These are representative sample records from Science.gov related to your search topic.
For comprehensive and current results, perform a real-time search at Science.gov.
1

Aquisição de Estreptococos Mutans e Desenvolvimento de Cárie Dental em Primogênitos  

PubMed Central

Objetivo Avaliar o momento de aquisição de estreptococos mutans (EM), desenvolvimento de cárie dental e as variáveis a eles associadas no decorrer de 23 meses, em primogênitos de famílias de baixo nível socioeconômico, desde os sete meses de idade. Método A amostra foi selecionada com base em mães densamente colonizadas por EM, incluindo todos os membros de 14 famílias que conviviam na mesma casa. Foram envolvidos no estudo 14 mães, pais e primogênitos e 8 parentes, na maioria avós. Exames clínicos e radiográficos iniciais determinaram os índices de cárie e condição periodontal dos adultos. Contagens de EM foram feitas em todos os adultos nas duas primeiras visitas. Nas crianças foram avaliados os níveis de EM, o número de dentes e de cáries, em quatro visitas. Resultados A prevalência de EM nos adultos foi alta, estando ausente em apenas um dos pais. EM foram detectados em 1, 2, 3 e 10 crianças, respectivamente nas visitas #1, 2, 3 e 4. A cárie dental foi detectada em apenas três crianças na última visita (aos 30 meses de idade), as quais apresentaram escores de EM significantemente maiores que as crianças sem cárie, na mesma visita. Conclusão Exclusivamente a condição social de baixa renda e mães densamente colonizadas por EM não são sinônimo de colonização precoce e alta atividade de cárie em crianças cuidadas em casa. O desenvolvimento de cárie está significantemente associado a escores elevados de EM nas crianças. PMID:22022218

NOCE, Erica; RUBIRA, Cassia Maria Fischer; da Silva ROSA, Odila Pereira; da SILVA, Salete Moura Bonifácio; BRETZ, Walter Antonio

2011-01-01

2

USO DE AGENTES COMPUTACIONAIS NO DESENVOLVIMENTO DE FERRAMENTAS PARA GERENCIAMENTO DE CURSOS EM EDUCAÇÃO A DISTÂNCIA  

Microsoft Academic Search

Este trabalho apresenta a descrição do projeto de um conjunto de ferramentas que se aplica às tarefas de gerenciamento de materiais didáticos apresentados no ambiente WWW. A proposta deste trabalho está centrada no desenvolvimento de mecanismos para a interação entre as entidades aluno e professor com o curso disponibilizado através do ambiente WWW, utilizando-se da tecnologia de agentes de software.

ELAINE QUINTINO DA SILVA; JOÃO BENEDITO DOS SANTOS; HARRISSON FERREIRA GOMES; GEHARDT DA SILVA; HUDSON DE PÁDUA MELO; JAMERSON JARDEL NERE; LEANDRO ALVARENGA ANDRADE; RAMON BORGES LOPES

1999-01-01

3

UNIVERSIDADE DE BRASLIA PROGRAMA DE PS-GRADUAO EM PROCESSOS DE DESENVOLVIMENTO  

E-print Network

vagas oferecidas para candidatos residentes no Brasil é: 2.1.1 Mestrado Acadêmico: 25 (vinte e cinco inscrição, os candidatos residentes no Brasil deverão, obrigatoriamente, entregar, pessoalmente ou por 001/2011-PGPDS, nome completo do candidato e número do CPF, na Secretaria de Pós-Graduação em

Lucero, Jorge Carlos

4

Georeferencing natural disaster impact footprints : lessons learned from the EM-DAT experience  

NASA Astrophysics Data System (ADS)

The Emergency Events Database (EM-DAT) contains data about the occurrence and consequences of all the disasters that have taken place since 1900. The main objectives of the database are to serve the purposes of humanitarian action at national and international levels; to aid decision making for disaster preparedness, as well as providing an objective base for vulnerability assessments and priority setting. EM-DAT records data on the human and economic impacts for each event as well as the location of said event. This is recorded as text data, namely the province, department, county, district, or village. The first purpose of geocoding (or georeferencing) the EM-DAT database is to transform the location data from text format into code data. The GAUL (Global Administrative Unit Layers) database (FAO) is used as a basis to identify the geographic footprint of the disaster, ideally to the second administrative level and add a unique code for each affected unit. Our first step has involved georeferencing earthquakes since the location of these is precise. The second purpose is to detail the degree of precision of georeferencing. The application and benefits of georeferencing are manifold. The geographic information of the footprint of past (after 2000) and future natural disasters permits the location of vulnerable areas with a GIS system and to cross data from different sources. It will allow the study of different elements such as the extent of a disaster and its human and economic consequences; the exposure and vulnerability of the population in space and time and the efficiency of mitigation measures. In addition, any association between events and external factors can be identified (e.g.: is the famine located at the same places as drought?) and precision of the information in the disaster report can be evaluated. Besides this, these maps will provide valuable communication support since maps have a high communication power and are easily understandable by the wider public and policy makers. Some results from the application of georeferencing will be presented during the session such as a study of the population potentially exposed and affected by natural disasters in Europe, a flood vulnerability analysis in Vietnam and the potential merging of watersheds analysis and flood footprints data.

Wallemacq, Pascaline; Guha Sapir, Debarati

2014-05-01

5

Desenvolvimento de NPCs para o Jogo Estrada Real Digital Carlcio S. Cordeiro, Carlos Augusto P. de Sousa, Diogo S. Sampaio, Luiz Gustavo  

E-print Network

Desenvolvimento de NPCs para o Jogo Estrada Real Digital Carlúcio S. Cordeiro, Carlos Augusto P. de a criação de personagens realísticos para o jogo "Estrada Real Digital" um jogo de aventura em primeira jogos modernos. Com o desenvolvimento de jogos com cenários e gráficos extremamente elaborados, tem

Chaimowicz, Luiz

6

TnE em Congressos XXXIII Reunio Anual da SAB Boletim da Sociedade Astronmica Brasileira (2007) Vol. 27, No.1, p. 234  

E-print Network

) Vol. 27, No.1, p. 234 DESENVOLVIMENTO COMPUTACIONAL PARA OBSERVA��ES ASTRON�MICAS REMOTAS Ana Lúcia da aumentaram sua confiabilidade. O desenvolvimento computacional ­ em código aberto ­ é baseado na linguagem

7

Nature  

NSDL National Science Digital Library

Nature is a weekly international journal publishing the finest peer-reviewed research in all fields of science and technology on the basis of its originality, importance, interdisciplinary interest, timeliness, accessibility, elegance, and surprising conclusions. Nature also provides rapid, authoritative, insightful and arresting news and interpretation of topical and coming trends affecting science, scientists and the wider public. Nature publishes more articles than any other multidisciplinary journal, and retains its position as the most cited weekly science journal. The site provides free access to news stories in the latest issue; access to research articles, and to the Nature archive, is by subscription.

8

Desenvolvimento Computacional para Observaes Astronmicas Remotas Ana Lcia da Silva Beraldo1, Andr de Castro Milone2  

E-print Network

Desenvolvimento Computacional para Observações Astronômicas Remotas Ana Lúcia da Silva Beraldo1 executada tanto em ambiente Linux como Windows. Atualmente, o Sistema está sendo aprimorado por Ana Lúcia e velocidade do vento. Luneta Meade DSI Pro (campo 3,8º x 2,7º). Focalizador automatizado. T

9

Engenharia de Groupware: Desenvolvimento de Aplicaes Colaborativas  

E-print Network

Capítulo 3 Engenharia de Groupware: Desenvolvimento de Aplicações Colaborativas Hugo Fuks1 realidade. Este curso é uma introdução à tecnologia de groupware, software para apoiar o trabalho de Groupware, com a qual espera-se identificar os elementos necessários à criação de aplicações

Barbosa, Alberto

10

SimTJS: A Model for Developing Serious Games for Training SimTJS: Uma Arquitetura para o Desenvolvimento de Jogos Serios para  

E-print Network

Desenvolvimento de Jogos S´erios para Treinamento Daniel Trindade, Peter Dam, Alberto Raposo Tecgraf, Departamento jogos s´erios que imitam cen´arios reais, permitindo que os profissionais realizem operac¸~oes que antes componentes que comp~oem a arquitetura, al´em de exemplos de utilizac¸~ao da mesma. Keywords-Jogos S

Barbosa, Alberto

11

Notas para uma Avaliação do Discurso Marxista em Douglass North  

Microsoft Academic Search

A partir da publicação do livro Institutions, Institutional Change and Economic Performance em 1990 e da obtenção do Nobel em 1993, as contribuições de Douglass North parecem ter entrado definitivamente no debate sobre a questão do desenvolvimento das economias no longo prazo. Muito se discute atualmente sobre a natureza da obra de North, mais especificamente sobre o grau de neoclassicismo

Gabriel Galípolo; Paulo Gala; Danilo Araujo Fernandes

2008-01-01

12

Development of an antibody to bovine IL-2 reveals multifunctional CD4 T(EM) cells in cattle naturally infected with bovine tuberculosis.  

PubMed

Gaining a better understanding of the T cell mechanisms underlying natural immunity to bovine tuberculosis would help to identify immune correlates of disease progression and facilitate the rational design of improved vaccine and diagnostic strategies. CD4 T cells play an established central role in immunity to TB, and recent interest has focussed on the potential role of multifunctional CD4 T cells expressing IFN-?, IL-2 and TNF-?. Until now, it has not been possible to assess the contribution of these multifunctional CD4 T cells in cattle due to the lack of reagents to detect bovine IL-2 (bIL-2). Using recombinant phage display technology, we have identified an antibody that recognises biologically active bIL-2. Using this antibody, we have developed a polychromatic flow cytometric staining panel that has allowed the investigation of multifunctional CD4 T-cells responses in cattle naturally infected with M. bovis. Assessment of the frequency of antigen specific CD4 T cell subsets reveals a dominant IFN-?(+)IL-2(+)TNF-?(+) and IFN-?(+) TNF-?(+) response in naturally infected cattle. These multifunctional CD4 T cells express a CD44(hi)CD45RO(+)CD62L(lo) T-effector memory (T(EM)) phenotype and display higher cytokine median fluorescence intensities than single cytokine producers, consistent with an enhanced 'quality of response' as reported for multifunctional cells in human and murine systems. Through our development of these novel immunological bovine tools, we provide the first description of multifunctional T(EM) cells in cattle. Application of these tools will improve our understanding of protective immunity in bovine TB and allow more direct comparisons of the complex T cell mediated immune responses between murine models, human clinical studies and bovine TB models in the future. PMID:22216206

Whelan, Adam O; Villarreal-Ramos, Bernardo; Vordermeier, H Martin; Hogarth, Philip J

2011-01-01

13

Secretaria de Gesto de Pessoas (SEGESP) Departamento de Desenvolvimento  

E-print Network

Secretaria de Gestão de Pessoas (SEGESP) Departamento de Desenvolvimento de Pessoas (DDP) Coordenadoria de Capacitação de Pessoas (CCP) Campus Prof. João David Ferreira Lima ­ CEP 88040-900 Trindade

Floeter, Sergio Ricardo

14

DESENVOLVIMENTO DE MUDAS DE CITROS CULTIVADAS EM VASO EM RESPOSTA À ADUBAÇÃO NPK1  

Microsoft Academic Search

The objective of this research was to evaluate the NPK fertilizer effect on 'Valencia' sweet orange nursery tree (Citrus sinensis) development, budded on Rangpur lime rootstocks (C. limonia ) in a protected environment using containers with Pinus bark, vermiculite and perlite substrates. The experiment consisted of a complete (1\\/5) 53 factorial randomized block design. Treatments comprised five concentrations in g

Campos Bernardi; Quirino Augusto de Camargo Carmello; Sérgio Alves

15

Secretaria de Gesto de Pessoas (SEGESP) Departamento de Desenvolvimento  

E-print Network

Página 1 Secretaria de Gestão de Pessoas (SEGESP) Departamento de Desenvolvimento de Pessoas (DDP) Coordenadoria de Capacitação de Pessoas (CCP) Campus Prof. João David Ferreira Lima ­ CEP 88040-900 Trindade

Floeter, Sergio Ricardo

16

Covariant gauge-natural conservation laws  

E-print Network

When a gauge-natural invariant variational principle is assigned, to determine {\\em canonical} covariant conservation laws, the vertical part of gauge-natural lifts of infinitesimal principal automorphisms -- defining infinitesimal variations of sections of gauge-natural bundles -- must satisfy generalized Jacobi equations for the gauge-natural invariant Lagrangian. {\\em Vice versa} all vertical parts of gauge-natural lifts of infinitesimal principal automorphisms which are in the kernel of generalized Jacobi morphisms are generators of canonical covariant currents and superpotentials. In particular, only a few gauge-natural lifts can be considered as {\\em canonical} generators of covariant gauge-natural physical charges.

Marcella Palese; Ekkehart Winterroth

2004-06-04

17

Abordagem do tema hipertensão arterial e suas relações com o tabagismo e a obesidade como forma de avaliação da aquisição e socialização de conhecimentos em Feiras de Ciências  

Microsoft Academic Search

O presente trabalho apresenta a experiência vivenciada por um professor do Ensino Fundamental de Escola Pública do Paraná, na orientação de uma equipe de alunos de 8ª série, em 2008, visando o desenvolvimento de trabalhos em Feiras de Ciências. A temática da equipe enfoca a hipertensão arterial e seus fatores de risco, tabagismo e obesidade, no município de Floresta. Escolheu-se

Eduardo de Almeida Grenier; Celso Ivam Conegero

2008-01-01

18

Teorias do Capital Social e Desenvolvimento Local: lições a partir da experiência de Pintadas (Bahia, Brasil)  

Microsoft Academic Search

A literatura acadêmica e os relatórios de agências internacionais que tratam do tema do capital social partem, de modo quase generalizado, da constatação de que as variáveis econômicas não são suficientes para produzir desenvolvimento socialmente justo e ambientalmente sustentável. Afirmam que o crescimento econômico não produz, necessária e diretamente, o desenvolvimento social; relembram que as instituições e o sistema social

Carlos Milani

2005-01-01

19

Nature Nature Publishing Group Nature  

E-print Network

users the chance to continue the debate initiated within the pages of Nature. Make the most from your, editorials and opinion · Online Specials ­ recent topics include the Expoplanets Special, Vaccines

Cai, Long

20

Reserva de Recursos e Qualidade de Servio em Redes de Computadores de Dbito Elevado  

E-print Network

Reserva de Recursos e Qualidade de Serviço em Redes de Computadores de Débito Elevado Elisabete trabalho insere-se na área das redes de comunicação de alta velocidade com garantia de qualidade de serviço desenvolvimento e a integração de mecanismos de garantia de qualidade de serviço (QoS) em protocolos de rede e de

Monteiro, Edmundo

21

UNIVERSIDADE DE BRASLIA PROGRAMA DE PS-GRADUAO EM PROCESSOS DE DESENVOLVIMENTO  

E-print Network

vagas oferecidas para candidatos residentes no Brasil é: 2.1.1 Mestrado Acadêmico: 35 (trinta e cinco de inscrição, os candidatos residentes no Brasil deverão, obrigatoriamente, entregar, pessoalmente ou processo ­ Edital 001/2010-PGPDS, nome completo do candidato e número do CPF, na Secretaria de Pós

Maier, Rudolf Richard

22

Concentrações hormonais e desenvolvimento folicular de vacas leiteiras em hipertermia sazonal e aguda  

Microsoft Academic Search

The present study evaluated the seasonal and acute heat stress on follicular development and steroid and inhibin concentrations in follicular fluid, in bovine dominant follicle. Cows were distributed into four treatments: summer (n=5), autumn (n=5), animals heat stressed during the winter (n=5) and winter (n=9). On day 7 of the estrous cycle, animals were slaughtered and parameters related to follicle

B. J. Lew; R. Meidan; D. Wolfenson

2006-01-01

23

ARTIGO INTERNET Jogos Srios em debate no IST  

E-print Network

ARTIGO INTERNET «Jogos Sérios» em debate no IST in http://sol.sapo.pt/ Data: 2011-9-15 Link: http://sol.sapo.pt/inicio/Tecn ... «Jogos Sérios» em debate no IST O Instituto Superior Técnico (IST) vai ser o palco da II Conferência Internacional sobre aplicações e desenvolvimento de «Jogos Sérios» A conferência terá lugar nos dias 19 e 20 de

Instituto de Sistemas e Robotica

24

Fiscalização sobre a produção e distribuição de carne bovina em Blumenau em 2006: políticas públicas do setor e desenvolvimento regional.  

E-print Network

??Existem doenças que são transmitidas através de alimentos contaminados. Este trabalho pretende mostrar as conseqüências da falta de fiscalização eficiente da vigilância sanitária nas esferas… (more)

Eliane Maria Maciel Salvalágio

2007-01-01

25

Modelo 3C de Colaborao para o desenvolvimento de Sistemas Colaborativos  

E-print Network

desenvolvimento: para auxiliar a análise do groupware a ser desenvolvido; no estabelecimento do foco para o desenvolvimento de sucessivas versões do groupware num processo iterativo e investigativo; e para o Groupware, Modelo 3C de Colaboração 1. INTRODU��O A colaboração envolve comunicação, coordenação e

Barbosa, Alberto

26

Psicologia organizacional e do trabalho no Brasil: desenvolvimento científico contemporâneo  

Microsoft Academic Search

This paper is a survey about Work and Organizational Psychology (WOP) of articles published from 2001 to 2005 in the following Brazilian journals: Estudos de Psicologia, Psicologia e Sociedade, Psicologia em Estudo, Psicologia: Reflexão e Crítica, Psicologia: Teoria e Pesquisa, Psicologia USP , and Psicologia: Organizações e Trabalho. The analysis examined the number of papers, themes, methodology, references, professional education

Aline Maria Tonetto; Mayte Raya Amazarray; Sílvia Helena Koller; William Barbosa Gomes

2008-01-01

27

Naturally Disastrous  

NSDL National Science Digital Library

Students are introduced to natural disasters and learn the difference between natural hazards and natural disasters. They discover the many types of natural hazardsâavalanche, earthquake, flood, forest fire, hurricane, landslide, thunderstorm, tornado, tsunami and volcanoâas well as specific examples of natural disasters. Students also explore why understanding these natural hazards is important to engineers and everyone's survival on our planet.

Integrated Teaching And Learning Program

28

Covariant gauge-natural conservation laws  

Microsoft Academic Search

When a gauge-natural invariant variational principle is assigned, to\\u000adetermine {\\\\em canonical} covariant conservation laws, the vertical part of\\u000agauge-natural lifts of infinitesimal principal automorphisms -- defining\\u000ainfinitesimal variations of sections of gauge-natural bundles -- must satisfy\\u000ageneralized Jacobi equations for the gauge-natural invariant Lagrangian. {\\\\em\\u000aVice versa} all vertical parts of gauge-natural lifts of infinitesimal\\u000aprincipal automorphisms which are

Marcella Palese; Ekkehart Winterroth

2004-01-01

29

Avaliao da QoS em redes Ethernet M. Carmo, J. S Silva, E. Monteiro, P. Simes, M. Curado and F. Boavida  

E-print Network

Avaliação da QoS em redes Ethernet M. Carmo, J. Sá Silva, E. Monteiro, P. Simões, M. Curado and F redes Ethernet foi superada com o desenvolvimento das normas IEEE 802.1D e IEEE 802.1Q. Este artigo serviço em redes Ethernet. Os módulos respeitam as normas IEEE 802.1Q/D e implementam as recomendações

Monteiro, Edmundo

30

MiCCS4Mobile Middleware para Comunicao e Coordenao Segura em Redes Ad-hoc  

E-print Network

MiCCS4Mobile Middleware para Comunicação e Coordenação Segura em Redes Ad-hoc com Participantes desenvolvimento de aplicações móveis. Algumas aplicações exploram protocolos de redes sem fios e a mobilidade dos dispositivos para aumentar as suas funciona- lidades. A classe de protocolos de redes sem fios com dispositivos

Neves, Nuno

31

Structure of Matter, Forces, EM Waves, Spectroscopy, Doppler Effect  

NSDL National Science Digital Library

These supplemental class notes cover the basic properties of matter, the nature of forces, the electromagnetic spectrum, and how astronomers exploit the properties of the EM spectrum to deduce the physical nature of distant objects.

O'Connell, Robert

2005-06-28

32

Natural resources  

NSDL National Science Digital Library

Natural resources are resources that occur in nature. Humans use these resources, but many of these resources are nonrenewable. They will eventually run out. Fossil fuels are naturally occurring fuels that are nonrenewable.

Olivia Worland (Purdue University; Biological Sciences)

2008-07-07

33

Em18 and Em16, new serologic marker epitopes for alveolar echinococcosis in western blot analysis, are the only two epitopes recognized by commercially available weak positive (cut off) sera for Em2plus-ELISA.  

PubMed

The assay system for antibody responses against Em2, the most specific antigen for serodiagnosis of alveolar echinococcosis (AE), has been established by enzyme-linked immunosorbent assay (ELISA) but not by Western blot assay, since Em2 antigen is not protein but carbohydrate in nature. Recently we reported that previously undescribed protein epitopes, designated Em18 and Em16 due to their molecular weights, were good serologic markers for AE by Western blot analysis. It has been shown that Em18 and Em16 are the only two epitopes recognized by commercially available weak positive (cut off) sera for the Em2plus-ELISA. PMID:8583132

Ito, A; Osawa, Y; Nakao, M; Horii, T; Okamoto, M; Itoh, M; Yamashita, T

1995-12-01

34

Nature Drawing  

NSDL National Science Digital Library

In this family or group activity, learners create a nature journal by visiting a local nature center or backyard, observing creatures in their natural habitats, and sketching what they see. Learners are encouraged to make notes about what they observe, weather conditions, and the date and time. This activity will help learners explore and record nature's variations while gaining respect for nature and developing their observation skills. Learners can sketch for 10 -30 minutes over the course of many days, once a month, or once a season to develop a complete journal. This guide includes library and internet resources for more information about nature journaling.

2012-07-24

35

It's Natural  

NSDL National Science Digital Library

This activity introduces learners to Native Americans as people who depended upon nature in the past and continue to emphasize the importance of nature in the present. Learners go outside and use their senses to make observations about their environment. This experience inspires curiosity about nature, helps learners understand that we all need and use natural resources and helps them imagine what it would be like to depend entirely on the natural world. This introductory activity is featured on pp.9-10 of the "One With the Earth: Native Americans and the Natural World" multidisciplinary unit of study for kindergarten through third grade.

Indianapolis, The C.

2014-04-30

36

Natural Selection  

Microsoft Academic Search

IN NATURE of June 8 there appears a letter from my friend Prof. Poulton in which he replies to my statement that `natural selection' affords no explanation of evolution. He quotes in extenso a letter from Darwin to the distinguished American botanist Asa Gray, in which Darwin endeavours to deal with the objection that natural selection is a truism and

E. W. MacBride

1929-01-01

37

Natural Selection and Natural Theology  

Microsoft Academic Search

A PERUSAL of Dr. Romanes' article on Natural Selection and Natural Theology, in the Contemporary Review for October, 1882, suggests a few remarks upon one or two points, which may not be out of place.

Asa Gray

1883-01-01

38

Natural Selection and Natural Theology  

Microsoft Academic Search

THE letter of Prof. Asa Gray (NATURE, vol. xxvii. p. 291) contains a sentence which seems to me to contain the essence of the difference between the views of organic life, as held by the supporters of Natural Selection and Natural Theology. He says: ``How is this presumption negatived or impaired by the supposition of Darwin's theory, that the ancestors

J. B. Hannay

1883-01-01

39

DESENVOLVIMENTO E IMPLEMENTAÇÃO DE UMA BASE COMPUTACIONAL ORIENTADA A OBJETOS PARA APLICAÇÕES EM SISTEMAS DE ENERGIA ELÉTRICA  

Microsoft Academic Search

This paper describes the application of the Object-Oriented Programming (OOP) on the modeling of Power Systems. It is intend to develop a computational object-oriented base to represent, in an efficient way, the physical component s of a Power System and their methodologies of analysis and synthesis. The generalization level of the classes' structure allows fut ure specializations, on the side

MARCELO N. AGOSTINI; ILDEMAR C. DECKER; AGUINALDO S. E SILVA

2000-01-01

40

Natural Polymers  

NSDL National Science Digital Library

Polymers that exist in nature, called biopolymers , include a large and diverse range of compounds. This chapter discusses the most important types of natural polymers--their chemical makeup, key properties, and where they are found. The focus will be more on the chemical and physical properties of natural polymers and less on their biological synthesis or physiological function. The references at the end of the chapter provide additional information.

David Teegarden

2004-01-01

41

Backyard Nature  

NSDL National Science Digital Library

Created by veteran naturalist Jim Conrad, Backyard Nature is an excellent resource for information about many aspects of the natural world. The website provides extensive, well-organized sections for backyard Ecology, Plants, Animals, and Fungi -- to name just a few. The site contains a section on Naming & Classifying living things, as well as information about tools for backyard naturalists such as field guides, binoculars, nature study notebooks, and an Online Phenology Database. The site also offers an impressive list of 101 Nature-Oriented Things to Do During the Summer.

Conrad, Jim

42

Natural Semantics  

Microsoft Academic Search

During the past few years, many researchers have begun to present semantic specifications in a style that has been strongly advocated by Plotkin in (19). The purpose of this paper is to introduce in an intuitive manner the essential ideas of the method that we call now Natural Semantics~ together with its connections to ideas in logic and computing. Natural

Gilles Kahn

1987-01-01

43

Natural Selection  

Microsoft Academic Search

IN NATURE for November 21, there appears a letter from Prof. E. W. MacBride in which he attempts to demonstrate that natural selection is not an agent in the evolution of mimetic resemblances. It is perhaps open to question how far statements of personal opinion on evolutionary mechanisms are worth making or answering, unless they are sufficiently detailed to include

E. B. Ford

1936-01-01

44

Nature Detectives  

ERIC Educational Resources Information Center

Richard Louv's "Last Child in the Woods" (2008) added to a growing consensus to get children outside and experiencing nature. Using ideas from place-based education, the authors present a simple year-long project that brings science, nature, and other curriculum standards to life right in your school yard. With a focus on journaling, this project…

Harr, Natalie; Lee, Richard E.; Jr.

2010-01-01

45

ABC's Naturally  

NSDL National Science Digital Library

In this activity (located on page 4 of the PDF), learners enjoy the sensory experience of creating letters using natural materials after listening to a book about finding the alphabet in nature. Assemble the alphabet shapes onto pages to form an alphabet book.

Museum, Chicago C.

2009-01-01

46

Natural Hazards  

NSDL National Science Digital Library

This lesson introduces students to a variety of natural hazards, emphasizing that when people understand these threats they are better able to avoid or reduce their potential impacts. First, the class discusses what they know about natural hazards and natural disasters. Then, working in pairs, they research particular hazards; the threats they pose and where and when those threats are most pronounced. Following this research period, the class assembles what they have learned into a general overview of natural hazards nationwide. Following the second class discussion, students work in pairs again to explore the hazards that affect particular towns, cities, or regions of the country. In doing so, they learn more about how and why certain natural hazards impact specific areas, as well as what people are doing to minimize the threats these hazards pose.

2006-01-01

47

Complete-data spaces and generalized EM algorithms  

Microsoft Academic Search

Expectation-maximization (EM) algorithms have been applied extensively for computing maximum-likelihood and penalized-likelihood parameter estimates in signal processing applications. Intrinsic to each EM algorithm is a complete-data space (CDS)-a hypothetical set of random variables that is related to the parameters more naturally than the measurements are. The authors describe two generalizations of the EM paradigm: (i) allowing the relationship between the

J. A. Fessler; A. O. Hero

1993-01-01

48

Desenvolvimento de um programa computacional para implantação econômica de lavouras canavieiras  

Microsoft Academic Search

Desenvolveu-se um algoritmo para a implantação convencional de lavouras canavieiras e em adição, uma implantação diferenciada com a finalidade de proporcionar produções, em toneladas, iguais nos anos subseqüentes à implantação, visto que, com o passar dos anos, as produtividades da cana-de-açúcar são diferentes; contudo, a nova metodologia fica limitada à área máxima de plantio, sendo que, em alguns casos, a

Tadeu A. Marques; Gil E. Serra; Patrícia A. A. Marques

2006-01-01

49

natural selection  

NSDL National Science Digital Library

Charles Darwin's theory of natural selection was the first plausible mechanism to explain the change of species over time, however, in it's original form it did not explain how new traits could form, or how traits that had formed could be passed on to successive generations. The rise in modern genetics helped to modify biologists understanding of evolution by attributing the origin of new traits in a species to random genetic processes of mutation and sexual recombination, with the survivability of species with the new traits subject to natural selection. This combination of random mutation and natural selection is often referred to as Neodarwinism.

David Joiner

50

Desenvolvimento, aplicação e avaliação de um modelo de intervenção positiva para pacientes com miastenia gravis.  

E-print Network

??Essa dissertação objetiva desenvolver, aplicar e avaliar um modelo de intervenção psicológica em grupo baseado nas abordagens cognitivo-comportamental e positiva para pacientes com miastenia gravis.… (more)

Bruna Larissa Seibel

2012-01-01

51

Natural England  

NSDL National Science Digital Library

Natural England has a very comprehensive website which explains not only the goals of the environmental conservation organization, but also provides a slew of scientific data, maps, free downloadable publications, and images that have been produced from their research and work. As the amount of information available can be overwhelming, the website offers the option of viewing the information based on the category of visitor, such as farmer, teacher, volunteer, and so on. On the far left side of the page, under the "Information for..." section, visitors can click on links for information that is relevant to "Farmers and Land Managers", "Researchers, Students & Teachers", "Local Authorities and Policy Makers", "Countryside Visitors", and "Volunteers". In the center of the homepage, there are links to the nine environmental regions of England. Clicking on any of the region's links will take the visitor to a menu that includes links to a "Map of the Region", "Nature on the Map", an interactive feature that allows one to see the nature in any area in England, "State of the Natural Environment", and "National Nature Reserves In Your Area". Clicking on the "Publications, Data & Forms" link on the far left side of the page will take the visitor to the "Publications Catalogue" link that can be browsed or searched, and offers well-written, appealing, and free downloadable publications about a dozen environmental topics of England, including "Wildlife Species", "Farming", "Habitats", and "Coasts & Seas".

52

Nature Walk  

NSDL National Science Digital Library

In this activity, learners take an indoor nature walk and discover various objects that have been brought in from the outdoor environment. In preparation for the activity, an educator places natural and man-made items around a room for learners to discover. Learners examine what they find and make notes about what they see and smell, how they (the learners) feel, and what each item looks like (including sketches). Then the group addresses the topic of "Leave No Trace" as it applies to a real nature walk. This would be a great activity before a field trip to a park, arboretum, or other outdoor environment, and can be done with one learner, a class, or even a large group at a family science event.

2012-12-27

53

Nature's Code  

NASA Astrophysics Data System (ADS)

We propose that the mathematical structures related to the `universal rewrite system' define a universal process applicable to Nature, which we may describe as `Nature's code'. We draw attention here to such concepts as 4 basic units, 64- and 20-unit structures, symmetry-breaking and 5-fold symmetry, chirality, double 3-dimensionality, the double helix, the Van der Waals force and the harmonic oscillator mechanism, and our explanation of how they necessarily lead to self-aggregation, complexity and emergence in higher-order systems. Biological concepts, such as translation, transcription, replication, the genetic code and the grouping of amino acids appear to be driven by fundamental processes of this kind, and it would seem that the Platonic solids, pentagonal symmetry and Fibonacci numbers have significant roles in organizing `Nature's code'.

Hill, Vanessa J.; Rowlands, Peter

2008-10-01

54

As redes universitrias de difuso das cincias matemticas como fator de desenvolvimento da perspectiva. Uma agenda de pesquisa  

E-print Network

As redes universitárias de difusão das ciências matemáticas como fator de desenvolvimento da)" #12;AS REDES UNIVERSITÁRIAS DA DIFUS�O DA PERSPECTIVA 2 Ghiberti enumera vinte intenções visível (não

Paris-Sud XI, Université de

55

O que bilíngues bimodais têm a nos dizer sobre desenvolvimento bilíngue?  

PubMed Central

O objetivo deste trabalho é apresentar o que as pesquisas que estamos desenvolvendo com crianças ouvintes, filhas de pais surdos, adquirindo Língua Brasileira de Sinais (Libras) e Português e Língua de Sinais Americana (ASL) e Inglês (Lillo-Martin et al. 2010) têm a nos dizer sobre desenvolvimento bilíngue. Os dados deste estudo fazem parte de um banco de dados de interações espontâneas coletadas longitudinalmente, alternando contextos de aquisição da Libras e do português como língua alvo, no Brasil e dados coletados longitudinalmente. nos mesmos contextos, de crianças adquirindo ASL e inglês1. Além disso, há também dados do estudo experimental com testes aplicados nos dois pares de línguas que se agregam ao presente estudo. Uma visão geral dos estudos desenvolvidos sobre a aquisição bilíngue bimodal por crianças ouvintes, filhas de pais surdos, será apresentada e, então, serão expostos alguns aspectos linguísticos deste tipo de aquisição, considerando as discussões sobre aquisição bilíngue a partir da pesquisa realizada. PMID:24431480

de Quadros, Ronice Müller; Lillo-Martin, Diane; Pichler, Deborah Chen

2013-01-01

56

Natural ecosystems  

USGS Publications Warehouse

Natural Ecosystems analyzes the association of observed changes in climate with changes in the geographic distributions and phenology (the timing of blossoms or migrations of birds) for Southwestern ecosystems and their species, portraying ecosystem disturbances—such as wildfires and outbreaks of forest pathogens—and carbon storage and release, in relation to climate change.

Fleishman, Erica; Belnap, Jayne; Cobb, Neil; Enquist, Carolyn A.F.; Ford, Karl; MacDonald, Glen; Pellant, Mike; Schoennagel, Tania; Schmit, Lara M.; Schwartz, Mark; van Drunick, Suzanne; Westerling, Anthony LeRoy; Keyser, Alisa; Lucas, Ryan

2013-01-01

57

Nature Watch  

ERIC Educational Resources Information Center

Children are naturally curious about the world in which they live. To focus this sense of wonder, have your students investigate their local habitat as it changes over the year. This multiseason study will build connections and add relevance to the habitats that children learn about. This series of activities for grades 4-6 explores the changing…

Sterling, Donna R.

2010-01-01

58

Natural games  

E-print Network

Behavior in the context of game theory is described as a natural process that follows the 2nd law of thermodynamics. The rate of entropy increase as the payoff function is derived from statistical physics of open systems. The thermodynamic formalism relates everything in terms of energy and describes various ways to consume free energy. This allows us to associate game theoretical models of behavior to physical reality. Ultimately behavior is viewed as a physical process where flows of energy naturally select ways to consume free energy as soon as possible. This natural process is, according to the profound thermodynamic principle, equivalent to entropy increase in the least time. However, the physical portrayal of behavior does not imply determinism. On the contrary, evolutionary equation for open systems reveals that when there are three or more degrees of freedom for behavior, the course of a game is inherently unpredictable in detail because each move affects motives of moves in the future. Eventually, when no moves are found to consume more free energy, the extensive-form game has arrived at a solution concept that satisfies the minimax theorem. The equilibrium is Lyapunov-stable against variation in behavior within strategies but will be perturbed by a new strategy that will draw even more surrounding resources to the game. Entropy as the payoff function also clarifies motives of collaboration and subjective nature of decision making.

Jani Anttila; Arto Annila

2011-03-05

59

Natural Selection and Natural Theology  

Microsoft Academic Search

I READ with interest, in NATURE, vol. xxvii. p. 362, the reply made by Dr. Romanes to a letter of mine which, although not originally addressed to a scientific organ, found hospitable reception in your columns. It w as not much out of place there, for it was essentially an inquiry whether certain infesences may or may not scientifically be

Asa Gray

1883-01-01

60

Natural Selection and Natural Theology  

Microsoft Academic Search

THE amicable discussion between Dr. Romanes and myself, ``endeavouring to help in determining the true position of an important question,'' has now (in NATURE, vol. xxvii. p. 527) reached a critical point, one seemingly capable of settlement by scientific inquiry, and upon which a brief note may be pertinent.

Asa Gray

1883-01-01

61

Natural Selection and Natural Theology  

Microsoft Academic Search

I AM very glad to find from Prof. Asa Gray's last communication (NATURE, vol. xxviii. p. 78) that the result of our ``amicable discussion'' has been that of coming to an agreement on all points save one, which, as he truly observes, is ``seemingly capable of settlement by scientific inquiry.'' This point simply is as to whether variation in plants

George J. Romanes

1883-01-01

62

Nature Stories  

NSDL National Science Digital Library

What do passenger pigeons, coal mining in Kentucky and cattle ranching have in common? Not a great deal, perhaps, but they are all grist for the mill of the Nature Conservancy's most excellent "Nature Stories" podcast series. The series started in February 2006, and currently there are well over 100 podcasts available on the site. Visitors can browse through them at their leisure, sign up for the podcast feed via iTunes, and also listen in right here. There's much to recommend here, but visitors might want to start by listening to the "Son of a Coalminer" podcast about a father and son coalmining team and "Wild Crafting", which profiles a couple who earn their living by foraging mushrooms and other items in Vermont.

63

EM International. Volume 1  

SciTech Connect

It is the intent of EM International to describe the Office of Environmental Restoration and Waste Management`s (EM`s) various roles and responsibilities within the international community. Cooperative agreements and programs, descriptions of projects and technologies, and synopses of visits to international sites are all highlighted in this semiannual journal. Focus on EM programs in this issue is on international collaboration in vitrification projects. Technology highlights covers: in situ sealing for contaminated sites; and remote sensors for toxic pollutants. Section on profiles of countries includes: Arctic contamination by the former Soviet Union, and EM activities with Germany--cooperative arrangements.

Not Available

1993-07-01

64

Natural Disasters  

NSDL National Science Digital Library

Students are introduced to our planet's structure and its dynamic system of natural forces through an examination of the natural hazards of earthquakes, volcanoes, landslides, tsunamis, floods and tornados, as well as avalanches, fires, hurricanes and thunderstorms. They see how these natural events become disasters when they impact people, and how engineers help to make people safe from them. Students begin by learning about the structure of the Earth; they create clay models showing the Earth's layers, see a continental drift demo, calculate drift over time, and make fault models. They learn how earthquakes happen; they investigate the integrity of structural designs using model seismographs. Using toothpicks and mini-marshmallows, they create and test structures in a simulated earthquake on a tray of Jell-O. Students learn about the causes, composition and types of volcanoes, and watch and measure a class mock eruption demo, observing the phases that change a mountain's shape. Students learn that the different types of landslides are all are the result of gravity, friction and the materials involved. Using a small-scale model of a debris chute, they explore how landslides start in response to variables in material, slope and water content. Students learn about tsunamis, discovering what causes them and makes them so dangerous. Using a table-top-sized tsunami generator, they test how model structures of different material types fare in devastating waves. Students learn about the causes of floods, their benefits and potential for disaster. Using riverbed models made of clay in baking pans, students simulate the impact of different river volumes, floodplain terrain and levee designs in experimental trials. They learn about the basic characteristics, damage and occurrence of tornadoes, examining them closely by creating water vortices in soda bottles. They complete mock engineering analyses of tornado damage, analyze and graph US tornado damage data, and draw and present structure designs intended to withstand high winds.

Integrated Teaching And Learning Program

65

Natural Selection  

NSDL National Science Digital Library

Learners simulate the process of natural selection using a variety of beans and a bowl with a hole cut into it. The variety of beans represents the variation in a population of microbes, and the bowl with a hole represents an antibiotic or some other selective pressure on the population. Only the beans that survive (don't fall through the hole) are allowed to reproduce for the next generation. Learners record and plot the number of each kind of bean through multiple generations. This activity also addresses the process of scientific investigation as learners are encouraged to design their own method of experimentation, make a hypothesis, record data, and share their results.

Thiel-Cobbey, Heather

2012-01-01

66

Natural Strain  

NASA Technical Reports Server (NTRS)

Logarithmic strain is the preferred measure of strain used by materials scientists, who typically refer to it as the "true strain." It was Nadai who gave it the name "natural strain," which seems more appropriate. This strain measure was proposed by Ludwik for the one-dimensional extension of a rod with length l. It was defined via the integral of dl/l to which Ludwik gave the name "effective specific strain." Today, it is after Hencky, who extended Ludwik's measure to three-dimensional analysis by defining logarithmic strains for the three principal directions.

Freed, Alan D.

1997-01-01

67

Nature: Debates  

NSDL National Science Digital Library

_Nature_, the prestigious international journal of science, has launched this 'Debates' site "to map out and define the landscape of international scientific controversy." More specifically, this site provides a forum for thinking about, and "discussing" (ex situ), several current scientific topics. The set-up of the site includes a list of monthly topics, moderated by selected experts (a short 'credentials' summary is provided for each), and contributions from select readers. The Current topic is entitled "Is the fossil record adequate?" The previous (first) topic was entitled "Benefits and Risks of Genetic Modification in Agriculture."

1998-01-01

68

Nature Soundmap  

NSDL National Science Digital Library

The Nature Soundmap offers unique access to the untouched and diverse wildlife that spans the globe, an experience that the Scout team could not pass up. In addition to high-quality audio, we enjoyed the articles within the newsletter that detail the remarkable travel ventures behind the recording process. We also appreciated that the site devotes itself to providing the best listening experience possible, offering tips on âÂÂHow to Listenâ and even a form for user suggestions.What does a humpback whale sound like? Or perhaps the White-cheeked Gibbon? The Nature Soundmap provides snippets of these sounds and much, much more. Visitors will find an interactive map of the world, complete with markers that allow audio wildlife travel from Central America to Central Asia a snap. Symphonies of animal noises can also be found here, as visitors can click on Greece to listen to "Summer Ambience" or France to find "Dawn in the Lezardrieux Forest.â Each marker includes information about the animal or setting profiled, along with a link to More Info for the generally curious.

69

Natural Selection  

NSDL National Science Digital Library

A common criticism of natural selection is: How can it produce novel complex useful structures by pure random chance? Darwin argued that selection is not a random process, and furthermore, it is cumulative. This lesson provides a way for students to actually compare the cumulative non-random selection of Darwin with the non-cumulative version so often erroneously implied. Students attempt to produce a full sequence of 13 cards of one suit (ace - to king). This must be done by shuffling the suit of cards for each round, then checking the cards. Half the teams must look for the full sequence each time, and repeat the process until this is accomplished. The other teams start to build their sequence by pulling the ace when it first appears as the top card, then adding to the stack whenever the next card for the sequence is shuffled to the top. Discussion reveals how the second method mimics Darwinian natural selection, while the first does not.

Heim, Werner

2007-12-12

70

Natural inflation  

SciTech Connect

A pseduo-Nambu-Goldstone boson, with a potential of the form V({phi}) = {Lambda}{sup 4}(1 {plus minus} cos({phi}/f)), can naturally give rise to an epoch of inflation in the early universe. Successful inflation can be achieved if f {approximately} m{sub pl} and {Lambda} {approximately} m{sub GUT}. Such mass scales arise in particle physics models with a gauge group that becomes strongly interacting a the GUT scale, e.g., as is expected to happen in the hidden sector of superstring theories. The density fluctuation spectrum is a non-scale-invariant power law, with extra power on large scales. 12 refs., 3 figs.

Frieman, J.A.

1991-02-01

71

Natural Strain  

NASA Technical Reports Server (NTRS)

The purpose of this paper is to present a consistent and thorough development of the strain and strain-rate measures affiliated with Hencky. Natural measures for strain and strain-rate, as I refer to them, are first expressed in terms of of the fundamental body-metric tensors of Lodge. These strain and strain-rate measures are mixed tensor fields. They are mapped from the body to space in both the Eulerian and Lagrangian configurations, and then transformed from general to Cartesian fields. There they are compared with the various strain and strain-rate measures found in the literature. A simple Cartesian description for Hencky strain-rate in the Lagrangian state is obtained.

Freed, Alan D.

1995-01-01

72

NATURE: Kalahari  

NSDL National Science Digital Library

This website is the Web companion to the two-part NATURE documentary on the Kalahari Desert, which aired on PBS during fall 2003. The first episode, Kalahari: The Great Thirstland, explores the intense extremes of the Kalahari landscape, where wildlife "struggle for survival on the African plains." The site offers a number of Web-only extras, including a species guide in the form of animal trading cards, a slide show showing seasonal change in the Kalahari, and more. Episode Two, Kalahari: The Flooded Desert, explores the desert wetland of the Okavango Delta, "one of the most unusual ecosystems in one of the harshest regions in the world." The Web companion for this episode can by accessed through the first website, and it's here that teachers will find an interdisciplinary lesson plan designed for grades 3-5. The lesson focuses on the rich diversity of Kalahari wildlife, and uses a number of interactive activities from other websites (links provided). Web-only features for this episode include an interactive journey through the Okavango Delta, a behind-the-scenes interview with the film's director, and of course, related links. [RS

2003-01-01

73

TandEM: Titan and Enceladus mission  

Microsoft Academic Search

TandEM was proposed as an L-class (large) mission in response to ESA’s Cosmic Vision 2015–2025 Call, and accepted for further\\u000a studies, with the goal of exploring Titan and Enceladus. The mission concept is to perform in situ investigations of two worlds\\u000a tied together by location and properties, whose remarkable natures have been partly revealed by the ongoing Cassini–Huygens\\u000a mission. These

A. Coustenis; S. K. Atreya; T. Balint; R. H. Brown; M. K. Dougherty; F. Ferri; M. Fulchignoni; D. Gautier; R. A. Gowen; C. A. Griffith; L. I. Gurvits; R. Jaumann; Y. Langevin; M. R. Leese; J. I. Lunine; C. P. McKay; X. Moussas; I. Müller-Wodarg; F. Neubauer; T. C. Owen; F. Raulin; E. C. Sittler; F. Sohl; C. Sotin; G. Tobie; T. Tokano; E. P. Turtle; J.-E. Wahlund; J. H. Waite; K. H. Baines; J. Blamont; A. J. Coates; I. Dandouras; T. Krimigis; E. Lellouch; R. D. Lorenz; A. Morse; C. C. Porco; M. Hirtzig; J. Saur; T. Spilker; J. C. Zarnecki; E. Choi; N. Achilleos; R. Amils; P. Annan; D. H. Atkinson; Y. Bénilan; C. Bertucci; B. Bézard; G. L. Bjoraker; M. Blanc; L. Boireau; J. Bouman; M. T. Capria; E. Chassefière; P. Coll; M. Combes; J. F. Cooper; A. Coradini; F. Crary; T. Cravens; I. A. Daglis; E. de Angelis; C. de Bergh; I. de Pater; C. Dunford; G. Durry; O. Dutuit; D. Fairbrother; F. M. Flasar; A. D. Fortes; R. Frampton; M. Fujimoto; M. Galand; O. Grasset; M. Grott; T. Haltigin; A. Herique; F. Hersant; H. Hussmann; W. Ip; R. Johnson; E. Kallio; S. Kempf; M. Knapmeyer; W. Kofman; R. Koop; T. Kostiuk; N. Krupp; M. Küppers; H. Lammer; L.-M. Lara; P. Lavvas; S. Le Mouélic; S. Lebonnois; S. Ledvina; J. Li; T. A. Livengood; R. M. Lopes; J.-J. Lopez-Moreno; D. Luz; P. R. Mahaffy; U. Mall; J. Martinez-Frias; B. Marty; T. McCord; C. Menor Salvan; A. Milillo; D. G. Mitchell; R. Modolo; O. Mousis; M. Nakamura; C. D. Neish; C. A. Nixon; D. Nna Mvondo; G. Orton; M. Paetzold; J. Pitman; S. Pogrebenko; W. Pollard; O. Prieto-Ballesteros; P. Rannou; K. Reh; L. Richter; F. T. Robb; R. Rodrigo; S. Rodriguez; P. Romani; M. Ruiz Bermejo; E. T. Sarris; P. Schenk; B. Schmitt; N. Schmitz; D. Schulze-Makuch; K. Schwingenschuh; A. Selig; B. Sicardy; L. Soderblom; L. J. Spilker; D. Stam; A. Steele; K. Stephan; D. F. Strobel; K. Szego; C. Szopa; R. Thissen; M. G. Tomasko; D. Toublanc; H. Vali; I. Vardavas; V. Vuitton; R. A. West; R. Yelle; E. F. Young

2009-01-01

74

ESPECIAO ESPONTNEA EM POPULAES ESPACIALMENTE  

E-print Network

hereditária de características por Gregor Mendel e os subsequentes desenvolvimentos da teoria genética par Gregor Mendel, de même que le développement de la théorie génétique qui lui a survenu ont

de Aguiar, Marcus A. M.

75

SUPPLEMENTARY INFORMATION 1www.nature.com/nature  

E-print Network

SUPPLEMENTARY INFORMATION 1www.nature.com/nature doi: 10.1038/nature07950 #12;2www.nature.com/nature doi: 10.1038/nature07950 SUPPLEMENTARY INFORMATION #12;3www.nature.com/nature SUPPLEMENTARY INFORMATIONdoi: 10.1038/nature07950 #12;4www.nature.com/nature doi: 10.1038/nature07950 SUPPLEMENTARY INFORMATION

Fortuna, Miguel A.

76

Memória fonológica em crianças bilíngues bimodais e crianças com implante coclear  

PubMed Central

RESUMO Este estudo comparou o desempenho de crianças bilíngues bimodais ouvintes (filhas de pais surdos) e crianças surdas usuárias de implante coclear (filhas de pais surdos e de pais ouvintes), com diferentes contextos de acesso à Língua Brasileira de Sinais (Libras), em tarefas que envolvem memória fonologica. Os testes utilizados foram: Teste de Pseudopalavras (Santos e Bueno, 2003) e Teste de Pseudosinais (desenvolvido pelos pesquisadores responsáveis pelo Projeto ‘Desenvolvimento Bilíngue Bimoda’). Além disso, foram incluídos dois grupos de controle, formados por crianças surdas (usuarias de Libras), e adultos bilíngues bimodais ouvintes. Na análise dos resultados, em relação ao desempenho entre os dois grupos testados foi constatado que o grupo de crianças bilíngues bimodais ouvintes apresentou desempenho superior, nos dois testes. No entanto, ao ser analisado o desempenho da criança surda usuaria de implante coclear, filha de pais surdos, que possui acesso irrestrito à Libras e comparado com o das crianças surdas usuárias de implante coclear, que possuem acesso restrito à Libras, foi constatado que o seu desempenho foi semelhante ao do grupo de crianças bilíngues bimodais ouvintes. As crianças surdas usuárias de implante coclear com acesso restrito à Libras e, portanto, com acesso maior ao Português apresentaram escores mais baixos nas tarefas, principalmente do teste em Português. Os resultados sugerem que as crianças surdas usuárias de implante coclear em processo de aquisição da línguagem podem se beneficiar com o acesso irrestrito à Libras, atingindo inclusive desempenho semelhante a de crianças bilíngues bimodais ouvintes. PMID:25110473

de Quadros, Ronice Müller; Cruz, Carina Rebello; Pizzio, Aline Lemos

2014-01-01

77

Environmental Media Services (EMS)  

NSDL National Science Digital Library

Environmental Media Services (EMS) is a nonprofit communications clearinghouse committed to the expansion of media coverage on critical environmental and public health issues. True to their mission, EMS staff "build relationships with top scientists, physicians, and other experts to bring journalists the latest and most credible information." EMS's modest homepage is free of clutter but full of content. While several sections are under construction and updates (currently) appear irregular, a series of available articles provides useful summaries of important environmental news issues over the past six months. Current articles include "The impacts of global warming on the oceans" and "Cool companies," among others.

78

Conservation Laws and Variational Sequences in Gauge-Natural Theories  

E-print Network

In the classical Lagrangian approach to conservation laws of gauge-natural field theories a suitable (vector) density is known to generate the so--called {\\em conserved Noether currents}. It turns out that along any section of the relevant gauge--natural bundle this density is the divergence of a skew--symmetric (tensor) density, which is called a {\\em superpotential} for the conserved currents. We describe gauge--natural superpotentials in the framework of finite order variational sequences according to Krupka. We refer to previous results of ours on {\\em variational Lie derivatives} concerning abstract versions of Noether's theorems, which are here interpreted in terms of ``horizontal'' and ``vertical'' conserved currents. The gauge--natural lift of principal automorphisms implies suitable linearity properties of the Lie derivative operator. Thus abstract results due to Kol\\'a\\v{r}, concerning the integration by parts procedure, can be applied to prove the {\\em existence} and {\\em globality} of superpotentials in a very general setting.

L. Fatibene; M. Francaviglia; M. Palese

2003-11-19

79

MAXIMUM (EM) POWER: A FOUNDATION PRINCIPLE LINKING MAN AND NATURE  

EPA Science Inventory

The fruitfulness of H.T. Odum?s commitment to a systems-based understanding of our biosphere, its dynamics, and the potential role of humans within it is indicated by his extensive and seminal contributions to the many branches of environmental science and socioeconomic policy st...

80

OPTIMIZAC ~ AO EM REDES  

E-print Network

OPTIMIZAC¸ ~ AO EM REDES UMA VIS ~ AO GLOBAL Deolinda Dias Rasteiro, Jose Luis Santos, Marta Braz; Optimiza¸c~ao em Redes ­ Uma Vis~ao Global N = fv 1 ; : : : ; v n g j f1; : : : ; ng ­ conjunto de n'os (v est~ao associados parâ??ametros Exemplo: `j 'i 1 `j 'i 2 `j 'i 3 `j 'i 4 \\Gamma \\Gamma \\Gamma \\Gamma

Pascoal, Marta Margarida Braz

81

Desenvolvimento de metodologia analítica para extração e pré-concentração de Ag(I) utilizando a moringa oleifera Lam.  

E-print Network

??Processos industriais tem sido historicamente um importante fator de degradação ambiental. A disposição inadequada de resíduos industriais contendo metais tóxicos em fontes de águas representa… (more)

Cleide Sandra Tavares Araújo

2009-01-01

82

Natural Language Processing.  

ERIC Educational Resources Information Center

Discusses issues related to natural language processing, including theoretical developments; natural language understanding; tools and techniques; natural language text processing systems; abstracting; information extraction; information retrieval; interfaces; software; Internet, Web, and digital library applications; machine translation for…

Chowdhury, Gobinda G.

2003-01-01

83

Sonar-Based Mapping With Mobile Robots Using EM  

Microsoft Academic Search

This paper presents an algorithms for learn- ing occupancy grid maps with mobile robots equipped with range finders, such as sonar sen- sors. Our approach employs the EM algorithm to solve the concurrent mapping and localization problem. To accommodate the spatial nature of range data, it relies on a two-layered representa- tion of maps, where global maps are composed from

Wolfram Burgard; Dieter Fox; Hauke Jans; Christian Matenar; Sebastian Thrun

84

Regulation of natural monopolies  

E-print Network

This chapter provides a comprehensive overview of the theoretical and empirical literature on the regulation of natural monopolies. It covers alternative definitions of natural monopoly, regulatory goals, alternative ...

Joskow, Paul L.

2005-01-01

85

Nature's DesignNature's Design Mark Whittle  

E-print Network

clusters #12;#12;Slow death of low mass star #12;Explosive death of high mass star #12;Supernova remnants) Emergence of structure: stars, galaxies, clusters/voids. 6) Origin of energy. #12;Shakespeare : "As You Like gravity, EM, QM gravity · Nuclei · Atoms · Stars/Planets · Galaxies Lets begin our brief tour

Whittle, Mark

86

SUPPLEMENTARY INFORMATION 1www.nature.com/nature  

E-print Network

SUPPLEMENTARY INFORMATION 1www.nature.com/nature doi: 10.1038/nature08976 ± ± #12;2www.nature.com/nature doi: 10.1038/nature08976 SUPPLEMENTARY INFORMATION #12;3www.nature.com/nature SUPPLEMENTARY INFORMATIONdoi: 10.1038/nature08976 5'-A*C*A*C*TCTTTCCCTACACGACGCTCTTCCGATCT*g*t*c*t-3' 5'-a

Good, Jeffrey M.

87

*Bacharel em Turismo.  

E-print Network

algumas questões que ainda fazem parte das discussões sobre as necessárias reformas estatais originadas no período da transição democrática e que se estendem até os dias atuais. Discussões essas que incluem também as transformações ocorridas na sociedade e que colocam as propostas de reformas para além da estrutura do Estado. É neste período que se pronuncia o esgotamento do planejamento centralizado como instrumento de condução política, não só em função dos problemas intrínsecos à estrutura estatal, mas principalmente por este não conseguir planejar a sociedade em virtude da nova complexidade social. Aliás, complexidade é a noção predominante nesse contexto em que se abrem novas propostas de planejamento, definidas através da co-responsabilidade entre os representantes do Estado e da

Ana Valéria Endres; Palavras-chave Turismo; Estado Planejamento; Planejamento Turístico

88

EM Radiation Program  

NSDL National Science Digital Library

The EM Radiation program displays the electric field vectors (in the x-y plane) and magnetic field contours (for the field in the z direction) calculated from the Lienard-Wiechert potentials for a charged particle. The default scenario shows the resulting radiation from a charged particle in simple harmonic motion. Additional particle trajectories can be specified using the Display | Switch GUI menu item. EM Radiation is an Open Source Physics program written for the teaching of electromagnetism. It is distributed as a ready-to-run (compiled) Java archive. Double clicking the em_radiation.jar file will run the program if Java is installed. Other electromagnetism programs are also available. They can be found by searching ComPADRE for Open Source Physics, OSP, or electromagnetism.

Christian, Wolfgang

2008-05-20

89

Considerações a respeito da ansiedade em jovens atletas a partir dos estágios psicossociais do desenvolvimento Considerations about the anxiety in young athletes from stages of psychosocial development  

Microsoft Academic Search

This review aims to consider the process of structu ring the anxiety within the theory of Psychosocial Development Erik Erikson and discuss the issue of l imitation of the studies of anxiety in sports. Thus , it is understood that the mechanisms of anxiety in the sp orting context can influence the performance of athletes and therefore a methodology for

Robério Silva de Paiva; Thaísa Vilhena Silva

90

EFEITO DO FÓSFORO E CÁLCIO NO DESENVOLVIMENTO E NA COMPOSIÇÃO QUÍMICA FOLIAR DE Eucalyptus grandis HILL EX MAIDEN EM CASA DE VEGETAÇÃO  

Microsoft Academic Search

The objective of this experiment was to study the effects of P and Ca in the development and the foliar chemical composition of Eucalyptus grandis in greenhouse conditions, using a regosol soil type in a clay pot containing 27 kg of dried air soil. The basic fertilization consisted of N, K, Mg, S, Zn, B, Cu, Fe, Mn, Mo, and

SÉRGIO VALIENGO VALERI; LENINE CORRADINI

91

Sketching in Nature  

NSDL National Science Digital Library

Science students will discover the beauty of communing with nature by utilizing a Nature journal during field observations. Nature journaling is a useful skill, independent of whether students consider themselves artists. Sketching from nature is one way to provide open-ended, inquiry-based learning while also bringing art into the process of learning science. This article includes two exercises, contour drawing and an observation activity, to get teachers started in the process of "sketching nature" into the science curriculum.

April Hobart

2005-01-01

92

The Nature of Natural Hazards Communication (Invited)  

NASA Astrophysics Data System (ADS)

Some of the many issues of interest to natural hazards professionals include the analysis of proactive approaches to the governance of risk from natural hazards and approaches to broaden the scope of public policies related to the management of risks from natural hazards, as well as including emergency and environmental management, community development and spatial planning related to natural hazards. During the talk we will present results of scientific review, analysis and synthesis, which emphasize same new trends in communication of the natural hazards theories and practices within an up-to-the-minute context of new environmental and climate change issues, new technologies, and a new focus on resiliency. The presentation is divided into five sections that focus on natural hazards communication in terms of education, risk management, public discourse, engaging the public, theoretical perspectives, and new media. It includes results of case studies and best practices. It delves into natural hazards communication theories, including diffusion, argumentation, and constructivism, to name a few. The presentation will provide information about: (1) A manual of natural hazards communication for scientists, policymakers, and media; (2) An up-to-the-minute context of environmental hazards, new technologies & political landscape; (3) A work by natural hazards scientists for geoscientists working with social scientists and communication principles; (4) A work underpinned by key natural hazards communication theories and interspersed with pragmatic solutions; (5) A work that crosses traditional natural hazards boundaries: international, interdisciplinary, theoretical/applied. We will further explore how spatial planning can contribute to risk governance by influencing the occupation of natural hazard-prone areas, and review the central role of emergency management in risk policy. The goal of this presentation is to contribute to the augmentation of the conceptual framework of risk governance and increase the awareness of practitioners and decision-makers to the need to adopt proactive policies, leading to a more integrated, participative, and adaptive governance that can respond more efficiently to the increasing uncertainty resulting from escalating natural hazards risk exposure.

Kontar, Y. Y.

2013-12-01

93

MESTRADO EM MICROBIOLOGIA EPIDEMIOLOGIA DE DOENAS TRANSMISSVEIS Faculdade de Cincias  

E-print Network

transmissíveis (DTs) e agentes etiológicos. História natural da infecção no hospedeiro. Noção de R0. Imunidade de grupo. Construção de modelos matemáticos para DTs: em equações às diferenças. Principais parâmetros dos modelos de DTs e sua estimação. Modelos para DTs formalizados em equações diferenciais. Padrões dinâmicos

Instituto de Sistemas e Robotica

94

TandEM: Titan and Enceladus mission  

USGS Publications Warehouse

TandEM was proposed as an L-class (large) mission in response to ESA's Cosmic Vision 2015-2025 Call, and accepted for further studies, with the goal of exploring Titan and Enceladus. The mission concept is to perform in situ investigations of two worlds tied together by location and properties, whose remarkable natures have been partly revealed by the ongoing Cassini-Huygens mission. These bodies still hold mysteries requiring a complete exploration using a variety of vehicles and instruments. TandEM is an ambitious mission because its targets are two of the most exciting and challenging bodies in the Solar System. It is designed to build on but exceed the scientific and technological accomplishments of the Cassini-Huygens mission, exploring Titan and Enceladus in ways that are not currently possible (full close-up and in situ coverage over long periods of time). In the current mission architecture, TandEM proposes to deliver two medium-sized spacecraft to the Saturnian system. One spacecraft would be an orbiter with a large host of instruments which would perform several Enceladus flybys and deliver penetrators to its surface before going into a dedicated orbit around Titan alone, while the other spacecraft would carry the Titan in situ investigation components, i.e. a hot-air balloon (Montgolfi??re) and possibly several landing probes to be delivered through the atmosphere. ?? Springer Science + Business Media B.V. 2008.

Coustenis, A.; Atreya, S.K.; Balint, T.; Brown, R.H.; Dougherty, M.K.; Ferri, F.; Fulchignoni, M.; Gautier, D.; Gowen, R.A.; Griffith, C.A.; Gurvits, L.I.; Jaumann, R.; Langevin, Y.; Leese, M.R.; Lunine, J.I.; McKay, C.P.; Moussas, X.; Muller-Wodarg, I.; Neubauer, F.; Owen, T.C.; Raulin, F.; Sittler, E.C.; Sohl, F.; Sotin, C.; Tobie, G.; Tokano, T.; Turtle, E.P.; Wahlund, J.-E.; Waite, J.H.; Baines, K.H.; Blamont, J.; Coates, A.J.; Dandouras, I.; Krimigis, T.; Lellouch, E.; Lorenz, R.D.; Morse, A.; Porco, C.C.; Hirtzig, M.; Saur, J.; Spilker, T.; Zarnecki, J.C.; Choi, E.; Achilleos, N.; Amils, R.; Annan, P.; Atkinson, D.H.; Benilan, Y.; Bertucci, C.; Bezard, B.; Bjoraker, G.L.; Blanc, M.; Boireau, L.; Bouman, J.; Cabane, M.; Capria, M.T.; Chassefiere, E.; Coll, P.; Combes, M.; Cooper, J.F.; Coradini, A.; Crary, F.; Cravens, T.; Daglis, I.A.; de Angelis, E.; De Bergh, C.; de Pater, I.; Dunford, C.; Durry, G.; Dutuit, O.; Fairbrother, D.; Flasar, F.M.; Fortes, A.D.; Frampton, R.; Fujimoto, M.; Galand, M.; Grasset, O.; Grott, M.; Haltigin, T.; Herique, A.; Hersant, F.; Hussmann, H.; Ip, W.; Johnson, R.; Kallio, E.; Kempf, S.; Knapmeyer, M.; Kofman, W.; Koop, R.; Kostiuk, T.; Krupp, N.; Kuppers, M.; Lammer, H.; Lara, L.-M.; Lavvas, P.; Le, Mouelic S.; Lebonnois, S.; Ledvina, S.; Li, J.; Livengood, T.A.; Lopes, R.M.; Lopez-Moreno, J. -J.; Luz, D.; Mahaffy, P.R.; Mall, U.; Martinez-Frias, J.; Marty, B.; McCord, T.; Salvan, C.M.; Milillo, A.; Mitchell, D.G.; Modolo, R.; Mousis, O.; Nakamura, M.; Neish, C.D.; Nixon, C.A.; Mvondo, D.N.; Orton, G.; Paetzold, M.; Pitman, J.; Pogrebenko, S.; Pollard, W.; Prieto-Ballesteros, O.; Rannou, P.; Reh, K.; Richter, L.; Robb, F.T.; Rodrigo, R.; Rodriguez, S.; Romani, P.; Bermejo, M.R.; Sarris, E.T.; Schenk, P.; Schmitt, B.; Schmitz, N.; Schulze-Makuch, D.; Schwingenschuh, K.; Selig, A.; Sicardy, B.; Soderblom, L.; Spilker, L.J.; Stam, D.; Steele, A.; Stephan, K.; Strobel, D.F.; Szego, K.; Szopa

2009-01-01

95

TandEM: Titan and Enceladus mission  

NASA Astrophysics Data System (ADS)

TandEM was proposed as an L-class (large) mission in response to ESA’s Cosmic Vision 2015-2025 Call, and accepted for further studies, with the goal of exploring Titan and Enceladus. The mission concept is to perform in situ investigations of two worlds tied together by location and properties, whose remarkable natures have been partly revealed by the ongoing Cassini-Huygens mission. These bodies still hold mysteries requiring a complete exploration using a variety of vehicles and instruments. TandEM is an ambitious mission because its targets are two of the most exciting and challenging bodies in the Solar System. It is designed to build on but exceed the scientific and technological accomplishments of the Cassini-Huygens mission, exploring Titan and Enceladus in ways that are not currently possible (full close-up and in situ coverage over long periods of time). In the current mission architecture, TandEM proposes to deliver two medium-sized spacecraft to the Saturnian system. One spacecraft would be an orbiter with a large host of instruments which would perform several Enceladus flybys and deliver penetrators to its surface before going into a dedicated orbit around Titan alone, while the other spacecraft would carry the Titan in situ investigation components, i.e. a hot-air balloon (Montgolfière) and possibly several landing probes to be delivered through the atmosphere.

Coustenis, A.; Atreya, S. K.; Balint, T.; Brown, R. H.; Dougherty, M. K.; Ferri, F.; Fulchignoni, M.; Gautier, D.; Gowen, R. A.; Griffith, C. A.; Gurvits, L. I.; Jaumann, R.; Langevin, Y.; Leese, M. R.; Lunine, J. I.; McKay, C. P.; Moussas, X.; Müller-Wodarg, I.; Neubauer, F.; Owen, T. C.; Raulin, F.; Sittler, E. C.; Sohl, F.; Sotin, C.; Tobie, G.; Tokano, T.; Turtle, E. P.; Wahlund, J.-E.; Waite, J. H.; Baines, K. H.; Blamont, J.; Coates, A. J.; Dandouras, I.; Krimigis, T.; Lellouch, E.; Lorenz, R. D.; Morse, A.; Porco, C. C.; Hirtzig, M.; Saur, J.; Spilker, T.; Zarnecki, J. C.; Choi, E.; Achilleos, N.; Amils, R.; Annan, P.; Atkinson, D. H.; Bénilan, Y.; Bertucci, C.; Bézard, B.; Bjoraker, G. L.; Blanc, M.; Boireau, L.; Bouman, J.; Cabane, M.; Capria, M. T.; Chassefière, E.; Coll, P.; Combes, M.; Cooper, J. F.; Coradini, A.; Crary, F.; Cravens, T.; Daglis, I. A.; de Angelis, E.; de Bergh, C.; de Pater, I.; Dunford, C.; Durry, G.; Dutuit, O.; Fairbrother, D.; Flasar, F. M.; Fortes, A. D.; Frampton, R.; Fujimoto, M.; Galand, M.; Grasset, O.; Grott, M.; Haltigin, T.; Herique, A.; Hersant, F.; Hussmann, H.; Ip, W.; Johnson, R.; Kallio, E.; Kempf, S.; Knapmeyer, M.; Kofman, W.; Koop, R.; Kostiuk, T.; Krupp, N.; Küppers, M.; Lammer, H.; Lara, L.-M.; Lavvas, P.; Le Mouélic, S.; Lebonnois, S.; Ledvina, S.; Li, J.; Livengood, T. A.; Lopes, R. M.; Lopez-Moreno, J.-J.; Luz, D.; Mahaffy, P. R.; Mall, U.; Martinez-Frias, J.; Marty, B.; McCord, T.; Menor Salvan, C.; Milillo, A.; Mitchell, D. G.; Modolo, R.; Mousis, O.; Nakamura, M.; Neish, C. D.; Nixon, C. A.; Nna Mvondo, D.; Orton, G.; Paetzold, M.; Pitman, J.; Pogrebenko, S.; Pollard, W.; Prieto-Ballesteros, O.; Rannou, P.; Reh, K.; Richter, L.; Robb, F. T.; Rodrigo, R.; Rodriguez, S.; Romani, P.; Ruiz Bermejo, M.; Sarris, E. T.; Schenk, P.; Schmitt, B.; Schmitz, N.; Schulze-Makuch, D.; Schwingenschuh, K.; Selig, A.; Sicardy, B.; Soderblom, L.; Spilker, L. J.; Stam, D.; Steele, A.; Stephan, K.; Strobel, D. F.; Szego, K.; Szopa, C.; Thissen, R.; Tomasko, M. G.; Toublanc, D.; Vali, H.; Vardavas, I.; Vuitton, V.; West, R. A.; Yelle, R.; Young, E. F.

2009-03-01

96

INTRODUCTION Nature's microbiome: introduction  

E-print Network

INTRODUCTION Nature's microbiome: introduction JACOB A. RUSSELL,* NICOLE DUBILIER and JENNIFER A of New Mexico, Albuquerque, NM 87131, USA Keywords: metagenomics, microbiome, next generation sequencing). But outside this field, nature's microbiome--the communities of microbes colonizing host eukaryotes (Lederberg

Bruns, Tom

97

Colours From Nature  

ERIC Educational Resources Information Center

In reference to American Indian ceremonial art, the importance of using natural pigments is emphasized, since the superior color values of natural dyes better reflect religious and philosophical depth and meaning. (JC)

Simon, Wilma

1974-01-01

98

Natural Gas Flare  

USGS Multimedia Gallery

A natural gas flare. Sometimes, often due to lack of transportation or storage capacity, natural gas that is co-produced with oil will be burned in a flare. This wellpad is in the Tuscaloosa Marine Shale....

99

Natural Gas Monthly  

EIA Publications

Highlights activities, events, and analyses associated with the natural gas industry. Volume and price data are presented each month for natural gas production, distribution, consumption, and interstate pipeline activities. Producer related activities and underground storage data are also reported.

2014-01-01

100

Biomimicry: Natural Designs  

NSDL National Science Digital Library

Students learn about biomimicry and how engineers often imitate nature in the design of innovative new products. They demonstrate their knowledge of biomimicry by practicing brainstorming and designing a new product based on what they know about animals and nature.

2014-09-18

101

Nature/Culture/Seawater  

E-print Network

This essay considers seawater as a substance and symbol in anthropological and social theory. Seawater has occupied an ambiguous place with respect to anthropological categories of nature and culture. Seawater as nature ...

Helmreich, Stefan

102

Is "Natural" Always Healthy?  

ERIC Educational Resources Information Center

Currently, the word "natural" is being used to imply health, safety, and wellness. However, many "natural" substances produce psychoactive or physiologic effects which are potentially toxic to the user. (CJ)

Kaufman, M. Robert; Siek, Theodore

1980-01-01

103

Processing Natural Language without Natural Language Processing  

Microsoft Academic Search

We can still create computer programs displaying only the most rudimentary natural language processing capabilities. One of\\u000a the greatest barriers to advanced natural language processing is our inability to overcome the linguistic knowledge acquisition\\u000a bottleneck. In this paper, we describe recent work in a number of areas, including grammar checker development, automatic\\u000a question answering, and language modeling, where state of

Eric Brill

2003-01-01

104

Natural gas annual 1995  

SciTech Connect

The Natural Gas Annual provides information on the supply and disposition of natural gas to a wide audience including industry, consumers, Federal and State agencies, and educational institutions. The 1995 data are presented in a sequence that follows natural gas (including supplemental supplies) from its production to its end use. This is followed by tables summarizing natural gas supply and disposition from 1991 to 1995 for each Census Division and each State. Annual historical data are shown at the national level.

NONE

1996-11-01

105

Nature Publishing Group Site Licenses  

E-print Network

-Based Dentistry) The EMBO Journal EMBO reports European Journal of Clinical Nutrition European Journal of Human Cell Death & Differentiation Cell Research Clinical Pharmacology & Therapeutics EBD (Evidence Nature Physics Nature Protocols Nature Reviews Cancer Nature Reviews Cardiology Nature Reviews Clinical

Cai, Long

106

The EM Earthquake Precursor  

NASA Astrophysics Data System (ADS)

Many attempts have been made to determine a sound forecasting method regarding earthquakes and warn the public in turn. Presently, the animal kingdom leads the precursor list alluding to a transmission related source. By applying the animal-based model to an electromagnetic (EM) wave model, various hypotheses were formed, but the most interesting one required the use of a magnetometer with a differing design and geometry. To date, numerous, high-end magnetometers have been in use in close proximity to fault zones for potential earthquake forecasting; however, something is still amiss. The problem still resides with what exactly is forecastable and the investigating direction of EM. After the 1989 Loma Prieta Earthquake, American earthquake investigators predetermined magnetometer use and a minimum earthquake magnitude necessary for EM detection. This action was set in motion, due to the extensive damage incurred and public outrage concerning earthquake forecasting; however, the magnetometers employed, grounded or buried, are completely subject to static and electric fields and have yet to correlate to an identifiable precursor. Secondly, there is neither a networked array for finding any epicentral locations, nor have there been any attempts to find even one. This methodology needs dismissal, because it is overly complicated, subject to continuous change, and provides no response time. As for the minimum magnitude threshold, which was set at M5, this is simply higher than what modern technological advances have gained. Detection can now be achieved at approximately M1, which greatly improves forecasting chances. A propagating precursor has now been detected in both the field and laboratory. Field antenna testing conducted outside the NE Texas town of Timpson in February, 2013, detected three strong EM sources along with numerous weaker signals. The antenna had mobility, and observations were noted for recurrence, duration, and frequency response. Next, two directional techniques were employed, resulting in three mapped, potential epicenters. The remaining, weaker signals presented similar directionality results to more epicentral locations. In addition, the directional results of the Timpson field tests lead to the design and construction of a third prototype antenna. In a laboratory setting, experiments were created to fail igneous rock types within a custom-designed Faraday Cage. An antenna emplaced within the cage detected EM emissions, which were both reproducible and distinct, and the laboratory results paralleled field results. With a viable system and continuous monitoring, a fracture cycle could be established and observed in real-time. Sequentially, field data would be reviewed quickly for assessment; thus, leading to a much improved earthquake forecasting capability. The EM precursor determined by this method may surpass all prior precursor claims, and the general public will finally receive long overdue forecasting.

Jones, K. B., II; Saxton, P. T.

2013-12-01

107

Learning in Nature  

ERIC Educational Resources Information Center

This paper traces the evolution of a theory of learning in nature in order to explain how people learn in natural settings. The intellectual roots of the theory in informal learning, cognition, affective development, experiential and meaningful learning are described and the synthesis into a comprehensive theory of learning in nature are…

Brody, Michael

2005-01-01

108

Visualizingandquantifying natural selection  

E-print Network

REVIEWS Visualizingandquantifying natural selection Edmund D. Brodie III, Allen 1. Moore. A thorough comprehen- sion of the occurrence, form and significance of selection in natural populations of current evolu- tionary research is the detection, demonstration and description of selection in nature

Brodie III, Edmund D.

109

Evolution by Natural Selection  

NSDL National Science Digital Library

Principles of natural selection are demonstrated by a simulation that involves different color pom-poms and student feeders equipped with different types of feeding implements. Students analyze results to see how different traits contribute to fitness in different habitats. Additional examples and questions help students to understand the process of natural selection, including three necessary conditions for natural selection to take place.

Doherty, Jennifer; Waldron, Ingrid

110

Drawing From Nature  

NSDL National Science Digital Library

In this activity, learners draw natural objects to explore the details, differences, and similarities of natural objects. Learners investigate plants, seeds, pinecones, and other items from nature at two stations. At station one, learners trace plants on plexiglass. At station two, learners observe small items through magnifying glasses and draw what they see.

2012-06-26

111

Nature in the City.  

ERIC Educational Resources Information Center

Describes a science program developed by the Cleveland Museum of Natural History, "Nature in the City," in which students and teachers learn together about the natural community surrounding their school. Includes program's rationale, list of "adventures," and methods. Discusses strategies of Sherlock Holmes'"adventure" focusing on animal tracks…

Ferbert, Mary Lou

1981-01-01

112

Bryce Canyon Natural Bridge  

USGS Multimedia Gallery

The Bryce Canyon Natural Bridge. Technically, this is not a natural bridge, which forms when running water erodes a tunnel into a rock formation. Instead, this is a natural arch, similar to the ones in nearby Arches National Park. Bryce Canyon is a unique sandstone formation in southern Utah. It is...

113

Editor, Nature Philip Campbell  

E-print Network

´ & D. Y. Gin 1008 Unusual sugar biosynthesis and natural product glycodiversification C. J. Thibodeaux. R. Bishop, M. Schuksz & J. D. Esko 1038 Exploiting the defensive sugars of HIV-1 for drug with trepidation. Like amino acids and nucleic acids, sugars are abundant in nature: many natural products contain

Cai, Long

114

Nature's Nature: Ideas of Nature in Curricula for Environmental Education  

ERIC Educational Resources Information Center

Two contrasting sets of ideas about nature in environmental education are described. An analytical framework is developed from inter-disciplinary histories of ideas and used in evaluating a specific curriculum. In conclusion, some general implications are suggested for curricula in environmental education. [This article was reprinted from…

St Maurice, Henry

2006-01-01

115

DESENVOLVIMENTO DE UM MODELO DE SIMULACAO PARA ANALISE DA CADEIA DE SUPRIMENTOS DE PETROLEO E DISTRIBUICAO DE DERIVADOS DA PETROBRAS NA REGIAO  

Microsoft Academic Search

This paper describes part of a project developed in a partnership between Centro de Pesquisa e Desenvolvimento - CENPES\\/PETROBRAS and Grupo de Produção Integrada - GPI\\/COPPE\\/UFRJ. The main objective is to develop a simulation model to support understanding how PETROBRAS's downstream supply-chain's logistics works, focusing on oil's flows and stocks. The project's first stage is described, approaching the following topics:

Juliana S. G. Yonamine; Bárbara C. Pereira; Heitor M. Caulliraux; Ivan de Pellegrin; Luis Cláudio Moreira Paschoal

116

A Natural Selection  

NSDL National Science Digital Library

The high school science laboratory provides a natural environment for students to learn through scientist-teacher partnerships. A dynamic learning community, authentic inquiry, a deeper understanding of the nature of science, and learning about scientific careers are all benefits of scientist-teacher partnerships. This article focuses on the benefits of partnerships while describing how one specific partnership team developed a natural selection laboratory to integrate with a high school biology curriculum.

Nielsen, Katherine M.; Siegel, Marcelle A.; Mlynarczyk-Evans, Susanna; Brenner, Tamara J.

2005-10-01

117

Thermoacoustic natural gas liquefier  

Microsoft Academic Search

Cryenco and Los Alamos are collaborating to develop a natural-gas-powered natural-gas liquefier that will have no moving parts and require no electrical power. It will have useful efficiency, remarkable reliability, and low cost. The liquefaction of natural gas, which occurs at only 115 Kelvin at atmospheric pressure, has previously required rather sophisticated refrigeration machinery. The 1990 invention of the thermoacoustically

1997-01-01

118

Natural gas liquefaction processes  

Microsoft Academic Search

\\u000a The liquefaction of natural gas using a mixed refrigerant process was first proposed by Kleemenko in 1959 [50]. Mixed refrigerant\\u000a processes were subsequently adopted for the commercial liquefaction of natural gas nearly 40 years ago. Over 95% of the base-load\\u000a LNG plants operate on mixed refrigerant processes, with the remaining few operating on conventional cascade processes. The\\u000a enthalpy of natural

Gadhiraju Venkatarathnam

2008-01-01

119

Thermoacoustic natural gas liquefier  

Microsoft Academic Search

This is the final report of a two-year, Laboratory-Directed Research and Development (LDRD) project at the Los Alamos National Laboratory (LANL). This project sought to develop a natural-gas-powered natural-gas liquefier that has absolutely no moving parts and requires no electrical power. It should have high efficiency, remarkable reliability, and low cost. The thermoacoustic natural-gas liquefier (TANGL) is based on our

G. Swift; D. Gardner; M. Hayden; R. Radebaugh; J. Wollan

1996-01-01

120

NATURE.COM/NATURE 2 February 2012  

E-print Network

32 MICROBIOLOGY RESISTANCE FIGHTERS The rocky road to an MRSA vaccine PAGE23 HIDDEN STRENGTHNonlinear failure of spider silk is secret of its success PAGE72 THE INTERNATIONAL WEEKLY JOURNAL OF SCIENCE #12;LETTER doi:10.1038/nature10739 Nonlinear material behaviour of spider silk yields robust webs Steven W

Buehler, Markus J.

121

Natural gas annual 1997  

SciTech Connect

The Natural Gas Annual provides information on the supply and disposition of natural gas to a wide audience including industry, consumers, Federal and State agencies, and educational institutions. The 1997 data are presented in a sequence that follows natural gas (including supplemental supplies) from its production to its end use. This is followed by tables summarizing natural gas supply and disposition from 1993 to 1997 for each Census Division and each State. Annual historical data are shown at the national level. 27 figs., 109 tabs.

NONE

1998-10-01

122

Nature: International Science Jobs  

NSDL National Science Digital Library

Nature journal's jobs page contains an international science jobs search engine. This feature lets users search out potential employment based on subject, location, type of organization, and position.

123

Correspondence of ectomycorrhizal diversity and colonisation of willows (Salix spp.) grown in short rotation coppice on arable sites and adjacent natural stands.  

PubMed

Willows (Salix spp.) are mycorrhizal tree species sometimes cultivated as short rotation coppice (SRC) on arable sites for energy purposes; they are also among the earliest plants colonising primary successional sites in natural stands. The objective of this study was to analyse the degree of colonisation and diversity of ectomycorrhizal (EM) communities on willows grown as SRC in arable soils and their adjacent natural or naturalized stands. Arable sites usually lack ectomycorrhizal host plants before the establishment of SRC, and adjacent natural or naturalized willow stands were hypothesized to be a leading source of ectomycorrhizal inoculum for the SRC. Three test sites including SRC stands (Salix viminalis, Salix dasyclados, and Salix schwerinii) and adjacent natural or naturalized (Salix caprea, Salix fragilis, and Salix?×?mollissima) stands in central Sweden were investigated on EM colonisation and morphotypes, and the fungal partners of 36 of the total 49 EM fungi morphotypes were identified using molecular tools. The frequency of mycorrhizas in the natural/naturalized stands was higher (two sites) or lower (one site) than in the corresponding cultivated stands. Correspondence analysis revealed that some EM taxa (e.g. Agaricales) were mostly associated with cultivated willows, while others (e.g. Thelephorales) were mostly found in natural/naturalized stands. In conclusion, we found strong effects of sites and willow genotype on EM fungi formation, but poor correspondence between the EM fungi abundance and diversity in SRC and their adjacent natural/naturalized stands. The underlying mechanism might be selective promotion of some EM fungi species by more effective spore dispersal. PMID:22415721

Hrynkiewicz, Katarzyna; Toljander, Ylva K; Baum, Christel; Fransson, Petra M A; Taylor, Andy F S; Weih, Martin

2012-11-01

124

Warner College of Natural Resources Warner College of Natural  

E-print Network

, and Conservation Biology Forestry Geology Natural Resource Recreation and Tourism Natural Resources Management in the conservation and sustainable management of natural and cultural resources on Department of Defense landsWarner College of Natural Resources Warner College of Natural Resources Office in Natural Resources

Collett Jr., Jeffrey L.

125

SUPPLEMENTARY INFORMATION 1www.nature.com/nature  

E-print Network

SUPPLEMENTARY INFORMATION 1www.nature.com/nature doi: 10.1038/nature07641 Figure S1 | Temporal-3). Images were taken at indicated times after induction of ER stress with 10 mM DTT. #12;2www.nature.com/nature doi: 10.1038/nature07641 SUPPLEMENTARY INFORMATION Figure S2 | Temporal relation of foci formation

Walter, Peter

126

EMS adaptation for climate change  

NASA Astrophysics Data System (ADS)

The purpose of this study was to find an appropriate scenario of pre-hospital transportation of an emergency medical service (EMS) system for burdensome casualties resulting from extreme climate events. A case of natural catastrophic events in Taiwan, 88 wind-caused disasters, was reviewed and analyzed. A sequential-conveyance method was designed to shorten the casualty transportation time and to promote the efficiency of ambulance services. A proposed mobile emergency medical center was first constructed in a safe area, but nearby the disaster area. The Center consists of professional medical personnel who process the triage of incoming patients and take care of casualties with minor injuries. Ambulances in the Center were ready to sequentially convey the casualties with severer conditions to an assigned hospital that is distant from the disaster area for further treatment. The study suggests that if we could construct a spacious and well-equipped mobile emergency medical center, only a small portion of casualties would need to be transferred to distant hospitals. This would reduce the over-crowding problem in hospital ERs. First-line ambulances only reciprocated between the mobile emergency medical center and the disaster area, saving time and shortening the working distances. Second-line ambulances were highly regulated between the mobile emergency medical center and requested hospitals. The ambulance service of the sequential-conveyance method was found to be more efficient than the conventional method and was concluded to be more profitable and reasonable on paper in adapting to climate change. Therefore, additional practical work should be launched to collect more precise quantitative data.

Pan, C.; Chang, Y.; Wen, J.; Tsai, M.

2010-12-01

127

On Teaching Natural Law.  

ERIC Educational Resources Information Center

A brief look at Columbia, Harvard, and Notre Dame law schools shows that the American tradition in teaching natural law has not been strong. The value of teaching natural law is discussed, a separate course or seminar is seen as the most effective option, and a selection of available sources for such a course is appended. (JMD)

Forte, David F.

1978-01-01

128

Is That Natural?  

NSDL National Science Digital Library

Students will brainstorm ways that they use â and waste â natural resources. Also, they will respond to some facts about population growth and how people use petroleum. Lastly, students will consider the different ways that engineers interact with and use our natural resources.

Integrated Teaching And Learning Program

129

Birds. Nature Discovery I.  

ERIC Educational Resources Information Center

The birds of New England and their particular habitats are explored in this guide which is part of a series of Nature Discovery publications. The materials are designed to directly supplement the natural science curricula and to complement other subject areas including social studies, language arts, music, and art. The program is designed for…

Stone, Sally F.

130

Island Natural Science School.  

ERIC Educational Resources Information Center

Prepared for students in grade six attending the Island Natural Science School, Toronto, Ontario, Canada, this booklet offers information and suggests activities in the areas of ecology, conservation, natural resources, and outdoor recreation. Introductory material describes island lore, its formation and significant features, followed by units of…

Toronto Board of Education (Ontario).

131

Design Inspired by Nature  

NSDL National Science Digital Library

Students discover how engineers can use biomimicry to enhance their designs. They learn how careful observation of nature — becoming a nature detective, so to speak — can lead to new innovations and products. In this activity, students reverse engineer a flower to glean design ideas for new products.

Integrated Teaching and Learning Program,

132

CONNECTICUT NATURAL DIVERSITY DATABASE  

EPA Science Inventory

This is a statewide datalayer at 1:24,000 scale of general areas of concern with regards to state and federally listed Endangered, Threatened, and Special Concern species and significant natural communities. Locations of species and natural communities are based on data collecte...

133

Epidemics after Natural Disasters  

Microsoft Academic Search

The relationship between natural disasters and com- municable diseases is frequently misconstrued. The risk for outbreaks is often presumed to be very high in the chaos that follows natural disasters, a fear likely derived from a perceived association between dead bodies and epidem- ics. However, the risk factors for outbreaks after disasters are associated primarily with population displacement. The availability

John T. Watson; Michelle Gayer; Maire A. Connolly

2007-01-01

134

Nature Foil Reliefs  

ERIC Educational Resources Information Center

Nature has always been a source of inspiration for artists across the centuries. Artists such as Leonardo da Vinci, Georgia O'Keeffe, Ansel Adams, and Andy Goldsworthy all drew inspiration for their work from nature. Seeds come from the dried pods, which when planted and cared for, bear fruit. In this article, the author describes how her…

Lane, Shaw J.

2012-01-01

135

Nature of Science Is...  

ERIC Educational Resources Information Center

The phrase "nature of science" refers to the characteristics of scientific knowledge that necessarily result from the scientific investigations that scientists conduct to develop knowledge. Yet, these characteristics are assumed by many to be "difficult" to teach. Not so. Many important aspects of nature of science can be directly linked to…

Lederman, Judith Sweeney; Lederman, Norman G.

2005-01-01

136

Nature's Advice Book  

ERIC Educational Resources Information Center

What do can people learn from the world around them? Can a tree really teach something about life? Many times teachers provide students with facts about nature but fail to consider what one can learn from the natural world around them. After many months of exploring various ecosystems such as the prairie, rain forest, and desert, one of the…

Mahlin, Kathryn; Robertson, Amy

2005-01-01

137

Natural Language Processing.  

ERIC Educational Resources Information Center

Examines recent trends in research in natural language processing and discusses some applications of this research to the solution of information management problems. The article emphasizes that the importance of natural language processing systems is reflected in their frequent use in support of other computer programs. (71 references) (CK)

Rindflesch, Thomas C.

1996-01-01

138

Natural Science Centers: Directory.  

ERIC Educational Resources Information Center

A nature center is defined as an organized and permanent nonprofit institution which is essentially educational, scientific, and cultural in purpose with professional staff, and open to the public on some regular schedule. A nature center manages and interprets its lands, native plants and animals and facilities to promote an understanding of…

Natural Science for Youth Foundation, Roswell, GA.

139

Rhetoric: Its Natural Enemies.  

ERIC Educational Resources Information Center

Every art and discipline must accept competition as a natural condition of life growing from the variant interests and aptitudes of different kinds of men. This competition may lead to the identification of "natural enemies" and, for the discipline of rhetoric, some of these are (1) the business man, who debases rhetoric by using fear and false…

Aly, Bower

1968-01-01

140

Bryce Canyon Natural Bridge  

USGS Multimedia Gallery

Bryce Canyon's Natural Bridge is technically a natural arch, similar to those in the nearby Arches National Park. Bryce Canyon is a unique sandstone formation in southern Utah. It is home to a large number of hoodoos, which are oddly shaped pillars of rock that formed due to different erosion rates...

141

Naturalness Under Stress  

E-print Network

Naturalness has for many years been a guiding principle in the search for physics beyond the Standard Model, particularly for understanding the physics of electroweak symmetry breaking. However, the discovery of the Higgs particle at 125 GeV, accompanied by exclusion of many types of new physics expected in natural models has called the principle into question. In addition, apart from the scale of weak interactions, there are other quantities in nature which appear unnaturally small and for which we have no proposal for a natural explanation.We first review the principle, and then discuss some of the conjectures which it has spawned. We then turn to some of the challenges to the naturalness idea and consider alternatives.

Dine, Michael

2015-01-01

142

Thermoacoustic natural gas liquefier  

SciTech Connect

This is the final report of a two-year, Laboratory-Directed Research and Development (LDRD) project at the Los Alamos National Laboratory (LANL). This project sought to develop a natural-gas-powered natural-gas liquefier that has absolutely no moving parts and requires no electrical power. It should have high efficiency, remarkable reliability, and low cost. The thermoacoustic natural-gas liquefier (TANGL) is based on our recent invention of the first no-moving-parts cryogenic refrigerator. In short, our invention uses acoustic phenomena to produce refrigeration from heat, with no moving parts. The required apparatus comprises nothing more than heat exchangers and pipes, made of common materials, without exacting tolerances. Its initial experimental success in a small size lead us to propose a more ambitious application: large-energy liquefaction of natural gas, using combustion of natural gas as the energy source. TANGL was designed to be maintenance-free, inexpensive, portable, and environmentally benign.

Swift, G.; Gardner, D.; Hayden, M.; Radebaugh, R. [National Inst. of Standards and Technology, Gaithersburg, MD (United States); Wollan, J. [Cryenco, Inc. (United States)

1996-07-01

143

Human Natures, Nature Conservation, and Environmental Ethics  

Microsoft Academic Search

scientific community today about the global ecological sit-uation and the resultant need for nature conservation (e. g., NAS 1993, UCS 1993). Now is a time of unprecedented, es-calating, and well-documented environmental danger. There is general agreement among environmental scientists that the accelerating loss of biodiversity, populations (Hughes et al. 1997), species, and communities, should be a matter of great concern.

PAUL R. EHRLICH

2002-01-01

144

Natural History Museum: British Natural History  

NSDL National Science Digital Library

Although some might fear that limited land resources and the usual development pressures are working to reduce Britain's natural history to footnote status, this website from the Natural History Museum in London effectively documents the UK's impressive biological and geological diversity. The site consists of interactive database features as well as videos (in both Windows Media and Quicktime formats). Exploring Biodiversity, an interactive introduction for students to UK biodiversity, allows users to compare the flora of different UK postal districts and also to download a version of WORLDMAP, the Museum's innovative distribution analysis software. The Earth Lab Datasite is a searchable database of fossils, rocks and minerals organized in part by geographic distribution. The Postcode Plants Database allows users to generate local lists of UK plants and/or animals. The British Natural History video, produced by the Museum's Darwin Centre, presents an online tour of the UK's wildlife scene, while Ornithology of the Orkney Islands looks at the work of bird researcher on these Scottish isles and also includes a discussion of migration studies with Museum ornithologist Douglas Russell. The site is best viewed with Netscape Communicator versions 4.5 to 4.8 and Microsoft Internet Explorer version 5 and later.

145

INFLUÊNCIAS CULTURAIS NA ADOÇÃO DA GESTÃO DE PROJETOS: UM ESTUDO QUALITATIVO EM EMPRESAS DE CONSULTORIA E DESENVOLVIMENTO EM TI CULTURAL INFLUENCES ON ADOPTION OF PROJECT MANAGEMENT: A QUALITATIVE STUDY IN CONSULTING AND IT DEVELOPMENT COMPANIES  

Microsoft Academic Search

If the Project Management is analyzed from the point of view of new combinations that include already known techniques with a generic approach to manage projects, its biggest contribution to the organizations is found. However, the question that is raised is: how to make these management approaches generally applicable in all types, forms or origins of organizations? This paper presents,

Carlos Ferreira da Rocha

2009-01-01

146

On nature's scaling effects  

NASA Astrophysics Data System (ADS)

This presentation afforded the opportunity to look back in the literature to discover scaling effects in nature that might be relevant to composites. Numerous examples were found in nature's approaches to wood, teeth, horns, leaves, eggs, feathers, etc. Nature transmits tensile forces rigidly with cohesive bonds, while dealing with compression forces usually through noncompressible hydraulics. The optimum design scaling approaches for aircraft were also reviewed for comparison with similitude laws. Finally, some historical evidence for the use of Weibull scaling in composites was reviewed.

Wilkins, Dick J.

1994-07-01

147

On nature's scaling effects  

NASA Technical Reports Server (NTRS)

This presentation afforded the opportunity to look back in the literature to discover scaling effects in nature that might be relevant to composites. Numerous examples were found in nature's approaches to wood, teeth, horns, leaves, eggs, feathers, etc. Nature transmits tensile forces rigidly with cohesive bonds, while dealing with compression forces usually through noncompressible hydraulics. The optimum design scaling approaches for aircraft were also reviewed for comparison with similitude laws. Finally, some historical evidence for the use of Weibull scaling in composites was reviewed.

Wilkins, Dick J.

1994-01-01

148

Drawing on Nature  

NSDL National Science Digital Library

Awaken and sharpen your students' powers of observation by using art, particulary drawing, in your science classroom. There is a commonality between methods that artists employ in portraying their subjects and the methods that those studying nature employ in learning about the world, and this similarity can provide encouragement in leading science students to study nature via art. One way to achieve this objective is to have students create a Naturalist's Journal, as described in this article, where drawing is an essential part of a process to gather information from the natural world and to synthesize the field and lab experiences from class.

Joe Dirnberger

2006-07-01

149

Nature North Zine  

NSDL National Science Digital Library

Nature North Zine is a folksy, online magazine focused on the natural history of Manitoba and surrounding regions of North America. Site visitors can access sections for Spring, Summer, Fall, and Winter. The seasonal sections contain a variety of brief articles (from different dates) that address such subjects as wood frogs, native plant gardening, violets, snow snakes, and amphibians of Manitoba. The site also contains some very nice nature photographs in the Dragonflies of Manitoba and Images of Manitoba sections. Be sure not to miss the beautiful image of the Bohemian waxwing with a bright, red berry in its beak.

150

Nature Tables: Stimulating Children's Interest in Natural Objects  

ERIC Educational Resources Information Center

Primary school pupils in the UK today may be less familiar with natural objects, less exposed to formal natural history teaching and have less time given to school-based observation and discussion of natural objects. This study of children's responses to a "Nature Table" of displayed natural objects was designed to assess pupils' knowledge of…

Tomkins, Stephen; Tunnicliffe, Sue Dale

2007-01-01

151

Natural Selection Lesson  

NSDL National Science Digital Library

The Natural Selection lesson uses a Monte Carlo model of spot size with variability between generations in an environment with predators to study how variation and environment can affect a species over time.

David Joiner

152

The "Natural Law Tradition."  

ERIC Educational Resources Information Center

A discussion of natural law outlines some of the theory and tradition surrounding it and examines its relationship to the social science and legal curriculum and to the teaching of jurisprudence. (MSE)

Finnis, John

1986-01-01

153

Nature of Science  

NSDL National Science Digital Library

Teacher resource to build background knowledge of Nature of Science and how to include in classroom instruction. This website includes a lesson plan and several activities that help students learn about the skill of observation in science.

Center for Technology and Teacher Education

2011-09-13

154

On cosmic natural selection  

E-print Network

The rate of black hole formation can be increased by increasing the value of the cosmological constant. This falsifies Smolin's conjecture that the values of all constants of nature are adjusted to maximize black hole production.

Alexander Vilenkin

2006-11-27

155

Natural Disasters in Florida  

NSDL National Science Digital Library

The students will translate the information they have gained into a poster/picture of Florida's natural disasters, label the storms, and list on the poster at least three safety practices to use with each storm.

Claudia Markham-Ahl

2011-10-18

156

CARDIOVASCULAR Editor, Nature  

E-print Network

CARDIOVASCULAR DISEASE Editor, Nature Philip Campbell Insights Publisher Sarah Greaves Publishing Imaging of atherosclerotic cardiovascular disease J. Sanz & Z. A. Fayad Cover illustration The human heart is increasing in the developing world. Cardiovascular disease usually stems from vascular dysfunction

Cai, Long

157

Natural flavor conservation  

SciTech Connect

It is shown that the fiats of Natural Flavor Conservation for an arbitrary U(1)-unbroken gauge theory require that all quarks of a given charge and helicity transform identically under the gauge group.

Rothman, A.C.; Kang, K.

1980-01-01

158

Natural drinking strategies  

E-print Network

We examine the fluid mechanics of drinking in nature. We classify the drinking strategies of a broad range of creatures according to the principal forces involved, and present physical pictures for each style. Simple scaling ...

Kim, Wonjung

159

Parallels with nature  

NASA Astrophysics Data System (ADS)

Adam Nelson and Stuart Warriner, from the University of Leeds, talk with Nature Chemistry about their work to develop viable synthetic strategies for preparing new chemical structures in parallel with the identification of desirable biological activity.

2014-10-01

160

Natural Hazards Term Project  

NSDL National Science Digital Library

Students apply the concepts learned in the class by preparing two (2) term projects discussing two natural hazards and how they impact the area where the student lives (or an area the student might like to live in).

Phillips, Michael

161

Immigration and Naturalization Statistics  

NSDL National Science Digital Library

The Immigration and Naturalizations Service Statistics site provides "comprehensive annual immigration statistics from 1994-1996, as well as state estimates of the United States' illegal alien resident and foreign-born populations."

Service., United S.

1997-01-01

162

Is image steganography natural?  

PubMed

Steganography is the art of secret communication. Its purpose is to hide the presence of information, using, for example, images as covers. We experimentally investigate if stego-images, bearing a secret message, are statistically "natural." For this purpose, we use recent results on the statistics of natural images and investigate the effect of some popular steganography techniques. We found that these fundamental statistics of natural images are, in fact, generally altered by the hidden "nonnatural" information. Frequently, the change is consistently biased in a given direction. However, for the class of natural images considered, the change generally falls within the intrinsic variability of the statistics, and, thus, does not allow for reliable detection, unless knowledge of the data hiding process is taken into account. In the latter case, significant levels of detection are demonstrated. PMID:16370457

Martín, Alvaro; Sapiro, Guillermo; Seroussi, Gadiel

2005-12-01

163

Natural Resources Defense Council  

NSDL National Science Digital Library

From the Natural Resources Defense Council, this website has the latest news from the Hill, plus information everyone needs on the state of our air, water, land and health. Initial contents include "State of Nature," a regular bulletin on environmental legislation; action guidelines; and findings on subjects ranging from children and environmental carcinogens to the pollution of U.S. coastal waters. Features in development include action alerts; consumer-oriented facts and FAQs; environmental multimedia clips; research tips; and more. The Natural Resources Defense Council is a national organization working in courtrooms, legislative chambers, regulatory agencies and the public arena to protect the world's natural resources and ensure a healthy environment for all.

164

Nature Picture Library  

NSDL National Science Digital Library

While a commercial enterprise, the Nature Picture Library offers viewers free online access to thousands of high-resolution photographs in its database. Containing fantastic shots of flora and fauna in settings of every variety, the Nature Picture Library is a great graphic resource for those in search of images of the natural world. Images can be purchased for direct downloads or can be stored online for free by registered users in lightboxes of their own design. The picture library allows registrants to create and store as many as fifty lightboxes for online consultation. A great way to see the world and all its creatures, the Nature Picture Library is sure to provoke awe, admiration, and devotion from users of every age.

2002-01-01

165

Modeling Natural Selection  

NSDL National Science Digital Library

In their research, scientists generate, test, and modify scientific models. These models can be shared with others and demonstrate a scientist's understanding of how the natural world works. Similarly, students can generate and modify models to gain a bet

Lotter, Christine; Bogiages, Christopher A.

2011-02-01

166

Nature Web Focus: SARS  

NSDL National Science Digital Library

The journal Nature offers this free Web focus on Severe Acute Respiratory Syndrome (SARS), in which Nature's reporters pose key questions about the outbreak, and assess our preparedness to deal with future viral threats. Reader will find dozens of articles, including editorials, Science Updates, and Brief Communications from the journal. The articles trace the chronology of the SARS epidemic, and the section titled What Have We Learned? offers an excellent overview of what we know and what remains to be seen.

2007-12-12

167

Natural Resource Technician DACUM  

NSDL National Science Digital Library

The Advanced Technology Environmental and Energy Center (ATEEC) provides this DACUM, or curriculum development tool, for natural resources technician training programs. The document includes a general occupation description and required areas of competence like conducting natural resource inventories, conducting land potential assessment activities and delineating property boundaries. Users must download this resource for viewing, which requires a free log-in. There is no cost to download the item. The document is available in PDF file format.

2012-11-14

168

What is natural selection?  

Microsoft Academic Search

‘Natural selection’ is, it seems, an ambiguous term. It is sometimes held to denote a consequence of variation, heredity,\\u000a and environment, while at other times as denoting a force that creates adaptations. I argue that the latter, the force interpretation,\\u000a is a redundant notion of natural selection. I will point to difficulties in making sense of this linguistic practise, and

Björn Brunnander

2007-01-01

169

Aristotle'S natural deduction reconsidered  

Microsoft Academic Search

John Corcoran’s natural deduction system for Aristotle’s syllogistic is reconsidered.Though Corcoran is no doubt right in interpreting Aristotle as viewing syllogisms as arguments and in rejecting Lukasiewicz’s treatment in terms of conditional sentences, it is argued that Corcoran is wrong in thinking that the only alternative is to construe Barbara and Celarent as deduction rules in a natural deduction system.An

John M. Martin

1997-01-01

170

Fossil Fuels: Natural Gas  

NSDL National Science Digital Library

This lesson provides an introduction to the use of natural gas as an energy source. Topics include its advantages (cleanliness, fewer carbon emissions), disadvantages (difficulty in transport and storage), sources, and usage. There is also a discussion of the creation and production of natural gas, the United States' production and reserves, and some potential new sources (coal bed methane, methane hydrates). The lesson includes an activity in which students investigate porosity and permeability in simulated sediments.

John Pratte

171

USGS: Natural Hazards Gateway  

NSDL National Science Digital Library

This portal provides access to maps, data, and other information on the distribution and frequency of natural hazards in the United States. The material is arranged into seven categories: earthquakes, floods, hurricanes, landslides, tsunamis, volcanoes, and wildfires. There are also links to disaster emergency and relief organizations and to real-time resources such as RSS feeds, advisories, and the Natural Hazards Support System (NHSS), a system that enables users to monitor events as they occur anywhere on Earth.

172

Natural Dark Matter  

E-print Network

In this talk we analyse the claim that supersymmetry (SUSY) naturally accounts for the observed dark matter density. In many cases, it is necessary to tune the parameters of a SUSY model to fit the WMAP data. We provide a quantitative analysis of the degree of tuning required for different annihilation channels. Some regions are natural, requiring no tuning at all, whereas others require tuning at the 0.1% level.

S. F. King; J. P. Roberts

2006-09-15

173

Behaviorism and Naturalism* Gary Hatfield  

E-print Network

in natural science itself. There were several versions of naturalism in American philosophy, and also several on the laws of operant conditioning. The naturalism in American philosophy of the early twentieth century, and the evolutionary naturalism and critical realism of Roy Wood Sellars (1916, 1922). This naturalism differed from

Hatfield, Gary

174

SUPPLEMENTARY INFORMATION 1www.nature.com/nature  

E-print Network

SUPPLEMENTARY INFORMATION 1www.nature.com/nature doi: 10.1038/nature07883 wt MEF Fu­/­ MTEC ac cilia in either wt or Fu-/- cells treated apical- ly with ShhN. #12;2www.nature.com/nature doi: 10.1038/nature07883 SUPPLEMENTARY INFORMATION acetylated tubulin wt MTEC Fu­/­ MTEC phalloidin merged a b c d e f

Chuang, Pao-Tien

175

EPA LABORATORIES IMPLEMENT EMS PROGRAM  

EPA Science Inventory

This paper highlights the breadth and magnitude of carrying out an effective Environmental Management System (EMS) program at the U.S. EPA's research and development laboratories. Federal research laboratories have unique operating challenges compared to more centralized industr...

176

Agrobacterium: nature’s genetic engineer  

PubMed Central

Agrobacterium was identified as the agent causing the plant tumor, crown gall over 100 years ago. Since then, studies have resulted in many surprising observations. Armin Braun demonstrated that Agrobacterium infected cells had unusual nutritional properties, and that the bacterium was necessary to start the infection but not for continued tumor development. He developed the concept of a tumor inducing principle (TIP), the factor that actually caused the disease. Thirty years later the TIP was shown to be a piece of a tumor inducing (Ti) plasmid excised by an endonuclease. In the next 20 years, most of the key features of the disease were described. The single-strand DNA (T-DNA) with the endonuclease attached is transferred through a type IV secretion system into the host cell where it is likely coated and protected from nucleases by a bacterial secreted protein to form the T-complex. A nuclear localization signal in the endonuclease guides the transferred strand (T-strand), into the nucleus where it is integrated randomly into the host chromosome. Other secreted proteins likely aid in uncoating the T-complex. The T-DNA encodes enzymes of auxin, cytokinin, and opine synthesis, the latter a food source for Agrobacterium. The genes associated with T-strand formation and transfer (vir) map to the Ti plasmid and are only expressed when the bacteria are in close association with a plant. Plant signals are recognized by a two-component regulatory system which activates vir genes. Chromosomal genes with pleiotropic functions also play important roles in plant transformation. The data now explain Braun’s old observations and also explain why Agrobacterium is nature’s genetic engineer. Any DNA inserted between the border sequences which define the T-DNA will be transferred and integrated into host cells. Thus, Agrobacterium has become the major vector in plant genetic engineering. PMID:25610442

Nester, Eugene W.

2015-01-01

177

SIGNIFICANT NATURAL HERITAGE AREAS (NC)  

EPA Science Inventory

The North Carolina Department of Environment and Natural Resources, Division of Parks and Recreation, Natural Heritage Program in cooperation with the NC Center for Geographic Information & Analysis, developed the Significant Natural Heritage Areas digital data to determine the a...

178

Second variational derivative of gauge-natural invariant Lagrangians and conservation laws  

E-print Network

We consider the second variational derivative of a given gauge-natural invariant Lagrangian taken with respect to (prolongations of) vertical parts of gauge-natural lifts of infinitesimal principal automorphisms. By requiring such a second variational derivative to vanish, {\\em via} the Second Noether Theorem we find that a covariant strongly conserved current is canonically associated with the deformed Lagrangian obtained by contracting Euler--Lagrange equations of the original Lagrangian with (prolongations of) vertical parts of gauge-natural lifts of infinitesimal principal automorphisms lying in the kernel of the generalized gauge-natural Jacobi morphism.

M. Francaviglia; M. Palese; E. Winterroth

2004-11-08

179

The Human Nature Review  

NSDL National Science Digital Library

While attempting to cover one area of scholarly discipline in a Web site may be a formidable task, the editors of the Human Nature Review are concerned with any substantive scholarship or research dealing with human nature in its entirety. As the Web site notes: "Our goal is to bring into communication the variety of approaches to the understanding of human nature which have a regrettable tendency to be less in touch with one another than they might." The site is edited by Dr. Ian Pitchford of the Creighton University School of Medicine and Professor Robert M. Young. Prominent features of the site include an online dictionary of mental health, a daily review (sent as an email, if users so desire) of updates on ongoing scholarship in the fields of psychology and psychotherapy, and a number of complete online texts. Finally, the site also houses hundreds of book reviews, contributed by scholars from a diverse set of fields, on works of topical importance.

1998-01-01

180

Forces of Nature  

NSDL National Science Digital Library

These interactive simulations allow students to investigate four of nature's more violent phenomena: volcanoes, earthquakes, hurricanes, and tornadoes. Each simulation begins with a brief written tutorial describing the characteristics and destructive potential of these hazards. Users may then adjust the various factors affecting the occurrence of these phenomena (for instance, ocean temperature, humidity, and atmospheric pressure for hurricanes) and observe the results. These simulations are related to the film National Geographic film "Forces of Nature"; other links provide access to lesson plans designed to accompany the film and to a list of locations where the film can be seen. There are also links to a preview of the film, fast facts, stories about famous natural disasters, and a glossary.

181

Lamarck and Natural Selection  

NSDL National Science Digital Library

Charles Darwin defined natural selection in "On the Origin of Species," however, Darwin did not invent the idea of evolution and not everyone saw his ideas as original. The shadow of Lamarckian theory which Darwin wanted desperately to escape is a genuine scientific precursor and what has become known as the Lamarckian Heresy has maintained a presence on the fringes of biology to this day. This radio broadcast explores who Lamarck was, how natural selection escaped from his shadow and gained acceptance from the scientific establishment, and whether any evidence has emerged that might challenge the elegant simplicity of natural selection. There is discussion about whether what is passed on to descendants may be affected by experience and environment; the experiments performed by Mendel that led to genetics; the role of DNA, gene mutations, and networks of genes in epigenetics; and how there seem to be fewer genes in humans than expected. The 2003 broadcast is 57 minutes in length.

182

USDA: Natural Inquirer  

NSDL National Science Digital Library

The Natural Inquirer offers a fun way to learn about the research conducted by scientists with the USDA Forest Service. Online since 1998, The Natural Inquirer is written with middle school students in mind. Each issue may be downloaded or ordered free of charge and includes discussion questions and learning activities that help students and teachers make the most of the articles. The Web site also includes a section just for teachers filled with related Web resources and tips on how to use The Natural Inquirer in the classroom. The most recent issue of the journal covers wildland fire management and is available in English or Spanish. Visitors should note that some issues are available as downloads only (printed issues are out of stock).

183

Arkansas Natural Resources Commission  

NSDL National Science Digital Library

In 1937, the Arkansas General Assembly enacted the nation's first conservation district law. Since that time, the state has grown to create entities like the Arkansas Natural Resources Commission to help protect its various natural resources. On this site, visitors can look through seven different sections, including Water Development, Conservation, and Arkansas Water Plan. Within each of these sections, visitors can look through a range of working papers, conservation documents, and online GIS data sets based on state-wide natural resource surveys. Moving on, the News & Publications features video blog posts, updates about conservation programs, and more. The Rules area is another helpful section of the site, providing a wide range of current rules created by the Commission to govern Arkansas wetlands, tax credits, groundwater management, and poultry management.

184

Forces of Nature  

NSDL National Science Digital Library

These interactive simulations allow students to investigate four of nature's more violent phenomena: volcanoes, earthquakes, hurricanes, and tornadoes. Each simulation begins with a brief written tutorial describing the characteristics and destructive potential of these hazards. Users may then adjust the various factors affecting the occurence of these phenomena (for instance, ocean temperature, humidity, and atmospheric pressure for hurricanes) and observe the results. These simulations are related to the film National Geogrpahic film Forces of Nature ; other links provide access to lesson plans designed to accompany the film and to a list of locations where the film can be seen. There are also links to a preview of the film, fast facts, stories about famous natural disasters, and a glossary.

2007-12-12

185

On natural inflation  

SciTech Connect

We reexamine the model of natural inflation, in which the inflaton potential is flat due to shift symmetries. The original version of the model, where the inflaton is a pseudo-Nambu-Goldstone boson with potential of the form V({phi})={lambda}{sup 4}[1{+-}cos({phi}/f)], is studied in light of recent data. We find that the model is alive and well. Successful inflation as well as data from the Wilkinson Microwave Anisotropy Probe require f>0.6m{sub Pl} (where m{sub Pl}=1.22x10{sup 19} GeV) and {lambda}{approx}m{sub GUT} (where m{sub GUT}{approx}10{sup 16} GeV), scales which can be accommodated in particle physics models. The detectability of tensor modes from natural inflation in upcoming microwave background experiments is discussed. We find that natural inflation predicts a tensor/scalar ratio within reach of future observations.

Freese, Katherine; Kinney, William H. [Michigan Center for Theoretical Physics, Department of Physics, University of Michigan, Ann Arbor, Michigan 48109 (United States); Department of Physics, University at Buffalo, SUNY, Buffalo, New York 14260 (United States)

2004-10-15

186

Natural photonic crystals  

NASA Astrophysics Data System (ADS)

Photonic structures appeared in nature several hundred millions years ago. In the living world, color is used for communication and this important function strongly impacts the individual chances of survival as well as the chances to reproduce. This has a statistical influence on species populations. Therefore, because they are involved in evolution, natural color-generating structures are - from some point of view - highly optimized. In this short review, a survey is presented of the development of natural photonic crystal-type structures occurring in insects, spiders, birds, fishes and other marine animals, in plants and more, from the standpoint of light-waves propagation. One-, two-, and three-dimensional structures will be reviewed with selected examples.

Vigneron, Jean Pol; Simonis, Priscilla

2012-10-01

187

1111 Emulating Natural Forest Landscape  

E-print Network

1111 1111 Emulating Natural Forest Landscape Disturbances Concepts and Applications Edited by AJITH University Press All rights reserved. LIBRARY OF CONGRESS CATALOGING-IN-PUBLICATION DATA Emulating natural

Wright, Dawn Jeannine

188

Reducing natural disaster vulnerability  

NASA Astrophysics Data System (ADS)

Because poor countries are vulnerable to the impact of natural disasters, the U.K. Department for International Development (DFID) launched on 30 March a new policy to better integrate natural disaster risk reduction into development and humanitarian activities. Gareth Thomas, U.K. development minister, said, ``There is nothing we can do to stop hurricanes, tsunamis, and earthquakes from striking. But what we can do is help put simple measures in place, such as better built houses, schools, and hospitals alongside more high-tech early warning systems to reduce the loss of life.''

Zielinski, Sarah

2006-04-01

189

Natural Cycles, Gases  

NASA Technical Reports Server (NTRS)

The major gaseous components of the exhaust of stratospheric aircraft are expected to be the products of combustion (CO2 and H2O), odd nitrogen (NO, NO2 HNO3), and products indicating combustion inefficiencies (CO and total unburned hydrocarbons). The species distributions are produced by a balance of photochemical and transport processes. A necessary element in evaluating the impact of aircraft exhaust on the lower stratospheric composition is to place the aircraft emissions in perspective within the natural cycles of stratospheric species. Following are a description of mass transport in the lower stratosphere and a discussion of the natural behavior of the major gaseous components of the stratospheric aircraft exhaust.

Douglass, Anne R.; Jackman, Charles H.; Rood, R. B.; Aikin, A. C.; Stolarski, R. S.; Mccormick, M. P.; Fahey, David W.

1992-01-01

190

Natural Resources Conservation Service  

NSDL National Science Digital Library

A division of the US Department of Agriculture, the Natural Resources Conservation Service (NRCS) has a mission to provide leadership and partner with private land owners to "help people conserve, maintain, and improve our natural resources and environment." Their home page is useful in that regard as it currently provides significant information on topics related to the 2002 Farm Bill, water quality and quantity, wildfires, conservation, and more. The site is easy to navigate, with top and side navigation bars that allow users to select information based on either the type of information or the category of user.

1969-12-31

191

Building natural gas locomotives  

SciTech Connect

This article describes a liquefied natural gas-fueled locomotive built by Morrison Knudsen which includes a Caterpillar 1200-horsepower V-16, a monofuel management system with double-wall super-insulated cryogenic tanks, and microprocessor-based controls. Efforts by railroad companies to reduce operating costs and meet future emissions standards have led engineers to look for innovative ways to design trains. In January, Morrison Knudsen Corp. of Boise, Idaho, powered its way into the locomotive manufacturing business when it introduced the natural gas-fueled MK1200G, to be used mostly around railroad company yards and on trips shorter than 50 miles.

O'Conner, L.

1994-04-01

192

Nature: The Human Genome  

NSDL National Science Digital Library

This special Web Focus from the journal Nature presents research papers that "serve as the definitive historical record for the sequences and analyses of human chromosomes -- the ultimate results of the Human Genome Project." Papers are available for chromosomes 6, 7, 14, 20, 21, 22, and Y, which readers can access (no subscription required) by clicking on the image of the corresponding chromosome. The papers for chromosome 6 are the most recent, published in the October 23, 2003 issue of Nature. The website also offers free feature articles on the subject.

2008-07-31

193

Natural History Notebooks  

NSDL National Science Digital Library

The Canadian Museum of Nature (CMN) offers an online version of its Natural History Notebook series originally published in 1977-81. Interesting facts and attractive black-and-white sketches are provided for each of the nearly 250 animal species (mostly vertebrates) featured in the Web site. All illustrations are by Charles Douglas, former chief illustrator at CMN. The notebook collection includes one each for mammals, birds, fish, reptiles, amphibians, invertebrates, endangered or extinct species, prehistoric life, and another that allows users to search for animals by geographical region.

1969-12-31

194

Natural warm inflation  

SciTech Connect

We derive the requirements that a generic axion-like field has to satisfy in order to play the role of the inflaton field in the warm inflation scenario. Compared to the parameter space in ordinary Natural Inflation models, we find that the parameter space in our model is enlarged. In particular, we avoid the problem of having an axion decay constant f that relates to the Planck scale, which is instead present in the ordinary Natural Inflation models; in fact, our model can easily accommodate values of the axion decay constant that lie well below the Planck scale.

Visinelli, Luca, E-mail: u0583682@utah.edu [Department of Physics and Astronomy, University of Utah, 115 South 1400 East 201, Salt Lake City, Utah 84112-0830 (United States)

2011-09-01

195

Natural Hazards Observer  

NSDL National Science Digital Library

The Natural Hazards Center of the University of Colorado Boulder offers a free online professional hazards publication called the Natural Hazards Observer. Readers will find information on current disaster issues; new international, national, and local disaster management, mitigation, and education programs; hazards research; political and policy developments; new information sources; upcoming conferences; and recent publications. The January 2003 issue (the latest of the bimonthly publication, which dates back to 1996) includes reports with titles such as Congress Passes Inland Flood Warning Bill and Dam Safety Act Passed. Those interested can view the issues online, download and view them, and even search their content by various parameters.

1996-01-01

196

Bioactive oligosaccharide natural products.  

PubMed

Covering up to December 2013. Oligosaccharide natural products target a wide spectrum of biological processes including disruption of cell wall biosynthesis, interference of bacterial translation, and inhibition of human ?-amylase. Correspondingly, oligosaccharides possess the potential for development as treatments of such diverse diseases as bacterial infections and type II diabetes. Despite their potent and selective activities and potential clinical relevance, isolated bioactive secondary metabolic oligosaccharides are less prevalent than other classes of natural products and their biosynthesis has received comparatively less attention. This review highlights the unique modes of action and biosynthesis of four classes of bioactive oligosaccharides: the orthosomycins, moenomycins, saccharomicins, and acarviostatins. PMID:24883430

McCranie, Emilianne K; Bachmann, Brian O

2014-08-01

197

Effect of EM on Soil Properties and Nutrient Cycling in a Citrus Agroecosystem  

Microsoft Academic Search

To test the effects of Effective Microorganisms (EM) on soil and on natural cycling of nutrients, a field investigation was conducted with citrus in the State of São Paulo, Brazil. A Typic Hapludox soil predominates as a deep, well-drained, clay soil with high hydrogen and aluminum contents and low base saturation, The organic matter content of the soil is moderate,

D. Paschoal; S. K. Homma; M. J. A. Jorge; M. C. S. Nogueira

198

Magnetic Properties of the Basalt in Hole EM 7, Mohole Project  

Microsoft Academic Search

The average direction of the remanent magnetization of the basalt layer at the bottom of hole EM 7 is inclined 36 ø above tile horizontal, indicating that the layer is reversely magnetized. Detailed demagnetization experiments with alternating magnetic fields to 800 oer- steds peak intensity indicate that the drilling operations did not remagnetize the basalts. The natural magnetization is extremely

Allan Cox; Richard R. Doell

1962-01-01

199

2008 Nature Publishing Group nature geoscience | VOL 1 | FEBRUARY 2008 | www.nature.com/naturegeoscience 79  

E-print Network

© 2008 Nature Publishing Group FEATURE nature geoscience | VOL 1 | FEBRUARY 2008 | www.nature.com/naturegeoscience 79 Gender imbalance in US geoscience academia Geoscientists explain women's under science. Unfortunately, the geosciences lag behind all other science, technology, engineering

Mahowald, Natalie

200

Nature Macmillan Publishers Ltd 1997 letters to nature  

E-print Network

­108 (1995). 3. Reiken, S. R. et al. Bispecific antibody modification of nicotine acetycholine receptorsNature © Macmillan Publishers Ltd 1997 letters to nature NATURE |VOL 387 |5 JUNE 1997 583 the immobilised Fab surface density. By varying the nature and type of receptor in the ICS biosensor, we have

Wang, Guan-Wu

201

Syllabus Natural Resource Policy & Administration 1 Natural Resource Policy & Administration  

E-print Network

Syllabus ­ Natural Resource Policy & Administration 1 Natural Resource Policy & Administration FNR and related natural resources administration and policies in the United States; policy components; policy of the course, you should be able to: State the key provisions of major natural resource policies Explain

Watson, Craig A.

202

Go Abroad in Natural ResourcesNatural Resources  

E-print Network

different approaches to natural resource restoration, conservation, and management · Gain new scienceGo Abroad in Natural ResourcesNatural Resources Program Contact: Connie Patterson Program.edu/ international The Natural Resources degree is ideally suited for students who wish to study abroad

Escher, Christine

203

NLP (Natural Language Processing) for NLP (Natural Language Programming)  

E-print Network

NLP (Natural Language Processing) for NLP (Natural Language Programming) Rada Mihalcea1 , Hugo Liu2 this assumption. We believe that modern Natural Language Processing techniques can make possible the use Introduction Natural Language Processing and Programming Languages are both established areas in the field

Lieberman, Henry

204

Nature, Education and Things  

ERIC Educational Resources Information Center

In this essay it is argued that the educational philosophy of John Dewey gains in depth and importance by being related to his philosophy of nature, his metaphysics. The result is that any experiental process is situated inside an event, an existence, a thing, and I try to interpret this "thing" as schools or major cultural events such…

Rømer, Thomas Aastrup

2013-01-01

205

Demystifying Nature of Science  

ERIC Educational Resources Information Center

With the emergence of the "Next Generation Science Standards" ("NGSS"; NGSS Lead States 2013), it is apparent that teaching and learning about nature of science (NOS) continues to be an important goal of science education for all K-12 students. With this emphasis on NOS, early childhood teachers are asking how to design…

Lederman, Judith; Bartels, Selina; Lederman, Norman; Gnanakkan, Dionysius

2014-01-01

206

Clean Cities Natural Gas  

E-print Network

2014 Vehicle Buyer's Guide Clean Cities Natural Gas Propane Biodiesel Electric Hybrid Ethanol Flex . . . . . . . . . . . . . . . . . . . . . 15 Plug-In Hybrid Electric . . . . . . . . . . 18 Hybrid Electric vehicles, and hybrid luxury cars are now in the marketplace. Early in the 2013 calendar year the number

207

Radioactivity: A Natural Phenomenon.  

ERIC Educational Resources Information Center

Discussed is misinformation people have on the subject of radiation. The importance of comparing artificial source levels of radiation to natural levels is emphasized. Measurements of radioactivity, its consequences, and comparisons between the risks induced by radiation in the environment and from artificial sources are included. (KR)

Ronneau, C.

1990-01-01

208

NATURAL RESOURCES LAND MANAGEMENT  

E-print Network

FOREWORD This manual, together with the following manuals, provides guidance, standards and technical information to personnel concerned with the protection and management of Natural Resources at Department of Defense installations: Forest Management-TM 5-631, AFM 126-3, and NAVFAC MO-100.2

Wildlife Management-tm

1982-01-01

209

Natural Gas Annual  

EIA Publications

Provides information on the supply and disposition of natural gas in the United States. Production, transmission, storage, deliveries, and price data are published by state for the current year. Summary data are presented for each state for the previous 5 years.

2014-01-01

210

Natural or Artificial  

NSDL National Science Digital Library

This worksheet, suitable for pre-readers, directs students to categorize pictures as sources of either natural or artificial light. The resource is part of the teacher's guide accompanying the video, NASA Why Files: The Case of the Mysterious Red Light. Lesson objectives supported by the video, additional resources, teaching tips and an answer sheet are included in the teacher's guide.

211

Saving Natural Inflation  

NASA Astrophysics Data System (ADS)

Slow-roll inflation requires the inflaton field to have an exceptionally flat potential, which combined with measurements of the scale of inflation demands some degree of fine-tuning. Alternatively, the flatness of the potential could be due to the inflaton's origin as a pseudo-Goldstone boson, as in Natural Inflation. Alas, consistency with Planck data places the original proposal of Natural Inflation in a tight spot, as it requires a trans-Planckian excursion of the inflaton. Although one can still tune the renormalizable potential to sub-Planckian values, higher order corrections from quantum gravity or sources of breaking of the Goldstone symmetry would ruin the predictivity of the model. In this paper we show how in more realistic models of Natural Inflation one could achieve inflation without a trans-Planckian excursion of the field. We show how a variant of Extra-natural inflation with bulk fermions can achieve the desired goal and discuss its four-dimensional duals. We also present a new type of four dimensional models inspired in Little Higgs and Composite Higgs models which can lead to sub-Planckian values of the inflaton field.

Croon, Djuna; Sanz, Verónica

2015-02-01

212

Dye Like A Natural  

NSDL National Science Digital Library

In this activity, learners stain fabrics--on purpose! Learners explore the art of natural dyeing by using dyes and substrates that are both derived from plant or animal sources as well as mordant solutions. Learners compare the color and effectiveness of different mordant/dye combinations on the different substrates.

Yu, Julie

2010-01-01

213

Natural gas industry directory  

SciTech Connect

This directory has information on the following: associations and organizations; exploration and production; gas compression; gas processors; gathering and transmission companies; liquefied natural gas; local distribution companies; marketing firms; regulatory agencies; service companies; suppliers and manufacturers; and regional buyer`s guide.

NONE

1999-11-01

214

Annatto: a natural choice.  

PubMed

Annatto is a pigment derived from the seeds of Bixa orellana. It has been used from antiquity in South America and for over 100 years in Europe. It is now an important safe additive for a wide range of food, partly finding favour due to its natural origin. PMID:11153116

Evans, W C

2000-09-01

215

Nature and Nurture  

NSDL National Science Digital Library

In this lesson from Science NetLinks, students begin to develop an understanding of the role played by nature (our genes) and nurture (the environment in which we live and the things that happen to us) in defining who we are and what it means to be human.

Science Netlinks;

2002-05-15

216

New force in nature  

SciTech Connect

We review recent experimental and theoretical work dealing with the proposed fifth force. Further analysis of the original Eoetvoes experiments has uncovered no challenges to our original assertion that these data evidence a correlation characteristic of the presence of a new coupling to baryon number or hypercharge. Various models suggest that the proposed fifth force could be accomodated naturally into the existing theoretical framework.

Fischbach, E.; Sudarsky, D.; Szafer, A.; Talmadge, C.; Aronson, S.H.

1986-10-15

217

Designing Nature's Way  

ERIC Educational Resources Information Center

In the case of cars and other engineered objects, humans go about the design process in a very intentional way. They pretty much know what they are aiming for. The activity described in this article demonstrates how a computer can simulate biological evolution and the laws of natural selection. The article is divided into the following sections:…

Fisher, Diane

2005-01-01

218

Picturing the Natural World  

ERIC Educational Resources Information Center

How is the natural environment in the neighborhood representative of the larger biosphere in which people live? Studying the local birds and flora of the Pacific Northwest in the context of the local parks and ponds provided a rich opportunity for third-grade students at St. Thomas School in Medina, Washington, to explore and learn about…

Salia, Hannah

2011-01-01

219

A Biospheric Natural History.  

ERIC Educational Resources Information Center

A group of Maine birdwatchers recognizes that the presence or absence of migrating songbirds is related to complex biospheric patterns. For schoolchildren, community groups, and environmental scientists, such local natural history observations can be a pathway to perceiving and understanding global ecological change and then to developing…

Thomashow, Mitchell

2001-01-01

220

Submicroscopic Nature Needs Megascience  

Microsoft Academic Search

The history of ``submicroscopic nature,'' that is, the history of particle physics, begins in the early 1950's and builds on the construction of a post WWII series of particle accelerators developed to study nuclear physics had been applied to the collisions, in the earth's atmosphere, of cosmic rays. These were high energy particles generated in cosmological events and colliding with

Leon Lederman

2005-01-01

221

Liquefied natural gas  

Microsoft Academic Search

This book summarizes recent developments in the general area of natural gas liquefaction and use. Treatment is technical rather than theoretical and thermodynamics, economic evaluations, and statistical data are relegated to the appendixes. The main part of the review consists of an introduction dealing with the historical development of cryogenics and gas liquefaction and their application in the gas industry.

Lom

1974-01-01

222

Liquefaction of natural gas  

Microsoft Academic Search

A process is described for the liquefaction of natural gas by heat exchange, initially with a first multicomponent mixture and thereafter with a second multicomponent mixture, each of these mixtures, respectively in a closed refrigeration cycle, being compressed, at least partially liquefied, and expanded, characterized in that the first multicomponent mixture, after the partial liquefaction thereof, is subjected to a

Foerg

1978-01-01

223

Nature in the City.  

ERIC Educational Resources Information Center

Presents three science activities targeted to help urban students learn about nature: (1) observing coloration patterns of pigeons; (2) measuring local rainfall and comparing it to other areas; and (3) conducting a biodiversity study by observing a patch of lawn. (YDS)

Melber, Leah W.

2000-01-01

224

Picturing the Natural Environment  

ERIC Educational Resources Information Center

Around Scout Island Education Center, a site used by schools in Fresno County to explore the area's natural environment, a total of 200 cylinder-shaped concrete stools display tiles representing small mammals, flying insects, birds, wildflowers, and more. Twenty sets have been created by elementary, middle, and high-school art students as part of…

Johnson, Phyllis Scott

2011-01-01

225

Natural Resources Education Notebook.  

ERIC Educational Resources Information Center

This notebook was developed cooperatively by the United States Soil Conservation Service and Iowa State University to be used by teachers in providing instruction regarding certain aspects of natural resources. It includes four sections which provide: (1) an instructional plan about the conservation provisions of the 1985 Food Security Act; (2) an…

Weber, Eldon C.

226

Natural hydrocarbon seeps  

Microsoft Academic Search

Recent investigations indicate that naturally occurring hydrocarbons are found in significant amounts in the marine environment. These hydrocarbons are not necessarily detrimental to marine life. Large amounts of bacteria growing in the enriched hydrocarbon water serve as food sources for shellfish, providing the beginning of a complex food chain. Therefore, future marine pollution by petroleum hydrocarbons appears to be less

1979-01-01

227

Natural antiemetics: an overview.  

PubMed

Emesis encompasses the forceful expulsion of the contents of stomach via the mouth or sometimes the nose. The adverse effects of currently available anti-emetic agents potentiate the natural product researchers to explore the natural anti-emetics with fewer side effects. The presented communication constitutes a review on anti-emetic effect of two hundred and forty five plants belonging to seventy-eight families found in different parts of the world. It also outlined the anti-emetic effect of plant extracts and isolated secondary metabolites studied through a variety of animal models of emesis. The reported anti-emetic plants in different countries and cultures and the scientific studies on extracts may help in the identification of promising single chemical compound(s) that may be used as a potential leads for developing safe anti-emetic agents in future. Moreover the reported secondary metabolites having the same effect may open the door for the search of same secondary metabolites from other natural sources. This review will provide useful information for the discovery of natural anti-emetic compounds and fill the gaps in knowledge. PMID:25176254

Ahmed, Salman; Hasan, Muhammad Mohtasheemul; Ahmed, Syed Waseemuddin

2014-09-01

228

A Natural Integration  

ERIC Educational Resources Information Center

A five-week study taught students how to write a field guide that identified the plants in a small wooded area they passed through on their way to their school playground. By creating this authentic genre of science writing, students came to understand and care for the natural world in their immediate environment. They also developed important…

Coskie, Tracy; Hornof, Michelle; Trudel, Heidi

2007-01-01

229

Nature in the City  

NSDL National Science Digital Library

Nature in the City is a project of the Earth Island Institute, and is "wholly dedicated to ecological conservation, restoration and stewardship of the [San] Franciscan bioregion." Their website's "About" section gives a thorough explanation of not only their goals, as well as a definition of nature. Furthermore, this section provides some philosophical insight into what exactly "urban nature" happens to be. Those visitors interested in a more visceral tour of San Francisco should check out the "Photo Gallery" link, and they should be sure to check out the "Natural Areas" album to view some eerie-looking oak woodlands in Golden Gate Park. Additionally, visitors to the site who are interested in the life that teems on Alcatraz Island will enjoy file number fourteen which includes an image of roosting double-crested cormorants on a dramatic hillside. Finally the "Local Ecology" link has an explanation of the "Biodiversity Crisis" in San Francisco, which can be attributed to ecological, political, institutional, social and cultural factors.

230

Tackling with Natural Monopoly in Electricity and Natural Gas Industries  

Microsoft Academic Search

\\u000a This chapter attempts to provide a theoretical work on natural monopoly versus perfect markets through concentrating on the\\u000a energy sector. In specific we discuss the natural monopolistic structure of Turkish natural gas and electricity markets by\\u000a comparing those of various countries in Europe. In this vein, our chapter starts with the introduction of natural monopoly\\u000a in both electricity and natural

Özgür Arslan; Hasan Kazdagùli

231

Nature Publishing Group Site Licenses  

E-print Network

) The EMBO Journal EMBO reports European Journal of Clinical Nutrition European Journal of Human Genetics Eye Physics Nature Protocols Nature Reviews Cancer Nature Reviews Cardiology Nature Reviews Clinical Oncology Death & Differentiation Cell Research Clinical Pharmacology & Therapeutics EBD (Evidence-Based Dentistry

Cai, Long

232

Natural Gas Expanders-Compressors  

Microsoft Academic Search

Natural gas expanders-compressors serve a variety of natural gas plants, ranging from primary treatment at the well (installations for comprehensive treatment of natural gas) to liquefaction for separation, storage, and transport. Natural gas expanders-compressors take on particular importance for wells with throttling cold. The growing demand for this equipment has been satisfied by imports until recently. The most popular was

V. M. Kulakov; V. V. Kulakov; A. V. Kulakov

2002-01-01

233

Natural Proofs Alexander A. Razborov  

E-print Network

are natural, or can be represented as natural. In Section 3 we present diverse examples of circuit lower bound proofs and show why they are natural in our sense. While Section 5 gives some general theoretical reasons why proofs against circuits tend to be natural. Section 4 gives evidence that \

Krajíèek, Jan

234

warnell school Forestry & Natural Resources  

E-print Network

#12;#12;warnell school Forestry & Natural Resources 2009 Annual Report o #12;VisionTo be recognized as one of the top five forestry and natural resource programs in the United States. Mission's renewable natural resources; and to place latest ideas and technology in forestry and natural resource

Hall, Daniel

235

3D Inversion of Natural Source Electromagnetics  

NASA Astrophysics Data System (ADS)

The superior depth of investigation of natural source electromagnetic techniques makes these methods excellent candidates for crustal studies as well as for mining and hydrocarbon exploration. The traditional natural source method, the magnetotelluric (MT) technique, has practical limitations because the surveys are costly and time consuming due to the labor intensive nature of ground based surveys. In an effort to continue to use the penetration advantage of natural sources, it has long been recognized that tipper data, the ratio of the local vertical magnetic field to the horizontal magnetic field, provide information about 3D electrical conductivity structure. It was this understanding that prompted the development of AFMAG (Audio Frequency Magnetics) and recently the new airborne Z-Axis Tipper Electromagnetic Technique (ZTEM). In ZTEM, the vertical component of the magnetic field is recorded above the entire survey area, while the horizontal fields are recorded at a ground-based reference station. MT processing techniques yield frequency domain transfer functions typically between 30-720 Hz that relate the vertical fields over the survey area to the horizontal fields at the reference station. The result is a cost effective procedure for collecting natural source EM data and for finding large scale targets at moderate depths. It is well known however that 1D layered structures produce zero vertical magnetic fields and thus ZTEM data cannot recover such background conductivities. This is in sharp contrast to the MT technique where electric fields are measured and a 1D background conductivity can be recovered from the off diagonal elements of the impedance tensor. While 1D models produce no vertical fields, two and three dimensional structures will produce anomalous currents and a ZTEM response. For such models the background conductivity structure does affect the data. In general however, the ZTEM data have weak sensitivity to the background conductivity and while we show that it is possible to obtain the background structure by inverting the ZTEM data alone, it is desirable to obtain robust background conductivity information from other sources. This information could come from a priori geologic and petrophysical information or from additional geophysical data such as MT. To counter the costly nature of large MT surveys and the limited sensitivity of the ZTEM technique to the background conductivity we show that an effective method is to collect and invert both MT and ZTEM data. A sparse MT survey grid can gather information about the background conductivity and deep structures while keeping the survey costs affordable. Higher spatial resolution at moderate depths can be obtained by flying multiple lines of ZTEM data.

Holtham, E. M.; Oldenburg, D. W.

2010-12-01

236

SPATIAL PYRAMID MINING FOR LOGO DETECTION IN NATURAL SCENES University of California Santa Barbara  

E-print Network

SPATIAL PYRAMID MINING FOR LOGO DETECTION IN NATURAL SCENES Jim Kleban University of California introduces a novel data mining scheme, spatial pyramid mining, to discover association rules at multiple res and then match in images from indexed templates. This work em- ploys a novel multiresolution spatial pyramid

California at Santa Barbara, University of

237

Notebaert Nature Museum  

NSDL National Science Digital Library

The Notebaert Nature Museum fosters environmental learning through its exhibits and over 100 science and nature programs. The museum puts a particular emphasis on environmental sustainability, with its extensive outdoor Greening Project exhibit and full sized Extreme Green House in the middle of the museum. It also boasts the only year round live butterfly exhibit in the region and River Works, an interactive water exhibit. The Museumâs new Teacher Advisory Board involves educators in brainstorming, evaluating, and piloting educational programming developed by Museum staff, and the Museum's Science Teaching Network is a summer institute and meetings designed to create a collaborative learning environment where teachers work together to develop integrated science curricula using classroom and Museum-based lessons. The website provides information on teacher workshops, field trips off site education, Scouts programs, summer camps, teen programs and community partnerships.

238

Genetics@nature.com  

NSDL National Science Digital Library

The Nature website brings together important findings and discoveries from the world of science, with a particular focus placed on biology, genetics, and related fields. To celebrate their findings and materials related to genetics, they created the genetics@nature website. Here visitors can make their way through featured articles from a range of journals, including Cell Research, Genes and Immunity, and Gene Therapy. Some of the articles only contain an abstract, but full bibliographic details are always made available. Further down the site, visitors will find a selection of "gateways", including thematic sections on cell migration and neuroscience. Along the right-hand side of the page, visitors will find related job postings and information about collaborative open innovation challenges from a range of scientific organizations.

239

Illinois Natural History Survey  

NSDL National Science Digital Library

The University of Illinois at Urbana-Champaign is responsible for the Illinois Natural History Survey (INHS), whose mission is "to investigate and document the biological resources of Illinois...and to acquire and provide natural history information...to promote the common understanding, conservation, and management of these resources." Along the top of the page visitors can find headings that include "Research", "Data", "Publications", and "Events". The "Research" portion of the website includes seven areas of research from which to choose including "Entomology", "Invasive Species", "Wildlife Ecology", and "Human Interactions". The "Data" section provides ecological monitoring data, GIS data, a clearinghouse of wildlife ecology software, and collection databases which allow visitors to search for specimens of plants and animals. The "Publications" include educational materials, annual reports, manuals, a bulletin, and a circular. For those interested in events at the INHS, the "Events" link provides a nice calendar of upcoming seminars.

240

Naturalness in emergent spacetime  

E-print Network

Effective field theories (EFTs) have been widely used as a framework in order to place constraints on the Planck suppressed Lorentz violations predicted by various models of quantum gravity. There are however technical problems in the EFT framework when it comes to ensuring that small Lorentz violations remain small -- this is the essence of the "naturalness" problem. Herein we present an "emergent" space-time model, based on the "analogue gravity'' programme, by investigating a specific condensed-matter system that is in principle capable of simulating the salient features of an EFT framework with Lorentz violations. Specifically, we consider the class of two-component BECs subject to laser-induced transitions between the components, and we show that this model is an example for Lorentz invariance violation due to ultraviolet physics. Furthermore our model explicitly avoids the "naturalness problem", and makes specific suggestions regarding how to construct a physically reasonable quantum gravity phenomenology.

Stefano Liberati; Matt Visser; Silke Weinfurtner

2005-12-22

241

Responses to natural disasters  

NASA Astrophysics Data System (ADS)

Since 1964, natural disasters caused by earthquakes, volcanic eruptions, or extreme weather in the form of floods, droughts, or hurricanes, have been responsible for more than 2,756,000 deaths worldwide in nations other than the United States, the Soviet Union, and the Eastern European Bloc, according to figures tabulated by the Office of Foreign Disaster Assistance (OFDA) of the Agency for International Development (AID). Over 95% of these fatalities occurred in developing or third world countries. Damage resulting from these calamities has been severe but extremely difficult to estimate in monetary terms. In 1986, U.S. government and voluntary agencies spent $303 million on natural disaster assistance around the world, 79% of total world assistance. In 1985 the U.S. total was nearly $900 million, 48% of the $1.84 billion world total.

Maggs, William Ward

242

Nature Outlook: Malaria  

NSDL National Science Digital Library

The journal Nature provides a range of peer-reviewed scientific works on a weekly basis, along with science updates and materials aimed at the general public. This particular feature on malaria is available at no charge to the curious public, and as the homepage asks, "What will it take to finally subdue this deadly disease?" Visitors will find a collection of recent articles in the Outlook area, such as "The Numbers Game" and "Vaccines: The Take Home Lesson." Moving on, the Collection area brings together peer-reviewed pieces on the story behind the efforts to eradicate the disease, along with some nice pieces about how the disease is transmitted. It's easy to see how this collection could be used in a public health course, or in another classroom setting. Finally, the site also includes links to popular articles from Nature, along with other open access materials.

243

Nevada Natural Heritage Program  

NSDL National Science Digital Library

The mission of the Nevada Natural Heritage Program is "to help coordinate the resource needs of Nevada's diverse biological heritage with human activities." Their website presents a wide range of resources for persons who might be interested in learning about their work in such fields as ecology, land management, land use planning, and conservation. A good way to start is in the "Special Program Area" section, which can be found on the left side of the homepage. Here visitors will find "Ecology Program", which provides information about Nevada's diverse biological heritage contained within special reports, vegetation coverage maps, and atlases of Nevada's mountain ranges. That's not all; also available in the special program area are the Rare Plant Atlas, wildflower reports, and information about ongoing efforts to create an online catalog of the mosses, hornworts, and liverworts of Nevada. The site is rounded out by a listing of the laws and regulations which govern the activities of the Nevada Natural Heritage Program.

244

Naturally selecting solutions  

PubMed Central

For decades, computer scientists have looked to nature for biologically inspired solutions to computational problems; ranging from robotic control to scheduling optimization. Paradoxically, as we move deeper into the post-genomics era, the reverse is occurring, as biologists and bioinformaticians look to computational techniques, to solve a variety of biological problems. One of the most common biologically inspired techniques are genetic algorithms (GAs), which take the Darwinian concept of natural selection as the driving force behind systems for solving real world problems, including those in the bioinformatics domain. Herein, we provide an overview of genetic algorithms and survey some of the most recent applications of this approach to bioinformatics based problems. PMID:23222169

Manning, Timmy; Sleator, Roy D; Walsh, Paul

2013-01-01

245

Woodland Trust: Nature Detectives  

NSDL National Science Digital Library

From the United Kingdom-based Woodland Trust, this Nature Detectives website contains information and activities for budding young naturalists. For elementary-aged children, the site contains an assortment of downloadable games, activity materials, and examples of nature art sure to guide and inspire students in their own artistic endeavors. The site also hosts a News section which currently links to a variety of articles and reports about the potential effects of global climate change. In addition, site visitors will find brief information entries and photos for a number of Amphibians, Birds, Insects, Trees, Flowers, and Fungi. The site also offers information about topics like seasonal color changes in leaves; and basic instructions for both primary and secondary-aged youth for keeping phenological records.

246

eNature.com  

NSDL National Science Digital Library

eNature.com provides a series of field guides with photos and information on thousands of plants, animals, and insects in the United States. These guides employ the same dataset used to create the printed Audubon Field Guides, which has been reviewed by experts in biology, zoology, and natural history. The guides are arranged by type of organism: amphibians, birds, spiders, trees, wildflowers, and others. Each one is further subdivided (salamanders, frogs and toads, turtles, and so forth) and is searchable by keyword. Users may also create species lists for their own localities by entering a ZIP code. Other materials include guides to threatened and endangered species, guides to national parks and wildlife refuges, an ask-an-expert feature, selected images for eCards and screen savers, and plant and animal pop-up cards that users can place on their own sites.

247

Epidemics after Natural Disasters  

PubMed Central

The relationship between natural disasters and communicable diseases is frequently misconstrued. The risk for outbreaks is often presumed to be very high in the chaos that follows natural disasters, a fear likely derived from a perceived association between dead bodies and epidemics. However, the risk factors for outbreaks after disasters are associated primarily with population displacement. The availability of safe water and sanitation facilities, the degree of crowding, the underlying health status of the population, and the availability of healthcare services all interact within the context of the local disease ecology to influence the risk for communicable diseases and death in the affected population. We outline the risk factors for outbreaks after a disaster, review the communicable diseases likely to be important, and establish priorities to address communicable diseases in disaster settings. PMID:17370508

Gayer, Michelle; Connolly, Maire A.

2007-01-01

248

In Her Nature  

E-print Network

of tree branches and nests. My mind wanders and remembers treasured parcels of time and memory: girlhood, milestones, upsets, heartaches, strange and mysterious images burned into my subconscious. Once my grandmother brought out an aged cardboard... and nourishment: the wildness of untamed nature, a flourishing tree full of asymmetrical order, the skeletal suggestion of the bare branches, the woven complexity of a leafless bush, the unfathomable expertise of a bird’s nest, tangible examples of the cyclical...

Scribner, Rachel

2014-05-31

249

Nature by Numbers  

NSDL National Science Digital Library

This 4-minute computer animation highlights three forms in nature that have connections with numbers and geometry. The Fibonacci sequence and the golden ratio are shown relating to the chambered nautilus shell and the sunflower seed pattern. The Delaunay triangulation and Voronoi tessellation are shown to simulate the capillary distribution on a dragonfly wing. Included are descriptions of the mathematics and stills from the production.

250

Natural Resource Ecology Laboratory  

NSDL National Science Digital Library

The Natural Resource Ecology Laboratory (NREL) at Colorado State University conducts multi-disciplinary research in ecosystem science, with the purpose of improving knowledge of "the complex interactions between humans, management activities, and ecosystems." The recently launched homepage, which is still under construction, includes background information on NREL; descriptions of research projects (a substantial and diverse list); publications, reports, and data; teaching and outreach; and contact information.

251

Natural Underwater Adhesives  

PubMed Central

The general topic of this review is protein-based underwater adhesives produced by aquatic organisms. The focus is on mechanisms of interfacial adhesion to native surfaces and controlled underwater solidification of natural water-borne adhesives. Four genera that exemplify the broad range of function, general mechanistic features, and unique adaptations are discussed in detail: blue mussels, acorn barnacles, sandcastle worms, and freshwater caddisfly larva. Aquatic surfaces in nature are charged and in equilibrium with their environment, populated by an electrical double layer of ions as well as adsorbed natural polyelectrolytes and microbial biofilms. Surface adsorption of underwater bioadhesives likely occurs by exchange of surface bound ligands by amino acid sidechains, driven primarily by relative affinities and effective concentrations of polymeric functional groups. Most aquatic organisms exploit modified amino acid sidechains, in particular phosphorylated serines and hydroxylated tyrosines (dopa), with high-surface affinity that form coordinative surface complexes. After delivery to the surfaces as a fluid, permanent natural adhesives solidify to bear sustained loads. Mussel plaques are assembled in a manner superficially reminiscent of in vitro layer-by-layer strategies, with sequentially delivered layers associated through Fe(dopa)3 coordination bonds. The adhesives of sandcastle worms, caddisfly larva, and barnacles may be delivered in a form somewhat similar to in vitro complex coacervation. Marine adhesives are secreted, or excreted, into seawater that has a significantly higher pH and ionic strength than the internal environment. Empirical evidence suggests these environment triggers could provide minimalistic, fail-safe timing mechanisms to prevent premature solidification (insolubilization) of the glue within the secretory system, yet allow rapid solidification after secretion. Underwater bioadhesives are further strengthened by secondary covalent curing. PMID:21643511

Stewart, Russell J.; Ransom, Todd C.; Hlady, Vladimir

2011-01-01

252

Logic and Natural Selection  

Microsoft Academic Search

Is logic, feasibly, a product of natural selection? In this paper we treat this question as dependent upon the prior question\\u000a of where logic is founded. After excluding other possibilities, we conclude that logic resides in our language, in the shape\\u000a of inferential rules governing the logical vocabulary of the language. This means that knowledge of (the laws of) logic

Jaroslav Peregrin

2010-01-01

253

Thermoacoustic natural gas liquefier  

SciTech Connect

Cryenco and Los Alamos are collaborating to develop a natural-gas-powered natural-gas liquefier that will have no moving parts and require no electrical power. It will have useful efficiency, remarkable reliability, and low cost. The liquefaction of natural gas, which occurs at only 115 Kelvin at atmospheric pressure, has previously required rather sophisticated refrigeration machinery. The 1990 invention of the thermoacoustically driven orifice pulse-tube refrigerator (TA-DOPTR) provides cryogenic refrigeration with no moving parts for the first time. In short, this invention uses acoustic phenomena to produce refrigeration from heat. The required apparatus consists of nothing more than helium-filled heat exchangers and pipes, made of common materials, without exacting tolerances. In the Cryenco-Los Alamos collaboration, the authors are developing a version of this invention suitable for use in the natural-gas industry. The project is known as acoustic liquefier for short. The present program plans call for a two-phase development. Phase 1, with capacity of 500 gallon per day (i.e., approximately 40,000 scfd, requiring a refrigeration power of about 7 kW), is large enough to illuminate all the issues of large-scale acoustic liquefaction without undue cost, and to demonstrate the liquefaction of 60--70% of input gas, while burning 30--40%. Phase 2 will target versions of approximately 10{sup 6} scfd = 10,000 gallon per day capacity. In parallel with both, they continue fundamental research on the technology, directed toward increased efficiency, to build scientific foundations and a patent portfolio for future acoustic liquefiers.

Swift, G.W. [Los Alamos National Lab., NM (United States). Condensed Matter and Thermal Physics Group

1997-05-01

254

Obesity: Nature or Nurture?  

Microsoft Academic Search

\\u000a The debate about the causes of the current obesity epidemic rages on. The issue of “Whose fault is it?” frequently devolves\\u000a into a related question: “Is it ‘nature’ (i.e., inherent in our genes and biochemistry before birth, and therefore out of\\u000a our control) or ‘nurture’ (i.e., behaviors learned after birth and within our control to change)?” This chapter explores the

Robert H. Lustig

255

Technology Versus Nature  

NSDL National Science Digital Library

This article, written by a member of the Partnership for Advanced Technology in Housing, discusses building materials and practices that can improve residential installation's resistance to major storms and natural disasters. An example of an area that is using these weather resistant designs is in Florida; the article cites the vulnerability of coastal homes to hurricanes and outlines some efforts to build them in a more structurally sound manner.

Mcnulty, Maureen

2008-01-07

256

New force in nature  

SciTech Connect

We review recent experimental and theoretical work dealing with the proposed fifth force. Further analysis of the original Eotvos experiments has uncovered no challenges to our original assertion that these data evidence a correlation characteristic of the presence of a new coupling to baryon number or hypercharge. Various models suggest that the proposed fifth force could be accommodated naturally into the existing theoretical framework. 40 refs.

Fischbach, E.; Sudarsky, D.; Szafer, A.; Talmadge, C.; Aronson, S.H.

1986-01-01

257

PBS NATURE: Flight School  

NSDL National Science Digital Library

Flight School is a PBS NATURE companion website for a video production about the amazing recovery of the Whooping Crane. The site includes an interview with Operation Migration's Joseph Duff, information about bird flyways, imprinting, and more. The website links to a downloadable Teacher's Guide, a list of relevant links and books, and desktop images. A short video clip of the whooping cranes in flight is provided as well.

258

Scitable by Nature Education  

NSDL National Science Digital Library

A free science library and personal learning tool brought to you by Nature Publishing Group, the world's leading publisher of science. Scitable currently concentrates on genetics, the study of evolution, variation, and the rich complexity of living organisms. As you cultivate your understanding of modern genetics on Scitable, you will explore not only what we know about genetics and the ways it impacts our society, but also the data and evidence that supports our knowledge.

259

Texas Nature Trackers  

NSDL National Science Digital Library

Through Texas Nature Trackers projects, you can learn how to gather data about various species found on public lands or on your own property. Collected data is sent to biologists who use the information to gain a better understanding of the status and management needs of various species. The goal of the program is to enable long-term conservation of these species and appreciation among Texas citizens.

Department, Texas P.

260

The Nature of Things  

NSDL National Science Digital Library

This site features interactive tools related to The Nature of Things television show. The tools include different videos and descriptions of a wide variety of subjects. Some examples include biomimicry, human illness, indoor pollution, and other issues affecting humans. The subject area covered is a very wide range, but users studying or interested in the human brain, biology of human beings, or relationships between animals will no doubt find this site intriguing.

261

Natural History of Hawaii  

NSDL National Science Digital Library

The first Web site (1) is a ThinkQuest entry designed by students from Kapolei Elementary School. Although it's geared toward kids, it offers a great overview of the natural history of Hawaii that should benefit anyone not already familiar with the islands. The next Web site (2), from the Hawaiian Ecosystems at Risk Project, outlines the alien species situation in Hawaii and presents a 10-point action plan for combating this problem. The National Wildlife Health Center of the US Geological Survey describes the projects of the Hawaii Field Station in this straightforward Web site (3). Visitors can take a virtual tour of Oahu's Lyon Arboretum and learn about some of Hawaii's unique flora along the way (4). The Hawaii Natural Area Reserves System Web site (5) contains general descriptions and photos of nature reserves on Kauai, Oahu, Molokai, Maui, and the Big Island. Visitors to the next site (6) can browse a gallery of colorful Hawaiian-themed prints created by naturalist painter N. Robert Wagstaff. Terra Galleria Photography offers another collection of beautiful images, this time of Haleakala National Park. Images from this Web site (7) include photos of the highly endangered silversword plant. The final Web site is an article from ScienceDaily Magazine about some of the efforts to save this rare plant, which serves as a symbol of Hawaii's ecological plight (8).

Sohmer, Rachel.

2002-01-01

262

NATURAL RESOURCES ASSESSMENT  

SciTech Connect

The purpose of this report is to summarize the scientific work that was performed to evaluate and assess the occurrence and economic potential of natural resources within the geologic setting of the Yucca Mountain area. The extent of the regional areas of investigation for each commodity differs and those areas are described in more detail in the major subsections of this report. Natural resource assessments have focused on an area defined as the ''conceptual controlled area'' because of the requirements contained in the U.S. Nuclear Regulatory Commission Regulation, 10 CFR Part 60, to define long-term boundaries for potential radionuclide releases. New requirements (proposed 10 CFR Part 63 [Dyer 1999]) have obviated the need for defining such an area. However, for the purposes of this report, the area being discussed, in most cases, is the previously defined ''conceptual controlled area'', now renamed the ''natural resources site study area'' for this report (shown on Figure 1). Resource potential can be difficult to assess because it is dependent upon many factors, including economics (demand, supply, cost), the potential discovery of new uses for resources, or the potential discovery of synthetics to replace natural resource use. The evaluations summarized are based on present-day use and economic potential of the resources. The objective of this report is to summarize the existing reports and information for the Yucca Mountain area on: (1) Metallic mineral and mined energy resources (such as gold, silver, etc., including uranium); (2) Industrial rocks and minerals (such as sand, gravel, building stone, etc.); (3) Hydrocarbons (including oil, natural gas, tar sands, oil shales, and coal); and (4) Geothermal resources. Groundwater is present at the Yucca Mountain site at depths ranging from 500 to 750 m (about 1,600 to 2,500 ft) below the ground surface. Groundwater resources are not discussed in this report, but are planned to be included in the hydrology section of future revisions of the ''Yucca Mountain Site Description'' (CRWMS M&O 2000c).

D.F. Fenster

2000-12-11

263

Nature Inspired Surface Coatings  

NASA Astrophysics Data System (ADS)

Materials Scientists more and more are looking to nature for clues on how to create highly functional surface coatings with exceptional properties. The fog harvesting capabilities of the Namib Desert beetle, the beautiful iridescent colors of the hummingbird, and the super water repellant abilities of the Lotus leaf are but a few examples of the amazing properties developed over many years in the natural world. Nature also makes extensive use of the pH-dependent behavior of weak functional groups such as carboxylic acid and amine functional groups. This presentation will explore synthetic mimics to the nano- and microstructures responsible for these fascinating properties. For example, we have demonstrated a pH-induced porosity transition that can be used to create porous films with pore sizes that are tunable from the nanometer scale to the multiple micron scale. The pores of these films, either nano- or micropores, can be reversibly opened and closed by changes in solution pH. The ability to engineer pH-gated porosity transitions in heterostructured thin films has led to the demonstration of broadband anti-reflection coatings that mimic the anti-reflection properties of the moth eye and pH-tunable Bragg reflectors with a structure and function similar to that found in hummingbird wings and the Longhorn beetle. In addition, the highly textured honeycomb-like surfaces created by the formation of micron-scale pores are ideally suited for the creation of superhydrophobic surfaces that mimic the behavior of the self-cleaning lotus leaf. The development of synthetic "backbacks" on immune system cells that may one day ferry drugs to disease sites will also be discussed.

Rubner, Michael

2011-04-01

264

Nature, nurture and epigenetics.  

PubMed

Real life by definition combines heritability (e.g., the legacy of exposures) and experience (e.g. stress during sensitive or 'critical' periods), but how to study or even model this interaction has proven difficult. The hoary concept of evaluating traits according to nature versus nurture continues to persist despite repeated demonstrations that it retards, rather than advances, our understanding of biological processes. Behavioral genetics has proven the obvious, that genes influence behavior and, vice versa, that behavior influences genes. The concept of Genes X Environment (G X E) and its modern variants was viewed as an improvement on nature-nurture but has proven that, except in rare instances, it is not possible to fractionate phenotypes into these constituent elements. The entanglement inherent in terms such as nature-nurture or G X E is a Gordian knot that cannot be dissected or even split. Given that the world today is not what it was less than a century ago, yet the arbitrator (differential survival and reproduction) has stayed constant, de novo principles and practices are needed to better predict what the future holds. Put simply, the transformation that is now occurring within and between individuals as a product of global endocrine disruption is quite independent of what has been regarded as evolution by selection. This new perspective should focus on how epigenetic modifications might revise approaches to understand how the phenotype and, in particular its components, is shaped. In this review we summarize the literature in this developing area, focusing on our research on the fungicide vinclozolin. PMID:25102229

Crews, David; Gillette, Ross; Miller-Crews, Isaac; Gore, Andrea C; Skinner, Michael K

2014-12-01

265

Extending cosmological natural selection  

E-print Network

The purpose of this paper is to propose an extension to Lee Smolin's hypothesis that our own universe belongs to a population of universes evolving by natural selection. Smolin's hypothesis explains why the parameters of physics possess the values we observe them to possess, but depends upon the contingent fact that the universe is a quantum relativistic universe. It is proposed that the prior existence of a quantum relativistic universe can itself be explained by postulating that a process of cosmogenic drift evolves universes towards stable ('rigid') mathematical structures.

Gordon McCabe

2009-08-31

266

NatureServe  

NSDL National Science Digital Library

A product of the Association for Biodiversity Information and the Natural Heritage Network, this site offers conservation information on more than 50,000 plants, animals, and ecological communities of the United States and Canada. Users can keyword-search the database for plants and animals or ecological communities or browse by group. Search options for both categories include common or scientific name (or either), location, and conservation status. Search returns contain conservation status, distribution, and links to detailed reports (summary, conservation, distribution, comprehensive). Information about the data used at the site and a glossary are also provided. A fine resource for students and researchers in wildlife ecology and conservation.

267

Natural Selection Simulation  

NSDL National Science Digital Library

This classroom activity introduces the concept of natural selection and how it relates to evolution. Students will use a variety of utensils including clothespins, tweezers and spoons to mimic animals with differently shaped mouths. The class will go through several trials, picking up at least twenty beans in one minute with their assigned utensil. If they fail to do so, their creature has died, demonstrating what happens to animals that cannot compete in the wild. Several discussion questions are included along with the activity.

2012-05-29

268

Nature.com Blogs  

NSDL National Science Digital Library

This site brings together all of the blogs for the Nature Publishing Group, including discussions on public health, genetics, chemistry, and other interesting topics. First-time visitors can glance over recent meditations from British physicians on new and improved surgical operations and the Higgs-Boson particle. Visitors can read through one or all of the fifteen blogs or scroll down to the New Comments and Popular areas. In this last section, visitors can get a sense of the Most Read, Most Shared, and Most Commented items by other readers.

269

Patterns in Nature  

NSDL National Science Digital Library

This page is a companion to the Exploring Patterns in Nature Curriculum Guides (see related pages) developed by the Center for Polymer Studies. It represents several basic Java Applets which illustrate basic concepts in statistical mechanics and fractals. Note that these programs do not necessarily match the software instructions in our curriculum guides. The guides were written to correspond to standalone software developed in the early 1990s. Since Apple Macintosh computers were most popular in schools at the time, we developed for that platform. Those programs were all Mac System 7 compatible and obviously are not OS X compatible. We have plans to breathe new life into these programs and curriculum.

Mcgath, Gary; Trunfio, Paul

2008-12-31

270

The Natural Science Pages  

NSDL National Science Digital Library

Anthony Carpi, assistant professor at John Jay College of Criminal Justice, provides the Natural Science Pages. The site is divided into two primary sections, NSC 107 course-specific material (online supplement to students enrolled in this course at John Jay College) and course lessons (general use). The topics covered in the Course Lessons are Scientific Method, Matter & Energy, Atomic Structure, Periodic Table, Atomic Bonding, Reactions, Acids & Bases, Nuclear Science, The Universe, Organic Chem, Nutrients, DNA, The Cell, and Basic Anatomy. Descriptions, images, diagrams, and links to related resources are provided for each topic. This is an excellent learning resource and is well worth a visit.

271

The Nature of Salt  

NSDL National Science Digital Library

This is a hands-on lab activity about the composition of salt. Learners will explain the general relationship between an element's Periodic Table Group Number and its tendency to gain or lose electron(s), and explain the difference between molecular compounds and ionic compounds. They will then use household materials to build a model to demonstrate sodium chloride's cubic form and describe the nature of the electrostatic attraction that holds the structure of salt together. Background information, common preconceptions, a glossary and more is included. This activity is part of the Aquarius Hands-on Laboratory Activities.

272

SUPPLEMENTARY INFORMATION 1www.nature.com/nature  

E-print Network

, USA Contents Part A ­ Natural selection versus kin selection 2 1 Mutation-selection analysis 3 2 3 Comparing natural selection and kin selection 9 3.1 Additional assumptions needed for inclusive References 39 Part A ­ Natural selection versus kin selection Kin selection theory based on the concept

Miller, Thomas E.

273

Second nature: improving transportation without putting nature second  

E-print Network

Biodiversity Planning ..14 Florida’s Planning Process .15 Sonoran DesertSonoran Desert Conservation Plan http://www.co.pima.az.us/cmo/sdcp/ Pima County Environmentally Sensitive Roadway Guidelines: http://www.dot.co.pima.az.us/docreview/envsens/ NatureServe on Biodiversity andbiodiversity plans. SECOND NATURE: Improving Transportation Without Putting Nature Second SONORAN DESERT

White, Patricia A.; Ernst, Michelle

2003-01-01

274

Angus Robichaud's Reel G Em D A Bm D7  

E-print Network

Angus Robichaud's Reel 4 4 D G A D D G A D 3 3 G Em D A Bm D7 3 3 G Em D A D Animas Reel Bernie Waugh 4 4 3 3 G D G Bm Em C Am C D G D G Bm Em C Am D G The Arkansas Traveler 4 2 D G A D Em A 3D G A D Em G A D D G D A Bm Em A D G D A Em G A D #12;Asher Rodney Miller 4 4 D Em F#m G A D Em G A D A D1 2

Doyle, Peter

275

Angus Robichaud's Reel G Em D A Bm D7  

E-print Network

Angus Robichaud's Reel 4 4 D G A D D G A D 3 3 G Em D A Bm D7 3 3 G Em D A D Animas Reel Bernie Waugh 4 4 3 3 G D G Bm Em C Am C D G D G Bm Em C Am D G The Arkansas Traveler 4 2 D G A D Em A 3 D G A D Em G A D D G D A Bm Em A D G D A Em G A D #12; Asher Rodney Miller 4 4 D Em F#m G A D Em G A D A D 1

Doyle, Peter

276

Natural Gas Exports from Iran  

EIA Publications

This assessment of the natural gas sector in Iran, with a focus on Iran’s natural gas exports, was prepared pursuant to section 505 (a) of the Iran Threat Reduction and Syria Human Rights Act of 2012 (Public Law No: 112-158). As requested, it includes: (1) an assessment of exports of natural gas from Iran; (2) an identification of the countries that purchase the most natural gas from Iran; (3) an assessment of alternative supplies of natural gas available to those countries; (4) an assessment of the impact a reduction in exports of natural gas from Iran would have on global natural gas supplies and the price of natural gas, especially in countries identified under number (2); and (5) such other information as the Administrator considers appropriate.

2012-01-01

277

Aesthetic perception, nature and experience   

E-print Network

This thesis is about the perceptual nature of aesthetic experience and the importance of nature as a paradigmatic object of aesthetic perception and aesthetic experience more broadly conceived. For this reason, it merits ...

Hall, Nicole Annette

2014-07-01

278

Natural ventilation generates building form  

E-print Network

Natural ventilation is an efficient design strategy for thermal comfort in hot and humid climates. The building forms can generate different pressures and temperatures to induce natural ventilation. This thesis develops a ...

Chen, Shaw-Bing

1996-01-01

279

Natural medicaments in dentistry  

PubMed Central

The major objective in root canal treatment is to disinfect the entire root canal system. Cleaning, shaping, and use of antimicrobial medicaments are effective in reducing the bacterial load to some extent, but some bacteria do remain behind and multiply, causing reinfection. Taking into consideration the ineffectiveness, potential side-effects and safety concerns of synthetic drugs, the herbal alternatives for endodontic usage might prove to be advantageous. Over the past decade, interest in drugs derived from medicinal plants has markedly increased. Phytomedicine has been used in dentistry as anti-inflammatory, antibiotic, analgesic, sedative and also as endodontic irrigant. Herbal preparations can be derived from the root, leaves, seeds, stem, and flowers. The PubMed database search revealed that the reference list for natural medicaments featured 1480 articles and in dentistry 173 articles. A forward search was undertaken on the selected articles and author names. This review focuses on various natural drugs and products as well as their therapeutic applications when used as phytomedicine in dentistry. PMID:25558153

Sinha, Dakshita J.; Sinha, Ashish A.

2014-01-01

280

Naturally acquired microchimerism  

PubMed Central

Bi-directional transplacental trafficking occurs routinely during the course of normal pregnancy, from fetus to mother and from mother to fetus. In addition to a variety of cell-free substances, it is now well recognized that some cells are also exchanged. Microchimerism refers to a small number of cells (or DNA) harbored by one individual that originated in a genetically different individual. While microchimerism can be the result of iatrogenic interventions such as transplantation or transfusion, by far the most common source is naturally acquired microchimerism from maternal-fetal trafficking during pregnancy. Microchimerism is a subject of much current interest for a number of reasons. During pregnancy, fetal microchimerism can be sought from the mother’s blood for the purpose of prenatal diagnosis. Moreover, studies of fetal microchimerism during pregnancy may offer insight into complications of pregnancy, such as preeclampsia, as well as insights into the pathogenesis of autoimmune diseases such as rheumatoid arthritis which usually ameliorates during pregnancy. Furthermore, it is now known that microchimerism persists decades later, both fetal microchimerism in women who have been pregnant and maternal microchimerism in her progeny. Investigation of the long-term consequences of fetal and maternal microchimerism is another exciting frontier of active study, with initial results pointing both to adverse and beneficial effects. This review will provide an overview of microchimerism during pregnancy and of current knowledge regarding long-term effects of naturally acquired fetal and maternal microchimerism. PMID:19924635

GAMMILL, HILARY S.; NELSON, J. LEE

2010-01-01

281

[Natural family planning (NFP)].  

PubMed

The author reviews and makes further recommendations for 3 points of the discussion in G. Freundl's pilot study of "Natural Family Planning (Symptothermal Method) and Objective Ovulation Indicators" published by Georg Thieme Verlag in Vlume 6, "Geburtshilfe und Frauenheilkunde," in 1984. It is suggested that the scientific basis of changes in methodological rules, such as the BT3 modified for the double control method in paragraph 3 of the discussion, must be reported Natural Family Planning (NFP) instructors in Bonn, West Germany, along with failure statistics whenever possible, to enable instructors to participate responsibly. In response to errors by users cited in paragraph 4 of the discussion, the reviewer asserts that adequate instructional materials (photos and slides) are available to acquaint the users with changes in cervical mucus and that personal guidance of a couple or small group should be carried out until detection of fertility signals is performed without difficulty and the couple has proved itself capable of abstaining for the required periods, the latter being the more difficult. The author further cautions that before shortening of the abstinence period can be promoted, instructors must be scientifically assured of the accuracy of the basal temperature -6 indicator. She emphasizes that user errors can be reduced with a shorter abstinence period, but that the couple demands reliable rules first and foremost. The author concludes with a call for closer cooperation between gynecologists and NFP instructors. PMID:6570123

Luh-Hardegg, G

1984-12-01

282

Natural gas monthly, July 1993  

SciTech Connect

The Natural Gas Monthly NGM highlights activities, events, and analyses of interest to public and private sector organizations associated with the natural gas industry. Volume and price data are presented each month for natural gas production, distribution, consumption, and interstate pipeline activities. Producer-related activities and underground storage data are also reported. From time to time, the NGM features articles designed to assist readers in using and interpreting natural gas information.

Not Available

1993-07-27

283

Natural gas monthly: September 1996  

SciTech Connect

The Natural Gas Monthly highlights activities, events, and analyses of interest to public and private sector organizations associated with the natural gas industry. Volume and price data are presented each month for natural gas production, distribution, consumption, and interstate pipeline activities. Producer-related activities and underground storage data are also reported. From time to time, the NGM features articles designed to assist readers in using and interpreting natural gas information. 6 figs., 24 tabs.

NONE

1996-09-01

284

Natural gas monthly, July 1994  

SciTech Connect

The Natural Gas Monthly (NGM) highlights activities, events, and analyses of interest to public and private sector organizations associated with the natural gas industry. Volume and price data are presented each month for natural gas production, distribution, consumption, and interstate pipeline activities. Producer-related activities and underground storage data are also reported. From time to time, the NGM features articles designed to assist readers in using and interpreting natural gas information.

Not Available

1994-07-20

285

Natural gas monthly, August 1994  

SciTech Connect

The Natural Gas Monthly (NGM) highlights activities, events, and analyses of interest to public and private sector organizations associated with the natural gas industry. Volume and price data are presented each month for natural gas production, distribution, consumption, and interstate pipeline activities. Producer-related activities and underground storage data are also reported. From time to time, the NGM features articles designed to assist readers in using and interpreting natural gas information.

Not Available

1994-08-24

286

Natural products as antiviral agents  

Microsoft Academic Search

Since the ancient times, natural products have served as a majorsource of drugs. About fifty percent of today's pharmaceutical drugs are derived from natural origin. Interest in natural products as a source of new drugs is growing due to many factors that will be discussed in this article. Viruses have been resistant to therapy or prophylaxis longer than any other

Khalid A. El Sayed

2000-01-01

287

Natural Selection and Geology 230  

E-print Network

;Natural Selection · The theory of natural selection was proposed by Charles Darwin in 1859, in his bookNatural Selection and Evolution Geology 230 Fossils and Evolution #12;The Study of Evolution the same theory as Darwin in the 1850s. #12;One of the most famous and influential books of science. #12

Kammer, Thomas

288

Molecular Signatures of Natural Selection  

E-print Network

Molecular Signatures of Natural Selection Rasmus Nielsen Center for Bioinformatics and Department There is an increasing interest in detecting genes, or genomic re- gions, that have been targeted by natural selection contribution of natural selection in shaping the genetic variation observed among living organisms. In one

Nielsen, Rasmus

289

Children's Moral Relationships with Nature.  

ERIC Educational Resources Information Center

Two studies of the development of children's moral relationships with nature addressed such questions as: (1) What does it mean to say that we have an obligation not to harm the natural environment? (2) Does the natural environment feel pain? (3) Does it have rights? or (4) Is moral obligation an inappropriate construct by which to understand the…

Kahn, Peter H., Jr.; McCoy, Ann

290

wind engineering & natural disaster mitigation  

E-print Network

wind engineering & natural disaster mitigation #12;wind engineering & natural disaster mitigation Investment WindEEE Dome at Advanced Manufacturing Park $31million Insurance Research Lab for Better Homes $8million Advanced Facility for Avian Research $9million #12;wind engineering & natural disaster mitigation

Denham, Graham

291

Natural Language Introduction to NLP  

E-print Network

Natural Language Processing Introduction to NLP #12;Speech and Language Processing - Jurafsky and Martin 2 Natural Language Processing We're going to study what goes into getting computers to perform for CSI 5386 @ uOttawa #12;Natural Language Processing 1/11/2014 Speech and Language Processing - Jurafsky

Inkpen, Diana

292

Nature and Nationhood: Danish Perspectives  

ERIC Educational Resources Information Center

In this paper, I shall discuss Danish perspectives on nature, showing the interdependence of conceptions of "nature" and "nationhood" in the formations of a particular cultural community. Nature, thus construed, is never innocent of culture and cannot therefore simply be "restored" to some pristine, pre-lapsarian state. On the other hand,…

Schnack, Karsten

2009-01-01

293

warnell school Forestry & Natural Resources  

E-print Network

warnell school Forestry & Natural Resources 2010 Annual Report o #12;VisionTo be recognized as one of the top five forestry and natural resource programs in the United States. MissionTo prepare resources; and to place latest ideas and technology in forestry and natural resource management into real

Hall, Daniel

294

US crude oil, natural gas, and natural gas liquids reserves  

SciTech Connect

This report presents estimates of proved reserves of crude oil, natural gas, and natural gas liquids as of December 31, 1989, and production volumes for the year 1989 for the total United States and for selected states and state sub-divisions. Estimates are presented for the following four categories of natural gas: total gas (wet after lease separation), its two major components (nonassociated and associated-dissolved gas), and total dry gas (wet gas adjusted for the removal of liquids at natural gas processing plants). In addition, two components of natural gas liquids, lease condensate and natural gas plant liquids, have their reserves and production reported separately. Also included is information on indicated additional crude oil reserves and crude oil, natural gas, and lease condensate reserves in nonproducing reservoirs. 28 refs., 9 figs., 15 tabs.

Not Available

1990-10-05

295

Natural Antibodies Against Sialoglycans.  

PubMed

Natural antibodies, part of the innate immunity system, are produced at strictly regulated levels in normal sera without immunization and thus are part of the innate immune system. The best studied natural antibodies are those directed against blood group antigens A and B and xeno-antigens including glycolylneuraminic acid containing Hanganutziu-Deicher (HD) glycolipid. Abnormal levels of anti-glycan antibodies were found in a number of pathologies. In many cases pathological antibodies are known to bind gangliosides. The genesis of anti-glycan antibodies in healthy humans and the reasons for their changes in pathologies are poorly understood. With a growing interest in their diagnostic applications, it is important to determine the carbohydrate structures that are recognized by antibodies present in the circulation of healthy individuals. We tested a large number of healthy donors using a printed glycan array (PGA) in a microchip format. The PGA contained ~300 glycans, representing mostly normal mammalian structures of glycoproteins and glycolipids, and many of the structures presented are biologically relevant sialylated motifs. As revealed by PGA, the sera interacted with at least 70 normal human glycans. With only few exceptions, antibodies recognizing sialosides have not been identified. Moderate levels of antibodies and moderate variability were observed in the case of SiaT n and its glycolyl variant. Unexpectedly, we found minimal antibody titer directed against Neu5Gc? and the trisaccharide Neu5Gc?2-6Gal?1-4GlcNAc, although this form of neuraminic acid does not occur naturally in humans. Antibodies recognizing sialosides in unnatural ?-configuration have been detected and confirmed Springer's paradigm that circulating antibodies represent a reaction against bacteria. Gram-negative bacteria contain LPS with ?KDN and/or ?KDO which are very close analogs of Neu5Ac that are found in ?-connected form. Antibodies against the biantennary N-glycan chain, (Neu5Ac?2-6Gal?1-4GlcNAc?1-2Man?)2-3,6-Man?1-4GlcNAc?1-4GlcNAc were never observed and similarly we never saw antibodies directed against the SiaLe(a)/SiaLe (x) motifs. Anti-sialoglycan antibodies can be masked with gangliosides: for example, we observe about a five times higher level of anti-GD3 in purified total IgG compared to the same concentration of total Ig in the composition of native serum. For several antibodies we observed anomalous binding in diluted sera, namely, the signals towards sialylated glycans were increased in the PGA if diluted sera were used. PMID:24037491

Shilova, Nadezhda; Huflejt, Margaret E; Vuskovic, Marko; Obukhova, Polina; Navakouski, Maksim; Khasbiullina, Nailya; Pazynina, Galina; Galanina, Oxana; Bazhenov, Alexey; Bovin, Nicolai

2013-09-14

296

Natural fracturing, by depth  

NASA Astrophysics Data System (ADS)

Natural opening-mode fractures commonly fall upon a spectrum whose end-members are veins, which have wide ranges of sizes and are mostly or thoroughly cemented, and joints, which have little opening displacement and little or no cement. The vein end-member is common in metamorphic rocks, whose high temperature and pressure of formation place them outside typical reservoir settings; conversely, many uncemented joints likely form near the surface and so too have limited relevance to subsurface exploration. Sampling of cores retrieved from tight-gas sandstone reservoirs suggest that it is intermediate fractures, not true joints or veins, that provide natural porosity and permeability. Such fractures have abundant pore space among fracture-bridging cements, which may hold fractures open despite varying states of stress through time. Thus the more sophisticated our understanding of the processes that form veins and joints, i.e., how natural fracturing varies by depth, the better our ability to predict intermediate fractures. Systematic differences between veins and joints, in terms of size-scaling and lateral and stratigraphic spatial arrangement, have been explained in the literature by the mechanical effects of sedimentary layering, which likely exert more control over fracture patterns at shallower depths. Thus stratabound joints commonly have narrow size ranges and regular spacing; non-stratabound veins have a wide range of sizes and spacings. However, new fieldwork and careful literature review suggest that the effects of mechanical layering are only half the story. Although atypical, veins may be highly stratabound and yet spatially clustered; non-stratabound fractures may nonetheless feature narrow size ranges. These anomalous fracture arrangements are better explained by the presence of precipitating cements during fracture opening than by mechanical layering. Cement is thought to be highly important for fracture permeability, but potential effects of synkinematic cement on fracture size and spacing have been largely overlooked. Such effects are currently poorly understood, but numerical models of fracture widening amid precipitating cements can replicate observed size-scaling patterns. Synkinematic fracture-bridging cements can also potentially account for irregular fracture spacing in stratabound fracture arrays.

Hooker, John; Laubach, Stephen

2013-04-01

297

Correlation of the NBME Advanced Clinical Examination in EM and the National EM M4 exams  

PubMed Central

Introduction Since 2011 two online, validated exams for fourth-year emergency medicine (EM) students have been available (National EM M4 Exams). In 2013 the National Board of Medical Examiners offered the Advanced Clinical Examination in Emergency Medicine (EM-ACE). All of these exams are now in widespread use; however, there are no data on how they correlate. This study evaluated the correlation between the EM-ACE exam and the National EM M4 Exams. Methods From May 2013 to April 2014 the EM-ACE and one version of the EM M4 exam were administered sequentially to fourth-year EM students at five U.S. medical schools. Data collected included institution, gross and scaled scores and version of the EM M4 exam. We performed Pearson’s correlation and random effects linear regression. Results 303 students took the EM-ACE and versions 1 (V1) or 2 (V2) of the EM M4 exams (279 and 24, respectively). The mean percent correct for the exams were as follows: EM-ACE 74.8 (SD-8.83), V1 83.0 (SD-6.41), V2 78.5 (SD-7.70). Pearson’s correlation coefficient for the V1/EM-ACE was 0.51 (0.42 scaled) and for the V2/EM-ACE was 0.59 (0.41 scaled). The coefficient of determination for V1/EM-ACE was 0.72 and for V2/EM-ACE = 0.71 (0.86 and 0.49 for scaled scores). The R-squared values were 0.25 and 0.30 (0.18 and 0.13, scaled), respectively. There was significant cluster effect by institution. Conclusion There was moderate positive correlation of student scores on the EM-ACE exam and the National EM M4 Exams.

Hiller, Katherine; Miller, Emily S.; Lawson, Luan; Wald, David; Beeson, Michael; Heitz, Corey; Morrissey, Thomas; House, Joseph; Poznanski, Stacey

2015-01-01

298

Natural hazard losses and acceptable risk criteria  

NASA Astrophysics Data System (ADS)

The criteria for the definition of acceptable risk to the lives of members of a society (commonly called societal risk) resulting from exposure to natural hazards are based in most countries on the frequency and characteristics of industrial accidents, e.g., nuclear power plants. However, historical records indicate that the frequency of natural hazard events is much higher than those involved in industrial hazards and their consequences are far greater. We find that the risk from natural hazards is unacceptable in the current risk criteria framework, i.e., they are an unacceptable risk with respect to the acceptable risk criteria based on the frequency and consequences of industrial accidents. According to a definition of risk, there are two main components; first, the probability of occurrence of the hazard and second, the consequence of the hazard. The occurrence of industrial accident events (hazard) can be controlled to a large extent in contrast to that of natural hazards. However, we can control natural hazard risk, in some cases by engineering solutions to control hazard and by reducing the consequences of the events by mitigating, risk management, warning and monitoring techniques. With reference to natural hazards reducing risk is mainly effected by reducing consequences. The FN-curve is a tool commonly used in societal risk assessment. It is built on a series of frequency-loss data associated with a particular process in a given period of time. It is also used to set acceptable risk criteria for countries or sub-national jurisdictions, by defining slopes and intercepts for plots of a particular (or group of) processes. The intercept of the acceptable risk curve is usually arbitrarily defined in the order of 10-7-10-1 deaths per year, and the slope criteria is based on an adopted aversion factor of the society to accident and disaster losses.The imposed slope criteria is usually between -1 and -2 whereas the slope of FN-curves based on real natural disaster data is <-1. Efforts have been made to make FN-curves more practical since there have been persistent difficulties in interpreting the curves dating back to their initial use in the 1960s. To this end we introduce a normalization procedure to the consequence part of the FN-curve. This involves taking N, number of fatalities and dividing N by the population exposed to the event. Since the population of regions are different, different societal risk results from differential exposure. We illustrate the use of the normalized consequence approach by analyzing losses from natural hazards in 32 European countries derived from the EM-DAT database. We examine historical losses in relation to acceptable risk criteria and find that risks defined in the modified FN curves far exceed those defined in industrial-accident-based acceptable risk criteria in current European use.

Khaleghy Rad, M.; Evans, S. G.; Nadim, F.; Lacasse, S.

2009-12-01

299

NATURE: Hippo Beach  

NSDL National Science Digital Library

This website is the online companion to Hippo Beach, which recently aired on the PBS series NATURE. And as the website explains, "from the study of hippos' essential relationships with birds to the discovery that hippos can communicate underwater, these mammals deserve a closer look." Students can get a closer look with "Sun, Sand, and Hippos," an interdisciplinary lesson plan for grades 3-5. The lesson guides students in researching and creating presentations on hippos and helpful weblinks, worksheets, and a teacher's guide are provided. The website contains other special features as well, including video clips from the program, multimedia activities, informative essays, and more. [RS] This site is also reviewed in the November 14, 2003 NSDL Life Sciences Report.

300

Nature of Light  

NSDL National Science Digital Library

What is light? Our experience with light is that which we can see. Our eyes contain two different types of photoreceptors, rods and cones. Rods are extremely sensitive to light but can't distinguish color. Cones which are less sensitive than rods, respond to light of different wavelengths, producing color vision. Instruction for understanding light begins with an understanding of mechanical waves and the properties of those waves. However, light also has particle-like properties, and exhibits a wave-particle duality. This SciGuide breaks down the complexity of teaching the nature of light into manageable chunks arranged in a logical sequence for learning. You may choose specific Themes or Keywords appropriate to your students and teaching objectives. Individual Themes and Keywords identify misconceptions and conceptual difficulties. Many web resources provide simulations and data to enhance understanding and engage students in inquiry.

National Science Teachers Association (NSTA)

1900-01-01

301

California Natural Diversity Database  

NSDL National Science Digital Library

What is the goal of the California Natural Diversity Database? Simply put, it is "a program that inventories the status and locations of rare plants and animals in California." On its page, visitors can look over a remarkable database of GIS-mapped locations, along with key facts about the database, a host of white papers, and information about its vegetation, classification, and mapping program. The Maps & Data area is a true find, as it contains interactive maps that offer visitors the ability to engage with data over time. Materials dating back to 2003 may be accessed here. Also, users can submit their own data to the database via the Submitting Data to CNDDB section of the site. Interested users can also sign up to receive updates about the site and its new additions.

302

New probe of naturalness.  

PubMed

Any new scalar fields that perturbatively solve the hierarchy problem by stabilizing the Higgs boson mass also generate new contributions to the Higgs boson field-strength renormalization, irrespective of their gauge representation. These new contributions are physical, and in explicit models their magnitude can be inferred from the requirement of quadratic divergence cancellation; hence, they are directly related to the resolution of the hierarchy problem. Upon canonically normalizing the Higgs field, these new contributions lead to modifications of Higgs couplings that are typically great enough that the hierarchy problem and the concept of electroweak naturalness can be probed thoroughly within a precision Higgs boson program. Specifically, at a lepton collider this can be achieved through precision measurements of the Higgs boson associated production cross section. This would lead to indirect constraints on perturbative solutions to the hierarchy problem in the broadest sense, even if the relevant new fields are gauge singlets. PMID:24093250

Craig, Nathaniel; Englert, Christoph; McCullough, Matthew

2013-09-20

303

Nature: Katrina's Animal Rescue  

NSDL National Science Digital Library

There have been many stories that have come out in the aftermath of Hurricane Katrina, and most of them have dealt with the human tragedies involved in this traumatic set of events. The people at the long-running PBS series, Nature, have created this website to complement a recent edition of the show that offered some insights into the effects the hurricane had on the animal population of Louisiana. On the site, visitors can take advantage of a number of special interactive features. These features allow visitors to ask questions of those involved in the animal rescue efforts and learn about the psychological and physical effects on animals. The site also contains a section where visitors can learn about other web-based resources, such as the homepages for Animal Rescue New Orleans and the Best Friends Animal Society.

2005-01-01

304

Natural flexible dermal armor.  

PubMed

Fish, reptiles, and mammals can possess flexible dermal armor for protection. Here we seek to find the means by which Nature derives its protection by examining the scales from several fish (Atractosteus spatula, Arapaima gigas, Polypterus senegalus, Morone saxatilis, Cyprinius carpio), and osteoderms from armadillos, alligators, and leatherback turtles. Dermal armor has clearly been developed by convergent evolution in these different species. In general, it has a hierarchical structure with collagen fibers joining more rigid units (scales or osteoderms), thereby increasing flexibility without significantly sacrificing strength, in contrast to rigid monolithic mineral composites. These dermal structures are also multifunctional, with hydrodynamic drag (in fish), coloration for camouflage or intraspecies recognition, temperature and fluid regulation being other important functions. The understanding of such flexible dermal armor is important as it may provide a basis for new synthetic, yet bioinspired, armor materials. PMID:23161399

Yang, Wen; Chen, Irene H; Gludovatz, Bernd; Zimmermann, Elizabeth A; Ritchie, Robert O; Meyers, Marc A

2013-01-01

305

Nature . . . an environmental yardstick  

USGS Publications Warehouse

To one who has spent his professional career in geologic science, conservation always has had special meaning. In the measurements so necessary to his work the geologist develops an integrity in the use of numbers and in the qualifications attending the validity of numbers. Scientific analysis of geologic events and sequence develops a keen sense of what is coincidental, correlative, and consequential. The geologist applies his science in evaluating hazards to man as natural catastrophes and/or benefits to man such as earth materials that form the resource base of his society. But more than these the geologist has acquired a deep appreciation for the planet as a whole, its inner structure, its landscape, and the living things that abound.

Pecora, William T.

1976-01-01

306

Nature: American Eagle  

NSDL National Science Digital Library

With its bold beak and talented talons, the bald eagle is perhaps one of the best symbols of the United States of America. Recently, the Nature program on PBS created this documentary to profile this majestic animal. Visitors to the site can watch the program in its entirety, leave their own comments, and learn about bald eagles' evolutionary ancestors. That's not all, as visitors can also look over an interactive map that tracks bald eagle populations over the past decades. For those who might want to watch smaller sections of the film, there are short clips available as well, including "Sibling Rivalry" and "Autumn Bounty on the Mississippi". Finally, visitors can also give their own feedback on the program, and there's a chance that the producer might chime in with his own response.

2011-01-07

307

Natural Radioactivity in Bananas  

SciTech Connect

The content of {sup 40}K natural radionuclide in bananas (Musa sapientum) from the Vale do Ribeira region, Sao Paulo, Brazil, has been measured. We have collected several samples of bananas prata and nanica, its peels, leaves, and also different soils where the banana tree was planted, such as soil with a standard amount of fertilizer, the fertilizer itself and also soil without fertilizer for comparison. We have used the gamma-ray spectroscopy technique with a NaI(T1) crystal inside a 12 cm thick lead shield to detect the gamma-radiation. The results indicate that only part of the available potassium is absorbed by the plant, which is mainly concentrated in the banana peel.

Zagatto, V. A. B.; Medina, N. H.; Okuno, E.; Umisedo, N. K. [Instituto de Fisica da Universidade de Sao Paulo (Brazil)

2008-08-07

308

Natural family planning methods.  

PubMed

Wade et al.'s report, entitled "A randomized prospective study of the use-effectiveness of 2 methods of natural family planning," contains items worthy of emphasis. These includes the following: 1) less than 5% of the women in the study were prevented from using the method assigned them because of problems in identifying their cervical mucus pattern; 2) those who were unable or unwilling to adhere to the methodology were encouraged to drop out; 3) the largest single category of pregnancies occurred in both groups when the volunteers failed to follow the rules for avoiding pregnancy; 4) it was judged that there were 6 pregnancies in the ovulation method group to be classified as method failures, apparently for a total of 4501 cycles, which gives a method-failure rate of 1.6%; 5) couples were required to sign an informed consent statement of their awareness that the chances of the occurrence of pregnancy could be as high as 25% for the ovulation method; 6) recruiting difficulties constituted an important finding, primarily because they were unexpected by the investigators; 7) the volunteers recruited into the trial were restricted to those women whose menstrual cycles were 24-36 days; 8) the couples who failed to continue with the use of these 2 natural methods--ovulation and temperature rhythm--were on the average younger, more sexually active, and had fewer children; and 9) the ovulation method brings the partners into confrontation with their fertility in each cycle, and this has marked psychological results, including an awakening of the suppressed desire for that fertility to become creative of human life. PMID:7081306

Billings, J J

1982-05-01

309

Pattern and Design in Nature  

NSDL National Science Digital Library

This activity suggests that art is a fun way to encourage children to see the world around them and increase their visual awareness. Students observe natural objects like shells, rocks, minerals, and plants and notice that they have subtle and striking detail, regularity of pattern, texture, and shape. By exploring natural design, students will be encouraged to observe the natural world more closely and will begin to observe natural objects carefully and note intricate design and structure beyond surface form. In discussion, students will learn how patterns result from natural growth processes and land-shaping processes.

Lauret Savoy

310

Natural gas monthly, November 1996  

SciTech Connect

The report highlights activities, events, and analyses of interest to public and private sector organizations associated with the natural gas industry. Volume and price data are presented each month for natural gas production, distribution, consumption, and interstate pipeline activities. Producer-related activities and underground storage data are also reported. From time to time, the Natural Gas Monthly features articles designed to assist readers in using and interpreting natural gas information. The feature article this month is ``US natural gas imports and exports-1995``. 6 figs., 24 tabs.

NONE

1996-11-01

311

Natural gas monthly, June 1994  

SciTech Connect

The Natural Gas Monthly (NGM) highlights activities, events, and analyses of interest to public and private sector organizations associated with the natural gas industry. Volume and price data are presented each month for natural gas production, distribution, consumption, and interstate pipeline activities. Producer-related activities and underground storage data are also reported. From time to time, the NGM features articles designed to assist readers in using and interpreting natural gas information. The feature article this month is the executive summary from Natural Gas 1994: Issues and Trends. 6 figs., 31 tabs.

Not Available

1994-06-01

312

Natural Gas Monthly, October 1993  

SciTech Connect

The (NGM) Natural Gas Monthly highlights activities, events, and analyses of interest to public and private sector organizations associated with the natural gas industry. Volume and price data are presented each month for natural gas production, distribution, consumption, and interstate pipeline activities. Producer-related activities and underground storage data are also reported. From time to time, the NGM features articles designed to assist readers in using and interpreting natural gas information. This month`s feature articles are: US Production of Natural Gas from Tight Reservoirs: and Expanding Rule of Underground Storage.

Not Available

1993-11-10

313

Natural gas monthly, September 1993  

SciTech Connect

The Natural Gas Monthly (NGM) is prepared in the Data Operations Branch of the Reserves and Natural Gas Division, Office of Oil and Gas, Energy Information Administration (EIA), US Department of Energy (DOE). The NGM highlights activities, events, and analyses of interest to public and private sector organizations associated with the natural gas industry. Volume and price data are presented each month for natural gas production, distribution, consumption, and interstate pipeline activities. Producer-related activities and underground storage data are also reported. From time to time, the NGM features articles designed to assist readers in using and interpreting natural gas information.

Not Available

1993-09-27

314

Natural gas monthly, April 1997  

SciTech Connect

The Natural Gas Monthly (NGM) highlights activities, events, and analyses of interest to public and private sector organizations associated with the natural gas industry. Volume and price data are present3ed each month for natural gas production, distribution, consumption, and interstate pipeline activities. Producer-related activities and underground storage data are also reported. From time to time, the NGM features articles designed to assist readers in using and interpreting natural gas information. The feature article is entitled ``Natural gas pipeline and system expansions.`` 6 figs., 27 tabs.

NONE

1997-04-01

315

Natural gas monthly, August 1995  

SciTech Connect

The Natural Gas Monthly (NGM) highlights activities, events, and analyses of interest to public and private sector organizations associated with the natural gas industry. Volume and price data are presented each month for natural gas production, distribution, consumption, and interstate pipeline activities. Producer-related activities and underground storage data are also reported. From time to time, the NGM features articles designed to assist readers in using and interpreting natural gas information. This month`s feature article is on US Natural Gas Imports and Exports 1994.

NONE

1995-08-24

316

Natural gas monthly, March 1997  

SciTech Connect

The Natural Gas Monthly (NGM) highlights activities, events, and analyses of interest to public and private sector organizations associated with the natural gas industry. Volume and price data are presented each month for natural gas production, distribution, consumption, and interstate pipeline activities. Producer-related activities and underground storage data are also reported. From time to time, the NGM features articles designed to assist readers in using and interpreting natural gas information. The feature article is entitled ``Natural gas analysis and geographic information systems.`` 6 figs., 27 tabs.

NONE

1997-03-01

317

RETIFICAO DO EDITAL N 10 e 11/DDPP/2011 A Diretora do Departamento de Desenvolvimento de Potencializao de Pessoas da Pr-  

E-print Network

nº 11/DDPP/2011, onde se lê: "2.1.1. Programa de Pós-Graduação em Engenharia de Alimentos: Campo de conhecimento: Engenharia de Alimentos/ Processos na Indústria de Alimentos. Área de concentração: Epistemologia Engenharia de Alimentos ou Engenharia Química." Leia-se: "2.1.1. Programa de Pós-Graduação em Engenharia de

Floeter, Sergio Ricardo

318

NATURAL GENETIC ENGINEERING AND NATURAL GENOME EDITING Learning from Bacteria about Natural  

E-print Network

the communication-based interplay between individual bacteria and the colony. Individ- ual cells assume newly coNATURAL GENETIC ENGINEERING AND NATURAL GENOME EDITING Learning from Bacteria about Natural conditions, bacteria live in complex hierarchical communities. To conduct complex cooperative behaviors

Jacob, Eshel Ben

319

96 NATURE|VOL427|8JANUARY2004|www.nature.com/nature Automatic archaeology  

E-print Network

96 NATURE|VOL427|8JANUARY2004|www.nature.com/nature Automatic archaeology Digging in the dirt and an archaeological hobbyist -- celebrated his sixtieth birthday three years ago. On that day he took his entire to the profession of archaeology," he says. With that goal in mind, Smilansky was directed to Ilan Sharon

Smilansky, Uzy

320

Natural gas monthly, April 1998  

SciTech Connect

This issue of the Natural Gas Monthly presents the most recent estimates of natural gas data from the Energy Information Administration (EIA). Estimates extend through April 1998 for many data series. The report highlights activities, events, and analyses of interest to public and private sector organizations associated with the natural gas industry. Volume and price data are presented each month for natural gas production, distribution, consumption, and interstate pipeline activities. Producer-related activities and underground storage data are also reported. From time to time, feature articles are presented designed to assist readers in using and interpreting natural gas information. This issue contains the special report, ``Natural Gas 1997: A Preliminary Summary.`` This report provides information on natural gas supply and disposition for the year 1997, based on monthly data through December from EIA surveys. 6 figs., 28 tabs.

NONE

1998-04-01

321

Lecture 12: EM Radiation (EMR)  

E-print Network

#12;James Clerk Maxwell You! 5 Finally, the pinnacle of EM... E · dA = qencl 0 B · dA = 0 E · dl = E = - dB dt{ Maxwell'sEquations F = q(E + v � B)Lorentz Force Law: Gauss's Law Gauss's Law for Mag. Faraday's Law Ampère's LawB · dl = µ0(Ireal + 0 dE dt ) 6 Must be cool 7 Maxwell's last two equations... B

Tobar, Michael

322

Natural family planning.  

PubMed

Frequently, when one mentions natural family planning methods, the response is doubt, bewilderment, ridicule, or scorn. Much of this is due to the fact that many people know only of the rhythm method, which depends on a calculation based on the menstrual pattern. What many people do not know, including physicians and nurses, is that in Australia Drs. John and Lyn Billings have been scientifically researching natural methods of family planning for 25 years, and they have pioneered this Ovulation Method of family planning. The Billings Ovulation Method depends only on the mucus sign. It is based on a scientific knowledge of the combined fertility of husband and wife, and an understanding of the physiology of the female body through simple observations. Important facts relating to the practice of the method include: ovulation takes place only once in the cycle; mucus is secreted by the cervical mucosa before ovulation; the ovum lives for only 3 days at the most; and the sperms live for 5 days at the most, and only in the presence of this fertile mucus. There a 2 types of mucus. The 1st type to appear is cloudy or white. It is nonslippery, sticky, and breaks when stretched between 2 fingers. The 2nd type is like the part of a hen's egg. It is very slippery, much clearer than the former, and stretches when pulled between 2 fingers. This is fertile mucus, and ovulation occurs on the last day that this is present. Of course, it cannot be recognized as the last day until its absence is observed on the following day. The mucus sign can be both seen and felt. After a few months a woman will readily recognize her fertile time, but daily charting is advocated. Simple signs, representing the various observations, are taught. Once a couple knows and understands their combined fertility through the observation of the mucus sign they can plan their family. Rules of the method are outlined. The self control required by this method can only serve to increase the selfless love and unselfish care and respect between partners. PMID:7168858

Bourdillon, C

1982-11-01

323

The Nature of Naive Explanations of Natural Selection.  

ERIC Educational Resources Information Center

Suggests that misconceptions about natural selection arise from mistaken categorization. Proposes that students often fail to understand the ontological features of equilibrium processes. Contains 32 references. (DDR)

Ferrari, Michel; Chi, Michelene T. H.

1998-01-01

324

ISSN 0103-9741 Monografias em Cincia da Computao  

E-print Network

abordagem por reflexão computacional baseada em lógica Dárlinton Barbosa Feres Carvalho Edward Hermann Lucena Dezembro, 2010 Análise de Riscos em Projetos: uma abordagem por reexão computacional baseada em em um projeto, é proposto neste trabalho um modelo para reexão computacional baseado em lógica

Endler, Markus

325

SUSY naturalness without prejudice  

E-print Network

Unlike the Standard Model (SM), supersymmetric models stabilize the electroweak (EW) scale $v$ at the quantum level and {\\it predict} that $v$ is a function of the TeV-valued SUSY parameters ($\\gamma_\\alpha$) of the UV Lagrangian. We show that the (inverse of the) covariance matrix of the model in the basis of these parameters and the usual deviation $\\delta\\chi^2$ (from $\\chi^2_{min}$ of a model) automatically encode information about the "traditional" EW fine-tuning measuring this stability, {\\it provided that} the EW scale $v\\sim m_Z$ is indeed regarded as a function $v=v(\\gamma)$. It is known that large EW fine-tuning may signal an incomplete theory of soft terms and can be reduced when relations among $\\gamma_\\alpha$ exist (due to GUT symmetries, etc). The global correlation coefficient of this matrix can help one investigate if such relations are present. An upper bound on the usual EW fine-tuning measure ("in quadrature") emerges from the analysis of the $\\delta\\chi^2$ and the s-standard deviation confidence interval by using $v=v(\\gamma)$ and the theoretical approximation (loop order) considered for the calculation of the observables. This upper bound avoids subjective criteria for the "acceptable" level of EW fine-tuning for which the model is still "natural".

D. M. Ghilencea

2014-04-14

326

Transient nature of thermotolerance  

SciTech Connect

Chinese hamster ovary and V79 cells were heated continuously at 41.4/sup 0/ or 41.9/sup 0/C for periods up to 72 hours. Thermotolerance developed in both cell lines but was transitory in that cells appeared to become sensitive again if the heating was continued for a sufficiently long period. This had the effect of making the dose-response curves for both cell lines triphasic in nature. At 41.9/sup 0/C, the first 4 hours of heating produced the steepest slope of the response curve; thermotolerance was then exhibited during the next 32 hours but diminished in the final 36 hours of heating as the cells appeared to become more sensitive again. Decreasing the temperature from 41.9/sup 0/ to 41.4/sup 0/C shortened the duration of thermotolerance and also increased the subsequent heat sensitivity. For heating times up up to 24 hours, more cell killing occurred at 41.9/sup 0/ than at 41.4/sup 0/C, whereas for longer heating intervals between 36 and 72 hours, the lower temperature produced a greater degree of cell kill. These results suggest that the decay of thermotolerance may be associated with perturbations in cell progression through the cycle.

Freeman, M.L.

1982-01-01

327

Nature, Nurture, and Expertise.  

PubMed

Rather than investigating the extent to which training can improve performance under experimental conditions ('what could be'), we ask about the origins of expertise as it exists in the world ('what is'). We used the twin method to investigate the genetic and environmental origins of exceptional performance in reading, a skill that is a major focus of educational training in the early school years. Selecting reading experts as the top 5% from a sample of 10,000 12-year-olds twins assessed on a battery of reading tests, three findings stand out. First, we found that genetic factors account for more than half of the difference in performance between expert and normal readers. Second, our results suggest that reading expertise is the quantitative extreme of the same genetic and environmental factors that affect reading performance for normal readers. Third, growing up in the same family and attending the same schools account for less than a fifth of the difference between expert and normal readers. We discuss implications and interpretations ('what is inherited is DNA sequence variation'; 'the abnormal is normal'). Finally, although there is no necessary relationship between 'what is' and 'what could be', the most far-reaching issues about the acquisition of expertise lie at the interface between them ('the nature of nurture: from a passive model of imposed environments to an active model of shaped experience'). PMID:24948844

Plomin, Robert; Shakeshaft, Nicholas G; McMillan, Andrew; Trzaskowski, Maciej

2014-07-01

328

Natural family planning.  

PubMed

It is now well accepted that a woman can conceive from an act of intercourse for a maximum of only about 7 days of her menstrual cycle. The reliability of natural family planning depends on identifying this window of fertility without ambiguity. Several symptomatic markers, cervical mucus and basal body temperature, have been used extensively and with considerable success in most women but failures occur. Ovarian and pituitary hormone production show characteristic patterns during the cycle. Urinary estrogen and pregnanediol measurements yield reliable information concerning the beginning, peak, and end of the fertile period, provided that the assays are accurate and performed on timed specimens of urine. We have developed such enzyme immunoassays for urinary estrogen and pregnanediol glucuronides that can be performed at home. In the early versions of the assays, enzyme reaction rates were measured by eye, but more recently, a simple photoelectronic rate meter has been used. The final problem to be solved is not technologic but whether women are sufficiently motivated to expend the same time and effort each day for 10 days a month, with less cost, on fertility awareness as they spend on making a cup of tea. PMID:3314524

Brown, J B; Blackwell, L F; Billings, J J; Conway, B; Cox, R I; Garrett, G; Holmes, J; Smith, M A

1987-10-01

329

Nature's Autonomous Oscillators  

NASA Technical Reports Server (NTRS)

Nonlinearity is required to produce autonomous oscillations without external time dependent source, and an example is the pendulum clock. The escapement mechanism of the clock imparts an impulse for each swing direction, which keeps the pendulum oscillating at the resonance frequency. Among nature's observed autonomous oscillators, examples are the quasi-biennial oscillation and bimonthly oscillation of the Earth atmosphere, and the 22-year solar oscillation. The oscillations have been simulated in numerical models without external time dependent source, and in Section 2 we summarize the results. Specifically, we shall discuss the nonlinearities that are involved in generating the oscillations, and the processes that produce the periodicities. In biology, insects have flight muscles, which function autonomously with wing frequencies that far exceed the animals' neural capacity; Stretch-activation of muscle contraction is the mechanism that produces the high frequency oscillation of insect flight, discussed in Section 3. The same mechanism is also invoked to explain the functioning of the cardiac muscle. In Section 4, we present a tutorial review of the cardio-vascular system, heart anatomy, and muscle cell physiology, leading up to Starling's Law of the Heart, which supports our notion that the human heart is also a nonlinear oscillator. In Section 5, we offer a broad perspective of the tenuous links between the fluid dynamical oscillators and the human heart physiology.

Mayr, H. G.; Yee, J.-H.; Mayr, M.; Schnetzler, R.

2012-01-01

330

Natural gas purchases  

SciTech Connect

In the 1970`s gas and boilers were like oil and water as far as policy makers were concerned, culminating in the Powerplant and Industrial Fuel Use Act (perhaps a more appropriate title would have been the Fuel Non-Use Act or the Gas Non-Use Act). But now, the last two Administrations have made gas the centerpiece of their energy and environmental strategies, including promotion of gas use for boilers and electric generation. The FERC`s Order 636 almost completes the Commission`s restructuring of the gas industry that began with Order 380 (eliminating commodity minimum bills) and progressed sharply with Orders 436 and 500. It is Order 636 that has transformed the interstate pipeline business into a transportation business, with the pipelines virtually out of the merchant business altogether because the Commission is not resting on its laurels after completing implementation of Order 636. Rather, it is exploring new ways to expand the growing competitive market for gas, including the possibility of using market-based rates for interstate pipeline transportation services. Methods for the procurement of natural gas supplies are discussed.

Grenier, E.J. Jr. [Partner, Sutherland, Asbill and Brennan, Washington, DC (United States)

1995-09-01

331

Nature of Human Error  

PubMed Central

Background: As the attitude to adverse events has changed from the defensive “blame and shame culture” to an open and transparent healthcare delivery system, it is timely to examine the nature of human errors and their impact on the quality of surgical health care. Methods: The approach of the review is generic rather than specific, and the account is based on the published psychologic and medical literature on the subject. Conclusions: Rather than detailing the various “surgical errors,” the concept of error categories within the surgical setting committed by surgeons as front-line operators is discussed. The important components of safe surgical practice identified include organizational structure with strategic control of healthcare delivery, teamwork and leadership, evidence-based practice, proficiency, continued professional development of all staff, availability of wireless health information technology, and well-embedded incident reporting and adverse events disclosure systems. In our quest for the safest possible surgical health care, there is a need for prospective observational multidisciplinary (surgeons and human factors specialists) studies as distinct for retrospective reports of adverse events. There is also need for research to establish the ideal system architecture for anonymous reporting of near miss and no harm events in surgical practice. PMID:17060751

Cuschieri, Alfred

2006-01-01

332

A natural topological insulator.  

PubMed

The earth's crust and outer space are rich sources of technologically relevant materials which have found application in a wide range of fields. Well-established examples are diamond, one of the hardest known materials, or graphite as a suitable precursor of graphene. The ongoing drive to discover novel materials useful for (opto)electronic applications has recently drawn strong attention to topological insulators. Here, we report that Kawazulite, a mineral with the approximate composition Bi2(Te,Se)2(Se,S), represents a naturally occurring topological insulator whose electronic properties compete well with those of its synthetic counterparts. Kawazulite flakes with a thickness of a few tens of nanometers were prepared by mechanical exfoliation. They exhibit a low intrinsic bulk doping level and correspondingly a sizable mobility of surface state carriers of more than 1000 cm(2)/(V s) at low temperature. Based on these findings, further minerals which due to their minimized defect densities display even better electronic characteristics may be identified in the future. PMID:23438015

Gehring, P; Benia, H M; Weng, Y; Dinnebier, R; Ast, C R; Burghard, M; Kern, K

2013-03-13

333

Nature, nurture, and expertise  

PubMed Central

Rather than investigating the extent to which training can improve performance under experimental conditions (‘what could be’), we ask about the origins of expertise as it exists in the world (‘what is’). We used the twin method to investigate the genetic and environmental origins of exceptional performance in reading, a skill that is a major focus of educational training in the early school years. Selecting reading experts as the top 5% from a sample of 10,000 12-year-old twins assessed on a battery of reading tests, three findings stand out. First, we found that genetic factors account for more than half of the difference in performance between expert and normal readers. Second, our results suggest that reading expertise is the quantitative extreme of the same genetic and environmental factors that affect reading performance for normal readers. Third, growing up in the same family and attending the same schools account for less than a fifth of the difference between expert and normal readers. We discuss implications and interpretations (‘what is inherited is DNA sequence variation’; ‘the abnormal is normal’). Finally, although there is no necessary relationship between ‘what is’ and ‘what could be’, the most far-reaching issues about the acquisition of expertise lie at the interface between them (‘the nature of nurture: from a passive model of imposed environments to an active model of shaped experience’). PMID:24948844

Plomin, Robert; Shakeshaft, Nicholas G.; McMillan, Andrew; Trzaskowski, Maciej

2014-01-01

334

Natural gas monthly, February 1996  

SciTech Connect

The NGM highlights activities, events, and analyses of interest to public and private sector organizations associated with the natural gas industry. Volume and price data are presented each month for natural gas production, distribution, consumption, and interstate pipeline activities. Producer-related activities and underground storage data are also reported. From time to time, the NGM features articles designed to assist readers in using and interpreting natural gas information.

NONE

1996-03-01

335

Contaminant Removal From Natural Resources  

NASA Technical Reports Server (NTRS)

A zero-valent metal emulsion containing zero-valent metal particles is used to remediate contaminated natural resources, such as groundwater and soil. In a preferred embodiment, the zero-valent metal emulsion removes heavy metals, such as lead (pb), from contaminated natural resources. In another preferred embodiment, the zero-valent metal emulsion is a bimetallic emulsion containing zero-valent metal particles doped with a catalytic metal to remediate halogenated aromatic compounds, such as polychlorinated biphenyls (PCBs), from natural resources.

Clausen, Christian A. (Inventor); Quinn, Jacqueline W. (Inventor); Geiger, Cheri L. (Inventor); Reinhart, Debra (Inventor); Fillpek, Laura B. (Inventor); Coon, Christina (Inventor); Devor, Robert (Inventor)

2006-01-01

336

Natural gas monthly, October 1995  

SciTech Connect

The Natural Gas Monthly highlights activities, events, and analyses of interest to public and private sector organizations associated with the natural gas industry. Volume and price data are presented each month for natural gas production, distribution, consumption, and interstate pipeline activities. Producer-related activities and underground storage data are also reported. A glossary of the terms used in this report is provided to assist readers in understanding the data presented in this publication. 6 figs., 30 tabs.

NONE

1995-10-23

337

Natural selection maximizes Fisher information  

Microsoft Academic Search

In biology, information flows from the environment to the genome by the\\u000aprocess of natural selection. But it has not been clear precisely what sort of\\u000ainformation metric properly describes natural selection. Here, I show that\\u000aFisher information arises as the intrinsic metric of natural selection and\\u000aevolutionary dynamics. Maximizing the amount of Fisher information about the\\u000aenvironment captured by

Steven A. Frank

2009-01-01

338

Natural Products as Molecular Messengers*  

PubMed Central

The chemistry of naturally-occurring compounds has long been pursued in the search for medicines, dyes, pesticides, flavors, and fragrances. In addition, the deeper aim of understanding life itself as a chemical phenomenon has motivated generations of scientists. One consequence of such studies has been the realization that natural products often serve central roles as biological signaling agents. We consider natural products from the viewpoint of the organisms that produce and/or respond to them, and suggest how a naturally-occurring compound may acquire its role in chemical communication. PMID:21190370

Meinwald, Jerrold

2011-01-01

339

The Nature Conservancy--Saving North Carolina's Natural Treasures.  

ERIC Educational Resources Information Center

Discusses the North Carolina branch of The Nature Conservancy and its efforts to preserve natural areas Camping and Outdoor Education; University of North Carolina Damping and Outdoor Education; University of North Carolina at Greensboro; Pine Lake Field Campus; 4016 Blumenthal Road; Greensboro, NC, 27406. (AN)

Annand, Fred

1980-01-01

340

Natural Gas Regulation and Its Effect on Natural Gas Supply  

Microsoft Academic Search

Natural gas is an environmentally benign, domestically abundand, and competitively priced fossil fuel. Despite these advantages, natural gas consumption in the industrial and electric-generation sectors has fallen significantly over the past two decades. The primary obstruction has been a regulatory morass that has created an atmosphere not condusive to the investment decisions necessary to expand the market for producers, transporters,

Rob Tyson

1992-01-01

341

Super Natural II-a database of natural products.  

PubMed

Natural products play a significant role in drug discovery and development. Many topological pharmacophore patterns are common between natural products and commercial drugs. A better understanding of the specific physicochemical and structural features of natural products is important for corresponding drug development. Several encyclopedias of natural compounds have been composed, but the information remains scattered or not freely available. The first version of the Supernatural database containing ?50 000 compounds was published in 2006 to face these challenges. Here we present a new, updated and expanded version of natural product database, Super Natural II (http://bioinformatics.charite.de/supernatural), comprising ?326 000 molecules. It provides all corresponding 2D structures, the most important structural and physicochemical properties, the predicted toxicity class for ?170 000 compounds and the vendor information for the vast majority of compounds. The new version allows a template-based search for similar compounds as well as a search for compound names, vendors, specific physical properties or any substructures. Super Natural II also provides information about the pathways associated with synthesis and degradation of the natural products, as well as their mechanism of action with respect to structurally similar drugs and their target proteins. PMID:25300487

Banerjee, Priyanka; Erehman, Jevgeni; Gohlke, Björn-Oliver; Wilhelm, Thomas; Preissner, Robert; Dunkel, Mathias

2015-01-28

342

Nature Macmillan Publishers Ltd 1998 letters to nature  

E-print Network

. Continental breakup and the ordinal diversification of birds and mammals. Nature 381, 226­229 (1996). 3 in cichlid fishes of Lake Malawi. Nature 364, 330­334 (1993). 7. Schluter, D. Experimental evidence that competition promotes divergence in adaptive radiation. Science 266, 798­801 (1994). 8. Grant, P. R. Ecology

Newsome, William

343

Natural electromagnetic waveguide structures based on myelin sheath in the neural system  

E-print Network

The saltatory propagation of action potentials on myelinated axons is conventionally explained by the mechanism employing local circuit ionic current flows between nodes of Ranvier. Under this framework, the myelin sheath with up to 100 layers of membrane only serves as the insulating shell. The speed of action potentials is measured to be as fast as 100 m/s on myelinated axons, but ions move in fluids at just 100 nm/s in a 1 V/m electric field. We show here the action potentials, in the form of electromagnetic (EM) pulses, can propagate in natural EM waveguide structures formed by the myelin sheath merged in fluids. The propagation time is mainly cost on the duration for triggering EM pulses at nodes of Ranvier. The result clearly reveals the evolution of axons from the unmyelinated to the myelinated, which has remarkably enhanced the propagation efficiency by increasing the thickness of myelin sheath.

Jiongwei Xue; Shengyong Xu

2012-10-08

344

Natural Language Processing P@trik Haslum  

E-print Network

Natural Language Processing P@trik Haslum COMP3620/6320 #12;Introduction Linguistics & Natural & Historical Linguistics. * Semiotics. #12;Introduction Linguistics & Natural Language Processing Natural Language Processing Linguistics: The Study of Language Grammar * Morphology: Formation of words. * Syntax

Haslum, Patrik

345

[Natural family planning].  

PubMed

Natural family planning (NFP) is based on the knowledge *largely nonexistent) of a women as to whether she is in her fertile period or not. In contrast to the calendar method, the Billings method consists of observing bodily functions, whereby women learn about the fertile and infertile period during the menstrual cycle. This method is very safe as long as the woman has been instructed thoroughly. The Pearl index (the number of pregnancies/100 woman years) can be 1. In a Swedish province, 7/1000 population used this method and had an abortion rate of .5/1000, a fact contradicting the allegation of mass abortion as a result of the method. Only well-trained NFP instructors can teach women, and at the University of Umea such training has been available for some years. The biological basis of the Billings method rests on the fact that every release of an egg is preceded by a ripening process of a follicle in the ovary. This follicle secretes increasing amounts of estrogen which stimulates the cervix to produce secretions for the sperm. Right before ovulation, the follicle reduces estrogen production and noradrenaline takes over, stimulating the peak-day secretion (P-secretion) for further selection of sperm. Ovulation usually occurs on the peak day, which is the day of maximum fertility and the last day of mucous symptoms. For 3 days after peak day until menstruation, the risk of becoming pregnant diminishes successively until it is as low as after sterilization. The instructor is trained to recognize and overcome certain factors that make it more difficult to identify the mucous symptoms, such as the previous use of oral contraceptives, certain illnesses, drugs, and life styles. NFP can also be used for attaining pregnancy by identifying the peak day; women with premenstrual syndrome can calculate when their symptoms start, and sportswomen can predict the time of their menstruation. NFP is fascinating when it is compared to other methods because of its human dimension, and there is still a great deal to be learned about it. PMID:1618690

Odeblad, E

1992-06-01

346

Natural family planning.  

PubMed

In her contribution to the international seminar on "Natural Family Planning" organized in October by the Irish Department of Health in cooperation with the World Health Organization, Professor Judith Bardwick, professor of psychology at the University of Michigan, offered an explanation for the high dropout rate from contraceptive programs based on periodic abstinence and for the difference between method failure rates of as little as 1% and user failure rates as high as 30% or more. She argued that contraceptive methods which ask women to maintain a continuous observation of the symptoms of their menstrual cycles will draw the attention of the women continuously to the act of coitus. Yet, simultaneously, the use of these symptoms as a contraceptive means requires abstinence from coitus. Even Bardwick was unable to make very definite statements regarding contraception based on periodic abstinence because of the lack of available data. A primary benefit of the Irish seminar was the presentation of the preliminary results from a 5-center international study of the Billings Method (also known as the Ovulation Method or the Cervical Mucus Method). The study, supervised by the World Health Organization in Geneva, is being conducted in Auckland, Bangalore, Dublin, Manila, and San Miguel and involves 870 couples. Over 80% of the couples are Roman Catholic. Professor H.G. Burger reported findings from the first 3 months of the study. The method (which uses observation of both the quantity and quality of vaginal mucus to determine the time of ovulation) required an average of 15-18 days abstinence in each cycle with 11-15 days available for intercourse. 90.8% of the women were thought to have acquired a good understanding of the method after the 1st cycle and 97.1% after the 3rd cycle. The couples' motivation for using the method was "religious" in 40% of the cases and "unhappiness with other methods" in about 25%. During the 2704 cycles under observation, there were 45 pregnancies in 5.2% of the women. 2 of these were regarded as user failures. Method related failures ranged from 0.48 to 3.00 and user-related failures from 0.96 to 19.25. PMID:12263405

Nowland, D

1980-04-01

347

Cross section, Decay Rate, Phase Space, Amplitude Below, the natural unit h = c = 1 is used throughout.  

E-print Network

Cross section, Decay Rate, Phase Space, Amplitude Below, the natural unit ¯h = c = 1 is used dilation effect and the decay is corresondingly delayed: e-t/i with = E/M. Differential Cross Section (two in the center-of-momentum frame if m1 = m2. Cross section (number of the scattering events per unit luminosity

Murayama, Hitoshi

348

The greening of American naturalism  

Microsoft Academic Search

If we conceive of American naturalism as a literature about appetite and environment, then why have so few critical conversations about food, waste, water, and land emerged in connection with these early twentieth-century texts? Critics of American literary naturalism have long been preoccupied with hunger, framed almost entirely by a discussion about the animalistic appetites of socially determined human beings

Cara Elana Erdheim

2010-01-01

349

WRF Nature Run John Michalakes,  

E-print Network

WRF Nature Run John Michalakes, Josh Hacker, Richard Loft Michael O.McCracken, Allan Snavely, Nicho- las J. Wright Tom Spelce, Brent Gorda Robert Walkup {michalak, hacker, loft} @ucar.edu {mmcrack is a nature run that provides very high-resolution "truth" against which more coarse simulations

Snavely, Allan

350

BREAKTHROUGHS College of Natural Resources  

E-print Network

BREAKTHROUGHS ® College of Natural Resources A Magazine for Alumni and Friends of the College BREAKTHROUGHS ® EDITOR Kathryn Stelljes DEAN Richard Malkin DIRECTOR OF COLLEGE RELATIONS Rosemary Lucier. Breakthroughs is a registered trademark and is published for alumni and friends of the College of Natural

Wildermuth, Mary C

351

Experimental techniques in natural convection  

Microsoft Academic Search

Experimental techniques in natural convection heat transfer employed in the author's laboratory are introduced. The techniques are mostly related to visualization of flow, temperature field, and heat flux distribution in fluids. Three topics are presented, the first being natural convection in a horizontal rectangular liquid layer driven by surface tension and buoyancy. The patterns of flow were visualized by suspending

Ichiro Tanasawa

1995-01-01

352

Nondescriptionality and Natural Kind Terms.  

ERIC Educational Resources Information Center

English, and presumably any natural language, contains a small group of expressions referring to species of things found in nature. These species are defined by their internal structure, determined by genetics in the case of living things and by chemical or physical properties in the case of others. The reference of these terms is determined by…

Abbott, Barbara

353

Natural gas monthly, July 1990  

SciTech Connect

This report highlights activities, events, and analyses of interest to public and private sector organizations associated with the natural gas industry. Volume and price data are presented each month for natural gas production, distribution, consumption, and interstate pipeline activities. Producer-related activities and underground storage data are also reported. A glossary is included. 7 figs., 33 tabs.

Not Available

1990-10-03

354

Darwin's Second Idea Natural Selection  

E-print Network

Darwin's Second Idea ­ Natural Selection · Evolution: controversial? · Natural selection ­ Darwin's postulates ­ Controversial? ­ Two examples of NS #12;Charles Darwin Darwin's Ideas 1. Species evolve over time: "descent with modification" Pattern #12;Charles Darwin Darwin's Ideas 1. Species evolve over time

355

Backpocket: Activities for Nature Study.  

ERIC Educational Resources Information Center

Leading naturalist-teachers share outdoor learning activities and techniques, including using binoculars as magnifiers, scavenger hunts, games such as "what's it called" and "I spy," insect study, guessing the age of trees by examining the bark, leading bird walks, exploring nature in the community, and enhancing nature hikes with props. (LP)

Hendry, Ian; And Others

1995-01-01

356

Convolution Kernels for Natural Language  

Microsoft Academic Search

We describe the application of kernel methods to Natural Language Pro- cessing (NLP) problems. In many NLP tasks the objects being modeled are strings, trees, graphs or other discrete structures whi ch require some mechanism to convert them into feature vectors. We describe kernels for various natural language structures, allowing rich, high d imensional rep- resentations of these structures. We

Michael Collins; Nigel Duffy

2001-01-01

357

Generalized Compositions of Natural Numbers  

E-print Network

We consider compositions of natural numbers when there are different types of each natural number. Several recursions as well as some closed formulas for the number of compositions is derived. We also find its relationships with some known classes of integers such as Fibonacci, Catalan, Pell, Pell-Lucas, and Jacobsthal numbers.

Janjic, Milan

2010-01-01

358

Natural Gas Imports and Exports  

EIA Publications

In the face of unprecedented levels of domestic natural gas production, net imports of natural gas into the United States fell 23% in 2012. A combination of both higher exports and lower imports led to a decline in net imports. In 2012, total imports decreased by 10% to 3,135 Bcf, while total exports increased by 8% to 1,619 Bcf.

2013-01-01

359

Illinois Birds. Nature Discovery I.  

ERIC Educational Resources Information Center

The birds of Illinois and their particular habitats are explored in this guide which is a part of a series of Nature Discovery publications. The materials are designed to directly supplement the natural science curricula and to complement other subject areas including social studies, language arts, music, and art. The program is formated for…

Stone, Sally F.

360

Discovering Nature with Young Children.  

ERIC Educational Resources Information Center

Young children's curiosity about nature and their need to make sense of the world presents an opportunity to incorporate science as a natural and critical part of children's early learning. This guide, part of a preschool science curriculum, uses an inquiry approach to encourage young naturalists to observe life more closely, build an…

Chalufour, Ingrid; Worth, Karen

361

Natural gas monthly, August 1990  

SciTech Connect

This report highlights activities, events, and analyses of interest to public and private sector oganizations associated with the natural gas industry. Volume and price data are presented each month for natural gas production, distribution, consumption, and interstate pipeline activities. Producer-related activities and underground storage data are also reported. 33 tabs.

Not Available

1990-11-05

362

Natural-draft Cooling Tower  

USGS Multimedia Gallery

Natural-draft cooling towers and one of two intake screens and associated pumps for the Tennessee Valley Authority, Sequoyah Nuclear Power Plant, Tennessee. Natural-draft tower airflow is drawn through the packing or fill (distributed at the base) by means of the small density difference between the...

363

Climate Change: Prospects for Nature  

SciTech Connect

Thomas Lovejoy, President of The H. John Heinz III Center for Science, Economics and the Environment, explores the impact of climate change on the natural world. He also discusses the implications of climate change for climate policy and natural resource management.

Thomas Lovejoy

2008-03-12

364

The Norwegian Nature Life Approach.  

ERIC Educational Resources Information Center

Briefly introduces the Norwegian Seminar for Nature Life with a discussion of the course methods, values, and attitudes as related to Norwegian culture. Explains the difference between this and other programs that use nature for experiential education, and addresses the need for creativity in experiential education. (SB)

Pendleton, Sarah

1983-01-01

365

Natural gas monthly, December 1996  

SciTech Connect

This document highlights activities, events, and analysis of interest to the public and private sector associated with the natural gas industry. Volume and price data are presented each month for natural gas production, distribution, consumption, and interstate pipeline activities. Producer-related activities and underground storage data are also included.

NONE

1996-12-01

366

Efeito do consumo de suco de cranberry de baixa caloria sobre fatores de risco cardiovascular em indivíduos com síndrome metabólica.  

E-print Network

??A Síndrome Metabólica (SM) é um transtorno patológico complexo que inclui resistência à insulina, hipertensão arterial, adiposidade visceral e dislipidemia, aumentando o risco de desenvolvimento… (more)

Tathiana Name Colado Simão

2012-01-01

367

Natural gas monthly - January 1996  

SciTech Connect

This highlight discusses changes in natural gas supply, demand, and prices for the first three quarters of 1995 (January thru September) compared to the same periods in 1993 and 1994. Production for the first three quarters of 1995 lagged year-earlier levels while natural gas consumption has continued a steady upward movement. Total U.S. natural gas production through the first three quarters at 14.1 trillion cubic feet, was less than 1 percent below the 1994 period, but remained well ahead of the comparable 1993 period. The three leading producing States (Texas, Louisiana, and Oklahoma) contributed nearly 70 percent of the total. Natural gas consumption totaled 16.0 trillion cubic feet for the first three quarters, 4 percent above the same period in 1994. Net imports of natural gas reached 2.0 trillion cubic feet by the end of the third quarter 1995 and accounted for nearly 13 percent of total consumption during this period.

NONE

1996-01-01

368

Natural gas monthly, October 1991  

SciTech Connect

The Natural Gas Monthly (NGM) is prepared in the Data Operations Branch of the Reserves and Natural Gas Division, Office of Oil and Gas, Energy Information Administration (EIA), US Department of Energy (DOE). The NGM highlights activities, events, and analyses of interest to public and private sector organizations associated with the natural gas industry. Volume and price data are presented each month for natural gas production, distribution, consumption, and interstate pipeline activities. Producer-related activities and underground storage data are also reported. The data in this publication are collected on surveys conducted by the EIA to fulfill its responsibilities for gathering and reporting energy data. Some of the data are collected under the authority of the Federal Energy Regulatory Commission (FERC), an independent commission within the DOE, which has jurisdiction primarily in the regulation of electric utilities and the interstate natural gas industry. Geographic coverage is the 50 States and the District of Columbia. 16 figs., 33 tabs.

Not Available

1991-11-05

369

ISSN 0103-9741 Monografias em Cincia da Computao  

E-print Network

.3 Desenvolvimento de Software Orientado a Aspectos . . . . . . . . . . . . . . 2 2.4 Aspect especíco da NASA e que faz parte de um dos trabalhos aqui relaciona- dos. Contudo foram exploradas-PLs, allowing runtime product derivation. As a Case- Study, it has been reused NASA Projects for ANTs

Endler, Markus

370

www.nature.com/reviews Leadingthe field  

E-print Network

* Nature Reviews Nephrology* Nature Reviews Neurology* Nature Reviews Rheumatology* Nature Reviews Urology in RA and SpA Characteristics and treatment RHEUMATOLOGY nrrheum_OFC_JUL13.indd 1 17/06/2013 16. www.nature.com/reviews/neurol Nature Reviews Rheumatology Chief Editor: Jenny Buckland, PhD Impact

Cai, Long

371

www.nature.com/reviews Leadingthe field  

E-print Network

* Nature Reviews Nephrology* Nature Reviews Neurology* Nature Reviews Rheumatology* Nature Reviews Urology to classification, ANCA detection and trial design focus Vasculitis RHEUMATOLOGY nrrheum_OFC_AUG14.indd 1 15. www.nature.com/reviews/neurol Nature Reviews Rheumatology Chief Editor: Jenny Buckland, PhD Impact

Cai, Long

372

International Year of Natural Fibres  

NSDL National Science Digital Library

The United Nations Food and Agriculture Organization has designated 2009 as the International Year of Natural Fibres. The goals of this year are three-fold: to raise the profile of natural fibers in a market increasingly dominated by synthetic fibers; convey the value of using natural fibers to consumers; and help sustain the income of the often poor farmers of natural fibers. This very interesting website for the "Year" is available in English, French, Chinese and Spanish. Visitors interested in learning about the history of natural fibers, as well as what different types of natural fibers there are, what they look like, and what they are used for, will find this website fits the bill. On the menu on the far right side of the page, visitors can click on the link "15 Natural Fibres" to peruse a brief history and learn about the different natural fibers that come from plants and animals. Most of the fibers featured include information on what the fiber is, who produces it, how it's produced, and how much is produced, which can be accessed by rolling the mouse over the name or picture of the fiber, and clicking. The link on the menu on the far right side of the page entitled "Fibre Stories" has four stories about new innovations for several different natural fibers. There is a story about cotton in Asia, hemp in China, alpaca in Peru, and sisal in Tanzania. Events around the world celebrating the International Year of Natural Fibres can be found on the far right menu, at the "Events" link.

373

School Budget Hold'em Facilitator's Guide  

ERIC Educational Resources Information Center

"School Budget Hold'em" is a game designed to help school districts rethink their budgeting process. It evolved out of Education Resource Strategies' (ERS) experience working with large urban districts around the country. "School Budget Hold'em" offers a completely new approach--one that can turn the budgeting process into a long-term visioning…

Education Resource Strategies, 2012

2012-01-01

374

Fully distributed EM for very large datasets  

Microsoft Academic Search

In EM and related algorithms, E-step compu- tations distribute easily, because data items are independent given parameters. For very large data sets, however, even storing all of the parameters in a single node for the M- step can be impractical. We present a frame- work that fully distributes the entire EM pro- cedure. Each node interacts only with pa- rameters

Jason Wolfe; Aria Haghighi; Dan Klein

2008-01-01

375

LANSIM and its applications to distributed EMS  

SciTech Connect

Distributed energy management systems (EMS) open up a host of alternative design options. Simulation plays an important role in evaluating performance and in comparing alternative designs. Currently all the proposed distributed EMSs are local area network (LAN)-based. To illustrate the application of LANSIM, comparisons are made with different distributed EMS configurations, different LAN technologies (Ethernet and FDDI), and different Ethernet implementations.

Lun, S.M.; Lo, T.; Wu, F.; Murphy, L. [Univ. of California, Berkeley, CA (United States). Dept. of Electrical Engineering and Computer Sciences; Sen, A. [ABB Systems Control, Santa Clara, CA (USD)

1996-08-01

376

Em que medida devem ser privados, em que medida devem ser pblicos o conhecimento e a informao?  

E-print Network

Em que medida devem ser privados, em que medida devem ser públicos o conhecimento e a informação? 1 Transparências com licença Creative Commons Em que medida devem ser privados, em que medida devem ser públicos o as alternativas? codexKonstanz #12;Em que medida devem ser privados, em que medida devem ser públicos o

Kuhlen, Rainer

377

Natural gas pipeline technology overview.  

SciTech Connect

The United States relies on natural gas for one-quarter of its energy needs. In 2001 alone, the nation consumed 21.5 trillion cubic feet of natural gas. A large portion of natural gas pipeline capacity within the United States is directed from major production areas in Texas and Louisiana, Wyoming, and other states to markets in the western, eastern, and midwestern regions of the country. In the past 10 years, increasing levels of gas from Canada have also been brought into these markets (EIA 2007). The United States has several major natural gas production basins and an extensive natural gas pipeline network, with almost 95% of U.S. natural gas imports coming from Canada. At present, the gas pipeline infrastructure is more developed between Canada and the United States than between Mexico and the United States. Gas flows from Canada to the United States through several major pipelines feeding U.S. markets in the Midwest, Northeast, Pacific Northwest, and California. Some key examples are the Alliance Pipeline, the Northern Border Pipeline, the Maritimes & Northeast Pipeline, the TransCanada Pipeline System, and Westcoast Energy pipelines. Major connections join Texas and northeastern Mexico, with additional connections to Arizona and between California and Baja California, Mexico (INGAA 2007). Of the natural gas consumed in the United States, 85% is produced domestically. Figure 1.1-1 shows the complex North American natural gas network. The pipeline transmission system--the 'interstate highway' for natural gas--consists of 180,000 miles of high-strength steel pipe varying in diameter, normally between 30 and 36 inches in diameter. The primary function of the transmission pipeline company is to move huge amounts of natural gas thousands of miles from producing regions to local natural gas utility delivery points. These delivery points, called 'city gate stations', are usually owned by distribution companies, although some are owned by transmission companies. Compressor stations at required distances boost the pressure that is lost through friction as the gas moves through the steel pipes (EPA 2000). The natural gas system is generally described in terms of production, processing and purification, transmission and storage, and distribution (NaturalGas.org 2004b). Figure 1.1-2 shows a schematic of the system through transmission. This report focuses on the transmission pipeline, compressor stations, and city gates.

Folga, S. M.; Decision and Information Sciences

2007-11-01

378

letters to nature NATURE |VOL 408 |7 DECEMBER 2000 |www.nature.com 701  

E-print Network

, the Jurassic/Cretaceous icehouse. Consid- ering the similarity of faunal assemblages, in our case brachiopods temperature derived from coral records. Nature 385, 705±707 (1997). 14. CLIMAP Project Members Map and Chart climates from high-latitude ice-rafting in the Cretaceous. Nature 333, 547±549 (1988). 23. Harland, W. B

Demouchy, Sylvie

379

Theory and detection scheme of seismic EM signals transferred into the atmosphere from the oceanic and continental lithosphere  

NASA Astrophysics Data System (ADS)

Due to the compound structure of the medium and large portions of energy transferred, a seismic excitation in the oceanic or continental lithosphere disturbs all types of geophysical fields. To investigate the problem of electromagnetic (EM) disturbances in the atmosphere from the seismically activated lithosphere, we have formulated two mathematical models of interaction of fields of different physical nature resulting in arising of the low-frequency (from 0.1 to 10 Hz by amplitude of a few hundreds of pT) EM signals in the atmosphere. First we have considered the EM field generation in the moving oceanic lithosphere and then in the moving continental one. For both cases, the main physical principles and geological data were applied for formulation of the model and characteristics of the computed signals of different nature agree with measurements of other authors. On the basis of the 2D model of the seismo-hydro-EM-temperature interaction in the lithosphere-Ocean-atmosphere domain, a block-scheme of a multisensory vertically distributed (from a seafloor up to the ionosphere) tsunami precursors' detection system is described. On the basis of the 3D model of the seismo-EM interaction in a lithosphere-atmosphere domain, we explain why Prof. Kopytenko (Inst. IZMIRAN of Russian Acad. Sci.) and co-authors were able to estimate location of the future seismic epicenter area from their magnetic field measurements in the atmosphere near the earth's surface.

Novik, Oleg; Ershov, Sergey; Ruzhin, Yuri; Smirnov, Fedor; Volgin, Maxim

2014-07-01

380

Natural gas monthly, February 1998  

SciTech Connect

This issue of the Natural Gas Monthly (NGM) presents the most recent estimates of natural gas data from the Energy Information Administration. Estimates extend through February 1998 for many data series, and through November 1997 for most natural gas prices. Highlights of the natural gas data contained in this issue are: Preliminary estimates for January and February 1998 show that dry natural gas production, net imports, and consumption are all within 1 percent of their levels in 1997. Warmer-than-normal weather in recent months has resulted in lower consumption of natural gas by the residential sector and lower net withdrawals of gas from under round storage facilities compared with a year ago. This has resulted in an estimate of the amount of working gas in storage at the end of February 1998 that is 18 percent higher than in February 1997. The national average natural gas wellhead price is estimated to be $3.05 per thousand cubic feet in November 1997, 7 percent higher than in October. The cumulative average wellhead price for January through November 1997 is estimated to be $2.42 per thousand cubic feet, 17 percent above that of the same period in 1996. This price increase is far less than 36-percent rise that occurred between 1995 and 1996. 6 figs., 26 tabs.

NONE

1998-02-01

381

Nature's Trust: A Paradigm for Natural Resources Stewardship  

NASA Astrophysics Data System (ADS)

Climate change uncertainty puts a premium on all remaining natural resources. Farmland, air, water, wetlands, wildlife, soils, mineral resources and forests must be protected to ensure that Americans - present citizens and future generations - have the fundamental survival resources they need in a future that holds many unknowns. Moreover, in light of the need to manage resources given climate and particle forcing, government must mitigate dangerous carbon loading of the atmosphere. Confronting climate change and protecting natural resources requires a clear sense of government obligation that is inherent to sovereignty, not a matter of political choice. Our government representatives can and must reframe government's discretion into a trustee obligation to protect Nature and ensure natural resource stewardship. Drawing upon enduring legal principles and court decisions, government can be characterized as a trustee of the natural resources essential to human survival. A trust is a fundamental type of ownership whereby one manages property for the benefit of another. Viewed as a trust, the environment consists of a portfolio of quantified natural assets that government manages. As beneficiaries, citizens hold a common property interest in defined, bounded assets that make up Nature's Trust. Such trust principles form the bedrock of statutory law. Trustees have a fiduciary obligation to protect trust assets and may not allow destruction of property they manage. This session will provide a policy frame for current scientific efforts to address climate change and natural resources loss. Under the Nature's Trust frame, U.S. government leaders and agencies at every level inherit a strict fiduciary obligation to protect our collective natural resources, including our water and the atmosphere, as assets in the trust. Their fiduciary standard of care consists of a proportionate responsibility, which ties directly to "Nature's Mandate" as defined by current climate scientists: each jurisdiction must cap and begin reducing total GHG emissions within the decade and continue reduction until they reach 80% below 1990 levels by 2050. The trust framework positions all nations of the world in a logical relationship that can guide international diplomacy. The atmosphere, oceans and the global hydrologic cycle are commonly held assets shared as property among all nations on Earth. Thus, all Nations are sovereign co-tenant trustees, each holding the fiduciary responsibility to not degrade the common asset and to accomplish proportionate carbon reduction.

Wood, M. C.; Whitelaw, E.; Doppelt, B.; Burchell, A.

2007-12-01

382

New Methods for Assessing the Fascinating Nature of Nature Experiences  

PubMed Central

In recent years, numerous environmental psychology studies have demonstrated that contact with nature as opposed to urban settings can improve an individual’s mood, can lead to increased levels of vitality, and can offer an opportunity to recover from stress. According to Attention Restoration Theory (ART) the restorative potential of natural environments is situated in the fact that nature can replenish depleted attentional resources. This replenishment takes place, in part, because nature is deemed to be a source of fascination, with fascination being described as having an “attentional”, an “affective” and an “effort” dimension. However, the claim that fascination with nature involves these three dimensions is to a large extent based on intuition or derived from introspection-based measurement methods, such as self-reports. In three studies, we aimed to more objectively assess whether these three dimensions indeed applied to experiences related to natural environments, before any (attentional) depletion has taken place. The instruments that were used were: (a) the affect misattribution procedure (Study 1), (b) the dot probe paradigm (Study 2) and (c) a cognitively effortful task (Study 3). These instrument were respectively aimed at verifying the affective, attentional and effort dimension of fascination. Overall, the results provide objective evidence for the claims made within the ART framework, that natural as opposed to urban settings are affectively positive (cfr., affective dimension) and that people have an attentional bias to natural (rather than urban) environments (cfr., attentional dimension). The results regarding the effort dimension are less straightforward, and suggest that this dimension only becomes important in sufficiently difficult cognitive tasks. PMID:23922645

Joye, Yannick; Pals, Roos; Steg, Linda; Evans, Ben Lewis

2013-01-01

383

New methods for assessing the fascinating nature of nature experiences.  

PubMed

In recent years, numerous environmental psychology studies have demonstrated that contact with nature as opposed to urban settings can improve an individual's mood, can lead to increased levels of vitality, and can offer an opportunity to recover from stress. According to Attention Restoration Theory (ART) the restorative potential of natural environments is situated in the fact that nature can replenish depleted attentional resources. This replenishment takes place, in part, because nature is deemed to be a source of fascination, with fascination being described as having an "attentional", an "affective" and an "effort" dimension. However, the claim that fascination with nature involves these three dimensions is to a large extent based on intuition or derived from introspection-based measurement methods, such as self-reports. In three studies, we aimed to more objectively assess whether these three dimensions indeed applied to experiences related to natural environments, before any (attentional) depletion has taken place. The instruments that were used were: (a) the affect misattribution procedure (Study 1), (b) the dot probe paradigm (Study 2) and (c) a cognitively effortful task (Study 3). These instrument were respectively aimed at verifying the affective, attentional and effort dimension of fascination. Overall, the results provide objective evidence for the claims made within the ART framework, that natural as opposed to urban settings are affectively positive (cfr., affective dimension) and that people have an attentional bias to natural (rather than urban) environments (cfr., attentional dimension). The results regarding the effort dimension are less straightforward, and suggest that this dimension only becomes important in sufficiently difficult cognitive tasks. PMID:23922645

Joye, Yannick; Pals, Roos; Steg, Linda; Evans, Ben Lewis

2013-01-01

384

Darwin's explanation of design: from natural theology to natural selection.  

PubMed

Copernicus, Galileo, Newton and other physical scientists ushered in a conception of the universe as matter in motion governed by natural laws. Their discoveries brought about a fundamental revolution, namely a commitment to the postulate that the universe obeys immanent laws that can account for natural phenomena. The workings of the universe were brought into the realm of science: explanation through natural laws. Darwin completed the Copernican revolution by extending it to the living world. Darwin demonstrated the evolution of organisms. More important yet is that he discovered natural selection, the process that explains the "design" of organisms. The adaptations and diversity of organisms, the origin of novel and complex species, even the origin of mankind, could now be explained by an orderly process of change governed by natural laws. The origin of species and the exquisite features of organisms had previously been explained as special creations of an Omniscient God. Darwin brought them into the domain of science. Evolution is a creative process that produces genuine novelty. The creative power of evolution arises from a distinctive interaction between chance and necessity, between random mutation and natural selection. PMID:19800418

Ayala, Francisco J

2010-08-01

385

Natural Fiber Composites: A Review  

SciTech Connect

The need for renewable fiber reinforced composites has never been as prevalent as it currently is. Natural fibers offer both cost savings and a reduction in density when compared to glass fibers. Though the strength of natural fibers is not as great as glass, the specific properties are comparable. Currently natural fiber composites have two issues that need to be addressed: resin compatibility and water absorption. The following preliminary research has investigated the use of Kenaf, Hibiscus cannabinus, as a possible glass replacement in fiber reinforced composites.

Westman, Matthew P.; Fifield, Leonard S.; Simmons, Kevin L.; Laddha, Sachin; Kafentzis, Tyler A.

2010-03-07

386

Natural carbon nanofibers in graphite  

NASA Astrophysics Data System (ADS)

Natural carbon nanofibers have been found in diamond-bearing carbonatites from the Chagatay trachyte-carbonatite complex (Uzbekistan) and described using a series of methods, including SEM, TEM, and Raman spectroscopy. The carbon nanofibers occur as tight aggregates within the host graphite, forming natural bulk nano-structural intergrowths. This is the first description of such carbon nanofibers either in nature or in the laboratory. The data from this study suggest a new possible means of diamond formation. These carbon intergrowths could potentially be used as a model for the fabrication of new types of carbon nanostructural material.

Shumilova, Tatyana Grygoryevna; Isaenko, Sergey Ivanovich; Divaev, Farid Karibovich; Akai, Junji

2012-03-01

387

Natural time analysis of critical phenomena: The case of pre-fracture electromagnetic emissions  

SciTech Connect

Criticality of complex systems reveals itself in various ways. One way to monitor a system at critical state is to analyze its observable manifestations using the recently introduced method of natural time. Pre-fracture electromagnetic (EM) emissions, in agreement to laboratory experiments, have been consistently detected in the MHz band prior to significant earthquakes. It has been proposed that these emissions stem from the fracture of the heterogeneous materials surrounding the strong entities (asperities) distributed along the fault, preventing the relative slipping. It has also been proposed that the fracture of heterogeneous material could be described in analogy to the critical phase transitions in statistical physics. In this work, the natural time analysis is for the first time applied to the pre-fracture MHz EM signals revealing their critical nature. Seismicity and pre-fracture EM emissions should be two sides of the same coin concerning the earthquake generation process. Therefore, we also examine the corresponding foreshock seismic activity, as another manifestation of the same complex system at critical state. We conclude that the foreshock seismicity data present criticality features as well.

Potirakis, S. M. [Department of Electronics, Technological Education Institute (TEI) of Piraeus, 250 Thivon and P. Ralli, Aigaleo, Athens GR-12244 (Greece)] [Department of Electronics, Technological Education Institute (TEI) of Piraeus, 250 Thivon and P. Ralli, Aigaleo, Athens GR-12244 (Greece); Karadimitrakis, A. [Department of Physics, Section of Electronics, Computers, Telecommunications and Control, University of Athens, Panepistimiopolis, Zografos, Athens GR-15784 (Greece)] [Department of Physics, Section of Electronics, Computers, Telecommunications and Control, University of Athens, Panepistimiopolis, Zografos, Athens GR-15784 (Greece); Eftaxias, K. [Department of Physics, Section of Solid State Physics, University of Athens, Panepistimiopolis, Zografos, Athens GR-15784 (Greece)] [Department of Physics, Section of Solid State Physics, University of Athens, Panepistimiopolis, Zografos, Athens GR-15784 (Greece)

2013-06-15

388

Charles Darwin II: Natural selection  

NSDL National Science Digital Library

This is the second in a series of modules which detail the research of Charles Darwin and evolutionary theory. This module continues with a discussion of the processes that led to Darwin's formulation of the theory of natural selection.

Alfred Rosenberger

2004-02-12

389

Toward understanding natural language directions  

E-print Network

Speaking using unconstrained natural language is an intuitive and flexible way for humans to interact with robots. Understanding this kind of linguistic input is challenging because diverse words and phrases must be mapped ...

Kollar, Thomas Fleming

390

Breastfeeding Following a Natural Disaster  

MedlinePLUS

... or visit us online at: www.OTISpregnancy.org . Breastfeeding Following a Natural Disaster The information below will ... advice from your health care provider. Why is breastfeeding good for my baby? There are many benefits ...

391

Natural Gas Monthly August 1998  

SciTech Connect

The Natural Gas Monthly (NGM) highlights activities, events, and analyses of interest to public and private sector organizations associated with the natural gas industry. Volume and price data are presented each month for natural gas production, distribution, consumption, and interstate pipeline activities. Producer-related activities and underground storage data are also reported. From time to time, the NGM features articles designed to assist readers in using and interpreting natural gas information. Explanatory notes supplement the information found in tables of the report. A description of the data collection surveys that support the NGM is provided. A glossary of the terms used in this report is also provided to assist readers in understanding the data presented in this publication.

NONE

1998-08-01

392

SUSTAINABILITY REPORTING NATURAL RESOURCES DEFENSE  

E-print Network

SUSTAINABILITY REPORTING AND THE NATURAL RESOURCES DEFENSE COUNCIL AUGUST 2012 Capstone Team RELEVANCE/CONTEXT 4 HISTORY OF SUSTAINABILITY REPORTING 4 ORGANIZATIONAL PROFILE 7 METHODOLOGY 8 FINDINGS AND DISCUSSION 11 FINDINGS FROM INTERVIEWS 11 SUSTAINABILITY FRAMEWORK ASSESSMENT 12

Qian, Ning

393

estry & Natural Resour PURDUE UNIVERSITY  

E-print Network

, Department of Forestry and Natural Resources, Purdue University A Landowner's Guide to Sustainable Forestry banana," is finding its way into ice cream shops, bakeries, and on to the menu of 4-star hotels. Pawpaw

394

Case Studies in Natural SystemsCase Studies in Natural Systems Lessons from NatureLessons from Nature  

E-print Network

Nature Robert K.Robert K. PeetPeet #12;Robert K.Robert K. PeetPeet BA: University of Wisconsin 1970 MS;Cowles Lamark Clements Tansley Gleason Whittaker Davis Forbes Spencer Darwin Curtis Structure of Pant

Jodice, Patrick

395

Natural Radionuclides in Ground Water.  

ERIC Educational Resources Information Center

Described are the natural trace radionuclides in ground water. Indicates the geologic origin of these radionuclides. Discusses the importance of these radionuclides. Suggests future uses of a number of additional radionuclides. (CW)

Davis, Stanley N.

1988-01-01

396

Natural laws and human prediction  

Microsoft Academic Search

Interrelations between dynamical and statistical laws in physics, on the one hand, and between classical and quantum mechanics,\\u000a on the other hand, are discussed within the philosophy of separating the natural from the human, as a very specific part of\\u000a Nature, and with emphasis on the new phenomenon of dynamical chaos.\\u000a \\u000a The principal results of the studies of chaos in

B. Chirikov

1996-01-01

397

More about natural family planning.  

PubMed

When properly taught and practised, natural family planning can be a highly effective form of birth regulation. Recent studies indicate low failure rates of less than three pregnancies per 100 women years for couples with a strong motivation to follow the method. Studies show that pregnancy rates are high when the rules for avoiding pregnancy are not adhered to. Successful natural family planning can lead to heightened self esteem and marital enrichment. PMID:6667188

Gallagher, J

1983-11-01

398

Investigating Natural Selection: Elementary School  

NSDL National Science Digital Library

This lesson plan is designed for fourth and fifth grade students learning about natural selection. The class will investigate the predator-prey relationship as an example of how natural selection occurs in a population. Students will work in groups of three or four and observe how predators select their prey, and how this affects the subsequent populations of a species. The concept of camouflage is also covered in the material. This lesson is designed to take about sixty minutes of class time.

2010-01-01

399

Perspective on completing natural inflation  

NASA Astrophysics Data System (ADS)

We present a perspective on the inflation paths in 2-, 3-,,, N-flation models based on the ultraviolet completion in heterotic string theory, where a number of grand unification scale axions are used. The number of non-Abelian gauge groups for a natural inflation is restricted in string compactification, and we argue that the most plausible completion of natural inflation from a theory perspective is the 2-flation.

Choi, Ki-Young; Kim, Jihn E.; Kyae, Bumseok

2015-01-01

400

Nature Web Focus: Ocean Genomics  

NSDL National Science Digital Library

The August 28, 2003 issue of the journal Nature presented a collection of reports that, "along with other analysis of key components of the ocean's food web, highlights the significance of genome sequences from the sea." This Web Focus provides access to these reports free of charge to any reader. The reports focus particularly on marine phytoplankton. The site also includes links to related articles from the Nature archives, but viewing these reports requires a paid subscription.

2003-01-01

401

TRP modulation by natural compounds.  

PubMed

The use of medicinal plants or other naturally derived products to relieve illness can be traced back over several millennia, and these natural products are still extensively used nowadays. Studies on natural products have, over the years, enormously contributed to the development of therapeutic drugs used in modern medicine. By means of the use of these substances as selective agonists, antagonists, enzyme inhibitors or activators, it has been possible to understand the complex function of many relevant targets. For instance, in an attempt to understand how pepper species evoke hot and painful actions, the pungent and active constituent capsaicin (from Capsicum sp.) was isolated in 1846 and the receptor for the biological actions of capsaicin was cloned in 1997, which is now known as TRPV1 (transient receptor potential vanilloid 1). Thus, TRPV1 agonists and antagonists have currently been tested in order to find new drug classes to treat different disorders. Indeed, the transient receptor potential (TRP) proteins are targets for several natural compounds, and antagonists of TRPs have been synthesised based on the knowledge of naturally derived products. In this context, this chapter focuses on naturally derived compounds (from plants and animals) that are reported to be able to modulate TRP channels. To clarify and make the understanding of the modulatory effects of natural compounds on TRPs easier, this chapter is divided into groups according to TRP subfamilies: TRPV (TRP vanilloid), TRPA (TRP ankyrin), TRPM (TRP melastatin), TRPC (TRP canonical) and TRPP (TRP polycystin). A general overview on the naturally derived compounds that modulate TRPs is depicted in Table 1. PMID:24961985

Meotti, Flavia Carla; Lemos de Andrade, Edinéia; Calixto, João B

2014-01-01

402

Nitrogen\\/oxygen permeability of natural rubber, epoxidised natural rubber and natural rubber\\/epoxidised natural rubber blends  

Microsoft Academic Search

Pure gas transport properties of natural rubber (NR), epoxidised natural rubber (ENR) and their blends have been determined. The permeabilities of the pure polymers and blends were determined with nitrogen and oxygen. The relation between oxygen-to-nitrogen selectivity and the glass transition temperature has been studied. NR is more permeable to nitrogen and oxygen but ENR-50 shows maximum oxygen-to-nitrogen selectivity. In

T. Johnson; Sabu Thomas

1999-01-01

403

EM International, July 1994, Volume 2  

SciTech Connect

The Office of Environmental Management (EM) at the Department of Energy (DOE) is seeking out and leveraging foreign technology, data, and resources in keeping with EM`s mandate to protect public health and the environment through the safe and cost-effective remediation of the Department`s nuclear weapons sites. EM works closely with foreign governments, industry, and universities to obtain innovative environmental technologies, scientific and engineering expertise, and operations experience that will support EM`s objectives. Where appropriate, these international resources are used to manage the more urgent risks at our sites, secure a safe workplace, help build consensus on critical issues, and strengthen our technology development program. Through international agreements EM engages in cooperative exchange of information, technology, and individuals. Currently, we are managing agreements with a dozen countries in Europe, Latin America, and Asia. These agreements focus on environmental restoration, waste management, transportation of radioactive wastes, and decontamination and decommissioning. This publication contains the following articles: in situ remediation integrated program; in-situ characterization and inspection of tanks; multimedia environmental pollutant assessment system (MEPAS); LLNL wet oxidation -- AEA technology. Besides these articles, this publication covers: EU activities with Russia; technology transfer activities; and international organization activities.

Not Available

1994-10-01

404

A Texas natural gas model  

SciTech Connect

The Railroad Commission of Texas, through its Gas Services Division, is responsible for the safety and economic regulation of natural gas downstream of the wellhead, including the gathering, processing, storage, transmission and distribution of natural gas. This responsibility requires an understanding of the movement of natural gas in Texas, which was the objective of a recently completed project of the Gas Services Division. The authors goal was to trace a molecule of gas from wellhead to burner tip and identify the incremental value added by each of the components along the path. The authors developed a Texas Natural Gas Model that relates the components of the path so that flow within individual segments of the industry, or between segments of the industry, can be analyzed. The Model links information on wellhead production and prices, marketing costs (reflecting gathering, processing, and compression), transmission costs, and end user consumption and costs. End user information is presented for the primary Texas local distribution companies (LDC) and electric utilities, as well as on an aggregate basis for industrial consumption. LDC costs are further subdivided into the city gate gas costs and average delivered cost to the residential, commercial and industrial sectors. The Model also quantifies by pipeline the significant amount of gas that leaves the state through the interstate pipeline system. The Texas Natural Gas Model provides a comprehensive volume and value balance of the natural gas system within Texas, recognizing the relationship between all segments of the industry.

Nalepa, K.J.; Feng, N.

1999-07-01

405

On the wave nature of matter  

E-print Network

Following the spirit of de Broglie and Einstein, we think the concepts of matter and radiation should be unified. In part 1, we examine the physical nature of matter wave. We propose that: (1) Like the photon, a particle is not a point-like object; instead, it behaves like a wave packet. (2) Like the photon, the matter wave of a particle is an excitation of a real physical field. (3) Different types of particles are different excitation modes of a unified field in the vacuum. We demonstrate that this model can provide a simpler explanation to many physical observations than the current theories. In part 2, we examine the origin of mass and the mass-energy relation. If matters are composed of waves, where does their mass come from? This problem can be solved by treating the rest mass on the same footing as energy and momentum. We hypothesize that, since the vacuum field behaves like an EM field in the long range (>1 fm), the wave equation of a free particle in the asymptotic region is similar to the Maxwell equation, which can be solved using the technique of separation of variables. Using the correspondence principle, our solution suggests that the rest mass of a particle is associated with a "transverse wave number". Results of this work have several important implications. First, we found that the relativistic relationship between energy, momentum and mass can be derived from the dispersion relation of the wavefunction of a free particle. Second, the wave equation describing the longitudinal component of the wavefunction is identical in form to the Klein-Gordon equation. This work suggests that relativity and quantum mechanics can have a common theoretical origin in wave mechanics.

Donald C. Chang

2005-05-02

406

DEPARTMENT OF HUMAN DIMENSIONS OF NATURAL RESOURCES  

E-print Network

to the conservation, stewardship and enjoyment of natural and cultural resources and the management of those resourcesCODE DEPARTMENT OF HUMAN DIMENSIONS OF NATURAL RESOURCES College of Natural Resources Colorado;3 DEPARTMENT OF NATURAL HUMAN DIMENSIONS OF NATURAL RESOURCES CODE ARTICLE I. GOAL AND OBJECTIVES A. DEPARTMENT

407

Natural gas pretreatment prior to liquefaction  

Microsoft Academic Search

This patent describes a method for pretreatment of natural gas having an elevated pressure and containing moisture and about 1.5% to 3.5% by volume of COâ prior to liquefaction of the natural gas which comprises the steps of: a. dehydrating the natural gas; b. partially cooling the natural gas by heat exchange with countercurrent streams of pretreated natural gas and

S. J. Markbreiter; I. Weiss

1989-01-01

408

Revealing Nature’s Synthetic Potential Through the Study of Ribosomal Natural Product Biosynthesis  

PubMed Central

Ribosomally synthesized posttranslationally modified peptides (RiPPs) are a rapidly growing class of natural products with diverse structures and activities. In recent years, a great deal of progress has been made in elucidating the biosynthesis of various RiPP family members. As with the study of nonribosomal peptide and polyketide biosynthetic enzymes, these investigations have led to the discovery of entirely new biological chemistry. With each unique enzyme investigated, a more complex picture of Nature’s synthetic potential is revealed. This review focuses on recent reports (since 2008) that have changed the way that we think about ribosomal natural product biosynthesis and the enzymology of complex bond-forming reactions. PMID:23286465

Dunbar, Kyle L.; Mitchell, Douglas A.

2013-01-01

409

letters to nature 730 NATURE |VOL 407 |12 OCTOBER 2000 |www.nature.com  

E-print Network

in the polar Southern Ocean stimulated by iron fertilization. Nature 407, 695­701 (2000). 6. Comiso, J. C., Mc. Does iron fertilization lead to rapid carbon export in the Southern Ocean? Geochem. Geophys. Geosyst

Shull, David H.

410

Imaging natural cognition in action?  

PubMed Central

The primary function of the human brain is arguably to optimize the results of our motor actions in an ever-changing environment. Our cognitive processes and supporting brain dynamics are inherently coupled both to our environment and to our physical structure and actions. To investigate human cognition in its most natural forms demands imaging of brain activity while participants perform naturally motivated actions and interactions within a full three-dimensional environment. Transient, distributed brain activity patterns supporting spontaneous motor actions, performed in pursuit of naturally motivated goals, may involve any or all parts of cortex and must be precisely timed at a speed faster than the speed of thought and action. Hemodynamic imaging methods give information about brain dynamics on a much slower scale, and established techniques for imaging brain dynamics in all modalities forbid participants from making natural extensive movements so as to avoid intractable movement-related artifacts. To overcome these limitations, we are developing mobile brain/body imaging (MoBI) approaches to study natural human cognition. By synchronizing lightweight, high-density electroencephalographic (EEG) recording with recordings of participant sensory experience, body and eye movements, and other physiological measures, we can apply advanced data analysis techniques to the recorded signal ensemble. This MoBI approach enables the study of human brain dynamics accompanying active human cognition in its most natural forms. Results from our studies have provided new insights into the brain dynamics supporting natural cognition and can extend theories of human cognition and its evolutionary function — to optimize the results of our behavior to meet ever-changing goals, challenges, and opportunities. PMID:24076470

Gramann, Klaus; Ferris, Daniel P.; Gwin, Joseph; Makeig, Scott

2014-01-01

411

Žem?s ?kio gamybos (ekologin?s ir ?prastin?s) ?taka dirvožemio savyb?ms ir žiemini? kvie?i? gr?d? kokybei.  

E-print Network

??Tyrimai atlikti 2008–2009 m. Lietuvos žem?s ?kio universiteto Agroekologijos centro ekologin?s gamybos ir mokomajame (chemizuota gamyba) ?kiuose. Darbo tikslas - ?vertinti ekologin?s žem?s ?kio gamybos… (more)

Užpurvis,; Edgaras

2010-01-01

412

What is Imbalance of Nature?  

NASA Astrophysics Data System (ADS)

The Mother Nature is imbalanced at all. The Mother Nature is every moment new, never returns to previous condition. The gravity and magnetosphere are changeable and imbalanced. The Sun is changeable and imbalanced. The climate is changeable and imbalanced. The atmosphere is changeable and imbalanced. The ocean is changeable and imbalanced. The crust and deep interior are changeable and imbalanced. The cryosphere is changeable and imbalanced. The life is simultaneously as the creator and the result of the imbalance of Nature. The people society is changeable and imbalanced. All chemical, physical, social, and other phenomenons are changeable and imbalanced. It's just that each phenomenon of the Mother Nature has some personal time-scale: one change in a nanosecond, and looks like for us as instable, i.e. imbalanced; while others change over millions years and, therefore, to us looks like not changeable, i.e. balanced. The scientists who are studying the Nature have convinced that the real balance never exist in Nature. Sometimes we can see something that is stable, i.e. balanced. But on closer study it appears that we are witnessing is not eternal rest and balance, it is not eternal STOP, but it is the perpetual motion, changing, there are a lot of imbalances. The balance it can be some result of the temporary mutual compensation the imbalanced processes in opposite directions. The balance it can be also some result of the inaccurate measurement, misunderstanding of conception or even request from bosses. But if we start use more accurate measurements, improve the models and not fear the bosses, than usually we got some new details. These new details show thet under the balanced visibility in really is hiding the interaction of many imbalanced processes of different directions. The balanced logic usually answers to question: What is it? The balanced answers are approximate and it will be updated many times during the development of science and practice. The imbalanced logic usually answers to question: How and why it is happened in details? The imbalanced answers are approximate also, and they will also be updated many times during the development of science and practice. But the imbalanced logic allows us to overcome of the inertia of the balanced logic and much closer come up to understanding the essence of Nature. We try to answer the central question of humanity: How to get calm, i.e. balanced life if the everything around us is imbalanced, the people themselves are restless and not eternal? The study of the Imbalance of Nature is multi-disciplinary because Nature is one. It is our main advantage.

Kontar, V. A.

2012-12-01

413

EMS offshore. A new horizon for paramedics.  

PubMed

The difficulty in getting medical aid to offshore drilling platforms can be a source of life-threatening delays. Recently, some companies have charted new waters by actually stationing EMS crews on their rigs. PMID:10116023

Mallard, A S

1991-10-01

414

EMS Division Potential Benefits of Selected  

E-print Network

Engineers Journal, January 1998, p 107 2 D. Kuhlmann-Wilsdorf, "Metal Fiber Brushes", in Electrical Contacts coils are stationary; there are no rotating cold seals #12;EMS Division Advanced Homopolar Motor Concept

415

Revisão sistemática sobre obesidade em adolescentes brasileiros  

Microsoft Academic Search

Resumo - O propósito deste estudo foi revisar, de forma sistemática, a literatura nacional sobre a prevalência e fatores associados à obesidade em adolescentes. A busca foi realizada nas bases de dados Pubmed e Bireme, através dos descritores: \\

Rafael Miranda Tassitano; Maria Cecília Marinho Tenório; Pedro C Hallal

416

Statistics of Natural Binaural Sounds  

PubMed Central

Binaural sound localization is usually considered a discrimination task, where interaural phase (IPD) and level (ILD) disparities at narrowly tuned frequency channels are utilized to identify a position of a sound source. In natural conditions however, binaural circuits are exposed to a stimulation by sound waves originating from multiple, often moving and overlapping sources. Therefore statistics of binaural cues depend on acoustic properties and the spatial configuration of the environment. Distribution of cues encountered naturally and their dependence on physical properties of an auditory scene have not been studied before. In the present work we analyzed statistics of naturally encountered binaural sounds. We performed binaural recordings of three auditory scenes with varying spatial configuration and analyzed empirical cue distributions from each scene. We have found that certain properties such as the spread of IPD distributions as well as an overall shape of ILD distributions do not vary strongly between different auditory scenes. Moreover, we found that ILD distributions vary much weaker across frequency channels and IPDs often attain much higher values, than can be predicted from head filtering properties. In order to understand the complexity of the binaural hearing task in the natural environment, sound waveforms were analyzed by performing Independent Component Analysis (ICA). Properties of learned basis functions indicate that in natural conditions soundwaves in each ear are predominantly generated by independent sources. This implies that the real-world sound localization must rely on mechanisms more complex than a mere cue extraction. PMID:25285658

M?ynarski, Wiktor; Jost, Jürgen

2014-01-01

417

Natural pedagogy as evolutionary adaptation.  

PubMed

We propose that the cognitive mechanisms that enable the transmission of cultural knowledge by communication between individuals constitute a system of 'natural pedagogy' in humans, and represent an evolutionary adaptation along the hominin lineage. We discuss three kinds of arguments that support this hypothesis. First, natural pedagogy is likely to be human-specific: while social learning and communication are both widespread in non-human animals, we know of no example of social learning by communication in any other species apart from humans. Second, natural pedagogy is universal: despite the huge variability in child-rearing practices, all human cultures rely on communication to transmit to novices a variety of different types of cultural knowledge, including information about artefact kinds, conventional behaviours, arbitrary referential symbols, cognitively opaque skills and know-how embedded in means-end actions. Third, the data available on early hominin technological culture are more compatible with the assumption that natural pedagogy was an independently selected adaptive cognitive system than considering it as a by-product of some other human-specific adaptation, such as language. By providing a qualitatively new type of social learning mechanism, natural pedagogy is not only the product but also one of the sources of the rich cultural heritage of our species. PMID:21357237

Csibra, Gergely; Gergely, György

2011-04-12

418

29 CFR 780.1013 - Natural evergreens.  

Code of Federal Regulations, 2010 CFR

... 3 2010-07-01 2010-07-01 false Natural evergreens. 780.1013 Section 780.1013... Requirements for Exemption § 780.1013 Natural evergreens. Only “natural” evergreens may comprise the principal part...

2010-07-01

419

The Nature of Psychopathology Mark H. Bickhard  

E-print Network

of Ontology.................................................................................14 Derivative Ways;The Nature of Psychopathology Introduction In this paper I wish to address the question of the nature fundamental form of the question concerning the nature of psychopathology is rarely posed in the literature

Bickhard, Mark H.

420

76 FR 57100 - Natural Resource Plan  

Federal Register 2010, 2011, 2012, 2013, 2014

...Statement for the Natural Resource Plan was published in the...Management, will guide TVA's natural resource management over the next...promote the proper use and conservation of the region's natural resources. TVA's threefold...

2011-09-15

421

Natural Language Processing: Challenges and Opportunities  

E-print Network

Natural Language Processing: Challenges and Opportunities in Intelligent Transportation Barbara Di Eugenio Computer Science University of Illinois at Chicago #12;Di Eugenio NLP Natural Language Processing Natural Language Processing (NLP) encompasses all computational aspects regarding the interpretation

Illinois at Chicago, University of

422

Crosslinking studies in natural products biosynthesis  

E-print Network

natural product biosynthesis and engineering functional communicationof the natural product. 5 Intramodular communication alsocommunication-mediating (COM) domains, are responsible for proper translocation of biosynthetic intermediates to produce the natural product.

Hur, Gene Hyeun

2010-01-01

423

29 CFR 780.1013 - Natural evergreens.  

Code of Federal Regulations, 2014 CFR

...2014-07-01 false Natural evergreens. 780.1013 Section 780.1013 Labor...wreath. The word “natural” qualifies all of...evergreens listed in the section, including “other evergreens.” The term natural means that...

2014-07-01

424

29 CFR 780.1013 - Natural evergreens.  

Code of Federal Regulations, 2013 CFR

...2013-07-01 false Natural evergreens. 780.1013 Section 780.1013 Labor...wreath. The word “natural” qualifies all of...evergreens listed in the section, including “other evergreens.” The term natural means that...

2013-07-01

425

29 CFR 780.1013 - Natural evergreens.  

Code of Federal Regulations, 2012 CFR

...2012-07-01 false Natural evergreens. 780.1013 Section 780.1013 Labor...wreath. The word “natural” qualifies all of...evergreens listed in the section, including “other evergreens.” The term natural means that...

2012-07-01

426

29 CFR 780.1013 - Natural evergreens.  

Code of Federal Regulations, 2011 CFR

...2011-07-01 false Natural evergreens. 780.1013 Section 780.1013 Labor...wreath. The word “natural” qualifies all of...evergreens listed in the section, including “other evergreens.” The term natural means that...

2011-07-01

427

New Jersey's EMS response to Superstorm Sandy: a case study of the emergency management assistance compact.  

PubMed

In the United States, understanding the Emergency Management Assistance Compact (EMAC) is critical to responding to a natural disaster or manmade event. Recently, the State of New Jersey responded to Superstorm Sandy and implemented the EMAC system by requesting ambulances to aid in the Emergency Medical Services response. New Jersey's response to Superstorm Sandy was unprecedented in that this storm affected the entire state and EMS community. New Jersey's EMS community and infrastructure were impacted greatly, despite years of planning and preparation for such an event. Once received, out-of-state EMS resources were integrated into New Jersey's emergency management and EMS systems. In this report, each phase of the EMAC in New Jersey is explored, from how the response was coordinated to how it ultimately was executed. The state coordinated its response on multiple levels and, as such, tested the practical applicability of the EMAC process and employed best practices and solutions to issues that arose. These best practices and solutions may prove invaluable for any state or territory that may activate the EMAC system for emergency medical service resources. PMID:24844291

Clancy, Terry; Christensen, Kenneth; Cortacans, Henry P

2014-06-01

428

Enantiomeric Natural Products: Occurrence and Biogenesis**  

PubMed Central

In Nature, chiral natural products are usually produced in optically pure form; however, on occasion Nature is known to produce enantiomerically opposite metabolites. These enantiomeric natural products can arise in Nature from a single species, or from different genera and/or species. Extensive research has been carried out over the years in an attempt to understand the biogenesis of naturally occurring enantiomers, however, many fascinating puzzles and stereochemical anomalies still remain. PMID:22555867

Finefield, Jennifer M.; Sherman, David H.; Kreitman, Martin; Williams, Robert M.

2012-01-01

429

Synthesis of Polycyclic Natural Products  

SciTech Connect

With the continuous advancements in molecular biology and modern medicine, organic synthesis has become vital to the support and extension of those discoveries. The isolations of new natural products allow for the understanding of their biological activities and therapeutic value. Organic synthesis is employed to aid in the determination of the relationship between structure and function of these natural products. The development of synthetic methodologies in the course of total syntheses is imperative for the expansion of this highly interdisciplinary field of science. In addition to the practical applications of total syntheses, the structural complexity of natural products represents a worthwhile challenge in itself. The pursuit of concise and efficient syntheses of complex molecules is both gratifying and enjoyable.

Tuan Hoang Nguyen

2003-05-31

430

Natural GUT and the cosmology  

NASA Astrophysics Data System (ADS)

In the natural GUT, not only realistic quark and lepton mass matrices can be obtained but also the most serious problem in the SUSY GUT, which is called the doublet-triplet splitting problem, can be solved under the natural assumption that all the interactions which are allowed by the symmetry are introduced with O(1) coefficients (including the higher dimensional operators). In this manuscript, we examine several cosmological aspects which are related with the natural GUT, B - L-genesis, non-thermal production of dark matter (DM), vacuum selection by particle production, and the inflation after the trapping. These works are based on several papers[1, 2, 3] collaborated with S. Enomoto, S. Iida, Y. Kurata, and T. Matsuda.

Maekawa, Nobuhiro

2012-07-01

431

Natural GUT and the cosmology  

SciTech Connect

In the natural GUT, not only realistic quark and lepton mass matrices can be obtained but also the most serious problem in the SUSY GUT, which is called the doublet-triplet splitting problem, can be solved under the natural assumption that all the interactions which are allowed by the symmetry are introduced with O(1) coefficients (including the higher dimensional operators). In this manuscript, we examine several cosmological aspects which are related with the natural GUT, B - L-genesis, non-thermal production of dark matter (DM), vacuum selection by particle production, and the inflation after the trapping. These works are based on several papers[1, 2, 3] collaborated with S. Enomoto, S. Iida, Y. Kurata, and T. Matsuda.

Maekawa, Nobuhiro [Nagoya Univ. Kobayashi-Maskawa Institute, Nagoya 464-8602 and Nagoya Univ. Department of Physics, Nagoya 464-8602 (Japan)

2012-07-27

432

Surface reactions of natural glasses  

SciTech Connect

Reactions at natural glass surfaces are important in studies involving nuclear waste transport due to chemical control on ground water in host rocks such as basalt and tuff, to potential diffusion into natural hydrated glass surfaces and as natural analogs for waste glass stability. Dissolution kinetics can be described by linear surface reaction coupled with cation interdiffusion with resulting rates similar to those of synthetic silicate glasses. Rates of Cs diffusion into hydrated obsidian surfaces between 25{sup 0} and 75{sup 0}C were determined by XPS depth profiles and loss rates from aqueous solutions. Calculated diffusion coefficients were ten others of magnitude more rapid than predicted from an Arrhenius extrapolation of high temperature tracer diffusion data due to surface hydration reactions.

White, A.F.

1986-12-31

433

Immunobiology of natural killer cells  

SciTech Connect

This book combines research from many disciplines into a review of natural killer (NK) cell-mediated immunity in humans and experimental animal system. Topics for the volumes include: Volume I: Assays for NK Cell Cytotoxicity; Their Values and Pitfalls. Separation and Characterization of Phenotypically Distinct Subsets of NK Cells. Ultrastructure and Cytochemistry of the Human Large Granular Lymphocytes. Phylogeny and Ontogeny of NK Cells. Tissue and Organ distribution of NK Cells. Genetic Control of NK Cell Activity in Rodents. Phenotype, Functional Heterogeneity, and Lineage of Natural Killer Cells. Target Cell Structures, Recognition Sites, and the Mechanism of NK Cytotoxicity. Natural Killer Cytotoxic Factors (NKCF) Role in Cell-Mediated Cytotoxicity. Characteristics of Cultured NK Cells. Lectin-Dependent Killer Cells. MLC-Induced Cytotoxicity as a Model for the Development and Regulation of NK Cytotoxicity. LGL Lymphoproliferative Diseases in Man and Experimental Animals: The Characteristics of These Cells and Their Potential Experimental Uses. Index.

Lotzova, E.; Herberman, R.B.

1986-01-01

434

SRI International: Natural Language Program  

NSDL National Science Digital Library

This website describes the Natural Language Program that is part of SRI International's Artificial Intelligence Center. The center's research focuses on natural language theory and applications, with emphasis on three subgroups of study. The subprogram on Multimedia / Multimodal Interfaces seeks to understand the optimal ways in which natural language can be incorporated into multimedia interfaces. The subprogram on Spoken Language Systems integrates linguistic processing with speech recognition for use in ATIS, a system for retrieving airline schedules, fares, and related information from a relational database. The subprogram on Written Language Systems researches the problems involved in interpreting and extracting information from written text, such as on-line newspaper articles. Additional information on these projects, related publications, and software are available from this website.

435

The function of terpene natural products in the natural world  

Microsoft Academic Search

As the largest class of natural products, terpenes have a variety of roles in mediating antagonistic and beneficial interactions among organisms. They defend many species of plants, animals and microorganisms against predators, pathogens and competitors, and they are involved in conveying messages to conspecifics and mutualists regarding the presence of food, mates and enemies. Despite the diversity of terpenes known,

Natalia Dudareva; Jonathan Gershenzon

2007-01-01

436

The Power of Nature and the Nature of Power  

ERIC Educational Resources Information Center

This paper explores the process of going outdoors and using "nature" as a way to support teaching about power and privilege within society. It explores how being inside the classroom hinders the process of understanding and disrupting power dynamics between learners and instructors. The classroom decontextualizes the learning process by denying…

Neilson, Alison Laurie

2009-01-01

437

On Adventure Therapy and the Natural Worlds: Respecting Nature's Healing.  

ERIC Educational Resources Information Center

The anthropomorphic paradigm in psychology and psychotherapy has prevented nature from being considered a factor in the curative relationship in adventure therapy. The effectiveness of therapeutic interventions are credited instead to human factors such as program design and facilitation. A paradigm shift is needed in adventure therapy to accept…

Beringer, Almut; Martin, Peter

2003-01-01

438

Nature Macmillan Publishers Ltd 1998 letters to nature  

E-print Network

a background count of non-mycorrhizal fungi in each treatment. In the non-mycorrhizal control treatments. & Mooney, H. A. (eds) Biodiversity and Ecosystem Function (Springer, Berlin, 1993). 2. Tilman, D. & Downing, J. A. Biodiversity and stability in grasslands. Nature 367, 363­365 (1994). 3. Naeem, S., Thompson

Carrasco, Marisa

439

NATURAL HISTORY OR NATURAL SYSTEM? ENCODING THE TEXTUAL SIGN  

Microsoft Academic Search

The dichotomy of system versus history is a time-honoured issue that has inflicted many scientific disciplines, including biology. Ever since the publication of his Systema Naturae in 1735, Carolus Linnaeus' position as father of taxonomy has been established, but his attempt at systematisation has also been severely challenged from time to time by natural historians. This paper will discuss the

Han-liang Chang

440

Wettability of natural superhydrophobic surfaces.  

PubMed

Since the description of the 'Lotus Effect' by Barthlott and Neinhuis in 1997, the existence of superhydrophobic surfaces in the natural world has become common knowledge. Superhydrophobicity is associated with a number of possible evolutionary benefits that may be bestowed upon an organism, ranging from the ease of dewetting of their surfaces and therefore prevention of encumbrance by water droplets, self-cleaning and removal of particulates and potential pathogens, and even to antimicrobial activity. The superhydrophobic properties of natural surfaces have been attributed to the presence of hierarchical microscale (>1 ?m) and nanoscale (typically below 200 nm) structures on the surface, and as a result, the generation of topographical hierarchy is usually considered of high importance in the fabrication of synthetic superhydrophobic surfaces. When one surveys the breadth of data available on naturally existing superhydrophobic surfaces, however, it can be observed that topographical hierarchy is not present on all naturally superhydrophobic surfaces; in fact, the only universal feature of these surfaces is the presence of a sophisticated nanoscale structure. Additionally, several natural surfaces, e.g. those present on rose petals and gecko feet, display high water contact angles and high adhesion of droplets, due to the pinning effect. These surfaces are not truly superhydrophobic, and lack significant degrees of nanoscale roughness. Here, we discuss the phenomena of superhydrophobicity and pseudo-superhydrophobicity in nature, and present an argument that while hierarchical surface roughness may aid in the stability of the superhydrophobic effect, it is nanoscale surface architecture alone that is the true determinant of superhydrophobicity. PMID:24556235

Webb, Hayden K; Crawford, Russell J; Ivanova, Elena P

2014-08-01

441

North American Natural Gas Markets  

SciTech Connect

This report summarizes die research by an Energy Modeling Forum working group on the evolution of the North American natural gas markets between now and 2010. The group's findings are based partly on the results of a set of economic models of the natural gas industry that were run for four scenarios representing significantly different conditions: two oil price scenarios (upper and lower), a smaller total US resource base (low US resource case), and increased potential gas demand for electric generation (high US demand case). Several issues, such as the direction of regulatory policy and the size of the gas resource base, were analyzed separately without the use of models.

Not Available

1989-02-01

442

Hawaiian Natural Resources Monitoring Database  

NSDL National Science Digital Library

The University of Hawaii's Hawaiian Natural Resources Monitoring Database is a centralized database that includes monitoring data for Hawaii's natural resources. Designed to help meet the information needs of land managers in Hawaii, the database includes "standardized and fully-documented data collection efforts by federal, state, and private agencies." A license (free, with permission) is required to access the database. Recently, the site added an updated master species list for Hawaii and an update (from US Fish and Wildlife Service) on the Endangered/Threatened status of Hawaiian species (.zip format).

443

Heat distribution by natural convection  

SciTech Connect

Natural convection between spaces in a building can play a major role in energy transfer. Two situations are investigated: convection through a single doorway into a remote room, and a convective loop in a two-story house with a south sunspace where a north stairway serves as the return path. A doorway-sizing equation is given for the single-door case. Detailed data are given from the monitoring of airflow in one two-story house and summary data are given for five others. Observations on the nature of the airflow and design guidelines are presented.

Balcomb, J.D.; Yamaguchi, K.

1983-01-01

444

Demographic Change and Rural Nature  

Microsoft Academic Search

\\u000a Future demographic change in Australia’s rural environments will yield substantial challenges and opportunities for biodiversity\\u000a conservation. Humans preferentially settle in the most biodiverse regions resulting in considerable spatial conflict between\\u000a human settlement\\u000a and species conservation. The natural amenities\\u000a of rural landscapes (e.g., mountains and forests) are recognised increasingly as factors important in influencing rural population\\u000a growth. A combination of natural

Gary W. Luck

445

Teaching about natural background radiation  

NASA Astrophysics Data System (ADS)

Ambient gamma dose rates in air were measured at different locations (indoors and outdoors) to demonstrate the ubiquitous nature of natural background radiation in the environment and to show that levels vary from one location to another, depending on the underlying geology. The effect of a lead shield on a gamma radiation field was also demonstrated to emphasize the important role of shielding in radiation protection. The measurements were carried out with a Geiger-Muller (GM)-based dosimeter and a NaI scintillation gamma-ray spectrometer, which are normally available in physics laboratories. Radioactivity in household materials was demonstrated using a gas mantle as an example.

Al-Azmi, Darwish; Karunakara, N.; Mustapha, Amidu O.

2013-07-01

446

Natural Milli-Charged Inflation  

E-print Network

We construct a natural inflation model with the inflaton as a linear combination of the fifth components of Abelian gauge fields in a five-dimensional theory. A seesaw mechanism is introduced to provide a natural milli-charge for matter fields under one combination of the gauge symmetries. As a result, the effective decay constant of the inflaton field can be above the Planck scale with all scales in the model below the Planck scale. Our model predicts a tensor-to-scalar ratio r between 0.033 and 0.125 for sixty e-folds and a reheating temperature of a few 10^11 GeV.

Yang Bai; Ben A. Stefanek

2014-05-26

447

M em ory for Item s and M em ory for R elations in the Procedural/D eclarative M em ory Fram ew ork  

E-print Network

ever, as we hope to m ake clear here, progress on this front M E M O R Y , 1 99 7, 5 (1 /2 ), 1 31 ±17M em ory for Item s and M em ory for R elations in the Procedural/D eclarative M em ory Fram ew ork ard Eichenbaum Boston U niversity, U SA A m ajor area of research in m em ory and am nesia concerns

Poldrack, Russ

448

164 nature physics | VOL 5 | MARCH 2009 | www.nature.com/naturephysics A quantum of natural selection  

E-print Network

of natural selection Seth Lloyd The modern evolutionary synthesis, which marries Darwin's theory of natural of natural selection. Perhaps the most surprising aspect of the book is that Darwin was able to construct his theory of how physical traits were handed down and naturally selected, despite operating

Loss, Daniel

449

BREAKTHROUGHS College of Natural Resources  

E-print Network

BREAKTHROUGHS ® College of Natural Resources A Magazine for Alumni and Friends of the College BREAKTHROUGHS ® EDITOR Sue Piper DEAN Richard Malkin DIRECTOR OF COLLEGE RELATIONS Rosemary Lucier CONTRIBUTING of the University of California. All rights reserved. Breakthroughs is a registered trademark and is published

Wildermuth, Mary C

450

Natural gas industry restructuring issues  

Microsoft Academic Search

The structure of the natural gas industry appears to be evolving towards one in which transportation service will be offered separately from the gas commodity itself, which is being withdrawn from government regulation in favor of pricing competition. Industry observers disagree on how to interpret the separation of transportation service and the gas commodity. This volume presents views of several

1986-01-01

451

Nature through Science and Art.  

ERIC Educational Resources Information Center

From breathtaking glacial ravines of Yosemite Valley to weeds growing in neglected rain gutters, this book of activities combines art with scientific research questions. The book is designed to help educators encourage children in the upper primary grades to learn more about the natural world and in particular their local environment. Sixty…

Criswell, Susie Gwen

452

Adaptation to natural flow regimes  

Microsoft Academic Search

Floods and droughts are important features of most running water ecosystems, but the alteration of natural flow regimes by recent human activities, such as dam building, raises questions related to both evolution and conservation. Among organisms inhabiting running waters, what adaptations exist for surviving floods and droughts? How will the alteration of the frequency, tim- ing and duration of flow

David A. Lytle; N. LeRoy Poff

2003-01-01

453

Boudinage in nature and experiment  

Microsoft Academic Search

Deformation of rocks produces structures at all scales that are in many cases periodic (folding or boudinage), with variable amplitude and wavelength. Here we focus on boudinage, a process of primordial importance for tectonics. In the present study, we carried out measurements of natural boudins and experimentally tested the effects of two variables on boudinage: layer thickness and compression rate.

Fernando O. Marques; Pedro D. Fonseca; Sarah Lechmann; Jean-Pierre Burg; Ana S. Marques; Alexandre J. M. Andrade; Carlos Alves

454

Natural history museums and cyberspace  

USGS Publications Warehouse

Natural history museums are entering the electronic age as they increasingly use computers to build accessible and shareable databases that support research and education on a world-wide basis. Museums are exploring the Internet and other shared uses of electronic media to enhance their traditional roles in education, training, identifications, technical assistance, and collections management.

Wemmer, C.; Erixon-Stanford, M.; Gardner, A.L.

1996-01-01

455

Nature, Nurture, and Dynamic Interactionism  

Microsoft Academic Search

From an organismic, probabilistic epigenetic viewpoint, development arises from a dynamic interaction between qualitatively different, yet totally interdependent nature and nurture variables. The syntheses defining this interaction involve the quality and timing of each source providing a basis of these parameters in the other. Covariation among the parameters shows interorganism variability in ecologically valid milieus. Organisms consequently develop lawful characteristics

Richard M. Lerner

1978-01-01

456

Natural Acceleration: Supporting Creative Trajectories  

ERIC Educational Resources Information Center

"Natural acceleration" happens through an internal fire that burns to learn and may transcend school boundaries. Based on their passionate interests and connections with a domain, children who hunger for domain understandings outside school curricula require different types of acceleration, motivated by these interests. The lifeworks, domains, and…

Cohen, LeoNora M.

2011-01-01

457

The Natural and Perturbed Troposphere  

Microsoft Academic Search

It is now generally accepted that the troposphere is a region of great chemical complexity and that many human activities may alter the chemical structure of the region. A prerequisite to any realistic assessment of human impacts on pollution and climate is an understanding of the natural budgets of atmospheric gases. This requires a detailed knowledge of physical, chemical, and

RICHARD W. STEWART; Sultan Hameed; Joseph Pinto

1978-01-01

458

Visualizing and quantifying natural selection  

Microsoft Academic Search

Modern methods of analysis are enabling researchers to study natural selection at a new level of detail. Multivariate statistical techniques can Identify specific targets of selection and provide parameter estimates that fit into equations for evolutionary change. A more Intuitive understanding of the form of selection can be provided through graphical representation of selection surfaces. Combinations of quantitative and visual

Edmund D. Brodie; Allen J. Moore; Fredric J. Janzen

1995-01-01

459

Natural products: DNA double whammy  

NASA Astrophysics Data System (ADS)

The lomaiviticins are exceedingly potent antibiotic agents, but the mechanism responsible for this activity has so far been unclear. Now, efficient generation of double-strand breaks in DNA by lomaiviticin A has been linked to the remarkable cytotoxicity of these diazobenzofluorene-containg natural products.

Gates, Kent S.

2014-06-01

460

San Diego Natural History Museum  

NSDL National Science Digital Library

The San Diego Natural History Museum traces its roots to a group of amateur naturalists, who formed the San Diego Society of Natural History in 1874. Today the Museum strives to help visitors interpret the natural world through research, education and exhibits. Active research in scientific field work and systematics has been ongoing since the Societies inception, and current fields of interest include Entomology, Botany, Geology, Mineralogy, Paleontology, and Birds and Mammals. The Museum offers an online specimen database, as well as information on publications, collections care and conservation, symposia and workshops and bi-national expeditions. There are a number of changing exhibits at the facility, and one can bring nature into your classroom, art studio, and home by becoming a member of the Museum's Loan Program. The program has over 1100 specimens that represent biologic and geologic diversity throughout the world. The Museums program Proyecto Bio-regional de Educación Ambiental, or PROBEA, designs innovative environmental education curricula to train educators, and engage teachers, students and others in projects to benefit their local environment.

461

NATURAL ATTENUATION OF CHLORINATED SOLVENTS  

EPA Science Inventory

The protocol will simply describe in detail, with references and illustrations, the approach currently used by staff of the SPRD to evaluate natural attenuation of chlorinated solvents in ground water. Staff of SPRD, and staff of the Air Force Center for environmental excellence...

462

Occupational Analysis: Natural Resources Technician  

NSDL National Science Digital Library

The Advanced Technology Environmental and Energy Center (ATEEC) has provided this document which includes an overview of general required competencies for natural resources technicians. Suggested general areas of competence and specific tasks within each area are provided. Users must download this resource for viewing, which requires a free log-in. There is no cost to download the item.

2011-03-04

463

Natural selection of visual symmetries  

Microsoft Academic Search

Implicitly, Wynn's target article starts from the transformational definition of symmetry. Unlike his suggestion, this traditional definition and the recent holographic definition are relevant to the discussion on the cognitive evolution of visual symmetries. These definitions reveal underlying properties and, thereby, they support the natural selection hypothesis. The holographic definition even agrees with an indirect test of this hypothesis

Peter A. van der Helm

2002-01-01

464

Natural Disaster Mitigation and Relief  

Microsoft Academic Search

Sudden-onset natural and technological disasters impose a substantial health burden, either directly on the population or indirectly on the capacity of the health services to address pri- mary health care needs. The relationship between communica- ble diseases and disasters merits special attention. This chapter does not address epidemics of emerging or reemerging dis- eases, chronic degradation of the environment, progressive

Ricardo Zapata Marti; Claudio Osorio

465

Natural gas monthly, January 1997  

SciTech Connect

This publication, the Natural Gas Monthly, presents the most recent data on natural gas supply, consumption, and prices from the Energy Information Administration (EIA). Of special interest in this issue are two articles summarizing reports recently published by EIA. The articles are {open_quotes}Natural Gas Productive Capacity{close_quotes} and {open_quotes}Outlook for Natural Gas Through 2015,{close_quotes} both of which precede the {open_quotes}Highlights{close_quotes} section. With this issue, January 1997, changes have been made to the format of the Highlights section and to several of the tabular and graphical presentations throughout the publication. The changes to the Highlights affect the discussion of developments in the industry and the presentation of weekly storage data. An overview of the developments in the industry is now presented in a brief summary followed by specific discussions of supply, end-use consumption, and prices. Spot and futures prices are discussed as appropriate in the Price section, together with wellhead and consumer prices.

NONE

1997-01-01

466

Wind Engineering & Natural Disaster Mitigation  

E-print Network

Wind Engineering & Natural Disaster Mitigation For more than 45 years, Western University has been internationally recognized as the leading university for wind engineering and wind- related research. Its of environmental disaster mitigation, with specific strengths in wind and earthquake research. Boundary Layer Wind

Denham, Graham

467

Lightweight Natural Language Text Compression  

Microsoft Academic Search

Variants of Hufiman codes where words are taken as the source symbols are currently the most attractive choices to compress natural language text databases. In particular, Tagged Hufiman Code by Moura et al. ofiers fast direct searching on the compressed text and random access capabilities, in exchange for producing around 11% larger compressed flles. This work describes End-Tagged Dense Code

Nieves R. Brisaboa; Antonio Fari; Gonzalo Navarro; Jose R. Parama

468

Lightweight natural language text compression  

Microsoft Academic Search

Variants of Huffman codes where words are taken as the source symbols are currently the most attractive choices to compress natural language text databases. In particular, Tagged Huffman Code by Moura et al. offers fast direct searching on the compressed text and random access capabilities, in exchange for producing around 11% larger compressed files. This work describes End-Tagged Dense Code

Nieves R. Brisaboa; Antonio Fariña; Gonzalo Navarro; Jose R. Parama

2007-01-01

469

Natural History of Burrowing Owls  

E-print Network

a federally listed Species of Management Concern and are a Species of Special Concern in California-native plant species. Burrowing owls are being forced to rely on less natural habi- tat for survival. When do-laying) occurs between Febru- ary 1 and August 30, depending on location. Females lay up to 12 eggs and incubate

Rosenberg, Daniel K.

470

Search for Natural Curium 247  

Microsoft Academic Search

A sample of rare-earth concentrate derived from euxenite was analyzed for the long-lived isotope Cmby mass spectrometric isotope dilution. Less than 10 - g of Cmper gram of rare earth was found. It is difficult to reconcile this negative result with the reported discovery of this isotope in nature. Introduction. In an abstract of the same title (Wetherill et al.,

G. W. Wetherill; W. F. Libby; G. W. Barton

1964-01-01

471

Natural Dyes. Third World Science.  

ERIC Educational Resources Information Center

This unit, developed by the Third World Science Project, is designed to add a multicultural element to existing science syllabi (for students aged 11-16) in the United Kingdom. The project seeks to develop an appreciation of the: boundless fascination of the natural world; knowledge, skills, and expertise possessed by men/women everywhere;…

Jones, Natalie; Hughes, Wyn

472

Natural Sciences Tripos EARTH SCIENCES  

E-print Network

Natural Sciences Tripos EARTH SCIENCES University of Cambridge Undergraduate Prospectus 2013.indd 1Undergraduate Prospectus 2013.indd 1 29/07/2013 16:44:3529/07/2013 16:44:35 #12;Department of Earth Sciences is the science of the Earth. What is the Earth made of? What processes shape and change it? What's happened

Cambridge, University of

473

Floating natural gas liquefaction plant  

Microsoft Academic Search

Floating LNG plants offer a technically feasible and economical method to produce natural gas from marginal offshore fields and are under certain circumstances an economical alternative to land-based LNG plants. The presented floating, semisubmersible plant can keep up production under northern North Sea conditions all the year round.

Meyer-Detring

1977-01-01

474

The Liquefaction of Natural Gas  

Microsoft Academic Search

The history and significance of natural gas liquefaction is traced showing that the main developments have occurred since 1960. The thermodynamics of liquefaction is reviewed paying special attention to the effect of the supply pressure of the gas, and its composition, on the minimum work requirement. It is shown that liquefier design requires highly accurate thermodynamic data for the process

G. G. Haselden

1977-01-01

475

Natural language processing information retrieval  

E-print Network

Natural language processing for information retrieval David D. Lewis AT&T Bell Laboratories Karen with `end' text. We will however use information retrieval (IR), sometimes taken to mean document retrieval the essential properties of document retrieval and reviews both conventional practice and research findings

Haddadi, Hamed

476

A Natural Resources Management Program  

ERIC Educational Resources Information Center

Three years of instruction in natural resources management (NRM) are offered at Louisa County High School, Mineral, Virginia, with 30 acres of land for use as outdoor classrooms. Instructional areas are grouped under forestry; crops and soils; and surveying, air, water, recreation, and general. Two years of basic agriculture science and mechanics…

Lancaster, George B.

1977-01-01

477

Genomics and natural language processing  

Microsoft Academic Search

The Human Genome and MEDLINE are both the foci of intense data-mining efforts worldwide. The biomedical literature has much to say about sequence, but it also seems that sequence can tell us much about the biomedical literature. Biological natural language processing is an emerging field of research that seeks to explore systematically the relationships between genes, sequences and the biomedical

William H. Majoros; Mark D. Yandell

2002-01-01

478

Natural language processing of lyrics  

Microsoft Academic Search

We report experiments on the use of standard natural language processing (NLP) tools for the analysis of music lyrics. A significant amount of music audio has lyrics. Lyrics encode an important part of the semantics of a song, therefore their analysis complements that of acoustic and cultural metadata and is fundamental for the development of complete music information retrieval systems.

Jose P. G. Mahedero; Álvaro MartÍnez; Pedro Cano; Markus Koppenberger; Fabien Gouyon

2005-01-01

479

Knowledge and natural language processing  

Microsoft Academic Search

KBNL is a knowledge-based natural language processing system that is novel in several ways, including the clean separation it enforces between linguistic knowledge and world knowledge, and its use of knowledge to aid in lexical acquisition. Applications of KBNL include intelligent interfaces, text retrieval, and machine translation.

Jim Barnett; Kevin Knight; Inderjeet Mani; Elaine Rich

1990-01-01

480

Inheritance in Natural Language Processing  

Microsoft Academic Search

In this introduction to the special issues, we begin by outlining a concrete example that indicates some of the motivations leading to the widespread use of inheritance networks in computational linguistics. This example allows us to illustrate some of the formal choices that have to be made by those who seek network solutions to natural language processing (NLP) problems. We

Walter Daelemans; Koenraad De Smedt; Gerald Gazdar

1992-01-01

481

First Follow Nature, Kit II.  

ERIC Educational Resources Information Center

Developing pupils' awareness of their environment, learning to distinguish between what is pleasant and unpleasant, and examining acts of man to determine which are destructive and which are in harmony with nature are the purposes of Scholastic's Earth Corps Environmental Study Kits for Grades 1-6. This kit explores in depth the reasons some…

1971

482

Nurturing the Nature of Science  

ERIC Educational Resources Information Center

Historical stories of scientists provide an excellent opportunity to help students see that science is indeed a human endeavor and demonstrate the interrelationships among science, technology, and society. A number of engaging historical accounts illustrate characteristics of the nature of science. The story of Lise Meitner leads students through…

Reeves, Carolyn; Chessin, Debby; Chambless, Martha

2007-01-01

483

MOLECULAR SIGNATURES OF NATURAL SELECTION  

Microsoft Academic Search

There is an increasing interest in detecting genes, or genomic re- gions, that have been targeted by natural selection. The interest stems from a basic desire to learn more about evolutionary pro- cesses in humans and other organisms, and from the realization that inferences regarding selection may provide important functional in- formation. This review provides a nonmathematical description of the

Rasmus Nielsen

2005-01-01

484

Nature Activities for Early Childhood.  

ERIC Educational Resources Information Center

This manual contains 44 separate projects which are designed to help teachers and parents provide young children (in kindergarten through second grade) with experiences in observing natural phenomena, plants, and animals. Each project centers around an activities section prefaced with scientific information meant to provide the teaching adult with…

Nickelsburg, Janet

485

Modeling Natural Variation through Distribution  

ERIC Educational Resources Information Center

This design study tracks the development of student thinking about natural variation as late elementary grade students learned about distribution in the context of modeling plant growth at the population level. The data-modeling approach assisted children in coordinating their understanding of particular cases with an evolving notion of data as an…

Lehrer, Richard; Schauble, Leona

2004-01-01

486

Chemical Nature of Wear Debris  

Microsoft Academic Search

Depending upon the mechanism of wear occurring within aircraft gas-turbine engines, different types of wear debris are expected to be produced in lubricating oils. A procedure was developed to identify the chemical nature of these wear species. The procedure involves filtration and solvent extraction techniques, followed by spectrometric analysis to separate and quantify the different chemical forms of the wear

R. E. Kauffman; C. S. Saba; W. E. Rhine; K. J. Eisentraut

1985-01-01

487

Peri-Saccadic Natural Vision  

PubMed Central

The fundamental role of the visual system is to guide behavior in natural environments. To optimize information transmission, many animals have evolved a non-homogeneous retina and serially sample visual scenes by saccadic eye movements. Such eye movements, however, introduce high-speed retinal motion and decouple external and internal reference frames. Until now, these processes have only been studied with unnatural stimuli, eye movement behavior, and tasks. These experiments confound retinotopic and geotopic coordinate systems and may probe a non-representative functional range. Here we develop a real-time, gaze-contingent display with precise spatiotemporal control over high-definition natural movies. In an active condition, human observers freely watched nature documentaries and indicated the location of periodic narrow-band contrast increments relative to their gaze position. In a passive condition under central fixation, the same retinal input was replayed to each observer by updating the video’s screen position. Comparison of visual sensitivity between conditions revealed three mechanisms that the visual system has adapted to compensate for peri-saccadic vision changes. Under natural conditions we show that reduced visual sensitivity during eye movements can be explained simply by the high retinal speed during a saccade without recourse to an extra-retinal mechanism of active suppression; we give evidence for enhanced sensitivity immediately after an eye movement indicative of visual receptive fields remapping in anticipation of forthcoming spatial structure; and we demonstrate that perceptual decisions can be made in world rather than retinal coordinates. PMID:23325257

Dorr, Michael; Bex, Peter J.

2013-01-01

488

Natural Recovery From Cocaine Dependence  

Microsoft Academic Search

Studies of natural recoveries from alcohol, heroin, and cocaine abuse have indicated that many individuals are able to change their drug or alcohol use when the benefits of using the drug are outweighed by the negatives. The present study investigated the recovery process using 50 abstinent (?1 year) untreated former cocaine users and 21 untreated and nonrecovered cocaine users. The

Tony Toneatto; Linda C. Sobell; Mark B. Sobell; Eric Rubel

1999-01-01

489

Peri-saccadic natural vision.  

PubMed

The fundamental role of the visual system is to guide behavior in natural environments. To optimize information transmission, many animals have evolved a non-homogeneous retina and serially sample visual scenes by saccadic eye movements. Such eye movements, however, introduce high-speed retinal motion and decouple external and internal reference frames. Until now, these processes have only been studied with unnatural stimuli, eye movement behavior, and tasks. These experiments confound retinotopic and geotopic coordinate systems and may probe a non-representative functional range. Here we develop a real-time, gaze-contingent display with precise spatiotemporal control over high-definition natural movies. In an active condition, human observers freely watched nature documentaries and indicated the location of periodic narrow-band contrast increments relative to their gaze position. In a passive condition under central fixation, the same retinal input was replayed to each observer by updating the video's screen position. Comparison of visual sensitivity between conditions revealed three mechanisms that the visual system has adapted to compensate for peri-saccadic vision changes. Under natural conditions we show that reduced visual sensitivity during eye movements can be explained simply by the high retinal speed during a saccade without recourse to an extra-retinal mechanism of active suppression; we give evidence for enhanced sensitivity immediately after an eye movement indicative of visual receptive fields remapping in anticipation of forthcoming spatial structure; and we demonstrate that perceptual decisions can be made in world rather than retinal coordinates. PMID:23325257

Dorr, Michael; Bex, Peter J

2013-01-16

490

The economics of natural disasters  

Microsoft Academic Search

Mitigating natural disasters is probably more important for society than it can be inferred from direct losses. Total economic losses, indeed, can be much larger than direct losses, especially for large disasters, which affect the economy for extended periods of time (e.g., New Orleans after Katrina), and represent an important obstacle to economic development in certain regions (e.g. Central America).

S. Hallegatte

2007-01-01

491

Natural Resource Management Plan Update  

E-print Network

Management - Evaluation of Deer Population - Establish monitoring programs - Provide for adaptive management natural resources · Established an "Adaptive Management" approach · Integrated other management needs (ex Eastern Hognose Snake · Better understanding of habitat needs Box Turtles · Home range and intraspecific

Homes, Christopher C.

492

Monophyly, Paraphyly, and Natural Kinds  

Microsoft Academic Search

A long-standing debate has dominated systematic biology and the ontological commitments made by its theories. The debate has contrasted individuals and the part – whole relationship with classes and the membership relation. This essay proposes to conceptualize the hierarchy of higher taxa is terms of a hierarchy of homeostatic property cluster natural kinds (biological species remain largely excluded from the

Olivier Rieppel

2005-01-01

493

Psychoanalysis as a Natural Science  

Microsoft Academic Search

Despite Freud's unwavering intention that psychoanalysis should conform to the requirements of a natural science, this aim has not been realized. Some analysts hold the aim have been mistaken. Others believe it can and should be achieved, proposing that traditional metapsychology be replaced by a new conceptual framework utilizing modern concepts not available to Freud. Utilizing data obtained from current

John Bowlby

1984-01-01

494

Dimensional stability of natural fibers  

SciTech Connect

One of the main problems associated with the use of natural fibers as reinforcing agents in composites is their uptake of moisture. Many natural fibers are lignocellulosic, which causes them to swell and shrink as the amount of available moisture changes. Swelling and shrinking can cause composites to prematurely fail. This paper presents the results of a preliminary study that considers the use of two different low molecular weight monomers, hydroxyethyl methacrylate (HEMA) and hydroxyethyl acrylate (HEA), polymerized by electron beam ionizing radiation, to dimensionally stabilize natural fibers. Eight different treatments consisting of varying amounts of monomer, encapsulating agent, and cross-linkers, were evaluated for their ability to dimensionally stabilize sisal fiber. Results indicate that both polymerized HEA and HEMA can reduce the swelling of sisal fiber. The effectiveness of HEA and HEMA can be further enhanced with the use of a cross-linker (SR 454). The use of hydroxylated monomers to dimensionally stabilize natural fibers may play an important role in reducing delamination and improving fiber-resin adhesion in composites.

Driscoll, Mark S. [Ultraviolet Light/Electron Beam (UV/EB) Technology Center, State University of New York College of Environmental Science and Forestry (SUNY-ESF), 1 Forestry Drive, Syracuse, NY 13210 (United States); Smith, Jennifer L.; Woods, Sean; Tiss, Kenneth J. [Ultraviolet Light/Electron Beam (UV/EB) Technology Center, State University of New York College of Environmental Science and Forestry (SUNY-ESF), 1 Forestry Drive, Syracuse, NY 13210 and Sustainable Construction Management and Engineering, SUNY-ESF (United States); Larsen, L. Scott [New York State Energy Research and Development Authority (NYSERDA), 17 Columbia Circle, Albany, NY 12203 (United States)

2013-04-19

495

The Work of Natural Killers  

NSDL National Science Digital Library

Second monthly installment of our "What A Year!" website project, introducing life science breakthroughs to middle and high school students and their teachers. This story looks at new understanding of and research into the role of natural killer T-cells in asthma.

2006-10-02

496

'Natural' methods of family planning.  

PubMed

There are currently signs that more women are considering the natural family planning methods as an alternative to medical contraception. In response to this revival of interest, the World Health Organization is now conducting field work on 'natural' family planning methods in New Zealand, the Philippines, India, California, and Columbia and is also preparing a teaching package to be pilot tested in several countries. The natural methods of family planning are all based on the woman correctly ascertaining the pattern of her natural menstrual cycle and abstaining from sexual intercourse during the fertile time. In most women this means that there are 2 "safe periods" - at the beginning of the 28-day cycle until a few days before ovulation and at the end of the cycle from 3 or 4 days after ovulation has occurred. Originally, the "safe period" was taught by the calendar method, which involved a woman carefully plotting her menstrual cycle over a period of six months to a year and making calculations as to the shortest possible and longest possible cycle length, and thus the likely time of ovulation. A more accurate measure is to actually find out the point of ovulation by measuring basal body temperature. With this method the woman must take her temperature every morning immediately upon waking, before rising, smoking, eating or drinking. The Billings' ovulation method is the method now becoming increasingly popular. The method involves noticing the natural changes in the body over the whole menstrual cycle, particularly the quantity and quality of the cervical mucous. 1 new aid for pinpointing the exact time of ovulation is the Ovutime Fertility Detection System developed at Harvard University Medical School and the Massachusetts Institute of Technology. In the long-term, the rhythm method is unlikely to prove the answer to the problem of fertility regulation for the modern woman. PMID:12260793

Jones, M

1978-10-01

497

Illicit Trafficking of Natural Radionuclides  

SciTech Connect

Natural radionuclides have been subject to trafficking worldwide, involving natural uranium ore (U 238), processed uranium (yellow cake), low enriched uranium (<20% U 235) or highly enriched uranium (>20% U 235), radium (Ra 226), polonium (Po 210), and natural thorium ore (Th 232). An important prerequisite to successful illicit trafficking activities is access to a suitable logistical infrastructure enabling an undercover shipment of radioactive materials and, in case of trafficking natural uranium or thorium ore, capable of transporting large volumes of material. Covert en route diversion of an authorised uranium transport, together with covert diversion of uranium concentrate from an operating or closed uranium mines or mills, are subject of case studies. Such cases, involving Israel, Iran, Pakistan and Libya, have been analyzed in terms of international actors involved and methods deployed. Using international incident data contained in the Database on Nuclear Smuggling, Theft and Orphan Radiation Sources (DSTO) and international experience gained from the fight against drug trafficking, a generic Trafficking Pathway Model (TPM) is developed for trafficking of natural radionuclides. The TPM covers the complete trafficking cycle, ranging from material diversion, covert material transport, material concealment, and all associated operational procedures. The model subdivides the trafficking cycle into five phases: (1) Material diversion by insider(s) or initiation by outsider(s); (2) Covert transport; (3) Material brokerage; (4) Material sale; (5) Material delivery. An Action Plan is recommended, addressing the strengthening of the national infrastructure for material protection and accounting, development of higher standards of good governance, and needs for improving the control system deployed by customs, border guards and security forces.

Friedrich, Steinhaeusler; Lyudmila, Zaitseva [Div. of Physics and Biophysics, University of Salzburg Hellbrunnerstr. 34, A 5020 Salzburg (Austria)

2008-08-07

498

Illicit Trafficking of Natural Radionuclides  

NASA Astrophysics Data System (ADS)

Natural radionuclides have been subject to trafficking worldwide, involving natural uranium ore (U 238), processed uranium (yellow cake), low enriched uranium (<20% U 235) or highly enriched uranium (>20% U 235), radium (Ra 226), polonium (Po 210), and natural thorium ore (Th 232). An important prerequisite to successful illicit trafficking activities is access to a suitable logistical infrastructure enabling an undercover shipment of radioactive materials and, in case of trafficking natural uranium or thorium ore, capable of transporting large volumes of material. Covert en route diversion of an authorised uranium transport, together with covert diversion of uranium concentrate from an operating or closed uranium mines or mills, are subject of case studies. Such cases, involving Israel, Iran, Pakistan and Libya, have been analyzed in terms of international actors involved and methods deployed. Using international incident data contained in the Database on Nuclear Smuggling, Theft and Orphan Radiation Sources (DSTO) and international experience gained from the fight against drug trafficking, a generic Trafficking Pathway Model (TPM) is developed for trafficking of natural radionuclides. The TPM covers the complete trafficking cycle, ranging from material diversion, covert material transport, material concealment, and all associated operational procedures. The model subdivides the trafficking cycle into five phases: (1) Material diversion by insider(s) or initiation by outsider(s); (2) Covert transport; (3) Material brokerage; (4) Material sale; (5) Material delivery. An Action Plan is recommended, addressing the strengthening of the national infrastructure for material protection and accounting, development of higher standards of good governance, and needs for improving the control system deployed by customs, border guards and security forces.

Friedrich, Steinhäusler; Lyudmila, Zaitseva

2008-08-01

499

The Dynamic Dielectric at a Brain Functional Site and an EM Wave Approach to Functional Brain Imaging  

PubMed Central

Functional brain imaging has tremendous applications. The existing methods for functional brain imaging include functional Magnetic Resonant Imaging (fMRI), scalp electroencephalography (EEG), implanted EEG, magnetoencephalography (MEG) and Positron Emission Tomography (PET), which have been widely and successfully applied to various brain imaging studies. To develop a new method for functional brain imaging, here we show that the dielectric at a brain functional site has a dynamic nature, varying with local neuronal activation as the permittivity of the dielectric varies with the ion concentration of the extracellular fluid surrounding neurons in activation. Therefore, the neuronal activation can be sensed by a radiofrequency (RF) electromagnetic (EM) wave propagating through the site as the phase change of the EM wave varies with the permittivity. Such a dynamic nature of the dielectric at a brain functional site provides the basis for an RF EM wave approach to detecting and imaging neuronal activation at brain functional sites, leading to an RF EM wave approach to functional brain imaging. PMID:25367217

Li, X. P.; Xia, Q.; Qu, D.; Wu, T. C.; Yang, D. G.; Hao, W. D.; Jiang, X.; Li, X. M.

2014-01-01

500

Natural radioactivity in phosphates, phosphogypsum and natural waters in Morocco.  

PubMed

The contents of natural radionuclides (uranium, actinium and thorium series) were measured in sedimentary phosphate rock samples using high-resolution gamma spectrometry. Data obtained for uranium content (ppm) were compared with the results obtained by a method based on the measurements using solid-state nuclear track detectors (SSNTD) in the same samples. The potential leaching of radionuclides from sedimentary phosphate rock during the industrial production of the phosphoric acid was studied. The process of leaching of the radioisotopes from phosphogypsum was discussed. A method for the direct alpha counting of 226Ra thin source, elaborated by the deposition of Ra from aqueous solutions on manganese oxides film deposited on polyvinyl support, have been developed and applied for the determination of 226Ra in natural water samples. The results show that only the water sample from the mine area reveals the presence of 226Ra at a level of about 0.2 Bq l-1. PMID:11378917

Azouazi, M; Ouahidi, Y; Fakhi, S; Andres, Y; Abbe, J C; Benmansour, M

2001-01-01