Science.gov

Sample records for em desenvolvimento natural

  1. Aquisição de Estreptococos Mutans e Desenvolvimento de Cárie Dental em Primogênitos

    PubMed Central

    NOCE, Erica; RUBIRA, Cassia Maria Fischer; da Silva ROSA, Odila Pereira; da SILVA, Salete Moura Bonifácio; BRETZ, Walter Antonio

    2011-01-01

    Objetivo Avaliar o momento de aquisição de estreptococos mutans (EM), desenvolvimento de cárie dental e as variáveis a eles associadas no decorrer de 23 meses, em primogênitos de famílias de baixo nível socioeconômico, desde os sete meses de idade. Método A amostra foi selecionada com base em mães densamente colonizadas por EM, incluindo todos os membros de 14 famílias que conviviam na mesma casa. Foram envolvidos no estudo 14 mães, pais e primogênitos e 8 parentes, na maioria avós. Exames clínicos e radiográficos iniciais determinaram os índices de cárie e condição periodontal dos adultos. Contagens de EM foram feitas em todos os adultos nas duas primeiras visitas. Nas crianças foram avaliados os níveis de EM, o número de dentes e de cáries, em quatro visitas. Resultados A prevalência de EM nos adultos foi alta, estando ausente em apenas um dos pais. EM foram detectados em 1, 2, 3 e 10 crianças, respectivamente nas visitas #1, 2, 3 e 4. A cárie dental foi detectada em apenas três crianças na última visita (aos 30 meses de idade), as quais apresentaram escores de EM significantemente maiores que as crianças sem cárie, na mesma visita. Conclusão Exclusivamente a condição social de baixa renda e mães densamente colonizadas por EM não são sinônimo de colonização precoce e alta atividade de cárie em crianças cuidadas em casa. O desenvolvimento de cárie está significantemente associado a escores elevados de EM nas crianças. PMID:22022218

  2. Relatrio de Atividades de 2002 da Linha de Pesquisa e Desenvolvimento em Fuso Termonuclear Controlada FUSO

    E-print Network

    de alta potência. O pessoal da equipe de apoio técnico teve, em sua maior parte, dedicação em tempo pesquisa, Teoria e Engenharia) Dr. Edson Del Bosco (Operação da máquina, Diagnósticos, Chefe do LAP ­ Tempo parcial) Dr. Joaquim José Barroso de Castro (Fontes de microondas ­ Tempo parcial) Dr. Luiz Ângelo Berni

  3. A Direo do Ncleo de Desenvolvimento Infantil do Centro de Cincias da Educao da Universidade Federal de Santa Catarina, no uso de suas atribuies e, tendo em vista

    E-print Network

    Floeter, Sergio Ricardo

    Federal de Santa Catarina, no uso de suas atribuições e, tendo em vista o que dispõe o edital n.01/NDI/04/2011 a 31/03/2012) 1. Alice da Silva Magnus 2. Antonio Maria Marçal Telo Nunes da Costa 3. Gustavo Reis

  4. Heuristic approach to a {\\em natural} unification of the Quantum Theory and the General Theory of Relativity

    E-print Network

    Sanjay M. Wagh

    2004-09-12

    In non-relativistic as well as in special relativistic quantum theory, {\\em mass} and {\\em charge} are {\\em pure numbers} appearing in various (quantum) operators and admit {\\em any values}, {\\it ie}, values for these quantities are to be prescribed {\\em by hand}. This is, in a theory of probability, understandable since we need to {\\em assume} some {\\em intrinsic} properties of the object we are calculating the probability about. Then, if we {\\em specify}, in some satisfactory manner, mass and charge for a point of the space in a suitable general-relativistic framework, the quantum theoretical framework could, in principle, be {\\em obtainable} within it. Heuristic arguments are presented to show that a {\\em natural unification} of the quantum theory and the general theory of relativity is achievable in this manner.

  5. Georeferencing natural disaster impact footprints : lessons learned from the EM-DAT experience

    NASA Astrophysics Data System (ADS)

    Wallemacq, Pascaline; Guha Sapir, Debarati

    2014-05-01

    The Emergency Events Database (EM-DAT) contains data about the occurrence and consequences of all the disasters that have taken place since 1900. The main objectives of the database are to serve the purposes of humanitarian action at national and international levels; to aid decision making for disaster preparedness, as well as providing an objective base for vulnerability assessments and priority setting. EM-DAT records data on the human and economic impacts for each event as well as the location of said event. This is recorded as text data, namely the province, department, county, district, or village. The first purpose of geocoding (or georeferencing) the EM-DAT database is to transform the location data from text format into code data. The GAUL (Global Administrative Unit Layers) database (FAO) is used as a basis to identify the geographic footprint of the disaster, ideally to the second administrative level and add a unique code for each affected unit. Our first step has involved georeferencing earthquakes since the location of these is precise. The second purpose is to detail the degree of precision of georeferencing. The application and benefits of georeferencing are manifold. The geographic information of the footprint of past (after 2000) and future natural disasters permits the location of vulnerable areas with a GIS system and to cross data from different sources. It will allow the study of different elements such as the extent of a disaster and its human and economic consequences; the exposure and vulnerability of the population in space and time and the efficiency of mitigation measures. In addition, any association between events and external factors can be identified (e.g.: is the famine located at the same places as drought?) and precision of the information in the disaster report can be evaluated. Besides this, these maps will provide valuable communication support since maps have a high communication power and are easily understandable by the wider public and policy makers. Some results from the application of georeferencing will be presented during the session such as a study of the population potentially exposed and affected by natural disasters in Europe, a flood vulnerability analysis in Vietnam and the potential merging of watersheds analysis and flood footprints data.

  6. SimTJS: A Model for Developing Serious Games for Training SimTJS: Uma Arquitetura para o Desenvolvimento de Jogos Serios para

    E-print Network

    Barbosa, Alberto

    Desenvolvimento de Jogos S´erios para Treinamento Daniel Trindade, Peter Dam, Alberto Raposo Tecgraf, Departamento jogos s´erios que imitam cen´arios reais, permitindo que os profissionais realizem operac¸~oes que antes componentes que comp~oem a arquitetura, al´em de exemplos de utilizac¸~ao da mesma. Keywords-Jogos S

  7. Chords: Em 022000 Em Em Em Em C C C C

    E-print Network

    Reiners, Peter W.

    Verse 1 Chorus Verse 2 Chorus Verse 3 Chords: Em 022000 C 035553 G 320002 F 133211 Intro: Em Em Em Em C C C C Em Em Em Em C C C C Em Em Em Em C C C C Em Em Em Em C C C C Verse: Em Em Em Em C C C C G G G G G G G G Em Em Em Em C C C C G G G G G G G G Em Em Em Em C C C C G G G G G G G G Em Em Em Em C C

  8. ARTIGO INTERNET Jogos Srios em debate no IST

    E-print Network

    Instituto de Sistemas e Robotica

    ARTIGO INTERNET «Jogos Sérios» em debate no IST in http://sol.sapo.pt/ Data: 2011-9-15 Link: http://sol.sapo.pt/inicio/Tecn ... «Jogos Sérios» em debate no IST O Instituto Superior Técnico (IST) vai ser o palco da II Conferência Internacional sobre aplicações e desenvolvimento de «Jogos Sérios» A conferência terá lugar nos dias 19 e 20 de

  9. Nature

    NASA Astrophysics Data System (ADS)

    Heinhorst, Sabine; Cannon, Gordon

    1997-01-01

    The fact that two of the original articles by this year's Nobel laureates were published in Nature bears witness to the pivotal role of this journal in documenting pioneering discoveries in all areas of science. The prize for Physiology or Medicine was awarded to immunologists Peter C. Doherty (University of Tennessee) and Rolf M. Zinkernagel (University of Zurich, Switzerland), honoring work that, in the 1970s, laid the foundation for our current understanding of the way in which our immune system differentiates between healthy cells and virus-infected ones that are targeted for destruction (p 465 in the October 10 issue of vol. 383). Three researchers share the Chemistry award for their discovery of C60 buckminsterfullerenes. The work by Robert Curl, Richard Smalley (both at Rice University), and Harry Kroto (University of Sussex, UK) has led to a burst of new approaches to materials development and in carbon chemistry (p 561 of the October 17 issue of vol. 383). This year's Nobel prize in physics went to three U.S. researchers, Douglas Osheroff (Stanford University) and David M. Lee and Robert C. Richardson (Cornell University), who were honored for their work on superfluidity, a frictionless liquid state, of supercooled 3He (p 562 of the October 17 issue of vol. 383).

  10. Resonances and Tides in Natural Satellites Systems. (Breton Title: Ressonâncias e Marés em Sistemas de Satélites Naturais.) Resonancias y Mareas en Sistemas de Satélites Naturales

    NASA Astrophysics Data System (ADS)

    Callegari, Nelson, Jr.

    2006-12-01

    In this work we describe some aspects of the dynamics of the mean-motion resonances. Emphasis to the case of resonances between regular satellites of the giant planets will be given, even so some aspects of the physics of the resonances in extra-solar planetary systems are also briefly treated. The role of the resonances in satellites systems is discussed through examples, showing how certain resonances, and its relations with the tidal dissipation effects, can be the key of the explanation of some phenomena still not explained in the Solar System. Amongst some examples we highlight the problem of the resurfacing of Enceladus, the existence of active volcanoes in Io, and the possible existence of the subsurface ocean in Europe. This work has as objective the divulgation of some topics in Celestial Mechanics and Planetary Sciences for an undergraduate public in exact sciences, as Astronomy and Physics, and not their detailed description. Neste trabalho descrevemos alguns aspectos da dinâmica de ressonâncias de movimentos médios. Será dada ênfase maior ao caso de ressonâncias entre satélites regulares dos planetas gigantes, embora alguns aspectos da física das ressonâncias em sistemas planetários extra-solares também sejam discutidos brevemente. A importância do estudo de ressonâncias em sistemas de satélites é discutida mais detalhadamente através de exemplos, mostrando como certas ressonâncias e suas relações com efeitos de dissipação de maré podem ser a chave de parte da explicação de alguns fenômenos ainda não explicados no Sistema Solar. Dentre vários exemplos destacamos o problema da remodelagem da superfície do satélite Enceladus, a existência de vulcões ativos em Io, e a possível existência do oceano subterrâneo em Europa. Este trabalho tem como objetivo a divulgação de alguns tópicos de Mecânica Celeste e Planetologia para um público de nível de graduação em disciplinas na área de exatas, em especial Astronomia e Física, e não a descrição detalhada dos conceitos aqui discutidos. Describimos en este trabajo algunos aspectos de la dinámica de resonancias de movimientos promedio. Será dado un énfasis mayor al caso de las resonancias entre satélites regulares de los planetas gigantes, aunque también son discutidos brevemente algunos aspectos de la física de resonancias en sistemas panetarios extrasolares. La importancia del estudio de las resonancias en sistemas de satélites es discutida más detalladamente através de ejemplos, mostrando cómo ciertas resonancias y los efectos de disipación por mareas pueden ser la clave de parte de la explicación de algunos fenómenos aún no comprendidos en el Sistema Solar. Entre varios ejemplos se destacan el problema de la superficie remodelada del satélite Enceladus, la existencia de volcanes activos en Io y la posible existencia de un océano subterráneo en Europa. Este trabajo tiene como objetivo la divulgación de algunos tópicos en Mecánica Celeste y Planetología para un público universitario de ciencias exactas, en particular Astronomía y Física, y no la descripción detallada de los conceptos aquí discutidos.

  11. Engenharia Eltrica DESENVOLVIMENTO DE SISTEMAS DE AQUISIO, PROCES-

    E-print Network

    Carvalho, João Luiz

    variabilidade da freqüência cardíaca, ou HRV (heart rate variability). A análise da HRV permite avaliar o análise de HRV. [METODOLOGIA] O primeiro passo foi concluir o sistema de análise de HRV, implementado em, respiração, entre outros. [RESULTADOS] O sistema de análise de HRV foi concluído. O programa pode ser

  12. DAC Decanato de Assuntos Comunitrios DDS Diretoria de Desenvolvimento Social

    E-print Network

    Maier, Rudolf Richard

    regularmente matriculados em disciplinas dos cursos presenciais de graduação e pós-graduação (mestrado e Universitário (RU): permite a todos os estudantes dos cursos presenciais de graduação e de pós socioeconômica, acesso gratuito às refeições (café da manhã, almoço e jantar) servidas nos Restaurantes

  13. DAC Decanato de Assuntos Comunitrios DDS Diretoria de Desenvolvimento Social

    E-print Network

    Maier, Rudolf Richard

    regularmente matriculados em disciplinas dos cursos presenciais de graduação e pós-graduação (mestrado e gratuita no Restaurante Universitário (RU): permite a todos os estudantes dos cursos presenciais de de vulnerabilidade socioeconômica, acesso gratuito às refeições (café da manhã, almoço e jantar

  14. DAC Decanato de Assuntos Comunitrios DDS Diretoria de Desenvolvimento Social

    E-print Network

    Maier, Rudolf Richard

    matriculados em disciplinas dos cursos presenciais de graduação e pós-graduação (mestrado e doutorado (cursos presenciais) do Campus Darcy Ribeiro e de pós-graduação (mestrado e #12;DAC ­ Decanato de Assuntos socioeconômica acesso gratuito às refeições no Restaurante Universitário (RU). c) Auxílio-Alimentação: repasse

  15. Nature Nature Publishing Group Nature

    E-print Network

    Cai, Long

    . Nature provides timely, hard-hitting, insightful and arresting news and interpretation to all readers who news goes live · a research article landing page ­ allowing readers to browse Nature articles

  16. Covariant gauge-natural conservation laws

    E-print Network

    Marcella Palese; Ekkehart Winterroth

    2006-04-12

    When a gauge-natural invariant variational principle is assigned, to determine {\\em canonical} covariant conservation laws, the vertical part of gauge-natural lifts of infinitesimal principal automorphisms -- defining infinitesimal variations of sections of gauge-natural bundles -- must satisfy generalized Jacobi equations for the gauge-natural invariant Lagrangian. {\\em Vice versa} all vertical parts of gauge-natural lifts of infinitesimal principal automorphisms which are in the kernel of generalized Jacobi morphisms are generators of canonical covariant currents and superpotentials. In particular, only a few gauge-natural lifts can be considered as {\\em canonical} generators of covariant gauge-natural physical charges.

  17. Middleware para Ger^encia de Energia em Clusters Web Dorgival Guedes , Wagner Meira Jr. , Di^ego Nogueira , Rodrigo Pereira

    E-print Network

    Guedes, Dorgival

    MPM: Middleware para Ger^encia de Energia em Clusters Web Dorgival Guedes , Wagner Meira Jr. , Di extra de energia. O desenvolvimento de aplicac¸ ~oes capazes de geren- ciar esse consumo requer formas desempenho com o controle de energia. Para avaliar a efic´acia da soluc¸~ao verificamos o seu funcionamento

  18. Experiências internacionais da aplicação de sistemas de apoio à decisão clínica em gastroenterologia

    PubMed Central

    Tenório, Josceli Maria; Hummel, Anderson Diniz; Sdepanian, Vera Lucia; Pisa, Ivan Torres; de Fátima Marin, Heimar

    2015-01-01

    Objetivo Descrever as experiências recentes com a aplicação de sistemas de apoio à decisão clínica em gastroenterologia, de forma a estabelecer o nível de desenvolvimento, testes e vantagens conferidas à prática médica com a introdução desses softwares. Métodos Foi realizada busca nas bases de dados PubMed, LILACS e ISI Web of Knowledge, utilizando termos relacionados à sistemas de apoio à decisão e à gastroenterogia, incluindo artigos originais publicados no período entre 2005 e 2010. Foram recuperadas 104 publicações, na busca inicial e, após a aplicação dos critérios de inclusão e exclusão, foram eleitos nove estudos para leitura do texto completo. Resultados Os sistemas de apoio à decisão clínica apresentam grande multiplicidade de problemas clínicos e investigação de doenças. Em 89% dos casos, são descritos modelos experimentais para o desenvolvimento de sistemas de apoio à decisão clínica. A descrição dos resultados obtidos por técnicas de inteligência artificial em 78% das publicações. Em dois dos estudos foram realizadas comparações com o médico e em apenas uma publicação um estudo controlado foi descrito, mostrando evidências de melhorias na prática médica. Conclusão Os estudos mostram potenciais benefícios dos sistemas de apoio à decisão clínica à prática médica, porém, estudos controlados em ambiente real devem ser realizados para comprovar esta perspectiva. PMID:26491625

  19. O que bilíngues bimodais têm a nos dizer sobre desenvolvimento bilíngue?

    PubMed Central

    de Quadros, Ronice Müller; Lillo-Martin, Diane; Pichler, Deborah Chen

    2013-01-01

    O objetivo deste trabalho é apresentar o que as pesquisas que estamos desenvolvendo com crianças ouvintes, filhas de pais surdos, adquirindo Língua Brasileira de Sinais (Libras) e Português e Língua de Sinais Americana (ASL) e Inglês (Lillo-Martin et al. 2010) têm a nos dizer sobre desenvolvimento bilíngue. Os dados deste estudo fazem parte de um banco de dados de interações espontâneas coletadas longitudinalmente, alternando contextos de aquisição da Libras e do português como língua alvo, no Brasil e dados coletados longitudinalmente. nos mesmos contextos, de crianças adquirindo ASL e inglês1. Além disso, há também dados do estudo experimental com testes aplicados nos dois pares de línguas que se agregam ao presente estudo. Uma visão geral dos estudos desenvolvidos sobre a aquisição bilíngue bimodal por crianças ouvintes, filhas de pais surdos, será apresentada e, então, serão expostos alguns aspectos linguísticos deste tipo de aquisição, considerando as discussões sobre aquisição bilíngue a partir da pesquisa realizada. PMID:24431480

  20. 7 CFR 1945.20 - Making EM loans available.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... Secretary in making a decision on the requested natural disaster determination. (4) The Secretary will... 7 Agriculture 13 2012-01-01 2012-01-01 false Making EM loans available. 1945.20 Section 1945.20...) PROGRAM REGULATIONS (CONTINUED) EMERGENCY Disaster Assistance-General § 1945.20 Making EM loans...

  1. 7 CFR 1945.20 - Making EM loans available.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... Secretary in making a decision on the requested natural disaster determination. (4) The Secretary will... 7 Agriculture 13 2010-01-01 2009-01-01 true Making EM loans available. 1945.20 Section 1945.20...) PROGRAM REGULATIONS (CONTINUED) EMERGENCY Disaster Assistance-General § 1945.20 Making EM loans...

  2. EM International. Volume 1

    SciTech Connect

    Not Available

    1993-07-01

    It is the intent of EM International to describe the Office of Environmental Restoration and Waste Management`s (EM`s) various roles and responsibilities within the international community. Cooperative agreements and programs, descriptions of projects and technologies, and synopses of visits to international sites are all highlighted in this semiannual journal. Focus on EM programs in this issue is on international collaboration in vitrification projects. Technology highlights covers: in situ sealing for contaminated sites; and remote sensors for toxic pollutants. Section on profiles of countries includes: Arctic contamination by the former Soviet Union, and EM activities with Germany--cooperative arrangements.

  3. Falta de investimento prejudica sector em Portugal

    E-print Network

    Instituto de Sistemas e Robotica

    , "falta verdadeiro capital de risco investidor em ciências da vida em ge- ral, e em biotecnologia em Investimento Menos de metade dos investidores em biotecnologia recuperam o seu Investimento. Mas em 2013, pela

  4. Firsthand Nature

    ERIC Educational Resources Information Center

    Gostev, Moses; Weiss, Francesca Michaelides

    2007-01-01

    It's no secret that many school programs don't give children enough opportunity to explore the natural world--i.e., to "mess about" and to have firsthand experience with nature and animals. Not so at the Muscota New School in New York City! This innovative public elementary school actively promotes inquiry-based learning and encourages teachers to…

  5. Nature Detectives

    ERIC Educational Resources Information Center

    Harr, Natalie; Lee, Richard E.; Jr.

    2010-01-01

    Richard Louv's "Last Child in the Woods" (2008) added to a growing consensus to get children outside and experiencing nature. Using ideas from place-based education, the authors present a simple year-long project that brings science, nature, and other curriculum standards to life right in your school yard. With a focus on journaling, this project…

  6. Matematica Natural.

    ERIC Educational Resources Information Center

    Lozano, Patricia; Medearis, Linda

    Matematica Natural (Natural Mathematics) is a mathematics curriculum for young children based on the assumption that they learn mathematics through concrete, real life, relevant experiences and that educational differences rather than cultural differences influence math achievement. The curriculum uses hands-on materials and activities to teach…

  7. Natural Beauty

    ERIC Educational Resources Information Center

    Coy, Mary

    2006-01-01

    In this article, the author describes how her art class students were able to create, in just four class periods, clay relief plaques depicting nature. A lesson on texture speeds up the completion of such a project. Seeing that clay is a natural material with its own unique texture, it seemed fitting that the final product should depict a variety…

  8. The Nature of Natural Languages.

    ERIC Educational Resources Information Center

    Pierce, Joe E.

    A variety of types of evidence are examined to help determine the true nature of "deep structure" and what, if any, implications this has for linguistic theory as well as culture theory generally. The evidence accumulated over the past century on the nature of phonetic and phonemic systems is briefly discussed, and the following areas of analysis…

  9. Nature's software

    E-print Network

    Daniel Canarutto

    2014-04-20

    I bring forward some arguments to support the thesis that nature is fundamentally discrete, and present my own thoughts about the direction in which one could look for a possible, consistent "theory of everything" describing gravitation and quantum particles.

  10. Natural Predator 

    E-print Network

    Wythe, Kathy

    2006-01-01

    Natural Predator Story by Kathy Wythe Natural Predator Foreign beetle shows promise for controlling saltcedar In the northern part of the Texas Panhandle andalong the West Texas banks of the Colorado andPecos rivers, Texas scientists are successfully... intro- ducing a foreign beetle to help control an invasive and exotic water-thirsty plant. Saltcedar, or Tamarix, was introduced to the western United States in the 1800s from central Asia as an ornamental tree and planted along riverbanks...

  11. Memória fonológica em crianças bilíngues bimodais e crianças com implante coclear

    PubMed Central

    de Quadros, Ronice Müller; Cruz, Carina Rebello; Pizzio, Aline Lemos

    2014-01-01

    RESUMO Este estudo comparou o desempenho de crianças bilíngues bimodais ouvintes (filhas de pais surdos) e crianças surdas usuárias de implante coclear (filhas de pais surdos e de pais ouvintes), com diferentes contextos de acesso à Língua Brasileira de Sinais (Libras), em tarefas que envolvem memória fonologica. Os testes utilizados foram: Teste de Pseudopalavras (Santos e Bueno, 2003) e Teste de Pseudosinais (desenvolvido pelos pesquisadores responsáveis pelo Projeto ‘Desenvolvimento Bilíngue Bimoda’). Além disso, foram incluídos dois grupos de controle, formados por crianças surdas (usuarias de Libras), e adultos bilíngues bimodais ouvintes. Na análise dos resultados, em relação ao desempenho entre os dois grupos testados foi constatado que o grupo de crianças bilíngues bimodais ouvintes apresentou desempenho superior, nos dois testes. No entanto, ao ser analisado o desempenho da criança surda usuaria de implante coclear, filha de pais surdos, que possui acesso irrestrito à Libras e comparado com o das crianças surdas usuárias de implante coclear, que possuem acesso restrito à Libras, foi constatado que o seu desempenho foi semelhante ao do grupo de crianças bilíngues bimodais ouvintes. As crianças surdas usuárias de implante coclear com acesso restrito à Libras e, portanto, com acesso maior ao Português apresentaram escores mais baixos nas tarefas, principalmente do teste em Português. Os resultados sugerem que as crianças surdas usuárias de implante coclear em processo de aquisição da línguagem podem se beneficiar com o acesso irrestrito à Libras, atingindo inclusive desempenho semelhante a de crianças bilíngues bimodais ouvintes. PMID:25110473

  12. Nature's Code

    NASA Astrophysics Data System (ADS)

    Hill, Vanessa J.; Rowlands, Peter

    2008-10-01

    We propose that the mathematical structures related to the `universal rewrite system' define a universal process applicable to Nature, which we may describe as `Nature's code'. We draw attention here to such concepts as 4 basic units, 64- and 20-unit structures, symmetry-breaking and 5-fold symmetry, chirality, double 3-dimensionality, the double helix, the Van der Waals force and the harmonic oscillator mechanism, and our explanation of how they necessarily lead to self-aggregation, complexity and emergence in higher-order systems. Biological concepts, such as translation, transcription, replication, the genetic code and the grouping of amino acids appear to be driven by fundamental processes of this kind, and it would seem that the Platonic solids, pentagonal symmetry and Fibonacci numbers have significant roles in organizing `Nature's code'.

  13. Natural games

    E-print Network

    Jani Anttila; Arto Annila

    2011-03-05

    Behavior in the context of game theory is described as a natural process that follows the 2nd law of thermodynamics. The rate of entropy increase as the payoff function is derived from statistical physics of open systems. The thermodynamic formalism relates everything in terms of energy and describes various ways to consume free energy. This allows us to associate game theoretical models of behavior to physical reality. Ultimately behavior is viewed as a physical process where flows of energy naturally select ways to consume free energy as soon as possible. This natural process is, according to the profound thermodynamic principle, equivalent to entropy increase in the least time. However, the physical portrayal of behavior does not imply determinism. On the contrary, evolutionary equation for open systems reveals that when there are three or more degrees of freedom for behavior, the course of a game is inherently unpredictable in detail because each move affects motives of moves in the future. Eventually, when no moves are found to consume more free energy, the extensive-form game has arrived at a solution concept that satisfies the minimax theorem. The equilibrium is Lyapunov-stable against variation in behavior within strategies but will be perturbed by a new strategy that will draw even more surrounding resources to the game. Entropy as the payoff function also clarifies motives of collaboration and subjective nature of decision making.

  14. Composing Nature

    ERIC Educational Resources Information Center

    Johnson-Sheehan, Richard

    2007-01-01

    The environment is a ready-made subject in writing classrooms, and teachers at all levels are encouraging students to write about nature and environmental issues. Environmental issues provide a equitable meeting place for students from a variety of different backgrounds, interests, and ideologies. There are also many pedagogical advantages to…

  15. Natural ecosystems

    USGS Publications Warehouse

    Fleishman, Erica; Belnap, Jayne; Cobb, Neil; Enquist, Carolyn A.F.; Ford, Karl; MacDonald, Glen; Pellant, Mike; Schoennagel, Tania; Schmit, Lara M.; Schwartz, Mark; van Drunick, Suzanne; Westerling, Anthony LeRoy; Keyser, Alisa; Lucas, Ryan

    2013-01-01

    Natural Ecosystems analyzes the association of observed changes in climate with changes in the geographic distributions and phenology (the timing of blossoms or migrations of birds) for Southwestern ecosystems and their species, portraying ecosystem disturbances—such as wildfires and outbreaks of forest pathogens—and carbon storage and release, in relation to climate change.

  16. Nature's Palette

    ERIC Educational Resources Information Center

    McBride, Brooke B.; Brewer, Carol A.

    2010-01-01

    Flower petals, acorn hats, exoskeletons of beetles, and lichens are just a few of the objects students may find in a surprising array of vivid colors. These tiny examples from nature's palette can be discovered in a school yard, a park, or even along the edges of a paved sidewalk...it simply takes careful observation! This article describes a…

  17. Nature Watch

    ERIC Educational Resources Information Center

    Sterling, Donna R.

    2010-01-01

    Children are naturally curious about the world in which they live. To focus this sense of wonder, have your students investigate their local habitat as it changes over the year. This multiseason study will build connections and add relevance to the habitats that children learn about. This series of activities for grades 4-6 explores the changing…

  18. Uranium, natural

    Integrated Risk Information System (IRIS)

    Uranium , natural ; CASRN 7440 - 61 - 1 Human health assessment information on a chemical substance is included in the IRIS database only after a comprehensive review of toxicity data , as outlined in the IRIS assessment development process . Sections I ( Health Hazard Assessments for Noncarcinogeni

  19. Nature's pumps

    NASA Astrophysics Data System (ADS)

    Vogel, Steven

    1994-10-01

    Although diverse in both form and function, the fluid-forcing devices in organisms have many of the capabilities and limitations of pumps of human design. Nature's pumps certainly look quite different from those of our technology, but all of them perform the same task. The author examines a few of these with an eye toward technological parallels and the two functional classes -- positive-displacement pumps and fluid-dynamic pumps.

  20. CONCURSO PBLICO PARA PROVIMENTO DE VAGAS EM CARGOS DE TECNOLOGISTA JNIOR PADRO I DA CARREIRA DE DESENVOLVIMENTO TECNOLGICO Edital 02/2014

    E-print Network

    da equação. Questão 11: ANULADA Justificativa: No nível de pressão de 700 hPa, os valores de e e es são aproximadamente 6 e 10,1 hPa, respectivamente. Deveria ser: nível de pressão de 700 hPa, os valores de e e es são aproximadamente 6 e 12,1 hPa, respectivamente. Portanto, procede o recurso, pois

  1. Naujas Lietuvos Teritorijos Vertikali?j? Žem?s Plutos Judesi? Žem?lapis

    NASA Astrophysics Data System (ADS)

    Zakarevi?ius, Algimantas; Šliaupa, Saulius; Anik?nien?, Asta

    2009-01-01

    Sudarytas naujas Lietuvos teritorijos dabartini? vertikali?j? Žem?s plutos judesi? grei?i? žem?lapis, judesiams modeliuoti taikant autori? pasi?lyt? metodik?. Metodika pagr?sta vertikali?j? judesi? reikšmi? ir teritorijos svarbiausi? georodikli? koreliacin?mis ir regresin?mis priklausomyb?mis, gautomis atlikus geodezinius matavimus. Dabartiniai vertikali?j? Žem?s plutos judesi? grei?iai Lietuvos teritorijoje yra nuo -3,5 iki +2,5 mm per metus. Intensyviausias Žem?s plutos kilimas ir didžiausia judesi? grei?i? gradient? kaita yra šiaur?s rytin?je Lietuvos dalyje, o grimzdimas - pietin?je ir pietvakarin?je srityse. Ištirtas pagal regresin? matematin? model? sudaryto žem?lapio patikimumas ir nustatyta, kad žem?lapio atitikimo pagal geodezini? matavim? rezultatus tikimyb? yra ne mažesn? nei 0,95.

  2. Natural Strain

    NASA Technical Reports Server (NTRS)

    Freed, Alan D.

    1997-01-01

    Logarithmic strain is the preferred measure of strain used by materials scientists, who typically refer to it as the "true strain." It was Nadai who gave it the name "natural strain," which seems more appropriate. This strain measure was proposed by Ludwik for the one-dimensional extension of a rod with length l. It was defined via the integral of dl/l to which Ludwik gave the name "effective specific strain." Today, it is after Hencky, who extended Ludwik's measure to three-dimensional analysis by defining logarithmic strains for the three principal directions.

  3. Natural Relaxation

    E-print Network

    Marzola, Luca

    2015-01-01

    Motivated by natural inflation, we propose a relaxation mechanism consistent with inflationary cosmology that explains the hierarchy between the electroweak scale and Planck scale. The scenario predicts the near-criticality and metastability of the standard model vacuum state, explaining the Higgs boson mass observed at the LHC. Once Majorana right-handed neutrinos are introduced to provide a viable reheating channel, our framework yields a corresponding mass scale that allows for the seesaw mechanism as well as for standard thermal leptogenesis. We also argue that considering singlet scalar dark matter extensions of the proposed scenario could solve the vacuum stability problem and discuss how the cosmological constant problem is possibly addressed.

  4. Mimicking Nature 

    E-print Network

    Wythe, Kathy

    2007-01-01

    and rivers, and the impact different water management decisions could have. ?We?re trying to mimic nature,? said Dr. Jeff Arnold, research leader and agricultural engineer for the Grassland Soil and Water Research Laboratory in Temple, part of the U....S. Department of Agriculture?s Agricultural Research Service (ARS). ?We give our best estimate of what?s going to happen. ?And SWAT?s estimation gives decision makers a tool to solve water quality problems, Arnold said. Dr. Raghavan Srinivasan, director...

  5. MAXIMUM (EM) POWER: A FOUNDATION PRINCIPLE LINKING MAN AND NATURE

    EPA Science Inventory

    The fruitfulness of H.T. Odum?s commitment to a systems-based understanding of our biosphere, its dynamics, and the potential role of humans within it is indicated by his extensive and seminal contributions to the many branches of environmental science and socioeconomic policy st...

  6. AN EM APPROACH TO MINERAL ANALYSIS USING NATURAL GAMMA RAYS

    E-print Network

    Huynh, Du

    minutes without contacting the coal or requiring the addition of sealed radioactive sources-channel analyzer, which sorts the measured gamma rays into a 1024 channel spectrum by energy. For a coal. This technique relies on strong linear correlations between concentrations of K, U and Th and ash in coal

  7. Natural Strain

    NASA Technical Reports Server (NTRS)

    Freed, Alan D.

    1995-01-01

    The purpose of this paper is to present a consistent and thorough development of the strain and strain-rate measures affiliated with Hencky. Natural measures for strain and strain-rate, as I refer to them, are first expressed in terms of of the fundamental body-metric tensors of Lodge. These strain and strain-rate measures are mixed tensor fields. They are mapped from the body to space in both the Eulerian and Lagrangian configurations, and then transformed from general to Cartesian fields. There they are compared with the various strain and strain-rate measures found in the literature. A simple Cartesian description for Hencky strain-rate in the Lagrangian state is obtained.

  8. TandEM: Titan and Enceladus mission

    USGS Publications Warehouse

    Coustenis, A.; Atreya, S.K.; Balint, T.; Brown, R.H.; Dougherty, M.K.; Ferri, F.; Fulchignoni, M.; Gautier, D.; Gowen, R.A.; Griffith, C.A.; Gurvits, L.I.; Jaumann, R.; Langevin, Y.; Leese, M.R.; Lunine, J.I.; McKay, C.P.; Moussas, X.; Muller-Wodarg, I.; Neubauer, F.; Owen, T.C.; Raulin, F.; Sittler, E.C.; Sohl, F.; Sotin, C.; Tobie, G.; Tokano, T.; Turtle, E.P.; Wahlund, J.-E.; Waite, J.H.; Baines, K.H.; Blamont, J.; Coates, A.J.; Dandouras, I.; Krimigis, T.; Lellouch, E.; Lorenz, R.D.; Morse, A.; Porco, C.C.; Hirtzig, M.; Saur, J.; Spilker, T.; Zarnecki, J.C.; Choi, E.; Achilleos, N.; Amils, R.; Annan, P.; Atkinson, D.H.; Benilan, Y.; Bertucci, C.; Bezard, B.; Bjoraker, G.L.; Blanc, M.; Boireau, L.; Bouman, J.; Cabane, M.; Capria, M.T.; Chassefiere, E.; Coll, P.; Combes, M.; Cooper, J.F.; Coradini, A.; Crary, F.; Cravens, T.; Daglis, I.A.; de Angelis, E.; De Bergh, C.; de Pater, I.; Dunford, C.; Durry, G.; Dutuit, O.; Fairbrother, D.; Flasar, F.M.; Fortes, A.D.; Frampton, R.; Fujimoto, M.; Galand, M.; Grasset, O.; Grott, M.; Haltigin, T.; Herique, A.; Hersant, F.; Hussmann, H.; Ip, W.; Johnson, R.; Kallio, E.; Kempf, S.; Knapmeyer, M.; Kofman, W.; Koop, R.; Kostiuk, T.; Krupp, N.; Kuppers, M.; Lammer, H.; Lara, L.-M.; Lavvas, P.; Le, Mouelic S.; Lebonnois, S.; Ledvina, S.; Li, J.; Livengood, T.A.; Lopes, R.M.; Lopez-Moreno, J. -J.; Luz, D.; Mahaffy, P.R.; Mall, U.; Martinez-Frias, J.; Marty, B.; McCord, T.; Salvan, C.M.; Milillo, A.; Mitchell, D.G.; Modolo, R.; Mousis, O.; Nakamura, M.; Neish, C.D.; Nixon, C.A.; Mvondo, D.N.; Orton, G.; Paetzold, M.; Pitman, J.; Pogrebenko, S.; Pollard, W.; Prieto-Ballesteros, O.; Rannou, P.; Reh, K.; Richter, L.; Robb, F.T.; Rodrigo, R.; Rodriguez, S.; Romani, P.; Bermejo, M.R.; Sarris, E.T.; Schenk, P.; Schmitt, B.; Schmitz, N.; Schulze-Makuch, D.; Schwingenschuh, K.; Selig, A.; Sicardy, B.; Soderblom, L.; Spilker, L.J.; Stam, D.; Steele, A.; Stephan, K.; Strobel, D.F.; Szego, K.; Szopa

    2009-01-01

    TandEM was proposed as an L-class (large) mission in response to ESA's Cosmic Vision 2015-2025 Call, and accepted for further studies, with the goal of exploring Titan and Enceladus. The mission concept is to perform in situ investigations of two worlds tied together by location and properties, whose remarkable natures have been partly revealed by the ongoing Cassini-Huygens mission. These bodies still hold mysteries requiring a complete exploration using a variety of vehicles and instruments. TandEM is an ambitious mission because its targets are two of the most exciting and challenging bodies in the Solar System. It is designed to build on but exceed the scientific and technological accomplishments of the Cassini-Huygens mission, exploring Titan and Enceladus in ways that are not currently possible (full close-up and in situ coverage over long periods of time). In the current mission architecture, TandEM proposes to deliver two medium-sized spacecraft to the Saturnian system. One spacecraft would be an orbiter with a large host of instruments which would perform several Enceladus flybys and deliver penetrators to its surface before going into a dedicated orbit around Titan alone, while the other spacecraft would carry the Titan in situ investigation components, i.e. a hot-air balloon (Montgolfi??re) and possibly several landing probes to be delivered through the atmosphere. ?? Springer Science + Business Media B.V. 2008.

  9. Conservation Laws and Variational Sequences in Gauge-Natural Theories

    E-print Network

    L. Fatibene; M. Francaviglia; M. Palese

    2003-11-19

    In the classical Lagrangian approach to conservation laws of gauge-natural field theories a suitable (vector) density is known to generate the so--called {\\em conserved Noether currents}. It turns out that along any section of the relevant gauge--natural bundle this density is the divergence of a skew--symmetric (tensor) density, which is called a {\\em superpotential} for the conserved currents. We describe gauge--natural superpotentials in the framework of finite order variational sequences according to Krupka. We refer to previous results of ours on {\\em variational Lie derivatives} concerning abstract versions of Noether's theorems, which are here interpreted in terms of ``horizontal'' and ``vertical'' conserved currents. The gauge--natural lift of principal automorphisms implies suitable linearity properties of the Lie derivative operator. Thus abstract results due to Kol\\'a\\v{r}, concerning the integration by parts procedure, can be applied to prove the {\\em existence} and {\\em globality} of superpotentials in a very general setting.

  10. ESPECIAO ESPONTNEA EM POPULAES ESPACIALMENTE

    E-print Network

    de Aguiar, Marcus A. M.

    público em geral. Em 1859 Charles Darwin deu passo fundamental para a solução desse problema com Charles Darwin a franchi le pas pour la solution de ce problème avec la publication de son oeuvre majeure do livro A origem das Espécies de Charles Darwin e muito se tem falado a respeito de teoria da

  11. Identified EM Earthquake Precursors

    NASA Astrophysics Data System (ADS)

    Jones, Kenneth, II; Saxton, Patrick

    2014-05-01

    Many attempts have been made to determine a sound forecasting method regarding earthquakes and warn the public in turn. Presently, the animal kingdom leads the precursor list alluding to a transmission related source. By applying the animal-based model to an electromagnetic (EM) wave model, various hypotheses were formed, but the most interesting one required the use of a magnetometer with a differing design and geometry. To date, numerous, high-end magnetometers have been in use in close proximity to fault zones for potential earthquake forecasting; however, something is still amiss. The problem still resides with what exactly is forecastable and the investigating direction of EM. After a number of custom rock experiments, two hypotheses were formed which could answer the EM wave model. The first hypothesis concerned a sufficient and continuous electron movement either by surface or penetrative flow, and the second regarded a novel approach to radio transmission. Electron flow along fracture surfaces was determined to be inadequate in creating strong EM fields, because rock has a very high electrical resistance making it a high quality insulator. Penetrative flow could not be corroborated as well, because it was discovered that rock was absorbing and confining electrons to a very thin skin depth. Radio wave transmission and detection worked with every single test administered. This hypothesis was reviewed for propagating, long-wave generation with sufficient amplitude, and the capability of penetrating solid rock. Additionally, fracture spaces, either air or ion-filled, can facilitate this concept from great depths and allow for surficial detection. A few propagating precursor signals have been detected in the field occurring with associated phases using custom-built loop antennae. Field testing was conducted in Southern California from 2006-2011, and outside the NE Texas town of Timpson in February, 2013. The antennae have mobility and observations were noted for recurrence, duration, and frequency response. At the Southern California field sites, one loop antenna was positioned for omni-directional reception and also detected a strong First Schumann Resonance; however, additional Schumann Resonances were absent. At the Timpson, TX field sites, loop antennae were positioned for directional reception, due to earthquake-induced, hydraulic fracturing activity currently conducted by the oil and gas industry. Two strong signals, one moderately strong signal, and approximately 6-8 weaker signals were detected in the immediate vicinity. The three stronger signals were mapped by a biangulation technique, followed by a triangulation technique for confirmation. This was the first antenna mapping technique ever performed for determining possible earthquake epicenters. Six and a half months later, Timpson experienced two M4 (M4.1 and M4.3) earthquakes on September 2, 2013 followed by a M2.4 earthquake three days later, all occurring at a depth of five kilometers. The Timpson earthquake activity now has a cyclical rate and a forecast was given to the proper authorities. As a result, the Southern California and Timpson, TX field results led to an improved design and construction of a third prototype antenna. With a loop antenna array, a viable communication system, and continuous monitoring, a full fracture cycle can be established and observed in real-time. In addition, field data could be reviewed quickly for assessment and lead to a much more improved earthquake forecasting capability. The EM precursors determined by this method appear to surpass all prior precursor claims, and the general public will finally receive long overdue forecasting.

  12. EMS adaptation for climate change

    NASA Astrophysics Data System (ADS)

    Pan, C.; Chang, Y.; Wen, J.; Tsai, M.

    2010-12-01

    The purpose of this study was to find an appropriate scenario of pre-hospital transportation of an emergency medical service (EMS) system for burdensome casualties resulting from extreme climate events. A case of natural catastrophic events in Taiwan, 88 wind-caused disasters, was reviewed and analyzed. A sequential-conveyance method was designed to shorten the casualty transportation time and to promote the efficiency of ambulance services. A proposed mobile emergency medical center was first constructed in a safe area, but nearby the disaster area. The Center consists of professional medical personnel who process the triage of incoming patients and take care of casualties with minor injuries. Ambulances in the Center were ready to sequentially convey the casualties with severer conditions to an assigned hospital that is distant from the disaster area for further treatment. The study suggests that if we could construct a spacious and well-equipped mobile emergency medical center, only a small portion of casualties would need to be transferred to distant hospitals. This would reduce the over-crowding problem in hospital ERs. First-line ambulances only reciprocated between the mobile emergency medical center and the disaster area, saving time and shortening the working distances. Second-line ambulances were highly regulated between the mobile emergency medical center and requested hospitals. The ambulance service of the sequential-conveyance method was found to be more efficient than the conventional method and was concluded to be more profitable and reasonable on paper in adapting to climate change. Therefore, additional practical work should be launched to collect more precise quantitative data.

  13. Natural Language Processing.

    ERIC Educational Resources Information Center

    Chowdhury, Gobinda G.

    2003-01-01

    Discusses issues related to natural language processing, including theoretical developments; natural language understanding; tools and techniques; natural language text processing systems; abstracting; information extraction; information retrieval; interfaces; software; Internet, Web, and digital library applications; machine translation for…

  14. Regulation of natural monopolies

    E-print Network

    Joskow, Paul L.

    2005-01-01

    This chapter provides a comprehensive overview of the theoretical and empirical literature on the regulation of natural monopolies. It covers alternative definitions of natural monopoly, regulatory goals, alternative ...

  15. The nature and ethics of natural experiments.

    PubMed

    Dawson, Angus; Sim, Julius

    2015-10-01

    Natural experiments are an important methodology often used to answer research questions that would, otherwise, be impossible to address, or employed because of ethical concerns about the use of randomisation to interventions that carry known risks. The UK Medical Research Council (MRC) recently produced an extremely useful document discussing the nature and significance of natural experiments within medical and public health research. In this paper, however, we suggest that the MRC document's definition of the term 'natural experiment' is insufficiently precise. In response, we offer a taxonomy of different types of natural experiments and related methods, and explore the ethical implications of these different types. We argue that while the ethical issues that may arise within natural experiments in relation to risks of harm or informed consent may differ from those within the randomised controlled trial, they are not thereby less pressing. The implications of the argument are explored and recommendations made for those involved in research governance. PMID:26187285

  16. 2002 E.M. Aboulhamid 1 Methodology

    E-print Network

    Aboulhamid, El Mostapha

    1 2002 E.M. Aboulhamid 1 Co-design Methodology and Synthesis Synthesis 2002 E.M. Aboulhamid 2 SystemC #12;2 2002 E.M. Aboulhamid 3 Introduction to SystemC 2002 E.M. Aboulhamid 4 C++ · C++ class executed #12;3 2002 E.M. Aboulhamid 5 C++ Language Standard Event-driven Simulation Events Processes Data

  17. ONDAS em MEIOS DESORDENADOS Andre Nachbin, IMPA

    E-print Network

    Liu, I-Shih

    ONDAS em MEIOS DESORDENADOS Andr´e Nachbin, IMPA Ondas em Meios Desordenados Modelos Estoc´asticos e Aplica¸c~oes,CBPF, 2007 Andr´e Nachbin IMPA http://www.impa.br/nachbin #12;ONDAS em MEIOS¸c~oes,CBPF, 2007 Andr´e Nachbin IMPA http://www.impa.br/nachbin #12;ONDAS em MEIOS DESORDENADOS Pesquisa em 3

  18. EPA LABORATORIES IMPLEMENT EMS PROGRAM

    EPA Science Inventory

    This paper highlights the breadth and magnitude of carrying out an effective Environmental Management System (EMS) program at the U.S. EPA's research and development laboratories. Federal research laboratories have unique operating challenges compared to more centralized industr...

  19. PROPERTY RIGHTS, NATURE CONSERVATION

    E-print Network

    Bateman, Ian J.

    PROPERTY RIGHTS, NATURE CONSERVATION AND LAND REFORM IN SOUTH AFRICA by Neil Adger CSERGE Working Paper GEC 95-25 #12;PROPERTY RIGHTS, NATURE CONSERVATION AND LAND REFORM IN SOUTH AFRICA by Neil Adger. In areas presently used for nature conservation, evidence is presented that nature conservation activities

  20. Geoff Brumfiel NATURE | NEWS

    E-print Network

    Geoff Brumfiel NATURE | NEWS Laser lab shifts focus to warheads US ignition facility will devote,000 pellets a minute (see Nature 483, 133­134; 2012). But unexpected The NIF's lasers blast a tiny pellet in the pellet. "Nature pushes back: that's my shorthand version of what's going on," Byer says. Nature isn

  1. Research Highlights Nature Nanotechnology

    E-print Network

    Müller, Markus

    © 2009 APS Research Highlights Nature Nanotechnology Published online: 17 July 2009 | doi:10 perfect fluid. Phys. Rev. Lett. 103, 025301 (2009). | Article |1. Nature Nanotechnology ISSN 1748 : Nature Nanotechnology http://www.nature.com/nnano/reshigh/2009/0709/full/nnano.2009.222.html 1 of 1 18

  2. SUPPLEMENTARY INFORMATION 1www.nature.com/nature

    E-print Network

    Good, Jeffrey M.

    SUPPLEMENTARY INFORMATION 1www.nature.com/nature doi: 10.1038/nature08976 ± ± #12;2www.nature.com/nature doi: 10.1038/nature08976 SUPPLEMENTARY INFORMATION #12;3www.nature.com/nature SUPPLEMENTARY INFORMATIONdoi: 10.1038/nature08976 5'-A*C*A*C*TCTTTCCCTACACGACGCTCTTCCGATCT*g*t*c*t-3' 5'-a

  3. Natural gas monthly

    SciTech Connect

    1998-01-01

    The Natural Gas Monthly highlights activities, events, and analyses of interest to public and private sector organizations associated with the natural gas industry. Volume and price data are presented each month for natural gas production, distribution, consumption, and interstate pipeline activities. Producer-related activities and underground storage data are also reported. From time to time, the Natural Gas Monthly features articles designed to assist readers in using and interpreting natural gas information.

  4. Natural and Restored Tidal Marshes Natural Marshes

    E-print Network

    Boyer, Katharyn

    processes within a salt marsh ecosystem. In addition, many diked lands have subsided to elevations too low.1. (A) Former ancient marsh channels still visible in a diked salt evaporation pond. (B) Rare plantsCONTENTS Natural and Restored Tidal Marshes Natural Marshes Restored Marshes Ecological

  5. The Nature of Natural Hazards Communication (Invited)

    NASA Astrophysics Data System (ADS)

    Kontar, Y. Y.

    2013-12-01

    Some of the many issues of interest to natural hazards professionals include the analysis of proactive approaches to the governance of risk from natural hazards and approaches to broaden the scope of public policies related to the management of risks from natural hazards, as well as including emergency and environmental management, community development and spatial planning related to natural hazards. During the talk we will present results of scientific review, analysis and synthesis, which emphasize same new trends in communication of the natural hazards theories and practices within an up-to-the-minute context of new environmental and climate change issues, new technologies, and a new focus on resiliency. The presentation is divided into five sections that focus on natural hazards communication in terms of education, risk management, public discourse, engaging the public, theoretical perspectives, and new media. It includes results of case studies and best practices. It delves into natural hazards communication theories, including diffusion, argumentation, and constructivism, to name a few. The presentation will provide information about: (1) A manual of natural hazards communication for scientists, policymakers, and media; (2) An up-to-the-minute context of environmental hazards, new technologies & political landscape; (3) A work by natural hazards scientists for geoscientists working with social scientists and communication principles; (4) A work underpinned by key natural hazards communication theories and interspersed with pragmatic solutions; (5) A work that crosses traditional natural hazards boundaries: international, interdisciplinary, theoretical/applied. We will further explore how spatial planning can contribute to risk governance by influencing the occupation of natural hazard-prone areas, and review the central role of emergency management in risk policy. The goal of this presentation is to contribute to the augmentation of the conceptual framework of risk governance and increase the awareness of practitioners and decision-makers to the need to adopt proactive policies, leading to a more integrated, participative, and adaptive governance that can respond more efficiently to the increasing uncertainty resulting from escalating natural hazards risk exposure.

  6. INTRODUCTION Nature's microbiome: introduction

    E-print Network

    INTRODUCTION Nature's microbiome: introduction JACOB A. RUSSELL,* NICOLE DUBILIER and JENNIFER A of New Mexico, Albuquerque, NM 87131, USA Keywords: metagenomics, microbiome, next generation sequencing). But outside this field, nature's microbiome--the communities of microbes colonizing host eukaryotes (Lederberg

  7. Natural Gas Monthly

    EIA Publications

    2015-01-01

    Highlights activities, events, and analyses associated with the natural gas industry. Volume and price data are presented each month for natural gas production, distribution, consumption, and interstate pipeline activities. Producer related activities and underground storage data are also reported.

  8. Colours From Nature

    ERIC Educational Resources Information Center

    Simon, Wilma

    1974-01-01

    In reference to American Indian ceremonial art, the importance of using natural pigments is emphasized, since the superior color values of natural dyes better reflect religious and philosophical depth and meaning. (JC)

  9. Perceptions of the natural

    E-print Network

    Filipovic, Renata, 1973-

    2005-01-01

    This thesis takes on the difficulty of defining a clear line that connects and separates natural and artificial in a contemporary landscape. It is a proposal for a park that addresses the image and understanding of nature. ...

  10. Natural Gas Flare

    USGS Multimedia Gallery

    A natural gas flare. Sometimes, often due to lack of transportation or storage capacity, natural gas that is co-produced with oil will be burned in a flare. This wellpad is in the Tuscaloosa Marine Shale....

  11. Fine Arts through Nature.

    ERIC Educational Resources Information Center

    Gentry, Carol

    1986-01-01

    Describes how high school students are involved in using natural materials found in the local environment for art projects. The materials used include wood, clay, and natural fibers. Provides photographs of ten students' projects. (JDH)

  12. Natural gas annual 1996

    SciTech Connect

    1997-09-01

    This document provides information on the supply and disposition of natural gas to a wide audience. The 1996 data are presented in a sequence that follows natural gas from it`s production to it`s end use.

  13. Nature/Culture/Seawater

    E-print Network

    Helmreich, Stefan

    This essay considers seawater as a substance and symbol in anthropological and social theory. Seawater has occupied an ambiguous place with respect to anthropological categories of nature and culture. Seawater as nature ...

  14. Natural gas annual 1994

    SciTech Connect

    1995-11-17

    The Natural Gas Annual provides information on the supply and disposition of natural gas to a wide audience including industry, consumers, Federal and State agencies, and educational institutions. The 1994 data are presented in a sequence that follows natural gas (including supplemental supplies) from its production to its end use. This is followed by tables summarizing natural gas supply and disposition from 1990 to 1994 for each Census Division and each State. Annual historical data are shown at the national level.

  15. Natural gas annual 1995

    SciTech Connect

    1996-11-01

    The Natural Gas Annual provides information on the supply and disposition of natural gas to a wide audience including industry, consumers, Federal and State agencies, and educational institutions. The 1995 data are presented in a sequence that follows natural gas (including supplemental supplies) from its production to its end use. This is followed by tables summarizing natural gas supply and disposition from 1991 to 1995 for each Census Division and each State. Annual historical data are shown at the national level.

  16. Nature's Nature: Ideas of Nature in Curricula for Environmental Education

    ERIC Educational Resources Information Center

    St Maurice, Henry

    2006-01-01

    Two contrasting sets of ideas about nature in environmental education are described. An analytical framework is developed from inter-disciplinary histories of ideas and used in evaluating a specific curriculum. In conclusion, some general implications are suggested for curricula in environmental education. [This article was reprinted from…

  17. Nature in the City.

    ERIC Educational Resources Information Center

    Ferbert, Mary Lou

    1981-01-01

    Describes a science program developed by the Cleveland Museum of Natural History, "Nature in the City," in which students and teachers learn together about the natural community surrounding their school. Includes program's rationale, list of "adventures," and methods. Discusses strategies of Sherlock Holmes'"adventure" focusing on animal tracks…

  18. Reconnecting with Nature.

    ERIC Educational Resources Information Center

    Cohen, Michael J.; And Others

    Earth and its people are at risk. This book empowers anyone to personally deal with being at risk, with destructive personal stress, and environmental trauma. It shows how to let nature place its wisdom into one's thinking and overcome society's separation from nature. It lets nature itself teach us how it works and how to participate in its…

  19. Fifth Conference Natural Language

    E-print Network

    Fifth Conference on Applied Natural Language Processing Association for Computational Linguistics natural language analyzers and generators. Our tool kit is slowly growing -- adding, in particular didn't understand about natural language. But we are also learning to make better use of the tools we

  20. Renewable Natural Gas (Biomethane)

    E-print Network

    California at Davis, University of

    Renewable Natural Gas (Biomethane) #12;Critical Barriers Impeding RNG as a Transportation Fuel-founder of Coalition for Renewable Natural Gas · Major equity holder and manager of group of companies that cost engines. #12;Coalition for Renewable Natural Gas Non-Profit Organization (501 c 6) ­ Founded in 2011

  1. Bryce Canyon Natural Bridge

    USGS Multimedia Gallery

    The Bryce Canyon Natural Bridge. Technically, this is not a natural bridge, which forms when running water erodes a tunnel into a rock formation. Instead, this is a natural arch, similar to the ones in nearby Arches National Park. Bryce Canyon is a unique sandstone formation in southern Utah. It is...

  2. Learning in Nature

    ERIC Educational Resources Information Center

    Brody, Michael

    2005-01-01

    This paper traces the evolution of a theory of learning in nature in order to explain how people learn in natural settings. The intellectual roots of the theory in informal learning, cognition, affective development, experiential and meaningful learning are described and the synthesis into a comprehensive theory of learning in nature are…

  3. Capturing Nature's Diversity

    PubMed Central

    Pascolutti, Mauro; Campitelli, Marc; Nguyen, Bao; Pham, Ngoc; Gorse, Alain-Dominique; Quinn, Ronald J.

    2015-01-01

    Natural products are universally recognized to contribute valuable chemical diversity to the design of molecular screening libraries. The analysis undertaken in this work, provides a foundation for the generation of fragment screening libraries that capture the diverse range of molecular recognition building blocks embedded within natural products. Physicochemical properties were used to select fragment-sized natural products from a database of known natural products (Dictionary of Natural Products). PCA analysis was used to illustrate the positioning of the fragment subset within the property space of the non-fragment sized natural products in the dataset. Structural diversity was analysed by three distinct methods: atom function analysis, using pharmacophore fingerprints, atom type analysis, using radial fingerprints, and scaffold analysis. Small pharmacophore triplets, representing the range of chemical features present in natural products that are capable of engaging in molecular interactions with small, contiguous areas of protein binding surfaces, were analysed. We demonstrate that fragment-sized natural products capture more than half of the small pharmacophore triplet diversity observed in non fragment-sized natural product datasets. Atom type analysis using radial fingerprints was represented by a self-organizing map. We examined the structural diversity of non-flat fragment-sized natural product scaffolds, rich in sp3 configured centres. From these results we demonstrate that 2-ring fragment-sized natural products effectively balance the opposing characteristics of minimal complexity and broad structural diversity when compared to the larger, more complex fragment-like natural products. These naturally-derived fragments could be used as the starting point for the generation of a highly diverse library with the scope for further medicinal chemistry elaboration due to their minimal structural complexity. This study highlights the possibility to capture a high proportion of the individual molecular interaction motifs embedded within natural products using a fragment screening library spanning 422 structural clusters and comprised of approximately 2800 natural products. PMID:25902039

  4. Neskelbti Tarpukario Lietuvos Topografiniai Žem?lapiai

    NASA Astrophysics Data System (ADS)

    Girkus, Romualdas; Lukoševi?ius, Viktoras

    2008-09-01

    Nemaža publikacij? apie tarpukario Lietuvos teritorijos topografin? kartografavim? teikia tapa?i? informacij?, kad iki Antrojo pasaulinio karo pradžios sp?ta išleisti 92 M 1:25 000 ir 44 M 1:100 000 žem?lapius. Straipsnyje nagrin?jami 1920-1940 m. laikotarpiu sudaryti neskelbti ?vairi? Lietuvos teritorijos dali? topografiniai žem?lapiai: Var?nos artilerijos poligono M 1:25 000 žem?lapis (1925 m.), Gaiži?n? karinio poligono M 1:100 000 (1930 m. ?) ir M 1:50 000 (1932 m.) žem?lapiai, Kauno ?gulos šaudyklos M 1:10 000 žem?lapis (1933 m.), Pabrad?s karinio poligono M 1:25 000 žem?lapis (1940 m.), ŠVENTOJI - DARB?NAI M 1:100 000 žem?lapis (1939 m. ?). Iliustracijose pateikiami žem?lapi? fragmentai.

  5. Populações estelares em galáxias HII

    NASA Astrophysics Data System (ADS)

    Westera, P.; Cuisinier, F.; Telles, E.; Kehrig, C.

    2003-08-01

    Analisamos o conteúdo estelar de 74 galáxias HII a partir do contínuo observado nos espectros ópticos dessas galáxias, utilizando métodos de síntese de população estelar. Descobrimos que todas as galáxias para as quais encontramos soluções contêm uma população estelar velha que domina a massa estelar, e numa maioria dessas também encontramos evidência de uma população de idade intermediaria além da geração jovem que está se formando agora. Concluímos que a formação estelar dessas galáxias se realiza em surtos individuais, Esses surtos são interrompidos por longos períodos de inatividade, com os primeiros consumindo a maior parte do gás. Sugerimos, portanto, que as galáxias HII sejam galáxias anãs normais flagradas em um período de surto.

  6. REGIMENTO DO CURSO DE PS-GRADUAO EM ENGENHARIA E TECNOLOGIA ESPACIAIS, REA DE CONCENTRAO EM

    E-print Network

    REGIMENTO DO CURSO DE PÓS-GRADUAÇÃO EM ENGENHARIA E TECNOLOGIA ESPACIAIS, ÁREA DE CONCENTRAÇÂO EM COMBUSTÃO E PROPULSÃO TÍTULO I DOS OBJETIVOS DO CURSO Art. 1o ­ A Área de Concentração em Combustão e Propulsão (PCP) do Curso de Pós-graduação em Engenharia e Tecnologia Espaciais (ETE) objetiva formar e

  7. Breastfeeding: Nature’s Safety Net

    PubMed Central

    Ghousia, S; Konde, Sapna; Raj, Sunil

    2012-01-01

    ABSTRACT Breastfeeding is a natural safety-net for the first few months in order to give the child a fairer start to life. The American Academy of Pediatric Dentistry recognizes the distinct nutritional advantages of human milk for infants and endorsed the position of the American Academy of Pediatrics on the promotion of breastfeeding. It therefore calls for increase in need to negotiate the roles and responsibilities of pediatric dentists to eliminate the existing gaps in preventive care and anticipatory guidance. The objective of this evidence-based review is to explore the beneficial roles of breastfeeding in orofacial growth and development and endorse the same through anticipatory guidance. How to cite this article: Agarwal M, Ghousia S, Konde S, Raj S. Breastfeeding: Nature’s Safety Net. Int J Clin Pediatr Dent 2012;5(1):49-53. PMID:25206134

  8. The European Mobile System (EMS)

    NASA Technical Reports Server (NTRS)

    Jongejans, A.; Rogard, R.; Mistretta, I.; Ananasso, F.

    1993-01-01

    The European Space Agency is presently procuring an L band payload in order to promote a regional European L band system coping with the specific needs of the European market. The payload, and the two communications systems to be supported, are described below. The potential market for EMS in Europe is discussed.

  9. Alveolar Echinococcosis: Characterization of Diagnostic Antigen Em18 and Serological Evaluation of Recombinant Em18

    PubMed Central

    Sako, Yasuhito; Nakao, Minoru; Nakaya, Kazuhiro; Yamasaki, Hiroshi; Gottstein, Bruno; Lightowers, Marshall W.; Schantz, Peter M.; Ito, Akira

    2002-01-01

    The Echinococcus multilocularis protein Em18 is one of the most promising antigens for use in serodiagnosis of alveolar echinococcosis in human patients. Here we identify an antigenic relationship between Em18 and a 65-kDa immunodominant E. multilocularis surface protein previously identified as either EM10 or EmII/3. The NH2-terminal sequence of native Em18 was determined, revealing it to be a fragment of EM10. Experiments were undertaken to investigate the effect of proteinase inhibitors on the degradation of EM10 in crude extracts of E. multilocularis protoscoleces. Em18 was found to be the product of degradation of EM10 by cysteine proteinase. A recombinant Em18 (RecEm18, derived from 349K to 508K of EM10) was successfully expressed by using Escherichia coli expression system and then evaluated for use in serodiagnosis of alveolar echinococcosis. RecEm18 was recognized by 27 (87.1%) and 28 (90.3%) of 31 serum samples from clinically and/or pathologically confirmed alveolar echinococcosis patients by enzyme-linked immunosorbent assay and immunoblotting, respectively. Of 33 serum samples from cystic echinococcosis patients, 1 was recorded as having a weak positive reaction to RecEm18; however, none of the serum samples which were tested from neurocysticercosis patients (n = 10) or healthy people (n = 15) showed positive reactions. RecEm18 has the potential for use in the differential serodiagnosis of alveolar echinococcosis. PMID:12149326

  10. NATURE.COM/NATURE 2 February 2012

    E-print Network

    Buehler, Markus J.

    32 MICROBIOLOGY RESISTANCE FIGHTERS The rocky road to an MRSA vaccine PAGE23 HIDDEN STRENGTHNonlinear failure of spider silk is secret of its success PAGE72 THE INTERNATIONAL WEEKLY JOURNAL OF SCIENCE #12;LETTER doi:10.1038/nature10739 Nonlinear material behaviour of spider silk yields robust webs Steven W

  11. Nature, Education, and the Natural Woman

    ERIC Educational Resources Information Center

    Miller, Peter J.

    1974-01-01

    An examination of 18th and 19th century naturalistic educational theory reveals that appeals to nature confirmed and strengthened contemporary attitudes and practices restricting woman's access to knowledge and her freedom to make decisions and to act. (Author/DW)

  12. Natural vacuum electronics

    NASA Technical Reports Server (NTRS)

    Leggett, Nickolaus

    1990-01-01

    The ambient natural vacuum of space is proposed as a basis for electron valves. Each valve is an electron controlling structure similiar to a vacuum tube that is operated without a vacuum sustaining envelope. The natural vacuum electron valves discussed offer a viable substitute for solid state devices. The natural vacuum valve is highly resistant to ionizing radiation, system generated electromagnetic pulse, current transients, and direct exposure to space conditions.

  13. Natural gas annual 1997

    SciTech Connect

    1998-10-01

    The Natural Gas Annual provides information on the supply and disposition of natural gas to a wide audience including industry, consumers, Federal and State agencies, and educational institutions. The 1997 data are presented in a sequence that follows natural gas (including supplemental supplies) from its production to its end use. This is followed by tables summarizing natural gas supply and disposition from 1993 to 1997 for each Census Division and each State. Annual historical data are shown at the national level. 27 figs., 109 tabs.

  14. Natural Cooling Retrofit 

    E-print Network

    Fenster, L. C.; Grantier, A. J.

    1981-01-01

    chilled water, but not with 42 degree chi lIed water. The following is a description of three meth ods of water-side Natural Cool ing: Tower Water Injection, Heat Exchanger, and C:entrifugal Natural Cool ing. TOWER WATER INJECTION Tower Water... Injection Cool ing is a method of providing natural cool ing by injecting condenser water from a cool ing tower directly into a chilled water system, as dictated by outdoor air wet bulb temperature (see Figure V). Tower Water Injection Natural Cool ing...

  15. SUPPLEMENTARY INFORMATION 1www.nature.com/nature

    E-print Network

    Kirchner, James W.

    SUPPLEMENTARY INFORMATION 1www.nature.com/nature doi: 10.1038/nature08174 University of California applicable. 60 80 100 120 140 160 180 200 Valleyspacing(m) x = 8 m x = 4 m x = 2 m #12;2www.nature.com/nature doi: 10.1038/nature08174 SUPPLEMENTARY INFORMATION experiments, like that summarized in Fig. S1

  16. Nature of Science Is...

    ERIC Educational Resources Information Center

    Lederman, Judith Sweeney; Lederman, Norman G.

    2005-01-01

    The phrase "nature of science" refers to the characteristics of scientific knowledge that necessarily result from the scientific investigations that scientists conduct to develop knowledge. Yet, these characteristics are assumed by many to be "difficult" to teach. Not so. Many important aspects of nature of science can be directly linked to…

  17. Introduction to Exploring Nature

    ERIC Educational Resources Information Center

    Early Childhood Today, 2006

    2006-01-01

    Children are fascinated with the world of nature. From the tiniest of seeds to the highest of birds, they wonder "Why?" "How?" and "What can I do with it?" This paper provides intriguing nature activities that provide a solid starting point for expanding children's thinking and learning. Through these activities, children will be building skills…

  18. Nature Foil Reliefs

    ERIC Educational Resources Information Center

    Lane, Shaw J.

    2012-01-01

    Nature has always been a source of inspiration for artists across the centuries. Artists such as Leonardo da Vinci, Georgia O'Keeffe, Ansel Adams, and Andy Goldsworthy all drew inspiration for their work from nature. Seeds come from the dried pods, which when planted and cared for, bear fruit. In this article, the author describes how her…

  19. CONNECTICUT NATURAL DIVERSITY DATABASE

    EPA Science Inventory

    This is a statewide datalayer at 1:24,000 scale of general areas of concern with regards to state and federally listed Endangered, Threatened, and Special Concern species and significant natural communities. Locations of species and natural communities are based on data collecte...

  20. On Teaching Natural Law.

    ERIC Educational Resources Information Center

    Forte, David F.

    1978-01-01

    A brief look at Columbia, Harvard, and Notre Dame law schools shows that the American tradition in teaching natural law has not been strong. The value of teaching natural law is discussed, a separate course or seminar is seen as the most effective option, and a selection of available sources for such a course is appended. (JMD)

  1. Modeling Natural Selection

    ERIC Educational Resources Information Center

    Bogiages, Christopher A.; Lotter, Christine

    2011-01-01

    In their research, scientists generate, test, and modify scientific models. These models can be shared with others and demonstrate a scientist's understanding of how the natural world works. Similarly, students can generate and modify models to gain a better understanding of the content, process, and nature of science (Kenyon, Schwarz, and Hug…

  2. Bryce Canyon Natural Bridge

    USGS Multimedia Gallery

    Bryce Canyon's Natural Bridge is technically a natural arch, similar to those in the nearby Arches National Park. Bryce Canyon is a unique sandstone formation in southern Utah. It is home to a large number of hoodoos, which are oddly shaped pillars of rock that formed due to different erosion rates...

  3. NATURAL MARINE HYDROCARBON SEEPAGE

    E-print Network

    Luyendyk, Bruce

    NATURAL MARINE HYDROCARBON SEEPAGE Hydrocarbon seepage from the world's conti- nental shelves in the environment (Hovland et al., 1993; Hornafius et al., 1999). Natural marine hydrocarbon seeps offshore of Coal of gaseous hydrocarbons (Killus and Moore, 1991; Cynar andYayanos, 1992) and residual asphaltic hydro

  4. Nature Experience and Education

    ERIC Educational Resources Information Center

    Rathunde, Kevin

    2013-01-01

    Kevin Rathunde turns his research lens to the task of finding out the relevance of the natural world, its impact on adolescent motivation, and its positive sustaining of concentration and focus. He cites "disembodiment and denaturing" as needing to be countered by contact with nature, leading to higher creativity, less drudgery, and more…

  5. Contaminants in Naturally Ventilated

    E-print Network

    Politècnica de Catalunya, Universitat

    a natural ventilation/flushing Volcanic Magma Chambers Deep Ocean Recirculation Basins Lakes Buildings (My;Displacement Ventilation An air distribution system in which incoming air originates at floor level and risesContaminants in Naturally Ventilated Closed Spaces Diogo Bolster #12;Outline Motivation Modelling

  6. Birds. Nature Discovery I.

    ERIC Educational Resources Information Center

    Stone, Sally F.

    The birds of New England and their particular habitats are explored in this guide which is part of a series of Nature Discovery publications. The materials are designed to directly supplement the natural science curricula and to complement other subject areas including social studies, language arts, music, and art. The program is designed for…

  7. Nature's Advice Book

    ERIC Educational Resources Information Center

    Mahlin, Kathryn; Robertson, Amy

    2005-01-01

    What do can people learn from the world around them? Can a tree really teach something about life? Many times teachers provide students with facts about nature but fail to consider what one can learn from the natural world around them. After many months of exploring various ecosystems such as the prairie, rain forest, and desert, one of the…

  8. Sketching in Nature

    ERIC Educational Resources Information Center

    Hobart, April

    2005-01-01

    Nature journaling is a useful skill for science students, independent of whether they also consider themselves artists. A pencil and sketchbook can be carried anywhere to record ecological information in many ways. A traditional page in a nature journal may consist of quick studies of plant and animal life sketched out as rudimentary line drawings…

  9. Naturalness Under Stress

    E-print Network

    Dine, Michael

    2015-01-01

    Naturalness has for many years been a guiding principle in the search for physics beyond the Standard Model, particularly for understanding the physics of electroweak symmetry breaking. However, the discovery of the Higgs particle at 125 GeV, accompanied by exclusion of many types of new physics expected in natural models has called the principle into question. In addition, apart from the scale of weak interactions, there are other quantities in nature which appear unnaturally small and for which we have no proposal for a natural explanation.We first review the principle, and then discuss some of the conjectures which it has spawned. We then turn to some of the challenges to the naturalness idea and consider alternatives.

  10. Naturalness Under Stress

    E-print Network

    Michael Dine

    2015-01-08

    Naturalness has for many years been a guiding principle in the search for physics beyond the Standard Model, particularly for understanding the physics of electroweak symmetry breaking. However, the discovery of the Higgs particle at 125 GeV, accompanied by exclusion of many types of new physics expected in natural models has called the principle into question. In addition, apart from the scale of weak interactions, there are other quantities in nature which appear unnaturally small and for which we have no proposal for a natural explanation.We first review the principle, and then discuss some of the conjectures which it has spawned. We then turn to some of the challenges to the naturalness idea and consider alternatives.

  11. Naturalness Under Stress

    NASA Astrophysics Data System (ADS)

    Dine, Michael

    2015-10-01

    Naturalness has for many years been a guiding principle in the search for physics beyond the Standard Model, particularly for understanding the physics of electroweak symmetry breaking. However, the discovery of the Higgs particle at 125 GeV, accompanied by the exclusion of many types of new physics expected in natural models, has called the principle into question. In addition, apart from the scale of weak interactions, there are other quantities in nature that appear unnaturally small and for which we have no proposal for a natural explanation. I first review the principle, then discuss some of the conjectures it has spawned. I then turn to some of the challenges to the naturalness idea and consider alternatives.

  12. Thermoacoustic natural gas liquefier

    SciTech Connect

    Swift, G.; Gardner, D.; Hayden, M.; Radebaugh, R.; Wollan, J.

    1996-07-01

    This is the final report of a two-year, Laboratory-Directed Research and Development (LDRD) project at the Los Alamos National Laboratory (LANL). This project sought to develop a natural-gas-powered natural-gas liquefier that has absolutely no moving parts and requires no electrical power. It should have high efficiency, remarkable reliability, and low cost. The thermoacoustic natural-gas liquefier (TANGL) is based on our recent invention of the first no-moving-parts cryogenic refrigerator. In short, our invention uses acoustic phenomena to produce refrigeration from heat, with no moving parts. The required apparatus comprises nothing more than heat exchangers and pipes, made of common materials, without exacting tolerances. Its initial experimental success in a small size lead us to propose a more ambitious application: large-energy liquefaction of natural gas, using combustion of natural gas as the energy source. TANGL was designed to be maintenance-free, inexpensive, portable, and environmentally benign.

  13. Naturalness Under Stress

    NASA Astrophysics Data System (ADS)

    Dine, Michael

    2015-11-01

    Naturalness has for many years been a guiding principle in the search for physics beyond the Standard Model, particularly for understanding the physics of electroweak symmetry breaking. However, the discovery of the Higgs particle at 125 GeV, accompanied by exclusion of many types of new physics expected in natural models has called the principle into question. In addition, apart from the scale of weak interactions, there are other quantities in nature which appear unnaturally small and for which we have no proposal for a natural explanation.We first review the principle, and then discuss some of the conjectures which it has spawned. We then turn to some of the challenges to the naturalness idea and consider alternatives.

  14. Naturally occurring insecticides.

    PubMed Central

    Soloway, S B

    1976-01-01

    Naturally occurring insecticides are abundant and varied in their effects, though but a few are articles of commerce. Even for these, pyrethrum, nicotine, rotenone, hellebore, ryania, and sabadilla, there is a paucity of information on mammalian toxicology and environmental effects. In general, these materials are characterized favorably by low acute toxicity and ready dissipation in nature. Unfavorable aspects of natural insecticides are the contained mixture of active and inactive components and the low active ingredient content on a crop yield basis pointing to a high unit cost. Natural insecticides can serve additionally as leads to unnatural mimics, of which the commercially successful synthetic pyrethroids are prime examples. The chemical nature, relationship of insecticidal activity to chemical structure, occurrence, production, and utilization, registered uses, metabolism, and insect and mammalian toxicity are reviewed. PMID:789058

  15. Nature Publishing Group Site Licenses

    E-print Network

    Kaski, Samuel

    Nature Publishing Group Site Licenses Nature Publishing Group Site Licenses NATURE PUBLISHING GROUP SITE LICENSES Nature Publishing Group Bilimsel ve tibbi mükemmeliyet Palgrave Macmillan Journals Sosyal düzeyleri Esnek içerik www.nature.com/libraries #12;Nature Publishing Group The American Journal

  16. letters to nature 440 NATURE |VOL 405 |25 MAY 2000 |www.nature.com

    E-print Network

    Daniel, Rosenfeld

    was supported in part by the Natural Sciences and Engineering Research Council of Canada, Photonics Researchletters to nature 440 NATURE |VOL 405 |25 MAY 2000 |www.nature.com Acknowledgements This work

  17. Discussions about the Nature of Science in a Course on the History of Astronomy. (Spanish Title: Discusiones sobre la Naturaleza de la Ciencia en un Curso sobre Historia de la Astronomía.) Discussões sobre a Natureza da Ciência em um Curso sobre a História da Astronomia

    NASA Astrophysics Data System (ADS)

    Pires de Andrade, Victória Flório; L'Astorina, Bruno

    2010-07-01

    There are an increasing number of researches in science education that affirm the importance of discussions on the "nature of science" in basic education level as well as in teacher training. The history of science applied to education is a way to contextualize epistemological discussions, allowing both the understanding of scientific content and learning about science concepts. We present some reasonably consensual definitions on the nature of science that have been widely discussed by the academic community. We show also some episodes in the history of astronomy which can lead to discussions involving some aspects of the nature of science, and how they can do it. Hay un número creciente de investigaciones en la enseñanza de las ciencias que afirman la importancia de debates sobre la "naturaleza de la ciencia" en la educación básica y formación del profesorado. La historia de la ciencia aplicada a la educación es una manera de contextualizar los debates de la epistemología, lo que permite tanto la comprensión de los contenidos científicos como el aprendizaje de conceptos científicos. En esto trabajo, presentamos algunas definiciones bastante consensuales sobre la naturaleza de la ciencia que han sido ampliamente discutidas por la comunidad académica y mostramos cómo algunos episodios en la historia de la astronomía pueden llevar a discusiones sobre algunos aspectos de la naturaleza de la ciencia. Há um número crescente de pesquisas na área de ensino de ciências que afirmam a importância de discussões sobre a "natureza da ciência" na educação básica e na formação de professores. A história da ciência aplicada ao ensino é uma maneira de contextualizar discussões epistemológicas, permitindo tanto a compreensão de conteúdos científicos quanto o aprendizado de noções sobre as ciências. Neste trabalho apresentamos algumas definições razoavelmente consensuais sobre a natureza da ciência que foram amplamente discutidas pela comunidade acadêmica e mostramos como alguns episódios da história da astronomia podem levar a discussões envolvendo alguns dos aspectos da natureza da ciência.

  18. Natural antimicrobials in pregnancy 

    E-print Network

    Stock, Sarah J.E.

    2008-01-01

    Natural antimicrobials are peptides that are essential components of the innate immune system, providing broad-spectrum protection against bacteria, yeasts and some viruses. In addition to their innate immune activity, ...

  19. Naturalism and Causal Explanation 

    E-print Network

    Toribio, Josefa

    1999-01-01

    Semantic properties are not commonly held to be part of the basic ontological furniture of the world. Consequently, we confront a problem: how to 'naturalize' semantics so as to reveal these properties in their true ...

  20. The "Natural Law Tradition."

    ERIC Educational Resources Information Center

    Finnis, John

    1986-01-01

    A discussion of natural law outlines some of the theory and tradition surrounding it and examines its relationship to the social science and legal curriculum and to the teaching of jurisprudence. (MSE)

  1. Automatic natural language parsing

    SciTech Connect

    Sprack-Jones, K.; Wilks, Y.

    1985-01-01

    This collection of papers on automatic natural language parsing examines research and development in language processing over the past decade. It focuses on current trends toward a phrase structure grammar and deterministic parsing.

  2. Natural family planning.

    PubMed

    Smoley, Brian A; Robinson, Christa M

    2012-11-15

    Natural family planning methods provide a unique option for committed couples. Advantages include the lack of medical adverse effects and the opportunity for participants to learn about reproduction. Modern methods of natural family planning involve observation of biologic markers to identify fertile days in a woman's reproductive cycle. The timing of intercourse can be planned to achieve or avoid pregnancy based on the identified fertile period. The current evidence for effectiveness of natural family planning methods is limited to lower-quality clinical trials without control groups. Nevertheless, perfect use of these methods is reported to be at least 95 percent effective in preventing pregnancy. The effectiveness of typical use is 76 percent, which demonstrates that motivation and commitment to the method are essential for success. Depending on the method, couples can learn about natural family planning methods in a single office visit, through online instruction, or from certified instructors. PMID:23157145

  3. Natural drinking strategies

    E-print Network

    Kim, Wonjung

    We examine the fluid mechanics of drinking in nature. We classify the drinking strategies of a broad range of creatures according to the principal forces involved, and present physical pictures for each style. Simple scaling ...

  4. Natural lighting and skylights 

    E-print Network

    Evans, Benjamin Hampton

    1961-01-01

    There are many physiological and psychological factors which enter into the proper design of space for human occupancy. One of these elements is light. Both natural light and manufactured light are basic tools with which any designer must work...

  5. Natural Family Planning

    MedlinePLUS

    ... ovaries releases an egg. This process is called ovulation. The egg moves toward the uterus through the ... intercourse takes place just before or just after ovulation. How does natural family planning work? Two methods ...

  6. Natural gas monthly

    SciTech Connect

    1996-05-01

    This document highlights activities, events, and analyses of interest to public and private sector organizations associated with the natural gas industry. Data presented include volume and price, production, consumption, underground storage, and interstate pipeline activities.

  7. Natural and accelerated bioremediation research program plan

    SciTech Connect

    1995-09-01

    This draft plan describes a ten-year program to develop the scientific understanding needed to harness and develop natural and enhanced biogeochemical processes to bioremediate contaminated soils, sediments and groundwater at DOE facilities. The Office of Health and Environmental Research (OHER) developed this program plan, with advice and assistance from DOE`s Office of Environmental Management (EM). The program builds on OHER`s tradition of sponsoring fundamental research in the life and environmental sciences and was motivated by OHER`s and Office of Energy Research`s (OER`s) commitment to supporting DOE`s environmental management mission and the belief that bioremediation is an important part of the solution to DOE`s environmental problems.

  8. Lesson "Balance in Nature

    NASA Astrophysics Data System (ADS)

    Chapanova, V.

    2012-04-01

    Lesson "Balance in Nature" This simulation game-lesson (Balance in Nature) gives an opportunity for the students to show creativity, work independently, and to create models and ideas. It creates future-oriented thought connected to their experience, allowing them to propose solutions for global problems and personal responsibility for their activities. The class is divided in two teams. Each team chooses questions. 1. Question: Pollution in the environment. 2. Question: Care for nature and climate. The teams work on the chosen tasks. They make drafts, notes and formulate their solutions on small pieces of paper, explaining the impact on nature and society. They express their points of view using many different opinions. This generates alternative thoughts and results in creative solutions. With the new knowledge and positive behaviour defined, everybody realizes that they can do something positive towards nature and climate problems and the importance of individuals for solving global problems is evident. Our main goal is to recover the ecological balance, and everybody explains his or her own well-grounded opinions. In this work process the students obtain knowledge, skills and more responsible behaviour. This process, based on his or her own experience, dialogue and teamwork, helps the participant's self-development. Making the model "human? nature" expresses how human activities impact the natural Earth and how these impacts in turn affect society. Taking personal responsibility, we can reduce global warming and help the Earth. By helping nature we help ourselves. Teacher: Veselina Boycheva-Chapanova " Saint Patriarch Evtimii" Scholl Str. "Ivan Vazov"-19 Plovdiv Bulgaria

  9. Second variational derivative of gauge-natural invariant Lagrangians and conservation laws

    E-print Network

    M. Francaviglia; M. Palese; E. Winterroth

    2005-06-15

    We consider the second variational derivative of a given gauge-natural invariant Lagrangian taken with respect to (prolongations of) vertical parts of gauge-natural lifts of infinitesimal principal automorphisms. By requiring such a second variational derivative to vanish, {\\em via} the Second Noether Theorem we find that a covariant strongly conserved current is canonically associated with the deformed Lagrangian obtained by contracting Euler--Lagrange equations of the original Lagrangian with (prolongations of) vertical parts of gauge-natural lifts of infinitesimal principal automorphisms lying in the kernel of the generalized gauge-natural Jacobi morphism.

  10. NATURE CHEMISTRY | www.nature.com/naturechemistry 1 SUPPLEMENTARY INFORMATION

    E-print Network

    Hergenrother, Paul J.

    NATURE CHEMISTRY | www.nature.com/naturechemistry 1 SUPPLEMENTARY INFORMATION DOI: 10.1038/NCHEM compounds from natural products Robert W. Huigens III, Karen C. Morrison, Robert W. Hicklin, Timothy A Publishers Limited. All rights reserved. #12;NATURE CHEMISTRY | www.nature.com/naturechemistry 2

  11. Nature Macmillan Publishers Ltd 1997 letters to nature

    E-print Network

    Toomey, Doug

    Nature © Macmillan Publishers Ltd 1997 letters to nature NATURE |VOL 388 |17 JULY 1997 259 behaves cannot be made at present. Although the one- dimensional nature of the SWNTs is expected to alter the nature of the continuum excitations, the T 300 K BWF frequency q0 of 1,567 cm-1 (Rb) and 1,565 cm-1 (K

  12. Nature Tables: Stimulating Children's Interest in Natural Objects

    ERIC Educational Resources Information Center

    Tomkins, Stephen; Tunnicliffe, Sue Dale

    2007-01-01

    Primary school pupils in the UK today may be less familiar with natural objects, less exposed to formal natural history teaching and have less time given to school-based observation and discussion of natural objects. This study of children's responses to a "Nature Table" of displayed natural objects was designed to assess pupils' knowledge of…

  13. Lietuvos teritorijos žem?s plutos deformacij? ir seismotektoninio potencialo ryšys

    NASA Astrophysics Data System (ADS)

    Zakarevi?ius, Algimantas; Stanionis, Arminas; Levinskait?, Daiva

    2010-01-01

    Lietuvoje yra statini?, kelian?i? ekologinio pavojaus gr?sm? (Ignalinos atomin? elektrin?, Mažeiki? naftos perdirbimo ?mon?, chemijos gamyklos Jonavoje bei K?dainiuose ir pan.). Seisminiai ?vykiai gali sutrikdyti ši? ?moni? veikl? ir net lemti didel? pavoj? aplinkai, t. y. gali b?ti sukelta didel? aplinkos tarša chemin?mis bei radioaktyviosiomis medžiagomis. Seisminius ?vykius lemia teritorijos seismotektoninis potencialas. Seismotektoninis potencialas ir Žem?s plutos deformacijos yra tarpusavyje susij? rei\\vskiniai, kuriuos sukelia dažnai tie patys giluminiai procesai Žem?s gelm?se. Žem?s plutos deformacij? tyrimas yra vienas iš informacijos šaltini? prognozuojant teritorijos seismotektonin? aktyvum?. Straipsnyje nagrin?jamos Žem?s plutos horizontaliosios deformacijos, nustatomi Žem?s plutos ?tempi? poky?iai Lietuvos teritorijoje pagal GPS matavim? duomenis. Atlikus tyrimus pagal pateikiam? Žem?s plutos horizontali?j? deformacij? ir ?tempi? tyrimo metodik?, gauti nauji horizontali?j? deformacij? charakteristik? bei ?tempi? poky?i? rezultatai ir nustatytos j? s?sajos su seismotektoniniu potencialu.

  14. Blackouts and natural risks

    NASA Astrophysics Data System (ADS)

    Danihelka, P.; Paldusová, E.; Dobeš, P.

    2009-04-01

    "Blackout" has become the common definition for the situation when electricity supply and demand are not balanced and security of supply fails. These failures have many impacts besides the lights going out, but this term is used commonly. Blackouts have drastic impacts for the society on whole and its citizens and some of them can influence big areas and last for long period, so the consequences are catastrophic. Even if at the European scale, the large extend blackouts are supposed to be exceptional, real frequency is relatively high, approximately once per two years. According to statistics, blackouts are often caused by natural causes, especially lightning. An example of lightning caused blackout is New York blackout 1977, leading to the stand-by of nuclear power plant Indian Point and with overall cost more than 300 mil. USD. There is a clear a distinction between those blackouts caused by nature and those that were caused by other faults. Usually, the nature-caused disturbances as Canada 1988, Sweden 2005 and France 1999, stay inside one country. However, their duration can extend to several weeks, and thus the costs of the interruptions and social impacts are high. Blackouts of only technologic and/or anthropogenic origin are frequently shorter, but may concern more end-users, when cascading from one country to another. Lightning is not the only natural event causing blackouts. Eighteen various case studies of blackout caused by natural events different then lightning were studied and following natural phenomenon found as a root causes: 1x forest fire, 1x snow calamity, 1x ice storm, 1x landslide, 1x high temperature, 1x geomagnetic storm, 2x earthquake, 2x inundation, 2x contact of line with trees, 6x storm (wind, hurricane…). We can conclude, that natural event are frequent cause of blackout of medium or large extend and this phenomena should be studied more in details. This contribution was supported by Ministry of Environment of the Czech Republic.

  15. Agrobacterium: nature’s genetic engineer

    PubMed Central

    Nester, Eugene W.

    2015-01-01

    Agrobacterium was identified as the agent causing the plant tumor, crown gall over 100 years ago. Since then, studies have resulted in many surprising observations. Armin Braun demonstrated that Agrobacterium infected cells had unusual nutritional properties, and that the bacterium was necessary to start the infection but not for continued tumor development. He developed the concept of a tumor inducing principle (TIP), the factor that actually caused the disease. Thirty years later the TIP was shown to be a piece of a tumor inducing (Ti) plasmid excised by an endonuclease. In the next 20 years, most of the key features of the disease were described. The single-strand DNA (T-DNA) with the endonuclease attached is transferred through a type IV secretion system into the host cell where it is likely coated and protected from nucleases by a bacterial secreted protein to form the T-complex. A nuclear localization signal in the endonuclease guides the transferred strand (T-strand), into the nucleus where it is integrated randomly into the host chromosome. Other secreted proteins likely aid in uncoating the T-complex. The T-DNA encodes enzymes of auxin, cytokinin, and opine synthesis, the latter a food source for Agrobacterium. The genes associated with T-strand formation and transfer (vir) map to the Ti plasmid and are only expressed when the bacteria are in close association with a plant. Plant signals are recognized by a two-component regulatory system which activates vir genes. Chromosomal genes with pleiotropic functions also play important roles in plant transformation. The data now explain Braun’s old observations and also explain why Agrobacterium is nature’s genetic engineer. Any DNA inserted between the border sequences which define the T-DNA will be transferred and integrated into host cells. Thus, Agrobacterium has become the major vector in plant genetic engineering. PMID:25610442

  16. Follow Futures: @NatureFutures

    E-print Network

    Loss, Daniel

    NATURE.COM Follow Futures: @NatureFutures go.nature.com/ mtoodm 890 NATURE PHYSICS | VOL 10 | NOVEMBER 2014 | www.nature.com/naturephysics futures T hree days, we've been on this planet. Over a year into my plastic cup. My secret still is why I've been out during late-shift in the first place. There

  17. Follow Futures: @NatureFutures

    E-print Network

    Loss, Daniel

    2015 | www.nature.com/naturephysics futures A fter the undervoid ship Human Hope arrived in orbitNATURE.COM Follow Futures: @NatureFutures go.nature.com/ mtoodm 516 NATURE PHYSICS | VOL 11 | JUNE of hissy language were routed to Human Hope's weak AI. We seem to have four separate languages so far

  18. Enhance Nature Exploration with Technology

    ERIC Educational Resources Information Center

    Holloway, Patricia; Mahan, Carol

    2012-01-01

    Kids and nature seem like a natural combination, but what was natural a generation ago is different today. Children are spending less time outdoors but continue to need nature for their physical, emotional, and mental development. This fact has led author Richard Louv to suggest that today's children are suffering from "nature-deficit disorder"…

  19. Nature/culture/seawater.

    PubMed

    Helmreich, Stefan

    2011-01-01

    Seawater has occupied an ambiguous place in anthropological categories of "nature" and "culture." Seawater as nature appears as potentiality of form and uncontainable flux; it moves faster than culture - with culture frequently figured through land-based metaphors - even as culture seeks to channel water's (nature's) flow. Seawater as culture manifests as a medium of pleasure, sustenance, travel, disaster. I argue that, although seawater's qualities in early anthropology were portrayed impressionistically, today technical, scientific descriptions of water's form prevail. For example, processes of globalization - which may also be called "oceanization" - are often described as "currents," "flows," and "circulations." Examining sea-set ethnography, maritime anthropologies, and contemporary social theory, I propose that seawater has operated as a “theory machine” for generating insights about human cultural organization. I develop this argument with ethnography from the Sargasso Sea and in the Sea Islands. I conclude with a critique of appeals to water's form in social theory. PMID:21560270

  20. Natural photonic crystals

    NASA Astrophysics Data System (ADS)

    Vigneron, Jean Pol; Simonis, Priscilla

    2012-10-01

    Photonic structures appeared in nature several hundred millions years ago. In the living world, color is used for communication and this important function strongly impacts the individual chances of survival as well as the chances to reproduce. This has a statistical influence on species populations. Therefore, because they are involved in evolution, natural color-generating structures are - from some point of view - highly optimized. In this short review, a survey is presented of the development of natural photonic crystal-type structures occurring in insects, spiders, birds, fishes and other marine animals, in plants and more, from the standpoint of light-waves propagation. One-, two-, and three-dimensional structures will be reviewed with selected examples.

  1. Natural gas monthly

    SciTech Connect

    Not Available

    1982-11-01

    This report presents data on the supply and disposition of natural gas in the USA during July 1982, as well as data on production, storage, imports, exports, and consumption. Selected data are also presented on the activities of the major interstate pipeline companies. Volumes of natural gas in storage continue to run slightly ahead of year-ago levels, especially for interstate operators. Weighted average prices received for gas sold by major interstate pipeline companies during July of 19982 ranged from a low of $2.61 per thousand cubic feet (Mcf) for Kansas-Nebraska to a high of $7.09 per Mcf for Pacific Gas. These variations are attributable to the sources of supply available to the various pipeline companies and the market structures of each. September 1982 applications for determination of a maximum lawful price under the Natural Gas Policy Act (NGPA) increased slightly for new gas (Section 102) and decreased significantly for high-cost gas (Section 107) when compared to August. Natural gas ceiling prices prescribed by the NGPA continued to move upward through the application of prescribed monthly inflation adjustments. In the 3-year period from November 1979 through November 1982, the price ceiling for new gas, for example, increased from $2.314 to $3.249 per million (MM) Btu's. The highest ceiling price permitted under the NGPA is natural gas produced from tight formations set for November 1982 at $5.396 per MMBtu. Market natural gas production during September of 1982 was 1444 billion cubic feet (Bcf) compared to the September 1981 level of 1578 Bcf. Consumption during the same period also declined from 1266 Bcf to 1176 Bcf.

  2. School Budget Hold'em Facilitator's Guide

    ERIC Educational Resources Information Center

    Education Resource Strategies, 2012

    2012-01-01

    "School Budget Hold'em" is a game designed to help school districts rethink their budgeting process. It evolved out of Education Resource Strategies' (ERS) experience working with large urban districts around the country. "School Budget Hold'em" offers a completely new approach--one that can turn the budgeting process into a long-term visioning…

  3. CURSO DE PS-GRADUAO EM METEOROLOGIA

    E-print Network

    CURSO DE PÓS-GRADUAÇÃO EM METEOROLOGIA Coordenador Acadêmico Dirceu Luis Herdies Membros do Conselho de Curso Luis Gustavo Gonçalves de Gonçalves José Antonio Marengo Orsini Clóvis Angeli Sansigolo Univ., 1969 Valdir Innocentini, Ph.D., Univ. of Reading, 1986 #12;2 CURSO DE PÓS-GRADUAÇÃO EM

  4. CURSO DE PS-GRADUAO EM METEOROLOGIA

    E-print Network

    CURSO DE PÓS-GRADUAÇÃO EM METEOROLOGIA Coordenador Acadêmico Dirceu Luis Herdies Membros do Conselho de Curso Luis Gustavo Gonçalves de Gonçalves José Antonio Marengo Orsini Clóvis Angeli Sansigolo Innocentini, Ph.D., Univ. of Reading, 1986 #12;2 CURSO DE PÓS-GRADUAÇÃO EM METEOROLOGIA PROGRAMAÇÃO ANUAL DAS

  5. EM international activities. February 1997 highlights

    SciTech Connect

    1997-02-01

    EM International Highlights is a brief summary of on-going international projects within the Department of Energy`s Office of Environmental Management (EM). This document contains sections on: Global Issues, activities in Western Europe, activities in central and Eastern Europe, activities in Russia, activities in Asia and the Pacific Rim, activities in South America, activities in North America, and International Organizations.

  6. Natural millicharged inflation

    NASA Astrophysics Data System (ADS)

    Bai, Yang; Stefanek, Ben. A.

    2015-05-01

    We construct a natural inflation model with the inflaton as a linear combination of the fifth components of Abelian gauge fields in a five-dimensional theory. A seesaw mechanism is introduced to provide a natural millicharge for matter fields under one combination of the gauge symmetries. As a result, the effective decay constant of the inflaton field can be above the Planck scale with all scales in the model below the Planck scale. Our model predicts a tensor-to-scalar ratio r between 0.033 and 0.125 for 60 e -folds and a reheating temperature of a few 1 011 GeV .

  7. Natural environment analysis

    NASA Technical Reports Server (NTRS)

    Frost, W.

    1985-01-01

    The influence of terrain features on wind loading of the space shuttle while on the launch pad, or during early liftoff, was investigated both qualitatively and quantitatively. The climatology and meteorology producing macroscale wind patterns and characteristics for the Vandenburg Air Force Base launch site are described. Field test data are analyzed, and the nature and characteristic of flow disturbances due to the various terrain features, both natural and man-made, are reviewed. The magnitude of these wind loads are estimated. Finally, effects of turbulence are discussed. It is concluded that the influence of complex terrain can create significant wind loading on the vehicle.

  8. Natural Cycles, Gases

    NASA Technical Reports Server (NTRS)

    Douglass, Anne R.; Jackman, Charles H.; Rood, R. B.; Aikin, A. C.; Stolarski, R. S.; Mccormick, M. P.; Fahey, David W.

    1992-01-01

    The major gaseous components of the exhaust of stratospheric aircraft are expected to be the products of combustion (CO2 and H2O), odd nitrogen (NO, NO2 HNO3), and products indicating combustion inefficiencies (CO and total unburned hydrocarbons). The species distributions are produced by a balance of photochemical and transport processes. A necessary element in evaluating the impact of aircraft exhaust on the lower stratospheric composition is to place the aircraft emissions in perspective within the natural cycles of stratospheric species. Following are a description of mass transport in the lower stratosphere and a discussion of the natural behavior of the major gaseous components of the stratospheric aircraft exhaust.

  9. SIGNIFICANT NATURAL HERITAGE AREAS (NC)

    EPA Science Inventory

    The North Carolina Department of Environment and Natural Resources, Division of Parks and Recreation, Natural Heritage Program in cooperation with the NC Center for Geographic Information & Analysis, developed the Significant Natural Heritage Areas digital data to determine the a...

  10. Em que medida devem ser privados, em que medida devem ser pblicos o conhecimento e a informao?

    E-print Network

    Kuhlen, Rainer

    Em que medida devem ser privados, em que medida devem ser públicos o conhecimento e a informação? 1 Transparências com licença Creative Commons Em que medida devem ser privados, em que medida devem ser públicos o as alternativas? codexKonstanz #12;Em que medida devem ser privados, em que medida devem ser públicos o

  11. letters to nature 192 NATURE |VOL 415 |10 JANUARY 2002 |www.nature.com

    E-print Network

    Croquette, Vincent

    letters to nature 192 NATURE |VOL 415 |10 JANUARY 2002 |www.nature.com heterodimer±ligand complexes signalling by receptor polarity and allosteric control of ligand binding. Nature 371, 528±531 (1994). 5 distinct actions of retinoid-receptor ligands. Nature 382, 819±822 (1996). 7. Vivat, V. et al. A mutation

  12. letters to nature NATURE |VOL 412 |23 AUGUST 2001 |www.nature.com 819

    E-print Network

    Falvo, Michael

    letters to nature NATURE |VOL 412 |23 AUGUST 2001 |www.nature.com 819 M. Maher, L. Milne, D. de commented on an earlier draft. This project was funded by a Natural Environment Research Council CASE, Rehovot 76100, Israel ³ Natural History Museum of Los Angeles County, Los Angeles, California 90007, USA

  13. On the nature of black hole information from unitarity

    E-print Network

    van Putten, Maurice H P M

    2015-01-01

    We identify the astronomically long evaporative lifetimes $t_{ev}$ of macroscopic black holes with unitary evolution in photon emissions one-by-one. To study the nature of black hole information, we consider observers ${\\cal O}$ of mass-energy $E$, experiencing discrete transitions in space-time with each photon emission. From the associated jumps in their velocity four-vector, we derive an integral of motion $EM$, where $M=M(t)$ denotes the mass of the black hole. $I=4\\pi EM$ was recently identified with the information localizing $E$ at the center of a sphere of radius $2M$. We here identify $I$ as a new conserved quantity underlying the no-hair theorem during black hole evaporation.

  14. The catastrophic nature of humans

    NASA Astrophysics Data System (ADS)

    Guthrie, Richard

    2015-06-01

    Natural landscapes are shaped by frequent moderate-sized events, except for the rare catastrophe. Human modifications to the Earth's surface are, compared with natural processes, increasingly catastrophic.

  15. Nature, Education and Things

    ERIC Educational Resources Information Center

    Rømer, Thomas Aastrup

    2013-01-01

    In this essay it is argued that the educational philosophy of John Dewey gains in depth and importance by being related to his philosophy of nature, his metaphysics. The result is that any experiental process is situated inside an event, an existence, a thing, and I try to interpret this "thing" as schools or major cultural events such…

  16. Natural Language Spatal Reasoning

    E-print Network

    Tellex, Stefanie

    Natural Language and Spatal Reasoning Stefanie Tellex MIT Media Lab Ph.D. Thesis Defense #12;Where, then, do, any, like, my, now, over, such, our, man, me, even, most, made, after, also, well, did, many, water, until, always, away, public, something, fact, less, through, far, put, head, think, called, set

  17. Natural Algorithms Bernard Chazelle

    E-print Network

    Chazelle, Bernard

    of bird flocks. We bound the time to reach steady state by a tower-of-twos of height linear in the number of birds. We prove that, surprisingly, the tower-of-twos growth is intrinsic to the model. This unexpected science might be of benefit to the study of natural algorithms. We consider two standard bird flocking

  18. The Nature of Atoms.

    ERIC Educational Resources Information Center

    Holden, Alan

    This monograph was written for the purpose of presenting physics to college students who are not preparing for careers in physics. It deals with the nature of atoms, and treats the following topics: (1) the atomic hypothesis, (2) the chemical elements, (3) models of an atom, (4) a particle in a one-dimensional well, (5) a particle in a central…

  19. The Nature of Evolution

    ERIC Educational Resources Information Center

    Alles, David L.

    2005-01-01

    The nature of evolution, the historical change in the universe, and the change that is caused by the workings of the dynamic processes at the smallest and largest scales are studied. It is viewed that the cumulative change in the historical systems is caused by evolution, which is a type of causal relationship and evolutionary processes could be…

  20. Naturalness after LHC8

    E-print Network

    Gian F. Giudice

    2013-08-11

    I review the status of naturalness of the weak scale after the results from the LHC operating at an energy of 8 TeV. Talk delivered at the 2013 Europhysics Conference on High Energy Physics (EPS), Stockholm, Sweden, 18-24 July 2013.

  1. Designing Nature's Way

    ERIC Educational Resources Information Center

    Fisher, Diane

    2005-01-01

    In the case of cars and other engineered objects, humans go about the design process in a very intentional way. They pretty much know what they are aiming for. The activity described in this article demonstrates how a computer can simulate biological evolution and the laws of natural selection. The article is divided into the following sections:…

  2. Natural Gas Annual

    EIA Publications

    2015-01-01

    Provides information on the supply and disposition of natural gas in the United States. Production, transmission, storage, deliveries, and price data are published by state for the current year. Summary data are presented for each state for the previous 5 years.

  3. Natural Language Sourcebook.

    ERIC Educational Resources Information Center

    Baker, Eva; And Others

    This sourcebook is intended to provide researchers and users of natural language computer systems with a classification scheme to describe language-related problems associated with such systems. Methods from the disciplines of artificial intelligence (AI), education, linguistics, psychology, anthropology, and psychometrics were applied in an…

  4. Reinventing Natural Selection

    ERIC Educational Resources Information Center

    Geraedts, Caspar L.; Boersma, Kerst Th.

    2006-01-01

    Although many research studies report students' Lamarckian misconceptions, only a few studies present learning and teaching strategies that focus on the successful development of the concept of natural selection. The learning and teaching strategy for upper secondary students (aged 15-16) presented in this study conducted in The Netherlands is…

  5. Natural Gas Purchasing Options 

    E-print Network

    Watkins, G.

    1988-01-01

    As a result of economic and regulatory changes, the natural gas marketplace now offers multiple options for purchasers. The purpose of this panel is to discuss short-term purchasing options and how to take advantage of these options both to lower...

  6. Research Highlights Nature Chemistry

    E-print Network

    Apeloig, Yitzhak

    Research Highlights Nature Chemistry Published online: 23 May 2008 | doi:10.1038/nchem.15 Subject Category: Inorganic chemistry Silicon chemistry: Come on silene Neil Withers Abstract Thermal rearrangement-silene -- a molecule with two Si=C bonds -- to be isolated. The crystal structure of the bis-silene reveals

  7. Criteria for natural hierarchies

    NASA Astrophysics Data System (ADS)

    de Gouvêa, André; Hernández, Daniel; Tait, Tim M. P.

    2014-06-01

    With the discovery of a particle that seems rather consistent with the minimal Standard Model Higgs boson, attention turns to questions of naturalness, fine-tuning, and what they imply for physics beyond the Standard Model and its discovery prospects at run II of the LHC. In this article we revisit the issue of naturalness, discussing some implicit assumptions that underly some of the most common statements, which tend to assign physical significance to certain regularization procedures. Vague arguments concerning fine-tuning can lead to conclusions that are too strong and perhaps not as generic as one would hope. Instead, we explore a more pragmatic definition of the hierarchy problem that does not rely on peeking beyond the murky boundaries of quantum field theory: we investigate the fine-tuning of the electroweak scale associated with thresholds from heavy particles, which is both calculable and dependent on the nature of the would-be ultraviolet completion of the Standard Model. We discuss different manifestations of new high-energy scales that are favored by experimental hints for new physics with an eye toward making use of fine-tuning in order to determine natural regions of the new physics parameter spaces.

  8. Research Highlights Nature Nanotechnology

    E-print Network

    Aksay, Ilhan A.

    have shown that the combustion performance of nitromethane, a potential rocket propellant, can metal oxide catalysts is that they do not leave any solid reaction products -- instead the sheets for enhanced fuel/propellant combustion. ACS Nano doi:10.1021/nn901006w (2009). | Article | OpenURL 1. Nature

  9. Nature in the City.

    ERIC Educational Resources Information Center

    Melber, Leah W.

    2000-01-01

    Presents three science activities targeted to help urban students learn about nature: (1) observing coloration patterns of pigeons; (2) measuring local rainfall and comparing it to other areas; and (3) conducting a biodiversity study by observing a patch of lawn. (YDS)

  10. Demystifying Nature of Science

    ERIC Educational Resources Information Center

    Lederman, Judith; Bartels, Selina; Lederman, Norman; Gnanakkan, Dionysius

    2014-01-01

    With the emergence of the "Next Generation Science Standards" ("NGSS"; NGSS Lead States 2013), it is apparent that teaching and learning about nature of science (NOS) continues to be an important goal of science education for all K-12 students. With this emphasis on NOS, early childhood teachers are asking how to design…

  11. A Natural Hazards Workbook.

    ERIC Educational Resources Information Center

    Kohler, Fred

    This paper discusses the development of and provides examples of exercises from a student workbook for a college-level course about natural hazards. The course is offered once a year to undergraduates at Western Illinois University. Students are introduced to 10 hazards (eight meteorological plus earthquakes and volcanoes) through slides, movies,…

  12. Nature and Nurture.

    ERIC Educational Resources Information Center

    Gardner, John W.; And Others

    1989-01-01

    Seven articles address topics related to leadership and library administration: (1) the nature of leadership; (2) the role of mentorship in developing library leaders; (3) the relationship between leadership and personnel development; (4) leadership roles for librarians; (5) library directors as middle managers; (6) raising librarians' salaries;…

  13. Picturing the Natural World

    ERIC Educational Resources Information Center

    Salia, Hannah

    2011-01-01

    How is the natural environment in the neighborhood representative of the larger biosphere in which people live? Studying the local birds and flora of the Pacific Northwest in the context of the local parks and ponds provided a rich opportunity for third-grade students at St. Thomas School in Medina, Washington, to explore and learn about…

  14. POTENTIAL NATURAL VEGETATION COVERAGE

    EPA Science Inventory

    "Potential natural vegetation is defined as the vegetation that would exist today if humans were removed from the scene and if the plant succession after their removal were telescoped into a single moment. The time compression eliminates the effects of future climatic fluc...

  15. Picturing the Natural Environment

    ERIC Educational Resources Information Center

    Johnson, Phyllis Scott

    2011-01-01

    Around Scout Island Education Center, a site used by schools in Fresno County to explore the area's natural environment, a total of 200 cylinder-shaped concrete stools display tiles representing small mammals, flying insects, birds, wildflowers, and more. Twenty sets have been created by elementary, middle, and high-school art students as part of…

  16. Radioactivity: A Natural Phenomenon.

    ERIC Educational Resources Information Center

    Ronneau, C.

    1990-01-01

    Discussed is misinformation people have on the subject of radiation. The importance of comparing artificial source levels of radiation to natural levels is emphasized. Measurements of radioactivity, its consequences, and comparisons between the risks induced by radiation in the environment and from artificial sources are included. (KR)

  17. Naturalizing Objectivity Rebecca Kukla

    E-print Network

    Galison, Peter L.

    285 Naturalizing Objectivity Rebecca Kukla University of South Florida Books reviewed in this essay: Lorraine Daston and Peter Galison, Objectivity (Cambridge: Zone Books, 2007). Karen Barad, Meeting, 2007). We can understand objectivity, in the broadest sense of the term, as epistemic accountability

  18. Saving Natural Inflation

    SciTech Connect

    Croon, Djuna; Sanz, Verónica E-mail: v.sanz@sussex.ac.uk

    2015-02-01

    Slow-roll inflation requires the inflaton field to have an exceptionally flat potential, which combined with measurements of the scale of inflation demands some degree of fine-tuning. Alternatively, the flatness of the potential could be due to the inflaton's origin as a pseudo-Goldstone boson, as in Natural Inflation. Alas, consistency with Planck data places the original proposal of Natural Inflation in a tight spot, as it requires a trans-Planckian excursion of the inflaton. Although one can still tune the renormalizable potential to sub-Planckian values, higher order corrections from quantum gravity or sources of breaking of the Goldstone symmetry would ruin the predictivity of the model. In this paper we show how in more realistic models of Natural Inflation one could achieve inflation without a trans-Planckian excursion of the field. We show how a variant of Extra-natural inflation with bulk fermions can achieve the desired goal and discuss its four-dimensional duals. We also present a new type of four dimensional models inspired in Little Higgs and Composite Higgs models which can lead to sub-Planckian values of the inflaton field.

  19. Antigone's Nature WILLIAM ROBERT

    E-print Network

    Doyle, Robert

    Antigone's Nature WILLIAM ROBERT Antigone fascinates G. W. F. Hegel and Luce Irigaray, both of whom turn to her in their explorations and articulations of ethics. Hegel and Irigaray make these re of examining Irigaray's complex relation to and creative uses of Hegel's thought. Tragedy is excessive

  20. Natural hazards science strategy

    USGS Publications Warehouse

    Holmes, Jr., Robert R.; Jones, Lucile M.; Eidenshink, Jeffery C.; Godt, Jonathan W.; Kirby, Stephen H.; Love, Jeffrey J.; Neal, Christina A.; Plant, Nathaniel G.; Plunkett, Michael L.; Weaver, Craig S.; Wein, Anne; Perry, Suzanne C.

    2012-01-01

    The mission of the U.S. Geological Survey (USGS) in natural hazards is to develop and apply hazard science to help protect the safety, security, and economic well-being of the Nation. The costs and consequences of natural hazards can be enormous, and each year more people and infrastructure are at risk. USGS scientific research - founded on detailed observations and improved understanding of the responsible physical processes - can help to understand and reduce natural hazard risks and to make and effectively communicate reliable statements about hazard characteristics, such as frequency, magnitude, extent, onset, consequences, and where possible, the time of future events. To accomplish its broad hazard mission, the USGS maintains an expert workforce of scientists and technicians in the earth sciences, hydrology, biology, geography, social and behavioral sciences, and other fields, and engages cooperatively with numerous agencies, research institutions, and organizations in the public and private sectors, across the Nation and around the world. The scientific expertise required to accomplish the USGS mission in natural hazards includes a wide range of disciplines that this report refers to, in aggregate, as hazard science. In October 2010, the Natural Hazards Science Strategy Planning Team (H-SSPT) was charged with developing a long-term (10-year) Science Strategy for the USGS mission in natural hazards. This report fulfills that charge, with a document hereinafter referred to as the Strategy, to provide scientific observations, analyses, and research that are critical for the Nation to become more resilient to natural hazards. Science provides the information that decisionmakers need to determine whether risk management activities are worthwhile. Moreover, as the agency with the perspective of geologic time, the USGS is uniquely positioned to extend the collective experience of society to prepare for events outside current memory. The USGS has critical statutory and nonstatutory roles regarding floods, earthquakes, tsunamis, landslides, coastal erosion, volcanic eruptions, wildfires, and magnetic storms - the hazards considered in this plan. There are numerous other hazards of societal importance that are considered either only peripherally or not at all in this Strategy because they are either in another of the USGS strategic science plans (such as drought) or not in the overall mission of the USGS (such as tornados).

  1. Natural products as photoprotection.

    PubMed

    Saewan, Nisakorn; Jimtaisong, Ampa

    2015-03-01

    The rise in solar ultraviolet radiation on the earth's surface has led to a depletion of stratospheric ozone over recent decades, thus accelerating the need to protect human skin against the harmful effects of UV radiation such as erythema, edema, hyperpigmentation, photoaging, and skin cancer. There are many different ways to protect skin against UV radiation's harmful effects. The most popular way to reduce the amount of UV radiation penetrating the skin is topical application of sunscreen products that contain UV absorbing or reflecting active molecules. Based on their protection mechanism, the active molecules in sunscreens are broadly divided into inorganic and organic agents. Inorganic sunscreens reflect and scatter UV and visible radiation, while organic sunscreens absorb UV radiation and then re-emit energy as heat or light. These synthetic molecules have limited concentration according to regulation concern. Several natural compounds with UV absorption property have been used to substitute for or to reduce the quantity of synthetic sunscreen agents. In addition to UV absorption property, most natural compounds were found to act as antioxidants, anti-inflammatory, and immunomodulatory agents, which provide further protection against the damaging effects of UV radiation exposure. Compounds derived from natural sources have gained considerable attention for use in sunscreen products and have bolstered the market trend toward natural cosmetics. This adds to the importance of there being a wide selection of active molecules in sunscreen formulations. This paper summarizes a number of natural products derived from propolis, plants, algae, and lichens that have shown potential photoprotection properties against UV radiation exposure-induced skin damage. PMID:25582033

  2. 2008 Nature Publishing Group nature geoscience | VOL 1 | FEBRUARY 2008 | www.nature.com/naturegeoscience 79

    E-print Network

    Mahowald, Natalie

    © 2008 Nature Publishing Group FEATURE nature geoscience | VOL 1 | FEBRUARY 2008 | www.nature.com/naturegeoscience 79 Gender imbalance in US geoscience academia Geoscientists explain women's under science. Unfortunately, the geosciences lag behind all other science, technology, engineering

  3. Warner College of Natural Resources Warner College of Natural

    E-print Network

    Warner College of Natural Resources Warner College of Natural Resources Office in Natural Resources in Conservation Biology The College offers studies and professional training in the management, administration, and outdoor recreation areas. The Natural Resource Ecology Laboratory, housed in the College, is devoted

  4. Nature Macmillan Publishers Ltd 1998 letters to nature

    E-print Network

    Queensland, University of

    Nature © Macmillan Publishers Ltd 1998 8 letters to nature NATURE |VOL 395 |8 OCTOBER 1998 |www.nature-1 mutant cells the early origin fired at the same time as in the wild type, whereas the late origin fired more than 10 min earlier than in the wild-type cells and continued for 30 min. In addition

  5. NATURE CHEMISTRY | www.nature.com/naturechemistry 1 SUPPLEMENTARY INFORMATION

    E-print Network

    Ihee, Hyotcherl

    NATURE CHEMISTRY | www.nature.com/naturechemistry 1 SUPPLEMENTARY INFORMATION DOI: 10.1038/NCHEM Macmillan Publishers Limited. All rights reserved. #12;NATURE CHEMISTRY | www.nature.com/naturechemistry 2 SUPPLEMENTARY INFORMATIONDOI: 10.1038/NCHEM.1565 2 Supplementary Methods Data collection protocol Wild-type PYP

  6. SUPPLEMENTARY INFORMATION 1www.nature.com/nature

    E-print Network

    van Oudenaarden, Alexander

    SUPPLEMENTARY INFORMATIONdoi: 10.1038/nature08781 b c d e a Supplementary figure 5 Wild-type(N2SUPPLEMENTARY INFORMATION 1www.nature.com/nature doi: 10.1038/nature08781 Supplementary figure 1 100 150 200 Time (minutes) 0 50 100 150 200 Time (minutes) 0 50 100 150 200 Time (minutes) Wild

  7. Why Is Nature Beneficial?: The Role of Connectedness to Nature

    ERIC Educational Resources Information Center

    Mayer, F. Stephan; Frants, Cynthia McPherson; Bruehlman-Senecal, Emma; Dolliver, Kyffin

    2009-01-01

    Three studies examine the effects of exposure to nature on positive affect and ability to reflect on a life problem. Participants spent 15 min walking in a natural setting (Studies 1, 2, & 3), an urban setting (Study 1), or watching videos of natural and urban settings (Studies 2 & 3). In all three studies, exposure to nature increased…

  8. Nature Macmillan Publishers Ltd 1998 letters to nature

    E-print Network

    Fraden, Seth

    Nature © Macmillan Publishers Ltd 1998 8 letters to nature NATURE |VOL 393 |28 MAY 1998 349 7 lead to improved catalysts and biosensors. Chem. Eng. News 74, 62 (1996). 11. Baum, R. M. Nurturing-walled carbon nanotubes. Nature 386, 377­379 (1997). 13. Gadd, G. E. et al. The world's smallest gas cylinders

  9. 3D Inversion of Natural Source Electromagnetics

    NASA Astrophysics Data System (ADS)

    Holtham, E. M.; Oldenburg, D. W.

    2010-12-01

    The superior depth of investigation of natural source electromagnetic techniques makes these methods excellent candidates for crustal studies as well as for mining and hydrocarbon exploration. The traditional natural source method, the magnetotelluric (MT) technique, has practical limitations because the surveys are costly and time consuming due to the labor intensive nature of ground based surveys. In an effort to continue to use the penetration advantage of natural sources, it has long been recognized that tipper data, the ratio of the local vertical magnetic field to the horizontal magnetic field, provide information about 3D electrical conductivity structure. It was this understanding that prompted the development of AFMAG (Audio Frequency Magnetics) and recently the new airborne Z-Axis Tipper Electromagnetic Technique (ZTEM). In ZTEM, the vertical component of the magnetic field is recorded above the entire survey area, while the horizontal fields are recorded at a ground-based reference station. MT processing techniques yield frequency domain transfer functions typically between 30-720 Hz that relate the vertical fields over the survey area to the horizontal fields at the reference station. The result is a cost effective procedure for collecting natural source EM data and for finding large scale targets at moderate depths. It is well known however that 1D layered structures produce zero vertical magnetic fields and thus ZTEM data cannot recover such background conductivities. This is in sharp contrast to the MT technique where electric fields are measured and a 1D background conductivity can be recovered from the off diagonal elements of the impedance tensor. While 1D models produce no vertical fields, two and three dimensional structures will produce anomalous currents and a ZTEM response. For such models the background conductivity structure does affect the data. In general however, the ZTEM data have weak sensitivity to the background conductivity and while we show that it is possible to obtain the background structure by inverting the ZTEM data alone, it is desirable to obtain robust background conductivity information from other sources. This information could come from a priori geologic and petrophysical information or from additional geophysical data such as MT. To counter the costly nature of large MT surveys and the limited sensitivity of the ZTEM technique to the background conductivity we show that an effective method is to collect and invert both MT and ZTEM data. A sparse MT survey grid can gather information about the background conductivity and deep structures while keeping the survey costs affordable. Higher spatial resolution at moderate depths can be obtained by flying multiple lines of ZTEM data.

  10. Project X RFQ EM Design

    SciTech Connect

    Romanov, Gennady; Hoff, Matthew; Li, Derun; Staples, John; Virostek, Steve; /LBNL

    2012-05-09

    Project X is a proposed multi-MW proton facility at Fermi National Accelerator Laboratory (FNAL). The Project X front-end would consist of an H- ion source, a low-energy beam transport (LEBT), a CW 162.5 MHz radio-frequency quadrupole (RFQ) accelerator, and a medium-energy beam transport (MEBT). Lawrence Berkeley National Laboratory (LBNL) and FNAL collaboration is currently developing the designs for various components in the Project X front end. This paper reports the detailed EM design of the CW 162.5 MHz RFQ that provides bunching of the 1-10 mA H- beam with acceleration from 30 keV to 2.1 MeV.

  11. EM International, July 1994, Volume 2

    SciTech Connect

    Not Available

    1994-10-01

    The Office of Environmental Management (EM) at the Department of Energy (DOE) is seeking out and leveraging foreign technology, data, and resources in keeping with EM`s mandate to protect public health and the environment through the safe and cost-effective remediation of the Department`s nuclear weapons sites. EM works closely with foreign governments, industry, and universities to obtain innovative environmental technologies, scientific and engineering expertise, and operations experience that will support EM`s objectives. Where appropriate, these international resources are used to manage the more urgent risks at our sites, secure a safe workplace, help build consensus on critical issues, and strengthen our technology development program. Through international agreements EM engages in cooperative exchange of information, technology, and individuals. Currently, we are managing agreements with a dozen countries in Europe, Latin America, and Asia. These agreements focus on environmental restoration, waste management, transportation of radioactive wastes, and decontamination and decommissioning. This publication contains the following articles: in situ remediation integrated program; in-situ characterization and inspection of tanks; multimedia environmental pollutant assessment system (MEPAS); LLNL wet oxidation -- AEA technology. Besides these articles, this publication covers: EU activities with Russia; technology transfer activities; and international organization activities.

  12. Abundâncias em estrelas de Bário

    NASA Astrophysics Data System (ADS)

    Allen, D. M.

    2003-08-01

    Estrelas de Bário apresentam linhas intensas de elementos produzidos pelo processos (ex: Ba, Y, Sr, Zr) e bandas intensas de CN, C2 e CH. A hipótese mais aceita sobre a origem deste grupo peculiar é a de que essas estrelas façam parte de sistemas binários, tendo recebido material enriquecido em elementos pesados da companheira mais evoluída. Apresentamos neste trabalho uma análise detalhada de uma amostra de estrelas desta classe, incluindo determinação de parâmetros atmosféricos e cálculo de abundâncias. As temperaturas efetivas foram determinadas a partir de dados fotométricos obtidos com o Fotrap instalado no telescópio Zeiss do LNA (Laboratório Nacional de Astrofísica) (B-V, V-I, R-I, V-R), e coletados na literatura nos catálogos Hipparcos (B-V), 2MASS (Two Micron All Sky Survey) (V-K) e The General Catalogue Photometric Data (sistema Geneva). Obtivemos uma faixa de temperaturas de 4400 £ Tef £ 6500. As metalicidades foram determinadas a partir de linhas de Fe I e Fe II, estando os resultados no intervalo -1 £ [Fe/H] £ +0.1. O log g foi determinado pelo equilíbrio de ionização e pela relação com a magnitude bolométrica, a temperatura e a massa, sendo os resultados na faixa 1.5 £ log g £ 4.5. As distâncias utilizadas foram determinadas com o auxílio das paralaxes Hipparcos, e as massas determinadas por modelos de isócronas. Os espectros utilizados foram obtidos com o espectrógrafo FEROS no Telescópio de 1,5m do ESO (European Southern Observatory). As abundâncias foram calculadas por meio de síntese espectral de linhas individuais incluindo elementos alfa, pico do Fe, s e r. Encontramos um excesso de elementos pesados em relação ao Fe, como esperado para estrelas de Bário.

  13. Potential of Renewable Natural Gas

    E-print Network

    California at Davis, University of

    Potential of Renewable Natural Gas Sloan Foundation Workshop on Natural Gas in Transportation Dr-60283. 740 BCF/yr RNG potential 2014 natural gas consumption in transportation = 35 BCF #12;Food/green waste natural gas consumption in transportation = 35 BCF #12;Landfill Gas Refuse Trucks Transit Buses Food

  14. PREPARATORY STUDY PROGRAM MEDICAL NATURAL

    E-print Network

    Henkel, Werner

    Study Program Medical Natural Sciences (MedNat) combines natural sciences, life sciences and medicinePREPARATORY STUDY PROGRAM MEDICAL NATURAL SCIENCES STUDY IN GERMANY #12;THE PROGRAM The preparatory to the advanced B2 level in the three years of study. The foundations of MedNat in the natural sciences are laid

  15. NATURAL PRODUCTS FOR PEST MANAGEMENT

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The topic of natural products as pesticides is reviewed, with a discussion of the advantages and disadvantages of adopting a natural product-based strategy for pesticide discovery. Current and past natural product and natural product-based herbicides, insecticides, fungicides, molluscicides, rodent...

  16. Notes on natural inflation

    SciTech Connect

    Yonekura, Kazuya

    2014-10-01

    In the so-called natural inflation, an axion-like inflaton is assumed to have a cosine-type periodic potential. This is not the case in a very simple model in which the axion-like inflaton is coupled to an SU(N) (or other) pure Yang–Mills, at least in the large N limit as pointed out by Witten. It has a multi-valued potential, which is effectively quadratic, i.e., there is only a mass term in the large N limit. Thanks to this property, chaotic inflation can be realized more naturally with the decay constant of the axion-like inflaton less than the Planck scale. We demonstrate these points explicitly by using softly broken N=1 Super-Yang-Mills which allows us to treat finite N. This analysis also suggests that moderately large gauge groups such as E{sub 8} are good enough with a Planck scale decay constant.

  17. Naturally selecting solutions

    PubMed Central

    Manning, Timmy; Sleator, Roy D; Walsh, Paul

    2013-01-01

    For decades, computer scientists have looked to nature for biologically inspired solutions to computational problems; ranging from robotic control to scheduling optimization. Paradoxically, as we move deeper into the post-genomics era, the reverse is occurring, as biologists and bioinformaticians look to computational techniques, to solve a variety of biological problems. One of the most common biologically inspired techniques are genetic algorithms (GAs), which take the Darwinian concept of natural selection as the driving force behind systems for solving real world problems, including those in the bioinformatics domain. Herein, we provide an overview of genetic algorithms and survey some of the most recent applications of this approach to bioinformatics based problems. PMID:23222169

  18. Natural environment analysis

    NASA Technical Reports Server (NTRS)

    1985-01-01

    Qualitative analyses (and quantitatively to the extend possible) of the influence of terrain features on wind loading of the space shuttle while on the launch pad, or during early liftoff, are presented. Initially, the climatology and meteorology producing macroscale wind patterns and characteristics fot he Vandenburg Air Force Base (VAFB) launch site are described. Also, limited field test data are analyzed, and then the nature and characteristic of flow disturbances due to the various terrain features, both natural and man-made, are then reviewed. Following this, the magnitude of these wind loads are estimated. Finally, effects of turbulence are discussed. The study concludes that the influence of complex terrain can create significant wind loading on the vehicle. Because of the limited information, it is not possible to quantify the magnitude of these loads.

  19. Safer Liquid Natural Gas

    NASA Technical Reports Server (NTRS)

    1976-01-01

    After the disaster of Staten Island in 1973 where 40 people were killed repairing a liquid natural gas storage tank, the New York Fire Commissioner requested NASA's help in drawing up a comprehensive plan to cover the design, construction, and operation of liquid natural gas facilities. Two programs are underway. The first transfers comprehensive risk management techniques and procedures which take the form of an instruction document that includes determining liquid-gas risks through engineering analysis and tests, controlling these risks by setting up redundant fail safe techniques, and establishing criteria calling for decisions that eliminate or accept certain risks. The second program prepares a liquid gas safety manual (the first of its kind).

  20. Epidemics after Natural Disasters

    PubMed Central

    Gayer, Michelle; Connolly, Maire A.

    2007-01-01

    The relationship between natural disasters and communicable diseases is frequently misconstrued. The risk for outbreaks is often presumed to be very high in the chaos that follows natural disasters, a fear likely derived from a perceived association between dead bodies and epidemics. However, the risk factors for outbreaks after disasters are associated primarily with population displacement. The availability of safe water and sanitation facilities, the degree of crowding, the underlying health status of the population, and the availability of healthcare services all interact within the context of the local disease ecology to influence the risk for communicable diseases and death in the affected population. We outline the risk factors for outbreaks after a disaster, review the communicable diseases likely to be important, and establish priorities to address communicable diseases in disaster settings. PMID:17370508

  1. Natural minimal dark matter

    E-print Network

    Fabbrichesi, Marco

    2015-01-01

    We show how the Higgs boson mass is protected from the potentially large corrections due to the introduction of minimal dark matter if the new physics sector is made supersymmetric. The fermionic dark matter candidate (a 5-plet of $SU(2)_L$) is accompanied by a scalar state. The weak gauge sector is made supersymmetric and the Higgs boson is embedded in a supersymmetric multiplet. The remaining standard model states are non-supersymmetric. Non vanishing corrections to the Higgs boson mass only appear at three-loop level and the model is natural for dark matter masses up to 15 TeV--a value larger than the one required by the cosmological relic density. The construction presented stands as an example of a general approach to naturalness that solves the little hierarchy problem which arises when new physics is added beyond the standard model at an energy scale around 10 TeV.

  2. Natural Dark Energy

    E-print Network

    Douglas Scott; Ali Frolop

    2007-03-30

    It is now well accepted that both Dark Matter and Dark Energy are required in any successful cosmological model. Although there is ample evidence that both Dark components are necessary, the conventional theories make no prediction for the contributions from each of them. Moreover, there is usually no intrinsic relationship between the two components, and no understanding of the nature of the mysteries of the Dark Sector. Here we suggest that if the Dark Side is so seductive then we should not be restricted to just 2 components. We further suggest that the most natural model has 5 distinct forms of Dark Energy in addition to the usual Dark Matter, each contributing precisely equally to the cosmic energy density budget.

  3. Natural Products for Antithrombosis

    PubMed Central

    Chen, Cen; Zhang, Qian; Wang, Feng-Qin; Hu, Yuan-Jia; Xia, Zhi-Ning

    2015-01-01

    Thrombosis is considered to be closely related to several diseases such as atherosclerosis, ischemic heart disease and stroke, as well as rheumatoid arthritis, hyperuricemia, and various inflammatory conditions. More and more studies have been focused on understanding the mechanism of molecular and cellular basis of thrombus formation as well as preventing thrombosis for the treatment of thrombotic diseases. In reality, there is considerable interest in the role of natural products and their bioactive components in the prevention and treatment of thrombosis related disorders. This paper briefly describes the mechanisms of thrombus formation on three aspects, including coagulation system, platelet activation, and aggregation, and change of blood flow conditions. Furthermore, the natural products for antithrombosis by anticoagulation, antiplatelet aggregation, and fibrinolysis were summarized, respectively. PMID:26075003

  4. The nature of beamstrahlung

    SciTech Connect

    Chen, P.

    1987-04-01

    The physical nature of beamstrahlung during beam-beam interaction in linear colliders is reviewed. We first make the distinction between a dense beam and a dilute beam. We then review the characteristics of synchrotron radiation (SR) and bremsstrahlung, and argue that for a wide range of beam parameters beamstrahlung is SR in nature, even if the beam is dilute. Some issues concerning the specific conditions in beamstrahlung as SR are then discussed. Finally we suggest that in order to suppress beamstrahlung energy loss and to improve energy resolution, it is desirable to partition a bunch into a train of bunchlets, where the length of each bunchlet is shorter than the SR convergence length.

  5. Principles of Natural Photosynthesis.

    PubMed

    Krewald, Vera; Retegan, Marius; Pantazis, Dimitrios A

    2016-01-01

    Nature relies on a unique and intricate biochemical setup to achieve sunlight-driven water splitting. Combined experimental and computational efforts have produced significant insights into the structural and functional principles governing the operation of the water-oxidizing enzyme Photosystem II in general, and of the oxygen-evolving manganese-calcium cluster at its active site in particular. Here we review the most important aspects of biological water oxidation, emphasizing current knowledge on the organization of the enzyme, the geometric and electronic structure of the catalyst, and the role of calcium and chloride cofactors. The combination of recent experimental work on the identification of possible substrate sites with computational modeling have considerably limited the possible mechanistic pathways for the critical O-O bond formation step. Taken together, the key features and principles of natural photosynthesis may serve as inspiration for the design, development, and implementation of artificial systems. PMID:26099285

  6. Nature as quantum computer

    E-print Network

    David Ritz Finkelstein

    2012-01-08

    Set theory reduces all processes to assembly and disassembly. A similar architecture is proposed for nature as quantum computer. It resolves the classical space-time underlying Feynman diagrams into a quantum network of creation and annihilation processes, reducing kinematics to quantum statistics, and regularizing the Lie algebra of the Einstein diffeomorphism group. The usually separate and singular Lie algebras of kinematics, statistics, and conserved currents merge into one regular statistics Lie algebra.

  7. Natural Underwater Adhesives

    PubMed Central

    Stewart, Russell J.; Ransom, Todd C.; Hlady, Vladimir

    2011-01-01

    The general topic of this review is protein-based underwater adhesives produced by aquatic organisms. The focus is on mechanisms of interfacial adhesion to native surfaces and controlled underwater solidification of natural water-borne adhesives. Four genera that exemplify the broad range of function, general mechanistic features, and unique adaptations are discussed in detail: blue mussels, acorn barnacles, sandcastle worms, and freshwater caddisfly larva. Aquatic surfaces in nature are charged and in equilibrium with their environment, populated by an electrical double layer of ions as well as adsorbed natural polyelectrolytes and microbial biofilms. Surface adsorption of underwater bioadhesives likely occurs by exchange of surface bound ligands by amino acid sidechains, driven primarily by relative affinities and effective concentrations of polymeric functional groups. Most aquatic organisms exploit modified amino acid sidechains, in particular phosphorylated serines and hydroxylated tyrosines (dopa), with high-surface affinity that form coordinative surface complexes. After delivery to the surfaces as a fluid, permanent natural adhesives solidify to bear sustained loads. Mussel plaques are assembled in a manner superficially reminiscent of in vitro layer-by-layer strategies, with sequentially delivered layers associated through Fe(dopa)3 coordination bonds. The adhesives of sandcastle worms, caddisfly larva, and barnacles may be delivered in a form somewhat similar to in vitro complex coacervation. Marine adhesives are secreted, or excreted, into seawater that has a significantly higher pH and ionic strength than the internal environment. Empirical evidence suggests these environment triggers could provide minimalistic, fail-safe timing mechanisms to prevent premature solidification (insolubilization) of the glue within the secretory system, yet allow rapid solidification after secretion. Underwater bioadhesives are further strengthened by secondary covalent curing. PMID:21643511

  8. Nature's Greatest Puzzles

    SciTech Connect

    Quigg, Chris; /Fermilab

    2005-02-01

    It is a pleasure to be part of the SLAC Summer Institute again, not simply because it is one of the great traditions in our field, but because this is a moment of great promise for particle physics. I look forward to exploring many opportunities with you over the course of our two weeks together. My first task in talking about Nature's Greatest Puzzles, the title of this year's Summer Institute, is to deconstruct the premise a little bit.

  9. Harnessing natural ventilation benefits.

    PubMed

    O'Leary, John

    2013-04-01

    Making sure that a healthcare establishment has a good supply of clean fresh air is an important factor in keeping patients, staff, and visitors, free from the negative effects of CO2 and other contaminants. John O'Leary of Trend Controls, a major international supplier of building energy management solutions (BEMS), examines the growing use of natural ventilation, and the health, energy-saving, and financial benefits, that it offers. PMID:23678661

  10. Thermoacoustic natural gas liquefier

    SciTech Connect

    Swift, G.W.

    1997-05-01

    Cryenco and Los Alamos are collaborating to develop a natural-gas-powered natural-gas liquefier that will have no moving parts and require no electrical power. It will have useful efficiency, remarkable reliability, and low cost. The liquefaction of natural gas, which occurs at only 115 Kelvin at atmospheric pressure, has previously required rather sophisticated refrigeration machinery. The 1990 invention of the thermoacoustically driven orifice pulse-tube refrigerator (TA-DOPTR) provides cryogenic refrigeration with no moving parts for the first time. In short, this invention uses acoustic phenomena to produce refrigeration from heat. The required apparatus consists of nothing more than helium-filled heat exchangers and pipes, made of common materials, without exacting tolerances. In the Cryenco-Los Alamos collaboration, the authors are developing a version of this invention suitable for use in the natural-gas industry. The project is known as acoustic liquefier for short. The present program plans call for a two-phase development. Phase 1, with capacity of 500 gallon per day (i.e., approximately 40,000 scfd, requiring a refrigeration power of about 7 kW), is large enough to illuminate all the issues of large-scale acoustic liquefaction without undue cost, and to demonstrate the liquefaction of 60--70% of input gas, while burning 30--40%. Phase 2 will target versions of approximately 10{sup 6} scfd = 10,000 gallon per day capacity. In parallel with both, they continue fundamental research on the technology, directed toward increased efficiency, to build scientific foundations and a patent portfolio for future acoustic liquefiers.

  11. Geomorphology and natural hazards

    NASA Astrophysics Data System (ADS)

    Gares, Paul A.; Sherman, Douglas J.; Nordstrom, Karl F.

    1994-08-01

    Natural hazards research was initiated in the 1960's by Gilbert White and his students who promulgated a research paradigm that involved assessing risk from a natural event, identifying adjustments to cope with the hazard, determining people's perception of the event, defining the process by which people choose adjustments, and estimating the effects of public policy on the choice process. Studies of the physical system played an important role in early research, but criticismsof the paradigm resulted in a shift to a prominence of social science. Geomorphologists are working to fill gaps in knowledge of the physical aspects of individual hazards, but use of the information by social scientists will only occur if information is presented in a format that is useful to them. One format involves identifying the hazard according to seven physical parameters established by White and his colleagues: magnitude, frequency, duration, areal extent, speed of onset, spatial dispersion, and temporal spacing. Geomorphic hazards are regarded as related to landscape changes that affect human systems. The processes that produce the changes are rarely geomorphic in nature, but are better regarded as atmospheric or hydrologic. An examination of geomorphic hazards in four fields — soil erosion, mass movement, coastal erosion and fluvial erosion — demonstrates that advances in those fields may be evaluated in terms of the seven parameters. Geomorphologists have contributed to hazard research by focusing on the dynamics of the landforms. The prediction of occurence, the determination of spatial and temporal characteristics, the impact of physical characteristics on people's perception, and the impact of physical characteristics on adjustment formulation. Opportunities for geomorphologists to improve our understanding of geomorphic hazards include research into the characteristics of the events particularly with respect to predicting the occurence, and increased evaluation of the impact of human activities on natural systems.

  12. Natural gas for Istanbul

    SciTech Connect

    Not Available

    1989-10-01

    Currently, Istanbul's gas customers receive manufactured gas produced by three plants and distributed through mains that are up to 100 years old. This paper describes the installation of a modern natural gas distribution system for Istanbul Gas Distribution Co. To avoid Bosphorus crossing, the networks will be fed from two gas sources located on the BOTAS gas line: one on the European side and one on the Anatolian side. The project is thus composed of two independent networks.

  13. Chlorophylls - natural solar cells

    E-print Network

    Jantschi, Lorentz; Balan, Mugur C; Sestras, Radu E

    2011-01-01

    A molecular modeling study was conducted on a series of six natural occurring chlorophylls. Quantum chemistry calculated orbital energies were used to estimate frequency of transitions between occupied molecular orbital and unoccupied molecular orbital energy levels of chlorophyll molecules in vivo conditions in standard (ASTMG173) environmental conditions. Obtained results are in good agreement with energies necessary to fix the Magnesium atom by chlorophyll molecules and with occurrence of chlorophylls in living vegetal organisms.

  14. Future natural gas supplies

    NASA Astrophysics Data System (ADS)

    Despite recent optimism about the outlook for the future supply of domestic conventional natural gas, the Congressional Office of Technology Assessment (OTA) finds insufficient evidence to clearly justify either an optimistic or a pessimistic view. In a technical memorandum entitled “U.S. Natural Gas Availability: Conventional Gas Supply Through the Year 2000,” released recently by Rep. Philip R. Sharp (D-Ind,), chairman of the Subcommittee on Fossil and Synthetic Fuels of the Committee on Energy and Commerce, OTA concluded that substantial technical uncertainties prevented a reliable estimation of the likely natural gas production rates for later in this century. Even ignoring the potential for significant changes in gas prices and technology, OTA estimated that conventional gas production by the lower 48 states in the year 2000 could range from 9 to 19 trillion cubic feet (TCF) (0.25 to 0.53 trillion cubic meters), compared to 1982 production of 17.5 TCF. Similarly, production in the year 1990 could range from 13 to 20 TCF.

  15. VII SEMINRIO DE PESQUISAS EM ANDAMENTO DA PGET

    E-print Network

    Hanazaki, Natalia

    .............................................................................................................................................................. 14 O mapeamento de conteúdos localizados no jogo Infamous 2: Uma análise baseada em corpus

  16. CURSO DE PS-GRADUAO EM ENGENHARIA E TECNOLOGIA ESPACIAIS

    E-print Network

    CURSO DE PÓS-GRADUAÇÃO EM ENGENHARIA E TECNOLOGIA ESPACIAIS ÁREA DE CONCENTRAÇÃO EM ENGENHARIA E GERENCIAMENTO DE SISTEMAS ESPACIAIS Coordenador Acadêmico do Curso Evandro Marconi Rocco Coordenadora da Área de;2 CURSO DE PÓS-GRADUAÇÃO EM ENGENHARIA E TECNOLOGIA ESPACIAIS ÁREA DE CONCENTRAÇÃO EM ENGENHARIA E

  17. NATURAL RESOURCES ASSESSMENT

    SciTech Connect

    D.F. Fenster

    2000-12-11

    The purpose of this report is to summarize the scientific work that was performed to evaluate and assess the occurrence and economic potential of natural resources within the geologic setting of the Yucca Mountain area. The extent of the regional areas of investigation for each commodity differs and those areas are described in more detail in the major subsections of this report. Natural resource assessments have focused on an area defined as the ''conceptual controlled area'' because of the requirements contained in the U.S. Nuclear Regulatory Commission Regulation, 10 CFR Part 60, to define long-term boundaries for potential radionuclide releases. New requirements (proposed 10 CFR Part 63 [Dyer 1999]) have obviated the need for defining such an area. However, for the purposes of this report, the area being discussed, in most cases, is the previously defined ''conceptual controlled area'', now renamed the ''natural resources site study area'' for this report (shown on Figure 1). Resource potential can be difficult to assess because it is dependent upon many factors, including economics (demand, supply, cost), the potential discovery of new uses for resources, or the potential discovery of synthetics to replace natural resource use. The evaluations summarized are based on present-day use and economic potential of the resources. The objective of this report is to summarize the existing reports and information for the Yucca Mountain area on: (1) Metallic mineral and mined energy resources (such as gold, silver, etc., including uranium); (2) Industrial rocks and minerals (such as sand, gravel, building stone, etc.); (3) Hydrocarbons (including oil, natural gas, tar sands, oil shales, and coal); and (4) Geothermal resources. Groundwater is present at the Yucca Mountain site at depths ranging from 500 to 750 m (about 1,600 to 2,500 ft) below the ground surface. Groundwater resources are not discussed in this report, but are planned to be included in the hydrology section of future revisions of the ''Yucca Mountain Site Description'' (CRWMS M&O 2000c).

  18. Rural Emergency Medical Services (EMS) and Trauma

    MedlinePLUS

    ... funding section of this topic guide. Are there continuing education programs for EMS personnel? The National Highway Traffic ... provide information on licensing, testing, and certification. The Continuing Education Coordinating Board for Emergency Medical Services provides a ...

  19. EMS Division Potential Benefits of Selected

    E-print Network

    For Systems Engineering Seminar at US Navy Post Graduate School Monterrey, CA August 18, 2005 Work supported coils are stationary; there are no rotating cold seals #12;EMS Division Advanced Homopolar Motor Concept

  20. Tpicos em Processos Estocsticos: Eventos Raros,

    E-print Network

    Moreira, Carlos Gustavo

    Software Livre/Gratuito - Alejandro C. Frery e Francisco Cribari-Neto · Espaços de Hardy no Disco Unitário Primeiro Curso sobre Teoria Ergódica com Aplicações - Krerley Oliveira · Uma Introdução à Simetrização em

  1. Nature, nurture and epigenetics.

    PubMed

    Crews, David; Gillette, Ross; Miller-Crews, Isaac; Gore, Andrea C; Skinner, Michael K

    2014-12-01

    Real life by definition combines heritability (e.g., the legacy of exposures) and experience (e.g. stress during sensitive or 'critical' periods), but how to study or even model this interaction has proven difficult. The hoary concept of evaluating traits according to nature versus nurture continues to persist despite repeated demonstrations that it retards, rather than advances, our understanding of biological processes. Behavioral genetics has proven the obvious, that genes influence behavior and, vice versa, that behavior influences genes. The concept of Genes X Environment (G X E) and its modern variants was viewed as an improvement on nature-nurture but has proven that, except in rare instances, it is not possible to fractionate phenotypes into these constituent elements. The entanglement inherent in terms such as nature-nurture or G X E is a Gordian knot that cannot be dissected or even split. Given that the world today is not what it was less than a century ago, yet the arbitrator (differential survival and reproduction) has stayed constant, de novo principles and practices are needed to better predict what the future holds. Put simply, the transformation that is now occurring within and between individuals as a product of global endocrine disruption is quite independent of what has been regarded as evolution by selection. This new perspective should focus on how epigenetic modifications might revise approaches to understand how the phenotype and, in particular its components, is shaped. In this review we summarize the literature in this developing area, focusing on our research on the fungicide vinclozolin. PMID:25102229

  2. World Natural Gas Model

    Energy Science and Technology Software Center (ESTSC)

    1994-12-01

    RAMSGAS, the Research and Development Analysis Modeling System World Natural Gas Model, was developed to support planning of unconventional gaseoues fuels research and development. The model is a scenario analysis tool that can simulate the penetration of unconventional gas into world markets for oil and gas. Given a set of parameter values, the model estimates the natural gas supply and demand for the world for the period from 1980 to 2030. RAMSGAS is based onmore »a supply/demand framwork and also accounts for the non-renewable nature of gas resources. The model has three fundamental components: a demand module, a wellhead production cost module, and a supply/demand interface module. The demand for gas is a product of total demand for oil and gas in each of 9 demand regions and the gas share. Demand for oil and gas is forecast from the base year of 1980 through 2030 for each demand region, based on energy growth rates and price-induced conservation. For each of 11 conventional and 19 unconventional gas supply regions, wellhead production costs are calculated. To these are added transportation and distribution costs estimates associated with moving gas from the supply region to each of the demand regions and any economic rents. Based on a weighted average of these costs and the world price of oil, fuel shares for gas and oil are computed for each demand region. The gas demand is the gas fuel share multiplied by the total demand for oil plus gas. This demand is then met from the available supply regions in inverse proportion to the cost of gas from each region. The user has almost complete control over the cost estimates for each unconventional gas source in each year and thus can compare contributions from unconventional resources under different cost/price/demand scenarios.« less

  3. Nature Inspired Surface Coatings

    NASA Astrophysics Data System (ADS)

    Rubner, Michael

    2011-04-01

    Materials Scientists more and more are looking to nature for clues on how to create highly functional surface coatings with exceptional properties. The fog harvesting capabilities of the Namib Desert beetle, the beautiful iridescent colors of the hummingbird, and the super water repellant abilities of the Lotus leaf are but a few examples of the amazing properties developed over many years in the natural world. Nature also makes extensive use of the pH-dependent behavior of weak functional groups such as carboxylic acid and amine functional groups. This presentation will explore synthetic mimics to the nano- and microstructures responsible for these fascinating properties. For example, we have demonstrated a pH-induced porosity transition that can be used to create porous films with pore sizes that are tunable from the nanometer scale to the multiple micron scale. The pores of these films, either nano- or micropores, can be reversibly opened and closed by changes in solution pH. The ability to engineer pH-gated porosity transitions in heterostructured thin films has led to the demonstration of broadband anti-reflection coatings that mimic the anti-reflection properties of the moth eye and pH-tunable Bragg reflectors with a structure and function similar to that found in hummingbird wings and the Longhorn beetle. In addition, the highly textured honeycomb-like surfaces created by the formation of micron-scale pores are ideally suited for the creation of superhydrophobic surfaces that mimic the behavior of the self-cleaning lotus leaf. The development of synthetic "backbacks" on immune system cells that may one day ferry drugs to disease sites will also be discussed.

  4. Nature, Nurture and Epigenetics

    PubMed Central

    Crews, David; Gillette, Ross; Miller-Crews, Isaac; Gore, Andrea C.; Skinner, Michael K.

    2015-01-01

    Real life by definition combines heritability (e.g., the legacy of exposures) and experience (e.g. stress during sensitive or ‘critical’ periods), but how to study or even model this interaction has proven difficult. The hoary concept of evaluating traits according to nature vs. nurture continues to persist despite repeated demonstrations that it retards, rather than advances, our understanding of biological processes. Behavioral genetics has proven the obvious, that genes influences behavior and, vice versa, that behavior influences genes. The concept of Genes X Environment (G X E) and its modern variants was viewed as an improvement on nature-nurture but has proven that, except in rare instances, it is not possible to fractionate phenotypes into these constituent elements. The entanglement inherent in terms such as nature-nurture or GXE is a Gordian knot that cannot be dissected or even split. Given that the world today is not what it was less than a century ago, yet the arbitrator (differential survival and reproduction) has stayed constant, de novo principles and practices are needed to better predict what the future holds. Put simply, the transformation that is now occurring within and between individuals as a product of global endocrine disruption is quite independent of what has been regarded as evolution by selection. This new perspective should focus on how epigenetic modifications might revise approaches to understand how the phenotype and, in particular its components, is shaped. In this review we summarize the literature in this developing area, focusing on our research on the fungicide vinclozolin. PMID:25102229

  5. Marine natural products.

    PubMed

    Blunt, John W; Copp, Brent R; Keyzers, Robert A; Munro, Murray H G; Prinsep, Michèle R

    2012-02-01

    Covering: 2010. Previous review: Nat. Prod. Rep., 2011, 28, 196. This review covers the literature published in 2010 for marine natural products, with 895 citations (590 for the period January to December 2010) referring to compounds isolated from marine microorganisms and phytoplankton, green, brown and red algae, sponges, cnidarians, bryozoans, molluscs, tunicates, echinoderms, mangroves and other intertidal plants and microorganisms. The emphasis is on new compounds (1003 for 2010), together with the relevant biological activities, source organisms and country of origin. Biosynthetic studies, first syntheses, and syntheses that lead to the revision of structures or stereochemistries, have been included. PMID:22193773

  6. Modulated Natural Inflation

    E-print Network

    Rolf Kappl; Hans Peter Nilles; Martin Wolfgang Winkler

    2015-11-17

    We discuss some model-independent implications of embedding (aligned) axionic inflation in string theory. As a consequence of string theoretic duality symmetries the pure cosine potentials of natural inflation are replaced by modular functions. This leads to "wiggles" in the inflationary potential that modify the predictions with respect to CMB-observations. In particular, the scalar power spectrum deviates from the standard power law form. As a by-product one can show that trans-Planckian excursions of the aligned effective axion are compatible with the weak gravity conjecture.

  7. Modulated Natural Inflation

    E-print Network

    Kappl, Rolf; Winkler, Martin Wolfgang

    2015-01-01

    We discuss some model-independent implications of embedding (aligned) axionic inflation in string theory. As a consequence of string theoretic duality symmetries the pure cosine potentials of natural inflation are replaced by modular functions. This leads to "wiggles" in the inflationary potential that modify the predictions with respect to CMB-observations. In particular, the scalar power spectrum deviates from the standard power law form. As a by-product one can show that trans-Planckian excursions of the aligned effective axion are compatible with the weak gravity conjecture.

  8. Marine natural products.

    PubMed

    Blunt, John W; Copp, Brent R; Keyzers, Robert A; Munro, Murray H G; Prinsep, Michèle R

    2015-02-01

    This review covers the literature published in 2013 for marine natural products (MNPs), with 982 citations (644 for the period January to December 2013) referring to compounds isolated from marine microorganisms and phytoplankton, green, brown and red algae, sponges, cnidarians, bryozoans, molluscs, tunicates, echinoderms, mangroves and other intertidal plants and microorganisms. The emphasis is on new compounds (1163 for 2013), together with the relevant biological activities, source organisms and country of origin. Reviews, biosynthetic studies, first syntheses, and syntheses that lead to the revision of structures or stereochemistries, have been included. PMID:25620233

  9. Marine natural products.

    PubMed

    Blunt, John W; Copp, Brent R; Keyzers, Robert A; Munro, Murray H G; Prinsep, Michèle R

    2013-02-01

    This review covers the literature published in 2011 for marine natural products, with 870 citations (558 for the period January to December 2011) referring to compounds isolated from marine microorganisms and phytoplankton, green, brown and red algae, sponges, cnidarians, bryozoans, molluscs, tunicates, echinoderms, mangroves and other intertidal plants and microorganisms. The emphasis is on new compounds (1152 for 2011), together with the relevant biological activities, source organisms and country of origin. Biosynthetic studies, first syntheses, and syntheses that lead to the revision of structures or stereochemistries, have been included. PMID:23263727

  10. Marine natural products.

    PubMed

    Blunt, John W; Copp, Brent R; Keyzers, Robert A; Munro, Murray H G; Prinsep, Michèle R

    2014-01-17

    This review covers the literature published in 2012 for marine natural products, with 1035 citations (673 for the period January to December 2012) referring to compounds isolated from marine microorganisms and phytoplankton, green, brown and red algae, sponges, cnidarians, bryozoans, molluscs, tunicates, echinoderms, mangroves and other intertidal plants and microorganisms. The emphasis is on new compounds (1241 for 2012), together with the relevant biological activities, source organisms and country of origin. Biosynthetic studies, first syntheses, and syntheses that lead to the revision of structures or stereochemistries, have been included. PMID:24389707

  11. Artificial nature : water infrastructure and its experience as natural space

    E-print Network

    Demirta?, Fatma Asl?han, 1970-

    2000-01-01

    This work is about water infrastructure and its experience as urban and natural space. It deals with the concepts of nature/geography, technology, and the integral experiential space by analyzing water dams and reservoirs ...

  12. [Natural philosophy in medieval medicine].

    PubMed

    Riha, Ortrun

    2007-01-01

    Medieval medicine is not much interested in natural philosophy. Nevertheless, it is based upon clear methodological and epistemological principles, where the word 'nature' is used in several ways. The natural 'virtues' of things--including magical ones--are most important for therapy. Human health is influenced by stars (planets, zodiac) and seasons, and the physician has to take into account such cosmic effects. The chances of healing depend on the patients' 'nature' in relation to the power of illness. A strong nature makes medicine superfluous, an overwhelming disease cannot be beaten. Thus, medicine is limited to 'neutral' situations when supporting the patient makes his 'nature' win. PMID:18447188

  13. Natural gas monthly, April 1999

    SciTech Connect

    1999-05-06

    The Natural Gas Monthly (NGM) highlights activities, events, and analyses of interest to public and private sector organizations associated with the natural gas industry. Volume and price data are presented each month for natural gas production, distribution, consumption, and interstate pipeline activities. Producer-related activities and underground storage data are also reported. From time to time, the NGM features articles designed to assist readers in using and interpreting natural gas information. There are two feature articles in this issue: Natural gas 1998: Issues and trends, Executive summary; and Special report: Natural gas 1998: A preliminary summary. 6 figs., 28 tabs.

  14. Natural medicaments in dentistry

    PubMed Central

    Sinha, Dakshita J.; Sinha, Ashish A.

    2014-01-01

    The major objective in root canal treatment is to disinfect the entire root canal system. Cleaning, shaping, and use of antimicrobial medicaments are effective in reducing the bacterial load to some extent, but some bacteria do remain behind and multiply, causing reinfection. Taking into consideration the ineffectiveness, potential side-effects and safety concerns of synthetic drugs, the herbal alternatives for endodontic usage might prove to be advantageous. Over the past decade, interest in drugs derived from medicinal plants has markedly increased. Phytomedicine has been used in dentistry as anti-inflammatory, antibiotic, analgesic, sedative and also as endodontic irrigant. Herbal preparations can be derived from the root, leaves, seeds, stem, and flowers. The PubMed database search revealed that the reference list for natural medicaments featured 1480 articles and in dentistry 173 articles. A forward search was undertaken on the selected articles and author names. This review focuses on various natural drugs and products as well as their therapeutic applications when used as phytomedicine in dentistry. PMID:25558153

  15. Naturally Occurring Food Toxins

    PubMed Central

    Dolan, Laurie C.; Matulka, Ray A.; Burdock, George A.

    2010-01-01

    Although many foods contain toxins as a naturally-occurring constituent or, are formed as the result of handling or processing, the incidence of adverse reactions to food is relatively low. The low incidence of adverse effects is the result of some pragmatic solutions by the US Food and Drug Administration (FDA) and other regulatory agencies through the creative use of specifications, action levels, tolerances, warning labels and prohibitions. Manufacturers have also played a role by setting limits on certain substances and developing mitigation procedures for process-induced toxins. Regardless of measures taken by regulators and food producers to protect consumers from natural food toxins, consumption of small levels of these materials is unavoidable. Although the risk for toxicity due to consumption of food toxins is fairly low, there is always the possibility of toxicity due to contamination, overconsumption, allergy or an unpredictable idiosyncratic response. The purpose of this review is to provide a toxicological and regulatory overview of some of the toxins present in some commonly consumed foods, and where possible, discuss the steps that have been taken to reduce consumer exposure, many of which are possible because of the unique process of food regulation in the United States. PMID:22069686

  16. Lands and natural resources

    SciTech Connect

    Sorensen, A.K.

    1985-01-01

    The Tenth Circuit has historically played a major role in the development of Indian law. Among the court's numerous decisions affecting Indians were those involving the standard of proof in cases seeking to disestablish Indian reservations, the duty owed by the Secretary of the Interior to the Indians in the administration of oil and gas leasing on Indian lands, the effect of state gas price control acts on Indian royalties, the necessary standard of compliance with acts allowing non-Indians to obtain interests in Indian real property, the conflict between Indian sovereign immunity and the Federal Rule of Civil Procedure requiring joinder of all necessary parties to an action, and the Indians' power to tax non-Indians who develop the Indians' natural resources. Additionally, this article discusses the enforcement power of Federal Energy Regulatory Commission under the Natural Gas Act; the construction of oil and gas operating agreements as to deep geologic horizons; and finally, the consequences of conveyancing real property when a predecessor in interest has suffered due process violations in the form of defective tax sales or condemnation proceedings.

  17. Thermoacoustic natural gas liquefier

    SciTech Connect

    Swift, G.W.

    1995-06-01

    In collaboration with Cryenco Inc. and NIST-Boulder, we intend to develop a natural gas-powered natural-gas liquefier which has absolutely no moving parts and requires no electrical power. It will have high efficiency, remarkable reliability, and low cost. Progress on the liquefier to be constructed at Cryenco continues satisfactorily. The thermoacoustic driver is still ahead of the pulse tube refrigerator, because of NIST`s schedule. We completed the thermoacoustics design in the fall of 1994, with Los Alamos providing physics input and checks of all aspects, and Cryenco providing engineering to ASME code, drafting, etc. Completion of this design represents a significant amount of work, especially in view of the many unexpected problems encountered. Meanwhile, Cryenco and NIST have almost completed the design of the pulse tube refrigerator. At Los Alamos, we have assembled a half-size scale model of the thermoacoustic portion of the 500 gal/day TANGL. This scale model will enable easy experimentation in harmonic suppression techniques, new stack geometries, new heat-exchanger geometries, resonator coiling, and other areas. As of March 1995, the scale model is complete and we are performing routine debugging tests and modifications.

  18. Nature's loss, Immunologists gain?

    PubMed

    Aluvihare

    2000-01-01

    Nature Reviews Molecular Cell Biology Nature Publishing Group (2000). ISSN 1471-0072. Monthly First there was Annual Reviews, then came the monthly Elsevier Trends Journals, both of which try to identify hot topics in their chosen fields. The Current Opinion journals followed several years later, and Current Opinion in Cell Biology is presently one of the highest 'impact factor' review journals, with a distinguished board of editors and advisors and a systematic approach to regular coverage of the major fields of cell biology. Important topics are visited once a year, whether or not something specially exciting happened in the last 12 months. Add to this list Seminars in Cell and Developmental Biology, the FASEB journal and the countless minireviews in 'real' journals, and you begin to wonder how anyone finds any time for doing experiments, or indeed reading the primary literature. So, into this already crowded field arrive three important newcomers: Nature Reviews in Molecular Cell Biology, Genetics, and Neurosciences, of which the first two will probably interest readers of Journal of Cell Science the most. Backed by the name and money of Nature and edited by experienced Nature staff, it is hard to see how these publications can possibly do other than succeed with writers and readers alike. What's inside the first issue? The cover of Nature Reviews in Molecular Cell Biology presents a 3-colour montage of a blue cell nucleus surrounded by splotches of green GPI-anchored GFP overlaid by orange actin stress fibres that seem to come from somewhere else. This image trails a comprehensive review from Kai Simons and Derek Toomre about Lipid Rafts. There are another five major review articles: calcium puffs and sparks, rings around DNA, HIV inhibitors, kinesin and the circadian clock provide a rich and varied mix of topics from authors who know what they're talking about. Surrounding this core is an entertaining mixture of 'highlights' at the front: news and views about a well-chosen selection of recent articles in the primary literature written by the three editors. These struck me as striking slightly too jokey a style. It is a terrible temptation and mistake in this kind of piece, I think, to equate lightheartedness with clarity. The sugar coating is more likely to irritate than enlighten. I would also question the wisdom, if it is indeed a policy, of only allowing editors to write in this section. I'm all for experienced writers writing, but I think I would prefer the variety of voice and authority evinced by the parental Nature News and Views. After the main reviews comes a section entitled 'perspectives', which include a 'Timeline' piece on Hayflick and his limit by Jerry Shay and Woodring Wright that I very much enjoyed, and a review (or Opinion) about cancer from Judah Folkman, Philip Hahnfeldt and Lynn Hlatky. In their own words, "the impetus for this Opinion article centres on the increasing awareness of the heterogeneity and instability of the cancer genome [. I]t is possible that suppressing this degenerative process may itself comprise an alternative constraint-based paradigm." The authors' fondness for portentous phrases of this kind rather spoiled their discussion for me. I also had trouble with an article on molecular computing. PCR reactions can solve the travelling salesman problem, it seems, but extremely slowly compared to a proper computer. The magazine has a nice heft to it, and is attractively designed and presented in glossy colour, although the main font is small enough to make reading difficult for your middle-aged reviewer in a particularly heavily overcast and rainy week in London. A first issue is supposed to be a kind of showcase, but if they can keep this up, the editors will surely have a success on their hands and you will probably be obliged to take out a personal subscription (£85), or persuade your library to part with £565. That's slightly cheaper than TiBS and a lot cheaper than Current Opinion in Cell Biology, both of which will have to run faster if they want to stay in the s

  19. Natural ventilation generates building form

    E-print Network

    Chen, Shaw-Bing

    1996-01-01

    Natural ventilation is an efficient design strategy for thermal comfort in hot and humid climates. The building forms can generate different pressures and temperatures to induce natural ventilation. This thesis develops a ...

  20. Natural Gas Exports from Iran

    EIA Publications

    2012-01-01

    This assessment of the natural gas sector in Iran, with a focus on Iran’s natural gas exports, was prepared pursuant to section 505 (a) of the Iran Threat Reduction and Syria Human Rights Act of 2012 (Public Law No: 112-158). As requested, it includes: (1) an assessment of exports of natural gas from Iran; (2) an identification of the countries that purchase the most natural gas from Iran; (3) an assessment of alternative supplies of natural gas available to those countries; (4) an assessment of the impact a reduction in exports of natural gas from Iran would have on global natural gas supplies and the price of natural gas, especially in countries identified under number (2); and (5) such other information as the Administrator considers appropriate.

  1. Natural products: Emulation illuminates biosynthesis

    NASA Astrophysics Data System (ADS)

    Mercer, Jaron A. M.; Burns, Noah Z.

    2015-11-01

    A concise synthesis of the fungal natural product epicolactone suggests that this highly stereochemically complex yet racemic natural product may come from a cascade reaction between two polyhydroxylated arenes.

  2. Flavor mediation delivers natural SUSY

    E-print Network

    Craig, Nathaniel

    If supersymmetry (SUSY) solves the hierarchy problem, then naturalness considerations coupled with recent LHC bounds require non-trivial superpartner flavor structures. Such “Natural SUSY” models exhibit a large mass ...

  3. Natural hazard losses and acceptable risk criteria

    NASA Astrophysics Data System (ADS)

    Khaleghy Rad, M.; Evans, S. G.; Nadim, F.; Lacasse, S.

    2009-12-01

    The criteria for the definition of acceptable risk to the lives of members of a society (commonly called societal risk) resulting from exposure to natural hazards are based in most countries on the frequency and characteristics of industrial accidents, e.g., nuclear power plants. However, historical records indicate that the frequency of natural hazard events is much higher than those involved in industrial hazards and their consequences are far greater. We find that the risk from natural hazards is unacceptable in the current risk criteria framework, i.e., they are an unacceptable risk with respect to the acceptable risk criteria based on the frequency and consequences of industrial accidents. According to a definition of risk, there are two main components; first, the probability of occurrence of the hazard and second, the consequence of the hazard. The occurrence of industrial accident events (hazard) can be controlled to a large extent in contrast to that of natural hazards. However, we can control natural hazard risk, in some cases by engineering solutions to control hazard and by reducing the consequences of the events by mitigating, risk management, warning and monitoring techniques. With reference to natural hazards reducing risk is mainly effected by reducing consequences. The FN-curve is a tool commonly used in societal risk assessment. It is built on a series of frequency-loss data associated with a particular process in a given period of time. It is also used to set acceptable risk criteria for countries or sub-national jurisdictions, by defining slopes and intercepts for plots of a particular (or group of) processes. The intercept of the acceptable risk curve is usually arbitrarily defined in the order of 10-7-10-1 deaths per year, and the slope criteria is based on an adopted aversion factor of the society to accident and disaster losses.The imposed slope criteria is usually between -1 and -2 whereas the slope of FN-curves based on real natural disaster data is <-1. Efforts have been made to make FN-curves more practical since there have been persistent difficulties in interpreting the curves dating back to their initial use in the 1960s. To this end we introduce a normalization procedure to the consequence part of the FN-curve. This involves taking N, number of fatalities and dividing N by the population exposed to the event. Since the population of regions are different, different societal risk results from differential exposure. We illustrate the use of the normalized consequence approach by analyzing losses from natural hazards in 32 European countries derived from the EM-DAT database. We examine historical losses in relation to acceptable risk criteria and find that risks defined in the modified FN curves far exceed those defined in industrial-accident-based acceptable risk criteria in current European use.

  4. Natural Antibodies Against Sialoglycans.

    PubMed

    Shilova, Nadezhda; Huflejt, Margaret E; Vuskovic, Marko; Obukhova, Polina; Navakouski, Maksim; Khasbiullina, Nailya; Pazynina, Galina; Galanina, Oxana; Bazhenov, Alexey; Bovin, Nicolai

    2015-01-01

    Natural antibodies, part of the innate immunity system, are produced at strictly regulated levels in normal sera without immunization and thus are part of the innate immune system. The best studied natural antibodies are those directed against blood group antigens A and B and xeno-antigens including glycolylneuraminic acid containing Hanganutziu-Deicher (HD) glycolipid. Abnormal levels of anti-glycan antibodies were found in a number of pathologies. In many cases pathological antibodies are known to bind gangliosides. The genesis of anti-glycan antibodies in healthy humans and the reasons for their changes in pathologies are poorly understood. With a growing interest in their diagnostic applications, it is important to determine the carbohydrate structures that are recognized by antibodies present in the circulation of healthy individuals. We tested a large number of healthy donors using a printed glycan array (PGA) in a microchip format. The PGA contained ~300 glycans, representing mostly normal mammalian structures of glycoproteins and glycolipids, and many of the structures presented are biologically relevant sialylated motifs. As revealed by PGA, the sera interacted with at least 70 normal human glycans. With only few exceptions, antibodies recognizing sialosides have not been identified. Moderate levels of antibodies and moderate variability were observed in the case of SiaT n and its glycolyl variant. Unexpectedly, we found minimal antibody titer directed against Neu5Gc? and the trisaccharide Neu5Gc?2-6Gal?1-4GlcNAc, although this form of neuraminic acid does not occur naturally in humans. Antibodies recognizing sialosides in unnatural ?-configuration have been detected and confirmed Springer's paradigm that circulating antibodies represent a reaction against bacteria. Gram-negative bacteria contain LPS with ?KDN and/or ?KDO which are very close analogs of Neu5Ac that are found in ?-connected form. Antibodies against the biantennary N-glycan chain, (Neu5Ac?2-6Gal?1-4GlcNAc?1-2Man?)2-3,6-Man?1-4GlcNAc?1-4GlcNAc were never observed and similarly we never saw antibodies directed against the SiaLe(a)/SiaLe (x) motifs. Anti-sialoglycan antibodies can be masked with gangliosides: for example, we observe about a five times higher level of anti-GD3 in purified total IgG compared to the same concentration of total Ig in the composition of native serum. For several antibodies we observed anomalous binding in diluted sera, namely, the signals towards sialylated glycans were increased in the PGA if diluted sera were used. PMID:24037491

  5. National Energy Efficiency Evaluation, Measurement and Verification (EM&V) Standard: Scoping Study of Issues and Implementation Requirements

    SciTech Connect

    Schiller Consulting, Inc.; Schiller, Steven R.; Goldman, Charles A.; Galawish, Elsia

    2011-02-04

    This report is a scoping study that identifies issues associated with developing a national evaluation, measurement and verification (EM&V) standard for end-use, non-transportation, energy efficiency activities. The objectives of this study are to identify the scope of such a standard and define EM&V requirements and issues that will need to be addressed in a standard. To explore these issues, we provide and discuss: (1) a set of definitions applicable to an EM&V standard; (2) a literature review of existing guidelines, standards, and 'initiatives' relating to EM&V standards as well as a review of 'bottom-up' versus 'top-down' evaluation approaches; (3) a summary of EM&V related provisions of two recent federal legislative proposals (Congressman Waxman's and Markey's American Clean Energy and Security Act of 2009 and Senator Bingaman's American Clean Energy Leadership Act of 2009) that include national efficiency resource requirements; (4) an annotated list of issues that that are likely to be central to, and need to be considered when, developing a national EM&V standard; and (5) a discussion of the implications of such issues. There are three primary reasons for developing a national efficiency EM&V standard. First, some policy makers, regulators and practitioners believe that a national standard would streamline EM&V implementation, reduce costs and complexity, and improve comparability of results across jurisdictions; although there are benefits associated with each jurisdiction setting its own EM&V requirements based on their specific portfolio and evaluation budgets and objectives. Secondly, if energy efficiency is determined by the US Environmental Protection Agency to be a Best Available Control Technology (BACT) for avoiding criteria pollutant and/or greenhouse gas emissions, then a standard can be required for documenting the emission reductions resulting from efficiency actions. The third reason for a national EM&V standard is that such a standard is likely to be required as a result of future federal energy legislation that includes end-use energy efficiency, either as a stand-alone energy-efficiency resource standard (EERS) or as part of a clean energy or renewable energy standard. This study is focused primarily on this third reason and thus explores issues associated with a national EM&V standard if energy efficiency is a qualifying resource in federal clean energy legislation. Developing a national EM&V standard is likely to be a lengthy process; this study focuses on the critical first step of identifying the issues that must be addressed in a future standard. Perhaps the most fundamental of these issues is 'how good is good enough?' This has always been the fundamental issue of EM&V for energy efficiency and is a result of the counter-factual nature of efficiency. Counter-factual in that savings are not measured, but estimated to varying degrees of accuracy by comparing energy consumption after a project (program) is implemented with what is assumed to have been the consumption of energy in the absence of the project (program). Therefore, the how good is good enough question is a short version of asking how certain does one have to be of the energy savings estimate that results from EM&V activities and is that level of certainty properly balanced against the amount of effort (resources, time, money) that is utilized to obtain that level of certainty. The implication is that not only should energy efficiency investments be cost-effective, but EM&V investments should consider risk management principles and thus also balance the costs and value of information derived from EM&V (EM&V should also be cost-effective).

  6. Natural gas monthly, June 1997

    SciTech Connect

    1997-06-01

    The Natural Gas Monthly (NGM) highlights activities, events, and analyses of interest to public and private sector organizations associated with the natural gas industry. Volume and price data are presented each month for natural gas production, distribution, consumption, and interstate pipeline activities. Producer-related activities and underground storage data are also reported. From time to time, the NGM features articles designed to assist readers in using and interpreting natural gas information. 6 figs., 24 tabs.

  7. Natural gas monthly, November 1995

    SciTech Connect

    1995-12-05

    The Natural Gas Monthly (NGM) highlights activities, events, and analyses of interest to public and private sector organizations associated with the natural gas industry. Volume and price data are presented each month for natural gas production, distribution, consumption, and interstate pipeline activities. Producer-related activities and underground storage data are also reported. From time to time, the NGM features articles designed to assist readers in using and interpreting natural gas information.

  8. Natural Gas Monthly, March 1996

    SciTech Connect

    1996-03-25

    The Natural Gas Monthly (NGM) highlights activities, events, and analyses of interest to public and private sector organizations associated with the natural gas industry. Volume and price data are presented each month for natural gas production, distribution, consumption, and interstate pipeline activities. Producer-related activities and underground storage data are also reported. From time to time, the NGM features articles designed to assist readers in using and interpreting natural gas information.

  9. Natural gas monthly: December 1993

    SciTech Connect

    Not Available

    1993-12-01

    The Natural Gas Monthly (NGM) highlights activities, events, and analyses of interest to public and private sector organizations associated with the natural gas industry. Volume and price data are presented each month for natural gas production, distribution, consumption, and interstate pipeline activities. Producer-related activities and underground storage data are also reported. Articles are included which are designed to assist readers in using and interpreting natural gas information.

  10. Natural gas monthly, June 1998

    SciTech Connect

    1998-06-01

    The Natural Gas Monthly (NGM) highlights activities, events, and analyses of interest to public and private sector organizations associated with the natural gas industry. Volume and price data are presented each month for natural gas production, distribution, consumption, and interstate pipeline activities. Producer-related activities and underground storage data are also reported. From time to time, the NGM features articles designed to assist readers in using and interpreting natural gas information. 6 figs., 27 tabs.

  11. Natural gas monthly, July 1994

    SciTech Connect

    Not Available

    1994-07-20

    The Natural Gas Monthly (NGM) highlights activities, events, and analyses of interest to public and private sector organizations associated with the natural gas industry. Volume and price data are presented each month for natural gas production, distribution, consumption, and interstate pipeline activities. Producer-related activities and underground storage data are also reported. From time to time, the NGM features articles designed to assist readers in using and interpreting natural gas information.

  12. Natural gas monthly, August 1994

    SciTech Connect

    Not Available

    1994-08-24

    The Natural Gas Monthly (NGM) highlights activities, events, and analyses of interest to public and private sector organizations associated with the natural gas industry. Volume and price data are presented each month for natural gas production, distribution, consumption, and interstate pipeline activities. Producer-related activities and underground storage data are also reported. From time to time, the NGM features articles designed to assist readers in using and interpreting natural gas information.

  13. Natural gas monthly, July 1993

    SciTech Connect

    Not Available

    1993-07-27

    The Natural Gas Monthly NGM highlights activities, events, and analyses of interest to public and private sector organizations associated with the natural gas industry. Volume and price data are presented each month for natural gas production, distribution, consumption, and interstate pipeline activities. Producer-related activities and underground storage data are also reported. From time to time, the NGM features articles designed to assist readers in using and interpreting natural gas information.

  14. Natural gas monthly, July 1998

    SciTech Connect

    1998-07-01

    The Natural Gas Monthly (NGM) highlights activities, events, and analyses of interest to public and private sector organizations associated with the natural gas industry. Volume and price data are presented each month for natural gas production, distribution, consumption, and interstate pipeline activities. Producer-related activities and underground storage data are also reported. From time to time, the NGM features articles designed to assist readers in using and interpreting natural gas information. 6 figs., 25 tabs.

  15. Natural electromagnetic waveguide structures based on myelin sheath in the neural system

    E-print Network

    Jiongwei Xue; Shengyong Xu

    2012-10-08

    The saltatory propagation of action potentials on myelinated axons is conventionally explained by the mechanism employing local circuit ionic current flows between nodes of Ranvier. Under this framework, the myelin sheath with up to 100 layers of membrane only serves as the insulating shell. The speed of action potentials is measured to be as fast as 100 m/s on myelinated axons, but ions move in fluids at just 100 nm/s in a 1 V/m electric field. We show here the action potentials, in the form of electromagnetic (EM) pulses, can propagate in natural EM waveguide structures formed by the myelin sheath merged in fluids. The propagation time is mainly cost on the duration for triggering EM pulses at nodes of Ranvier. The result clearly reveals the evolution of axons from the unmyelinated to the myelinated, which has remarkably enhanced the propagation efficiency by increasing the thickness of myelin sheath.

  16. New probe of naturalness.

    PubMed

    Craig, Nathaniel; Englert, Christoph; McCullough, Matthew

    2013-09-20

    Any new scalar fields that perturbatively solve the hierarchy problem by stabilizing the Higgs boson mass also generate new contributions to the Higgs boson field-strength renormalization, irrespective of their gauge representation. These new contributions are physical, and in explicit models their magnitude can be inferred from the requirement of quadratic divergence cancellation; hence, they are directly related to the resolution of the hierarchy problem. Upon canonically normalizing the Higgs field, these new contributions lead to modifications of Higgs couplings that are typically great enough that the hierarchy problem and the concept of electroweak naturalness can be probed thoroughly within a precision Higgs boson program. Specifically, at a lepton collider this can be achieved through precision measurements of the Higgs boson associated production cross section. This would lead to indirect constraints on perturbative solutions to the hierarchy problem in the broadest sense, even if the relevant new fields are gauge singlets. PMID:24093250

  17. Natural dispersion revisited.

    PubMed

    Johansen, Øistein; Reed, Mark; Bodsberg, Nils Rune

    2015-04-15

    This paper presents a new semi-empirical model for oil droplet size distributions generated by single breaking wave events. Empirical data was obtained from laboratory experiments with different crude oils at different stages of weathering. The paper starts with a review of the most commonly used model for natural dispersion, which is followed by a presentation of the laboratory study on oil droplet size distributions formed by breaking waves conducted by SINTEF on behalf of the NOAA/UNH Coastal Response Research Center. The next section presents the theoretical and empirical foundation for the new model. The model is based on dimensional analysis and contains two non-dimensional groups; the Weber and Reynolds number. The model was validated with data from a full scale experimental oil spill conducted in the Haltenbanken area offshore Norway in July 1982, as described in the last section of the paper. PMID:25752537

  18. Nature Neuroscience Review

    PubMed Central

    Maze, Ian; Shen, Li; Zhang, Bin; Garcia, Benjamin A.; Shao, Ningyi; Mitchell, Amanda; Sun, HaoSheng; Akbarian, Schahram; Allis, C. David; Nestler, Eric J.

    2014-01-01

    Over the past decade, rapid advances in epigenomics research have extensively characterized critical roles for chromatin regulatory events during normal periods of eukaryotic cell development and plasticity, as well as part of aberrant processes implicated in human disease. Application of such approaches to studies of the central nervous system (CNS), however, is more recent. Here, we provide a comprehensive overview of currently available tools to analyze neuroepigenomics data, as well as a discussion of pending challenges specific to the field of neuroscience. Integration of numerous unbiased genome-wide and proteomic approaches will be necessary to fully understand the neuroepigenome and the extraordinarily complex nature of the human brain. This will be critical to the development of future diagnostic and therapeutic strategies aimed at alleviating the vast array of heterogeneous and genetically distinct disorders of the CNS. PMID:25349914

  19. Dengue fever: natural management.

    PubMed

    Qadir, Muhammad Imran; Abbas, Khizar; Tahir, Madeha; Irfan, Muhammad; Raza Bukhari, Syeda Fiza; Ahmed, Bilal; Hanif, Muhammad; Rasul, Akhtar; Ali, Muhammad

    2015-03-01

    Dengue fever is caused by the mosquito-borne dengue virus (DENV) serotypes 1-4, and is the most common arboviral infection of humans in subtropical and tropical regions of the world. Dengue virus infections can present with a spacious range of clinical signs, from a mild feverish illness to a life-threatening shock syndrome. Till now, there is no approved vaccine or drug against this virus. Therefore, there is an urgent need of development of alternative solutions for dengue. Several plant species have been reported with anti-dengue activity. Many herbal/natural drugs, most of which are commonly used as nutritional components, have been used as antiviral, larvicidal, mosquitocidal and mosquito repellents that may be used against dengue. The objective of this review article was to provide current approaches for the treatment and management/prevention of dengue fever by targeting viral proteins involved in replication cycle of the virus and different developmental stages of mosquito. PMID:25730815

  20. Liquefied Natural Gas Transfer

    NASA Technical Reports Server (NTRS)

    1980-01-01

    Chicago Bridge & Iron Company's tanks and associated piping are parts of system for transferring liquefied natural gas from ship to shore and storing it. LNG is a "cryogenic" fluid meaning that it must be contained and transferred at very low temperatures, about 260 degrees below Fahrenheit. Before the LNG can be pumped from the ship to the storage tanks, the two foot diameter transfer pipes must be cooled in order to avoid difficulties associated with sharp differences of temperature between the supercold fluid and relatively warm pipes. Cooldown is accomplished by sending small steady flow of the cryogenic substance through the pipeline; the rate of flow must be precisely controlled or the transfer line will be subjected to undesirable thermal stress.

  1. Nature . . . an environmental yardstick

    USGS Publications Warehouse

    Pecora, William T.

    1976-01-01

    To one who has spent his professional career in geologic science, conservation always has had special meaning. In the measurements so necessary to his work the geologist develops an integrity in the use of numbers and in the qualifications attending the validity of numbers. Scientific analysis of geologic events and sequence develops a keen sense of what is coincidental, correlative, and consequential. The geologist applies his science in evaluating hazards to man as natural catastrophes and/or benefits to man such as earth materials that form the resource base of his society. But more than these the geologist has acquired a deep appreciation for the planet as a whole, its inner structure, its landscape, and the living things that abound.

  2. Natural Air Purifier

    NASA Technical Reports Server (NTRS)

    1993-01-01

    NASA environmental research has led to a plant-based air filtering system. Dr. B.C. Wolverton, a former NASA engineer who developed a biological filtering system for space life support, served as a consultant to Terra Firma Environmental. The company is marketing the BioFilter, a natural air purifier that combines activated carbon and other filter media with living plants and microorganisms. The filter material traps and holds indoor pollutants; plant roots and microorganisms then convert the pollutants into food for the plant. Most non-flowering house plants will work. After pollutants have been removed, the cleansed air is returned to the room through slits in the planter. Terra Firma is currently developing a filter that will also disinfect the air.

  3. Natural Radioactivity in Bananas

    SciTech Connect

    Zagatto, V. A. B.; Medina, N. H.; Okuno, E.; Umisedo, N. K.

    2008-08-07

    The content of {sup 40}K natural radionuclide in bananas (Musa sapientum) from the Vale do Ribeira region, Sao Paulo, Brazil, has been measured. We have collected several samples of bananas prata and nanica, its peels, leaves, and also different soils where the banana tree was planted, such as soil with a standard amount of fertilizer, the fertilizer itself and also soil without fertilizer for comparison. We have used the gamma-ray spectroscopy technique with a NaI(T1) crystal inside a 12 cm thick lead shield to detect the gamma-radiation. The results indicate that only part of the available potassium is absorbed by the plant, which is mainly concentrated in the banana peel.

  4. Natural fertility and longevity.

    PubMed

    Gagnon, Alain

    2015-05-01

    Much empirical work suggests an association between fertility patterns and longevity. I review this association, focusing on natural fertility populations and emphasizing the role of both the timing and the intensity of fertility. Overall, it appears that although age at last reproduction routinely correlates with post-reproductive longevity, suggesting a slower rate of senescence among late fertile women, the same is not true for age at first reproduction and parity. I discuss some of the conceptual and methodologic issues, as well as the sources of the biases, that have been a persistent feature of this body of research. I conclude by suggesting avenues of research that could be initiated or pursued in the area. PMID:25934597

  5. US crude oil, natural gas, and natural gas liquids reserves

    SciTech Connect

    Not Available

    1990-10-05

    This report presents estimates of proved reserves of crude oil, natural gas, and natural gas liquids as of December 31, 1989, and production volumes for the year 1989 for the total United States and for selected states and state sub-divisions. Estimates are presented for the following four categories of natural gas: total gas (wet after lease separation), its two major components (nonassociated and associated-dissolved gas), and total dry gas (wet gas adjusted for the removal of liquids at natural gas processing plants). In addition, two components of natural gas liquids, lease condensate and natural gas plant liquids, have their reserves and production reported separately. Also included is information on indicated additional crude oil reserves and crude oil, natural gas, and lease condensate reserves in nonproducing reservoirs. 28 refs., 9 figs., 15 tabs.

  6. Nature and Nationhood: Danish Perspectives

    ERIC Educational Resources Information Center

    Schnack, Karsten

    2009-01-01

    In this paper, I shall discuss Danish perspectives on nature, showing the interdependence of conceptions of "nature" and "nationhood" in the formations of a particular cultural community. Nature, thus construed, is never innocent of culture and cannot therefore simply be "restored" to some pristine, pre-lapsarian state. On the other hand,…

  7. BREAKTHROUGHS College of Natural Resources

    E-print Network

    Wildermuth, Mary C

    BREAKTHROUGHS ® College of Natural Resources A Magazine for Alumni and Friends of the College of Natural Resources, University of California, BerkeleySpring 2001 VOLUME 7, NUMBER 1 the art #12;11 THE ART OF TEACHING Teaching is as important as research in the College of Natural Resources. Whether standing before

  8. Children's Moral Relationships with Nature.

    ERIC Educational Resources Information Center

    Kahn, Peter H., Jr.; McCoy, Ann

    Two studies of the development of children's moral relationships with nature addressed such questions as: (1) What does it mean to say that we have an obligation not to harm the natural environment? (2) Does the natural environment feel pain? (3) Does it have rights? or (4) Is moral obligation an inappropriate construct by which to understand the…

  9. PROTECTING PERSONS AFFECTED BY NATURAL

    E-print Network

    Spirtes, Peter

    PROTECTING PERSONS AFFECTED BY NATURAL DISASTERS IASC Operational Guidelines on Human Rights and Natural Disasters IASC Inter-Agency Standing Committee #12;Published by: Brookings-Bern Project-Agency Standing Committee PROTECTING PERSONS AFFECTED BY NATURAL DISASTERS IASC Operational Guidelines on Human

  10. Natural gas monthly, November 1998

    SciTech Connect

    1998-11-01

    The Natural Gas Monthly (NGM) highlights activities, events, and analyses of interest to public and private sector organizations associated with the natural gas industry. Volume and price data are presented each month for natural gas production, distribution, consumption, and interstate pipeline activities. Producer-related activities and underground storage data are also reported. 6 figs., 27 tabs.

  11. Natural gas monthly, January 1999

    SciTech Connect

    1999-02-01

    The Natural Gas Monthly (NGM) highlights activities, events, and analyses of interest to public and private sector organizations associated with the natural gas industry. Volume and price data are presented each month for natural gas production, distribution, consumption, and interstate pipeline activities. Producer-related activities and underground storage data are also reported. 6 figs., 28 tabs.

  12. Natural gas monthly, February 1999

    SciTech Connect

    1999-02-01

    The Natural Gas Monthly (NGM) highlights activities, events, and analyses of interest to public and private sector organizations associated with the natural gas industry. Volume and price data are presented each month for natural gas production, distribution, consumption, and interstate pipeline activities. Producer-related activities and underground storage data are also reported. 6 figs., 28 tabs.

  13. Injury risks of EMS responders: evidence from the National Fire Fighter Near-Miss Reporting System

    PubMed Central

    Taylor, Jennifer A; Davis, Andrea L; Barnes, Brittany; Lacovara, Alicia V; Patel, Reema

    2015-01-01

    Objectives We analysed near-miss and injury events reported to the National Fire Fighter Near-Miss Reporting System (NFFNMRS) to investigate the workplace hazards and safety concerns of Emergency Medical Services (EMS) responders in the USA. Methods We reviewed 769 ‘non-fire emergency event’ reports from the NFFNMRS using a mixed methods approach. We identified 185 emergency medical calls and analysed their narrative text fields. We assigned Mechanism of Near-Miss/Injury and Nature of Injury codes and then tabulated frequencies (quantitative). We coded major themes regarding work hazards and safety concerns reported by the EMS responders (qualitative). Results Of the 185 emergency medical calls, the most commonly identified Mechanisms of Near-Miss/Injury to EMS responders was Assaults, followed by Struck-by Motor Vehicle, and Motor Vehicle Collision. The most commonly identified weapon used in an assault was a firearm. We identified 5 major domains of workplace hazards and safety concerns: Assaults by Patients, Risks from Motor Vehicles, Personal Protective Equipment, Relationships between Emergency Responders, and Policies, Procedures and Practices. Conclusions Narrative text from the NFFNMRS is a rich source of data that can be analysed quantitatively and qualitatively to provide insight into near-misses and injuries sustained by EMS responders. Near-miss reporting systems are critical components for occupational hazard surveillance. PMID:26068510

  14. Natural Gas Monthly, October 1993

    SciTech Connect

    Not Available

    1993-11-10

    The (NGM) Natural Gas Monthly highlights activities, events, and analyses of interest to public and private sector organizations associated with the natural gas industry. Volume and price data are presented each month for natural gas production, distribution, consumption, and interstate pipeline activities. Producer-related activities and underground storage data are also reported. From time to time, the NGM features articles designed to assist readers in using and interpreting natural gas information. This month`s feature articles are: US Production of Natural Gas from Tight Reservoirs: and Expanding Rule of Underground Storage.

  15. Natural gas monthly, October 1997

    SciTech Connect

    1997-10-01

    The Natural Gas Monthly highlights activities, events, and analyses of interest to public and private sector organizations associated with the natural gas industry. Volume and price data are presented each month for natural gas production, distribution, consumption, and interstate pipeline activities. Producer-related activities and underground storage data are also reported. From time to time, the NGM features articles designed to assist readers in using and interpreting natural gas information. The feature article in this issue is a special report, ``Comparison of Natural Gas Storage Estimates from the EIA and AGA.`` 6 figs., 26 tabs.

  16. Natural gas monthly, July 1997

    SciTech Connect

    1997-07-01

    The Natural Gas Monthly (NGM) highlights activities, events, and analyses of interest to public and private sector organizations associated with the natural gas industry. Volume and price data are presented each month for natural gas production, distribution, consumption, and interstate pipeline activities. Producer-related activities and underground storage data are also reported. From time to time, the NGM features articles designed to assist readers in using and interpreting natural gas information. The feature article this month is entitled ``Intricate puzzle of oil and gas reserves growth.`` A special report is included on revisions to monthly natural gas data. 6 figs., 24 tabs.

  17. Natural gas monthly, April 1997

    SciTech Connect

    1997-04-01

    The Natural Gas Monthly (NGM) highlights activities, events, and analyses of interest to public and private sector organizations associated with the natural gas industry. Volume and price data are present3ed each month for natural gas production, distribution, consumption, and interstate pipeline activities. Producer-related activities and underground storage data are also reported. From time to time, the NGM features articles designed to assist readers in using and interpreting natural gas information. The feature article is entitled ``Natural gas pipeline and system expansions.`` 6 figs., 27 tabs.

  18. Natural gas monthly, August 1993

    SciTech Connect

    Not Available

    1993-08-25

    The Natural Gas Monthly (NGM) is prepared in the Data Operations Branch of the Reserves and Natural Gas Division, Office of Oil and Gas, Energy Information Administration (EIA), US Department of Energy (DOE). The NGM highhghts activities, events, and analyses of interest to public and private sector organizations associated with the natural gas industry. Volume and price data are presented each month for natural gas production, distribution, consumption, and interstate pipeline activities. Producer-related activities and underground storage data are also reported. From time to time, the NGM features articles designed to assist readers in using and interpreting natural gas information.

  19. Heat distribution by natural convection

    SciTech Connect

    Balcomb, J.D.

    1985-01-01

    Natural convection can provide adequate heat distribution in many situtations that arise in buildings. This is appropriate, for example, in passive solar buildings where some rooms tend to be more strongly solar heated than others or to reduce the number of heating units required in a building. Natural airflow and heat transport through doorways and other internal building apertures is predictable and can be accounted for in the design. The nature of natural convection is described, and a design chart is presented appropriate to a simple, single-doorway situation. Natural convective loops that can occur in buildings are described and a few design guidelines are presented.

  20. Natural gas monthly, September 1993

    SciTech Connect

    Not Available

    1993-09-27

    The Natural Gas Monthly (NGM) is prepared in the Data Operations Branch of the Reserves and Natural Gas Division, Office of Oil and Gas, Energy Information Administration (EIA), US Department of Energy (DOE). The NGM highlights activities, events, and analyses of interest to public and private sector organizations associated with the natural gas industry. Volume and price data are presented each month for natural gas production, distribution, consumption, and interstate pipeline activities. Producer-related activities and underground storage data are also reported. From time to time, the NGM features articles designed to assist readers in using and interpreting natural gas information.

  1. Natural gas marketing and transportation

    SciTech Connect

    Not Available

    1991-01-01

    This book covers: Overview of the natural gas industry; Federal regulation of marketing and transportation; State regulation of transportation; Fundamentals of gas marketing contracts; Gas marketing options and strategies; End user agreements; Transportation on interstate pipelines; Administration of natural gas contracts; Structuring transactions with the nonconventional source fuels credit; Take-or-pay wars- a cautionary analysis for the future; Antitrust pitfalls in the natural gas industry; Producer imbalances; Natural gas futures for the complete novice; State non-utility regulation of production, transportation and marketing; Natural gas processing agreements and Disproportionate sales, gas balancing, and accounting to royalty owners.

  2. Natural gas monthly, June 1994

    SciTech Connect

    Not Available

    1994-06-01

    The Natural Gas Monthly (NGM) highlights activities, events, and analyses of interest to public and private sector organizations associated with the natural gas industry. Volume and price data are presented each month for natural gas production, distribution, consumption, and interstate pipeline activities. Producer-related activities and underground storage data are also reported. From time to time, the NGM features articles designed to assist readers in using and interpreting natural gas information. The feature article this month is the executive summary from Natural Gas 1994: Issues and Trends. 6 figs., 31 tabs.

  3. Natural gas monthly: April 1996

    SciTech Connect

    1996-04-01

    The Natural Gas Monthly highlights activities, events, and analyses of interest to public and private sector organizations associated with the natural gas industry. Volume and price data are presented each month for natural gas production, distribution, consumption, and interstate pipeline activities. Producer-related activities and underground storage data are also reported. From time to time, the NGM features articles designed to assist readers in using and interpreting natural gas information. This month`s feature article focuses on preliminary highlights from the 1995 natural gas industry. 7 figs., 25 tabs.

  4. Natural gas monthly, May 1997

    SciTech Connect

    1997-05-01

    The Natural Gas Monthly highlights activities, events, and analyses of interest to public and private sector organizations associated with the natural gas industry. Volume and price data are presented each month for natural gas production, distribution, consumption, and interstate pipeline activities. Producer-related activities and underground storage data are also reported. From time to time, the NGM features articles designed to assist readers in using and interpreting natural gas information. The feature article this month is ``Restructuring energy industries: Lessons from natural gas.`` 6 figs., 26 tabs.

  5. Natural gas monthly, October 1996

    SciTech Connect

    1996-10-01

    The Natural Gas Monthly (NGM) is prepared in the Data Operations Branch of the Reserves and Natural Gas Division, Office of Oil and Gas, Energy Information Administration (EIA), U.S. Department of Energy (DOE). The NGM highlights activities, events, and analyses of interest to public and private sector organizations associated with the natural gas industry. Volume and price data are presented each month for natural gas production, distribution, consumption, and interstate pipeline activities. Producer-related activities and underground storage data are also reported. From time to time, the NGM features articles designed to assist readers in using and interpreting natural gas information.

  6. Natural gas monthly, May 1994

    SciTech Connect

    Not Available

    1994-05-25

    The Natural Gas Monthly (NGM) highlights activities, events, and analyses of interest to public and private sector organizations associated with the natural gas industry. Volume and price data are presented each month for natural gas production, distribution, consumption, and interstate pipeline activities. Producer-related activities and underground storage data are also reported. From time to time, the NGM features articles designed to assist readers in using and interpreting natural gas information. The featured articles for this month are: Opportunities with fuel cells, and revisions to monthly natural gas data.

  7. Natural gas monthly, June 1996

    SciTech Connect

    1996-06-24

    The natural gas monthly (NGM) highlights activities, events, and analyses of interest to public and private sector organizations associated with the natural gas industry. Volume and price data are presented each month for natural gas production, distribution, consumption, and interstate pipeline activities. Producer-related activities and underground storage data are also reported. From time to time, the NGM features articles designed to assist readers in using and interpreting natural gas information. The feature article for this month is Natural Gas Industry Restructuring and EIA Data Collection.

  8. Natural gas monthly, April 1998

    SciTech Connect

    1998-04-01

    This issue of the Natural Gas Monthly presents the most recent estimates of natural gas data from the Energy Information Administration (EIA). Estimates extend through April 1998 for many data series. The report highlights activities, events, and analyses of interest to public and private sector organizations associated with the natural gas industry. Volume and price data are presented each month for natural gas production, distribution, consumption, and interstate pipeline activities. Producer-related activities and underground storage data are also reported. From time to time, feature articles are presented designed to assist readers in using and interpreting natural gas information. This issue contains the special report, ``Natural Gas 1997: A Preliminary Summary.`` This report provides information on natural gas supply and disposition for the year 1997, based on monthly data through December from EIA surveys. 6 figs., 28 tabs.

  9. letters to nature NATURE |VOL 408 |14 DECEMBER 2000 |www.nature.com 847

    E-print Network

    Losos, Jonathan B.

    that the current number of species still falls below the speciation±extinction equilibrium. The 143 species the number of Anolis species on large islands has reached speciation± extinction equilibrium. Countsletters to nature NATURE |VOL 408 |14 DECEMBER 2000 |www.nature.com 847

  10. letters to nature NATURE |VOL 411 |24 MAY 2001 |www.nature.com 473

    E-print Network

    He, Sheng

    letters to nature NATURE |VOL 411 |24 MAY 2001 |www.nature.com 473 tunic. The large funnel tunicate was a suspension feeder, with water entering the oral siphon and being expelled through to a free cheek of a trilobite. This arrangement could indicate burial of the tunicate in situ. The presence

  11. letters to nature 614 NATURE |VOL 409 |1 FEBRUARY 2001 |www.nature.com

    E-print Network

    Eizirik, Eduardo

    letters to nature 614 NATURE |VOL 409 |1 FEBRUARY 2001 |www.nature.com acid repeat region of the A2 are based on 500 replications except for maximum likelihood (100 replications). Maximum-likelihood bootstrap a weighted-average distance approach25 with the eight partitions indicated above for the 5,708-bp data set

  12. letters to nature NATURE |VOL 406 |17 AUGUST 2000 |www.nature.com 747

    E-print Network

    letters to nature NATURE |VOL 406 |17 AUGUST 2000 |www.nature.com 747 Received 17 February; accepted 24 May 2000. 1. Cheng, A. M. & Chan, A. C. Protein tyrosine kinases in thymocyte development. Curr. Biochem. 245, 84±90 (1997). 19. Deckert, M., Tartare-Deckert, S., Couture, C., Mustelin, T. & Altman, A

  13. letters to nature 546 NATURE |VOL 414 |29 NOVEMBER 2001 |www.nature.com

    E-print Network

    Gluck, Mark

    letters to nature 546 NATURE |VOL 414 |29 NOVEMBER 2001 |www.nature.com Thus our results prove that C4 photosynthesis exists in a terres- trial plant without the dual-cell Kranz anatomy system. C4 of functions in terrestrial C4 plants has been associated only with Kranz-type leaf anatomy. B. aralocaspica

  14. letters to nature 494 NATURE |VOL 406 |3 AUGUST 2000 |www.nature.com

    E-print Network

    Vekilov, Peter

    letters to nature 494 NATURE |VOL 406 |3 AUGUST 2000 |www.nature.com 18. Friedrich, B. et al Materie (FOM)', which is ®nancially supported by the `Nederlandse Organisatie voor Wetenschappelijk for Microgravity and Materials Research, and ²Department of Chemistry, University of Alabama in Huntsville

  15. letters to nature NATURE |VOL 404 |9 MARCH 2000 |www.nature.com 171

    E-print Network

    Stephens, Britton B.

    letters to nature NATURE |VOL 404 |9 MARCH 2000 |www.nature.com 171 powder size (see Supplementary that it should be possible to achieve dense, nanostructured materials of grain size 25±50 nm by exploiting materials, in order to take advantage of their grain-size-dependent physical properties. M Methods We used

  16. Methylgermanium in natural waters

    NASA Astrophysics Data System (ADS)

    Lewis, Brent L.; Froelich, Philip N.; Andreae, Meinrat O.

    1985-01-01

    Biological methylation of metallic elements1 and the occurrence and cycling of organometals in the environment have been investigated in Japan during the 1950s and 1960s, where the ingestion of fish and shellfish contaminated with methylmercury compounds caused mercury poisoning2,3. Biomethylation ability has been demonstrated in bacteria, fungi and algae for As, Cd, Hg, Pb, Se, Sn, Te and Tl4-7. Naturally-occurring methylated species have been reported in estuaries and seawater for Sb8, As9, Ge10-13 and Sn14, although recent evidence suggests that some reports of methyltin species result from interferences by Ge and volatile sulphur compounds15. With the exception of Sb8, As9,12,16 and Ge11,12, there are no consistent estuarine or oceanic profiles for methylmetal compounds in the literature from which to judge their biogeochemical behaviour. Early investigations17-19 reported that methylgermanium species do not exist in the aquatic environment. Subsequently, we identified monomethylgermanium (MMGe) and dimethylgermanium (DMGe) in estuaries10,12, the Baltic Sea11 and the Bering and Sargasso seas13. We report here recent measurements of methylgermanium compounds in river water, estuaries, seawater and anoxic basins.

  17. Nature, Nurture, and Expertise.

    PubMed

    Plomin, Robert; Shakeshaft, Nicholas G; McMillan, Andrew; Trzaskowski, Maciej

    2014-07-01

    Rather than investigating the extent to which training can improve performance under experimental conditions ('what could be'), we ask about the origins of expertise as it exists in the world ('what is'). We used the twin method to investigate the genetic and environmental origins of exceptional performance in reading, a skill that is a major focus of educational training in the early school years. Selecting reading experts as the top 5% from a sample of 10,000 12-year-olds twins assessed on a battery of reading tests, three findings stand out. First, we found that genetic factors account for more than half of the difference in performance between expert and normal readers. Second, our results suggest that reading expertise is the quantitative extreme of the same genetic and environmental factors that affect reading performance for normal readers. Third, growing up in the same family and attending the same schools account for less than a fifth of the difference between expert and normal readers. We discuss implications and interpretations ('what is inherited is DNA sequence variation'; 'the abnormal is normal'). Finally, although there is no necessary relationship between 'what is' and 'what could be', the most far-reaching issues about the acquisition of expertise lie at the interface between them ('the nature of nurture: from a passive model of imposed environments to an active model of shaped experience'). PMID:24948844

  18. Rx: human nature.

    PubMed

    Ashraf, Nava

    2013-04-01

    Why doesn't a woman who continues to have unwanted pregnancies avail herself of the free contraception at a nearby clinic? What keeps people from using free chlorine tablets to purify their drinking water? Behavioral economics has shown us that we don't always act in our own best interests. This is as true of health decisions as it is of economic ones. An array of biases, limits on cognition, and motivations leads people all over the world to make suboptimal health choices. The good news is that human nature can also be a source of solutions. Through her studies in Zambia exploring the reasons for unwanted pregnancies and the incentives that would motivate hairdressers to sell condoms to their clients, the author has found that designing effective health programs requires more than providing accessible, affordable care; it requires understanding what makes both end users and providers tick. By understanding the cognitive processes underlying our choices and applying the tools of behavioral economics--such as commitment devices, material incentives, defaults, and tools that tap our desire to help others--it's possible to design simple, inexpensive programs that encourage good health decisions and long-term behavior change. PMID:23593771

  19. Nature's Autonomous Oscillators

    NASA Technical Reports Server (NTRS)

    Mayr, H. G.; Yee, J.-H.; Mayr, M.; Schnetzler, R.

    2012-01-01

    Nonlinearity is required to produce autonomous oscillations without external time dependent source, and an example is the pendulum clock. The escapement mechanism of the clock imparts an impulse for each swing direction, which keeps the pendulum oscillating at the resonance frequency. Among nature's observed autonomous oscillators, examples are the quasi-biennial oscillation and bimonthly oscillation of the Earth atmosphere, and the 22-year solar oscillation. The oscillations have been simulated in numerical models without external time dependent source, and in Section 2 we summarize the results. Specifically, we shall discuss the nonlinearities that are involved in generating the oscillations, and the processes that produce the periodicities. In biology, insects have flight muscles, which function autonomously with wing frequencies that far exceed the animals' neural capacity; Stretch-activation of muscle contraction is the mechanism that produces the high frequency oscillation of insect flight, discussed in Section 3. The same mechanism is also invoked to explain the functioning of the cardiac muscle. In Section 4, we present a tutorial review of the cardio-vascular system, heart anatomy, and muscle cell physiology, leading up to Starling's Law of the Heart, which supports our notion that the human heart is also a nonlinear oscillator. In Section 5, we offer a broad perspective of the tenuous links between the fluid dynamical oscillators and the human heart physiology.

  20. Nature of orchestral noise.

    PubMed

    O'Brien, Ian; Wilson, Wayne; Bradley, Andrew

    2008-08-01

    Professional orchestral musicians are at risk of exposure to excessive noise when at work. This is an industry-wide problem that threatens not only the hearing of orchestral musicians but also the way orchestras operate. The research described in this paper recorded noise levels within a professional orchestra over three years in order to provide greater insight to the orchestral noise environment; to guide future research into orchestral noise management and hearing conservation strategies; and to provide a basis for the future education of musicians and their managers. Every rehearsal, performance, and recording from May 2004 to May 2007 was monitored, with the woodwind, brass, and percussion sections monitored in greatest detail. The study recorded dBALEQ and dBC peak data, which are presented in graphical form with accompanying summarized data tables. The findings indicate that the principal trumpet, first and third horns, and principal trombone are at greatest risk of exposure to excessive sustained noise levels and that the percussion and timpani are at greatest risk of exposure to excessive peak noise levels. However, the findings also strongly support the notion that the true nature of orchestral noise is a great deal more complex than this simple statement would imply. PMID:18681585

  1. Nature, nurture, and expertise

    PubMed Central

    Plomin, Robert; Shakeshaft, Nicholas G.; McMillan, Andrew; Trzaskowski, Maciej

    2014-01-01

    Rather than investigating the extent to which training can improve performance under experimental conditions (‘what could be’), we ask about the origins of expertise as it exists in the world (‘what is’). We used the twin method to investigate the genetic and environmental origins of exceptional performance in reading, a skill that is a major focus of educational training in the early school years. Selecting reading experts as the top 5% from a sample of 10,000 12-year-old twins assessed on a battery of reading tests, three findings stand out. First, we found that genetic factors account for more than half of the difference in performance between expert and normal readers. Second, our results suggest that reading expertise is the quantitative extreme of the same genetic and environmental factors that affect reading performance for normal readers. Third, growing up in the same family and attending the same schools account for less than a fifth of the difference between expert and normal readers. We discuss implications and interpretations (‘what is inherited is DNA sequence variation’; ‘the abnormal is normal’). Finally, although there is no necessary relationship between ‘what is’ and ‘what could be’, the most far-reaching issues about the acquisition of expertise lie at the interface between them (‘the nature of nurture: from a passive model of imposed environments to an active model of shaped experience’). PMID:24948844

  2. SUSY naturalness without prejudice

    NASA Astrophysics Data System (ADS)

    Ghilencea, D. M.

    2014-05-01

    Unlike the Standard Model (SM), supersymmetric models stabilize the electroweak (EW) scale v at the quantum level and predict that v is a function of the TeV-valued SUSY parameters (??) of the UV Lagrangian. We show that the (inverse of the) covariance matrix of the model in the basis of these parameters and the usual deviation ??2 (from ?min2 of a model) automatically encode information about the "traditional" EW fine-tuning measuring this stability, provided that the EW scale v ˜mZ is indeed regarded as a function v =v(?). It is known that large EW fine-tuning may signal an incomplete theory of soft terms and can be reduced when relations among ?? exist (due to GUT symmetries, etc.). The global correlation coefficient of this matrix can help one investigate if such relations are present. An upper bound on the usual EW fine-tuning measure ("in quadrature") emerges from the analysis of the ??2 and the s-standard deviation confidence interval by using v =v(?) and the theoretical approximation (loop order) considered for the calculation of the observables. This upper bound avoids subjective criteria for the "acceptable" level of EW fine-tuning for which the model is still "natural."

  3. Optically switchable natural silk

    SciTech Connect

    Krasnov, Igor Müller, Martin; Krekiehn, Nicolai R.; Jung, Ulrich; Magnussen, Olaf M.; Krywka, Christina; Zillohu, Ahnaf U.; Strunskus, Thomas; Elbahri, Mady

    2015-03-02

    An optically active bio-material is created by blending natural silk fibers with photoisomerizable chromophore molecules—azobenzenebromide (AzBr). The material converts the energy of unpolarized light directly into mechanical work with a well-defined direction of action. The feasibility of the idea to produce optically driven microsized actuators on the basis of bio-material (silk) is proven. The switching behavior of the embedded AzBr molecules was studied in terms of UV/Vis spectroscopy. To test the opto-mechanical properties of the modified fibers and the structural changes they undergo upon optically induced switching, single fiber X-ray diffraction with a micron-sized synchrotron radiation beam was combined in situ with optical switching as well as with mechanical testing and monitoring. The crystalline regions of silk are not modified by the presence of the guest molecules, hence occupy only the amorphous part of the fibers. It is shown that chromophore molecules embedded into fibers can be reversibly switched between the trans and cis conformation by illumination with light of defined wavelengths. The host fibers respond to this switching with a variation of the internal stress. The amplitude of the mechanical response is independent of the applied external stress and its characteristic time is shorter than the relaxation time of the usual mechanical response of silk.

  4. A natural topological insulator.

    PubMed

    Gehring, P; Benia, H M; Weng, Y; Dinnebier, R; Ast, C R; Burghard, M; Kern, K

    2013-03-13

    The earth's crust and outer space are rich sources of technologically relevant materials which have found application in a wide range of fields. Well-established examples are diamond, one of the hardest known materials, or graphite as a suitable precursor of graphene. The ongoing drive to discover novel materials useful for (opto)electronic applications has recently drawn strong attention to topological insulators. Here, we report that Kawazulite, a mineral with the approximate composition Bi2(Te,Se)2(Se,S), represents a naturally occurring topological insulator whose electronic properties compete well with those of its synthetic counterparts. Kawazulite flakes with a thickness of a few tens of nanometers were prepared by mechanical exfoliation. They exhibit a low intrinsic bulk doping level and correspondingly a sizable mobility of surface state carriers of more than 1000 cm(2)/(V s) at low temperature. Based on these findings, further minerals which due to their minimized defect densities display even better electronic characteristics may be identified in the future. PMID:23438015

  5. SUPPLEMENTARY INFORMATION 1www.nature.com/nature

    E-print Network

    Jacobsen, Steve

    SUPPLEMENTARY INFORMATION 1www.nature.com/nature doi: 10.1038/nature09290 0 5 10 15 20 25 30 35 2C to wild-type. (a) The log2 ratios of genomic DNA Illumina reads from atxr5 atxr6 compared to wild- type 2C pericentromeric regions in nuclei with different ploidy levels in wild type and atxr5 atxr6 mutants were computed

  6. EMS in the Sultanate of Oman.

    PubMed

    Al-Shaqsi, Sultan Zayed Khalifah

    2009-07-01

    The Emergency Medical Services (EMS) in Oman is a relatively new project in the country. It has been developed based on the Anglo-American system of EMS. Currently, it is run by trained Omani Advanced Emergency Medical Technicians (AEMT) under the auspices of the Royal Oman Police (ROP) Ambulance Division. The system covers most of the country and responds to medical and trauma emergencies. It is state-funded and free of charge for all people in Oman. There are plans to incorporate aero-medical services into the system, to support the land ambulance service, and there are also plans to expand its coverage to the whole country by 2012. The EMS in Oman has hard challenges ahead but there are also promising plans in place to improve the system. PMID:19467757

  7. Development of Educational Resources to Include the Teaching of Astronomy in the First Years of the Basic Education. (Spanish Title: Desarrollo de Recursos Pedagógicos Para Incluir la Enseñanza de la Astronomía en los Primeros Años de la Educación Básica.) Desenvolvimento de Recursos Pedagógicos Para Inserir o Ensino de Astronomia nas Séries Iniciais do Ensino Fundamental

    NASA Astrophysics Data System (ADS)

    da Silva Morett, Samara; de Oliveira Souza, Marcelo

    2010-07-01

    In this report will be presented the development of educational resources for the presentation of concepts of astronomy in the early grades of elementary school. This material is composed by presentations developed with the use of new technological resources, by the development of experiments and by the presentation of curiosities related to this field. The experiments were constructed with low cost material in order to allow the students involved to rework them in other occasions. The material presented aims to emphasize the relationship between Astronomy and the daily life of students. The inclusion of Astronomy in elementary school is a way to demonstrate to students how this area is present in an active way in their daily lives. The classes involved in the project participated in a survey with the aim of providing information about the prior knowledge they had about topics in astronomy that were considered during the project. With the experiments conducted, and the aid of new technologies, the astronomical concepts were presented to students of 4th and 5th years of basic education of a municipal school of Campos dos Goytacazes (RJ). After the presentations new data collections were carried out with the aim of verifying the level of learning obtained and it was observed that the method used was an important tool to aid the process of teaching and learning. The project obtained good results. En este informe se presenta el desarrollo de recursos pedagógicos para la presentación de los conceptos de la astronomía en los primeros grados de la escuela primaria. Este material consiste en las presentaciones hechas con el uso de nuevos recursos tecnológicos, haciendo experimentos y análisis de objetos de interés relacionados con este ámbito. Los experimentos fueron construidos con material de bajo costo a fin de que los estudiantes involucrados podrían rehacer en otras ocasiones. El material presentado tiene como objetivo destacar la relación entre la astronomía y la vida cotidiana de los estudiantes. La inclusión de la astronomía en la escuela primaria es una manera de demostrar a los estudiantes cómo este campo está presente de forma activa en su vida cotidiana. Las clases que participan en el proyecto participaron en un estudio con el objetivo de proporcionar información a los conocimientos previos que tenían sobre los temas de la astronomía que se examinaron durante el proyecto. Con los experimentos realizados, y la ayuda de las nuevas tecnologías, conceptos astronómicos fueron presentados a los estudiantes de 4to y 5to año de la educación básica de una escuela municipal de Campos dos Goytacazes (RJ). Después de las presentaciones nuevos datos fueran colectados y se han llevado a cabo con el fin de verificar el nivel de aprendizaje alcanzado y se observó que el método utilizado fue una herramienta importante para ayudar al proceso de enseñanza y aprendizaje. El proyecto logró resultados satisfactorios. Neste trabalho será apresentado o desenvolvimento de recursos pedagógicos para a apresentação de conceitos de astronomia nas séries iniciais do ensino fundamental. Este material é composto por apresentações realizadas com o uso de novos recursos tecnológicos, pela fabricação de experimentos e a discussão de curiosidades relativas a esta área de conhecimento. Os experimentos foram construídos com material de baixo custo com o objetivo de permitir que os alunos envolvidos pudessem refazê-los em outras ocasiões. O material apresentado busca enfatizar a relação entre a astronomia e o cotidiano dos alunos. A inclusão da astronomia no ensino fundamental e uma forma de demonstrar aoestudante como esta área está presente de forma ativa em seu cotidiano. As turmas envolvidas no projeto participaram de uma pesquisa com o objetivo de obter dados relativos ao conhecimento prévio que possuíam sobre os tópicos de astronomia que foram considerados no decorrer do projeto. Com os experimentos desenvolvidos, o auxílio de novas tecnologias, foram apresentados conceitos astronômicos aos aluno

  8. Dirio Econmico -Universidades Como ser investigador em Portugal

    E-print Network

    Instituto de Sistemas e Robotica

    Diário Económico - Universidades Como é ser investigador em Portugal Autor: N.D. Editora: ST e SF - Universidades Como é ser investigador em Portugal Autor: N.D. Editora: ST e SF Id: 1646658 Data Publicação: 19

  9. 10 CFR Appendixes E-M to Part 52 - [Reserved

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 10 Energy 2 2013-01-01 2013-01-01 false E Appendixes E-M to Part 52 Energy NUCLEAR REGULATORY COMMISSION (CONTINUED) LICENSES, CERTIFICATIONS, AND APPROVALS FOR NUCLEAR POWER PLANTS Appendixes E-M to Part...

  10. 10 CFR Appendixes E-M to Part 52 - [Reserved

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 10 Energy 2 2012-01-01 2012-01-01 false E Appendixes E-M to Part 52 Energy NUCLEAR REGULATORY COMMISSION (CONTINUED) LICENSES, CERTIFICATIONS, AND APPROVALS FOR NUCLEAR POWER PLANTS Appendixes E-M to Part 52...

  11. 10 CFR Appendixes E-M to Part 52 - [Reserved

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 10 Energy 2 2011-01-01 2011-01-01 false E Appendixes E-M to Part 52 Energy NUCLEAR REGULATORY COMMISSION (CONTINUED) LICENSES, CERTIFICATIONS, AND APPROVALS FOR NUCLEAR POWER PLANTS Appendixes E-M to Part...

  12. 10 CFR Appendixes E-M to Part 52 - [Reserved

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 10 Energy 2 2010-01-01 2010-01-01 false E Appendixes E-M to Part 52 Energy NUCLEAR REGULATORY COMMISSION (CONTINUED) LICENSES, CERTIFICATIONS, AND APPROVALS FOR NUCLEAR POWER PLANTS Appendixes E-M to Part 52...

  13. 10 CFR Appendixes E-M to Part 52 - [Reserved

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 10 Energy 2 2014-01-01 2014-01-01 false E Appendixes E-M to Part 52 Energy NUCLEAR REGULATORY COMMISSION (CONTINUED) LICENSES, CERTIFICATIONS, AND APPROVALS FOR NUCLEAR POWER PLANTS Appendixes E-M to Part 52...

  14. ECE 341: Electromagnetic Fields I EM devices and systems

    E-print Network

    Connors, Daniel A.

    in material media - Electromagnetic induction - Inductance - Magnetic energy Applications: - ElectronicsECE 341: Electromagnetic Fields I EM devices and systems - Can compute and analyze potentials compositions - Can evaluate capacitance, inductance, resistance, and conductance of EM structures - Understands

  15. Risk Communication Within the EM Program

    SciTech Connect

    Edelson, M.

    2003-02-26

    The U.S. Department of Energy Environmental Management program (EM) conducts the most extensive environmental remediation effort in the world. The annual EM budgets have exceeded $6,000,000,000 for approximately ten years and EM has assumed responsibility for the cleanup of the largest DOE reservations (i.e., at Hanford, Washington, Aiken, South Carolina, and Idaho Falls, Idaho) as well as the facilities at Rocky Flats, Colorado and in Ohio. Each of these sites has areas of extensive radioactive and chemical contamination, numerous surplus facilities that require decontamination and removal, while some have special nuclear material that requires secure storage. The EM program has been criticized for being ineffective (1) and has been repeatedly reorganized to address perceived shortcomings. The most recent reorganization was announced in 2001 to become effective at the beginning of the 2003 Federal Fiscal Year (i.e., October 2002). It was preceded by a ''top to bottom'' review (TTBR) of the program (2) that identified several deficiencies that were to be corrected as a result of the reorganization. One prominent outcome of the TTBR was the identification of ''risk reduction'' as an organizing principle to prioritize the activities of the new EM program. The new program also sought to accelerate progress by identifying a set of critical activities at each site that could be accelerated and result in more rapid site closure, with attendant risk, cost, and schedule benefits. This paper investigates how the new emphasis on risk reduction in the EM program has been communicated to EM stakeholders and regulators. It focuses on the Rocky Flats Environmental Technology Site (RFETS) as a case study and finds that there is little evidence for a new emphasis on risk reduction in EM communications with RFETS stakeholders. Discussions between DOE and RFETS stakeholders often refer to ''risk,'' but the word serves as a placeholder for other concepts. Thus ''risk'' communication at RFETS is lively and involves important issues, but often does not inform participants about true ''risk reduction.''

  16. Diffusion in natural ilmenite

    NASA Astrophysics Data System (ADS)

    Stenhouse, Iona; O'Neill, Hugh; Lister, Gordon

    2010-05-01

    Diffusion rates in natural ilmenite of composition Fe0.842+ Fe0.163+Mn0.07Mg0.01Ti 0.92O3 from the Vishnevye Mountains (Urals, Russia) have been measured at 1000° C. Experiments were carried out in a one atmosphere furnace with oxygen fugacity controlled by flow of a CO-CO2 gas mixture, over a period of four hours. The diffusant source was a synthetic ilmenite (FeTiO3) powder doped with trace amounts of Mg, Co, Ni, Zr, Hf, V, Nb, Ta, Al, Cr, Ga and Y. Since, the natural ilmenite crystal contained Mn it was also possible to study diffusion of Mn from the ilmenite crystal. The experiments were analysed using the electron microprobe and scanning laser ablation ICP-MS. Diffusion profiles were measured for Al, Mg, Mn, Co, Ni, Ga, and Y. Diffusion of Cr, Hf, Zr, V, Nb and Ta was too slow to allow diffusion profiles to be accurately measured for the times and temperatures studied so far. The preliminary results show that diffusion in ilmenite is fast, with the diffusivity determined in this study on the order of 10-13 to 10-16 m2s-1. For comparison, Chakraborty (1997) found interdiffusion of Fe and Mg in olivine at 1000° C on the order of 10-17 to 10-18m2s-1 and Dieckmann (1998) found diffusivity of Fe, Mg, Co in magnetite at 1200° C to be on the order of 10-13 to 10-14 m2s-1. The order in which the diffusivity of the elements decreases is Mn > Co > Mg ? Ni > Al ? Y ? Ga, that is to say that Mn diffuses the fastest and Ga the slowest. Overall, this study intends to determine diffusion parameters such as frequency factor, activation energy and activation volume as a function of temperature and oxygen fugacity. This research is taking place in the context of a larger study focusing on the use of the garnet-ilmenite system as a geospeedometer. Examination of the consequences of simultaneous diffusion of multiple elements is a necessity if we are to develop an understanding of the crystal-chemical controls on diffusion (cf Spandler & O'Neill, in press). Chakraborty, S. (1997). Rates and mechanisms of Fe-Mg interdiffusion in olivine at 980° C -1300° C. Journal of geophysical research 102 (B6) p.12317-12331. Dieckmann, R. (1998). Point defects and transport in non-stoichiometric oxides: solved and unsolved problems. Journal of Physics and Chemistry of Solids 59 (4) p. 507-525. Spandler, C., O'Neill, H. St. C. (in press). Diffusion and partition coefficients of minor and trace elements in San Carlos olivine at 1300° C with some geochemical implications. Contributions to Mineralogy and Petrology doi: 10.1007/s00410-009-0456-8.

  17. Heat distribution by natural convection

    SciTech Connect

    Balcomb, J.D.

    1985-01-01

    Natural convection can provide adequate heat distribution in many situations that arise in buildings. This is appropriate, for example, in passive solar buildings where some rooms tend to be more strongly solar heated than others. Natural convection can also be used to reduce the number of auxiliary heating units required in a building. Natural airflow and heat transport through doorways and other internal building apertures are predictable and can be accounted for in the design. The nature of natural convection is described, and a design chart is presented appropriate to a simple, single-doorway situation. Experimental results are summarized based on the monitoring of 15 passive solar buildings which employ a wide variety of geometrical configurations including natural convective loops.

  18. Natural gas monthly, March 1998

    SciTech Connect

    1998-03-01

    The March 1998 edition of the Natural Gas Monthly highlights activities, events, and analyses associated with the natural gas industry. Volume and price data are presented for natural gas production, distribution, consumption, and interstate pipeline activities. Producer-related activities and underground storage data are also reported. This report also features an article on the correction of errors in the drilling activity estimates series, and in-depth drilling activity data. 6 figs., 28 tabs.

  19. Contaminant Removal From Natural Resources

    NASA Technical Reports Server (NTRS)

    Clausen, Christian A. (Inventor); Quinn, Jacqueline W. (Inventor); Geiger, Cheri L. (Inventor); Reinhart, Debra (Inventor); Fillpek, Laura B. (Inventor); Coon, Christina (Inventor); Devor, Robert (Inventor)

    2006-01-01

    A zero-valent metal emulsion containing zero-valent metal particles is used to remediate contaminated natural resources, such as groundwater and soil. In a preferred embodiment, the zero-valent metal emulsion removes heavy metals, such as lead (pb), from contaminated natural resources. In another preferred embodiment, the zero-valent metal emulsion is a bimetallic emulsion containing zero-valent metal particles doped with a catalytic metal to remediate halogenated aromatic compounds, such as polychlorinated biphenyls (PCBs), from natural resources.

  20. Natural gas monthly, February 1994

    SciTech Connect

    Not Available

    1994-02-25

    The NGM highlights activities, events, and analyses of interest to public and private sector organizations associated with the natural gas industry. Volume and price data are presented each month for natural gas production, distribution, consumption, and interstate pipeline activities. Producer-related activities and underground storage data are also reported. The NGM also features articles designed to assist readers in using and interpreting natural gas information.

  1. Natural gas monthly, February 1996

    SciTech Connect

    1996-03-01

    The NGM highlights activities, events, and analyses of interest to public and private sector organizations associated with the natural gas industry. Volume and price data are presented each month for natural gas production, distribution, consumption, and interstate pipeline activities. Producer-related activities and underground storage data are also reported. From time to time, the NGM features articles designed to assist readers in using and interpreting natural gas information.

  2. Natural gas monthly, September 1998

    SciTech Connect

    1998-09-01

    The National Gas Monthly (NGM) highlights activities, events, and analyses of interest to public and private sector organizations associated with the natural gas industry. Volume and price data are presented each month for natural gas production, distribution, consumption, and interstate pipeline activities. Producer-related activities and underground storage data are also reported. From time to time, the NGM features articles designed to assist readers in using and interpreting natural gas information. 6 figs., 27 tabs.

  3. Natural gas monthly, April 1994

    SciTech Connect

    Not Available

    1994-04-26

    The National Gas Monthly (NGM) highlights activities, events, and analyses of interest to public and private sector organizations associated with the natural gas industry. Volume and price data are presented each month for natural gas production, distribution, consumption, and interstate pipeline activities. Producer-related activities and underground storage data are also reported. From time to time, the NGM features articles designed to assist readers in using and interpreting natural gas information.

  4. Discovering natural communities in networks

    NASA Astrophysics Data System (ADS)

    Li, Angsheng; Li, Jiankou; Pan, Yicheng

    2015-10-01

    Understanding and detecting natural communities in networks have been a fundamental challenge in networks, and in science generally. Recently, we proposed a hypothesis that homophyly/kinship is the principle of natural communities based on real network experiments, proposed a model of networks to explore the principle of natural selection in nature evolving, and proposed the measure of structure entropy of networks. Here we proposed a community finding algorithm by our measure of structure entropy of networks. We found that our community finding algorithm exactly identifies almost all natural communities of networks generated by natural selection, if any, and that the algorithm exactly identifies or precisely approximates almost all the communities planted in the networks of the existing models. We verified that our algorithm identifies or very well approximates the ground-truth communities of some real world networks, if the ground-truth communities are semantically well-defined, that our algorithm naturally finds the balanced communities, and that the communities found by our algorithm may have larger modularity than that by the algorithms based on modularity, for some networks. Our algorithm provides for the first time an approach to detecting and analyzing natural or true communities in real world networks. Our results demonstrate that structure entropy minimization is the principle of detecting the natural or true communities in large-scale networks.

  5. Leica EM AFS2 Automatic Freeze Substitution System

    E-print Network

    Chapman, Michael S.

    Leica EM AFS2 Automatic Freeze Substitution System Leica EM FSP Freeze Substitution Processor #12 working range · "Deep Freeze" allows sample transfer at temperatures below -140 °C · Transfer function "TF steel working platform Leica EM AFS2 Freeze Substitution has never been easier... Freeze Substitution

  6. REGIMENTO DO CURSO DE PSGRADUAO EM COMPUTAO APLICADA

    E-print Network

    REGIMENTO DO CURSO DE PÓSGRADUAÇÃO EM COMPUTAÇÃO APLICADA Regimento aprovado pelo CPG em 19/02/2003. TÍTULO I DOS OBJETIVOS E FINALIDADES Art 1º O Curso de PósGraduação a nível de Mestrado e Doutorado em Computação Aplicada CAP, doravante referido como Curso, objetiva formar e capacitar pessoal de nível

  7. CURSO DE PS-GRADUAO EM ENGENHARIA E TECNOLOGIA ESPACIAIS

    E-print Network

    CURSO DE PÓS-GRADUAÇÃO EM ENGENHARIA E TECNOLOGIA ESPACIAIS ÁREA DE CONCENTRAÇÃO EM ENGENHARIA E GERENCIAMENTO DE SISTEMAS ESPACIAIS Coordenador Acadêmico do Curso Evandro Marconi Rocco Coordenador da Área de, Doutora, ITA, Brasil, 1990 Roberto Luiz Galski, Doutor, INPE, Brasil, 2006 #12;2 CURSO DE PÓS-GRADUAÇÃO EM

  8. REGIMENTO DO CURSO DE PSGRADUAO EM COMPUTAO APLICADA

    E-print Network

    REGIMENTO DO CURSO DE PÓSGRADUAÇÃO EM COMPUTAÇÃO APLICADA Regimento aprovado pelo CPG em 04/11/2004. TÍTULO I DOS OBJETIVOS E FINALIDADES Art 1º O Curso de PósGraduação a nível de Mestrado e Doutorado em Computação Aplicada CAP, doravante referido como Curso, objetiva formar e capacitar pessoal de nível

  9. CURSO DE PS-GRADUAO EM ENGENHARIA E TECNOLOGIA ESPACIAIS

    E-print Network

    CURSO DE PÓS-GRADUAÇÃO EM ENGENHARIA E TECNOLOGIA ESPACIAIS ÁREA DE CONCENTRAÇÃO EM CIÊNCIA E TECNOLOGIA DE MATERIAIS E SENSORES Coordenador Acadêmico do Curso Evandro Marconi Rocco Coordenador Acadêmico Vladimir Jesus Trava-Airoldi, Doutor, ITA, Brasil, 1986 #12;2 CURSO DE PÓS-GRADUAÇÃO EM ENGENHARIA E

  10. REGIMENTO DO CURSO DE PSGRADUAO EM COMPUTAO APLICADA

    E-print Network

    REGIMENTO DO CURSO DE PÓSGRADUAÇÃO EM COMPUTAÇÃO APLICADA Regimento aprovado pelo CPG em 17/11/2005. TÍTULO I DOS OBJETIVOS E FINALIDADES Art 1º O Curso de pósgraduação em Computação Aplicada, doravante referido como Curso, mantém programas de Mestrado e Doutorado com objetivo de

  11. Connection to Nature: Children's Affective Attitude toward Nature

    ERIC Educational Resources Information Center

    Cheng, Judith Chen-Hsuan; Monroe, Martha C.

    2012-01-01

    A connection to nature index was developed and tested to measure children's affective attitude toward the natural environment. The index was employed through a survey that investigates students' attitude toward Lagoon Quest, a mandatory environmental education program for all fourth-grade, public school students in Brevard County, Florida. Factor…

  12. Super Natural II—a database of natural products

    PubMed Central

    Banerjee, Priyanka; Erehman, Jevgeni; Gohlke, Björn-Oliver; Wilhelm, Thomas; Preissner, Robert; Dunkel, Mathias

    2015-01-01

    Natural products play a significant role in drug discovery and development. Many topological pharmacophore patterns are common between natural products and commercial drugs. A better understanding of the specific physicochemical and structural features of natural products is important for corresponding drug development. Several encyclopedias of natural compounds have been composed, but the information remains scattered or not freely available. The first version of the Supernatural database containing ?50 000 compounds was published in 2006 to face these challenges. Here we present a new, updated and expanded version of natural product database, Super Natural II (http://bioinformatics.charite.de/supernatural), comprising ?326 000 molecules. It provides all corresponding 2D structures, the most important structural and physicochemical properties, the predicted toxicity class for ?170 000 compounds and the vendor information for the vast majority of compounds. The new version allows a template-based search for similar compounds as well as a search for compound names, vendors, specific physical properties or any substructures. Super Natural II also provides information about the pathways associated with synthesis and degradation of the natural products, as well as their mechanism of action with respect to structurally similar drugs and their target proteins. PMID:25300487

  13. Natural antibodies to glycans.

    PubMed

    Bovin, N V

    2013-07-01

    A wide variety of so-called natural antibodies (nAbs), i.e. immunoglobulins generated by B-1 cells, are directed to glycans. nAbs to glycans can be divided in three groups: 1) conservative nAbs, i.e. practically the same in all healthy donors with respect to their epitope specificity and level in blood; 2) allo-antibodies to blood group antigens; 3) plastic antibodies related to the first or the second group but discussed separately because their level changes considerably during diseases and some temporary conditions, in particular inflammation and pregnancy. Antibodies from the third group proved to be prospective markers of a number of diseases, whereas their unusual level (below or above the norm) is not necessarily the consequence of disease/state. Modern microarrays allowed the determination of the human repertoire, which proved to be unexpectedly broad. It was observed that the content of some nAbs reaches about 0.1% of total immunoglobulins. Immunoglobulins of M class dominate for most nAbs, constituting up to 80-90%. Their affinity (to a monovalent glycan, in KD terms) were found to be within the range 10(-4)-10(-6) M. Antibodies to Gal?1-3GlcNAc (Le(C)), 4-HSO3Gal?1-4GalNAc (4'-O-SuLN), Fuc?1-3GlcNAc, Fuc?1-4GlcNAc, GalNAc?1-3Gal (Adi), Gal?1-4Gal?1-4Glc (P(k)), Gal?1-4Gal?1-4GlcNAc (P1), GlcNAc?-terminated glycans, and hyaluronic acid should be noted among the nAbs revealed and studied during the last decade. At the same time, a kind of "taboo" is observed for a number of glycans: antibodies to Le(X) and Le(Y), and almost all gangliosides have not been observed in healthy persons. Many of the revealed nAbs were directed to constrained inner (core) part of glycan, directly adjoined to lipid of cell membrane or protein. The biological function of these nAbs remains unclear; for anti-core antibodies, a role of surveillance on appearance of aberrant, especially cancer, antigens is supposed. The first data related to oncodiagnostics based on quantitation of anti-glycan nAbs are reported. PMID:24010841

  14. Privileging Naturals Over Strivers: The Costs of the Naturalness Bias.

    PubMed

    Tsay, Chia-Jung

    2016-01-01

    A preference for "naturals" over "strivers" in performance judgments was investigated to test whether the effect is generalizable across domains, as well as to ascertain any costs imposed on decision quality by favoring naturals. Despite being presented with entrepreneurs equal in achievement, participants judged the natural and his business proposal to be superior to the striver and his proposal on multiple dimensions of performance and success (Study 1a and Study 1b). These findings were extended in Study 2, which quantified the costs of the naturalness bias using conjoint analysis to measure specific decision tradeoffs. Together, these three studies show that people tend to pass over better-qualified individuals in favor of apparent naturals. PMID:26481449

  15. Natural time analysis of critical phenomena: the case of pre-fracture electromagnetic emissions.

    PubMed

    Potirakis, S M; Karadimitrakis, A; Eftaxias, K

    2013-06-01

    Criticality of complex systems reveals itself in various ways. One way to monitor a system at critical state is to analyze its observable manifestations using the recently introduced method of natural time. Pre-fracture electromagnetic (EM) emissions, in agreement to laboratory experiments, have been consistently detected in the MHz band prior to significant earthquakes. It has been proposed that these emissions stem from the fracture of the heterogeneous materials surrounding the strong entities (asperities) distributed along the fault, preventing the relative slipping. It has also been proposed that the fracture of heterogeneous material could be described in analogy to the critical phase transitions in statistical physics. In this work, the natural time analysis is for the first time applied to the pre-fracture MHz EM signals revealing their critical nature. Seismicity and pre-fracture EM emissions should be two sides of the same coin concerning the earthquake generation process. Therefore, we also examine the corresponding foreshock seismic activity, as another manifestation of the same complex system at critical state. We conclude that the foreshock seismicity data present criticality features as well. PMID:23822482

  16. Natural time analysis of critical phenomena: The case of pre-fracture electromagnetic emissions

    SciTech Connect

    Potirakis, S. M.; Karadimitrakis, A.; Eftaxias, K.

    2013-06-15

    Criticality of complex systems reveals itself in various ways. One way to monitor a system at critical state is to analyze its observable manifestations using the recently introduced method of natural time. Pre-fracture electromagnetic (EM) emissions, in agreement to laboratory experiments, have been consistently detected in the MHz band prior to significant earthquakes. It has been proposed that these emissions stem from the fracture of the heterogeneous materials surrounding the strong entities (asperities) distributed along the fault, preventing the relative slipping. It has also been proposed that the fracture of heterogeneous material could be described in analogy to the critical phase transitions in statistical physics. In this work, the natural time analysis is for the first time applied to the pre-fracture MHz EM signals revealing their critical nature. Seismicity and pre-fracture EM emissions should be two sides of the same coin concerning the earthquake generation process. Therefore, we also examine the corresponding foreshock seismic activity, as another manifestation of the same complex system at critical state. We conclude that the foreshock seismicity data present criticality features as well.

  17. Erdvini? Žem?s Plutos Judesi? Apibendrint?j? Charakteristik? Nustatymas Pagal GPS Matavim? Duomenis

    NASA Astrophysics Data System (ADS)

    Zakarevi?ius, Algimantas; Aksamitauskas, Vladislovas ?eslovas; Stanionis, Arminas; Levinskait?, Daiva

    2009-01-01

    Erdvini? Žem?s plutos judesi? apibendrintosios charakteristikos pagal GPS matavim? duomenis Ignalinos atomin?s elektrin?s rajone ?vertintos taikant tenzorin?s analiz?s metodik?. Svarbiausi?j? tektonini? ?tempi? poky?iai nustatyti trigonometriniu metodu. Apskai?iuoti nauji erdvini? Žem?s plutos judesi? apibendrint?j? charakteristik? duomenys - poslinkiai koordina?i? aši? kryptimis; blokin?s strukt?ros pos?kis; santykin?s linijin?s bei šlyties deformacijos; normalini?, tangentini? bei svarbiausi?j? tektonini? ?tempi? poky?iai. Apibendrintosios santykin?s deformacijos kinta nuo 0,012 · 10-6, iki -0,760 · 10-6, ?tempiai svyruoja nuo -0,003 MPa iki -0,059 MPa. Nustatyta, kad santykini? deformacij? ir ?tempi? poky?i? reikšm?s visame nagrin?jamame Ignalinos atomin?s elektrin?s rajone yra neigiamo ženklo, t. y. teritorija yra veikiama bendrojo tektoninio spaudimo.

  18. UNIVERSIDADE DE BRASLIA PROGRAMA DE PS-GRADUAO EM CINCIAS E TECNOLOGIAS EM SADE

    E-print Network

    Maier, Rudolf Richard

    deglutição. Dor orofacial. 1 1 Biologia Molecular aplicada ao estudo de fungos patogênicos humanos 1 0 deglutição. Dor orofacial. 1 1 Biologia Molecular aplicada PROCESSOS BIOLÓGICOS EM SAÚDE 1.1. Mecanismos Moleculares e Funcionais da Saúde Humana Mecanismos

  19. TIME DOMAIN EM PROFILING SHALLOW CONDUCTING TARGET

    E-print Network

    Merriam, James

    . Introduction The target is constructed from three separate 24 gage galvanized steel sheets pop-riveted toTIME DOMAIN EM PROFILING OVER A SHALLOW CONDUCTING TARGET J.B. Merriam University of Saskatchewan-47 profile over a known target at one to three m depth is described here. The response of the highly

  20. Transportes em Revista.com Pas: Portugal

    E-print Network

    Instituto de Sistemas e Robotica

    menos de 25 km por dia por: Carlos Moura Tags: Automóveis Galp Energia Mobilidade el étrica realizado em Portugal que resultou de uma parceria entre a Toyota Caetano Portugal, a Galp Energia o s f o r a m e n t r e g u e s a o s colaboradores da Galp Energia, residentes nos concelhos de

  1. Electro Magnetic (EM) Uses Radio Waves

    E-print Network

    Naik, Naren

    #12;RADAR Electro Magnetic (EM) SENSOR Uses Radio Waves Used for Detection of Objects Finding as a Motivation for Learning and Understanding DSP Radar concepts can be used in ROBOT Radar, SONAR ,Ultrasonic ranging etc #12;INTRODUCTION TO RADAR RADAR = Radio Detection and Ranging · Detects targets by receipt

  2. REGIMENTO DO CURSO DE PSGRADUAO EM COMPUTAO APLICADA Regimento aprovado pelo CPG em 07/11/2006

    E-print Network

    REGIMENTO DO CURSO DE PÓSGRADUAÇÃO EM COMPUTAÇÃO APLICADA Regimento aprovado pelo CPG em 07/11/2006 TÍTULO I DOS OBJETIVOS E FINALIDADES Art 1º O Curso de pósgraduação em Computação Aplicada, doravante referido como Curso, mantém programas de Mestrado e Doutorado com objetivo de formar e capacitar pessoal

  3. Pgina Inicial Empresas Start-ups portuguesas mostram-se hoje a investidores suecos em Lisboa Empresas criadas em

    E-print Network

    Instituto de Sistemas e Robotica

    Página Inicial Empresas Start-ups portuguesas mostram-se hoje a investidores suecos em Lisboa | Start-ups portuguesas mostram-se hoje a investidores suecos em Lisboa Comprei uns óculos, fui à organizado pela AICEP e universidades Start-ups portuguesas mostram-se hoje a investidores suecos em Lisboa

  4. Follow Futures: @NatureFutures

    E-print Network

    Loss, Daniel

    is of a quantum nature, performing a physical transformation of matter. The biggest breakthrough since stopping PHYSICS | VOL 11 | NOVEMBER 2015 | www.nature.com/naturephysics futures "This looks wrong," Detective clearings on the bed, where Dr Mayerhofer must've been sleeping, and on the desk. A window stood open

  5. Backpocket: Activities for Nature Study.

    ERIC Educational Resources Information Center

    Hendry, Ian; And Others

    1995-01-01

    Leading naturalist-teachers share outdoor learning activities and techniques, including using binoculars as magnifiers, scavenger hunts, games such as "what's it called" and "I spy," insect study, guessing the age of trees by examining the bark, leading bird walks, exploring nature in the community, and enhancing nature hikes with props. (LP)

  6. Beholding Nature: Contemplation and Connectedness

    ERIC Educational Resources Information Center

    Chambliss, Kathleen Mary

    2013-01-01

    Two related exploratory studies, one with families, and a second one with adult and child members of an independent school community, suggest that our connections with the rhythms, processes, species, and cycles of nature, our "love" and feelings of affinity for nature, can be strengthened by practicing contemplation outdoors. In The…

  7. Natural Learning Case Study Archives

    ERIC Educational Resources Information Center

    Lawler, Robert W.

    2015-01-01

    Natural Learning Case Study Archives (NLCSA) is a research facility for those interested in using case study analysis to deepen their understanding of common sense knowledge and natural learning (how the mind interacts with everyday experiences to develop common sense knowledge). The database comprises three case study corpora based on experiences…

  8. Reconceptualizing the "Nature" of Childhood

    ERIC Educational Resources Information Center

    Taylor, Affrica

    2011-01-01

    This interdisciplinary article draws upon human geography to bring fresh new perspectives to the relationship between two commonly conflated concepts: "childhood" and "nature". Childhood studies scholars have gone a long way towards retheorizing childhood beyond the "natural" and the "universal" by pointing to its historical and cultural…

  9. Natural Gas Energy Educational Kit.

    ERIC Educational Resources Information Center

    American Gas Association, Arlington, VA. Educational Services.

    Prepared by energy experts and educators to introduce middle school and high school students to natural gas and its role in our society, this kit is designed to be incorporated into existing science and social studies curricula. The materials and activities focus on the origin, discovery, production, delivery, and use of natural gas. The role of…

  10. Czech Children's Drawing of Nature

    ERIC Educational Resources Information Center

    Yilmaz, Zuhal; Kubiatko, Milan; Topal, Hatice

    2012-01-01

    Do world children draw nature pictures in a certain way? Range of mountains in the background, a sun, couple clouds, a river rising from mountains. Is this type of drawing universal in the way these nature items are organized on a drawing paper? The sample size from Czech Republic included 33 participants from two kindergartens. They were 5 and 6…

  11. Collaborating with Forms in Nature

    ERIC Educational Resources Information Center

    Castro, Aileen Pugliese

    2011-01-01

    Taking students outside is a great opportunity to make art. In this article, the author describes how her students collaborated with forms in nature to create their own visual structures to communicate ideas. This lesson can be done on the beach, in a sand box on the school playground, in grassy areas, or nature can even be brought into the…

  12. Nature Nearby for Young Children.

    ERIC Educational Resources Information Center

    Silver, Marty

    Young children learn best in nearby natural places, where they can use their senses to experience the pleasures of real discovery. This paper introduces outdoor activities for young children that will help them learn about nature. The activities encourage hands-on discovery based in careful, accurate sensory observation, keyed to the common…

  13. Nature's Four Seasons as Inspiration.

    ERIC Educational Resources Information Center

    Bain, Christina; Padgelek, Mary

    1999-01-01

    Presents an instructional resource examining artwork by Charles Burchfield, Utagawa Hiroshige, Childe Hassam, and Georgia O'Keeffe that focuses on nature's four seasons. Offers activities to encourage students' observational skills and guide them to depict their personal views of nature in their own artwork (CMK)

  14. Natural gas monthly, December 1996

    SciTech Connect

    1996-12-01

    This document highlights activities, events, and analysis of interest to the public and private sector associated with the natural gas industry. Volume and price data are presented each month for natural gas production, distribution, consumption, and interstate pipeline activities. Producer-related activities and underground storage data are also included.

  15. Natural Gas Industry and Markets

    EIA Publications

    2006-01-01

    This special report provides an overview of the supply and disposition of natural gas in 2004 and is intended as a supplement to the Energy Information Administration's (EIA) Natural Gas Annual 2004 (NGA). Unless otherwise stated, all data and figures in this report are based on summary statistics published in the NGA 2004.

  16. NATURAL EMISSIONS OF OXIDANT PRECURSORS

    EPA Science Inventory

    This paper provides an overview of the sources, the estimation methodology, and the relative amounts of natural hydrocarbon and nitrogen oxide emissions. he most recent estimate of natural nonmethane hydrocarbon (NMHC) emissions for the United States is 28 teragrams per year (Tg/...

  17. Natural-draft Cooling Tower

    USGS Multimedia Gallery

    Natural-draft cooling towers and one of two intake screens and associated pumps for the Tennessee Valley Authority, Sequoyah Nuclear Power Plant, Tennessee. Natural-draft tower airflow is drawn through the packing or fill (distributed at the base) by means of the small density difference between the...

  18. Color in Nature Barb Cutler

    E-print Network

    Durand, Frédo

    1 Color in Nature Barb Cutler Color in Nature · Color is NOT just a compound that comes in a wide range of hues and tones · Types of Color dyes & stains, pigments, suspended particles, bioluminescence, structural · Purpose of Color warning, mimicry, camouflage, transparency Blue Sapphire (intervalence charge

  19. Illinois Birds. Nature Discovery I.

    ERIC Educational Resources Information Center

    Stone, Sally F.

    The birds of Illinois and their particular habitats are explored in this guide which is a part of a series of Nature Discovery publications. The materials are designed to directly supplement the natural science curricula and to complement other subject areas including social studies, language arts, music, and art. The program is formated for…

  20. Evaluation of Natural Resource Interventions

    ERIC Educational Resources Information Center

    Rowe, Andy

    2012-01-01

    This article provides a frame for evaluation of natural resource interventions, which necessarily involves both human and natural systems. Two-system evaluands require us to adapt evaluation methods for comparison and attribution and to address differences in time and space occurring across the systems as well as potentially very different values…

  1. Natural gas monthly, July 1990

    SciTech Connect

    Not Available

    1990-10-03

    This report highlights activities, events, and analyses of interest to public and private sector organizations associated with the natural gas industry. Volume and price data are presented each month for natural gas production, distribution, consumption, and interstate pipeline activities. Producer-related activities and underground storage data are also reported. A glossary is included. 7 figs., 33 tabs.

  2. Discovering Nature with Young Children.

    ERIC Educational Resources Information Center

    Chalufour, Ingrid; Worth, Karen

    Young children's curiosity about nature and their need to make sense of the world presents an opportunity to incorporate science as a natural and critical part of children's early learning. This guide, part of a preschool science curriculum, uses an inquiry approach to encourage young naturalists to observe life more closely, build an…

  3. Anania Shirakatsi's Natural Philosophical Views

    NASA Astrophysics Data System (ADS)

    Arevshatyan, Sen

    2014-10-01

    A review on Anania Shirakatsi's natural philosophical views is given. He was the first to distinguish natural sciences from philosophy, establishing the basis for such sciences as mathematics, cosmography, astronomy, meteorology, chronology, and metrology. Shirakatsi's works are discussed related to these sciences.

  4. Commentary: Biochemistry Re-Natured

    ERIC Educational Resources Information Center

    White, Harold B.

    2010-01-01

    In his last commentary on "Biochemistry Denatured," this author dealt with his perception that college students today have spent too little of their childhood years playing outside in nature and as a consequence have not learned basic things about the world from personal experience. This "nature-deficit disorder" removes many opportunities for…

  5. Climate Change: Prospects for Nature

    SciTech Connect

    Thomas Lovejoy

    2008-03-12

    Thomas Lovejoy, President of The H. John Heinz III Center for Science, Economics and the Environment, explores the impact of climate change on the natural world. He also discusses the implications of climate change for climate policy and natural resource management.

  6. Natural gas monthly, August 1990

    SciTech Connect

    Not Available

    1990-11-05

    This report highlights activities, events, and analyses of interest to public and private sector oganizations associated with the natural gas industry. Volume and price data are presented each month for natural gas production, distribution, consumption, and interstate pipeline activities. Producer-related activities and underground storage data are also reported. 33 tabs.

  7. The Natural Human Learning Process.

    ERIC Educational Resources Information Center

    Smilkstein, Rita Phipps

    1993-01-01

    Reviews research on the physiology of learning, suggesting the development of a new educational model consistent with natural brain development. Considers connected learning a physiological imperative. Discusses ways of using the Natural Human Learning Process (NHLP) in the classroom and the development of an NHLP curriculum unit. (27 citations)…

  8. Teaching about Natural Background Radiation

    ERIC Educational Resources Information Center

    Al-Azmi, Darwish; Karunakara, N.; Mustapha, Amidu O.

    2013-01-01

    Ambient gamma dose rates in air were measured at different locations (indoors and outdoors) to demonstrate the ubiquitous nature of natural background radiation in the environment and to show that levels vary from one location to another, depending on the underlying geology. The effect of a lead shield on a gamma radiation field was also…

  9. NATURE GEOSCIENCE | VOL 7 | JANUARY 2014 | www.nature.com/naturegeoscience 1 Half a year ago, Nature Geoscience and

    E-print Network

    Cai, Long

    NATURE GEOSCIENCE | VOL 7 | JANUARY 2014 | www.nature.com/naturegeoscience 1 editorial Half a year ago, Nature Geoscience and Nature Climate Change started to offer authors the option to remain still are) inviting the corresponding authors of all submissions to Nature Geoscience and Nature Climate

  10. nature.com nature publishing group nature science update naturejobs help my account e-alert subscribe regist

    E-print Network

    Rogers, John A.

    authors advertising about us contact us resources Nature Nature Materials Nature Biotechnology Nature Science Update Nature Physics Portal Naturejobs NPG Subject areas Access material from all ourHot off the press 1/26/2003http://www.nature.com/cgi-taf/Gateway.taf?g=3&file=/materials

  11. Natural gas monthly - January 1996

    SciTech Connect

    1996-01-01

    This highlight discusses changes in natural gas supply, demand, and prices for the first three quarters of 1995 (January thru September) compared to the same periods in 1993 and 1994. Production for the first three quarters of 1995 lagged year-earlier levels while natural gas consumption has continued a steady upward movement. Total U.S. natural gas production through the first three quarters at 14.1 trillion cubic feet, was less than 1 percent below the 1994 period, but remained well ahead of the comparable 1993 period. The three leading producing States (Texas, Louisiana, and Oklahoma) contributed nearly 70 percent of the total. Natural gas consumption totaled 16.0 trillion cubic feet for the first three quarters, 4 percent above the same period in 1994. Net imports of natural gas reached 2.0 trillion cubic feet by the end of the third quarter 1995 and accounted for nearly 13 percent of total consumption during this period.

  12. Natural gas monthly, October 1991

    SciTech Connect

    Not Available

    1991-11-05

    The Natural Gas Monthly (NGM) is prepared in the Data Operations Branch of the Reserves and Natural Gas Division, Office of Oil and Gas, Energy Information Administration (EIA), US Department of Energy (DOE). The NGM highlights activities, events, and analyses of interest to public and private sector organizations associated with the natural gas industry. Volume and price data are presented each month for natural gas production, distribution, consumption, and interstate pipeline activities. Producer-related activities and underground storage data are also reported. The data in this publication are collected on surveys conducted by the EIA to fulfill its responsibilities for gathering and reporting energy data. Some of the data are collected under the authority of the Federal Energy Regulatory Commission (FERC), an independent commission within the DOE, which has jurisdiction primarily in the regulation of electric utilities and the interstate natural gas industry. Geographic coverage is the 50 States and the District of Columbia. 16 figs., 33 tabs.

  13. Unnatural monopoly: natural gas industry

    SciTech Connect

    Copulos, M.

    1984-07-01

    There appears to be no change in position despite the annual congressional debate over natural gas issues. A fresh look is needed, particularly at the idea that interstate gas pipelines are a natural monopoly that require a government franchise. The Natural Gas Act of 1938 giving the Federal Power Commission jurisdiction over gas pipelines was intended to correct abuses, but resulted in encouraging the pipelines to assume a monopolistic behavior. This was not a serous problem until natural gas prices began rising and shortages appeared due to uneven distribution. The Natural Gas Policy Act reinforced the monopolistic behavior by extending federal controls to the intrastate market. Contract carriage is a remedy that would allow firms and utilities to contract for gas on their own. They would pay pipelines for transport costs only. Competition would increase because there would be new buyers and sellers, and pipelines would have an incentive to seek lower wellhead prices for their contract gas.

  14. 34 CFR 303.18 - Natural environments.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ...2010-07-01 2010-07-01 false Natural environments. 303.18 Section 303.18 Education...General Provisions § 303.18 Natural environments. As used in this part, natural environments means settings that are natural...

  15. NATURAL GAS STORAGE ENGINEERING Kashy Aminian

    E-print Network

    Mohaghegh, Shahab

    NATURAL GAS STORAGE ENGINEERING Kashy Aminian Petroleum & Natural Gas Engineering, West Virginia University, Morgantown, WV, USA. Shahab D. Mohaghegh Petroleum & Natural Gas Engineering, West Virginia University, Morgantown, WV, USA. Keywords: Gas Storage, Natural Gas, Storage, Deliverability, Inventory

  16. 34 CFR 303.26 - Natural environments.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ...2012-07-01 2012-07-01 false Natural environments. 303.26 Section 303.26 Education...Definitions Used in This Part § 303.26 Natural environments. Natural environments means settings that are natural or...

  17. 34 CFR 303.26 - Natural environments.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ...2014-07-01 2013-07-01 true Natural environments. 303.26 Section 303.26 Education...Definitions Used in This Part § 303.26 Natural environments. Natural environments means settings that are natural or...

  18. 34 CFR 303.26 - Natural environments.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ...2013-07-01 2013-07-01 false Natural environments. 303.26 Section 303.26 Education...Definitions Used in This Part § 303.26 Natural environments. Natural environments means settings that are natural or...

  19. 34 CFR 303.18 - Natural environments.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ...2011-07-01 2010-07-01 true Natural environments. 303.18 Section 303.18 Education...General Provisions § 303.18 Natural environments. As used in this part, natural environments means settings that are natural...

  20. Natural gas pipeline technology overview.

    SciTech Connect

    Folga, S. M.; Decision and Information Sciences

    2007-11-01

    The United States relies on natural gas for one-quarter of its energy needs. In 2001 alone, the nation consumed 21.5 trillion cubic feet of natural gas. A large portion of natural gas pipeline capacity within the United States is directed from major production areas in Texas and Louisiana, Wyoming, and other states to markets in the western, eastern, and midwestern regions of the country. In the past 10 years, increasing levels of gas from Canada have also been brought into these markets (EIA 2007). The United States has several major natural gas production basins and an extensive natural gas pipeline network, with almost 95% of U.S. natural gas imports coming from Canada. At present, the gas pipeline infrastructure is more developed between Canada and the United States than between Mexico and the United States. Gas flows from Canada to the United States through several major pipelines feeding U.S. markets in the Midwest, Northeast, Pacific Northwest, and California. Some key examples are the Alliance Pipeline, the Northern Border Pipeline, the Maritimes & Northeast Pipeline, the TransCanada Pipeline System, and Westcoast Energy pipelines. Major connections join Texas and northeastern Mexico, with additional connections to Arizona and between California and Baja California, Mexico (INGAA 2007). Of the natural gas consumed in the United States, 85% is produced domestically. Figure 1.1-1 shows the complex North American natural gas network. The pipeline transmission system--the 'interstate highway' for natural gas--consists of 180,000 miles of high-strength steel pipe varying in diameter, normally between 30 and 36 inches in diameter. The primary function of the transmission pipeline company is to move huge amounts of natural gas thousands of miles from producing regions to local natural gas utility delivery points. These delivery points, called 'city gate stations', are usually owned by distribution companies, although some are owned by transmission companies. Compressor stations at required distances boost the pressure that is lost through friction as the gas moves through the steel pipes (EPA 2000). The natural gas system is generally described in terms of production, processing and purification, transmission and storage, and distribution (NaturalGas.org 2004b). Figure 1.1-2 shows a schematic of the system through transmission. This report focuses on the transmission pipeline, compressor stations, and city gates.

  1. The Science of Middle Nature

    NASA Astrophysics Data System (ADS)

    Pataki, D. E.; Pincetl, S.

    2012-12-01

    In the field of biogeochemistry, urbanization is often considered as an "alteration" or "disturbance" to the earth's surface and its natural processes. This view is an outcome of the view of nature inherent in earth system science and ecology, in which nature is defined as separate from humans and society. However, other disciplines are based in alternative views of nature in which humans are more integral components of the landscape. Urban planning, landscape architecture, agriculture, and horticulture, for example, more fully integrate the role of landscape design and management in the functioning of human-dominated ecosystems. We suggest that the field of urban biogeochemistry has been somewhat limited by the predominant, disturbance-based view of the role of nature in cities, and that more deeply evaluating and broadening the concept of nature inherent in studies of urban processes can enhance our understanding of the role of urbanization in the earth system. A particularly useful concept is the "middle nature" proposed by Cosgrove (1993), which serves a purpose of "actively transforming nature into culture." It is this view of urban landscapes as middle nature, or transformation of urban space into human-dominated nature with a purpose, that is lacking from the current scientific discourse about the role of biogeochemistry in urban ecosystem services. A scientific evaluation of middle nature implies studying the performance of urban designs to meet intended cultural and environmental goals, including beauty, social equity, governance, and social capital as well as environmental quality. We describe our work in evaluating the transformed urban landscapes of Los Angeles from multiple perspectives that focus on urban livability, equity, and beauty as well as the physical impacts of plants and soils on the environment. The outcomes of this process do not necessary meet the traditional demands of biophysical ecology such as utilizing native species, maximizing carbon sequestration, or minimizing human disturbance. Rather, in our project the discourse is shifting away from the ecosystem services framework, and towards a shared vision for middle nature as the intersection between nature as we have traditionally valued it outside of the city, and its integral role in urban culture, design, function, and quality of life.

  2. NATURE ARABIC EDITION MEDIA OPTIONS 2014

    E-print Network

    Napp, Nils

    NATURE ARABIC EDITION MEDIA OPTIONS 2014 NATURE ARABIC EDITION MEDIA OPTIONS 2014 © 2014 Macmillan Publishers Limited. All rights reserved #12;Media Options 2014 | Nature Arabic Edition CONTENTS Nature Arabic Edition 2-3 Banner advertising 4 Email alerts 5 Inserts and outserts 6 Print: Nature, Nature Research

  3. 2007 Nature Publishing Group nature nanotechnology | ADVANCE ONLINE PUBLICATION | www.nature.com/naturenanotechnology 1

    E-print Network

    Dekker, Cees

    © 2007 Nature Publishing Group nature nanotechnology | ADVANCE ONLINE PUBLICATION | www, advances in nanotechnology now allow single polymer molecules to be threaded through nanopores that measure their genomes into cells via pores that they insert into the cell membrane. Some of the transport through pores

  4. letters to nature NATURE |VOL 408 |2 NOVEMBER 2000 |www.nature.com 115

    E-print Network

    Hill, Chris

    . The Toll-like receptor 2 is recruited to macrophage phagosomes and discriminates between pathogens. Nature. The Toll-receptor family and control of innate immunity. Curr. Opin. Immunol. 11, 13­18 (1999). 3. Anderson). 4. Gay, N. J. & Keith, F. J. Drosophila Toll and IL-1 receptor. Nature 351, 355­356 (1991). 5

  5. The association between EMS workplace safety culture and safety outcomes

    PubMed Central

    Weaver, Matthew D.; Wang, Henry E.; Fairbanks, Rollin J.; Patterson, Daniel

    2012-01-01

    Objective Prior studies have highlighted wide variation in EMS workplace safety culture across agencies. We sought to determine the association between EMS workplace safety culture scores and patient or provider safety outcomes. Methods We administered a cross-sectional survey to EMS workers affiliated with a convenience sample of agencies. We recruited these agencies from a national EMS management organization. We used the EMS Safety Attitudes Questionnaire (EMS-SAQ) to measure workplace safety culture and the EMS Safety Inventory (EMS-SI), a tool developed to capture self-reported safety outcomes from EMS workers. The EMS-SAQ provides reliable and valid measures of six domains: safety climate, teamwork climate, perceptions of management, perceptions of working conditions, stress recognition, and job satisfaction. A panel of medical directors, paramedics, and occupational epidemiologists developed the EMS-SI to measure self-reported injury, medical errors and adverse events, and safety-compromising behaviors. We used hierarchical linear models to evaluate the association between EMS-SAQ scores and EMS-SI safety outcome measures. Results Sixteen percent of all respondents reported experiencing an injury in the past 3 months, four of every 10 respondents reported an error or adverse event (AE), and 90% reported safety-compromising behaviors. Respondents reporting injury scored lower on 5 of the 6 domains of safety culture. Respondents reporting an error or AE scored lower for 4 of the 6 domains, while respondents reporting safety-compromising behavior had lower safety culture scores for 5 of 6 domains. Conclusions Individual EMS worker perceptions of workplace safety culture are associated with composite measures of patient and provider safety outcomes. This study is preliminary evidence of the association between safety culture and patient or provider safety outcomes. PMID:21950463

  6. Nature Macmillan Publishers Ltd 1998 letters to nature

    E-print Network

    Garnero, Ed

    ., Bjarnason, I. T., VanDecar, J. C. & Solomon, S. C. Seismic structure of the Iceland mantle plume. Nature 385., Bjarnason, I. T. & Purdy, G. Hot mantle transition zone beneath Iceland and the adjacent mid-Atlantic Ridge

  7. Nature's Trust: A Paradigm for Natural Resources Stewardship

    NASA Astrophysics Data System (ADS)

    Wood, M. C.; Whitelaw, E.; Doppelt, B.; Burchell, A.

    2007-12-01

    Climate change uncertainty puts a premium on all remaining natural resources. Farmland, air, water, wetlands, wildlife, soils, mineral resources and forests must be protected to ensure that Americans - present citizens and future generations - have the fundamental survival resources they need in a future that holds many unknowns. Moreover, in light of the need to manage resources given climate and particle forcing, government must mitigate dangerous carbon loading of the atmosphere. Confronting climate change and protecting natural resources requires a clear sense of government obligation that is inherent to sovereignty, not a matter of political choice. Our government representatives can and must reframe government's discretion into a trustee obligation to protect Nature and ensure natural resource stewardship. Drawing upon enduring legal principles and court decisions, government can be characterized as a trustee of the natural resources essential to human survival. A trust is a fundamental type of ownership whereby one manages property for the benefit of another. Viewed as a trust, the environment consists of a portfolio of quantified natural assets that government manages. As beneficiaries, citizens hold a common property interest in defined, bounded assets that make up Nature's Trust. Such trust principles form the bedrock of statutory law. Trustees have a fiduciary obligation to protect trust assets and may not allow destruction of property they manage. This session will provide a policy frame for current scientific efforts to address climate change and natural resources loss. Under the Nature's Trust frame, U.S. government leaders and agencies at every level inherit a strict fiduciary obligation to protect our collective natural resources, including our water and the atmosphere, as assets in the trust. Their fiduciary standard of care consists of a proportionate responsibility, which ties directly to "Nature's Mandate" as defined by current climate scientists: each jurisdiction must cap and begin reducing total GHG emissions within the decade and continue reduction until they reach 80% below 1990 levels by 2050. The trust framework positions all nations of the world in a logical relationship that can guide international diplomacy. The atmosphere, oceans and the global hydrologic cycle are commonly held assets shared as property among all nations on Earth. Thus, all Nations are sovereign co-tenant trustees, each holding the fiduciary responsibility to not degrade the common asset and to accomplish proportionate carbon reduction.

  8. Natural Products Synthesis: Enabling Tools to Penetrate Nature’s Secrets of Biogenesis and Biomechanism†

    PubMed Central

    Williams, Robert M.

    2011-01-01

    Selected examples from our laboratory of how synthetic technology platforms developed for the total synthesis of several disparate families of natural products was harnessed to penetrate biomechanistic and/or biosynthetic queries is discussed. Unexpected discoveries of biomechanistic reactivity and/or penetrating the biogenesis of naturally occurring substances were made possible through access to substances available only through chemical synthesis. Hypothesis-driven total synthesis programs are emerging as very useful conceptual templates for penetrating and exploiting the inherent reactivity of biologically active natural substances. In many instances, new enabling synthetic technologies were required to be developed. The examples demonstrate the often un-tapped richness of complex molecule synthesis to provide powerful tools to understand, manipulate and exploit Nature’s vast and creative palette of secondary metabolites. PMID:21438619

  9. New Methods for Assessing the Fascinating Nature of Nature Experiences

    PubMed Central

    Joye, Yannick; Pals, Roos; Steg, Linda; Evans, Ben Lewis

    2013-01-01

    In recent years, numerous environmental psychology studies have demonstrated that contact with nature as opposed to urban settings can improve an individual’s mood, can lead to increased levels of vitality, and can offer an opportunity to recover from stress. According to Attention Restoration Theory (ART) the restorative potential of natural environments is situated in the fact that nature can replenish depleted attentional resources. This replenishment takes place, in part, because nature is deemed to be a source of fascination, with fascination being described as having an “attentional”, an “affective” and an “effort” dimension. However, the claim that fascination with nature involves these three dimensions is to a large extent based on intuition or derived from introspection-based measurement methods, such as self-reports. In three studies, we aimed to more objectively assess whether these three dimensions indeed applied to experiences related to natural environments, before any (attentional) depletion has taken place. The instruments that were used were: (a) the affect misattribution procedure (Study 1), (b) the dot probe paradigm (Study 2) and (c) a cognitively effortful task (Study 3). These instrument were respectively aimed at verifying the affective, attentional and effort dimension of fascination. Overall, the results provide objective evidence for the claims made within the ART framework, that natural as opposed to urban settings are affectively positive (cfr., affective dimension) and that people have an attentional bias to natural (rather than urban) environments (cfr., attentional dimension). The results regarding the effort dimension are less straightforward, and suggest that this dimension only becomes important in sufficiently difficult cognitive tasks. PMID:23922645

  10. M. Bahrami ENSC 388 (F09) Natural Convection 1 Natural Convection

    E-print Network

    Bahrami, Majid

    Convection 1 Natural Convection In natural convection, the fluid motion occurs by natural means such as buoyancy. Since the fluid velocity associated with natural convection is relatively low, the heat transfer coefficient encountered in natural convection is also low. Mechanisms

  11. 18 CFR 2.78 - Utilization and conservation of natural resources-natural gas.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ...conservation of natural resources-natural gas. 2.78 Section 2.78 Conservation...Policy and Interpretations Under the Natural Gas Act § 2.78 Utilization and conservation of natural resources—natural gas. (a)(1) The national...

  12. 18 CFR 2.78 - Utilization and conservation of natural resources-natural gas.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ...conservation of natural resources-natural gas. 2.78 Section 2.78 Conservation...Policy and Interpretations Under the Natural Gas Act § 2.78 Utilization and conservation of natural resources—natural gas. (a)(1) The national...

  13. 18 CFR 2.78 - Utilization and conservation of natural resources-natural gas.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ...conservation of natural resources-natural gas. 2.78 Section 2.78 Conservation...Policy and Interpretations Under the Natural Gas Act § 2.78 Utilization and conservation of natural resources—natural gas. (a)(1) The national...

  14. 18 CFR 2.78 - Utilization and conservation of natural resources-natural gas.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ...conservation of natural resources-natural gas. 2.78 Section 2.78 Conservation...Policy and Interpretations Under the Natural Gas Act § 2.78 Utilization and conservation of natural resources—natural gas. (a)(1) The national...

  15. Darwin's explanation of design: from natural theology to natural selection.

    PubMed

    Ayala, Francisco J

    2010-08-01

    Copernicus, Galileo, Newton and other physical scientists ushered in a conception of the universe as matter in motion governed by natural laws. Their discoveries brought about a fundamental revolution, namely a commitment to the postulate that the universe obeys immanent laws that can account for natural phenomena. The workings of the universe were brought into the realm of science: explanation through natural laws. Darwin completed the Copernican revolution by extending it to the living world. Darwin demonstrated the evolution of organisms. More important yet is that he discovered natural selection, the process that explains the "design" of organisms. The adaptations and diversity of organisms, the origin of novel and complex species, even the origin of mankind, could now be explained by an orderly process of change governed by natural laws. The origin of species and the exquisite features of organisms had previously been explained as special creations of an Omniscient God. Darwin brought them into the domain of science. Evolution is a creative process that produces genuine novelty. The creative power of evolution arises from a distinctive interaction between chance and necessity, between random mutation and natural selection. PMID:19800418

  16. Natural Fiber Composites: A Review

    SciTech Connect

    Westman, Matthew P.; Fifield, Leonard S.; Simmons, Kevin L.; Laddha, Sachin; Kafentzis, Tyler A.

    2010-03-07

    The need for renewable fiber reinforced composites has never been as prevalent as it currently is. Natural fibers offer both cost savings and a reduction in density when compared to glass fibers. Though the strength of natural fibers is not as great as glass, the specific properties are comparable. Currently natural fiber composites have two issues that need to be addressed: resin compatibility and water absorption. The following preliminary research has investigated the use of Kenaf, Hibiscus cannabinus, as a possible glass replacement in fiber reinforced composites.

  17. Natural attenuation of contaminated soils.

    PubMed

    Mulligan, Catherine N; Yong, Raymond N

    2004-06-01

    Natural attenuation is increasing in use as a low cost means of remediating contaminated soil and groundwater. Modelling of contaminant migration plays a key role in evaluating natural attenuation as a remediation option and in ensuring that there will be no adverse impact on humans and the environment. During natural attenuation, the contamination must be characterized thoroughly and monitored through the process. In this paper, attenuation mechanisms for both organic and inorganic contaminants, use of models and protocols, role of monitoring and field case studies will be reviewed. PMID:15031019

  18. Natural Product Xn on matrices

    E-print Network

    W. B. Vasantha Kandasamy; Florentin Smarandache

    2012-02-20

    This book has eight chapters. The first chapter is introductory in nature. Polynomials with matrix coefficients are introduced in chapter two. Algebraic structures on these polynomials with matrix coefficients is defined and described in chapter three. Chapter four introduces natural product on matrices. Natural product on super matrices is introduced in chapter five. Super matrix linear algebra is introduced in chapter six. Chapter seven claims only after this notion becomes popular we can find interesting applications of them. The final chapter suggests over 100 problems some of which are at research level.

  19. Application of EM38 and ERT methods in estimation of saturated hydraulic conductivity in unsaturated soil

    NASA Astrophysics Data System (ADS)

    Farzamian, Mohammad; Monteiro Santos, Fernando A.; Khalil, Mohamed A.

    2015-01-01

    Soil apparent electrical conductivity is being considerably used as a surrogate measure for soil properties and hydraulic parameters. In this study, measurements of electrical conductivity were accomplished with electrical resistivity tomography (ERT) and EM38 to develop multiple datasets for defining spatiotemporal moisture content variations and estimating saturated hydraulic conductivity under natural conditions in an experimental site located in Lisbon, Portugal. In addition, EM38 capability in monitoring electrical conductivity variations in comparison with ERT method was examined. In order to achieve these objectives, appropriate relationships were derived based on determination of experimental curve resistivity vs. degree of saturation by in-situ investigation to convert electrical resistivity maps inferred from ERT and EM38 data to moisture content distribution maps. In addition, the surface temperature variations during the experiment were measured and the effects of the temperature variations were removed by assuming 2% change in electrical resistivity per °C change in temperature. The conducted experiment proves that the soil is fairly homogenous and semi-pervious sediment and the spatiotemporal moisture content variations during the experiment barely exceed 10%. Our calculations constrain the range of saturated hydraulic conductivity to be 3-9 (cm/day) range.

  20. Natural Radionuclides in Ground Water.

    ERIC Educational Resources Information Center

    Davis, Stanley N.

    1988-01-01

    Described are the natural trace radionuclides in ground water. Indicates the geologic origin of these radionuclides. Discusses the importance of these radionuclides. Suggests future uses of a number of additional radionuclides. (CW)

  1. Follow Futures: @NatureFutures

    E-print Network

    Loss, Daniel

    | JANUARY 2015 | www.nature.com/naturephysics futures E arth seemed unimportant to the two alien ships down our life support system is no way to run Spaceship Earth." "Well, we sent out those two Voyagers

  2. Building representations from natural language

    E-print Network

    Seifter, Mark J

    2007-01-01

    In this thesis, I describe a system I built that produces instantiated representations from descriptions embedded in natural language. For example, in the sentence 'The girl walked to the table', my system produces a ...

  3. Salmonella in Natural Animal Casings

    PubMed Central

    Gabis, D. A.; Silliker, J. H.

    1974-01-01

    Destruction of salmonellae in inoculated and naturally contaminated natural animal casings was studied. Salmonellae were effectively destroyed (99.999%) in inoculated hog casings after exposure for 24 h to saturated brine at pH 4.0 and 10.0 adjusted with acetic acid and sodium hydroxide, respectively. Treatment of inoculated hog and sheep casings in saturated brine or saturated brine with citric acid was not nearly as effective as brine containing acetic acid or sodium hydroxide. Salmonellae in naturally contaminated hog casings were virtually eliminated after 21 days of storage in crystalline sodium chloride. Salmonella in sheep and hog casings were eliminated after 7 days of storage in crystalline salt. Treatment of naturally contaminated hog casings with glycerin-salt or sorbitol-salt solutions was not as effective in destroying salmonellae as treatment with crystalline salt. PMID:4589143

  4. Energy as a Natural Resource

    ERIC Educational Resources Information Center

    Seeger, Raymond J.

    1971-01-01

    Briefly discusses energy consumption per capita as an index of technical progress, a historical review of concepts related to energy conservation, energy conversion, natural sources, man-made sources, and social implications. (PR)

  5. Bioactive natural products from Lysobacter.

    PubMed

    Xie, Yunxuan; Wright, Stephen; Shen, Yuemao; Du, Liangcheng

    2012-11-01

    The gliding Gram-negative Lysobacter bacteria are emerging as a promising source of new bioactive natural products. These ubiquitous freshwater and soil microorganisms are fast growing, simple to use and maintain, and genetically amenable for biosynthetic engineering. This Highlight reviews a group of biologically active and structurally distinct natural products from the genus Lysobacter, with a focus on their biosyntheses. Although Lysobacter sp. are known as prolific producers of bioactive natural products, detailed molecular mechanistic studies of their enzymatic assembly have been surprisingly scarce. We hope to provide a snapshot of the important work done on the lysobacterial natural products and to provide useful information for future biosynthetic engineering of novel antibiotics in Lysobacter. PMID:22898908

  6. Natural quasicrystal with decagonal symmetry

    E-print Network

    Bindi, Luca

    We report the first occurrence of a natural quasicrystal with decagonal symmetry. The quasicrystal, with composition Al[subscript 71]Ni[subscript 24]Fe[subscript 5], was discovered in the Khatyrka meteorite, a recently ...

  7. Natural Products as Aromatase Inhibitors

    PubMed Central

    Balunas, Marcy J.; Su, Bin; Brueggemeier, Robert W.; Kinghorn, A. Douglas

    2010-01-01

    With the clinical success of several synthetic aromatase inhibitors (AIs) in the treatment of postmenopausal estrogen receptor-positive breast cancer, researchers have also been investigating also the potential of natural products as AIs. Natural products from terrestrial and marine organisms provide a chemically diverse array of compounds not always available through current synthetic chemistry techniques. Natural products that have been used traditionally for nutritional or medicinal purposes (e.g., botanical dietary supplements) may also afford AIs with reduced side effects. A thorough review of the literature regarding natural product extracts and secondary metabolites of plant, microbial, and marine origin that have been shown to exhibit aromatase inhibitory activity is presented herein. PMID:18690828

  8. SLE curves and natural parametrization

    E-print Network

    Lawler, Gregory F

    2010-01-01

    Developing the theory of two-sided radial and chordal $SLE$, we prove that the natural parametrization on $SLE_\\kappa$ curves is well defined for all $\\kappa < 8$. Our proof uses a two-interior-point local martingale.

  9. Is Science Biased Toward Natural?

    EPA Science Inventory

    Having widely available, accurate, understandable, and unbiased scientific information is central to the successful resolution of the typically contentious, divisive, and litigious natural resource policy issue. Three examples are offered to illustrate how science is often misus...

  10. Natural Gas Monthly August 1998

    SciTech Connect

    1998-08-01

    The Natural Gas Monthly (NGM) highlights activities, events, and analyses of interest to public and private sector organizations associated with the natural gas industry. Volume and price data are presented each month for natural gas production, distribution, consumption, and interstate pipeline activities. Producer-related activities and underground storage data are also reported. From time to time, the NGM features articles designed to assist readers in using and interpreting natural gas information. Explanatory notes supplement the information found in tables of the report. A description of the data collection surveys that support the NGM is provided. A glossary of the terms used in this report is also provided to assist readers in understanding the data presented in this publication.

  11. Introduction to natural language processing

    SciTech Connect

    Harris, M.D.

    1984-01-01

    This book presents an overview of the production by computers and utilization of natural language, as differentiated from programming language. It considers both the practical and theoretical problems of natural language input-output. It presents the computational aspects of the subject with exceptional clarity through the use of concrete programs written in Pascal. It outlines methods for analysis, synthesis, and transformation of language. The book treats syntax and grammar (structure), semantics (inherent meaning), and representation of knowledge (storage and access).

  12. The natural approach to osteoporosis

    PubMed Central

    Bartolozzi, Emanuela

    2015-01-01

    Summary Osteoporosis is normally the result of a wrong life-style (diet, physical inactivity, smoke, dental hygiene, intestinal dysbiosis,…) and environmental toxicity which stimulate the chronic expression of inflammatory genes and alter the immuno-endocrine balance. A natural approch should face all the factors involved, leading the patients to become aware of their own responsability, and helping them with natural therapies, healthy food and life-style which support their body in the process of self-healing. PMID:26604935

  13. Afghanistan's energy and natural resources

    SciTech Connect

    Balcome-Rawding, R.; Porter, K.C.

    1989-10-01

    This study provides a resource perspective from which to better plan the necessary steps toward the viable reconstruction and economic development of post war Afghanistan. The vast availability of natural resources affords the opportunity to formulate a framework upon which Afghanistan can grow and prosper in the future. The paper includes the following sections: Historical Overview: Thwarted Opportunities; Natural Resources: A Survey of Possibilities; The Future: Post War Rehabilitation and Reconstruction; and Conclusions: Future Energy Sources.

  14. Electric generation with natural gas

    SciTech Connect

    Long, G.M.

    1989-01-01

    This paper discusses the benefits of natural gas use in electric generating stations. Modes of gas use in converting existing plants are listed and are followed by some precautions to take in avoiding problems. Dual-fuel plants are described as to their benefits when full natural gas supply is not always feasible. Addition of electric generating capacity with gas turbine-driven units is discussed. Cogeneration and utilization of waste heat are described. 5 refs., 5 figs.

  15. EM modeling for GPIR using 3D FDTD modeling codes

    SciTech Connect

    Nelson, S.D.

    1994-10-01

    An analysis of the one-, two-, and three-dimensional electrical characteristics of structural cement and concrete is presented. This work connects experimental efforts in characterizing cement and concrete in the frequency and time domains with the Finite Difference Time Domain (FDTD) modeling efforts of these substances. These efforts include Electromagnetic (EM) modeling of simple lossless homogeneous materials with aggregate and targets and the modeling dispersive and lossy materials with aggregate and complex target geometries for Ground Penetrating Imaging Radar (GPIR). Two- and three-dimensional FDTD codes (developed at LLNL) where used for the modeling efforts. Purpose of the experimental and modeling efforts is to gain knowledge about the electrical properties of concrete typically used in the construction industry for bridges and other load bearing structures. The goal is to optimize the performance of a high-sample-rate impulse radar and data acquisition system and to design an antenna system to match the characteristics of this material. Results show agreement to within 2 dB of the amplitudes of the experimental and modeled data while the frequency peaks correlate to within 10% the differences being due to the unknown exact nature of the aggregate placement.

  16. 164 nature physics | VOL 5 | MARCH 2009 | www.nature.com/naturephysics A quantum of natural selection

    E-print Network

    Loss, Daniel

    164 nature physics | VOL 5 | MARCH 2009 | www.nature.com/naturephysics commentary A quantum of natural selection Seth Lloyd The modern evolutionary synthesis, which marries Darwin's theory of natural of natural selection. Perhaps the most surprising aspect of the book is that Darwin was able to construct his

  17. insight review articles 884 NATURE | VOL 426 |18/25 DECEMBER 2003 | www.nature.com/nature

    E-print Network

    Hardy, Jeanne

    insight review articles 884 NATURE | VOL 426 |18/25 DECEMBER 2003 | www.nature.com/nature O ne-term stability in crowded biologi- cal environments and are able to interact selectively with their natural.Inthisarticleweexploretheunderlyingmechanismof protein folding and of the nature and consequences of misfoldinganditslinkswithdisease. The fundamental

  18. news and views NATURE|VOL430|8JULY2004|www.nature.com/nature 151

    E-print Network

    Steinberger, Bernhard

    news and views NATURE|VOL430|8JULY2004|www.nature.com/nature 151 Earth science Kinks and circuits magna ex parte adleventur. From Nature 7 July 1904. 50 YEARS AGO The main point I wish to make. This is so because the atoms are fastened together by bonds which have definite positions. Hence Nature has

  19. NATURE|VOL423|15MAY2003|www.nature.com/nature 211 JimGiles,London

    E-print Network

    NATURE|VOL423|15MAY2003|www.nature.com/nature 211 JimGiles,London Leading neuroscientist Colin facing a barrage of criticism lately from the community it funds (see Nature 422, 461; 2003). Currently neurobiologist at King's College London. But Lumsden, like other researchers contacted by Nature, says

  20. Sampling and Analysis Plan Update for Groundwater Monitoring 1100-EM-1 Operable Unit

    SciTech Connect

    DR Newcomer

    1999-06-17

    This document updates the sampling and analysis plan (Department of Energy/Richland Operations--95-50) to reflect current groundwater monitoring at the 1100-EM-1Operable Unit. Items requiring updating included sampling and analysis protocol, quality assurance and quality control, groundwater level measurement procedure, and data management. The plan covers groundwater monitoring, as specified in the 1993 Record of Decision, during the 5-year review period from 1995 through 1999. Following the 5-year review period, groundwater-monitoring data will be reviewed by Environmental Protection Agency to evaluate the progress of natural attenuation of trichloroethylene. Monitored natural attenuation and institutional controls for groundwater use at the inactive Horn Rapids Landfill was the selected remedy specified in the Record of Decision.

  1. Idaho National Engineering Laboratory materials in inventory natural and enriched uranium management and storage costs

    SciTech Connect

    Nebeker, R.L.

    1995-11-01

    On July 13, 1994, the Office of Environmental Management (EM) was requested to develop a planning process that would result in management policies for dealing with nuclear materials in inventory. In response to this request, EM launched the Materials In Inventory (MIN) Initiative. A Headquarters Working Group was established to develop the broad policy framework for developing MIN management policies. MIN activities cover essentially all nuclear materials within the DOE complex, including such items as spent nuclear fuel, depleted uranium, plutonium, natural and enriched uranium, and other materials. In August 1995, a report discussing the natural and enriched uranium portion of the Initiative for the Idaho National Engineering Laboratory (INEL) was published. That report, `Idaho National Engineering Laboratory Materials-in-Inventory, Natural and Enriched Uranium`.` identified MIN under the control of Lockheed Idaho Technologies Company at the INEL. Later, additional information related to the costs associated with the storage of MIN materials was requested to supplement this report. This report provides the cost information for storing, disposing, or consolidating the natural and enriched uranium portion of the MIN materials at the INEL. The information consists of eight specific tables which detail present management costs and estimated costs of future activities.

  2. Revealing Nature’s Synthetic Potential Through the Study of Ribosomal Natural Product Biosynthesis

    PubMed Central

    Dunbar, Kyle L.; Mitchell, Douglas A.

    2013-01-01

    Ribosomally synthesized posttranslationally modified peptides (RiPPs) are a rapidly growing class of natural products with diverse structures and activities. In recent years, a great deal of progress has been made in elucidating the biosynthesis of various RiPP family members. As with the study of nonribosomal peptide and polyketide biosynthetic enzymes, these investigations have led to the discovery of entirely new biological chemistry. With each unique enzyme investigated, a more complex picture of Nature’s synthetic potential is revealed. This review focuses on recent reports (since 2008) that have changed the way that we think about ribosomal natural product biosynthesis and the enzymology of complex bond-forming reactions. PMID:23286465

  3. Fractal Nature of Solar Interior

    E-print Network

    Koushik Ghosh; Probhas Raychaudhuri

    2006-05-04

    Fractal method has been studied to understand the irregular and chaotic nature of any physical structure. Conventionally it is suggested that the solar interior is rigid in nature. Since solar neutrino flux is the indicator of the interior solar structure it is natural to study the solar neutrino flux source to find if the nuclear energy generation inside the sun is fractal in nature or not. At present there exist five solar neutrino experiments to detect neutrinos from the sun which can suggest which type of nuclear energy generation occurs inside the sun. Since we know that the solar atmosphere is irregular in nature many authors have studied this irregular nature by fractal analysis. In this regard we have studied solar neutrino flux data from 1) Homestake detector during the period from March, 1970 to April, 1994; 2) SAGE detector during the period from 1st January, 1990 to 31st December, 2000; 3) SAGE detector during the period from April, 1998 to December, 2001; 4) GALLEX detector during the period from May, 1991 to January, 1997; 5) GNO detector during the period from May, 1998 to December, 2001; 6) GALLEX-GNO detector (combined data) from May, 1991 to December, 2001; 7) average of the data from GNO and SAGE detectors during the period from May, 1998 to December, 2001; 8) 5-day-long samples from Super-Kamiokande-I detector during the period from June, 1996 to July,2001; 9) 10-day-long samples from Super-Kamiokande-I detector during the period from June,1996 to July,2001 and 10) 45-day-long samples from Super-Kamiokande-I detector during the period from June,1996 to July,2001 by fractal analysis and we have arrived at the conclusion that the solar neutrino flux data are fractal in nature.

  4. UNIVERSIDADE FEDERAL DE SANTA CATARINA CENTRO DE CINCIAS BIOLGICAS

    E-print Network

    Hanazaki, Natalia

    BIOLOGIA CELULAR E DO DESENVOLVIMENTO Florianópolis - Santa Catarina - Brasil - CEP 88040-900 www A Coordenação do Programa de Pós-Graduação em Biologia Celular e do Desenvolvimento (PPGBCD), do Centro de no Programa de Pós-Graduação em Biologia Celular e do Desenvolvimento - nível de Mestrado Acadêmico. I. DAS

  5. UNIVERSIDADE FEDERAL DE SANTA CATARINA CENTRO DE CINCIAS BIOLGICAS

    E-print Network

    Hanazaki, Natalia

    BIOLOGIA CELULAR E DO DESENVOLVIMENTO Florianópolis - Santa Catarina - Brasil - CEP 88040-900 www A Coordenação do Programa de Pós-Graduação em Biologia Celular e do Desenvolvimento (PPGBCD), do Centro de no Programa de Pós-Graduação em Biologia Celular e do Desenvolvimento ­ nível de Doutorado. I. DAS VAGAS

  6. 1999 Macmillan Magazines Ltd letters to nature

    E-print Network

    Cho, John Y. N.

    © 1999 Macmillan Magazines Ltd letters to nature 316 NATURE |VOL 398 |25 MARCH 1999 |www.nature. Molecular recognition in biomineralization. Nature 332, 119±124 (1988). 2. Berman, A. et al. Intercalation). 3. Mann, S. Molecular tectonics in biomineralization and biomimetic materials chemistry. Nature 365

  7. "Nature creates nothing without a purpose"

    E-print Network

    Huang, Jianbin

    products Nature Product-Centric Approach of Discovering Small-Molecule Probes or Drugs #12; #12; B12 "" " " #12;· · · #12; Source of 1355 small-molecule approved drugs N: Natural product NB: Natural product botanical ND: Derived from natural product NM: Natural product mimetic S: Totally synthetic drug S*: Made

  8. DEPARTMENT OF HUMAN DIMENSIONS OF NATURAL RESOURCES

    E-print Network

    the human dimensions of natural resource management and integrate them with the biophysical elementsCODE DEPARTMENT OF HUMAN DIMENSIONS OF NATURAL RESOURCES College of Natural Resources Colorado;3 DEPARTMENT OF NATURAL HUMAN DIMENSIONS OF NATURAL RESOURCES CODE ARTICLE I. GOAL AND OBJECTIVES A. DEPARTMENT

  9. What is Imbalance of Nature?

    NASA Astrophysics Data System (ADS)

    Kontar, V. A.

    2012-12-01

    The Mother Nature is imbalanced at all. The Mother Nature is every moment new, never returns to previous condition. The gravity and magnetosphere are changeable and imbalanced. The Sun is changeable and imbalanced. The climate is changeable and imbalanced. The atmosphere is changeable and imbalanced. The ocean is changeable and imbalanced. The crust and deep interior are changeable and imbalanced. The cryosphere is changeable and imbalanced. The life is simultaneously as the creator and the result of the imbalance of Nature. The people society is changeable and imbalanced. All chemical, physical, social, and other phenomenons are changeable and imbalanced. It's just that each phenomenon of the Mother Nature has some personal time-scale: one change in a nanosecond, and looks like for us as instable, i.e. imbalanced; while others change over millions years and, therefore, to us looks like not changeable, i.e. balanced. The scientists who are studying the Nature have convinced that the real balance never exist in Nature. Sometimes we can see something that is stable, i.e. balanced. But on closer study it appears that we are witnessing is not eternal rest and balance, it is not eternal STOP, but it is the perpetual motion, changing, there are a lot of imbalances. The balance it can be some result of the temporary mutual compensation the imbalanced processes in opposite directions. The balance it can be also some result of the inaccurate measurement, misunderstanding of conception or even request from bosses. But if we start use more accurate measurements, improve the models and not fear the bosses, than usually we got some new details. These new details show thet under the balanced visibility in really is hiding the interaction of many imbalanced processes of different directions. The balanced logic usually answers to question: What is it? The balanced answers are approximate and it will be updated many times during the development of science and practice. The imbalanced logic usually answers to question: How and why it is happened in details? The imbalanced answers are approximate also, and they will also be updated many times during the development of science and practice. But the imbalanced logic allows us to overcome of the inertia of the balanced logic and much closer come up to understanding the essence of Nature. We try to answer the central question of humanity: How to get calm, i.e. balanced life if the everything around us is imbalanced, the people themselves are restless and not eternal? The study of the Imbalance of Nature is multi-disciplinary because Nature is one. It is our main advantage.

  10. Natural pigments and sacred art

    NASA Astrophysics Data System (ADS)

    Kelekian, Lena, ,, Lady

    2010-05-01

    Since the dawn of mankind, cavemen has expressed himself through art. The earliest known cave paintings date to some 32,000 years ago and used 4 colours derived from the earth. These pigments were iron oxides and known as ochres, blacks and whites. All pigments known by the Egyptians, the Greeks, the Romans and Renaissance man were natural and it was not until the 18th century that synthetic pigments were made and widely used. Until that time all art, be it sacred or secular used only natural pigments, of which the preparation of many have been lost or rarely used because of their tedious preparation. As a geologist, a mineralogist and an artist specializing in iconography, I have been able to rediscover 89 natural pigments extracted from minerals. I use these pigments to paint my icons in the traditional Byzantine manner and also to restore old icons, bringing back their glamour and conserving them for years to come. The use of the natural pigments in its proper way also helps to preserve the traditional skills of the iconographer. In the ancient past, pigments were extremely precious. Many took an exceedingly long journey to reach the artists, and came from remote countries. Research into these pigments is the work of history, geography and anthropology. It is an interesting journey in itself to discover that the blue aquamarines came from Afghanistan, the reds from Spain, the greens Africa, and so on. In this contribution I will be describing the origins, preparation and use of some natural pigments, together with their history and provenance. Additionally, I will show how the natural pigments are used in the creation of an icon. Being a geologist iconographer, for me, is a sacrement that transforms that which is earthly, material and natural into a thing of beauty that is sacred. As bread and wine in the Eucharist, water during baptism and oil in Holy Union transmit sanctification to the beholder, natural pigments do the same when one considers an icon. The iconographer uses earthly creations to create divine images: "Thine own of Thine own we offer unto Thee." (Byzantine Liturgy). Thus, by combining geology with art and religion, I can render homage to God through His creation by using minerals of the Planet Earth, as natural pigments in painting His image.

  11. Environmentalism and natural aggregate mining

    USGS Publications Warehouse

    Drew, L.J.; Langer, W.H.; Sachs, J.S.

    2002-01-01

    Sustaining a developed economy and expanding a developing one require the use of large volumes of natural aggregate. Almost all human activity (commercial, recreational, or leisure) is transacted in or on facilities constructed from natural aggregate. In our urban and suburban worlds, we are almost totally dependent on supplies of water collected behind dams and transported through aqueducts made from concrete. Natural aggregate is essential to the facilities that produce energy-hydroelectric dams and coal-fired powerplants. Ironically, the utility created for mankind by the use of natural aggregate is rarely compared favorably with the environmental impacts of mining it. Instead, the empty quarries and pits are seen as large negative environmental consequences. At the root of this disassociation is the philosophy of environmentalism, which flavors our perceptions of the excavation, processing, and distribution of natural aggregate. The two end-member ideas in this philosophy are ecocentrism and anthropocentrism. Ecocentrism takes the position that the natural world is a organism whose arteries are the rivers-their flow must not be altered. The soil is another vital organ and must not be covered with concrete and asphalt. The motto of the ecocentrist is "man must live more lightly on the land." The anthropocentrist wants clean water and air and an uncluttered landscape for human use. Mining is allowed and even encouraged, but dust and noise from quarry and pit operations must be minimized. The large volume of truck traffic is viewed as a real menace to human life and should be regulated and isolated. The environmental problems that the producers of natural aggregate (crushed stone and sand and gravel) face today are mostly difficult social and political concerns associated with the large holes dug in the ground and the large volume of heavy truck traffic associated with quarry and pit operations. These concerns have increased in recent years as society's demand for living space has encroached on the sites of production; in other words, the act of production has engendered condemnation. Many other environmental problems that are associated with dust and noise and blasting from quarry and pit operations have been reduced through the efficient use of technology. Recycling concrete in buildings, bridges, and roads and asphaltic pavements will ultimately reduce the demand for virgin natural aggregate. The impact created by the large holes in the ground required for the mining of natural aggregate can be greatly reduced by planning their reclamation before mining begins. ?? 2002 International Association for Mathematical Geology.

  12. 1999 Macmillan Magazines LtdNATURE |VOL 399 |3 JUNE 1999 |www.nature.com 437 letters to nature

    E-print Network

    Lockwood, Mike

    © 1999 Macmillan Magazines LtdNATURE |VOL 399 |3 JUNE 1999 |www.nature.com 437 letters to nature A doubling of the Sun's coronal magnetic field during the past 100 years M. Lockwood, R. Stamper & M. N. Wild

  13. Economics of natural gas upgrading

    SciTech Connect

    Hackworth, J.H.; Koch, R.W.

    1995-07-01

    Natural gas could be an important alternative energy source in meeting some of the market demand presently met by liquid products from crude oil. This study was initiated to analyze three energy markets to determine if greater use could be made of natural gas or natural gas derived products and if those products could be provided on an economically competitive basis. The three markets targeted for possible increases in gas use were motor fuels, power generation, and the chemical feedstocks market. The economics of processes to convert natural gas to transportation fuels, chemical products, and power were analyzed. The economic analysis was accomplished by drawing on a variety of detailed economic studies, updating them and bringing the results to a common basis. The processes analyzed included production of methanol, MTBE, higher alcohols, gasoline, CNG, and LNG for the transportation market. Production and use of methanol and ammonia in the chemical feedstock market and use of natural gas for power generation were also assessed. Use of both high and low quality gas as a process feed stream was evaluated. The analysis also explored the impact of various gas price growth rates and process facility locations, including remote gas areas. In assessing the transportation fuels market the analysis examined production and use of both conventional and new alternative motor fuels.

  14. Fueling up with natural gas

    SciTech Connect

    Stodolsky, F.; Santini, D.J. )

    1993-10-01

    A careful analysis is needed of the energy efficiency of the fuel cycle (the efficiency of the conversion from resource extraction to final use by consumers) and the environmental impact of natural gas fuels. This information can help policy makers decide which fuels could be used to displace imported oil, maintain air quality, and be the basis of a new transportation fuels infrastructure. The authors compare the impact of natural gas fuels and additives derived from natural gas and blended with gasoline with that of gasoline alone by examining the energy efficiency of the fuel cycle as well as greenhouse gas emissions. Although this subject has been studied before, they add to those earlier studied by looking at MTBE, alkylate, and gasoline (from natural gas). The authors also reexamine CNG, LPG, and methanol on the basis of a vehicle's efficiency potential. Although LNG vehicles were included in an earlier study, they are not included here because lifecycle greenhouse gas emissions were found to be comparable to those from CNG vehicles. They compare natural gas fuels against a baseline fuel--nonoxygenated gasoline (hereafter referred to simply as baseline gasoline).

  15. Toward a New Natural Medicine

    NASA Astrophysics Data System (ADS)

    Buckel, Peter

    Treatments summarized under the term "natural medicine," i.e., those offered as an alternative or in addition to conventional medicine, have enjoyed a surge in popularity in recent years. The "natural" descriptor employed in connection with these healing methods is frequently misunderstood, leading to underestimation of the risks arising from incorrect use. However, the essential principle underlying traditional natural medicine, mobilization of the body's own forces against disease, is increasingly being employed in a new, rational form of medicine: molecular medicine. A range of natural endogenous substances for medical use are already available. Human proteins such as erythropoietin can now be produced as medicines in highly pure form with the aid of genetic engineering techniques. Our increasing understanding of the function of our genes and the resulting descriptions of molecular mechanisms underlying disease are also helping us to utilize the body's own construction set. New techniques such as gene therapy will in future enable us to reproduce the natural conditions in the healthy body with increasing specificity in our attempts to cure illnesses. One such application will be the activation of the immune system to combat cancer. The complete decoding of the human genome will not only allow illnesses to be described, and possibly prevented, at an earlier stage. Illnesses will also be able to described more precisely and individually at the molecular level, opening up the possibility of targeted, patient-specific cures.

  16. Natural pedagogy as evolutionary adaptation

    PubMed Central

    Csibra, Gergely; Gergely, György

    2011-01-01

    We propose that the cognitive mechanisms that enable the transmission of cultural knowledge by communication between individuals constitute a system of ‘natural pedagogy’ in humans, and represent an evolutionary adaptation along the hominin lineage. We discuss three kinds of arguments that support this hypothesis. First, natural pedagogy is likely to be human-specific: while social learning and communication are both widespread in non-human animals, we know of no example of social learning by communication in any other species apart from humans. Second, natural pedagogy is universal: despite the huge variability in child-rearing practices, all human cultures rely on communication to transmit to novices a variety of different types of cultural knowledge, including information about artefact kinds, conventional behaviours, arbitrary referential symbols, cognitively opaque skills and know-how embedded in means-end actions. Third, the data available on early hominin technological culture are more compatible with the assumption that natural pedagogy was an independently selected adaptive cognitive system than considering it as a by-product of some other human-specific adaptation, such as language. By providing a qualitatively new type of social learning mechanism, natural pedagogy is not only the product but also one of the sources of the rich cultural heritage of our species. PMID:21357237

  17. Proceedings of the 2013 Conference on Empirical Methods in Natural Language Processing, pages 152162, Seattle, Washington, USA, 18-21 October 2013. c 2013 Association for Computational Linguistics

    E-print Network

    Proceedings of the 2013 Conference on Empirical Methods in Natural Language Processing, pages 152- ing a simple expectation-maximization (EM) algorithm. We empirically evaluate the pro- posed method multinomial Naive Bayes model with latent variables to conduct supervised word cluster- ing on labeled

  18. 2. HI PAR (ACQUISITION RADAR) TOWER AND ENLISTED MEN (EM) ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    2. HI PAR (ACQUISITION RADAR) TOWER AND ENLISTED MEN (EM) BARRACKS WITH RADAR ATTACHED. - Nike Hercules Missile Battery Summit Site, Battery Control Administration & Barracks Building, Anchorage, Anchorage, AK

  19. Natural GUT and the cosmology

    SciTech Connect

    Maekawa, Nobuhiro

    2012-07-27

    In the natural GUT, not only realistic quark and lepton mass matrices can be obtained but also the most serious problem in the SUSY GUT, which is called the doublet-triplet splitting problem, can be solved under the natural assumption that all the interactions which are allowed by the symmetry are introduced with O(1) coefficients (including the higher dimensional operators). In this manuscript, we examine several cosmological aspects which are related with the natural GUT, B - L-genesis, non-thermal production of dark matter (DM), vacuum selection by particle production, and the inflation after the trapping. These works are based on several papers[1, 2, 3] collaborated with S. Enomoto, S. Iida, Y. Kurata, and T. Matsuda.

  20. Surface reactions of natural glasses

    SciTech Connect

    White, A.F.

    1986-12-31

    Reactions at natural glass surfaces are important in studies involving nuclear waste transport due to chemical control on ground water in host rocks such as basalt and tuff, to potential diffusion into natural hydrated glass surfaces and as natural analogs for waste glass stability. Dissolution kinetics can be described by linear surface reaction coupled with cation interdiffusion with resulting rates similar to those of synthetic silicate glasses. Rates of Cs diffusion into hydrated obsidian surfaces between 25{sup 0} and 75{sup 0}C were determined by XPS depth profiles and loss rates from aqueous solutions. Calculated diffusion coefficients were ten others of magnitude more rapid than predicted from an Arrhenius extrapolation of high temperature tracer diffusion data due to surface hydration reactions.

  1. Naturalizing phenomenology - A philosophical imperative.

    PubMed

    Harney, Maurita

    2015-12-01

    Phenomenology since Husserl has always had a problematic relationship with empirical science. In its early articulations, there was Husserl's rejection of 'the scientific attitude', Merleau-Ponty's distancing of the scientifically-objectified self, and Heidegger's critique of modern science. These suggest an antipathy to science and to its methods of explaining the natural world. Recent developments in neuroscience have opened new opportunities for an engagement between phenomenology and cognitive science and through this, a re-thinking of science and its hidden assumptions more generally. This is so partly because of the shortcomings of conventional mechanistically-conceived science in dealing with complex and dynamic phenomena such as climate change, brain plasticity, the behaviour of collectives, the dynamics of various microbiological processes, etc. But it is also due to recent phenomenological scholarship focussed on the 'embodied' phenomenology of Husserl's Ideen II and Merleau Ponty's later ontology of nature which have helped to extend the insights of phenomenology beyond the narrowly 'human' to an understanding of nature (which includes the human) more generally. Thus re-contextualised, phenomenology is well placed to examine some of the assumptions that give rise to the reductionism and associated scientism which has characterised conventional science in its approach to the study of natural processes. In light of this, it might be suggested that the 'anti-science' of early articulations of phenomenology is more a hostility to the underlying assumptions of science as conventionally understood than to science itself - that it is scientism rather than science that is targeted. In this paper, I aim to show how a phenomenological naturalism might be seen as a necessary step towards the development of a non-reductionist and non-scientistic approach to scientific inquiry. A key to this is a reconceptualization of nature as inclusive of meanings and of mind. It is a conception developed by Merleau-Ponty, especially in his later ontology of nature, and one that is shared by American pragmatist philosopher of science, C.S. Peirce (1839-1914). For both philosophers, meaning must be understood in terms of an ontology which is relational rather than atomistic, and dynamic or processual rather than static and substance-based. For Merleau-Ponty this is an experientially-derived ontology; for Peirce it is a more conceptually-based one. In this paper, I explore this connection between these two philosophers in two stages. The first is by reference to Peirce's theory of signs or semiotics. More specifically, I look at the application of this theory to the study of biological processes as developed in Peirce-inspired biosemiotics. In the light of this, I suggest that Merleau-Ponty's account of intentional relations in nature might be articulated as semiotic relations, and can serve as a philosophical basis for a non-reductive biological science. I then turn to questions relating to the ontology of nature. I explore Merleau-Ponty's experientially-based "ontology of flesh" and Peirce's distinctive form of naturalism to show affinities at this ontological level. These affinities consist in commitments to a reality that includes possibility, meaning, temporality, and final causation - that is, an ontology which is far more inclusive than that of conventional positivistic science. Peirce's broader scientific metaphysics enables us to extend Merleau-Ponty's phenomenological naturalism beyond the biological to the physical sciences. Whilst Merleau-Ponty's ontology of nature provides the experiential basis necessary for a critique of scientism, Peirce establishes the relevance of that ontology for a re-conceived empirical science. PMID:26272798

  2. Natural gas monthly, February 1997

    SciTech Connect

    1997-02-01

    This issue of the Natural Gas Monthly presents estimates of natural gas supply and consumption through February 1997. Estimates of natural gas prices are through November 1996 except electric utility prices that are through October 1996. Cumulatively for January through February 1997, the daily average rates for several data series remain close to those of 1996. (Comparing daily rates accounts for the fact that February 1996 had 29 days.) Daily total consumption for January through February is estimated to be 83 billion cubic feet per day, 1 percent higher than during the same period in 1996. Similarly, the estimate of average daily production of 53 billion cubic feet is 1.5 percent higher than in 1996, while daily net imports during the first 2 months of 1997 are virtually unchanged from 1996.

  3. Synthesis of Polycyclic Natural Products

    SciTech Connect

    Tuan Hoang Nguyen

    2003-05-31

    With the continuous advancements in molecular biology and modern medicine, organic synthesis has become vital to the support and extension of those discoveries. The isolations of new natural products allow for the understanding of their biological activities and therapeutic value. Organic synthesis is employed to aid in the determination of the relationship between structure and function of these natural products. The development of synthetic methodologies in the course of total syntheses is imperative for the expansion of this highly interdisciplinary field of science. In addition to the practical applications of total syntheses, the structural complexity of natural products represents a worthwhile challenge in itself. The pursuit of concise and efficient syntheses of complex molecules is both gratifying and enjoyable.

  4. Natural polysaccharides as electroactive polymers.

    PubMed

    Finkenstadt, Victoria L

    2005-06-01

    Electroactive polymers (EAPs), a new class of materials, have the potential to be used for applications like biosensors, environmentally sensitive membranes, artificial muscles, actuators, corrosion protection, electronic shielding, visual displays, solar materials, and components in high-energy batteries. The commercialization of synthetic EAPs, however, has so far been severely limited. Biological polymers offer a degree of functionality not available in most synthetic EAPs. Carbohydrate polymers are produced with great frequency in nature. Starch, cellulose, and chitin are some of the most abundant natural polymers on earth. Biopolymers are a renewable resource and have a wide range of uses in nature, functioning as energy storage, transport, signaling, and structural components. In general, electroactive materials with polysaccharide matrices reach conductance levels comparable with synthetic ion-conducting EAPs. This review gives a brief history of EAPs, including terminology, describes evaluation methods, and reports on the current progress of incorporating polysaccharides as matrices for doped, blended, and grafted electroactive materials. PMID:15724215

  5. Hegel's notion of natural purpose.

    PubMed

    Michelini, Francesca

    2012-03-01

    This paper argues that the notion of natural purpose developed by Hegel can only be thoroughly grasped by considering its intimate connection with the idea of contradiction and, particularly, with what Hegel in his philosophy of nature called the 'activity of deficiency'. This expression is used by Hegel to denote the ontological situation of every living being, which is embodied most authentically in the concepts of need and drive. For Hegel, life itself is imbued with contradiction because it is inextricably bound up with what it lacks: its identity is at one with its negation. This paper defends the thesis that Hegel's philosophy-and not just his philosophy of nature-can be characterized as an 'ontology of life' (to use the same expression that Martin Heidegger applied to Aristotle's De Anima), or more precisely, as an ontology of living individuality. PMID:22326082

  6. letters to nature NATURE |VOL 391 |26 FEBRUARY 1998 889

    E-print Network

    Waxman, David

    . 1. Unwin, D. Pterosaur locomotion: joggers or waddlers? Nature 327, 13­14 (1987). 2. Padian, K analysis of flying and walking in pterosaurs. Paleobiology 9, 218­239 (1983). 4. Padian, K. in Biomechanics. Press, 1991). 5. Padian, K. & Rayner, J. V. The wings of pterosaurs. Am. J. Sci. 239-A, 91­166 (1993). 6

  7. Nature Macmillan Publishers Ltd 1998 letters to nature

    E-print Network

    Romanowicz, Barbara

    bloom induced by an ecosystem-scale iron fertilization experiment in the equatorial Pacific Ocean 21 February 1998. 1. Martin, J. H. & Fitzwater, S. E. Iron deficiency limits phytoplankton growth. Nature 383, 495­501 (1996). 3. de Baar, H. J. W. et al. On iron limitation of the Southern Ocean

  8. Nature of Science Contextualized: Studying Nature of Science with Scientists

    ERIC Educational Resources Information Center

    Tala, Suvi; Vesterinen, Veli-Matti

    2015-01-01

    Understanding nature of science (NOS) is widely considered an important educational objective and views of NOS are closely linked to science teaching and learning. Thus there is a lively discussion about what understanding NOS means and how it is reached. As a result of analyses in educational, philosophical, sociological and historical research,…

  9. The Power of Nature and the Nature of Power

    ERIC Educational Resources Information Center

    Neilson, Alison Laurie

    2009-01-01

    This paper explores the process of going outdoors and using "nature" as a way to support teaching about power and privilege within society. It explores how being inside the classroom hinders the process of understanding and disrupting power dynamics between learners and instructors. The classroom decontextualizes the learning process by denying…

  10. Nature Macmillan Publishers Ltd 1998 letters to nature

    E-print Network

    Kaye, Jason P.

    and chemical composition of non-eruptive plumes from Mt. St. Helens 1980±88. J. Volcanol. Geotherm. Res. 51 to the atmosphere by volcanoes. J. Volcanol. Geotherm. Res. 33, 1±8 (1987). 29. Symonds, R. B., Rose, W. I. & Reed, M. H. Contribution of Cl- and F-bearing gases to the atmosphere by volcanoes. Nature 334, 415

  11. Nature Macmillan Publishers Ltd 1998 letters to nature

    E-print Network

    Jaeger, Dieter

    biodiversity of different sets of areas?: on hotspots, complementarity and pattern-based approaches. Biodiv, the coincidence of diversity hotspots and conservation strategies. Nature 365, 335±337 (1993). 4. Lombard, A. T. The problems with multi-species conservation: do hotspots, ideal reserves and existing reserves coincide? S

  12. The Anthropocene, Ethics, and the Nature of Nature

    NASA Astrophysics Data System (ADS)

    Trachtenberg, Z.

    2012-12-01

    For Earth scientists the Anthropocene has a strict meaning, tied to evidence that human activities have produced pervasive impacts on the Earth. But it is also significant for scholars outside the Earth sciences. Social scientists study the ways human societies transform the landscape to make it more suited to human habitation; the Anthropocene idea has already served to reveal conceptual linkages among physical and social science research programs. And the Anthropocene has important implications for normative theorists who enquire into the basis of ethical standards that, ideally, guide human activities within the environment. An influential view has held the condition of the Earth's systems in the absence of human interference as such a standard. This view emphasizes the preservation of environmental systems in (or restoration to) their "natural" condition—either because that condition is the most advantageous for human beings, or because those systems have an intrinsic moral value human beings ought to respect. However, Anthropocene research destabilizes the concept of nature. For the "natural" is typically opposed to the artificial, i.e. to the results of human action, and although nature obviously provides the context for human activity, that context is taken to be exogenously given. For virtually all of Earth's history, its systems were "natural" in this sense. However, since the appearance of life on Earth, organisms engaging in what is called niche construction have fundamentally transformed those systems up to the planetary scale. There is no reason to regard human niche construction (e.g. agriculture) as different in kind—though of course anthropogenic impacts are greater than the impacts of other species. It follows that the Anthropocene demands that we move away from an outlook based on a strict opposition between a "natural" condition and the human activities which change it, towards one that conceives of the natural not as a condition, but as a highly complex system of processes which includes human activity as a component. This outlook thus discounts the idea that there is a condition of the environment that, in virtue of being "natural," can meaningfully serve as an ethical standard for human activity. It might be feared that this outlook could weaken inhibitions that serve to lessen the impact human beings have on their surroundings. For in the absence of a natural standard, people might feel licensed to intensify their transformative activities, generating a feedback loop by which the emergence of the idea of the Anthropocene makes the appearance of widespread anthropogenic impacts on Earth more likely. However, it is not inevitable that the Anthropocene idea will prompt a runaway feedback process. For the idea by no means implies an absence of normative restraints on human behavior. Instead, in denying that there is a way nature "ought" to be, the Anthropocene lends support to ethical views that regard normative standards as human conventions, aimed at enhancing the interests of the human community. And because it is tied to a systemic view of human activity in the environment, the Anthropocene idea can help focus attention on ways certain activities lead to adverse impacts on human interests, thus providing an ethical justification for restraints on those activities. That is, the idea might help make anthropogenic change, not less likely, but more acceptable.

  13. North American Natural Gas Markets

    SciTech Connect

    Not Available

    1989-02-01

    This report summarizes die research by an Energy Modeling Forum working group on the evolution of the North American natural gas markets between now and 2010. The group's findings are based partly on the results of a set of economic models of the natural gas industry that were run for four scenarios representing significantly different conditions: two oil price scenarios (upper and lower), a smaller total US resource base (low US resource case), and increased potential gas demand for electric generation (high US demand case). Several issues, such as the direction of regulatory policy and the size of the gas resource base, were analyzed separately without the use of models.

  14. A new dialogue with nature

    NASA Astrophysics Data System (ADS)

    Timashev, S. F.

    2000-02-01

    A real possibility to realize a "new dialogue with Nature" (after I. Prigogine and I. Stengers) is discussed. It is shown that a phenomenological approach which may be called Flicker-Noise Spectroscopy presents an attempt to give positive answers to these general questions: What type of general phenomenological information is actually contained in signals (time series or "spatial series" if spatial structures are studied) coming from complex natural systems of different content, and what is the physical meaning of this hidden information? What tools and methods allow anyone to extract this information in a correct way and in a desirable quantity?

  15. Defocus blur discrimination in natural images with natural optics

    PubMed Central

    Sebastian, Stephen; Burge, Johannes; Geisler, Wilson S.

    2015-01-01

    The lens system in the human eye is able to best focus light from only one distance at a time.Therefore, many objects in the natural environment are not imaged sharply on the retina. Furthermore, light from objects in the environment is subject to the particular aberrations of the observer's lens system (e.g., astigmatism and chromatic aberration). We refer to blur created by the observer's optics as “natural” or “defocus” blur as opposed to “on-screen” blur created by software on a display screen. Although blur discrimination has been studied extensively, human ability to discriminate defocus blur in images of natural scenes has not been systematically investigated. Here, we measured discrimination of defocus blur for a collection of natural image patches, sampled from well-focused photographs. We constructed a rig capable of presenting stimuli at three physical distances simultaneously. In Experiment 1, subjects viewed monocularly two simultaneously presented natural image patches through a 4-mm artificial pupil at ±1° eccentricity. The task was to identify the sharper patch. Discrimination thresholds varied substantially between stimuli but were correlated between subjects. The lowest thresholds were at or below the lowest thresholds ever reported. In a second experiment, we paralyzed accommodation and retested a subset of conditions from Experiment 1. A third experiment showed that removing contrast as a cue to defocus blur had only a modest effect on thresholds. Finally, we describe a simple masking model and evaluate how well it can explain our experimental results and the results from previous blur discrimination experiments. PMID:26067534

  16. 40 CFR 1065.715 - Natural gas.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ...2010-07-01 2010-07-01 false Natural gas. 1065.715 Section 1065...Calibration Standards § 1065.715 Natural gas. (a) Except as specified in paragraph (b) of this section, natural gas for testing must meet the...

  17. 40 CFR 1065.715 - Natural gas.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ...2013-07-01 2013-07-01 false Natural gas. 1065.715 Section 1065...Calibration Standards § 1065.715 Natural gas. (a) Except as specified in paragraph (b) of this section, natural gas for testing must meet the...

  18. 40 CFR 1065.715 - Natural gas.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ...2011-07-01 2011-07-01 false Natural gas. 1065.715 Section 1065...Calibration Standards § 1065.715 Natural gas. (a) Except as specified in paragraph (b) of this section, natural gas for testing must meet the...

  19. 40 CFR 1065.715 - Natural gas.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ...2014-07-01 2014-07-01 false Natural gas. 1065.715 Section 1065...Calibration Standards § 1065.715 Natural gas. (a) Except as specified in paragraph (b) of this section, natural gas for testing must meet the...

  20. 40 CFR 1065.715 - Natural gas.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ...2012-07-01 2012-07-01 false Natural gas. 1065.715 Section 1065...Calibration Standards § 1065.715 Natural gas. (a) Except as specified in paragraph (b) of this section, natural gas for testing must meet the...

  1. Natural selection in a contemporary human population

    E-print Network

    Natural selection in a contemporary human population Sean G. Byarsa , Douglas Ewbankb , Diddahally heritability Homo sapiens medical traits Are contemporary humans experiencing natural selection and evolving community (1) holds that natural selection does not operate on contemporary human populations because

  2. Natural Gas Hydrates Update 1998-2000

    EIA Publications

    2001-01-01

    Significant events have transpired on the natural gas hydrate research and development front since "Future Supply Potential of Natural Gas Hydrates" appeared in Natural Gas 1998 Issues and Trends and in the Potential Gas Committee's 1998 biennial report.

  3. www.nature.com/reviews Leadingthe field

    E-print Network

    Cai, Long

    journals in their fields.* All are in the top 7 of their specialties Nature Reviews Cardiology* Nature in adult and pediatric disorders of the kidney, including specialists in general internal medicine. Nature

  4. 31 CFR 540.309 - Natural uranium.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ...ASSETS CONTROL REGULATIONS General Definitions § 540.309 Natural uranium. The term natural uranium means uranium found in nature, with an average concentration of 0.711 percent by weight of the isotope...

  5. It's Only Natural: Mother's Love, Mother's Milk

    MedlinePLUS

    ... Enter email address Submit Home > It's Only Natural It's Only Natural Every woman’s journey to motherhood is ... a mom is how to feed your child. It's Only Natural helps African-American women and their ...

  6. The problem of natural funnel asymmetries: a simulation analysis of meta-analysis in macroeconomics.

    PubMed

    Callot, Laurent; Paldam, Martin

    2011-06-01

    Effect sizes in macroeconomic are estimated by regressions on data published by statistical agencies. Funnel plots are a representation of the distribution of the resulting regression coefficients. They are normally much wider than predicted by the t-ratio of the coefficients and often asymmetric. The standard method of meta-analysts in economics assumes that the asymmetries are because of publication bias causing censoring and adjusts the average accordingly. The paper shows that some funnel asymmetries may be 'natural' so that they occur without censoring. We investigate such asymmetries by simulating funnels by pairs of data generating processes (DGPs) and estimating models (EMs), in which the EM has the problem that it disregards a property of the DGP. The problems are data dependency, structural breaks, non-normal residuals, non-linearity, and omitted variables. We show that some of these problems generate funnel asymmetries. When they do, the standard method often fails. Copyright © 2011 John Wiley & Sons, Ltd. PMID:26061677

  7. Enantiomeric Natural Products: Occurrence and Biogenesis**

    PubMed Central

    Finefield, Jennifer M.; Sherman, David H.; Kreitman, Martin; Williams, Robert M.

    2012-01-01

    In Nature, chiral natural products are usually produced in optically pure form; however, on occasion Nature is known to produce enantiomerically opposite metabolites. These enantiomeric natural products can arise in Nature from a single species, or from different genera and/or species. Extensive research has been carried out over the years in an attempt to understand the biogenesis of naturally occurring enantiomers, however, many fascinating puzzles and stereochemical anomalies still remain. PMID:22555867

  8. Svarbiausi?j? Erdvini? Žem?s Plutos ?tempi? Poky?i? Nustatymas Pagal GPS matavim? Rezultatus

    NASA Astrophysics Data System (ADS)

    Stanionis, Arminas

    2008-06-01

    Svarbiausi?j? erdvini? Žem?s plutos ?tempi? poky?iai pagal GPS matavim? Ignalinos atomin?s elektrin?s rajone rezultatus nustatyti tenzorin?s analiz?s b?du. Taikant atvirkštin? Huko d?sn? apskai?iuoti nauji dabartini? Žem?s plutos judesi? charakteristikos duomenys - svarbiausi?j? erdvini? ?tempi? poky?iai. Jie siekia nuo -0,082 MPa iki 0,112 MPa. Nustatyta, kad svarbiausi?j? ?tempi? poky?i? savybi? kaita yra d?sninga, t. y. susijusi su kristalinio pamato tektonini? l?ži? išsid?stymu.

  9. AVALIAÇÃO DA PRESENÇA DE ENDOSSIMBIONTES Cardinium em DIFERENTES ESPÉCIES DE ARTRÓPODES.

    Technology Transfer Automated Retrieval System (TEKTRAN)

    A presença de endossimbiontes do gênero Cardinium em alguns grupos de artrópodes foi recentemente relatada e relacionada com diversas alterações reprodutivas em seus hospedeiros, tais como feminilização de ácaros, partenogênese em parasitóides, incompatibilidade citoplasmática e aumento da fecundida...

  10. Marine EM Reference Database http://marineemlab.ucsd.edu/~kkey/MarineEM

    E-print Network

    Key, Kerry

    to document the peer-reviewed published papers that cover any aspect of marine electromagnetic induction. Techniques and instrumentation for study of natu- ral electromagnetic induction at sea. Physics Of The Earth. I started this database as part of a review paper that was presented at the 20th EM Induction

  11. 7 CFR 650.23 - Natural areas.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... insofar as possible. Natural conditions usually result from allowing ordinary physical and biological... maintained for a variety of purposes including: (i) Furthering science and education. Natural areas...

  12. Berkeley Natural History Museums Organizational Chart

    E-print Network

    Alvarez-Cohen, Lisa

    Berkeley Natural History Museums Organizational Chart November 2008 VICE CHANCELLOR FOR RESEARCH BIODIVERSITY CTER. Mary Power, Director BERKELEY NATURAL HISTORY MUSEUMS Rosemary Gillespie, Chair BERKELEY

  13. Nature in Play: Measuring the Relationship of Nature and Unstructured Play through Case Studies 

    E-print Network

    McCleary, Lisa Christine

    2009-06-09

    posed a limitation to the research. Three case studies document play spaces with little nature, some nature, and complete nature. The Auerberg neighborhood playground (little nature) was not well maintained in a space located near apartments for a low...

  14. 75 FR 73071 - Northern Natural Gas Company, Southern Natural Gas Company, Florida Gas Transmission Company, LLC...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-11-29

    ... Energy Regulatory Commission Northern Natural Gas Company, Southern Natural Gas Company, Florida Gas Transmission Company, LLC, Transcontinental Gas Pipe Line Company, LLC, Enterprise Field Services, LLC; Notice... Abandonment Project proposed by Northern Natural Gas Company, Southern Natural Gas Company, Florida......

  15. Communication - An Effective Tool for Implementing ISO 14001/EMS

    SciTech Connect

    Rachel Damewood; Bowen Huntsman

    2004-04-01

    The Idaho National Engineering and Environmental Laboratory (INEEL) received ISO 14001/EMS certification in June 2002. Communication played an effective role in implementing ISO 14001/EMS at the INEEL. This paper describes communication strategies used during the implementation and certification processes. The INEEL achieved Integrated Safety Management System (ISMS) and Voluntary Protection Program (VPP) Star status in 2001. ISMS implemented a formal process to plan and execute work. VPP facilitated worker involvement by establishing geographic units at various facilities with employee points of contact and management champions. The INEEL Environmental Management System (EMS) was developed to integrate the environmental functional area into its ISMS and VPP. Since the core functions of ISMS, VPP, and EMS are interchangeable, they were easy to integrate. Communication is essential to successfully implement an EMS. (According to ISO 14001 requirements, communication interacts with 12 other elements of the requirements.) We developed communication strategies that integrated ISMS, VPP, and EMS. For example, the ISMS, VPP, and EMS Web sites communicated messages to the work force, such as “VPP emphasizes the people side of doing business, ISMS emphasizes the system side of doing business, and EMS emphasizes the systems to protect the environment; but they all define work, identify and analyze hazards, and mitigate the hazards.” As a result of this integration, the work force supported and implemented the EMS. In addition, the INEEL established a cross-functional communication team to assist with implementing the EMS. The team included members from the Training and Communication organizations, VPP office, Pollution Prevention, Employee and Media Relations, a union representative, facility environmental support, and EMS staff. This crossfunctional team used various communication strategies to promote our EMS to all organization levels and successfully implemented EMS activities through VPP geographic units. In summary, the ISMS and VPP process at the INEEL provided the basic framework of management support and worker involvement to implement our EMS. A cross-functional communication team was established to facilitate the implementation with great success. Communication has been an effective tool for implementing an ISO 14001/EMS at the INEEL.

  16. EM threat analysis for wireless systems.

    SciTech Connect

    Burkholder, R. J. (Ohio State University Electroscience Laboratory); Mariano, Robert J.; Schniter, P. (Ohio State University Electroscience Laboratory); Gupta, I. J. (Ohio State University Electroscience Laboratory)

    2006-06-01

    Modern digital radio systems are complex and must be carefully designed, especially when expected to operate in harsh propagation environments. The ability to accurately predict the effects of propagation on wireless radio performance could lead to more efficient radio designs as well as the ability to perform vulnerability analyses before and after system deployment. In this report, the authors--experts in electromagnetic (EM) modeling and wireless communication theory--describe the construction of a simulation environment that is capable of quantifying the effects of wireless propagation on the performance of digital communication.

  17. INACTIVATION OF NATURALLY OCCURRING ENTEROVIRUSES

    EPA Science Inventory

    The goal of this project was to compare the kinetics of chlorine inactivation of a naturally-shed virus and its tissue culture grown counterpart. Since inactivation studies require purified preparation possessing high infectivity titer and low chlorine demand a major part of this...

  18. Natural Rubber from Domestic Crops

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The United States is wholly dependent upon imports of natural rubber from tropical countries and is the world’s largest consumer of this strategic raw material. Development of domestic rubber crops will create supply security for this strategic raw material, enhance rural development, and create bio...

  19. Wind Engineering & Natural Disaster Mitigation

    E-print Network

    Lennard, William N.

    Wind Engineering & Natural Disaster Mitigation For more than 45 years, Western University has been internationally recognized as the leading university for wind engineering and wind- related research. Its of environmental disaster mitigation, with specific strengths in wind and earthquake research. Boundary Layer Wind

  20. Modeling Natural Variation through Distribution

    ERIC Educational Resources Information Center

    Lehrer, Richard; Schauble, Leona

    2004-01-01

    This design study tracks the development of student thinking about natural variation as late elementary grade students learned about distribution in the context of modeling plant growth at the population level. The data-modeling approach assisted children in coordinating their understanding of particular cases with an evolving notion of data as an…

  1. BREAKTHROUGHS College of Natural Resources

    E-print Network

    Wildermuth, Mary C

    CONTRIBUTING WRITERS Sarah Yang Robert Sanders GRAPHIC DESIGN Chen Design Associates PRINTING UC Printing commitment to applied as well as basic research, students take cutting-edge skills with them confidence and leadership skills, enabling them to contribute solutions for today's complex natural resource

  2. Natural selection in chemical evolution.

    PubMed

    Fernando, Chrisantha; Rowe, Jonathan

    2007-07-01

    We propose that chemical evolution can take place by natural selection if a geophysical process is capable of heterotrophic formation of liposomes that grow at some base rate, divide by external agitation, and are subject to stochastic chemical avalanches, in the absence of nucleotides or any monomers capable of modular heredity. We model this process using a simple hill-climbing algorithm, and an artificial chemistry that is unique in exhibiting conservation of mass and energy in an open thermodynamic system. Selection at the liposome level results in the stabilization of rarely occurring molecular autocatalysts that either catalyse or are consumed in reactions that confer liposome level fitness; typically they contribute in parallel to an increasingly conserved intermediary metabolism. Loss of competing autocatalysts can sometimes be adaptive. Steady-state energy flux by the individual increases due to the energetic demands of growth, but also of memory, i.e. maintaining variations in the chemical network. Self-organizing principles such as those proposed by Kauffman, Fontana, and Morowitz have been hypothesized as an ordering principle in chemical evolution, rather than chemical evolution by natural selection. We reject those notions as either logically flawed or at best insufficient in the absence of natural selection. Finally, a finite population model without elitism shows the practical evolutionary constraints for achieving chemical evolution by natural selection in the lab. PMID:17399743

  3. The Nature of Adventure Education.

    ERIC Educational Resources Information Center

    Cousineau, Claude

    Man answers a natural call for adventure in many ways including escape into fantasy, vertigo seeking, kinetic euphoria, and by exercising the pioneer spirit. Adventure education can help equip people to satisfy their need for adventure in meaningful, enriching ways. A reaction to unsatisfactory educational milieus, adventure education has emerged…

  4. Follow Futures: @NatureFutures

    E-print Network

    Loss, Daniel

    despair. Philosophers and public- relations teamed up to reframe humanity in new ways: Human beings | DECEMBER 2014 | www.nature.com/naturephysics futures A fter six millennia, the human race aborted its proof! Never one to walk away from a contest, the human race set to work scouring old data

  5. Integrating the Nature of Science

    ERIC Educational Resources Information Center

    Weiland, Ingrid; Blieden, Katherine; Akerson, Valarie

    2014-01-01

    The nature of science (NOS) describes what science is and how knowledge in science is developed (NSTA 2013). To develop elementary students' understandings of how scientists explore the world, the authors--an education professor and a third-grade teacher--endeavored to integrate NOS into a third-grade life science unit. Throughout the lesson,…

  6. NATURAL ATTENUATION OF CHLORINATED SOLVENTS

    EPA Science Inventory

    The protocol will simply describe in detail, with references and illustrations, the approach currently used by staff of the SPRD to evaluate natural attenuation of chlorinated solvents in ground water. Staff of SPRD, and staff of the Air Force Center for environmental excellence...

  7. Natural enemies of stink bugs

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Stink bugs have become an increasing problem worldwide, attacking a wide range of economically important crops. Considerable work has been done on biological control of selected stink bug species, but relatively little is known about the complex of natural enemies attacking stink bugs and its effica...

  8. EIA's Natural Gas Production Data

    EIA Publications

    2009-01-01

    This special report examines the stages of natural gas processing from the wellhead to the pipeline network through which the raw product becomes ready for transportation and eventual consumption, and how this sequence is reflected in the data published by the Energy Information Administration (EIA).

  9. Staff Handbook on Natural Gas.

    ERIC Educational Resources Information Center

    Gorges, H. A., Ed.; Raine, L. P., Ed.

    The Department of Commerce created a Natural Gas Action Group early in the fall of 1975 to assist industrial firms and the communities they serve to cope with the effects of potentially severe and crippling curtailment situations. This action group was trained to assess a specific local situation, review the potential for remedial action and…

  10. Natural history museums and cyberspace

    USGS Publications Warehouse

    Wemmer, C.; Erixon-Stanford, M.; Gardner, A.L.

    1996-01-01

    Natural history museums are entering the electronic age as they increasingly use computers to build accessible and shareable databases that support research and education on a world-wide basis. Museums are exploring the Internet and other shared uses of electronic media to enhance their traditional roles in education, training, identifications, technical assistance, and collections management.

  11. A Natural Resources Management Program

    ERIC Educational Resources Information Center

    Lancaster, George B.

    1977-01-01

    Three years of instruction in natural resources management (NRM) are offered at Louisa County High School, Mineral, Virginia, with 30 acres of land for use as outdoor classrooms. Instructional areas are grouped under forestry; crops and soils; and surveying, air, water, recreation, and general. Two years of basic agriculture science and mechanics…

  12. Dimensional stability of natural fibers

    SciTech Connect

    Driscoll, Mark S.

    2013-04-19

    One of the main problems associated with the use of natural fibers as reinforcing agents in composites is their uptake of moisture. Many natural fibers are lignocellulosic, which causes them to swell and shrink as the amount of available moisture changes. Swelling and shrinking can cause composites to prematurely fail. This paper presents the results of a preliminary study that considers the use of two different low molecular weight monomers, hydroxyethyl methacrylate (HEMA) and hydroxyethyl acrylate (HEA), polymerized by electron beam ionizing radiation, to dimensionally stabilize natural fibers. Eight different treatments consisting of varying amounts of monomer, encapsulating agent, and cross-linkers, were evaluated for their ability to dimensionally stabilize sisal fiber. Results indicate that both polymerized HEA and HEMA can reduce the swelling of sisal fiber. The effectiveness of HEA and HEMA can be further enhanced with the use of a cross-linker (SR 454). The use of hydroxylated monomers to dimensionally stabilize natural fibers may play an important role in reducing delamination and improving fiber-resin adhesion in composites.

  13. The Nature of Organizational Politics.

    ERIC Educational Resources Information Center

    Newman, Belinda K.; Carpenter, D. Stanley

    1993-01-01

    Examines the role organizational politics play in student affairs. Sees background knowledge of politics as a concept critical to understanding idiosyncratic nature of any organization. Notes that both organizational conditions and individual behavior contribute to organization's political climate. Concludes that professionals who fail to…

  14. Natural Dyes. Third World Science.

    ERIC Educational Resources Information Center

    Jones, Natalie; Hughes, Wyn

    This unit, developed by the Third World Science Project, is designed to add a multicultural element to existing science syllabi (for students aged 11-16) in the United Kingdom. The project seeks to develop an appreciation of the: boundless fascination of the natural world; knowledge, skills, and expertise possessed by men/women everywhere;…

  15. Nurturing the Nature of Science

    ERIC Educational Resources Information Center

    Reeves, Carolyn; Chessin, Debby; Chambless, Martha

    2007-01-01

    Historical stories of scientists provide an excellent opportunity to help students see that science is indeed a human endeavor and demonstrate the interrelationships among science, technology, and society. A number of engaging historical accounts illustrate characteristics of the nature of science. The story of Lise Meitner leads students through…

  16. First natural occurrence of coesite

    USGS Publications Warehouse

    Chao, E.C.T.; Shoemaker, E.M.; Madsen, B.M.

    1960-01-01

    Coesite, the high-pressure polymorph of SiO2, hitherto known only as a synthetic compound, is identified as an abundant mineral in sheared Coconino sandstone at Meteor Crater, Arizona. This natural occurrence has important bearing on the recognition of meteorite impact craters in quartz-bearing geologic formations.

  17. NATURAL INTERACTION WITH SOCIAL ROBOTS

    E-print Network

    Dautenhahn, Kerstin

    : Cognitive Neuroscience, Psychology Research interests: Human-robot interaction, assistive robotics, socialNATURAL INTERACTION WITH SOCIAL ROBOTS Agnieszka Wykowska and Anna Esposito Topic Group coordinated and quantitative dynamic behavioral (gestural and emotional) features in human-human and human-machine interactions

  18. Natural Acceleration: Supporting Creative Trajectories

    ERIC Educational Resources Information Center

    Cohen, LeoNora M.

    2011-01-01

    "Natural acceleration" happens through an internal fire that burns to learn and may transcend school boundaries. Based on their passionate interests and connections with a domain, children who hunger for domain understandings outside school curricula require different types of acceleration, motivated by these interests. The lifeworks, domains, and…

  19. Natural products: DNA double whammy

    NASA Astrophysics Data System (ADS)

    Gates, Kent S.

    2014-06-01

    The lomaiviticins are exceedingly potent antibiotic agents, but the mechanism responsible for this activity has so far been unclear. Now, efficient generation of double-strand breaks in DNA by lomaiviticin A has been linked to the remarkable cytotoxicity of these diazobenzofluorene-containg natural products.

  20. Readings in natural language processing

    SciTech Connect

    Grosz, B.J.; Jones, K.S.; Webber, B.L.

    1986-01-01

    The book presents papers on natural language processing, focusing on the central issues of representation, reasoning, and recognition. The introduction discusses theoretical issues, historical developments, and current problems and approaches. The book presents work in syntactic models (parsing and grammars), semantic interpretation, discourse interpretation, language action and intentions, language generation, and systems.