These are representative sample records from Science.gov related to your search topic.
For comprehensive and current results, perform a real-time search at Science.gov.
1

The Economic Effect of Nature Farming by EM  

Microsoft Academic Search

Along with the increasing concern among farmers and the general public about the adverse effect of conventional farming, questions have been increasingly raised in recent years about the long-term sustainability of the current agricultural system that relies on agricultural chemicals such as fertilizers and pesticides. Effective Micro-organisms (EM), as a potentially valuable technology that pursues more ecologically oriented agriculture than

B. N. Lee; C. K. Kang; K. H. Lee

2

DESENVOLVIMENTO E VALIDAÇÃO DE MÉTODO ANALÍTICO PARA QUANTIFICAÇÃO DE DOXICICLINA EM PLASMA HUMANO The development and validation of an analytical method for doxycycline quantification in human plasma  

Microsoft Academic Search

RESUMO O objetivo deste estudo foi desenvolver e validar método simples, rápido e sensível para determinação de doxiciclina em plasma humano por cromatografia líquida de alta eficiência (CLAE). A doxiciclina e oxitetraciclina (padrão interno), foram extraídas de 0,5 mL de plasma com acetato de etila. Utilizaram-se o sistema de CLAE com bomba isocrática, com temperatura controlada (30°C) e coluna cromatográfica

Geysa Aguiar Romeu; Eunice Kazue Kano

3

PROMETEUS FILOSOFIA EM REVISTA  

Microsoft Academic Search

Resumo: O uso heurístico do conceito de natureza é importante para os propósitos concernentes à ideia de uma história como palco para o desenvolvimento das disposições originárias do ser humano. Esse argumento torna possível falar do desenvolvimento ativo das disposições originárias do ser humano sem ferir o núcleo crítico que marca a filosofia kantiana em seu período áureo. Nosso argumento

VIVA VOX; João Roberto Barros II; Marcos Antonio da Silva

2010-01-01

4

Georeferencing natural disaster impact footprints : lessons learned from the EM-DAT experience  

NASA Astrophysics Data System (ADS)

The Emergency Events Database (EM-DAT) contains data about the occurrence and consequences of all the disasters that have taken place since 1900. The main objectives of the database are to serve the purposes of humanitarian action at national and international levels; to aid decision making for disaster preparedness, as well as providing an objective base for vulnerability assessments and priority setting. EM-DAT records data on the human and economic impacts for each event as well as the location of said event. This is recorded as text data, namely the province, department, county, district, or village. The first purpose of geocoding (or georeferencing) the EM-DAT database is to transform the location data from text format into code data. The GAUL (Global Administrative Unit Layers) database (FAO) is used as a basis to identify the geographic footprint of the disaster, ideally to the second administrative level and add a unique code for each affected unit. Our first step has involved georeferencing earthquakes since the location of these is precise. The second purpose is to detail the degree of precision of georeferencing. The application and benefits of georeferencing are manifold. The geographic information of the footprint of past (after 2000) and future natural disasters permits the location of vulnerable areas with a GIS system and to cross data from different sources. It will allow the study of different elements such as the extent of a disaster and its human and economic consequences; the exposure and vulnerability of the population in space and time and the efficiency of mitigation measures. In addition, any association between events and external factors can be identified (e.g.: is the famine located at the same places as drought?) and precision of the information in the disaster report can be evaluated. Besides this, these maps will provide valuable communication support since maps have a high communication power and are easily understandable by the wider public and policy makers. Some results from the application of georeferencing will be presented during the session such as a study of the population potentially exposed and affected by natural disasters in Europe, a flood vulnerability analysis in Vietnam and the potential merging of watersheds analysis and flood footprints data.

Wallemacq, Pascaline; Guha Sapir, Debarati

2014-05-01

5

Feeding preference of Diabrotica speciosa (Ger.) (Coleoptera: Chrysomelidae) by broccoli leaves from natural, organic and conventional farming systems Preferência alimentar de Diabrotica speciosa (Ger.) (Coleoptera: Chrysomelidae) por folhas de brócolos cultivado em sistema natural, orgânico e convencional  

Microsoft Academic Search

Multiple-choice laboratory tests were achieved to compare feeding preference of Diabrotica speciosa (Ger.) to leaves of broccoli (Brassica oleraceae L. var. italica) from natural, conventional and organic farming systems. Natural farming systems included incorporation of the elephant grass Pennisetum purpureum Schumacher cv. Napier (50 ton\\/ha), Bokashi compost (1.5 ton\\/ha) and spray of EM 4 (Natural 1), or the incorporation of

Maurício Ursi Ventura; Adriana Ototumi; Pedro M. O. J. Neves

6

OS AVANÇOS E OS DESAFIOS DA FORMAÇÃO CONTINUADA NO PROGRAMA DE DESENVOLVIMENTO EDUCACIONAL DO ESTADO DO PARANÁ, NA DISCIPLINA DE GEOGRAFIA  

Microsoft Academic Search

Este estudo vem apresentar, por meio de pesquisas bibliográficas e experimentos práticos, novas perspectivas quanto às possibilidades de formação docente continuada, propiciadas pelo Programa de Desenvolvimento Educacional - PDE, implantado pela Secretaria de Educação do Estado do Paraná, destacando a capacitação em serviço e a capacitação em ambientes virtuais, norteadas pelos princípios que regem a formação do profissional crítico-reflexivo, como

Maria Luiza Pereira; Rosana Figueiredo Salvi

7

Sobre o uso das séries de Puiseux em mecanica celeste  

NASA Astrophysics Data System (ADS)

Neste trabalho é apresentada uma demonstração do uso dos diferentes desenvolvimentos em séries para as equações de perturbação em Mecânica Celeste no marco Hamiltoniano. Em trabalhos clássicos como os de Poincaré (Poincaré, 1893) por exemplo, já esta planteado o uso de potências não inteiras no pequeno parâmetro, o que evidencia a não analiticidade das funções quando uma ressonância ocorre. Nestes trabalhos os desenvolvimentos são na raíz quadrada da massa de Júpiter (o pequeno parâmetro). Mais recentemente (Ferraz-Mello, 1985) outros tipos de desenvolvimentos foram aplicados modificando substancialmente as ordens de grandeza e a velocidade de convergência das séries. Com esta abordagem, os desenvolvimentos foram expressados em termos da raíz cúbica do pequeno parâmetro. Neste trabalho apresentamos um enfoque geral, onde os diferentes tipos de desenvolvimentos em séries de Puiseux (Valiron, 1950) são obtidos a partir da aplicação de Teorema de Preparação de Weierstrass (Goursat, 1916) considerando a equação de Hamilton-Jacobi como uma equação algébrica. Os resultados são aplicados ao problema restrito dos três corpos em ressonância de primeira ordem e, dependendo da grandeza da excentricidade do asteróide em relação à de Júpiter, obtemos os diferentes desenvolvimentos, em raíz quadrada ou raíz cúbica da massa de Júpiter.

Miloni, O. I.

2003-08-01

8

Primeira infância e educação natural em Rousseau (I): as necessidades da criança 1  

Microsoft Academic Search

Rousseau sketches in Émile a project of natural education for his fictional pupil, thinking his moral-cognitive development in different stages and ages, and casting specific situations and problems for them. The article concentrates on reflecting about the problems that arise in the first childhood, by considering the tension between the child's needs and the adult's cares as a constituent core

Cláudio Almir Dalbosco

9

Nature  

NSDL National Science Digital Library

Nature is a weekly international journal publishing the finest peer-reviewed research in all fields of science and technology on the basis of its originality, importance, interdisciplinary interest, timeliness, accessibility, elegance, and surprising conclusions. Nature also provides rapid, authoritative, insightful and arresting news and interpretation of topical and coming trends affecting science, scientists and the wider public. Nature publishes more articles than any other multidisciplinary journal, and retains its position as the most cited weekly science journal. The site provides free access to news stories in the latest issue; access to research articles, and to the Nature archive, is by subscription.

10

ESTRATÉGIAS PARA AGRICULTORES FAMILIARES EM ÁREAS DE PROTEÇÃO AMBIENTAL: DESENVOLVIMENTO RURAL E PRESERVAÇÃO DA NATUREZA1 Strategies to Family Farmers in Environmental Protection Areas: Rural Development and Nature Preservation  

Microsoft Academic Search

3 Professor do Dep. de Engenharia Florestal da UFV, . Resumo: A agricultura familiar passou por grandes mudanças técnicas e revisões teóricas nas últimas décadas do século XX, principalmente após o processo de modernização agrícola, que acarretou inúmeras conseqüências ambientais. As bacias hidrográficas têm sido consideradas unidades físicas naturais para implementação de programas que visam o aumento da produção agrícola

Jussara Machado; Jardim Rocha; Elias Silva

11

Chords: Em 022000 Em Em Em Em C C C C  

E-print Network

Verse 1 Chorus Verse 2 Chorus Verse 3 Chords: Em 022000 C 035553 G 320002 F 133211 Intro: Em Em Em Em C C C C Em Em Em Em C C C C Em Em Em Em C C C C Em Em Em Em C C C C Verse: Em Em Em Em C C C C G G G G G G G G Em Em Em Em C C C C G G G G G G G G Em Em Em Em C C C C G G G G G G G G Em Em Em Em C C

Reiners, Peter W.

12

MINISTRIO DA CINCIA, TECNOLOGIA E INOVAO (MCTI) CONCURSO PBLICO PARA PROVIMENTO DE VAGAS EM CARGOS  

E-print Network

1 MINISTÉRIO DA CIÊNCIA, TECNOLOGIA E INOVAÇÃO (MCTI) CONCURSO PÚBLICO PARA PROVIMENTO DE VAGAS EM DA CIÊNCIA, TECNOLOGIA E INOVAÇÃO, tendo em vista o disposto na Portaria nº 553, de 8 de dezembro de, Planejamento e Infraestrutura em Ciência e Tecnologia e da Carreira de Desenvolvimento Tecnológico de que trata

13

Instituto Superior Tecnico Desenvolvimento de Modelos  

E-print Network

Pwetty Catarina. Vemo-nos em S~ao Francisco e Las Vegas. ii #12;Resumo Concep¸c~ao de uma arquitectura de. Implementa¸c~ao da arquitectura desenvolvida aplicada ao futebol rob´otico. Palavras chave Arquitectura de iii #12;´Indice 1 Introdu¸c~ao 1 2 Arquitectura de Software 4 2.1 Futebol Rob

Instituto de Sistemas e Robotica

14

Reserva de Recursos e Qualidade de Servio em Redes de Computadores de Dbito Elevado  

E-print Network

Reserva de Recursos e Qualidade de Serviço em Redes de Computadores de Débito Elevado Elisabete trabalho insere-se na área das redes de comunicação de alta velocidade com garantia de qualidade de serviço desenvolvimento e a integração de mecanismos de garantia de qualidade de serviço (QoS) em protocolos de rede e de

Monteiro, Edmundo

15

Pr-Reitoria de Desenvolvimento Humano e Social -PRDHS  

E-print Network

Classificação/ Nível de Capacitação/ Padrão de Vencimento Carga Horária Analista de Tecnologia da Informação superior em Jornalismo ou Comunicação Social com Habilitação em Jornalismo. 2 E/I/01 25 horas Médico/Medicina do Trabalho Curso superior em Medicina e Especialização em Medicina do Trabalho. Registro no Conselho

Floeter, Sergio Ricardo

16

Workshop: Avanos em Sensoriamento Remoto da Agricultura (Advances in Remote Sensing of Agriculture) Coordenador: Clement Atzberger (University of Natural Resources and Life Sciences, BOKU, Vienna, Austria)  

E-print Network

) Coordenador: Clement Atzberger (University of Natural Resources and Life Sciences, BOKU, Vienna, Austria) O Apresentador 09:00 Opening Clement Atzberger (University of Natural Resources and Life Sciences, BOKU, Vienna Retrieval of Agricultural Crops Clement Atzberger (University of Natural Resources and Life Sciences, BOKU

17

Avaliao da QoS em redes Ethernet M. Carmo, J. S Silva, E. Monteiro, P. Simes, M. Curado and F. Boavida  

E-print Network

Avaliação da QoS em redes Ethernet M. Carmo, J. Sá Silva, E. Monteiro, P. Simões, M. Curado and F redes Ethernet foi superada com o desenvolvimento das normas IEEE 802.1D e IEEE 802.1Q. Este artigo serviço em redes Ethernet. Os módulos respeitam as normas IEEE 802.1Q/D e implementam as recomendações

Monteiro, Edmundo

18

SOBRE O PROCESSO DE MEDIAÇÃO SOCIAL NOS PROJETOS DE DESENVOLVIMENTO: UMA REFLEXÃO TEÓRICA  

Microsoft Academic Search

A mediação social é um tema que nos últimos anos vem ganhando espaço nas discussões sobre o desenvolvimento rural, mais especificamente, nas questões referentes à intervenção para o desenvolvimento. Este processo compreende uma relação que se apresenta como uma “via de mão dupla”, ou seja, a via representa a relação, uma das mãos é os mediadores, e a outra é

Cidonea Machado Deponti; Jalcione Almeida

2008-01-01

19

MiCCS4Mobile Middleware para Comunicao e Coordenao Segura em Redes Ad-hoc  

E-print Network

MiCCS4Mobile Middleware para Comunicação e Coordenação Segura em Redes Ad-hoc com Participantes desenvolvimento de aplicações móveis. Algumas aplicações exploram protocolos de redes sem fios e a mobilidade dos dispositivos para aumentar as suas funciona- lidades. A classe de protocolos de redes sem fios com dispositivos

Neves, Nuno

20

Relatrio de Atividades de 2002 da Linha de Pesquisa e Desenvolvimento em Fuso Termonuclear Controlada FUSO  

E-print Network

os avanços internacionais na área. · Desenvolver o tokamak esférico ETE (Experimento Tokamak Esférico operação, são: raio maior R0 = 0,3 m, raio menor a = 0,2 m, elongação k = 1,6, campo magnético toroidal B0

21

Covariant gauge-natural conservation laws  

E-print Network

When a gauge-natural invariant variational principle is assigned, to determine {\\em canonical} covariant conservation laws, the vertical part of gauge-natural lifts of infinitesimal principal automorphisms -- defining infinitesimal variations of sections of gauge-natural bundles -- must satisfy generalized Jacobi equations for the gauge-natural invariant Lagrangian. {\\em Vice versa} all vertical parts of gauge-natural lifts of infinitesimal principal automorphisms which are in the kernel of generalized Jacobi morphisms are generators of canonical covariant currents and superpotentials. In particular, only a few gauge-natural lifts can be considered as {\\em canonical} generators of covariant gauge-natural physical charges.

Marcella Palese; Ekkehart Winterroth

2006-04-12

22

Resonances and Tides in Natural Satellites Systems. (Breton Title: Ressonâncias e Marés em Sistemas de Satélites Naturais.) Resonancias y Mareas en Sistemas de Satélites Naturales  

NASA Astrophysics Data System (ADS)

In this work we describe some aspects of the dynamics of the mean-motion resonances. Emphasis to the case of resonances between regular satellites of the giant planets will be given, even so some aspects of the physics of the resonances in extra-solar planetary systems are also briefly treated. The role of the resonances in satellites systems is discussed through examples, showing how certain resonances, and its relations with the tidal dissipation effects, can be the key of the explanation of some phenomena still not explained in the Solar System. Amongst some examples we highlight the problem of the resurfacing of Enceladus, the existence of active volcanoes in Io, and the possible existence of the subsurface ocean in Europe. This work has as objective the divulgation of some topics in Celestial Mechanics and Planetary Sciences for an undergraduate public in exact sciences, as Astronomy and Physics, and not their detailed description. Neste trabalho descrevemos alguns aspectos da dinâmica de ressonâncias de movimentos médios. Será dada ênfase maior ao caso de ressonâncias entre satélites regulares dos planetas gigantes, embora alguns aspectos da física das ressonâncias em sistemas planetários extra-solares também sejam discutidos brevemente. A importância do estudo de ressonâncias em sistemas de satélites é discutida mais detalhadamente através de exemplos, mostrando como certas ressonâncias e suas relações com efeitos de dissipação de maré podem ser a chave de parte da explicação de alguns fenômenos ainda não explicados no Sistema Solar. Dentre vários exemplos destacamos o problema da remodelagem da superfície do satélite Enceladus, a existência de vulcões ativos em Io, e a possível existência do oceano subterrâneo em Europa. Este trabalho tem como objetivo a divulgação de alguns tópicos de Mecânica Celeste e Planetologia para um público de nível de graduação em disciplinas na área de exatas, em especial Astronomia e Física, e não a descrição detalhada dos conceitos aqui discutidos. Describimos en este trabajo algunos aspectos de la dinámica de resonancias de movimientos promedio. Será dado un énfasis mayor al caso de las resonancias entre satélites regulares de los planetas gigantes, aunque también son discutidos brevemente algunos aspectos de la física de resonancias en sistemas panetarios extrasolares. La importancia del estudio de las resonancias en sistemas de satélites es discutida más detalladamente através de ejemplos, mostrando cómo ciertas resonancias y los efectos de disipación por mareas pueden ser la clave de parte de la explicación de algunos fenómenos aún no comprendidos en el Sistema Solar. Entre varios ejemplos se destacan el problema de la superficie remodelada del satélite Enceladus, la existencia de volcanes activos en Io y la posible existencia de un océano subterráneo en Europa. Este trabajo tiene como objetivo la divulgación de algunos tópicos en Mecánica Celeste y Planetología para un público universitario de ciencias exactas, en particular Astronomía y Física, y no la descripción detallada de los conceptos aquí discutidos.

Callegari, Nelson, Jr.

2006-12-01

23

Políticas Públicas para Radiodifusão Comunitária no Desenvolvimento Local1  

Microsoft Academic Search

Resumo: Resgate de aspectos conceituais históricos das políticas públicas de comunicação. Objetivamos identificar passagens relativas à comunicação comunitária e local, além de compreender como o tema é tratado. A base do estudo é bibliográfica. Trabalhamos com fragmentos de propostas de políticas de comunicação originárias e recentes nas partes em que ressaltam os temas do direito, da comunicação local, comunitária e\\/ou

Cicilia M. Krohling Peruzzo

24

AVALIAÇÕES BIOFÍSICAS E BIOQUÍMICAS EM PLANTAS DE MOGNO (SWIETENIA MACROPHYLLA KING) SOB DOIS PERIODOS, SECO E CHUVOSO  

Microsoft Academic Search

O presente trabalho teve como objetivo estudar o desenvolvimento do mogno (Swietenia macrophylla King), sob arranjo de sistemas agroflorestais (SAFs), através de análises ecofisiológicas no município de Santa Bárbara-PA. As avaliações ecofisiológicas (biofísicas e bioquímicas) nas plantas de mogno foram realizadas às 13:00 h, em dois períodos: chuvoso (maio) e seco (novembro), no ano de 2007. Durante o período seco

Manoel Tavares de Paula; Benedito Gomes dos Santos Filho; Yvens Ely Martins Cordeiro; Orlando Shigueo Ohashi; Raimundo Amaro Conde; Heriberto Wagner Amanajás Pena

2011-01-01

25

Modelos hierarquicos bayesianos para estudar a distribuicao espacial da infestacao da broca do cafe em n´ivel local  

Microsoft Academic Search

Resumo Estudar a distribuicao espacial de pragas em sistemas agr´icolas pode fornecer informacao importante sobre os mecanismos de dispersao das especies e sua interacao com fatores ambientais, sendoutil tambem no desenvolvimento de planos de amostragem, na otimizacao de programas de manejo integrado de pragas e no planejamento de experimentos. Neste trabalho foram comparados varios modelos para estudar a variacao es-

Clarice G. B. Demetrio; Renato M. Assunc; Roseli A. Leandro

26

Desenvolvimento de game multi-mouse sobre o Bioma Mata Atlntica Ana Beatriz Bahia Cristina Santos Emlio Takase  

E-print Network

-mouse, edutainment, Mata Atlântica, serious game, colaboração, educação. Contatos dos autores: abbahiaDesenvolvimento de game multi-mouse sobre o Bioma Mata Atlântica Ana Beatriz Bahia Cristina Santos aborda o processo de desenvolvimento de um game educativo e colaborativo sobre o Bioma Mata Atlântica

Floeter, Sergio Ricardo

27

O DEBATE BRASILEIRO SOBRE PLURIATIVIDADE: IMPLICAÇÕES SOBRE O DESENVOLVIMENTO RURAL E AS POLÍTICAS PÚBLICAS  

Microsoft Academic Search

O fenômeno da pluriatividade tem sido um tema bastante debatido e controverso. Nesse debate destacam-se duas perspectivas teóricas que polarizam o debate que são: a do “novo rural” e a da pluriatividade como “estratégia de reprodução social”. Essas perspectivas, apesar de vêem esse fenômeno como eixo dinâmico para o desenvolvimento do meio rural, possuem interpretações diferentes do que vem a

Raquel Pereira Souza; Marcelo Santos Souza

2008-01-01

28

Resultados do desenvolvimento de um propulsor à plasma no Brasil  

NASA Astrophysics Data System (ADS)

Uma das partes mais importantes de um satélite é o controle de atitude do mesmo. E se tratando de um satélite científico, a atenção para este sistema deve ser redobrada. Uma possibilidade atraente para executar esta tarefa é a propulsão elétrica. Aqui, mostraremos resultados obtidos pelo propulsor à plasma PHALL-01, desenvolvido na Universidade de Brasília entre 2000 e 2003. Este é derivado do propulsor russo SPT-100 (Stationary Plasma Thruster), mas com o emprego inovador de um arranjo de imãs permanentes como fonte do campo magnético, este último o agente da aceleração do plasma. Esta alteração foi motivada pelo objetivo de que o mesmo operasse com o mínimo de potência elétrica. A partir da formulação teórica do mecanismo de aceleração, tendo como base as equações da magnetohidrodinâmica, pode-se obter vínculos sob os quais o propulsor pudesse ser construído. O mais forte destes é o que dita a topologia do campo magnético. Sendo assim, foram realizadas simulações computacionais, que definiram a geometria do propulsor. Após construído, este foi diagnosticado usando-se sondas de Langmuir e analisadores de energia. Como resultados, obtivemos a distribuição espacial da temperatura, densidade e potencial do plasma, bem como a distribuição angular do feixe produzido pelo mesmo em vários regimes de operação. O espectro de energia do feixe de plasma também foi medido, indicando íons de até 560eV. Combinando estes resultados, calculou-se o empuxo do propulsor: 84mN; e o impulso específico: 1083s. Estes demonstram que o mesmo estará qualificado, num futuro próximo, para o emprego no controle de atitude de satélites científicos, ou até mesmo como parte do conjunto propulsor primário, responsáveis pela transferência de órbitas.

Ferreira, I. S.; Ferreira, J. L.

2003-08-01

29

National EMS Research Agenda.  

PubMed

Now, more than ever before, the spirit of the emergency services professional is recognized by people everywhere. Individuals from every walk of life comprehend the reality of the job these professionals do each day. Placing the safety of others above their own is their acknowledged responsibility. Rescue and treatment of ill and injured patients are their purpose as well as their gratification. The men and women who provide prehospital care are well aware of the unpredictable nature of emergency medical services (EMS). Prehospital care is given when and where it is needed: in urban settings with vertical challenges and gridlock; in rural settings with limited access; in confined spaces; within entrapments; or simply in the street, exposed to the elements. Despite the challenges, EMS professionals rise to the occasion to do their best with the resources available. Despite more than 30 years of dedicated service by thousands of EMS professionals, academic researchers, and public policy makers, the nation's EMS system is treating victims of illness and injury with little or no evidence that the care they provide is optimal. A national investment in the EMS research infrastructure is necessary to overcome obstacles currently impeding the accumulation of essential evidence of the effectiveness of EMS practice. Funding is required to train new researchers and to help them establish their careers. Financial backing is needed to support the development of effective prehospital treatments for the diseases that drive the design of the EMS system, including injury and sudden cardiac arrest. Innovative strategies to make EMS research easier to accomplish in emergency situations must be implemented. Researchers must have access to patient outcome information in order to evaluate and improve prehospital care. New biomedical and technical advances must be evaluated using scientific methodology. Research is the key to maintaining focus on improving the overall health of the community in a competitive and cost-conscious health care market. Most importantly, research is essential to ensure that the best possible patient care is provided in the prehospital setting. The bravery and dedication of EMS professionals cannot be underestimated. Images of firefighters, EMS personnel, and others going into danger while others are evacuating will remain burned in our collective consciousness. These professionals deserve the benefit of research to assist them in providing the best possible care in the challenging circumstances they encounter. With this document, we are seeking support for elevating the science of EMS and prehospital care to the next level. It is essential that we examine innovative ways to deliver prehospital care. Strategies to protect the safety of both the patient and the public safety worker must be devised and tested. There are many questions that remain to be asked, many practices to be evaluated, and many procedures to be improved. Research is the key to obtaining the answers. PMID:12108581

Sayre, M R; White, L J; Brown, L H; McHenry, S D

2002-01-01

30

Covariant gauge-natural conservation laws  

Microsoft Academic Search

When a gauge-natural invariant variational principle is assigned, to\\u000adetermine {\\\\em canonical} covariant conservation laws, the vertical part of\\u000agauge-natural lifts of infinitesimal principal automorphisms -- defining\\u000ainfinitesimal variations of sections of gauge-natural bundles -- must satisfy\\u000ageneralized Jacobi equations for the gauge-natural invariant Lagrangian. {\\\\em\\u000aVice versa} all vertical parts of gauge-natural lifts of infinitesimal\\u000aprincipal automorphisms which are

Marcella Palese; Ekkehart Winterroth

2004-01-01

31

Naturally Disastrous  

NSDL National Science Digital Library

Students are introduced to natural disasters and learn the difference between natural hazards and natural disasters. They discover the many types of natural hazards—avalanche, earthquake, flood, forest fire, hurricane, landslide, thunderstorm, tornado, tsunami and volcano—as well as specific examples of natural disasters. Students also explore why understanding these natural hazards is important to engineers and everyone's survival on our planet.

Integrated Teaching and Learning Program,

32

Desenvolvimento de um data logger portátil para sinais de movimento utilizando cartões MMC  

Microsoft Academic Search

Resumo - Neste artigo descreve-se o desenvolvimento de um data logger portátil para armazenagem de sinais relacionados ao movimento humano. O sistema utiliza cartões MultiMediaCard™ como dispositivo de armazenamento de alta capacidade e um microcontrolador com oito canais de conversão A\\/D para entrada dos sinais analógicos provenientes de sensores de movimento ou eletrodos de eletromiografia. A taxa de amostragem pode

R. E. M. Farias; J. P. J Conti; E. F. Manffra; P. Nohama

33

DESENVOLVIMENTO DE EQUIPAMENTO BASEADO EM MICROCONTROLADOR PARA MEDIÇÃO DE ESPESSURA DO TECIDO ADIPOSO SUBCUTÂNEO POR ULTRA-SOM  

Microsoft Academic Search

This paper presents the study, simulation and development of a human subcutaneous fat tissue measuring equipment. At present, measuring is performed by the adipometer. The development of a device that uses ultrasound acoustic waves controlled by an MCU that processes the time of flying by the wave and interprets it as a thickness measure equivalent is presented. In this paper,

C. M. P. Cursino; R. R. A. Galvão; R. C. S. Freire; J. B. A. Silva; E. J. L. Costa

34

Projeto E-FOTO: O Desenvolvimento de um Ambiente Integrado para o Ensino de Fotogrametria Digital em Software Livre  

Microsoft Academic Search

The academic community has been experiencing the benefits of the development of Free-software in many areas of knowledge. However, Digital Photogrammetry is a field that remains practically unexplored. One exception is the E-FOTO project which aims at developing a Digital Photogrammetric Workstation (DFW) for educational purposes. This project is based upon the self-learning approach and on the principles of the

S. Brito; Luiz C. T. Coelho Filho; Francisco J. C. da Silveira; Guilherme L. A. Mota; Orlando Bernardo Filho; João A. Ribeiro

2006-01-01

35

Natural resources  

NSDL National Science Digital Library

Natural resources are resources that occur in nature. Humans use these resources, but many of these resources are nonrenewable. They will eventually run out. Fossil fuels are naturally occurring fuels that are nonrenewable.

Olivia Worland (Purdue University; Biological Sciences)

2008-07-07

36

Nature Watch  

NSDL National Science Digital Library

Nature Watch is a partnership program of the U.S. Forest Service that provides nature viewing opportunities and encourages safe and sound viewing ethics. The Nature Watch program is for people to experience wildlife, fish, and flowers in their natural settings; to promote recreational viewing opportunities, facilitate learning about the environment, and to promote conservation efforts and wise use of natural resources. This site contains information on Nature Watch programs, coloring books, links to environmental science journals, and information on educational curricula.

37

It's Natural  

NSDL National Science Digital Library

This activity introduces learners to Native Americans as people who depended upon nature in the past and continue to emphasize the importance of nature in the present. Learners go outside and use their senses to make observations about their environment. This experience inspires curiosity about nature, helps learners understand that we all need and use natural resources and helps them imagine what it would be like to depend entirely on the natural world. This introductory activity is featured on pp.9-10 of the "One With the Earth: Native Americans and the Natural World" multidisciplinary unit of study for kindergarten through third grade.

The Children's Museum of Indianapolis

2014-04-30

38

Nature Drawing  

NSDL National Science Digital Library

In this family or group activity, learners create a nature journal by visiting a local nature center or backyard, observing creatures in their natural habitats, and sketching what they see. Learners are encouraged to make notes about what they observe, weather conditions, and the date and time. This activity will help learners explore and record nature's variations while gaining respect for nature and developing their observation skills. Learners can sketch for 10 -30 minutes over the course of many days, once a month, or once a season to develop a complete journal. This guide includes library and internet resources for more information about nature journaling.

Smithsonian National Zoological Park

2012-07-24

39

Natural gas  

NSDL National Science Digital Library

Natural gas is used as a means of power in households. Natural gas has no natural odor, so an odor is added to the gas. This is useful because gas leaks can be detected better and it also reduces the risk of accidents in homes.

N/A N/A (None; )

2003-07-27

40

Naturally Speaking  

NSDL National Science Digital Library

In this lesson, students will identify the Earth's natural resources and classify them as renewable or non-renewable. They will simulate the distribution of resources and discuss the fairness and effectiveness of the distribution. Students will identify ways that they use — and waste — natural resources, and they will explore ways that engineers interact with natural resources.

Integrated Teaching and Learning Program,

41

Natural Selection and Natural Theology  

Microsoft Academic Search

A PERUSAL of Dr. Romanes' article on Natural Selection and Natural Theology, in the Contemporary Review for October, 1882, suggests a few remarks upon one or two points, which may not be out of place.

Asa Gray

1883-01-01

42

Natural Selection and Natural Theology  

Microsoft Academic Search

THE letter of Prof. Asa Gray (NATURE, vol. xxvii. p. 291) contains a sentence which seems to me to contain the essence of the difference between the views of organic life, as held by the supporters of Natural Selection and Natural Theology. He says: ``How is this presumption negatived or impaired by the supposition of Darwin's theory, that the ancestors

J. B. Hannay

1883-01-01

43

O que bilíngues bimodais têm a nos dizer sobre desenvolvimento bilíngue?  

PubMed Central

O objetivo deste trabalho é apresentar o que as pesquisas que estamos desenvolvendo com crianças ouvintes, filhas de pais surdos, adquirindo Língua Brasileira de Sinais (Libras) e Português e Língua de Sinais Americana (ASL) e Inglês (Lillo-Martin et al. 2010) têm a nos dizer sobre desenvolvimento bilíngue. Os dados deste estudo fazem parte de um banco de dados de interações espontâneas coletadas longitudinalmente, alternando contextos de aquisição da Libras e do português como língua alvo, no Brasil e dados coletados longitudinalmente. nos mesmos contextos, de crianças adquirindo ASL e inglês1. Além disso, há também dados do estudo experimental com testes aplicados nos dois pares de línguas que se agregam ao presente estudo. Uma visão geral dos estudos desenvolvidos sobre a aquisição bilíngue bimodal por crianças ouvintes, filhas de pais surdos, será apresentada e, então, serão expostos alguns aspectos linguísticos deste tipo de aquisição, considerando as discussões sobre aquisição bilíngue a partir da pesquisa realizada. PMID:24431480

de Quadros, Ronice Müller; Lillo-Martin, Diane; Pichler, Deborah Chen

2013-01-01

44

Nature Watch  

NSDL National Science Digital Library

Nature Watch is a series of volunteer environmental monitoring programs coordinated by the Ecological Monitoring and Assessment Network (EMANCO), the Canadian Nature Federation, and the University of Guelph. Nature Watch is a growing network that currently includes Frog Watch, Ice Watch, Plant Watch, and Worm Watch. Site visitors can access the home pages of each of the participating programs for details about each program, how to collect and contribute data, and to view data that has already been collected.

45

Natural Polymers  

NSDL National Science Digital Library

Polymers that exist in nature, called biopolymers , include a large and diverse range of compounds. This chapter discusses the most important types of natural polymers--their chemical makeup, key properties, and where they are found. The focus will be more on the chemical and physical properties of natural polymers and less on their biological synthesis or physiological function. The references at the end of the chapter provide additional information.

David Teegarden

2004-01-01

46

Backyard Nature  

NSDL National Science Digital Library

Created by veteran naturalist Jim Conrad, Backyard Nature is an excellent resource for information about many aspects of the natural world. The website provides extensive, well-organized sections for backyard Ecology, Plants, Animals, and Fungi -- to name just a few. The site contains a section on Naming & Classifying living things, as well as information about tools for backyard naturalists such as field guides, binoculars, nature study notebooks, and an Online Phenology Database. The site also offers an impressive list of 101 Nature-Oriented Things to Do During the Summer.

Conrad, Jim

47

Estudo em microondas do aprisionamento e precipitação de elétrons em explosões solares  

NASA Astrophysics Data System (ADS)

Uma explosão solar é uma variação rápida e intensa do brilho que ocorre nas chamadas regiões ativas da atmosfera, constituídas por um plasma magnetizado com intensa indução magnética. Os modelos de explosões solares atuais, discutidos na literatura, apresentam características de aprisionamento e precipitação de elétrons em ambientes magnéticos simplificados. Neste trabalho, nos propusemos a separar a emissão dos elétrons aprisionados da emissão dos elétrons em precipitação apenas a partir da emissão em microondas, melhorando portanto o controle sobre o conjunto de parâmetros inferidos. A emissão em microondas da população em precipitação é bastante fraca e portanto da nossa base de dados de 130 explosões observadas pelo Rádio Polarímetro de Nobeyama, em sete freqüências, apenas para 32 foi possível separar as duas componentes de emissão com uma boa razão sinal/ruído. A partir de estudos das escalas de tempo das emissões devidas à variação gradual da emissão no aprisionamento e da variação rápida da emissão dos elétrons em precipitação foi possível obter a separação utilizando um filtro temporal nas emissões resultantes. Em nossa análise destas explosões estudamos os espectros girossincrotrônicos da emissão gradual, a qual associamos provir do topo dos arcos magnéticos e da emissão de variação rápida associada aos elétrons em precipitação. Estes espectros foram calculados e dos quais inferimos que a indução magnética efetiva do topo e dos pés foi em média, Btopo = 236 G e Bpés = 577 G, inferidas das freqüências de pico dos espectros em ntopo = 11,8 GHz e npés = 14,6 GHz com leve anisotropia (pequeno alargamento espectral). O índice espectral da distribuição não-térmica de elétrons d, inferido do índice espectral de fótons da emissão em regime opticamente fino, foi de dtopo = 3,3 e dpés = 3,9. Estes parâmetros são típicos da maioria das análises realizadas em ambiente único de emissão e a relação dos índices espectrais, dpés > dtopo prioriza as interpretações com difusão em ângulo de passo devida a colisões Coulombianas. Nesta difusão o déficit de elétrons energéticos na precipitação seria uma conseqüência natural da dependência em e-3/2 das colisões elétron-próton (onde e é a energia dos elétrons).

Rosal, A. C.; Costa, J. E. R.

2003-08-01

48

Nature Detectives  

ERIC Educational Resources Information Center

Richard Louv's "Last Child in the Woods" (2008) added to a growing consensus to get children outside and experiencing nature. Using ideas from place-based education, the authors present a simple year-long project that brings science, nature, and other curriculum standards to life right in your school yard. With a focus on journaling, this project…

Harr, Natalie; Lee, Richard E.; Jr.

2010-01-01

49

Natural Semantics  

Microsoft Academic Search

During the past few years, many researchers have begun to present semantic specifications in a style that has been strongly advocated by Plotkin in (19). The purpose of this paper is to introduce in an intuitive manner the essential ideas of the method that we call now Natural Semantics~ together with its connections to ideas in logic and computing. Natural

Gilles Kahn

1987-01-01

50

Matematica Natural.  

ERIC Educational Resources Information Center

Matematica Natural (Natural Mathematics) is a mathematics curriculum for young children based on the assumption that they learn mathematics through concrete, real life, relevant experiences and that educational differences rather than cultural differences influence math achievement. The curriculum uses hands-on materials and activities to teach…

Lozano, Patricia; Medearis, Linda

51

Natural Beauty  

ERIC Educational Resources Information Center

In this article, the author describes how her art class students were able to create, in just four class periods, clay relief plaques depicting nature. A lesson on texture speeds up the completion of such a project. Seeing that clay is a natural material with its own unique texture, it seemed fitting that the final product should depict a variety…

Coy, Mary

2006-01-01

52

EM International. Volume 1  

SciTech Connect

It is the intent of EM International to describe the Office of Environmental Restoration and Waste Management`s (EM`s) various roles and responsibilities within the international community. Cooperative agreements and programs, descriptions of projects and technologies, and synopses of visits to international sites are all highlighted in this semiannual journal. Focus on EM programs in this issue is on international collaboration in vitrification projects. Technology highlights covers: in situ sealing for contaminated sites; and remote sensors for toxic pollutants. Section on profiles of countries includes: Arctic contamination by the former Soviet Union, and EM activities with Germany--cooperative arrangements.

Not Available

1993-07-01

53

The Nature of Natural Languages.  

ERIC Educational Resources Information Center

A variety of types of evidence are examined to help determine the true nature of "deep structure" and what, if any, implications this has for linguistic theory as well as culture theory generally. The evidence accumulated over the past century on the nature of phonetic and phonemic systems is briefly discussed, and the following areas of analysis…

Pierce, Joe E.

54

natural selection  

NSDL National Science Digital Library

Charles Darwin's theory of natural selection was the first plausible mechanism to explain the change of species over time, however, in it's original form it did not explain how new traits could form, or how traits that had formed could be passed on to successive generations. The rise in modern genetics helped to modify biologists understanding of evolution by attributing the origin of new traits in a species to random genetic processes of mutation and sexual recombination, with the survivability of species with the new traits subject to natural selection. This combination of random mutation and natural selection is often referred to as Neodarwinism.

David Joiner

55

Natural Cycle  

NSDL National Science Digital Library

In this short video from ClimateCentral, host Jessica Harrop explains what evidence scientists have for claiming that recent global warming is caused by humans and is not just part of a natural cycle.

Climate Central

56

Nature's software  

E-print Network

I bring forward some arguments to support the thesis that nature is fundamentally discrete, and present my own thoughts about the direction in which one could look for a possible, consistent "theory of everything" describing gravitation and quantum particles.

Daniel Canarutto

2014-04-20

57

Natural Hazards  

NSDL National Science Digital Library

NASA's Earth Observatory Web site's newest addition, Natural Hazards, is a continually updated resource of remarkable photography taken from the satellite MODIS (Moderate-resolution Imaging Spectroradiometer) of visible natural disasters around the globe of things such as the thick cloud of pollution currently over India and the dozen ravaging bush fires in Australia. Each page contains a high-resolution image of the event, a description of what is taking place, and links to any related images.

58

[Natural disasters].  

PubMed

The attempt is made to illustrate the role played by natural disasters in the history of the earth and mankind by examples of past catastrophes. Subsequently, the earthquake of Tangshan/China in 1976 and the hypothetical scenario of a repeat of the 1906 San Francisco earthquake in a modern setting serve as a basis for discussion of the significance of natural disasters in modern times. PMID:3211205

Smolka, A

1988-07-01

59

Naturalness redux  

E-print Network

The idea of naturalness, as originally conceived, refers only to the finite renormalization of the Higgs boson mass induced by the introduction of heavier states. In this respect, naturalness is still a powerful heuristic principle in model building beyond the standard model whenever new massive states are coupled to the Higgs field. The most compelling case is provided by the generation of neutrino masses. In this paper we confront this problem from a new perspective. The right-handed sector responsible for the seesaw mechanism---which introduces a large energy threshold above the electroweak scale---is made supersymmetric to comply with naturalness while the standard model is left unchanged and non-supersymmetric. Cancellations necessary to the naturalness requirement break down only at two loops, thus offering the possibility to increase the right-handed neutrino mass scale up to one order of magnitude above the usual values allowed by naturalness. If also the weak boson sector of the standard model is made supersymmetric, cancellations break down at three loops and the scale of new physics can be further raised. In the type-I seesaw, this implementation provides right-handed neutrino masses that are natural and at the same time large enough to give rise to baryogenesis (via leptogenesis). The model contains a dark matter candidate and distinctive new physics in the leptonic sector.

Marco Fabbrichesi; Alfredo Urbano

2015-04-21

60

IRD Sige, 44, boulevard de dunkerque 13572 Marseille cedex 02 Conferncia das Naes Unidas sobre o desenvolvimento sustentvel  

E-print Network

tripartite sobre a luta contra a desertificação na África. Os pesquisadores do IRD organizarâo também cerca de dez eventos durante a conferência, participando dos debates científicos. Luta contra desenvolvimento científico e tecnológico ­ CNPq) desejam promover a luta contra a desertificação na África

61

Universidade de Braslia Decanato de Extenso/Diretoria de Desenvolvimento e Integrao Regional Pgina 1 de 7  

E-print Network

: Desenvolvimento Rural Cássio José da Silva Fac. de Agronomia e Medicina Veterinária - FAV #12;Universidade de as mãos - Ciência, Tecnologia e Sociedade (CTS) na construção de pontes entre pesquisa, ensino e extensão - Tecnologia assistiva para acessibilidade, autonomia e inclusão L10: Direitos Humanos Antônio Padilha Lanari

Lucero, Jorge Carlos

62

Código para imageamento indireto de estrelas em sistemas binarios: simulação de variações elipsoidais e do perfil das linhas  

NASA Astrophysics Data System (ADS)

As estrelas secundárias em variáveis cataclí smicas (VCs) e binárias-x de baixa massa (BXBMs) são cruciais para o entendimento da origem, evolução e comportamento destas binárias interagentes. Elas são estrelas magneticamente ativas submetidas a condições ambientais extremas [e.g., estão muito próximas de uma fonte quente e irradiante; têm rotação extremamente rápida e forma distorcida; estão perdendo massa a taxas de 10-8-10-10 M¤/ano] que contribuem para que suas propriedades sejam distintas das de estrelas de mesma massa na seqüência principal. Por outro lado, o padrão de irradiação na face da secundária fornece informação sobre a geometria das estruturas de acréscimo em torno da estrela primária. Assim, a obtenção de imagens da superfície destas estrelas é de grande interesse astrofísico. A Tomografia Roche usa as variações no perfil das linhas de emissão/absorção da estrela secundária em função da fase orbital para mapear a distribuição de brilho em sua superfície. Neste trabalho apresentamos os resultados iniciais do desenvolvimento de um programa para o mapeamento da distribuição de brilho na superfí cie das estrelas secundárias em VCs e BXBMs com técnicas de astro-tomografia. Presentemente temos em operação um código que simula as variações no perfil das linhas em conseqüência de efeito Doppler resultante da combinação de rotação e translação de uma estrela em forma de lobo de Roche em torno do centro de massa da binária, em função da distribuição de brilho na superfície desta estrela. O código igualmente produz a curva de luz resultante das variações de aspecto da estrela em função da fase orbital (variações elipsoidais).

Souza, T. R.; Baptista, R.

2003-08-01

63

Natural England  

NSDL National Science Digital Library

Natural England has a very comprehensive website which explains not only the goals of the environmental conservation organization, but also provides a slew of scientific data, maps, free downloadable publications, and images that have been produced from their research and work. As the amount of information available can be overwhelming, the website offers the option of viewing the information based on the category of visitor, such as farmer, teacher, volunteer, and so on. On the far left side of the page, under the "Information for..." section, visitors can click on links for information that is relevant to "Farmers and Land Managers", "Researchers, Students & Teachers", "Local Authorities and Policy Makers", "Countryside Visitors", and "Volunteers". In the center of the homepage, there are links to the nine environmental regions of England. Clicking on any of the region's links will take the visitor to a menu that includes links to a "Map of the Region", "Nature on the Map", an interactive feature that allows one to see the nature in any area in England, "State of the Natural Environment", and "National Nature Reserves In Your Area". Clicking on the "Publications, Data & Forms" link on the far left side of the page will take the visitor to the "Publications Catalogue" link that can be browsed or searched, and offers well-written, appealing, and free downloadable publications about a dozen environmental topics of England, including "Wildlife Species", "Farming", "Habitats", and "Coasts & Seas".

64

Naturalness redux  

E-print Network

The idea of naturalness, as originally conceived, refers only to the finite renormalization of the Higgs boson mass induced by the introduction of heavier states. In this respect, naturalness is still a powerful heuristic principle in model building beyond the standard model whenever new massive states are coupled to the Higgs field. The most compelling case is provided by the generation of neutrino masses. In this paper we confront this problem from a new perspective. The right-handed sector responsible for the seesaw mechanism---which introduces a large energy threshold above the electroweak scale---is made supersymmetric to comply with naturalness while the standard model is left unchanged and non-supersymmetric. Cancellations necessary to the naturalness requirement break down only at two loops, thus offering the possibility to increase the right-handed neutrino mass scale up to one order of magnitude above the usual values allowed by naturalness. If also the weak boson sector of the standard model is mad...

Fabbrichesi, Marco

2015-01-01

65

Nature Walk  

NSDL National Science Digital Library

In this activity, learners take an indoor nature walk and discover various objects that have been brought in from the outdoor environment. In preparation for the activity, an educator places natural and man-made items around a room for learners to discover. Learners examine what they find and make notes about what they see and smell, how they (the learners) feel, and what each item looks like (including sketches). Then the group addresses the topic of "Leave No Trace" as it applies to a real nature walk. This would be a great activity before a field trip to a park, arboretum, or other outdoor environment, and can be done with one learner, a class, or even a large group at a family science event.

National 4-H Council

2009-01-01

66

Nature's Code  

NASA Astrophysics Data System (ADS)

We propose that the mathematical structures related to the `universal rewrite system' define a universal process applicable to Nature, which we may describe as `Nature's code'. We draw attention here to such concepts as 4 basic units, 64- and 20-unit structures, symmetry-breaking and 5-fold symmetry, chirality, double 3-dimensionality, the double helix, the Van der Waals force and the harmonic oscillator mechanism, and our explanation of how they necessarily lead to self-aggregation, complexity and emergence in higher-order systems. Biological concepts, such as translation, transcription, replication, the genetic code and the grouping of amino acids appear to be driven by fundamental processes of this kind, and it would seem that the Platonic solids, pentagonal symmetry and Fibonacci numbers have significant roles in organizing `Nature's code'.

Hill, Vanessa J.; Rowlands, Peter

2008-10-01

67

Composing Nature  

ERIC Educational Resources Information Center

The environment is a ready-made subject in writing classrooms, and teachers at all levels are encouraging students to write about nature and environmental issues. Environmental issues provide a equitable meeting place for students from a variety of different backgrounds, interests, and ideologies. There are also many pedagogical advantages to…

Johnson-Sheehan, Richard

2007-01-01

68

Nature Watch  

ERIC Educational Resources Information Center

Children are naturally curious about the world in which they live. To focus this sense of wonder, have your students investigate their local habitat as it changes over the year. This multiseason study will build connections and add relevance to the habitats that children learn about. This series of activities for grades 4-6 explores the changing…

Sterling, Donna R.

2010-01-01

69

Natural games  

E-print Network

Behavior in the context of game theory is described as a natural process that follows the 2nd law of thermodynamics. The rate of entropy increase as the payoff function is derived from statistical physics of open systems. The thermodynamic formalism relates everything in terms of energy and describes various ways to consume free energy. This allows us to associate game theoretical models of behavior to physical reality. Ultimately behavior is viewed as a physical process where flows of energy naturally select ways to consume free energy as soon as possible. This natural process is, according to the profound thermodynamic principle, equivalent to entropy increase in the least time. However, the physical portrayal of behavior does not imply determinism. On the contrary, evolutionary equation for open systems reveals that when there are three or more degrees of freedom for behavior, the course of a game is inherently unpredictable in detail because each move affects motives of moves in the future. Eventually, when no moves are found to consume more free energy, the extensive-form game has arrived at a solution concept that satisfies the minimax theorem. The equilibrium is Lyapunov-stable against variation in behavior within strategies but will be perturbed by a new strategy that will draw even more surrounding resources to the game. Entropy as the payoff function also clarifies motives of collaboration and subjective nature of decision making.

Jani Anttila; Arto Annila

2011-03-05

70

Nature's Palette  

ERIC Educational Resources Information Center

Flower petals, acorn hats, exoskeletons of beetles, and lichens are just a few of the objects students may find in a surprising array of vivid colors. These tiny examples from nature's palette can be discovered in a school yard, a park, or even along the edges of a paved sidewalk...it simply takes careful observation! This article describes a…

McBride, Brooke B.; Brewer, Carol A.

2010-01-01

71

Natural Childbirth  

MedlinePLUS

... natural, and healthy process but takes a neutral position toward pain medication, encouraging women to make an informed decision about whether it's ... or situations, like emergency C-sections. Other ways women handle pain during labor include: hypnosis ... position (such as walking around, showering, rocking, or leaning ...

72

Natural restoration  

SciTech Connect

After a company pays millions of dollars to clean up contaminated site, its liability may not be over. It may have to spend tens of millions more to restore damaged natural resources under an oft-overlooked Superfund program. Examples of liability are cited in this report from the Exxon Valdez oil spill and a pcb leak which contaminated a harbor.

Kamlet, K.S.

1993-02-01

73

natural populations  

Microsoft Academic Search

Evolution may depend more strongly on variation in gene expression than on differences between variant forms of pro- teins1. Regions of DNA that affect gene expression are highly variable, containing 0.6% polymorphic sites 2 . These naturally occurring polymorphic nucleotides can alter in vivo transcrip- tion rates 3-7 . Thus, one might expect substantial variation in gene expression between individuals.

Marjorie F. Oleksiak; Gary A. Churchill; Douglas L. Crawford

74

Nature's Palette  

NSDL National Science Digital Library

Flower petals, acorn hats, exoskeletons of beetles, and lichens are just a few of the objects students may find in a surprising array of vivid colors. These tiny examples from nature's palette can be discovered in a school yard, a park, or even along the

Brooke B. McBride

2010-10-01

75

TandEM: Titan and Enceladus mission  

Microsoft Academic Search

TandEM was proposed as an L-class (large) mission in response to ESA’s Cosmic Vision 2015–2025 Call, and accepted for further\\u000a studies, with the goal of exploring Titan and Enceladus. The mission concept is to perform in situ investigations of two worlds\\u000a tied together by location and properties, whose remarkable natures have been partly revealed by the ongoing Cassini–Huygens\\u000a mission. These

A. Coustenis; S. K. Atreya; T. Balint; R. H. Brown; M. K. Dougherty; F. Ferri; M. Fulchignoni; D. Gautier; R. A. Gowen; C. A. Griffith; L. I. Gurvits; R. Jaumann; Y. Langevin; M. R. Leese; J. I. Lunine; C. P. McKay; X. Moussas; I. Müller-Wodarg; F. Neubauer; T. C. Owen; F. Raulin; E. C. Sittler; F. Sohl; C. Sotin; G. Tobie; T. Tokano; E. P. Turtle; J.-E. Wahlund; J. H. Waite; K. H. Baines; J. Blamont; A. J. Coates; I. Dandouras; T. Krimigis; E. Lellouch; R. D. Lorenz; A. Morse; C. C. Porco; M. Hirtzig; J. Saur; T. Spilker; J. C. Zarnecki; E. Choi; N. Achilleos; R. Amils; P. Annan; D. H. Atkinson; Y. Bénilan; C. Bertucci; B. Bézard; G. L. Bjoraker; M. Blanc; L. Boireau; J. Bouman; M. T. Capria; E. Chassefière; P. Coll; M. Combes; J. F. Cooper; A. Coradini; F. Crary; T. Cravens; I. A. Daglis; E. de Angelis; C. de Bergh; I. de Pater; C. Dunford; G. Durry; O. Dutuit; D. Fairbrother; F. M. Flasar; A. D. Fortes; R. Frampton; M. Fujimoto; M. Galand; O. Grasset; M. Grott; T. Haltigin; A. Herique; F. Hersant; H. Hussmann; W. Ip; R. Johnson; E. Kallio; S. Kempf; M. Knapmeyer; W. Kofman; R. Koop; T. Kostiuk; N. Krupp; M. Küppers; H. Lammer; L.-M. Lara; P. Lavvas; S. Le Mouélic; S. Lebonnois; S. Ledvina; J. Li; T. A. Livengood; R. M. Lopes; J.-J. Lopez-Moreno; D. Luz; P. R. Mahaffy; U. Mall; J. Martinez-Frias; B. Marty; T. McCord; C. Menor Salvan; A. Milillo; D. G. Mitchell; R. Modolo; O. Mousis; M. Nakamura; C. D. Neish; C. A. Nixon; D. Nna Mvondo; G. Orton; M. Paetzold; J. Pitman; S. Pogrebenko; W. Pollard; O. Prieto-Ballesteros; P. Rannou; K. Reh; L. Richter; F. T. Robb; R. Rodrigo; S. Rodriguez; P. Romani; M. Ruiz Bermejo; E. T. Sarris; P. Schenk; B. Schmitt; N. Schmitz; D. Schulze-Makuch; K. Schwingenschuh; A. Selig; B. Sicardy; L. Soderblom; L. J. Spilker; D. Stam; A. Steele; K. Stephan; D. F. Strobel; K. Szego; C. Szopa; R. Thissen; M. G. Tomasko; D. Toublanc; H. Vali; I. Vardavas; V. Vuitton; R. A. West; R. Yelle; E. F. Young

2009-01-01

76

Equipment management system (EMS)  

Microsoft Academic Search

Equipment Management System (EMS) is a software tool used to monitor and track equipment states, restrictions and PM schedules in real time. EMS has been designed and customized to support the MOS-2 die production facility. The system provides graphical representation of the entire factory. Color coded icons represent equipment's current state (i.e. qualification, production, unscheduled maintenance, etc.). Preventative maintenance schedules

T. Yurtsever; M. Comerford

1995-01-01

77

Is EM dead?  

PubMed

Since electron microscopy (EM) first appeared in the 1930s, it has held centre stage as the primary tool for the exploration of biological structure. Yet, with the recent developments of light microscopy techniques that overcome the limitations imposed by the diffraction boundary, the question arises as to whether the importance of EM in on the wane. This Commentary describes some of the pioneering studies that have shaped our understanding of cell structure. These include the development of cryo-EM techniques that have given researchers the ability to capture images of native structures and at the molecular level. It also describes how a number of recent developments significantly increase the ability of EM to visualise biological systems across a range of length scales, and in 3D, ensuring that EM will remain at the forefront of biology research for the foreseeable future. PMID:24124192

Knott, Graham; Genoud, Christel

2013-10-15

78

ESPECIAO ESPONTNEA EM POPULAES ESPACIALMENTE  

E-print Network

hereditária de características por Gregor Mendel e os subsequentes desenvolvimentos da teoria genética par Gregor Mendel, de même que le développement de la théorie génétique qui lui a survenu ont

de Aguiar, Marcus A. M.

79

Geothermal -- nature`s boiler  

SciTech Connect

The video shows how natural heat energy stored in and under the earth`s crust can be put to work, just as the Geysers Geothermal Field now supplies half the electric power for San Francisco`s needs. These reservoirs may heat, cool, and light homes and factories across the country.

NONE

1994-12-31

80

Natural Selection and Natural Theology  

Microsoft Academic Search

THE amicable discussion between Dr. Romanes and myself, ``endeavouring to help in determining the true position of an important question,'' has now (in NATURE, vol. xxvii. p. 527) reached a critical point, one seemingly capable of settlement by scientific inquiry, and upon which a brief note may be pertinent.

Asa Gray

1883-01-01

81

Natural Selection and Natural Theology  

Microsoft Academic Search

I READ with interest, in NATURE, vol. xxvii. p. 362, the reply made by Dr. Romanes to a letter of mine which, although not originally addressed to a scientific organ, found hospitable reception in your columns. It w as not much out of place there, for it was essentially an inquiry whether certain infesences may or may not scientifically be

Asa Gray

1883-01-01

82

Natural Selection and Natural Theology  

Microsoft Academic Search

I AM very glad to find from Prof. Asa Gray's last communication (NATURE, vol. xxviii. p. 78) that the result of our ``amicable discussion'' has been that of coming to an agreement on all points save one, which, as he truly observes, is ``seemingly capable of settlement by scientific inquiry.'' This point simply is as to whether variation in plants

George J. Romanes

1883-01-01

83

Nature Stories  

NSDL National Science Digital Library

What do passenger pigeons, coal mining in Kentucky and cattle ranching have in common? Not a great deal, perhaps, but they are all grist for the mill of the Nature Conservancy's most excellent "Nature Stories" podcast series. The series started in February 2006, and currently there are well over 100 podcasts available on the site. Visitors can browse through them at their leisure, sign up for the podcast feed via iTunes, and also listen in right here. There's much to recommend here, but visitors might want to start by listening to the "Son of a Coalminer" podcast about a father and son coalmining team and "Wild Crafting", which profiles a couple who earn their living by foraging mushrooms and other items in Vermont.

84

Nature Milestones  

NSDL National Science Digital Library

What were the most important advances in cutaneous biology of the past 100 years? The Nature Milestones website provides a detailed answer to that question, along with similar responses regarding light microscopy, cancer, and gene expression. All told there are ten special features on the site, and each feature includes an interactive timeline, scientific commentaries, and a selection of articles from Nature magazine and other peer-reviewed publications. Additionally, each feature includes a list of academic advisors, sponsors, and links to external resources on the subject. Visitors may wish to use these resources in the classroom setting, as they provide basic and advanced materials that can be used by a number of introductory courses. Finally, a number of the materials are also available in the pdf format for easy printing.

85

Natural Predator  

E-print Network

, they are self-sustaining and no additional releases, and hopefully no additional controls, will be necessary. Getting the saltcedar back into the right balance is going to take time. ?We estimate that four to five years of repeated defoliation by beetles... to reduce saltcedar, its natural enemy, the saltcedar leaf beetle, or Diorhabda elongata, offers a low-cost, sustainable alternative. If established over time, a sufficient popu- lation of saltcedar beetles has the potential to shrink the saltcedar popu...

Wythe, Kathy

2006-01-01

86

Natural Justice  

Microsoft Academic Search

Justice is a natural virtue. Well-functioning humans are just, as are well-ordered human societies. Roughly, this means that in a well-ordered society, just humans internalize the laws and social norms (the nomoi)--they internalize lawfulness as a disposition that guides the way they relate to other humans. In societies that are mostly well-ordered, with isolated zones of substantial dysfunction, the nomoi

Lawrence B. Solum

2006-01-01

87

Environmental Media Services (EMS)  

NSDL National Science Digital Library

Environmental Media Services (EMS) is a nonprofit communications clearinghouse committed to the expansion of media coverage on critical environmental and public health issues. True to their mission, EMS staff "build relationships with top scientists, physicians, and other experts to bring journalists the latest and most credible information." EMS's modest homepage is free of clutter but full of content. While several sections are under construction and updates (currently) appear irregular, a series of available articles provides useful summaries of important environmental news issues over the past six months. Current articles include "The impacts of global warming on the oceans" and "Cool companies," among others.

88

Natural Disasters  

NSDL National Science Digital Library

Students are introduced to our planet's structure and its dynamic system of natural forces through an examination of the natural hazards of earthquakes, volcanoes, landslides, tsunamis, floods and tornados, as well as avalanches, fires, hurricanes and thunderstorms. They see how these natural events become disasters when they impact people, and how engineers help to make people safe from them. Students begin by learning about the structure of the Earth; they create clay models showing the Earth's layers, see a continental drift demo, calculate drift over time, and make fault models. They learn how earthquakes happen; they investigate the integrity of structural designs using model seismographs. Using toothpicks and mini-marshmallows, they create and test structures in a simulated earthquake on a tray of Jell-O. Students learn about the causes, composition and types of volcanoes, and watch and measure a class mock eruption demo, observing the phases that change a mountain's shape. Students learn that the different types of landslides are all are the result of gravity, friction and the materials involved. Using a small-scale model of a debris chute, they explore how landslides start in response to variables in material, slope and water content. Students learn about tsunamis, discovering what causes them and makes them so dangerous. Using a table-top-sized tsunami generator, they test how model structures of different material types fare in devastating waves. Students learn about the causes of floods, their benefits and potential for disaster. Using riverbed models made of clay in baking pans, students simulate the impact of different river volumes, floodplain terrain and levee designs in experimental trials. They learn about the basic characteristics, damage and occurrence of tornadoes, examining them closely by creating water vortices in soda bottles. They complete mock engineering analyses of tornado damage, analyze and graph US tornado damage data, and draw and present structure designs intended to withstand high winds.

Integrated Teaching and Learning Program,

89

Natural Perspective  

NSDL National Science Digital Library

This great natural history hypertext was created by long-time naturalists Ari and Susan Kornfeld, and contains informative sections on four taxonomic Kingdoms of Life: Plantae, Animalia, Protoctista, and Fungi (reported on in the NSDL Scout Report for Life Sciences, January 23, 2004). Each Kingdom section offers great images and information about our planet's many diverse forms of life. Site visitors can view this 38-page site one page at a time or by selecting specific sections from the table of contents. The site also includes a nice Species Index -- organized by both scientific and common name -- with individual species hyperlinked to photos and information in the text.

Kornfeld, Ari and Susan

90

Nature: Debates  

NSDL National Science Digital Library

_Nature_, the prestigious international journal of science, has launched this 'Debates' site "to map out and define the landscape of international scientific controversy." More specifically, this site provides a forum for thinking about, and "discussing" (ex situ), several current scientific topics. The set-up of the site includes a list of monthly topics, moderated by selected experts (a short 'credentials' summary is provided for each), and contributions from select readers. The Current topic is entitled "Is the fossil record adequate?" The previous (first) topic was entitled "Benefits and Risks of Genetic Modification in Agriculture."

91

Natural Strain  

NASA Technical Reports Server (NTRS)

Logarithmic strain is the preferred measure of strain used by materials scientists, who typically refer to it as the "true strain." It was Nadai who gave it the name "natural strain," which seems more appropriate. This strain measure was proposed by Ludwik for the one-dimensional extension of a rod with length l. It was defined via the integral of dl/l to which Ludwik gave the name "effective specific strain." Today, it is after Hencky, who extended Ludwik's measure to three-dimensional analysis by defining logarithmic strains for the three principal directions.

Freed, Alan D.

1997-01-01

92

Natural Selection  

NSDL National Science Digital Library

Learners simulate the process of natural selection using a variety of beans and a bowl with a hole cut into it. The variety of beans represents the variation in a population of microbes, and the bowl with a hole represents an antibiotic or some other selective pressure on the population. Only the beans that survive (don't fall through the hole) are allowed to reproduce for the next generation. Learners record and plot the number of each kind of bean through multiple generations. This activity also addresses the process of scientific investigation as learners are encouraged to design their own method of experimentation, make a hypothesis, record data, and share their results.

Heather Thiel-Cobbey

2012-01-01

93

Memória fonológica em crianças bilíngues bimodais e crianças com implante coclear  

PubMed Central

RESUMO Este estudo comparou o desempenho de crianças bilíngues bimodais ouvintes (filhas de pais surdos) e crianças surdas usuárias de implante coclear (filhas de pais surdos e de pais ouvintes), com diferentes contextos de acesso à Língua Brasileira de Sinais (Libras), em tarefas que envolvem memória fonologica. Os testes utilizados foram: Teste de Pseudopalavras (Santos e Bueno, 2003) e Teste de Pseudosinais (desenvolvido pelos pesquisadores responsáveis pelo Projeto ‘Desenvolvimento Bilíngue Bimoda’). Além disso, foram incluídos dois grupos de controle, formados por crianças surdas (usuarias de Libras), e adultos bilíngues bimodais ouvintes. Na análise dos resultados, em relação ao desempenho entre os dois grupos testados foi constatado que o grupo de crianças bilíngues bimodais ouvintes apresentou desempenho superior, nos dois testes. No entanto, ao ser analisado o desempenho da criança surda usuaria de implante coclear, filha de pais surdos, que possui acesso irrestrito à Libras e comparado com o das crianças surdas usuárias de implante coclear, que possuem acesso restrito à Libras, foi constatado que o seu desempenho foi semelhante ao do grupo de crianças bilíngues bimodais ouvintes. As crianças surdas usuárias de implante coclear com acesso restrito à Libras e, portanto, com acesso maior ao Português apresentaram escores mais baixos nas tarefas, principalmente do teste em Português. Os resultados sugerem que as crianças surdas usuárias de implante coclear em processo de aquisição da línguagem podem se beneficiar com o acesso irrestrito à Libras, atingindo inclusive desempenho semelhante a de crianças bilíngues bimodais ouvintes. PMID:25110473

de Quadros, Ronice Müller; Cruz, Carina Rebello; Pizzio, Aline Lemos

2014-01-01

94

Nature Soundmap  

NSDL National Science Digital Library

The Nature Soundmap offers unique access to the untouched and diverse wildlife that spans the globe, an experience that the Scout team could not pass up. In addition to high-quality audio, we enjoyed the articles within the newsletter that detail the remarkable travel ventures behind the recording process. We also appreciated that the site devotes itself to providing the best listening experience possible, offering tips on â??How to Listenâ? and even a form for user suggestions.What does a humpback whale sound like? Or perhaps the White-cheeked Gibbon? The Nature Soundmap provides snippets of these sounds and much, much more. Visitors will find an interactive map of the world, complete with markers that allow audio wildlife travel from Central America to Central Asia a snap. Symphonies of animal noises can also be found here, as visitors can click on Greece to listen to "Summer Ambience" or France to find "Dawn in the Lezardrieux Forest.â? Each marker includes information about the animal or setting profiled, along with a link to More Info for the generally curious.

95

Natural Selection  

NSDL National Science Digital Library

A common criticism of natural selection is: How can it produce novel complex useful structures by pure random chance? Darwin argued that selection is not a random process, and furthermore, it is cumulative. This lesson provides a way for students to actually compare the cumulative non-random selection of Darwin with the non-cumulative version so often erroneously implied. Students attempt to produce a full sequence of 13 cards of one suit (ace - to king). This must be done by shuffling the suit of cards for each round, then checking the cards. Half the teams must look for the full sequence each time, and repeat the process until this is accomplished. The other teams start to build their sequence by pulling the ace when it first appears as the top card, then adding to the stack whenever the next card for the sequence is shuffled to the top. Discussion reveals how the second method mimics Darwinian natural selection, while the first does not.

Werner Heim

2007-12-12

96

www.nature.com/naturemethods NATURE METHODS | VOL.4 NO.1 | JANUARY 2007  

E-print Network

% for GST. POSTMASTER: Send address changes to Nature Methods, Subscriptions Dept., PO Box 5054, Brentwood Uhlén NEWS AND VIEWS 19 4D brain signaling Nima Marandi & Arthur Konnerth see article page 73 20 From cryo-EM, multiple protein structures in one shot Fred J Sigworth see article page 27 TECHNOLOGY FEATURE

Cai, Long

97

A Fully Automated Approach to Segmentation of Irregularly Shaped Cellular Structures in EM Images  

Microsoft Academic Search

While there has been substantial progress in segmenting natural im- ages, state-of-the-art methods that perform well in such tasks unfortunately tend to underperform when confronted with the different challenges posed by electron microscope (EM) data. For example, in EM imagery of neural tissue, numerous cells and subcellular structures appear within a single image, they exhibit irreg- ular shapes that cannot

Aurélien Lucchi; Kevin Smith; Radhakrishna Achanta; Vincent Lepetit; Pascal Fua

2010-01-01

98

EMPREGO DE MISTURAS SOLO-ALCATRÃO DE MADEIRA DE EUCALIPTO EM ESTRADAS FLORESTAIS 1  

Microsoft Academic Search

6 RESUMO: Analisou-se o potencial de uso do alcatrão de madeira de eucalipto como aditivo químico para a estabilização de solos para estradas florestais. O programa de ensaios de laboratório englobou ensaios de caracterização e índice de suporte Califórnia (CBR), realizados em solos no estado natural e em misturas solo-alcatrão. Três amostras de solo representativas da cidade de Viçosa, estado

Dalila C. M. Fernandes; Carlos C. Machado; Dario C. Lima; Reginaldo S. Pereira

99

OPTIMIZAC ~ AO EM REDES  

E-print Network

OPTIMIZAC¸ ~ AO EM REDES UMA VIS ~ AO GLOBAL Deolinda Dias Rasteiro, Jose Luis Santos, Marta Braz; Optimiza¸c~ao em Redes ­ Uma Vis~ao Global N = fv 1 ; : : : ; v n g j f1; : : : ; ng ­ conjunto de n'os (v; j) Rede (N ; A) ­ grafo (N ; A) com um v'ertice inicial s e um v'ertice terminal t, a cujos arcos

Pascoal, Marta Margarida Braz

100

Marine EM in GOM: Advances and outlook  

NASA Astrophysics Data System (ADS)

Marine electromagnetic (EM) sounding methods provide valuable complementary information to conventional seismic exploration methods and success stories have been claimed by several oil companies: 1) as indicator of hydrocarbon presence derived from strong resistive anomalies 2) as complimentary tool in structural exploration. While 3D seismic identifies geological structures, it does not directly reveal the fluid content (hydrocarbons). Marine EM sounding exploits variations in electrical resistivity, and is directly sensitive to fluid saturation and thus resistive hydrocarbons. Under the right circumstances it can confirm the presence of hydrocarbons by identifying their resistive characteristics. This means that the possibility of drilling dry exploration wells is significantly reduced, as is the need for extensive appraisal drilling. EM data is used to resolve ambiguities in the structural interpretation of seismic data. For example, whereas the top of a diapiric salt body is often well constrained by seismic data, the position of the lower boundaries is often more elusive. Carbonate (or salt blankets, or resistive basalt) layers complicate the detection and characterization of deeper structure because of diffusive scattering in the layer. However, the resistivity contrast between these layers and the sediments below is an ideal target for EM sounding methods. Recently, two marine EM methods have become popular: The controlled source EM (CSEM) method and magnetotellurics (MT). The CSEM method uses an electric dipole source to transmit low frequency electromagnetic signals to an array of receivers that measure the electromagnetic field at the seafloor. Variation in amplitude and phase of the received signal as the source is towed through the receiver array yield the resistivity structure of the sub-surface to depths of several kilometers. The MT method uses naturally occurring electromagnetic source fields to determine the resistivity of the sub-surface. Thus, by studying the variation in response as a function of frequency, the variation in resistivity as a function of depth may be determined. These methods give complementary information about the resistivity structure of the sub-seafloor. Whereas CSEM data are primarily sensitive to resistive structures, and in particular to layers that are thin compared to their depth of burial, MT data can constrain larger scale conductive structure. By combining natural and controlled source methods better constraints on the geometry and properties of the seafloor can be gained than from either data type alone. Several case histories with large salt structures in the section illustrate that the techniques are useful for future exploration in the GOM. We see the technology moving from its present focus of deep water to include shallower water depths (where CSEM sounding is presently restricted). In addition, we envision the integration of complimentary EM techniques to get a better constrained resistivity image of the subsurface.

MacGregor, L. M.; Strack, K. M.

2005-05-01

101

Natural Strain  

NASA Technical Reports Server (NTRS)

The purpose of this paper is to present a consistent and thorough development of the strain and strain-rate measures affiliated with Hencky. Natural measures for strain and strain-rate, as I refer to them, are first expressed in terms of of the fundamental body-metric tensors of Lodge. These strain and strain-rate measures are mixed tensor fields. They are mapped from the body to space in both the Eulerian and Lagrangian configurations, and then transformed from general to Cartesian fields. There they are compared with the various strain and strain-rate measures found in the literature. A simple Cartesian description for Hencky strain-rate in the Lagrangian state is obtained.

Freed, Alan D.

1995-01-01

102

Falta de investimento prejudica sector em Portugal  

E-print Network

.car*alF»o@ecOnomlco.pt Portugal tem condições para se tornar um exemplo de sucesso no desenvolvimento da biotecnologia, mas ainda acarinhada nos últimos 20 anos ao nível da Investigação e Desenvolvimento (I&D) " . Há interesse, da parte da. A mesma mensagem é passada por Helena Vieira, professora associada convidada da Fa- culdade de Ciências da

Instituto de Sistemas e Robotica

103

NATURE: Kalahari  

NSDL National Science Digital Library

This website is the Web companion to the two-part NATURE documentary on the Kalahari Desert, which aired on PBS during fall 2003. The first episode, Kalahari: The Great Thirstland, explores the intense extremes of the Kalahari landscape, where wildlife "struggle for survival on the African plains." The site offers a number of Web-only extras, including a species guide in the form of animal trading cards, a slide show showing seasonal change in the Kalahari, and more. Episode Two, Kalahari: The Flooded Desert, explores the desert wetland of the Okavango Delta, "one of the most unusual ecosystems in one of the harshest regions in the world." The Web companion for this episode can by accessed through the first website, and it's here that teachers will find an interdisciplinary lesson plan designed for grades 3-5. The lesson focuses on the rich diversity of Kalahari wildlife, and uses a number of interactive activities from other websites (links provided). Web-only features for this episode include an interactive journey through the Okavango Delta, a behind-the-scenes interview with the film's director, and of course, related links. [RS

2003-01-01

104

Sonar-Based Mapping With Mobile Robots Using EM  

Microsoft Academic Search

This paper presents an algorithms for learn- ing occupancy grid maps with mobile robots equipped with range finders, such as sonar sen- sors. Our approach employs the EM algorithm to solve the concurrent mapping and localization problem. To accommodate the spatial nature of range data, it relies on a two-layered representa- tion of maps, where global maps are composed from

Wolfram Burgard; Dieter Fox; Hauke Jans; Christian Matenar; Sebastian Thrun

105

DESENVOLVIMENTO DE UM ALGORITMO GENÉTICO PARA MINERAÇÃO DE DADOS NA AGRICULTURA DE PRECISÃO  

Microsoft Academic Search

The great volume of data generates in Precision Agriculture can be analyzed in a more efficient way through the use of techniques of Data Mining, existing among other, the technique based on the analogy with the processes of natural selection and evolutionary genetics: Genetic Algorithms. The present work aims the development of a genetic algorithm to determine the behavior of

A. M. GUIMARÃES; L. M. VRIESMANN; M. G. CANTERI; A. CATANEO; J. P. MOLIN

106

MAXIMUM (EM) POWER: A FOUNDATION PRINCIPLE LINKING MAN AND NATURE  

EPA Science Inventory

The fruitfulness of H.T. Odum?s commitment to a systems-based understanding of our biosphere, its dynamics, and the potential role of humans within it is indicated by his extensive and seminal contributions to the many branches of environmental science and socioeconomic policy st...

107

Considerações a respeito da ansiedade em jovens atletas a partir dos estágios psicossociais do desenvolvimento Considerations about the anxiety in young athletes from stages of psychosocial development  

Microsoft Academic Search

This review aims to consider the process of structu ring the anxiety within the theory of Psychosocial Development Erik Erikson and discuss the issue of l imitation of the studies of anxiety in sports. Thus , it is understood that the mechanisms of anxiety in the sp orting context can influence the performance of athletes and therefore a methodology for

Robério Silva de Paiva; Thaísa Vilhena Silva

108

Conservation Laws and Variational Sequences in Gauge-Natural Theories  

E-print Network

In the classical Lagrangian approach to conservation laws of gauge-natural field theories a suitable (vector) density is known to generate the so--called {\\em conserved Noether currents}. It turns out that along any section of the relevant gauge--natural bundle this density is the divergence of a skew--symmetric (tensor) density, which is called a {\\em superpotential} for the conserved currents. We describe gauge--natural superpotentials in the framework of finite order variational sequences according to Krupka. We refer to previous results of ours on {\\em variational Lie derivatives} concerning abstract versions of Noether's theorems, which are here interpreted in terms of ``horizontal'' and ``vertical'' conserved currents. The gauge--natural lift of principal automorphisms implies suitable linearity properties of the Lie derivative operator. Thus abstract results due to Kol\\'a\\v{r}, concerning the integration by parts procedure, can be applied to prove the {\\em existence} and {\\em globality} of superpotentials in a very general setting.

L. Fatibene; M. Francaviglia; M. Palese

2003-11-19

109

......... em o Moscow, Idaho  

E-print Network

#12;#12;#12;#12;#12;......... em o #12;'"''!.. . ' I The UNIVERSITY of IDAHO Moscow, Idaho Editors Donald W. Samuelson, who strode purposefully out of the North, became Idaho's leading gentle- man will determine his place in Idaho history. Perhaps no governor of a Western state has more complex

O'Laughlin, Jay

110

by EM tomography  

Microsoft Academic Search

We have studied the in vitro reconstitution of sperm nuclei and small DNA templates to mitotic chroma- tin in Xenopus laevis egg extracts by three-dimensional (3D) electron microscopy (EM) tomography. Using specif- ically developed software, the reconstituted chromatin was interpreted in terms of nucleosomal patterns and the overall chromatin connectivity. The condensed chromatin formed

Peter König; Michael B. Braunfeld; John W. Sedat; David A. Agard

111

TandEM: Titan and Enceladus mission  

USGS Publications Warehouse

TandEM was proposed as an L-class (large) mission in response to ESA's Cosmic Vision 2015-2025 Call, and accepted for further studies, with the goal of exploring Titan and Enceladus. The mission concept is to perform in situ investigations of two worlds tied together by location and properties, whose remarkable natures have been partly revealed by the ongoing Cassini-Huygens mission. These bodies still hold mysteries requiring a complete exploration using a variety of vehicles and instruments. TandEM is an ambitious mission because its targets are two of the most exciting and challenging bodies in the Solar System. It is designed to build on but exceed the scientific and technological accomplishments of the Cassini-Huygens mission, exploring Titan and Enceladus in ways that are not currently possible (full close-up and in situ coverage over long periods of time). In the current mission architecture, TandEM proposes to deliver two medium-sized spacecraft to the Saturnian system. One spacecraft would be an orbiter with a large host of instruments which would perform several Enceladus flybys and deliver penetrators to its surface before going into a dedicated orbit around Titan alone, while the other spacecraft would carry the Titan in situ investigation components, i.e. a hot-air balloon (Montgolfi??re) and possibly several landing probes to be delivered through the atmosphere. ?? Springer Science + Business Media B.V. 2008.

Coustenis, A.; Atreya, S.K.; Balint, T.; Brown, R.H.; Dougherty, M.K.; Ferri, F.; Fulchignoni, M.; Gautier, D.; Gowen, R.A.; Griffith, C.A.; Gurvits, L.I.; Jaumann, R.; Langevin, Y.; Leese, M.R.; Lunine, J.I.; McKay, C.P.; Moussas, X.; Muller-Wodarg, I.; Neubauer, F.; Owen, T.C.; Raulin, F.; Sittler, E.C.; Sohl, F.; Sotin, C.; Tobie, G.; Tokano, T.; Turtle, E.P.; Wahlund, J.-E.; Waite, J.H.; Baines, K.H.; Blamont, J.; Coates, A.J.; Dandouras, I.; Krimigis, T.; Lellouch, E.; Lorenz, R.D.; Morse, A.; Porco, C.C.; Hirtzig, M.; Saur, J.; Spilker, T.; Zarnecki, J.C.; Choi, E.; Achilleos, N.; Amils, R.; Annan, P.; Atkinson, D.H.; Benilan, Y.; Bertucci, C.; Bezard, B.; Bjoraker, G.L.; Blanc, M.; Boireau, L.; Bouman, J.; Cabane, M.; Capria, M.T.; Chassefiere, E.; Coll, P.; Combes, M.; Cooper, J.F.; Coradini, A.; Crary, F.; Cravens, T.; Daglis, I.A.; de Angelis, E.; De Bergh, C.; de Pater, I.; Dunford, C.; Durry, G.; Dutuit, O.; Fairbrother, D.; Flasar, F.M.; Fortes, A.D.; Frampton, R.; Fujimoto, M.; Galand, M.; Grasset, O.; Grott, M.; Haltigin, T.; Herique, A.; Hersant, F.; Hussmann, H.; Ip, W.; Johnson, R.; Kallio, E.; Kempf, S.; Knapmeyer, M.; Kofman, W.; Koop, R.; Kostiuk, T.; Krupp, N.; Kuppers, M.; Lammer, H.; Lara, L.-M.; Lavvas, P.; Le, Mouelic S.; Lebonnois, S.; Ledvina, S.; Li, J.; Livengood, T.A.; Lopes, R.M.; Lopez-Moreno, J. -J.; Luz, D.; Mahaffy, P.R.; Mall, U.; Martinez-Frias, J.; Marty, B.; McCord, T.; Salvan, C.M.; Milillo, A.; Mitchell, D.G.; Modolo, R.; Mousis, O.; Nakamura, M.; Neish, C.D.; Nixon, C.A.; Mvondo, D.N.; Orton, G.; Paetzold, M.; Pitman, J.; Pogrebenko, S.; Pollard, W.; Prieto-Ballesteros, O.; Rannou, P.; Reh, K.; Richter, L.; Robb, F.T.; Rodrigo, R.; Rodriguez, S.; Romani, P.; Bermejo, M.R.; Sarris, E.T.; Schenk, P.; Schmitt, B.; Schmitz, N.; Schulze-Makuch, D.; Schwingenschuh, K.; Selig, A.; Sicardy, B.; Soderblom, L.; Spilker, L.J.; Stam, D.; Steele, A.; Stephan, K.; Strobel, D.F.; Szego, K.; Szopa

2009-01-01

112

The EM Earthquake Precursor  

NASA Astrophysics Data System (ADS)

Many attempts have been made to determine a sound forecasting method regarding earthquakes and warn the public in turn. Presently, the animal kingdom leads the precursor list alluding to a transmission related source. By applying the animal-based model to an electromagnetic (EM) wave model, various hypotheses were formed, but the most interesting one required the use of a magnetometer with a differing design and geometry. To date, numerous, high-end magnetometers have been in use in close proximity to fault zones for potential earthquake forecasting; however, something is still amiss. The problem still resides with what exactly is forecastable and the investigating direction of EM. After the 1989 Loma Prieta Earthquake, American earthquake investigators predetermined magnetometer use and a minimum earthquake magnitude necessary for EM detection. This action was set in motion, due to the extensive damage incurred and public outrage concerning earthquake forecasting; however, the magnetometers employed, grounded or buried, are completely subject to static and electric fields and have yet to correlate to an identifiable precursor. Secondly, there is neither a networked array for finding any epicentral locations, nor have there been any attempts to find even one. This methodology needs dismissal, because it is overly complicated, subject to continuous change, and provides no response time. As for the minimum magnitude threshold, which was set at M5, this is simply higher than what modern technological advances have gained. Detection can now be achieved at approximately M1, which greatly improves forecasting chances. A propagating precursor has now been detected in both the field and laboratory. Field antenna testing conducted outside the NE Texas town of Timpson in February, 2013, detected three strong EM sources along with numerous weaker signals. The antenna had mobility, and observations were noted for recurrence, duration, and frequency response. Next, two directional techniques were employed, resulting in three mapped, potential epicenters. The remaining, weaker signals presented similar directionality results to more epicentral locations. In addition, the directional results of the Timpson field tests lead to the design and construction of a third prototype antenna. In a laboratory setting, experiments were created to fail igneous rock types within a custom-designed Faraday Cage. An antenna emplaced within the cage detected EM emissions, which were both reproducible and distinct, and the laboratory results paralleled field results. With a viable system and continuous monitoring, a fracture cycle could be established and observed in real-time. Sequentially, field data would be reviewed quickly for assessment; thus, leading to a much improved earthquake forecasting capability. The EM precursor determined by this method may surpass all prior precursor claims, and the general public will finally receive long overdue forecasting.

Jones, K. B., II; Saxton, P. T.

2013-12-01

113

Bioterrorism awareness for EMS.  

PubMed

It is important to understand that the issues surrounding bioterrorism and all weapons of mass destruction are complex. In an effort to enhance response to such events, EMS should handle all incidents from the perspective of an all-hazards approach. Prevention, preparation, response and recovery are essential to the safe mitigation of all incidents. Organizations must be prepared. Plan now for a safer tomorrow. Your personnel and communities depend on you. PMID:15131906

Patrick, Richard W

2004-04-01

114

Natural Language Processing.  

ERIC Educational Resources Information Center

Discusses issues related to natural language processing, including theoretical developments; natural language understanding; tools and techniques; natural language text processing systems; abstracting; information extraction; information retrieval; interfaces; software; Internet, Web, and digital library applications; machine translation for…

Chowdhury, Gobinda G.

2003-01-01

115

Cyanobacterial precipitation of gypsum, calcite, and magnesite from natural alkaline lake water  

NASA Astrophysics Data System (ADS)

Results from transmission electron microscopy provide direct evidence for cyanobacterial biomineralization of gypsum and calcite in aquatic environments. Laboratory simulations using filter-sterilized natural lake water inoculated with Synechococcusem> sp., isolated from Fayette ville Green Lake, New York, revealed epicellular biomineralization of gypsum, calcite, and magnesite. Experimental, electron microscopical, and sedimentological evidence indicates that Synechococcusem> is responsible for a major proportion of the marl sediment and carbonate bioherms in Green Lake. The elucidated role of Synechococcusem> in biomineralization and its ubiquitous distribution in nature have widespread implications for cyanobacterial mineralization in marine and freshwater environments since late Archean time.

Thompson, J. B.; Ferris, F. G.

1990-10-01

116

Integrated dryland weed control in nature farming systems  

Microsoft Academic Search

As practices of integrated weed control in nature farming systems, surface application of a bioactive organic fertilizer, pigtailed wheat straw mulch, and intercropped peanut as a smother crop were tested with soybean, Japanese pumpkin and tomato, respectively. A bioactive organic fertilizer using rice bran, oil mill sludge and fish meal as materials and a microbial inoculant (EM as its commercial

Hui-lian Xu; Feifei Qin; Fahong Wang; Qicong Xu; Shailendra K. Shah; Fengmin Li

2009-01-01

117

Multi-Level Annotation of Natural Scenes Using Dominant Image  

E-print Network

Multi-Level Annotation of Natural Scenes Using Dominant Image Compounds and Semantic Concepts at Charlotte #12;Outline of Presentation Research Motivation Semantic Image Representation Semantic Image Concept Modeling Adaptive EM Algorithm for Classifier Training Multi-Level Image Annotation Conclusions

Fan, Jianping

118

Quantitation of PET data with the EM reconstruction technique  

SciTech Connect

The expectation maximization (EM) algorithm offers high spatial resolution and excellent noise reduction with low statistics PET data, since it incorporates the Poisson nature of the data. The main difficulties are long computation times, difficulties to find appropriate criteria to terminate the reconstruction and to quantify the resulting image data. In the present work a modified EM algorithm has been implements on a VAX 11/780. Its capability to quantify image data has been tested in phantom studies and in two clinical cases, cerebral blood flow studies and dopamine D2-receptor studies. Data from phantom studies indicate the superiority of images reconstructed with the EM technique compared to images reconstructed with the conventional filtered back-projection (FB) technique in areas with low statistics. At higher statistics the noise characteristics of the two techniques coincide. Clinical data support these findings.

Rosenqvist, G.; Dahlbom, M.; Erikson, L.; Bohm, C.; Blomqvist, G.

1989-02-01

119

UNIVERSIDADE DE BRASLIA PROGRAMA DE PS-GRADUAO EM CINCIAS E TECNOLOGIAS EM SADE  

E-print Network

1 UNIVERSIDADE DE BRASÍLIA PROGRAMA DE PÓS-GRADUAÇÃO EM CIÊNCIAS E TECNOLOGIAS EM SAÚDE EDITAL N. 01/2011 SELEÇÃO DE CANDIDATOS ÀS VAGAS DO PROGRAMA DE PÓS-GRADUAÇÃO EM CIÊNCIAS E TECNOLOGIAS EM. PREÂMBULO 1.1 A Coordenadora do Programa de Pós-Graduação em Ciências e Tecnologias em Saúde, no uso de suas

Maier, Rudolf Richard

120

SUPPLEMENTARY INFORMATION 1www.nature.com/nature  

E-print Network

SUPPLEMENTARY INFORMATION 1www.nature.com/nature doi: 10.1038/nature08976 ± ± #12;2www.nature.com/nature doi: 10.1038/nature08976 SUPPLEMENTARY INFORMATION #12;3www.nature.com/nature SUPPLEMENTARY INFORMATIONdoi: 10.1038/nature08976 5'-A*C*A*C*TCTTTCCCTACACGACGCTCTTCCGATCT*g*t*c*t-3' 5'-a

Good, Jeffrey M.

121

Engaging Nature Aesthetically  

ERIC Educational Resources Information Center

For the most part, most people appreciate nature as spectators. Some portion of a natural scene is viewed as if it were a painting or photograph. However, thinking of nature solely or chiefly as an aesthetic scene to be observed is unnecessarily limiting. Regarding natural phenomena as material for detached, pictorial observation overlooks the…

Kupfer, Joseph H.

2003-01-01

122

Natural Resources Research Institute  

E-print Network

Growing Strong Industries Developing New Ideas Natural Resources Research Institute Nurturing Natural Resources PRoject HIgHlIgHts #12;Founded by the state legislature in 1983, the Natural Resources Research Institute fosters the economic development of Minnesota's natural resources in an environmentally

Netoff, Theoden

123

Research Highlights Nature Nanotechnology  

E-print Network

© 2009 APS Research Highlights Nature Nanotechnology Published online: 17 July 2009 | doi:10 perfect fluid. Phys. Rev. Lett. 103, 025301 (2009). | Article |1. Nature Nanotechnology ISSN 1748 : Nature Nanotechnology http://www.nature.com/nnano/reshigh/2009/0709/full/nnano.2009.222.html 1 of 1 18

Müller, Markus

124

Branching Art From Nature  

NSDL National Science Digital Library

In this activity, learners use materials from nature to create original works of art. Learners go on a "natural-supply" hunt outside to find materials and then sort the found objects into groups by color, shape, size, or other characteristics. Learners can use their found objects to create patterns/designs, a natural rock garden, a nature collage, or sculptures.

Chicago Children's Museum

2008-01-01

125

Geoff Brumfiel NATURE | NEWS  

E-print Network

Geoff Brumfiel NATURE | NEWS Laser lab shifts focus to warheads US ignition facility will devote,000 pellets a minute (see Nature 483, 133­134; 2012). But unexpected The NIF's lasers blast a tiny pellet in the pellet. "Nature pushes back: that's my shorthand version of what's going on," Byer says. Nature isn

126

MESTRADO EM MICROBIOLOGIA INOVAO, EMPREENDEDORISMO E TRANSFERNCIA DE TECNOLOGIA EM  

E-print Network

MESTRADO EM MICROBIOLOGIA INOVAÇÃO, EMPREENDEDORISMO E TRANSFERÊNCIA DE TECNOLOGIA EM MICROBIOLOGIA conceitos sobre os princípios e metodologias da moderna Transferência de Tecnologia. Assim, inclui-se numa alunos aprendem por realização real e directa do processo de transferência de tecnologia, utilizando

Instituto de Sistemas e Robotica

127

Sketching in Nature  

NSDL National Science Digital Library

Science students will discover the beauty of communing with nature by utilizing a Nature journal during field observations. Nature journaling is a useful skill, independent of whether students consider themselves artists. Sketching from nature is one way to provide open-ended, inquiry-based learning while also bringing art into the process of learning science. This article includes two exercises, contour drawing and an observation activity, to get teachers started in the process of "sketching nature" into the science curriculum.

April Hobart

2005-01-01

128

Natural gas monthly  

SciTech Connect

The Natural Gas Monthly highlights activities, events, and analyses of interest to public and private sector organizations associated with the natural gas industry. Volume and price data are presented each month for natural gas production, distribution, consumption, and interstate pipeline activities. Producer-related activities and underground storage data are also reported. From time to time, the Natural Gas Monthly features articles designed to assist readers in using and interpreting natural gas information.

NONE

1998-01-01

129

Nature's DesignNature's Design Mark Whittle  

E-print Network

clusters #12;#12;Slow death of low mass star #12;Explosive death of high mass star #12;Supernova remnantsNature's DesignNature's Design Mark Whittle Astronomy Department, University of Virginia April 20's surface Topic 13 (this one): the rest of the Universe....... In terms of size : Topic 13Topics 1

Whittle, Mark

130

Identified EM Earthquake Precursors  

NASA Astrophysics Data System (ADS)

Many attempts have been made to determine a sound forecasting method regarding earthquakes and warn the public in turn. Presently, the animal kingdom leads the precursor list alluding to a transmission related source. By applying the animal-based model to an electromagnetic (EM) wave model, various hypotheses were formed, but the most interesting one required the use of a magnetometer with a differing design and geometry. To date, numerous, high-end magnetometers have been in use in close proximity to fault zones for potential earthquake forecasting; however, something is still amiss. The problem still resides with what exactly is forecastable and the investigating direction of EM. After a number of custom rock experiments, two hypotheses were formed which could answer the EM wave model. The first hypothesis concerned a sufficient and continuous electron movement either by surface or penetrative flow, and the second regarded a novel approach to radio transmission. Electron flow along fracture surfaces was determined to be inadequate in creating strong EM fields, because rock has a very high electrical resistance making it a high quality insulator. Penetrative flow could not be corroborated as well, because it was discovered that rock was absorbing and confining electrons to a very thin skin depth. Radio wave transmission and detection worked with every single test administered. This hypothesis was reviewed for propagating, long-wave generation with sufficient amplitude, and the capability of penetrating solid rock. Additionally, fracture spaces, either air or ion-filled, can facilitate this concept from great depths and allow for surficial detection. A few propagating precursor signals have been detected in the field occurring with associated phases using custom-built loop antennae. Field testing was conducted in Southern California from 2006-2011, and outside the NE Texas town of Timpson in February, 2013. The antennae have mobility and observations were noted for recurrence, duration, and frequency response. At the Southern California field sites, one loop antenna was positioned for omni-directional reception and also detected a strong First Schumann Resonance; however, additional Schumann Resonances were absent. At the Timpson, TX field sites, loop antennae were positioned for directional reception, due to earthquake-induced, hydraulic fracturing activity currently conducted by the oil and gas industry. Two strong signals, one moderately strong signal, and approximately 6-8 weaker signals were detected in the immediate vicinity. The three stronger signals were mapped by a biangulation technique, followed by a triangulation technique for confirmation. This was the first antenna mapping technique ever performed for determining possible earthquake epicenters. Six and a half months later, Timpson experienced two M4 (M4.1 and M4.3) earthquakes on September 2, 2013 followed by a M2.4 earthquake three days later, all occurring at a depth of five kilometers. The Timpson earthquake activity now has a cyclical rate and a forecast was given to the proper authorities. As a result, the Southern California and Timpson, TX field results led to an improved design and construction of a third prototype antenna. With a loop antenna array, a viable communication system, and continuous monitoring, a full fracture cycle can be established and observed in real-time. In addition, field data could be reviewed quickly for assessment and lead to a much more improved earthquake forecasting capability. The EM precursors determined by this method appear to surpass all prior precursor claims, and the general public will finally receive long overdue forecasting.

Jones, Kenneth, II; Saxton, Patrick

2014-05-01

131

The Nature of Natural Hazards Communication (Invited)  

NASA Astrophysics Data System (ADS)

Some of the many issues of interest to natural hazards professionals include the analysis of proactive approaches to the governance of risk from natural hazards and approaches to broaden the scope of public policies related to the management of risks from natural hazards, as well as including emergency and environmental management, community development and spatial planning related to natural hazards. During the talk we will present results of scientific review, analysis and synthesis, which emphasize same new trends in communication of the natural hazards theories and practices within an up-to-the-minute context of new environmental and climate change issues, new technologies, and a new focus on resiliency. The presentation is divided into five sections that focus on natural hazards communication in terms of education, risk management, public discourse, engaging the public, theoretical perspectives, and new media. It includes results of case studies and best practices. It delves into natural hazards communication theories, including diffusion, argumentation, and constructivism, to name a few. The presentation will provide information about: (1) A manual of natural hazards communication for scientists, policymakers, and media; (2) An up-to-the-minute context of environmental hazards, new technologies & political landscape; (3) A work by natural hazards scientists for geoscientists working with social scientists and communication principles; (4) A work underpinned by key natural hazards communication theories and interspersed with pragmatic solutions; (5) A work that crosses traditional natural hazards boundaries: international, interdisciplinary, theoretical/applied. We will further explore how spatial planning can contribute to risk governance by influencing the occupation of natural hazard-prone areas, and review the central role of emergency management in risk policy. The goal of this presentation is to contribute to the augmentation of the conceptual framework of risk governance and increase the awareness of practitioners and decision-makers to the need to adopt proactive policies, leading to a more integrated, participative, and adaptive governance that can respond more efficiently to the increasing uncertainty resulting from escalating natural hazards risk exposure.

Kontar, Y. Y.

2013-12-01

132

Is "Natural" Always Healthy?  

ERIC Educational Resources Information Center

Currently, the word "natural" is being used to imply health, safety, and wellness. However, many "natural" substances produce psychoactive or physiologic effects which are potentially toxic to the user. (CJ)

Kaufman, M. Robert; Siek, Theodore

1980-01-01

133

The Nature of Haiku  

NSDL National Science Digital Library

Haiku takes advantage of children's curiosity and interest in nature. The open-ended nature of haiku writing is motivational and student centered. Also, the simplicity of haiku allows children to have successful writing experiences. This article describes

JoAnn V. Cleland

1999-10-01

134

Nature/Culture/Seawater  

E-print Network

This essay considers seawater as a substance and symbol in anthropological and social theory. Seawater has occupied an ambiguous place with respect to anthropological categories of nature and culture. Seawater as nature ...

Helmreich, Stefan

135

Natural Gas Flare  

USGS Multimedia Gallery

A natural gas flare. Sometimes, often due to lack of transportation or storage capacity, natural gas that is co-produced with oil will be burned in a flare. This wellpad is in the Tuscaloosa Marine Shale....

136

Erasmus Darwin's Cosmopolitan Nature  

Microsoft Academic Search

No nature poem written during the 1790s was more controversial or more radical in defining what nature is in the modern world than Erasmus Darwin's Botanic Garden. By examining this poem and Henry Jones's \\

Alan Bewell

2009-01-01

137

Natural gas annual 1996  

SciTech Connect

This document provides information on the supply and disposition of natural gas to a wide audience. The 1996 data are presented in a sequence that follows natural gas from it`s production to it`s end use.

NONE

1997-09-01

138

Natural Gas Monthly  

EIA Publications

Highlights activities, events, and analyses associated with the natural gas industry. Volume and price data are presented each month for natural gas production, distribution, consumption, and interstate pipeline activities. Producer related activities and underground storage data are also reported.

2015-01-01

139

Demonstrating Natural Selection  

ERIC Educational Resources Information Center

Describes laboratory exercises with chickens selecting their food from dyed and natural corn kernels as a method of demonstrating natural selection. The procedure is based on the fact that organisms that blend into their surroundings escape predation. (BR)

Hinds, David S.; Amundson, John C.

1975-01-01

140

Natural gas annual 1995  

SciTech Connect

The Natural Gas Annual provides information on the supply and disposition of natural gas to a wide audience including industry, consumers, Federal and State agencies, and educational institutions. The 1995 data are presented in a sequence that follows natural gas (including supplemental supplies) from its production to its end use. This is followed by tables summarizing natural gas supply and disposition from 1991 to 1995 for each Census Division and each State. Annual historical data are shown at the national level.

NONE

1996-11-01

141

Natural gas annual 1994  

SciTech Connect

The Natural Gas Annual provides information on the supply and disposition of natural gas to a wide audience including industry, consumers, Federal and State agencies, and educational institutions. The 1994 data are presented in a sequence that follows natural gas (including supplemental supplies) from its production to its end use. This is followed by tables summarizing natural gas supply and disposition from 1990 to 1994 for each Census Division and each State. Annual historical data are shown at the national level.

NONE

1995-11-17

142

Processing Natural Language without Natural Language Processing  

Microsoft Academic Search

We can still create computer programs displaying only the most rudimentary natural language processing capabilities. One of\\u000a the greatest barriers to advanced natural language processing is our inability to overcome the linguistic knowledge acquisition\\u000a bottleneck. In this paper, we describe recent work in a number of areas, including grammar checker development, automatic\\u000a question answering, and language modeling, where state of

Eric Brill

2003-01-01

143

Antigone's Nature WILLIAM ROBERT  

E-print Network

Antigone's Nature WILLIAM ROBERT Antigone fascinates G. W. F. Hegel and Luce Irigaray, both of whom-turns to Antigone through the double and related lenses of nature and sexual difference. This essay investigates these figures of Antigone and the accompanying ethical accounts of nature and sexual difference as a way

Kovalev, Leonid

144

Drawing From Nature  

NSDL National Science Digital Library

In this activity, learners draw natural objects to explore the details, differences, and similarities of natural objects. Learners investigate plants, seeds, pinecones, and other items from nature at two stations. At station one, learners trace plants on plexiglass. At station two, learners observe small items through magnifying glasses and draw what they see.

2012-06-26

145

Natural and Academic Learning.  

ERIC Educational Resources Information Center

For centuries, there has been a raging debate over the origin of knowledge and the nature of learning. This paper describes the essence of that debate as it relates to understanding the current disjunction between natural learning and academic learning. Natural learning represents the wealth of learning that occurs outside of school, especially…

Collier, Sunya; Iran-Nejad, Asghar

146

PLANNING A NATURE CENTER.  

ERIC Educational Resources Information Center

THIS BULLETIN IS PRODUCED BY THE NATURE CENTERS DIVISION, NATIONAL AUDUBON SOCIETY TO PROVIDE PROFESSIONAL GUIDANCE AND TECHNICAL KNOW-HOW IN THE DEVELOPMENT OF COMMUNITY NATURE AND CONSERVATION CENTERS. THE TOPICS COVERED ARE--(1) PURPOSE AND VALUE OF A NATURE AND CONSERVATION CENTER, (2) INITIAL CONSIDERATIONS SUCH AS COMMUNITY READINESS, LAND…

ASHBAUGH, BYRON L.

147

Natural-gas liquids  

Microsoft Academic Search

Casinghead gasoline or natural gasoline, now more suitably known as natural-gas liquids (NGL), was a nuisance when first found, but was developed into a major and profitable commodity. This part of the petroleum industry began at about the turn of the century, and more than 60 yr later the petroleum industry recovers approx. one million bbl of natural-gas liquids a

W. B. Blackstock; G. W. McCullough; R. C. McCutchan

1968-01-01

148

Bryce Canyon Natural Bridge  

USGS Multimedia Gallery

The Bryce Canyon Natural Bridge. Technically, this is not a natural bridge, which forms when running water erodes a tunnel into a rock formation. Instead, this is a natural arch, similar to the ones in nearby Arches National Park. Bryce Canyon is a unique sandstone formation in southern Utah. It is...

149

Natural Resource Extension Professionals  

E-print Network

3rd Natural Resource Extension Professionals Conference Revolutionizing or Evolutionizing Extension of University of Florida, IFAS Communication Services Center for Natural Resources #12;#12;i Welcome to the 3rd Natural Resource Extension Professionals Conference! The program committee has prepared an exciting

Watson, Craig A.

150

Evolution by Natural Selection  

NSDL National Science Digital Library

Principles of natural selection are demonstrated by a simulation that involves different color pom-poms and student feeders equipped with different types of feeding implements. Students analyze results to see how different traits contribute to fitness in different habitats. Additional examples and questions help students to understand the process of natural selection, including three necessary conditions for natural selection to take place.

Jennifer Doherty

151

Visualizingandquantifying natural selection  

E-print Network

REVIEWS Visualizingandquantifying natural selection Edmund D. Brodie III, Allen 1. Moore. A thorough comprehen- sion of the occurrence, form and significance of selection in natural populations of current evolu- tionary research is the detection, demonstration and description of selection in nature

Brodie III, Edmund D.

152

Natural language processors  

SciTech Connect

The development of natural language processors has required a shift in the perception of language structures to bring the user interface closer to the ultimate ease of natural language dialogue. This article explains the principles of these new natural language processors which are increasingly becoming commercially available.

Rauzino, V.C.

1983-09-05

153

College of Engineering EM Engineering Mechanics  

E-print Network

College of Engineering EM Engineering Mechanics KEY: # = new course * = course changed = course or concur: MA 213. EM 302 MECHANICS OF DEFORMABLE SOLIDS. (3 of Engineering or consent of chairperson, and EM 221; prereq or concur: MA 214. EM 313 DYNAMICS. (3

MacAdam, Keith

154

Ncleo de Aplicao e Pesquisa de Geotecnologias em Desastres Naturais e Eventos Extremos no Centro Regional Sul do INPE  

E-print Network

and Research of Geotecnologies in Natural Disasters and Extreme Events of the INPE Southern Regional Center and their consequences. Palavras-chave: natural disaster, geotechnologies, southern region, Mercosul, INPE/CSR, desastres tornádicas no hemisfério Sul (Brooks et al. 2003). Marcelino (2003) confirma a atuação destas tempestades em

155

On nature and bioethics.  

PubMed

The account of nature and humanity's relationship to nature are of central importance for bioethics. The Scientific Revolution was a critical development in the history of this question and many contemporary accounts of nature find their beginnings here. While the innovative approach to nature going out of the seventeenth century was reliant upon accounts of nature from the early modern period, the Middle Ages, late-antiquity and antiquity, it also parted ways with some of the understandings of nature from these epochs. Here I analyze this development and suggests that some of the insights from older understandings of nature may be helpful for bioethics today, even if there can be no simple return to them. PMID:21644431

Peterson, Paul Silas

2010-01-01

156

Novel natural food antimicrobials.  

PubMed

Naturally occurring antimicrobial compounds could be applied as food preservatives to protect food quality and extend the shelf life of foods and beverages. These compounds are naturally produced and isolated from various sources, including plants, animals and microorganisms, in which they constitute part of host defense systems. Many naturally occurring compounds, such as nisin, plant essential oils, and natamycin, have been widely studied and are reported to be effective in their potential role as antimicrobial agents against spoilage and pathogenic microorganisms. Although some of these natural antimicrobials are commercially available and applied in food processing, their efficacy, consumer acceptance and regulation are not well defined. This manuscript reviews natural antimicrobial compounds with reference to their applications in food when applied individually or in combination with other hurdles. It also reviews the mechanism of action of selected natural antimicrobials, factors affecting their antimicrobial activities, and future prospects for use of natural antimicrobials in the food industry. PMID:22385168

Juneja, Vijay K; Dwivedi, Hari P; Yan, Xianghe

2012-01-01

157

EPA LABORATORIES IMPLEMENT EMS PROGRAM  

EPA Science Inventory

This paper highlights the breadth and magnitude of carrying out an effective Environmental Management System (EMS) program at the U.S. EPA's research and development laboratories. Federal research laboratories have unique operating challenges compared to more centralized industr...

158

Spatial based Expectation Maximizing (EM)  

PubMed Central

Background Expectation maximizing (EM) is one of the common approaches for image segmentation. Methods an improvement of the EM algorithm is proposed and its effectiveness for MRI brain image segmentation is investigated. In order to improve EM performance, the proposed algorithms incorporates neighbourhood information into the clustering process. At first, average image is obtained as neighbourhood information and then it is incorporated in clustering process. Also, as an option, user-interaction is used to improve segmentation results. Simulated and real MR volumes are used to compare the efficiency of the proposed improvement with the existing neighbourhood based extension for EM and FCM. Results the findings show that the proposed algorithm produces higher similarity index. Conclusions experiments demonstrate the effectiveness of the proposed algorithm in compare to other existing algorithms on various noise levels. PMID:22029864

2011-01-01

159

238 NATURE|VOL431|16SEPTEMBER2004|www.nature.com/nature 2004 NaturePublishing Group  

E-print Network

238 NATURE|VOL431|16SEPTEMBER2004|www.nature.com/nature ©2004 NaturePublishing Group #12;I n. So, for the first time in Nature's history, we have given the candidates the chance to address editor See news@nature.com for more election coverage www.nature.com/news Head to head The party

160

B-EM: A Classifier Incorporating Bootstrap with EM Approach for Data Mining  

E-print Network

B-EM: A Classifier Incorporating Bootstrap with EM Approach for Data Mining Xintao Wu UNC that the more unlabeled examples are combined in learning, the more accurate the result. We then introduce B-EM

Wu, Xintao

161

Nature Macmillan Publishers Ltd 1998 letters to nature  

E-print Network

. Kaunzinger & Peter J. Morin Department of Ecology, Evolution & Natural Resources, Rutgers University, New Brunswick, New Jersey 08903-0231, USANature © Macmillan Publishers Ltd 1998 8 letters to nature NATURE |VOL 395 |1 OCTOBER 1998 |www.nature

Utrecht, Universiteit

162

Nature and health.  

PubMed

Urbanization, resource exploitation, and lifestyle changes have diminished possibilities for human contact with nature in urbanized societies. Concern about the loss has helped motivate research on the health benefits of contact with nature. Reviewing that research here, we focus on nature as represented by aspects of the physical environment relevant to planning, design, and policy measures that serve broad segments of urbanized societies. We discuss difficulties in defining "nature" and reasons for the current expansion of the research field, and we assess available reviews. We then consider research on pathways between nature and health involving air quality, physical activity, social cohesion, and stress reduction. Finally, we discuss methodological issues and priorities for future research. The extant research does describe an array of benefits of contact with nature, and evidence regarding some benefits is strong; however, some findings indicate caution is needed in applying beliefs about those benefits, and substantial gaps in knowledge remain. PMID:24387090

Hartig, Terry; Mitchell, Richard; de Vries, Sjerp; Frumkin, Howard

2014-01-01

163

A Natural Selection  

NSDL National Science Digital Library

The high school science laboratory provides a natural environment for students to learn through scientist-teacher partnerships. A dynamic learning community, authentic inquiry, a deeper understanding of the nature of science, and learning about scientific careers are all benefits of scientist-teacher partnerships. This article focuses on the benefits of partnerships while describing how one specific partnership team developed a natural selection laboratory to integrate with a high school biology curriculum.

Katherine M. Nielsen

2005-10-01

164

Eternal recurrence and nature  

E-print Network

believe that we have a measure of control over the forces of Nature. But eternal recurrence, according to Seung, functions as a metaphor that forces Zarathustra to acknowledge his autonomous will?s inability to assert itself against Nature. For eternal... ETERNAL RECURRENCE AND NATURE A Thesis by KYLE EVAN MASK Submitted to the Office of Graduate Studies of Texas A&M University in partial fulfillment of the requirements for the degree of MASTER OF ARTS August 2008...

Mask, Kyle Evan

2008-10-10

165

Adsorbed Natural Gas Technology  

NASA Astrophysics Data System (ADS)

The current status of adsorbed natural gas technology for the vehicle fueling sector is reviewed. It is shown that there are solutions to the all of the problems associated to adsorption storage, and that it is possible to build a light, compact, and efficient system for storage, distribution, and dispensing of natural gas. The practical achievement of this objective is essential for the natural gas vehicle to create a strong and sustained interest of the automotive market.

Mota, José Paulo

166

Preparing for Natural Disasters  

NSDL National Science Digital Library

How can you prepare for different natural disasters? Let's learn about different ways to prepare for natural disasters. Use classroom login for BrainPop Jr. Videos. Complete the Natural Disaster Chart as you learn from these websites and videos. First, watch the Earthquake Video Now scroll to page 5 of How to Prepare for Earthquakes. Next, watch the Flood Video Now scroll to page 4 of How to Prepare for Floods. Next, watch the Hurricane Video Now scroll ...

casey_piper

2012-04-05

167

Natural gas annual 1997  

SciTech Connect

The Natural Gas Annual provides information on the supply and disposition of natural gas to a wide audience including industry, consumers, Federal and State agencies, and educational institutions. The 1997 data are presented in a sequence that follows natural gas (including supplemental supplies) from its production to its end use. This is followed by tables summarizing natural gas supply and disposition from 1993 to 1997 for each Census Division and each State. Annual historical data are shown at the national level. 27 figs., 109 tabs.

NONE

1998-10-01

168

Nature: International Science Jobs  

NSDL National Science Digital Library

Nature journal's jobs page contains an international science jobs search engine. This feature lets users search out potential employment based on subject, location, type of organization, and position.

169

SUPPLEMENTARY INFORMATION 1www.nature.com/nature  

E-print Network

SUPPLEMENTARY INFORMATION 1www.nature.com/nature doi: 10.1038/nature07641 Figure S1 | Temporal-3). Images were taken at indicated times after induction of ER stress with 10 mM DTT. #12;2www.nature.com/nature doi: 10.1038/nature07641 SUPPLEMENTARY INFORMATION Figure S2 | Temporal relation of foci formation

Walter, Peter

170

SUPPLEMENTARY INFORMATION 1www.nature.com/nature  

E-print Network

SUPPLEMENTARY INFORMATION 1www.nature.com/nature doi: 10.1038/nature07883 wt MEF Fu­/­ MTEC ac cilia in either wt or Fu-/- cells treated apical- ly with ShhN. #12;2www.nature.com/nature doi: 10.1038/nature07883 SUPPLEMENTARY INFORMATION acetylated tubulin wt MTEC Fu­/­ MTEC phalloidin merged a b c d e f

Chuang, Pao-Tien

171

Magnetic Properties of the Basalt in Hole EM 7, Mohole Project  

Microsoft Academic Search

The average direction of the remanent magnetization of the basalt layer at the bottom of hole EM 7 is inclined 36 ø above tile horizontal, indicating that the layer is reversely magnetized. Detailed demagnetization experiments with alternating magnetic fields to 800 oer- steds peak intensity indicate that the drilling operations did not remagnetize the basalts. The natural magnetization is extremely

Allan Cox; Richard R. Doell

1962-01-01

172

Is That Natural?  

NSDL National Science Digital Library

Students will brainstorm ways that they use — and waste — natural resources. Also, they will respond to some facts about population growth and how people use petroleum. Lastly, students will consider the different ways that engineers interact with and use our natural resources.

Integrated Teaching and Learning Program,

173

Birds. Nature Discovery I.  

ERIC Educational Resources Information Center

The birds of New England and their particular habitats are explored in this guide which is part of a series of Nature Discovery publications. The materials are designed to directly supplement the natural science curricula and to complement other subject areas including social studies, language arts, music, and art. The program is designed for…

Stone, Sally F.

174

Introduction to Exploring Nature  

ERIC Educational Resources Information Center

Children are fascinated with the world of nature. From the tiniest of seeds to the highest of birds, they wonder "Why?" "How?" and "What can I do with it?" This paper provides intriguing nature activities that provide a solid starting point for expanding children's thinking and learning. Through these activities, children will be building skills…

Early Childhood Today, 2006

2006-01-01

175

CONNECTICUT NATURAL DIVERSITY DATABASE  

EPA Science Inventory

This is a statewide datalayer at 1:24,000 scale of general areas of concern with regards to state and federally listed Endangered, Threatened, and Special Concern species and significant natural communities. Locations of species and natural communities are based on data collecte...

176

Sketching in Nature  

ERIC Educational Resources Information Center

Nature journaling is a useful skill for science students, independent of whether they also consider themselves artists. A pencil and sketchbook can be carried anywhere to record ecological information in many ways. A traditional page in a nature journal may consist of quick studies of plant and animal life sketched out as rudimentary line drawings…

Hobart, April

2005-01-01

177

Natural capital and sustainability  

Microsoft Academic Search

This paper develops and rigorously analyses a model describing the optimal use of natural capital in a utilitarian framework. Natural capital is treated as an aggregate including exhaustibles, renewables and ‘environmentals’, performing several functions. It is found that it converges to a steady-state in which it is kept constant by simultaneous investments and use.

Jan van Geldrop; Cees Withagen

2000-01-01

178

SENECA AND NATURE  

Microsoft Academic Search

Ralph Waldo Emerson addresses nature in two of his works: an 1836 booklet which is a ponderous religious tract 1 and an elegant and sophisticated essay, one of the second series of essays published in 1844. 2 His first words, “On a beautiful October day,” furnish the clue for how he starts: he begins by talking of nature as if

THOMAS G. ROSENMEYER

2000-01-01

179

Nature Foil Reliefs  

ERIC Educational Resources Information Center

Nature has always been a source of inspiration for artists across the centuries. Artists such as Leonardo da Vinci, Georgia O'Keeffe, Ansel Adams, and Andy Goldsworthy all drew inspiration for their work from nature. Seeds come from the dried pods, which when planted and cared for, bear fruit. In this article, the author describes how her…

Lane, Shaw J.

2012-01-01

180

Epidemics after Natural Disasters  

Microsoft Academic Search

The relationship between natural disasters and com- municable diseases is frequently misconstrued. The risk for outbreaks is often presumed to be very high in the chaos that follows natural disasters, a fear likely derived from a perceived association between dead bodies and epidem- ics. However, the risk factors for outbreaks after disasters are associated primarily with population displacement. The availability

John T. Watson; Michelle Gayer; Maire A. Connolly

2007-01-01

181

Bryce Canyon Natural Bridge  

USGS Multimedia Gallery

Bryce Canyon's Natural Bridge is technically a natural arch, similar to those in the nearby Arches National Park. Bryce Canyon is a unique sandstone formation in southern Utah. It is home to a large number of hoodoos, which are oddly shaped pillars of rock that formed due to different erosion rates...

182

Natural Resources Bibliography.  

ERIC Educational Resources Information Center

This bibliography presents a modern definition of the conceptual framework from which to view natural resources, and affords access to information which examines resources from the social scientists point of view. It presents five broad divisions of activity or variables which include (1) Natural and Human Resources, (2) Epistomological and…

Hoadley, Irene Braden

183

Nature and Embodied Education  

Microsoft Academic Search

An embodied educational environment is one that is in tune with the intimate connection of the body and the mind. This article explores the importance of nature in creating such environments. The main theme is that emerging multidisciplinary thought on the embodied mind can provide new ways to understand the positive role of nature in children's education. New pers- pectives

Kevin Rathunde

184

Design Inspired by Nature  

NSDL National Science Digital Library

Students discover how engineers can use biomimicry to enhance their designs. They learn how careful observation of nature — becoming a nature detective, so to speak — can lead to new innovations and products. In this activity, students reverse engineer a flower to glean design ideas for new products.

2014-09-18

185

On Teaching Natural Law.  

ERIC Educational Resources Information Center

A brief look at Columbia, Harvard, and Notre Dame law schools shows that the American tradition in teaching natural law has not been strong. The value of teaching natural law is discussed, a separate course or seminar is seen as the most effective option, and a selection of available sources for such a course is appended. (JMD)

Forte, David F.

1978-01-01

186

Modeling Natural Selection  

ERIC Educational Resources Information Center

In their research, scientists generate, test, and modify scientific models. These models can be shared with others and demonstrate a scientist's understanding of how the natural world works. Similarly, students can generate and modify models to gain a better understanding of the content, process, and nature of science (Kenyon, Schwarz, and Hug…

Bogiages, Christopher A.; Lotter, Christine

2011-01-01

187

On Valuing Nature  

Microsoft Academic Search

The impersonal side of accounting for nature is discussed, where accounting reduces the environment to mere monetary values. The cause of personal interest in the beauty and worth of nature is pleaded and weighed against the mercenary interests of sacrificing the environment to industrial, national and professional self-advancement in the name of accounting, i.e. accountancy should be bound by the

Ruth Hines

1991-01-01

188

Research Component - Natural Sciences.  

ERIC Educational Resources Information Center

The research component in the natural sciences does not have to be changed. Ninety-three percent of the students surveyed by Ann Heiss for her book "The Challenge to the Graduate Schools" felt that the research component of the natural sciences contributed to their scientific development, and 85 percent felt that it was intellectually stimulating.…

Cooke, Donald

189

Thermoacoustic natural gas liquefier  

SciTech Connect

This is the final report of a two-year, Laboratory-Directed Research and Development (LDRD) project at the Los Alamos National Laboratory (LANL). This project sought to develop a natural-gas-powered natural-gas liquefier that has absolutely no moving parts and requires no electrical power. It should have high efficiency, remarkable reliability, and low cost. The thermoacoustic natural-gas liquefier (TANGL) is based on our recent invention of the first no-moving-parts cryogenic refrigerator. In short, our invention uses acoustic phenomena to produce refrigeration from heat, with no moving parts. The required apparatus comprises nothing more than heat exchangers and pipes, made of common materials, without exacting tolerances. Its initial experimental success in a small size lead us to propose a more ambitious application: large-energy liquefaction of natural gas, using combustion of natural gas as the energy source. TANGL was designed to be maintenance-free, inexpensive, portable, and environmentally benign.

Swift, G.; Gardner, D.; Hayden, M.; Radebaugh, R. [National Inst. of Standards and Technology, Gaithersburg, MD (United States); Wollan, J. [Cryenco, Inc. (United States)

1996-07-01

190

Human Natures, Nature Conservation, and Environmental Ethics  

Microsoft Academic Search

scientific community today about the global ecological sit-uation and the resultant need for nature conservation (e. g., NAS 1993, UCS 1993). Now is a time of unprecedented, es-calating, and well-documented environmental danger. There is general agreement among environmental scientists that the accelerating loss of biodiversity, populations (Hughes et al. 1997), species, and communities, should be a matter of great concern.

PAUL R. EHRLICH

2002-01-01

191

Nature as Second Nature: Plasticity and Habit  

Microsoft Academic Search

I will begin where Stephen Erickson ends “Reflections on Secular Foundationalism and Our Human Future,” with the grape (Erickson,\\u000a 2009). His speculations concerning the moral issues that will likely arise in light of the development of new biotechnologies\\u000a draws into question the very possibility of clearly dividing human nature from cultural artifice. They draw into question\\u000a the possibility of distinguishing

Peter Wake

192

Natural History Museum: British Natural History  

NSDL National Science Digital Library

Although some might fear that limited land resources and the usual development pressures are working to reduce Britain's natural history to footnote status, this website from the Natural History Museum in London effectively documents the UK's impressive biological and geological diversity. The site consists of interactive database features as well as videos (in both Windows Media and Quicktime formats). Exploring Biodiversity, an interactive introduction for students to UK biodiversity, allows users to compare the flora of different UK postal districts and also to download a version of WORLDMAP, the Museum's innovative distribution analysis software. The Earth Lab Datasite is a searchable database of fossils, rocks and minerals organized in part by geographic distribution. The Postcode Plants Database allows users to generate local lists of UK plants and/or animals. The British Natural History video, produced by the Museum's Darwin Centre, presents an online tour of the UK's wildlife scene, while Ornithology of the Orkney Islands looks at the work of bird researcher on these Scottish isles and also includes a discussion of migration studies with Museum ornithologist Douglas Russell. The site is best viewed with Netscape Communicator versions 4.5 to 4.8 and Microsoft Internet Explorer version 5 and later.

193

Populações estelares em galáxias HII  

NASA Astrophysics Data System (ADS)

Analisamos o conteúdo estelar de 74 galáxias HII a partir do contínuo observado nos espectros ópticos dessas galáxias, utilizando métodos de síntese de população estelar. Descobrimos que todas as galáxias para as quais encontramos soluções contêm uma população estelar velha que domina a massa estelar, e numa maioria dessas também encontramos evidência de uma população de idade intermediaria além da geração jovem que está se formando agora. Concluímos que a formação estelar dessas galáxias se realiza em surtos individuais, Esses surtos são interrompidos por longos períodos de inatividade, com os primeiros consumindo a maior parte do gás. Sugerimos, portanto, que as galáxias HII sejam galáxias anãs normais flagradas em um período de surto.

Westera, P.; Cuisinier, F.; Telles, E.; Kehrig, C.

2003-08-01

194

REGIMENTO DO CURSO DE PS-GRADUAO EM ENGENHARIA E TECNOLOGIA ESPACIAIS, REA DE CONCENTRAO EM  

E-print Network

REGIMENTO DO CURSO DE PÓS-GRADUAÇÃO EM ENGENHARIA E TECNOLOGIA ESPACIAIS, ÁREA DE CONCENTRAÇÂO EM Propulsão (PCP) do Curso de Pós-graduação em Engenharia e Tecnologia Espaciais (ETE) objetiva formar e de Pós-Graduação, pelo Regimento do Curso de Pós- Graduação em Engenharia e Tecnologia Espaciais e

195

Burning the EMS candle. EMS shifts and worker fatigue.  

PubMed

Has coffee become your best friend? Do you sleep only in your dreams? Is your bed merely an illusion? If so, you are not alone; sleep deprivation is a fact of life for many EMS personnel. Though widely accepted, isn't it time that we question the effects of those long days and nights? PMID:10116022

McCallion, R; Fazackerley, J

1991-10-01

196

Nature North Zine  

NSDL National Science Digital Library

Nature North Zine is a folksy, online magazine focused on the natural history of Manitoba and surrounding regions of North America. Site visitors can access sections for Spring, Summer, Fall, and Winter. The seasonal sections contain a variety of brief articles (from different dates) that address such subjects as wood frogs, native plant gardening, violets, snow snakes, and amphibians of Manitoba. The site also contains some very nice nature photographs in the Dragonflies of Manitoba and Images of Manitoba sections. Be sure not to miss the beautiful image of the Bohemian waxwing with a bright, red berry in its beak.

197

Natural resources - constitutional law  

SciTech Connect

New England Power Co. reaffirms Congressional authority under the commerce clause to regulate interstate trade in natural resources. The Supreme Court has consistently held that states cannot restrict to their own citizens the benefits of natural resources located within state boundaries. As a result, a state's control over such resources is largely limited to taxing their generation or extraction. New England Power Co. reiterates the Court's adamant stand against economic protectionism, especially when natural resources are concerned. Secondarily, this case establishes that Congressional consent to otherwise impermissible state regulation of interstate commerce must be express; the Court will not infer such consent. 29 references.

Jorgensen, C.L.

1983-10-01

198

Natural Resources Conservation Service  

NSDL National Science Digital Library

The Natural Resources Conservation Service(NRCS)provides leadership in a partnership effort to help people conserve, maintain, and improve our natural resources and environment. This site offers an overview of the agency's goals, history, and organization as well as information on the latest news involving or affecting natural resources and/or NRCS. Topics found on this site may include a plants database, farming and ranching information, widespread conservation information, and practical backyard conservation. More specific topics are covered in greater detail through government reports, conservation tips & techniques, and reports from NRCS research projects.

199

Natural Cooling Retrofit  

E-print Network

's commercial and industrial buildings have a significant, year-round cool ing load during "occupied" hours due to interior heat gain from people, I ights, and equipment. Many bui ldings with non-reflective glass experience significant solar cool ing loads... of the most important design considerations for any method of Natural Cool ing is the chil led water temperature range selected for use during Natural Cool ing. Figure VI shows that for a hypo thetical Chicago plant, the hours of operation for a Natural...

Fenster, L. C.; Grantier, A. J.

1981-01-01

200

Instituto Brasileiro de Informao em Cincia e Tecnologia  

E-print Network

ibict Instituto Brasileiro de Informação em Ciência e Tecnologia OJS em uma Hora 1 OJS em uma hora Meinert ­ 06 de outubro de 2006 #12;ibict Instituto Brasileiro de Informação em Ciência e Tecnologia OJS Brasileiro de Informação em Ciência e Tecnologia OJS em uma Hora 3 Visão GeralVisão GeralVisão Geral

Paraná, Universidade Federal do

201

What is a Natural SUSY scenario?  

E-print Network

The idea of "Natural SUSY", understood as a supersymmetric scenario where the fine-tuning is as mild as possible, is a reasonable guide to explore supersymmetric phenomenology. In this paper, we re-examine this issue including several improvements, such as the mixing of the fine-tuning conditions for different soft terms and the presence of potential extra fine-tunings that must be combined with the electroweak one. We give tables and plots that allow to easily evaluate the fine-tuning and the corresponding naturalness bounds for any theoretical model defined at any high-energy (HE) scale. Then, we analyze in detail the complete fine-tuning bounds for the unconstrained MSSM, defined at any HE scale. We show that Natural SUSY does {\\em not} demand light stops. Actually, an average stop mass below 800~GeV is disfavored, though one of the stops might be very light. Regarding phenomenology, the most stringent upper bound from naturalness is the one on the gluino mass, which typically sets the present level fine-tuning at ${\\cal O}(1\\%)$. However, this result presents a strong dependence on the HE scale. E.g. if the latter is $10^7$~GeV the level of fine-tuning is $\\sim$ four times less severe. Finally, the most robust result of Natural SUSY is by far that Higgsinos should be rather light, certainly below 700~GeV for a fine-tuning of ${\\cal O}(1\\%)$ or milder. Incidentally, this upper bound is not far from $\\simeq1$~TeV, which is the value required if dark matter is made of Higgsinos.

J. Alberto Casas; Jesus M. Moreno; Sandra Robles; Krzysztof Rolbiecki; Bryan Zaldivar

2014-07-25

202

EM 306 Statics ABET EC2000 syllabus  

E-print Network

Edition Other Required Material: None Course Objectives: To be able to analyze systems of forcesEM 306 ­ Statics Page 1 ABET EC2000 syllabus EM 306 ­ Statics Fall and Spring 2009-10 Required Assignments: None Laboratory Projects: None #12;EM 306 ­ Statics Page 2 ABET EC2000 syllabus Contribution

Ben-Yakar, Adela

203

Project planning for EMS and SCADA systems  

Microsoft Academic Search

A typical supervisory control and data acquisition (SCADA) system or an energy management system (EMS) has an installed life of only 10 to 15 years. Because it can take five years or more to implement a new EMS or SCADA system, managing such projects is becoming a way of life for utilities. Project planning for EMS and SCADA systems is

Charles T. Lindeberg; Wayne R. Block

1993-01-01

204

The Human Relation With Nature and Technological Nature  

Microsoft Academic Search

Two world trends are powerfully reshaping human existence: the degradation, if not destruction, of large parts of the natural world, and unprecedented technological development. At the nexus of these two trends lies technological nature—technologies that in various ways mediate, augment, or simulate the natural world. Current examples of technological nature include videos and live webcams of nature, robot animals, and

Peter H. Kahn; Rachel L. Severson; Jolina H. Ruckert

2009-01-01

205

Nature Tables: Stimulating Children's Interest in Natural Objects  

ERIC Educational Resources Information Center

Primary school pupils in the UK today may be less familiar with natural objects, less exposed to formal natural history teaching and have less time given to school-based observation and discussion of natural objects. This study of children's responses to a "Nature Table" of displayed natural objects was designed to assess pupils' knowledge of…

Tomkins, Stephen; Tunnicliffe, Sue Dale

2007-01-01

206

NATURE CHEMISTRY | www.nature.com/naturechemistry 1 SUPPLEMENTARY INFORMATION  

E-print Network

NATURE CHEMISTRY | www.nature.com/naturechemistry 1 SUPPLEMENTARY INFORMATION DOI: 10.1038/NCHEM compounds from natural products Robert W. Huigens III, Karen C. Morrison, Robert W. Hicklin, Timothy A Publishers Limited. All rights reserved. #12;NATURE CHEMISTRY | www.nature.com/naturechemistry 2

Hergenrother, Paul J.

207

Natural Resources Defense Council  

NSDL National Science Digital Library

From the Natural Resources Defense Council, this website has the latest news from the Hill, plus information everyone needs on the state of our air, water, land and health. Initial contents include "State of Nature," a regular bulletin on environmental legislation; action guidelines; and findings on subjects ranging from children and environmental carcinogens to the pollution of U.S. coastal waters. Features in development include action alerts; consumer-oriented facts and FAQs; environmental multimedia clips; research tips; and more. The Natural Resources Defense Council is a national organization working in courtrooms, legislative chambers, regulatory agencies and the public arena to protect the world's natural resources and ensure a healthy environment for all.

208

Nature Picture Library  

NSDL National Science Digital Library

While a commercial enterprise, the Nature Picture Library offers viewers free online access to thousands of high-resolution photographs in its database. Containing fantastic shots of flora and fauna in settings of every variety, the Nature Picture Library is a great graphic resource for those in search of images of the natural world. Images can be purchased for direct downloads or can be stored online for free by registered users in lightboxes of their own design. The picture library allows registrants to create and store as many as fifty lightboxes for online consultation. A great way to see the world and all its creatures, the Nature Picture Library is sure to provoke awe, admiration, and devotion from users of every age.

209

Some Natural Pesticide Alternatives  

MedlinePLUS

... Pest Management web site. http://www.epa.gov/pesticides/factsheets/ipm.htm City of Tucson/ Pima County ... Grant Road Printed on recycled paper. SOME NATURAL PESTICIDE ALTERNATIVES For the safety of you, your family ...

210

Natural antimicrobials in pregnancy   

E-print Network

Natural antimicrobials are peptides that are essential components of the innate immune system, providing broad-spectrum protection against bacteria, yeasts and some viruses. In addition to their innate immune activity, ...

Stock, Sarah J.E.

2008-01-01

211

Natural drinking strategies  

E-print Network

We examine the fluid mechanics of drinking in nature. We classify the drinking strategies of a broad range of creatures according to the principal forces involved, and present physical pictures for each style. Simple scaling ...

Kim, Wonjung

212

Automatic natural language parsing  

SciTech Connect

This collection of papers on automatic natural language parsing examines research and development in language processing over the past decade. It focuses on current trends toward a phrase structure grammar and deterministic parsing.

Sprack-Jones, K.; Wilks, Y.

1985-01-01

213

Natural Disasters in Florida  

NSDL National Science Digital Library

The students will translate the information they have gained into a poster/picture of Florida's natural disasters, label the storms, and list on the poster at least three safety practices to use with each storm.

Claudia Markham-Ahl

2011-10-18

214

Natural Selection Lesson  

NSDL National Science Digital Library

The Natural Selection lesson uses a Monte Carlo model of spot size with variability between generations in an environment with predators to study how variation and environment can affect a species over time.

David Joiner

215

Natural Aggregate: A Primer  

NSDL National Science Digital Library

This slide show provides an introduction to the production and uses of natural aggregate. Topics include some definitions, uses, and demand for aggregate. There is also information on its occurrence, mining, and production.

Bill Langer

216

Immigration and Naturalization Statistics  

NSDL National Science Digital Library

The Immigration and Naturalizations Service Statistics site provides "comprehensive annual immigration statistics from 1994-1996, as well as state estimates of the United States' illegal alien resident and foreign-born populations."

United States. Immigration and Naturalization Service.

217

Natural gas monthly  

SciTech Connect

This document highlights activities, events, and analyses of interest to public and private sector organizations associated with the natural gas industry. Data presented include volume and price, production, consumption, underground storage, and interstate pipeline activities.

NONE

1996-05-01

218

Parallels with nature  

NASA Astrophysics Data System (ADS)

Adam Nelson and Stuart Warriner, from the University of Leeds, talk with Nature Chemistry about their work to develop viable synthetic strategies for preparing new chemical structures in parallel with the identification of desirable biological activity.

2014-10-01

219

The "Natural Law Tradition."  

ERIC Educational Resources Information Center

A discussion of natural law outlines some of the theory and tradition surrounding it and examines its relationship to the social science and legal curriculum and to the teaching of jurisprudence. (MSE)

Finnis, John

1986-01-01

220

On cosmic natural selection  

E-print Network

The rate of black hole formation can be increased by increasing the value of the cosmological constant. This falsifies Smolin's conjecture that the values of all constants of nature are adjusted to maximize black hole production.

Alexander Vilenkin

2006-11-27

221

Natural Hazards Term Project  

NSDL National Science Digital Library

Students apply the concepts learned in the class by preparing two (2) term projects discussing two natural hazards and how they impact the area where the student lives (or an area the student might like to live in).

Michael Phillips

222

Make a Nature Trail  

ERIC Educational Resources Information Center

Discusses the planning, construction, use, and maintenance of a nature trail. Ideal for demonstrating interrelationships between plants and animals, conservation practices, wildlife management, plant succession, forestry, geologic features and other scientific phenomena. (JR)

Johnson, Janice K.

1973-01-01

223

Research Highlights Nature Nanotechnology  

E-print Network

have shown that the combustion performance of nitromethane, a potential rocket propellant, can for enhanced fuel/propellant combustion. ACS Nano doi:10.1021/nn901006w (2009). | Article | OpenURL 1. Nature

Aksay, Ilhan A.

224

Nature of Science  

NSDL National Science Digital Library

Teacher resource to build background knowledge of Nature of Science and how to include in classroom instruction. This website includes a lesson plan and several activities that help students learn about the skill of observation in science.

Center for Technology and Teacher Education

2011-09-13

225

Mutualistic relationships in nature  

NSDL National Science Digital Library

Many organisms depend on other organisms for survival. Mutualism is when two organisms have a relationship in nature and each benefits from the relationship. Pollination and lichens are the best examples of mutualism.

Katie Hale (California State University, Fullerton; Student, Biological Science)

2006-12-30

226

Second variational derivative of gauge-natural invariant Lagrangians and conservation laws  

E-print Network

We consider the second variational derivative of a given gauge-natural invariant Lagrangian taken with respect to (prolongations of) vertical parts of gauge-natural lifts of infinitesimal principal automorphisms. By requiring such a second variational derivative to vanish, {\\em via} the Second Noether Theorem we find that a covariant strongly conserved current is canonically associated with the deformed Lagrangian obtained by contracting Euler--Lagrange equations of the original Lagrangian with (prolongations of) vertical parts of gauge-natural lifts of infinitesimal principal automorphisms lying in the kernel of the generalized gauge-natural Jacobi morphism.

M. Francaviglia; M. Palese; E. Winterroth

2005-06-15

227

Fossil Fuels: Natural Gas  

NSDL National Science Digital Library

This lesson provides an introduction to the use of natural gas as an energy source. Topics include its advantages (cleanliness, fewer carbon emissions), disadvantages (difficulty in transport and storage), sources, and usage. There is also a discussion of the creation and production of natural gas, the United States' production and reserves, and some potential new sources (coal bed methane, methane hydrates). The lesson includes an activity in which students investigate porosity and permeability in simulated sediments.

John Pratte

228

Nature Web Focus: SARS  

NSDL National Science Digital Library

The journal Nature offers this free Web focus on Severe Acute Respiratory Syndrome (SARS), in which Nature's reporters pose key questions about the outbreak, and assess our preparedness to deal with future viral threats. Reader will find dozens of articles, including editorials, Science Updates, and Brief Communications from the journal. The articles trace the chronology of the SARS epidemic, and the section titled What Have We Learned? offers an excellent overview of what we know and what remains to be seen.

2007-12-12

229

USGS: Natural Hazards Gateway  

NSDL National Science Digital Library

This portal provides access to maps, data, and other information on the distribution and frequency of natural hazards in the United States. The material is arranged into seven categories: earthquakes, floods, hurricanes, landslides, tsunamis, volcanoes, and wildfires. There are also links to disaster emergency and relief organizations and to real-time resources such as RSS feeds, advisories, and the Natural Hazards Support System (NHSS), a system that enables users to monitor events as they occur anywhere on Earth.

230

Lesson "Balance in Nature  

NASA Astrophysics Data System (ADS)

Lesson "Balance in Nature" This simulation game-lesson (Balance in Nature) gives an opportunity for the students to show creativity, work independently, and to create models and ideas. It creates future-oriented thought connected to their experience, allowing them to propose solutions for global problems and personal responsibility for their activities. The class is divided in two teams. Each team chooses questions. 1. Question: Pollution in the environment. 2. Question: Care for nature and climate. The teams work on the chosen tasks. They make drafts, notes and formulate their solutions on small pieces of paper, explaining the impact on nature and society. They express their points of view using many different opinions. This generates alternative thoughts and results in creative solutions. With the new knowledge and positive behaviour defined, everybody realizes that they can do something positive towards nature and climate problems and the importance of individuals for solving global problems is evident. Our main goal is to recover the ecological balance, and everybody explains his or her own well-grounded opinions. In this work process the students obtain knowledge, skills and more responsible behaviour. This process, based on his or her own experience, dialogue and teamwork, helps the participant's self-development. Making the model "human? nature" expresses how human activities impact the natural Earth and how these impacts in turn affect society. Taking personal responsibility, we can reduce global warming and help the Earth. By helping nature we help ourselves. Teacher: Veselina Boycheva-Chapanova " Saint Patriarch Evtimii" Scholl Str. "Ivan Vazov"-19 Plovdiv Bulgaria

Chapanova, V.

2012-04-01

231

Mining for Natural Resources  

NSDL National Science Digital Library

In this activity, students mine the chips from chocolate chip cookies. They weigh the cookies before and after mining, weigh the chips, and calculate the percent yield. This lab is designed to give students a better understanding of the processes involved in harvesting a natural resource and the impact it has on their environment and community. Analysis and conclusion questions focus on the fact that the mining of nonrenewable natural resources has a dramatic effect on our environment.

Vince Obremski

232

Natural hazard zonation  

USGS Publications Warehouse

This paper presents the basic scientific principles underpinning the professional practice of zonation for natural hazards such as floods, severe storms, earthquakes, volcanic eruptions, landslides, wildfires, tsunamis, and droughts. Zonation is the scientific process of identifying those parts of a geographic area which are best and least suited for community development in terms of their exposure to the physical effects of recurring, rapid onset, natural hazards.

Hays, Walter W.

1996-01-01

233

Aristotle'S natural deduction reconsidered  

Microsoft Academic Search

John Corcoran’s natural deduction system for Aristotle’s syllogistic is reconsidered.Though Corcoran is no doubt right in interpreting Aristotle as viewing syllogisms as arguments and in rejecting Lukasiewicz’s treatment in terms of conditional sentences, it is argued that Corcoran is wrong in thinking that the only alternative is to construe Barbara and Celarent as deduction rules in a natural deduction system.An

John M. Martin

1997-01-01

234

Natural Resources Canada  

NSDL National Science Digital Library

This website is home to Natural Resources Canada (NRCan), a government agency dealing with natural resource issues important to Canadians. It covers energy, climate change, earthquakes, geography, geology, floods, landslides, minerals and metals, forest fires, mining, remote sensing, and forestry. This site links to numerous government agencies, including the Geological Survey of Canada, Canadian Forest Service, and the Office of Energy. Also offered are a Kid's page with activities, information for teachers, and links to maps, databases, publications, and library resources.

235

NatureNews  

NSDL National Science Digital Library

NatureNews is the science news website of the journal Nature. The site provides a daily summary of news about research and discoveries in life, physical and applied sciences, and clinical medicine. Materials include a daily top story, featured stories, videos, a news blog, and event announcements. There are also longer format reports, opinion features, podcasts, and an archive of past issues organized by year and month.

236

Charge, from EM fields only  

E-print Network

An electron is a purely electromagnetic particle, a PEP. The biggest problem has been charge. Most simply put, charge is a source or sink of E fields. A way to assemble EM fields into a stable configuration that exhibits charge and other particle properties has been found, based in part on Weber's interpretation of the Faraday homopolar generator. A dipolar B field, spinning about its symmetry axis, creates a radial vxB electric field that falls off as 1/r^2. This paper suggests that pair production involves the rearrangement of the EM fields of each half a photon. The EM fields then oscillate at the Compton frequency between a dipolar B field and a toroidal E field. Electric and magnetic flux are quantized. An electron has angular momentum, and so the EM field assembly is spinning. The 1/r^2 E=vxB electric field, created by the spinning dipolar B field, is strongest at the waist and zero at the poles. Precession of the spin axis about a different axis and with the same rate as spin, produces charge. Otherwis...

Collins, R L

2006-01-01

237

WRF-EMS Aviation Products  

NSDL National Science Digital Library

This lesson illustrates how numerical guidance from the Weather Research and Forecasting Model - Environmental Modeling System (WRF-EMS) can be added to surface observations, satellite graphics, and conceptual models of important aviation phenomena, to produce TAFs. Specifically, the lesson describes how visibility, cloud ceilings, and the flight categories variables provide values for aviation forecasts in Africa.

2014-09-14

238

CURSO DE ESPECIALIZAO EM FISIOTERAPIA  

E-print Network

Bioquímica Fisiológica Medicina do Exercício em Pediatria Fisioterapia Respiratória Fisioterapia na Saúde ginecológica Nanotecnologia ­ Atualidades e Perspectivas Vinculadas à Tecnologia dos Materiais Biomecânica

Floeter, Sergio Ricardo

239

Natural Hazards, Second Edition  

NASA Astrophysics Data System (ADS)

Natural disaster loss is on the rise, and the vulnerability of the human and physical environment to the violent forces of nature is increasing. In many parts of the world, disasters caused by natural hazards such as earthquakes, floods, landslides, drought, wildfires, intense windstorms, tsunami, and volcanic eruptions have caused the loss of human lives, injury, homelessness, and the destruction of economic and social infrastructure. Over the last few years, there has been an increase in the occurrence, severity, and intensity of disasters, culminating with the devastating tsunami of 26 December 2004 in South East Asia.Natural hazards are often unexpected or uncontrollable natural events of varying magnitude. Understanding their mechanisms and assessing their distribution in time and space are necessary for refining risk mitigation measures. This second edition of Natural Hazards, (following a first edition published in 1991 by Cambridge University Press), written by Edward Bryant, associate dean of science at Wollongong University, Australia, grapples with this crucial issue, aspects of hazard prediction, and other issues. The book presents a comprehensive analysis of different categories of hazards of climatic and geological origin.

Rouhban, Badaoui

240

Enhance Nature Exploration with Technology  

ERIC Educational Resources Information Center

Kids and nature seem like a natural combination, but what was natural a generation ago is different today. Children are spending less time outdoors but continue to need nature for their physical, emotional, and mental development. This fact has led author Richard Louv to suggest that today's children are suffering from "nature-deficit disorder"…

Holloway, Patricia; Mahan, Carol

2012-01-01

241

Natural and accelerated bioremediation research program plan  

SciTech Connect

This draft plan describes a ten-year program to develop the scientific understanding needed to harness and develop natural and enhanced biogeochemical processes to bioremediate contaminated soils, sediments and groundwater at DOE facilities. The Office of Health and Environmental Research (OHER) developed this program plan, with advice and assistance from DOE`s Office of Environmental Management (EM). The program builds on OHER`s tradition of sponsoring fundamental research in the life and environmental sciences and was motivated by OHER`s and Office of Energy Research`s (OER`s) commitment to supporting DOE`s environmental management mission and the belief that bioremediation is an important part of the solution to DOE`s environmental problems.

NONE

1995-09-01

242

Discussions about the Nature of Science in a Course on the History of Astronomy. (Spanish Title: Discusiones sobre la Naturaleza de la Ciencia en un Curso sobre Historia de la Astronomía.) Discussões sobre a Natureza da Ciência em um Curso sobre a História da Astronomia  

NASA Astrophysics Data System (ADS)

There are an increasing number of researches in science education that affirm the importance of discussions on the "nature of science" in basic education level as well as in teacher training. The history of science applied to education is a way to contextualize epistemological discussions, allowing both the understanding of scientific content and learning about science concepts. We present some reasonably consensual definitions on the nature of science that have been widely discussed by the academic community. We show also some episodes in the history of astronomy which can lead to discussions involving some aspects of the nature of science, and how they can do it. Hay un número creciente de investigaciones en la enseñanza de las ciencias que afirman la importancia de debates sobre la "naturaleza de la ciencia" en la educación básica y formación del profesorado. La historia de la ciencia aplicada a la educación es una manera de contextualizar los debates de la epistemología, lo que permite tanto la comprensión de los contenidos científicos como el aprendizaje de conceptos científicos. En esto trabajo, presentamos algunas definiciones bastante consensuales sobre la naturaleza de la ciencia que han sido ampliamente discutidas por la comunidad académica y mostramos cómo algunos episodios en la historia de la astronomía pueden llevar a discusiones sobre algunos aspectos de la naturaleza de la ciencia. Há um número crescente de pesquisas na área de ensino de ciências que afirmam a importância de discussões sobre a "natureza da ciência" na educação básica e na formação de professores. A história da ciência aplicada ao ensino é uma maneira de contextualizar discussões epistemológicas, permitindo tanto a compreensão de conteúdos científicos quanto o aprendizado de noções sobre as ciências. Neste trabalho apresentamos algumas definições razoavelmente consensuais sobre a natureza da ciência que foram amplamente discutidas pela comunidade acadêmica e mostramos como alguns episódios da história da astronomia podem levar a discussões envolvendo alguns dos aspectos da natureza da ciência.

Pires de Andrade, Victória Flório; L'Astorina, Bruno

2010-07-01

243

Natural Freedom and Wilderness Survival  

ERIC Educational Resources Information Center

The "naturalism" of Jean Jacques Rousseau offers a philosophical base for wilderness survival: the renewal of participants in nature so that they can reenter civilization with a proper balance of natural and civil liberty. (MJB)

Welton, George E.

1978-01-01

244

SIGNIFICANT NATURAL HERITAGE AREAS (NC)  

EPA Science Inventory

The North Carolina Department of Environment and Natural Resources, Division of Parks and Recreation, Natural Heritage Program in cooperation with the NC Center for Geographic Information & Analysis, developed the Significant Natural Heritage Areas digital data to determine the a...

245

Agrobacterium: nature’s genetic engineer  

PubMed Central

Agrobacterium was identified as the agent causing the plant tumor, crown gall over 100 years ago. Since then, studies have resulted in many surprising observations. Armin Braun demonstrated that Agrobacterium infected cells had unusual nutritional properties, and that the bacterium was necessary to start the infection but not for continued tumor development. He developed the concept of a tumor inducing principle (TIP), the factor that actually caused the disease. Thirty years later the TIP was shown to be a piece of a tumor inducing (Ti) plasmid excised by an endonuclease. In the next 20 years, most of the key features of the disease were described. The single-strand DNA (T-DNA) with the endonuclease attached is transferred through a type IV secretion system into the host cell where it is likely coated and protected from nucleases by a bacterial secreted protein to form the T-complex. A nuclear localization signal in the endonuclease guides the transferred strand (T-strand), into the nucleus where it is integrated randomly into the host chromosome. Other secreted proteins likely aid in uncoating the T-complex. The T-DNA encodes enzymes of auxin, cytokinin, and opine synthesis, the latter a food source for Agrobacterium. The genes associated with T-strand formation and transfer (vir) map to the Ti plasmid and are only expressed when the bacteria are in close association with a plant. Plant signals are recognized by a two-component regulatory system which activates vir genes. Chromosomal genes with pleiotropic functions also play important roles in plant transformation. The data now explain Braun’s old observations and also explain why Agrobacterium is nature’s genetic engineer. Any DNA inserted between the border sequences which define the T-DNA will be transferred and integrated into host cells. Thus, Agrobacterium has become the major vector in plant genetic engineering. PMID:25610442

Nester, Eugene W.

2015-01-01

246

letters to nature 430 NATURE |VOL 414 |22 NOVEMBER 2001 |www.nature.com  

E-print Network

letters to nature 430 NATURE |VOL 414 |22 NOVEMBER 2001 |www.nature.com ®rst-order transition does. Soc. Lond. A 165, 372±414 (1938). 2. Radu, G. T. & Suhl, H. (eds) MagnetismÐATreatise on Modern Theory of superconductivity and ferromagnetism in the d-band metal ZrZn2. Nature 412, 58±61 (2001); Erratum Nature 412, 660

Keinan, Ehud

247

letters to nature 470 NATURE |VOL 414 |22 NOVEMBER 2001 |www.nature.com  

E-print Network

letters to nature 470 NATURE |VOL 414 |22 NOVEMBER 2001 |www.nature.com Acknowledgements We. Gwilliam, S. Ledain, G. Shao & K. P. Homewood Nature 410, 192±194 (2001. Green, M. A., Shao, J., Wang, A., Reece, P. J. & Gal, M. Ef®cient silicon light-emitting diodes. Nature

Kwak, Juhyoun

248

Characteristics of Seismoelectric Wave Fields Associated with Natural Microcracks  

NASA Astrophysics Data System (ADS)

Properties of seismoelectric waves in relation to natural earthquakes have been investigated. The electromagnetic disturbances were analyzed to test the hypothesis that pulse-like electric variations are directly related to microcracks as source. Because variation is very difficult to detect, there have been few quantitative field investigations. We used selected events with clear S and P phases from the data catalog obtained before the Tohoku earthquake in 2011. The electric strength of the fast P wave (P f), S wave (S), and electromagnetic wave (EM) associated with formation of cracks of tensile mode were estimated. The co-seismic electric signal accompanied by the S wave has the largest strength, well above the noise level, and the EM wave has the lowest strength. Analytical estimation of the ratio of the strengths of the Pf and EM phases to that of the S phase by use of Pride's equations gave results partially in agreement with observation (the order was Apf > A s > A em). The strength of the observed electromagnetic mode is approximately two orders of magnitude larger than that estimated from the theory. We suggest this greater strength can be attributed to the converted modes at layer contracts or to the effect of the boundary between free atmosphere and crust. Overall agreement between observations and theoretical estimates suggests that electromagnetic anomalies, crustal deformation, and groundwater changes can be investigated on the basis of the unified equations for the coupled electromagnetics, acoustics, and hydrodynamics of porous media.

Fujinawa, Yukio; Noda, Yoichi

2015-03-01

249

Correlation of the NBME Advanced Clinical Examination in EM and the National EM M4 exams  

PubMed Central

Introduction Since 2011 two online, validated exams for fourth-year emergency medicine (EM) students have been available (National EM M4 Exams). In 2013 the National Board of Medical Examiners offered the Advanced Clinical Examination in Emergency Medicine (EM-ACE). All of these exams are now in widespread use; however, there are no data on how they correlate. This study evaluated the correlation between the EM-ACE exam and the National EM M4 Exams. Methods From May 2013 to April 2014 the EM-ACE and one version of the EM M4 exam were administered sequentially to fourth-year EM students at five U.S. medical schools. Data collected included institution, gross and scaled scores and version of the EM M4 exam. We performed Pearson’s correlation and random effects linear regression. Results 303 students took the EM-ACE and versions 1 (V1) or 2 (V2) of the EM M4 exams (279 and 24, respectively). The mean percent correct for the exams were as follows: EM-ACE 74.8 (SD-8.83), V1 83.0 (SD-6.41), V2 78.5 (SD-7.70). Pearson’s correlation coefficient for the V1/EM-ACE was 0.51 (0.42 scaled) and for the V2/EM-ACE was 0.59 (0.41 scaled). The coefficient of determination for V1/EM-ACE was 0.72 and for V2/EM-ACE = 0.71 (0.86 and 0.49 for scaled scores). The R-squared values were 0.25 and 0.30 (0.18 and 0.13, scaled), respectively. There was significant cluster effect by institution. Conclusion There was moderate positive correlation of student scores on the EM-ACE exam and the National EM M4 Exams. PMID:25671023

Hiller, Katherine; Miller, Emily S.; Lawson, Luan; Wald, David; Beeson, Michael; Heitz, Corey; Morrissey, Thomas; House, Joseph; Poznanski, Stacey

2015-01-01

250

Novel medicines from nature.  

PubMed

A meeting held at the Royal Society of Medicine brought together a wide variety of people to look at a number of scientific, legal and ethical issues associated with the discovery of new drugs from nature, including plant, marine and animal sources. The meeting began with a historic overview of plant medicine, followed by presentations and discussion on particular aspects of bioprospecting and biodiversity. This was followed by an overview of the methods that can be used to identify potentially important drugs from natural products. The session on biological sources was the most important of the meeting as far as the discovery of new drugs was concerned. The final session of the meeting was pharmaco-socioeconomic in nature. PMID:15616628

Jack, D B

1998-08-01

251

Forces of Nature  

NSDL National Science Digital Library

These interactive simulations allow students to investigate four of nature's more violent phenomena: volcanoes, earthquakes, hurricanes, and tornadoes. Each simulation begins with a brief written tutorial describing the characteristics and destructive potential of these hazards. Users may then adjust the various factors affecting the occurence of these phenomena (for instance, ocean temperature, humidity, and atmospheric pressure for hurricanes) and observe the results. These simulations are related to the film National Geogrpahic film Forces of Nature ; other links provide access to lesson plans designed to accompany the film and to a list of locations where the film can be seen. There are also links to a preview of the film, fast facts, stories about famous natural disasters, and a glossary.

2007-12-12

252

The Human Nature Review  

NSDL National Science Digital Library

While attempting to cover one area of scholarly discipline in a Web site may be a formidable task, the editors of the Human Nature Review are concerned with any substantive scholarship or research dealing with human nature in its entirety. As the Web site notes: "Our goal is to bring into communication the variety of approaches to the understanding of human nature which have a regrettable tendency to be less in touch with one another than they might." The site is edited by Dr. Ian Pitchford of the Creighton University School of Medicine and Professor Robert M. Young. Prominent features of the site include an online dictionary of mental health, a daily review (sent as an email, if users so desire) of updates on ongoing scholarship in the fields of psychology and psychotherapy, and a number of complete online texts. Finally, the site also houses hundreds of book reviews, contributed by scholars from a diverse set of fields, on works of topical importance.

253

Lamarck and Natural Selection  

NSDL National Science Digital Library

Charles Darwin defined natural selection in "On the Origin of Species," however, Darwin did not invent the idea of evolution and not everyone saw his ideas as original. The shadow of Lamarckian theory which Darwin wanted desperately to escape is a genuine scientific precursor and what has become known as the Lamarckian Heresy has maintained a presence on the fringes of biology to this day. This radio broadcast explores who Lamarck was, how natural selection escaped from his shadow and gained acceptance from the scientific establishment, and whether any evidence has emerged that might challenge the elegant simplicity of natural selection. There is discussion about whether what is passed on to descendants may be affected by experience and environment; the experiments performed by Mendel that led to genetics; the role of DNA, gene mutations, and networks of genes in epigenetics; and how there seem to be fewer genes in humans than expected. The 2003 broadcast is 57 minutes in length.

254

Arkansas Natural Resources Commission  

NSDL National Science Digital Library

In 1937, the Arkansas General Assembly enacted the nation's first conservation district law. Since that time, the state has grown to create entities like the Arkansas Natural Resources Commission to help protect its various natural resources. On this site, visitors can look through seven different sections, including Water Development, Conservation, and Arkansas Water Plan. Within each of these sections, visitors can look through a range of working papers, conservation documents, and online GIS data sets based on state-wide natural resource surveys. Moving on, the News & Publications features video blog posts, updates about conservation programs, and more. The Rules area is another helpful section of the site, providing a wide range of current rules created by the Commission to govern Arkansas wetlands, tax credits, groundwater management, and poultry management.

255

Building natural gas locomotives  

SciTech Connect

This article describes a liquefied natural gas-fueled locomotive built by Morrison Knudsen which includes a Caterpillar 1200-horsepower V-16, a monofuel management system with double-wall super-insulated cryogenic tanks, and microprocessor-based controls. Efforts by railroad companies to reduce operating costs and meet future emissions standards have led engineers to look for innovative ways to design trains. In January, Morrison Knudsen Corp. of Boise, Idaho, powered its way into the locomotive manufacturing business when it introduced the natural gas-fueled MK1200G, to be used mostly around railroad company yards and on trips shorter than 50 miles.

O'Conner, L.

1994-04-01

256

Natural History Notebooks  

NSDL National Science Digital Library

The Canadian Museum of Nature (CMN) offers an online version of its Natural History Notebook series originally published in 1977-81. Interesting facts and attractive black-and-white sketches are provided for each of the nearly 250 animal species (mostly vertebrates) featured in the Web site. All illustrations are by Charles Douglas, former chief illustrator at CMN. The notebook collection includes one each for mammals, birds, fish, reptiles, amphibians, invertebrates, endangered or extinct species, prehistoric life, and another that allows users to search for animals by geographical region.

1969-12-31

257

Bioactive oligosaccharide natural products.  

PubMed

Covering up to December 2013. Oligosaccharide natural products target a wide spectrum of biological processes including disruption of cell wall biosynthesis, interference of bacterial translation, and inhibition of human ?-amylase. Correspondingly, oligosaccharides possess the potential for development as treatments of such diverse diseases as bacterial infections and type II diabetes. Despite their potent and selective activities and potential clinical relevance, isolated bioactive secondary metabolic oligosaccharides are less prevalent than other classes of natural products and their biosynthesis has received comparatively less attention. This review highlights the unique modes of action and biosynthesis of four classes of bioactive oligosaccharides: the orthosomycins, moenomycins, saccharomicins, and acarviostatins. PMID:24883430

McCranie, Emilianne K; Bachmann, Brian O

2014-08-01

258

Natural environment analysis  

NASA Technical Reports Server (NTRS)

The influence of terrain features on wind loading of the space shuttle while on the launch pad, or during early liftoff, was investigated both qualitatively and quantitatively. The climatology and meteorology producing macroscale wind patterns and characteristics for the Vandenburg Air Force Base launch site are described. Field test data are analyzed, and the nature and characteristic of flow disturbances due to the various terrain features, both natural and man-made, are reviewed. The magnitude of these wind loads are estimated. Finally, effects of turbulence are discussed. It is concluded that the influence of complex terrain can create significant wind loading on the vehicle.

Frost, W.

1985-01-01

259

Natural History Notebooks  

NSDL National Science Digital Library

The Canadian Museum of Nature (CMN) offers an online version of its Natural History Notebook series originally published in 1977-81. Interesting facts and attractive black-and-white sketches are provided for each of the nearly 250 animal species featured in the Web site. All illustrations are by Charles Douglas, former chief illustrator at CMN. The notebook collection includes one each for mammals, birds, fish, reptiles, amphibians, invertebrates, endangered or extinct species, prehistoric life, and another that allows users to search for animals by geographical region.

260

Natural warm inflation  

SciTech Connect

We derive the requirements that a generic axion-like field has to satisfy in order to play the role of the inflaton field in the warm inflation scenario. Compared to the parameter space in ordinary Natural Inflation models, we find that the parameter space in our model is enlarged. In particular, we avoid the problem of having an axion decay constant f that relates to the Planck scale, which is instead present in the ordinary Natural Inflation models; in fact, our model can easily accommodate values of the axion decay constant that lie well below the Planck scale.

Visinelli, Luca, E-mail: u0583682@utah.edu [Department of Physics and Astronomy, University of Utah, 115 South 1400 East 201, Salt Lake City, Utah 84112-0830 (United States)

2011-09-01

261

Natural Cycles, Gases  

NASA Technical Reports Server (NTRS)

The major gaseous components of the exhaust of stratospheric aircraft are expected to be the products of combustion (CO2 and H2O), odd nitrogen (NO, NO2 HNO3), and products indicating combustion inefficiencies (CO and total unburned hydrocarbons). The species distributions are produced by a balance of photochemical and transport processes. A necessary element in evaluating the impact of aircraft exhaust on the lower stratospheric composition is to place the aircraft emissions in perspective within the natural cycles of stratospheric species. Following are a description of mass transport in the lower stratosphere and a discussion of the natural behavior of the major gaseous components of the stratospheric aircraft exhaust.

Douglass, Anne R.; Jackman, Charles H.; Rood, R. B.; Aikin, A. C.; Stolarski, R. S.; Mccormick, M. P.; Fahey, David W.

1992-01-01

262

Natural Resources Conservation Service  

NSDL National Science Digital Library

A division of the US Department of Agriculture, the Natural Resources Conservation Service (NRCS) has a mission to provide leadership and partner with private land owners to "help people conserve, maintain, and improve our natural resources and environment." Their home page is useful in that regard as it currently provides significant information on topics related to the 2002 Farm Bill, water quality and quantity, wildfires, conservation, and more. The site is easy to navigate, with top and side navigation bars that allow users to select information based on either the type of information or the category of user.

1969-12-31

263

Introduction to Natural Selection  

NSDL National Science Digital Library

This lesson will help students develop an understanding of natural selection, specifically, how it unfolds from generation to generation. The Motivation section introduces a species of bird that became (over millions of years) numerous species, through adaptation. The Development section is a hands-on activity that demonstrates how populations change little by little, generation by generation, due to survival of species that have traits that are beneficial in an environment. Students will learn why organisms evolve over time, how natural selection works, and how certain factors determine survival and differences in organisms.

264

Nature: The Mouse Genome  

NSDL National Science Digital Library

This Web site from the journal Nature offers a one-stop online resource for information on the mouse genome -- "the experimental key to the human genome." Visitors have free access to all content from the journal's special mouse genome issue. Web features include an interactive timeline detailing the history of the mouse in genetics, related news articles and commentary, Web links, and more. Scientific papers and letters to Nature are also available for those who would like to delve into the subject at depth. Additionally, the site provides a selection of classic research papers free to registered users until March 5, 2003.

2003-01-01

265

Warnell School of Forestry and Natural Resources 2011 Publications Page 1 2011 Publications  

E-print Network

. Williams, G. A. Gale, R. J. Cooper, and S. Raimondo. 2011. Assessment of indirect pesticide effects on Worm 2011 Publications Pages Fisheries and Wildlife 2 ­ 11 Forestry 12 ­ 28 Natural Resources Recreation · 2011 Publications Page 2 Fisheries and Wildlife Allen, KE, MJ Yabsley, EM Johnson, MV

Hall, Daniel

266

Bayesian Inference with Tears a tutorial workbook for natural language researchers  

E-print Network

an idiot. That was not the turning point in my life, though. The turning point was EM. Here was a learning experiments without lots of new code and new bugs. 3. Another turning point? When I recently started seeing September 2009 1. Introduction When I first saw this in a natural language paper, it certainly brought tears

Zhang, Yi

267

Why Is Nature Beneficial?: The Role of Connectedness to Nature  

ERIC Educational Resources Information Center

Three studies examine the effects of exposure to nature on positive affect and ability to reflect on a life problem. Participants spent 15 min walking in a natural setting (Studies 1, 2, & 3), an urban setting (Study 1), or watching videos of natural and urban settings (Studies 2 & 3). In all three studies, exposure to nature increased…

Mayer, F. Stephan; Frants, Cynthia McPherson; Bruehlman-Senecal, Emma; Dolliver, Kyffin

2009-01-01

268

From Nature to Manufacture 1 From nature to manufacture  

E-print Network

of the Modern Style. The decorative element was no longer defined by its nature itself but in accordanceFrom Nature to Manufacture 1 From nature to manufacture Philippe MARIN1 , Jean-Claude BIGNON2 and assembly characteristics as well as CNC facilities. halshs-00445327,version1-8Jan2010 #12;From Nature

Boyer, Edmond

269

Natural Solutions Response July 24, 2007 1 Natural Solutions  

E-print Network

relatively short here. Natural Solutions has been able to capitalize on the generous support and scientificNatural Solutions Response July 24, 2007 1 Natural Solutions 1890 Sierra Rd. East Helena, MT 59602 SW 6th Avenue, Suite 100 Portland, OR 97204-1348 Dear Ms. O'Toole: Natural Solutions appreciates

270

Syllabus Natural Resource Policy & Economics 1 Natural Resource Policy & Economics  

E-print Network

Syllabus ­ Natural Resource Policy & Economics 1 Natural Resource Policy & Economics FOR6934 (3 natural resources administration and policies in the United States; policy components; policy formation of the course, you should be able to: State the key provisions of major natural resource policies Explain

Slatton, Clint

271

Syllabus Natural Resource Policy & Administration 1 Natural Resource Policy & Administration  

E-print Network

Syllabus ­ Natural Resource Policy & Administration 1 Natural Resource Policy & Administration FNR and related natural resources administration and policies in the United States; policy components; policy of the course, you should be able to: State the key provisions of major natural resource policies Explain

Watson, Craig A.

272

Natural gas sampling  

Microsoft Academic Search

Two simple, inexpensive devices for sampling natural gas from small and noncommercial deposits are described. One device is intended for sampling of minute gas seepage from the bottom of shallow basins such as ponds or marshes where the gas might have an environmental impact. A shallow, inverted large metal funnel with a small hole in the side is placed on

N. P. Prokopovich; D. C. Magleby

1981-01-01

273

Criteria for natural hierarchies  

NASA Astrophysics Data System (ADS)

With the discovery of a particle that seems rather consistent with the minimal Standard Model Higgs boson, attention turns to questions of naturalness, fine-tuning, and what they imply for physics beyond the Standard Model and its discovery prospects at run II of the LHC. In this article we revisit the issue of naturalness, discussing some implicit assumptions that underly some of the most common statements, which tend to assign physical significance to certain regularization procedures. Vague arguments concerning fine-tuning can lead to conclusions that are too strong and perhaps not as generic as one would hope. Instead, we explore a more pragmatic definition of the hierarchy problem that does not rely on peeking beyond the murky boundaries of quantum field theory: we investigate the fine-tuning of the electroweak scale associated with thresholds from heavy particles, which is both calculable and dependent on the nature of the would-be ultraviolet completion of the Standard Model. We discuss different manifestations of new high-energy scales that are favored by experimental hints for new physics with an eye toward making use of fine-tuning in order to determine natural regions of the new physics parameter spaces.

de Gouvêa, André; Hernández, Daniel; Tait, Tim M. P.

2014-06-01

274

POTENTIAL NATURAL VEGETATION COVERAGE  

EPA Science Inventory

"Potential natural vegetation is defined as the vegetation that would exist today if humans were removed from the scene and if the plant succession after their removal were telescoped into a single moment. The time compression eliminates the effects of future climatic fluc...

275

Picturing the Natural World  

ERIC Educational Resources Information Center

How is the natural environment in the neighborhood representative of the larger biosphere in which people live? Studying the local birds and flora of the Pacific Northwest in the context of the local parks and ponds provided a rich opportunity for third-grade students at St. Thomas School in Medina, Washington, to explore and learn about…

Salia, Hannah

2011-01-01

276

Saving Natural Areas.  

ERIC Educational Resources Information Center

This manual serves as a handbook for those involved in the art of land saving. The various topics in the booklet are dealt with in great detail since little has been published on the preservation of natural areas in international publications. Most of the document is derived from articles, books, and publications published by, or describing the…

Buchinger, Maria

277

NATURE METHODS ADVERTISING FEATURE  

E-print Network

NATURE METHODS ADVERTISING FEATURE APPLICATION NOTES siRNA design including secondary structure target site prediction Gerrit Schramm & Rebecca Ramey When performing RNA interference (RNAi) experiments created an online design tool allowing researchers to analyze mRNA target sites. RNAi mechanism

Cai, Long

278

Dye Like A Natural  

NSDL National Science Digital Library

In this activity, learners stain fabrics--on purpose! Learners explore the art of natural dyeing by using dyes and substrates that are both derived from plant or animal sources as well as mordant solutions. Learners compare the color and effectiveness of different mordant/dye combinations on the different substrates.

Julie Yu

2010-01-01

279

Natural Gas Purchasing Options  

E-print Network

As a result of economic and regulatory changes, the natural gas marketplace now offers multiple options for purchasers. The purpose of this panel is to discuss short-term purchasing options and how to take advantage of these options both to lower...

Watkins, G.

280

Appreciation of Nature.  

ERIC Educational Resources Information Center

Presents American Indian cultural activities that encourage student awareness of nature and its beauty and the need for balance in our lives. Includes an explanation of the powers of the Medicine Wheel, a legend about the dream catcher, and instructions for seven related craft activities. (SV)

Wilson, Maithel Lee, Ed.

1992-01-01

281

Nature Conservation in Bophuthatswana.  

ERIC Educational Resources Information Center

This presentation to the International Girl Guides Jamboree, July 1991, addressed the issue of nature conservation and the role of the National Parks and Wildlife Management Board of Bophuthatswana in creating parks and conserving wildlife. Describes three national parks and the boards' achievements in preserving wildlife. (MDH)

Motaung, Maria

1992-01-01

282

Submicroscopic Nature Needs Megascience  

Microsoft Academic Search

The history of ``submicroscopic nature,'' that is, the history of particle physics, begins in the early 1950's and builds on the construction of a post WWII series of particle accelerators developed to study nuclear physics had been applied to the collisions, in the earth's atmosphere, of cosmic rays. These were high energy particles generated in cosmological events and colliding with

Leon Lederman

2005-01-01

283

Naturalness and the Landscape  

E-print Network

In this paper I review some arguments of Douglas and myself concerning the concept of naturalness in string theory. I explain why the usual argument for low energy supersymmetry do not apply in this context. An incorrect argument in \\cite{Susskind} is corrected. The statistical properties of the Landscape of vacua are strongly biased against low energy supersymmetry.

Susskind, L

2004-01-01

284

Natural fracture systems studies  

SciTech Connect

The objectives of this program are (1) to develop a basinal-analysis methodology for natural fracture exploration and exploitation, and (2) to determine the important characteristics of natural fracture systems for use in completion, stimulation, and production operations. Natural-fracture basinal analysis begins with studies of fractures in outcrop, core and logs in order to determine the type of fracturing and the relationship of the fractures to the lithologic environment. Of particular interest are the regional fracture systems that are pervasive in western US tight sand basins. A Methodology for applying this analysis is being developed, with the goal of providing a structure for rationally characterizing natural fracture systems basin-wide. Such basin-wide characterizations can then be expanded and supplemented locally, at sites where production may be favorable. Initial application of this analysis is to the Piceance basin where there is a wealth of data from the Multiwell Experiment (MWX), DOE cooperative wells, and other basin studies conducted by Sandia, CER Corporation, and the USGS (Lorenz and Finley, 1989, Lorenz et aI., 1989, and Spencer and Keighin, 1984). Such a basinal approach has been capable of explaining the fracture characteristics found throughout the southern part of the Piceance basin and along the Grand Hogback.

Lorenz, J.C.; Warpinski, N.R.

1992-09-01

285

Saving Natural Inflation  

NASA Astrophysics Data System (ADS)

Slow-roll inflation requires the inflaton field to have an exceptionally flat potential, which combined with measurements of the scale of inflation demands some degree of fine-tuning. Alternatively, the flatness of the potential could be due to the inflaton's origin as a pseudo-Goldstone boson, as in Natural Inflation. Alas, consistency with Planck data places the original proposal of Natural Inflation in a tight spot, as it requires a trans-Planckian excursion of the inflaton. Although one can still tune the renormalizable potential to sub-Planckian values, higher order corrections from quantum gravity or sources of breaking of the Goldstone symmetry would ruin the predictivity of the model. In this paper we show how in more realistic models of Natural Inflation one could achieve inflation without a trans-Planckian excursion of the field. We show how a variant of Extra-natural inflation with bulk fermions can achieve the desired goal and discuss its four-dimensional duals. We also present a new type of four dimensional models inspired in Little Higgs and Composite Higgs models which can lead to sub-Planckian values of the inflaton field.

Croon, Djuna; Sanz, Verónica

2015-02-01

286

Nature in the City  

NSDL National Science Digital Library

Nature in the City is a project of the Earth Island Institute, and is "wholly dedicated to ecological conservation, restoration and stewardship of the [San] Franciscan bioregion." Their website's "About" section gives a thorough explanation of not only their goals, as well as a definition of nature. Furthermore, this section provides some philosophical insight into what exactly "urban nature" happens to be. Those visitors interested in a more visceral tour of San Francisco should check out the "Photo Gallery" link, and they should be sure to check out the "Natural Areas" album to view some eerie-looking oak woodlands in Golden Gate Park. Additionally, visitors to the site who are interested in the life that teems on Alcatraz Island will enjoy file number fourteen which includes an image of roosting double-crested cormorants on a dramatic hillside. Finally the "Local Ecology" link has an explanation of the "Biodiversity Crisis" in San Francisco, which can be attributed to ecological, political, institutional, social and cultural factors.

287

History of Natural Rubber  

Microsoft Academic Search

Natural rubber derived from latex of the Hevea brasiliensis tree constitutes over 30% of the world's rubber hydrocarbon consumption. Though known to Indians of South America centuries before Columbus, Europeans could not make practical use of “cahutchu” for some 300 years. Goodyear's discovery of vulcanization in 1839 sparked an industry that was to grow dramatically at the turn of the

Paul E. Hurley

1981-01-01

288

Clean Cities Natural Gas  

E-print Network

2014 Vehicle Buyer's Guide Clean Cities Natural Gas Propane Biodiesel Electric Hybrid Ethanol Flex . . . . . . . . . . . . . . . . . . . . . 15 Plug-In Hybrid Electric . . . . . . . . . . 18 Hybrid Electric vehicles, and hybrid luxury cars are now in the marketplace. Early in the 2013 calendar year the number

289

Natural or Artificial  

NSDL National Science Digital Library

This worksheet, suitable for pre-readers, directs students to categorize pictures as sources of either natural or artificial light. The resource is part of the teacher's guide accompanying the video, NASA Why Files: The Case of the Mysterious Red Light. Lesson objectives supported by the video, additional resources, teaching tips and an answer sheet are included in the teacher's guide.

2012-08-03

290

Nature, Education and Things  

ERIC Educational Resources Information Center

In this essay it is argued that the educational philosophy of John Dewey gains in depth and importance by being related to his philosophy of nature, his metaphysics. The result is that any experiental process is situated inside an event, an existence, a thing, and I try to interpret this "thing" as schools or major cultural events such…

Rømer, Thomas Aastrup

2013-01-01

291

The Nature of Diamonds  

NSDL National Science Digital Library

This Web site looks at how diamonds are created (naturally and synthetically), and how they have been used throughout history. It contains information on composition and structure, the origins and history of diamonds, mining & distribution and an overview of the many uses of diamonds and how they are grown synthetically. A bibliography provides a listing of more than 75 resources for further study.

292

Picturing the Natural Environment  

ERIC Educational Resources Information Center

Around Scout Island Education Center, a site used by schools in Fresno County to explore the area's natural environment, a total of 200 cylinder-shaped concrete stools display tiles representing small mammals, flying insects, birds, wildflowers, and more. Twenty sets have been created by elementary, middle, and high-school art students as part of…

Johnson, Phyllis Scott

2011-01-01

293

Natural Gas Annual  

EIA Publications

Provides information on the supply and disposition of natural gas in the United States. Production, transmission, storage, deliveries, and price data are published by state for the current year. Summary data are presented for each state for the previous 5 years.

2014-01-01

294

The Nature of Evolution  

ERIC Educational Resources Information Center

The nature of evolution, the historical change in the universe, and the change that is caused by the workings of the dynamic processes at the smallest and largest scales are studied. It is viewed that the cumulative change in the historical systems is caused by evolution, which is a type of causal relationship and evolutionary processes could be…

Alles, David L.

2005-01-01

295

Demystifying Nature of Science  

ERIC Educational Resources Information Center

With the emergence of the "Next Generation Science Standards" ("NGSS"; NGSS Lead States 2013), it is apparent that teaching and learning about nature of science (NOS) continues to be an important goal of science education for all K-12 students. With this emphasis on NOS, early childhood teachers are asking how to design…

Lederman, Judith; Bartels, Selina; Lederman, Norman; Gnanakkan, Dionysius

2014-01-01

296

Designing Nature's Way  

ERIC Educational Resources Information Center

In the case of cars and other engineered objects, humans go about the design process in a very intentional way. They pretty much know what they are aiming for. The activity described in this article demonstrates how a computer can simulate biological evolution and the laws of natural selection. The article is divided into the following sections:…

Fisher, Diane

2005-01-01

297

The Natural Learning Process  

ERIC Educational Resources Information Center

Teacher-educator and researcher Daniel L. Kohut suggests in "Musical Performance: Learning Theory and Pedagogy" that there are many problems that result from the way music teachers often teach. Most teachers focus on the process, not the goal. The Natural Learning Process that Kohut advocates is the same process that young children use when they…

Criss, Ellen

2008-01-01

298

Reinventing Natural Selection  

ERIC Educational Resources Information Center

Although many research studies report students' Lamarckian misconceptions, only a few studies present learning and teaching strategies that focus on the successful development of the concept of natural selection. The learning and teaching strategy for upper secondary students (aged 15-16) presented in this study conducted in The Netherlands is…

Geraedts, Caspar L.; Boersma, Kerst Th.

2006-01-01

299

Natural Resources: Stargazing  

NSDL National Science Digital Library

In 2009, we had the year of astronomy. Even President Obama hosted an astronomy night on the White House lawn. Your explorations of nature need not be limited to daylight hours--though it is important to point our when celestial objects like the Moon are v

Valynda Mayes

2010-03-01

300

Natural Dark Energy  

Microsoft Academic Search

It is now well accepted that both Dark Matter and Dark Energy are required in any successful cosmological model. Although there is ample evidence that both Dark components are necessary, the conventional theories make no prediction for the contributions from each of them. Moreover, there is usually no intrinsic relationship between the two components, and no understanding of the nature

Douglas Scott; Ali Frolop

2007-01-01

301

Pupils, Nature, and Writing.  

ERIC Educational Resources Information Center

A lesson in writing stresses that pupils can choose what to write about in a nature setting. Answers to numerous questions arising when involving pupils in writing can be found in this activity, including: (1) how to motivate learners to write; (2) whether to teach specific writing skills as they write; (3) what guidance and assistance to offer on…

Ediger, Marlow

302

A Biospheric Natural History.  

ERIC Educational Resources Information Center

A group of Maine birdwatchers recognizes that the presence or absence of migrating songbirds is related to complex biospheric patterns. For schoolchildren, community groups, and environmental scientists, such local natural history observations can be a pathway to perceiving and understanding global ecological change and then to developing…

Thomashow, Mitchell

2001-01-01

303

Nature and Nurture  

NSDL National Science Digital Library

In this lesson from Science NetLinks, students begin to develop an understanding of the role played by nature (our genes) and nurture (the environment in which we live and the things that happen to us) in defining who we are and what it means to be human.

Science Netlinks

2002-05-15

304

Radioactivity: A Natural Phenomenon.  

ERIC Educational Resources Information Center

Discussed is misinformation people have on the subject of radiation. The importance of comparing artificial source levels of radiation to natural levels is emphasized. Measurements of radioactivity, its consequences, and comparisons between the risks induced by radiation in the environment and from artificial sources are included. (KR)

Ronneau, C.

1990-01-01

305

3D Inversion of Natural Source Electromagnetics  

NASA Astrophysics Data System (ADS)

The superior depth of investigation of natural source electromagnetic techniques makes these methods excellent candidates for crustal studies as well as for mining and hydrocarbon exploration. The traditional natural source method, the magnetotelluric (MT) technique, has practical limitations because the surveys are costly and time consuming due to the labor intensive nature of ground based surveys. In an effort to continue to use the penetration advantage of natural sources, it has long been recognized that tipper data, the ratio of the local vertical magnetic field to the horizontal magnetic field, provide information about 3D electrical conductivity structure. It was this understanding that prompted the development of AFMAG (Audio Frequency Magnetics) and recently the new airborne Z-Axis Tipper Electromagnetic Technique (ZTEM). In ZTEM, the vertical component of the magnetic field is recorded above the entire survey area, while the horizontal fields are recorded at a ground-based reference station. MT processing techniques yield frequency domain transfer functions typically between 30-720 Hz that relate the vertical fields over the survey area to the horizontal fields at the reference station. The result is a cost effective procedure for collecting natural source EM data and for finding large scale targets at moderate depths. It is well known however that 1D layered structures produce zero vertical magnetic fields and thus ZTEM data cannot recover such background conductivities. This is in sharp contrast to the MT technique where electric fields are measured and a 1D background conductivity can be recovered from the off diagonal elements of the impedance tensor. While 1D models produce no vertical fields, two and three dimensional structures will produce anomalous currents and a ZTEM response. For such models the background conductivity structure does affect the data. In general however, the ZTEM data have weak sensitivity to the background conductivity and while we show that it is possible to obtain the background structure by inverting the ZTEM data alone, it is desirable to obtain robust background conductivity information from other sources. This information could come from a priori geologic and petrophysical information or from additional geophysical data such as MT. To counter the costly nature of large MT surveys and the limited sensitivity of the ZTEM technique to the background conductivity we show that an effective method is to collect and invert both MT and ZTEM data. A sparse MT survey grid can gather information about the background conductivity and deep structures while keeping the survey costs affordable. Higher spatial resolution at moderate depths can be obtained by flying multiple lines of ZTEM data.

Holtham, E. M.; Oldenburg, D. W.

2010-12-01

306

Natural Gas Expanders-Compressors  

Microsoft Academic Search

Natural gas expanders-compressors serve a variety of natural gas plants, ranging from primary treatment at the well (installations for comprehensive treatment of natural gas) to liquefaction for separation, storage, and transport. Natural gas expanders-compressors take on particular importance for wells with throttling cold. The growing demand for this equipment has been satisfied by imports until recently. The most popular was

V. M. Kulakov; V. V. Kulakov; A. V. Kulakov

2002-01-01

307

Nature Publishing Group Site Licenses  

E-print Network

European Journal of Clinical Nutrition European Journal of Human Genetics Eye Gene Therapy Genes & Immunity Journal of Cancer) Bone Marrow Transplantation Cancer Gene Therapy Cell Death & Differentiation Cell Therapy Mucosal Immunology Nature Nature archive: 1869-1949 Nature archive: 1950-1986 Nature archive: 1987

Cai, Long

308

NATURAL PRODUCTS FOR PEST MANAGEMENT  

Technology Transfer Automated Retrieval System (TEKTRAN)

The topic of natural products as pesticides is reviewed, with a discussion of the advantages and disadvantages of adopting a natural product-based strategy for pesticide discovery. Current and past natural product and natural product-based herbicides, insecticides, fungicides, molluscicides, rodent...

309

Mestrado e Doutorado em Filosofia edital 2014  

E-print Network

Mestrado e Doutorado em Filosofia PUC-Rio edital 2014 O Departamento de Filosofia da Pontifícia Pós-graduação em Filosofia, nos níveis de mestrado e doutorado. Para a seleção de 2014, são oferecidas Filosofia; o candidato ao doutorado deverá ser mestre em Filosofia ou ter titulação equivalente. 1.3. Os

310

Universidade de Braslia Programa de Ps-Graduao em Cincias e Tecnologias em Sade -PGCTS/FCE  

E-print Network

Universidade de Brasília Programa de Pós-Graduação em Ciências e Tecnologias em Saúde - PGCTS/FCE Edital n. 01/2013 1 UNIVERSIDADE DE BRASÍLIA PROGRAMA DE PÓS-GRADUAÇÃO EM CIÊNCIAS E TECNOLOGIAS EM SAÚDE EDITAL Nº 01/2013 SELEÇÃO DE CANDIDATOS ÀS VAGAS DO PROGRAMA DE PÓS-GRADUAÇÃO EM CIÊNCIAS E TECNOLOGIAS

Maier, Rudolf Richard

311

eNature.com  

NSDL National Science Digital Library

eNature.com provides a series of field guides with photos and information on thousands of plants, animals, and insects in the United States. These guides employ the same dataset used to create the printed Audubon Field Guides, which has been reviewed by experts in biology, zoology, and natural history. The guides are arranged by type of organism: amphibians, birds, spiders, trees, wildflowers, and others. Each one is further subdivided (salamanders, frogs and toads, turtles, and so forth) and is searchable by keyword. Users may also create species lists for their own localities by entering a ZIP code. Other materials include guides to threatened and endangered species, guides to national parks and wildlife refuges, an ask-an-expert feature, selected images for eCards and screen savers, and plant and animal pop-up cards that users can place on their own sites.

312

Nevada Natural Heritage Program  

NSDL National Science Digital Library

The mission of the Nevada Natural Heritage Program is "to help coordinate the resource needs of Nevada's diverse biological heritage with human activities." Their website presents a wide range of resources for persons who might be interested in learning about their work in such fields as ecology, land management, land use planning, and conservation. A good way to start is in the "Special Program Area" section, which can be found on the left side of the homepage. Here visitors will find "Ecology Program", which provides information about Nevada's diverse biological heritage contained within special reports, vegetation coverage maps, and atlases of Nevada's mountain ranges. That's not all; also available in the special program area are the Rare Plant Atlas, wildflower reports, and information about ongoing efforts to create an online catalog of the mosses, hornworts, and liverworts of Nevada. The site is rounded out by a listing of the laws and regulations which govern the activities of the Nevada Natural Heritage Program.

313

Epidemics after Natural Disasters  

PubMed Central

The relationship between natural disasters and communicable diseases is frequently misconstrued. The risk for outbreaks is often presumed to be very high in the chaos that follows natural disasters, a fear likely derived from a perceived association between dead bodies and epidemics. However, the risk factors for outbreaks after disasters are associated primarily with population displacement. The availability of safe water and sanitation facilities, the degree of crowding, the underlying health status of the population, and the availability of healthcare services all interact within the context of the local disease ecology to influence the risk for communicable diseases and death in the affected population. We outline the risk factors for outbreaks after a disaster, review the communicable diseases likely to be important, and establish priorities to address communicable diseases in disaster settings. PMID:17370508

Gayer, Michelle; Connolly, Maire A.

2007-01-01

314

Woodland Trust: Nature Detectives  

NSDL National Science Digital Library

From the United Kingdom-based Woodland Trust, this Nature Detectives website contains information and activities for budding young naturalists. For elementary-aged children, the site contains an assortment of downloadable games, activity materials, and examples of nature art sure to guide and inspire students in their own artistic endeavors. The site also hosts a News section which currently links to a variety of articles and reports about the potential effects of global climate change. In addition, site visitors will find brief information entries and photos for a number of Amphibians, Birds, Insects, Trees, Flowers, and Fungi. The site also offers information about topics like seasonal color changes in leaves; and basic instructions for both primary and secondary-aged youth for keeping phenological records.

315

Nature Outlook: Malaria  

NSDL National Science Digital Library

The journal Nature provides a range of peer-reviewed scientific works on a weekly basis, along with science updates and materials aimed at the general public. This particular feature on malaria is available at no charge to the curious public, and as the homepage asks, "What will it take to finally subdue this deadly disease?" Visitors will find a collection of recent articles in the Outlook area, such as "The Numbers Game" and "Vaccines: The Take Home Lesson." Moving on, the Collection area brings together peer-reviewed pieces on the story behind the efforts to eradicate the disease, along with some nice pieces about how the disease is transmitted. It's easy to see how this collection could be used in a public health course, or in another classroom setting. Finally, the site also includes links to popular articles from Nature, along with other open access materials.

316

Naturally selecting solutions  

PubMed Central

For decades, computer scientists have looked to nature for biologically inspired solutions to computational problems; ranging from robotic control to scheduling optimization. Paradoxically, as we move deeper into the post-genomics era, the reverse is occurring, as biologists and bioinformaticians look to computational techniques, to solve a variety of biological problems. One of the most common biologically inspired techniques are genetic algorithms (GAs), which take the Darwinian concept of natural selection as the driving force behind systems for solving real world problems, including those in the bioinformatics domain. Herein, we provide an overview of genetic algorithms and survey some of the most recent applications of this approach to bioinformatics based problems. PMID:23222169

Manning, Timmy; Sleator, Roy D; Walsh, Paul

2013-01-01

317

Illinois Natural History Survey  

NSDL National Science Digital Library

The University of Illinois at Urbana-Champaign is responsible for the Illinois Natural History Survey (INHS), whose mission is "to investigate and document the biological resources of Illinois...and to acquire and provide natural history information...to promote the common understanding, conservation, and management of these resources." Along the top of the page visitors can find headings that include "Research", "Data", "Publications", and "Events". The "Research" portion of the website includes seven areas of research from which to choose including "Entomology", "Invasive Species", "Wildlife Ecology", and "Human Interactions". The "Data" section provides ecological monitoring data, GIS data, a clearinghouse of wildlife ecology software, and collection databases which allow visitors to search for specimens of plants and animals. The "Publications" include educational materials, annual reports, manuals, a bulletin, and a circular. For those interested in events at the INHS, the "Events" link provides a nice calendar of upcoming seminars.

318

Natural environment analysis  

NASA Technical Reports Server (NTRS)

Qualitative analyses (and quantitatively to the extend possible) of the influence of terrain features on wind loading of the space shuttle while on the launch pad, or during early liftoff, are presented. Initially, the climatology and meteorology producing macroscale wind patterns and characteristics fot he Vandenburg Air Force Base (VAFB) launch site are described. Also, limited field test data are analyzed, and then the nature and characteristic of flow disturbances due to the various terrain features, both natural and man-made, are then reviewed. Following this, the magnitude of these wind loads are estimated. Finally, effects of turbulence are discussed. The study concludes that the influence of complex terrain can create significant wind loading on the vehicle. Because of the limited information, it is not possible to quantify the magnitude of these loads.

1985-01-01

319

Notebaert Nature Museum  

NSDL National Science Digital Library

The Notebaert Nature Museum fosters environmental learning through its exhibits and over 100 science and nature programs. The museum puts a particular emphasis on environmental sustainability, with its extensive outdoor Greening Project exhibit and full sized Extreme Green House in the middle of the museum. It also boasts the only year round live butterfly exhibit in the region and River Works, an interactive water exhibit. The Museum’s new Teacher Advisory Board involves educators in brainstorming, evaluating, and piloting educational programming developed by Museum staff, and the Museum's Science Teaching Network is a summer institute and meetings designed to create a collaborative learning environment where teachers work together to develop integrated science curricula using classroom and Museum-based lessons. The website provides information on teacher workshops, field trips off site education, Scouts programs, summer camps, teen programs and community partnerships.

320

Responses to natural disasters  

NASA Astrophysics Data System (ADS)

Since 1964, natural disasters caused by earthquakes, volcanic eruptions, or extreme weather in the form of floods, droughts, or hurricanes, have been responsible for more than 2,756,000 deaths worldwide in nations other than the United States, the Soviet Union, and the Eastern European Bloc, according to figures tabulated by the Office of Foreign Disaster Assistance (OFDA) of the Agency for International Development (AID). Over 95% of these fatalities occurred in developing or third world countries. Damage resulting from these calamities has been severe but extremely difficult to estimate in monetary terms. In 1986, U.S. government and voluntary agencies spent $303 million on natural disaster assistance around the world, 79% of total world assistance. In 1985 the U.S. total was nearly $900 million, 48% of the $1.84 billion world total.

Maggs, William Ward

321

eNature.com  

NSDL National Science Digital Library

This new nature portal offers online searchable field guides to over 4,800 plant and animal species. Derived from 35 different Audubon Society Field Guides, Regional Guides, and Nature Guides, the database is keyword-searchable by group (mammals, amphibians, fishes, trees, etc.) or browseable within subheadings for each group. The field guide entries include a large thumbnail image, description, and varying additional information. Users can also conduct an advanced search by size, color, habitat, region, and other options within each group. Registered members (it's free) can add selected plants or animals to their "Life List," which is saved at the site, along with notes or comments. While the field guides alone make the site worth a visit, there is more, including an Ask an Expert message board, Habitat Guides, news features, tips for teachers, and in the future, a comprehensive Outdoor Planner.

322

Investigating Natural Selection  

NSDL National Science Digital Library

In this activity, students experience one mechanism for evolution through a simulation that models the principles of natural selection and helps answer the question 'how might biological change have occurred and been reinforced over time?' Students will discover that species evolve over time and evolution is the consequence of the interaction of the potential for a species to increase in number, the genetic variability of offspring due to mutation and recombination of genes, a finite supply of the resources required for life, and the ensuing selection of those offspring better able to survive and leave offspring in a particular environment. Natural selection and its evolutionary consequences provide a scientific explanation for the fossil record of ancient life forms, as well as for the striking molecular similarities observed among the diverse species of living organisms. The site also contains a list of materials and all information and instructions required to complete this activity.

323

PBS Science and Nature  

NSDL National Science Digital Library

Information on programs and related content for Public Broadcasting Service (PBS) television shows on science and nature, including "Nature," "Nova," "I, Cringely," and "Scientific American Frontiers." The site's home page features a listing of individual program episodes arranged by topic (archaeology and anthropology, earth and habitat, physics, technology and inventions, creatures, health and medicine, and space). There is also a listing of featured sites, programming schedules, and links to interactive features (quizzes, games, polls, and others). The PBS teachers' page provides access to lesson plans, interactives, and other resources based on PBS science programming. There are also links to materials for younger students, such as the "Dragonfly TV" site, with games, activities, podcasts, and other items, and hands-on activities from the program "ZOOMsci" which students can perform themselves.

324

Natural Dark Energy  

E-print Network

It is now well accepted that both Dark Matter and Dark Energy are required in any successful cosmological model. Although there is ample evidence that both Dark components are necessary, the conventional theories make no prediction for the contributions from each of them. Moreover, there is usually no intrinsic relationship between the two components, and no understanding of the nature of the mysteries of the Dark Sector. Here we suggest that if the Dark Side is so seductive then we should not be restricted to just 2 components. We further suggest that the most natural model has 5 distinct forms of Dark Energy in addition to the usual Dark Matter, each contributing precisely equally to the cosmic energy density budget.

Douglas Scott; Ali Frolop

2007-03-30

325

Natural Dark Energy  

E-print Network

It is now well accepted that both Dark Matter and Dark Energy are required in any successful cosmological model. Although there is ample evidence that both Dark components are necessary, the conventional theories make no prediction for the contributions from each of them. Moreover, there is usually no intrinsic relationship between the two components, and no understanding of the nature of the mysteries of the Dark Sector. Here we suggest that if the Dark Side is so seductive then we should not be restricted to just 2 components. We further suggest that the most natural model has 5 distinct forms of Dark Energy in addition to the usual Dark Matter, each contributing precisely equally to the cosmic energy density budget.

Scott, Douglas

2007-01-01

326

Notes on natural inflation  

NASA Astrophysics Data System (ADS)

In the so-called natural inflation, an axion-like inflaton is assumed to have a cosine-type periodic potential. This is not the case in a very simple model in which the axion-like inflaton is coupled to an SU(N) (or other) pure Yang-Mills, at least in the large N limit as pointed out by Witten. It has a multi-valued potential, which is effectively quadratic, i.e., there is only a mass term in the large N limit. Thanks to this property, chaotic inflation can be realized more naturally with the decay constant of the axion-like inflaton less than the Planck scale. We demonstrate these points explicitly by using softly broken Script N=1 Super-Yang-Mills which allows us to treat finite N. This analysis also suggests that moderately large gauge groups such as E8 are good enough with a Planck scale decay constant.

Yonekura, Kazuya

2014-10-01

327

Obesity: Nature or Nurture?  

Microsoft Academic Search

\\u000a The debate about the causes of the current obesity epidemic rages on. The issue of “Whose fault is it?” frequently devolves\\u000a into a related question: “Is it ‘nature’ (i.e., inherent in our genes and biochemistry before birth, and therefore out of\\u000a our control) or ‘nurture’ (i.e., behaviors learned after birth and within our control to change)?” This chapter explores the

Robert H. Lustig

328

Natural Attenuation Tool Kit  

NSDL National Science Digital Library

Created by Julie Crosby, this site provides information and links to agencies and companies concerned with environmental remediation, in particular by natural attenuation. Although some sections are still under construction, Products provides interested parties with links to software and field applications. The Papers section contains four technical papers and six regulatory papers plus two publication metasites maintained by the Environmental Protection Agency (EPA). Other areas of interest at the site include links to government agencies and a list of conferences, updated regularly.

329

Thermoacoustic natural gas liquefier  

SciTech Connect

Cryenco and Los Alamos are collaborating to develop a natural-gas-powered natural-gas liquefier that will have no moving parts and require no electrical power. It will have useful efficiency, remarkable reliability, and low cost. The liquefaction of natural gas, which occurs at only 115 Kelvin at atmospheric pressure, has previously required rather sophisticated refrigeration machinery. The 1990 invention of the thermoacoustically driven orifice pulse-tube refrigerator (TA-DOPTR) provides cryogenic refrigeration with no moving parts for the first time. In short, this invention uses acoustic phenomena to produce refrigeration from heat. The required apparatus consists of nothing more than helium-filled heat exchangers and pipes, made of common materials, without exacting tolerances. In the Cryenco-Los Alamos collaboration, the authors are developing a version of this invention suitable for use in the natural-gas industry. The project is known as acoustic liquefier for short. The present program plans call for a two-phase development. Phase 1, with capacity of 500 gallon per day (i.e., approximately 40,000 scfd, requiring a refrigeration power of about 7 kW), is large enough to illuminate all the issues of large-scale acoustic liquefaction without undue cost, and to demonstrate the liquefaction of 60--70% of input gas, while burning 30--40%. Phase 2 will target versions of approximately 10{sup 6} scfd = 10,000 gallon per day capacity. In parallel with both, they continue fundamental research on the technology, directed toward increased efficiency, to build scientific foundations and a patent portfolio for future acoustic liquefiers.

Swift, G.W. [Los Alamos National Lab., NM (United States). Condensed Matter and Thermal Physics Group

1997-05-01

330

The Nature of Things  

NSDL National Science Digital Library

This site features interactive tools related to The Nature of Things television show. The tools include different videos and descriptions of a wide variety of subjects. Some examples include biomimicry, human illness, indoor pollution, and other issues affecting humans. The subject area covered is a very wide range, but users studying or interested in the human brain, biology of human beings, or relationships between animals will no doubt find this site intriguing.

331

Nature by Numbers  

NSDL National Science Digital Library

This 4-minute computer animation highlights three forms in nature that have connections with numbers and geometry. The Fibonacci sequence and the golden ratio are shown relating to the chambered nautilus shell and the sunflower seed pattern. The Delaunay triangulation and Voronoi tessellation are shown to simulate the capillary distribution on a dragonfly wing. Included are descriptions of the mathematics and stills from the production.

332

Natural Language Processing  

Microsoft Academic Search

\\u000a Text processing represents a preliminary phase to many document content handling tasks aimed at extracting and organizing\\u000a information therein. The computer science disciplines devoted to understanding language, and hence useful for such objectives,\\u000a are Computational Linguistics and Natural Language Processing. They rely on the availability of suitable linguistic resources (corpora, computational lexica, etc.) and of standard representation\\u000a models of linguistic

Stefano Ferilli

333

Natural Disturbance Production Functions  

Microsoft Academic Search

Natural disturbances in forests are driven by physical and biological processes. Large, landscape scale disturbances derive\\u000a primarily from weather (droughts, winds, ice storms, and floods), geophysical activities (earthquakes, volcanic eruptions,\\u000a even asteroid strikes), fires, insects, and diseases. Humans have always been affected by these processes and have invented\\u000a ways to harness such processes or manipulate vegetation to enhance the values

Jeffrey P. Prestemon; D. Evan Mercer; John M. Pye

334

A Natural Integration  

NSDL National Science Digital Library

A five-week study taught students how to write a field guide that identified the plants in a small wooded area they passed through on their way to their school playground. By creating this authentic genre of science writing, students came to understand and care for the natural world in their immediate environment. They also developed important science, reading, and writing skills through purposeful work.

Heidi Trudel

2007-04-01

335

Natural killer cell memory  

Microsoft Academic Search

Natural killer (NK) cells are bone marrow–derived granular lymphocytes that have a key role in immune defense against viral and bacterial infections and malignancies. NK cells are traditionally defined as cells of the innate immune response because they lack RAG recombinase–dependent clonal antigen receptors. However, evidence suggests that specific subsets of mouse NK cells can nevertheless develop long-lived and highly

Silke Paust; Ulrich H von Andrian

2011-01-01

336

Scitable by Nature Education  

NSDL National Science Digital Library

A free science library and personal learning tool brought to you by Nature Publishing Group, the world's leading publisher of science. Scitable currently concentrates on genetics, the study of evolution, variation, and the rich complexity of living organisms. As you cultivate your understanding of modern genetics on Scitable, you will explore not only what we know about genetics and the ways it impacts our society, but also the data and evidence that supports our knowledge.

337

Nature's way of optimizing  

Microsoft Academic Search

We propose a general-purpose method for finding high-quality solutions to hard optimization problems, inspired by self-organizing processes often found in nature. The method, called Extremal Optimization, successively eliminates extremely undesirable components of sub-optimal solutions. Drawing upon models used to simulate far-from-equilibrium dynamics, it complements approximation methods inspired by equilibrium statistical physics, such as Simulated Annealing. With only one adjustable parameter,

Stefan Boettcher; Allon G. Percus

2000-01-01

338

Nature's Greatest Puzzles  

SciTech Connect

It is a pleasure to be part of the SLAC Summer Institute again, not simply because it is one of the great traditions in our field, but because this is a moment of great promise for particle physics. I look forward to exploring many opportunities with you over the course of our two weeks together. My first task in talking about Nature's Greatest Puzzles, the title of this year's Summer Institute, is to deconstruct the premise a little bit.

Quigg, Chris; /Fermilab

2005-02-01

339

Natural Underwater Adhesives  

PubMed Central

The general topic of this review is protein-based underwater adhesives produced by aquatic organisms. The focus is on mechanisms of interfacial adhesion to native surfaces and controlled underwater solidification of natural water-borne adhesives. Four genera that exemplify the broad range of function, general mechanistic features, and unique adaptations are discussed in detail: blue mussels, acorn barnacles, sandcastle worms, and freshwater caddisfly larva. Aquatic surfaces in nature are charged and in equilibrium with their environment, populated by an electrical double layer of ions as well as adsorbed natural polyelectrolytes and microbial biofilms. Surface adsorption of underwater bioadhesives likely occurs by exchange of surface bound ligands by amino acid sidechains, driven primarily by relative affinities and effective concentrations of polymeric functional groups. Most aquatic organisms exploit modified amino acid sidechains, in particular phosphorylated serines and hydroxylated tyrosines (dopa), with high-surface affinity that form coordinative surface complexes. After delivery to the surfaces as a fluid, permanent natural adhesives solidify to bear sustained loads. Mussel plaques are assembled in a manner superficially reminiscent of in vitro layer-by-layer strategies, with sequentially delivered layers associated through Fe(dopa)3 coordination bonds. The adhesives of sandcastle worms, caddisfly larva, and barnacles may be delivered in a form somewhat similar to in vitro complex coacervation. Marine adhesives are secreted, or excreted, into seawater that has a significantly higher pH and ionic strength than the internal environment. Empirical evidence suggests these environment triggers could provide minimalistic, fail-safe timing mechanisms to prevent premature solidification (insolubilization) of the glue within the secretory system, yet allow rapid solidification after secretion. Underwater bioadhesives are further strengthened by secondary covalent curing. PMID:21643511

Stewart, Russell J.; Ransom, Todd C.; Hlady, Vladimir

2011-01-01

340

PBS NATURE: Flight School  

NSDL National Science Digital Library

Flight School is a PBS NATURE companion website for a video production about the amazing recovery of the Whooping Crane. The site includes an interview with Operation Migration's Joseph Duff, information about bird flyways, imprinting, and more. The website links to a downloadable Teacher's Guide, a list of relevant links and books, and desktop images. A short video clip of the whooping cranes in flight is provided as well.

341

Technology Versus Nature  

NSDL National Science Digital Library

This article, written by a member of the Partnership for Advanced Technology in Housing, discusses building materials and practices that can improve residential installation's resistance to major storms and natural disasters. An example of an area that is using these weather resistant designs is in Florida; the article cites the vulnerability of coastal homes to hurricanes and outlines some efforts to build them in a more structurally sound manner.

McNulty, Maureen

342

Zion Natural History Association  

NSDL National Science Digital Library

The Zion Natural History Association (ZNHA) is a non-profit organization established in 1931 to support education, research, publication and other programs for the benefit of Zion National Park, Cedar Breaks National Monument, and Pipe Spring National Monument. Visitors to this site can acess information about the scientific, educational, historical, and interpretive activities of the Association and its sister organization, the Zion Canyon Field Institute.

343

Harnessing natural ventilation benefits.  

PubMed

Making sure that a healthcare establishment has a good supply of clean fresh air is an important factor in keeping patients, staff, and visitors, free from the negative effects of CO2 and other contaminants. John O'Leary of Trend Controls, a major international supplier of building energy management solutions (BEMS), examines the growing use of natural ventilation, and the health, energy-saving, and financial benefits, that it offers. PMID:23678661

O'Leary, John

2013-04-01

344

Introduction to Natural Selection  

NSDL National Science Digital Library

This lesson is an introduction to natural selection and is suited to any student who is just beginning his or her discovery of evolution. The motivation introduces a species of bird that became (over millions of years) numerous species, through adaptation. The development is a hands-on activity that demonstrates how populations change little by little, generation by generation, due to survival of species that have traits that are beneficial in an environment.

Science Netlinks

2002-03-28

345

Texas Nature Trackers  

NSDL National Science Digital Library

Through Texas Nature Trackers projects, you can learn how to gather data about various species found on public lands or on your own property. Collected data is sent to biologists who use the information to gain a better understanding of the status and management needs of various species. The goal of the program is to enable long-term conservation of these species and appreciation among Texas citizens.

2014-05-14

346

Nature as quantum computer  

E-print Network

Set theory reduces all processes to assembly and disassembly. A similar architecture is proposed for nature as quantum computer. It resolves the classical space-time underlying Feynman diagrams into a quantum network of creation and annihilation processes, reducing kinematics to quantum statistics, and regularizing the Lie algebra of the Einstein diffeomorphism group. The usually separate and singular Lie algebras of kinematics, statistics, and conserved currents merge into one regular statistics Lie algebra.

David Ritz Finkelstein

2012-01-08

347

Natural History of Hawaii  

NSDL National Science Digital Library

The first Web site (1) is a ThinkQuest entry designed by students from Kapolei Elementary School. Although it's geared toward kids, it offers a great overview of the natural history of Hawaii that should benefit anyone not already familiar with the islands. The next Web site (2), from the Hawaiian Ecosystems at Risk Project, outlines the alien species situation in Hawaii and presents a 10-point action plan for combating this problem. The National Wildlife Health Center of the US Geological Survey describes the projects of the Hawaii Field Station in this straightforward Web site (3). Visitors can take a virtual tour of Oahu's Lyon Arboretum and learn about some of Hawaii's unique flora along the way (4). The Hawaii Natural Area Reserves System Web site (5) contains general descriptions and photos of nature reserves on Kauai, Oahu, Molokai, Maui, and the Big Island. Visitors to the next site (6) can browse a gallery of colorful Hawaiian-themed prints created by naturalist painter N. Robert Wagstaff. Terra Galleria Photography offers another collection of beautiful images, this time of Haleakala National Park. Images from this Web site (7) include photos of the highly endangered silversword plant. The final Web site is an article from ScienceDaily Magazine about some of the efforts to save this rare plant, which serves as a symbol of Hawaii's ecological plight (8).

Sohmer, Rachel.

2002-01-01

348

Microflyers: inspiration from nature  

NASA Astrophysics Data System (ADS)

Over the past decade, there has been considerable interest in miniaturizing aircraft to create a class of extremely small, robotic vehicles with a gross mass on the order of tens of grams and a dimension on the order of tens of centimeters. These are collectively refered to as micro aerial vehicles (MAVs) or microflyers. Because the size of microflyers is on the same order as that of small birds and large insects, engineers are turning to nature for inspiration. Bioinspired concepts make use of structural or aerodynamic mechanisms that are observed in insects and birds, such as elastic energy storage and unsteady aerodynamics. Biomimetic concepts attempt to replicate the form and function of natural flyers, such as flapping-wing propulsion and external appearance. This paper reviews recent developments in the area of man-made microflyers. The design space for microflyers will be described, along with fundamental physical limits to miniaturization. Key aerodynamic phenomena at the scale of microflyers will be highlighted. Because the focus is on bioinspiration and biomimetics, scaled-down versions of conventional aircraft, such as fixed wing micro air vehicles and microhelicopters will not be addressed. A few representative bioinspired and biomimetic microflyer concepts developed by researchers will be described in detail. Finally, some of the sensing mechanisms used by natural flyers that are being implemented in man-made microflyers will be discussed.

Sirohi, Jayant

2013-04-01

349

One for All?: Connectedness to Nature, Inclusion of Nature, Environmental Identity, and Implicit Association with Nature  

Microsoft Academic Search

Pleasurable experiences in nature are suspected to promote a personal connection with nature, and subsequently, nature conservation in individuals. Using an Internet-based survey employing a convenience sample of the general population (N = 1,309), we developed a connection-with-nature instrument that relies on only simple self-reflection. That is, connection with nature is indirectly derived from inspecting reports of past bonding activities

Adrian Brügger; Florian G. Kaiser; Nina Roczen

2010-01-01

350

NATURAL RESOURCES ASSESSMENT  

SciTech Connect

The purpose of this report is to summarize the scientific work that was performed to evaluate and assess the occurrence and economic potential of natural resources within the geologic setting of the Yucca Mountain area. The extent of the regional areas of investigation for each commodity differs and those areas are described in more detail in the major subsections of this report. Natural resource assessments have focused on an area defined as the ''conceptual controlled area'' because of the requirements contained in the U.S. Nuclear Regulatory Commission Regulation, 10 CFR Part 60, to define long-term boundaries for potential radionuclide releases. New requirements (proposed 10 CFR Part 63 [Dyer 1999]) have obviated the need for defining such an area. However, for the purposes of this report, the area being discussed, in most cases, is the previously defined ''conceptual controlled area'', now renamed the ''natural resources site study area'' for this report (shown on Figure 1). Resource potential can be difficult to assess because it is dependent upon many factors, including economics (demand, supply, cost), the potential discovery of new uses for resources, or the potential discovery of synthetics to replace natural resource use. The evaluations summarized are based on present-day use and economic potential of the resources. The objective of this report is to summarize the existing reports and information for the Yucca Mountain area on: (1) Metallic mineral and mined energy resources (such as gold, silver, etc., including uranium); (2) Industrial rocks and minerals (such as sand, gravel, building stone, etc.); (3) Hydrocarbons (including oil, natural gas, tar sands, oil shales, and coal); and (4) Geothermal resources. Groundwater is present at the Yucca Mountain site at depths ranging from 500 to 750 m (about 1,600 to 2,500 ft) below the ground surface. Groundwater resources are not discussed in this report, but are planned to be included in the hydrology section of future revisions of the ''Yucca Mountain Site Description'' (CRWMS M&O 2000c).

D.F. Fenster

2000-12-11

351

CURSO DE PS-GRADUAO EM ENGENHARIA E TECNOLOGIA ESPACIAIS  

E-print Network

CURSO DE PÓS-GRADUAÇÃO EM ENGENHARIA E TECNOLOGIA ESPACIAIS ÁREA DE CONCENTRAÇÃO EM COMBUSTÃO E TECNOLOGIA ESPACIAIS ÁREA DE CONCENTRAÇÃO EM COMBUSTÃO E PROPULSÃO Adaptação Obrigatórias para o mestrado PCP

352

nature.com nature publishing group nature science update naturejobs help my account e-alert subscribe regist  

E-print Network

nature.com nature publishing group nature science update naturejobs help my account e authors advertising about us contact us resources Nature Nature Materials Nature Biotechnology Nature Science Update Nature Physics Portal Naturejobs NPG Subject areas Access material from all our

Rogers, John A.

353

Artificial nature : water infrastructure and its experience as natural space  

E-print Network

This work is about water infrastructure and its experience as urban and natural space. It deals with the concepts of nature/geography, technology, and the integral experiential space by analyzing water dams and reservoirs ...

Demirta?, Fatma Asl?han, 1970-

2000-01-01

354

Natural gas monthly, April 1999  

SciTech Connect

The Natural Gas Monthly (NGM) highlights activities, events, and analyses of interest to public and private sector organizations associated with the natural gas industry. Volume and price data are presented each month for natural gas production, distribution, consumption, and interstate pipeline activities. Producer-related activities and underground storage data are also reported. From time to time, the NGM features articles designed to assist readers in using and interpreting natural gas information. There are two feature articles in this issue: Natural gas 1998: Issues and trends, Executive summary; and Special report: Natural gas 1998: A preliminary summary. 6 figs., 28 tabs.

NONE

1999-05-06

355

[Natural philosophy in medieval medicine].  

PubMed

Medieval medicine is not much interested in natural philosophy. Nevertheless, it is based upon clear methodological and epistemological principles, where the word 'nature' is used in several ways. The natural 'virtues' of things--including magical ones--are most important for therapy. Human health is influenced by stars (planets, zodiac) and seasons, and the physician has to take into account such cosmic effects. The chances of healing depend on the patients' 'nature' in relation to the power of illness. A strong nature makes medicine superfluous, an overwhelming disease cannot be beaten. Thus, medicine is limited to 'neutral' situations when supporting the patient makes his 'nature' win. PMID:18447188

Riha, Ortrun

2007-01-01

356

Natural theology and natural philosophy in the late Renaissance  

E-print Network

, there being so few atheists to convince. There simply does not appear to be the theoretical ‘market’ for arguments for God’s existence drawn from nature. Harold Fructbaum has written that ‘the message of natural... Henry suggests that a ‘sudden encroachment’ of theology into natural philosophy in the late sixteenth century was occasioned by a polemical aim to show that nature vindicated a ‘particular brand of religion better than any other.’34 Harold Fruchtbaum...

Woolford, Thomas

2012-04-10

357

Nature of Light  

NSDL National Science Digital Library

Overview: The Nature of Light SciPack explains the concept of light as electromagnetic radiation and as waves. It covers the electromagnetic spectrum and the effects of wavelength on the interaction of light with different materials, including some examples of phenomena that can be explained by differences in wavelength. It also covers electromagnetic waves as a form of energy. It does not address the ray model of light or optics. In addition to comprehensive inquiry-based learning materials tied to Science Education Standards and Benchmarks, the SciPack includes the following additional components: Pedagogical Implications section addressing common misconceptions, teaching resources and strand maps linking grade band appropriate content to standards. Access to one-on-one support via e-mail to content "Wizards". Final Assessment which can be used to certify mastery of the concepts. Learning Outcomes: Nature of Light: Characteristics of Light Trace a light ray as it hits a smooth reflecting surface, or, choose the correct path among given options. Predict the path of a light ray as it passes through a series of transparent materials (given the index of refraction of each material). Describe the behavior of light waves as they are diffract (or bend) around corners. Recognize examples of phenomena in your environment that are caused by the diffraction or interference of waves (the fact that you can hear someone around a corner, the behavior of water waves, light through diffraction grating). Nature of Light: Light As Waves Provide examples of energy transfer by light (such as tanning, light warming a surface, solar cells, etc.) Describe the characteristics of transverse waves and explain how waves transfer energy from place to place. Describe the relationship between the wavelength and frequency of light waves. Explain how electromagnetic waves are produced either in nature or by humans. Identify the various parts of the electromagnetic spectrum, and place them in order of increasing or decreasing wavelength. Determine the behavior of two light waves that interfere with one another. Nature of Light: Light and Color Describe the relationship of color as perceived by the human eye and the wavelength of light waves. Describe the relationship of the colors in the visible spectrum (as perceived by the human eye) to the electromagnetic spectrum. Describe how the color of a beam of light is affected by scattering. Summarize the interaction of the molecules of greenhouse gases and different wavelengths of light, and how that results in heat being trapped in the troposphere. Nature of Light: So, What Is Light? Describe the circumstances (experiments, real world situations) in which the behavior of light is best described as a wave or a particle. Describe the relationship between the frequency of a photon and its energy. Explain how a unique series of spectral lines are formed for an element (an atom or a group of free atoms of that element). Describe how spectra can be used to identify substances.

National Science Teachers Association (NSTA)

2009-05-01

358

Go Abroad in Natural ResourcesNatural Resources  

E-print Network

. Natural Resources students have options in Sweden & Finland and New Zealand. IE3 Global Internships: IE3 geographic region and people. Study abroad may enhance your ability to: · Consider natural resource issues different approaches to natural resource restoration, conservation, and management · Gain new science

Escher, Christine

359

Does Mother Nature Corrupt? Natural Resources, Corruption, and Economic Growth  

Microsoft Academic Search

This paper argues that natural resource abundance creates opportunities for rent-seeking behavior and is an important factor in determining a country's level of corruption. In a simple growth model, we illustrate the interrelationships between natural resources, corruption, and economic growth, and discuss potential anti-corruption policies. We show that the extent of corruption depends on natural resource abundance, government policies, and

Carlos Leite; Jens Weidmann

1999-01-01

360

SUPPLEMENTARY INFORMATION 1www.nature.com/nature  

E-print Network

, USA Contents Part A ­ Natural selection versus kin selection 2 1 Mutation-selection analysis 3 2 3 Comparing natural selection and kin selection 9 3.1 Additional assumptions needed for inclusive References 39 Part A ­ Natural selection versus kin selection Kin selection theory based on the concept

Miller, Thomas E.

361

nature geoscience | www.nature.com/naturegeoscience 1 SUPPLEMENTARY INFORMATION  

E-print Network

nature geoscience | www.nature.com/naturegeoscience 1 SUPPLEMENTARY INFORMATION doi: 10.1038/ngeo: Seasonal cycle of a) precipitation and b) 18 O in NE Brazil for control run and mid-Holocene (6 ky B)Abissal Stalagmite. Error bars indicate 2 error. #12;2 nature geoscience | www

Massachusetts at Amherst, University of

362

Warner College of Natural Resources Warner College of Natural  

E-print Network

. COLLEGE PROGRAMS Undergraduate Majors The scope of the College's programs is more broadly based than most Resources. It is desirable that students in the College have opportunities to study abroad, just as studentsWarner College of Natural Resources Warner College of Natural Resources Office in Natural Resources

Collett Jr., Jeffrey L.

363

EM international activities. February 1997 highlights  

SciTech Connect

EM International Highlights is a brief summary of on-going international projects within the Department of Energy`s Office of Environmental Management (EM). This document contains sections on: Global Issues, activities in Western Europe, activities in central and Eastern Europe, activities in Russia, activities in Asia and the Pacific Rim, activities in South America, activities in North America, and International Organizations.

NONE

1997-02-01

364

School Budget Hold'em Facilitator's Guide  

ERIC Educational Resources Information Center

"School Budget Hold'em" is a game designed to help school districts rethink their budgeting process. It evolved out of Education Resource Strategies' (ERS) experience working with large urban districts around the country. "School Budget Hold'em" offers a completely new approach--one that can turn the budgeting process into a long-term visioning…

Education Resource Strategies, 2012

2012-01-01

365

Analysis of EM Channel of Producing Well  

Microsoft Academic Search

Measurements while drilling (MWD) is a new technology by which we can observe the measurement values of the drilling parameters in the way of real-time. Use the results of searching the electromagnetic (EM) transmission channel for MWD for reference, an EM transmission model for the wireless transmission is set up. In addition, the model parameters are calculated by using the

Jintao Yu; Mingli Ding; Tingwei Liang

2008-01-01

366

Nature, nurture and epigenetics.  

PubMed

Real life by definition combines heritability (e.g., the legacy of exposures) and experience (e.g. stress during sensitive or 'critical' periods), but how to study or even model this interaction has proven difficult. The hoary concept of evaluating traits according to nature versus nurture continues to persist despite repeated demonstrations that it retards, rather than advances, our understanding of biological processes. Behavioral genetics has proven the obvious, that genes influence behavior and, vice versa, that behavior influences genes. The concept of Genes X Environment (G X E) and its modern variants was viewed as an improvement on nature-nurture but has proven that, except in rare instances, it is not possible to fractionate phenotypes into these constituent elements. The entanglement inherent in terms such as nature-nurture or G X E is a Gordian knot that cannot be dissected or even split. Given that the world today is not what it was less than a century ago, yet the arbitrator (differential survival and reproduction) has stayed constant, de novo principles and practices are needed to better predict what the future holds. Put simply, the transformation that is now occurring within and between individuals as a product of global endocrine disruption is quite independent of what has been regarded as evolution by selection. This new perspective should focus on how epigenetic modifications might revise approaches to understand how the phenotype and, in particular its components, is shaped. In this review we summarize the literature in this developing area, focusing on our research on the fungicide vinclozolin. PMID:25102229

Crews, David; Gillette, Ross; Miller-Crews, Isaac; Gore, Andrea C; Skinner, Michael K

2014-12-01

367

Nature.com Blogs  

NSDL National Science Digital Library

This site brings together all of the blogs for the Nature Publishing Group, including discussions on public health, genetics, chemistry, and other interesting topics. First-time visitors can glance over recent meditations from British physicians on new and improved surgical operations and the Higgs-Boson particle. Visitors can read through one or all of the fifteen blogs or scroll down to the New Comments and Popular areas. In this last section, visitors can get a sense of the Most Read, Most Shared, and Most Commented items by other readers.

368

The Nature of Salt  

NSDL National Science Digital Library

This is a hands-on lab activity about the composition of salt. Learners will explain the general relationship between an element's Periodic Table Group Number and its tendency to gain or lose electron(s), and explain the difference between molecular compounds and ionic compounds. They will then use household materials to build a model to demonstrate sodium chloride's cubic form and describe the nature of the electrostatic attraction that holds the structure of salt together. Background information, common preconceptions, a glossary and more is included. This activity is part of the Aquarius Hands-on Laboratory Activities.

2012-08-03

369

Marine natural products.  

PubMed

This review covers the literature published in 2011 for marine natural products, with 870 citations (558 for the period January to December 2011) referring to compounds isolated from marine microorganisms and phytoplankton, green, brown and red algae, sponges, cnidarians, bryozoans, molluscs, tunicates, echinoderms, mangroves and other intertidal plants and microorganisms. The emphasis is on new compounds (1152 for 2011), together with the relevant biological activities, source organisms and country of origin. Biosynthetic studies, first syntheses, and syntheses that lead to the revision of structures or stereochemistries, have been included. PMID:23263727

Blunt, John W; Copp, Brent R; Keyzers, Robert A; Munro, Murray H G; Prinsep, Michèle R

2013-02-01

370

Marine natural products.  

PubMed

Covering: 2010. Previous review: Nat. Prod. Rep., 2011, 28, 196. This review covers the literature published in 2010 for marine natural products, with 895 citations (590 for the period January to December 2010) referring to compounds isolated from marine microorganisms and phytoplankton, green, brown and red algae, sponges, cnidarians, bryozoans, molluscs, tunicates, echinoderms, mangroves and other intertidal plants and microorganisms. The emphasis is on new compounds (1003 for 2010), together with the relevant biological activities, source organisms and country of origin. Biosynthetic studies, first syntheses, and syntheses that lead to the revision of structures or stereochemistries, have been included. PMID:22193773

Blunt, John W; Copp, Brent R; Keyzers, Robert A; Munro, Murray H G; Prinsep, Michèle R

2012-02-01

371

Marine natural products.  

PubMed

This review covers the literature published in 2012 for marine natural products, with 1035 citations (673 for the period January to December 2012) referring to compounds isolated from marine microorganisms and phytoplankton, green, brown and red algae, sponges, cnidarians, bryozoans, molluscs, tunicates, echinoderms, mangroves and other intertidal plants and microorganisms. The emphasis is on new compounds (1241 for 2012), together with the relevant biological activities, source organisms and country of origin. Biosynthetic studies, first syntheses, and syntheses that lead to the revision of structures or stereochemistries, have been included. PMID:24389707

Blunt, John W; Copp, Brent R; Keyzers, Robert A; Munro, Murray H G; Prinsep, Michèle R

2014-01-17

372

Patterns in Nature  

NSDL National Science Digital Library

This page is a companion to the Exploring Patterns in Nature Curriculum Guides (see related pages) developed by the Center for Polymer Studies. It represents several basic Java Applets which illustrate basic concepts in statistical mechanics and fractals. Note that these programs do not necessarily match the software instructions in our curriculum guides. The guides were written to correspond to standalone software developed in the early 1990s. Since Apple Macintosh computers were most popular in schools at the time, we developed for that platform. Those programs were all Mac System 7 compatible and obviously are not OS X compatible. We have plans to breathe new life into these programs and curriculum.

McGath, Gary

373

Nature: Extraordinary Birds  

NSDL National Science Digital Library

This Web site is the online companion to Extraordinary Birds, a recent documentary from PBS's Nature. "From Kundha Kulam's vibrant monsoon marshes to the rugged American Rockies," Extraordinary Birds explores the "intimate links that people have forged with birds." This is a great site to visit whether you've seen the program or not. Users will find video clips, an interview with the editor of American Falconry magazine, a short quiz, and other engaging features. The Web site also provides links and other resources for further exploring this fascinating subject. This site is also reviewed in the September 5, 2003 NSDL Life Sciences Report.

374

"Naturally occurring asbestos  

NASA Astrophysics Data System (ADS)

The term asbestos refers to six silicate minerals from amphibole and serpentine groups. By definition, it consists in bundles of thin and flexible long fibers, with high-tensile strength, and chemical and heat resistance. In contrast to asbestos found within commercial products and mining, the specific term ''naturally occurring asbestos'' (NOA) refers to asbestiform minerals occurring within rocks or soils that can be released by human activities or weathering processes. The fact that the exposure to asbestos is related to lung pathologies is now widely demonstrated (e.g. asbestosis, mesothelioma and lung cancer). However, if health risks associated with exposure to NOA exist, they are not yet well documented. The crystallization of natural asbestos occurs in specific Mg-rich lithologies associated with peculiar structural and metamorphic conditions. By recognizing and combining such specific geologic criteria, the presence or the absence of asbestos in bedrock terrains can be reasonably predicted and maps of NOA hazard can be drawn. We present here new results of geological mapping and petrological study concerning the evaluation of the NOA hazard in the Alps and Corsica, in France. The three folds approach consists in (1) a determination of lithologies with potential NOA from a bibliographic compilation and extraction of target zones from a geological geodatabase (2) a geological mapping of the target zones followed by a petrological characterization of sampled asbestiform minerals in the laboratory (optical microscopy, TEM, SEM, and Raman spectroscopy technics), and (3) the drawing of the final map of NOA hazard, at regional-scale. Occurrence criteria can be retained as follows: 1. NOA are abundant in the internal zones of the Alps and Corsica, especially within ophiolitic complexes. Natural asbestos are mostly concentrated within ultramafic rocks but can also occur within basic lithologies such as Mg-metagabbros, metabasalts and meta-pillow-lavas, 2. Asbestos is commonly located within fractures, shear-bands or shear-planes, developed during late retrograde metamorphic history, 3. Tremolite-actinolite-type asbestos is abundant both in ultramafic and mafic rocks, 4. Natural asbestos occur in few places within the external zones of the Alps, especially within hercynian ophiolitic massifs or concentrated in late Alpine fractures affecting leptyno-amphibolic lithologies.

Cagnard, F.; Lahondère, D.; Blein, O.; Lahfid, A.; Wille, G.

2012-04-01

375

Lands and natural resources  

SciTech Connect

The Tenth Circuit Court of Appeals decided a surprisingly small number of controversies involving lands and natural resources during the time period covered by the Tenth Annual Tenth Circuit Survey. The subject matter of the few land and resource decisions was also limited. Whereas in recent years the court has considered a wide variety of resource and land issues, the past year is distinguished by its lack of variety. Of the eight land and resource decisions published by the court, six concerned public lands, one involved Indian lands, and one resolved an environmental law question. This survey highlights the issues resolved in each of these cases.

Crane, J.

1984-01-01

376

Extending cosmological natural selection  

E-print Network

The purpose of this paper is to propose an extension to Lee Smolin's hypothesis that our own universe belongs to a population of universes evolving by natural selection. Smolin's hypothesis explains why the parameters of physics possess the values we observe them to possess, but depends upon the contingent fact that the universe is a quantum relativistic universe. It is proposed that the prior existence of a quantum relativistic universe can itself be explained by postulating that a process of cosmogenic drift evolves universes towards stable ('rigid') mathematical structures.

Gordon McCabe

2009-08-31

377

Natural Selection Simulation  

NSDL National Science Digital Library

This classroom activity introduces the concept of natural selection and how it relates to evolution. Students will use a variety of utensils including clothespins, tweezers and spoons to mimic animals with differently shaped mouths. The class will go through several trials, picking up at least twenty beans in one minute with their assigned utensil. If they fail to do so, their creature has died, demonstrating what happens to animals that cannot compete in the wild. Several discussion questions are included along with the activity.

2012-05-29

378

Marine natural products.  

PubMed

Covering: 2013. Previous review: Nat. Prod. Rep., 2014, 31, 160-258This review covers the literature published in 2013 for marine natural products (MNPs), with 982 citations (644 for the period January to December 2013) referring to compounds isolated from marine microorganisms and phytoplankton, green, brown and red algae, sponges, cnidarians, bryozoans, molluscs, tunicates, echinoderms, mangroves and other intertidal plants and microorganisms. The emphasis is on new compounds (1163 for 2013), together with the relevant biological activities, source organisms and country of origin. Reviews, biosynthetic studies, first syntheses, and syntheses that lead to the revision of structures or stereochemistries, have been included. PMID:25620233

Blunt, John W; Copp, Brent R; Keyzers, Robert A; Munro, Murray H G; Prinsep, Michèle R

2015-01-28

379

Natural antisense transcripts.  

PubMed

Recent years have seen the increasing understanding of the crucial role of RNA in the functioning of the eukaryotic genome. These discoveries, fueled by the achievements of the FANTOM, and later GENCODE and ENCODE consortia, led to the recognition of the important regulatory roles of natural antisense transcripts (NATs) arising from what was previously thought to be 'junk DNA'. Roughly defined as non-coding regulatory RNA transcribed from the opposite strand of a coding gene locus, NATs are proving to be a heterogeneous group with high potential for therapeutic application. Here, we attempt to summarize the rapidly growing knowledge about this important non-coding RNA subclass. PMID:24838284

Khorkova, Olga; Myers, Amanda J; Hsiao, Jane; Wahlestedt, Claes

2014-09-15

380

The Natural Science Pages  

NSDL National Science Digital Library

Anthony Carpi, assistant professor at John Jay College of Criminal Justice, provides the Natural Science Pages. The site is divided into two primary sections, NSC 107 course-specific material (online supplement to students enrolled in this course at John Jay College) and course lessons (general use). The topics covered in the Course Lessons are Scientific Method, Matter & Energy, Atomic Structure, Periodic Table, Atomic Bonding, Reactions, Acids & Bases, Nuclear Science, The Universe, Organic Chem, Nutrients, DNA, The Cell, and Basic Anatomy. Descriptions, images, diagrams, and links to related resources are provided for each topic. This is an excellent learning resource and is well worth a visit.

381

Em que medida devem ser privados, em que medida devem ser pblicos o conhecimento e a informao?  

E-print Network

Em que medida devem ser privados, em que medida devem ser públicos o conhecimento e a informação? 1 Transparências com licença Creative Commons Em que medida devem ser privados, em que medida devem ser públicos o as alternativas? codexKonstanz #12;Em que medida devem ser privados, em que medida devem ser públicos o

Kuhlen, Rainer

382

Pest management with natural products  

Technology Transfer Automated Retrieval System (TEKTRAN)

The 2012 Philadelphia ACS Symposium on Natural Products for Pest Management introduced recent discoveries and applications of natural products from insect, terrestrial plant, microbial, and synthetic sources for the management of insects, weeds, plant pathogenic microbes, and nematodes. The symposiu...

383

Natural ventilation generates building form  

E-print Network

Natural ventilation is an efficient design strategy for thermal comfort in hot and humid climates. The building forms can generate different pressures and temperatures to induce natural ventilation. This thesis develops a ...

Chen, Shaw-Bing

1996-01-01

384

Natural gas monthly, December 1995  

SciTech Connect

This report presents information of interest to organizations associated with the natural gas industry. Data are presented on natural gas production, distribution, consumption, and interstate pipeline activities. Producer-related activities and underground storage data are also included.

NONE

1995-12-01

385

Nature Publishing Group Site Licenses  

E-print Network

Genetics Eye Gene Therapy Genes & Immunity Heredity Hypertension Research Immunology & Cell Biology (British Dental Journal) BJC (British Journal of Cancer) Bone Marrow Transplantation Cancer Gene Therapy Psychiatry Molecular Systems Biology Molecular Therapy Mucosal Immunology Nature Nature archive: 1869

Cai, Long

386

Natural Gas Exports from Iran  

EIA Publications

This assessment of the natural gas sector in Iran, with a focus on Iran’s natural gas exports, was prepared pursuant to section 505 (a) of the Iran Threat Reduction and Syria Human Rights Act of 2012 (Public Law No: 112-158). As requested, it includes: (1) an assessment of exports of natural gas from Iran; (2) an identification of the countries that purchase the most natural gas from Iran; (3) an assessment of alternative supplies of natural gas available to those countries; (4) an assessment of the impact a reduction in exports of natural gas from Iran would have on global natural gas supplies and the price of natural gas, especially in countries identified under number (2); and (5) such other information as the Administrator considers appropriate.

2012-01-01

387

Aesthetic perception, nature and experience   

E-print Network

This thesis is about the perceptual nature of aesthetic experience and the importance of nature as a paradigmatic object of aesthetic perception and aesthetic experience more broadly conceived. For this reason, it merits ...

Hall, Nicole Annette

2014-07-01

388

Natural gas monthly, July 1993  

SciTech Connect

The Natural Gas Monthly NGM highlights activities, events, and analyses of interest to public and private sector organizations associated with the natural gas industry. Volume and price data are presented each month for natural gas production, distribution, consumption, and interstate pipeline activities. Producer-related activities and underground storage data are also reported. From time to time, the NGM features articles designed to assist readers in using and interpreting natural gas information.

Not Available

1993-07-27

389

Natural gas monthly, November 1995  

SciTech Connect

The Natural Gas Monthly (NGM) highlights activities, events, and analyses of interest to public and private sector organizations associated with the natural gas industry. Volume and price data are presented each month for natural gas production, distribution, consumption, and interstate pipeline activities. Producer-related activities and underground storage data are also reported. From time to time, the NGM features articles designed to assist readers in using and interpreting natural gas information.

NONE

1995-12-05

390

Natural gas monthly, October 1998  

SciTech Connect

The Natural Gas Monthly (NGM) highlights activities, events, and analyses of interest to public and private sector organizations associated with the natural gas industry. Volume and price data are presented each month for natural gas production, distribution, consumption, and interstate pipeline activities. Producer-related activities and underground storage data are also reported. From time to time, the NGM features articles designed to assist readers in using and interpreting natural gas information. 6 figs., 27 tabs.

NONE

1998-10-01

391

Natural gas monthly, September 1995  

SciTech Connect

The (NGM) Natural Gas Monthly highlights activities, events, and analyses of interest to public and private sector organizations associated with the natural gas industry. Volume and price data are presented each month for natural gas production, distribution, consumption, and interstate pipeline activities. Producer-related activities and underground storage data are also reported. From time to time, the NGM features articles designed to assist readers in using and interpreting natural gas information.

NONE

1995-09-27

392

Natural gas monthly, June 1997  

SciTech Connect

The Natural Gas Monthly (NGM) highlights activities, events, and analyses of interest to public and private sector organizations associated with the natural gas industry. Volume and price data are presented each month for natural gas production, distribution, consumption, and interstate pipeline activities. Producer-related activities and underground storage data are also reported. From time to time, the NGM features articles designed to assist readers in using and interpreting natural gas information. 6 figs., 24 tabs.

NONE

1997-06-01

393

Natural gas monthly, June 1998  

SciTech Connect

The Natural Gas Monthly (NGM) highlights activities, events, and analyses of interest to public and private sector organizations associated with the natural gas industry. Volume and price data are presented each month for natural gas production, distribution, consumption, and interstate pipeline activities. Producer-related activities and underground storage data are also reported. From time to time, the NGM features articles designed to assist readers in using and interpreting natural gas information. 6 figs., 27 tabs.

NONE

1998-06-01

394

Natural gas monthly: September 1996  

SciTech Connect

The Natural Gas Monthly highlights activities, events, and analyses of interest to public and private sector organizations associated with the natural gas industry. Volume and price data are presented each month for natural gas production, distribution, consumption, and interstate pipeline activities. Producer-related activities and underground storage data are also reported. From time to time, the NGM features articles designed to assist readers in using and interpreting natural gas information. 6 figs., 24 tabs.

NONE

1996-09-01

395

Natural Gas Monthly, March 1996  

SciTech Connect

The Natural Gas Monthly (NGM) highlights activities, events, and analyses of interest to public and private sector organizations associated with the natural gas industry. Volume and price data are presented each month for natural gas production, distribution, consumption, and interstate pipeline activities. Producer-related activities and underground storage data are also reported. From time to time, the NGM features articles designed to assist readers in using and interpreting natural gas information.

NONE

1996-03-25

396

Natural gas monthly, June 1999  

SciTech Connect

The Natural Gas Monthly (NGM) highlights activities, events, and analyses of interest to public and private sector organizations associated with the natural gas industry. Volume and price data are presented each month for natural gas production, distribution, consumption, and interstate pipeline activities. Producer-related activities and underground storage data are also reported. From time to time, the NGM features articles designed to assist readers in using and interpreting natural gas information. 6 figs., 25 tabs.

NONE

1999-06-01

397

Natural gas monthly, April 1995  

SciTech Connect

The Natural Gas Monthly highlights activities, events, and analyses of interest to public and private sector organizations associated with the natural gas industry. Volume and price data are presented each month for natural gas production, distribution, consumption, and interstate pipeline activities. Producer-related activities and underground storage data are also reported. From time to time, the NGM features articles designed to assist readers in using and interpreting natural gas information. 6 figs., 31 tabs.

NONE

1995-04-27

398

Natural gas monthly, May 1999  

SciTech Connect

The Natural Gas Monthly (NGM) highlights activities, events, and analyses of interest to public and private sector organizations associated with the natural gas industry. Volume and price data are presented each month for natural gas production, distribution, consumption, and interstate pipeline activities. Producer-related activities and underground storage data are also reported. From time to time the NGM features articles designed to assist readers in using and interpreting natural gas information. 6 figs., 27 tabs.

NONE

1999-05-01

399

Natural gas monthly, July 1998  

SciTech Connect

The Natural Gas Monthly (NGM) highlights activities, events, and analyses of interest to public and private sector organizations associated with the natural gas industry. Volume and price data are presented each month for natural gas production, distribution, consumption, and interstate pipeline activities. Producer-related activities and underground storage data are also reported. From time to time, the NGM features articles designed to assist readers in using and interpreting natural gas information. 6 figs., 25 tabs.

NONE

1998-07-01

400

En-gauging naturalness  

NASA Astrophysics Data System (ADS)

The discovery of a 125.5 GeV Higgs with standard model-like couplings and naturalness considerations motivate gauge extensions of the MSSM. We analyse two variants of such an extension and carry out a phenomenological study of regions of the parameter space satisfying current direct and indirect constraints, employing state-of-the-art two-loop RGE evolution and GMSB boundary conditions. We find that due to the appearance of non-decoupled D-terms it is possible to obtain a 125.5 GeV Higgs with stops below 2 TeV, while the uncoloured sparticles could still lie within reach of the LHC. We compare the contributions of the stop sector and the non-decoupled D-terms to the Higgs mass, and study their effect on the Higgs couplings. We further investigate the nature of the next-to lightest supersymmetric particle, in light of the GMSB motivated searches currently being pursued by ATLAS and CMS.

Bharucha, Aoife; Goudelis, Andreas; McGarrie, Moritz

2014-05-01

401

Nature against depression.  

PubMed

Depression is a major health problem currently recognized as a leading cause of morbidity worldwide. In the United States alone, depression affects approximately 20% of the population. With current medications suffering from major shortcomings that include slow onset of action, poor efficacy, and unwanted side effects, the search for new and improved antidepressants is ever increasing. In an effort to evade side effects, people have been resorting to popular traditional herbal medicines to relieve the symptoms of depression, and there is a need for more empirical knowledge about their use and effectiveness. This review provides an overview of the current knowledge state regarding a variety of natural plant products commonly used in depression. Herbal medicines discussed that have been used in clinical trials for the treatment of mild to moderate depression states include the popular St. John's wort, saffron, Rhodiola, lavender, Echium, and the Chinese formula banxia houpu. In addition, new emerging herbal products that have been studied in different animal models are discussed including Polygala tenuifolia, the traditional Chinese herbal SYJN formula, gan mai da zao, and Cannabis sativa constituents. A comprehensive review of the chemical, pharmacological, and clinical aspects of each of the reviewed products is provided. Finally, recent preclinical studies reporting the antidepressant action of marine-derived natural products are discussed at the end of the review. PMID:22414105

El-Alfy, A T; Abourashed, E A; Matsumoto, R R

2012-01-01

402

Natural medicaments in dentistry  

PubMed Central

The major objective in root canal treatment is to disinfect the entire root canal system. Cleaning, shaping, and use of antimicrobial medicaments are effective in reducing the bacterial load to some extent, but some bacteria do remain behind and multiply, causing reinfection. Taking into consideration the ineffectiveness, potential side-effects and safety concerns of synthetic drugs, the herbal alternatives for endodontic usage might prove to be advantageous. Over the past decade, interest in drugs derived from medicinal plants has markedly increased. Phytomedicine has been used in dentistry as anti-inflammatory, antibiotic, analgesic, sedative and also as endodontic irrigant. Herbal preparations can be derived from the root, leaves, seeds, stem, and flowers. The PubMed database search revealed that the reference list for natural medicaments featured 1480 articles and in dentistry 173 articles. A forward search was undertaken on the selected articles and author names. This review focuses on various natural drugs and products as well as their therapeutic applications when used as phytomedicine in dentistry. PMID:25558153

Sinha, Dakshita J.; Sinha, Ashish A.

2014-01-01

403

Naturally Occurring Food Toxins  

PubMed Central

Although many foods contain toxins as a naturally-occurring constituent or, are formed as the result of handling or processing, the incidence of adverse reactions to food is relatively low. The low incidence of adverse effects is the result of some pragmatic solutions by the US Food and Drug Administration (FDA) and other regulatory agencies through the creative use of specifications, action levels, tolerances, warning labels and prohibitions. Manufacturers have also played a role by setting limits on certain substances and developing mitigation procedures for process-induced toxins. Regardless of measures taken by regulators and food producers to protect consumers from natural food toxins, consumption of small levels of these materials is unavoidable. Although the risk for toxicity due to consumption of food toxins is fairly low, there is always the possibility of toxicity due to contamination, overconsumption, allergy or an unpredictable idiosyncratic response. The purpose of this review is to provide a toxicological and regulatory overview of some of the toxins present in some commonly consumed foods, and where possible, discuss the steps that have been taken to reduce consumer exposure, many of which are possible because of the unique process of food regulation in the United States. PMID:22069686

Dolan, Laurie C.; Matulka, Ray A.; Burdock, George A.

2010-01-01

404

Modelagem 3D e animação para o desenvolvimento de um modelo virtual interativo em realidade virtual (VRML) na área de moda 3D modeling and animation for the development of an interactive virtual model in virtual reality (VRML) in fashion  

Microsoft Academic Search

This article describes the development of a project that combines modeling and animation of three-dimensional objects (virtual model, clothing, environment) in the software 3D Studio Max with VRML (Virtual Reality Modeling Language). The project allows various interactions between the user and the environment developed. The main interaction is the choice of clothing, in which different parts can be proven in

Andressa Schneider Alves; José Luís Farinatti Aymone

2009-01-01

405

A nova geografia da produção e o papel assumido por países em desenvolvimento no âmbito das cadeias de valor global: o perfil da inserção internacional brasileira a partir do comércio exterior  

Microsoft Academic Search

Resumo: Nas últimas décadas o modo de organização da atividade industrial global tem sido alterado de forma a lidar com a reformulação das estratégias (reestruturação e racionalização) das grandes empresas com vistas a maiores níveis de competitividade. Neste contexto, ganhou destaque a utilização crescente de processos de externalização produtiva, através de mecanismos de subcontratação, por multinacionais. O conjunto de transformações

Wellington Pereira

406

FENÔMENOS DE ENFERMAGEM EM PORTADORES DE LESÃO MEDULAR E O DESENVOLVIMENTO DE ÚLCERAS POR PRESSÃO NURSING PHENOMENA IN PATIENTS WITH SPINAL CORD INJURY AND THE DEVELOPMENT OF PRESSURE ULCERS  

Microsoft Academic Search

ABSTRACT ABSTRACT ABSTRACT ABSTRACT: : : : : Pressure ulcers are complications frequently found in patients with spinal cord injury, because of the systemic alterations that the spinal cord lesion brings. The purpose of this study was to analyze the profile of nursing phenomena in people with spinal cord injury and its association with the development of pressure ulcers. A

Marcos Venícios de Oliveira

407

Introduction The Nature of Design  

E-print Network

Introduction The Nature of Design The Concept of Entropy in MTC Design Complexity Conclusions. Entropy in Design 1 #12;Introduction The Nature of Design The Concept of Entropy in MTC Design Complexity Conclusions Outline 1 Introduction 2 The Nature of Design 3 The Concept of Entropy in MTC 4 Design Complexity

Berlin,Technische Universität

408

Nature and Nationhood: Danish Perspectives  

ERIC Educational Resources Information Center

In this paper, I shall discuss Danish perspectives on nature, showing the interdependence of conceptions of "nature" and "nationhood" in the formations of a particular cultural community. Nature, thus construed, is never innocent of culture and cannot therefore simply be "restored" to some pristine, pre-lapsarian state. On the other hand,…

Schnack, Karsten

2009-01-01

409

Natural products as antiviral agents  

Microsoft Academic Search

Since the ancient times, natural products have served as a majorsource of drugs. About fifty percent of today's pharmaceutical drugs are derived from natural origin. Interest in natural products as a source of new drugs is growing due to many factors that will be discussed in this article. Viruses have been resistant to therapy or prophylaxis longer than any other

Khalid A. El Sayed

2000-01-01

410

Epicureanism and Early Modern Naturalism  

Microsoft Academic Search

It is often suggested that certain forms of early modern philosophy are naturalistic. Although I have some sympathy with this description, I argue that applying the category of naturalism to early modern philosophy is not useful. There is another category that does most of the work we want the category of naturalism to do – one that, unlike naturalism, was actually used

Antonia LoLordo

2011-01-01

411

wind engineering & natural disaster mitigation  

E-print Network

wind engineering & natural disaster mitigation #12;wind engineering & natural disaster mitigation Investment WindEEE Dome at Advanced Manufacturing Park $31million Insurance Research Lab for Better Homes $8million Advanced Facility for Avian Research $9million #12;wind engineering & natural disaster mitigation

Denham, Graham

412

Performing Nature at World's Ends  

Microsoft Academic Search

In introducing this special edition, we argue that a shift in emphasis from positionality and representation to performativity and ontology offers a new approach to thinking about nature categories. Rather than criticising dualisms, we focus on how nature categories are produced and reproduced. The article addresses contexts of settler societies and industrial modernity, where concepts of wilderness and nature are

Simone Abram; Marianne Elisabeth Lien

2011-01-01

413

Natural gas pipeline technology overview  

Microsoft Academic Search

The United States relies on natural gas for one-quarter of its energy needs. In 2001 alone, the nation consumed 21.5 trillion cubic feet of natural gas. A large portion of natural gas pipeline capacity within the United States is directed from major production areas in Texas and Louisiana, Wyoming, and other states to markets in the western, eastern, and midwestern

S. M. Folga

2007-01-01

414

Material flows vs. `natural capital'  

Microsoft Academic Search

In the discourse about sustainable development, `constant natural capital' is frequently referred to as a criterion for ecological sustainability. But what is `natural capital'? The concept will be analyzed by presenting arguments in favour of using the term and different versions of sustainability (strong and weak). Subsequently, a critique of the `natural capital' concept is brought forward, from an ecological

Friedrich Hinterberger; Fred Luks; Friedrich Schmidt-Bleek

1997-01-01

415

Natural Selection and Geology 230  

E-print Network

;Natural Selection · The theory of natural selection was proposed by Charles Darwin in 1859, in his bookNatural Selection and Evolution Geology 230 Fossils and Evolution #12;The Study of Evolution the same theory as Darwin in the 1850s. #12;One of the most famous and influential books of science. #12

Kammer, Thomas

416

Natural gas monthly, November 1998  

SciTech Connect

The Natural Gas Monthly (NGM) highlights activities, events, and analyses of interest to public and private sector organizations associated with the natural gas industry. Volume and price data are presented each month for natural gas production, distribution, consumption, and interstate pipeline activities. Producer-related activities and underground storage data are also reported. 6 figs., 27 tabs.

NONE

1998-11-01

417

Natural gas monthly, February 1999  

SciTech Connect

The Natural Gas Monthly (NGM) highlights activities, events, and analyses of interest to public and private sector organizations associated with the natural gas industry. Volume and price data are presented each month for natural gas production, distribution, consumption, and interstate pipeline activities. Producer-related activities and underground storage data are also reported. 6 figs., 28 tabs.

NONE

1999-02-01

418

Natural gas monthly, January 1999  

SciTech Connect

The Natural Gas Monthly (NGM) highlights activities, events, and analyses of interest to public and private sector organizations associated with the natural gas industry. Volume and price data are presented each month for natural gas production, distribution, consumption, and interstate pipeline activities. Producer-related activities and underground storage data are also reported. 6 figs., 28 tabs.

NONE

1999-02-01

419

Children's Moral Relationships with Nature.  

ERIC Educational Resources Information Center

Two studies of the development of children's moral relationships with nature addressed such questions as: (1) What does it mean to say that we have an obligation not to harm the natural environment? (2) Does the natural environment feel pain? (3) Does it have rights? or (4) Is moral obligation an inappropriate construct by which to understand the…

Kahn, Peter H., Jr.; McCoy, Ann

420

warnell school Forestry & Natural Resources  

E-print Network

warnell school Forestry & Natural Resources 2010 Annual Report o #12;VisionTo be recognized as one of the top five forestry and natural resource programs in the United States. MissionTo prepare resources; to discover improved methods for the restoration and utilization of the earth's renewable natural

Hall, Daniel

421

warnell school Forestry & Natural Resources  

E-print Network

#12;#12;warnell school Forestry & Natural Resources 2009 Annual Report o #12;VisionTo be recognized as one of the top five forestry and natural resource programs in the United States. Mission natural resources; to discover improved methods for the restoration and utilization of the earth

Hall, Daniel

422

BREAKTHROUGHS College of Natural Resources  

E-print Network

BREAKTHROUGHS ® College of Natural Resources A Magazine for Alumni and Friends of the College of Natural Resources, University of California, BerkeleySpring 2002 VOLUME 8, NUMBER 1 #12;11 EXPLORING the College of Natural Resources 27 ALUMNI NEWS Emeritus Entomologist William Allen dies Class Notes

Wildermuth, Mary C

423

LAND USE AND NATURAL RESOURCES  

E-print Network

1 LAND USE AND NATURAL RESOURCES CONTINUING AND PROFESSIONAL EDUCATION SUMMER 2013 Including in a white Cadillac. It was worth the trip. We in the Land Use and Natural Resources and Sustainability Lave Johnston Director, Land Use and Natural Resources Department UC Davis Extension #12;3 CONTENTS

Ferrara, Katherine W.

424

School of Natural Resources and  

E-print Network

School of Natural Resources and Environment Contributing to Florida, the Nation and the World natural resources. Our population is projected to increase by 72 percent to 27.5 million over the next, and natural resource pressures. In effect, Florida is a bellwether state, and any solutions we find for our

Watson, Craig A.

425

Molecular Signatures of Natural Selection  

E-print Network

Molecular Signatures of Natural Selection Rasmus Nielsen Center for Bioinformatics and Department There is an increasing interest in detecting genes, or genomic re- gions, that have been targeted by natural selection contribution of natural selection in shaping the genetic variation observed among living organisms. In one

Nielsen, Rasmus

426

US crude oil, natural gas, and natural gas liquids reserves  

SciTech Connect

This report presents estimates of proved reserves of crude oil, natural gas, and natural gas liquids as of December 31, 1989, and production volumes for the year 1989 for the total United States and for selected states and state sub-divisions. Estimates are presented for the following four categories of natural gas: total gas (wet after lease separation), its two major components (nonassociated and associated-dissolved gas), and total dry gas (wet gas adjusted for the removal of liquids at natural gas processing plants). In addition, two components of natural gas liquids, lease condensate and natural gas plant liquids, have their reserves and production reported separately. Also included is information on indicated additional crude oil reserves and crude oil, natural gas, and lease condensate reserves in nonproducing reservoirs. 28 refs., 9 figs., 15 tabs.

Not Available

1990-10-05

427

Theory and detection scheme of seismic EM signals transferred into the atmosphere from the oceanic and continental lithosphere  

NASA Astrophysics Data System (ADS)

Due to the compound structure of the medium and large portions of energy transferred, a seismic excitation in the oceanic or continental lithosphere disturbs all types of geophysical fields. To investigate the problem of electromagnetic (EM) disturbances in the atmosphere from the seismically activated lithosphere, we have formulated two mathematical models of interaction of fields of different physical nature resulting in arising of the low-frequency (from 0.1 to 10 Hz by amplitude of a few hundreds of pT) EM signals in the atmosphere. First we have considered the EM field generation in the moving oceanic lithosphere and then in the moving continental one. For both cases, the main physical principles and geological data were applied for formulation of the model and characteristics of the computed signals of different nature agree with measurements of other authors. On the basis of the 2D model of the seismo-hydro-EM-temperature interaction in the lithosphere-Ocean-atmosphere domain, a block-scheme of a multisensory vertically distributed (from a seafloor up to the ionosphere) tsunami precursors' detection system is described. On the basis of the 3D model of the seismo-EM interaction in a lithosphere-atmosphere domain, we explain why Prof. Kopytenko (Inst. IZMIRAN of Russian Acad. Sci.) and co-authors were able to estimate location of the future seismic epicenter area from their magnetic field measurements in the atmosphere near the earth's surface.

Novik, Oleg; Ershov, Sergey; Ruzhin, Yuri; Smirnov, Fedor; Volgin, Maxim

2014-07-01

428

letters to nature 568 NATURE |VOL 411 |31 MAY 2001 |www.nature.com  

E-print Network

, F. Natural bond orbital analysis of internal rotation barriers and related phenomena. Isr. J. Chem. & Weinhold, F. Natural bond orbital analysis of steric interactions. J. Chem. Phys. 107, 5406±5421 (1997). 20

Rempel, Alan W.

429

Natural fracturing, by depth  

NASA Astrophysics Data System (ADS)

Natural opening-mode fractures commonly fall upon a spectrum whose end-members are veins, which have wide ranges of sizes and are mostly or thoroughly cemented, and joints, which have little opening displacement and little or no cement. The vein end-member is common in metamorphic rocks, whose high temperature and pressure of formation place them outside typical reservoir settings; conversely, many uncemented joints likely form near the surface and so too have limited relevance to subsurface exploration. Sampling of cores retrieved from tight-gas sandstone reservoirs suggest that it is intermediate fractures, not true joints or veins, that provide natural porosity and permeability. Such fractures have abundant pore space among fracture-bridging cements, which may hold fractures open despite varying states of stress through time. Thus the more sophisticated our understanding of the processes that form veins and joints, i.e., how natural fracturing varies by depth, the better our ability to predict intermediate fractures. Systematic differences between veins and joints, in terms of size-scaling and lateral and stratigraphic spatial arrangement, have been explained in the literature by the mechanical effects of sedimentary layering, which likely exert more control over fracture patterns at shallower depths. Thus stratabound joints commonly have narrow size ranges and regular spacing; non-stratabound veins have a wide range of sizes and spacings. However, new fieldwork and careful literature review suggest that the effects of mechanical layering are only half the story. Although atypical, veins may be highly stratabound and yet spatially clustered; non-stratabound fractures may nonetheless feature narrow size ranges. These anomalous fracture arrangements are better explained by the presence of precipitating cements during fracture opening than by mechanical layering. Cement is thought to be highly important for fracture permeability, but potential effects of synkinematic cement on fracture size and spacing have been largely overlooked. Such effects are currently poorly understood, but numerical models of fracture widening amid precipitating cements can replicate observed size-scaling patterns. Synkinematic fracture-bridging cements can also potentially account for irregular fracture spacing in stratabound fracture arrays.

Hooker, John; Laubach, Stephen

2013-04-01

430

Natural Gas Monthly, October 1993  

SciTech Connect

The (NGM) Natural Gas Monthly highlights activities, events, and analyses of interest to public and private sector organizations associated with the natural gas industry. Volume and price data are presented each month for natural gas production, distribution, consumption, and interstate pipeline activities. Producer-related activities and underground storage data are also reported. From time to time, the NGM features articles designed to assist readers in using and interpreting natural gas information. This month`s feature articles are: US Production of Natural Gas from Tight Reservoirs: and Expanding Rule of Underground Storage.

Not Available

1993-11-10

431

Pattern and Design in Nature  

NSDL National Science Digital Library

This activity suggests that art is a fun way to encourage children to see the world around them and increase their visual awareness. Students observe natural objects like shells, rocks, minerals, and plants and notice that they have subtle and striking detail, regularity of pattern, texture, and shape. By exploring natural design, students will be encouraged to observe the natural world more closely and will begin to observe natural objects carefully and note intricate design and structure beyond surface form. In discussion, students will learn how patterns result from natural growth processes and land-shaping processes.

Lauret Savoy

432

Natural gas monthly, April 1997  

SciTech Connect

The Natural Gas Monthly (NGM) highlights activities, events, and analyses of interest to public and private sector organizations associated with the natural gas industry. Volume and price data are present3ed each month for natural gas production, distribution, consumption, and interstate pipeline activities. Producer-related activities and underground storage data are also reported. From time to time, the NGM features articles designed to assist readers in using and interpreting natural gas information. The feature article is entitled ``Natural gas pipeline and system expansions.`` 6 figs., 27 tabs.

NONE

1997-04-01

433

Natural gas monthly, March 1997  

SciTech Connect

The Natural Gas Monthly (NGM) highlights activities, events, and analyses of interest to public and private sector organizations associated with the natural gas industry. Volume and price data are presented each month for natural gas production, distribution, consumption, and interstate pipeline activities. Producer-related activities and underground storage data are also reported. From time to time, the NGM features articles designed to assist readers in using and interpreting natural gas information. The feature article is entitled ``Natural gas analysis and geographic information systems.`` 6 figs., 27 tabs.

NONE

1997-03-01

434

Natural gas monthly: April 1996  

SciTech Connect

The Natural Gas Monthly highlights activities, events, and analyses of interest to public and private sector organizations associated with the natural gas industry. Volume and price data are presented each month for natural gas production, distribution, consumption, and interstate pipeline activities. Producer-related activities and underground storage data are also reported. From time to time, the NGM features articles designed to assist readers in using and interpreting natural gas information. This month`s feature article focuses on preliminary highlights from the 1995 natural gas industry. 7 figs., 25 tabs.

NONE

1996-04-01

435

Natural gas monthly, June 1996  

SciTech Connect

The natural gas monthly (NGM) highlights activities, events, and analyses of interest to public and private sector organizations associated with the natural gas industry. Volume and price data are presented each month for natural gas production, distribution, consumption, and interstate pipeline activities. Producer-related activities and underground storage data are also reported. From time to time, the NGM features articles designed to assist readers in using and interpreting natural gas information. The feature article for this month is Natural Gas Industry Restructuring and EIA Data Collection.

NONE

1996-06-24

436

Natural gas monthly, August 1995  

SciTech Connect

The Natural Gas Monthly (NGM) highlights activities, events, and analyses of interest to public and private sector organizations associated with the natural gas industry. Volume and price data are presented each month for natural gas production, distribution, consumption, and interstate pipeline activities. Producer-related activities and underground storage data are also reported. From time to time, the NGM features articles designed to assist readers in using and interpreting natural gas information. This month`s feature article is on US Natural Gas Imports and Exports 1994.

NONE

1995-08-24

437

Natural gas monthly, December 1997  

SciTech Connect

The Natural Gas Monthly highlights activities, events, and analyses of interest to public and private sector organizations associated with the natural gas industry. Volume and price data are presented each month for natural gas production, distribution, consumption, and interstate pipeline activities. Producer-related activities and underground storage data are also reported. From time to time, the NGM features articles designed to assist readers in using and interpreting natural gas information. The article this month is entitled ``Recent Trends in Natural Gas Spot Prices.`` 6 figs., 27 tabs.

NONE

1997-12-01

438

Natural gas monthly, June 1995  

SciTech Connect

The Natural Gas Monthly (NGM) highlights activities, events, and analyses of interest to public and private sector organizations associated with the natural gas industry. Volume and price data are presented each month for natural gas production, distribution, consumption, and interstate pipeline activities. Producer-related activities and underground storage data are also reported. From time to time, the NGM features articles designed to assist readers in using and interpreting natural gas information. This month feature is on the value of underground storage in today`s natural gas industry.

NONE

1995-06-21

439

Natural gas monthly, July 1997  

SciTech Connect

The Natural Gas Monthly (NGM) highlights activities, events, and analyses of interest to public and private sector organizations associated with the natural gas industry. Volume and price data are presented each month for natural gas production, distribution, consumption, and interstate pipeline activities. Producer-related activities and underground storage data are also reported. From time to time, the NGM features articles designed to assist readers in using and interpreting natural gas information. The feature article this month is entitled ``Intricate puzzle of oil and gas reserves growth.`` A special report is included on revisions to monthly natural gas data. 6 figs., 24 tabs.

NONE

1997-07-01

440

Natural gas monthly, November 1996  

SciTech Connect

The report highlights activities, events, and analyses of interest to public and private sector organizations associated with the natural gas industry. Volume and price data are presented each month for natural gas production, distribution, consumption, and interstate pipeline activities. Producer-related activities and underground storage data are also reported. From time to time, the Natural Gas Monthly features articles designed to assist readers in using and interpreting natural gas information. The feature article this month is ``US natural gas imports and exports-1995``. 6 figs., 24 tabs.

NONE

1996-11-01

441

Natural gas monthly, May 1997  

SciTech Connect

The Natural Gas Monthly highlights activities, events, and analyses of interest to public and private sector organizations associated with the natural gas industry. Volume and price data are presented each month for natural gas production, distribution, consumption, and interstate pipeline activities. Producer-related activities and underground storage data are also reported. From time to time, the NGM features articles designed to assist readers in using and interpreting natural gas information. The feature article this month is ``Restructuring energy industries: Lessons from natural gas.`` 6 figs., 26 tabs.

NONE

1997-05-01

442

Natural gas monthly, October 1996  

SciTech Connect

The Natural Gas Monthly (NGM) is prepared in the Data Operations Branch of the Reserves and Natural Gas Division, Office of Oil and Gas, Energy Information Administration (EIA), U.S. Department of Energy (DOE). The NGM highlights activities, events, and analyses of interest to public and private sector organizations associated with the natural gas industry. Volume and price data are presented each month for natural gas production, distribution, consumption, and interstate pipeline activities. Producer-related activities and underground storage data are also reported. From time to time, the NGM features articles designed to assist readers in using and interpreting natural gas information.

NONE

1996-10-01

443

Natural gas monthly, October 1997  

SciTech Connect

The Natural Gas Monthly highlights activities, events, and analyses of interest to public and private sector organizations associated with the natural gas industry. Volume and price data are presented each month for natural gas production, distribution, consumption, and interstate pipeline activities. Producer-related activities and underground storage data are also reported. From time to time, the NGM features articles designed to assist readers in using and interpreting natural gas information. The feature article in this issue is a special report, ``Comparison of Natural Gas Storage Estimates from the EIA and AGA.`` 6 figs., 26 tabs.

NONE

1997-10-01

444

Natural gas monthly, September 1993  

SciTech Connect

The Natural Gas Monthly (NGM) is prepared in the Data Operations Branch of the Reserves and Natural Gas Division, Office of Oil and Gas, Energy Information Administration (EIA), US Department of Energy (DOE). The NGM highlights activities, events, and analyses of interest to public and private sector organizations associated with the natural gas industry. Volume and price data are presented each month for natural gas production, distribution, consumption, and interstate pipeline activities. Producer-related activities and underground storage data are also reported. From time to time, the NGM features articles designed to assist readers in using and interpreting natural gas information.

Not Available

1993-09-27

445

The discursive nature of nature: Towards a post-modern concept of nature  

Microsoft Academic Search

Starting from post-modern discourse theory this paper elaborates a post-modern account of nature that differs fundamentally from the traditional essentialist concept of nature. Given the post-modern premise that there is nothing outside of discourse, it is argued that post-modern discourse theory can be applied to the conceptualization of nature. Based on the Foucaultian notion of the omnipresence of power, nature

Johannes Dingler

2005-01-01

446

Project X RFQ EM Design  

SciTech Connect

Project X is a proposed multi-MW proton facility at Fermi National Accelerator Laboratory (FNAL). The Project X front-end would consist of an H- ion source, a low-energy beam transport (LEBT), a CW 162.5 MHz radio-frequency quadrupole (RFQ) accelerator, and a medium-energy beam transport (MEBT). Lawrence Berkeley National Laboratory (LBNL) and FNAL collaboration is currently developing the designs for various components in the Project X front end. This paper reports the detailed EM design of the CW 162.5 MHz RFQ that provides bunching of the 1-10 mA H- beam with acceleration from 30 keV to 2.1 MeV.

Romanov, Gennady; /Fermilab; Hoff, Matthew; Li, Derun; Staples, John; Virostek, Steve; /LBNL

2012-05-09

447

New probe of naturalness.  

PubMed

Any new scalar fields that perturbatively solve the hierarchy problem by stabilizing the Higgs boson mass also generate new contributions to the Higgs boson field-strength renormalization, irrespective of their gauge representation. These new contributions are physical, and in explicit models their magnitude can be inferred from the requirement of quadratic divergence cancellation; hence, they are directly related to the resolution of the hierarchy problem. Upon canonically normalizing the Higgs field, these new contributions lead to modifications of Higgs couplings that are typically great enough that the hierarchy problem and the concept of electroweak naturalness can be probed thoroughly within a precision Higgs boson program. Specifically, at a lepton collider this can be achieved through precision measurements of the Higgs boson associated production cross section. This would lead to indirect constraints on perturbative solutions to the hierarchy problem in the broadest sense, even if the relevant new fields are gauge singlets. PMID:24093250

Craig, Nathaniel; Englert, Christoph; McCullough, Matthew

2013-09-20

448

The nature of confidentiality.  

PubMed Central

This paper examines confidentiality and its nature and analyses the guidelines laid down by the Hippocratic Oath as well as the British and World Medical Associations for maintaining such confidentiality between doctor and patient. There are exceptions to practically any code of rules and this is true also for confidentiality. Some of these exceptions make it appear that very little is confidential. The three values implicit in confidentiality would seem to be privacy, confidence and secrecy. Each of these values is discussed and developed in this paper. In conclusion, the question is suggested that maybe in the face of death, doctor and patient need to re-examine the pre-suppositions of privacy, confidence and secrecy on which the confidential relationship is based. PMID:469872

Thompson, I E

1979-01-01

449

Nature: American Eagle  

NSDL National Science Digital Library

With its bold beak and talented talons, the bald eagle is perhaps one of the best symbols of the United States of America. Recently, the Nature program on PBS created this documentary to profile this majestic animal. Visitors to the site can watch the program in its entirety, leave their own comments, and learn about bald eagles' evolutionary ancestors. That's not all, as visitors can also look over an interactive map that tracks bald eagle populations over the past decades. For those who might want to watch smaller sections of the film, there are short clips available as well, including "Sibling Rivalry" and "Autumn Bounty on the Mississippi". Finally, visitors can also give their own feedback on the program, and there's a chance that the producer might chime in with his own response.

450

Nature of Light  

NSDL National Science Digital Library

What is light? Our experience with light is that which we can see. Our eyes contain two different types of photoreceptors, rods and cones. Rods are extremely sensitive to light but can't distinguish color. Cones which are less sensitive than rods, respond to light of different wavelengths, producing color vision. Instruction for understanding light begins with an understanding of mechanical waves and the properties of those waves. However, light also has particle-like properties, and exhibits a wave-particle duality. This SciGuide breaks down the complexity of teaching the nature of light into manageable chunks arranged in a logical sequence for learning. You may choose specific Themes or Keywords appropriate to your students and teaching objectives. Individual Themes and Keywords identify misconceptions and conceptual difficulties. Many web resources provide simulations and data to enhance understanding and engage students in inquiry.

National Science Teachers Association (NSTA)

1900-01-01

451

Natural dispersion revisited.  

PubMed

This paper presents a new semi-empirical model for oil droplet size distributions generated by single breaking wave events. Empirical data was obtained from laboratory experiments with different crude oils at different stages of weathering. The paper starts with a review of the most commonly used model for natural dispersion, which is followed by a presentation of the laboratory study on oil droplet size distributions formed by breaking waves conducted by SINTEF on behalf of the NOAA/UNH Coastal Response Research Center. The next section presents the theoretical and empirical foundation for the new model. The model is based on dimensional analysis and contains two non-dimensional groups; the Weber and Reynolds number. The model was validated with data from a full scale experimental oil spill conducted in the Haltenbanken area offshore Norway in July 1982, as described in the last section of the paper. PMID:25752537

Johansen, Øistein; Reed, Mark; Bodsberg, Nils Rune

2015-04-15

452

Natural Radioactivity in Bananas  

SciTech Connect

The content of {sup 40}K natural radionuclide in bananas (Musa sapientum) from the Vale do Ribeira region, Sao Paulo, Brazil, has been measured. We have collected several samples of bananas prata and nanica, its peels, leaves, and also different soils where the banana tree was planted, such as soil with a standard amount of fertilizer, the fertilizer itself and also soil without fertilizer for comparison. We have used the gamma-ray spectroscopy technique with a NaI(T1) crystal inside a 12 cm thick lead shield to detect the gamma-radiation. The results indicate that only part of the available potassium is absorbed by the plant, which is mainly concentrated in the banana peel.

Zagatto, V. A. B.; Medina, N. H.; Okuno, E.; Umisedo, N. K. [Instituto de Fisica da Universidade de Sao Paulo (Brazil)

2008-08-07

453

Natural Air Purifier  

NASA Technical Reports Server (NTRS)

NASA environmental research has led to a plant-based air filtering system. Dr. B.C. Wolverton, a former NASA engineer who developed a biological filtering system for space life support, served as a consultant to Terra Firma Environmental. The company is marketing the BioFilter, a natural air purifier that combines activated carbon and other filter media with living plants and microorganisms. The filter material traps and holds indoor pollutants; plant roots and microorganisms then convert the pollutants into food for the plant. Most non-flowering house plants will work. After pollutants have been removed, the cleansed air is returned to the room through slits in the planter. Terra Firma is currently developing a filter that will also disinfect the air.

1993-01-01

454

Nature: Katrina's Animal Rescue  

NSDL National Science Digital Library

There have been many stories that have come out in the aftermath of Hurricane Katrina, and most of them have dealt with the human tragedies involved in this traumatic set of events. The people at the long-running PBS series, Nature, have created this website to complement a recent edition of the show that offered some insights into the effects the hurricane had on the animal population of Louisiana. On the site, visitors can take advantage of a number of special interactive features. These features allow visitors to ask questions of those involved in the animal rescue efforts and learn about the psychological and physical effects on animals. The site also contains a section where visitors can learn about other web-based resources, such as the homepages for Animal Rescue New Orleans and the Best Friends Animal Society.

2005-01-01

455

Nature . . . an environmental yardstick  

USGS Publications Warehouse

To one who has spent his professional career in geologic science, conservation always has had special meaning. In the measurements so necessary to his work the geologist develops an integrity in the use of numbers and in the qualifications attending the validity of numbers. Scientific analysis of geologic events and sequence develops a keen sense of what is coincidental, correlative, and consequential. The geologist applies his science in evaluating hazards to man as natural catastrophes and/or benefits to man such as earth materials that form the resource base of his society. But more than these the geologist has acquired a deep appreciation for the planet as a whole, its inner structure, its landscape, and the living things that abound.

Pecora, William T.

1976-01-01

456

EM International, July 1994, Volume 2  

SciTech Connect

The Office of Environmental Management (EM) at the Department of Energy (DOE) is seeking out and leveraging foreign technology, data, and resources in keeping with EM`s mandate to protect public health and the environment through the safe and cost-effective remediation of the Department`s nuclear weapons sites. EM works closely with foreign governments, industry, and universities to obtain innovative environmental technologies, scientific and engineering expertise, and operations experience that will support EM`s objectives. Where appropriate, these international resources are used to manage the more urgent risks at our sites, secure a safe workplace, help build consensus on critical issues, and strengthen our technology development program. Through international agreements EM engages in cooperative exchange of information, technology, and individuals. Currently, we are managing agreements with a dozen countries in Europe, Latin America, and Asia. These agreements focus on environmental restoration, waste management, transportation of radioactive wastes, and decontamination and decommissioning. This publication contains the following articles: in situ remediation integrated program; in-situ characterization and inspection of tanks; multimedia environmental pollutant assessment system (MEPAS); LLNL wet oxidation -- AEA technology. Besides these articles, this publication covers: EU activities with Russia; technology transfer activities; and international organization activities.

Not Available

1994-10-01

457

Ambiente e formação estelar em galáxias  

NASA Astrophysics Data System (ADS)

Estudamos o ambiente de galáxias com formação estelar inicialmente a partir de uma amostra limitada em volume proveniente do 2dF Galaxy Redshift Survey. Discriminamos as galáxias com formação estelar com base em distintas classes espectrais, utilizando para esta classificação as larguras equivalentes das linhas [OII]l3727 e Hd. O ambiente é caracterizado pela densidade espacial local de galáxias. Mostramos que a fração de galáxias com formação estelar é bastante reduzida em ambientes densos, enquanto a de galáxias passivas aumenta nestas regiões. Por outro lado, quando analisamos a fração de galáxias que apresentam um surto recente de formação estelar, notamos que ela independe do ambiente, sendo que em regiões mais densas alguns destes objetos apresentam distorções em sua morfologia. Estes resultados são confrontados com a análise da dependência ambiental da taxa de formação estelar, estimada pela emissão em Ha, de uma amostra extraída do Sloan Digital Sky Survey. Um declínio gradual da formação estelar também é observado nesta análise, sugerindo que as interações por efeitos de maré sejam responsáveis pela redução da formação estelar em ambientes densos através da remoção do reservatório de gás das galáxias. No entanto, estas interações também podem induzir surtos de formação estelar nas galáxias, além de peculiaridades morfológicas observadas nos objetos que habitam regiões mais densas.

Mateus, A., Jr.; Sodré, L., Jr.

2003-08-01

458

letters to nature NATURE |VOL 413 |6 SEPTEMBER 2001 |www.nature.com 51  

E-print Network

letters to nature NATURE |VOL 413 |6 SEPTEMBER 2001 |www.nature.com 51 Note added in proof: After ®eld. Received 14 May; accepted 20 July 2001. 1. Ramirez, A. P. in Handbook of Magnetic Materials Vol. The entropy of water and the third law of thermodynamics. The heat capacity of ice from 15K to 273K. J. Am

Klein, Jacob

459

How natural is a nature reserve?: an ideological study of British nature conservation landscapes  

Microsoft Academic Search

Areas set apart for nature conservation in Britain are broadly categorised according to their cultural purpose, and names are assigned to these in this paper. Nature reserves may be similar to zoos and botanic gardens in aiming to maintain the diversity of species and if so are termed ‘biodiversity reserves’. This tradition understands nature as a static collection of entities

Nigel S. Cooper

2000-01-01

460

letters to nature 164 NATURE |VOL 406 |13 JULY 2000 |www.nature.com  

E-print Network

letters to nature 164 NATURE |VOL 406 |13 JULY 2000 |www.nature.com 20. London, F. Superfluids of Physics, University of Colorado and National Institute of Standards and Technology, Campus Box 440, Boulder, Colorado 80309-0440, USA Delft University of Technology, 2600 GA Delft, The Netherlands

461

96 NATURE|VOL427|8JANUARY2004|www.nature.com/nature Automatic archaeology  

E-print Network

96 NATURE|VOL427|8JANUARY2004|www.nature.com/nature Automatic archaeology Digging in the dirt and an archaeological hobbyist -- celebrated his sixtieth birthday three years ago. On that day he took his entire to the profession of archaeology," he says. With that goal in mind, Smilansky was directed to Ilan Sharon

Smilansky, Uzy

462

letters to nature NATURE |VOL 411 |24 MAY 2001 |www.nature.com 473  

E-print Network

letters to nature NATURE |VOL 411 |24 MAY 2001 |www.nature.com 473 tunic. The large funnel tunicate was a suspension feeder, with water entering the oral siphon and being expelled through to a free cheek of a trilobite. This arrangement could indicate burial of the tunicate in situ. The presence

He, Sheng

463

letters to nature 120 NATURE |VOL 410 |1 MARCH 2001 |www.nature.com  

E-print Network

±45 (2000). 2. Turner, B. M. Histone acetylation and an epigenetic code. BioEssays 22, 836±845 (2000). 3 and is expressed in B lymphocytes, the developing CNS, and adult testis. Genes Dev. 6, 1589±1607 (1992). 14. Pierceletters to nature 120 NATURE |VOL 410 |1 MARCH 2001 |www.nature.com of GFP expression, indirect

Miska, Eric

464

letters to nature NATURE |VOL 407 |19 OCTOBER 2000 |www.nature.com 923  

E-print Network

22 h after cocaine treatment. Blood was drawn from the eye for determi- nation of serum alanineletters to nature NATURE |VOL 407 |19 OCTOBER 2000 |www.nature.com 923 Animal treatment At least 3 mice between 8 and 10 weeks old were used for each treatment. Mice were pretreated by intraperitoneal

Read, Randy J.

465

letters to nature NATURE |VOL 405 |11 MAY 2000 |www.nature.com 187  

E-print Network

letters to nature NATURE |VOL 405 |11 MAY 2000 |www.nature.com 187 11. Cesare, P. & McNaughton, P. Sci. USA 93, 15435±15439 (1996). 12. Nagy, I. & Rang, H. P. Similarities and differences between. Nagy, J. I. & Kooy, D. van der. Effects of neonatal capsaicin treatment on nociceptive thresholds

Bergles, Dwight

466

autumn books NATURE|VOL425|23OCTOBER2003|www.nature.com/nature 769  

E-print Network

autumn books NATURE|VOL425|23OCTOBER2003|www.nature.com/nature 769 capacities. These capacities points out, it is unclear how quickly children identifysuchrules. Tomasello presents a wealth of obser on constructions in syntax, and to psychological research on children's under- standing of intentions and beliefs

Alvarez, Nadir

467

Natural gas monthly, April 1998  

SciTech Connect

This issue of the Natural Gas Monthly presents the most recent estimates of natural gas data from the Energy Information Administration (EIA). Estimates extend through April 1998 for many data series. The report highlights activities, events, and analyses of interest to public and private sector organizations associated with the natural gas industry. Volume and price data are presented each month for natural gas production, distribution, consumption, and interstate pipeline activities. Producer-related activities and underground storage data are also reported. From time to time, feature articles are presented designed to assist readers in using and interpreting natural gas information. This issue contains the special report, ``Natural Gas 1997: A Preliminary Summary.`` This report provides information on natural gas supply and disposition for the year 1997, based on monthly data through December from EIA surveys. 6 figs., 28 tabs.

NONE

1998-04-01

468

CURSO DE PS-GRADUAO EM ENGENHARIA E TECNOLOGIA ESPACIAIS  

E-print Network

CURSO DE PÓS-GRADUAÇÃO EM ENGENHARIA E TECNOLOGIA ESPACIAIS ÁREA DE CONCENTRAÇÃO EM ENGENHARIA E PÓS-GRADUAÇÃO EM ENGENHARIA E TECNOLOGIA ESPACIAIS ÁREA DE CONCENTRAÇÃO EM ENGENHARIA E GERENCIAMENTO Tecnologia de Satélites petronio.souza@lit.inpe.br CSE-201-4 Introdução à Engenharia de Sistemas Espaciais

469

CURSO DE PS-GRADUAO EM ENGENHARIA E TECNOLOGIA ESPACIAIS  

E-print Network

CURSO DE PÓS-GRADUAÇÃO EM ENGENHARIA E TECNOLOGIA ESPACIAIS ÁREA DE CONCENTRAÇÃO EM ENGENHARIA E;2 CURSO DE PÓS-GRADUAÇÃO EM ENGENHARIA E TECNOLOGIA ESPACIAIS ÁREA DE CONCENTRAÇÃO EM ENGENHARIA E Tecnologia de Satélites petronio.souza@lit.inpe.br CSE-201-4 Introdução à Engenharia de Sistemas Espaciais

470

Investigao em clulas estaminais no Biocant deu origem a cinco patentes em dois anos  

E-print Network

Investigação em células estaminais no Biocant deu origem a cinco patentes em dois anos, nos últimos dois anos, em cinco patentes, duas delas já licenciadas a empresas, disse à Lusa o vias de dar origem a um projeto empresarial" no âmbito do rastreio e criação de novos fármacos. As duas

Instituto de Sistemas e Robotica

471

Nature's palette: the search for natural blue colorants.  

PubMed

The food and beverage industry is seeking to broaden the palette of naturally derived colorants. Although considerable effort has been devoted to the search for new blue colorants in fruits and vegetables, less attention has been directed toward blue compounds from other sources such as bacteria and fungi. The current work reviews known organic blue compounds from natural plant, animal, fungal, and microbial sources. The scarcity of blue-colored metabolites in the natural world relative to metabolites of other colors is discussed, and structural trends common among natural blue compounds are identified. These compounds are grouped into seven structural classes and evaluated for their potential as new color additives. PMID:24930897

Newsome, Andrew G; Culver, Catherine A; van Breemen, Richard B

2014-07-16

472

FACULDADE DE CEILNDIA CAMPUS UnB CEILNDIA PROGRAMA DE PS-GRADUAO EM CINCIAS E TECNOLOGIAS EM SADE  

E-print Network

1 FACULDADE DE CEILÂNDIA ­ CAMPUS UnB CEILÂNDIA PROGRAMA DE PÓS-GRADUAÇÃO EM CIÊNCIAS E TECNOLOGIAS TECNOLOGIAS EM SAÚDE PARA OS CURSOS DE MESTRADO ACADÊMICO E DOUTORADO PARA O PRIMEIRO PERÍODO LETIVO DE 2012 1. PREÂMBULO 1.1. A Coordenadora do Programa de Pós-Graduação em Ciências e Tecnologias em Saúde, no uso de

Lucero, Jorge Carlos

473

EMS offshore. A new horizon for paramedics.  

PubMed

The difficulty in getting medical aid to offshore drilling platforms can be a source of life-threatening delays. Recently, some companies have charted new waters by actually stationing EMS crews on their rigs. PMID:10116023

Mallard, A S

1991-10-01

474

EM-dissertations completed in 2007  

E-print Network

2007 #12;Virtual Thermo-Mechanical Prototyping of Microelectronics Devices Driel, W.D. van Advisors-90-9022179-3 EM research theme: Computational and Experimental Mechanics Thermomechanical fatigue failure

Franssen, Michael

475

Natural gas sampling  

SciTech Connect

Two simple, inexpensive devices for sampling natural gas from small and noncommercial deposits are described. One device is intended for sampling of minute gas seepage from the bottom of shallow basins such as ponds or marshes where the gas might have an environmental impact. A shallow, inverted large metal funnel with a small hole in the side is placed on the bottom sediments in the basin. A rod pushed through the hole in the funnel liberates gas which after being trapped by the funnel is diverted through a tube attached to the funnel outlet into a sampling bottle. The second device intended for sampling gas seepage encountered in cased and uncased holes consists of an open-topped cylindrical steel container with a small nipple in its bottom. Threads on the nipple facilitate attachment of the sampler to a closed topped segment of a casing. During sampling, the cylindrical container is filled almost to the top with water, and a rigid tube attached to the upper portion of the nipple inside the cylindrical container conducts gas into a common glass sample bottle. (BLM)

Prokopovich, N.P.; Magleby, D.C.

1981-06-01

476

Optically switchable natural silk  

NASA Astrophysics Data System (ADS)

An optically active bio-material is created by blending natural silk fibers with photoisomerizable chromophore molecules—azobenzenebromide (AzBr). The material converts the energy of unpolarized light directly into mechanical work with a well-defined direction of action. The feasibility of the idea to produce optically driven microsized actuators on the basis of bio-material (silk) is proven. The switching behavior of the embedded AzBr molecules was studied in terms of UV/Vis spectroscopy. To test the opto-mechanical properties of the modified fibers and the structural changes they undergo upon optically induced switching, single fiber X-ray diffraction with a micron-sized synchrotron radiation beam was combined in situ with optical switching as well as with mechanical testing and monitoring. The crystalline regions of silk are not modified by the presence of the guest molecules, hence occupy only the amorphous part of the fibers. It is shown that chromophore molecules embedded into fibers can be reversibly switched between the trans and cis conformation by illumination with light of defined wavelengths. The host fibers respond to this switching with a variation of the internal stress. The amplitude of the mechanical response is independent of the applied external stress and its characteristic time is shorter than the relaxation time of the usual mechanical response of silk.

Krasnov, Igor; Krekiehn, Nicolai R.; Krywka, Christina; Jung, Ulrich; Zillohu, Ahnaf U.; Strunskus, Thomas; Elbahri, Mady; Magnussen, Olaf M.; Müller, Martin

2015-03-01

477

Nature's Autonomous Oscillators  

NASA Technical Reports Server (NTRS)

Nonlinearity is required to produce autonomous oscillations without external time dependent source, and an example is the pendulum clock. The escapement mechanism of the clock imparts an impulse for each swing direction, which keeps the pendulum oscillating at the resonance frequency. Among nature's observed autonomous oscillators, examples are the quasi-biennial oscillation and bimonthly oscillation of the Earth atmosphere, and the 22-year solar oscillation. The oscillations have been simulated in numerical models without external time dependent source, and in Section 2 we summarize the results. Specifically, we shall discuss the nonlinearities that are involved in generating the oscillations, and the processes that produce the periodicities. In biology, insects have flight muscles, which function autonomously with wing frequencies that far exceed the animals' neural capacity; Stretch-activation of muscle contraction is the mechanism that produces the high frequency oscillation of insect flight, discussed in Section 3. The same mechanism is also invoked to explain the functioning of the cardiac muscle. In Section 4, we present a tutorial review of the cardio-vascular system, heart anatomy, and muscle cell physiology, leading up to Starling's Law of the Heart, which supports our notion that the human heart is also a nonlinear oscillator. In Section 5, we offer a broad perspective of the tenuous links between the fluid dynamical oscillators and the human heart physiology.

Mayr, H. G.; Yee, J.-H.; Mayr, M.; Schnetzler, R.

2012-01-01

478

SUSY naturalness without prejudice  

E-print Network

Unlike the Standard Model (SM), supersymmetric models stabilize the electroweak (EW) scale $v$ at the quantum level and {\\it predict} that $v$ is a function of the TeV-valued SUSY parameters ($\\gamma_\\alpha$) of the UV Lagrangian. We show that the (inverse of the) covariance matrix of the model in the basis of these parameters and the usual deviation $\\delta\\chi^2$ (from $\\chi^2_{min}$ of a model) automatically encode information about the "traditional" EW fine-tuning measuring this stability, {\\it provided that} the EW scale $v\\sim m_Z$ is indeed regarded as a function $v=v(\\gamma)$. It is known that large EW fine-tuning may signal an incomplete theory of soft terms and can be reduced when relations among $\\gamma_\\alpha$ exist (due to GUT symmetries, etc). The global correlation coefficient of this matrix can help one investigate if such relations are present. An upper bound on the usual EW fine-tuning measure ("in quadrature") emerges from the analysis of the $\\delta\\chi^2$ and the s-standard deviation confidence interval by using $v=v(\\gamma)$ and the theoretical approximation (loop order) considered for the calculation of the observables. This upper bound avoids subjective criteria for the "acceptable" level of EW fine-tuning for which the model is still "natural".

D. M. Ghilencea

2014-04-14

479

Nature of eclipsing pulsars  

E-print Network

We present a model for pulsar radio eclipses in some binary systems, and test this model for PSRs B1957+20 and J2051-0827. We suggest that in these binaries the companion stars are degenerate dwarfs with strong surface magnetic fields. The magnetospheres of these stars are permanently infused by the relativistic particles of the pulsar wind. We argue that the radio waves emitted by the pulsar split into the eigenmodes of the electron-positron plasma as they enter the companion's magnetosphere and are then strongly damped due to cyclotron resonance with the ambient plasma particles. Our model explains in a natural way the anomalous duration and behavior of radio eclipses observed in such systems. In particular, it provides stable, continuous, and frequency-dependent eclipses, in agreement with the observations. We predict a significant variation of linear polarization both at eclipse ingress and egress. In this paper we also suggest several possible mechanisms of generation of the optical and $X$-ray emission observed from these binary systems.

David Khechinashvili; George Melikidze; Janusz Gil

2000-01-08

480

A natural topological insulator.  

PubMed

The earth's crust and outer space are rich sources of technologically relevant materials which have found application in a wide range of fields. Well-established examples are diamond, one of the hardest known materials, or graphite as a suitable precursor of graphene. The ongoing drive to discover novel materials useful for (opto)electronic applications has recently drawn strong attention to topological insulators. Here, we report that Kawazulite, a mineral with the approximate composition Bi2(Te,Se)2(Se,S), represents a naturally occurring topological insulator whose electronic properties compete well with those of its synthetic counterparts. Kawazulite flakes with a thickness of a few tens of nanometers were prepared by mechanical exfoliation. They exhibit a low intrinsic bulk doping level and correspondingly a sizable mobility of surface state carriers of more than 1000 cm(2)/(V s) at low temperature. Based on these findings, further minerals which due to their minimized defect densities display even better electronic characteristics may be identified in the future. PMID:23438015

Gehring, P; Benia, H M; Weng, Y; Dinnebier, R; Ast, C R; Burghard, M; Kern, K

2013-03-13

481

Nature of orchestral noise.  

PubMed

Professional orchestral musicians are at risk of exposure to excessive noise when at work. This is an industry-wide problem that threatens not only the hearing of orchestral musicians but also the way orchestras operate. The research described in this paper recorded noise levels within a professional orchestra over three years in order to provide greater insight to the orchestral noise environment; to guide future research into orchestral noise management and hearing conservation strategies; and to provide a basis for the future education of musicians and their managers. Every rehearsal, performance, and recording from May 2004 to May 2007 was monitored, with the woodwind, brass, and percussion sections monitored in greatest detail. The study recorded dBALEQ and dBC peak data, which are presented in graphical form with accompanying summarized data tables. The findings indicate that the principal trumpet, first and third horns, and principal trombone are at greatest risk of exposure to excessive sustained noise levels and that the percussion and timpani are at greatest risk of exposure to excessive peak noise levels. However, the findings also strongly support the notion that the true nature of orchestral noise is a great deal more complex than this simple statement would imply. PMID:18681585

O'Brien, Ian; Wilson, Wayne; Bradley, Andrew

2008-08-01

482

Freedom in nature  

NASA Astrophysics Data System (ADS)

The paper starts with the proposal that the cause of the apparent insolubility of the free-will problem are several popular but strongly metaphysical notions and hypotheses. To reduce the metaphysics, some ideas are borrowed from physics. A concept of event causality is discussed. The importance of Hume’s Principle of Causality is stressed and his Principle of Causation is weakened. The key concept of the paper, the so-called relative freedom, is also suggested by physics. It is a kind of freedom that can be observed everywhere in nature. Turning to biology, incomplete knowledge is defined for all organisms. They cope with the problem by Popper’s trial and error processes. One source of their success is the relative freedom of choice from the basic option ranges: mutations, motions and neural connections. Finally, the conjecture is adopted that communicability can be used as a criterion of consciousness and free will is defined as a conscious version of relative freedom. The resulting notion is logically self-consistent and it describes an observable phenomenon that agrees with our experience.

Hájí?ek, P.

2009-09-01

483

The SCHOOL of nature  

PubMed Central

During the co-evolution of viruses and their hosts, the latter have equipped themselves with an elaborate immune system to defend themselves from the invading viruses. In order to establish a successful infection, replicate and persist in the host, viruses have evolved numerous strategies to counter and evade host antiviral immune responses as well as exploit them for productive viral replication. These strategies include those that modulate signaling mediated by cell surface receptors. Despite tremendous advancement in recent years, the exact molecular mechanisms underlying these critical points in viral pathogenesis remain unknown. In this work, based on a novel platform of receptor signaling, the Signaling Chain HOmoOLigomerization (SCHOOL) platform, I suggest specific mechanisms used by different viruses such as human immunodeficiency virus (HIV), cytomegalovirus (CMV), severe acute respiratory syndrome coronavirus, human herpesvirus 6 and others, to modulate receptor signaling. I also use the example of HIV and CMV to illustrate how two unrelated enveloped viruses use a similar SCHOOL mechanism to modulate the host immune response mediated by two functionally different receptors: T cell antigen receptor and natural killer cell receptor, NKp30. This suggests that it is very likely that similar general mechanisms can be or are used by other viral and possibly non-viral pathogens. Learning from viruses how to target cell surface receptors not only helps us understand viral strategies to escape from the host immune surveillance, but also provides novel avenues in rational drug design and the development of new therapies for immune disorders. PMID:21487503

2010-01-01

484

Nature, Nurture, and Expertise.  

PubMed

Rather than investigating the extent to which training can improve performance under experimental conditions ('what could be'), we ask about the origins of expertise as it exists in the world ('what is'). We used the twin method to investigate the genetic and environmental origins of exceptional performance in reading, a skill that is a major focus of educational training in the early school years. Selecting reading experts as the top 5% from a sample of 10,000 12-year-olds twins assessed on a battery of reading tests, three findings stand out. First, we found that genetic factors account for more than half of the difference in performance between expert and normal readers. Second, our results suggest that reading expertise is the quantitative extreme of the same genetic and environmental factors that affect reading performance for normal readers. Third, growing up in the same family and attending the same schools account for less than a fifth of the difference between expert and normal readers. We discuss implications and interpretations ('what is inherited is DNA sequence variation'; 'the abnormal is normal'). Finally, although there is no necessary relationship between 'what is' and 'what could be', the most far-reaching issues about the acquisition of expertise lie at the interface between them ('the nature of nurture: from a passive model of imposed environments to an active model of shaped experience'). PMID:24948844

Plomin, Robert; Shakeshaft, Nicholas G; McMillan, Andrew; Trzaskowski, Maciej

2014-07-01

485

Super-Natural MSSM  

E-print Network

We point out that the electroweak fine-tuning problem in the supersymmetric Standard Models (SSMs) is mainly due to the high energy definition of the fine-tuning measure. We propose super-natural supersymmetry which has an order one high energy fine-tuning measure automatically. The key point is that all the mass parameters in the SSMs arise from a single supersymmetry breaking parameter. In this paper, we show that there is no supersymmetry electroweak fine-tuning problem explicitly in the Minimal SSM (MSSM) with no-scale supergravity and Giudice-Masiero (GM) mechanism. We demonstrate that the $Z$-boson mass, the supersymmteric Higgs mixing parameter $\\mu$ at the unification scale, and the sparticle spectrum can be given as functions of the universal gaugino mass $M_{1/2}$. Because the light stau is the lightest supersymmetric particle (LSP) in the no-scale MSSM, to preserve $R$ parity, we introduce a non-thermally generated axino as the LSP dark matter candidate. We estimate the lifetime of the light stau b...

Du, Guangle; Nanopoulos, D V; Raza, Shabbar

2015-01-01

486

Nature, nurture, and expertise  

PubMed Central

Rather than investigating the extent to which training can improve performance under experimental conditions (‘what could be’), we ask about the origins of expertise as it exists in the world (‘what is’). We used the twin method to investigate the genetic and environmental origins of exceptional performance in reading, a skill that is a major focus of educational training in the early school years. Selecting reading experts as the top 5% from a sample of 10,000 12-year-old twins assessed on a battery of reading tests, three findings stand out. First, we found that genetic factors account for more than half of the difference in performance between expert and normal readers. Second, our results suggest that reading expertise is the quantitative extreme of the same genetic and environmental factors that affect reading performance for normal readers. Third, growing up in the same family and attending the same schools account for less than a fifth of the difference between expert and normal readers. We discuss implications and interpretations (‘what is inherited is DNA sequence variation’; ‘the abnormal is normal’). Finally, although there is no necessary relationship between ‘what is’ and ‘what could be’, the most far-reaching issues about the acquisition of expertise lie at the interface between them (‘the nature of nurture: from a passive model of imposed environments to an active model of shaped experience’). PMID:24948844

Plomin, Robert; Shakeshaft, Nicholas G.; McMillan, Andrew; Trzaskowski, Maciej

2014-01-01

487

Contaminant Removal From Natural Resources  

NASA Technical Reports Server (NTRS)

A zero-valent metal emulsion containing zero-valent metal particles is used to remediate contaminated natural resources, such as groundwater and soil. In a preferred embodiment, the zero-valent metal emulsion removes heavy metals, such as lead (pb), from contaminated natural resources. In another preferred embodiment, the zero-valent metal emulsion is a bimetallic emulsion containing zero-valent metal particles doped with a catalytic metal to remediate halogenated aromatic compounds, such as polychlorinated biphenyls (PCBs), from natural resources.

Clausen, Christian A. (Inventor); Quinn, Jacqueline W. (Inventor); Geiger, Cheri L. (Inventor); Reinhart, Debra (Inventor); Fillpek, Laura B. (Inventor); Coon, Christina (Inventor); Devor, Robert (Inventor)

2006-01-01

488

Natural gas monthly, February 1996  

SciTech Connect

The NGM highlights activities, events, and analyses of interest to public and private sector organizations associated with the natural gas industry. Volume and price data are presented each month for natural gas production, distribution, consumption, and interstate pipeline activities. Producer-related activities and underground storage data are also reported. From time to time, the NGM features articles designed to assist readers in using and interpreting natural gas information.

NONE

1996-03-01

489

Natural gas monthly, May 1995  

SciTech Connect

The NGM highlights activities, events, and analyses of interest to public and private sector organizations associated with the natural gas industry. Volume and price data are presented each month for natural gas production, distribution, consumption, and interstate pipeline activities. Producer-related activities and underground storage data are also reported. From time to time, the NGM features articles designed to assist readers in using and interpreting natural gas information.

NONE

1995-05-24

490

Natural gas monthly, March 1998  

SciTech Connect

The March 1998 edition of the Natural Gas Monthly highlights activities, events, and analyses associated with the natural gas industry. Volume and price data are presented for natural gas production, distribution, consumption, and interstate pipeline activities. Producer-related activities and underground storage data are also reported. This report also features an article on the correction of errors in the drilling activity estimates series, and in-depth drilling activity data. 6 figs., 28 tabs.

NONE

1998-03-01

491

Natural gas monthly, October 1995  

SciTech Connect

The Natural Gas Monthly highlights activities, events, and analyses of interest to public and private sector organizations associated with the natural gas industry. Volume and price data are presented each month for natural gas production, distribution, consumption, and interstate pipeline activities. Producer-related activities and underground storage data are also reported. A glossary of the terms used in this report is provided to assist readers in understanding the data presented in this publication. 6 figs., 30 tabs.

NONE

1995-10-23

492

Natural gas monthly, September 1998  

SciTech Connect

The National Gas Monthly (NGM) highlights activities, events, and analyses of interest to public and private sector organizations associated with the natural gas industry. Volume and price data are presented each month for natural gas production, distribution, consumption, and interstate pipeline activities. Producer-related activities and underground storage data are also reported. From time to time, the NGM features articles designed to assist readers in using and interpreting natural gas information. 6 figs., 27 tabs.

NONE

1998-09-01

493

Natural gas monthly, January 1994  

SciTech Connect

The Natural Gas Monthly (NGM) highlights activities, events, and analyses of interest to public and private sector organizations associated with the natural gas industry. Volume and price data are presented each month for natural gas production, distribution, consumption, and interstate pipeline activities. Producer-related activities and underground storage data are also reported. From time to time, the NGM features articles designed to assist readers in using and interpreting natural gas information. The featured article for this month is on US coalbed methane production.

Not Available

1994-02-01

494

Nature Centers and Land Trusts--Natural Partners.  

ERIC Educational Resources Information Center

The main goal of land trusts is land preservation by purchase or other means. Land trusts generally lack the personnel, funds, and expertise to take advantage of the land's potential for education, interpretation, and research. A nature center can provide the expertise to put the property to good use. Discusses trusts, nature centers, and their…

Davis, William L.; McDonald, Brook S.

1997-01-01

495

Super Natural II—a database of natural products  

PubMed Central

Natural products play a significant role in drug discovery and development. Many topological pharmacophore patterns are common between natural products and commercial drugs. A better understanding of the specific physicochemical and structural features of natural products is important for corresponding drug development. Several encyclopedias of natural compounds have been composed, but the information remains scattered or not freely available. The first version of the Supernatural database containing ?50 000 compounds was published in 2006 to face these challenges. Here we present a new, updated and expanded version of natural product database, Super Natural II (http://bioinformatics.charite.de/supernatural), comprising ?326 000 molecules. It provides all corresponding 2D structures, the most important structural and physicochemical properties, the predicted toxicity class for ?170 000 compounds and the vendor information for the vast majority of compounds. The new version allows a template-based search for similar compounds as well as a search for compound names, vendors, specific physical properties or any substructures. Super Natural II also provides information about the pathways associated with synthesis and degradation of the natural products, as well as their mechanism of action with respect to structurally similar drugs and their target proteins. PMID:25300487

Banerjee, Priyanka; Erehman, Jevgeni; Gohlke, Björn-Oliver; Wilhelm, Thomas; Preissner, Robert; Dunkel, Mathias

2015-01-01

496

Nature versus Technology: Nature-Deficit Disorder in Children  

Microsoft Academic Search

In 2005, Richard Louv published Last Child in the Woods. Louv attests that children are spending less time outdoors and more time interacting with technology, and thus, leading to a multitude of behavioral problems. Does this “condition,” aptly named nature-deficit disorder, impact the behavior of children? How is this condition remedied? How can children be introduced to nature both in

Amanda K Webber

2012-01-01

497

On the hermeneutical nature of modern natural science  

Microsoft Academic Search

An effort is made in this essay to show the intrinsic hermeneutic nature of the natural sciences by means of a critical reflection on data taken from the history of classical mechanics and astronomy. The events which eventually would lead to the origin of Newton's mechanics are critically analyzed, with the aim of showing that and in what sense the

Joseph J. Kockelmans

1997-01-01

498

Natural Resources and Economic Development The curse of natural resources  

Microsoft Academic Search

This paper summarizes and extends previous research that has shown evidence of acurse of natural resourcesa } countries withgreat natural resource wealthtend nevertheless to grow more slowly than resource-poor countries. This result is not easily explained by other variables, or by alternative ways to measure resource abundance. This paper shows that there is little direct evidence that omitted geographical or

D. Sachs; Andrew M. Warner

2001-01-01

499

Connection to Nature: Children's Affective Attitude toward Nature  

ERIC Educational Resources Information Center

A connection to nature index was developed and tested to measure children's affective attitude toward the natural environment. The index was employed through a survey that investigates students' attitude toward Lagoon Quest, a mandatory environmental education program for all fourth-grade, public school students in Brevard County, Florida. Factor…

Cheng, Judith Chen-Hsuan; Monroe, Martha C.

2012-01-01

500

Super-Natural MSSM  

E-print Network

We point out that the electroweak fine-tuning problem in the supersymmetric Standard Models (SSMs) is mainly due to the high energy definition of the fine-tuning measure. We propose super-natural supersymmetry which has an order one high energy fine-tuning measure automatically. The key point is that all the mass parameters in the SSMs arise from a single supersymmetry breaking parameter. In this paper, we show that there is no supersymmetry electroweak fine-tuning problem explicitly in the Minimal SSM (MSSM) with no-scale supergravity and Giudice-Masiero (GM) mechanism. We demonstrate that the $Z$-boson mass, the supersymmteric Higgs mixing parameter $\\mu$ at the unification scale, and the sparticle spectrum can be given as functions of the universal gaugino mass $M_{1/2}$. Because the light stau is the lightest supersymmetric particle (LSP) in the no-scale MSSM, to preserve $R$ parity, we introduce a non-thermally generated axino as the LSP dark matter candidate. We estimate the lifetime of the light stau by calculating its 2-body and 3-body decays to the LSP axino for several values of axion decay constant $f_a$, and find that the light stau has a lifetime $\\tau_{\\tilde \\tau_1}$ in $[10^{-4},100]$ s for an $f_a$ range $[10^{9},10^{12}]$ GeV. We show that our next to the LSP stau solutions are consistent with all the current experimental constraints, including the sparticle mass bounds, B-physics bounds, Higgs mass, cosmological bounds, and the bounds on long-lived charge particles at the LHC.

Guangle Du; Tianjun Li; D. V. Nanopoulos; Shabbar Raza

2015-02-24