t...

  20. Alcoholism, Alpha Production, and Biofeedback

    ERIC Educational Resources Information Center

    Jones, Frances W.; Holmes, David S.

    1976-01-01

    Electroencephalograms of 20 alcoholics and 20 nonalcoholics were obtained. Data indicated that alcoholics produced less alpha than nonalcoholics. In one training condition subjects were given accurate biofeedback, whereas in the other condition subjects were given random (noncontingent) feedback. Accurate biofeedback did not result in greater…

  1. Meet the Alpha-Pets.

    ERIC Educational Resources Information Center

    Zitlaw, Jo Ann Bruce; Frank, Cheryl Standish

    1985-01-01

    "Alpha-Pets" are the focal point of an integrated, multidisciplinary curriculum. Each pet is featured for a week in a vocabulary-rich story and introduces related activities beginning with the featured letter, such as the four food groups during Freddie Fish's week or universe during Ulysses Unicorn's week. (MT)

  2. Sparse Coding for Alpha Matting

    NASA Astrophysics Data System (ADS)

    Johnson, Jubin; Varnousfaderani, Ehsan Shahrian; Cholakkal, Hisham; Rajan, Deepu

    2016-07-01

    Existing color sampling based alpha matting methods use the compositing equation to estimate alpha at a pixel from pairs of foreground (F) and background (B) samples. The quality of the matte depends on the selected (F,B) pairs. In this paper, the matting problem is reinterpreted as a sparse coding of pixel features, wherein the sum of the codes gives the estimate of the alpha matte from a set of unpaired F and B samples. A non-parametric probabilistic segmentation provides a certainty measure on the pixel belonging to foreground or background, based on which a dictionary is formed for use in sparse coding. By removing the restriction to conform to (F,B) pairs, this method allows for better alpha estimation from multiple F and B samples. The same framework is extended to videos, where the requirement of temporal coherence is handled effectively. Here, the dictionary is formed by samples from multiple frames. A multi-frame graph model, as opposed to a single image as for image matting, is proposed that can be solved efficiently in closed form. Quantitative and qualitative evaluations on a benchmark dataset are provided to show that the proposed method outperforms current state-of-the-art in image and video matting.

  3. Hepatic effects of a methionine-choline-deficient diet in hepatocyte RXR{alpha}-null mice

    SciTech Connect

    Gyamfi, Maxwell Afari; Tanaka, Yuji; He Lin; Klaassen, Curtis D.; Wan, Y.-J.Y.

    2009-01-15

    Retinoid X receptor-{alpha} (RXR{alpha}) is an obligate partner for several nuclear hormone receptors that regulate important physiological processes in the liver. In this study the impact of hepatocyte RXR{alpha} deficiency on methionine and choline deficient (MCD) diet-induced steatosis, oxidative stress, inflammation, and hepatic transporters gene expression were examined. The mRNA of sterol regulatory element-binding protein (SREBP)-regulated genes, important for lipid synthesis, were not altered in wild type (WT) mice, but were increased 2.0- to 5.4-fold in hepatocyte RXR{alpha}-null (H-RXR{alpha}-null) mice fed a MCD diet for 14 days. Furthermore, hepatic mRNAs and proteins essential for fatty acid {beta}-oxidation were not altered in WT mice, but were decreased in the MCD diet-fed H-RXR{alpha}-null mice, resulting in increased hepatic free fatty acid levels. Cyp2e1 enzyme activity and lipid peroxide levels were induced only in MCD-fed WT mice. In contrast, hepatic mRNA levels of pro-inflammatory factors were increased only in H-RXR{alpha}-null mice fed the MCD diet. Hepatic uptake transporters Oatp1a1 and Oatp1b2 mRNA levels were decreased in WT mice fed the MCD diet, whereas the efflux transporter Mrp4 was increased. However, in the H-RXR{alpha}-null mice, the MCD diet only moderately decreased Oatp1a1 and induced both Oatp1a4 and Mrp4 gene expression. Whereas the MCD diet increased serum bile acid levels and alkaline phosphatase activity in both WT and H-RXR{alpha}-null mice, serum ALT levels were induced (2.9-fold) only in the H-RXR{alpha}-null mice. In conclusion, these data suggest a critical role for RXR{alpha} in hepatic fatty acid homeostasis and protection against MCD-induced hepatocyte injury.

  4. Identification and characterization of an alternative promoter of the human PGC-1{alpha} gene

    SciTech Connect

    Yoshioka, Toyo; Inagaki, Kenjiro; Noguchi, Tetsuya; Sakai, Mashito; Ogawa, Wataru; Hosooka, Tetsuya; Iguchi, Haruhisa; Watanabe, Eijiro; Matsuki, Yasushi; Hiramatsu, Ryuji; Kasuga, Masato

    2009-04-17

    The transcriptional regulator peroxisome proliferator-activated receptor-{gamma} coactivator-1{alpha} (PGC-1{alpha}) controls mitochondrial biogenesis and energy homeostasis. Although physical exercise induces PGC-1{alpha} expression in muscle, the underlying mechanism of this effect has remained incompletely understood. We recently identified a novel muscle-enriched isoform of PGC-1{alpha} transcript (designated PGC-1{alpha}-b) that is derived from a previously unidentified first exon. We have now cloned and characterized the human PGC-1{alpha}-b promoter. The muscle-specific transcription factors MyoD and MRF4 transactivated this promoter through interaction with a proximal E-box motif. Furthermore, either forced expression of Ca{sup 2+}- and calmodulin-dependent protein kinase IV (CaMKIV), calcineurin A, or the p38 mitogen-activated protein kinase (p38 MAPK) kinase MKK6 or the intracellular accumulation of cAMP activated the PGC-1{alpha}-b promoter in cultured myoblasts through recruitment of cAMP response element (CRE)-binding protein (CREB) to a putative CRE located downstream of the E-box. Our results thus reveal a potential molecular basis for isoform-specific regulation of PGC-1{alpha} expression in contracting muscle.

  5. PPAR{alpha} is a key regulator of hepatic FGF21

    SciTech Connect

    Lundasen, Thomas; Hunt, Mary C.; Nilsson, Lisa-Mari; Sanyal, Sabyasachi; Angelin, Bo; Alexson, Stefan E.H.; Rudling, Mats . E-mail: mats.rudling@cnt.ki.se

    2007-08-24

    The metabolic regulator fibroblast growth factor 21 (FGF21) has antidiabetic properties in animal models of diabetes and obesity. Using quantitative RT-PCR, we here show that the hepatic gene expression of FGF21 is regulated by the peroxisome proliferator-activated receptor alpha (PPAR{alpha}). Fasting or treatment of mice with the PPAR{alpha} agonist Wy-14,643 induced FGF21 mRNA by 10-fold and 8-fold, respectively. In contrast, FGF21 mRNA was low in PPAR{alpha} deficient mice, and fasting or treatment with Wy-14,643 did not induce FGF21. Obese ob/ob mice, known to have increased PPAR{alpha} levels, displayed 12-fold increased hepatic FGF21 mRNA levels. The potential importance of PPAR{alpha} for FGF21 expression also in human liver was shown by Wy-14,643 induction of FGF21 mRNA in human primary hepatocytes, and PPAR{alpha} response elements were identified in both the human and mouse FGF21 promoters. Further studies on the mechanisms of regulation of FGF21 by PPAR{alpha} in humans will be of great interest.

  6. Modulation of gene expression by alpha-tocopherol and alpha-tocopheryl phosphate in thp-1 monocytes

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The naturally occurring vitamin E analogue, alpha-tocopheryl phosphate (alphaTP), has been reported to be more potent than the un-phosphorylated alpha alpha-tocopherol (alphaT). We have now measured plasma levels of alphaTP and compared the cellular effects of alphaTP and gamma-tocopheryl phosphate ...

  7. Coexistence of {alpha}+{alpha}+n+n and {alpha}+t+t cluster structures in {sup 10}Be

    SciTech Connect

    Itagaki, N.; Ito, M.; Milin, M.; Hashimoto, T.; Ishiyama, H.; Miyatake, H.

    2008-06-15

    The coexistence of the {alpha}+{alpha}+n+n and {alpha}+t+t cluster structures in the excited states of {sup 10}Be has been discussed. In the previous analysis, all the low-lying states of {sup 10}Be were found to be well described by the motion of the two valence neutrons around two {alpha} clusters. However, the {alpha}+t+t cluster structure was found to coexist with the {alpha}+{alpha}+n+n structure around E{sub x}=15 MeV, close to the corresponding threshold. We have introduced a microscopic model to solve the coupling effect between these two configurations. The K=0 and K=1 states are generated from the {alpha}+t+t configurations due to the spin coupling of two triton clusters. The present case of {sup 10}Be is one of the few examples in which completely different configurations of triton-type ({alpha}+t+t three-center) and {alpha}-type ({alpha}+{alpha}+n+n two-center) clusters coexist in a single nucleus in the same energy region.

  8. New elements produced at GSI

    NASA Astrophysics Data System (ADS)

    Hofmann, Sigurd

    1998-12-01

    In two series of experiments at SHIP, six new elements (Z=107-112) were synthesized via fusion reactions using lead or bismuth targets and 1n-deexcitation channels. The isotopes were unambiguously identified by means of α-α correlations. Not fission, but alpha decay is the dominant decay mode. Cross-sections decrease by two orders of magnitude from bohrium (Z=107) to element 112, for which a cross-section of 1 pb was measured. Based on our results, it is likely that the production of isotopes of element 114 close to the island of spherical SuperHeavy Elements (SHE) could be achieved by fusion reactions using 208Pb targets. Systematic studies of the reaction cross-sections indicate that the transfer of nucleons is an important process for the initiation of fusion. The data allow for the fixing of a narrow energy window for the production of SHE using 1n-emission channels. The likelihood of broadening the energy window by investigation of radiative capture reactions, use of neutron deficient projectile isotopes and use of actinide targets is discussed.

  9. DNase1 footprints suggest the involvement of at least three types of transcription factors in the regulation of alpha-Amy2/A by gibberellin.

    PubMed

    Willmott, R L; Rushton, P J; Hooley, R; Lazarus, C M

    1998-11-01

    To elucidate the mechanisms by which alpha-amylase genes are expressed in wild oat aleurone, two genes, alpha-Amy2/A and alpha-Amy2/D, were isolated. Both were shown to be positively regulated by gibberellin (GA) during germination and both contain the conserved cis-acting elements Box 2, GA-response element (TAACAGA) and TATCSATSS (where S is C or G). In addition, they possess a conserved initiator element (CATCA) that is present in both alpha-Amy2 and alpha-Amy1 genes, and also in a number of other plant TATA-containing and TATA-less promoters. DNase 1 footprint analysis showed the alpha-Amy2/A promoter to be a complex array of binding sites for a number of different classes of DNA-binding proteins. Our data suggest that the area around the initiator element (Inr) is bound by a large complex of general transcription factors, that the TATA box is bound by the TFIID complex, that Box 2 is bound by one or more WRKY proteins and that the GA-response element is bound by one or more MYBs. Two other elements containing the core sequence CCATGG/C are bound by nuclear protein and this sequence is the core of the Sph element. The regulation of alpha-Amy2 genes by GA therefore involves an interplay of at least three different types of transcription factor. PMID:9862499

  10. The RNA polymerase II trigger loop functions in substrate selection and is directly targeted by alpha-amanitin.

    PubMed

    Kaplan, Craig D; Larsson, Karl-Magnus; Kornberg, Roger D

    2008-06-01

    Structural, biochemical, and genetic studies have led to proposals that a mobile element of multisubunit RNA polymerases, the Trigger Loop (TL), plays a critical role in catalysis and can be targeted by antibiotic inhibitors. Here we present evidence that the Saccharomyces cerevisiae RNA Polymerase II (Pol II) TL participates in substrate selection. Amino acid substitutions within the Pol II TL preferentially alter substrate usage and enzyme fidelity, as does inhibition of transcription by alpha-amanitin. Finally, substitution of His1085 in the TL specifically renders Pol II highly resistant to alpha-amanitin, indicating a functional interaction between His1085 and alpha-amanitin that is supported by rerefinement of an alpha-amanitin-Pol II crystal structure. We propose that alpha-amanitin-inhibited Pol II elongation, which is slow and exhibits reduced substrate selectivity, results from direct alpha-amanitin interference with the TL. PMID:18538653