Science.gov

Sample records for encoding lipoic acid

  1. Diabetes and Alpha Lipoic Acid

    PubMed Central

    Golbidi, Saeid; Badran, Mohammad; Laher, Ismail

    2011-01-01

    Diabetes mellitus is a multi-faceted metabolic disorder where there is increased oxidative stress that contributes to the pathogenesis of this debilitating disease. This has prompted several investigations into the use of antioxidants as a complementary therapeutic approach. Alpha lipoic acid, a naturally occurring dithiol compound which plays an essential role in mitochondrial bioenergetic reactions, has gained considerable attention as an antioxidant for use in managing diabetic complications. Lipoic acid quenches reactive oxygen species, chelates metal ions, and reduces the oxidized forms of other antioxidants such as vitamin C, vitamin E, and glutathione. It also boosts antioxidant defense system through Nrf-2-mediated antioxidant gene expression and by modulation of peroxisome proliferator activated receptors-regulated genes. ALA inhibits nuclear factor kappa B and activates AMPK in skeletal muscles, which in turn have a plethora of metabolic consequences. These diverse actions suggest that lipoic acid acts by multiple mechanisms, many of which have only been uncovered recently. In this review we briefly summarize the known biochemical properties of lipoic acid and then discussed the oxidative mechanisms implicated in diabetic complications and the mechanisms by which lipoic acid may ameliorate these reactions. The findings of some of the clinical trials in which lipoic acid administration has been tested in diabetic patients during the last 10 years are summarized. It appears that the clearest benefit of lipoic acid supplementation is in patients with diabetic neuropathy. PMID:22125537

  2. Lipoic Acid Metabolism in Microbial Pathogens

    PubMed Central

    Spalding, Maroya D.; Prigge, Sean T.

    2010-01-01

    Summary: Lipoic acid [(R)-5-(1,2-dithiolan-3-yl)pentanoic acid] is an enzyme cofactor required for intermediate metabolism in free-living cells. Lipoic acid was discovered nearly 60 years ago and was shown to be covalently attached to proteins in several multicomponent dehydrogenases. Cells can acquire lipoate (the deprotonated charge form of lipoic acid that dominates at physiological pH) through either scavenging or de novo synthesis. Microbial pathogens implement these basic lipoylation strategies with a surprising variety of adaptations which can affect pathogenesis and virulence. Similarly, lipoylated proteins are responsible for effects beyond their classical roles in catalysis. These include roles in oxidative defense, bacterial sporulation, and gene expression. This review surveys the role of lipoate metabolism in bacterial, fungal, and protozoan pathogens and how these organisms have employed this metabolism to adapt to niche environments. PMID:20508247

  3. A new regulatory mechanism for bacterial lipoic acid synthesis

    PubMed Central

    Zhang, Huimin; Luo, Qixia; Gao, Haichun; Feng, Youjun

    2015-01-01

    Lipoic acid, an essential enzyme cofactor, is required in three domains of life. In the past 60 years since its discovery, most of the pathway for lipoic acid synthesis and metabolism has been elucidated. However, genetic control of lipoic acid synthesis remains unclear. Here, we report integrative evidence that bacterial cAMP-dependent signaling is linked to lipoic acid synthesis in Shewanella species, the certain of unique marine-borne bacteria with special ability of metal reduction. Physiological requirement of protein lipoylation in γ-proteobacteria including Shewanella oneidensis was detected using Western blotting with rabbit anti-lipoyl protein primary antibody. The two genes (lipB and lipA) encoding lipoic acid synthesis pathway were proved to be organized into an operon lipBA in Shewanella, and the promoter was mapped. Electrophoretic mobility shift assays confirmed that the putative CRP-recognizable site (AAGTGTGATCTATCTTACATTT) binds to cAMP-CRP protein with origins of both Escherichia coli and Shewanella. The native lipBA promoter of Shewanella was fused to a LacZ reporter gene to create a chromosome lipBA-lacZ transcriptional fusion in E. coli and S. oneidensis, allowing us to directly assay its expression level by β-galactosidase activity. As anticipated, the removal of E. coli crp gene gave above fourfold increment of lipBA promoter-driven β-gal expression. The similar scenario was confirmed by both the real-time quantitative PCR and the LacZ transcriptional fusion in the crp mutant of Shewanella. Furthermore, the glucose effect on the lipBA expression of Shewanella was evaluated in the alternative microorganism E. coli. As anticipated, an addition of glucose into media effectively induces the transcriptional level of Shewanella lipBA in that the lowered cAMP level relieves the repression of lipBA by cAMP-CRP complex. Therefore, our finding might represent a first paradigm mechanism for genetic control of bacterial lipoic acid synthesis. PMID

  4. Effects of Lipoic Acid on Acrylamide Induced Testicular Damage

    PubMed Central

    Lebda, Mohamed; Gad, Shereen; Gaafar, Hossam

    2014-01-01

    Introduction: Acrylamide is very toxic to various organs and associated with significant increase of oxidative stress and depletion of antioxidants. Alpha-lipoic acid enhances cellular antioxidant defense capacity, thereby protecting cells from oxidative stress. Aim of the study: This study aimed to evaluate the protective role of alpha-lipoic acid on the oxidative damage induced by acrylamide in testicular and epididymal tissues. Material and methods: Forty adult male rats were divided into four groups (10 rats each). Control group; acrylamide treated group administered acrylamide 0.05% (w/v) in drinking water for 21 days; alpha-lipoic acid group received basal diet supplemented with 1% alpha-lipoic acid and forth group was exposed to acrylamide and treated with alpha-lipoic acid at the same doses and treatment regimen mentioned before. Results: The administration of acrylamide resulted in significant elevation in testicular and epididymal malondialdehyde level (MDA) and significant reduction in the level of reduced glutathione (GSH) and the activities of glutathione-S-transferase (GST), glutathione peroxidase (GPX) and glutathione reductase (GR). Also, acrylamide significantly reduced serum total testosterone and progesterone but increased estradiol (E2) levels. Treatment with alpha-lipoic acid prior to acrylamide induced protective effects and attenuated these biochemical changes. Conclusion: Alpha-lipoic acid has been shown to possess antioxidant properties offering promising efficacy against oxidative stress induced by acrylamide administration. PMID:25126019

  5. Antioxidant capacity and stability of liposomes containing a triglyceride derivative of lipoic acid

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The multi-functional nutritional agent lipoic acid offers numerous beneficial effects to oxidatively stressed tissues. Lipoic acid was enzymatically incorporated into a triglyceride in conjunction with oleic acid, creating lipoyl dioleoylglycerol, and then chemically reduced to form dihydrolipoyl d...

  6. Lipoic acid - biological activity and therapeutic potential.

    PubMed

    Gorąca, Anna; Huk-Kolega, Halina; Piechota, Aleksandra; Kleniewska, Paulina; Ciejka, Elżbieta; Skibska, Beata

    2011-01-01

    α-Lipoic acid (LA; 5-(1,2-dithiolan-3-yl)pentanoic acid) was originally isolated from bovine liver by Reed et al. in 1951. LA was once considered a vitamin. Subsequently, it was found that LA is not a vitamin and is synthesized by plants and animals. LA is covalently bound to the ε-amino group of lysine residues and functions as a cofactor for mitochondrial enzymes by catalyzing the oxidative decarboxylation of pyruvate, α-ketoglutarate and branched-chain α-keto acids. LA and its reduced form - dihydrolipoic acid (DHLA), meet all the criteria for an ideal antioxidant because they can easily quench radicals, can chelate metals, have an amphiphlic character and they do not exhibit any serious side effects. They interact with other antioxidants and can regenerate them. For this reason, LA is called an antioxidant of antioxidants. LA has an influence on the second messenger nuclear factor κB (NF-κB) and attenuates the release of free radicals and cytotoxic cytokines. The therapeutic action of LA is based on its antioxidant properties. Current studies support its use in the ancillary treatment of many diseases, such as diabetes, cardiovascular, neurodegenerative, autoimmune diseases, cancer and AIDS. This review was undertaken to gather the most recent information regarding the therapeutic properties of LA and its possible utility in disease treatment. PMID:22001972

  7. Lipoic acid attenuates Aroclor 1260-induced hepatotoxicity in adult rats.

    PubMed

    Aly, Hamdy A A; Mansour, Ahmed M; Hassan, Memy H; Abd-Ellah, Mohamed F

    2016-08-01

    The present study was aimed to investigate the mechanistic aspect of Aroclor 1260-induced hepatotoxicity and its protection by lipoic acid. The adult male Albino rats were divided into six groups. Group I served as control. Group II received lipoic acid (35 mg/kg/day). Aroclor 1260 was given to rats by oral gavage at doses 20, 40, or 60 mg/kg/day (Groups III, IV, and V, respectively). Group VI was pretreated with lipoic acid (35 mg/kg/day) 24 h before Aroclor 1260 (40 mg/kg/day). Treatment in all groups was continued for further 15 consecutive days. Serum alanine aminotransferase, aspartate aminotransferase, alkaline phosphatase, and lactate dehydrogenase activities and total bilirubin, total cholesterol, and triglycerides were significantly increased while total protein, total albumin, and high-density lipoprotein were significantly decreased. Hydrogen peroxide production and lipid peroxidation were significantly increased while superoxide dismutase and catalase activities and reduced glutathione (GSH) content was significantly decreased in liver. Caspase-3 & -9 activities were significantly increased in liver. Lipoic acid pretreatment significantly reverted all these abnormalities toward their normal levels. In conclusion, Aroclor 1260 induced liver dysfunction, at least in part, by induction of oxidative stress. Apoptotic effect of hepatic cells is involved in Aroclor 1260-induced liver injury. Lipoic acid could protect rats against Aroclor 1260-induced hepatotoxicity. © 2014 Wiley Periodicals, Inc. Environ Toxicol 31: 913-922, 2016. PMID:25533183

  8. A Novel Two-Gene Requirement for the Octanoyltransfer Reaction of Bacillus subtilis Lipoic Acid Biosynthesis

    PubMed Central

    Martin, Natalia; Christensen, Quin H.; Mansilla, María C.; Cronan, John E.; de Mendoza, Diego

    2011-01-01

    SUMMARY The Bacillus subtilis genome encodes three apparent lipoyl ligase homologues: yhfJ, yqhM, and ywfL which we have renamed lplJ, lipM and lipL, respectively. We show that LplJ encodes the sole lipoyl ligase of this bacterium. Physiological and biochemical characterization of a ΔlipM strain showed that LipM is absolutely required for the endogenous lipoylation of all lipoate-dependent proteins, confirming its role as the B. subtilis octanoyltransferase. However, we also report that in contrast to E. coli, B. subtilis requires a third protein for lipoic acid assembly, LipL. B. subtilis ΔlipL strains are unable to synthesize lipoic acid despite the presence of LipM and the sulfur insertion enzyme, LipA, which should suffice for lipoic acid biosynthesis based on the E. coli model. LipM is only required for the endogenous lipoylation pathway, whereas LipL also plays a role in lipoic acid scavenging. Expression of E. coli lipB allows growth of B. subtilis ΔlipL or ΔlipM strains in the absence of supplements. In contrast, growth of an E. coli ΔlipB strain can be complemented with lipM, but not lipL. These data together with those of the companion paper (Christensen et al., 2011) provide evidence that LipM and LipL catalyze sequential reactions in a novel pathway for lipoic acid biosynthesis. PMID:21338420

  9. Lipoic Acid Metabolism of Plasmodium - A Suitable Drug Target

    PubMed Central

    Storm, Janet; Müller, Sylke

    2012-01-01

    α-Lipoic acid (6,8-thioctic acid; LA) is a vital co-factor of α-ketoacid dehydrogenase complexes and the glycine cleavage system. In recent years it was shown that biosynthesis and salvage of LA in Plasmodium are necessary for the parasites to complete their complex life cycle. LA salvage requires two lipoic acid protein ligases (LplA1 and LplA2). LplA1 is confined to the mitochondrion while LplA2 is located in both the mitochondrion and the apicoplast. LplA1 exclusively uses salvaged LA and lipoylates α-ketoglutarate dehydrogenase, branched chain α-ketoacid dehydrogenase and the H-protein of the glycine cleavage system. LplA2 cannot compensate for the loss of LplA1 function during blood stage development suggesting a specific function for LplA2 that has yet to be elucidated. LA salvage is essential for the intra-erythrocytic and liver stage development of Plasmodium and thus offers great potential for future drug or vaccine development. LA biosynthesis, comprising octanoyl-acyl carrier protein (ACP) : protein N-octanoyltransferase (LipB) and lipoate synthase (LipA), is exclusively found in the apicoplast of Plasmodium where it generates LA de novo from octanoyl-ACP, provided by the type II fatty acid biosynthesis (FAS II) pathway also present in the organelle. LA is the co-factor of the acetyltransferase subunit of the apicoplast located pyruvate dehydrogenase (PDH), which generates acetyl-CoA, feeding into FAS II. LA biosynthesis is not vital for intra-erythrocytic development of Plasmodium, but the deletion of several genes encoding components of FAS II or PDH was detrimental for liver stage development of the parasites indirectly suggesting that the same applies to LA biosynthesis. These data provide strong evidence that LA salvage and biosynthesis are vital for different stages of Plasmodium development and offer potential for drug and vaccine design against malaria. PMID:22607141

  10. Lipoic acid metabolism of Plasmodium--a suitable drug target.

    PubMed

    Storm, Janet; Müller, Sylke

    2012-01-01

    α-Lipoic acid (6,8-thioctic acid; LA) is a vital co-factor of α-ketoacid dehydrogenase complexes and the glycine cleavage system. In recent years it was shown that biosynthesis and salvage of LA in Plasmodium are necessary for the parasites to complete their complex life cycle. LA salvage requires two lipoic acid protein ligases (LplA1 and LplA2). LplA1 is confined to the mitochondrion while LplA2 is located in both the mitochondrion and the apicoplast. LplA1 exclusively uses salvaged LA and lipoylates α-ketoglutarate dehydrogenase, branched chain α-ketoacid dehydrogenase and the H-protein of the glycine cleavage system. LplA2 cannot compensate for the loss of LplA1 function during blood stage development suggesting a specific function for LplA2 that has yet to be elucidated. LA salvage is essential for the intra-erythrocytic and liver stage development of Plasmodium and thus offers great potential for future drug or vaccine development. LA biosynthesis, comprising octanoyl-acyl carrier protein (ACP) : protein N-octanoyltransferase (LipB) and lipoate synthase (LipA), is exclusively found in the apicoplast of Plasmodium where it generates LA de novo from octanoyl-ACP, provided by the type II fatty acid biosynthesis (FAS II) pathway also present in the organelle. LA is the co-factor of the acetyltransferase subunit of the apicoplast located pyruvate dehydrogenase (PDH), which generates acetyl-CoA, feeding into FAS II. LA biosynthesis is not vital for intra-erythrocytic development of Plasmodium, but the deletion of several genes encoding components of FAS II or PDH was detrimental for liver stage development of the parasites indirectly suggesting that the same applies to LA biosynthesis. These data provide strong evidence that LA salvage and biosynthesis are vital for different stages of Plasmodium development and offer potential for drug and vaccine design against malaria. PMID:22607141

  11. Physicochemical Profiling of α-Lipoic Acid and Related Compounds.

    PubMed

    Mirzahosseini, Arash; Szilvay, András; Noszál, Béla

    2016-07-01

    Lipoic acid, the biomolecule of vital importance following glycolysis, shows diversity in its thiol/disulfide equilibria and also in its eight different protonation forms of the reduced molecule. In this paper, lipoic acid, lipoamide, and their dihydro derivatives were studied to quantify their solubility, acid-base, and lipophilicity properties at a submolecular level. The acid-base properties are characterized in terms of six macroscopic, 12 microscopic protonation constants, and three interactivity parameters. The species-specific basicities, the pH-dependent distribution of the microspecies, and lipophilicity parameters are interpreted by various intramolecular effects, and contribute to understanding the antioxidant, chelate-forming, and enzyme cofactor behavior of the molecules observed. PMID:27272749

  12. alpha-Lipoic acid as a biological antioxidant.

    PubMed

    Packer, L; Witt, E H; Tritschler, H J

    1995-08-01

    alpha-Lipoic acid, which plays an essential role in mitochondrial dehydrogenase reactions, has recently gained considerable attention as an antioxidant. Lipoate, or its reduced form, dihydrolipoate, reacts with reactive oxygen species such as superoxide radicals, hydroxyl radicals, hypochlorous acid, peroxyl radicals, and singlet oxygen. It also protects membranes by interacting with vitamin C and glutathione, which may in turn recycle vitamin E. In addition to its antioxidant activities, dihydrolipoate may exert prooxidant actions through reduction of iron. alpha-Lipoic acid administration has been shown to be beneficial in a number of oxidative stress models such as ischemia-reperfusion injury, diabetes (both alpha-lipoic acid and dihydrolipoic acid exhibit hydrophobic binding to proteins such as albumin, which can prevent glycation reactions), cataract formation, HIV activation, neurodegeneration, and radiation injury. Furthermore, lipoate can function as a redox regulator of proteins such as myoglobin, prolactin, thioredoxin and NF-kappa B transcription factor. We review the properties of lipoate in terms of (1) reactions with reactive oxygen species; (2) interactions with other antioxidants; (3) beneficial effects in oxidative stress models or clinical conditions. PMID:7649494

  13. Nonlinear Optical Properties of Au-Nanoparticles Conjugated with Lipoic Acid in Water

    NASA Astrophysics Data System (ADS)

    Trejo-Durán, M.; Cornejo-Monroy, D.; Alvarado-Méndez, E.; Olivares-Vargas, A.; Castano, V. M.

    2014-08-01

    Gold nanoparticles were chemically conjugated with lipoic acid to control their optical properties. Z-scan and other optical techniques were used to characterize the non-linear behavior of the resulting nanostructured materials. The results show that the nonlinearity is of thermal origin, which can be controlled by the use of lipoic acid as well as other organic molecules conjugated onto metal nanoparticles. In particular, the presence of lipoic acid increases n_2 and dn/dT.

  14. Comparison of antioxidant effectiveness of lipoic acid and dihydrolipoic acid.

    PubMed

    Zhao, Feng; Liu, Zai-Qun

    2011-01-01

    The abilities of dihydrolipoic acid (DHLA) to scavenge peroxynitrite (ONOO(-) ), galvinoxyl radical, 2,2'-azinobis(3-ethylbenzothiazoline-6-sulfonate) cation radical (ABTS(+•) ), and 2,2'-diphenyl-1-picrylhydrazyl radical (DPPH) were higher than those of lipoic acid (LA). The effectiveness of DHLA to protect methyl linoleate against 2,2'-azobis(2-amidinopropane hydrochloride) (AAPH)-induced oxidation was about 2.2-fold higher than that of LA, and DHLA can retard the autoxidation of linoleic acid (LH) in the β-carotene-bleaching test. DHLA can also trap ∼0.6 radicals in AAPH-induced oxidation of LH. Moreover, DHLA can scavenge ∼2.0 radicals in AAPH-induced oxidation of DNA and AAPH-induced hemolysis of erythrocytes, whereas LA can scavenge ∼1.5 radicals at the same experimental conditions. DHLA can protect erythrocytes against hemin-induced hemolysis, but accelerate the degradation of DNA in the presence of Cu(2+) . Therefore, the antioxidant capacity of -SH in DHLA is higher than S-S in LA. PMID:21812071

  15. Biotin and Lipoic Acid: Synthesis, Attachment, and Regulation.

    PubMed

    Cronan, John E

    2014-05-01

    Two vitamins, biotin and lipoic acid, are essential in all three domains of life. Both coenzymes function only when covalently attached to key metabolic enzymes. There they act as "swinging arms" that shuttle intermediates between two active sites (= covalent substrate channeling) of key metabolic enzymes. Although biotin was discovered over 100 years ago and lipoic acid 60 years ago, it was not known how either coenzyme is made until recently. In Escherichia coli the synthetic pathways for both coenzymes have now been worked out for the first time. The late steps of biotin synthesis, those involved in assembling the fused rings, were well described biochemically years ago, although recent progress has been made on the BioB reaction, the last step of the pathway in which the biotin sulfur moiety is inserted. In contrast, the early steps of biotin synthesis, assembly of the fatty acid-like "arm" of biotin were unknown. It has now been demonstrated that the arm is made by using disguised substrates to gain entry into the fatty acid synthesis pathway followed by removal of the disguise when the proper chain length is attained. The BioC methyltransferase is responsible for introducing the disguise, and the BioH esterase is responsible for its removal. In contrast to biotin, which is attached to its cognate proteins as a finished molecule, lipoic acid is assembled on its cognate proteins. An octanoyl moiety is transferred from the octanoyl acyl carrier protein of fatty acid synthesis to a specific lysine residue of a cognate protein by the LipB octanoyltransferase followed by sulfur insertion at carbons C-6 and C-8 by the LipA lipoyl synthetase. Assembly on the cognate proteins regulates the amount of lipoic acid synthesized, and, thus, there is no transcriptional control of the synthetic genes. In contrast, transcriptional control of the biotin synthetic genes is wielded by a remarkably sophisticated, yet simple, system, exerted through BirA, a dual-function protein

  16. Biotin and Lipoic Acid: Synthesis, Attachment, and Regulation.

    PubMed

    Cronan, John E

    2008-09-01

    Two vitamins, biotin and lipoic acid, are essential in all three domains of life. Both coenzymes function only when covalently attached to key metabolic enzymes. There they act as "swinging arms" that shuttle intermediates between two active sites (= covalent substrate channeling) of key metabolic enzymes. Although biotin was discovered over 100 years ago and lipoic acid was discovered 60 years ago, it was not known how either coenzyme is made until recently. In Escherichia coli the synthetic pathways for both coenzymes have now been worked out for the first time. The late steps of biotin synthesis, those involved in assembling the fused rings, were well described biochemically years ago, although recent progress has been made on the BioB reaction, the last step of the pathway, in which the biotin sulfur moiety is inserted. In contrast, the early steps of biotin synthesis, assembly of the fatty acid-like "arm" of biotin, were unknown. It has now been demonstrated that the arm is made by using disguised substrates to gain entry into the fatty acid synthesis pathway followed by removal of the disguise when the proper chain length is attained. The BioC methyltransferase is responsible for introducing the disguise and the BioH esterase for its removal. In contrast to biotin, which is attached to its cognate proteins as a finished molecule, lipoic acid is assembled on its cognate proteins. An octanoyl moiety is transferred from the octanoyl-ACP of fatty acid synthesis to a specific lysine residue of a cognate protein by the LipB octanoyl transferase, followed by sulfur insertion at carbons C6 and C8 by the LipA lipoyl synthetase. Assembly on the cognate proteins regulates the amount of lipoic acid synthesized, and thus there is no transcriptional control of the synthetic genes. In contrast, transcriptional control of the biotin synthetic genes is wielded by a remarkably sophisticated, yet simple, system exerted through BirA, a dual-function protein that both represses

  17. Biotin and Lipoic Acid: Synthesis, Attachment and Regulation

    PubMed Central

    Cronan, John E.

    2014-01-01

    Summary Two vitamins, biotin and lipoic acid, are essential in all three domains of life. Both coenzymes function only when covalently attached to key metabolic enzymes. There they act as “swinging arms” that shuttle intermediates between two active sites (= covalent substrate channeling) of key metabolic enzymes. Although biotin was discovered over 100 years ago and lipoic acid 60 years ago, it was not known how either coenzyme is made until recently. In Escherichia coli the synthetic pathways for both coenzymes have now been worked out for the first time. The late steps of biotin synthesis, those involved in assembling the fused rings, were well-described biochemically years ago, although recent progress has been made on the BioB reaction, the last step of the pathway in which the biotin sulfur moiety is inserted. In contrast, the early steps of biotin synthesis, assembly of the fatty acid-like “arm” of biotin were unknown. It has now been demonstrated that the arm is made by using disguised substrates to gain entry into the fatty acid synthesis pathway followed by removal of the disguise when the proper chain length is attained. The BioC methyltransferase is responsible for introducing the disguise and the BioH esterase for its removal. In contrast to biotin, which is attached to its cognate proteins as a finished molecule, lipoic acid is assembled on its cognate proteins. An octanoyl moiety is transferred from the octanoyl-ACP of fatty acid synthesis to a specific lysine residue of a cognate protein by the LipB octanoyl transferase followed by sulfur insertion at carbons C6 and C8 by the LipA lipoyl synthetase. Assembly on the cognate proteins regulates the amount of lipoic acid synthesized and thus there is no transcriptional control of the synthetic genes. In contrast transcriptional control of the biotin synthetic genes is wielded by a remarkably sophisticated, yet simple, system, exerted through BirA a dual function protein that both represses

  18. Possible involvement of lipoic acid in binding protein-dependent transport systems in Escherichia coli.

    PubMed

    Richarme, G

    1985-04-01

    We describe the properties of the binding protein dependent-transport of ribose, galactose, and maltose and of the lactose permease, and the phosphoenolpyruvate-glucose phosphotransferase transport systems in a strain of Escherichia coli which is deficient in the synthesis of lipoic acid, a cofactor involved in alpha-keto acid dehydrogenation. Such a strain can grow in the absence of lipoic acid in minimal medium supplemented with acetate and succinate. Although the lactose permease and the phosphoenolypyruvate-glucose phosphotransferase are not affected by lipoic acid deprivation, the binding protein-dependent transports are reduced by 70% in conditions of lipoic acid deprivation when compared with their activity in conditions of lipoic acid supply. The remaining transport is not affected by arsenate but is inhibited by the uncoupler carbonylcyanide-m-chlorophenylhydrazone; however the lipoic acid-dependent transport is completely inhibited by arsenate and only weakly inhibited by carbonylcyanide-m-chlorophenylhydrazone. The known inhibitor of alpha-keto acid dehydrogenases, 5-methoxyindole-2-carboxylic acid, completely inhibits all binding protein-dependent transports whether in conditions of lipoic supply or deprivation; the results suggest a possible relation between binding protein-dependent transport and alpha-keto acid dehydrogenases and shed light on the inhibition of these transports by arsenicals and uncouplers. PMID:3920206

  19. Long-term physical and oxidative stability of liposomes containing glycerides of lipoic acid

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The acyl glycerides of lipoic and dihydrolipoic acids may serve as slow-release sources for cutaneous delivery of these antioxidants when formulated in a liposomal vehicle. Accelerated storage testing was conducted to determine the storage stability of the lipoic derivatives and of the soybean phosp...

  20. Effect of alpha-lipoic acid on memory, oxidation, and lifespan in SAMP8 mice.

    PubMed

    Farr, Susan A; Price, Tulin O; Banks, William A; Ercal, Nuran; Morley, John E

    2012-01-01

    Oxidative damage is associated with neurodegenerative disorders such as Alzheimer's disease (AD). The antioxidant alpha-lipoic acid has been found to improve memory in mouse models of AD. Here, we administered alpha-lipoic acid daily to SAMP8 mice starting at 11 months of age and continuing until death. We found that treatment with alpha-lipoic acid decreased survival from 34 weeks in those receiving vehicle to 20 weeks. A subset of 18 month old mice given alpha-lipoic acid for two weeks and then tested in an object-place recognition paradigm had improved memory. A second subset of 18 month old mice given alpha-lipoic acid for two weeks and tested in the Barnes maze had improved learning. After testing, the mice were sacrificed and indices of oxidative damage were measured in the brain tissue. The mice that received alpha-lipoic acid had significantly increased glutathione and decreased glutathione peroxidase and malondialdehyde indicating reversal of oxidative stress. These results indicate that alpha-lipoic acid improves memory and reverses indices of oxidative stress in extremely old SAMP8 mice, but decreases lifespan. These findings are similar to studies using other types of antioxidants. PMID:22785389

  1. [Role of lipoic acid in health and disease].

    PubMed

    Huk-Kolega, Halina; Skibska, Beata; Kleniewska, Paulina; Piechota, Aleksandra; Michalski, Łukasz; Goraca, Anna

    2011-09-01

    Oxidative stress disturbs organism's homeostasis and leads to excessive reactive oxygen species (ROS) production. Researchers are still focused on antioxidants that help to reduce oxidative stress level and are helpful in treatment of diseases were ROS overproduction is observed. Among those antioxidants is lipoic acid (LA). When applied systemically LA accumulates in tissues and is converted to dihyrolipoic acid (DHLA) by lipoamide dehydrogenase. Both LA and DHLA are biologically active. LA scavenges hydroxyl radical, subchloric acid and singlet oxygen. Moreover, LA is able to chelate transient ions. Therefore, LA is used in diabetic nephropaties, fungi or heavy metal intoxication, liver diseases, neurodegenerative and cardiovascular diseases. This review surveys the antioxidant ability of LA and its role in pathological states where increased concentration of ROS is observed. PMID:21991851

  2. Alpha-lipoic acid supplementation: a tool for obesity therapy?

    PubMed

    Carbonelli, M G; Di Renzo, L; Bigioni, M; Di Daniele, N; De Lorenzo, A; Fusco, M A

    2010-01-01

    Lipid peroxidation has supposed as the major biochemical alteration underling oxidant-induced cell injury in stress including numerous diseases. One of the natural molecules know to prevent or retard oxidation is alpha-lipoic acid (LA) and, therefore, the lipoic acid/dihydrolipoic acid (LA/DHLA) redox couple has received considerable attention. Recent studies have highlighted the potential of free LA and DHLA as powerful metabolic antioxidants that are able to scavenge the reactive oxygen species, to recycle other antioxidants. Our aim was to investigate the beneficial effects of LA in the treatment of Italian pre-obese and obese subjects. We screened 1612 subjects for enrollment; of these, 1127 subjects (445 men and 682 women, 18-60 age) met enrolment criteria and were enrolled in the study. According to body mass index (BMI) the 53% was obese and the 43% was pre-obese. The subjects were treated for 4 month with 800 mg/day of LA. In pre-obese subject significant reduction (p<0.001) of weight (8%, both gender), BMI (2 points), blood pressure, and abdominal circumference (female 6 cm, male 7 cm) were observed. In obese subjects significant reductions (p<0.001) of weight (9%, both gender), BMI (female 3 point, male 4 point), blood pressure and abdominal circumference (female 9 cm, male 11 cm) were observed. Our study indicated that LA is an ideal antioxidant candidate for the therapy of obesity related diseases. Further clinical studies should be considered to highlight the role and efficacy of LA treatment. PMID:20388095

  3. Effects of lipoic acid and dihydrolipoic acid on 4-aminophenol-mediated erythrocytic toxicity in vitro.

    PubMed

    Coleman, Michael D; Williams, Charlotte; Haenen, Guido R M M

    2006-09-01

    The effects of the antioxidant lipoic acid and its reduced form, dihydrolipoic acid (DHLA), were studied on the process of the erythrocytic toxicity of 4-aminophenol in human erythrocytes in vitro. 4-Aminophenol alone caused a stepwise increase in methaemoglobin formation, along with a commensurate decrease in total thiols. At 10 min., in the presence of lipoic acid alone and the thiol depletor 1-chloro-2,4-dinitrobenzene (CDNB) alone, 4-aminophenol-mediated methaemoglobin formation was significantly increased, whilst thiol levels were significantly reduced compared with the 4-aminophenol alone. At 10 min., with DHLA and CDNB alone, 4-aminophenol was associated with significantly increased methaemoglobin formation. However, thiol levels were not significantly different in the presence of DHLA compared with 4-aminophenol alone, although thiol levels were different compared with control (4-aminophenol alone) in the incubations with CDNB alone. At 15 min., only CDNB/4-aminophenol methaemoglobin formation differed from control, whilst thiol levels were significantly lower in the presence of CDNB alone compared with 4-aminophenol alone. Lipoic acid enhanced the toxicity of 4-aminophenol in terms of increased methaemoglobin formation coupled with increased thiol depletion, whilst DHLA showed increased 4-aminophenol-mediated methaemoglobin formation without thiol depletion. Lipoic acid, and to a lesser extent its reduced derivative DHLA, acted as a prooxidant in the presence of 4-aminophenol, enhancing the oxidative stress effects of the amine in human erythrocytes. PMID:16930295

  4. Yeast display evolution of a kinetically efficient 13-amino acid substrate for lipoic acid ligase

    PubMed Central

    Puthenveetil, Sujiet; Liu, Daniel S.; White, Katharine A.; Thompson, Samuel; Ting, Alice Y.

    2009-01-01

    E. coli lipoic acid ligase (LplA) catalyzes ATP-dependent covalent ligation of lipoic acid onto specific lysine sidechains of three acceptor proteins involved in oxidative metabolism. Our lab has shown that LplA and engineered mutants can ligate useful small-molecule probes such as alkyl azides (Nat. Biotechnol. 2007, 25, 1483–1487) and photocrosslinkers (Angew. Chem Int. Ed Engl. 2008, 47, 7018–7021) in place of lipoic acid, facilitating imaging and proteomic studies. Both to further our understanding of lipoic acid metabolism, and to improve LplA’s utility as a biotechnological platform, we have engineered a novel 13-amino acid peptide substrate for LplA. LplA’s natural protein substrates have a conserved β-hairpin structure, a conformation that is difficult to recapitulate in a peptide, and thus we performed in vitro evolution to engineer the LplA peptide substrate, called “LplA Acceptor Peptide” (LAP). A ~107 library of LAP variants was displayed on the surface of yeast cells, labeled by LplA with either lipoic acid or bromoalkanoic acid, and the most efficiently labeled LAP clones were isolated by fluorescence activated cell sorting. Four rounds of evolution followed by additional rational mutagenesis produced a “LAP2” sequence with a kcat/Km of 0.99 μM−1min−1, >70-fold better than our previous rationally-designed 22-amino acid LAP1 sequence (Nat. Biotechnol. 2007, 25, 1483–1487), and only 8-fold worse than the kcat/Km values of natural lipoate and biotin acceptor proteins. The kinetic improvement over LAP1 allowed us to rapidly label cell surface peptide-fused receptors with quantum dots. PMID:19863063

  5. Lipoic acid: energy metabolism and redox regulation of transcription and cell signaling

    PubMed Central

    Packer, Lester; Cadenas, Enrique

    2011-01-01

    The role of R-α-lipoic acid as a cofactor (lipoyllysine) in mitochondrial energy metabolism is well established. Lipoic acid non-covalently bound and exogenously administered to cells or supplemented in the diet is a potent modulator of the cell’s redox status. The diversity of beneficial effects of lipoic acid in a variety of tissues can be mechanistically viewed in terms of thiol/disulfide exchange reactions that modulate the environment’s redox and energy status. Lipoic acid-driven thiol/disulfide exchange reactions appear critical for the modulation of proteins involved in cell signaling and transcription factors. This review emphasizes the effects of lipoic acid on PI3K and AMPK signaling and related transcriptional pathways that are integrated by PGC-1α, a critical regulator of energy homoestasis. The effects of lipoic acid on the neuronal energy-redox axis are largely reviewed in terms of their outcomes for aging and age-related neurodegenerative diseases. PMID:21297908

  6. Lipoic Acid Exerts Antioxidant and Anti-inflammatory Effects in Response to Heat Shock in C2C12 Myotubes.

    PubMed

    Lee, Cheng-Tse; Chang, Li-Ching; Wu, Pei-Fung

    2016-06-01

    This study explored that lipoic acid treatment for 24 h significantly upregulated and promoted heat shock-induced catalase expression and downregulated GPx1 messenger RNA (mRNA) expression, indicating that lipoic acid exhibits antioxidant activity in the decomposition of hydrogen peroxide by upregulating catalase expression. Moreover, lipoic acid treatment for 3 h increased and promoted heat shock-induced interleukin (IL)-6 mRNA and protein levels and that for 24 h downregulated IL-6 mRNA expression, suggesting a dual effect of lipoic acid on IL-6 regulation. Lipoic acid alone failed to increase or reduce tumor necrosis factor (TNF)-α mRNA and protein levels, whereas heat shock alone downregulated TNF-α mRNA and protein expression. These data suggest that lipoic acid does not have a proinflammatory role and that heat shock acts as an anti-inflammatory agent by downregulating TNF-α expression in C2C12 myotubes. Moreover, lipoic acid or heat shock alone upregulated the IL-6 receptor (IL-6R-α) and glycoprotein 130 (gp130) mRNA expression followed by IL-6 expression; these data indicate that the regulation of lipoic acid or heat shock is mediated by IL-6R signaling, thus suggesting that C2C12 myotubes possesses a mechanism for regulating IL-6R and gp130 expression following lipoic acid treatment or heat shock. PMID:27086282

  7. THE COMBINATION OF α-LIPOIC ACID INTAKE WITH ECCENTRIC EXERCISE MODULATES ERYTHROPOIETIN RELEASE

    PubMed Central

    Morawin, B.; Turowski, D.; Naczk, M.; Siatkowski, I.

    2014-01-01

    The generation of reactive nitrogen/oxygen species (RN/OS) represents an important mechanism in erythropoietin (EPO) expression and skeletal muscle adaptation to physical and metabolic stress. RN/OS generation can be modulated by intense exercise and nutrition supplements such as α-lipoic acid, which demonstrates both anti- and pro-oxidative action. The study was designed to show the changes in the haematological response through the combination of α-lipoic acid intake with running eccentric exercise. Sixteen healthy young males participated in the randomised and placebo-controlled study. The exercise trial involved a 90-min run followed by a 15-min eccentric phase at 65% VO2max (-10% gradient). It significantly increased serum concentrations of nitric oxide (NO), hydrogen peroxide (H2O2) and pro-oxidative products such as 8-isoprostanes (8-iso), lipid peroxides (LPO) and protein carbonyls (PC). α-Lipoic acid intake (Thiogamma: 1200 mg daily for 10 days prior to exercise) resulted in a 2-fold elevation of serum H2O2 concentration before exercise, but it prevented the generation of NO, 8-iso, LPO and PC at 20 min, 24 h, and 48 h after exercise. α-Lipoic acid also elevated serum EPO level, which highly correlated with NO/H2O2 ratio (r = 0.718, P < 0.01). Serum total creatine kinase (CK) activity, as a marker of muscle damage, reached a peak at 24 h after exercise (placebo 732 ± 207 IU · L-1, α-lipoic acid 481 ± 103 IU · L-1), and correlated with EPO (r = 0.478, P < 0.01) in the α-lipoic acid group. In conclusion, the intake of high α-lipoic acid modulates RN/OS generation, enhances EPO release and reduces muscle damage after running eccentric exercise. PMID:25177095

  8. Analysis of Reaction between α-Lipoic Acid and 2-Chloro-1-methylquinolinium Tetrafluoroborate Used as a Precolumn Derivatization Technique in Chromatographic Determination of α-Lipoic Acid

    PubMed Central

    Godlewska, Magdalena; Odachowska, Angelika; Turkowicz, Monika; Karpinska, Joanna

    2015-01-01

    The present study offers results of analysis concerning the course of reaction between reduced α-lipoic acid (LA) and 2-chloro-1-methylquinolinium tetrafluoroborate (CMQT). In water environments, the reaction between CMQT and hydrophilic thiols proceeds very rapidly and the resultant products are stable. For the described analysis, optimum reaction conditions, such as concentration of the reducing agent, environment pH, and concentration of the reagent were carefully selected. The spectrophotometric assay was carried out measuring absorbance at λ = 348 nm (i.e., the spectral band of the obtained reaction product). Furthermore, the calibration curve of lipoic acid was registered. It was concluded that the Lambert-Beer law was observed within the range 1–10 μmol L−1. Later, the reaction between LA and CMQT was used as precolumn derivatization in a chromatographic determination of the lipoic acid in the range 2.5–50 μmol L−1. Practical applicability of the designed methods was evaluated by determining lipoic acid in Revitanerv pharmaceutical preparation which contains 300 mg LA in a single capsule. The error of the determination did not exceed 0.5% in relation to the declared value. PMID:26504616

  9. Analysis of Reaction between α-Lipoic Acid and 2-Chloro-1-methylquinolinium Tetrafluoroborate Used as a Precolumn Derivatization Technique in Chromatographic Determination of α-Lipoic Acid.

    PubMed

    Godlewska, Magdalena; Odachowska, Angelika; Turkowicz, Monika; Karpinska, Joanna

    2015-01-01

    The present study offers results of analysis concerning the course of reaction between reduced α-lipoic acid (LA) and 2-chloro-1-methylquinolinium tetrafluoroborate (CMQT). In water environments, the reaction between CMQT and hydrophilic thiols proceeds very rapidly and the resultant products are stable. For the described analysis, optimum reaction conditions, such as concentration of the reducing agent, environment pH, and concentration of the reagent were carefully selected. The spectrophotometric assay was carried out measuring absorbance at λ = 348 nm (i.e., the spectral band of the obtained reaction product). Furthermore, the calibration curve of lipoic acid was registered. It was concluded that the Lambert-Beer law was observed within the range 1-10 μmol L(-1). Later, the reaction between LA and CMQT was used as precolumn derivatization in a chromatographic determination of the lipoic acid in the range 2.5-50 μmol L(-1). Practical applicability of the designed methods was evaluated by determining lipoic acid in Revitanerv pharmaceutical preparation which contains 300 mg LA in a single capsule. The error of the determination did not exceed 0.5% in relation to the declared value. PMID:26504616

  10. Lipoic acid suppression of neutrophil respiratory burst: effect of NADPH.

    PubMed

    O'Neill, Heidi C; Rancourt, Raymond C; White, Carl W

    2008-02-01

    Lipoic acid (LA) and its reduced product dihydrolipoic acid (DHLA) are potent antioxidants with capacity to scavenge reactive oxygen species (ROS) and recycle endogenous antioxidants. LA may increase cellular glutathione (GSH), an antioxidant lacking in the lung's epithelial lining fluid in lung disorders such as idiopathic pulmonary fibrosis (IPF). Neutrophils (PMN) are key innate responders and are pivotal in clearing bacterial infection, therefore it is crucial to understand the impact LA may have on their function. Circulating neutrophils were isolated from healthy volunteers and pretreated with LA or diluent. Cells were subsequently activated with phorbol 12-myristate 13-acetate (PMA, 100 ng/ml) to induce ROS production. SOD-inhibitable reduction of acetylated cytochrome c demonstrated the PMA-dependent respiratory burst was suppressed by LA. Oxygen consumption also was diminished when PMA-stimulated cells were pretreated with LA. PMN respiratory burst was partially restored by addition of NADPH but not other pyridine nucleotides. LA did not inhibit glucose-6-phosphate dehydrogenase activity of PMN. These data together suggest that the reduction of LA to DHLA using cellular NADPH may limit the capacity of the PMN NADPH oxidase to produce superoxide. Further studies will be required to determine if LA can diminish excessive superoxide produced by PMN and/or alveolar macrophages in IPF or relevant disease models in vivo. PMID:18158760

  11. The Effects of α-Lipoic Acid against Testicular Ischemia-Reperfusion Injury in Rats

    PubMed Central

    Ozbal, Seda; Ergur, Bekir Ugur; Erbil, Guven; Tekmen, Isıl; Bagrıyanık, Alper; Cavdar, Zahide

    2012-01-01

    Testicular torsion is one of the urologic emergencies occurring frequently in neonatal and adolescent period. Testis is sensitive to ischemia-reperfusion injury, and, therefore, ischemia and consecutive reperfusion cause an enhanced formation of reactive oxygen species that result in testicular cell damage and apoptosis. α-lipoic acid is a free radical scavenger and a biological antioxidant. It is widely used in the prevention of oxidative stress and cellular damage. We aimed to investigate the protective effect of α-lipoic acid on testicular damage in rats subjected to testicular ischemia-reperfusion injury. 35 rats were randomly divided into 5 groups: control, sham operated, ischemia, ischemia-reperfusion, and ischemia-reperfusion +lipoic acid groups, 2 h torsion and 2 h detorsion of the testis were performed. Testicular cell damage was examined by H-E staining. TUNEL and active caspase-3 immunostaining were used to detect germ cell apoptosis. GPx , SOD activity, and MDA levels were evaluated. Histological evaluation showed that α-lipoic acid pretreatment reduced testicular cell damage and decreased TUNEL and caspase-3-positive cells. Additionally, α-lipoic acid administration decreased the GPx and SOD activity and increased the MDA levels. The present results suggest that LA is a potentially beneficial agent in protecting testicular I/R in rats. PMID:23193380

  12. α-Lipoic acid as a triglyceride-lowering nutraceutical.

    PubMed

    Pashaj, Anjeza; Xia, Mengna; Moreau, Régis

    2015-12-01

    Considering the current obesity epidemic in the United States (>100 million adults are overweight or obese), the prevalence of hypertriglyceridemia is likely to grow beyond present statistics of ∼30% of the population. Conventional therapies for managing hypertriglyceridemia include lifestyle modifications such as diet and exercise, pharmacological approaches, and nutritional supplements. It is critically important to identify new strategies that would be safe and effective in lowering hypertriglyceridemia. α-Lipoic acid (LA) is a naturally occurring enzyme cofactor found in the human body in small quantities. A growing body of evidence indicates a role of LA in ameliorating metabolic dysfunction and lipid anomalies primarily in animals. Limited human studies suggest LA is most efficacious in situations where blood triglycerides are markedly elevated. LA is commercially available as dietary supplements and is clinically shown to be safe and effective against diabetic polyneuropathies. LA is described as a potent biological antioxidant, a detoxification agent, and a diabetes medicine. Given its strong safety record, LA may be a useful nutraceutical, either alone or in combination with other lipid-lowering strategies, when treating severe hypertriglyceridemia and diabetic dyslipidemia. This review examines the current evidence regarding the use of LA as a means of normalizing blood triglycerides. Also presented are the leading mechanisms of action of LA on triglyceride metabolism. PMID:26235242

  13. Impact evaluation of α-lipoic acid in gamma-irradiated erythrocytes

    NASA Astrophysics Data System (ADS)

    Desouky, Omar S.; Selim, Nabila S.; Elbakrawy, Eman M.; Rezk, Rezk A.

    2011-03-01

    This work is intended to study in vitro the ability of lipoic acid to protect erythrocytes against the oxidative damage resulting from exposure to gamma radiation through measurement of their rheological properties and to study the effects of detergent on their membrane solubility and permeability. Different doses of gamma radiation were applied: the most recommended and applied dose (25 Gy), and two higher doses, namely 50 and 100 Gy. The effect of addition of lipoic acid as well as its effect as a radioprotector was tested. The obtained results show changes in structural integrity of the erythrocyte cell membrane components as a result of oxidative damage due to gamma radiation that could be improved by pre-treatment with the antioxidant lipoic acid.

  14. Treatment of carpal tunnel syndrome with alpha-lipoic acid.

    PubMed

    Di Geronimo, G; Caccese, A Fonzone; Caruso, L; Soldati, A; Passaretti, U

    2009-01-01

    Carpal Tunnel Syndrome (CTS) is the most common peripheral mononeuropathy; its symptoms and functional limitations significantly penalize the daily activities and quality of life of many people. While surgery is reserved to most severe cases, the earlier stages of disease may be controlled by a pharmacological treatment aimed to "neuroprotection", i.e. to limiting and correcting the nerve damage. Our study was aimed to compare the efficacy of a fixed association of alpha-lipoic acid (ALA) 600 mg/die and gamma-linolenic acid (GLA) 360 mg/die, and a multivitamin B preparation (Vit B6 150 mg, Vit B1 100 mg, Vit B12 500 microg daily) for 90 days in 112 subjects with moderately severe CTS. Demographic, case-history and treatment efficacy data were collected; the Boston questionnaire was administered and the patients were evaluated by Hi-Ob scale and electro-myography. A significant reduction in both symptoms scores and functional impairment (Boston questionnaire) was observed in ALA/GLA group, while the multivitamin group experienced a slight improvement of symptoms and a deterioration of functional scores. Electromyography showed a statistically significant improvement with ALA/GLA, but not with the multivitamin product. The Hi-Ob scale showed significant efficacy of ALA/GLA in improving symptoms and functional impairment, while in the multivitamin group the improvement was significant, but less marked than in the ALA/GLA group. In conclusion, the fixed association of ALA and GLA proved to be a useful tool and may be proposed for controlling symptoms and improving the evolution of CTS, especially in the earlier stages of disease. PMID:19499849

  15. Electrooxidation of pyrrole-terminated self-assembled lipoic acid derivatives

    NASA Astrophysics Data System (ADS)

    Cabrita, Joana F.; Viana, Ana S.; Eberle, Christoph; Montforts, Franz-Peter; Mourato, Ana; Abrantes, Luisa M.

    2009-08-01

    New pyrrole derivatives, pyrrolyl lipoic acid (Py-LA 3) and dipyrrolyl lipoic acid (Py 2-LA 2) have been used for surface attachment and immobilisation on gold surfaces, by self-assembly. The electrooxidation of the surface-confined pyrroles was analysed by cyclic voltammetry and the modified electrodes morphological and thickness changes addressed by scanning probe microscopy and ellipsometry. The data support the formation of oligomers as a result of the pendant-pyrrolyl units ease oxidation but provide no evidence of an effective subsequent polymerisation.

  16. Wheat germ oil and α-lipoic acid predominantly improve the lipid profile of broiler meat.

    PubMed

    Arshad, Muhammad Sajid; Anjum, Faqir Muhammad; Khan, Muhammad Issa; Shahid, Muhammad

    2013-11-20

    In response to recent assertions that synthetic antioxidants may have the potential to cause toxic effects and to consumers' increased attention to consuming natural products, the poultry industry has been seeking sources of natural antioxidants, alone or in combination with synthetic antioxidants that are currently being used by the industry. The present study was conducted to determine the effect of α-lipoic acid, α-tocopherol, and wheat germ oil on the status of antioxidant enzymes, fatty acid profile, and serum biochemical profile of broiler blood. One-day-old (180) broiler birds were fed six different feeds varying in their antioxidant content: no addition (T1), natural α-tocopherol (wheat germ oil, T2), synthetic α-tocopherol (T3), α-lipoic acid (T4), α-lipoic acid together with natural α-tocopherol (T5), and α-lipoic acid together with synthetic α-tocopherol (T6). The composition of saturated and unsaturated fatty acids in the breast and leg meat was positively influenced by the different dietary supplements. The content of fatty acid was significantly greater in broilers receiving T2 both in breast (23.92%) and in leg (25.82%) meat, whereas lower fatty acid levels was found in broilers receiving diets containing T6 in the breast (19.57%) and leg (21.30%) meat. Serum total cholesterol (113.42 mg/dL) and triglycerides (52.29 mg/dL) were lowest in the group given natural α-tocopherol and α-lipoic acid. Wheat germ oil containing natural α-tocopherol alone or with α-lipoic acid was more effective than synthetic α-tocopherol in raising levels of antioxidant enzymes superoxide dismutase, catalase, and glutathione reductase while lowering plasma total cholesterol, low-density lipoprotein, and triglycerides and raising high-density lipoprotein and plasma protein significantly. It was concluded that the combination of wheat germ oil and α-lipoic acid is helpful in improving the lipid profile of broilers. PMID:24191686

  17. Comparison of the Protective Effects of Radix Astragali, α-Lipoic Acid, and Vitamin E on Acute Acoustic Trauma

    PubMed Central

    Xiong, Min; Lai, Huangwen; Yang, Chuanhong; Huang, Weiyi; Wang, Jian; Fu, Xiaoyan; He, Qinglian

    2012-01-01

    Objective Oxidative damage is a critical role which involves hearing loss induced by impulse noise. That exogenous antioxidant agents reduce noise induced hearing loss (NIHL) has been well demonstrated in both animal studies and clinical practices. Choosing a stronger and more effective antioxidant is very important for treatment of NIHL. Vitamin E, α-lipoic acid, and radix astragali are the most commonly used anti-oxidants for cochlear oxidative damage from acoustic trauma. In this study, the protective effects of radix astragali, α-lipoic acid, and vitamin E on acute acoustic trauma are investigated. Methods Guinea pigs in the experimental groups were intragastrically administered vitamin E, α-lipoic acid, and radix astragali. Auditory thresholds were assessed by sound-evoked auditory brainstem response (ABR) at click and tone bursts of 8, 16 and 32 kHz, 24 hours before and 72 hours after exposure to impulse noise. Cochlear malondialdehyde (MDA) concentrations were detected. Hair cell damage was analyzed by scanning electron microscopy. Results Vitamin E, α-lipoic acid, and radix astragali significantly reduced ABR deficits, reduced hair cell damage, and decreased the concentrations of MDA. α-lipoic acid and radix astragali were better than vitamin E, and there were no significant differences between α-lipoic acid and radix astragali. Conclusions α-lipoic acid or radix astragali are recommended for treatment of NIHL. PMID:24179406

  18. [Use of alpha-lipoic acid and omega-3 in postpartum pain treatment].

    PubMed

    Costantino, D; Guaraldi, C; Costantino, M; Bounous, V E

    2015-10-01

    Postpartum pain is a frequent condition that negatively affects women's quality of life, interferring with everyday life. Analgesic drugs and surgery are often contraindicated in pregnancy and during breast feeding. This review of the literature aims to evaluate the rational of the association of lipoic acid and omega-3 employ in the management of postpartum pain. Lipoic acid is a cofactor essential in mitochondrial metabolism with antioxidant and anti-inflammatory activity. Lipoic acid has been shown to be effective in neuropatic pain treatment in patients with sciatica, carpal tunnel syndrome and diabetic neuropathy. Omega-3 are known for their anti-inflammatory and neurotrophic activity. The peripheral and central activity of both substances allows to act on neuroinflammation mechanisms thus reducing cronicization of pain and also determining a potential improvement of women's emotional status. The preliminary data here presented confirm the positive effect of this association on the treatment of postpartum perineal pain. The supplementation of lipoic acid in association with omega-3 seems effective and safe for the treatment of chronic postpartum pain, allowing a pathogenetic approach to neuroinflammation, thus reducing the consumption of analgesic drugs, often contraindicated during breast-feeding. PMID:26491825

  19. Oxidative modification of lipoic acid by HNE in Alzheimer disease brain☆

    PubMed Central

    Hardas, Sarita S.; Sultana, Rukhsana; Clark, Amy M.; Beckett, Tina L.; Szweda, Luke I.; Murphy, M. Paul; Butterfield, D. Allan

    2013-01-01

    Alzheimer disease (AD) is an age-related neurodegenerative disease characterized by the presence of three pathological hallmarks: synapse loss, extracellular senile plaques (SP) and intracellular neurofibrillary tangles (NFTs). The major component of SP is amyloid β-peptide (Aβ), which has been shown to induce oxidative stress. The AD brain shows increased levels of lipid peroxidation products, including 4-hydroxy-2-nonenal (HNE). HNE can react covalently with Cys, His, or Lys residues on proteins, altering structure and function of the latter. In the present study we measured the levels of the HNE-modified lipoic acid in brain of subjects with AD and age-matched controls. Lipoic acid is a key co-factor for a number of proteins including pyruvate dehydrogenase and α-ketoglutarate dehydrogenase, key complexes for cellular energetics. We observed a significant decrease in the levels of HNE-lipoic acid in the AD brain compared to that of age-matched controls. To investigate this phenomenon further, the levels and activity of lipoamide dehydrogenase (LADH) were measured in AD and control brains. Additionally, LADH activities were measured after in-vitro HNE-treatment to mice brains. Both LADH levels and activities were found to be significantly reduced in AD brain compared to age-matched control. HNE-treatment also reduced the LADH activity in mice brain. These data are consistent with a two-hit hypothesis of AD: oxidative stress leads to lipid peroxidation that, in turn, causes oxidative dysfunction of key energy-related complexes in mitochondria, triggering neurodegeneration. This study is consonant with the notion that lipoic acid supplementation could be a potential treatment for the observed loss of cellular energetics in AD and potentiate the antioxidant defense system to prevent or delay the oxidative stress in and progression of this devastating dementing disorder. PMID:24024140

  20. Effect of alpha-lipoic acid on boar spermatozoa quality during freezing-thawing

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Alpha-lipoic acid (ALA) is known as a natural antioxidant. The aim of the present study was to evaluate the cryoprotective effect of ALA on the motility of boar sperm and the antioxidant effect of ALA on boar sperm during freezing-thawing. Different concentrations (2.0, 4.0, 6.0, 8.0, and 10.0, mg/m...

  1. Lipid Lowering Effect of Antioxidant Alpha-Lipoic Acid in Experimental Atherosclerosis

    PubMed Central

    Amom, Zulkhairi; Zakaria, Zaiton; Mohamed, Jamaluddin; Azlan, Azrina; Bahari, Hasnah; Taufik Hidayat Baharuldin, Mohd; Aris Moklas, Mohd; Osman, Khairul; Asmawi, Zanariyah; Kamal Nik Hassan, Mohd

    2008-01-01

    Accumulating data demonstrated that hypercholesterolemia and oxidative stress play an important role in the development of atherosclerosis. In the present study, a protective activity of alpha-lipoic acid; a metabolic antioxidant in hypercholesterolemic-induced animals was investigated. Eighteen adult male New Zealand White (NZW) rabbit were segregated into three groups labelled as group N, HCD and ALA (n = 6). Group N (normal control) was fed with normal chow, the rest (HCD and ALA) were fed with 100 g/head/day of 1% cholesterol rich diet to induce hypercholesterolemia. Four point two mg/body weight of alpha lipoic acid was concomintantly supplemented to the ALA group. Drinking water was given ad-libitum. The study was designed for 10 weeks. Blood sampling was taken from the ear lobe vein at the beginning, week 5 and week 10. Plasma was prepared for lipid profile estimation and microsomal lipid peroxidation index indicated with malondialdehyde (MDA) formation. At the end of the experiment, the animals were sacrificed and the aorta were excised for intimal lesion analysis. The plasma total cholesterol (TC) and low density lipoprotein (LDL) levels were found to be significantly low in ALA group compared to that of the HCD group (p<0.05). Similarly, low level of MDA (p<0.05) in ALA group was observed compared to that of the HCD group showing a significant reduction of lipid peroxidation activity. Histomorphometric intimal lesion analysis of the aorta showing less of atheromatous plaque formation in alpha lipoic acid supplemented group (p<0.05) compared to HCD group. These findings suggested that alpha lipoic acid posses a dual lipid lowering and anti-atherosclerotic properties indicated with low plasma TC and LDL levels and reduction of athero-lesion formation in hypercholesterolemic-induced rabbits. PMID:18818758

  2. Alpha-lipoic acid loaded in chitosan conduit enhances sciatic nerve regeneration in rat

    PubMed Central

    Azizi, Saeed; Heshmatian, Behnam; Amini, Keyvan; Raisi, Abbas; Azimzadeh, Mohammad

    2015-01-01

    Objective(s): To investigate the effect of topical administration of alpha-lipoic acid into chitosan conduit on peripheral nerve regeneration using a rat sciatic nerve transection model. Materials and Methods: Forty five Wistar rats were divided into three experimental groups randomly. A 10-mm gap of sciatic nerve was bridged with a chitosan conduit following surgical preparation and anesthesia. In treatment group, the conduit was filled with 30 µl alpha-lipoic acid (10 mg/kg/bw).It was filled with 30 µl phosphate buffered saline solution in control group. In Sham group sciatic nerve was just exposed. Results: The recovery of nerve function was faster in treatment group than in control, at 4 and 8 weeks after surgery (P-value<0.05). Conduction velocity was better in treatment group than in control group at 4 and 12 weeks (P-value<0.05). Recovery index was higher in treatment group than the control group, 8 weeks after surgery (P-value <0.05). Greater nerve fiber diameter, axon diameter, and myelin sheath thickness were observed in treatment group compared to control group at 8 and 12 weeks after surgery (P-value<0.05). The immunoreactivity of regenerated axons and myelin sheath in treatment group were far more similar to sham group. Conclusion: Alpha-lipoic acid when loaded in a chitosan conduit could improve transected sciatic nerve regeneration in rat. PMID:25945234

  3. Investigation of Enantioselective Membrane Permeability of α-Lipoic Acid in Caco-2 and MDCKII Cell.

    PubMed

    Uchida, Ryota; Okamoto, Hinako; Ikuta, Naoko; Terao, Keiji; Hirota, Takashi

    2016-01-01

    α-Lipoic acid (LA) contains a chiral carbon and exists as two enantiomers (R-α-lipoic acid (RLA) and S-α-lipoic acid (SLA)). We previously demonstrated that oral bioavailability of RLA is better than that of SLA. This difference arose from the fraction absorbed multiplied by gastrointestinal availability (F(a) × F(g)) and hepatic availability (F(h)) in the absorption phase. However, it remains unclear whether F(a) and/or F(g) are involved in enantioselectivity. In this study, Caco-2 cells and Madin-Darby canine kidney strain II cells were used to assess the enantioselectivity of membrane permeability. LA was actively transported from the apical side to basal side, regardless of the differences in its steric structure. Permeability rates were proportionally increased in the range of 10-250 µg LA/mL, and the permeability coefficient did not differ significantly between enantiomers. Hence, we conclude that enantioselective pharmacokinetics arose from the metabolism (F(h) or F(g) × F(h)), and definitely not from the membrane permeation (F(a)) in the absorption phase. PMID:26821014

  4. Alpha-lipoic acid as a pleiotropic compound with potential therapeutic use in diabetes and other chronic diseases.

    PubMed

    Gomes, Marilia Brito; Negrato, Carlos Antonio

    2014-01-01

    Alpha-lipoic acid is a naturally occurring substance, essential for the function of different enzymes that take part in mitochondria's oxidative metabolism. It is believed that alpha-lipoic acid or its reduced form, dihydrolipoic acid have many biochemical functions acting as biological antioxidants, as metal chelators, reducers of the oxidized forms of other antioxidant agents such as vitamin C and E, and modulator of the signaling transduction of several pathways. These above-mentioned actions have been shown in experimental studies emphasizing the use of alpha-lipoic acid as a potential therapeutic agent for many chronic diseases with great epidemiological as well economic and social impact such as brain diseases and cognitive dysfunctions like Alzheimer disease, obesity, nonalcoholic fatty liver disease, burning mouth syndrome, cardiovascular disease, hypertension, some types of cancer, glaucoma and osteoporosis. Many conflicting data have been found concerning the clinical use of alpha-lipoic acid in the treatment of diabetes and of diabetes-related chronic complications such as retinopathy, nephropathy, neuropathy, wound healing and diabetic cardiovascular autonomic neuropathy. The most frequent clinical condition in which alpha-lipoic acid has been studied was in the management of diabetic peripheral neuropathy in patients with type 1 as well type 2 diabetes. Considering that oxidative stress, a imbalance between pro and antioxidants with excessive production of reactive oxygen species, is a factor in the development of many diseases and that alpha-lipoic acid, a natural thiol antioxidant, has been shown to have beneficial effects on oxidative stress parameters in various tissues we wrote this article in order to make an up-to-date review of current thinking regarding alpha-lipoic acid and its use as an antioxidant drug therapy for a myriad of diseases that could have potential benefits from its use. PMID:25104975

  5. Inhibition of Pseudomonas aeruginosa biofilm formation by 2,2’-bipyridyl, lipoic, kojic and picolinic acids

    PubMed Central

    Çevik, Kübra; Ulusoy, Seyhan

    2015-01-01

    Objective(s): The inhibitory effects of iron chelators, and FeCl3 chelation on biofilm formation and swarming motility were investigated against an opportunistic human pathogen Pseudomonas aeruginosa. Materials and Methods: The inhibitory activity of 2,2’-bipyridyl, lipoic acid, kojic acid and picolinic acid on biofilm formation of P. aeruginosa strain PAO1 and three clinical isolates (P. aeruginosa PAK01, P. aeruginosa PAK02 and P. aeruginosa PAK03) were investigated, based on crystal violet assay, and swarming motility test. Results: The kojic, lipoic and picolinic acid inhibited biofilm formation by 5-33% in all tested P. aeruginosa isolates. When chelated iron was added, biofilm inhibition rates were determined to be 39-57%. Among the tested chelators against P. aeruginosa, lipoic acid (84%) and kojic acid (68%) presented the highest inhibition of swarming motility. This is the first study to report the inhibitory effect of lipoic acid on biofilm formation and swarming motility of P. aeruginosa. Conclusion: It is considered that lipoic and picolinic acids can serve as alternatives for the treatment of the P. aeruginosa infections by inhibiting biofilm formation. PMID:26557964

  6. The effect of biothiol on UV irradiated alpha-lipoic acid.

    PubMed

    Wada, Naoki; Wakami, Hirotaka; Konishi, Tetsuya; Matsugo, Seiichi

    2008-01-01

    alpha-Lipoic acid (LA) and its reduced form dihydrolipoic acid (DHLA) are well known as strong antioxidants. LA has the characteristic distorted five membered 1,2-dithiolane ring, which is quite vulnerable to UV irradiation. The UV induced decomposition of LA and the effect of the following addition of biothiols to the photoirradiated solution of LA were investigated by UV-vis spectrometry and (1)H NMR spectral analysis. The mechanism of UV irradiated LA decomposition was proposed based on the results obtained from NMR and GPC measurements. PMID:19850983

  7. Prevention of chromate induced oxidative stress by alpha-lipoic acid.

    PubMed

    Budhwar, Roli; Kumar, Sushil

    2005-06-01

    The parenteral administration of alpha-lipoic acid (LA) protected against chromate induced oxidative stress in mouse liver. A shift in Cr induced pro-oxidant state to antioxidant-state by LA was noteworthy. The degree of protection was significant and similar in different LA administration regimens (prior-, co- and post- parenteral Cr exposure) explored. An improved status of the tissue antioxidants by LA appeared to be the mechanism of mitigation. The results are of chemopreventive value and suggest a possible alternative to ascorbic acid for abrogation of Cr toxicity. PMID:15997482

  8. Lipoic acid and dihydrolipoic acid. A comprehensive theoretical study of their antioxidant activity supported by available experimental kinetic data.

    PubMed

    Castañeda-Arriaga, Romina; Alvarez-Idaboy, J Raul

    2014-06-23

    The free radical scavenging activity of lipoic acid (LA) and dihydrolipoic acid (DHLA) has been studied in nonpolar and aqueous solutions, using the density functional theory and several oxygen centered radicals. It was found that lipoic acid is capable of scavenging only very reactive radicals, while the dehydrogenated form is an excellent scavenger via a hydrogen transfer mechanism. The environment plays an important role in the free radical scavenging activity of DHLA because in water it is deprotonated, and this enhances its activity. In particular, the reaction rate constant of DHLA in water with an HOO(•) radical is close to the diffusion limit. This has been explained on the basis of the strong H-bonding interactions found in the transition state, which involve the carboxylate moiety, and it might have implications for other biological systems in which this group is present. PMID:24881907

  9. Synthesis, pulse radiolysis, and in vitro radioprotection studies of melatoninolipoamide, a novel conjugate of melatonin and alpha-lipoic acid.

    PubMed

    Venkatachalam, S R; Salaskar, A; Chattopadhyay, A; Barik, A; Mishra, B; Gangabhagirathi, R; Priyadarsini, K I

    2006-09-15

    A novel conjugate of melatonin 2 and alpha-lipoic acid 4 has been prepared using DCC mediated coupling. The conjugate named melatoninolipoamide has been assigned its structure 1 on the basis of spectral analysis (UV, IR, NMR, and EI-MS). Pulse radiolysis studies of the conjugate were carried out in aqueous solutions with both oxidizing and reducing radicals. The results indicate that the melatonin moiety of the conjugate reacts preferably with oxidizing radicals and the lipoic acid moiety exhibits preferential reaction with reducing radicals. The in vitro radioprotection ability of 1 was examined by gamma-radiation induced lipid peroxidation in liposomes and hemolysis of erythrocytes, and compared the results with those of melatonin and alpha-lipoic acid. The studies suggest that the conjugate can be explored as a probable radioprotector. PMID:16766192

  10. CUTANEOUS DELIVERY OF α-TOCOPHEROL AND LIPOIC ACID USING MICROEMULSIONS: INFLUENCE OF COMPOSITION AND CHARGE

    PubMed Central

    Cichewicz, Allie; Pacleb, Chelsea; Connors, Ashley; Hass, Martha A.; Lopes, Luciana B.

    2013-01-01

    Objectives To assess whether the composition and charge of microemulsions affect their ability to simultaneously deliver α-tocopherol and lipoic acid into viable skin layers. Methods α-tocopherol and lipoic acid were added (1.1 and 0.5% w/w, respectively) to decylglucoside-based microemulsions containing mono-dicaprylin. Microemulsions containing surfactant:oil:water (w/w/w) at 60:30:10 (ME-O) and 46:23:31 (ME-W), as well as a cationic form of ME-W containing 1% phytosphingosine (ME-Wphy) were characterized, and their ability to disrupt the skin barrier and deliver the antioxidants in vitro in the skin was evaluated. Antioxidant activity in ME-Wphy-treated skin was assessed using the thiobarbituric acid-reactive substances (TBARS) assay. Key findings internal phase diameters of microemulsions ranged between 47.0–53.2 nm; phytosphingosine addition and pH adjustment to 5.0 increased zeta potential from −4.3 to +29.1 mV. ME-O displayed w/o structure, whereas ME-W and ME-Wphy were consistent with o/w. Microemulsions affected skin electrical resistance and transepidermal water loss, but did not affect lipoic acid penetration. α-Tocopherol delivery increased following the order ME-O

  11. The anticonvulant effect of cooling in comparison to α-lipoic acid: a neurochemical study.

    PubMed

    Khadrawy, Yasser A; Aboulezz, Heba S; Ahmed, Nawal A; Mohammed, Haitham S

    2013-05-01

    Brain cooling has pronounced effects on seizures and epileptic activity. The aim of the present study is to evaluate the anticonvulsant effect of brain cooling on the oxidative stress and changes in Na(+), K(+)-ATPase and acetylcholinesterase (AchE) activities during status epilepticus induced by pilocarpine in the hippocampus of adult male rat in comparison with α-lipoic acid. Rats were divided into four groups: control, rats treated with pilocarpine for induction of status epilepticus, rats treated for 3 consecutive days with α-lipoic acid before pilocarpine and rats subjected to whole body cooling for 30 min before pilocarpine. The present findings indicated that pilocarine-induced status epilepticus was accompanied by a state of oxidative stress as clear from the significant increase in lipid peroxidation (MDA) and superoxide dismutase (SOD) and significant decrease in reduced glutathione and nitric oxide (NO) levels and the activities of catalase, AchE and Na(+), K(+)-ATPase. Pretreatment with α-lipoic acid ameliorated the state of oxidative stress and restored AchE to nearly control activity. However, Na(+), K(+)-ATPase activity showed a significant decrease. Rats exposed to cooling for 30 min before the induction of status epilepticus revealed significant increases in MDA and NO levels and SOD activity. AchE returned to control value while the significant decrease in Na(+), K(+)-ATPase persisted. The present data suggest that cooling may have an anticonvulsant effect which may be mediated by the elevated NO level. However, brain cooling may have drastic unwanted insults such as oxidative stress and the decrease in Na(+), K(+)-ATPase activity. PMID:23389664

  12. Synthesis and effects of 3-methylthiopropanoyl thiolesters of lipoic acid, methional metabolite mimics.

    PubMed

    Courvoisier, Celine; Paret, Marie Julie; Chantepie, Jacqueline; Goré, Jacques; Fournet, Guy; Quash, Gerard

    2006-02-01

    6S,8S-Bis(3-methylthiopropanoyl) thiolesters of lipoic acid were synthesized with the carboxyl moiety of lipoate modified as methyl or water soluble choline esters. Evaluation on different cell lines in culture showed that they possessed modest antiproliferative activity. However, the 6-fold decrease in IC50 (from 270 to 45 microM) observed with the water soluble 6S,8S-bis(3-methylthiopropenoyl) thiolester dehydro derivative on a human epithelial prostate cancer cell line (DU145) argues in favor of 3-methylthiopropanoyl metabolites as endogenous growth regulatory (apoptogenic) compounds derived from methionine. PMID:16387348

  13. Lipoic acid reduces inflammation in a mouse focal cortical experimental autoimmune encephalomyelitis model.

    PubMed

    Chaudhary, Priya; Marracci, Gail; Galipeau, Danielle; Pocius, Edvinas; Morris, Brooke; Bourdette, Dennis

    2015-12-15

    Cortical lesions are a crucial part of MS pathology and it is critical to determine that new MS therapies have the ability to alter cortical inflammatory lesions given the differences between white and gray matter lesions. We tested lipoic acid (LA) in a mouse focal cortical EAE model. Brain sections were stained with antibodies against CD4, CD11b and galectin-3. Compared with vehicle, treatment with LA significantly decreased CD4+ and galectin-3+ immune cells in the brain. LA treated mice had fewer galectin-3+ cells with no projections indicating decrease in the number of infiltrating monocytes. LA significantly reduces inflammation in a focal cortical model of MS. PMID:26616873

  14. Pro-oxidant actions of alpha-lipoic acid and dihydrolipoic acid.

    PubMed

    Cakatay, Ufuk

    2006-01-01

    There is strong accumulating evidence that a alpha-lipoic acid (LA) supplement is good insurance, and would markedly improve human health. LA is readily absorbed from the diet, transported to cells and reduced to dihydrolipoic acid (DHLA). Of the two compounds, DHLA evidently has greater antioxidant activity. Much research has focused on the antioxidant properties of these compounds. Aside from its antioxidant role, in vitro and in vivo studies suggest that LA and its reduced form DHLA also act as a pro-oxidant properties. Limited number of studies concerning the pro-oxidant potential of LA and DHLA were performed only in recent years. The ability of LA and/or DHLA to function as either anti- or pro-oxidants, at least in part, is determined by the type of oxidant stress and the physiological circumstances. These pro-oxidant actions suggest that LA and DHLA act by multiple mechanisms, many of which are only now being explored. LA has been reported to have a number of potentially beneficial effects in both prevention and treatment of oxygen-related diseases. Selection of appropriate pharmacological doses of LA for use in oxygen-related diseases is critical. On the other hand, much of the discussion in clinical studies has been devoted to the pro-oxidant role of LA. This aspect remains to be elucidated. In further studies, careful evaluation will be necessary for the decision in the biological system whether LA administration is beneficial or harmful. PMID:16165311

  15. Physiological and Histopathological Investigations on the Effects of α-Lipoic Acid in Rats Exposed to Malathion

    PubMed Central

    Al-Attar, Atef M.

    2010-01-01

    The present study was designed to evaluate the influence of α-lipoic acid treatment in rats exposed to malathion. Forty adult male rats were used in this study and distributed into four groups. Animals of group 1 were untreated and served as control. Rats of group 2 were orally given malathion at a dose level of 100 mg/kg body weight (BW) for a period of one month. Experimental animals of group 3 were orally given α-lipoic acid at a dose level of 20 mg/kg BW and after 3 hours exposed to malathion at the same dose given to group 2. Rats of group 4 were supplemented with α-lipoic acid at the same dose given to group 3. The activities of serum glutamic oxaloacetic acid transaminase (GOT), glutamic pyruvic acid transaminase (GPT), alkaline phosphatase (ALP), and acid phosphatase (ACP), and the values of creatinine, urea, and uric acid were statistically increased, while the values of total protein and total albumin were significantly decreased in rats exposed to malathion. Moreover, administration of malathion for one month resulted in damage of liver and kidney structures. Administration of α-lipoic acid before malathion exposure to rat can prevent severe alterations of hematobiochemical parameters and disruptions of liver and kidney structures. In conclusion, this study obviously demonstrated that pretreatment with α-lipoic acid significantly attenuated the physiological and histopathological alterations induced by malathion. Also, the present study identifies new areas of research for development of better therapeutic agents for liver, kidney, and other organs' dysfunctions and diseases. PMID:20454535

  16. Direct and indirect antioxidant properties of α-lipoic acid and therapeutic potential.

    PubMed

    Rochette, Luc; Ghibu, Stéliana; Richard, Carole; Zeller, Marianne; Cottin, Yves; Vergely, Catherine

    2013-01-01

    Diabetes has emerged as a major threat to worldwide health. The exact mechanisms underlying the disease are unknown; however, there is growing evidence that the excess generation of reactive oxygen species (ROS) associated with hyperglycemia, causes oxidative stress in a variety of tissues. In this context, various natural compounds with pleiotropic actions like α-lipoic acid (LA) are of interest, especially in metabolic diseases such as diabetes. LA, either as a dietary supplement or a therapeutic agent, modulates redox potential because of its ability to match the redox status between different subcellular compartments as well as extracellularly. Both the oxidized (disulfide) and reduced (di-thiol: dihydro-lipoic acid, DHLA) forms of LA show antioxidant properties. LA exerts antioxidant effects in biological systems through ROS quenching but also via an action on transition metal chelation. Dietary supplementation with LA has been successfully employed in a variety of in vivo models of disease associated with an imbalance of redox status: diabetes and cardiovascular diseases. The complex and intimate association between increased oxidative stress and increased inflammation in related disorders such as diabetes, makes it difficult to establish the temporal sequence of the relationship. PMID:23293044

  17. Alpha lipoic acid efficacy in burning mouth syndrome. A controlled clinical trial

    PubMed Central

    Palacios-Sánchez, Begoña; Cerero-Lapiedra, Rocío; Llamas-Martínez, Silvia; Esparza-Gómez, Germán

    2015-01-01

    Background A double-blind placebo-controlled trial was conducted in order to evaluate the efficacy of alpha lipoic acid (ALA) and determine the statistical significance of the outcome variables. Burning mouth syndrome (BMS) is defined as an oral burning sensation in the absence of clinical signs which could justify the syndrome. Recent studies suggest the existence of neurological factors as a possible cause of the disease. Material and Methods 60 patients with BMS, in two groups: case group with 600 mg/day and placebo as control group; with follow up of 2 months. Results 64% of ALA patients reported some level of improvement, with a level of maintenance of 68.75% one month after treatment. 27.6% of the placebo group also demonstrated some reduction in BMS symptoms. Conclusions Long-term evolution and the intensity of symptoms are variables that reduce the probability of improvement with ALA treatment. Key words: Burning mouth syndrome, neuropathy, alpha lipoic acid. PMID:26034927

  18. Preparation of aqueous alpha-lipoic acid dispersions with octenylsuccinylated high amylose starch.

    PubMed

    Li, Yi-Xuan; Lim, Seung-Taik

    2016-04-20

    Aqueous dispersions prepared with OSA-modified high amylose starch were investigated in comparison with native high amylose starch and beta-cyclodextrin using alpha-lipoic acid as a model substance. Alpha-lipoic acid (ALA), a lipophilic antioxidant essential for energy metabolism in human, was dispersed in gelatinized starch solutions (1.0% w/v) at different temperatures (50-90°C) and times (3-12h). High amylose starch modified with 3% OSA (dry starch base) was most favored in maximizing the dispersibility of ALA (84% recovery) under mild heating (70°C for 3h). The optimally prepared dispersion was milky white and contained particles with a narrow size distribution (200-300nm). The precipitate isolated from the dispersion contained crystalline V-complexes of ALA and amylose while the supernatant contained free ALA accounting for 1/3 of total ALA, indicating OSA-modified high amylose starch stabilized ALA either by complexing with amylose or by retarding aggregation of ALA. PMID:26876852

  19. Redox homeostasis of albumin in relation to alpha-lipoic acid and dihydrolipoic acid.

    PubMed

    Atukeren, Pinar; Aydin, Seval; Uslu, Ezel; Gumustas, M Koray; Cakatay, Ufuk

    2010-01-01

    Albumin represents the predominant circulating antioxidant agent in plasma exposed to continuous oxidative stress and a change in serum albumin structure accounts for its antioxidant properties. Alterations in the redox status of albumin may result in impairments of its biological properties. Alpha-lipoic acid (LA), a naturally occurring thiol compound found in virtually all species, is a potent antioxidant with high efficacy which is also involved in the chelation of metal ions, regeneration of antioxidants, and repair of oxidatively damaged proteins. In human body LA is rapidly reduced to dihydrolipoic acid (DHLA) after intake into the cell. Both, LA and DHLA are amphipathic molecules which act as antioxidants both in hydrophilic and lipophilic environments. The present study aimed to investigate the antioxidant/pro-oxidant effects of LA and DHLA due to their concentrations in metal-catalyzed protein oxidation (MCO) of human serum albumin (HSA). Progressive oxidative modification of albumin was found in MCO system by an increased content of protein hydroperoxides (POOH), protein carbonyl groups (PCO) which is the former's major breakdown product, and other protein oxidation markers such as advanced oxidized protein products (AOPP) and protein thiol groups (P-SH). The possible antioxidant protective effects of LA and DHLA were observed with 25 microM and 50 microM; DHLA being more influential. Protein oxidation parameters were found to be lower and P-SH levels seemed higher. However, prooxidant effects of both LA and DHLA came on the scene with increased concentrations of 75 microM and 100 microM where the latter seemed the most hazardous with contradicted results. It is clear that the loss of biological activity of human serum albumin by MCO system appears of medical relevance and if LA exerts similar effects seen in the present study, it is possible that cellular prooxidant activity can also result consuming this unique antioxidant in certain doses. PMID

  20. A combination of alpha lipoic acid and calcium hydroxycitrate is efficient against mouse cancer models: preliminary results.

    PubMed

    Schwartz, Laurent; Abolhassani, Mohammad; Guais, Adeline; Sanders, Edward; Steyaert, Jean-Marc; Campion, Frederic; Israël, Maurice

    2010-05-01

    The impact of metabolic dysregulation on tumor development has long been established. We have targeted two enzymes that are altered during carcinogenesis: pyruvate dehydrogenase (PDH), which is down-regulated, and ATP citrate lyase, which is overexpressed in cancer cells. Alpha lipoic acid is a cofactor of PDH, while hydroxycitrate is a known inhibitor of ATP citrate lyase. Our hypothesis is that a combination of these drugs may have antitumoral potential. The efficacy of these molecules was screened in vitro by treatment of different human cancer and murine cell lines. Lipoic acid reduced the cell number by 10-50% depending on concentrations (0.1-10 microM) and cell types. Calcium hydroxycitrate reduced the cell number by 5-60% at different concentrations (10-500 microM). When hydroxycitrate and lipoic acid were used together, there was a major cytotoxic effect: complete cell death was seen following 8 microM lipoic acid and 300 microM hydroxycitrate treatment for 72 h. The combination of alpha lipoic acid and hydroxycitrate was administered to healthy mice, at doses currently utilized for other indications than cancer; no demonstrable toxicity was observed. The combination was used to treat mouse syngenic cancer models: MBT-2 bladder transitional cell carcinoma, B16-F10 melanoma and LL/2 Lewis lung carcinoma. The efficacy of this combination appears similar to conventional chemotherapy (cisplatin or 5-fluorouracil) as it resulted in significant tumor growth retardation and enhanced survival. This preliminary study suggests that this combination of drugs is efficient against cancer cell proliferation both in vitro and in vivo. A clinical trial is warranted. PMID:20372858

  1. The photochemistry of lipoic acid: photoionization and observation of a triplet excited state of a disulfide.

    PubMed

    Bucher, Götz; Lu, Changyuan; Sander, Wolfram

    2005-12-01

    Under short-wavelength UV irradiation, lipoic acid (LipSS) and its reduced form, dihydrolipoic acid (DHLA), undergo photoionization processes through a bi- or monophotonic pathway. After ionization, the LipSS radical cation (LipSS*+) and radical anion (LipSS*-) are generated. LipSS*- can be converted to equimolar amounts of LipSS and DHLA through second-order decay. Triplet acetone can be quenched by LipSS and DHLA with a rate close to the diffusion-controlled limit. The mechanism was further confirmed by continuous irradiation experiments. When LipSS is directly irradiated with UVA light, the first excited triplet state of LipSS is observed, with a lifetime tau=75 ns. Characteristic reactions include triplet energy transfer to oxygen and beta-carotene and addition to isoprene. The lifetime of triplet LipSS is also shortened by addition of water and methanol. PMID:16331730

  2. Alpha-lipoic acid exhibits anti-amyloidogenicity for beta-amyloid fibrils in vitro.

    PubMed

    Ono, Kenjiro; Hirohata, Mie; Yamada, Masahito

    2006-03-24

    Inhibition of the formation of beta-amyloid fibrils (fAbeta), as well as the destabilization of preformed fAbeta in the CNS would be attractive therapeutic targets for the treatment of Alzheimer's disease (AD). Using fluorescence spectroscopic analysis with thioflavin T and electron microscopic studies, we examined the effects of alpha-lipoic acid (LA) and the metabolic product of LA, dihydrolipoic acid (DHLA), on the formation, extension, and destabilization of fAbeta at pH 7.5 at 37 degrees C in vitro. LA and DHLA dose-dependently inhibited fAbeta formation from amyloid beta-protein, as well as their extension. Moreover, they destabilized preformed fAbetas. LA and DHLA could be key molecules for the development of therapeutics for AD. PMID:16460684

  3. {alpha}-Lipoic acid exhibits anti-amyloidogenicity for {beta}-amyloid fibrils in vitro

    SciTech Connect

    Ono, Kenjiro; Hirohata, Mie; Yamada, Masahito . E-mail: m-yamada@med.kanazawa-u.ac.jp

    2006-03-24

    Inhibition of the formation of {beta}-amyloid fibrils (fA{beta}), as well as the destabilization of preformed fA{beta} in the CNS would be attractive therapeutic targets for the treatment of Alzheimer's disease (AD). Using fluorescence spectroscopic analysis with thioflavin T and electron microscopic studies, we examined the effects of {alpha}-lipoic acid (LA) and the metabolic product of LA, dihydrolipoic acid (DHLA), on the formation, extension, and destabilization of fA{beta} at pH 7.5 at 37 {sup o}C in vitro. LA and DHLA dose-dependently inhibited fA{beta} formation from amyloid {beta}-protein, as well as their extension. Moreover, they destabilized preformed fA{beta}s. LA and DHLA could be key molecules for the development of therapeutics for AD.

  4. Grafting of 4-aminomethylbenzensulfonamide-lipoic acid conjugate on gold nanoparticles

    NASA Astrophysics Data System (ADS)

    Stiti, M.; Bouzit, H.; Abdaoui, M.; Winum, J. Y.

    2012-02-01

    In this paper, we describe the synthesis of goldnanoparticles bearing aminomethylbenzensulfonamide via a lipoyl moiety. The resulting stable nanoparticles with an average size of 4.0 nm have been achieved by a facile and high-yielding one phase method, by the action of 4-aminomethylbenzensulfonamide-lipoic acid bioconjugate on chloroauric acide, using dimethylsulfoxide (DMSO) as the solvent and sodium tetrahydridoborate (NaBH4) as the reducing agent. UV-vis absorption, transmission electron microscopy (TEM) and X-ray diffraction were used to analyse the morphology and the structure of the obtained nanoparticles. Preliminary study shows that these new nanoparticles are endowed with highly and specific inhibitory activity for the isoform (IX) of carbonic anhydrase over expressed in many cancers, and are therefore attractive candidate to be used both in diagnosis and in treatment of tumours.

  5. Assembly of Lipoic Acid on Its Cognate Enzymes: an Extraordinary and Essential Biosynthetic Pathway.

    PubMed

    Cronan, John E

    2016-06-01

    Although the structure of lipoic acid and its role in bacterial metabolism were clear over 50 years ago, it is only in the past decade that the pathways of biosynthesis of this universally conserved cofactor have become understood. Unlike most cofactors, lipoic acid must be covalently bound to its cognate enzyme proteins (the 2-oxoacid dehydrogenases and the glycine cleavage system) in order to function in central metabolism. Indeed, the cofactor is assembled on its cognate proteins rather than being assembled and subsequently attached as in the typical pathway, like that of biotin attachment. The first lipoate biosynthetic pathway determined was that of Escherichia coli, which utilizes two enzymes to form the active lipoylated protein from a fatty acid biosynthetic intermediate. Recently, a more complex pathway requiring four proteins was discovered in Bacillus subtilis, which is probably an evolutionary relic. This pathway requires the H protein of the glycine cleavage system of single-carbon metabolism to form active (lipoyl) 2-oxoacid dehydrogenases. The bacterial pathways inform the lipoate pathways of eukaryotic organisms. Plants use the E. coli pathway, whereas mammals and fungi probably use the B. subtilis pathway. The lipoate metabolism enzymes (except those of sulfur insertion) are members of PFAM family PF03099 (the cofactor transferase family). Although these enzymes share some sequence similarity, they catalyze three markedly distinct enzyme reactions, making the usual assignment of function based on alignments prone to frequent mistaken annotations. This state of affairs has possibly clouded the interpretation of one of the disorders of human lipoate metabolism. PMID:27074917

  6. Alpha-lipoic acid protects against indomethacin-induced gastric oxidative toxicity by modulating antioxidant system.

    PubMed

    Kaplan, Kursat Ali; Odabasoglu, Fehmi; Halici, Zekai; Halici, Mesut; Cadirci, Elif; Atalay, Fadime; Aydin, Ozlem; Cakir, Ahmet

    2012-11-01

    Gastroprotective effects of α-lipoic acid (ALA) against oxidative gastric damage induced by indomethacin (IND) have been investigated. All doses (50, 75, 100, 150, 200, and 300 mg/kg body weight) of ALA reduced the ulcer index with 88.2% to 96.1% inhibition ratio. In biochemical analyses of stomach tissues, ALA administration decreased the level of lipid peroxidation (LPO) and activities of myeloperoxidase (MPO) and catalase (CAT) in gastric tissues, which were increased after IND application. ALA also increased the level of glutathione (GSH) and activities of superoxide dismutase (SOD) and glutathione S-transferase (GST) that were decreased in gastric damaged stomach tissues. In conclusion, the gastroprotective effect of ALA could be attributed to its ameliorating effect on the antioxidant defense systems. PMID:23057764

  7. Protective effect of α-lipoic acid against radiation-induced fibrosis in mice.

    PubMed

    Ryu, Seung-Hee; Park, Eun-Young; Kwak, Sungmin; Heo, Seung-Ho; Ryu, Je-Won; Park, Jin-Hong; Choi, Kyung-Chul; Lee, Sang-Wook

    2016-03-29

    Radiation-induced fibrosis (RIF) is one of the most common late complications of radiation therapy. We found that α-lipoic acid (α-LA) effectively prevents RIF. In RIF a mouse model, leg contracture assay was used to test the in vivo efficacy of α-LA. α-LA suppressed the expression of pro-fibrotic genes after irradiation, both in vivo and in vitro, and inhibited the up-regulation of TGF-β1-mediated p300/CBP activity. Thus, α-LA prevents radiation-induced fibrosis (RIF) by inhibiting the transcriptional activity of NF-κB through inhibition of histone acetyltransferase activity. α-LA is a new therapeutic methods that can be used in the prevention-treatment of RIF. PMID:26799284

  8. Protective effect of α-lipoic acid against radiation-induced fibrosis in mice

    PubMed Central

    Ryu, Seung-Hee; Park, Eun-Young; Kwak, Sungmin; Heo, Seung-Ho; Ryu, Je-Won; Park, Jin-hong

    2016-01-01

    Radiation-induced fibrosis (RIF) is one of the most common late complications of radiation therapy. We found that α-lipoic acid (α-LA) effectively prevents RIF. In RIF a mouse model, leg contracture assay was used to test the in vivo efficacy of α-LA. α-LA suppressed the expression of pro-fibrotic genes after irradiation, both in vivo and in vitro, and inhibited the up-regulation of TGF-β1-mediated p300/CBP activity. Thus, α-LA prevents radiation-induced fibrosis (RIF) by inhibiting the transcriptional activity of NF-κB through inhibition of histone acetyltransferase activity. α-LA is a new therapeutic methods that can be used in the prevention-treatment of RIF. PMID:26799284

  9. Alpha-Lipoic Acid Attenuates Oxidative Damage in Organs After Sepsis.

    PubMed

    Petronilho, Fabricia; Florentino, Drielly; Danielski, Lucinéia Gainski; Vieira, Luiz Carlos; Martins, Maryane Modolon; Vieira, Andriele; Bonfante, Sandra; Goldim, Mariana Pereira; Vuolo, Francieli

    2016-02-01

    Sepsis progression is linked with the imbalance between reactive oxygen species and antioxidant enzymes. Thus, the aim of this study was to evaluate the effect of alpha-lipoic acid (ALA), a powerful antioxidant, in organs of rats submitted to sepsis. Male Wistar rats were subjected to sepsis by cecal ligation puncture (CLP) and treated with ALA or vehicle. After CLP (12 and 24 h), the myeloperoxidase (MPO) activity, protein and lipid oxidative damage, and antioxidant enzymes in the liver, kidney, heart, and lung were evaluated. ALA was effective in reducing MPO activity, lipid peroxidation in the liver, and protein carbonylation only in the kidney in 12 h after CLP. In 12 h, SOD activity increased in the kidney and CAT activity in the liver and kidney with ALA treatment. Thus, ALA was able to reduce the inflammation and oxidative stress in the liver and kidney after sepsis in rats. PMID:26431839

  10. The Protective Effects of Alpha-Lipoic Acid and Coenzyme Q10 Combination on Ovarian Ischemia-Reperfusion Injury: An Experimental Study

    PubMed Central

    Bozkurt, Mehmet Fatih; Koken, Tulay; Dogan, Nurhan; Pektaş, Mine Kanat; Baskin Embleton, Didem

    2016-01-01

    Objective. This study aims to evaluate whether alpha-lipoic acid and/or coenzyme Q10 can protect the prepubertal ovarian tissue from ischemia-reperfusion injury in an experimental rat model of ovarian torsion. Materials and Methods. Forty-two female preadolescent Wistar-Albino rats were divided into 6 equal groups randomly. The sham group had laparotomy without torsion; the other groups had torsion/detorsion procedure. After undergoing torsion, group 2 received saline, group 3 received olive oil, group 4 received alpha-lipoic acid, group 5 received coenzyme Q10, and group 6 received both alpha-lipoic acid and coenzyme Q10 orally. The oxidant-antioxidant statuses of these groups were compared using biochemical measurement of oxidized/reduced glutathione, glutathione peroxidase and malondialdehyde, pathological evaluation of damage and apoptosis within the ovarian tissue, and immunohistochemical assessment of nitric oxide synthase. Results. The left ovaries of the alpha-lipoic acid + coenzyme Q10 group had significantly lower apoptosis scores and significantly higher nitric oxide synthase content than the left ovaries of the control groups. The alpha-lipoic acid + coenzyme Q10 group had significantly higher glutathione peroxidase levels and serum malondialdehyde concentrations than the sham group. Conclusions. The combination of alpha-lipoic acid and coenzyme Q10 has beneficial effects on oxidative stress induced by ischemia-reperfusion injury related to ovarian torsion. PMID:27597986

  11. The Protective Effects of Alpha-Lipoic Acid and Coenzyme Q10 Combination on Ovarian Ischemia-Reperfusion Injury: An Experimental Study.

    PubMed

    Tuncer, Ahmet Ali; Bozkurt, Mehmet Fatih; Koken, Tulay; Dogan, Nurhan; Pektaş, Mine Kanat; Baskin Embleton, Didem

    2016-01-01

    Objective. This study aims to evaluate whether alpha-lipoic acid and/or coenzyme Q10 can protect the prepubertal ovarian tissue from ischemia-reperfusion injury in an experimental rat model of ovarian torsion. Materials and Methods. Forty-two female preadolescent Wistar-Albino rats were divided into 6 equal groups randomly. The sham group had laparotomy without torsion; the other groups had torsion/detorsion procedure. After undergoing torsion, group 2 received saline, group 3 received olive oil, group 4 received alpha-lipoic acid, group 5 received coenzyme Q10, and group 6 received both alpha-lipoic acid and coenzyme Q10 orally. The oxidant-antioxidant statuses of these groups were compared using biochemical measurement of oxidized/reduced glutathione, glutathione peroxidase and malondialdehyde, pathological evaluation of damage and apoptosis within the ovarian tissue, and immunohistochemical assessment of nitric oxide synthase. Results. The left ovaries of the alpha-lipoic acid + coenzyme Q10 group had significantly lower apoptosis scores and significantly higher nitric oxide synthase content than the left ovaries of the control groups. The alpha-lipoic acid + coenzyme Q10 group had significantly higher glutathione peroxidase levels and serum malondialdehyde concentrations than the sham group. Conclusions. The combination of alpha-lipoic acid and coenzyme Q10 has beneficial effects on oxidative stress induced by ischemia-reperfusion injury related to ovarian torsion. PMID:27597986

  12. Role of α-lipoic acid in dextran sulfate sodium-induced ulcerative colitis in mice: studies on inflammation, oxidative stress, DNA damage and fibrosis.

    PubMed

    Trivedi, P P; Jena, G B

    2013-09-01

    Ulcerative colitis affects many people worldwide. Inflammation and oxidative stress play a vital role in its pathogenesis. Previously, we reported that ulcerative colitis leads to systemic genotoxicity in mice. The present study was aimed at elucidating the role of α-lipoic acid in ulcerative colitis-associated local and systemic damage in mice. Experimental colitis was induced using 3%w/v dextran sulfate sodium in drinking water for 2 cycles. α-Lipoic acid was administered in a co-treatment (20, 40, 80 mg/kg bw) and post-treatment (80 mg/kg bw) schedule. Various biochemical parameters, histological evaluation, comet and micronucleus assays, immunohistochemistry and western blot analysis were employed to evaluate the effect of α-lipoic acid in mice with ulcerative colitis. The protective effect of α-lipoic acid was mediated through the modulation of nuclear factor kappa B, cyclooxygenase-2, interleukin 17, signal transducer and activator of transcription 3, nuclear erythroid 2-related factor 2, NADPH: quinone oxidoreductase-1, matrix metalloproteinase-9 and connective tissue growth factor. Further, ulcerative colitis led to an increased gut permeability, plasma lipopolysaccharide level, systemic inflammation and genotoxicity in mice, which was reduced with α-lipoic acid treatment. The present study identifies the underlying mechanisms involved in α-lipoic acid-mediated protection against ulcerative colitis and the associated systemic damage in mice. PMID:23793040

  13. Effect of treatment with the antioxidant alpha-lipoic (thioctic) acid on heart and kidney microvasculature in spontaneously hypertensive rats.

    PubMed

    Tayebati, Seyed Khosrow; Tomassoni, Daniele; Di Cesare Mannelli, Lorenzo; Amenta, Francesco

    2016-01-01

    Endothelial cells represent an important vascular site of signaling and development of damage during ischemia, inflammation and other pathological conditions. Excessive reactive oxygen species production causes pathological activation of endothelium including exposure of cell to adhesion molecules. Intercellular adhesion molecule-1 (ICAM-1), vascular cell adhesion molecule-1 (VCAM-1) and platelet-endothelial cell adhesion molecule-1 (PECAM-1) are members of the immunoglobulin super-family which are present on the surface of endothelial cells. These molecules represent important markers of endothelial inflammation. The present study was designed to investigate, with immunochemical and immunohistochemical techniques, the effect of treatment with (+/-)-alpha lipoic (thioctic) acid and its enantiomers on heart and kidney endothelium in spontaneously hypertensive rats (SHR). Arterial hypertension is accompanied by an increased oxidative stress status in the heart characterized by thiobarbituric acid reactive substances (TBARS) and nucleic acid oxidation increase. The higher oxidative stress also modifies adhesion molecules expression. In the heart VCAM-1, which was higher than ICAM-1 and PECAM-1, was increased in SHR. ICAM-1, VCAM-1 and PECAM-1 expression was significantly greater in the renal endothelium of SHR. (+/-)-Alpha lipoic acid and (+)-alpha lipoic acid treatment significantly decreased TBARS levels, the nucleic acid oxidation and prevented adhesion molecules expression in cardiac and renal vascular endothelium. These data suggest that endothelial molecules may be used for studying the mechanisms of vascular injury on target organs of hypertension. The effects observed after treatment with (+)-alpha lipoic acid could open new perspectives for countering heart and kidney microvascular injury which represent a common feature in hypertensive end-organs damage. PMID:26207883

  14. [An endogenous dithiol with antioxidant properties: alpha-lipoic acid, potential uses in cardiovascular diseases].

    PubMed

    Ghibu, S; Richard, C; Delemasure, S; Vergely, C; Mogosan, C; Muresan, A

    2008-06-01

    Alpha-Lipoic acid (ALA) is a natural compound, chemically named 1,2-dithiolane-3-pentanoic acid, also referred to as thioctic acid. In humans, ALA is synthetized by the liver and other tissues with high metabolic activity: heart, kidney. ALA is both water and fat soluble and therefore, is widely distributed in both cellular membranes and cytosol. Recently, a greater deal of attention has been given to antioxidant function for ALA and its reduced formed: dihydrolipoic acid (DHLA). ALA scavenges hydroxyl radicals, hypochlorous acid and singlet oxygen. It may also exert antioxidant effects in biological systems through transitional metal chelation. Dihydrolipoic acid has been shown to have antioxidant but also pro-oxidant properties in systems in which hydroxyl radical was generated. ALA/DHLA ratio has the capacity to recycle endogenous antioxidants such as vitamin E. A number of experimental as well as clinical studies point to the usefulness of ALA as a therapeutic agent for such diverse conditions as diabetes, atherosclerosis, insulin resistance, neuropathy, neurodegenerative diseases and ischemia-reperfusion injury. ALA represents a potential agent on the vascular endothelium, recording to ALA/DHLA redox couple is one of the most powerful biological antioxidant systems. PMID:18571145

  15. Simultaneous determination of lipoic acid (LA) and dihydrolipoic acid (DHLA) in human plasma using high-performance liquid chromatography coupled with electrochemical detection.

    PubMed

    Khan, Abad; Iqbal, Zafar; Watson, David G; Khan, Amirzada; Khan, Inamullah; Muhammad, Naveed; Muhammad, Salar; Nasib, Hashmat Ara; Iqbal, Naveed; Faiz-Ur-Rehman; Kashif, Muhammad

    2011-06-15

    A fast, simple, and a reliable high-performance liquid chromatography linked with electrochemical detector (HPLC-ECD) method for the assessment of lipoic acid (LA) and dihydrolipoic acid (DHLA) in plasma was developed using naproxen sodium as an internal standard (IS) and validated according to standard guidelines. Extraction of both analytes and IS from plasma (250 μl) was carried out with a single step liquid-liquid extraction applying dichloromethane. The separated organic layer was dried under stream of nitrogen at 40°C and the residue was reconstituted with the mobile phase. Complete separation of both compounds and IS at 30°C on Discovery HS C18 RP column (250 mm × 4.6 mm, 5 μm) was achieved in 9 min using acetonitrile: 0.05 M phosphate buffer (pH 2.4 adjusted with phosphoric acid) (52:48, v/v) as a mobile phase pumped at flow rate of 1.5 ml min(-1) using electrochemical detector in DC mode at the detector potential of 1.0 V. The limit of detection and limit of quantification for lipoic acid were 500 pg/ml and 3 ng/ml, and for dihydrolipoic acid were 3 ng/ml and 10 ng/ml, respectively. The absolute recoveries of lipoic acid and dihydrolipoic acid determined on three nominal concentrations were in the range of 93.40-97.06, and 93.00-97.10, respectively. Similarly coefficient of variations (% CV) for both intra-day and inter-day were between 0.829 and 3.097% for lipoic acid and between 1.620 and 5.681% for dihydrolipoic acid, respectively. This validated method was applied for the analysis of lipoic acid/dihydrolipoic acid in the plasma of human volunteers and will be used for the quantification of these compounds in patients with oxidative stress induced pathologies. PMID:21550862

  16. Lipoic acid entrains the hepatic circadian clock and lipid metabolic proteins that have been desynchronized with advanced age

    SciTech Connect

    Keith, Dove; Finlay, Liam; Butler, Judy; Gómez, Luis; Smith, Eric; Moreau, Régis; Hagen, Tory

    2014-07-18

    Highlights: • 24 month old rats were supplemented with 0.2% lipoic acid in the diet for 2 weeks. • Lipoic acid shifts phase of core circadian clock proteins. • Lipoic acid corrects age-induced desynchronized lipid metabolism rhythms. - Abstract: It is well established that lipid metabolism is controlled, in part, by circadian clocks. However, circadian clocks lose temporal precision with age and correlates with elevated incidence in dyslipidemia and metabolic syndrome in older adults. Because our lab has shown that lipoic acid (LA) improves lipid homeostasis in aged animals, we hypothesized that LA affects the circadian clock to achieve these results. We fed 24 month old male F344 rats a diet supplemented with 0.2% (w/w) LA for 2 weeks prior to sacrifice and quantified hepatic circadian clock protein levels and clock-controlled lipid metabolic enzymes. LA treatment caused a significant phase-shift in the expression patterns of the circadian clock proteins Period (Per) 2, Brain and Muscle Arnt-Like1 (BMAL1), and Reverse Erythroblastosis virus (Rev-erb) β without altering the amplitude of protein levels during the light phase of the day. LA also significantly altered the oscillatory patterns of clock-controlled proteins associated with lipid metabolism. The level of peroxisome proliferator-activated receptor (PPAR) α was significantly increased and acetyl-CoA carboxylase (ACC) and fatty acid synthase (FAS) were both significantly reduced, suggesting that the LA-supplemented aged animals are in a catabolic state. We conclude that LA remediates some of the dyslipidemic processes associated with advanced age, and this mechanism may be at least partially through entrainment of circadian clocks.

  17. Molecular aspects of lipoic acid in the prevention of diabetes complications.

    PubMed

    Packer, L; Kraemer, K; Rimbach, G

    2001-10-01

    Alpha-lipoic acid (LA) and its reduced form, dihydrolipoic acid, are powerful antioxidants. LA scavenges hydroxyl radicals, hypochlorous acid, peroxynitrite, and singlet oxygen. Dihydrolipoic acid also scavenges superoxide and peroxyl radicals and can regenerate thioredoxin, vitamin C, and glutathione, which in turn can recycle vitamin E. There are several possible sources of oxidative stress in diabetes including glycation reactions, decompartmentalization of transition metals, and a shift in the reduced-oxygen status of the diabetic cells. Diabetics have increased levels of lipid hydroperoxides, DNA adducts, and protein carbonyls. Available data strongly suggest that LA, because of its antioxidant properties, is particularly suited to the prevention and/or treatment of diabetic complications that arise from an overproduction of reactive oxygen and nitrogen species. In addition to its antioxidant properties, LA increases glucose uptake through recruitment of the glucose transporter-4 to plasma membranes, a mechanism that is shared with insulin-stimulated glucose uptake. Further, recent trials have demonstrated that LA improves glucose disposal in patients with type II diabetes. In experimental and clinical studies, LA markedly reduced the symptoms of diabetic pathologies, including cataract formation, vascular damage, and polyneuropathy. To develop a better understanding of the preventative and therapeutic potentials of LA, much of the current interest is focused on elucidating its molecular mechanisms in redox dependent gene expression. PMID:11684397

  18. Alpha lipoic acid possess dual antioxidant and lipid lowering properties in atherosclerotic-induced New Zealand White rabbit.

    PubMed

    Zulkhairi, A; Zaiton, Z; Jamaluddin, M; Sharida, F; Mohd, T H B; Hasnah, B; Nazmi, H M; Khairul, O; Zanariyah, A

    2008-12-01

    There is accumulating data demonstrated hypercholesterolemia and oxidative stress play an important role in the development of atherosclerosis. In the present study, a protective activity of alpha-lipoic acid; a metabolic antioxidant in hypercholesterolemic-induced animals was investigated. Eighteen adult male New Zealand White (NZW) rabbit were segregated into three groups labelled as group K, AT and ALA (n=6). While group K was fed with normal chow and acted as a control, the rest fed with 100 g/head/day with 1% high cholesterol diet to induce hypercholesterolemia. 4.2 mg/body weight of alpha lipoic acid was supplemented daily to the ALA group. Drinking water was given ad-libitum. The study was designed for 10 weeks. Blood sampling was taken from the ear lobe vein at the beginning of the study, week 5 and week 10 and plasma was prepared for lipid profile estimation and microsomal lipid peroxidation index indicated with malondialdehyde (MDA) formation. Animals were sacrificed at the end of the study and the aortas were excised for intimal lesion analysis. The results showed a significant reduction of lipid peroxidation index indicated with low MDA level (p<0.05) in ALA group compared to that of the AT group. The blood total cholesterol (TCHOL) and low density lipoprotein (LDL) levels were found to be significantly low in ALA group compared to that of the AT group (p<0.05). Histomorphometric intimal lesion analysis of the aorta showing less of atheromatous plaque formation in alpha lipoic acid supplemented group (p<0.05) compared to that of AT group. These findings suggested that apart from its antioxidant activity, alpha lipoic acid may also posses a lipid lowering effect indicated with low plasma TCHOL and LDL levels and reduced the athero-lesion formation in rabbits fed a high cholesterol diet. PMID:18538528

  19. Alpha-lipoic acid as a new treatment option for Alzheimer's disease--a 48 months follow-up analysis.

    PubMed

    Hager, K; Kenklies, M; McAfoose, J; Engel, J; Münch, G

    2007-01-01

    Oxidative stress and neuronal energy depletion are characteristic biochemical hallmarks of Alzheimer's disease (AD). It is therefore conceivable that pro-energetic and antioxidant drugs such as alpha-lipoic acid might delay the onset or slow down the progression of the disease. In a previous study, 600mg alpha-lipoic acid was given daily to nine patients with AD (receiving a standard treatment with choline-esterase inhibitors) in an open-label study over an observation period of 12 months. The treatment led to a stabilization of cognitive functions in the study group, demonstrated by constant scores in two neuropsychological tests (the mini mental state exam, MMSE and the Alzheimer's disease assessment score cognitive subscale, ADAScog). In this report, we have extended the analysis to 43 patients over an observation period of up to 48 months. In patients with mild dementia (ADAScog < 15), the disease progressed extremely slowly (ADAScog: +1.2 points/year, MMSE: -0.6 points/year), in patients with moderate dementia at approximately twice the rate. However, the progression appears dramatically lower than data reported for untreated patients or patients on choline-esterase inhibitors in the second year of long-term studies. Despite the fact that this study was not double-blinded, placebo-controlled and randomized, our data suggest that treatment with alpha-lipoic acid might be a successful 'neuroprotective' therapy option for AD. However, a state-of-the-art phase II trial is needed urgently. PMID:17982894

  20. Effect of α -Lipoic Acid on Oxidative Stress in End-Stage Renal Disease Patients Receiving Intravenous Iron.

    PubMed

    Showkat, Arif; Bastnagel, William R; Hudson, Joanna Q

    2014-01-01

    Oxidative stress is associated with increased risk of cardiovascular disease in end-stage renal disease (ESRD) patients. Intravenous (IV) iron has been shown to increase oxidative stress. The aim of the study was to evaluate changes in oxidative stress markers following administration of IV sodium ferric gluconate (SFG) to ESRD patients with and without administration of the antioxidant, α -lipoic acid. This is an open-label, crossover study. 125 mg of IV SFG was administered during control (C) and intervention (I) visits. During the I visit, 600 mg of α -lipoic acid was given orally prior to IV SFG. Blood samples were collected at defined time periods for F2-isoprostane (FIP), lipid hydroperoxide (LHP), malondialdehyde (MDA), and iron indices. We recruited ten African-American ESRD subjects: 50% male; mean age 45 ± 9 years; mean hemoglobin 13 ± 1 g/dL; ferritin 449 ± 145 ng/mL; transferrin saturation 27 ± 4%. There were no significant differences in iron indices between the two visits after IV SFG. MDA, FIP, and LHP increased significantly for both C and I visits with a greater increase in the I group. Administration of IV SFG results in an acute rise in oxidative stress in ESRD patients. In contrast to previous studies, administration of α -lipoic acid was associated with a greater increase in oxidative stress. PMID:24967245

  1. Effect of α-Lipoic Acid on Oxidative Stress in End-Stage Renal Disease Patients Receiving Intravenous Iron

    PubMed Central

    Showkat, Arif; Bastnagel, William R.; Hudson, Joanna Q.

    2014-01-01

    Oxidative stress is associated with increased risk of cardiovascular disease in end-stage renal disease (ESRD) patients. Intravenous (IV) iron has been shown to increase oxidative stress. The aim of the study was to evaluate changes in oxidative stress markers following administration of IV sodium ferric gluconate (SFG) to ESRD patients with and without administration of the antioxidant, α-lipoic acid. This is an open-label, crossover study. 125 mg of IV SFG was administered during control (C) and intervention (I) visits. During the I visit, 600 mg of α-lipoic acid was given orally prior to IV SFG. Blood samples were collected at defined time periods for F2-isoprostane (FIP), lipid hydroperoxide (LHP), malondialdehyde (MDA), and iron indices. We recruited ten African-American ESRD subjects: 50% male; mean age 45 ± 9 years; mean hemoglobin 13 ± 1 g/dL; ferritin 449 ± 145 ng/mL; transferrin saturation 27 ± 4%. There were no significant differences in iron indices between the two visits after IV SFG. MDA, FIP, and LHP increased significantly for both C and I visits with a greater increase in the I group. Administration of IV SFG results in an acute rise in oxidative stress in ESRD patients. In contrast to previous studies, administration of α-lipoic acid was associated with a greater increase in oxidative stress. PMID:24967245

  2. α-Lipoic acid inhibits sevoflurane-induced neuronal apoptosis through PI3K/Akt signalling pathway.

    PubMed

    Ma, Rong; Wang, Xiang; Peng, Peipei; Xiong, Jingwei; Dong, Hongquan; Wang, Lixia; Ding, Zhengnian

    2016-01-01

    Sevoflurane is a widely used anaesthetic agent, including in anaesthesia of children and infants. Recent studies indicated that the general anaesthesia might cause the cell apoptosis in the brain. This issue raises the concerns about the neuronal toxicity induced by the application of anaesthetic agents, especially in the infants and young children. In this study, we used Morris water maze, western blotting and immunohistochemistry to elucidate the role of α-lipoic acid in the inhibition of neuronal apoptosis. We found that sevoflurane led to the long-term cognitive impairment in the young rats. This adverse effect may be caused by the neuronal death in the hippocampal region, mediated through PI3K/Akt signalling pathway. We also showed that α-lipoic acid offset the effect of sevoflurane on the neuronal apoptosis and cognitive dysfunction. This study elucidated the potential clinical role of α-lipoic acid, providing a promising way in the prevention and treatment of long-term cognitive impairment induced by sevoflurane general anesthesia. PMID:26781804

  3. BACE1 activity impairs neuronal glucose oxidation: rescue by beta-hydroxybutyrate and lipoic acid

    PubMed Central

    Findlay, John A.; Hamilton, David L.; Ashford, Michael L. J.

    2015-01-01

    Glucose hypometabolism and impaired mitochondrial function in neurons have been suggested to play early and perhaps causative roles in Alzheimer's disease (AD) pathogenesis. Activity of the aspartic acid protease, beta-site amyloid precursor protein (APP) cleaving enzyme 1 (BACE1), responsible for beta amyloid peptide generation, has recently been demonstrated to modify glucose metabolism. We therefore examined, using a human neuroblastoma (SH-SY5Y) cell line, whether increased BACE1 activity is responsible for a reduction in cellular glucose metabolism. Overexpression of active BACE1, but not a protease-dead mutant BACE1, protein in SH-SY5Y cells reduced glucose oxidation and the basal oxygen consumption rate, which was associated with a compensatory increase in glycolysis. Increased BACE1 activity had no effect on the mitochondrial electron transfer process but was found to diminish substrate delivery to the mitochondria by inhibition of key mitochondrial decarboxylation reaction enzymes. This BACE1 activity-dependent deficit in glucose oxidation was alleviated by the presence of beta hydroxybutyrate or α-lipoic acid. Consequently our data indicate that raised cellular BACE1 activity drives reduced glucose oxidation in a human neuronal cell line through impairments in the activity of specific tricarboxylic acid cycle enzymes. Because this bioenergetic deficit is recoverable by neutraceutical compounds we suggest that such agents, perhaps in conjunction with BACE1 inhibitors, may be an effective therapeutic strategy in the early-stage management or treatment of AD. PMID:26483636

  4. Site-Specific Radiofluorination of Biomolecules with 8-[(18)F]-Fluorooctanoic Acid Catalyzed by Lipoic Acid Ligase.

    PubMed

    Drake, Christopher R; Sevillano, Natalia; Truillet, Charles; Craik, Charles S; VanBrocklin, Henry F; Evans, Michael J

    2016-06-17

    New methodologies for site-specifically radiolabeling proteins with (18)F are required to generate high quality radiotracers for preclinical and clinical applications with positron emission tomography. Herein, we report an approach by which we use lipoic acid ligase (LplA) to conjugate [(18)F]-fluorooctanoic acid to an antibody fragment bearing the peptide substrate of LplA. The mild conditions of the reaction preserve antibody immunoreactivity, and the efficiency of LplA allows for >90% yield even with very small amounts of peptidic precursor (1-10 nmol). These features are advantageous compared to the current gold standard in the field. Moreover, the methodology introduces a new application for an important tool in chemical biology. PMID:27008570

  5. A randomized placebo-controlled pilot trial of omega-3 fatty acids and alpha lipoic acid in Alzheimer's disease.

    PubMed

    Shinto, Lynne; Quinn, Joseph; Montine, Thomas; Dodge, Hiroko H; Woodward, William; Baldauf-Wagner, Sara; Waichunas, Dana; Bumgarner, Lauren; Bourdette, Dennis; Silbert, Lisa; Kaye, Jeffrey

    2014-01-01

    Oxidative stress, inflammation, and increased cholesterol levels are all mechanisms that have been associated with Alzheimer's disease (AD) pathology. Several epidemiologic studies have reported a decreased risk of AD with fish consumption. This pilot study was designed to evaluate the effects of supplementation with omega-3 fatty acids alone (ω-3) or omega-3 plus alpha lipoic acid (ω-3 + LA) compared to placebo on oxidative stress biomarkers in AD. The primary outcome measure was peripheral F2-isoprostane levels (oxidative stress measure). Secondary outcome measures included performance on: Mini-Mental State Examination (MMSE), Activities of Daily Living/Instrumental Activities of Daily Living (ADL/IADL), and Alzheimer Disease Assessment Scale-cognitive subscale (ADAS-cog). Thirty-nine AD subjects were randomized to one of three groups: 1) placebo, 2) ω-3, or 3) ω-3 + LA for a treatment duration of 12 months. Eighty seven percent (34/39) of the subjects completed the 12-month intervention. There was no difference between groups at 12 months in peripheral F2-isoprostane levels (p = 0.83). The ω-3 + LA and ω-3 were not significantly different than the placebo group in ADAS-cog (p = 0.98, p = 0.86) and in ADL (p = 0.15, p = 0.82). Compared to placebo, the ω-3 + LA showed less decline in MMSE (p < 0.01) and IADL (p = 0.01) and the ω-3 group showed less decline in IADL (p < 0.01). The combination of ω-3 + LA slowed cognitive and functional decline in AD over 12 months. Because the results were generated from a small sample size, further evaluation of the combination of omega-3 fatty acids plus alpha-lipoic acid as a potential treatment in AD is warranted. PMID:24077434

  6. Combination of inositol and alpha lipoic acid in metabolic syndrome-affected women: a randomized placebo-controlled trial

    PubMed Central

    2013-01-01

    Background Inositol has been reported to improve insulin sensitivity since it works as a second messenger achieving insulin-like effects on metabolic enzymes. The aim of this study was to evaluate the inositol and alpha lipoic acid combination effectiveness on metabolic syndrome features in postmenopausal women at risk of breast cancer. Methods A six-month prospective, randomized placebo-controlled trial was carried out on a total of 155 postmenopausal women affected by metabolic syndrome at risk of breast cancer, the INOSIDEX trial. All women were asked to follow a low-calorie diet and were assigned randomly to daily consumption of a combination of inositol and alpha lipoic acid (77 pts) or placebo (78 pts) for six months. Primary outcomes we wanted to achieve were both reduction of more than 20% of the HOMA-IR index and of triglycerides serum levels. Secondary outcomes expected were both the improvement of high-density lipoprotein cholesterol levels and the reduction of anthropometric features such as body mass index and waist-hip ratio. Results A significant HOMA-IR reduction of more than 20% was evidenced in 66.7% (P <0.0001) of patients, associated with a serum insulin level decrease in 89.3% (P <0.0000). A decrease in triglycerides was evidenced in 43.2% of patients consuming the supplement (P <0.0001). An increase in HDL cholesterol (48.6%) was found in the group consuming inositol with respect to the placebo group. A reduction in waist circumference and waist-hip ratio was found in the treated group with respect to the placebo group. Conclusions Inositol combined with alpha lipoic acid can be used as a dietary supplement in insulin-resistant patients in order to increase their insulin sensitiveness. Daily consumption of inositol combined with alpha lipoic acid has a significant bearing on metabolic syndrome. As metabolic syndrome is considered a modifiable risk factor of breast tumorigenesis, further studies are required to assess whether inositol combined

  7. The effects of the antioxidant lipoic acid on beef longissimus bloom time.

    PubMed

    Rentfrow, G; Linville, M L; Stahl, C A; Olson, K C; Berg, E P

    2004-10-01

    The objective of this study was to evaluate the influence of lipoic acid (LA) on beef LM steak bloom time, as well-as to characterize bloom time in the CIE L*, a*, and b* color space over a 93-min period. Thirty-two Simmental steers were supplemented with LA for 21 d immediately before slaughter at levels of 0, 8, 16, or 24 mg of LA/kg BW (eight steers per treatment). Lipoic acid was mixed with liquid paraffin, allowed to solidify, prilled, and top-dressed over a standard finishing diet. Steers were slaughtered at the University of Missouri abattoir in four groups of eight (two steers per treatment) over a 2-wk period. After a 24-h chill at 4 degrees C, the right LM was removed from each carcass. One 2.54cm steak was removed from the anterior portion of the LM, and its color characteristics (CIE L*, a*, and b*) were measured immediately with a standardized spectrocolorimeter. Color measurements were taken every 3 min thereafter for a total of 93-min. Hue angle (true red) and chroma (color saturation) were calculated from the color measurements. Addition of LA to the diet had no effect on bloom time (P = 0.67). When treatment means were analyzed, the addition of 24 mg of LA/kg BW to the diet resulted in higher (lighter) L* values (P < 0.05) compared with other treatments, whereas the addition of 16 mg of LA/kg BW to the diet caused lower hue angles (more true red; P < 0.05) when compared with other treatments. Addition of LA to the diet did not affect a* (P = 0.13) and b* (P = 0.18) values or chroma (P = 0.62). In the absence of treatment effects, bloom times for all treatments were pooled, and L* values did not change (P > 0.05) during the 93-min bloom time; however, a* and chroma values increased for 9 min and plateaued after 12 min (P < 0.01). Similarly, b* values increased (P < 0.01) for the first 6 min, and after 9 min, no further increase in yellowness was detected. Bloom time had little effect on hue angle, which stabilized after 3 min. Supplementing steers

  8. Is it time to reassess alpha lipoic acid and niacinamide therapy in schizophrenia?

    PubMed

    Seybolt, Sheila E J

    2010-12-01

    As sulfur containing thiols, alpha lipoic acid (ALA) and its reduced form dihydrolipoic acid (DHLA) are powerful antioxidants and free radical scavengers capable of performing many of the same functions as glutathione (GSH). ALA supplementation may help protect mitochondria from oxidative stress, a possible mechanism contributing to certain forms of brain diseases called schizophrenia. Shortly before the advent of antipsychotic medications, two small studies found ALA relieved psychiatric symptoms in schizophrenia. More recently, animal studies have shown ALA augmentation improves mitochondrial function. At pharmaceutical levels, niacinamide helps preserve mitochondrial membrane integrity and acts as an antioxidant. ALA is a precursor for lipoamide, an essential mitochondrial coenzyme and niacinamide is a component of niacinamide adenine dinucleotide (NAD). NADH, the reduced form of NAD, is involved in the reduction of ALA to DHLA within the mitochondria. This is relevant to contemporary research because DHLA increases GSH and low GSH levels contribute to mitochondrial dysfunction and oxidative stress which have been implicated in the pathophysiology of schizophrenia. PMID:20708342

  9. Alpha-lipoic acid: molecular mechanisms and therapeutic potential in diabetes.

    PubMed

    Rochette, Luc; Ghibu, Steliana; Muresan, Adriana; Vergely, Catherine

    2015-12-01

    Diabetes is a chronic metabolic disease with a high prevalence worldwide. Diabetes and insulin resistance are associated with the development of cardiovascular and nervous diseases. The development of these disorders reflects complex pathological processes in which the oxidative stress caused by reactive oxygen species (ROS) and reactive nitrogen species (RNS) plays a pivotal role. It is widely accepted that diabetes impairs endothelial nitric oxide synthase (eNOS) activity and increases the production of ROS, thus resulting in diminished NO bioavailability and increased oxidative stress. Alpha-lipoic acid (LA) possesses beneficial effects both in the prevention and in the treatment of diabetes. LA is a potent antioxidant with insulin-mimetic and anti-inflammatory activity. LA in the diet is quickly absorbed, transported to the intracellular compartments, and reduced to dihydrolipoic acid (DHLA) under the action of enzymes. LA, which plays an essential role in mitochondrial bioenergetic reactions, has drawn considerable attention as an antioxidant for use in managing diabetic complications such as retinopathy, neuropathy and other vascular diseases. PMID:26406389

  10. Bioavailability of an R-α-Lipoic Acid/γ-Cyclodextrin Complex in Healthy Volunteers

    PubMed Central

    Ikuta, Naoko; Okamoto, Hinako; Furune, Takahiro; Uekaji, Yukiko; Terao, Keiji; Uchida, Ryota; Iwamoto, Kosuke; Miyajima, Atsushi; Hirota, Takashi; Sakamoto, Norihiro

    2016-01-01

    R-α-lipoic acid (R-LA) is a cofactor of mitochondrial enzymes and a very strong antioxidant. R-LA is available as a functional food ingredient but is unstable against heat or acid. Stabilized R-LA was prepared through complexation with γ-cyclodextrin (CD), yielding R-LA/CD. R-LA/CD was orally administered to six healthy volunteers and showed higher plasma levels with an area under the plasma concentration-time curve that was 2.5 times higher than that after oral administration of non-complexed R-LA, although the time to reach the maximum plasma concentration and half-life did not differ. Furthermore, the plasma glucose level after a single oral administration of R-LA/CD or R-LA was not affected and no side effects were observed. These results indicate that R-LA/CD could be easily absorbed in the intestine. In conclusion, γ-CD complexation is a promising technology for delivering functional but unstable ingredients like R-LA. PMID:27314343

  11. Inhibitory effects of indole α-lipoic acid derivatives on nitric oxide production in LPS/IFNγ activated RAW 264.7 macrophages.

    PubMed

    Karabay, Arzu Zeynep; Koc, Aslı; Gurkan-Alp, A Selen; Buyukbingol, Zeliha; Buyukbingol, Erdem

    2015-04-01

    Alpha-lipoic acid (α-lipoic acid) is a potent antioxidant compound that has been shown to possess anti-inflammatory effects. RAW 264.7 macrophages produce various inflammatory mediators such as nitric oxide, IL-1β, IL-6 and TNF-alpha upon activation with LPS (Lipopolysaccharide) and IFNγ (interferon gamma). In this study, the effect of 12 synthetic indole α-lipoic acid derivatives on nitric oxide production and iNOS (inducible nitric oxide synthase) protein expression in LPS/IFNγ activated RAW 264.7 macrophages was determined. Cell proliferation, nitric oxide levels and iNOS protein expression were examined with thiazolyl blue tetrazolium blue test, griess assay and western blot, respectively. Our results showed that all of the indole α-lipoic acid derivatives showed significant inhibitory effects on nitric oxide production and iNOS protein levels (p < 0.05). The most active compounds were identified as compound I-4b, I-4e and II-3b. In conclusion, these indole α-lipoic acid derivatives may have the potential for treatment of inflammatory conditions related with high nitric oxide production. PMID:25727912

  12. {alpha}-Lipoic acid prevents lipotoxic cardiomyopathy in acyl CoA-synthase transgenic mice

    SciTech Connect

    Lee, Young; Naseem, R. Haris; Park, Byung-Hyun; Garry, Daniel J.; Richardson, James A.; Schaffer, Jean E.; Unger, Roger H. . E-mail: roger.unger@utsouthwestern.edu

    2006-05-26

    {alpha}-Lipoic acid ({alpha}-LA) mimics the hypothalamic actions of leptin on food intake, energy expenditure, and activation of AMP-activated protein kinase (AMPK). To determine if, like leptin, {alpha}-LA protects against cardiac lipotoxicity, {alpha}-LA was fed to transgenic mice with cardiomyocyte-specific overexpression of the acyl CoA synthase (ACS) gene. Untreated ACS-transgenic mice died prematurely with increased triacylglycerol content and dilated cardiomyopathy, impaired systolic function and myofiber disorganization, apoptosis, and interstitial fibrosis on microscopy. In {alpha}-LA-treated ACS-transgenic mice heart size, echocardiogram and TG content were normal. Plasma TG fell 50%, hepatic-activated phospho-AMPK rose 6-fold, sterol regulatory element-binding protein-1c declined 50%, and peroxisome proliferator-activated receptor-{gamma} cofactor-1{alpha} mRNA rose 4-fold. Since food restriction did not prevent lipotoxicity, we conclude that {alpha}-LA treatment, like hyperleptinemia, protects the heart of ACS-transgenic mice from lipotoxicity.

  13. Alpha-lipoic acid protects cardiomyocytes against hypoxia/reoxygenation injury by inhibiting autophagy

    SciTech Connect

    Cao, Xueming; Chen, Aihua Yang, Pingzhen; Song, Xudong; Liu, Yingfeng; Li, Zhiliang; Wang, Xianbao; Wang, Lizi; Li, Yunpeng

    2013-11-29

    Highlights: •We observed the cell viability and death subjected to H/R in H9c2 cardiomyocytes. •We observed the degree of autophagy subjected to H/R in H9c2 cardiomyocytes. •LA inhibited the degree of autophagy in parallel to the enhanced cell survival. •LA inhibited the autophagy in parallel to the decreased total cell death. •We concluded that LA protected cardiomyocytes against H/R by inhibiting autophagy. -- Abstract: Hypoxia/reoxygenation (H/R) is an important in vitro model for exploring the molecular mechanisms and functions of autophagy during myocardial ischemia/reperfusion (I/R). Alpha-lipoic acid (LA) plays an important role in the etiology of cardiovascular disease. Autophagy is widely implicated in myocardial I/R injury. We assessed the degree of autophagy by pretreatment with LA exposed to H/R in H9c2 cell based on the expression levels of Beclin-1, LC3II/LC3I, and green fluorescent protein-labeled LC3 fusion proteins. Autophagic vacuoles were confirmed in H9c2 cells exposed to H/R using transmission electron microscopy. Our findings indicated that pretreatment with LA inhibited the degree of autophagy in parallel to the enhanced cell survival and decreased total cell death in H9c2 cells exposed to H/R. We conclude that LA protects cardiomyocytes against H/R injury by inhibiting autophagy.

  14. Neuronal mitochondrial amelioration by feeding acetyl-L-carnitine and lipoic acid to aged rats

    PubMed Central

    Aliev, Gjumrakch; Liu, Jiankang; Shenk, Justin C; Fischbach, Kathryn; Pacheco, Gerardo J; Chen, Shu G; Obrenovich, Mark E; Ward, Walter F; Richardson, Arlan G; Smith, Mark A; Gasimov, Eldar; Perry, George; Ames, Bruce N

    2009-01-01

    Abstract Brain function declines with age and is associated with diminishing mitochondrial integrity. The neuronal mitochondrial ultrastructural changes of young (4 months) and old (21 months) F344 rats supplemented with two mitochondrial metabolites, acetyl-L-carnitine (ALCAR, 0.2%[wt/vol] in the drinking water) and R-α-lipoic acid (LA, 0.1%[wt/wt] in the chow), were analysed using qualitative and quantitative electron microscopy techniques. Two independent morphologists blinded to sample identity examined and scored all electron micrographs. Mitochondria were examined in each micrograph, and each structure was scored according to the degree of injury. Controls displayed an age-associated significant decrease in the number of intact mitochondria (P = 0.026) as well as an increase in mitochondria with broken cristae (P < 0.001) in the hippocampus as demonstrated by electron microscopic observations. Neuronal mitochondrial damage was associated with damage in vessel wall cells, especially vascular endothelial cells. Dietary supplementation of young and aged animals increased the proliferation of intact mitochondria and reduced the density of mitochondria associated with vacuoles and lipofuscin. Feeding old rats ALCAR and LA significantly reduced the number of severely damaged mitochondria (P = 0.02) and increased the number of intact mitochondria (P < 0.001) in the hippocampus. These results suggest that feeding ALCAR with LA may ameliorate age-associated mitochondrial ultrastructural decay and are consistent with previous studies showing improved brain function. PMID:18373733

  15. Neuronal mitochondrial amelioration by feeding acetyl-L-carnitine and lipoic acid to aged rats.

    PubMed

    Aliev, Gjumrakch; Liu, Jiankang; Shenk, Justin C; Fischbach, Kathryn; Pacheco, Gerardo J; Chen, Shu G; Obrenovich, Mark E; Ward, Walter F; Richardson, Arlan G; Smith, Mark A; Gasimov, Eldar; Perry, George; Ames, Bruce N

    2009-02-01

    Brain function declines with age and is associated with diminishing mitochondrial integrity. The neuronal mitochondrial ultrastructural changes of young (4 months) and old (21 months) F344 rats supplemented with two mitochondrial metabolites, acetyl-L-carnitine (ALCAR, 0.2%[wt/vol] in the drinking water) and R-alpha-lipoic acid (LA, 0.1%[wt/wt] in the chow), were analysed using qualitative and quantitative electron microscopy techniques. Two independent morphologists blinded to sample identity examined and scored all electron micrographs. Mitochondria were examined in each micrograph, and each structure was scored according to the degree of injury. Controls displayed an age-associated significant decrease in the number of intact mitochondria (P = 0.026) as well as an increase in mitochondria with broken cristae (P < 0.001) in the hippocampus as demonstrated by electron microscopic observations. Neuronal mitochondrial damage was associated with damage in vessel wall cells, especially vascular endothelial cells. Dietary supplementation of young and aged animals increased the proliferation of intact mitochondria and reduced the density of mitochondria associated with vacuoles and lipofuscin. Feeding old rats ALCAR and LA significantly reduced the number of severely damaged mitochondria (P = 0.02) and increased the number of intact mitochondria (P < 0.001) in the hippocampus. These results suggest that feeding ALCAR with LA may ameliorate age-associated mitochondrial ultrastructural decay and are consistent with previous studies showing improved brain function. PMID:18373733

  16. Effect of alpha-lipoic acid on boar spermatozoa quality during freezing-thawing.

    PubMed

    Shen, Tao; Jiang, Zhong-Liang; Li, Cong-Jun; Hu, Xiao-Chen; Li, Qing-Wang

    2016-04-01

    Alpha-lipoic acid (ALA) is known to be a natural antioxidant. The aim of the present study was to evaluate the cryoprotective effect of ALA on the motility of boar spermatozoa and its antioxidant effect on boar spermatozoa during freezing-thawing. Different concentrations (2.0, 4.0, 6.0, 8.0 or 10.0 mg/ml) of ALA were added to the extender used to freeze boar semen, and the effects on the quality and endogenous antioxidant enzyme activities of frozen-thawed spermatozoa were assessed. The results indicated that the addition of ALA to the extender resulted in a higher percentage of motile spermatozoa post-thaw (P < 0.05). The activities of superoxide dismutase, lactate dehydrogenase, glutamic-oxaloacetic transaminase and catalase improved after adding ALA to the extender (P < 0.05). Artificial insemination results showed that pregnancy rate and litter size were significantly higher at 6.0 mg/ml in the ALA group than in the control group (P < 0.05). In conclusion, ALA conferred a cryoprotective capacity to the extender used for boar semen during the process of freezing-thawing, and the optimal concentration of ALA for the frozen extender was 6.0 mg/ml. PMID:26099848

  17. Aqueous Growth of Gold Clusters with Tunable Fluorescence Using Photochemically Modified Lipoic Acid-Based Ligands.

    PubMed

    Mishra, Dinesh; Aldeek, Fadi; Lochner, Eric; Palui, Goutam; Zeng, Birong; Mackowski, Sebastian; Mattoussi, Hedi

    2016-06-28

    We report a one-phase aqueous growth of fluorescent gold nanoclusters (AuNCs) with tunable emission in the visible spectrum, using a ligand scaffold that is made of poly(ethylene glycol) segment appended with a metal coordinating lipoic acid at one end and a functional group at the other end. This synthetic scheme exploits the ability of the UV-induced photochemical transformation of LA-based ligands to provide DHLA and other thiol byproducts that exhibit great affinity to metal nanoparticles, obviating the need for chemical reduction of the dithiolane ring using classical reducing agents. The influence of various experimental conditions, including the photoirradiation time, gold precursor-to-ligand molar ratios, time of reaction, temperature, and the medium pH, on the growth of AuNCs has been systematically investigated. The photophysical properties, size, and structural characterization were carried out using UV-vis absorption and fluorescence spectroscopy, TEM, DOSY-NMR, and X-ray photoelectron spectroscopy. The hydrodynamic size (RH) obtained by DOSY-NMR indicates that the size of these clusters follows the trend anticipated from the absorption and PL data, with RH(red) > RH(yellow) > RH(blue). The tunable emission and size of these gold nanoclusters combined with their high biocompatibility would make them greatly promising for potential use in imaging and sensing applications. PMID:27254320

  18. Lipoic Acid Decreases Inflammation and Confers Neuroprotection in Experimental Autoimmune Optic Neuritis

    PubMed Central

    Chaudhary, Priya; Marracci, Gail; Yu, Xiaolin; Galipeau, Danielle; Morris, Brooke; Bourdette, Dennis

    2016-01-01

    Lipoic acid (LA) is an antioxidant that is effective in treating experimental autoimmune encephalomyelitis (EAE), a model for multiple sclerosis (MS). C57BL/6 mice with EAE develop experimental autoimmune optic neuritis (EAON), which models acute optic neuritis in humans. Here we determined whether LA is therapeutically effective in EAON. We immunized C57BL/6 mice with MOG 35–55 peptide. Mice received either daily subcutaneous injections of LA (100 mg/kg) or saline in early or late suppression paradigms. In the early suppression paradigm, optic nerve cross sections showed 14.9 ± 3.8% (mean ± SEM) damage in mice receiving saline (n = 7) and 2.0 ± 0.4 % damage in mice given LA (n = 7, p = 0.001). In the late suppression paradigm, optic nerve sections showed 24.6 ± 3.5% damage in mice treated with saline (n = 7) and 8.4 ± 2.5% in mice treated with LA (n = 7, p = 0.004). Thus a dramatic reduction in axonal injury was seen after LA administration in both experimental paradigms. Compared with saline treated mice with EAON, optic nerves from mice receiving LA had significantly fewer CD4+ and CD11b+ cells in both paradigms. This study provides a rationale for investigating the therapeutic efficacy of LA in acute optic neuritis in humans. PMID:21215462

  19. Near-Infrared Electrogenerated Chemiluminescence from Aqueous Soluble Lipoic Acid Au Nanoclusters.

    PubMed

    Wang, Tanyu; Wang, Dengchao; Padelford, Jonathan W; Jiang, Jie; Wang, Gangli

    2016-05-25

    Strong electrogenerated chemiluminescence (ECL) is detected from dithiolate Au nanoclusters (AuNCs) in aqueous solution under ambient conditions. A novel mechanism to drastically enhance the ECL is established by covalent attachment of coreactants N,N-diethylethylenediamine (DEDA) onto lipoic acid stabilized Au (Au-LA) clusters with matching redox activities. The materials design reduces the complication of mass transport between the reactants during the lifetime of radical intermediates involved in conventional ECL generation pathway. The intracluster reactions are highly advantageous for applications by eliminating additional and high excess coreactants otherwise needed. The enhanced ECL efficiency also benefits uniquely from the multiple energy states per Au cluster and multiple DEDA ligands in the monolayer. Potential step and sweeping experiments reveal an onset potential of 0.78 V for oxidative-reduction ECL generation. Multifolds higher efficiency is found for the Au clusters alone in reference to the standard Rubpy with high excess TPrA. The ECL in near-IR region (beyond 700 nm) is highly advantageous with drastically reduced interference signals over visible ones. The features of ECL intensity responsive to electrode potential and solution pH under ambient conditions make Au-LA-DEDA clusters promising ECL reagents for broad applications. The strategy to attach coreactants on Au clusters is generalizable for other nanomaterials. PMID:27172252

  20. A novel fullerene lipoic acid derivative: Synthesis and preparation of self-assembled monolayers on gold

    NASA Astrophysics Data System (ADS)

    Viana, A. S.; Leupold, S.; Eberle, C.; Shokati, T.; Montforts, F.-P.; Abrantes, L. M.

    2007-11-01

    Synthesis and preparation of self-assembled monolayers of a novel fullerene lipoic acid derivative on gold are reported. The presence of densely packed SAMs was confirmed by ellipsometry and cyclic voltammetry. The electrochemical response of the modified electrode in organic media exhibits the first two redox peaks characteristic of the extended π-electron system of fullerene. C 60 surface coverage (1.4 × 10 -10 mol cm -2) has been electrochemically determined by the redox process of the adsorbed fullerene moiety and by reductive desorption of the SAM in strong alkaline solution. Electrochemical data indicate that all four sulphur atoms are involved in the self-assembly process, providing an increase of SAM stability in comparison to mono or di-thiolated appended molecules. Visualisation of discrete fullerene molecules by scanning tunnelling microscopy supplied further evidence for gold modification and molecular distribution on the surface. Mixed monolayers of hexanethiol and fullerene derivatives in a proportion of 1:2 have been also studied with the purpose of controlling the amount and distribution of fullerene units on the gold surface.

  1. [Oxidative homeostasis and functional parameters of rats at high altitudes with alpha-lipoic acid correction].

    PubMed

    Vishnevskiĭ, A A; Dzhantaeva, G A; Zhaparalieva, Ch O

    2011-01-01

    Oxidative and functional effects of alpha-lipoic acid (a-LA) were studied in the course of 45-day adaptation to high altitudes (3200 m in the Central Tien Shan, June - August). Comparison of a-LA with mildronate stated similarity of their antioxidant and membrane effects on the third (stable) phase of adaptation (day 45), as both substances demonstrated a distinct lyso-PL-limiting effect and did not change dramatically concentration of diene conjugates (primary products of lipid peroxidation) in brain tissue. a-LA surpassed mildronate in the rate of the compensating effect in respect of behavior disorders and anxiety in rats. Besides, the substances contributed equally to physical performance increment by the end of adaptation. The positive effect of a-LA on the functional characteristics was hand in hand with minimization of the consequences of oxidative stress. These experimental data imply that a-LA can be effective in controlling the long process of adaptation to high altitude conditions. PMID:21916251

  2. Alpha-lipoic acid enhances DMSO-induced cardiomyogenic differentiation of P19 cells.

    PubMed

    Shen, Xinghua; Yang, Qinghui; Jin, Peng; Li, Xueqi

    2014-09-01

    Alpha-lipoic acid (α-LA) is a potent antioxidant that acts as an essential cofactor in mitochondrial dehydrogenase reactions. α-LA has been shown to possess anti-inflammatory and cytoprotective properties, and is used to improve symptoms of diabetic neuropathy. However, the role of α-LA in stem cell differentiation and the underlying molecular mechanisms remain unknown. In the present study, we showed that α-LA significantly promoted dimethyl sulfoxide (DMSO)-induced cardiomyogenic differentiation of mouse embryonic carcinoma P19 cells. α-LA dose dependently increased beating embryonic body (EB) percentages of DMSO-differentiated P19 cells. The expressions of cardiac specific genes TNNT2, Nkx2.5, GATA4, MEF2C, and MLC2V and cardiac isoform of troponin T (cTnT)-positively stained cell population were significantly up-regulated by the addition of α-LA. We also demonstrated that the differentiation time after EB formation was critical for α-LA to take effect. Interestingly, without DMSO treatment, α-LA did not stimulate the cardiomyogenic differentiation of P19 cells. Further investigation indicated that collagen synthesis-enhancing activity, instead of the antioxidative property, plays a significant role in the cardiomyogenic differentiation-promoting function of α-LA. These findings highlight the potential use of α-LA for regenerative therapies in heart diseases. PMID:25112287

  3. Lipoic acid suppresses compound 48/80-induced anaphylaxis-like reaction

    PubMed Central

    Choi, Yun Ho; Chai, Ok Hee; Han, Eui-Hyeog; Choi, Su-Young; Kim, Hyoung Tae

    2010-01-01

    Alpha-lipoic acid (LA), a naturally occurring dithiol compound, is an essential cofactor in metabolic reactions involved in energy utilization. LA improves glycemic control, reduces diabetic polyneuropathies, atherosclerosis, and allergic inflammation. The effects of LA on mast cell-mediated anaphylactic reactions, however, are unknown. LA dose-dependently inhibited systemic and passive cutaneous anaphylaxis-like reactions in mice induced by compound 48/80, a condensation product of N-methyl-p-methoxyphenethylamine and formaldehyde. Pretreatment with LA, prior to induction of the systemic anaphylaxis-like reaction with compound 48/80, reduced plasma histamine levels in a dose-dependent manner. In our in vitro study, LA decreased histamine release from rat peritoneal mast cells (RPMCs) triggered by compound 48/80. Moreover, an increase in calcium uptake activated by compound 48/80 was inhibited by LA. LA also significantly elevated intracellular cyclic adenosine-3',5' monophosphate (cAMP) levels in RPMCs. This inhibition of mediator release from RPMCs may be due to inhibition of calcium uptake and augmentation of intracellular cAMP levels. Based on these results, we suggest that LA may be a potential remedy for allergy-related diseases. PMID:21267406

  4. Effect of alpha-lipoic acid on radiation-induced small intestine injury in mice

    PubMed Central

    Jeong, Bae Kwon; Song, Jin Ho; Jeong, Hojin; Choi, Hoon Sik; Jung, Jung Hwa; Hahm, Jong Ryeal; Woo, Seung Hoon; Jung, Myeong Hee; Choi, Bong-Hoi; Kim, Jin Hyun; Kang, Ki Mun

    2016-01-01

    Purpose Radiation therapy is a highly effective treatment for patients with solid tumors. However, it can cause damage and inflammation in normal tissues. Here, we investigated the effects of alpha-lipoic acid (ALA) as radioprotection agent for the small intestine in a mouse model. Materials and Methods Whole abdomen was evenly irradiated with total a dose of 15 Gy. Mice were treated with either ALA (100 mg/kg, intraperitoneal injection [i.p.]) or saline (equal volume, i.p.) the prior to radiation as 100 mg/kg/day for 3 days. Body weight, food intake, histopathology, and biochemical parameters were evaluated. Results Significant differences in body weight and food intake were observed between the radiation (RT) and ALA + RT groups. Moreover, the number of crypt cells was higher in the ALA + RT group. Inflammation was decreased and recovery time was shortened in the ALA + RT group compared with the RT group. The levels of inflammation-related factors (i.e., phosphorylated nuclear factor kappa B and matrix metalloproteinase-9) and mitogen-activated protein kinases were significantly decreased in the ALA + RT group compared with those in the RT group. Conclusions ALA treatment prior to radiation decreases the severity and duration of radiation-induced enteritis by reducing inflammation, oxidative stress, and cell death. PMID:26943777

  5. Protective effect of alpha-lipoic acid on cypermethrin-induced oxidative stress in Wistar rats.

    PubMed

    Mignini, F; Nasuti, C; Fedeli, D; Mattioli, L; Cosenza, M; Artico, M; Gabbianelli, R

    2013-01-01

    Cypermethrin (CY), a class II pyrethroid pesticide, is globally used to control insects in the household and in agriculture. Despite beneficial roles, its uncontrolled and repetitive application leads to unintended effects in non-target organisms. In light of the relevant anti-oxidant properties of alpha-lipoic acid (ALA), in the work described herein we tested the effect of a commercially available ALA formulation on cypermethrin CY)-induced oxidative stress in Wistar rats. The rats were orally administered with 53.14 mg/kg of ALA and 35.71 mg/kg of CY for 60 days. The treatment with CY did not induce changes in either locomotor activities or in body weight. Differences were observed on superoxide dismutase (SOD), catalase (CAT) and lipid peroxidation that were re-established by ALA treatment at similar levels of the placebo group. Furthermore, ALA formulation increased glutathione (GSH) level and glutathione peroxidase (GPx) activity. Because of the widespread use of CY, higher amounts of pesticide residues are present in food, and a diet supplementation with ALA could be an active free radical scavenger protecting against diseases associated with oxidative stress. PMID:24355222

  6. Effect of αlipoic acid and silymarin on bladder outlet obstruction.

    PubMed

    Yildirim, Abidin; Başeskioğlu, Barbaros; Temel, Halide E; Erkasap, Nilüfer; Yenilmez, Aydin; Uslu, Sema; Ozer, Caner; Ozkurt, Mete; Dönmez, Turgut

    2013-02-01

    The aim of the present study was to determine whether the treatment of obstructed rat bladders with αlipoic acid (ALA) and silymarin reverses the biochemical and physiological responses to bladder outlet obstruction (BOO). A total of 32 adult Sprague Dawley rats were divided into four groups (n=8 per group): sham (placebo surgery) animals with no treatment (group 1); control animals with surgically induced BOO (group 2); obstructed rats treated with ALA (group 3); and obstructed rats treated with silymarin (group 4). Histological evaluation, bladder weights, collagen structure, TdT-mediated biotin nick end-labeling (TUNEL), inducible nitric oxide sentase (iNOS) mRNA levels, malondialdehyde (MDA) levels and tumor necrosis factor (TNF) levels were investigated. The ALA-treated group had similar bladder weights, collagen levels and TUNEL positivity and decreased iNOS levels compared with the control group, while the silymarin group exhibited further differences. Serum MDA and TNF-α levels were both decreased in the ALA and silymarin groups. ALA treatment reduced the increased oxidative stress and bladder inflammation caused by BOO and may contribute to the protection of bladder function. PMID:23403734

  7. Ginger and alpha lipoic acid ameliorate age-related ultrastructural changes in rat liver.

    PubMed

    Mahmoud, Y I; Hegazy, H G

    2016-01-01

    Because of the important role that oxidative stress is thought to play in the aging process, antioxidants could be candidates for preventing its related pathologies. We investigated the ameliorative effects of two antioxidant supplements, ginger and alpha lipoic acid (ALA), on hepatic ultrastructural alterations in old rats. Livers of young (4 months) and old (24 months) Wistar rats were studied using transmission electron microscopy. Livers of old rats showed sinusoidal collapse and congestion, endothelial thickening and defenestration, and inconsistent perisinusoidal extracellular matrix deposition. Aged hepatocytes were characterized by hypertrophy, cytoplasmic vacuolization and a significant increase in the volume densities of the nuclei, mitochondria and dense bodies. Lipofuscin accumulation and decreased microvilli in bile canaliculi and space of Disse also were observed. The adverse alterations were ameliorated significantly by both ginger and ALA supplementation; ALA was more effective than ginger. Ginger and ALA appear to be promising anti-aging agents based on their amelioration of ultrastructural alterations in livers of old rats. PMID:26528730

  8. Behavioral and Neurochemical Effects of Alpha-Lipoic Acid in the Model of Parkinson's Disease Induced by Unilateral Stereotaxic Injection of 6-Ohda in Rat

    PubMed Central

    de Araújo, Dayane Pessoa; De Sousa, Caren Nádia Soares; Araújo, Paulo Victor Pontes; Menezes, Carlos Eduardo de Souza; Sousa Rodrigues, Francisca Taciana; Escudeiro, Sarah Souza; Lima, Nicole Brito Cortez; Patrocínio, Manoel Claúdio Azevedo; Aguiar, Lissiana Magna Vasconcelos; Viana, Glauce Socorro de Barros; Vasconcelos, Silvânia Maria Mendes

    2013-01-01

    This study aimed to investigate behavioral and neurochemical effects of α-lipoic acid (100 mg/kg or 200 mg/kg) alone or associated with L-DOPA using an animal model of Parkinson's disease induced by stereotaxic injection of 6-hydroxydopamine (6-OHDA) in rat striatum. Motor behavior was assessed by monitoring body rotations induced by apomorphine, open field test and cylinder test. Oxidative stress was accessed by determination of lipid peroxidation using the TBARS method, concentration of nitrite and evaluation of catalase activity. α-Lipoic acid decreased body rotations induced by apomorphine, as well as caused an improvement in motor performance by increasing locomotor activity in the open field test and use of contralateral paw (in the opposite side of the lesion produced by 6-OHDA) at cylinder test. α-lipoic acid showed antioxidant effects, decreasing lipid peroxidation and nitrite levels and interacting with antioxidant system by decreasing of endogenous catalase activity. Therefore, α-lipoic acid prevented the damage induced by 6-OHDA or by chronic use of L-DOPA in dopaminergic neurons, suggesting that α-lipoic could be a new therapeutic target for Parkinson's disease prevention and treatment. PMID:24023579

  9. The impact of high fructose on cardiovascular system: Role of α-lipoic acid.

    PubMed

    Saygin, M; Asci, H; Cankara, F N; Bayram, D; Yesilot, S; Candan, I A; Alp, H H

    2016-02-01

    The aim of this study was to evaluate the role of α-lipoic acid (α-LA) on oxidative damage and inflammation that occur in endothelium of aorta and heart while constant consumption of high-fructose corn syrup (HFCS). The rats were randomly divided into three groups with each group containing eight rats. The groups include HFCS, HFCS + α-LA treatment, and control. HFCS was given to the rats at a ratio of 30% of F30 corn syrup in drinking water for 10 weeks. α-LA treatment was given to the rats at a dose of 100 mg/kg/day orally for the last 6 weeks. At the end of the experiment, the rats were killed by cervical dislocation. The blood samples were collected for biochemical studies, and the aortic and cardiac tissues were collected for evaluation of oxidant-antioxidant system, tissue bath, and pathological examination. HFCS had increased the levels of malondialdehyde, creatine kinase MB, lactate dehydrogenase, and uric acid and showed significant structural changes in the heart of the rats by histopathology. Those changes were improved by α-LA treatment as it was found in this treatment group. Immunohistochemical expressions of tumor necrosis factor α and inducible nitric oxide synthase were increased in HFCS group, and these receptor levels were decreased by α-LA treatment. All the tissue bath studies supported these findings. Chronic consumption of HFCS caused several problems like cardiac and endothelial injury of aorta by hyperuricemia and induced oxidative stress and inflammation. α-LA treatment reduced uric acid levels, oxidative stress, and corrected vascular responses. α-LA can be added to cardiac drugs due to its cardiovascular protective effects against the cardiovascular diseases. PMID:25825413

  10. Lipoic acid as a novel treatment for Alzheimer's disease and related dementias.

    PubMed

    Holmquist, Lina; Stuchbury, Grant; Berbaum, Katrin; Muscat, Sonja; Young, Simon; Hager, Klaus; Engel, Jürgen; Münch, Gerald

    2007-01-01

    Alzheimer's disease (AD) is a progressive neurodegenerative disorder that destroys patient memory and cognition, communication ability with the social environment and the ability to carry out daily activities. Despite extensive research into the pathogenesis of AD, a neuroprotective treatment - particularly for the early stages of disease - remains unavailable for clinical use. In this review, we advance the suggestion that lipoic acid (LA) may fulfil this therapeutic need. A naturally occurring precursor of an essential cofactor for mitochondrial enzymes, including pyruvate dehydrogenase (PDH) and alpha-ketoglutarate dehydrogenase (KGDH), LA has been shown to have a variety of properties which can interfere with pathogenic principles of AD. For example, LA increases acetylcholine (ACh) production by activation of choline acetyltransferase and increases glucose uptake, thus supplying more acetyl-CoA for the production of ACh. LA chelates redox-active transition metals, thus inhibiting the formation of hydroxyl radicals and also scavenges reactive oxygen species (ROS), thereby increasing the levels of reduced glutathione. Via the same mechanisms, downregulation redox-sensitive inflammatory processes is also achieved. Furthermore, LA can scavenge lipid peroxidation products such as hydroxynonenal and acrolein. The reduced form of LA, dihydrolipoic acid (DHLA), is the active compound responsible for most of these beneficial effects. R-alpha-LA can be applied instead of DHLA, as it is reduced by mitochondrial lipoamide dehydrogenase, a part of the PDH complex. In this review, the properties of LA are explored with particular emphasis on how this agent, particularly the R-alpha-enantiomer, may be effective to treat AD and related dementias. PMID:16989905

  11. Dihydrolipoic but not alpha-lipoic acid affects susceptibility of eukaryotic cells to bacterial invasion.

    PubMed

    Bozhokina, Ekaterina; Khaitlina, Sofia; Gamaley, Irina

    2015-05-01

    Sensitivity of eukaryotic cells to facultative pathogens can depend on physiological state of host cells. Previously we have shown that pretreatment of HeLa cells with N-acetylcysteine (NAC) makes the cells 2-3-fold more sensitive to invasion by the wild-type Serratia grimesii and recombinant Escherichia coli expressing gene of actin-specific metalloprotease grimelysin [1]. To evaluate the impact of chemically different antioxidants, in the present work we studied the effects of α-Lipoic acid (LA) and dihydrolipoic acid (DHLA) on efficiency of S. grimesii and recombinant E. coli expressing grimelysin gene to penetrate into HeLa and CaCo cells. Similarly to the effect of NAC, pretreatment of HeLa and CaCo cells with 0.6 or 1.25 mM DHLA increased the entry of grimelysin producing bacteria by a factor of 2.5 and 3 for the wild-type S. grimesii and recombinant E. coli, respectively. In contrast, pretreatment of the cells with 0.6 or 1.25 mM LA did not affect the bacteria uptake. The increased invasion of HeLa and CaCo cells correlated with the enhanced expression of E-cadherin and β-catenin genes, whereas expression of these genes in the LA-treated cells was not changed. Comparison of these results suggests that it is sulfhydryl group of DHLA that promotes efficient modification of cell properties assisting bacterial uptake. We assume that the NAC- and DHLA-induced stimulation of the E-cadherin-catenin pathway contributes to the increased internalization of the grimelysin producing bacteria within transformed cells. PMID:25817791

  12. Alpha lipoic acid inhibits proliferation and epithelial mesenchymal transition of thyroid cancer cells.

    PubMed

    Jeon, Min Ji; Kim, Won Gu; Lim, Seonhee; Choi, Hyun-Jeung; Sim, Soyoung; Kim, Tae Yong; Shong, Young Kee; Kim, Won Bae

    2016-01-01

    The naturally occurring short-chain fatty acid, α-lipoic acid (ALA) is a powerful antioxidant which is clinically used for treatment of diabetic neuropathy. Recent studies suggested the possibility of ALA as a potential anti-cancer agent, because it could activate adenosine monophosphate activated protein kinase (AMPK) and inhibit transforming growth factor-β (TGFβ) pathway. In this study, we evaluate the effects of ALA on thyroid cancer cell proliferation, migration and invasion. We performed in vitro cell proliferation analysis using BCPAP, HTH-83, CAL-62 and FTC-133 cells. ALA suppressed thyroid cancer cell proliferation through activation of AMPK and subsequent down-regulation of mammalian target of rapamycin (mTOR)-S6 signaling pathway. Low-dose ALA, which had minimal effects on cell proliferation, also decreased cell migration and invasion of BCPAP, CAL-62 and HTH-83 cells. ALA inhibited epithelial mesenchymal transition (EMT) evidently by increase of E-cadherin and decreases of activated β-catenin, vimentin, snail, and twist in these cells. ALA suppressed TGFβ production and inhibited induction of p-Smad2 and twist by TGFβ1 or TGFβ2. These findings indicate that ALA reduces cancer cell migration and invasion through suppression of TGFβ production and inhibition of TGFβ signaling pathways in thyroid cancer cells. ALA also significantly suppressed tumor growth in mouse xenograft model using BCPAP and FTC-133 cells. This is the first study to show anti-cancer effect of ALA on thyroid cancer cells. ALA could be a potential therapeutic agent for treatment of advanced thyroid cancer, possibly as an adjuvant therapy with other systemic therapeutic agents. PMID:26463583

  13. Effect of myo-inositol and alpha-lipoic acid on oocyte quality in polycystic ovary syndrome non-obese women undergoing in vitro fertilization: a pilot study.

    PubMed

    Rago, R; Marcucci, I; Leto, G; Caponecchia, L; Salacone, P; Bonanni, P; Fiori, C; Sorrenti, G; Sebastianelli, A

    2015-01-01

    The aim of the present study was to evaluate the effectiveness of the combined administration of myo-inositol and α-lipoic acid in polycystic ovary syndrome (PCOS) patients with normal body mass index (BMI), who had previously undergone intracytoplasmic sperm injection (ICSI) and received myo-inositol alone. Thirty-six of 65 normal-weight patients affected by PCOS who did not achieve pregnancy and one patient who had a spontaneous abortion were re-enrolled and given a cycle of treatment with myo-inositol and α-lipoic acid. For all female partners of the treated couples, the endocrine-metabolic and ultrasound parameters, ovarian volume, oocyte and embryo quality, and pregnancy rates were assessed before and after three months of treatment and compared with those of previous in vitro fertilization (IVF) cycle(s). After supplementation of myo-inositol with α-lipoic acid, insulin levels, BMI and ovarian volume were significantly reduced compared with myo-inositol alone. No differences were found in the fertilization and cleavage rate or in the mean number of transferred embryos between the two different treatments, whereas the number of grade 1 embryos was significantly increased, with a significant reduction in the number of grade 2 embryos treated with myo-inositol plus α-lipoic acid. Clinical pregnancy was not significantly different with a trend for a higher percentage for of myo-inositol and α-lipoic acid compared to the myo-inositol alone group. Our preliminary data suggest that the supplementation of myo-inositol and α-lipoic acid in PCOS patients undergoing an IVF cycle can help to improve their reproductive outcome and also their metabolic profiles, opening potential for their use in long-term prevention of PCOS. PMID:26753656

  14. Stability, cutaneous delivery and antioxidant potential of a lipoic acid and α-tocopherol co-drug incorporated in microemulsions

    PubMed Central

    Thomas, Siji; Vieira, Camila S.; Hass, Martha A.; Lopes, Luciana B.

    2014-01-01

    The aim of this study was to assess the skin penetration, stability and antioxidant effects of a α-tocopherol-lipoic acid co-drug. To enhance penetration, we evaluated three microemulsions varying in water content and composition of the oil phase (isopropyl myristate with either monocaprylin or oleic acid). The co-drug was incorporated at 1% (w/w). Co-drug hydrolysis in the microemulsion increased with increases in time (up to 48 h) and formulation water content (10–30%, w/w). Microemulsions increased the co-drug delivery into viable layers of porcine ear skin by 2.9–7.8–fold compared to a control formulation (20% monocaprylin in isopropyl myristate) after 24 h. Penetration enhancement was influenced by the oil phase, with the formulation containing monocaprylin displaying the most pronounced effect. Antioxidant activity, assessed in skin bioequivalents using the thiobarbituric acid-reactive substances (TBARS) assay, demonstrated that TBARS levels decreased by 39% after treatment with the co-drug-containing microemulsion compared to the unloaded formulation. In addition to the co-drug, tocopherol (8.2 ± 0.6 μg/cm2) was detected in the viable bioequivalent tissues, suggesting that the co-drug was partly hydrolyzed after 12 h. Taken together, these results support the potential of nanodispersed formulations containing a tocopherol-lipoic acid co-drug to improve skin antioxidant activity. PMID:24961388

  15. Protective effects of L-carnitine and alpha-lipoic acid in rats with adjuvant arthritis.

    PubMed

    Tastekin, Nurettin; Aydogdu, Nurettin; Dokmeci, Dikmen; Usta, Ufuk; Birtane, Murat; Erbas, Hakan; Ture, Mevlut

    2007-10-01

    Free radicals play an important role in the pathophysiology of adjuvant arthritis. The purpose of this study was to assess the efficacy of L-carnitine (LC) and alpha-lipoic acid (alpha-LA) which are known to have antioxidant effects, in the treatment of adjuvant arthritis. Arthritis model was created by the administration of complete Freund's adjuvant (CFA) in 32 of 40 male Sprague-Dawley rats. The rats were divided into five groups. Rats in Group I served as controls and received 0.1 ml kg(-1) saline. Group II received only 0.1 ml of CFA and served as the CFA-control for the other groups. Groups III-V, after being injected with CFA, were treated with LC, alpha-LA or diclofenac, respectively. Levels of malondialdehyde (MDA) and glutathione (GSH) were measured in plasma samples. Enzyme activities of superoxide dismutase (SOD) and glutathione peroxidase (GPx) were measured. The paws of rats were evaluated histopathologically to investigate the anti-inflammatory effects. TNF-alpha levels were measured for the evaluation of inflammation. In Group II plasma MDA increased, levels of glutathione decreased, enzyme activities of SOD and GPx decreased. Histopathological damage increased in the paws of the rats in this group. MDA levels decreased in Groups III-V when compared with Group II. GSH levels significantly increased in Group III and IV than Group V. SOD activity of Group IV was higher than Group III and V. TNF-alpha levels were significantly lower in Group IV and V. LC and alpha-LA seemed to have protective effects against oxidative damage in adjuvant arthritis model. PMID:17826175

  16. Reduction of Conjunctival Fibrosis After Trabeculectomy Using Topical α-Lipoic Acid in Rabbit Eyes

    PubMed Central

    Çagatay, Halil Hüseyin; Ceylan, Erdinç; Keles, Sadullah; Koban, Yaran; Gokce, Gökçen; Huseyinoğlu, Urfettin; Ozcan, Ece; Oba, Mehmet E.

    2014-01-01

    Purpose: To evaluate the efficacy of α-lipoic acid (ALA) in reducing scarring after trabeculectomy. Materials and Methods: Eighteen adult New Zealand white rabbits underwent trabeculectomy. During trabeculectomy, thin sponges were placed between the sclera and Tenon’s capsule for 3 minutes, saline solution, mitomycin-C (MMC) and ALA was applied to the control group (CG) (n=6 eyes), MMC group (MMCG) (n=6 eyes), and ALA group (ALAG) (n=6 eyes), respectively. After surgery, topical saline and ALA was applied for 28 days to the control and ALAGs, respectively. Filtrating bleb patency was evaluated by using 0.1% trepan blue. Hematoxylin and eosin and Masson trichrome staining for toxicity, total cellularity, and collagen organization; α-smooth muscle actin immunohistochemistry staining performed for myofibroblast phenotype identification. Results: Clinical evaluation showed that all 6 blebs (100%) of the CG had failed, whereas there were only 2 failures (33%) in the ALAG and no failures in the MMCG on day 28. Histologic evaluation showed significantly lower inflammatory cell infiltration in the ALAGs and CGs than the MMCG. Toxicity change was more significant in the MMCG than the control and ALAGs. Collagen was better organized in the ALAG than control and MMCGs. In immunohistochemistry evaluation, ALA significantly reduced the population of cells expressing α-smooth muscle action. Conclusions: ΑLA prevents and/or reduces fibrosis by inhibition of inflammation pathways, revascularization, and accumulation of extracellular matrix. It can be used as an agent for delaying tissue regeneration and for providing a more functional-permanent fistula. PMID:25055213

  17. α-Lipoic Acid Antioxidant Treatment Limits Glaucoma-Related Retinal Ganglion Cell Death and Dysfunction

    PubMed Central

    Calkins, David J.; Horner, Philip J.

    2013-01-01

    Oxidative stress has been implicated in neurodegenerative diseases, including glaucoma. However, due to the lack of clinically relevant models and expense of long-term testing, few studies have modeled antioxidant therapy for prevention of neurodegeneration. We investigated the contribution of oxidative stress to the pathogenesis of glaucoma in the DBA/2J mouse model of glaucoma. Similar to other neurodegenerative diseases, we observed lipid peroxidation and upregulation of oxidative stress-related mRNA and protein in DBA/2J retina. To test the role of oxidative stress in disease progression, we chose to deliver the naturally occurring, antioxidant α-lipoic acid (ALA) to DBA/2J mice in their diet. We used two paradigms for ALA delivery: an intervention paradigm in which DBA/2J mice at 6 months of age received ALA in order to intervene in glaucoma development, and a prevention paradigm in which DBA/2J mice were raised on a diet supplemented with ALA, with the goal of preventing glaucoma development. At 10 and 12 months of age (after 4 and 11 months of dietary ALA respectively), we measured changes in genes and proteins related to oxidative stress, retinal ganglion cell (RGC) number, axon transport, and axon number and integrity. Both ALA treatment paradigms showed increased antioxidant gene and protein expression, increased protection of RGCs and improved retrograde transport compared to control. Measures of lipid peroxidation, protein nitrosylation, and DNA oxidation in retina verified decreased oxidative stress in the prevention and intervention paradigms. These data demonstrate the utility of dietary therapy for reducing oxidative stress and improving RGC survival in glaucoma. PMID:23755225

  18. Effects of lipoic acid on lipolysis in 3T3-L1 adipocytes[S

    PubMed Central

    Fernández-Galilea, Marta; Pérez-Matute, Patricia; Prieto-Hontoria, Pedro L; Martinez, J Alfredo; Moreno-Aliaga, Maria J

    2012-01-01

    Lipoic acid (LA) is a naturally occurring compound with beneficial effects on obesity. The aim of this study was to evaluate its effects on lipolysis in 3T3-L1 adipocytes and the mechanisms involved. Our results revealed that LA induced a dose- and time-dependent lipolytic action, which was reversed by pretreatment with the c-Jun N-terminal kinase inhibitor SP600125, the PKA inhibitor H89, and the AMP-activated protein kinase activator AICAR. In contrast, the PI3K/Akt inhibitor LY294002 and the PDE3B antagonist cilostamide enhanced LA-induced lipolysis. LA treatment for 1 h did not modify total protein content of hormone-sensitive lipase (HSL) but significantly increased the phosphorylation of HSL at Ser563 and at Ser660, which was reversed by H89. LA treatment also induced a marked increase in PKA-mediated perilipin phosphorylation. LA did not significantly modify the protein levels of adipose triglyceride lipase or its activator comparative gene identification 58 (CGI-58) and inhibitor G(0)/G(1) switch gene 2 (G0S2). Furthermore, LA caused a significant inhibition of adipose-specific phospholipase A2 (AdPLA) protein and mRNA levels in parallel with a decrease in the amount of prostaglandin E2 released and an increase in cAMP content. Together, these data suggest that the lipolytic actions of LA are mainly mediated by phosphorylation of HSL through cAMP-mediated activation of protein kinase A probably through the inhibition of AdPLA and prostaglandin E2. PMID:22941773

  19. Bio-active nanoemulsions enriched with gold nanoparticle, marigold extracts and lipoic acid: In vitro investigations.

    PubMed

    Guler, Emine; Barlas, F Baris; Yavuz, Murat; Demir, Bilal; Gumus, Z Pinar; Baspinar, Yucel; Coskunol, Hakan; Timur, Suna

    2014-09-01

    A novel and efficient approach for the preparation of enriched herbal formulations was described and their potential applications including wound healing and antioxidant activity (cell based and cell free) were investigated via in vitro cell culture studies. Nigella sativa oil was enriched with Calendula officinalis extract and lipoic acid capped gold nanoparticles (AuNP-LA) using nanoemulsion systems. The combination of these bio-active compounds was used to design oil in water (O/W) and water in oil (W/O) emulsions. The resulted emulsions were characterized by particle size measurements. The phenolic content of each nanoemulsion was examined by using both colorimetric assay and chromatographic analyses. Two different methods containing cell free chemical assay (1-diphenyl-2-picrylhydrazyl method) and cell based antioxidant activity test were used to evaluate the antioxidant capacities. In order to investigate the bio-activities of the herbal formulations, in vitro cell culture experiments, including cytotoxicity, scratch assay, antioxidant activity and cell proliferation were carried out using Vero cell line as a model cell line. Furthermore, to monitor localization of the nanoemulsions after application of the cell culture, the cell images were monitored via fluorescence microscope after FITC labeling. All data confirmed that the enriched N. sativa formulations exhibited better antioxidant and wound healing activity than N. sativa emulsion without any enrichment. In conclusion, the incorporation of AuNP-LA and C. officinalis extract into the N. sativa emulsions significantly increased the bio-activities. The present work may support further studies about using the other bio-active agents for the enrichment of herbal preparations to strengthen their activities. PMID:25009101

  20. Attenuation of uremia by orally feeding alpha-lipoic acid on acetaminophen induced uremic rats.

    PubMed

    Pradhan, Shrabani; Mandal, Shreya; Roy, Suchismita; Mandal, Arpita; Das, Koushik; Nandi, Dilip K

    2013-04-01

    Uremia means excess nitrogenous waste products in the blood & their toxic effects. An acute acetaminophen (paracetamol, N-acetyl p-aminophenol; APAP) overdose may result into potentially fatal hepatic and renal necrosis in humans and experimental animals. The aims of this present study were to investigate the protective effect of alpha-lipoic acid (ALA) on oxidative stress & uremia on male albino rats induced by acetaminophen. The study was performed by 24 albino male Wister strain rats which were randomly divided into four groups: Group I, control - receives normal food and water, Groups II, III & IV receive acetaminophen interperitoneally at the dose of 500 mg/kg/day for 10 days, from 11th day Groups III & IV were treated with ALA at the dose of 5 mg & 10 mg/100 g/day for 15 days, respectively. After 25 days of treatment, it was observed that there was a significant increase in plasma urea, creatinine, sodium and malondialdehyde (MDA) levels (p < 0.05) but a significant decrease in super oxide dismutase (SOD) & catalase activity & potassium level in uremic group is compared with control group & there was a significant increase in SOD & catalase (p < 0.05) & a significant decrease in serum urea, creatinine & Na and MDA (p < 0.05) in Group III & Group IV is compared with Group II & significant changes were observed in high ALA dose group. In conclusion it was observed that the ALA has nephroprotective activities by biochemical observations against acetaminophen induced uremic rats. PMID:23960834

  1. Spectroscopic studies of R(+)-α-lipoic acid--cyclodextrin complexes.

    PubMed

    Ikuta, Naoko; Tanaka, Akira; Otsubo, Ayako; Ogawa, Noriko; Yamamoto, Hiromitsu; Mizukami, Tomoyuki; Arai, Shoji; Okuno, Masayuki; Terao, Keiji; Matsugo, Seiichi

    2014-01-01

    α-Lipoic acid (ALA) has a chiral center at the C6 position, and exists as two enantiomers, R(+)-ALA (RALA) and S(-)-ALA (SALA). RALA is naturally occurring, and is a cofactor for mitochondrial enzymes, therefore playing a major role in energy metabolism. However, RALA cannot be used for pharmaceuticals or nutraceuticals because it readily polymerizes via a 1,2-dithiolane ring-opening when exposed to light or heat. So, it is highly desired to find out the method to stabilize RALA. The purpose of this study is to provide the spectroscopic information of stabilized RALA and SALA through complexation with cyclodextrins (CDs), α-CD, β-CD and γ-CD and to examine the physical characteristics of the resultant complexes in the solid state. The RALA-CD structures were elucidated based on the micro fourier transform infrared (FT-IR) and Raman analyses. The FT-IR results showed that the C=O stretching vibration of RALA appeared at 1717 cm⁻¹ and then shifted on formation of the RALA-CD complexes. The Raman spectra showed that the S-S and C-S stretching vibrations for RALA at 511 cm⁻¹ (S-S), 631 cm⁻¹ (C-S) and 675 cm⁻¹ (C-S) drastically weakened and almost disappeared upon complexation with CDs. Several peaks indicative of O-H vibrations also shifted or changed in intensity. These results indicate that RALA and CDs form host-guest complexes by interacting with one another. PMID:25387076

  2. Interaction of α-Lipoic Acid with the Human Na+/Multivitamin Transporter (hSMVT).

    PubMed

    Zehnpfennig, Britta; Wiriyasermkul, Pattama; Carlson, David A; Quick, Matthias

    2015-06-26

    The human Na(+)/multivitamin transporter (hSMVT) has been suggested to transport α-lipoic acid (LA), a potent antioxidant and anti-inflammatory agent used in therapeutic applications, e.g. in the treatment of diabetic neuropathy and Alzheimer disease. However, the molecular basis of the cellular delivery of LA and in particular the stereospecificity of the transport process are not well understood. Here, we expressed recombinant hSMVT in Pichia pastoris and used affinity chromatography to purify the detergent-solubilized protein followed by reconstitution of hSMVT in lipid bilayers. Using a combined approach encompassing radiolabeled LA transport and equilibrium binding studies in conjunction with the stabilized R-(+)- and S-(-)-enantiomers and the R,S-(+/-) racemic mixture of LA or lipoamide, we identified the biologically active form of LA, R-LA, to be the physiological substrate of hSMVT. Interaction of R-LA with hSMVT is strictly dependent on Na(+). Under equilibrium conditions, hSMVT can simultaneously bind ~2 molecules of R-LA in a biphasic binding isotherm with dissociation constants (Kd) of 0.9 and 7.4 μm. Transport of R-LA in the oocyte and reconstituted system is exclusively dependent on Na(+) and exhibits an affinity of ~3 μm. Measuring transport with known amounts of protein in proteoliposomes containing hSMVT in outside-out orientation yielded a catalytic turnover number (kcat) of about 1 s(-1), a value that is well in agreement with other Na(+)-coupled transporters. Our data suggest that hSMVT-mediated transport is highly specific for R-LA at our tested concentration range, a finding with wide ramifications for the use of LA in therapeutic applications. PMID:25971966

  3. The disulfide compound α-lipoic acid and its derivatives: A novel class of anticancer agents targeting mitochondria.

    PubMed

    Dörsam, Bastian; Fahrer, Jörg

    2016-02-01

    The endogenous disulfide α-lipoic acid (LA) is an essential mitochondrial co-factor. In addition, LA and its reduced counterpart dihydro lipoic acid form a potent redox couple with antioxidative functions, for which it is used as dietary supplement and therapeutic. Recently, it has gained attention due to its cytotoxic effects in cancer cells, which is the key aspect of this review. We initially recapitulate the dietary occurrence, gastrointestinal absorption and pharmacokinetics of LA, illustrating its diverse antioxidative mechanisms. We then focus on its mode of action in cancer cells, in which it triggers primarily the mitochondrial pathway of apoptosis, whereas non-transformed primary cells are hardly affected. Furthermore, LA impairs oncogenic signaling and displays anti-metastatic potential. Novel LA derivatives such as CPI-613, which target mitochondrial energy metabolism, are described and recent pre-clinical studies are presented, which demonstrate that LA and its derivatives exert antitumor activity in vivo. Finally, we highlight clinical studies currently performed with the LA analog CPI-613. In summary, LA and its derivatives are promising candidates to complement the arsenal of established anticancer drugs due to their mitochondria-targeted mode of action and non-genotoxic properties. PMID:26604131

  4. The Protective Effects of 5-Methoxytryptamine-α-lipoic Acid on Ionizing Radiation-Induced Hematopoietic Injury

    PubMed Central

    Li, Deguan; Tian, Zhenyuan; Tang, Weisheng; Zhang, Junling; Lu, Lu; Sun, Zhaojin; Zhou, Zewei; Fan, Feiyue

    2016-01-01

    Antioxidants are prospective radioprotectors because of their ability to scavenge radiation-induced reactive oxygen species (ROS). The hematopoietic system is widely studied in radiation research because of its high radiosensitivity. In the present study, we describe the beneficial effects of 5-methoxytryptamine-α-lipoic acid (MLA), which was synthesized from melatonin and α-lipoic acid, against radiation-induced hematopoietic injury. MLA administration significantly enhanced the survival rate of mice after 7.2 Gy total body irradiation. The results showed that MLA not only markedly increased the numbers and clonogenic potential of hematopoietic cells but also decreased DNA damage, as determined by flow cytometric analysis of histone H2AX phosphorylation. In addition, MLA decreased the levels of ROS in hematopoietic cells by inhibiting NOX4 expression. These data demonstrate that MLA prevents radiation-induced hematopoietic syndrome by increasing the number and function of and by inhibiting DNA damage and ROS production in hematopoietic cells. These data suggest MLA is beneficial for the protection of radiation injuries. PMID:27314327

  5. Novel Conjugates of 1,3-Diacylglycerol and Lipoic Acid: Synthesis, DPPH Assay, and RP-LC-MS-APCI Analysis

    PubMed Central

    Madawala, Samanthi R. P.; Andersson, Rolf E.; Jastrebova, Jelena A.; Almeida, Maria; Dutta, Paresh C.

    2011-01-01

    1,3-Diacylglycerol is known to reduce body weight and fat deposits in humans. α-Lipoic acid is a potent antioxidant and effective against many pathological conditions, including obesity and related metabolic syndromes. The present work is based on the hypothesis that the hybrid molecules of 1,3-diacylglycerol and lipoic acid possess synergistic and/or additive effects compared with the parent compounds against obesity, overweight, and related metabolic syndromes. Laboratory scale synthesis of 1,3-dioleoyl-2-lipoyl-sn-glycerol (yield 80%) and 1,3-dioleoyl-2-dihydrolipoyl-sn-glycerol (yield 70%) was performed for the first time and supported by NMR and MS data. Free radical scavenging capacity of the conjugates was assayed using DPPH test. A remarkably high in vitro free radical scavenging capacity was demonstrated for the 1,3-dioleoyl-2-dihydrolipoyl-sn-glycerol (EC50 value 0.21). RP-HPLC-MS-APCI analysis showed satisfactory separation between the conjugates (R~1). Protonated molecular ion of the conjugates at m/z 809 and m/z at 811, respectively, and their characteristic fragment ions were abundant. PMID:21966595

  6. The Protective Effects of 5-Methoxytryptamine-α-lipoic Acid on Ionizing Radiation-Induced Hematopoietic Injury.

    PubMed

    Li, Deguan; Tian, Zhenyuan; Tang, Weisheng; Zhang, Junling; Lu, Lu; Sun, Zhaojin; Zhou, Zewei; Fan, Feiyue

    2016-01-01

    Antioxidants are prospective radioprotectors because of their ability to scavenge radiation-induced reactive oxygen species (ROS). The hematopoietic system is widely studied in radiation research because of its high radiosensitivity. In the present study, we describe the beneficial effects of 5-methoxytryptamine-α-lipoic acid (MLA), which was synthesized from melatonin and α-lipoic acid, against radiation-induced hematopoietic injury. MLA administration significantly enhanced the survival rate of mice after 7.2 Gy total body irradiation. The results showed that MLA not only markedly increased the numbers and clonogenic potential of hematopoietic cells but also decreased DNA damage, as determined by flow cytometric analysis of histone H2AX phosphorylation. In addition, MLA decreased the levels of ROS in hematopoietic cells by inhibiting NOX4 expression. These data demonstrate that MLA prevents radiation-induced hematopoietic syndrome by increasing the number and function of and by inhibiting DNA damage and ROS production in hematopoietic cells. These data suggest MLA is beneficial for the protection of radiation injuries. PMID:27314327

  7. Increasing bioavailability of (R)-alpha-lipoic acid to boost antioxidant activity in the treatment of neuropathic pain.

    PubMed

    Maglione, Emilia; Marrese, Cinzia; Migliaro, Elisa; Marcuccio, Fortuna; Panico, Claudia; Salvati, Carmine; Citro, Giuseppe; Quercio, Marco; Roncagliolo, Federico; Torello, Carlo; Brufani, Mario

    2015-01-01

    a-lipoic acid (a-LA) is a potent natural antioxidant because it has a broad spectrum of action towards a great many free radical species and boosts the endogenous antioxidant systems.Although it is a multi-functional molecule, its pharmacokinetic characteristics pose restrictions to its use in the treatment of oxidative stress-dependent illnesses. Formulations that increase the bioavailability of a-LA have a better potential efficacy as adjuvants for the treatment of these conditions.This objective was achieved with a liquid formulation for oral use containing only R-aLA, the natural enantiomeric and most active form of a-lipoic acid.For the first time, the effects of this formulation were evaluated on neuropathic pain, a symptom caused by an increase in oxidative stress, regardless of the underlying cause. Neuropathic patients who have used this dietary supplement noticed an improvement in their quality of life and a significant reduction was observed in a number of certain descriptive pain parameters (intensity, burning, unpleasantness, superficial pain).Undoubtedly further, more in-depth, studies need to be conducted; however, this first investigation confirms the role of R-aLA as an anti-oxidant for the aetiological treatment of peripheral neuropathy. Increasing its plasma bioavailability even after a non-invasive administration through the oral route is a good starting point for proposing a valid adjuvant for the treatment of pain symptoms. PMID:26694149

  8. Alpha-lipoic acid: an inhibitor of secretory phospholipase A2 with anti-inflammatory activity.

    PubMed

    Jameel, Noor Mohamed; Shekhar, Mysore A; Vishwanath, Bannikuppe S

    2006-12-14

    Alpha-lipoic acid (ALA) and its reduced form dihydrolipoic acid (DHLA) are powerful antioxidants both in hydrophilic and lipophylic environments with diverse pharmacological properties including anti-inflammatory activity. The mechanism of anti-inflammatory activity of ALA and DHALA is not known. The present study describes the interaction of ALA and DHALA with pro-inflammatory secretory PLA(2) enzymes from inflammatory fluids and snake venoms. In vitro enzymatic inhibition of sPLA(2) from Vipera russellii, Naja naja and partially purified sPLA(2) enzymes from human ascitic fluid (HAF), human pleural fluid (HPF) and normal human serum (HS) by ALA and DHLA was studied using (14)C-oleate labeled Escherichia coli as the substrate. Biophysical interaction of ALA with sPLA(2) was studied by fluorescent spectral analysis and circular dichroism studies. In vivo anti-inflammatory activity was checked using sPLA(2) induced mouse paw edema model. ALA but not DHLA inhibited purified sPLA(2) enzymes from V. russellii, N. naja and partially purified HAF, HPF and HS in a dose dependent manner. This data indicated that ALA is critical for inhibition. IC(50) value calculated for these enzymes ranges from 0.75 to 3.0 microM. The inhibition is independent of calcium and substrate concentration. Inflammatory sPLA(2) enzymes are more sensitive to inhibition by ALA than snake venom sPLA(2) enzymes. ALA quenched the fluorescence intensity of sPLA(2) enzyme in a dose dependent manner. Apparent shift in the far UV-CD spectra of sPLA(2) with ALA indicated change in its alpha-helical confirmation and these results suggest its direct interaction with the enzyme. ALA inhibits the sPLA(2) induced mouse paw edema in a dose dependent manner and confirms the sPLA(2) inhibitory activity in vivo also. These data suggest that ALA may act as an endogenous regulator of sPLA(2) enzyme activity and suppress inflammatory reactions. PMID:17011589

  9. [Changes in antioxidant capacity of the guinea pig exposed to noise and the protective effect of alpha-lipoic acid against acoustic trauma].

    PubMed

    Diao, Ming-Fang; Liu, Hai-Ying; Zhang, Yan-Min; Gao, Wen-Yuan

    2003-12-25

    The study was aimed at exploring the effect of noise on total antioxidant capacity (TAC) in serum, nitric oxide (NO) level in the cochlea and the protective action of alpha-lipoic acid against noise-induced hearing loss (NIHL). Sixty guinea pigs (350-400 g) were divided randomly into three groups (control group, noise+saline group and noise+alpha-lipoic acid group). Serum and cochlear tissue were treated immediately after noise exposure (4-kHz octave band, 115 dB SPL 5 h) to determine the level of TAC and NO, respectively. Auditory brainstem responses (ABRs) were measured before and immediately after exposure. The threshold of hearing in the control group was relatively stable, while the hearing threshold in the noise+saline group was significantly higher than those in the noise+alpha-lipoic acid group (P<0.05). TAC level of the noise+saline group was significantly lower than that of the control group P<0.05 . TAC level of the noise+alpha-lipoic acid group was significantly higher than that of the noise+saline group P<0.05 , while there was no significant difference in the levels between the noise+alpha-lipoic acid group and the control group (P>0.05). The NO level of the cochlear tissue in the noise+saline group was significantly higher than that of the control group (P<0.05). Cochlear NO level in the noise+alpha-lipoic acid group was significantly lower than that of the noise+saline group (P<0.05), while there was no significant difference in cochlear NO levels between the noise+alpha-lipoic acid group and the control group (P>0.05). The results obtained indicate that noise exposure causes a decrease in serum TAC and an increase in NO in cochlea. alpha-Lipoid acid exerts a protective effect against hearing loss in acoustic trauma through its antioxidant effects. PMID:14695484

  10. Alpha-Lipoic Acid and Antioxidant Diet Help to Improve Endothelial Dysfunction in Adolescents with Type 1 Diabetes: A Pilot Trial

    PubMed Central

    Scaramuzza, Andrea; Giani, Elisa; Redaelli, Francesca; Ungheri, Saverio; Macedoni, Maddalena; Giudici, Valentina; Bosetti, Alessandra; Ferrari, Matteo; Zuccotti, Gian Vincenzo

    2015-01-01

    After evaluating the prevalence of early endothelial dysfunction, as measured by means of reactive hyperemia in adolescents with type 1 diabetes, we started a 6-month, double-blind, randomized trial to test the efficacy of an antioxidant diet (± alpha-lipoic acid supplementation) to improve endothelial dysfunction. Seventy-one children and adolescents, ages 17 ± 3.9 yrs, with type 1 diabetes since 9.5 ± 5.3 yrs, using intensified insulin therapy, were randomized into 3 arms: (a) antioxidant diet 10.000 ORAC + alpha-lipoic acid; (b) antioxidant diet 10.000 ORAC + placebo; (c) controls. BMI, blood pressure, fasting lipid profile, HbA1c, insulin requirement, dietary habits, and body composition were determined in each patient. An antioxidant diet significantly improved endothelial dysfunction when supplemented with alpha-lipoic acid, unlike diet with placebo or controls. A significant reduction in bolus insulin was also observed. We speculate that alpha-lipoic acid might have an antioxidant effect in pediatric diabetes patients by reducing insulin. PMID:26171398

  11. Effect of the Administration of Alpha-Lipoic Acid on Contrast Sensitivity in Patients with Type 1 and Type 2 Diabetes

    PubMed Central

    Gębka, Anna; Raczyńska, Dorota

    2014-01-01

    The aim of this study was to estimate the effects of oral supplementation of alpha-lipoic acid (ALA) on contrast sensitivity (CS) in patients with type 1 diabetes mellitus (T1DM) and type 2 diabetes mellitus (T2DM). The study included 12 patients with T1DM aged 43±12 years, 48 patients with T2DM aged 59±10 years, and 20 control subjects aged 33±8 years. Patients from each studied group, including the control group, were randomly assigned to receive 300 mg of ALA orally once daily for 3 months. CS was evaluated with the Functional Acuity Contrast Test (FACT, Stereo Optical). In the group of patients with T1DM receiving ALA for 3 months CS remained stable and improved in those with T2DM. Reduction of CS in both T1DM and T2DM patients without alpha-lipoic acid supplementation was observed. In the control group on alpha-lipoic acid supplementation, CS improvement was noticed at one spatial frequency. Changes in the CS were observed, despite stable visual acuity and eye fundus image in all studied subjects. Our study demonstrated that oral administration of alpha-lipoic acid had influence on CS in both T1DM and T2DM patients. PMID:24665163

  12. Age-dependent modulation of synaptic plasticity and insulin mimetic effect of lipoic acid on a mouse model of Alzheimer's disease.

    PubMed

    Sancheti, Harsh; Akopian, Garnik; Yin, Fei; Brinton, Roberta D; Walsh, John P; Cadenas, Enrique

    2013-01-01

    Alzheimer's disease is a progressive neurodegenerative disease that entails impairments of memory, thinking and behavior and culminates into brain atrophy. Impaired glucose uptake (accumulating into energy deficits) and synaptic plasticity have been shown to be affected in the early stages of Alzheimer's disease. This study examines the ability of lipoic acid to increase brain glucose uptake and lead to improvements in synaptic plasticity on a triple transgenic mouse model of Alzheimer's disease (3xTg-AD) that shows progression of pathology as a function of age; two age groups: 6 months (young) and 12 months (old) were used in this study. 3xTg-AD mice fed 0.23% w/v lipoic acid in drinking water for 4 weeks showed an insulin mimetic effect that consisted of increased brain glucose uptake, activation of the insulin receptor substrate and of the PI3K/Akt signaling pathway. Lipoic acid supplementation led to important changes in synaptic function as shown by increased input/output (I/O) and long term potentiation (LTP) (measured by electrophysiology). Lipoic acid was more effective in stimulating an insulin-like effect and reversing the impaired synaptic plasticity in the old mice, wherein the impairment of insulin signaling and synaptic plasticity was more pronounced than those in young mice. PMID:23875003

  13. Development of Sensitive Analytical Approach for the Quantification of α-Lipoic Acid Using Boron Doped Diamond Electrode.

    PubMed

    Stankovic, Dalibor M; Mehmeti, Eda; Kalcher, Kurt

    2016-01-01

    A boron doped diamond (BDD) electrode was investigated for use as an electrochemical sensor for α-lipoic acid (LA) using amperometric and differential pulse voltammetric detection. LA displays a well expressed oxidation peak at +0.9 V vs. Ag/AgCl in solutions with a pH value of 3. It was found that signals obtained are linearly related to the concentration range from 0.3 to 105 μM with detection limit of 0.088 μM. Interferences by common compounds such as ascorbic acid, uric acid and dopamine were tested and the method was successfully applied to the determination of LA in human body fluids where it gave recoveries in the range from 95 to 97%. PMID:27506710

  14. Α‑lipoic acid protects against cerebral ischemia/reperfusion-induced injury in rats.

    PubMed

    Deng, Houliang; Zuo, Xialin; Zhang, Jingjing; Liu, Xiaoxia; Liu, Li; Xu, Qian; Wu, Zhuomin; Ji, Aimin

    2015-05-01

    It is well established that the brain is sensitive to ischemia/reperfusion (I/R)‑induced injury. α‑lipoic acid (LA), a free radical scavenger and antioxidant, has a neuroprotective effect against cerebral I/R‑induced injury, however, the underlying mechanisms remain to be elucidated. Therefore, the present study was undertaken to evaluate whether LA was able to protect against cerebral I/R‑induced injury and to examine the potential mechanisms. The neuroprotective effects of LA were investigated in a rat model of transient focal ischemia induced by middle cerebral artery occlusion (MCAO) followed by reperfusion. Adult male Sprague‑Dawley rats were randomly assigned into the sham, cerebral I/R injury model and model plus LA groups. Cerebral I/R injury was induced by 90 min MCAO followed by reperfusion for 24 h. Cerebral infarct size was detected by 2,3,5‑triphenyltetrazolium chloride staining. Neurological deficit score (NDS), brain water content and oxidative parameters, including malondialdehyde (MDA), nitric oxide (NO), total antioxidant capacity (T‑AOC) and superoxide dismutase (SOD) were measured. The expression of cleaved caspase‑3, brain‑derived neurotrophic factor (BDNF), phosphatidylinositol‑4,5‑bisphosphate 3‑kinase (PI3K), p‑Akt and phosphorylated extracellular signal‑regulated kinase 1/2 (p‑ERK1/2) were also analyzed using western blotting. The present study demonstrated that pretreatment with LA significantly decreased the infarction size, brain water content and improved NDS. LA reversed the levels of oxidative parameters, including MDA, NO, T‑AOC and SOD to their normal state in rat brains following cerebral I/R. Furthermore, the expression of cleaved caspase‑3 markedly decreased and the expression of BDNF, PI3K, p‑Akt and p‑ERK1/2 significantly increased following administration of LA. On the basis of these findings, it was concluded that LA protected the brain from cerebral I/R damage by attenuation of

  15. Alpha Lipoic Acid Attenuates Radiation-Induced Thyroid Injury in Rats

    PubMed Central

    Jung, Jung Hwa; Jung, Jaehoon; Kim, Soo Kyoung; Woo, Seung Hoon; Kang, Ki Mun; Jeong, Bae-Kwon; Jung, Myeong Hee; Kim, Jin Hyun; Hahm, Jong Ryeal

    2014-01-01

    Exposure of the thyroid to radiation during radiotherapy of the head and neck is often unavoidable. The present study aimed to investigate the protective effect of α-lipoic acid (ALA) on radiation-induced thyroid injury in rats. Rats were randomly assigned to four groups: healthy controls (CTL), irradiated (RT), received ALA before irradiation (ALA + RT), and received ALA only (ALA, 100 mg/kg, i.p.). ALA was treated at 24 h and 30 minutes prior to irradiation. The neck area including the thyroid gland was evenly irradiated with 2 Gy per minute (total dose of 18 Gy) using a photon 6-MV linear accelerator. Greater numbers of abnormal and unusually small follicles in the irradiated thyroid tissues were observed compared to the controls and the ALA group on days 4 and 7 after irradiation. However, all pathologies were decreased by ALA pretreatment. The quantity of small follicles in the irradiated rats was greater on day 7 than day 4 after irradiation. However, in the ALA-treated irradiated rats, the numbers of small and medium follicles were significantly decreased to a similar degree as in the control and ALA-only groups. The PAS-positive density of the colloid in RT group was decreased significantly compared with all other groups and reversed by ALA pretreatment. The high activity index in the irradiated rats was lowered by ALA treatment. TGF-ß1 immunoreactivity was enhanced in irradiated rats and was more severe on the day 7 after radiation exposure than on day 4. Expression of TGF-ß1 was reduced in the thyroid that had undergone ALA pretreatment. Levels of serum pro-inflammatory cytokines (TNF-α, IL-1ß and IL-6) did not differ significantly between the all groups. This study provides that pretreatment with ALA decreased the severity of radiation-induced thyroid injury by reducing inflammation and fibrotic infiltration and lowering the activity index. Thus, ALA could be used to ameliorate radiation-induced thyroid injury. PMID:25401725

  16. Short-Term Continuous Subcutaneous Insulin Infusion Combined with Insulin Sensitizers Rosiglitazone, Metformin, or Antioxidant α-Lipoic Acid in Patients with Newly Diagnosed Type 2 Diabetes Mellitus

    PubMed Central

    Huang, Zhimin; Wan, Xuesi; Liu, Juan; Deng, Wanping; Chen, Ailing; Liu, Liehua; Liu, Jianbin; Wei, Guohong; Li, Hai; Fang, Donghong

    2013-01-01

    Abstract Background Short-term continuous subcutaneous insulin infusion (CSII) in patients with newly diagnosed type 2 diabetes has been proved effective in improving metabolic control and β-cell function, thus inducing long-term drug-free remission. A randomized controlled trial was conducted to investigate whether CSII in combination with rosiglitazone, metformin, or α-lipoic acid separately brings about extra benefits. Patients and Methods One hundred sixty patients with newly diagnosed type 2 diabetes were randomized to one of four treatment groups: CSII alone, CSII in combination with rosiglitazone or metformin for 3 months, or CSII with α-lipoic acid intravenous infusion for 2 weeks. Duration of CSII treatment was identical in the four groups. Glucose and lipid profiles, homeostasis model assessment (HOMA) indices, acute insulin response (AIR), intramyocellular lipid (IMCL) level, and malondialdehyde level were compared before and after intervention. Results The near-normoglycemia rate at the third month in CSII alone and that in combination with rosiglitazone, metformin, or α-lipoic acid was 72.5%, 87.5%, 90%, and 75%, respectively (metformin group vs. CSII alone, P=0.045). The metformin group achieved euglycemia in a shorter time (2.6±1.3 vs. 3.7±1.8 days, P=0.020) with less daily insulin dosage and was more powerful in lowering total cholesterol, increasing AIR and HOMA β-cell function, whereas reduction of IMCL in the soleus was more obvious in the rosiglitazone group but not in the metformin group. The efficacy of combination with α-lipoic acid was similar to that of CSII alone. Conclusions Short-term CSII in combination with rosiglitazone or metformin is superior to CSII alone, yet the efficacy of the two differs in some way, whereas that with α-lipoic acid might not have an additive effect. PMID:23991629

  17. Lipoic acid stimulates cAMP production via G protein-coupled receptor-dependent and -independent mechanisms.

    PubMed

    Salinthone, Sonemany; Schillace, Robynn V; Tsang, Catherine; Regan, John W; Bourdette, Dennis N; Carr, Daniel W

    2011-07-01

    Lipoic acid (LA) is a naturally occurring fatty acid that exhibits anti-oxidant and anti-inflammatory properties and is being pursued as a therapeutic for many diseases including multiple sclerosis, diabetic polyneuropathy and Alzheimer's disease. We previously reported on the novel finding that racemic LA (50:50 mixture of R-LA and S-LA) stimulates cAMP production, activates prostanoid EP2 and EP4 receptors and adenylyl cyclases (AC), and suppresses activation and cytotoxicity in NK cells. In this study, we present evidence that furthers our understanding of the mechanisms of action of LA. Using various LA derivatives, such as dihydrolipoic acid (DHLA), S,S-dimethyl lipoic acid (DMLA) and lipoamide (LPM), we discovered that only LA is capable of stimulating cAMP production in NK cells. Furthermore, there is no difference in cAMP production after stimulation with either R-LA, S-LA or racemic LA. Competition and synergistic studies indicate that LA may also activate AC independent of the EP2 and EP4 receptors. Pretreatment of PBMCs with KH7 (a specific peptide inhibitor of soluble AC) and the calcium inhibitor (Bapta) prior to LA treatment resulted in reduced cAMP levels, suggesting that soluble AC and calcium signaling mediate LA stimulation of cAMP production. In addition, pharmacological inhibitor studies demonstrate that LA also activates other G protein-coupled receptors, including histamine and adenosine but not the β-adrenergic receptors. These novel findings provide information to better understand the mechanisms of action of LA, which can help facilitate the use of LA as a therapeutic for various diseases. PMID:21036588

  18. Wheat germ oil enrichment in broiler feed with α-lipoic acid to enhance the antioxidant potential and lipid stability of meat

    PubMed Central

    2013-01-01

    Background Lipid peroxidation is the cause of declining the meat quality. Natural antioxidants plays a vital role in enhancing the stability and quality of meat. The supplementation of natural antioxidants in feed decreases lipid peroxidation and improves the stability of meat. Methods The present research was conducted to determine the effect of α-lipoic acid, α-tocopherol and wheat germ oil on the status of antioxidants, quality and lipid stability of broiler meat. One day old male broilers were fed with different feeds containing antioxidants i.e. natural (wheat germ oil) and synthetic α-tocopherol and α-lipoic acid during the two experimental years. Results The feed treatments have significant variation on the body weight and feed conversion ratio (FCR) while having no influence on the feed intake. The broilers fed on wheat germ oil (natural α-tocopherol) gained maximum body weight (2451.97 g & 2466.07 g) in the experimental years 2010–11 & 2011–12, respectively. The higher total phenolic contents were found in the broilers fed on wheat germ oil plus α-lipoic acid in breast (162.73±4.8 mg Gallic acid equivalent/100 g & 162.18±4.5 mg Gallic acid equivalent/100 g) and leg (149.67±3.3 mg Gallic acid equivalent/100 g & 146.07±3.2 mg Gallic acid equivalent/100 g) meat during both experimental years. Similar trend was observed for the 2,2-diphenyl-1-picrylhydrazyl (DPPH) and ferric reducing antioxidant power assay (FRAP). The production of malondialdehydes in the breast and leg meat increased with progressive increase in the time period. The deposition of α-tocopherol (AT) and α-lipoic acid (ALA) contents were found to be higher in the broilers fed on wheat germ oil plus α-lipoic acid in breast and leg meat during the both experimental years. Conclusion In conclusion, the combination of wheat germ oil and α-lipoic acid has more beneficial for stability and the quality of the broiler meat and more work should be needed in future for the bio

  19. α-Lipoic acid attenuates LPS-induced liver injury by improving mitochondrial function in association with GR mitochondrial DNA occupancy.

    PubMed

    Liu, Zhiqing; Guo, Jun; Sun, Hailin; Huang, Yanping; Zhao, Ruqian; Yang, Xiaojing

    2015-09-01

    α-Lipoic acid (LA) has been demonstrated to be a key regulator of energy metabolism. However, whether LA can protect the liver from inflammation, as well as the underlying mechanism involved, are still largely unclear. In the present study, mice treated with lipopolysaccharide (LPS) and injected with LA were used as a model. Liver injury, energy metabolism and mitochondrial regulation were investigated to assess the protective effect of LA on the liver and explore the possible mechanisms involved. Our results showed that LA attenuated liver injury, as evidenced by the decreased plasma alanine aminotransferase (ALT) and aspartate aminotransferase (AST) levels after LA treatment compared with the LPS-treated group. The hepatic ATP and NADH levels, expression levels of most mitochondrial DNA (mtDNA)-encoded genes as well as mitochondrial complex I, IV and V activities were all significantly increased in the LA-treated group compared with the LPS-treated group. Levels of Sirt3 protein, which is essential for the regulation of mitochondrial metabolism, were also increased in the LA-treated group. Regarding the regulation of mtDNA-encoded genes expression, we observed no obvious change in the methylation status of the mtDNA D-loop region. However, compared to the LPS-treated group, LA treatment increased glucocorticoid receptor (GR) protein expression in the liver, as well as the level of GR occupancy on the mtDNA D-loop region. Our study demonstrates that LA exerts a liver-protective effect in an inflammation state by improving mitochondrial function. Furthermore, to the best of our knowledge, we demonstrate for the first time that GR may be involved in this effect via an enhanced binding to the mtDNA transcriptional control region, thereby regulating the expression of mtDNA-encoded genes. PMID:26133658

  20. Alpha-Lipoic acid increases energy expenditure by enhancing adenosine monophosphate-activated protein kinase-peroxisome proliferator-activated receptor-gamma coactivator-1alpha signaling in the skeletal muscle of aged mice

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Skeletal muscle mitochondrial dysfunction is associated with aging and diabetes, which decreases respiratory capacity and increases reactive oxygen species. Lipoic acid (LA) possesses antioxidative and antidiabetic properties. Metabolic action of LA is mediated by activation of adenosine monophospha...

  1. The Protective Effect of Lipoic Acid on Selected Cardiovascular Diseases Caused by Age-Related Oxidative Stress

    PubMed Central

    Goraca, Anna

    2015-01-01

    Oxidative stress is considered to be the primary cause of many cardiovascular diseases, including endothelial dysfunction in atherosclerosis and ischemic heart disease, hypertension, and heart failure. Oxidative stress increases during the aging process, resulting in either increased reactive oxygen species (ROS) production or decreased antioxidant defense. The increase in the incidence of cardiovascular disease is directly related to age. Aging is also associated with oxidative stress, which in turn leads to accelerated cellular senescence and organ dysfunction. Antioxidants may help lower the incidence of some pathologies of cardiovascular diseases and have antiaging properties. Lipoic acid (LA) is a natural antioxidant which is believed to have a beneficial effect on oxidative stress parameters in relation to diseases of the cardiovascular system. PMID:25949771

  2. Bioprotective carnitinoids: lipoic acid, butyrate, and mitochondria-targeting to treat radiation injury: mitochondrial drugs come of age.

    PubMed

    Steliou, Kosta; Faller, Douglas V; Pinkert, Carl A; Irwin, Michael H; Moos, Walter H

    2015-06-01

    Preclinical Research Given nuclear-power-plant incidents such as the 2011 Japanese Fukushima-Daiichi disaster, an urgent need for effective medicines to protect against and treat the harmful biological effects of radiation is evident. To address such a challenge, we describe potential strategies herein including mitochondrial and epigenetic-driven methods using lipoic and butyric acid ester conjugates of carnitine. The antioxidant and other therapeutically beneficial properties of this class of agents may protect against ionizing radiation and resultant mitochondrial dysfunction. Recent studies of the compounds described herein reveal the potential-although further research and development is required to prove the effectiveness of this approach-to provide field-ready radiation-protective drugs. PMID:26109467

  3. Mitochondrial decay in the brains of old rats: ameliorating effect of alpha-lipoic acid and acetyl-L-carnitine.

    PubMed

    Long, Jiangang; Gao, Feng; Tong, Liqi; Cotman, Carl W; Ames, Bruce N; Liu, Jiankang

    2009-04-01

    To investigate the mitochondrial decay and oxidative damage resulting from aging, the activities/kinetics of the mitochondrial complexes were examined in the brains of young and old rats as well as in old rats fed R-alpha-lipoic acid plus acetyl-L-carnitine (LA/ALC). The brain mitochondria of old rats, compared with young rats, had significantly decreased endogenous antioxidants and superoxide dismutase activity; more oxidative damage to lipids and proteins; and decreased activities of complex I, IV and V. Complex I showed a decrease in binding affinity (increase in K(m)) for substrates. Feeding LA/ALC to old rats partially restored age-associated mitochondrial dysfunction to the levels of the young rats. These results indicate that oxidative mitochondrial decay plays an important role in brain aging and that a combination of nutrients targeting mitochondria, such as LA/ALC, could ameliorate mitochondrial decay through preventing mitochondrial oxidative damage. PMID:18846423

  4. Mitochondrial Decay in the Brains of Old Rats: Ameliorating Effect of Alpha-Lipoic Acid and Acetyl-L-carnitine

    PubMed Central

    Long, Jiangang; Gao, Feng; Tong, Liqi; Cotman, Carl W.; Ames, Bruce N.

    2009-01-01

    To investigate the mitochondrial decay and oxidative damage resulting from aging, the activities/kinetics of the mitochondrial complexes were examined in the brains of young and old rats as well as in old rats fed R-α-lipoic acid plus acetyl-L-carnitine (LA/ALC). The brain mitochondria of old rats, compared with young rats, had significantly decreased endogenous antioxidants and superoxide dismutase activity; more oxidative damage to lipids and proteins; and decreased activities of complex I, IV and V. Complex I showed a decrease in binding affinity (increase in Km) for substrates. Feeding LA/ALC to old rats partially restored age-associated mitochondrial dysfunction to the levels of the young rats. These results indicate that oxidative mitochondrial decay plays an important role in brain aging and that a combination of nutrients targeting mitochondria, such as LA/ALC, could ameliorate mitochondrial decay through preventing mitochondrial oxidative damage. PMID:18846423

  5. Thermoregulatory and cardiovascular responses to creatine, glycerol and alpha lipoic acid in trained cyclists

    PubMed Central

    2012-01-01

    Background It has been shown that supplementation with creatine (Cr) and glycerol (Gly), when combined with glucose (Glu) necessary for the enhancement of Cr uptake by skeletal muscle, induces significant improvements in thermoregulatory and cardiovascular responses during exercise in the heat. Purpose To determine whether Cr/Gly-induced thermoregulatory and cardiovascular responses are maintained when the majority (~75%) of the Glu in the Cr/Gly supplement is replaced with the insulintropic agent alpha lipoic acid (Ala). Methods 22 healthy endurance trained cyclists were randomly assigned to receive either 20 g/day (4 × 5 g/day) of Cr, 2 g .kg-1 BM per day (4 × 0.5 g .kg-1 BM per day) of Gly and 150 g/day (4 × 37.5 g/day) of Glu or 20 g/day (4 × 5 g/day) of Cr monohydrate, 2 g .kg-1 BM per day (4 × 0.5 g .kg-1 BM per day) of Gly (100 g/day (4 × 25 g/day) of Glu and 1000 mg/day (4 × 250 mg/day) of Ala for 7 days for 7 days. Exercise trials were conducted pre- and post-supplementation and involved 40 min of constant-load cycling exercise at 70% O2 max by a self-paced 16.1 km time trial at 30°C and 70% relative humidity. Results Median and range values of TBW increased significantly by 2.1 (1.3-3.3) L and 1.8 (0.2-4.6) L in Cr/Gly/Glu and Cr/Gly/Glu/Ala groups respectively (P = 0.03) and of BM not significantly by 1.8 (0.2-3.0) kg and 1.2 (0.5-2.1) kg in Cr/Gly/Glu and in Cr/Gly/Glu/Ala, respectively (P = 0.75). During constant load exercise, heart rate (HR) and core temperature (Tcore) were significantly lower post-supplementation: HR was reduced on average by 3.3 ± 2.1 beats/min and by 4.8 ± 3.3 beats/min (mean ± SD) and Tcore by 0.2 ± 0.1 (mean ± SD) in the Cr/Gly/Glu and Cr/Gly/Glu/Ala, respectively The reduction in HR and Tcore was not significantly different between the supplementation groups. Conclusions In comparison to the established hyper hydrating Cr

  6. Reversal of metabolic deficits by lipoic acid in a triple transgenic mouse model of Alzheimer's disease: a 13C NMR study.

    PubMed

    Sancheti, Harsh; Kanamori, Keiko; Patil, Ishan; Díaz Brinton, Roberta; Ross, Brian D; Cadenas, Enrique

    2014-02-01

    Alzheimer's disease is an age-related neurodegenerative disease characterized by deterioration of cognition and loss of memory. Several clinical studies have shown Alzheimer's disease to be associated with disturbances in glucose metabolism and the subsequent tricarboxylic acid (TCA) cycle-related metabolites like glutamate (Glu), glutamine (Gln), and N-acetylaspartate (NAA). These metabolites have been viewed as biomarkers by (a) assisting early diagnosis of Alzheimer's disease and (b) evaluating the efficacy of a treatment regimen. In this study, 13-month-old triple transgenic mice (a mouse model of Alzheimer's disease (3xTg-AD)) were given intravenous infusion of [1-(13)C]glucose followed by an ex vivo (13)C NMR to determine the concentrations of (13)C-labeled isotopomers of Glu, Gln, aspartate (Asp), GABA, myo-inositol, and NAA. Total ((12)C+(13)C) Glu, Gln, and Asp were quantified by high-performance liquid chromatography to calculate enrichment. Furthermore, we examined the effects of lipoic acid in modulating these metabolites, based on its previously established insulin mimetic effects. Total (13)C labeling and percent enrichment decreased by ∼50% in the 3xTg-AD mice. This hypometabolism was partially or completely restored by lipoic acid feeding. The ability of lipoic acid to restore glucose metabolism and subsequent TCA cycle-related metabolites further substantiates its role in overcoming the hypometabolic state inherent in early stages of Alzheimer's disease. PMID:24220168

  7. Antioxidant properties of an endogenous thiol: Alpha-lipoic acid, useful in the prevention of cardiovascular diseases.

    PubMed

    Ghibu, Stéliana; Richard, Carole; Vergely, Catherine; Zeller, Marianne; Cottin, Yves; Rochette, Luc

    2009-11-01

    In the past few years, a growing interest has been given to the possible antioxidant functions of a natural acid, synthesized in human tissues: alpha-lipoic acid (ALA). Both the oxidized (disulfide) and reduced (dithiol: dihydrolipoic acid, DHLA) forms of ALA show antioxidant properties. ALA administered in the diet accumulates in tissues, and a substantial part is converted to DHLA via a lipoamide dehydrogenase. Commercial ALA is usually a racemic mixture of the R and S forms. Chemical studies have indicated that ALA scavenges hydroxyl radicals, hypochlorous acid, and singlet oxygen. ALA exerts antioxidant effects in biological systems not only through direct ROS quenching but also via transition metal chelation. ALA has been shown to possess a number of beneficial effects both in the prevention and treatment of diabetes in experimental conditions. ALA presents beneficial effects in the management of symptomatic diabetic neuropathy and has been used in this context in Germany for more than 30 years. In cardiovascular disease, dietary supplementation with ALA has been successfully employed in a variety of in vivo models: ischemia-reperfusion, heart failure, and hypertension. More mechanistic and human in vivo studies are needed to determine whether optimizing the dietary intake of ALA can help to decrease cardiovascular diseases. A more complete understanding of cellular biochemical events that influence oxidative damage is required to guide future therapeutic advances. PMID:19998523

  8. Quantum dot targeting with lipoic acid ligase and HaloTag for single-molecule imaging on living cells.

    PubMed

    Liu, Daniel S; Phipps, William S; Loh, Ken H; Howarth, Mark; Ting, Alice Y

    2012-12-21

    We present a methodology for targeting quantum dots to specific proteins on living cells in two steps. In the first step, Escherichia coli lipoic acid ligase (LplA) site-specifically attaches 10-bromodecanoic acid onto a 13 amino acid recognition sequence that is genetically fused to a protein of interest. In the second step, quantum dots derivatized with HaloTag, a modified haloalkane dehalogenase, react with the ligated bromodecanoic acid to form a covalent adduct. We found this targeting method to be specific, fast, and fully orthogonal to a previously reported and analogous quantum dot targeting method using E. coli biotin ligase and streptavidin. We used these two methods in combination for two-color quantum dot visualization of different proteins expressed on the same cell or on neighboring cells. Both methods were also used to track single molecules of neurexin, a synaptic adhesion protein, to measure its lateral diffusion in the presence of neuroligin, its trans-synaptic adhesion partner. PMID:23181687

  9. Coenzyme Q10 and α-lipoic acid: antioxidant and pro-oxidant effects in plasma and peripheral blood lymphocytes of supplemented subjects

    PubMed Central

    Silvestri, Sonia; Orlando, Patrick; Armeni, Tatiana; Padella, Lucia; Brugè, Francesca; Seddaiu, Giovanna; Littarru, Gian Paolo; Tiano, Luca

    2015-01-01

    Reactive oxygen species not only cause damage but also have a physiological role in the protection against pathogens and in cell signalling. Mitochondrial nutrients, such as coenzyme Q10 and α-lipoic acid, beside their acknowledged antioxidant activities, show interesting features in relation to their redox state and consequent biological activity. In this study, we tested whether oral supplementation with 200 mg/day of coenzyme Q10 alone or in association with 200 mg/die of α-lipoic acid for 15 days on 16 healthy subjects was able to modulate the oxidative status into different compartments (plasma and cells), in basal condition and following an oxidative insult in peripheral blood lymphocytes exposed in vitro to H2O2. Data have shown that tested compounds produced antioxidant and bioenergetic effects improving oxidative status of the lipid compartment and mitochondrial functionality in peripheral blood lymphocytes. Simultaneously, an increased intracellular reactive oxygen species level was observed, although they did not lead to enhanced DNA oxidative damage. Coenzyme Q10 and α-lipoic acid produced beneficial effects also steering intracellular redox poise toward a pro-oxidant environment. In contrast with other antioxidant molecules, pro-oxidant activities of tested mitochondrial nutrients and consequent oxidant mediated signalling, could have important implications in promoting adaptive response to oxidative stress. PMID:26236096

  10. Inhibition of Peripheral TNF-α and Downregulation of Microglial Activation by Alpha-Lipoic Acid and Etanercept Protect Rat Brain Against Ischemic Stroke.

    PubMed

    Wu, Ming-Hsiu; Huang, Chao-Ching; Chio, Chung-Ching; Tsai, Kuen-Jer; Chang, Ching-Ping; Lin, Nan-Kai; Lin, Mao-Tsun

    2016-09-01

    Ischemic stroke, caused by obstruction of blood flow to the brain, would initiate microglia activation which contributes to neuronal damage. Therefore, inhibition of microglia-mediated neuroinflammation could be a therapeutic strategy for ischemic stroke. This study was aimed to elucidate the anti-inflammatory effects of alpha-lipoic acid and etanercept given either singly or in combination in rats subjected to middle cerebral artery occlusion. Both α-lipoic acid and etanercept markedly reduced cerebral infarct, blood-brain barrier disruption, and neurological motor deficits with the former drug being more effective with the dosage used. Furthermore, when used in combination, the reduction was more substantial. Remarkably, a greater diminution in the serum levels of tumor necrosis factor-alpha as well as the brain levels of microglial activation (e.g., microgliosis, amoeboid microglia, and microglial overexpression of tumor necrosis factor-α) was observed with the combined drug treatment as compared to the drugs given separately. We conclude that inhibition of peripheral tumor necrosis factor-alpha as well as downregulation of brain microglial activation by alpha-lipoic acid or etanercept protect rat brain against ischemic stroke. Moreover, when both drugs were used in combination, the stroke recovery was promoted more extensively. PMID:26374550

  11. Reversal of Lead-Induced Acute Toxicity by Lipoic Acid with Nutritional Supplements in Male Wistar Rats.

    PubMed

    Shukla, Sangeeta; Sharma, Yamini; Shrivastava, Sadhana

    2016-01-01

    Lead (Pb) is a pleiotropic toxicant. The potential role of oxidative stress injury that is associated with Pb poisoning suggests that antioxidants may enhance the efficacy of treatment designed to mitigate Pb-induced toxicity. The aim of this study is to investigate the comparative ameliorative potential of lipoic acid (LA) alone or in combination with calcium (Ca) and zinc (Zn). Pb acetate (50 mg/kg, intraperitoneally) was administered for 3 d. After 24 h of the last toxicant dose, LA (100 mg/kg, orally [po]) alone or in conjuction with Ca (50 mg/kg, po) and Zn (10 mg/kg, po) was administered for 3 d. Significant alterations in the concentration of urea, uric acid, triglycerides, cholesterol, aspartate amino transferase, alanine amino transferase, lipid peroxidation, and reduced glutathione as well as alterations in enzyme activity of δ-aminolevulinic acid (ALA) dehydratase were observed following acute Pb exposure. These findings were also supported by elevated mean DNA damage and Pb body burden in blood and soft tissues compared to controls (p ≤ 0.05). Three d posttreatment with LA along with Zn and Ca could significantly restore the biochemical parameters and Pb body burden to near-normal status through antioxidant activity or by preventing bioaccumulation of Pb within the blood and tissues of experimental rats. PMID:27481494

  12. Function of heterologous Mycobacterium tuberculosis InhA, a type 2 fatty acid synthase enzyme involved in extending C20 fatty acids to C60-to-C90 mycolic acids, during de novo lipoic acid synthesis in Saccharomyces cerevisiae.

    PubMed

    Gurvitz, Aner; Hiltunen, J Kalervo; Kastaniotis, Alexander J

    2008-08-01

    We describe the physiological function of heterologously expressed Mycobacterium tuberculosis InhA during de novo lipoic acid synthesis in yeast (Saccharomyces cerevisiae) mitochondria. InhA, representing 2-trans-enoyl-acyl carrier protein reductase and the target for the front-line antituberculous drug isoniazid, is involved in the activity of dissociative type 2 fatty acid synthase (FASII) that extends associative type 1 fatty acid synthase (FASI)-derived C(20) fatty acids to form C(60)-to-C(90) mycolic acids. Mycolic acids are major constituents of the protective layer around the pathogen that contribute to virulence and resistance to certain antimicrobials. Unlike FASI, FASII is thought to be incapable of de novo biosynthesis of fatty acids. Here, the genes for InhA (Rv1484) and four similar proteins (Rv0927c, Rv3485c, Rv3530c, and Rv3559c) were expressed in S. cerevisiae etr1Delta cells lacking mitochondrial 2-trans-enoyl-thioester reductase activity. The phenotype of the yeast mutants includes the inability to produce sufficient levels of lipoic acid, form mitochondrial cytochromes, respire, or grow on nonfermentable carbon sources. Yeast etr1Delta cells expressing mitochondrial InhA were able to respire, grow on glycerol, and produce lipoic acid. Commensurate with a role in mitochondrial de novo fatty acid biosynthesis, InhA could accept in vivo much shorter acyl-thioesters (C(4) to C(8)) than was previously thought (>C(12)). Moreover, InhA functioned in the absence of AcpM or protein-protein interactions with its native FASII partners KasA, KasB, FabD, and FabH. None of the four proteins similar to InhA complemented the yeast mutant phenotype. We discuss the implications of our findings with reference to lipoic acid synthesis in M. tuberculosis and the potential use of yeast FASII mutants for investigating the physiological function of drug-targeted pathogen enzymes involved in fatty acid biosynthesis. PMID:18552191

  13. Lipoic acid: a novel therapeutic approach for multiple sclerosis and other chronic inflammatory diseases of the CNS.

    PubMed

    Salinthone, Sonemany; Yadav, Vijayshree; Bourdette, Dennis N; Carr, Daniel W

    2008-06-01

    The naturally occurring antioxidant lipoic acid (LA) was first described as an essential cofactor for the conversion of pyruvate to Acetyl-CoA, a critical step in respiration. LA is now recognized as a compound that has many biological functions. Along with its reduced form dihydrolipoic acid (DHLA), LA reduces and recycles cellular antioxidants such as glutathione, and chelates zinc, copper and other transition metal ions in addition to heavy metals. LA can also act as a scavenger of reactive oxygen and nitrogen species. By acting as an insulin mimetic agent, LA stimulates glucose uptake in many different cell types and can also modulate insulin signaling. The p38 and ERK MAP kinase pathways, AKT and NFkappaB are all regulated by LA. In addition, LA activates the prostaglandin EP2 and EP4 receptors to stimulate the production of the small molecule cyclic adenosine 5' monophosphate (cAMP). These diverse actions suggest that LA may be therapeutically effective in treating oxidative stress associated diseases. This review discusses the known biochemical properties of LA, its antioxidant properties, its ability to modulate signal transduction pathways, and the recent progress made in the utilization of LA as a therapeutic alternative for multiple sclerosis, Alzheimer's disease and diabetic neuropathy. PMID:18537699

  14. Prophylactic action of lipoic acid on oxidative stress and growth performance in broilers at risk of developing ascites syndrome.

    PubMed

    Díaz-Cruz, Antonio; Serret, Maurilio; Ramírez, Guadalupe; Avila, Ernesto; Guinzberg, Raquel; Piña, Enrique

    2003-12-01

    The objective of this study was to assess the effects of dietary supplementation with lipoic acid (LA) on broilers maintained at 2235 m above sea level with high risk to develop ascites syndrome (AS). A total of 2040 chicks were fed under commercial conditions with water and specific diets ad libitum during 7 weeks in two consecutive experiments. Mortality and indicators of performance and oxidative stress were compared weekly in broilers fed a basal diet plus 0, 10, 20, or 40 parts/10(6) LA. The effects of LA at 40 parts/10(6) were also studied during the initial 3 weeks or the last 4 weeks of the production cycle. Diets supplemented with 40 parts/10(6) of LA during 7 weeks significantly improved feed conversion, decreased general mortality and mortality attributable to AS, and lowered thiobarbituric acid reactive substances and hydroxyl radicals in liver, and increased total glutathione pool. Smaller doses or shorter periods of exposure to LA were partially effective. In conclusion, LA under our experimental conditions has a prophylactic action in broilers with high risk to develop AS due to oxygen availability limitation. PMID:14676017

  15. Effect of γ-Cyclodextrin Inclusion Complex on the Absorption of R-α-Lipoic Acid in Rats

    PubMed Central

    Uchida, Ryota; Iwamoto, Kosuke; Nagayama, Suetada; Miyajima, Atsushi; Okamoto, Hinako; Ikuta, Naoko; Fukumi, Hiroshi; Terao, Keiji; Hirota, Takashi

    2015-01-01

    R-α-lipoic acid (RLA) is an endogenous organic acid, and works as a cofactor for mitochondrial enzymes and as a kind of antioxidant. Inclusion complexes of RLA with α-, β- or γ-cyclodextrins (CD) were prepared and orally administered as a suspension to rats. Among them, RLA/γ-CD showed the highest plasma exposure, and its area under the plasma concentration-time curve (AUC) of RLA was 2.2 times higher than that after oral administration of non-inclusion RLA. On the other hand, the AUC after oral administration of non-inclusion RLA and RLA/γ-CD to pylorus-ligated rats did not differ. However, the AUC after intraduodenal administration of RLA/γ-CD was 5.1 times higher than that of non-inclusion RLA, and was almost comparable to the AUC after intraduodenal administration of RLA-Na solution. Furthermore, the AUC after intraduodenal administration of RLA/γ-CD was not affected by biliary ligation or co-administration of an amylase inhibitor. These findings demonstrated that RLA was absorbed from the small intestine effectively when orally administered as a γ-CD inclusion complex, which could be easily dissolved in the lumen of the intestine. In conclusion, γ-CD inclusion complex is an appropriate formulation for supplying RLA as a drug or nutritional supplement with respect to absorption. PMID:25946345

  16. Lipoic acid entrains the hepatic circadian clock and lipid metabolic proteins that have been desynchronized with advanced age.

    PubMed

    Keith, Dove; Finlay, Liam; Butler, Judy; Gómez, Luis; Smith, Eric; Moreau, Régis; Hagen, Tory

    2014-07-18

    It is well established that lipid metabolism is controlled, in part, by circadian clocks. However, circadian clocks lose temporal precision with age and correlates with elevated incidence in dyslipidemia and metabolic syndrome in older adults. Because our lab has shown that lipoic acid (LA) improves lipid homeostasis in aged animals, we hypothesized that LA affects the circadian clock to achieve these results. We fed 24 month old male F344 rats a diet supplemented with 0.2% (w/w) LA for 2 weeks prior to sacrifice and quantified hepatic circadian clock protein levels and clock-controlled lipid metabolic enzymes. LA treatment caused a significant phase-shift in the expression patterns of the circadian clock proteins Period (Per) 2, Brain and Muscle Arnt-Like1 (BMAL1), and Reverse Erythroblastosis virus (Rev-erb) β without altering the amplitude of protein levels during the light phase of the day. LA also significantly altered the oscillatory patterns of clock-controlled proteins associated with lipid metabolism. The level of peroxisome proliferator-activated receptor (PPAR) α was significantly increased and acetyl-CoA carboxylase (ACC) and fatty acid synthase (FAS) were both significantly reduced, suggesting that the LA-supplemented aged animals are in a catabolic state. We conclude that LA remediates some of the dyslipidemic processes associated with advanced age, and this mechanism may be at least partially through entrainment of circadian clocks. PMID:24944020

  17. Nucleic acid compositions and the encoding proteins

    DOEpatents

    Preston, III, James F.; Chow, Virginia; Nong, Guang; Rice, John D.; St. John, Franz J.

    2014-09-02

    The subject invention provides at least one nucleic acid sequence encoding an aldouronate-utilization regulon isolated from Paenibacillus sp. strain JDR-2, a bacterium which efficiently utilizes xylan and metabolizes aldouronates (methylglucuronoxylosaccharides). The subject invention also provides a means for providing a coordinately regulated process in which xylan depolymerization and product assimilation are coupled in Paenibacillus sp. strain JDR-2 to provide a favorable system for the conversion of lignocellulosic biomass to biobased products. Additionally, the nucleic acid sequences encoding the aldouronate-utilization regulon can be used to transform other bacteria to form organisms capable of producing a desired product (e.g., ethanol, 1-butanol, acetoin, 2,3-butanediol, 1,3-propanediol, succinate, lactate, acetate, malate or alanine) from lignocellulosic biomass.

  18. Simultaneous determination of alpha-lipoic acid and its reduced form by high-performance liquid chromatography with fluorescence detection.

    PubMed

    Satoh, Soichiro; Toyo'oka, Toshimasa; Fukushima, Takeshi; Inagaki, Shinsuke

    2007-07-01

    The simultaneous determination of alpha-lipoic acid (LA) and DHLA (reduced form of LA) was carried out by HPLC with fluorescence detection. DHLA in the sample was first labeled with ABD-F at room temperature for 10 min and then the LA was labeled with SBD-F at 50 degrees C for 1 h after conversion to DHLA using the reducing agent, TCEP. The resulting fluorophores, ABD-DHLA and SBD-DHLA, were separated by reversed-phase chromatography and detected at 510 nm (excitation at 380 nm). Both fluorophors were completely separated without any interference of endogenous thiols and disulfides in the sample and sensitively detected by fluorimetry. The proposed method was applied to the assay of the LA supplement and the determination in human plasma after the oral administration of LA tablets. The concentration (%) of LA in the tablet was reasonable to the stated amount. Furthermore, the result of a time course study in the plasma after the administration of LA did not differ from a previous report. Thus, the present method seems to be applicable to the simultaneous determination of LA and DHLA in various biological specimens. PMID:17462965

  19. α-Lipoic acid promotes α-tubulin hyperacetylation and blocks the turnover of mitochondria through mitophagy.

    PubMed

    Stoner, Michael W; Thapa, Dharendra; Zhang, Manling; Gibson, Gregory A; Calderon, Michael J; St Croix, Claudette M; Scott, Iain

    2016-06-15

    Lysine acetylation is tightly coupled to the nutritional status of the cell, as the availability of its cofactor, acetyl-CoA, fluctuates with changing metabolic conditions. Recent studies have demonstrated that acetyl-CoA levels act as an indicator of cellular nourishment, and increased abundance of this metabolite can block the induction of cellular recycling programmes. In the present study we investigated the cross-talk between mitochondrial metabolic pathways, acetylation and autophagy, using chemical inducers of mitochondrial acetyl-CoA production. Treatment of cells with α-lipoic acid (αLA), a cofactor of the pyruvate dehydrogenase complex, led to the unexpected hyperacetylation of α-tubulin in the cytosol. This acetylation was blocked by pharmacological inhibition of mitochondrial citrate export (a source for mitochondria-derived acetyl-CoA in the cytosol), was dependent on the α-tubulin acetyltransferase (αTAT) and was coupled to a loss in function of the cytosolic histone deacetylase, HDAC6. We further demonstrate that αLA slows the flux of substrates through autophagy-related pathways, and severely limits the ability of cells to remove depolarized mitochondria through PTEN-associated kinase 1 (PINK1)-mediated mitophagy. PMID:27099338

  20. Ammonia-induced oxidative damage in neurons is prevented by resveratrol and lipoic acid with participation of heme oxygenase 1.

    PubMed

    Bobermin, Larissa Daniele; Wartchow, Krista Minéia; Flores, Marianne Pires; Leite, Marina Concli; Quincozes-Santos, André; Gonçalves, Carlos-Alberto

    2015-07-01

    Ammonia is a metabolite that, at high concentrations, is implicated in neurological disorders, such as hepatic encephalopathy (HE), which is associated with acute or chronic liver failure. Astrocytes are considered the primary target of ammonia toxicity in the central nervous system (CNS) because glutamine synthetase (GS), responsible for ammonia metabolism in CNS, is an astrocytic enzyme. Thus, neuronal dysfunction has been associated as secondary to astrocytic impairment. However, we demonstrated that ammonia can induce direct effects on neuronal cells. The cell viability was decreased by ammonia in SH-SY5Y cells and cerebellar granule neurons. In addition, ammonia induced increased reactive oxygen species (ROS) production and decreased GSH intracellular content, the main antioxidant in CNS. As ammonia neurotoxicity is strongly associated with oxidative stress, we also investigated the potential neuroprotective roles of the antioxidants, resveratrol (RSV) and lipoic acid (LA), against ammonia toxicity in cerebellar granule neurons. RSV and LA were able to prevent the oxidative damage induced by ammonia, maintaining the levels of ROS production and GSH close to basal values. Both antioxidants also decreased ROS production and increased GSH content under basal conditions (in the absence of ammonia). Moreover, we showed that heme oxygenase 1 (HO1), a protein associated with protection against stress conditions, is involved in the beneficial effects of RSV and LA in cerebellar granule neurons. Thus, this study reinforces the neuroprotective effects of RSV and LA. Although more studies in vivo are required, RSV and LA could represent interesting therapeutic strategies for the management of HE. PMID:26003724

  1. Lipoic acid does not improve renal function markers in 5/6 nephrectomy model: possible role of Nrf2 inactivation.

    PubMed

    Lo, Sze M; Dal Lin, Fernando T; Soares, Maria F; Hauser, Aline B; Pecoits-Filho, Roberto; Nakao, Lia S

    2016-05-01

    Chronic kidney disease (CKD) progression and complications are associated with increased oxidative stress, as well as with Nrf2 inactivation. Lipoic acid (LA) has been considered an inducer of Nrf2 antioxidant response. We tested whether oral administration of LA provides beneficial effects in experimental CKD in rats. Wistar rats underwent 5/6 nephrectomy (CKD group) or sham laparotomy. Seven days later, CKD group was divided into three subgroups that received: (i) LA continuously in the drinking water (100 mg/kg/day), (ii) LA by gavage every other day (100 mg/kg), or (iii) no LA treatment. LA treatment lasted until day 60. Plasma urea and creatinine, 24 h-proteinuria, glomerulosclerosis, interstitial fibrosis/tubular atrophy, and Nrf2 activation were analyzed. All parameters measured were significantly altered in the untreated CKD group, compared with the sham group, as expected. Oral LA administration, either in the drinking water or by gavage, did not improve significantly any parameter, comparing the treated-groups with the untreated CKD group. These results indicate that oral LA administration for 53 days was ineffective to reactivate Nrf2 in the remnant kidney of uremic rats, likely preventing improvements in biochemical and histopathological markers of renal function. PMID:26904958

  2. Molecular Mechanisms of Lipoic Acid Protection against Aflatoxin B1-Induced Liver Oxidative Damage and Inflammatory Responses in Broilers

    PubMed Central

    Ma, Qiugang; Li, Yan; Fan, Yu; Zhao, Lihong; Wei, Hua; Ji, Cheng; Zhang, Jianyun

    2015-01-01

    Alpha-lipoic acid (α-LA) was evaluated in this study for its molecular mechanisms against liver oxidative damage and inflammatory responses induced by aflatoxin B1 (AFB1). Birds were randomly allocated into four groups with different diets for three weeks: a basal diet, a 300 mg/kg α-LA supplementation in a basal diet, a diet containing 74 μg/kg AFB1, and 300 mg/kg α-LA supplementation in a diet containing 74 μg/kg AFB1. In the AFB1 group, the expression of GSH-PX mRNA was down-regulated (p < 0.05), and the levels of lipid peroxide and nitric oxide were increased (p < 0.05) in the chicken livers compared to those of the control group. Additionally, the mRNA level of the pro-inflammatory factor interleukin-6 was up-regulated significantly (p < 0.05), the protein expressions of both the nuclear factor kappa B (NF-κB) p65 and the inducible nitric oxide synthase were enhanced significantly (p < 0.05) in the AFB1 group. All of these negative effects were inhibited by α-LA. These results indicate that α-LA may be effective in preventing hepatic oxidative stress, down-regulating the expression of hepatic pro-inflammatory cytokines, as well as inhibiting NF-κB expression. PMID:26694462

  3. Fast quantification of α-lipoic acid in biological samples and dietary supplements using batch injection analysis with amperometric detection.

    PubMed

    Santos Pereira, Laise Nayra Dos; da Silva, Iranaldo Santos; Araújo, Thaylan Pinheiro; Tanaka, Auro Atsushi; Angnes, Lúcio

    2016-07-01

    Batch injection analysis (BIA) with amperometric detection, using a pyrolytic graphite electrode modified with cobalt phthalocyanine (PG/CoPc), was employed for determination of α-lipoic acid (ALA) in pharmaceutical product and in synthetic urine samples. The proposed BIA method is based on the application of a potential of +0.9V vs. Ag/AgCl, KCl sat, enabling quantification of ALA over a concentration range from 1.3×10(-6) to 1.0×10(-4)molL(-1), with a detection limit of 1.5×10(-8)molL(-1). A sampling rate of 180 injections per hour was attained and measurements of the reproducibility of successive injections (100µmolL(-1) ALA on the same electrode) showed a RSD of 2.11% for 40 successive injections. The new sensor was utilised for ALA quantification in a dietary pharmaceutical supplement and in synthetic urine and the results obtained for both samples were compared with parallel analysis using high performance liquid chromatography (HPLC), the method recommended by the United States Pharmacopeia. The results obtained were similar (at a 95% confidence level) and in the case of the synthetic urine sample (prepared with a known amount of ALA) the recovery was situated between 98.0% and 102.6%. PMID:27154671

  4. α-Lipoic Acid in Soluplus(®) Polymeric Nanomicelles for Ocular Treatment of Diabetes-Associated Corneal Diseases.

    PubMed

    Alvarez-Rivera, Fernando; Fernández-Villanueva, David; Concheiro, Angel; Alvarez-Lorenzo, Carmen

    2016-09-01

    α-Lipoic acid (ALA) is a powerful antioxidant valuable for prevention and treatment of ophthalmic complications such as diabetic keratopathy and retinopathy. The aim of this work was to develop micelle-based formulations that can enhance the solubility, stability, and corneal permeability of ALA. Compared to a conventional surfactant (sodium dioctylsulfosuccinate), Soluplus(®) (polyvinyl caprolactam-polyvinyl acetate-polyethylene glycol copolymer) led to smaller micelles (70-80 vs. 240-528 nm) with improved ability to solubilize ALA, maintaining ocular compatibility (Hens Egg Test on the Chorio-Allantoic Membrane). Soluplus nanomicelles enhanced more than 10-fold ALA solubility compared to common eye drops and withstood strong dilution in lachrymal fluid, filtration through sterilizing membranes, and freeze-drying. Interestingly, Soluplus nanomicelle formulation prepared with 1 or 2 mM block copolymer concentration exhibited in situ gelling capability and transformed into weak gels at 35°C, which is expected to increase corneal residence time. Bovine corneal permeability revealed that Soluplus nanomicelles notably enhanced ALA accumulation into the cornea as well as flux of drug toward the receptor chamber. Overall, these findings point out Soluplus nanomicelles as suitable carriers of ALA that may exhibit improved performance compared to currently available eye drop solutions. PMID:27103010

  5. Crosslinked Redox-Responsive Micelles Based on Lipoic Acid-Derived Amphiphiles for Enhanced siRNA Delivery.

    PubMed

    Tschiche, Ariane; Thota, Bala N S; Neumann, Falko; Schäfer, Andreas; Ma, Nan; Haag, Rainer

    2016-06-01

    Successful application of gene silencing approaches critically depends on systems that are able to safely and efficiently deliver genetic material such as small interfering RNA (siRNA). Due to their beneficial well-defined dendritic nanostructure, self-assembling dendrimers are emerging as promising nanovectors for siRNA delivery. However, these kinds of vectors are plagued with stability issues, especially when considered for in vivo applications. Therefore, in the present study, disulfide-based temporarily fixed micelles are developed that can degrade upon reductive conditions, and thus lead to efficient cargo release. In detail, lipoic acid-derived crosslinked micelles are synthesized based on small polymerizable dendritic amphiphiles. Particularly, one candidate out of this series is able to efficiently release siRNA due to its redox-responsive biodegradable profile when exposed to simulated intracellular environments. As a result, the reduction-triggered disassembly leads to potent gene silencing. In contrast, noncrosslinkable, structurally related constructs fails under the tested assay conditions, thereby confirming the applied rational design approach and demonstrating its large potential for future in vivo applications. PMID:26847397

  6. Pre-clinical and Clinical Safety Studies of CMX-2043: A Cytoprotective Lipoic Acid Analogue for Ischaemia–Reperfusion Injury

    PubMed Central

    Kates, Steven A; Lader, Alan S; Casale, Ralph; Beeuwkes, Reinier

    2014-01-01

    CMX-2043 is an α-lipoic acid analogue targeted to reduction of cellular injury and organ damage due to ischaemia–reperfusion injury (IRI). It has been shown to be effective in a rat model of cardiac IRI. The studies here reported evaluate its safety and pharmacokinetic profile in preparation for human clinical studies in procedures associated with IRI. Safety and tolerability were tested in standard pre-clinical in vitro and animal models and in a Phase 1 human clinical trial. CMX-2043 did not bind to a wide range of receptors and specific targets at approximately 4 μg/mL (10 μM). It was not mutagenic by Ames assay, did not produce chromosome aberrations in Chinese hamster ovary (CHO) cells, and was negative for clastogenic potential. Toxicological studies in rats including both single and 14-day repeat intravenous doses and in dogs (single intravenous dose) with a 2-week recovery period were conducted. The NOAEL in rats and dogs was 30 and >10 mg/kg, respectively. No serious adverse events were reported in a placebo-controlled, sequential dose escalation Phase 1 clinical trial. The low toxicity in the pre-clinical studies and the absence of adverse events in the Phase 1 trial have supported investigation of CMX-2043 in a human efficacy trial. PMID:24751172

  7. Biochemical responses over time in common carp Cyprinus carpio (Teleostei, Cyprinidae) during fed supplementation with α-lipoic acid.

    PubMed

    Enamorado, Alain D; Martins, Atila C; Flores, Juliana A; Tesser, Marcelo Borges; Caldas, Sergiane S; Primel, Ednei G; Monserrat, José Maria

    2015-10-01

    The current study aimed to evaluate the influence of lipoic acid (LA) supplementation (439.84±6.71 mg LA/kg feed) on antioxidants responses throughout the time in intestine, liver and muscle of juvenile common carp Cyprinus carpio. Two experimental groups were fed during four weeks with a diet with or without LA. Glutathione-S-transferase (GST) activity, glutathione (GSH) content, antioxidant capacity against peroxyl radicals (ACAP) and lipid peroxidation (TBARS) were evaluated in these organs. Also, a technique to measure protein disulfide bonds and sulfhydryl groups was optimized for intestine samples. GST activity was significantly higher (p<0.05) in intestine after two weeks of supplementation. GSH content was also significantly higher (p<0.05) in intestine, liver and muscle of fish fed with LA after two and three weeks, respectively. Total capacity antioxidant against peroxyl radicals was significantly increased (p<0.05) in the muscle of animals fed with LA after the fourth week. Concentration of disulfide bonds was higher in the intestine of fish fed with LA but this group also showed higher concentration of sulfhydryl groups (p<0.05). It is concluded that supplementation with LA is a safe strategy to induce antioxidant responses and improves the antioxidant status in different organs of common carp. Two week of supplementation are required to induce antioxidant responses in intestine and liver and three week for muscle. PMID:26037328

  8. Molecular Mechanisms of Lipoic Acid Protection against Aflatoxin B₁-Induced Liver Oxidative Damage and Inflammatory Responses in Broilers.

    PubMed

    Ma, Qiugang; Li, Yan; Fan, Yu; Zhao, Lihong; Wei, Hua; Ji, Cheng; Zhang, Jianyun

    2015-12-01

    Alpha-lipoic acid (α-LA) was evaluated in this study for its molecular mechanisms against liver oxidative damage and inflammatory responses induced by aflatoxin B₁ (AFB₁). Birds were randomly allocated into four groups with different diets for three weeks: a basal diet, a 300 mg/kg α-LA supplementation in a basal diet, a diet containing 74 μg/kg AFB₁, and 300 mg/kg α-LA supplementation in a diet containing 74 μg/kg AFB₁. In the AFB₁ group, the expression of GSH-PX mRNA was down-regulated (p < 0.05), and the levels of lipid peroxide and nitric oxide were increased (p < 0.05) in the chicken livers compared to those of the control group. Additionally, the mRNA level of the pro-inflammatory factor interleukin-6 was up-regulated significantly (p < 0.05), the protein expressions of both the nuclear factor kappa B (NF-κB) p65 and the inducible nitric oxide synthase were enhanced significantly (p < 0.05) in the AFB₁ group. All of these negative effects were inhibited by α-LA. These results indicate that α-LA may be effective in preventing hepatic oxidative stress, down-regulating the expression of hepatic pro-inflammatory cytokines, as well as inhibiting NF-κB expression. PMID:26694462

  9. Quantification of lipoic acid from skin samples by HPLC using ultraviolet, electrochemical and evaporative light scattering detectors.

    PubMed

    Campos, Patrícia Mazureki; Praça, Fabíola Silva Garcia; Bentley, Maria Vitória Lopes Badra

    2016-04-15

    Lipoic acid (LA) is an endogenous organosulfur compound with potent antioxidant property. LA is often used as a drug for the treatment of skin disorders. For the accomplishment of topical applications of LA appropriate drug quantification methods are essential. Thus far, no HPLC methods have been reported for the measurement of LA extracted from skin. In this article we report on the development and validation of three sensitive and specific HPLC methods for LA and dihydrolipoic acid (DHLA) using ultraviolet (UV), electrochemical (EC) or evaporative light scattering (ELS) detection. These methods demonstrate different linearity ranges. The chromatographic separations were performed by RP-HPLC (250×4mm, 5μm) with isocratic elution using an acidic mobile phase for the three detection techniques. The lower limits of detection and quantification were 0.04 and 0.08ng LA, respectively, for HPLC coupled to ELS, an innovative detector for LA with high sensitivity. The extraction of LA from skin samples showed recoveries greater than 71%. The recovered LA concentrations from stratum corneum and epidermis+dermis layers were: 5.41±0.56 and 4.92±0.33μg/mL, respectively for HPLC/UV and 6.52±0.49 and 5.01±0.41μg/mL, respectively, for HPLC/EC for the added LA concentration (6.67μg/mL), and 8.88±0.46 and 8.95±0.08μg/mL, respectively, for HPLC/ELS for the added LA concentration (10μg/mL). These three optimized HPLC methods allowed for a simple, rapid and reliable determination of LA in human skin. They should be useful for the development of drug delivery systems for topical applications of LA. PMID:26307348

  10. Effect of combination therapy consisting of enalapril, α-lipoic acid, and menhaden oil on diabetic neuropathy in a high fat/low dose streptozotocin treated rat.

    PubMed

    Davidson, Eric P; Holmes, Amey; Coppey, Lawrence J; Yorek, Mark A

    2015-10-15

    We have previously demonstrated that treating diabetic rats with enalapril, an angiotensin converting enzyme (ACE) inhibitor, α-lipoic acid, an antioxidant, or menhaden oil, a natural source of omega-3 fatty acids can partially improve diabetic peripheral neuropathy. In this study we sought to determine the efficacy of combining these three treatments on vascular and neural complications in a high fat fed low dose streptozotocin treated rat, a model of type 2 diabetes. Rats were fed a high fat diet for 8 weeks followed by a 30 mg/kg dose of streptozotocin. Eight weeks after the onset of hyperglycemia diabetic rats were treated with a combination of enalapril, α-lipoic acid and menhaden oil. Diabetic rats not receiving treatment were continued on the high fat diet. Glucose clearance was impaired in diabetic rats and significantly improved with treatment. Diabetes caused steatosis, elevated serum lipid levels, slowing of motor and sensory nerve conduction, thermal hypoalgesia, reduction in intraepidermal nerve fiber profiles, decrease in cornea sub-basal nerve fiber length and corneal sensitivity and impairment in vascular relaxation to acetylcholine and calcitonin gene-related peptide in epineurial arterioles of the sciatic nerve. Treating diabetic rats with the combination of enalapril, α-lipoic acid and menhaden oil reversed all these deficits to near control levels except for motor nerve conduction velocity which was also significantly improved compared to diabetic rats but remained significantly decreased compared to control rats. These studies suggest that a combination therapeutic approach may be most effective for treating vascular and neural complications of type 2 diabetes. PMID:26291662

  11. Complementary Cholesterol-Lowering Response of a Phytosterol/α-Lipoic Acid Combination in Obese Zucker Rats

    PubMed Central

    Rideout, Todd C.; Carrier, Bradley; Wen, Shin; Raslawsky, Amy; Browne, Richard W.; Harding, Scott V.

    2015-01-01

    To investigate the cholesterol-lowering effectiveness of a phytosterol/α-lipoic acid (PS/αLA) therapy, thirty-two male Zucker rats were randomly assigned to 1 of 4 diets for 30 days: (i) high fat diet (HF, 40% energy from fat); (ii) HF diet supplemented with 3% phytosterols; (iii) HF diet supplemented with 0.25% αLA; or (iv) HF diet supplemented with PS (3%) and αLA (0.25%, PS/αLA). Compared with the HF diet, combination PS/αLA proved more effective in reducing non-HDL cholesterol (−55%) than either the PS (−24%) or the αLA (−25%) therapies alone. PS supplementation did not affect LDL particle number, however, αLA supplementation reduced LDL particle number when supplemented alone (−47%) or in combination with PS (−54%). Compared with the HF-fed animals, evidence of increased HDL-particle number was evident in all treatment groups to a similar extent (21–22%). PS-mediated interruption of intestinal cholesterol absorption was evident by increased fecal cholesterol loss (52%) and compensatory increase in HMG-CoA reductase mRNA (1.6 fold of HF), however, αLA supplementation did not affect fecal cholesterol loss. Hepatic mRNA and protein expression patterns suggested that αLA modulated multiple aspects of cholesterol homeostasis including reduced synthesis (HMG-CoA reductase mRNA, 0.7 fold of HF), reduced bile acid synthesis (CYP7a1 expression, 0.17 of HF), and increased cholesterol clearance (reduced PCSK9 mRNA, 0.5 fold of HF; increased LDLr protein, 2 fold of HF). Taken together, this data suggests that PS and αLA work through unique and complementary mechanisms to provide a superior and more comprehensive cholesterol lowering response than either therapy alone. PMID:25664679

  12. Mice with heterozygous deficiency of lipoic acid synthase have an increased sensitivity to lipopolysaccharide-induced tissue injury

    PubMed Central

    Yi, Xianwen; Kim, Kuikwon; Yuan, Weiping; Xu, Longquan; Kim, Hyung-Suk; Homeister, Jonathon W.; Key, Nigel S.; Maeda, Nobuyo

    2009-01-01

    α-Lipoic acid (1, 2-dithiolane-3-pentanoic acid; LA), synthesized in mitochondria by LA synthase (Lias), is a potent antioxidant and a cofactor for metabolic enzyme complexes. In this study, we examined the effect of genetic reduction of LA synthesis on its antioxidant and anti-inflammatory properties using a model of LPS-induced inflammation in Lias+/– mice. The increase of plasma proinflammatory cytokine, TNF-α, and NF-κB at an early phase following LPS injection was greater in Lias+/– mice compared with Lias+/+ mice. The circulating blood white blood cell (WBC) and platelet counts dropped continuously during the initial 4 h. The counts subsequently recovered partially in Lias+/+ mice, but the recovery was impaired totally in Lias+/– mice. Administration of exogenous LA normalized the recovery of WBC counts in Lias+/– mice but not platelets. Enhanced neutrophil sequestration in the livers of Lias+/– mice was associated with increased hepatocyte injury and increased gene expression of growth-related oncogene, E-selectin, and VCAM-1 in the liver and/or lung. Lias gene expression in tissues was 50% of normal expression in Lias+/– mice and reduced further by LPS treatment. Decreased Lias expression was associated with diminished hepatic LA and tissue oxidative stress. Finally, Lias+/– mice displayed enhanced mortality when exposed to LPS-induced sepsis. These data demonstrate the importance of endogenously produced LA for preventing leukocyte accumulation and tissue injury that result from LPS-induced inflammation. PMID:18845616

  13. Complementary Cholesterol-Lowering Response of a Phytosterol/α-Lipoic Acid Combination in Obese Zucker Rats.

    PubMed

    Rideout, Todd C; Carrier, Bradley; Wen, Shin; Raslawsky, Amy; Browne, Richard W; Harding, Scott V

    2016-01-01

    To investigate the cholesterol-lowering effectiveness of a phytosterol/α-lipoic acid (PS/αLA) therapy, thirty-two male Zucker rats were randomly assigned to 1 of 4 diets for 30 days: (i) high fat diet (HF, 40% energy from fat); (ii) HF diet supplemented with 3% phytosterols; (iii) HF diet supplemented with 0.25% αLA; or (iv) HF diet supplemented with PS (3%) and αLA (0.25%, PS/αLA). Compared with the HF diet, combination PS/αLA proved more effective in reducing non-HDL cholesterol (-55%) than either the PS (-24%) or the αLA (-25%) therapies alone. PS supplementation did not affect LDL particle number, however, αLA supplementation reduced LDL particle number when supplemented alone (-47%) or in combination with PS (-54%). Compared with the HF-fed animals, evidence of increased HDL-particle number was evident in all treatment groups to a similar extent (21-22%). PS-mediated interruption of intestinal cholesterol absorption was evident by increased fecal cholesterol loss (+52%) and compensatory increase in HMG-CoA reductase mRNA (1.6 fold of HF), however, αLA supplementation did not affect fecal cholesterol loss. Hepatic mRNA and protein expression patterns suggested that αLA modulated multiple aspects of cholesterol homeostasis including reduced synthesis (HMG-CoA reductase mRNA, 0.7 fold of HF), reduced bile acid synthesis (CYP7a1 expression, 0.17 of HF), and increased cholesterol clearance (reduced PCSK9 mRNA, 0.5 fold of HF; increased LDLr protein, 2 fold of HF). Taken together, this data suggests that PS and αLA work through unique and complementary mechanisms to provide a superior and more comprehensive cholesterol lowering response than either therapy alone. PMID:25664679

  14. Nucleic acids encoding human trithorax protein

    DOEpatents

    Evans, Glen A.; Djabali, Malek; Selleri, Licia; Parry, Pauline

    2001-01-01

    In accordance with the present invention, there is provided an isolated peptide having the characteristics of human trithorax protein (as well as DNA encoding same, antisense DNA derived therefrom and antagonists therefor). The invention peptide is characterized by having a DNA binding domain comprising multiple zinc fingers and at least 40% amino acid identity with respect to the DNA binding domain of Drosophila trithorax protein and at least 70% conserved sequence with respect to the DNA binding domain of Drosophila trithorax protein, and wherein said peptide is encoded by a gene located at chromosome 11 of the human genome at q23. Also provided are methods for the treatment of subject(s) suffering from immunodeficiency, developmental abnormality, inherited disease, or cancer by administering to said subject a therapeutically effective amount of one of the above-described agents (i.e., peptide, antagonist therefor, DNA encoding said peptide or antisense DNA derived therefrom). Also provided is a method for the diagnosis, in a subject, of immunodeficiency, developmental abnormality, inherited disease, or cancer associated with disruption of chromosome 11 at q23.

  15. Curcumin, Silybin Phytosome(®) and α-R-Lipoic Acid Mitigate Chronic Hepatitis in Rat by Inhibiting Oxidative Stress and Inflammatory Cytokines Production.

    PubMed

    Ali, Shimaa O; Darwish, Hebatallah A; Ismail, Nabila A

    2016-05-01

    Chronic hepatitis is recognized as a worldwide health problem that gradually progresses towards cirrhosis and hepatocellular carcinoma. Despite the large number of experiments using animal models for allergic hepatitis, it is still difficult to produce a picture of chronic hepatitis. Therefore, this study was conducted to introduce an animal model approximating to the mechanism of chronicity in human hepatitis. The study also aimed to examine the hepatoprotective effects of curcumin, silybin phytosome(®) and α-R-lipoic acid against thioacetamide (TAA)-induced chronic hepatitis in rat model. TAA was administered intraperitoneally at a dose of 200 mg/kg three times weekly for 4 weeks. At the end of this period, a group of rats was killed to assess the development of chronic hepatitis in comparison with their respective control group. TAA administration was then discontinued, and the remaining animals were subsequently allocated into four groups. Group 1 was left untreated, whereas groups 2-4 were allowed to receive daily oral doses of curcumin, silybin phytosome(®) or α-R-lipoic acid, respectively, for 7 weeks. Increases in hepatic levels of malondialdehyde associated with TAA administration were inhibited in groups receiving supplements. Furthermore, glutathione depletion, collagen deposition, macrophage activation and nuclear factor κappa-B expression as well as tumour necrosis factor-α and interleukin-6 levels were significantly decreased in response to supplements administration. Serological analysis of liver function and liver histopathological examination reinforced the results. The above evidence collectively indicates that the antioxidant and anti-inflammatory activities of curcumin, silybin phytosome(®) and α-R-lipoic acid may confer therapeutic efficacy against chronic hepatitis. PMID:26457982

  16. Mapping the response of human fibroblast growth factor 21 (FGF21) promoter to serum availability and lipoic acid in HepG2 hepatoma cells.

    PubMed

    Xia, Mengna; Erickson, Anjeza; Yi, Xiaohua; Moreau, Régis

    2016-03-01

    The hormone-like polypeptide, fibroblast growth factor 21 (FGF21), is a major modulator of lipid and glucose metabolism and an exploratory treatment strategy for obesity related metabolic disorders. The costs of recombinant FGF21 and mode of delivery by injection are important constraints to its wide therapeutic use. The stimulation of endogenous FGF21 production through diet is being explored as an alternative approach. To that end, we examined the mechanism(s) by which serum manipulation and lipoic acid (a dietary activator of FGF21) induce FGF21 in human hepatocellular carcinoma HepG2 cells. Serum withdrawal markedly induced FGF21 mRNA levels (88 fold) and FGF21 secreted in the media (19 fold). Lipoic acid induced FGF21 mRNA 7 fold above DMSO-treated control cells and FGF21 secretion 3 fold. These effects were several-fold greater than those of PPARα agonist, Wy14643, which failed to induce FGF21 above and beyond the induction seen with serum withdrawal. The use of transcription inhibitor, actinomycin D, revealed that de novo mRNA synthesis drives FGF21 secretion in response to serum starvation. Four previously unrecognized loci in FGF21 promoter were nucleosome depleted and enriched in acetylated histone H3 revealing their role as transcriptional enhancers and putative transcription factor binding sites. FGF21 did not accumulate to a significant degree in induced HepG2 cells, which secreted FGF21 time dependently in media. We conclude that lipoic acid cell signaling connects with the transcriptional upregulation of FGF21 and it may prove to be a safe and affordable means to stimulate FGF21 production. PMID:26691139

  17. Correlation of α-Lipoic Acid and S. Glutathione Level with Free Radical Excess in Tobacco Consumers

    PubMed Central

    Kaur, Manjinder; Suhalka, M.L.; Shrivastav, Chanchal

    2016-01-01

    Introduction Tobacco consumption is a serious health hazard and most important avoidable cause of death worldwide. Tobacco is recognized as lethal toxin, ripping off 7-11 minutes of human life with each cigarette through harmful compounds and inducing free radical synthesis and a high rate of lipid peroxidation. These free radicals are scavenged by the endogenous antioxidants viz. S. Glutathione (S.GSH) and S. α-Lipoic acid (S. α-LA), thus preventing the endothelial damage. Aim The present study was designed with an aim to find out the lipid peroxidative stress through S. Malondialdehyde (S.MDA) and its correlation with antioxidant levels like S. Glutathione (S. GSH) and S. α- Lipoic acid (S. α- LA) among tobacco users (in both smokers and chewers). Materials and Methods A case control cross-sectional study was carried out in the Department of Physiology among 200 subjects; aged 18-50 years of both sexes which were chosen randomly from institutional campus and healthy volunteers. The subjects were broadly divided into two groups (A & B); group A comprised of tobacco users (n=150) with history of smoking cigarette/biddies and chewing tobacco daily, for at least one year and group B had controls (non tobacco users) (n=50). S. MDA, S.GSH and S. α-LA levels were estimated by standardized methods. The data was analysed by unpaired student t-test and Pearson’s correlation coefficient (r) for finding the correlation between antioxidants and S.MDA in group-A and group-B. Results The present study reports the significantly higher (p<0.0001) levels of S.MDA and lower (p<0.0001) levels of S.GSH and S. α-LA in tobacco users as compared to nontobacco users. The observed value of S.MDA was (2.72±0.87, 1.39±0.47) nmol/ml, S. α-LA was (9.94±5.96, 14.24 ± 4.34) μg/ml and S.GSH was (23.24±7.04, 32.82±2.95) mg/dl respectively in group-A and group-B. A significant (p<0.01) strong negative correlation was observed between S. MDA and antioxidants (S.GSH and S.

  18. Bacteriological analysis of water by potentiometric measurement of lipoic acid reduction: preliminary assays for selective detection of indicator organisms.

    PubMed Central

    Charriere, G; Jouenne, T; Lemeland, J F; Selegny, E; Junter, G A

    1984-01-01

    The practical task of adapting an original potentiometric technique to the bacteriological analysis of water is discussed. Various laboratory strains of organisms belonging to the usual aquatic flora were inoculated one by one in a minimal lactose broth supplied with lipoic (thioctic) acid. The time evolution of the redox potential of the cultures was followed during incubation by combined gold versus reference electrodes. When the incubation temperature was regulated at 36 degrees C, most organisms were able to grow and to reduce the coenzyme, generating changes in the redox potential of the culture. However, very few organisms developed significant reductive activity when the temperature was increased to 41 degrees C and when the broth was provided with sodium deoxycholate. Among the fecal coliform organisms, only Escherichia coli and Klebsiella pneumoniae exhibited early but reproducible potential-time responses. Positive potentiometric responses were also recorded with Acinetobacter calcoaceticus. E. coli showed rapid potentiometric signals as compared with K. pneumoniae. The time required for 100-mV shift of potential to be detected was related to the logarithm of the initial concentration of E. coli or K. pneumoniae in the culture broth. Experiments on natural surface water samples showed the the potentiometric method, associated with the selective incubation conditions, mainly detected E. coli among the bacterial flora of the tested environmental water. The calibration curve relating the time required for a 100-mV shift of potential to be detected to the number of fecal coliforms, as determined by control fecal coliform-selective plate counts, was consistent with the composite standard curve of detection times obtained with six different laboratory strains of E. coli.(ABSTRACT TRUNCATED AT 250 WORDS) PMID:6421230

  19. Flaxseed oil and alpha-lipoic acid combination ameliorates hepatic oxidative stress and lipid accumulation in comparison to lard

    PubMed Central

    2013-01-01

    Background Intake of high-fat diet is associated with increased non-alcoholic fatty liver disease (NAFLD). Hepatic lipid accumulation and oxidative stress are key pathophysiological mechanisms in NAFLD. Both flaxseed oil (FO) and α-lipoic acid (LA) exert potential benefit to NAFLD. The aim of this study was to determine the effect of the combination of FO and LA on hepatic lipid accumulation and oxidative stress in rats induced by high-fat diet. Methods LA was dissolved in flaxseed oil to a final concentration of 8 g/kg (FO + LA). The rodent diet contained 20% fat. One-fifth of the fat was soybean oil and the others were lard (control group), or 75% lard and 25% FO + LA (L-FO + LA group), or 50% lard and 50% FO + LA (M-FO + LA group), or FO + LA (H-FO + LA group). Male Sprague–Dawley rats were fed for 10 weeks and then killed for liver collection. Results Intake of high-fat lard caused a significant hepatic steatosis. Replacement with FO + LA was effective in reducing steatosis as well as total triglyceride and total cholesterol contents in liver. The combination of FO and LA also significantly elevated hepatic antioxidant defense capacities, as evaluated by the remarkable increase in the activities of SOD, CAT and GPx as well as the level of GSH, and the significant decline in lipid peroxidation. Conclusion The combination of FO and LA may contribute to prevent fatty livers such as NAFLD by ameliorating hepatic lipid accumulation and oxidative stress. PMID:23634883

  20. Age and gender dependent bioavailability of R- and R,S-α-lipoic acid: A pilot study

    PubMed Central

    Keith, Dove J.; Butler, Judy A.; Bemer, Brett; Dixon, Brian; Johnson, Shawn; Garrard, Mary; Sudakin, Daniel L.; Christensen, J. Mark; Pereira, Cliff; Hagen, Tory M.

    2014-01-01

    Lipoic acid (LA) shows promise as a beneficial micronutrient toward improving elder health. Studies using old rats show that (R)-α-LA (R-LA) significantly increases low molecular weight antioxidants that otherwise decline with age. Despite this rationale for benefiting human health, little is known about age-associated alterations in absorption characteristics of LA, or whether the commercially available racemic mixture of LA (R,S-LA) is equally as bioavailable as the naturally occurring R-enantiomer. To address these discrepancies, a pilot study was performed to establish which form of LA is most effectively absorbed in older subjects relative to young volunteers. Young adults (average age = 32 years) and older adults (average age = 79 years) each received 500 mg of either R- or R,S-LA. Blood samples were collected for 3 h after supplementation. After a washout period they were given the other chiral form of LA not originally ingested. Results showed that 2 out of 6 elder males exhibited greater maximal plasma LA and area under the curve for the R-form of LA versus the racemic mixture. The elder subjects also demonstrated a reduced time to reach maximal plasma LA concentration following R-LA supplementation than for the racemic mixture. In contrast, young males had a tendency for increased bioavailability of R,S-LA. Overall, bioavailability for either LA isoform was much more variable between older subjects compared to young adults. Plasma glutathione levels were not altered during the sampling period. Thus subject age, and potential for varied response, should be considered when determining an LA supplementation regimen. PMID:22609537

  1. Age and gender dependent bioavailability of R- and R,S-α-lipoic acid: a pilot study.

    PubMed

    Keith, Dove J; Butler, Judy A; Bemer, Brett; Dixon, Brian; Johnson, Shawn; Garrard, Mary; Sudakin, Daniel L; Christensen, J Mark; Pereira, Cliff; Hagen, Tory M

    2012-09-01

    Lipoic acid (LA) shows promise as a beneficial micronutrient toward improving elder health. Studies using old rats show that (R)-α-LA (R-LA) significantly increases low molecular weight antioxidants that otherwise decline with age. Despite this rationale for benefiting human health, little is known about age-associated alterations in absorption characteristics of LA, or whether the commercially available racemic mixture of LA (R,S-LA) is equally as bioavailable as the naturally occurring R-enantiomer. To address these discrepancies, a pilot study was performed to establish which form of LA is most effectively absorbed in older subjects relative to young volunteers. Young adults (average age=32 years) and older adults (average age=79 years) each received 500 mg of either R- or R,S-LA. Blood samples were collected for 3h after supplementation. After a washout period they were given the other chiral form of LA not originally ingested. Results showed that 2 out of 6 elder males exhibited greater maximal plasma LA and area under the curve for the R-form of LA versus the racemic mixture. The elder subjects also demonstrated a reduced time to reach maximal plasma LA concentration following R-LA supplementation than for the racemic mixture. In contrast, young males had a tendency for increased bioavailability of R,S-LA. Overall, bioavailability for either LA isoform was much more variable between older subjects compared to young adults. Plasma glutathione levels were not altered during the sampling period. Thus subject age, and potential for varied response, should be considered when determining an LA supplementation regimen. PMID:22609537

  2. Structural Analysis of Crystalline R(+)-α-Lipoic Acid-α-cyclodextrin Complex Based on Microscopic and Spectroscopic Studies

    PubMed Central

    Ikuta, Naoko; Endo, Takatsugu; Hosomi, Shota; Setou, Keita; Tanaka, Shiori; Ogawa, Noriko; Yamamoto, Hiromitsu; Mizukami, Tomoyuki; Arai, Shoji; Okuno, Masayuki; Takahashi, Kenji; Terao, Keiji; Matsugo, Seiichi

    2015-01-01

    R(+)-α-lipoic acid (RALA) is a naturally-occurring substance, and its protein-bound form plays significant role in the energy metabolism in the mitochondria. RALA is vulnerable to a variety of physical stimuli, including heat and UV light, which prompted us to study the stability of its complexes with cyclodextrins (CDs). In this study, we have prepared and purified a crystalline RALA-αCD complex and evaluated its properties in the solid state. The results of 1H NMR and PXRD analyses indicated that the crystalline RALA-αCD complex is a channel type complex with a molar ratio of 2:3 (RALA:α-CD). Attenuated total reflection/Fourier transform infrared analysis of the complex showed the shift of the C=O stretching vibration of RALA due to the formation of the RALA-αCD complex. Raman spectroscopic analysis revealed the significant weakness of the S–S and C–S stretching vibrations of RALA in the RALA-αCD complex implying that the dithiolane ring of RALA is almost enclosed in glucose ring of α-CD. Extent of this effect was dependent on the direction of the excitation laser to the hexagonal morphology of the crystal. Solid-state NMR analysis allowed for the chemical shift of the C=O peak to be precisely determined. These results suggested that RALA was positioned in the α-CD cavity with its 1,2-dithiolane ring orientated perpendicular to the plane of the α-CD ring. PMID:26501268

  3. Evidence for protective effect of lipoic acid and desvenlafaxine on oxidative stress in a model depression in mice.

    PubMed

    Silva, Márcia Calheiros Chaves; de Sousa, Caren Nádia Soares; Gomes, Patrícia Xavier Lima; de Oliveira, Gersilene Valente; Araújo, Fernanda Yvelize Ramos; Ximenes, Naiara Coelho; da Silva, Jéssica Calheiros; Vasconcelos, Germana Silva; Leal, Luzia Kalyne Almeida Moreira; Macêdo, Danielle; Vasconcelos, Silvânia Maria Mendes

    2016-01-01

    Oxidative stress is implicated in the neurobiology of depression. Here we investigated oxidative alterations in brain areas of animals submitted to the model of depression induced by corticosterone (CORT) and the effects of the antioxidant compound alpha-lipoic acid (ALA) alone or associated with the antidepressant desvenlafaxine (DVS) in these alterations. Female mice received vehicle or CORT (20 mg/kg) during 14 days. From the 15th to 21st days different animals received further administrations of: vehicle, DVS (10 or 20 mg/kg), ALA (100 or 200 mg/kg), or the combinations of DVS10+ALA100, DVS20+ALA100, DVS10+ALA200, or DVS20+ALA200. Twenty-four hours after the last drug administration prefrontal cortex (PFC), hippocampus (HC) and striatum (ST) were dissected for the determination of the activity of superoxide dismutase (SOD), reduced glutathione (GSH) and lipid peroxidation (LP) levels. CORT significantly increased SOD activity in the PFC and HC, decreased GSH levels in the HC and increased LP in all brain areas studied when compared to saline-treated animals. Decrements of SOD activity were observed in all groups and brain areas studied when compared to controls and CORT. The hippocampal decrease in GSH was reversed by ALA100, DVS10+ALA100, DVS20+ALA100 and DVS20+ALA200. The same DVS+ALA combination groups presented increased levels of GSH in the PFC and ST. The greater GSH levels were observed in the PFC, HC and ST of DVS20+ALA200 mice. LP was reversed in the groups ALA200 (PFC), DVS10+ALA100, DVS20+ALA100 (PFC, HC and ST), and DVS20+ALA200 (PFC, HC). Our findings contribute to the previous preclinical evidences implicating ALA as a promising agent for augmentation therapy in depression. PMID:26265141

  4. Alpha-lipoic acid affects the oxidative stress in various brain structures in mice with methionine and choline deficiency.

    PubMed

    Veskovic, Milena; Mladenovic, Dusan; Jorgacevic, Bojan; Stevanovic, Ivana; de Luka, Silvio; Radosavljevic, Tatjana

    2015-04-01

    Deficiency in methionine or choline can induce oxidative stress in various organs such as liver, kidney, heart, and brain. This study was to examine the effects of alpha-lipoic acid (LA) on oxidative stress induced by methionine and choline deficiency (MCD) in several brain structures. Male mice C57BL/6 (n = 28) were divided into four groups: (1) control - continuously fed with standard chow; (2) LA - fed with standard chow and receiving LA; (3) MCD2 - fed with MCD diet for two weeks, and (4) MCD2+LA - fed with MCD diet for two weeks and receiving LA (100 mg/kg/day intraperitonealy [i.p.]). Brain tissue (cortex, hypothalamus, striatum and hippocampus) was taken for determination of oxidative stress parameters. MCD diet induced a significant increase in malondialdehyde and NOx concentration in all brain regions, while LA restored their content to normal values. Similar to this, in MCD2 group, activity of total SOD, MnSOD, and Cu/ZnSOD was reduced by MCD diet, while LA treatment improved their activities in all brain structures. Besides, in MCD2 group a decrease in catalase activity in cortex and GSH content in hypothalamus was evident, while LA treatment induced an increase in catalase activity in cortex and striatum and GSH content in hypothalamus. LA treatment can significantly reduce lipid peroxidation and nitrosative stress, caused by MCD diet, in all brain regions by restoring antioxidant enzymes activities, predominantly total SOD, MnSOD, and Cu/ZnSOD, and to a lesser extent by modulating catalase activity and GSH content. LA supplementation may be used in order to prevent brain oxidative injury induced by methionine and choline deficiency. PMID:25193852

  5. Efficacy and safety of prostaglandin E1 plus lipoic acid combination therapy versus monotherapy for patients with diabetic peripheral neuropathy.

    PubMed

    Jiang, De-Qi; Li, Ming-Xing; Ma, Yan-Jiao; Wang, Yan; Wang, Yong

    2016-05-01

    The aim of this report was to evaluate the efficacy and safety of prostaglandin E1 (PGE1) plus lipoic acid (LA) for the treatment of diabetic peripheral neuropathy (DPN) compared with that of PGE1 or LA monotherapy. Randomized controlled trials (RCT) published up to 3 August 2014 were reviewed. A random or fixed effect model was used to analyze outcomes expressed as risk ratios (RR) or mean difference (MD) with a 95% confidence interval (CI). I(2) statistic was used to assess heterogeneity. Subgroup and sensitivity analyses were performed. The outcomes measured were as follows: clinical efficacy, median motor nerve conduction velocity (MNCV), median sensory nerve conduction velocity (SNCV), peroneal MNCV, peroneal SNCV and adverse effects. Thirty-one RCT with 2676 participants were included. Clinical efficacy of PGE1+LA combination therapy was significantly better than monotherapy (p<0.00001, RR=1.32, 95% CI 1.26 to 1.38). Compared with monotherapy, PGE1+LA combination therapy led to significant improvements in median MNCV (p<0.00001, MD=4.69, 95% CI 3.16 to 6.23), median SNCV (p<0.00001, MD=5.46, 95% CI 4.04 to 6.88), peroneal MNCV (p<0.00001, MD=5.19, 95% CI 3.71 to 6.67) and peroneal SNCV (p<0.00001, MD=5.50, 95% CI 3.30 to 7.70). There were no serious adverse events associated with drug intervention. PGE1+LA combination therapy is superior to PGE1 or LA monotherapy for improvement of neuropathic symptoms and nerve conduction velocities in patients with DPN. These findings should be further validated by larger well-designed and high-quality RCT. PMID:26775115

  6. Effects of alpha-lipoic acid on chemerin secretion in 3T3-L1 and human adipocytes.

    PubMed

    Prieto-Hontoria, Pedro L; Pérez-Matute, Patricia; Fernández-Galilea, Marta; López-Yoldi, Miguel; Sinal, Christopher J; Martínez, J Alfredo; Moreno-Aliaga, María J

    2016-03-01

    Chemerin is a novel adipokine associated with obesity and insulin resistance. α-Lipoic acid (α-LA) has shown beneficial properties on diabetes and obesity. The aim of this study was to examine the effects of α-LA on chemerin production in adipocytes in absence or presence of TNF-α, insulin and AICAR. The potential signaling pathways involved in α-LA effects on chemerin were also analyzed. α-LA actions on chemerin were tested in differentiated 3T3-L1 adipocytes and in some cases in human subcutaneous and omental adipocytes. Chemerin mRNA levels were measured by RT-PCR and the amount of chemerin secreted to culture media was determined by ELISA. α-LA induced a concentration-dependent inhibition on both chemerin secretion and mRNA levels in 3T3-L1 adipocytes. The AMPK activator AICAR and the PI3K inhibitor LY294002 dramatically abrogated both chemerin secretion and gene expression, and further potentiated the inhibitory effect of α-LA on chemerin secretion. Insulin was able to partially reverse the inhibitory action of α-LA on chemerin secretion. α-LA also reduced basal chemerin secretion in both subcutaneous and omental adipocytes from overweight/obese subjects. Moreover, α-LA was able to abolish the stimulatory effects of the pro-inflammatory cytokine TNF-α on chemerin secretion. Our data demonstrated the ability of α-LA to inhibit chemerin production, an adipokine associated to obesity and metabolic syndrome, suggesting that the reduction of chemerin could contribute to the antiobesity/antidiabetic properties described for α-LA. PMID:26721419

  7. Protective Efficacy of Alpha-lipoic Acid against AflatoxinB1-induced Oxidative Damage in the Liver

    PubMed Central

    Li, Y.; Ma, Q. G.; Zhao, L. H.; Guo, Y. Q.; Duan, G. X.; Zhang, J. Y.; Ji, C.

    2014-01-01

    Alpha-lipoic acid (α-LA) is not only involved in energy metabolism, but is also a powerful antioxidant that can protect against hepatic oxidative stress induced by some drugs, toxins, or under various physiological and pathophysiological conditions. Here, we investigated the effect of α-LA against liver oxidative damage in broilers exposed to aflatoxin B1 (AFB1). Birds were randomly divided into four groups and assigned different diets: basal diet, 300 mg/kg α-LA supplementation in basal diet, diet containing 74 μg/kg AFB1, and 300 mg/kg α-LA supplementation in diet containing 74 μg/kg AFB1, for 3 weeks. The results revealed that the addition of 300 mg/kg α-LA protected against the liver function damage of broilers induced by chronic low dose of AFB1 as estimated by a significant (p<0.05) change in levels of plasma total protein, albumin, alkaline phosphatase and the activities of liver glutamic-oxalacetic transaminase and glutamic-pyruvic transaminase. The histopathological analysis also showed that liver tissues were injured in the AFB1 diet, but this effect was alleviated by the addition of 300 mg/kg α-LA. Additionally, AFB1 induced a profound elevation of oxidative stress in birds, as indicated by an increase in malondialdehyde level, a decrease in glutathione peroxidase activity and a depletion of the glutathione content in the liver. All of these negative effects were inhibited by treatment with α-LA. Our results suggest that the inhibition of AFB1-induced excess production of lipid peroxides and the maintenance of intracellular antioxidant status may play important roles in the protective effects of α-LA against AFB1-induced oxidative damage in the liver. PMID:25050030

  8. Alpha-lipoic acid-mediated activation of muscarinic receptors improves hippocampus- and amygdala-dependent memory.

    PubMed

    Mahboob, Aamra; Farhat, Syeda Mehpara; Iqbal, Ghazala; Babar, Mustafeez Mujtaba; Zaidi, Najam-us-Sahar Sadaf; Nabavi, Seyed Mohammad; Ahmed, Touqeer

    2016-04-01

    Aluminum (Al) is a neurotoxic agent which readily crosses the blood-brain-barrier (BBB) and accumulates in the brain leading to neurodegenerative disorders, characterised by cognitive impairment. Alpha-lipoic acid (ALA) is an antioxidant and has a potential to improve cognitive functions. This study aimed to evaluate the neuroprotective effect of ALA in AlCl3-induced neurotoxicity mouse model. Effect of ALA (25mg/kg/day) was evaluated in the AlCl3-induced neurotoxicity (AlCl3 150 mg/kg/day) mouse model on learning and memory using behaviour tests and on the expression of muscarinic receptor genes (using RT-PCR), in hippocampus and amygdala. Following ALA treatment, the expression of muscarinic receptor genes M1, M2 and choline acetyltransferase (ChaT) were significantly improved (p<0.05) relative to AlCl3-treated group. ALA enhanced fear memory (p<0.01) and social novelty preference (p<0.001) comparative to the AlCl3-treated group. Fear extinction memory was remarkably restored (p<0.001) in ALA-treated group demonstrated by reduced freezing response as compared to the AlCl3-treated group which showed higher freezing. In-silico analysis showed that racemic mixture of ALA has higher binding affinity for M1 and M2 compared to acetylcholine. These novel findings highlight the potential role of ALA in cognitive functions and cholinergic system enhancement thus presenting it an enviable therapeutic candidate for the treatment of neurodegenerative disorders. PMID:26912408

  9. Effects of α-lipoic acid on endothelial function in aged diabetic and high-fat fed rats

    PubMed Central

    Sena, C M; Nunes, E; Louro, T; Proença, T; Fernandes, R; Boarder, M R; Seiça, R M

    2007-01-01

    Background and purpose: This study was conducted to investigate the effects of α-lipoic acid (α-LA) on endothelial function in diabetic and high-fat fed animal models and elucidate the potential mechanism underlying the benefits of α-LA. Experimental approach: Plasma metabolites reflecting glucose and lipid metabolism, endothelial function, urinary albumin excretion (UAE), plasma and aortic malondialdehyde (MDA) and urinary 8-hydroxydeoxyguanosine (8-OHdG) were assessed in non-diabetic controls (Wistar rats), untreated Goto-Kakizaki (GK) diabetic and high-fat fed GK rats (fed with atherogenic diet only, treated with α-LA and treated with vehicle, for 3 months). Vascular eNOS, nitrotyrosine, carbonyl groups and superoxide anion were also assessed in the different groups. Key results: α-LA and soybean oil significantly reduced both total and non-HDL serum cholesterol and triglycerides induced by atherogenic diet. MDA, carbonyl groups, vascular superoxide and 8-OHdG levels were higher in GK and high-fat fed GK groups and fully reversed with α-LA treatment. High-fat fed GK diabetic rats showed significantly reduced endothelial function and increased UAE, effects ameliorated with α-LA. This endothelial dysfunction was associated with decreased NO production, decreased expression of eNOS and increased vascular superoxide production and nitrotyrosine expression. Conclusions and implications: α-LA restores endothelial function and significantly improves systemic and local oxidative stress in high-fat fed GK diabetic rats. Improved endothelial function due to α-LA was at least partially attributed to recoupling of eNOS and increased NO bioavailability and represents a pharmacological approach to prevent major complications associated with type 2 diabetes. PMID:17906683

  10. Rheology as a Tool to Predict the Release of Alpha-Lipoic Acid from Emulsions Used for the Prevention of Skin Aging

    PubMed Central

    Isaac, Vera Lucia Borges; Chiari-Andréo, Bruna Galdorfini; Marto, Joana Marques; Moraes, Jemima Daniela Dias; Leone, Beatriz Alves; Corrêa, Marcos Antonio; Ribeiro, Helena Margarida

    2015-01-01

    The availability of an active substance through the skin depends basically on two consecutive steps: the release of this substance from the vehicle and its subsequent permeation through the skin. Hence, studies on the specific properties of vehicles, such as their rheological behavior, are of great interest in the field of dermatological products. Recent studies have shown the influence of the rheological features of a vehicle on the release of drugs and active compounds from the formulation. In this context, the aim of this study was to evaluate the influence of the rheological features of two different emulsion formulations on the release of alpha-lipoic acid. Alpha-lipoic acid (ALA) was chosen for this study because of its antioxidant characteristics, which could be useful for the prevention of skin diseases and aging. The rheological and mechanical behavior and the in vitro release profile were assayed. The results showed that rheological features, such as viscosity, thixotropy, and compliance, strongly influenced the release of ALA from the emulsion and that the presence of a hydrophilic polymer in one of the emulsions was an important factor affecting the rheology and, therefore, the release of ALA. PMID:26788510

  11. Clinical Usefulness of Oral Supplementation with Alpha-Lipoic Acid, Curcumin Phytosome, and B-Group Vitamins in Patients with Carpal Tunnel Syndrome Undergoing Surgical Treatment

    PubMed Central

    Pajardi, Giorgio; Bortot, Paola; Ponti, Veronica; Novelli, Chiara

    2014-01-01

    We investigated the clinical usefulness of oral supplementation with a combination product containing alpha-lipoic acid, curcumin phytosome, and B-group vitamins in 180 patients with carpal tunnel syndrome (CTS), scheduled to undergo surgical decompression of the median nerve. Patients in Group A (n = 60) served as controls and did not receive any treatment either before or after surgery. Patients in Group B (n = 60) received oral supplementation twice a day for 3 months both before and after surgery (totaling 6 months of supplementation). Patients in Group C (n = 60) received oral supplementation twice a day for 3 months before surgery only. Patients in Group B showed significantly lower nocturnal symptoms scores compared with Group A subjects at both 40 days and 3 months after surgery (both P values <0.05). Moreover, patients in Group B had a significantly lower number of positive Phalen's tests at 3 months compared with the other study groups (P < 0.05). We conclude that oral supplementation with alpha-lipoic acid, curcumin phytosome, and B-group vitamins twice a day both before and after surgery is safe and effective in CTS patients scheduled to undergo surgical decompression of the median nerve. PMID:24563654

  12. Modulatory effects of curcumin, silybin-phytosome and alpha-R-lipoic acid against thioacetamide-induced liver cirrhosis in rats.

    PubMed

    Ali, Shimaa Omar; Darwish, Hebatallah Abd El-moeti; Ismail, Nabila Abd El-fattah

    2014-06-01

    Liver cirrhosis is the final consequence of a progressive fibrotic process characterized by excessive collagen deposition and destruction of the normal liver architecture. This study aimed to investigate the protective effects of curcumin, silybin-phytosome and alpha-R-lipoic acid against thioacetamide-induced cirrhosis. Male rats were allocated into five groups of which one group received saline and served as normal control. Animals from groups 2-5 were treated with thioacetamide administered intraperitoneally at a dose of 200 mg/kg 3 times per week for 7 weeks. Group 2 was left untreated while groups from 3 to 5 were given a daily oral dose of curcumin, silybin-phytosome or alpha-R-lipoic acid simultaneously with thioacetamide. Increases in hepatic levels of malondialdehyde (MDA) and protein carbonyls (Pr Co) associated with thioacetamide administration were partially blocked in those groups receiving supplements. Glutathione (GSH) depletion, collagen deposition, matrix metalloproteinase-2 (MMP-2) activity, transforming growth factor-β1 (TGF-β1) level as well as α-smooth muscle actin (α-SMA) and heat shock protein-47 (HSP-47) gene expressions were also decreased in response to supplements administration. Serological analysis of liver function and histopathological examination reinforced the results. In conclusion, the present study highlights the antioxidant and the antifibrotic potentials of these supplements against chronic liver diseases caused by ongoing hepatic damage. PMID:24704557

  13. Clinical usefulness of oral supplementation with alpha-lipoic Acid, curcumin phytosome, and B-group vitamins in patients with carpal tunnel syndrome undergoing surgical treatment.

    PubMed

    Pajardi, Giorgio; Bortot, Paola; Ponti, Veronica; Novelli, Chiara

    2014-01-01

    We investigated the clinical usefulness of oral supplementation with a combination product containing alpha-lipoic acid, curcumin phytosome, and B-group vitamins in 180 patients with carpal tunnel syndrome (CTS), scheduled to undergo surgical decompression of the median nerve. Patients in Group A (n = 60) served as controls and did not receive any treatment either before or after surgery. Patients in Group B (n = 60) received oral supplementation twice a day for 3 months both before and after surgery (totaling 6 months of supplementation). Patients in Group C (n = 60) received oral supplementation twice a day for 3 months before surgery only. Patients in Group B showed significantly lower nocturnal symptoms scores compared with Group A subjects at both 40 days and 3 months after surgery (both P values <0.05). Moreover, patients in Group B had a significantly lower number of positive Phalen's tests at 3 months compared with the other study groups (P < 0.05). We conclude that oral supplementation with alpha-lipoic acid, curcumin phytosome, and B-group vitamins twice a day both before and after surgery is safe and effective in CTS patients scheduled to undergo surgical decompression of the median nerve. PMID:24563654

  14. Effect of stents coated with a combination of sirolimus and alpha-lipoic acid in a porcine coronary restenosis model.

    PubMed

    Lim, Kyung Seob; Park, Jun-Kyu; Jeong, Myung Ho; Bae, In-Ho; Nah, Jae-Woon; Park, Dae Sung; Kim, Jong Min; Kim, Jung Ha; Lee, So Youn; Jang, Eun Jae; Jang, Suyoung; Kim, Hyun Kuk; Sim, Doo Sun; Park, Keun-Ho; Hong, Young Joon; Ahn, Youngkeun; Kang, Jung Chaee

    2016-04-01

    The aim of this study was to evaluate antiproliferative sirolimus- and antioxidative alpha-lipoic acid (ALA)-eluting stents using biodegradable polymer [poly-L-lactic acid (PLA)] in a porcine coronary overstretch restenosis model. Forty coronary arteries of 20 pigs were randomized into four groups in which the coronary arteries had a bare metal stent (BMS, n = 10), ALA-eluting stent with PLA (AES, n = 10), sirolimus-eluting stent with PLA (SES, n = 10), or sirolimus- and ALA-eluting stent with PLA (SAS, n = 10). A histopathological analysis was performed 28 days after the stenting. The ALA and sirolimus released slowly over 30 days. There were no significant differences between groups in the injury or inflammation score; however, there were significant differences in the percent area of stenosis (56.2 ± 11.78% in BMS vs. 51.5 ± 12.20% in AES vs. 34.7 ± 7.23% in SES vs. 28.7 ± 7.30% in SAS, P < 0.0001) and fibrin score [1.0 (range 1.0-1.0) in BMS vs. 1.0 (range 1.0-1.0) in AES vs. 2.0 (range 2.0-2.0) in SES vs. 2.0 (range 2.0-2.0) in SAS, P < 0.0001] between the four groups. The percent area of stenosis based on micro-computed tomography corresponded with the restenosis rates based on histopathological stenosis in different proportions in the four groups (54.8 ± 7.88% in BMS vs. 50.4 ± 14.87% in AES vs. 34.5 ± 7.22% in SES vs. 28.9 ± 7.22% in SAS, P < 0.05). SAS showed a better neointimal inhibitory effect than BMS, AES, and SES at 1 month after stenting in a porcine coronary restenosis model. Therefore, SAS with PLA can be a useful drug combination for coronary stent coating to suppress neointimal hyperplasia. PMID:26886814

  15. Comparison of shock wave therapy and nutraceutical composed of Echinacea angustifolia, alpha lipoic acid, conjugated linoleic acid and quercetin (perinerv) in patients with carpal tunnel syndrome.

    PubMed

    Notarnicola, Angela; Maccagnano, Giuseppe; Tafuri, Silvio; Fiore, Alessandra; Pesce, Vito; Moretti, Biagio

    2015-06-01

    Even though the initial treatment of carpal tunnel syndrome (CTS) is conservative, knowledge of the clinical effects of supplements and of some methods of physiotherapy is still preliminary. Many biological mechanisms can support the administration of shock wave therapy (ESWT) or of alpha lipoic acid (ALA) based nutraceutical, conjugated linoleic acid (GLA), anti-oxidants and Echinacea angustifolia for CTS. The shock waves reduce the nerve compression, produce an anti-inflammatory action, and accelerate the regeneration of neuropathy. ALA and GLA induce antioxidant protective actions, reduce inflammation, promote neuroregeneration, and decrease pain. The Echinacea modulates the endogenous cannabinoid system.The aim of study is to verify the efficiency of shock wave therapy versus nutraceutical composed of ALA, GLA, and Echinacea in CTS. Sixty patients were enrolled in this study and they were randomly assigned to one of two treatments. Both groups showed significant improvements in pain, symptoms' severity and functional scores, and electrodiagnostic results until the sixth month. We verified a trend to a better pain regression in the nutraceutical group. The presence of the medicinal Echinacea represents an added value to the antioxidant effect in ALA and GLA, which can justify this result. ESWT or the association of ALA, GLA, and Echinacea proved to be two effective treatments for controlling symptoms and improving the evolution of CTS. PMID:25953494

  16. The clinical efficacy of cosmeceutical application of liquid crystalline nanostructured dispersions of alpha lipoic acid as anti-wrinkle.

    PubMed

    Sherif, Saly; Bendas, Ehab R; Badawy, Sabry

    2014-02-01

    Topical 5% alpha lipoic acid (ALA) has shown efficacy in treatment of photo-damaged skin. The aim of this work was to evaluate the potential of poloxamer (P407) gel as a vehicle for the novel lipid base particulate system (cubosome dispersions) of ALA. Cubosome dispersions were formulated by two different approaches, emulsification of glyceryl monoolein (GMO) and poloxamer (P407) in water followed by ultrasonication, and the dilution method using a hydrotrope. Three different concentrations of GMO were used to formulate the cubosome dispersions using the first method, 5% (D1), 10% (D2) and 15% w/w (D3). In the second technique an isotropic liquid was produced by combining GMO with ethanol, and this isotropic liquid was then diluted with a P407 solution (D4). The dispersions were characterized by zeta potential, light scattering techniques, optical and transmission electron microscopy, encapsulation efficiency and in vitro drug release. Results showed that D4 was not a uniform dispersion and that D1, D2 and D3 were uniform dispersions, in which by increasing the GMO content in the dispersion, the size of the cubosomes decreased, zeta potential became more negative, encapsulation efficiency increased up to 86.48% and the drug release rate was slower. P407 gels were prepared using the cold method. Two concentrations of P407 gel were fabricated, 20 and 30% w/w. P407 gels were loaded with either ALA or dispersions containing ALA cubosomes. P407 gels were characterized by critical gelation temperature, rheological measurements and in vitro drug release studies. Results suggested that by increasing P407 concentration, the gelation temperature decreases and viscosity increases. Drug release in both cases was found to follow the Higuchi square root model. Gel loaded with ALA cubosomes provided a significantly lower release rate than the gel loaded with the un-encapsulated ALA. A double blinded placebo controlled clinical study was conducted, aiming to evaluate the efficacy

  17. Selective deposition of dietary α-Lipoic acid in mitochondrial fraction and its synergistic effect with α-Tocoperhol acetate on broiler meat oxidative stability

    PubMed Central

    2013-01-01

    The use of bioactive antioxidants in feed of broiler to mitigate reactive oxygen species (ROS) in biological systems is one of promising nutritional strategies. The aim of present study was to alleviate ROS production in mitochondrial fraction (MF) of meat by supplemented dietary antioxidant in feed of broiler. For this purpose, mitochondria specific antioxidant: α-lipoic acid (25 mg, 75 mg and 150 mg) with or without combination of α-tocopherol acetate (200 mg) used in normal and palm olein oxidized oil (4%) supplemented feed. One hundred and eighty one day old broiler birds were randomly divided into six treatments and provided the mentioned feed from third week. Feed intake, feed conversion ratio (FCR) remained statistically same in all groups while body weight decreased in supplemented groups accordingly at the end of study. The broiler meat MF antioxidant potential was significantly improved by feeding supplemented feed estimated as 1,1-di phenyl-2-picrylhydrazyl (DPPH) free radical scavenging activity, 2,2-azinobis-(3- ethylbenzothiazoline-6-sulphonic acid) (ABTS+) and thiobarbituric acid reactive substances (TBARS). The maximum antioxidant activity was depicted in group fed on 150 mg/kg α-lipoic acid (ALA) and 200 mg/kg α-tocopherol acetate (ATA) (T4) in both breast and leg MF. Moreover, TBARS were higher in leg as compared to breast MF. Although, oxidized oil containing feed reduced the growth, lipid stability and antioxidant potential of MF whilst these traits were improved by receiving feed containing ALA and ATA. ALA and ATA showed higher deposition in T4 group while least in group received oxidized oil containing feed (T5). Positive correlation exists between DPPH free radical scavenging activity and the ABTS + reducing activity. In conclusion, ALA and ATA supplementation in feed had positive effect on antioxidant status of MF that consequently diminished the oxidative stress in polyunsaturated fatty acid enriched meat. PMID:23617815

  18. Selective deposition of dietary α-lipoic acid in mitochondrial fraction and its synergistic effect with α-tocoperhol acetate on broiler meat oxidative stability.

    PubMed

    Parveen, Rashida; Asghar, Ali; Anjum, Faqir M; Khan, Muhammad I; Arshad, Muhammad Sajid; Yasmeen, Ammara

    2013-01-01

    The use of bioactive antioxidants in feed of broiler to mitigate reactive oxygen species (ROS) in biological systems is one of promising nutritional strategies. The aim of present study was to alleviate ROS production in mitochondrial fraction (MF) of meat by supplemented dietary antioxidant in feed of broiler. For this purpose, mitochondria specific antioxidant: α-lipoic acid (25 mg, 75 mg and 150 mg) with or without combination of α-tocopherol acetate (200 mg) used in normal and palm olein oxidized oil (4%) supplemented feed. One hundred and eighty one day old broiler birds were randomly divided into six treatments and provided the mentioned feed from third week. Feed intake, feed conversion ratio (FCR) remained statistically same in all groups while body weight decreased in supplemented groups accordingly at the end of study. The broiler meat MF antioxidant potential was significantly improved by feeding supplemented feed estimated as 1,1-di phenyl-2-picrylhydrazyl (DPPH) free radical scavenging activity, 2,2-azinobis-(3- ethylbenzothiazoline-6-sulphonic acid) (ABTS+) and thiobarbituric acid reactive substances (TBARS). The maximum antioxidant activity was depicted in group fed on 150 mg/kg α-lipoic acid (ALA) and 200 mg/kg α-tocopherol acetate (ATA) (T4) in both breast and leg MF. Moreover, TBARS were higher in leg as compared to breast MF. Although, oxidized oil containing feed reduced the growth, lipid stability and antioxidant potential of MF whilst these traits were improved by receiving feed containing ALA and ATA. ALA and ATA showed higher deposition in T4 group while least in group received oxidized oil containing feed (T5). Positive correlation exists between DPPH free radical scavenging activity and the ABTS + reducing activity. In conclusion, ALA and ATA supplementation in feed had positive effect on antioxidant status of MF that consequently diminished the oxidative stress in polyunsaturated fatty acid enriched meat. PMID:23617815

  19. Lead induced oxidative damage and its response to combined administration of alpha-lipoic acid and succimers in rats.

    PubMed

    Pande, Manisha; Flora, S J S

    2002-08-15

    Alpha-lipoic acid (LA) has been reported to be highly effective in improving the thiol capacity of the cells and in reducing lead induced oxidative stress. These results suggested its possible role as a therapeutic intervention of lead poisoning in combination with a chelator. We investigated the effects of LA, either alone or when administered in combination with succimer (meso 2,3-dimercaptosuccinic acid; DMSA or one of its analogue monoisoamyl DMSA), in influencing the lead induced alterations in haem synthesis pathway, hepatic, renal and brain oxidative stress and lead concentration from blood and soft tissues. The results suggest a significant lead induced inhibition of delta-aminolevulinic acid dehydratase (ALAD), reduction in glutathione (GSH) and an increased zinc protoporphyrin (ZPP) level in blood, indicating altered heme synthesis pathway. Both the thiol chelators were able to increase blood ALAD activity and GSH level towards normal. The most prominent effect on blood ALAD activity was however observed when monoisoamyl DMSA (MiADMSA) was co-administered with LA. Lead exposure produced significant depletion of hepatic GSH, while, oxidized glutahione (GSSG), thiobarbituric acid reactive substances (TBARS) and catalase activity increased significantly, suggesting hepatic oxidative stress. All the treatments were able to increase hepatic GSH and reduce GSSG levels, while, TBARS level reduced significantly in animals administered LA and MiADMSA, individually or in combination. Lead induced increase in renal GSSG, TBARS levels and catalase activity, were effectively reduced by LA, while, the two chelators when administered alone were effective only in reducing GSSG and catalase activity. The most prominent beneficial effects, however, were observed in animals treated concomitantly with LA and one of the chelators (DMSA or MiADMSA). Brain GSH and GSSG levels decreased moderately while superoxide dismutase (SOD) activity remained statistically unaltered on lead

  20. The Effects of α-Lipoic Acid on Liver Oxidative Stress and Free Fatty Acid Composition in Methionine–Choline Deficient Diet-Induced NAFLD

    PubMed Central

    Stanković, Milena N.; Mladenović, Dušan; Ninković, Milica; Ðuričić, Ivana; Šobajić, Slađana; Jorgačević, Bojan; de Luka, Silvio; Vukicevic, Rada Jesic

    2014-01-01

    Abstract Development of nonalcoholic fatty liver disease (NAFLD) occurs through initial steatosis and subsequent oxidative stress. The aim of this study was to examine the effects of α-lipoic acid (LA) on methionine–choline deficient (MCD) diet-induced NAFLD in mice. Male C57BL/6 mice (n=21) were divided into three groups (n=7 per group): (1) control fed with standard chow, (2) MCD2 group—fed with MCD diet for 2 weeks, and (3) MCD2+LA group—2 weeks on MCD receiving LA i.p. 100 mg/kg/day. After the treatment, liver samples were taken for pathohistology, oxidative stress parameters, antioxidative enzymes, and liver free fatty acid (FFA) composition. Mild microvesicular hepatic steatosis was found in MCD2 group, while it was reduced to single fat droplets evident in MCD2+LA group. Lipid peroxidation and nitrosative stress were increased by MCD diet, while LA administration induced a decrease in liver malondialdehyde and nitrates+nitrites level. Similary, LA improved liver antioxidative capacity by increasing total superoxide dismutase (tSOD), manganese SOD (MnSOD), and copper/zinc-SOD (Cu/ZnSOD) activity as well as glutathione (GSH) content. Liver FFA profile has shown a significant decrease in saturated acids, arachidonic, and docosahexaenoic acid (DHA), while LA treatment increased their proportions. It can be concluded that LA ameliorates lipid peroxidation and nitrosative stress in MCD diet-induced hepatic steatosis through an increase in SOD activity and GSH level. In addition, LA increases the proportion of palmitic, stearic, arachidonic, and DHA in the fatty liver. An increase in DHA may be a potential mechanism of anti-inflammatory and antioxidant effects of LA in MCD diet-induced NAFLD. PMID:24325457

  1. Is alpha-lipoic acid a scavenger of reactive oxygen species in vivo? Evidence for its initiation of stress signaling pathways that promote endogenous antioxidant capacity.

    PubMed

    Petersen Shay, Kate; Moreau, Régis F; Smith, Eric J; Hagen, Tory M

    2008-06-01

    The chemical reduction and oxidation (redox) properties of alpha-lipoic acid (LA) suggest that it may have potent antioxidant potential. A significant number of studies now show that LA and its reduced form, dihydrolipoic acid (DHLA), directly scavenge reactive oxygen species (ROS) and reactive nitrogen species (RNS) species and protect cells against a host of insults where oxidative stress is part of the underlying etiology. However, owing to its limited and transient accumulation in tissues following oral intake, the efficacy of nonprotein-bound LA to function as a physiological antioxidant has been questioned. Herein, we review the evidence that the micronutrient functions of LA may be more as an effector of important cellular stress response pathways that ultimately influence endogenous cellular antioxidant levels and reduce proinflammatory mechanisms. This would promote a sustained improvement in cellular resistance to pathologies where oxidative stress is involved, which would not be forthcoming if LA solely acted as a transient ROS scavenger. PMID:18409172

  2. Hypermetabolic state in the 7-month-old triple transgenic mouse model of Alzheimer's disease and the effect of lipoic acid: a 13C-NMR study

    PubMed Central

    Sancheti, Harsh; Patil, Ishan; Kanamori, Keiko; Díaz Brinton, Roberta; Zhang, Wei; Lin, Ai-Ling; Cadenas, Enrique

    2014-01-01

    Alzheimer's disease (AD) is characterized by age-dependent biochemical, metabolic, and physiologic changes. These age-dependent changes ultimately converge to impair cognitive functions. This study was carried out to examine the metabolic changes by probing glucose and tricarboxylic acid cycle metabolism in a 7-month-old triple transgenic mouse model of AD (3xTg-AD). The effect of lipoic acid, an insulin-mimetic agent, was also investigated to examine its ability in modulating age-dependent metabolic changes. Seven-month-old 3xTg-AD mice were given intravenous infusion of [1-13C]glucose followed by an ex vivo 13C nuclear magnetic resonance to determine the concentrations of 13C-labeled isotopomers of glutamate, glutamine, aspartate, gamma aminobutyric acid, and N-acetylaspartate. An intravenous infusion of [1-13C]glucose+[1,2-13C]acetate was given for different periods of time to distinguish neuronal and astrocytic metabolism. Enrichments of glutamate, glutamine, and aspartate were calculated after quantifying the total (12C+13C) concentrations by high-performance liquid chromatography. A hypermetabolic state was clearly evident in 7-month-old 3xTg-AD mice in contrast to the hypometabolic state reported earlier in 13-month-old mice. Hypermetabolism was evidenced by prominent increase of 13C labeling and enrichment in the 3xTg-AD mice. Lipoic acid feeding to the hypermetabolic 3xTg-AD mice brought the metabolic parameters to the levels of nonTg mice. PMID:25099753

  3. Hypermetabolic state in the 7-month-old triple transgenic mouse model of Alzheimer's disease and the effect of lipoic acid: a 13C-NMR study.

    PubMed

    Sancheti, Harsh; Patil, Ishan; Kanamori, Keiko; Díaz Brinton, Roberta; Zhang, Wei; Lin, Ai-Ling; Cadenas, Enrique

    2014-11-01

    Alzheimer's disease (AD) is characterized by age-dependent biochemical, metabolic, and physiologic changes. These age-dependent changes ultimately converge to impair cognitive functions. This study was carried out to examine the metabolic changes by probing glucose and tricarboxylic acid cycle metabolism in a 7-month-old triple transgenic mouse model of AD (3xTg-AD). The effect of lipoic acid, an insulin-mimetic agent, was also investigated to examine its ability in modulating age-dependent metabolic changes. Seven-month-old 3xTg-AD mice were given intravenous infusion of [1-(13)C]glucose followed by an ex vivo (13)C nuclear magnetic resonance to determine the concentrations of (13)C-labeled isotopomers of glutamate, glutamine, aspartate, gamma aminobutyric acid, and N-acetylaspartate. An intravenous infusion of [1-(13)C]glucose+[1,2-(13)C]acetate was given for different periods of time to distinguish neuronal and astrocytic metabolism. Enrichments of glutamate, glutamine, and aspartate were calculated after quantifying the total ((12)C+(13)C) concentrations by high-performance liquid chromatography. A hypermetabolic state was clearly evident in 7-month-old 3xTg-AD mice in contrast to the hypometabolic state reported earlier in 13-month-old mice. Hypermetabolism was evidenced by prominent increase of (13)C labeling and enrichment in the 3xTg-AD mice. Lipoic acid feeding to the hypermetabolic 3xTg-AD mice brought the metabolic parameters to the levels of nonTg mice. PMID:25099753

  4. EGVII endoglucanase and nucleic acids encoding the same

    SciTech Connect

    Dunn-Coleman, Nigel; Goedegebuur, Frits; Ward, Michael; Yao, Jian

    2014-02-25

    The present invention provides a novel endoglucanase nucleic acid sequence, designated egl7, and the corresponding EGVII amino acid sequence. The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding EGVII, recombinant EGVII proteins and methods for producing the same.

  5. EGVII endoglucanase and nucleic acids encoding the same

    SciTech Connect

    Dunn-Coleman, Nigel; Goedegebuur, Frits; Ward, Michael; Yao, Jian

    2015-04-14

    The present invention provides a novel endoglucanase nucleic acid sequence, designated egl7, and the corresponding EGVII amino acid sequence. The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding EGVII, recombinant EGVII proteins and methods for producing the same.

  6. EGVII endoglucanase and nucleic acids encoding the same

    SciTech Connect

    Dunn-Coleman, Nigel; Goedegebuur, Frits; Ward, Michael; Yao, Jian

    2013-07-16

    The present invention provides a novel endoglucanase nucleic acid sequence, designated egl7, and the corresponding EGVII amino acid sequence. The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding EGVII, recombinant EGVII proteins and methods for producing the same.

  7. EGVII endoglucanase and nucleic acids encoding the same

    SciTech Connect

    Dunn-Coleman, Nigel; Goedegebuur, Frits; Ward, Michael; Yao, Jian

    2012-02-14

    The present invention provides a novel endoglucanase nucleic acid sequence, designated egl7, and the corresponding EGVII amino acid sequence. The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding EGVII, recombinant EGVII proteins and methods for producing the same.

  8. EGVI endoglucanase and nucleic acids encoding the same

    DOEpatents

    Dunn-Coleman, Nigel; Goedegebuur, Frits; Ward, Michael; Yao, Jian

    2008-04-01

    The present invention provides a novel endoglucanase nucleic acid sequence, designated egl6, and the corresponding EGVI amino acid sequence. The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding EGVI, recombinant EGVI proteins and methods for producing the same.

  9. EGVII endoglucanase and nucleic acids encoding the same

    DOEpatents

    Dunn-Coleman, Nigel; Goedegebuur, Frits; Ward, Michael; Yao, Jian

    2009-05-05

    The present invention provides an endoglucanase nucleic acid sequence, designated egl7, and the corresponding EGVII amino acid sequence. The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding EGVII, recombinant EGVII proteins and methods for producing the same.

  10. EGVII endoglucanase and nucleic acids encoding the same

    DOEpatents

    Dunn-Coleman, Nigel; Goedegebuur, Frits; Ward, Michael; Yao, Jian

    2008-11-11

    The present invention provides a novel endoglucanase nucleic acid sequence, designated egl7, and the corresponding EGVII amino acid sequence. The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding EGVII, recombinant EGVII proteins and methods for producing the same.

  11. EGVI endoglucanase and nucleic acids encoding the same

    DOEpatents

    Dunn-Coleman, Nigel; Goedegebuur, Frits; Ward, Michael; Yao, Jian

    2010-10-05

    The present invention provides a novel endoglucanase nucleic acid sequence, designated egl6, and the corresponding EGVI amino acid sequence. The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding EGVI, recombinant EGVI proteins and methods for producing the same.

  12. EGVI endoglucanase and nucleic acids encoding the same

    DOEpatents

    Dunn-Coleman, Nigel; Goedegebuur, Frits; Ward, Michael; Yao, Jian

    2010-10-12

    The present invention provides a novel endoglucanase nucleic acid sequence, designated egl6, and the corresponding EGVI amino acid sequence. The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding EGVI, recombinant EGVI proteins and methods for producing the same.

  13. Isolated menthone reductase and nucleic acid molecules encoding same

    DOEpatents

    Croteau, Rodney B; Davis, Edward M; Ringer, Kerry L

    2013-04-23

    The present invention provides isolated menthone reductase proteins, isolated nucleic acid molecules encoding menthone reductase proteins, methods for expressing and isolating menthone reductase proteins, and transgenic plants expressing elevated levels of menthone reductase protein.

  14. Genetically encoded fluorescent coumarin amino acids

    DOEpatents

    Wang, Jiangyun; Xie, Jianming; Schultz, Peter G.

    2010-10-05

    The invention relates to orthogonal pairs of tRNAs and aminoacyl-tRNA synthetases that can incorporate the coumarin unnatural amino acid L-(7-hydroxycoumarin-4-yl) ethylglycine into proteins produced in eubacterial host cells such as E. coli. The invention provides, for example but not limited to, novel orthogonal synthetases, methods for identifying and making the novel synthetases, methods for producing proteins containing the unnatural amino acid L-(7-hydroxycoumarin-4-yl)ethylglycine and related translation systems.

  15. Genetically encoded fluorescent coumarin amino acids

    DOEpatents

    Wang, Jiangyun; Xie, Jianming; Schultz, Peter G.

    2012-06-05

    The invention relates to orthogonal pairs of tRNAs and aminoacyl-tRNA synthetases that can incorporate the coumarin unnatural amino acid L-(7-hydroxycoumarin-4-yl)ethylglycine into proteins produced in eubacterial host cells such as E. coli. The invention provides, for example but not limited to, novel orthogonal synthetases, methods for identifying and making the novel synthetases, methods for producing proteins containing the unnatural amino acid L-(7-hydroxycoumarin-4-yl)ethylglycine and related translation systems.

  16. Nucleic acids encoding metal uptake transporters and their uses

    DOEpatents

    Schroeder, Julian I.; Antosiewicz, Danuta M.; Schachtman, Daniel P.; Clemens, Stephan

    1999-01-01

    The invention provides LCT1 nucleic acids which encode metal ion uptake transporters. The invention also provides methods of modulating heavy metal and alkali metal uptake in plants. The methods involve producing transgenic plants comprising a recombinant expression cassette containing an LCT1 nucleic acid linked to a plant promoter.

  17. Extraordinarily Adaptive Properties of the Genetically Encoded Amino Acids

    PubMed Central

    Ilardo, Melissa; Meringer, Markus; Freeland, Stephen; Rasulev, Bakhtiyor; Cleaves II, H. James

    2015-01-01

    Using novel advances in computational chemistry, we demonstrate that the set of 20 genetically encoded amino acids, used nearly universally to construct all coded terrestrial proteins, has been highly influenced by natural selection. We defined an adaptive set of amino acids as one whose members thoroughly cover relevant physico-chemical properties, or “chemistry space.” Using this metric, we compared the encoded amino acid alphabet to random sets of amino acids. These random sets were drawn from a computationally generated compound library containing 1913 alternative amino acids that lie within the molecular weight range of the encoded amino acids. Sets that cover chemistry space better than the genetically encoded alphabet are extremely rare and energetically costly. Further analysis of more adaptive sets reveals common features and anomalies, and we explore their implications for synthetic biology. We present these computations as evidence that the set of 20 amino acids found within the standard genetic code is the result of considerable natural selection. The amino acids used for constructing coded proteins may represent a largely global optimum, such that any aqueous biochemistry would use a very similar set. PMID:25802223

  18. Extraordinarily Adaptive Properties of the Genetically Encoded Amino Acids

    NASA Astrophysics Data System (ADS)

    Ilardo, Melissa; Meringer, Markus; Freeland, Stephen; Rasulev, Bakhtiyor; Cleaves, H. James, II

    2015-03-01

    Using novel advances in computational chemistry, we demonstrate that the set of 20 genetically encoded amino acids, used nearly universally to construct all coded terrestrial proteins, has been highly influenced by natural selection. We defined an adaptive set of amino acids as one whose members thoroughly cover relevant physico-chemical properties, or ``chemistry space.'' Using this metric, we compared the encoded amino acid alphabet to random sets of amino acids. These random sets were drawn from a computationally generated compound library containing 1913 alternative amino acids that lie within the molecular weight range of the encoded amino acids. Sets that cover chemistry space better than the genetically encoded alphabet are extremely rare and energetically costly. Further analysis of more adaptive sets reveals common features and anomalies, and we explore their implications for synthetic biology. We present these computations as evidence that the set of 20 amino acids found within the standard genetic code is the result of considerable natural selection. The amino acids used for constructing coded proteins may represent a largely global optimum, such that any aqueous biochemistry would use a very similar set.

  19. α-Lipoic Acid Inhibits Expression of IL-8 by Suppressing Activation of MAPK, Jak/Stat, and NF-κB in H. pylori-Infected Gastric Epithelial AGS Cells

    PubMed Central

    Choi, Ji Hyun; Cho, Soon Ok

    2016-01-01

    The epithelial cytokine response, associated with reactive oxygen species (ROS), is important in Helicobacter pylori (H. pylori)-induced inflammation. H. pylori induces the production of ROS, which may be involved in the activation of mitogen-activated protein kinases (MAPK), janus kinase/signal transducers and activators of transcription (Jak/Stat), and oxidant-sensitive transcription factor, nuclear factor kappa-light-chain-enhancer of activated B cells (NF-κB), and thus, expression of interleukin-8 (IL-8) in gastric epithelial cells. α-lipoic acid, a naturally occurring thiol compound, is a potential antioxidant. It shows beneficial effects in treatment of oxidant-associated diseases including diabetes. The present study is purposed to investigate whether α-lipoic acid inhibits expression of inflammatory cytokine IL-8 by suppressing activation of MAPK, Jak/Stat, and NF-κB in H. pylori-infected gastric epithelial cells. Gastric epithelial AGS cells were pretreated with or without α-lipoic acid for 2 h and infected with H. pylori in a Korean isolate (HP99) at a ratio of 300:1. IL-8 mRNA expression was analyzed by RT-PCR analysis. IL-8 levels in the medium were determined by enzyme-linked immunosorbent assay. NF-κB-DNA binding activity was determined by electrophoretic mobility shift assay. Phospho-specific and total forms of MAPK and Jak/Stat were assessed by Western blot analysis. ROS levels were determined using dichlorofluorescein fluorescence. As a result, H. pylori induced increases in ROS levels, mRNA, and protein levels of IL-8, as well as the activation of MAPK [extracellular signal-regulated kinase 1/2 (ERK1/2), c-Jun NH2-terminal kinase 1/2 (JNK1/2), p38], Jak/Stat (Jak1/2, Stat3), and NF-κB in AGS cells, which was inhibited by α-lipoic acid. In conclusion, α-lipoic acid may be beneficial for prevention and/or treatment of H. pylori infection-associated gastric inflammation. PMID:26632410

  20. α-Lipoic Acid Inhibits Expression of IL-8 by Suppressing Activation of MAPK, Jak/Stat, and NF-κB in H. pylori-Infected Gastric Epithelial AGS Cells.

    PubMed

    Choi, Ji Hyun; Cho, Soon Ok; Kim, Hyeyoung

    2016-01-01

    The epithelial cytokine response, associated with reactive oxygen species (ROS), is important in Helicobacter pylori (H. pylori)-induced inflammation. H. pylori induces the production of ROS, which may be involved in the activation of mitogen-activated protein kinases (MAPK), janus kinase/signal transducers and activators of transcription (Jak/Stat), and oxidant-sensitive transcription factor, nuclear factor kappa-light-chain-enhancer of activated B cells (NF-κB), and thus, expression of interleukin-8 (IL-8) in gastric epithelial cells. α-lipoic acid, a naturally occurring thiol compound, is a potential antioxidant. It shows beneficial effects in treatment of oxidant-associated diseases including diabetes. The present study is purposed to investigate whether α-lipoic acid inhibits expression of inflammatory cytokine IL-8 by suppressing activation of MAPK, Jak/Stat, and NF-κB in H. pylori-infected gastric epithelial cells. Gastric epithelial AGS cells were pretreated with or without α-lipoic acid for 2 h and infected with H. pylori in a Korean isolate (HP99) at a ratio of 300:1. IL-8 mRNA expression was analyzed by RT-PCR analysis. IL-8 levels in the medium were determined by enzyme-linked immunosorbent assay. NF-κB-DNA binding activity was determined by electrophoretic mobility shift assay. Phospho-specific and total forms of MAPK and Jak/Stat were assessed by Western blot analysis. ROS levels were determined using dichlorofluorescein fluorescence. As a result, H. pylori induced increases in ROS levels, mRNA, and protein levels of IL-8, as well as the activation of MAPK [extracellular signal-regulated kinase 1/2 (ERK1/2), c-Jun NH2-terminal kinase 1/2 (JNK1/2), p38], Jak/Stat (Jak1/2, Stat3), and NF-κB in AGS cells, which was inhibited by α-lipoic acid. In conclusion, α-lipoic acid may be beneficial for prevention and/or treatment of H. pylori infection-associated gastric inflammation. PMID:26632410

  1. Modulatory effects of vitamin E, acetyl-L-carnitine and α-lipoic acid on new potential biomarkers for Alzheimer's disease in rat model.

    PubMed

    Ahmed, Hanaa H

    2012-09-01

    Alzheimer's disease (AD) is the most common chronic neurodegenerative disorder associated with aging. This study aimed to explore new markers for AD as total homocysteine (tHcy), insulin, insulin like growth factor-1 (IGF-1), interlukin-1β (IL-1β) and tumor necrosis factor-α (TNF-α); to determine the modulatory effects of vitamin E (VE), acetyl-L-carnitine (ALC) and α-lipoic acid (LA) on the investigated parameters and to evaluate the possible therapeutic role of these nutraceutical in AD-induced in rats. Our results revealed that brain acetylcholine esterase (AChE) activity and tHcy levels were significantly increased in AD model. Folic acid, vitamin B(12) levels and Na(+)/K(+) ATPase activity were markedly reduced. Plasma insulin and IGF-1 levels were noticeably decreased but plasma TNF-α and IL-1β concentrations were significantly increased, confirming that abnormal inflammatory response is associated with AD. Treatment by VE, ALC and LA restored the above mentioned parameters to about normal levels comparable to those of donepezil, indicating that tHcy, insulin, IGF-1, IL-1β and TNF-α may be considered as new biomarkers for AD. The study points to the potential restoring effects of VE, ALC and LA in AD model. Our study provides evidence for the importance of dietary supplementation in delaying the progression of age-related neurodegenerative diseases. PMID:21183322

  2. Plasma malondialdehyde levels and opiate withdrawal signs observed in rats treated with morphine plus naloxone: effects of alpha-lipoic acid administration.

    PubMed

    Pinelli, Arnaldo; Cighetti, Giuliana; Trivulzio, Silvio

    2008-08-01

    A number of experimental studies have found that reactive oxygen species are involved during morphine treatment or withdrawal. The aims of this study were to analyse whether morphine administration and/or removal are related to peroxide generation and/or signs of withdrawal in rats, and whether the changes in antioxidant status induced by the administration of an antioxidant may modify peroxide levels and behavioural signs. We injected morphine or morphine and naloxone into rats and evaluated the plasma levels of peroxide malondialdehyde (MDA) and the appearance of withdrawal signs. We also investigated the effects on these parameters induced by the administration of the antioxidant alpha-lipoic acid (LA). Morphine treatment increased MDA levels. Abrupt naloxone-induced morphine withdrawal caused a further and significant increase in MDA, and the appearance of withdrawal signs such as abnormal fecal excretion, shortened latency times and jumping. The administration of LA lowered MDA levels in the rats treated with morphine or morphine plus naloxone, and also decreased MDA values and abstinence signs in the animals treated with morphine plus naloxone. The effects of LA were attributed to its capacity to scavenge peroxides and interfere with the biogenesis of the arachidonic acid metabolites involved in the expression of abstinence symptoms. PMID:18705754

  3. α-Lipoic acid inhibits liver fibrosis through the attenuation of ROS-triggered signaling in hepatic stellate cells activated by PDGF and TGF-β.

    PubMed

    Foo, Ning-Ping; Lin, Shu-Huei; Lee, Yu-Hsuan; Wu, Ming-Jiuan; Wang, Ying-Jan

    2011-03-28

    Reactive oxygen species (ROS) have been implicated in hepatic stellate cell activation and liver fibrosis. We previously reported that α-lipoic acid (LA) and its reduced form dihydrolipoic acid (DHLA) inhibited toxicant-induced inflammation and ROS generation. In the present study, we further examined the effects of LA/DHLA on thioacetamide (TAA)-induced liver fibrosis in rats and the possible underlying mechanisms in hepatic stellate cells in vitro. We found that co-administration of LA to rats chronically treated with TAA inhibited the development of liver cirrhosis, as indicated by reductions in cirrhosis incidence, hepatic fibrosis, and AST/ALT activities. We also found that DHLA inhibited TGF-β/PDGF-stimulated HSC-T6 activation and ROS generation. These effects could be mediated by the MAPK and PI3K/Akt pathways. According to our current results, LA may have a beneficial role in the treatment of chronic liver diseases caused by ongoing hepatic damage. PMID:21251946

  4. Geranyl diphosphate synthase molecules, and nucleic acid molecules encoding same

    SciTech Connect

    Croteau, Rodney Bruce; Burke, Charles Cullen

    2008-06-24

    In one aspect, the present invention provides isolated nucleic acid molecules that each encode a geranyl diphosphate synthase protein, wherein each isolated nucleic acid molecule hybridizes to a nucleic acid molecule consisting of the sequence set forth in SEQ ID NO:1 under conditions of 5.times.SSC at 45.degree. C. for one hour. The present invention also provides isolated geranyl diphosphate synthase proteins, and methods for altering the level of expression of geranyl diphosphate synthase protein in a host cell.

  5. Nucleic acids encoding antifungal polypeptides and uses thereof

    DOEpatents

    Altier, Daniel J.; Ellanskaya, I. A.; Gilliam, Jacob T.; Hunter-Cevera, Jennie; Presnail, James K; Schepers, Eric; Simmons, Carl R.; Torok, Tamas; Yalpani, Nasser

    2010-11-02

    Compositions and methods for protecting a plant from a pathogen, particularly a fungal pathogen, are provided. Compositions include an amino acid sequence, and variants and fragments thereof, for an antipathogenic polypeptide that was isolated from a fungal fermentation broth. Nucleic acid molecules that encode the antipathogenic polypeptides of the invention, and antipathogenic domains thereof, are also provided. A method for inducing pathogen resistance in a plant using the nucleotide sequences disclosed herein is further provided. The method comprises introducing into a plant an expression cassette comprising a promoter operably linked to a nucleotide sequence that encodes an antipathogenic polypeptide of the invention. Compositions comprising an antipathogenic polypeptide or a transformed microorganism comprising a nucleic acid of the invention in combination with a carrier and methods of using these compositions to protect a plant from a pathogen are further provided. Transformed plants, plant cells, seeds, and microorganisms comprising a nucleotide sequence that encodes an antipathogenic polypeptide of the invention are also disclosed.

  6. Isolated nucleic acids encoding antipathogenic polypeptides and uses thereof

    DOEpatents

    Altier, Daniel J.; Crane, Virginia C.; Ellanskaya, Irina; Ellanskaya, Natalia; Gilliam, Jacob T.; Hunter-Cevera, Jennie; Presnail, James K.; Schepers, Eric J.; Simmons, Carl R.; Torok, Tamas; Yalpani, Nasser

    2010-04-20

    Compositions and methods for protecting a plant from a pathogen, particularly a fungal pathogen, are provided. Compositions include amino acid sequences, and variants and fragments thereof, for antipathogenic polypeptides that were isolated from fungal fermentation broths. Nucleic acids that encode the antipathogenic polypeptides are also provided. A method for inducing pathogen resistance in a plant using the nucleotide sequences disclosed herein is further provided. The method comprises introducing into a plant an expression cassette comprising a promoter operably linked to a nucleotide sequence that encodes an antipathogenic polypeptide of the invention. Compositions comprising an antipathogenic polypeptide or a transformed microorganism comprising a nucleic acid of the invention in combination with a carrier and methods of using these compositions to protect a plant from a pathogen are further provided. Transformed plants, plant cells, seeds, and microorganisms comprising a nucleotide sequence that encodes an antipathogenic polypeptide of the invention are also disclosed.

  7. Human jagged polypeptide, encoding nucleic acids and methods of use

    DOEpatents

    Li, Linheng; Hood, Leroy

    2000-01-01

    The present invention provides an isolated polypeptide exhibiting substantially the same amino acid sequence as JAGGED, or an active fragment thereof, provided that the polypeptide does not have the amino acid sequence of SEQ ID NO:5 or SEQ ID NO:6. The invention further provides an isolated nucleic acid molecule containing a nucleotide sequence encoding substantially the same amino acid sequence as JAGGED, or an active fragment thereof, provided that the nucleotide sequence does not encode the amino acid sequence of SEQ ID NO:5 or SEQ ID NO:6. Also provided herein is a method of inhibiting differentiation of hematopoietic progenitor cells by contacting the progenitor cells with an isolated JAGGED polypeptide, or active fragment thereof. The invention additionally provides a method of diagnosing Alagille Syndrome in an individual. The method consists of detecting an Alagille Syndrome disease-associated mutation linked to a JAGGED locus.

  8. The Influence of α-Lipoic Acid and Garlic Administration on Biomarkers of Oxidative Stress and Inflammation in Rabbits Exposed to Oxidized Nutrition Oils

    PubMed Central

    Zalejska-Fiolka, Jolanta; Wielkoszyński, Tomasz; Rokicki, Wojciech; Dąbrowska, Natalia; Strzelczyk, Joanna Katarzyna; Kasperczyk, Aleksandra; Owczarek, Aleksander; Błaszczyk, Urszula; Kasperczyk, Sławomir; Stawiarska-Pięta, Barbara; Birkner, Ewa; Gamian, Andrzej

    2015-01-01

    We hypothesized that addition of substances with antioxidant activity could decrease the concentrations of biomarkers of oxidative stress and inflammatory process, thus inhibiting nonalcoholic steatohepatitis development. We investigated the influence of α-lipoic acid (ALA) and garlic administration on the development of adverse changes in rabbit liver and serum under oxidative stress conditions induced with HFD from oxidized oils. We determined 8-hydroxy-2′-deoxyguanosine (8OHdG) and malondialdehyde (MDA) in liver homogenates, total oxidant status (TOS), lipid peroxides (LOO) and tumor necrosis factor alpha (TNFα) in blood serum, and TNFα and IL-1α genes expression in liver. The results indicate that the intake of dietary ALA and garlic was significantly associated with decreases of 8OHdG and MDA levels in rabbits' liver tissue as well as TOS and LOO levels in rabbits' serum. Similarly, TNFα and IL-1α gene expressions were suppressed due to ALA and garlic supplementation. The histopathological analysis confirmed that HFD results in liver disorder leading to steatosis. This adverse effect of HFD was ameliorated by the supplementation of ALA and garlic. The obtained results indicate a beneficial effect of ALA and garlic administration by reducing the oxidative stress intensity and the levels of some proinflammatory cytokines in rabbits fed HFD. PMID:26634212

  9. Gas-saturated solution process to obtain microcomposite particles of alpha lipoic acid/hydrogenated colza oil in supercritical carbon dioxide.

    PubMed

    Mishima, Kenji; Honjo, Masatoshi; Sharmin, Tanjina; Ito, Shota; Kawakami, Ryo; Kato, Takafumi; Misumi, Makoto; Suetsugu, Tadashi; Orii, Hideaki; Kawano, Hiroyuki; Irie, Keiichi; Sano, Kazunori; Mishima, Kenichi; Harada, Takunori; Ouchi, Mikio

    2016-09-01

    Alpha lipoic acid (ALA), an active substance in anti-aging products and dietary supplements, need to be masked with an edible polymer to obscure its unpleasant taste. However, the high viscosity of the ALA molecules prevents them from forming microcomposites with masking materials even in supercritical carbon dioxide (scCO2). Therefore, the purpose of this study was to investigate and develop a novel production method for microcomposite particles for ALA in hydrogenated colza oil (HCO). Microcomposite particles of ALA/HCO were prepared by using a novel gas-saturated solution (PGSS) process in which the solid-dispersion method is used along with stepwise temperature control (PGSS-STC). Its high viscosity prevents the formation of microcomposites in the conventional PGSS process even under strong agitation. Here, we disperse the solid particles of ALA and HCO in scCO2 at low temperatures and change the temperature stepwise in order to mix the melted ALA and HCO in scCO2. As a result, a homogeneous dispersion of the droplets of ALA in melted HCO saturated with CO2 is obtained at high temperatures. After the rapid expansion of the saturated solution through a nozzle, microcomposite particles of ALA/HCO several micrometers in diameter are obtained. PMID:26024240

  10. Treatment with α-Lipoic Acid over 16 Weeks in Type 2 Diabetic Patients with Symptomatic Polyneuropathy Who Responded to Initial 4-Week High-Dose Loading

    PubMed Central

    Garcia-Alcala, Hector; Santos Vichido, Celia Isabel; Islas Macedo, Silverio; Genestier-Tamborero, Christelle Nathalie; Minutti-Palacios, Marissa; Hirales Tamez, Omara; García, Carlos; Ziegler, Dan

    2015-01-01

    Effective treatment of diabetic sensorimotor polyneuropathy remains a challenge. To assess the efficacy and safety of α-lipoic acid (ALA) over 20 weeks, we conducted a multicenter randomized withdrawal open-label study, in which 45 patients with type 2 diabetes and symptomatic polyneuropathy were initially treated with ALA (600 mg tid) for 4 weeks (phase 1). Subsequently, responders were randomized to receive ALA (600 mg qd; n = 16) or to ALA withdrawal (n = 17) for 16 weeks (phase 2). During phase 1, the Total Symptom Score (TSS) decreased from 8.9 ± 1.8 points to 3.46 ± 2.0 points. During phase 2, TSS improved from 3.7 ± 1.9 points to 2.5 ± 2.5 points in the ALA treated group (p < 0.05) and remained unchanged in the ALA withdrawal group. The use of analgesic rescue medication was higher in the ALA withdrawal group than ALA treated group (p < 0.05). In conclusion, in type 2 diabetic patients with symptomatic polyneuropathy who responded to initial 4-week high-dose (600 mg tid) administration of ALA, subsequent treatment with ALA (600 mg qd) over 16 weeks improved neuropathic symptoms, whereas ALA withdrawal was associated with a higher use of rescue analgesic drugs. This trial is registered with ClinicalTrials.gov Identifier: NCT02439879. PMID:26345602

  11. The effect of acetyl-L-Carnitine and Lipoic acid treatment in ApoE4 mouse as a model of human Alzheimer’s disease

    PubMed Central

    Shenk, Justin C.; Liu, Jiankang; Fischbach, Kathryn; Xu, Kui; Puchowicz, Michel; Obrenovich, Mark E.; Gasimov, Eldar; Alvarez, Ludis Morales; Ames, Bruce N.; LaManna, Joseph C.; Aliev, Gjumrakch

    2009-01-01

    We measured age-dependent effects of the human ApoE4 on cerebral blood flow (CBF) using ApoE4 transgenic mice compared to age-matched wild-type (WT) mice by use of [14C] iodoantipyrene autoradiography. ApoE4 associated factors reduce CBF gradually to create brain hypoperfusion when compared to WT and the differences in CBF are greatest as animals age from 6-weeks to 12-months. Transmission electron microscopy with colloidal gold immunocytochemistry showed structural damage in young and aged microvessel endothelium of ApoE4 animals extended to the cytoplasm of perivascular cells, perivascular nerve terminals and hippocampal neurons and glial cells. These abnormalities coexist with mitochondrial structural alteration and mitochondrial DNA overproliferation and/or deletion in all brain cellular compartments. Spatial memory and temporal memory tests showed a trend in improving cognitive function in ApoE4 mice fed selective mitochondrial antioxidants acetyl-L-Carnitine and R-Lipoic acid. Our findings indicate that ApoE4 genotype-induced mitochondrial changes and associated structural damage may explain age-dependent pathology seen in AD, indicating potential for novel treatment strategies in the near future. PMID:19342064

  12. The effect of acetyl-L-carnitine and R-alpha-lipoic acid treatment in ApoE4 mouse as a model of human Alzheimer's disease.

    PubMed

    Shenk, Justin C; Liu, Jiankang; Fischbach, Kathryn; Xu, Kui; Puchowicz, Michel; Obrenovich, Mark E; Gasimov, Eldar; Alvarez, Ludis Morales; Ames, Bruce N; Lamanna, Joseph C; Aliev, Gjumrakch

    2009-08-15

    We measured age-dependent effects of human ApoE4 on cerebral blood flow (CBF) using ApoE4 transgenic mice compared to age-matched wild-type (WT) mice by use of [(14)C] iodoantipyrene autoradiography. ApoE4 associated factors reduce CBF gradually to create brain hypoperfusion when compared to WT, and the differences in CBF are greatest as animals age from 6-weeks to 12-months. Transmission electron microscopy with colloidal gold immunocytochemistry showed structural damage in young and aged microvessel endothelium of ApoE4 animals extended to the cytoplasm of perivascular cells, perivascular nerve terminals and hippocampal neurons and glial cells. These abnormalities coexist with mitochondrial structural alteration and mitochondrial DNA overproliferation and/or deletion in all brain cellular compartments. Spatial memory and temporal memory tests showed a trend in improving cognitive function in ApoE4 mice fed selective mitochondrial antioxidants acetyl-l-carnitine and R-alpha-lipoic acid. Our findings indicate that ApoE4 genotype-induced mitochondrial changes and associated structural damage may explain age-dependent pathology seen in AD, indicating potential for novel treatment strategies in the near future. PMID:19342064

  13. Alpha-lipoic acid attenuates endoplasmic reticulum stress-induced insulin resistance by improving mitochondrial function in HepG2 cells.

    PubMed

    Lei, Lin; Zhu, Yiwei; Gao, Wenwen; Du, Xiliang; Zhang, Min; Peng, Zhicheng; Fu, Shoupeng; Li, Xiaobing; Zhe, Wang; Li, Xinwei; Liu, Guowen

    2016-10-01

    Alpha-lipoic acid (ALA) has been reported to have beneficial effects for improving insulin sensitivity. However, the underlying molecular mechanism of the beneficial effects remains poorly understood. Endoplasmic reticulum (ER) stress and mitochondrial dysfunction are considered causal factors that induce insulin resistance. In this study, we investigated the effect of ALA on the modulation of insulin resistance in ER-stressed HepG2 cells, and we explored the potential mechanism of this effect. HepG2 cells were incubated with tunicamycin (Tun) for 6h to establish an ER stress cell model. Tun treatment induced ER stress, mitochondrial dysfunction and insulin resistance. Interestingly, ALA had no significant effect on ER stress signals. Pretreatment of the ER stress cell model with ALA for 24h improved insulin sensitivity, restored the expression levels of mitochondrial oxidative phosphorylation (OXPHOS) complexes and increased intracellular ATP production. Moreover, ALA augmented the β-oxidation capacity of the mitochondria. Importantly, ALA treatment could decrease oligomycin-induced mitochondrial dysfunction and then improved insulin resistance. Taken together, our data suggest that ALA prevents ER stress-induced insulin resistance by enhancing mitochondrial function. PMID:27377964

  14. Comparative analysis of the effects combined physical procedures and alpha-lipoic acid on the electroneurographic parameters of patients with distal sensorimotor diabetic polyneuropathy

    PubMed Central

    Grbovic, Vesna; Jurisic-Skevin, Aleksandra; Djukic, Svetlana; Stefanović, Srdjan; Nurkovic, Jasmin

    2016-01-01

    [Purpose] Painful diabetic polyneuropathy occurs as a complication in 16% of all patients with diabetes mellitus. [Subjects and Methods] A clinical, prospective open-label randomized intervention study was conducted of 60 adult patients, with distal sensorimotor diabetic neuropathy two groups of 30 patients, with diabetes mellitus type 2 with distal sensorimotor diabetic neuropathy. Patients in group A were treated with combined physical procedures, and patients in group B were treated with alpha lipoic acid. [Results] There where a statistically significant improvements in terminal latency and the amplitude of the action potential in group A patients, while group B patients showed a statistically significant improvements in conduction velocity and terminal latency of n. peroneus. Group A patients showed a statistically significant improvements in conduction velocity and terminal latency, while group B patients also showed a statistically significant improvements in conduction velocity and terminal latency. This was reflected in a significant improvements in electrophysiological parameters (conduction velocity, amplitude and latency) of the motor and sensory nerves (n. peroneus, n. suralis). [Conclusion] These results present further evidence justifying of the use of physical agents in the treatment of diabetic sensorimotor polyneuropathy. PMID:27065527

  15. Glutaredoxin S15 Is Involved in Fe-S Cluster Transfer in Mitochondria Influencing Lipoic Acid-Dependent Enzymes, Plant Growth, and Arsenic Tolerance in Arabidopsis1[OPEN

    PubMed Central

    2016-01-01

    Glutaredoxins (Grxs) are small proteins that function as oxidoreductases with roles in deglutathionylation of proteins, reduction of antioxidants, and assembly of iron-sulfur (Fe-S) cluster-containing enzymes. Which of the 33 Grxs in Arabidopsis (Arabidopsis thaliana) perform roles in Fe-S assembly in mitochondria is unknown. We have examined in detail the function of the monothiol GrxS15 in plants. Our results show its exclusive mitochondrial localization, and we are concluding it is the major or only Grx in this subcellular location. Recombinant GrxS15 has a very low deglutathionylation and dehydroascorbate reductase activity, but it binds a Fe-S cluster. Partially removing GrxS15 from mitochondria slowed whole plant growth and respiration. Native GrxS15 is shown to be especially important for lipoic acid-dependent enzymes in mitochondria, highlighting a putative role in the transfer of Fe-S clusters in this process. The enhanced effect of the toxin arsenic on the growth of GrxS15 knockdown plants compared to wild type highlights the role of mitochondrial glutaredoxin Fe-S-binding in whole plant growth and toxin tolerance. PMID:26672074

  16. Alpha-lipoic acid supplementation reduces mTORC1 signaling in skeletal muscle from high fat fed, obese Zucker rats.

    PubMed

    Li, Zhuyun; Dungan, Cory M; Carrier, Bradley; Rideout, Todd C; Williamson, David L

    2014-12-01

    The mammalian target of rapamycin (mTOR) signaling pathway is hyperactive in liver, adipose and skeletal muscle tissues of obese rodents. Alpha-lipoic acid (αLA) has been well accepted as a weight-loss treatment, though there are limited studies on its effect on mTOR signaling in high-fat fed, obese rodents. Therefore, the goal of this study was to determine mTOR signaling and oxidative protein alterations in skeletal muscle of high-fat fed, obese rats after αLA supplementation. Phosphorylation of the mTOR substrate, eukaryotic initiation factor (eIF) 4E-binding protein 1 (4E-BP1) and eIF4B were significantly reduced (p < 0.05) in muscle from αLA supplemented rats. Activation of AMP-activated protein kinase (AMPK), an mTOR inhibitory kinase, was higher (p < 0.05) in the αLA group. Protein expression of markers of oxidative metabolism, acetyl CoA carboxylase (ACC), cytochrome c oxidase IV (COX IV), peroxisome proliferator-activated receptor (PPAR), and PPAR gamma coactivator 1-alpha (PGC-1α) were significantly higher (p < 0.05) after αLA supplementation compared to non-supplemented group. Our findings show that αLA supplementation limits the negative ramifications of consuming a high fat diet on skeletal muscle markers of oxidative metabolism and mTORC1 signaling. PMID:25366515

  17. α-Lipoic Acids Promote the Protein Synthesis of C2C12 Myotubes by the TLR2/PI3K Signaling Pathway.

    PubMed

    Jing, Yuanyuan; Cai, Xingcai; Xu, Yaqiong; Zhu, Canjun; Wang, Lina; Wang, Songbo; Zhu, Xiaotong; Gao, Ping; Zhang, Yongliang; Jiang, Qingyan; Shu, Gang

    2016-03-01

    Skeletal muscle protein turnover is regulated by endocrine hormones, nutrients, and inflammation. α-Lipoic acid (ALA) plays an important role in energy homeostasis. Therefore, the aim of this study was to investigate the effects of ALA on protein synthesis in skeletal muscles and reveal the underlying mechanism. ALA (25 μM) significantly increased the protein synthesis and phosphorylation of Akt, mTOR, and S6 in C2C12 myotubes with attenuated phosphorylation of AMPK, Ikkα/β, and eIF2α. Intraperitoneal injection of 50 mg/kg ALA also produced the same results in mouse gastrocnemius. Both the PI3K (LY294002) and mTOR (rapamycin) inhibitors abolished the effects of ALA on protein synthesis in the C2C12 myotubes. However, AICAR (AMPK agonist) failed to block the activation of mTOR and S6 by ALA. ALA increased TLR2 and MyD88 mRNA expression in the C2C12 myotubes. TLR2 knockdown by siRNA almost eliminated the effects of ALA on protein synthesis and the Akt/mTOR pathway in the C2C12 myotubes. Immunoprecipitation data showed that ALA enhanced the p85 subunit of PI3K binding to MyD88. These findings indicate that ALA induces protein synthesis and the PI3K/Akt signaling pathway by TLR2. PMID:26855124

  18. Glutaredoxin S15 Is Involved in Fe-S Cluster Transfer in Mitochondria Influencing Lipoic Acid-Dependent Enzymes, Plant Growth, and Arsenic Tolerance in Arabidopsis.

    PubMed

    Ströher, Elke; Grassl, Julia; Carrie, Chris; Fenske, Ricarda; Whelan, James; Millar, A Harvey

    2016-03-01

    Glutaredoxins (Grxs) are small proteins that function as oxidoreductases with roles in deglutathionylation of proteins, reduction of antioxidants, and assembly of iron-sulfur (Fe-S) cluster-containing enzymes. Which of the 33 Grxs in Arabidopsis (Arabidopsis thaliana) perform roles in Fe-S assembly in mitochondria is unknown. We have examined in detail the function of the monothiol GrxS15 in plants. Our results show its exclusive mitochondrial localization, and we are concluding it is the major or only Grx in this subcellular location. Recombinant GrxS15 has a very low deglutathionylation and dehydroascorbate reductase activity, but it binds a Fe-S cluster. Partially removing GrxS15 from mitochondria slowed whole plant growth and respiration. Native GrxS15 is shown to be especially important for lipoic acid-dependent enzymes in mitochondria, highlighting a putative role in the transfer of Fe-S clusters in this process. The enhanced effect of the toxin arsenic on the growth of GrxS15 knockdown plants compared to wild type highlights the role of mitochondrial glutaredoxin Fe-S-binding in whole plant growth and toxin tolerance. PMID:26672074

  19. Effects of Lipoic Acid on Immune Function, the Antioxidant Defense System, and Inflammation-Related Genes Expression of Broiler Chickens Fed Aflatoxin Contaminated Diets

    PubMed Central

    Li, Yan; Ma, Qiu-Gang; Zhao, Li-Hong; Wei, Hua; Duan, Guo-Xiang; Zhang, Jian-Yun; Ji, Cheng

    2014-01-01

    This study was designed to evaluate the effect of low level of Aflatoxin B1 (AFB1) on oxidative stress, immune reaction and inflammation response and the possible ameliorating effects of dietary alpha-lipoic acid (α-LA) in broilers. Birds were randomly allocated into three groups and assigned to receive different diets: basal diet, diet containing 74 μg/kg AFB1, and 300 mg/kg α-LA supplementation in diet containing 74 μg/kg AFB1 for three weeks. The results showed that the serum levels of malondialdehyde, tumor necrosis factor alpha (TNFα) and interferon gamma (IFNγ) in the AFB1-treated group were significantly increased than the control group. In addition, the increased expressions of interleukin 6 (IL6), TNFα and IFNγ were observed in birds exposed to the AFB1-contaminated diet. These degenerative changes were inhibited by α-LA-supplement. The activities of total superoxide dismutase and glutathione peroxidase, the levels of humoral immunity, and the expressions of nuclear factor-κB p65 and heme oxygenase-1, however, were not affected by AFB1. The results suggest that α-LA alleviates AFB1 induced oxidative stress and immune changes and modulates the inflammatory response at least partly through changes in the expression of proinflammatory cytokines of spleen such as IL6 and TNFα in broiler chickens. PMID:24699046

  20. Reversal of corticosterone-induced BDNF alterations by the natural antioxidant alpha-lipoic acid alone and combined with desvenlafaxine: Emphasis on the neurotrophic hypothesis of depression.

    PubMed

    de Sousa, Caren Nádia Soares; Meneses, Lucas Nascimento; Vasconcelos, Germana Silva; Silva, Márcia Calheiros Chaves; da Silva, Jéssica Calheiros; Macêdo, Danielle; de Lucena, David Freitas; Vasconcelos, Silvânia Maria Mendes

    2015-12-15

    Brain derived neurotrophic factor (BDNF) is linked to the pathophysiology of depression. We hypothesized that BDNF is one of the neurobiological pathways related to the augmentation effect of alpha-lipoic acid (ALA) when associated with antidepressants. Female mice were administered vehicle or CORT 20mg/kg during 14 days. From the 15th to 21st days the animals were divided in groups that were further administered: vehicle, desvenlafaxine (DVS) 10 or 20mg/kg, ALA 100 or 200mg/kg or the combinations of DVS10+ALA100, DVS20+ALA100, DVS10+ALA200 or DVS20+ALA200. ALA or DVS alone or in combination reversed CORT-induced increase in immobility time in the forced swimming test and decrease in sucrose preference, presenting, thus, an antidepressant-like effect. DVS10 alone reversed CORT-induced decrease in BDNF in the prefrontal cortex (PFC), hippocampus (HC) and striatum (ST). The same was observed in the HC and ST of ALA200 treated animals. The combination of DVS and ALA200 reversed CORT-induced alterations in BDNF and even, in some cases, increased the levels of this neurotrophin when compared to vehicle-treated animals in HC and ST. Taken together, these results suggest that the combination of the DVS+ALA may be valuable for treating conditions in which BDNF levels are decreased, such as depression. PMID:26350703

  1. Synergistic ameliorative effects of sesame oil and alpha-lipoic acid against subacute diazinon toxicity in rats: hematological, biochemical, and antioxidant studies.

    PubMed

    Abdel-Daim, Mohamed M; Taha, Ramadan; Ghazy, Emad W; El-Sayed, Yasser S

    2016-01-01

    Diazinon (DZN) is a common organophosphorus insecticide extensively used for agriculture and veterinary purposes. DZN toxicity is not limited to insects; it also induces harmful effects in mammals and birds. Our experiment evaluated the protective and antioxidant potential of sesame oil (SO) and (or) alpha-lipoic acid (ALA) against DZN toxicity in male Wistar albino rats. DZN-treated animals exhibited macrocytic hypochromic anemia and significant increases in serum biochemical parameters related to liver injury, including aspartate aminotransferase (AST), alanine aminotransferase (ALT), alkaline phosphatase (ALP), γ-glutamyl transferase (γGT), cholesterol, and triglycerides. They also had elevated levels of markers related to cardiac injury, such as lactate dehydrogenase (LDH) and creatine phosphokinase (CPK), and increased biomarkers of renal injury, urea and creatinine. DZN also increased hepatic, renal, and cardiac lipid peroxidation and decreased antioxidant biomarker levels. SO and (or) ALA supplementation ameliorated the deleterious effects of DZN intoxication. Treatment improved hematology and serum parameters, enhanced endogenous antioxidant status, and reduced lipid peroxidation. Importantly, they exerted synergistic hepatoprotective, nephroprotective, and cardioprotective effects. Our findings demonstrate that SO and (or) ALA supplementation can alleviate the toxic effects of DZN via their potent antioxidant and free radical-scavenging activities. PMID:26550680

  2. Treatment with α-Lipoic Acid over 16 Weeks in Type 2 Diabetic Patients with Symptomatic Polyneuropathy Who Responded to Initial 4-Week High-Dose Loading.

    PubMed

    Garcia-Alcala, Hector; Santos Vichido, Celia Isabel; Islas Macedo, Silverio; Genestier-Tamborero, Christelle Nathalie; Minutti-Palacios, Marissa; Hirales Tamez, Omara; García, Carlos; Ziegler, Dan

    2015-01-01

    Effective treatment of diabetic sensorimotor polyneuropathy remains a challenge. To assess the efficacy and safety of α-lipoic acid (ALA) over 20 weeks, we conducted a multicenter randomized withdrawal open-label study, in which 45 patients with type 2 diabetes and symptomatic polyneuropathy were initially treated with ALA (600 mg tid) for 4 weeks (phase 1). Subsequently, responders were randomized to receive ALA (600 mg qd; n = 16) or to ALA withdrawal (n = 17) for 16 weeks (phase 2). During phase 1, the Total Symptom Score (TSS) decreased from 8.9 ± 1.8 points to 3.46 ± 2.0 points. During phase 2, TSS improved from 3.7 ± 1.9 points to 2.5 ± 2.5 points in the ALA treated group (p < 0.05) and remained unchanged in the ALA withdrawal group. The use of analgesic rescue medication was higher in the ALA withdrawal group than ALA treated group (p < 0.05). In conclusion, in type 2 diabetic patients with symptomatic polyneuropathy who responded to initial 4-week high-dose (600 mg tid) administration of ALA, subsequent treatment with ALA (600 mg qd) over 16 weeks improved neuropathic symptoms, whereas ALA withdrawal was associated with a higher use of rescue analgesic drugs. This trial is registered with ClinicalTrials.gov Identifier: NCT02439879. PMID:26345602

  3. Comparative analysis of the effects combined physical procedures and alpha-lipoic acid on the electroneurographic parameters of patients with distal sensorimotor diabetic polyneuropathy.

    PubMed

    Grbovic, Vesna; Jurisic-Skevin, Aleksandra; Djukic, Svetlana; Stefanović, Srdjan; Nurkovic, Jasmin

    2016-01-01

    [Purpose] Painful diabetic polyneuropathy occurs as a complication in 16% of all patients with diabetes mellitus. [Subjects and Methods] A clinical, prospective open-label randomized intervention study was conducted of 60 adult patients, with distal sensorimotor diabetic neuropathy two groups of 30 patients, with diabetes mellitus type 2 with distal sensorimotor diabetic neuropathy. Patients in group A were treated with combined physical procedures, and patients in group B were treated with alpha lipoic acid. [Results] There where a statistically significant improvements in terminal latency and the amplitude of the action potential in group A patients, while group B patients showed a statistically significant improvements in conduction velocity and terminal latency of n. peroneus. Group A patients showed a statistically significant improvements in conduction velocity and terminal latency, while group B patients also showed a statistically significant improvements in conduction velocity and terminal latency. This was reflected in a significant improvements in electrophysiological parameters (conduction velocity, amplitude and latency) of the motor and sensory nerves (n. peroneus, n. suralis). [Conclusion] These results present further evidence justifying of the use of physical agents in the treatment of diabetic sensorimotor polyneuropathy. PMID:27065527

  4. Restoration of Dioxin-Induced Damage to Fetal Steroidogenesis and Gonadotropin Formation by Maternal Co-Treatment with α-Lipoic Acid

    PubMed Central

    Koga, Takayuki; Ishida, Takumi; Takeda, Tomoki; Ishii, Yuji; Uchi, Hiroshi; Tsukimori, Kiyomi; Yamamoto, Midori; Himeno, Masaru; Furue, Masutaka; Yamada, Hideyuki

    2012-01-01

    2,3,7,8-Tetrachlorodibenzo-p-dioxin (TCDD), an endocrine disruptor, causes reproductive and developmental toxic effects in pups following maternal exposure in a number of animal models. Our previous studies have demonstrated that TCDD imprints sexual immaturity by suppressing the expression of fetal pituitary gonadotropins, the regulators of gonadal steroidogenesis. In the present study, we discovered that all TCDD-produced damage to fetal production of pituitary gonadotropins as well as testicular steroidogenesis can be repaired by co-treating pregnant rats with α-lipoic acid (LA), an obligate co-factor for intermediary metabolism including energy production. While LA also acts as an anti-oxidant, other anti-oxidants; i.e., ascorbic acid, butylated hydroxyanisole and edaravone, failed to exhibit any beneficial effects. Neither wasting syndrome nor CYP1A1 induction in the fetal brain caused through the activation of aryl hydrocarbon receptor (AhR) could be attenuated by LA. These lines of evidence suggest that oxidative stress makes only a minor contribution to the TCDD-induced disorder of fetal steroidogenesis, and LA has a restorative effect by targeting on mechanism(s) other than AhR activation. Following a metabolomic analysis, it was found that TCDD caused a more marked change in the hypothalamus, a pituitary regulator, than in the pituitary itself. Although the components of the tricarboxylic acid cycle and the ATP content of the fetal hypothalamus were significantly changed by TCDD, all these changes were again rectified by exogenous LA. We also provided evidence that the fetal hypothalamic content of endogenous LA is significantly reduced following maternal exposure to TCDD. Thus, the data obtained strongly suggest that TCDD reduces the expression of fetal pituitary gonadotropins to imprint sexual immaturity or disturb development by suppressing the level of LA, one of the key players serving energy production. PMID:22911699

  5. Alpha-Lipoic Acid Reduces LDL-Particle Number and PCSK9 Concentrations in High-Fat Fed Obese Zucker Rats

    PubMed Central

    Carrier, Bradley; Wen, Shin; Zigouras, Sophia; Browne, Richard W.; Li, Zhuyun; Patel, Mulchand S.; Williamson, David L.; Rideout, Todd C.

    2014-01-01

    We characterized the hypolipidemic effects of alpha-lipoic acid (LA, R-form) and examined the associated molecular mechanisms in a high fat fed Zucker rat model. Rats (n = 8) were assigned to a high fat (HF) diet or the HF diet with 0.25% LA (HF-LA) for 30 days and pair fed to remove confounding effects associated with the anorectic properties of LA. Compared with the HF controls, the HF-LA group was protected against diet-induced obesity (102.5±3.1 vs. 121.5±3.6,% change BW) and hypercholesterolemia with a reduction in total-C (−21%), non-HDL-C (−25%), LDL-C (−16%), and total LDL particle number (−46%) and an increase in total HDL particles (∼22%). This cholesterol-lowering response was associated with a reduction in plasma PCSK9 concentration (−70%) and an increase in hepatic LDLr receptor protein abundance (2 fold of HF). Compared with the HF-fed animals, livers of LA-supplemented animals were protected against TG accumulation (−46%), likely through multiple mechanisms including: a suppressed lipogenic response (down-regulation of hepatic acetyl-CoA carboxylase and fatty acid synthase expression); enhanced hepatic fat oxidation (increased carnitine palmitoyltransferase Iα expression); and enhanced VLDL export (increased hepatic diacylglycerol acyltransferase and microsomal triglyceride transfer protein expression and elevated plasma VLDL particle number). Study results also support an enhanced fatty acid uptake (2.8 fold increase in total lipase activity) and oxidation (increased CPT1β protein abundance) in muscle tissue in LA-supplemented animals compared with the HF group. In summary, in the absence of a change in caloric intake, LA was effective in protecting against hypercholesterolemia and hepatic fat accumulation under conditions of strong genetic and dietary predisposition toward obesity and dyslipidemia. PMID:24595397

  6. Polypeptides having cellulolytic enhancing activity and nucleic acids encoding same

    DOEpatents

    Brown, Kimberly; Harris, Paul; Zaretsky, Elizabeth; Re, Edward; Vlasenko, Elena; McFarland, Keith; Lopez de Leon, Alfredo

    2016-08-09

    The present invention relates to isolated polypeptides having cellulolytic enhancing activity and isolated polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods for producing and using the polypeptides.

  7. Nucleic acid encoding TGF-. beta. and its uses

    SciTech Connect

    Derynck, R.M.A.; Goeddel, D.V.

    1989-12-12

    This patent describes a method. It comprises: constructing a vector which includes nucleic acid encoding biologically active TGF-{beta}, transforming a host eukaryotic cell with the vector, culturing the transformed cell and recovering mature TGF-{beta} from the culture medium.

  8. Polypeptides having cellulolytic enhancing activity and nucleic acids encoding same

    SciTech Connect

    Brown, Kimberly; Harris, Paul; Zaretsky, Elizabeth; Re, Edward; Vlasenko, Elena; McFarland, Keith; Lopez de Leon, Alfredo

    2014-09-30

    The present invention relates to isolated polypeptides having cellulolytic enhancing activity and isolated polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods for producing and using the polypeptides.

  9. Polypeptides having cellulolytic enhancing activity and nucleic acids encoding same

    SciTech Connect

    Brown, Kimberly; Harris, Paul; Zaretsky, Elizabeth; Re, Edward; Vlasenko, Elena; McFarland, Keith; Lopez de Leon, Alfredo

    2012-10-16

    The present invention relates to isolated polypeptides having cellulolytic enhancing activity and isolated polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods for producing and using the polypeptides.

  10. Method for Enzyme Design with Genetically Encoded Unnatural Amino Acids.

    PubMed

    Hu, C; Wang, J

    2016-01-01

    We describe the methodologies for the design of artificial enzymes with genetically encoded unnatural amino acids. Genetically encoded unnatural amino acids offer great promise for constructing artificial enzymes with novel activities. In our studies, the designs of artificial enzyme were divided into two steps. First, we considered the unnatural amino acids and the protein scaffold separately. The scaffold is designed by traditional protein design methods. The unnatural amino acids are inspired by natural structure and organic chemistry methods, and synthesized by either organic chemistry methods or enzymatic conversion. With the increasing number of published unnatural amino acids with various functions, we described an unnatural amino acids toolkit containing metal chelators, redox mediators, and click chemistry reagents. These efforts enable a researcher to search the toolkit for appropriate unnatural amino acids for the study, rather than design and synthesize the unnatural amino acids from the beginning. After the first step, the model enzyme was optimized by computational methods and directed evolution. Lastly, we describe a general method for evolving aminoacyl-tRNA synthetase and expressing unnatural amino acids incorporated into a protein. PMID:27586330

  11. Antioxidant properties of alpha-lipoic acid: effects on red blood membrane permeability and adaptation of isolated rat heart to reversible ischemia.

    PubMed

    Ghibu, S; Lauzier, B; Delemasure, S; Amoureux, S; Sicard, P; Vergely, C; Muresan, A; Mogosan, C; Rochette, L

    2009-01-01

    The aim of our work was to study (1) the antioxidant properties of lipoic acid (LA) and its reduced metabolite dihydrolipoic acid (DHLA) formed by reduction of LA and (2) the effects of treatment with LA and DHLA on (a) K(+) efflux from human red blood cells and (b) post-ischemic recovery and oxidative stress in isolated perfused rat hearts challenged with an ischemia-reperfusion (IR) sequence. In vitro, we used xanthine and xanthine oxidase to generate superoxide anion, which is not directly measurable by electron paramagnetic resonance (EPR), but specifically oxidizes the spin probe CPH into an EPR-detectable long lasting CP(*) nitroxide radical. While 5 mM of LA was ineffective in reducing the kinetics of CP(*) nitroxide formation, DHLA was shown to lessen this rate in a dose-dependent manner and at 30 mM was even more efficient than 300 UI/ml SOD. These results are in agreement with the fact that DHLA is able to directly scavenge superoxide anion. Red cells are a good model to investigate oxidative damage in biological membranes; hence, we used a suspension of erythrocytes incubated with 2,2(')-azobis(2-amidinopropane) hydrochloride (AAPH) which generates in vitro free radicals. DHLA provided more effective protection of red cells membranes than LA; DHLA was comparable to Trolox for its antioxidant potency. In vivo, treatment of rats (50 mg/kg/day i.p. for 7 days) with LA induced a slight increase in coronary flow (CF) in isolated perfused hearts, after 30 min of global total ischemia. This effect was not associated with an improvement in contractile function and reduction of myocardial oxidative stress. In conclusion, because of their ability to scavenge free radicals, LA and to an even greater degree DHLA were able to protect the membranes of red blood cells. This finding suggests that LA and DHLA might be useful in the treatment of diseases associated with oxidative stress such as diabetes. PMID:18839280

  12. Sulforaphane and alpha-lipoic acid upregulate the expression of the pi class of glutathione S-transferase through c-jun and Nrf2 activation.

    PubMed

    Lii, Chong-Kuei; Liu, Kai-Li; Cheng, Yi-Ping; Lin, Ai-Hsuan; Chen, Haw-Wen; Tsai, Chia-Wen

    2010-05-01

    The anticarcinogenic effect of dietary organosulfur compounds has been partly attributed to their modulation of the activity and expression of phase II detoxification enzymes. Our previous studies indicated that garlic allyl sulfides upregulate the expression of the pi class of glutathione S-transferase (GSTP) through the activator protein-1 pathway. Here, we examined the modulatory effect of sulforaphane (SFN) and alpha-lipoic acid (LA) or dihydrolipoic acid (DHLA) on GSTP expression in rat Clone 9 liver cells. Cells were treated with LA or DHLA (50-600 micromol/L) or SFN (0.2-5 micromol/L) for 24 h. Immunoblots and real-time PCR showed that SFN, LA, and DHLA dose dependently induced GSTP protein and mRNA expression. Compared with the induction by the garlic organosulfur compound diallyl trisulfide (DATS), the effectiveness was in the order of SFN > DATS > LA = DHLA. The increase in GSTP enzyme activity in cells treated with 5 micromol/L SFN, 50 micromol/L DATS, and 600 micromol/L LA and DHLA was 172, 75, 122, and 117%, respectively (P < 0.05). A reporter assay showed that the GSTP enhancer I (GPEI) was required for GSTP induction by the organosulfur compounds. Electromobility gel shift assays showed that the DNA binding of GPEI to nuclear proteins reached a maximum at 0.5-1 h after SFN, LA, and DHLA treatment. Super-shift assay revealed that the transcription factors c-jun and nuclear factor erythroid-2 related factor 2 (Nrf2) were bound to GPEI. These results suggest that SFN and LA in either its oxidized or reduced form upregulate the transcription of the GSTP gene by activating c-jun and Nrf2 binding to the enhancer element GPEI. PMID:20237067

  13. The effects of alpha-lipoic acid on nitric oxide synthetase dispersion in penile function in streptozotocin-induced diabetic rats.

    PubMed

    Hurdag, C; Ozkara, H; Citci, S; Uyaner, I; Demirci, C

    2005-01-01

    Diabetes-induced erectile dysfunction is one of the most prevalent complications of diabetes in males. alpha-Lipoic acid (ALA) and its reduced form, dihydrolipoic acid, are powerful antioxidants. Data strongly suggest that, because of its antioxidant properties, ALA is particularly suited to the prevention and/or treatment of diabetic complications that arise from overproduction of reactive oxygen and nitrogen. The aim of this study was to investigate the localization of nitric oxide synthetase (NOS) in normal and diabetic rat cavernous smooth muscles and to examine the effects of ALA on them. Rats were divided into four groups: control, diabetic, diabetic plus ALA, and ALA only. Penile tissues were taken 15 days after drug application and examined histochemically and immunohistochemically. Comparison of the control and diabetic groups revealed that the axons of nerve cells were not identified with Masson trichrome in the diabetic group, whereas in the control group NOS localization and immunostaining (endothelial NOS [eNOS]) were normal. Diabetic rats administered ALA showed improvement in Masson trichrome, nicotinamide adenine dinucleotide phosphate diaphorase (NADPH-d) and eNOS localization compared with untreated diabetic rats. Although there was no difference between the control group and the group administered ALA only, we observed an increase in NADPH-d and eNOS. In erection, eNOS and neuronal NOS (nNOS) may have a significant role. In pathologic conditions, erectile dysfunction may occur as a result of an increase in inducible macrophage-type NOS (iNOS). ALA plays an important role in treatment of erectile dysfunction by decreasing iNOS and increasing other isoforms of NOS. PMID:16372481

  14. Lipoic acid inhibits the DNA repair protein O 6-methylguanine-DNA methyltransferase (MGMT) and triggers its depletion in colorectal cancer cells with concomitant autophagy induction.

    PubMed

    Göder, Anja; Nagel, Georg; Kraus, Alexander; Dörsam, Bastian; Seiwert, Nina; Kaina, Bernd; Fahrer, Jörg

    2015-08-01

    Alkylating agents are present in food and tobacco smoke, but are also used in cancer chemotherapy, inducing the DNA lesion O (6)-methylguanine. This critical adduct is repaired by O (6)-methylguanine-DNA methyltransferase (MGMT), resulting in MGMT inactivation and degradation. In the present study, we analyzed the effects of the natural disulfide compound lipoic acid (LA) on MGMT in vitro and in colorectal cancer cells. We show that LA, but not its reduced form dihydrolipoic acid, potently inhibits the activity of recombinant MGMT by interfering with its catalytic Cys-145 residue, which was partially reversible by N-acetyl cysteine. Incubation of HCT116 colorectal cancer cells with LA altered their glutathione pool and caused a decline in MGMT activity. This was mirrored by LA-induced depletion of MGMT protein, which was not attributable to changes in MGMT messenger RNA levels. Loss of MGMT protein coincided with LA-induced autophagy, a process resulting in lysosomal degradation of proteins, including presumably MGMT. LA-stimulated autophagy in a p53-independent manner as revealed by the response of isogenic HCT116 cell lines. Knockdown of the crucial autophagy component beclin-1 and chemical inhibitors blocked LA-induced autophagy, but did not abrogate LA-triggered MGMT degradation. Concomitant with MGMT depletion, LA pretreatment resulted in enhanced O (6)-methylguanine levels in DNA. It also increased the cytotoxicity of the alkylating anticancer drug temozolomide in temozolomide-resistant colorectal cancer cells. Taken together, our study showed that the natural compound LA inhibits MGMT and induces autophagy. Furthermore, LA enhanced the cytotoxic effects of temozolomide, which makes it a candidate for a supplement in cancer therapy. PMID:25998848

  15. Alpha-lipoic acid and N-acetylcysteine protects intensive swimming exercise-mediated germ-cell depletion, pro-oxidant generation, and alteration of steroidogenesis in rat testis.

    PubMed

    Jana, Kuladip; Dutta, Ananya; Chakraborty, Pratip; Manna, Indranil; Firdaus, Syed Benazir; Bandyopadhyay, Debasish; Chattopadhyay, Ratna; Chakravarty, Baidyanath

    2014-09-01

    Prolonged and strenuous exercise has been proposed as a possible source of male-factor infertility. Forced intensive swimming has also been identified as one source of a dysfunctional male reproduction system. The present study evaluated the possible protective role of α-lipoic acid and N-acetylcysteine (NAC) on intensive swimming-induced germ-cell depletion in adult male rats. Forced exhaustive swimming of 1 hr/day, 6 days/week for 8 consecutive weeks resulted in a significant (P < 0.05) reduction in epididymal sperm; testicular androgenic enzyme activities; and plasma and intra-testicular testosterone; and produced different types of germ cells in the seminiferous epithelium cycle. Conversely, plasma corticosterone levels and sperm-head abnormalities increased. Western-blot analysis showed a considerable decrease in testicular StAR protein expression whereas reverse-transcriptase PCR analysis showed no significant change in cytochrome P450scc (Cyp11a1) gene expression. Significant (P < 0.05) elevation in testicular reactive oxygen species (ROS), lipid peroxidation, protein carbonyl content versus reduction in glucose-6-phosphate dehydrogenase, glutathione peroxidase, glutathione S-transferase, and caspase-3 activities along with a depletion in the glutathione pool, mitochondrial membrane potential (▵ψm ), and intracellular ATP generation. A considerable level of DNA damage in testicular spermatogenic cells were also noted following forced extensive swimming. Alpha-lipoic acid and NAC supplementation prevented the swimming-induced testicular spermatogenic and steroidogenic disorders by lowering ROS generation. We therefore conclude that intensive forced swimming causes germ-cell depletion through the generation of ROS and depletion of steroidogenesis in the testis, which can be protected by the co-administration of α-lipoic acid and NAC. PMID:25104294

  16. Consequences of the Combined α-tocopherol, Ascorbic Acid and α-lipoic Acid on the Glutathione, Cholesterol and Fatty Acid Composition in Muscle and Liver of Diabetic Rats

    PubMed Central

    YILMAZ, Okkes; ERSAN, Yasemin; Dilek OZSAHIN, Ayse; Ihsan OZTURK, Ali; OZKAN, Yusuf

    2013-01-01

    Objective(s): Our objective was to evaluate the effects of a triple antioxidant combination [α-tocopherol (AT), ascorbic acid (AA) and α-lipoic acid (LA); AT+AA+LA] on the cholesterol and glutathione levels, and the fatty acid composition of liver and muscle tissues in diabetic rats. Materials and Methods: Forty-three Wistar rats were randomly divided into five groups. The first group was used as a control. The second, third and fourth groups received STZ (45 mg/kg) in citrate buffer. The fourth and fifth groups were injected with intraperitoneal (IP) 50 mg/kg DL-AT and 50 mg /kg DL-LA four times per week and received water-soluble vitamin C (50 mg/kg) in their drinking water for a period of six weeks. Results: Liver cholesterol levels in the AT+AA+LA group were lower than the control (P<0.05). Glutathione level was lower in D-2 (P<0.05) and were higher in D+AT+AA+LA and AT+AA+LA groups than the control groups (P≤ 0.05). The muscle cholesterol levels in the D-1 and D+AT+AA+LA groups were higher than the control group (P≤ 0.05). The levels of oleic acid were higher in the D-1 group and lower in the D-2 group (P<0.001). The arachidonic acid level in the D-1 and D-2 groups were lower (P<0.05), and higher in the D+AT+AA+LA group. Conclusion: Our results revealed that glutathione levels and the Stearoyl CoA Desaturase enzyme products in liver tissues of diabetic and non-diabetic rats were increased by triple antioxidant mixture. PMID:24298385

  17. Lipoic acid improves neuronal insulin signalling and rescues cognitive function regulating VGlut1 expression in high-fat-fed rats: Implications for Alzheimer's disease.

    PubMed

    Rodriguez-Perdigon, Manuel; Solas, Maite; Moreno-Aliaga, Maria Jesús; Ramirez, Maria Javier

    2016-04-01

    The concept of central insulin resistance and dysfunctional insulin signalling in sporadic Alzheimer's disease (AD) is now widely accepted and diabetes is recognized as one of the main risk factors for developing AD. Moreover, some lines of evidence indicated that VGlut1 is impaired in frontal regions of AD patients and this impairment is correlated with the progression of cognitive decline in AD. The present work hypothesizes that ketosis associated to insulin resistance could interfere with the normal activity of VGlut1 and its role in the release of glutamate in the hippocampus, which might ultimately lead to cognitive deficits. High fat diet (HFD) rats showed memory impairments and both peripheral (as shown by increased fasting plasma insulin levels and HOMA index) and hippocampal (as shown by decreased activation of insulin receptor, IRS-1 and pAkt) insulin pathway alterations, accompanied by increased ketone bodies production. All these effects were counteracted by α-lipoic acid (LA) administration. VGlut1 levels were significantly decreased in the hippocampus of HFD rats, and this decrease was reversed by LA. Altogether, the present results suggest that HFD induced alterations in central insulin signalling could switch metabolism to produce ketone bodies, which in turn, in the hippocampus, might lead to a decreased expression of VGlut1, and therefore to a decreased release of glutamate and hence, to the glutamatergic deficit described in AD. The ability of LA treatment to prevent the alterations in insulin signalling in this model of HFD might represent a possible new therapeutic target for the treatment of AD. PMID:26769360

  18. Acetyl-L-carnitine and lipoic acid improve mitochondrial abnormalities and serum levels of liver enzymes in a mouse model of nonalcoholic fatty liver disease.

    PubMed

    Kathirvel, Elango; Morgan, Kengathevy; French, Samuel W; Morgan, Timothy R

    2013-11-01

    Mitochondrial abnormalities are suggested to be associated with the development of nonalcoholic fatty liver. Liver mitochondrial content and function have been shown to improve in oral feeding of acetyl-L-carnitine (ALC) to rodents. Carnitine is involved in the transport of acyl-coenzyme A across the mitochondrial membrane to be used in mitochondrial β-oxidation. We hypothesized that oral administration ALC with the antioxidant lipoic acid (ALC + LA) would benefit nonalcoholic fatty liver. To test our hypothesis, we fed Balb/C mice a standard diet (SF) or SF with ALC + LA or high-fat diet (HF) or HF with ALC + LA for 6 months. Acetyl-L-carnitine and LA were dissolved at 0.2:0.1% (wt/vol) in drinking water, and mice were allowed free access to food and water. Along with physical parameters, insulin resistance (blood glucose, insulin, glucose tolerance), liver function (alanine transaminase [ALT], aspartate transaminase [AST]), liver histology (hematoxylin and eosin), oxidative stress (malondialdehyde), and mitochondrial abnormalities (carbamoyl phosphate synthase 1 and electron microscopy) were done. Compared with SF, HF had higher body, liver, liver-to-body weight ratio, white adipose tissue, ALT, AST, liver fat, oxidative stress, and insulin resistance. Coadministration of ALC + LA to HF animals significantly improved the mitochondrial marker carbamoyl phosphate synthase 1 and the size of the mitochondria in liver. Alanine transaminase and AST levels were decreased. In a nonalcoholic fatty liver mice model, ALC + LA combination improved liver mitochondrial content, size, serum ALT, and AST without significant changes in oxidative stress, insulin resistance, and liver fat accumulation. PMID:24176233

  19. α-Lipoic acid up-regulates expression of peroxisome proliferator-activated receptor β in skeletal muscle: involvement of the JNK signaling pathway.

    PubMed

    Rousseau, Anne-Sophie; Sibille, Brigitte; Murdaca, Joseph; Mothe-Satney, Isabelle; Grimaldi, Paul A; Neels, Jaap G

    2016-03-01

    We hypothesized that α-lipoic acid (α-LA) might interact with the transcriptional control of peroxisome proliferator-activated receptor (PPAR)β in skeletal muscle. Molecular mechanisms were investigated using differentiated C2C12 myotubes treated with α-LA and/or PPARβ agonist GW0742. In vivo studies with 3-mo-old C57Bl6 mice were realized: voluntary wheel running (VWR) training (7 wk), and a 6 wk diet containing (or not) α-LA (0.25% wt/wt). This last condition was combined with (or not) 1 bout of treadmill exercise (18 m/min for 1 h). Using a reporter assay, we demonstrate that α-LA is not an agonist of PPARβ but regulates PPARβ target gene expression through an active PPARβ pathway. GW0742-induced pyruvate dehydrogenase kinase 4 mRNA is potentiated by α-LA. In C2C12, α-LA lowers the activation of the JNK signaling pathway and increases PPARβ mRNA and protein levels (2-fold) to the same extent as with the JNK inhibitor SP600125. Similarly to VWR training effect, PPARβ expression increases (2-fold) in vastus lateralis of animals fed an α-LA-enriched diet. However, α-LA treatment does not further stimulate the adaptive up-regulation of PPARβ observed in response to 1 bout of exercise. We have identified a novel mechanism of regulation of PPARβ expression/action in skeletal muscle with potential physiologic application through the action of α-LA, involving the JNK pathway. PMID:26655383

  20. Inhibitory Effects of α-Lipoic Acid on Oxidative Stress-Induced Adipogenesis in Orbital Fibroblasts From Patients With Graves Ophthalmopathy

    PubMed Central

    Hwang, Sena; Byun, Jung Woo; Yoon, Jin Sook; Lee, Eun Jig

    2016-01-01

    Abstract A choice of the optimal treatment for Graves ophthalmopathy (GO) is a challenge due to the complexity of the pathogenesis. Alpha-lipoic acid (ALA) is well known as a multifunctional antioxidant, helping to protect cells against oxidative stress and inflammatory damage. The aim of this study was to investigate the effects of ALA on intracellular production of reactive oxygen species (ROS), inflammation, and adipogenesis using primary cultured orbital fibroblasts from patients with GO. Intracellular ROS levels and mRNA expressions of proinflammatory cytokines and chemokines including intercellular adhesion molecule-1 (ICAM-1), interleukin (IL)-6, monocyte chemoattractant protein (MCP)-1, and regulated upon activation normal T cell expressed and presumably secreted (RANTES) were measured. After adipogenesis, the expressions of peroxisome proliferator-activated receptor (PPAR)γ, CCAAT-enhancer-binding proteins (C/EBP)α and β, and heme oxygenase-1 (HO-1) were investigated. H2O2 dose-dependently stimulated ROS production and HO-1 expression. Addition of ALA strongly attenuated ROS production and further increased HO-1 expression. However, by pretreatment of zinc protoporphyrin (ZnPP), HO-1 inhibitor, ALA inhibition of ROS generation by H2O2 was abolished. Tumor necrosis factor (TNF)α-induced mRNA expressions of ICAM-1, IL-6, MCP-1, and RANTES were inhibited by ALA treatment. In this context, TNFα-induced phosphorylation of P65 was also inhibited. In addition, ALA dose-dependently inhibited H2O2-induced intracellular accumulation of lipid droplets. The expression of adipogenic transcription factors, including PPARγ, C/EBPα, and β, was also inhibited. ALA is a potential therapeutic agent for GO because of the inhibitory effects on ROS production and gene expression of proinflammatory cytokines and chemokines, resulting in prevention of adipose-tissue expansion. PMID:26765462

  1. Inhibitory Effects of α-Lipoic Acid on Oxidative Stress-Induced Adipogenesis in Orbital Fibroblasts From Patients With Graves Ophthalmopathy.

    PubMed

    Hwang, Sena; Byun, Jung Woo; Yoon, Jin Sook; Lee, Eun Jig

    2016-01-01

    A choice of the optimal treatment for Graves ophthalmopathy (GO) is a challenge due to the complexity of the pathogenesis. Alpha-lipoic acid (ALA) is well known as a multifunctional antioxidant, helping to protect cells against oxidative stress and inflammatory damage.The aim of this study was to investigate the effects of ALA on intracellular production of reactive oxygen species (ROS), inflammation, and adipogenesis using primary cultured orbital fibroblasts from patients with GO.Intracellular ROS levels and mRNA expressions of proinflammatory cytokines and chemokines including intercellular adhesion molecule-1 (ICAM-1), interleukin (IL)-6, monocyte chemoattractant protein (MCP)-1, and regulated upon activation normal T cell expressed and presumably secreted (RANTES) were measured. After adipogenesis, the expressions of peroxisome proliferator-activated receptor (PPAR)γ, CCAAT-enhancer-binding proteins (C/EBP)α and β, and heme oxygenase-1 (HO-1) were investigated.H2O2 dose-dependently stimulated ROS production and HO-1 expression. Addition of ALA strongly attenuated ROS production and further increased HO-1 expression. However, by pretreatment of zinc protoporphyrin (ZnPP), HO-1 inhibitor, ALA inhibition of ROS generation by H2O2 was abolished. Tumor necrosis factor (TNF)α-induced mRNA expressions of ICAM-1, IL-6, MCP-1, and RANTES were inhibited by ALA treatment. In this context, TNFα-induced phosphorylation of P65 was also inhibited. In addition, ALA dose-dependently inhibited H2O2-induced intracellular accumulation of lipid droplets. The expression of adipogenic transcription factors, including PPARγ, C/EBPα, and β, was also inhibited.ALA is a potential therapeutic agent for GO because of the inhibitory effects on ROS production and gene expression of proinflammatory cytokines and chemokines, resulting in prevention of adipose-tissue expansion. PMID:26765462

  2. Effect of In Vitro Maturation Technique and Alpha Lipoic Acid Supplementation on Oocyte Maturation Rate: Focus on Oxidative Status of Oocytes

    PubMed Central

    Zavareh, Saeed; Karimi, Isaac; Salehnia, Mojdeh; Rahnama, Ali

    2016-01-01

    Background Therapeutic potential of in vitro maturation (IVM) in infertility is growing with great promise. Although significant progress is obtained in recent years, existing IVM protocols are far from favorable results. The first aim of this study was to investigate whether two step IVM manner change reactive oxygen species (ROS) and total anti- oxidant capacity (TAC) levels. The second aim was to find the effect of alpha lipoic acid (ALA) supplementation on oocyte maturation rate and on ROS/TAC levels during IVM. Materials and Methods In this experimental study, mouse germinal vesicle (GV) oocytes divided into cumulus denuded oocytes (DOs) and cumulus oocyte complexes (COCs) groups. GVs were matured in vitro in the presence or absence of ALA only for 18 hours (control) or with pre-culture of forskolin plus cilostamide for an additional 18 hours. Matured oocytes obtained following 18 and 36 hours based on experimental design. In parallel, the ROS and TAC levels were measured at different time (0, 18 and 36 hours) by 2',7'-dichlorodihydrofluorescein (DCFH) probe and ferric reducing/antioxidant power (FRAP) assay, respectively. Results Maturation rate of COCs was significantly higher than DOs in control group (P<0.05), while there was no significant difference between COCs and DOs when were pre-cultured with forskolin plus cilostamide. ROS and TAC levels was increased and decreased respectively in DOs after 18 hours while in COCs did not change at 18 hours and showed a significant increase and decrease respectively at 36 hours (P<0.05). ROS and TAC levels in the presence of ALA were significantly decreased and increased respectively after 36 hours (P<0.05) whereas, maturation rates of COCs and DOs were similar to their corresponding control groups. Conclusion ALA decreased ROS and increased TAC but could not affect maturation rate of both COCs and DOs in one or two step IVM manner. PMID:26985332

  3. Type 1 5'-deiodinase activity is inhibited by oxidative stress and restored by alpha-lipoic acid in HepG2 cells.

    PubMed

    Chen, Kanjun; Yan, Biao; Wang, Fei; Wen, Feiting; Xing, Xingan; Tang, Xue; Shi, Yonghui; Le, Guowei

    2016-04-01

    3,3',5-triiodothyronine (T3) is largely generated from thyroxine (T4) by the catalysis of deiodinases in peripheral tissues. Emerging evidences have indicated its broad participation in regulating various metabolic process via protecting tissues from oxidative stress and improving cellular antioxidant capacity. However, the potential correlation between the oxidative stress and conversion of T4 to T3 is still unclear. In the present study, the effects of T3 and T4 on redox homeostasis in HepG2 cells pre-treated with H2O2 was investigated. It revealed that T3 significantly rescued the apoptotic cell death, consistent with an upregulation of cell antioxidant ability and reduction of ROS accumulation while T4 did not. Afterwards, we examined the enzyme activity and mRNA expression of type 1 5'-deiodianse (DIO1), T3 and rT3 level and found that H2O2 reduced both DIO1 activity and expression in a dose-dependent manner, which consequently declined T3 and rT3 generation. Alpha-lipoic acid (LA) treatment notably restored DIO1 activity, T3 and rT3 level, as well as transcriptional abnormalities of inflammation-associated genes. It suggests that oxidative stress may reduce DIO1 activity by an indirect way like activating cellular inflammatory responses. All these results indicate that the oxidative stress downregulates the conversion of T4 to T3 through DIO1 function in HepG2 cells. PMID:26947333

  4. Prophylactic and abundant intake of α-lipoic acid causes hepatic steatosis and should be reconsidered in usage as an anti-aging drug.

    PubMed

    Kuhla, Angela; Derbenev, Margarita; Shih, Hao Yu; Vollmar, Brigitte

    2016-01-01

    The majority of research has suggested that α-lipoic acid (ALA) is a potential therapeutic agent for chronic diseases associated with oxidative stress, including atherosclerosis, diabetes, and neurodegeneration. Therefore, a nutritional supplementation with ALA is recommended although the effects of a short- and long-term intake of ALA on central organs in healthy individuals are not studied in detail yet. Therefore, liver tissue of 4 and 74 weeks ALA-treated healthy C57BL6/J mice with respect to lipid metabolism was analyzed. In doing so, it was shown that short-term and long-term ALA treatment caused a marked increase of β-oxidation, as indicated by a significant rise of mRNA expression of fgf21, pparα, and its target genes, for example, acox1, cpt1α, and cpt2, as well as of Fgf21 plasma concentration. Glycolytic activity, as assessed by pklr1 mRNA expression and pyruvate kinase activity, was also found increased. In addition, it was shown that both short- and long-term ALA treatment increased cholesterol content, induced systemic triglyceridemia, and enhanced rxrα and lxrα mRNA expression. Despite the fact that short-term ALA intake reduced lipogenesis, as given by significant declines of fas and srebp1c mRNA expression, and that a long-term ALA intake induced a significant rise of these lipogenic genes, both treatment regimen caused fat accumulation. This, however, was more pronounced upon long-term ALA intake, leading to hepatic steatosis and liver injury, as indicated by increased inflammation and disruption of the general hepatic architecture. In summary, the prophylactic and abundant use of ALA under healthy conditions should be considered with caution. © 2016 BioFactors, 42(2):179-189, 2016. PMID:26876280

  5. Effects of Dietary L-carnosine and Alpha-lipoic Acid on Growth Performance, Blood Thyroid Hormones and Lipid Profiles in Finishing Pigs

    PubMed Central

    Bao, Yinghui; Gao, Chunqi; Hao, Wenbo; Ji, Cheng; Zhao, Lihong; Zhang, Jianyun; Liu, Tao; Ma, Qiugang

    2015-01-01

    The present study was conducted to determine the effects of L-carnosine (LC) and/or alpha-lipoic acid (ALA) supplementation on growth performance, blood thyroid hormones and lipid profiles in finishing pigs. A total of 40 (Landrace×Yorkshire) pigs with an initial body weight of 57.93±3.14 kg were randomly allocated to 4 experimental diets using a 2×2 factorial arrangement with 2 LC supplemental levels (0 or 0.1%) and 2 ALA supplemental levels (0 or 0.03%) in basal diets. The results showed that pigs fed LC-supplemented diets increased final live weight, average daily gain, and average daily feed intake compared to those of pigs fed without LC-supplemented diets (p<0.05). Dietary supplementation with ALA did not affect the growth performance and carcass traits of pigs (p>0.05). Additionally, LC supplementation increased serum triiodothyronine, thyroxine levels, and ALA supplementation increased serum triiodothyronine levels (p<0.05). Serum total cholesterol and triglycerides levels were significantly decreased in LC and ALA supplemented groups, respectively (p<0.05). Moreover, serum low density lipoprotein cholesterol levels were lower in the ALA-supplemented groups than those of pigs fed without ALA-supplemented diets (p<0.05). However, no significant LC×ALA interaction effect on growth performance, blood thyroid hormones and lipid profiles was found. This study suggested that dietary supplementation of LC resulted in better growth performance compared to that of ALA supplementation. L-carnosine and/or ALA supplementation positively modified blood lipid profiles, which may have the potential to prevent cardiovascular diseases. PMID:26194221

  6. The Effects of cAMP-elevating Agents and Alpha Lipoic Acid on In Vitro Maturation of Mouse Germinal Vesicle Oocytes

    PubMed Central

    Rahnama, Ali; Zavareh, Saeed; Ghorbanian, Mohammad Taghi; Karimi, Isaac

    2013-01-01

    Background In spite of extensive efforts to improve in vitro oocyte maturation, the obtained results are not very efficient. This study was conducted to assess impacts of cAMP elevating agents and alpha lipoic acid (ALA) on in vitro oocyte maturation and fertilization. Methods Mouse germinal vesicle (GV) oocytes were categorized into cumulus denuded oocytes (DOs; n=896) and cumulus oocyte complexes (COCs; n=1077) groups. GV oocytes were matured in vitro with or without ALA; (I) without the meiotic inhibitors; (II) supplemented with cilostamide; (III) supplemented with forskolin and (IV) supplemented with Forskolin plus cilostamide. The obtained metaphase II (MII) oocytes were subjected to in vitro fertilization. Independent-samples t-testand ANOVA were used for data analysis. A p-value less than 0.05 was considered to be statistically significant. Results The COCs maturation, fertilization and two cell embryo rates were higher than those of DOs in the control group, while no significant difference was observed between relevant COCs and DOs when they were cultured with cilostamide meiotic inhibitors in two step manner. Combined treatment of cilostamide and forskolin significantly elevated the developmental rates in both COCs and DOs as compared to other groups. The developmental rates of COCs and DOs in the presence of ALA were similar to their respective groups without ALA. Conclusion cAMP elevating agents were more effective on DOs than COCs with regard to rates of maturation and fertilization. However, ALA did not affect the developmental rates of both COCs and DOs in in vitro maturation in one or two step manner. PMID:24551571

  7. α-lipoic acid protects against hypoxia/reoxygenation-induced injury in human umbilical vein endothelial cells through suppression of apoptosis and autophagy

    PubMed Central

    ZHANG, JINGJING; DENG, HOULIANG; LIU, LI; LIU, XIAOXIA; ZUO, XIALIN; XU, QIAN; WU, ZHUOMIN; PENG, XIAOBIN; JI, AIMIN

    2015-01-01

    α-lipoic acid (ALA) is known as a powerful antioxidant, which has been reported to have protective effects against various cardiovascular diseases. The present study aimed to determine whether ALA pre- or post-treatment induced protective effects against hypoxia/reoxygenation-induced injury via inhibition of apoptosis and autophagy in human umbilical vein endothelial cells (HUVECs). In order to simulate the conditions of hypoxia/reoxygenation, HUVECs were subjected to 4 h of oxygen-glucose deprivation (OGD) followed by 12 h of reoxygenation. For the pre-treatment, ALA was added to the buffer 12 h prior to OGD, whereas for the post-treatment, ALA was added at the initiation of reoxygenation. The results demonstrated that ALA pre- or post-treatment significantly reduced lactate dehydrogenase (LDH) release induced through hypoxia/reoxygenation in HUVECs in a dose-dependent manner; of note, 1 mM ALA pre- or post-treatment exhibited the most potent protective effects. In addition, ALA significantly reduced hypoxia/reoxygenation-induced loss of mitochondrial membrane potential, apoptosis and the expression of cleaved caspase-3 in HUVECs. In the presence of the specific autophagy inhibitor 3-methyladenine, hypoxia/reoxygenation-induced apoptosis was significantly reduced. Furthermore, the formation of autophagosomes, cytosolic microtubule-associated protein 1A/1B-light chain 3 ratio and beclin1 levels significantly increased following hypoxia/reoxygenation injury; however, all of these effects were ameliorated following pre- or post-treatment with ALA. The results of the present study suggested that ALA may provide beneficial protection against hypoxia/reoxygenation-induced injury via attenuation of apoptosis and autophagy in HUVECs. PMID:25684163

  8. Alpha-lipoic acid alone and combined with clozapine reverses schizophrenia-like symptoms induced by ketamine in mice: Participation of antioxidant, nitrergic and neurotrophic mechanisms.

    PubMed

    Vasconcelos, Germana Silva; Ximenes, Naiara Coelho; de Sousa, Caren Nádia Soares; Oliveira, Tatiana de Queiroz; Lima, Laio Ladislau Lopes; de Lucena, David Freitas; Gama, Clarissa Severino; Macêdo, Danielle; Vasconcelos, Silvânia Maria Mendes

    2015-07-01

    Oxidative stress has important implications in schizophrenia. Alpha-lipoic acid (ALA) is a natural antioxidant synthesized in human tissues with clinical uses. We studied the effect of ALA or clozapine (CLZ) alone or in combination in the reversal of schizophrenia-like alterations induced by ketamine (KET). Adult male mice received saline or KET for 14 days. From 8th to 14th days mice were additionally administered saline, ALA (100 mg/kg), CLZ 2.5 or 5 mg/kg or the combinations ALA+CLZ2.5 or ALA+CLZ5. Schizophrenia-like symptoms were evaluated by prepulse inhibition of the startle (PPI) and locomotor activity (positive-like), social preference (negative-like) and Y maze (cognitive-like). Oxidative alterations (reduced glutathione - GSH and lipid peroxidation - LP) and nitrite in the prefrontal cortex (PFC), hippocampus (HC) and striatum (ST) and BDNF in the PFC were also determined. KET caused deficits in PPI, working memory, social interaction and hyperlocomotion. Decreased levels of GSH, nitrite (HC) and BDNF and increased LP were also observed in KET-treated mice. ALA and CLZ alone reversed KET-induced behavioral alterations. These drugs also reversed the decreases in GSH (HC) and BDNF and increase in LP (PFC, HC and ST). The combination ALA+CLZ2.5 reversed behavioral and some neurochemical parameters. However, ALA+CLZ5 caused motor impairment. Therefore, ALA presented an antipsychotic-like profile reversing KET-induced positive- and negative-like symptoms. The mechanism partially involves antioxidant, neurotrophic and nitrergic pathways. The combination of ALA+CLZ2.5 improved most of the parameters evaluated in this study without causing motor impairment demonstrating, thus, that possibly when combined with ALA a lower dose of CLZ is required. PMID:25937462

  9. Alpha-Lipoic Acid Promotes Osteoblastic Formation in H2O2 -Treated MC3T3-E1 Cells and Prevents Bone Loss in Ovariectomized Rats.

    PubMed

    Fu, Chao; Xu, Dong; Wang, Chang-Yuan; Jin, Yue; Liu, Qi; Meng, Qiang; Liu, Ke-Xin; Sun, Hui-Jun; Liu, Mo-Zhen

    2015-09-01

    Alpha-lipoic acid (ALA), a naturally occurring compound and dietary supplement, has been established as a potent antioxidant that is a strong scavenger of free radicals. Recently, accumulating evidences has indicated the relationship between oxidative stress and osteoporosis (OP). Some studies have investigated the possible beneficial effects of ALA on OP both in vivo and in vitro; however, the precise mechanism(s) underlying the bone-protective action of ALA remains unclear. Considering this, we focused on the anti-oxidative capacity of ALA to exert bone-protective effects in vitro and in vivo. In the present study, the effects of ALA on osteoblastic formation in H(2)O(2) -treated MC3T3-E1 pre-osteoblasts and ovariectomy (OVX)-induced bone loss in rats were investigated. The results showed that ALA promoted osteoblast differentiation, mineralization and maturation and inhibited osteoblast apoptosis, thus increasing the OPG/receptor activator of nuclear factor-κB (NF-κB) ligand (RANKL) ratio and leading to enhanced bone formation in vitro and inhibited bone loss in vivo. Further study revealed that ALA exerted its bone-protective effects by inhibiting reactive oxygen species (ROS) generation by down-regulating Nox4 gene expression and protein synthesis and attenuating the transcriptional activation of NF-κB. In addition, ALA might exert its bone-protective effects by activating the Wnt/Lrp5/β-catenin signaling pathway. Taken together, the present study indicated that ALA promoted osteoblastic formation in H(2)O(2) -treated MC3T3-E1 cells and prevented OVX-induced bone loss in rats by regulating Nox4/ROS/NF-κB and Wnt/Lrp5/β-catenin signaling pathways, which provided possible mechanisms of bone-protective effects in regulating osteoblastic formation and preventing bone loss. Taken together, the results suggest that ALA may be a candidate for clinical OP treatment. PMID:25655087

  10. Improvement of mTORC1-driven overproduction of apoB-containing triacylglyceride-rich lipoproteins by short-chain fatty acids, 4-phenylbutyric acid and (R)-α-lipoic acid, in human hepatocellular carcinoma cells.

    PubMed

    Roberts, Joseph L; He, Bo; Erickson, Anjeza; Moreau, Régis

    2016-03-01

    The activation of hepatic kinase mechanistic target of rapamycin complex 1 (mTORC1) is implicated in the development of obesity-related metabolic disorders. This study investigated the metabolic sequelae of mTORC1 hyperactivation in human hepatoma cells and the lipid-regulating mechanisms of two short-chain fatty acids: 4-phenylbutyric acid (PBA) and (R)-α-lipoic acid (LA). We created three stable cell lines that exhibit low, normal, or high mTORC1 activity. mTORC1 hyperactivation induced the expression of lipogenic (DGAT1 and DGAT2) and lipoprotein assembly (MTP and APOB) genes, thereby raising cellular triacylglyceride (TG) and exacerbating secretion of apoB-containing TG-rich lipoproteins. LYS6K2, a specific inhibitor of the p70 S6 kinase branch of mTORC1 signaling, reversed these effects. PBA and LA decreased secreted TG through distinct mechanisms. PBA repressed apoB expression (both mRNA and protein) and lowered secreted TG without mitigation of mTORC1 hyperactivity or activation of AMPK. LA decreased cellular and secreted TG by attenuating mTORC1 signaling in an AMPK-independent manner. LA did not regulate apoB expression but led to the secretion of apoB-containing TG-poor lipoproteins by repressing the expression of lipogenic genes, FASN, DGAT1, and DGAT2. Our studies provide new mechanistic insight into the hypolipidemic activity of PBA and LA in the context of mTORC1 hyperactivation and suggest that the short-chain fatty acids may aid in the prevention and treatment of hypertriglyceridemia. PMID:26680362

  11. Safety and efficacy of an add-on therapy with curcumin phytosome and piperine and/or lipoic acid in subjects with a diagnosis of peripheral neuropathy treated with dexibuprofen.

    PubMed

    Di Pierro, Francesco; Settembre, Roberto

    2013-01-01

    We conducted an 8-week, open, randomized controlled clinical trial on 141 subjects affected by neuropathic pain to investigate the role of an adjunctive therapy added to the administration of dexibuprofen (400 mg twice a day) and based on a multi-ingredient formula (Lipicur), consisting of lipoic acid plus curcumin phytosome and piperine, in patients with a diagnosis of lumbar sciatica, lumbar disk herniation, and/or lumbar canal stenosis (96 subjects), or with carpal tunnel syndrome (45 subjects). A total of 135 participants completed the study. Treatment with the multi-ingredient formula (Lipicur) reduced neuropathic pain by more than 66% in both conditions (subjects with lumbar sciatica and with carpal tunnel syndrome), and these reductions were statistically significant. Moreover, the treatment reduced dexibuprofen use by about 40%. An add-on therapy with only lipoic acid has not shown any significant results. On the basis of its safety and efficacy, Lipicur could be considered an effective complementary therapy to be added to conventional treatments to achieve better efficacy in reducing neuropathic pain. PMID:23861596

  12. Safety and efficacy of an add-on therapy with curcumin phytosome and piperine and/or lipoic acid in subjects with a diagnosis of peripheral neuropathy treated with dexibuprofen

    PubMed Central

    Di Pierro, Francesco; Settembre, Roberto

    2013-01-01

    We conducted an 8-week, open, randomized controlled clinical trial on 141 subjects affected by neuropathic pain to investigate the role of an adjunctive therapy added to the administration of dexibuprofen (400 mg twice a day) and based on a multi-ingredient formula (Lipicur), consisting of lipoic acid plus curcumin phytosome and piperine, in patients with a diagnosis of lumbar sciatica, lumbar disk herniation, and/or lumbar canal stenosis (96 subjects), or with carpal tunnel syndrome (45 subjects). A total of 135 participants completed the study. Treatment with the multi-ingredient formula (Lipicur) reduced neuropathic pain by more than 66% in both conditions (subjects with lumbar sciatica and with carpal tunnel syndrome), and these reductions were statistically significant. Moreover, the treatment reduced dexibuprofen use by about 40%. An add-on therapy with only lipoic acid has not shown any significant results. On the basis of its safety and efficacy, Lipicur could be considered an effective complementary therapy to be added to conventional treatments to achieve better efficacy in reducing neuropathic pain. PMID:23861596

  13. AAE13 encodes a dual-localized malonyl-CoA synthetase that is crucial for mitochondrial fatty acid biosynthesis.

    PubMed

    Guan, Xin; Nikolau, Basil J

    2016-03-01

    Malonyl-CoA is a key intermediate in a number of metabolic processes associated with its role as a substrate in acylation and condensation reactions. These types of reactions occur in plastids, the cytosol and mitochondria, and although carboxylation of acetyl-CoA is the known mechanism for generating the distinct plastidial and cytosolic pools, the metabolic origin of the mitochondrial malonyl-CoA pool is still unclear. In this study we demonstrate that malonyl-CoA synthetase encoded by the Arabidopsis AAE13 (AT3G16170) gene is localized in both the cytosol and the mitochondria. These isoforms are translated from two types of transcripts, one that contains and one that does not contain a mitochondrial-targeting pre-sequence. Whereas the cytosolic AAE13 protein is not essential, due to the presence of a redundant malonyl-CoA generating system provided by a cytosolic acetyl-CoA carboxylase, the mitochondrial AAE13 protein is essential for plant growth. Phenotypes of the aae13-1 mutant are transgenically reversed only if the mitochondrial pre-sequence is present in the ectopically expressed AAE13 proteins. The aae13-1 mutant exhibits typical metabolic phenotypes associated with a deficiency in the mitochondrial fatty acid synthase system, namely depleted lipoylation of the H subunit of the photorespiratory enzyme glycine decarboxylase, increased accumulation of glycine and glycolate and reduced levels of sucrose. Most of these metabolic alterations, and associated morphological changes, are reversed when the aae13-1 mutant is grown in a non-photorespiratory condition (i.e. a 1% CO2 atmosphere), demonstrating that they are a consequence of the deficiency in photorespiration due to the inability to generate lipoic acid from mitochondrially synthesized fatty acids. PMID:26836315

  14. Effects of Dietary Alpha-lipoic Acid and Acetyl-L-carnitine on Growth Performance and Meat Quality in Arbor Acres Broilers

    PubMed Central

    Zhang, Yong; Jia, Ru; Ji, Cheng; Ma, Qiugang; Huang, Jin; Yin, Haicheng; Liu, Laiting

    2014-01-01

    An experiment was conducted to evaluate the effects of dietary alpha-lipoic acid (LA) and acetyl-L-carnitine (ALC) on growth performance, carcass characteristics and meat quality in Arbor Acres broilers. A total of 486 1-d-old male Arbor Acres broilers were randomly allocated to 9 dietary treatments, 9 treatments were group A (0 mg/kg LA and 0 mg/kg ALC), group B (50 mg/kg LA and 0 mg/kg ALC), group C (100 mg/kg LA and 0 mg/kg ALC), group D (0 mg/kg LA and 50 mg/kg ALC), group E (50 mg/kg LA and 50 mg/kg ALC), group F (100 mg/kg LA and 50 mg/kg ALC), group G (0 mg/kg LA and 100 mg/kg ALC), group H (50 mg/kg LA and 100 mg/kg ALC), group I (100 mg/kg LA and 100 mg/kg ALC). Birds were slaughtered at 42 days old. Average daily gain (ADG), average feed intake (AFI), feed conversion rate (FCR), eviscerated rate, breast muscle percentage, thigh muscle percentage, abdominal fat percentage, liver weight, muscle color (L* value, a* value, b* value), pH values at 45 min and 24 h postmortem were measured. Results showed that there existed an interaction between LA and ALC in growth performance of broilers, carcass traits and meat quality. The overall result is that high level of LA and ALC led to lower AFI, ADG (p<0.01), lower abdominal fat percentage, liver weight (p<0.01), lower L* value, a* value, and b* value of breast muscle, L* value of thigh muscle (p<0.05), and higher FCR (p<0.01), eviscerated rate (p<0.01), breast muscle percentage, thigh muscle percentage (p<0.05), a* value, pH 45 min and pH 24 h of thigh muscle (p<0.01). These results suggested that dietary LA and ALC contributed to the improvement of meat quality in broilers. PMID:25050042

  15. Enhancement of lipid stability of broiler breast meat and meat products fed on alpha lipoic acid and alpha tocopherol acetate supplemented feed

    PubMed Central

    2012-01-01

    This study was designed to investigate the effect of alpha lipoic acid (ALA) and alpha tocopherol acetate (ATA) on the antioxidant potential, lipid stability and the quality of the broiler breast meat and meat products. The treatment plan was as (T1 = control feed, T2 = 200 mg ATA + 25 mg ALA/kg feed, T3 = 200 mg ATA + 75 mg ALA/kg feed, T4 = 200 mg ATA + 150 mg ALA/kg feed, T5 = Oxidized oil (4%), T6 = 200 mg ATA + 150 mg ALA + Oxidized oil (4%)/kg feed). After two weeks of acclimatization the birds were fed with ALA and ATA enriched diet. The results revealed that maximum deposition of ALA took place in T4 which contain maximum dose of ALA. The TBARS and DPPH values of the broiler breast meat were in T4 (0.14 ± 0.01 MDA/kg of meat, 76.69 ± 0.14%) and in T5 were (0.24 ± 0.15 MDA/Kg of meat, 44.98 ± 0.04%) accordingly. ATA concentration were also highest in T4 (206.43 ± 0.22 mg/g of meat) and lowest in T5 (79.09 ± 0.06 mg/g of meat). Sensory evaluation results showed that nuggets and patties made of T5 containing oxidized oil were least liked and T4 got highest score. In a nutshell, 150 mg/kg feed dietary supplementation of ALA with constant level of ATA can ameliorate the antioxidant potential, lipid stability and nutritional qualities of broiler breast meat and meat products. PMID:22640892

  16. Cardioprotective effects of lipoic acid, quercetin and resveratrol on oxidative stress related to thyroid hormone alterations in long-term obesity.

    PubMed

    Cheserek, Maureen Jepkorir; Wu, Guirong; Li, Longnan; Li, Lirong; Karangwa, Eric; Shi, Yonghui; Le, Guowei

    2016-07-01

    This study investigated possible mechanisms for cardioprotective effects of lipoic acid (LA), quercetin (Q) and resveratrol (R) on oxidative stress related to thyroid hormone alterations in long-term obesity. Female C57BL/6 mice were fed on high-fat diet (HFD), HFD+LA, HFD+R, HFD+Q and normal diet for 26weeks. Body weight, blood pressure, thyroid hormones, oxidative stress markers, angiotensin converting enzyme (ACE), nitric oxide synthase (NOS) and ion pump activities were measured, and expression of cardiac genes was analyzed by real-time polymerase chain reaction. HFD induced marked increase (P<.05) in body weight, blood pressure and oxidative stress, while plasma triidothyronine levels reduced. ACE activity increased (P<.05) in HFD mice (0.69±0.225U/mg protein) compared with controls (0.28±0.114U/mg protein), HFD+LA (0.231±0.02U/mg protein) and HFD+Q (0.182±0.096U/mg protein) at 26weeks. Moreover, Na(+)/K(+)-ATPase and Ca(2+)-ATPase activities increased in HFD mice whereas NOS reduced. A 1.5-fold increase in TRα1 and reduction in expression of the deiodinase iodothyronine DIO1, threonine protein kinase and NOS3 as well as up-regulation of AT1α, ACE, ATP1B1, GSK3β and Cja1 genes also occurred in HFD mice. Conversely, LA, Q and R inhibited weight gain; reduced TRα1 expression as well as increased DIO1; reduced ACE activity and AT1α, ATP1B1 and Cja1 gene expression as well as inhibited GSK3β; increased total antioxidant capacity, GSH and catalase activity; and reduced blood pressure. In conclusion, LA, resveratrol and quercetin supplementation reduces obesity thereby restoring plasma thyroid hormone levels and attenuating oxidative stress in the heart and thus may have therapeutic potential in heart diseases. PMID:27260466

  17. Multiple mechanisms of age-dependent accumulation of amyloid beta protein in rat brain: Prevention by dietary supplementation with N-acetylcysteine, α-lipoic acid and α-tocopherol.

    PubMed

    Sinha, Maitrayee; Bir, Aritri; Banerjee, Anindita; Bhowmick, Pritha; Chakrabarti, Sasanka

    2016-05-01

    The aged brain may be used as a tool to investigate altered metabolism of amyloid beta protein (Aβ42) that may have implications in the pathogenesis of Alzheimer's disease (AD). In the present study, we have observed a striking increase in the amyloid precursor protein (APP) level in the brain cortex of aged rats (22-24 months) along with a mild but statistically significant increase in the level of APP mRNA. Moreover, the activity of β secretase is elevated (nearly 55%) and that of neprilysin diminished (48%) in brain cortex of aged rats compared to that in young rats (4-6 months). All these changes lead to a markedly increased accumulation of Aβ42 in brain cortical tissue of aged rats. Long-term dietary supplementation of rats with a combination of N-acetylcysteine, α-lipoic and α-tocopherol from 18 months onwards daily till the sacrifice of the animals by 22-24 months, attenuates the age-related alterations in amyloid beta metabolism. In separate experiments, a significant impairment of spatial learning and memory has been observed in aged rats, and the phenomenon is remarkably prevented by the dietary supplementation of the aged animals by the same combination of N-acetylcysteine, α-lipoic acid and α-tocopherol. The results call for further explorations of this combination in suitable animal models in ameliorating AD related brain deficits. PMID:26463138

  18. Chlamydia pneumoniae encodes a functional aromatic amino acid hydroxylase

    PubMed Central

    Abromaitis, Stephanie; Hefty, P. Scott; Stephens, Richard S.

    2010-01-01

    Chlamydia pneumoniae is a community-acquired respiratory pathogen that has been associated with the development of atherosclerosis. Analysis of the C. pneumoniae genome identified a gene (Cpn1046) homologous to eukaryotic aromatic amino acid hydroxylases. Aromatic amino acid hydroxylases (AroAA-H) hydroxylate phenylalanine, tyrosine, and tryptophan into tyrosine, dihydroxyphenylalanine (L-DOPA), and 5-hydroxytryptophan, respectively. Sequence analysis of Cpn1046 demonstrated that residues essential for AroAA-H enzymatic function are conserved and that a subset of Chlamydia species contain an AroAA-H homolog. The chlamydial AroAA-H are transcriptionally linked to a putative bacterial membrane transport protein. We determined that recombinant Cpn1046 is able to hydroxylate phenylalanine, tyrosine, and tryptophan with roughly equivalent activity for all three substrates. Cpn1046 is expressed within 24 h of infection, allowing C. pneumoniae to hydroxylae host stores of aromatic amino acids during the period of logarithmic bacterial growth. From these results we can conclude that C. pneumoniae, as well as a subset of other Chlamydia species, encode an AroAA-H that is able to use all three aromatic amino acids as substrates. The maintenance of this gene within a number of Chlamydia suggests that the enzyme may have an important role in shaping the metabolism or overall pathogenesis of these bacteria. PMID:19141112

  19. Chlamydia pneumoniae encodes a functional aromatic amino acid hydroxylase.

    PubMed

    Abromaitis, Stephanie; Hefty, P Scott; Stephens, Richard S

    2009-03-01

    Chlamydia pneumoniae is a community-acquired respiratory pathogen that has been associated with the development of atherosclerosis. Analysis of the C. pneumoniae genome identified a gene (Cpn1046) homologous to eukaryotic aromatic amino acid hydroxylases (AroAA-Hs). AroAA-Hs hydroxylate phenylalanine, tyrosine, and tryptophan into tyrosine, dihydroxyphenylalanine, and 5-hydroxytryptophan, respectively. Sequence analysis of Cpn1046 demonstrated that residues essential for AroAA-H enzymatic function are conserved and that a subset of Chlamydia species contain an AroAA-H homolog. The chlamydial AroAA-Hs are transcriptionally linked to a putative bacterial membrane transport protein. We determined that recombinant Cpn1046 is able to hydroxylate phenylalanine, tyrosine, and tryptophan with roughly equivalent activity for all three substrates. Cpn1046 is expressed within 24 h of infection, allowing C. pneumoniae to hydroxylate host stores of aromatic amino acids during the period of logarithmic bacterial growth. From these results we can conclude that C. pneumoniae, as well as a subset of other Chlamydia species, encode an AroAA-H that is able to use all three aromatic amino acids as substrates. The maintenance of this gene within a number of Chlamydia suggests that the enzyme may have an important role in shaping the metabolism or overall pathogenesis of these bacteria. PMID:19141112

  20. Thermal and acid tolerant beta xylosidases, arabinofuranosidases, genes encoding, related organisms, and methods

    DOEpatents

    Thompson, David N; Thompson, Vicki S; Schaller, Kastli D; Apel, William A; Reed, David W; Lacey, Jeffrey A

    2013-04-30

    Isolated and/or purified polypeptides and nucleic acid sequences encoding polypeptides from Alicyclobacillus acidocaldarius and variations thereof are provided. Further provided are methods of at least partially degrading xylotriose, xylobiose, and/or arabinofuranose-substituted xylan using isolated and/or purified polypeptides and nucleic acid sequences encoding polypeptides from Alicyclobacillus acidocaldarius and variations thereof.

  1. Thermal and acid tolerant beta-xylosidases, genes encoding, related organisms, and methods

    DOEpatents

    Thompson, David N.; Thompson, Vicki S.; Schaller, Kastli D.; Apel, William A.; Lacey, Jeffrey A.; Reed, David W.

    2011-04-12

    Isolated and/or purified polypeptides and nucleic acid sequences encoding polypeptides from Alicyclobacillus acidocaldarius and variations thereof are provided. Further provided are methods of at least partially degrading xylotriose and/or xylobiose using isolated and/or purified polypeptides and nucleic acid sequences encoding polypeptides from Alicyclobacillus acidocaldarius and variations thereof.

  2. Regulation of Vascular Tone, Angiogenesis and Cellular Bioenergetics by the 3-Mercaptopyruvate Sulfurtransferase/H2S Pathway: Functional Impairment by Hyperglycemia and Restoration by DL-α-Lipoic Acid.

    PubMed

    Coletta, Ciro; Módis, Katalin; Szczesny, Bartosz; Brunyánszki, Attila; Oláh, Gábor; Rios, Ester C S; Yanagi, Kazunori; Ahmad, Akbar; Papapetropoulos, Andreas; Szabo, Csaba

    2015-01-01

    Hydrogen sulfide (H2S), as a reducing agent and an antioxidant molecule, exerts protective effects against hyperglycemic stress in the vascular endothelium. The mitochondrial enzyme 3-mercaptopyruvate sulfurtransferase (3-MST) is an important biological source of H2S. We have recently demonstrated that 3-MST activity is inhibited by oxidative stress in vitro and speculated that this may have an adverse effect on cellular homeostasis. In the current study, given the importance of H2S as a vasorelaxant, angiogenesis stimulator and cellular bioenergetic mediator, we first determined whether the 3-MST/H2S system plays a physiological regulatory role in endothelial cells. Next, we tested whether a dysfunction of this pathway develops during the development of hyperglycemia and μmol/L to diabetes-associated vascular complications. Intraperitoneal (IP) 3-MP (1 mg/kg) raised plasma H2S levels in rats. 3-MP (10 1 mmol/L) promoted angiogenesis in vitro in bEnd3 microvascular endothelial cells and in vivo in a Matrigel assay in mice (0.3-1 mg/kg). In vitro studies with bEnd3 cell homogenates demonstrated that the 3-MP-induced increases in H2S production depended on enzymatic activity, although at higher concentrations (1-3 mmol/L) there was also evidence for an additional nonenzymatic H2S production by 3-MP. In vivo, 3-MP facilitated wound healing in rats, induced the relaxation of dermal microvessels and increased mitochondrial bioenergetic function. In vitro hyperglycemia or in vivo streptozotocin diabetes impaired angiogenesis, attenuated mitochondrial function and delayed wound healing; all of these responses were associated with an impairment of the proangiogenic and bioenergetic effects of 3-MP. The antioxidants DL-α-lipoic acid (LA) in vivo, or dihydrolipoic acid (DHLA) in vitro restored the ability of 3-MP to stimulate angiogenesis, cellular bioenergetics and wound healing in hyperglycemia and diabetes. We conclude that diabetes leads to an impairment of the 3-MST

  3. Regulation of Vascular Tone, Angiogenesis and Cellular Bioenergetics by the 3-Mercaptopyruvate Sulfurtransferase/H2S Pathway: Functional Impairment by Hyperglycemia and Restoration by dl-α-Lipoic Acid

    PubMed Central

    Coletta, Ciro; Módis, Katalin; Szczesny, Bartosz; Brunyánszki, Attila; Oláh, Gábor; Rios, Ester CS; Yanagi, Kazunori; Ahmad, Akbar; Papapetropoulos, Andreas; Szabo, Csaba

    2015-01-01

    Hydrogen sulfide (H2S), as a reducing agent and an antioxidant molecule, exerts protective effects against hyperglycemic stress in the vascular endothelium. The mitochondrial enzyme 3-mercaptopyruvate sulfurtransferase (3-MST) is an important biological source of H2S. We have recently demonstrated that 3-MST activity is inhibited by oxidative stress in vitro and speculated that this may have an adverse effect on cellular homeostasis. In the current study, given the importance of H2S as a vasorelaxant, angiogenesis stimulator and cellular bioenergetic mediator, we first determined whether the 3-MST/H2S system plays a physiological regulatory role in endothelial cells. Next, we tested whether a dysfunction of this pathway develops during the development of hyperglycemia and μmol/L to diabetes-associated vascular complications. Intraperitoneal (IP) 3-MP (1 mg/kg) raised plasma H2S levels in rats. 3-MP (10 1 mmol/L) promoted angiogenesis in vitro in bEnd3 microvascular endothelial cells and in vivo in a Matrigel assay in mice (0.3–1 mg/kg). In vitro studies with bEnd3 cell homogenates demonstrated that the 3-MP-induced increases in H2S production depended on enzymatic activity, although at higher concentrations (1–3 mmol/L) there was also evidence for an additional nonenzymatic H2S production by 3-MP. In vivo, 3-MP facilitated wound healing in rats, induced the relaxation of dermal microvessels and increased mitochondrial bioenergetic function. In vitro hyperglycemia or in vivo streptozotocin diabetes impaired angiogenesis, attenuated mitochondrial function and delayed wound healing; all of these responses were associated with an impairment of the proangiogenic and bioenergetic effects of 3-MP. The antioxidants dl-α-lipoic acid (LA) in vivo, or dihydrolipoic acid (DHLA) in vitro restored the ability of 3-MP to stimulate angiogenesis, cellular bioenergetics and wound healing in hyperglycemia and diabetes. We conclude that diabetes leads to an impairment of the 3

  4. BGL7 beta-glucosidase and nucleic acids encoding the same

    SciTech Connect

    Dunn-Coleman, Nigel; Ward, Michael

    2015-04-14

    The present invention provides a novel .beta.-glucosidase nucleic acid sequence, designated bgl7, and the corresponding BGL7 amino acid sequence. The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding BGL7, recombinant BGL7 proteins and methods for producing the same.

  5. BGL6 beta-glucosidase and nucleic acids encoding the same

    SciTech Connect

    Dunn-Coleman, Nigel; Ward, Michael

    2015-08-11

    The present invention provides a novel .beta.-glucosidase nucleic acid sequence, designated bgl6, and the corresponding BGL6 amino acid sequence. The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding BGL6, recombinant BGL6 proteins and methods for producing the same.

  6. BGL7 beta-glucosidase and nucleic acids encoding the same

    SciTech Connect

    Dunn-Coleman, Nigel; Ward, Michael

    2014-03-25

    The present invention provides a novel .beta.-glucosidase nucleic acid sequence, designated bgl7, and the corresponding BGL7 amino acid sequence. The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding BGL7, recombinant BGL7 proteins and methods for producing the same.

  7. BGL6 beta-glucosidase and nucleic acids encoding the same

    SciTech Connect

    Dunn-Coleman, Nigel; Ward, Michael

    2014-03-04

    The present invention provides a novel .beta.-glucosidase nucleic acid sequence, designated bgl6, and the corresponding BGL6 amino acid sequence. The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding BGL6, recombinant BGL6 proteins and methods for producing the same.

  8. BGL7 beta-glucosidase and nucleic acids encoding the same

    SciTech Connect

    Dunn-Coleman, Nigel; Ward, Michael

    2013-01-29

    The present invention provides a novel .beta.-glucosidase nucleic acid sequence, designated bgl7, and the corresponding BGL7 amino acid sequence. The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding BGL7, recombinant BGL7 proteins and methods for producing the same.

  9. BGL6 .beta.-glucosidase and nucleic acids encoding the same

    SciTech Connect

    Dunn-Coleman, Nigel; Ward, Michael

    2012-10-02

    The present invention provides a novel .beta.-glucosidase nucleic acid sequence, designated bgl6, and the corresponding BGL6 amino acid sequence. The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding BGL6, recombinant BGL6 proteins and methods for producing the same.

  10. BGL3 beta-glucosidase and nucleic acids encoding the same

    SciTech Connect

    Dunn-Coleman, Nigel; Goedegebuur, Frits; Ward, Michael; Yao, Jian

    2012-10-30

    The present invention provides a novel .beta.-glucosidase nucleic acid sequence, designated bgl3, and the corresponding BGL3 amino acid sequence. The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding BGL3, recombinant BGL3 proteins and methods for producing the same.

  11. BGL3 beta-glucosidase and nucleic acids encoding the same

    SciTech Connect

    Dunn-Coleman, Nigel; Goedegebuur, Frits; Ward, Michael; Yao, Jian

    2011-06-14

    The present invention provides a novel .beta.-glucosidase nucleic acid sequence, designated bgl3, and the corresponding BGL3 amino acid sequence. The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding BGL3, recombinant BGL3 proteins and methods for producing the same.

  12. BGL3 beta-glucosidase and nucleic acids encoding the same

    DOEpatents

    Dunn-Coleman, Nigel; Goedegebuur, Frits; Ward, Michael; Yao, Jian

    2008-04-01

    The present invention provides a novel .beta.-glucosidase nucleic acid sequence, designated bgl3, and the corresponding BGL3 amino acid sequence. The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding BGL3, recombinant BGL3 proteins and methods for producing the same.

  13. BGL5 .beta.-glucosidase and nucleic acids encoding the same

    DOEpatents

    Dunn-Coleman, Nigel; Goedegebuur, Frits; Ward, Michael; Yao, Jian

    2008-03-18

    The present invention provides a novel .beta.-glucosidase nucleic acid sequence, designated bgl5, and the corresponding BGL5 amino acid sequence. The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding BGL5, recombinant BGL5 proteins and methods for producing the same.

  14. BGL6 beta-glucosidase and nucleic acids encoding the same

    DOEpatents

    Dunn-Coleman, Nigel; Ward, Michael

    2009-09-01

    The present invention provides a novel .beta.-glucosidase nucleic acid sequence, designated bgl6, and the corresponding BGL6 amino acid sequence. The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding BGL6, recombinant BGL6 proteins and methods for producing the same.

  15. BGL7 beta-glucosidase and nucleic acids encoding the same

    DOEpatents

    Dunn-Coleman, Nigel; Ward, Michael

    2008-08-05

    The present invention provides a novel .beta.-glucosidase nucleic acid sequence, designated bgl7, and the corresponding BGL7 amino acid sequence. The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding BGL7, recombinant BGL7 proteins and methods for producing the same.

  16. BGL4 beta-glucosidase and nucleic acids encoding the same

    DOEpatents

    Dunn-Coleman, Nigel [Los Gatos, CA; Goedegebuur, Frits [Vlaardingen, NL; Ward, Michael [San Francisco, CA; Yao, Jian [Sunnyvale, CA

    2008-01-22

    The present invention provides a novel .beta.-glucosidase nucleic acid sequence, designated bgl4, and the corresponding BGL4 amino acid sequence. The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding BGL4, recombinant BGL4 proteins and methods for producing the same.

  17. BGL3 beta-glucosidase and nucleic acids encoding the same

    DOEpatents

    Dunn-Coleman, Nigel; Goedegebuur, Frits; Ward, Michael; Yao, Jian

    2007-09-25

    The present invention provides a novel .beta.-glucosidase nucleic acid sequence, designated bgl3, and the corresponding BGL3 amino acid sequence. The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding BGL3, recombinant BGL3 proteins and methods for producing the same.

  18. BGL4 beta-glucosidase and nucleic acids encoding the same

    DOEpatents

    Dunn-Coleman, Nigel; Goedegebuur, Frits; Ward, Michael; Yao, Jian

    2011-12-06

    The present invention provides a novel .beta.-glucosidase nucleic acid sequence, designated bgl4, and the corresponding BGL4 amino acid sequence. The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding BGL4, recombinant BGL4 proteins and methods for producing the same.

  19. The Combination of N-Acetyl Cysteine, Alpha-Lipoic Acid, and Bromelain Shows High Anti-Inflammatory Properties in Novel In Vivo and In Vitro Models of Endometriosis

    PubMed Central

    Agostinis, C.; Zorzet, S.; De Leo, R.; Zauli, G.; De Seta, F.; Bulla, R.

    2015-01-01

    To evaluate the efficacy of an association of N-acetyl cystein, alpha-lipoic acid, and bromelain (NAC/LA/Br) in the treatment of endometriosis we set up a new in vivo murine model. We explored the anti-inflammatory and proapoptotic effect of this combination on human endometriotic endothelial cells (EECs) and on endothelial cells isolated from normal uterus (UtMECs). We implanted fragments of human endometriotic cysts intraperitoneally into SCID mice to evaluate the efficacy of NAC/LA/Br treatment. UtMECs and EECs, untreated or treated with NAC/LA/Br, were activated with the proinflammatory stimulus TNF-α and their response in terms of VCAM1 expression was evaluated. The proapoptotic effect of higher doses of NAC/LA/Br on UtMECs and EECs was measured with a fluorogenic substrate for activated caspases 3 and 7. The preincubation of EECs with NAC/LA/Br prior to cell stimulation with TNF-α prevents the upregulation of the expression of the inflammatory “marker” VCAM1. Furthermore NAC/LA/Br were able to induce EEC, but not UtMEC, apoptosis. Finally, the novel mouse model allowed us to demonstrate that mice treated with NAC/LA/Br presented a lower number of cysts, smaller in size, compared to untreated mice. Our findings suggest that these dietary supplements may have potential therapeutic uses in the treatment of chronic inflammatory diseases like endometriosis. PMID:25960622

  20. Adjunctive α-lipoic acid reduces weight gain compared with placebo at 12 weeks in schizophrenic patients treated with atypical antipsychotics: a double-blind randomized placebo-controlled study.

    PubMed

    Kim, Nam Wook; Song, Yul-Mai; Kim, Eosu; Cho, Hyun-Sang; Cheon, Keun-Ah; Kim, Su Jin; Park, Jin Young

    2016-09-01

    α-Lipoic acid (ALA) has been reported to be effective in reducing body weight in rodents and obese patients. Our previous open trial showed that ALA may play a role in reducing weight gain in patients with schizophrenia on atypical antipsychotics. The present study evaluated the efficacy of ALA in reducing weight and BMI in patients with schizophrenia who had experienced significant weight gain since taking atypical antipsychotics. In a 12-week, double-blind randomized placebo-controlled study, 22 overweight and clinically stable patients with schizophrenia were randomly assigned to receive ALA or placebo. ALA was administered at 600-1800 mg, as tolerated. Weight, BMI, abdomen fat area measured by computed tomography, and metabolic values were determined. Adverse effects were also assessed to examine safety. Overall, 15 patients completed 12 weeks of treatment. There was significant weight loss and decreased visceral fat levels in the ALA group compared with the placebo group. There were no instances of psychopathologic aggravation or severe ALA-associated adverse effects. ALA was effective in reducing weight and abdominal obesity in patients with schizophrenia who had experienced significant weight gain since beginning an atypical antipsychotic regimen. Moreover, ALA was well tolerated throughout this study. ALA might play an important role as an adjunctive treatment in decreasing obesity in patients who take atypical antipsychotics. PMID:27276401

  1. The combination of N-acetyl cysteine, alpha-lipoic acid, and bromelain shows high anti-inflammatory properties in novel in vivo and in vitro models of endometriosis.

    PubMed

    Agostinis, C; Zorzet, S; De Leo, R; Zauli, G; De Seta, F; Bulla, R

    2015-01-01

    To evaluate the efficacy of an association of N-acetyl cystein, alpha-lipoic acid, and bromelain (NAC/LA/Br) in the treatment of endometriosis we set up a new in vivo murine model. We explored the anti-inflammatory and proapoptotic effect of this combination on human endometriotic endothelial cells (EECs) and on endothelial cells isolated from normal uterus (UtMECs). We implanted fragments of human endometriotic cysts intraperitoneally into SCID mice to evaluate the efficacy of NAC/LA/Br treatment. UtMECs and EECs, untreated or treated with NAC/LA/Br, were activated with the proinflammatory stimulus TNF-α and their response in terms of VCAM1 expression was evaluated. The proapoptotic effect of higher doses of NAC/LA/Br on UtMECs and EECs was measured with a fluorogenic substrate for activated caspases 3 and 7. The preincubation of EECs with NAC/LA/Br prior to cell stimulation with TNF-α prevents the upregulation of the expression of the inflammatory "marker" VCAM1. Furthermore NAC/LA/Br were able to induce EEC, but not UtMEC, apoptosis. Finally, the novel mouse model allowed us to demonstrate that mice treated with NAC/LA/Br presented a lower number of cysts, smaller in size, compared to untreated mice. Our findings suggest that these dietary supplements may have potential therapeutic uses in the treatment of chronic inflammatory diseases like endometriosis. PMID:25960622

  2. Nucleic acids encoding mosaic clade M human immunodeficiency virus type 1 (HIV-1) envelope immunogens

    DOEpatents

    Korber, Bette T; Fischer, William; Liao, Hua-Xin; Haynes, Barton F; Letvin, Norman; Hahn, Beatrice H

    2015-04-21

    The present invention relates to nucleic acids encoding mosaic clade M HIV-1 Env polypeptides and to compositions and vectors comprising same. The nucleic acids of the invention are suitable for use in inducing an immune response to HIV-1 in a human.

  3. Glutathione, N-acetylcysteine and lipoic acid down-regulate starvation-induced apoptosis, RANKL/OPG ratio and sclerostin in osteocytes: involvement of JNK and ERK1/2 signalling.

    PubMed

    Fontani, Filippo; Marcucci, Gemma; Iantomasi, Teresa; Brandi, Maria Luisa; Vincenzini, Maria Teresa

    2015-04-01

    Osteocyte apoptosis due to microdamage and/or oxidative stress is related to increased local bone turnover and resorption observed in various bone diseases. Previous data on osteoblasts and osteoclasts have linked reactive oxygen species and antioxidants to bone remodelling. This study performs a comprehensive analysis on the effect of antioxidants such as glutathione (GSH), N-acetylcysteine and lipoic acid (LA) on starvation-induced osteocyte apoptosis and on cytokines involved in bone remodelling such as the receptor activator kB ligand (RANKL), osteoprotegerin (OPG) and sclerostin. For this study, apoptosis was induced by serum starvation in a murine osteocyte-like cell line MLO-Y4; this condition mimics in part osteocyte apoptosis due to microdamage. The results show that starvation-induced apoptosis and expression of RANKL, OPG and sclerostin are redox regulated processes. All antioxidants are able to inhibit the apoptosis due to starvation. They down-regulate the expression and the release of RANKL, the expression of sclerostin and RANKL/OPG ratio, whereas they only in part up-regulate OPG expression. Antioxidants mediate their effect on starvation-induced apoptosis by JNK signalling and on cytokine expression by both JNK and ERK1/2 activities. This study shows the possible involvement of biological antioxidants such as GSH and LA on redox regulated mechanisms related to apoptosis and expression of cytokines involved in bone remodelling. Moreover, it suggests that both JNK and ERK1/2 may be useful biological targets for drugs affecting bone diseases associated with increased oxidative stress. PMID:25660312

  4. α-Lipoic Acid Reduces Infarct Size and Preserves Cardiac Function in Rat Myocardial Ischemia/Reperfusion Injury through Activation of PI3K/Akt/Nrf2 Pathway

    PubMed Central

    Yi, Wei; Ma, Li; Zhao, Bijun; Cheng, Liang; Zhang, Jinzhou; Cao, Feng; Yi, Dinghua

    2013-01-01

    Background The present study investigates the effects and mechanisms of α-Lipoic acid (LA) on myocardial infarct size, cardiac function and cardiomyocyte apoptosis in rat hearts subjected to in vivo myocardial ischemia/reperfusion (MI/R) injury. Methodology/Principal Findings Male adult rats underwent 30 minutes of ischemia followed by 3, 24, or 72 h of reperfusion. Animals were pretreated with LA or vehicle before coronary artery ligation. The level of MI/R- induced LDH and CK release, infarct size, cardiomyocyte apoptosis and cardiac functional impairment were examined and compared. Western blot analysis was performed to elucidate the mechanism of LA pretreatment. The level of inflammatory cytokine TNF-α released to serum and accumulated in injured myocardium as well as neutrophil accumulation in injured myocardium were also examined after MI/R injury. Our results reveal that LA administration significantly reduced LDH and CK release, attenuated myocardial infarct size, decreased cardiomyocytes apoptosis, and partially preserved heart function. Western blot analysis showed that LA pretreatment up-regulated Akt phosphorylation and Nrf2 nuclear translocation while producing no impact on p38MAPK activation or nitric oxide (NO) production. LA pretreatment also increased expression of HO-1, a major target of Nrf2. LA treatment inhibited neutrophil accumulation and release of TNF-α. Moreover, PI3K inhibition abolished the beneficial effects of LA. Conclusions/Significance This study indicates that LA attenuates cardiac dysfunction by reducing cardiomyoctyes necrosis, apoptosis and inflammation after MI/R. LA exerts its action by activating the PI3K/Akt pathway as well as subsequent Nrf2 nuclear translocation and induction of cytoprotective genes such as HO-1. PMID:23505496

  5. Antiallodynic effects of alpha lipoic acid in an optimized RR-EAE mouse model of MS-neuropathic pain are accompanied by attenuation of upregulated BDNF-TrkB-ERK signaling in the dorsal horn of the spinal cord.

    PubMed

    Khan, Nemat; Gordon, Richard; Woodruff, Trent M; Smith, Maree T

    2015-06-01

    Neuropathic pain may affect patients with multiple sclerosis (MS) even in early disease. In an experimental autoimmune encephalomyelitis (EAE)-mouse model of MS, chronic alpha lipoic acid (ALA) treatment reduced clinical disease severity, but MS-neuropathic pain was not assessed. Hence, we investigated the pain-relieving efficacy and mode of action of ALA using our optimized relapsing-remitting (RR)-EAE mouse model of MS-associated neuropathic pain. C57BL/6 mice were immunized with MOG35-55 and adjuvants (Quil A and pertussis toxin) to induce RR-EAE; sham-mice received adjuvants only. RR-EAE mice received subcutaneous ALA (3 or 10 mg kg(-1) day(-1)) or vehicle for 21 days (15-35 d.p.i.; [days postimmunization]); sham-mice received vehicle. Hindpaw hypersensitivity was assessed blinded using von Frey filaments. Following euthanasia (day 35 d.p.i.), lumbar spinal cords were removed for immunohistochemical and molecular biological assessments. Fully developed mechanical allodynia in the bilateral hindpaws of vehicle-treated RR-EAE mice was accompanied by marked CD3(+) T-cell infiltration, microglia activation, and increased brain-derived neurotrophic factor (BDNF)-tyrosine kinase B (TrkB) signaling in the dorsal horn of the lumbar spinal cord. Consequently, phospho-ERK, a marker of central sensitization in neuropathic pain, was upregulated in the spinal dorsal horn. Importantly, hindpaw hypersensitivity was completely attenuated in RR-EAE mice administered ALA at 10 mg kg(-1) day(-1) but not 3 mg kg(-1) day(-1). The antiallodynic effect of ALA (10 mg kg(-1) day(-1)) was associated with a marked reduction in the aforementioned spinal dorsal horn markers to match their respective levels in the vehicle-treated sham-mice. Our findings suggest that ALA at 10 mg kg(-1) day(-1) produced its antiallodynic effects in RR-EAE mice by reducing augmented CD3(+) T-cell infiltration and BDNF-TrkB-ERK signaling in the spinal dorsal horn. PMID:26171221

  6. Nucleic Acid Encoding A Lectin-Derived Progenitor Cell Preservation Factor

    DOEpatents

    Colucci, M. Gabriella; Chrispeels, Maarten J.; Moore, Jeffrey G.

    2001-10-30

    The invention relates to an isolated nucleic acid molecule that encodes a protein that is effective to preserve progenitor cells, such as hematopoietic progenitor cells. The nucleic acid comprises a sequence defined by SEQ ID NO:1, a homolog thereof, or a fragment thereof. The encoded protein has an amino acid sequence that comprises a sequence defined by SEQ ID NO:2, a homolog thereof, or a fragment thereof that contains an amino acid sequence TNNVLQVT. Methods of using the encoded protein for preserving progenitor cells in vitro, ex vivo, and in vivo are also described. The invention, therefore, include methods such as myeloablation therapies for cancer treatment wherein myeloid reconstitution is facilitated by means of the specified protein. Other therapeutic utilities are also enabled through the invention, for example, expanding progenitor cell populations ex vivo to increase chances of engraftation, improving conditions for transporting and storing progenitor cells, and facilitating gene therapy to treat and cure a broad range of life-threatening hematologic diseases.

  7. Branched-chain-amino-acid biosynthesis in plants: molecular cloning and characterization of the gene encoding acetohydroxy acid isomeroreductase (ketol-acid reductoisomerase) from Arabidopsis thaliana (thale cress).

    PubMed Central

    Dumas, R; Curien, G; DeRose, R T; Douce, R

    1993-01-01

    Towards the goal of gaining a better understanding of the molecular mechanisms controlling branched-chain-amino-acid biosynthesis in plants, we have isolated, sequenced and characterized a gene encoding acetohydroxy acid isomero-reductase (ketol-acid reductoisomerase) from Arabidopsis thaliana (thale cress). Comparison between the acetohydroxy acid isomeroreductase cDNA and the genomic sequence has allowed us to determine the exon structure of the coding region. The isolated acetohydroxy acid isomeroreductase gene is distributed over approx. 4.5 kbp and contains nine introns (79-347 bp). The transcriptional start site was found to be 52 bp upstream of the translational initiation site. Southern-blot analysis of A. thaliana genomic DNA shows that the acetohydroxy acid isomeroreductase is encoded by a single-copy gene. Images Figure 3 Figure 5 PMID:8379936

  8. Nucleic acids encoding modified human immunodeficiency virus type 1 (HIV-1) group M consensus envelope glycoproteins

    DOEpatents

    Haynes, Barton F.; Gao, Feng; Korber, Bette T.; Hahn, Beatrice H.; Shaw, George M.; Kothe, Denise; Li, Ying Ying; Decker, Julie; Liao, Hua-Xin

    2011-12-06

    The present invention relates, in general, to an immunogen and, in particular, to an immunogen for inducing antibodies that neutralizes a wide spectrum of HIV primary isolates and/or to an immunogen that induces a T cell immune response. The invention also relates to a method of inducing anti-HIV antibodies, and/or to a method of inducing a T cell immune response, using such an immunogen. The invention further relates to nucleic acid sequences encoding the present immunogens.

  9. Genetically encoding photoswitchable click amino acids in Escherichia coli and mammalian cells.

    PubMed

    Hoppmann, Christian; Lacey, Vanessa K; Louie, Gordon V; Wei, Jing; Noel, Joseph P; Wang, Lei

    2014-04-01

    The ability to reversibly control protein structure and function with light would offer high spatiotemporal resolution for investigating biological processes. To confer photoresponsiveness on general proteins, we genetically incorporated a set of photoswitchable click amino acids (PSCaas), which contain both a reversible photoswitch and an additional click functional group for further modifications. Orthogonal tRNA-synthetases were evolved to genetically encode PSCaas bearing azobenzene with an alkene, keto, or benzyl chloride group in E. coli and in mammalian cells. After incorporation into calmodulin, the benzyl chloride PSCaa spontaneously generated a covalent protein bridge by reacting with a nearby cysteine residue through proximity-enabled bioreactivity. The resultant azobenzene bridge isomerized in response to light, thereby changing the conformation of calmodulin. These genetically encodable PSCaas will prove valuable for engineering photoswitchable bridges into proteins for reversible optogenetic regulation. PMID:24615769

  10. Modified pseudomonas oleovorans phaC1 nucleic acids encoding bispecific polyhydroxyalkanoate polymerase

    SciTech Connect

    Srienc, Friedrich; Jackson, John K.; Somers, David A.

    2000-01-01

    A genetically engineered Pseudomonas oleovorans phaC1 polyhydroxyalkanoate (PHA) polymerase having tailored substrate specificity is provided. The modified PHA polymerase is preferably a "bispecific" PHA polymerase capable of copolymerizing a short chain length monomer and a medium chain length monomer is provided. Methods for making the modified PHA polymerase and for making nucleic acids encoding the modified PHA polymerase are also disclosed, as are methods of producing PHA using the modified PHA polymerase. The invention further includes methods to assay for altered substrate specificity.

  11. Nucleic acids encoding plant glutamine phenylpyruvate transaminase (GPT) and uses thereof

    DOEpatents

    Unkefer, Pat J.; Anderson, Penelope S.; Knight, Thomas J.

    2016-03-29

    Glutamine phenylpyruvate transaminase (GPT) proteins, nucleic acid molecules encoding GPT proteins, and uses thereof are disclosed. Provided herein are various GPT proteins and GPT gene coding sequences isolated from a number of plant species. As disclosed herein, GPT proteins share remarkable structural similarity within plant species, and are active in catalyzing the synthesis of 2-hydroxy-5-oxoproline (2-oxoglutaramate), a powerful signal metabolite which regulates the function of a large number of genes involved in the photosynthesis apparatus, carbon fixation and nitrogen metabolism.

  12. Nucleic acid encoding DS-CAM proteins and products related thereto

    SciTech Connect

    Korenberg, Julie R.

    2005-11-01

    In accordance with the present invention, there are provided Down Syndrome-Cell Adhesion Molecule (DS-CAM) proteins. Nucleic acid sequences encoding such proteins and assays employing same are also disclosed. The invention DS-CAM proteins can be employed in a variety of ways, for example, for the production of anti-DS-CAM antibodies thereto, in therapeutic compositions and methods employing such proteins and/or antibodies. DS-CAM proteins are also useful in bioassays to identify agonists and antagonists thereto.

  13. Molecular dynamics simulations data of the twenty encoded amino acids in different force fields.

    PubMed

    Vitalini, F; Noé, F; Keller, B G

    2016-06-01

    We present extensive all-atom Molecular Dynamics (MD) simulation data of the twenty encoded amino acids in explicit water, simulated with different force fields. The termini of the amino acids have been capped to ensure that the dynamics of the Φ and ψ torsion angles are analogues to the dynamics within a peptide chain. We use representatives of each of the four major force field families: AMBER ff-99SBILDN [1], AMBER ff-03 [2], OPLS-AA/L [3], CHARMM27 [4] and GROMOS43a1 [5], [6]. Our data represents a library and test bed for method development for MD simulations and for force fields development. Part of the data set has been previously used for comparison of the dynamic properties of force fields (Vitalini et al., 2015) [7] and for the construction of peptide basis functions for the variational approach to molecular kinetics [8]. PMID:27054161

  14. Molecular dynamics simulations data of the twenty encoded amino acids in different force fields

    PubMed Central

    Vitalini, F.; Noé, F.; Keller, B.G.

    2016-01-01

    We present extensive all-atom Molecular Dynamics (MD) simulation data of the twenty encoded amino acids in explicit water, simulated with different force fields. The termini of the amino acids have been capped to ensure that the dynamics of the Φ and ψ torsion angles are analogues to the dynamics within a peptide chain. We use representatives of each of the four major force field families: AMBER ff-99SBILDN [1], AMBER ff-03 [2], OPLS-AA/L [3], CHARMM27 [4] and GROMOS43a1 [5], [6]. Our data represents a library and test bed for method development for MD simulations and for force fields development. Part of the data set has been previously used for comparison of the dynamic properties of force fields (Vitalini et al., 2015) [7] and for the construction of peptide basis functions for the variational approach to molecular kinetics [8]. PMID:27054161

  15. Molecular analysis of two cDNA clones encoding acidic class I chitinase in maize.

    PubMed Central

    Wu, S; Kriz, A L; Widholm, J M

    1994-01-01

    The cloning and analysis of two different cDNA clones encoding putative maize (Zea mays L.) chitinases obtained by polymerase chain reaction (PCR) and cDNA library screening is described. The cDNA library was made from poly(A)+ RNA from leaves challenged with mercuric chloride for 2 d. The two clones, pCh2 and pCh11, appear to encode class I chitinase isoforms with cysteine-rich domains (not found in pCh11 due to the incomplete sequence) and proline-/glycine-rich or proline-rich hinge domains, respectively. The pCh11 clone resembles a previously reported maize seed chitinase; however, the deduced proteins were found to have acidic isoelectric points. Analysis of all monocot chitinase sequences available to date shows that not all class I chitinases possess the basic isoelectric points usually found in dicotyledonous plants and that monocot class II chitinases do not necessarily exhibit acidic isoelectric points. Based on sequence analysis, the pCh2 protein is apparently synthesized as a precursor polypeptide with a signal peptide. Although these two clones belong to class I chitinases, they share only about 70% amino acid homology in the catalytic domain region. Southern blot analysis showed that pCh2 may be encoded by a small gene family, whereas pCh11 was single copy. Northern blot analysis demonstrated that these genes are differentially regulated by mercuric chloride treatment. Mercuric chloride treatment caused rapid induction of pCh2 from 6 to 48 h, whereas pCh11 responded only slightly to the same treatment. During seed germination, embryos constitutively expressed both chitinase genes and the phytohormone abscisic acid had no effect on the expression. The fungus Aspergillus flavus was able to induce both genes to comparable levels in aleurone layers and embryos but not in endosperm tissue. Maize callus growth on the same plate with A. flavus for 1 week showed induction of the transcripts corresponding to pCh2 but not to pCh11. These studies indicate that

  16. Nucleic acid molecules encoding isopentenyl monophosphate kinase, and methods of use

    DOEpatents

    Croteau, Rodney B.; Lange, Bernd M.

    2001-01-01

    A cDNA encoding isopentenyl monophosphate kinase (IPK) from peppermint (Mentha x piperita) has been isolated and sequenced, and the corresponding amino acid sequence has been determined. Accordingly, an isolated DNA sequence (SEQ ID NO:1) is provided which codes for the expression of isopentenyl monophosphate kinase (SEQ ID NO:2), from peppermint (Mentha x piperita). In other aspects, replicable recombinant cloning vehicles are provided which code for isopentenyl monophosphate kinase, or for a base sequence sufficiently complementary to at least a portion of isopentenyl monophosphate kinase DNA or RNA to enable hybridization therewith. In yet other aspects, modified host cells are provided that have been transformed, transfected, infected and/or injected with a recombinant cloning vehicle and/or DNA sequence encoding isopentenyl monophosphate kinase. Thus, systems and methods are provided for the recombinant expression of the aforementioned recombinant isopentenyl monophosphate kinase that may be used to facilitate its production, isolation and purification in significant amounts. Recombinant isopentenyl monophosphate kinase may be used to obtain expression or enhanced expression of isopentenyl monophosphate kinase in plants in order to enhance the production of isopentenyl monophosphate kinase, or isoprenoids derived therefrom, or may be otherwise employed for the regulation or expression of isopentenyl monophosphate kinase, or the production of its products.

  17. Genetically Encoding an Electrophilic Amino Acid for Protein Stapling and Covalent Binding to Native Receptors

    PubMed Central

    2015-01-01

    Covalent bonds can be generated within and between proteins by an unnatural amino acid (Uaa) reacting with a natural residue through proximity-enabled bioreactivity. Until now, Uaas have been developed to react mainly with cysteine in proteins. Here we genetically encoded an electrophilic Uaa capable of reacting with histidine and lysine, thereby expanding the diversity of target proteins and the scope of the proximity-enabled protein cross-linking technology. In addition to efficient cross-linking of proteins inter- and intramolecularly, this Uaa permits direct stapling of a protein α-helix in a recombinant manner and covalent binding of native membrane receptors in live cells. The target diversity, recombinant stapling, and covalent targeting of endogenous proteins enabled by this versatile Uaa should prove valuable in developing novel research tools, biological diagnostics, and therapeutics by exploiting covalent protein linkages for specificity, irreversibility, and stability. PMID:25010185

  18. The fatty acid desaturase 3 gene encodes for different FADS3 protein isoforms in mammalian tissues

    PubMed Central

    Pédrono, Frédérique; Blanchard, Hélène; Kloareg, Maela; D'andréa, Sabine; Daval, Stéphanie; Rioux, Vincent; Legrand, Philippe

    2010-01-01

    In 2000, Marquardt et al. (A. Marquardt, H. Stöhr, K. White, and B. H. F. Weber. 2000. cDNA cloning, genomic structure, and chromosomal localization of three members of the human fatty acid desaturase family. Genomics. 66: 176–183.) described the genomic structure of the fatty acid desaturase (FADS) cluster in humans. This cluster includes the FADS1 and FADS2 genes encoding, respectively, for the Δ5- and Δ6-desaturases involved in polyunsaturated fatty acid biosynthesis. A third gene, named FADS3, has recently been identified but no functional role has yet been attributed to the putative FADS3 protein. In this study, we investigated the FADS3 occurrence in rat tissues by using two specific polyclonal antibodies directed against the N-terminal and C-terminal ends of rat FADS3. Our results showed three potential protein isoforms of FADS3 (75 kDa, 51 kDa, and 37 kDa) present in a tissue-dependent manner. The occurrence of these FADS3 isoforms did not depend on the mRNA level determined by real-time PCR. In parallel, mouse tissues were also tested and showed the same three FADS3 isoforms but with a different tissue distribution. Finally, we reported the existence of FADS3 in human cells and tissues but different new isoforms were identified. To conclude, we showed in this study that FADS3 does exist under multiple protein isoforms depending on the mammalian tissues. These results will help further investigations to determine the physiological function of FADS3. PMID:19752397

  19. Identification and functional characterization of genes encoding omega-3 polyunsaturated fatty acid biosynthetic activities from unicellular microalgae.

    PubMed

    Vaezi, Royah; Napier, Johnathan A; Sayanova, Olga

    2013-12-01

    In order to identify novel genes encoding enzymes involved in the biosynthesis of nutritionally important omega-3 long chain polyunsaturated fatty acids, a database search was carried out in the genomes of the unicellular photoautotrophic green alga Ostreococcus RCC809 and cold-water diatom Fragilariopsis cylindrus. The search led to the identification of two putative "front-end" desaturases (Δ6 and Δ4) from Ostreococcus RCC809 and one Δ6-elongase from F. cylindrus. Heterologous expression of putative open reading frames (ORFs) in yeast revealed that the encoded enzyme activities efficiently convert their respective substrates: 54.1% conversion of α-linolenic acid for Δ6-desaturase, 15.1% conversion of 22:5n-3 for Δ4-desaturase and 38.1% conversion of γ-linolenic acid for Δ6-elongase. The Δ6-desaturase from Ostreococcus RCC809 displays a very strong substrate preference resulting in the predominant synthesis of stearidonic acid (C18:4Δ6,9,12,15). These data confirm the functional characterization of omega-3 long chain polyunsaturated fatty acid biosynthetic genes from these two species which have until now not been investigated for such activities. The identification of these new genes will also serve to expand the repertoire of activities available for metabolically engineering the omega-3 trait in heterologous hosts as well as providing better insights into the synthesis of eicosapentaenoic acid (EPA) and docosahexaenoic acid (DHA) in marine microalgae. PMID:24351909

  20. Identification and Functional Characterization of Genes Encoding Omega-3 Polyunsaturated Fatty Acid Biosynthetic Activities from Unicellular Microalgae

    PubMed Central

    Vaezi, Royah; Napier, Johnathan A.; Sayanova, Olga

    2013-01-01

    In order to identify novel genes encoding enzymes involved in the biosynthesis of nutritionally important omega-3 long chain polyunsaturated fatty acids, a database search was carried out in the genomes of the unicellular photoautotrophic green alga Ostreococcus RCC809 and cold-water diatom Fragilariopsis cylindrus. The search led to the identification of two putative “front-end” desaturases (Δ6 and Δ4) from Ostreococcus RCC809 and one Δ6-elongase from F. cylindrus. Heterologous expression of putative open reading frames (ORFs) in yeast revealed that the encoded enzyme activities efficiently convert their respective substrates: 54.1% conversion of α-linolenic acid for Δ6-desaturase, 15.1% conversion of 22:5n-3 for Δ4-desaturase and 38.1% conversion of γ-linolenic acid for Δ6-elongase. The Δ6-desaturase from Ostreococcus RCC809 displays a very strong substrate preference resulting in the predominant synthesis of stearidonic acid (C18:4Δ6,9,12,15). These data confirm the functional characterization of omega-3 long chain polyunsaturated fatty acid biosynthetic genes from these two species which have until now not been investigated for such activities. The identification of these new genes will also serve to expand the repertoire of activities available for metabolically engineering the omega-3 trait in heterologous hosts as well as providing better insights into the synthesis of eicosapentaenoic acid (EPA) and docosahexaenoic acid (DHA) in marine microalgae. PMID:24351909

  1. Relative Catalytic Efficiency of ldhL- and ldhD-Encoded Products Is Crucial for Optical Purity of Lactic Acid Produced by Lactobacillus Strains

    PubMed Central

    Zheng, Zhaojuan; Sheng, Binbin; Zhang, Haiwei; Gao, Chao; Su, Fei

    2012-01-01

    NAD-dependent l- and d-lactate dehydrogenases coexist in Lactobacillus genomes and may convert pyruvic acid into l-lactic acid and d-lactic acid, respectively. Our findings suggest that the relative catalytic efficiencies of ldhL- and ldhD-encoded products are crucial for the optical purity of lactic acid produced by Lactobacillus strains. PMID:22344644

  2. Garlic and alpha lipoic supplementation enhance the immune system of albino rats and alleviate implications of pesticides mixtures

    PubMed Central

    Elhalwagy, Manal EA; Darwish, Nevine S; Shokry, Dina A; El-Aal, Aly GE Abd; Abd-Alrahman, Sherif H; Nahas, Abd-Alhamed; Ziada, Reem M

    2015-01-01

    This study aimed to investigate age dependent immune-system response versus exposure to different doses of mixture of (chlorpyrifos, profenofose, and fenitrothion) and/or combined with 60 and 250 mg kg-1 alpha lipoic acid and garlic, respectively. 120 males of albino rats were divided to two groups according to age; weaning group (2 months age and 60-80 gm.), adult (6 months and 180-200 gm). Each age was divided into 6 subgroups treated orally for 3 months , G1 (control), G2 high dose (HDPM) CPF10 mg kg-1, PRO 3 mg kg-1, FEN 6 mg kg-1, G3 low dose (LDPM) CPF 1 mg kg-1, PFN 0.3 mg kg-1 and FEN 0.6 mg kg-1, G4 AOX (alpha lipoic + Garlic), G5 HDPM + AOX and G6 LDPM + AOX. Results showed significant inhibition in serum acetylcholinesterase (AChE), elevation in malondialdehyde (MDA) concurrent with reduction in total reduced glutathione (GSH) in both ages was recorded as well as, decrease in IGG, IGM, Lymphocyte transformation and Phagocytosis humeral and cellular immunity confirmed by alteration in lymph nodes architecture. This study was concluded that the supplementation with alpha lipoic acid and garlic improved previous alternations slightly to be more or less near the control level in both adult and weaning rats. It seems that, immune-responses of both adult and weaning rats were slightly similar. PMID:26221319

  3. Chlorophenol hydroxylases encoded by plasmid pJP4 differentially contribute to chlorophenoxyacetic acid degradation.

    PubMed

    Ledger, T; Pieper, D H; González, B

    2006-04-01

    Phenoxyalkanoic compounds are used worldwide as herbicides. Cupriavidus necator JMP134(pJP4) catabolizes 2,4-dichlorophenoxyacetate (2,4-D) and 4-chloro-2-methylphenoxyacetate (MCPA), using tfd functions carried on plasmid pJP4. TfdA cleaves the ether bonds of these herbicides to produce 2,4-dichlorophenol (2,4-DCP) and 4-chloro-2-methylphenol (MCP), respectively. These intermediates can be degraded by two chlorophenol hydroxylases encoded by the tfdB(I) and tfdB(II) genes to produce the respective chlorocatechols. We studied the specific contribution of each of the TfdB enzymes to the 2,4-D/MCPA degradation pathway. To accomplish this, the tfdB(I) and tfdB(II) genes were independently inactivated, and growth on each chlorophenoxyacetate and total chlorophenol hydroxylase activity were measured for the mutant strains. The phenotype of these mutants shows that both TfdB enzymes are used for growth on 2,4-D or MCPA but that TfdB(I) contributes to a significantly higher extent than TfdB(II). Both enzymes showed similar specificity profiles, with 2,4-DCP, MCP, and 4-chlorophenol being the best substrates. An accumulation of chlorophenol was found to inhibit chlorophenoxyacetate degradation, and inactivation of the tfdB genes enhanced the toxic effect of 2,4-DCP on C. necator cells. Furthermore, increased chlorophenol production by overexpression of TfdA also had a negative effect on 2,4-D degradation by C. necator JMP134 and by a different host, Burkholderia xenovorans LB400, harboring plasmid pJP4. The results of this work indicate that codification and expression of the two tfdB genes in pJP4 are important to avoid toxic accumulations of chlorophenols during phenoxyacetic acid degradation and that a balance between chlorophenol-producing and chlorophenol-consuming reactions is necessary for growth on these compounds. PMID:16597983

  4. Cellulases, nucleic acids encoding them and methods for making and using them

    DOEpatents

    Blum, David; Gemsch Cuenca, Joslin; Dycaico, Mark

    2013-04-23

    This invention relates to molecular and cellular biology and biochemistry. In one aspect, the invention provides polypeptides having cellulase activity, e.g., endoglucanase, cellobiohydrolase, mannanase and/or .beta.-glucosidase activity, polynucleotides encoding these polypeptides, and methods of making and using these polynucleotides and polypeptides. In one aspect, the invention is directed to polypeptides cellulase activity, e.g., endoglucanase, cellobiohydrolase, mannanase and/or .beta.-glucosidase activity, including thermostable and thermotolerant activity, and polynucleotides encoding these enzymes, and making and using these polynucleotides and polypeptides. The polypeptides of the invention can be used in a variety of pharmaceutical, agricultural, food and feed processing and industrial contexts.

  5. Methods of combined bioprocessing and related microorganisms, thermophilic and/or acidophilic enzymes, and nucleic acids encoding said enzymes

    DOEpatents

    Thompson, David N; Apel, William A; Thompson, Vicki S; Ward, Thomas E

    2013-07-23

    A genetically modified organism comprising: at least one nucleic acid sequence and/or at least one recombinant nucleic acid isolated from Alicyclobacillus acidocaldarius and encoding a polypeptide involved in at least partially degrading, cleaving, transporting, metabolizing, or removing polysaccharides, cellulose, lignocellulose, hemicellulose, lignin, starch, sugars, sugar oligomers, carbohydrates, complex carbohydrates, chitin, heteroxylans, glycosides, xylan-, glucan-, galactan-, or mannan-decorating groups; and at least one nucleic acid sequence and/or at least one recombinant nucleic acid encoding a polypeptide involved in fermenting sugar molecules to a product. Additionally, enzymatic and/or proteinaceous extracts may be isolated from one or more genetically modified organisms. The extracts are utilized to convert biomass into a product. Further provided are methods of converting biomass into products comprising: placing the genetically modified organism and/or enzymatic extracts thereof in fluid contact with polysaccharides, cellulose, lignocellulose, hemicellulose, lignin, starch, sugars, sugar oligomers, carbohydrates, complex carbohydrates, chitin, heteroxylans, glycosides, and/or xylan-, glucan-, galactan-, or mannan-decorating groups.

  6. Methods of combined bioprocessing and related microorganisms, thermophilic and/or acidophilic enzymes, and nucleic acids encoding said enzymes

    DOEpatents

    Thompson, David N; Apel, William A; Thompson, Vicki S; Ward, Thomas E

    2014-04-08

    A genetically modified organism comprising: at least one nucleic acid sequence and/or at least one recombinant nucleic acid isolated from Alicyclobacillus acidocaldarius and encoding a polypeptide involved in at least partially degrading, cleaving, transporting, metabolizing, or removing polysaccharides, cellulose, lignocellulose, hemicellulose, lignin, starch, sugars, sugar oligomers, carbohydrates, complex carbohydrates, chitin, heteroxylans, glycosides, xylan-, glucan-, galactan-, or mannan-decorating groups; and at least one nucleic acid sequence and/or at least one recombinant nucleic acid encoding a polypeptide involved in fermenting sugar molecules to a product. Additionally, enzymatic and/or proteinaceous extracts may be isolated from one or more genetically modified organisms. The extracts are utilized to convert biomass into a product. Further provided are methods of converting biomass into products comprising: placing the genetically modified organism and/or enzymatic extracts thereof in fluid contact with polysaccharides, cellulose, lignocellulose, hemicellulose, lignin, starch, sugars, sugar oligomers, carbohydrates, complex carbohydrates, chitin, heteroxylans, glycosides, and/or xylan-, glucan-, galactan-, or mannan-decorating groups.

  7. Methods of combined bioprocessing and related microorganisms, thermophilic and/or acidophilic enzymes, and nucleic acids encoding said enzymes

    DOEpatents

    Thompson, David N.; Apel, William A.; Thompson, Vicki S.; Ward, Thomas E.

    2016-03-22

    A genetically modified organism comprising: at least one nucleic acid sequence and/or at least one recombinant nucleic acid isolated from Alicyclobacillus acidocaldarius and encoding a polypeptide involved in at least partially degrading, cleaving, transporting, metabolizing, or removing polysaccharides, cellulose, lignocellulose, hemicellulose, lignin, starch, sugars, sugar oligomers, carbohydrates, complex carbohydrates, chitin, heteroxylans, glycosides, xylan-, glucan-, galactan-, or mannan-decorating groups; and at least one nucleic acid sequence and/or at least one recombinant nucleic acid encoding a polypeptide involved in fermenting sugar molecules to a product. Additionally, enzymatic and/or proteinaceous extracts may be isolated from one or more genetically modified organisms. The extracts are utilized to convert biomass into a product. Further provided are methods of converting biomass into products comprising: placing the genetically modified organism and/or enzymatic extracts thereof in fluid contact with polysaccharides, cellulose, lignocellulose, hemicellulose, lignin, starch, sugars, sugar oligomers, carbohydrates, complex carbohydrates, chitin, heteroxylans, glycosides, and/or xylan-, glucan-, galactan-, or mannan-decorating groups.

  8. The oxalic acid biosynthetic activity of Burkholderia mallei is encoded by a single locus

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Although it is known that oxalic acid provides a selective advantage to the secreting microbe, our understanding of how this acid is biosynthesized remains incomplete. This study reports the identification, cloning, and partial characterization of the oxalic acid biosynthetic enzyme from the animal ...

  9. Molecular mapping of genes encoding microsomal omega-6 desaturase enzymes and their cosegregation with QTL affecting oleic acid content in soybean

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The microsomal omega-6 desaturase enzymes, which catalyze the desaturation of oleic acid to linoleic acid during fatty acid biosynthesis, are encoded by the FAD2-1 and FAD2-2 genes in soybeans. Breeders aim to incorporate the high oleate trait into soybean germplasm in order to improve the nutrition...

  10. Identification of an Amino Acid Domain Encoded by the Capsid Protein Gene of Porcine Circovirus Type 2 that Modulates Viral Protein Distribution During Replication

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Previous work showed that distinct amino acid motifs are encoded by the Rep, Cap and ORF3 genes of two subgroups of porcine circoviruses (PCV), PCV2a and PCV2b. At a specific location of the gene, a certain amino acid residue or sequence is preferred. Specifically, two amino acid domains located in ...

  11. Nucleic acids encoding phloem small RNA-binding proteins and transgenic plants comprising them

    DOEpatents

    Lucas, William J.; Yoo, Byung-Chun; Lough, Tony J.; Varkonyi-Gasic, Erika

    2007-03-13

    The present invention provides a polynucleotide sequence encoding a component of the protein machinery involved in small RNA trafficking, Cucurbita maxima phloem small RNA-binding protein (CmPSRB 1), and the corresponding polypeptide sequence. The invention also provides genetic constructs and transgenic plants comprising the polynucleotide sequence encoding a phloem small RNA-binding protein to alter (e.g., prevent, reduce or elevate) non-cell autonomous signaling events in the plants involving small RNA metabolism. These signaling events are involved in a broad spectrum of plant physiological and biochemical processes, including, for example, systemic resistance to pathogens, responses to environmental stresses, e.g., heat, drought, salinity, and systemic gene silencing (e.g., viral infections).

  12. Deletion of the Saccharomyces cerevisiae ARO8 gene, encoding an aromatic amino acid transaminase, enhances phenylethanol production from glucose.

    PubMed

    Romagnoli, Gabriele; Knijnenburg, Theo A; Liti, Gianni; Louis, Edward J; Pronk, Jack T; Daran, Jean-Marc

    2015-01-01

    Phenylethanol has a characteristic rose-like aroma that makes it a popular ingredient in foods, beverages and cosmetics. Microbial production of phenylethanol currently relies on whole-cell bioconversion of phenylalanine with yeasts that harbour an Ehrlich pathway for phenylalanine catabolism. Complete biosynthesis of phenylethanol from a cheap carbon source, such as glucose, provides an economically attractive alternative for phenylalanine bioconversion. In this study, synthetic genetic array (SGA) screening was applied to identify genes involved in regulation of phenylethanol synthesis in Saccharomyces cerevisiae. The screen focused on transcriptional regulation of ARO10, which encodes the major decarboxylase involved in conversion of phenylpyruvate to phenylethanol. A deletion in ARO8, which encodes an aromatic amino acid transaminase, was found to underlie the transcriptional upregulation of ARO10 during growth, with ammonium sulphate as the sole nitrogen source. Physiological characterization revealed that the aro8Δ mutation led to substantial changes in the absolute and relative intracellular concentrations of amino acids. Moreover, deletion of ARO8 led to de novo production of phenylethanol during growth on a glucose synthetic medium with ammonium as the sole nitrogen source. The aro8Δ mutation also stimulated phenylethanol production when combined with other, previously documented, mutations that deregulate aromatic amino acid biosynthesis in S. cerevisiae. The resulting engineered S. cerevisiae strain produced >3 mm phenylethanol from glucose during growth on a simple synthetic medium. The strong impact of a transaminase deletion on intracellular amino acid concentrations opens new possibilities for yeast-based production of amino acid-derived products. PMID:24733517

  13. TaOPR2 encodes a 12-oxo-phytodienoic acid reductase involved in the biosynthesis of jasmonic acid in wheat (Triticum aestivum L.).

    PubMed

    Wang, Yukun; Yuan, Guoliang; Yuan, Shaohua; Duan, Wenjing; Wang, Peng; Bai, Jianfang; Zhang, Fengting; Gao, Shiqing; Zhang, Liping; Zhao, Changping

    2016-01-29

    The 12-oxo-phytodienoic acid reductases (OPRs) are involved in the various processes of growth and development in plants, and classified into the OPRⅠ and OPRⅡ subgroups. In higher plants, only OPRⅡ subgroup genes take part in the biosynthesis of endogenous jasmonic acid. In this study, we isolated a novel OPRⅡ subgroup gene named TaOPR2 (GeneBank accession: KM216389) from the thermo-sensitive genic male sterile (TGMS) wheat cultivar BS366. TaOPR2 was predicted to encode a protein with 390 amino acids. The encoded protein contained the typical oxidored_FMN domain, the C-terminus peroxisomal-targeting signal peptide, and conserved FMN-binding sites. TaOPR2 was mapped to wheat chromosome 7B and located on peroxisome. Protein evolution analysis revealed that TaOPR2 belongs to the OPRⅡ subgroup and shares a high degree of identity with other higher plant OPR proteins. The quantitative real-time PCR results indicated that the expression of TaOPR2 is inhibited by abscisic acid (ABA), salicylic acid (SA), gibberellic acid (GA3), low temperatures and high salinity. In contrast, the expression of TaOPR2 can be induced by wounding, drought and methyl jasmonate (MeJA). Furthermore, the transcription level of TaOPR2 increased after infection with Puccinia striiformis f. sp. tritici and Puccinia recondite f. sp. tritici. TaOPR2 has NADPH-dependent oxidoreductase activity. In addition, the constitutive expression of TaOPR2 can rescue the male sterility phenotype of Arabidopsis mutant opr3. These results suggest that TaOPR2 is involved in the biosynthesis of jasmonic acid (JA) in wheat. PMID:26778003

  14. Oxalic acid biosynthesis is encoded by an operon in Burkholderia glumae

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Although the biosynthesis of oxalic acid is known to occur in a number of bacteria, the mechanism(s) regulating its production remains largely unknown. To date, there is no report on the identification of an oxalic acid biosynthetic pathway gene from bacteria. In an attempt to identify such a gene...

  15. Celluloytic enzymes, nucleic acids encoding them and methods for making and using them

    SciTech Connect

    Gray, Kevin A; Zhao, Lishan; Cayouette, Michelle H

    2015-11-04

    The invention is directed to polypeptides having any cellulolytic activity, e.g., a cellulase activity, e.g., endoglucanase, cellobiohydrolase, beta-glucosidase, xylanase, mannanse, .beta.-xylosidase, arabinofuranosidase, and/or oligomerase activity, including thermostable and thermotolerant activity, and polynucleotides encoding these enzymes, and making and using these polynucleotides and polypeptides. The polypeptides of the invention can be used in a variety of pharmaceutical, agricultural, food and feed processing and industrial contexts. The invention also provides compositions or products of manufacture comprising mixtures of enzymes comprising at least one enzyme of this invention.

  16. Celluloytic enzymes, nucleic acids encoding them and methods for making and using them

    SciTech Connect

    Gray, Kevin A.; Zhao, Lishan; Cayouette, Michelle H.

    2015-09-08

    The invention is directed to polypeptides having any cellulolytic activity, e.g., a cellulase activity, e.g., endoglucanase, cellobiohydrolase, beta-glucosidase, xylanase, mannanse, .beta.-xylosidase, arabinofuranosidase, and/or oligomerase activity, including thermostable and thermotolerant activity, and polynucleotides encoding these enzymes, and making and using these polynucleotides and polypeptides. The polypeptides of the invention can be used in a variety of pharmaceutical, agricultural, food and feed processing and industrial contexts. The invention also provides compositions or products of manufacture comprising mixtures of enzymes comprising at least one enzyme of this invention.

  17. Cloning and characterization of a complementary deoxyribonucleic acid encoding haploid-specific alanine-rich acidic protein located on chromosome-X.

    PubMed

    Uchida, K; Tsuchida, J; Tanaka, H; Koga, M; Nishina, Y; Nozaki, M; Yoshinaga, K; Toshimori, K; Matsumiya, K; Okuyama, A; Nishimune, Y

    2000-10-01

    We have isolated a cDNA clone encoding a germ cell-specific protein from an expression cDNA library prepared from the mouse testis using testis-specific polyclonal antibodies. Northern blot analysis showed a transcript of 1.1 kilobases exclusively expressed in haploid germ cells of the testis. Sequence analysis of the cDNA revealed one long open reading frame consisting of 238 deduced amino acids, rich in basic amino acids in the N-terminal one-third that also contained the nuclear localization signal, and rich in acidic amino acids, including two type of acidic alanine-rich repeats, in the rest of the deduced protein. The protein having a molecular weight of approximately 55 kDa and an isoelectric point of pH 4.3-4.7 was also exclusively detected in the testis by Western blot analysis. As the cDNA was located on chromosome-X, Halap-X (haploid-specific alanine-rich acidic protein located on chromosome-X) was proposed for the name of the protein encoded by the cDNA. Immunohistochemical observation revealed that the Halap-X protein was predominantly present in the nucleoplasm of round spermatids but gradually decreased as spermatids matured, followed by the subsequent appearance in the cytoplasm of elongating spermatids. Thus, the Halap-X protein was transferred from the nuclei to the cytoplasm during the spermatid maturation when the chromatin condensation and transformation of the nuclei occurred. The Halap-X may facilitate specific association of nuclear DNA with some basic chromosomal proteins and play important roles in the process of chromatin condensation. PMID:10993819

  18. The maize (Zea mays ssp. mays var. B73) genome encodes 33 members of the purple acid phosphatase family.

    PubMed

    González-Muñoz, Eliécer; Avendaño-Vázquez, Aida-Odette; Montes, Ricardo A Chávez; de Folter, Stefan; Andrés-Hernández, Liliana; Abreu-Goodger, Cei; Sawers, Ruairidh J H

    2015-01-01

    Purple acid phosphatases (PAPs) play an important role in plant phosphorus nutrition, both by liberating phosphorus from organic sources in the soil and by modulating distribution within the plant throughout growth and development. Furthermore, members of the PAP protein family have been implicated in a broader role in plant mineral homeostasis, stress responses and development. We have identified 33 candidate PAP encoding gene models in the maize (Zea mays ssp. mays var. B73) reference genome. The maize Pap family includes a clear single-copy ortholog of the Arabidopsis gene AtPAP26, shown previously to encode both major intracellular and secreted acid phosphatase activities. Certain groups of PAPs present in Arabidopsis, however, are absent in maize, while the maize family contains a number of expansions, including a distinct radiation not present in Arabidopsis. Analysis of RNA-sequencing based transcriptome data revealed accumulation of maize Pap transcripts in multiple plant tissues at multiple stages of development, and increased accumulation of specific transcripts under low phosphorus availability. These data suggest the maize PAP family as a whole to have broad significance throughout the plant life cycle, while highlighting potential functional specialization of individual family members. PMID:26042133

  19. The maize (Zea mays ssp. mays var. B73) genome encodes 33 members of the purple acid phosphatase family

    PubMed Central

    González-Muñoz, Eliécer; Avendaño-Vázquez, Aida-Odette; Montes, Ricardo A. Chávez; de Folter, Stefan; Andrés-Hernández, Liliana; Abreu-Goodger, Cei; Sawers, Ruairidh J. H.

    2015-01-01

    Purple acid phosphatases (PAPs) play an important role in plant phosphorus nutrition, both by liberating phosphorus from organic sources in the soil and by modulating distribution within the plant throughout growth and development. Furthermore, members of the PAP protein family have been implicated in a broader role in plant mineral homeostasis, stress responses and development. We have identified 33 candidate PAP encoding gene models in the maize (Zea mays ssp. mays var. B73) reference genome. The maize Pap family includes a clear single-copy ortholog of the Arabidopsis gene AtPAP26, shown previously to encode both major intracellular and secreted acid phosphatase activities. Certain groups of PAPs present in Arabidopsis, however, are absent in maize, while the maize family contains a number of expansions, including a distinct radiation not present in Arabidopsis. Analysis of RNA-sequencing based transcriptome data revealed accumulation of maize Pap transcripts in multiple plant tissues at multiple stages of development, and increased accumulation of specific transcripts under low phosphorus availability. These data suggest the maize PAP family as a whole to have broad significance throughout the plant life cycle, while highlighting potential functional specialization of individual family members. PMID:26042133

  20. Cellulolytic enzymes, nucleic acids encoding them and methods for making and using them

    DOEpatents

    Gray, Kevin A.; Zhao, Lishan; Cayouette, Michelle H.

    2012-01-24

    The invention provides polypeptides having any cellulolytic activity, e.g., a cellulase activity, a endoglucanase, a cellobiohydrolase, a beta-glucosidase, a xylanase, a mannanse, a .beta.-xylosidase, an arabinofuranosidase, and/or an oligomerase activity, polynucleotides encoding these polypeptides, and methods of making and using these polynucleotides and polypeptides. In one aspect, the invention is directed to polypeptides having any cellulolytic activity, e.g., a cellulase activity, e.g., endoglucanase, cellobiohydrolase, beta-glucosidase, xylanase, mannanse, .beta.-xylosidase, arabinofuranosidase, and/or oligomerase activity, including thermostable and thermotolerant activity, and polynucleotides encoding these enzymes, and making and using these polynucleotides and polypeptides. In one aspect, the invention provides polypeptides having an oligomerase activity, e.g., enzymes that convert recalcitrant soluble oligomers to fermentable sugars in the saccharification of biomass. The polypeptides of the invention can be used in a variety of pharmaceutical, agricultural, food and feed processing and industrial contexts. The invention also provides compositions or products of manufacture comprising mixtures of enzymes comprising at least one enzyme of this invention.

  1. Electrophile-modified lipoic derivatives of PDC-E2 elicits anti-mitochondrial antibody reactivity.

    PubMed

    Naiyanetr, Phornnop; Butler, Jeffrey D; Meng, Liping; Pfeiff, Janice; Kenny, Thomas P; Guggenheim, Kathryn G; Reiger, Roman; Lam, Kit; Kurth, Mark J; Ansari, Aftab A; Coppel, Ross L; López-Hoyos, Marcos; Gershwin, M Eric; Leung, Patrick S C

    2011-11-01

    Our laboratory has hypothesized that xenobiotic modification of the native lipoyl moiety of the major mitochondrial autoantigen, the E2 subunit of the pyruvate dehydrogenase complex (PDC-E2), may lead to loss of self-tolerance in primary biliary cirrhosis (PBC). This thesis is based on the finding of readily detectable levels of immunoreactivity of PBC sera against extensive panels of protein microarrays containing mimics of the inner lipoyl domain of PDC-E2 and subsequent quantitative structure-activity relationships (QSARs). Importantly, we have demonstrated that murine immunization with one such mimic, 2-octynoic acid coupled to bovine serum albumin (BSA), induces anti-mitochondrial antibodies (AMAs) and cholangitis. Based upon these data, we have focused on covalent modifications of the lipoic acid disulfide ring and subsequent analysis of such xenobiotics coupled to a 15mer of PDC-E2 for immunoreactivity against a broad panel of sera from patients with PBC and controls. Our results demonstrate that AMA-positive PBC sera demonstrate marked reactivity against 6,8-bis(acetylthio)octanoic acid, implying that chemical modification of the lipoyl ring, i.e. disruption of the S-S disulfide, renders lipoic acid to its reduced form that will promote xenobiotic modification. This observation is particularly significant in light of the function of the lipoyl moiety in electron transport of which the catalytic disulfide constantly opens and closes and, thus, raises the intriguing thesis that common electrophilic agents, i.e. acetaminophen or non-steroidal anti-inflammatory drugs (NSAIDs), may lead to xenobiotic modification in genetically susceptible individuals that results in the generation of AMAs and ultimately clinical PBC. PMID:21763105

  2. Electrophile-Modified Lipoic Derivatives of PDC-E2 Elicits Anti-mitochondrial Antibody Reactivity

    PubMed Central

    Naiyanetr, Phornnop; Butler, Jeffrey D.; Meng, Liping; Pfeiff, Janice; Kenny, Thomas P.; Guggenheim, Kathryn G.; Reiger, Roman; Lam, Kit; Kurth, Mark J.; Ansari, Aftab. A.; Coppel, Ross L.; López-Hoyos, Marcos; Gershwin, M. Eric; Leung, Patrick S.C.

    2011-01-01

    Our laboratory has hypothesized that xenobiotic modification of the native lipoyl moiety of the major mitochondrial autoantigen, the E2 subunit of the pyruvate dehydrogenase complex (PDC-E2), may lead to loss of self-tolerance in primary biliary cirrhosis (PBC). This thesis is based on the finding of readily detectable levels of immunoreactivity of PBC sera against extensive panels of protein microarrays containing mimics of the inner lipoyl domain of PDC-E2 and subsequent quantitative structure-activity relationships (QSARs). Importantly, we have demonstrated that murine immunization with one such mimic, 2-octynoic acid coupled to bovine serum albumin (BSA), induces antimitochondrial antibodies (AMAs) and cholangitis. Based upon these data, we have focused on covalent modifications of the lipoic acid disulfide ring and subsequent analysis of such xenobiotics coupled to a 15mer of PDC-E2 for immunoreactivity against a broad panel of sera from patients with PBC and controls. Our results demonstrate that AMA-positive PBC sera demonstrate marked reactivity against 6,8-bis(acetylthio)octanoic acid, implying that chemical modification of the lipoyl ring, i.e. disruption of the S-S disulfide, renders lipoic acid to its reduced form that will promote xenobiotic modification. This observation is particularly significant in light of the function of the lipoyl1oiety in electron transport of which the catalytic disulfide constantly opens and closes and, thus, raises the intriguing thesis that common electrophilic agents, i.e. acetaminophen or non-steroidal anti-inflammatory drugs (NSAIDs), may lead to xenobiotic modification in genetically susceptible individuals that results in the generation of AMAs and ultimately clinical PBC. PMID:21763105

  3. Striking similarities are exhibited by two small Epstein-Barr virus-encoded ribonucleic acids and the adenovirus-associated ribonucleic acids VAI and VAII

    SciTech Connect

    Rosa, M.D.; Gottlieb, E.; Lerner, M.R.; Steitz, J.A.

    1981-09-01

    The nucleotide sequence of the region of the Epstein-Barr virus genome that specified two small ribonucleic acids (RNAs), EBER 1 and EBER 2, has been determined. Both of these RNAs are encoded by the right-hand 1,000 base pairs of the EcoRI J fragment of EBV deoxyribonucleic acid. EBER 1 is 166 (167) nucleotides long and EBER 2 is 172 +- 1 nucleotides long; the heterogeneity resides at the 3' termini. The EBER genes are separated by 161 base pairs and are transcribed from the same deoxyribonucleic acid strand. In vitro, both EBER genes can be transcribed by RNA polymerase III; sequences homologous to previously identified RNA polymerase III intragenic transcription control regions are present. Striking similarities are therefore apparent both between the EBERs and the two adenovirus-associated RNAs, VAI and VAII, and between the regions of the two viral genomes that specify these small RNAs. We have shown that VAII RNA as well as VAI RNA and the EBERs exist in ribonucleoprotein complexes which are precipitable by anti-La antibodies associated with systemic lupus erythematosus. Finally the authors have demonstrated that the binding of protein(s) from uninfected cells confers antigenicity on each of the four virus-encoded small RNAs.

  4. Characterization of a Gene Encoding Clathrin Heavy Chain in Maize Up-Regulated by Salicylic Acid, Abscisic Acid and High Boron Supply

    PubMed Central

    Zeng, Mu-Heng; Liu, Sheng-Hong; Yang, Miao-Xian; Zhang, Ya-Jun; Liang, Jia-Yong; Wan, Xiao-Rong; Liang, Hong

    2013-01-01

    Clathrin, a three-legged triskelion composed of three clathrin heavy chains (CHCs) and three light chains (CLCs), plays a critical role in clathrin-mediated endocytosis (CME) in eukaryotic cells. In this study, the genes ZmCHC1 and ZmCHC2 encoding clathrin heavy chain in maize were cloned and characterized for the first time in monocots. ZmCHC1 encodes a 1693-amino acid-protein including 29 exons and 28 introns, and ZmCHC2 encodes a 1746-amino acid-protein including 28 exons and 27 introns. The high similarities of gene structure, protein sequences and 3D models among ZmCHC1, and Arabidopsis AtCHC1 and AtCHC2 suggest their similar functions in CME. ZmCHC1 gene is predominantly expressed in maize roots instead of ubiquitous expression of ZmCHC2. Consistent with a typical predicted salicylic acid (SA)-responsive element and four predicted ABA-responsive elements (ABREs) in the promoter sequence of ZmCHC1, the expression of ZmCHC1 instead of ZmCHC2 in maize roots is significantly up-regulated by SA or ABA, suggesting that ZmCHC1 gene may be involved in the SA signaling pathway in maize defense responses. The expressions of ZmCHC1 and ZmCHC2 genes in maize are down-regulated by azide or cold treatment, further revealing the energy requirement of CME and suggesting that CME in plants is sensitive to low temperatures. PMID:23880865

  5. Cloning and characterization of a locus encoding an indolepyruvate decarboxylase involved in indole-3-acetic acid synthesis in Erwinia herbicola.

    PubMed Central

    Brandl, M T; Lindow, S E

    1996-01-01

    Erwinia herbicola 299R synthesizes indole-3-acetic acid (IAA) primarily by the indole-3-pyruvic acid pathway. A gene involved in the biosynthesis of IAA was cloned from strain 299R. This gene (ipdC) conferred the synthesis of indole-3-acetaldehyde and tryptophol upon Escherichia coli DH5 alpha in cultures supplemented with L-tryptophan. The deduced amino acid sequence of the gene product has high similarity to that of the indolepyruvate decarboxylase of Enterobacter cloacae. Regions within pyruvate decarboxylases of various fungal and plant species also exhibited considerable homology to portions of this gene. This gene therefore presumably encodes an indolepyruvate decarboxylase (IpdC) which catalyzes the conversion of indole-3-pyruvic acid to indole-3-acetaldehyde. Insertions of Tn3-spice within ipdC abolished the ability of strain 299R to synthesize indole-3-acetaldehyde and tryptophol and reduced its IAA production in tryptophan-supplemented minimal medium by approximately 10-fold, thus providing genetic evidence for the role of the indolepyruvate pathway in IAA synthesis in this strain. An ipdC probe hybridized strongly with the genomic DNA of all E. herbicola strains tested in Southern hybridization studies, suggesting that the indolepyruvate pathway is common in this species. Maximum parsimony analysis revealed that the ipdC gene is highly conserved within this group and that strains of diverse geographic origin were very similar with respect to ipdC. PMID:8900003

  6. Bioconjugation of therapeutic proteins and enzymes using the expanded set of genetically encoded amino acids.

    PubMed

    Lim, Sung In; Kwon, Inchan

    2016-10-01

    The last decade has witnessed striking progress in the development of bioorthogonal reactions that are strictly directed towards intended sites in biomolecules while avoiding interference by a number of physical and chemical factors in biological environment. Efforts to exploit bioorthogonal reactions in protein conjugation have led to the evolution of protein translational machineries and the expansion of genetic codes that systematically incorporate a range of non-natural amino acids containing bioorthogonal groups into recombinant proteins in a site-specific manner. Chemoselective conjugation of proteins has begun to find valuable applications to previously inaccessible problems. In this review, we describe bioorthogonal reactions useful for protein conjugation, and biosynthetic methods that produce proteins amenable to those reactions through an expanded genetic code. We then provide key examples in which novel protein conjugates, generated by the genetic incorporation of a non-natural amino acid and the chemoselective reactions, address unmet needs in protein therapeutics and enzyme engineering. PMID:26036278

  7. Proximity-enabled protein crosslinking through genetically encoding haloalkane unnatural amino acids.

    PubMed

    Xiang, Zheng; Lacey, Vanessa K; Ren, Haiyan; Xu, Jing; Burban, David J; Jennings, Patricia A; Wang, Lei

    2014-02-17

    The selective generation of covalent bonds between and within proteins would provide new avenues for studying protein function and engineering proteins with new properties. New covalent bonds were genetically introduced into proteins by enabling an unnatural amino acid (Uaa) to selectively react with a proximal natural residue. This proximity-enabled bioreactivity was expanded to a series of haloalkane Uaas. Orthogonal tRNA/synthetase pairs were evolved to incorporate these Uaas, which only form a covalent thioether bond with cysteine when positioned in close proximity. By using the Uaa and cysteine, spontaneous covalent bond formation was demonstrated between an affibody and its substrate Z protein, thereby leading to irreversible binding, and within the affibody to increase its thermostability. This strategy of proximity-enabled protein crosslinking (PEPC) may be generally expanded to target different natural amino acids, thus providing diversity and flexibility in covalent bond formation for protein research and protein engineering. PMID:24449339

  8. Enhanced efficacy of an AAV vector encoding chimeric, highly secreted acid alpha-glucosidase in glycogen storage disease type II.

    PubMed

    Sun, Baodong; Zhang, Haoyue; Benjamin, Daniel K; Brown, Talmage; Bird, Andrew; Young, Sarah P; McVie-Wylie, Alison; Chen, Y-T; Koeberl, Dwight D

    2006-12-01

    Glycogen storage disease type II (GSD-II; Pompe disease; MIM 232300) is an inherited muscular dystrophy caused by deficiency in the activity of the lysosomal enzyme acid alpha-glucosidase (GAA). We hypothesized that chimeric GAA containing an alternative signal peptide could increase the secretion of GAA from transduced cells and enhance the receptor-mediated uptake of GAA in striated muscle. The relative secretion of chimeric GAA from transfected 293 cells increased up to 26-fold. Receptor-mediated uptake of secreted, chimeric GAA corrected cultured GSD-II patient cells. High-level hGAA was sustained in the plasma of GSD-II mice for 24 weeks following administration of an AAV2/8 vector encoding chimeric GAA; furthermore, GAA activity was increased and glycogen content was significantly reduced in striated muscle and in the brain. Administration of only 1 x 10(10) vector particles increased GAA activity in the heart and diaphragm for >18 weeks, whereas 3 x 10(10) vector particles increased GAA activity and reduced glycogen content in the heart, diaphragm, and quadriceps. Furthermore, an AAV2/2 vector encoding chimeric GAA produced secreted hGAA for >12 weeks in the majority of treated GSD-II mice. Thus, chimeric, highly secreted GAA enhanced the efficacy of AAV vector-mediated gene therapy in GSD-II mice. PMID:16987711

  9. Evaluation of DNA encoding acidic ribosomal protein P2 of Cryptosporidium parvum as a potential vaccine candidate for cryptosporidiosis

    PubMed Central

    Benitez, Alvaro; Priest, Jeffrey W.; Ehigiator, Humphrey N.; McNair, Nina; Mead, Jan R.

    2011-01-01

    The Cryptosporidium parvum acidic ribosomal protein P2 (CpP2) is an important immunodominant marker in C. parvum infection. In this study, the CpP2 antigen was evaluated as a vaccine candidate using a DNA vaccine model in adult C57BL/6 IL-12 knockout (KO) mice, which are susceptible to C. parvum infection. Our data show that subcutaneous immunization in the ear with DNA encoding CpP2 (CpP2-DNA) cloned into the pUMVC4b vector induced a significant anti-CpP2 IgG antibody response that was predominantly of the IgG1 isotype. Compared to control KO mice immunized with plasmid alone, CpP2-immunized mice demonstrated specific in vitro spleen cell proliferation as well as enhanced IFN-γ production to recombinant CpP2. Further, parasite loads in CpP2 DNA-immunized mice were compared to control mice challenged with C. parvum oocysts. Although a trend in reduction of infection was observed in the CpP2 DNA-immunized mice, differences between groups were not statistically significant. These results suggest that a DNA vaccine encoding the C. parvum P2 antigen is able to provide an effective means of eliciting humoral and cellular responses and has the potential to generate protective immunity against C. parvum infection but may require using alternative vectors or adjuvant to generate a more potent and balanced response. PMID:21968447

  10. Enzymes of the shikimic acid pathway encoded in the genome of a basal metazoan, Nematostella vectensis, have microbial origins

    PubMed Central

    Starcevic, Antonio; Akthar, Shamima; Dunlap, Walter C.; Shick, J. Malcolm; Hranueli, Daslav; Cullum, John; Long, Paul F.

    2008-01-01

    The shikimic acid pathway is responsible for the biosynthesis of many aromatic compounds by a broad range of organisms, including bacteria, fungi, plants, and some protozoans. Animals are considered to lack this pathway, as evinced by their dietary requirement for shikimate-derived aromatic amino acids. We challenge the universality of this traditional view in this report of genes encoding enzymes for the shikimate pathway in an animal, the starlet sea anemone Nematostella vectensis. Molecular evidence establishes horizontal transfer of ancestral genes of the shikimic acid pathway into the N. vectensis genome from both bacterial and eukaryotic (dinoflagellate) donors. Bioinformatic analysis also reveals four genes that are closely related to those of Tenacibaculum sp. MED152, raising speculation for the existence of a previously unsuspected bacterial symbiont. Indeed, the genome of the holobiont (i.e., the entity consisting of the host and its symbionts) comprises a high content of Tenacibaculum-like gene orthologs, including a 16S rRNA sequence that establishes the phylogenetic position of this associate to be within the family Flavobacteriaceae. These results provide a complementary view for the biogenesis of shikimate-related metabolites in marine Cnidaria as a “shared metabolic adaptation” between the partners. PMID:18268342

  11. Investigation of the fatty acid transporter-encoding genes SLC27A3 and SLC27A4 in autism.

    PubMed

    Maekawa, Motoko; Iwayama, Yoshimi; Ohnishi, Tetsuo; Toyoshima, Manabu; Shimamoto, Chie; Hisano, Yasuko; Toyota, Tomoko; Balan, Shabeesh; Matsuzaki, Hideo; Iwata, Yasuhide; Takagai, Shu; Yamada, Kohei; Ota, Motonori; Fukuchi, Satoshi; Okada, Yohei; Akamatsu, Wado; Tsujii, Masatsugu; Kojima, Nobuhiko; Owada, Yuji; Okano, Hideyuki; Mori, Norio; Yoshikawa, Takeo

    2015-01-01

    The solute carrier 27A (SLC27A) gene family encodes fatty acid transport proteins (FATPs) and includes 6 members. During fetal and postnatal periods of development, the growing brain requires a reliable supply of fatty acids. Because autism spectrum disorders (ASD) are now recognized as disorders caused by impaired early brain development, it is possible that functional abnormalities of SLC27A genes may contribute to the pathogenesis of ASD. Here, we confirmed the expression of SLC27A3 and SLC27A4 in human neural stem cells derived from human induced pluripotent stem cells, which suggested their involvement in the developmental stage of the central nervous system. Additionally, we resequenced the SLC27A3 and SLC27A4 genes using 267 ASD patient and 1140 control samples and detected 47 (44 novel and 29 nonsynonymous) and 30 (17 novel and 14 nonsynonymous) variants for the SLC27A3 and SLC27A4, respectively, revealing that they are highly polymorphic with multiple rare variants. The SLC27A4 Ser209 allele was more frequently represented in ASD samples. Furthermore, we showed that a SLC27A4 Ser209 mutant resulted in significantly higher fluorescently-labeled fatty acid uptake into bEnd3 cells, a mouse brain capillary-derived endothelial cell line, compared with SLC27A4 Gly209, suggesting that the functional change may contribute to ASD pathophysiology. PMID:26548558

  12. Investigation of the fatty acid transporter-encoding genes SLC27A3 and SLC27A4 in autism

    PubMed Central

    Maekawa, Motoko; Iwayama, Yoshimi; Ohnishi, Tetsuo; Toyoshima, Manabu; Shimamoto, Chie; Hisano, Yasuko; Toyota, Tomoko; Balan, Shabeesh; Matsuzaki, Hideo; Iwata, Yasuhide; Takagai, Shu; Yamada, Kohei; Ota, Motonori; Fukuchi, Satoshi; Okada, Yohei; Akamatsu, Wado; Tsujii, Masatsugu; Kojima, Nobuhiko; Owada, Yuji; Okano, Hideyuki; Mori, Norio; Yoshikawa, Takeo

    2015-01-01

    The solute carrier 27A (SLC27A) gene family encodes fatty acid transport proteins (FATPs) and includes 6 members. During fetal and postnatal periods of development, the growing brain requires a reliable supply of fatty acids. Because autism spectrum disorders (ASD) are now recognized as disorders caused by impaired early brain development, it is possible that functional abnormalities of SLC27A genes may contribute to the pathogenesis of ASD. Here, we confirmed the expression of SLC27A3 and SLC27A4 in human neural stem cells derived from human induced pluripotent stem cells, which suggested their involvement in the developmental stage of the central nervous system. Additionally, we resequenced the SLC27A3 and SLC27A4 genes using 267 ASD patient and 1140 control samples and detected 47 (44 novel and 29 nonsynonymous) and 30 (17 novel and 14 nonsynonymous) variants for the SLC27A3 and SLC27A4, respectively, revealing that they are highly polymorphic with multiple rare variants. The SLC27A4 Ser209 allele was more frequently represented in ASD samples. Furthermore, we showed that a SLC27A4 Ser209 mutant resulted in significantly higher fluorescently-labeled fatty acid uptake into bEnd3 cells, a mouse brain capillary-derived endothelial cell line, compared with SLC27A4 Gly209, suggesting that the functional change may contribute to ASD pathophysiology. PMID:26548558

  13. Enzymes of the shikimic acid pathway encoded in the genome of a basal metazoan, Nematostella vectensis, have microbial origins.

    PubMed

    Starcevic, Antonio; Akthar, Shamima; Dunlap, Walter C; Shick, J Malcolm; Hranueli, Daslav; Cullum, John; Long, Paul F

    2008-02-19

    The shikimic acid pathway is responsible for the biosynthesis of many aromatic compounds by a broad range of organisms, including bacteria, fungi, plants, and some protozoans. Animals are considered to lack this pathway, as evinced by their dietary requirement for shikimate-derived aromatic amino acids. We challenge the universality of this traditional view in this report of genes encoding enzymes for the shikimate pathway in an animal, the starlet sea anemone Nematostella vectensis. Molecular evidence establishes horizontal transfer of ancestral genes of the shikimic acid pathway into the N. vectensis genome from both bacterial and eukaryotic (dinoflagellate) donors. Bioinformatic analysis also reveals four genes that are closely related to those of Tenacibaculum sp. MED152, raising speculation for the existence of a previously unsuspected bacterial symbiont. Indeed, the genome of the holobiont (i.e., the entity consisting of the host and its symbionts) comprises a high content of Tenacibaculum-like gene orthologs, including a 16S rRNA sequence that establishes the phylogenetic position of this associate to be within the family Flavobacteriaceae. These results provide a complementary view for the biogenesis of shikimate-related metabolites in marine Cnidaria as a "shared metabolic adaptation" between the partners. PMID:18268342

  14. The human gene SLC25A29, of solute carrier family 25, encodes a mitochondrial transporter of basic amino acids.

    PubMed

    Porcelli, Vito; Fiermonte, Giuseppe; Longo, Antonella; Palmieri, Ferdinando

    2014-05-01

    The human genome encodes 53 members of the solute carrier family 25 (SLC25), also called the mitochondrial carrier family, many of which have been shown to transport carboxylates, amino acids, nucleotides, and cofactors across the inner mitochondrial membrane, thereby connecting cytosolic and matrix functions. In this work, a member of this family, SLC25A29, previously reported to be a mitochondrial carnitine/acylcarnitine- or ornithine-like carrier, has been thoroughly characterized biochemically. The SLC25A29 gene was overexpressed in Escherichia coli, and the gene product was purified and reconstituted in phospholipid vesicles. Its transport properties and kinetic parameters demonstrate that SLC25A29 transports arginine, lysine, homoarginine, methylarginine and, to a much lesser extent, ornithine and histidine. Carnitine and acylcarnitines were not transported by SLC25A29. This carrier catalyzed substantial uniport besides a counter-exchange transport, exhibited a high transport affinity for arginine and lysine, and was saturable and inhibited by mercurial compounds and other inhibitors of mitochondrial carriers to various degrees. The main physiological role of SLC25A29 is to import basic amino acids into mitochondria for mitochondrial protein synthesis and amino acid degradation. PMID:24652292

  15. Transcripts for genes encoding soluble acid invertase and sucrose synthase accumulate in root tip and cortical cells containing mycorrhizal arbuscules.

    PubMed

    Blee, Kristopher A; Anderson, Anne J

    2002-09-01

    Arbuscule formation by the arbuscular mycorrhizal fungus Glomus intraradices (Schenck & Smith) was limited to cortical cells immediately adjacent to the endodermis. Because these cortical cells are the first to intercept photosynthate exiting the vascular cylinder, transcript levels for sucrose metabolizing-enzymes were compared between mycorrhizal and non-mycorrhizal roots. The probes corresponded to genes encoding a soluble acid invertase with potential vacuolar targeting, which we generated from Phaseolus vulgaris roots, a Rhizobium-responsive sucrose synthase of soybean and a cell wall acid invertase of carrot. Transcripts in non-mycorrhizal roots were developmentally regulated and abundant in the root tips for all three probes but in differentiated roots of P. vulgaris they were predominantly located in phloem tissues for sucrose synthase or the endodermis and phloem for soluble acid invertase. In mycorrhizal roots increased accumulations of transcripts for sucrose synthase and vacuolar invertase were both observed in the same cortical cells bearing arbuscules that fluoresce. There was no effect on the expression of the cell wall invertase gene in fluorescent carrot cells containing arbuscules. Thus, it appears that presence of the fungal hyphae in the fluorescent arbusculated cell stimulates discrete alterations in expression of sucrose metabolizing enzymes to increase the sink potential of the cell. PMID:12175013

  16. Nucleotide and predicted amino acid sequence of a cDNA clone encoding part of human transketolase.

    PubMed

    Abedinia, M; Layfield, R; Jones, S M; Nixon, P F; Mattick, J S

    1992-03-31

    Transketolase is a key enzyme in the pentose-phosphate pathway which has been implicated in the latent human genetic disease, Wernicke-Korsakoff syndrome. Here we report the cloning and partial characterisation of the coding sequences encoding human transketolase from a human brain cDNA library. The library was screened with oligonucleotide probes based on the amino acid sequence of proteolytic fragments of the purified protein. Northern blots showed that the transketolase mRNA is approximately 2.2 kb, close to the minimum expected, of which approximately 60% was represented in the largest cDNA clone. Sequence analysis of the transketolase coding sequences reveals a number of homologies with related enzymes from other species. PMID:1567394

  17. Nucleic acid sequences encoding D1 and D1/D2 domains of human coxsackievirus and adenovirus receptor (CAR)

    DOEpatents

    Freimuth, Paul I.

    2010-04-06

    The invention provides recombinant human CAR (coxsackievirus and adenovirus receptor) polypeptides which bind adenovirus. Specifically, polypeptides corresponding to adenovirus binding domain D1 and the entire extracellular domain of human CAR protein comprising D1 and D2 are provided. In another aspect, the invention provides nucleic acid sequences encoding these domains and expression vectors for producing the domains and bacterial cells containing such vectors. The invention also includes an isolated fusion protein comprised of the D1 polypeptide fused to a polypeptide which facilitates folding of D1 when expressed in bacteria. The functional D1 domain finds application in a therapeutic method for treating a patient infected with a CAR D1-binding virus, and also in a method for identifying an antiviral compound which interferes with viral attachment. The invention also provides a method for specifically targeting a cell for infection by a virus which binds to D1.

  18. Abscisic acid enhances tolerance of wheat seedlings to drought and regulates transcript levels of genes encoding ascorbate-glutathione biosynthesis.

    PubMed

    Wei, Liting; Wang, Lina; Yang, Yang; Wang, Pengfei; Guo, Tiancai; Kang, Guozhang

    2015-01-01

    Glutathione (GSH) and ascorbate (ASA) are associated with the abscisic acid (ABA)-induced abiotic tolerance in higher plant, however, its molecular mechanism remains obscure. In this study, exogenous application (10 μM) of ABA significantly increased the tolerance of seedlings of common wheat (Triticum aestivum L.) suffering from 5 days of 15% polyethylene glycol (PEG)-stimulated drought stress, as demonstrated by increased shoot lengths and shoot and root dry weights, while showing decreased content of hydrogen peroxide (H2O2) and malondialdehyde (MDA). Under drought stress conditions, ABA markedly increased content of GSH and ASA in both leaves and roots of ABA-treated plants. Temporal and spatial expression patterns of eight genes encoding ASA and GSH synthesis-related enzymes were measured using quantitative real-time reverse transcription polymerase chain reaction (qPCR). The results showed that ABA temporally regulated the transcript levels of genes encoding ASA-GSH cycle enzymes. Moreover, these genes exhibited differential expression patterns between the root and leaf organs of ABA-treated wheat seedlings during drought stress. These results implied that exogenous ABA increased the levels of GSH and ASA in drought-stressed wheat seedlings in time- and organ-specific manners. Moreover, the transcriptional profiles of ASA-GSH synthesis-related enzyme genes in the leaf tissue were compared between ABA- and salicylic acid (SA)-treated wheat seedlings under PEG-stimulated drought stress, suggesting that they increased the content of ASA and GSH by differentially regulating expression levels of ASA-GSH synthesis enzyme genes. Our results increase our understanding of the molecular mechanism of ABA-induced drought tolerance in higher plants. PMID:26175737

  19. Abscisic acid enhances tolerance of wheat seedlings to drought and regulates transcript levels of genes encoding ascorbate-glutathione biosynthesis

    PubMed Central

    Wei, Liting; Wang, Lina; Yang, Yang; Wang, Pengfei; Guo, Tiancai; Kang, Guozhang

    2015-01-01

    Glutathione (GSH) and ascorbate (ASA) are associated with the abscisic acid (ABA)-induced abiotic tolerance in higher plant, however, its molecular mechanism remains obscure. In this study, exogenous application (10 μM) of ABA significantly increased the tolerance of seedlings of common wheat (Triticum aestivum L.) suffering from 5 days of 15% polyethylene glycol (PEG)-stimulated drought stress, as demonstrated by increased shoot lengths and shoot and root dry weights, while showing decreased content of hydrogen peroxide (H2O2) and malondialdehyde (MDA). Under drought stress conditions, ABA markedly increased content of GSH and ASA in both leaves and roots of ABA-treated plants. Temporal and spatial expression patterns of eight genes encoding ASA and GSH synthesis-related enzymes were measured using quantitative real-time reverse transcription polymerase chain reaction (qPCR). The results showed that ABA temporally regulated the transcript levels of genes encoding ASA-GSH cycle enzymes. Moreover, these genes exhibited differential expression patterns between the root and leaf organs of ABA-treated wheat seedlings during drought stress. These results implied that exogenous ABA increased the levels of GSH and ASA in drought-stressed wheat seedlings in time- and organ-specific manners. Moreover, the transcriptional profiles of ASA-GSH synthesis-related enzyme genes in the leaf tissue were compared between ABA- and salicylic acid (SA)-treated wheat seedlings under PEG-stimulated drought stress, suggesting that they increased the content of ASA and GSH by differentially regulating expression levels of ASA-GSH synthesis enzyme genes. Our results increase our understanding of the molecular mechanism of ABA-induced drought tolerance in higher plants. PMID:26175737

  20. Interactions Between Fatty Acid Transport Proteins, Genes That Encode for Them, and Exercise: A Systematic Review.

    PubMed

    Jayewardene, Avindra F; Mavros, Yorgi; Reeves, Anneliese; Hancock, Dale P; Gwinn, Tom; Rooney, Kieron B

    2016-08-01

    Long-chain fatty acid (LCFA) movement into skeletal muscle involves a highly mediated process in which lipid rafts are utilized in the cellular membrane, involving numerous putative plasma membrane-associated LCFA transport proteins. The process of LCFA uptake and oxidation is of particular metabolic significance both at rest and during light to moderate exercise. A comprehensive systematic search of electronic databases was conducted to investigate whether exercise alters protein and/or gene expression of putative LCFA transport proteins. There were 31 studies meeting all eligibility criteria, of these 13 utilized an acute exercise protocol and 18 examined chronic exercise adaptations. Seventeen involved a study design incorporating an exercise stimulus, while the remaining 14 incorporated a combined exercise and diet stimulus. Divergent data relating to acute exercise, as well as prolonged exercise training (≥3 weeks), on protein content (PC) response was identified for proteins CD36, FABPpm and CAV1. Messenger ribonucleic acid (mRNA) data did not always correspond to functional PC, supporting previous suggestions of a disconnect due to potentially limiting factors post gene expression. The large array of study designs, cohorts, and primary dependent variables within the studies included in the present review elucidate the complexity of the interaction between exercise and LCFA transport proteins. Summary of the results in the present review validate the need for further targeted investigation within this topic, and provide an important information base for such research. J. Cell. Physiol. 231: 1671-1687, 2016. © 2015 Wiley Periodicals, Inc. PMID:26638980

  1. Expression of the Rhodobacter sphaeroides hemA and hemT genes, encoding two 5-aminolevulinic acid synthase isozymes.

    PubMed Central

    Neidle, E L; Kaplan, S

    1993-01-01

    The nucleotide sequences of the Rhodobacter sphaeroides hemA and hemT genes, encoding 5-aminolevulinic acid (ALA) synthase isozymes, were determined. ALA synthase catalyzes the condensation of glycine and succinyl coenzyme A, the first and rate-limiting step in tetrapyrrole biosynthesis. The hemA and hemT structural gene sequences were 65% identical to each other, and the deduced HemA and HemT polypeptide sequences were 53% identical, with an additional 16% of aligned amino acids being similar. HemA and HemT were homologous to all characterized ALA synthases, including two human ALA synthase isozymes. In addition, they were evolutionarily related to 7-keto-8-aminopelargonic acid synthetase (BioF) and 2-amino-3-ketobutyrate coenzyme A ligase (Kbl), enzymes which catalyze similar reactions. Two hemA transcripts were identified, both expressed under photosynthetic conditions at levels approximately three times higher than those found under aerobic conditions. A single transcriptional start point was identified for both transcripts, and a consensus sequence at this location indicated that an Fnr-like protein may be involved in the transcriptional regulation of hemA. Transcription of hemT was not detected in wild-type cells under the physiological growth conditions tested. In a mutant strain in which the hemA gene had been inactivated, however, hemT was expressed. In this mutant, hemT transcripts were characterized by Northern (RNA) hybridization, primer extension, and ribonuclease protection techniques. A small open reading frame of unknown function was identified upstream of, and transcribed in the same direction as, hemA. Images PMID:8468290

  2. Early region 1B of adenovirus 2 encodes two coterminal proteins of 495 and 155 amino acid residues.

    PubMed Central

    Anderson, C W; Schmitt, R C; Smart, J E; Lewis, J B

    1984-01-01

    Partial sequence analysis of tryptic peptides has identified the E1B-495R (E1b-57K) (early transcription region 1B of 495 amino acid residues, with an approximate molecular weight of 57,000) protein of adenovirus 2 as encoded by the 495 amino acid open reading frame located in the adenovirus 2 DNA sequence between nucleotides 2016 and 3500. Additional proteins of 16,000 Mr and 18,000 Mr that are related to the E1B-495R protein were identified by cell-free translation of hybridization-selected mRNA. Analysis of [35S]methionine-containing amino terminal tryptic peptides by thin-layer chromatography showed that the E1B-495R, E1B-18K, and E1B-16K proteins all begin at the same initiation codon. The E1B-495R protein from 293 cells also has the same initial tryptic peptide, acetyl-methionyl-glutamyl-arginine. Sequence analysis of E1B-18K tryptic peptides indicated that this protein also has the same carboxy terminus as the E1B-495R protein and that it is derived from an mRNA that is spliced to remove sequences between nucleotides 2250 and 3269, resulting in a protein product of 155 amino acid residues. Analysis of E1B-16K tryptic peptides has not yet revealed the carboxy terminal structure of this protein. Both the E1B-495R and the E1B-155R (E1B-18K) proteins, as well as the E1B-16K protein, were precipitated from cell-free translations and from extracts of infected cells by antiserum against an amino terminal nonapeptide common to these proteins. Images PMID:6323739

  3. Molecular cloning and characterization of a human cDNA and gene encoding a novel acid ceramidase-like protein.

    PubMed

    Hong, S B; Li, C M; Rhee, H J; Park, J H; He, X; Levy, B; Yoo, O J; Schuchman, E H

    1999-12-01

    Computer-assisted database analysis of sequences homologous to human acid ceramidase (ASAH) revealed a 1233-bp cDNA (previously designated cPj-LTR) whose 266-amino-acid open reading frame had approximately 36% identity with the ASAH polypeptide. Based on this high degree of homology, we undertook further molecular characterization of cPj-LTR and now report the full-length cDNA sequence, complete gene structure (renamed human ASAHL since it is a human acid ceramidase-like sequence), chromosomal location, primer extension and promoter analysis, and transient expression results. The full-length human ASAHL cDNA was 1825 bp and contained an open-reading frame encoding a 359-amino-acid polypeptide that was 33% identical and 69% similar to the ASAH polypeptide over its entire length. Numerous short regions of complete identity were observed between these two sequences and two sequences obtained from the Caenorhabditis elegans genome database. The 30-kb human ASAHL genomic sequence contained 11 exons, which ranged in size from 26 to 671 bp, and 10 introns, which ranged from 150 bp to 6.4 kb. The gene was localized to the chromosomal region 4q21.1 by fluorescence in situ hybridization analysis. Northern blotting experiments revealed a major 2.0-kb ASAHL transcript that was expressed at high levels in the liver and kidney, but at relatively low levels in other tissues such as the lung, heart, and brain. Sequence analysis of the 5'-flanking region of the human ASAHL gene revealed a putative promoter region that lacked a TATA box and was GC rich, typical features of a housekeeping gene promoter, as well as several tissue-specific and/or hormone-induced transcription regulatory sites. 5'-Deletion analysis localized the promoter activity to a 1. 1-kb fragment within this region. A major transcription start site also was located 72 bp upstream from the ATG translation initiation site by primer extension analysis. Expression analysis of a green fluorescence protein/ASAHL fusion

  4. Identification and characterization of a new gene from Variovorax paradoxus Iso1 encoding N-acyl-D-amino acid amidohydrolase responsible for D-amino acid production.

    PubMed

    Lin, Pei-Hsun; Su, Shiun-Cheng; Tsai, Ying-Chieh; Lee, Chia-Yin

    2002-10-01

    An N-acyl-d-amino acid amidohydrolase (N-D-AAase) was identified in cell extracts of a strain, Iso1, isolated from an environment containing N-acetyl-d-methionine. The bacterium was classified as Variovorax paradoxus by phylogenetic analysis. The gene was cloned and sequenced. The gene consisted of a 1467-bp ORF encoding a polypeptide of 488 amino acids. The V. paradoxusN-D-AAase showed significant amino acid similarity to the N-acyl-d-amino acid amidohydrolases of the two eubacteria Alcaligenes xylosoxydans A-6 (44-56% identity), Alcaligenes facelis DA1 (54% identity) and the hyperthermophilic archaeon Pyrococcus abyssi (42% identity). After over-expression of the N-D-AAase protein in Escherichia coli, the enzyme was purified by multistep chromatography. The native molecular mass was 52.8 kDa, which agreed with the predicted molecular mass of 52 798 Da and the enzyme appeared to be a monomer protein by gel-filtration chromatography. A homogenous protein with a specific activity of 516 U.mg-1 was finally obtained. After peptide sequencing by LC/MS/MS, the results were in agreement with the deduced amino acid sequence of the N-D-AAase. The pI of the enzyme was 5.12 and it had an optimal pH and temperature of 7.5 and 50 degrees C, respectively. After 30 min heat treatment at 45 degrees C, between pH 6 and pH 8, 80% activity remained. The N-D-AAase had higher hydrolysing activity against N-acetyl-d-amino acid derivates containing d-methionine, d-leucine and d-alanine and against N-chloroacetyl-d-phenylalanine. Importantly, the enzyme does not act on the N-acetyl-l-amino acid derivatives. The enzyme was inhibited by chelating agents and certain metal ions, but was activated by 1 mm of Co2+ and Mg2+. Thus, the N-D-AAase from V. paradoxus can be considered a chiral specific and metal-dependent enzyme. PMID:12354118

  5. RECRUITMENT OF A CHROMOSOMALLY-ENCODED MALEYLACETATE REDYCTASE FOR THE DEGRADATION OF 2,4-DICHLOROPHENOXY-ACETIC ACID (TFD) BY PLASMID PJP4

    EPA Science Inventory

    When Pseudomonas aeruginosa PAO1c or P. putida PP0220 or PP0300 carry plasmid pJP4, which encodes enzymes for the degradation of 2,4-dichlorophenoxyacetic acid (TFD) or 2-chloromaleylacetate, cells do not grow on TFD and UV-absorbing material with spectral characteristics of chlo...

  6. Saponin biosynthesis in Saponaria vaccaria. cDNAs encoding beta-amyrin synthase and a triterpene carboxylic acid glucosyltransferase.

    PubMed

    Meesapyodsuk, Dauenpen; Balsevich, John; Reed, Darwin W; Covello, Patrick S

    2007-02-01

    Saponaria vaccaria (Caryophyllaceae), a soapwort, known in western Canada as cowcockle, contains bioactive oleanane-type saponins similar to those found in soapbark tree (Quillaja saponaria; Rosaceae). To improve our understanding of the biosynthesis of these saponins, a combined polymerase chain reaction and expressed sequence tag approach was taken to identify the genes involved. A cDNA encoding a beta-amyrin synthase (SvBS) was isolated by reverse transcription-polymerase chain reaction and characterized by expression in yeast (Saccharomyces cerevisiae). The SvBS gene is predominantly expressed in leaves. A S. vaccaria developing seed expressed sequence tag collection was developed and used for the isolation of a full-length cDNA bearing sequence similarity to ester-forming glycosyltransferases. The gene product of the cDNA, classified as UGT74M1, was expressed in Escherichia coli, purified, and identified as a triterpene carboxylic acid glucosyltransferase. UGT74M1 is expressed in roots and leaves and appears to be involved in monodesmoside biosynthesis in S. vaccaria. PMID:17172290

  7. Enhanced Delivery of Plasmid Encoding Interleukin-12 Gene by Diethylene Triamine Penta-Acetic Acid (DTPA)-Conjugated PEI Nanoparticles.

    PubMed

    Dehshahri, Ali; Sadeghpour, Hossein; Keykhaee, Maryam; Khalvati, Bahman; Sheikhsaran, Fatemeh

    2016-05-01

    Recombinant therapeutic proteins have been considered as an efficient category of medications used for the treatment of various diseases. Despite their effectiveness, there are some reports on the systemic adverse effects of recombinant therapeutic proteins limiting their wide clinical applications. Among different cytokines used for cancer immunotherapy, interleukin-12 (IL-12) has shown great ability as a powerful antitumor and antiangiogenic agent. However, significant toxic reactions following the systemic administration of IL-12 have led researchers to seek for alternative approaches such as the delivery and local expression of the IL-12 gene inside the tumor tissues. In order to transfer the plasmid encoding IL-12 gene, the most extensively investigated polycationic polymer, polyethylenimine (PEI), was modified by diethylene triamine penta-acetic acid (DTPA) to modulate the hydrophobic-hydrophilic balance of the polymer as well as its toxicity. DTPA-conjugated PEI derivatives were able to form complexes in the size range around 100-180 nm with great condensation ability and protection of the plasmid against enzymatic degradation. The highest gene transfer ability was achieved by the DTPA-conjugated PEI at the conjugation degree of 0.1 % where the level of IL-12 production increased up to twofold compared with that of the unmodified PEI. Results of the present study demonstrated that modulation of the surface positive charge of PEI along with the improvement of the polymer hydrophobic balance could be considered as a successful strategy to develop safe and powerful nanocarriers. PMID:26801817

  8. A genetic algorithm encoded with the structural information of amino acids and dipeptides for efficient conformational searches of oligopeptides.

    PubMed

    Ru, Xiao; Song, Ce; Lin, Zijing

    2016-05-15

    The genetic algorithm (GA) is an intelligent approach for finding minima in a highly dimensional parametric space. However, the success of GA searches for low energy conformations of biomolecules is rather limited so far. Herein an improved GA scheme is proposed for the conformational search of oligopeptides. A systematic analysis of the backbone dihedral angles of conformations of amino acids (AAs) and dipeptides is performed. The structural information is used to design a new encoding scheme to improve the efficiency of GA search. Local geometry optimizations based on the energy calculations by the density functional theory are employed to safeguard the quality and reliability of the GA structures. The GA scheme is applied to the conformational searches of Lys, Arg, Met-Gly, Lys-Gly, and Phe-Gly-Gly representative of AAs, dipeptides, and tripeptides with complicated side chains. Comparison with the best literature results shows that the new GA method is both highly efficient and reliable by providing the most complete set of the low energy conformations. Moreover, the computational cost of the GA method increases only moderately with the complexity of the molecule. The GA scheme is valuable for the study of the conformations and properties of oligopeptides. © 2016 Wiley Periodicals, Inc. PMID:26833761

  9. Hydrophobicity, expressivity and aromaticity are the major trends of amino-acid usage in 999 Escherichia coli chromosome-encoded genes.

    PubMed Central

    Lobry, J R; Gautier, C

    1994-01-01

    Multivariate analysis of the amino-acid compositions of 999 chromosome-encoded proteins from Escherichia coli showed that three main factors influence the variability of amino-acid composition. The first factor was correlated with the global hydrophobicity of proteins, and it discriminated integral membrane proteins from the others. The second factor was correlated with gene expressivity, showing a bias in highly expressed genes towards amino-acids having abundant major tRNAs. Just as highly expressed genes have reduced codon diversity in protein coding sequences, so do they have a reduced diversity of amino-acid choice. This showed that translational constraints are important enough to affect the global amino-acid composition of proteins. The third factor was correlated with the aromaticity of proteins, showing that aromatic amino-acid content is highly variable. PMID:8065933

  10. Nucleotide sequences and characterization of liv genes encoding components of the high-affinity branched-chain amino acid transport system in Salmonella typhimurium.

    PubMed

    Matsubara, K; Ohnishi, K; Kiritani, K

    1992-07-01

    A 7.6-kb fragment of Salmonella typhimurium LT2 containing the liv gene cluster, which specifies the high-affinity branched-chain amino acid transport system (LIV-I), has been isolated. The upstream region contains the livB and livC genes encoding the leucine-isoleucine-valine-threonine and leucine-specific binding proteins, respectively. In this study, the nucleotide sequence of the 4-kb downstream segment was determined and found to contain four reading frames, designated as livA, livE, livF, and livG, that encode putative membrane-associated proteins. The livA and livE genes encode hydrophobic proteins composed of 308 and 425 amino acid residues, respectively. The livF and livG genes encode hydrophilic proteins of 255 and 237 amino acids, respectively; both the proteins contain consensus amino acid sequences found in proteins with ATP-binding sites. These four genes linked together have a potential rho-independent transcriptional terminator adjacent to the 3'-end of livG. No promoter sequence was found in the immediate upstream region of the livAEFG cluster. The livA, livE, livF, and livG gene products were identified as proteins with apparent M(r)s of 25,500, 34,500, 28,000, and 26,000, respectively, by SDS-polyacryl-amide gel electrophoresis. The deduced amino acid sequences of these four proteins showed strong homology to those of the corresponding membrane-associated proteins required for the high-affinity branched-chain amino acid transport systems from both Escherichia coli and Pseudomonas aeruginosa. PMID:1429514

  11. Cloning and functional analysis of HpFAD2 and HpFAD3 genes encoding Δ12- and Δ15-fatty acid desaturases in Hansenula polymorpha.

    PubMed

    Sangwallek, Juthaporn; Kaneko, Yoshinobu; Tsukamoto, Tomoya; Marui, Makoto; Sugiyama, Minetaka; Ono, Hisayo; Bamba, Takeshi; Fukusaki, Eiichiro; Harashima, Satoshi

    2014-01-01

    Two fatty acid desaturase genes have been cloned: HpFAD2 and HpFAD3 encode Hansenula polymorpha Δ12-fatty acid desaturase (HpFad2) and Δ15-fatty acid desaturase (HpFad3), which are responsible for the production of linoleic acid (LA, C18:2, Δ9, Δ12) and α-linolenic acid (ALA, αC18:3, Δ9, Δ12, Δ15), respectively. The open reading frame of the HpFAD2 and HpFAD3 genes is 1215bp and 1239bp, encoding 405 and 413 amino acids, respectively. The putative amino acid sequences of HpFad2 and HpFad3 share more than 60% similarity and three conserved histidine-box motifs with other known yeast Fad homologs. Hpfad2Δ disruptant cannot produce C18:2 and αC18:3, while the deletion of HpFAD3 only causes the absence of αC18:3. Heterologous expression of either the HpFAD2 or the HpFAD3 gene in Saccharomyces cerevisiae resulted in the presence of C18:2 and αC18:3 when the C18:2 precursor was added. Taken together, these observations indicate that HpFAD2 and HpFAD3 indeed encode Δ12- and Δ15-fatty acid desaturases that function as the only ones responsible for desaturation of oleic acid (C18:1) and linoleic acid (C18:2), respectively, in H. polymorpha. Because a Fatty Acid Regulated (FAR) region and a Low Oxygen Response Element (LORE), which are responsible for regulation of a Δ9-fatty acid desaturase gene (ScOLE1) in S. cerevisiae, are present in the upstream regions of both genes, we investigated whether the transcriptional levels of HpFAD2 and HpFAD3 are affected by supplementation with nutrient unsaturated fatty acids or by low oxygen conditions. Whereas both genes were up-regulated under low oxygen conditions, only HpFAD3 transcription was repressed by an excess of C18:1, C18:2 and C18:3, while the HpFAD2 transcript level did not significantly change. These observations indicate that HpFAD2 expression is not controlled at the transcriptional level by fatty acids even though it contains a FAR-like region. This study indicates that HpFAD2 may be regulated by post

  12. Role of GlnR in Acid-Mediated Repression of Genes Encoding Proteins Involved in Glutamine and Glutamate Metabolism in Streptococcus mutans▿ †

    PubMed Central

    Chen , Pei-Min; Chen, Yi-Ywan M.; Yu, Sung-Liang; Sher, Singh; Lai, Chern-Hsiung; Chia, Jean-San

    2010-01-01

    The acid tolerance response (ATR) is one of the major virulence traits of Streptococcus mutans. In this study, the role of GlnR in acid-mediated gene repression that affects the adaptive ATR in S. mutans was investigated. Using a whole-genome microarray and in silico analyses, we demonstrated that GlnR and the GlnR box (ATGTNAN7TNACAT) were involved in the transcriptional repression of clusters of genes encoding proteins involved in glutamine and glutamate metabolism under acidic challenge. Reverse transcription-PCR (RT-PCR) analysis revealed that the coordinated regulation of the GlnR regulon occurred 5 min after acid treatment and that prolonged acid exposure (30 min) resulted in further reduction in expression. A lower level but consistent reduction in response to acidic pH was also observed in chemostat-grown cells, confirming the negative regulation of GlnR. The repression by GlnR through the GlnR box in response to acidic pH was further confirmed in the citBZC operon, containing genes encoding the first three enzymes in the glutamine/glutamate biosynthesis pathway. The survival rate of the GlnR-deficient mutant at pH 2.8 was more than 10-fold lower than that in the wild-type strain 45 min after acid treatment, suggesting that the GlnR regulon participates in S. mutans ATR. It is hypothesized that downregulation of the synthesis of the amino acid precursors in response to acid challenge would promote citrate metabolism to pyruvate, with the consumption of H+ and potential ATP synthesis. Such regulation will ensure an optimal acid adaption in S. mutans. PMID:20173059

  13. Genetic Structure Associated with blaOXA-18, Encoding a Clavulanic Acid-Inhibited Extended-Spectrum Oxacillinase▿

    PubMed Central

    Naas, Thierry; Namdari, Fatemeh; Bogaerts, Pierre; Huang, Te-Din; Glupczynski, Youri; Nordmann, Patrice

    2008-01-01

    The genetic environment of the blaOXA-18 gene encoding a peculiar clavulanic acid-inhibitable Ambler class D extended-spectrum β-lactamase was determined from the prototype OXA-18-producing Pseudomonas aeruginosa MUS clinical isolate. An 8.2-kb genomic DNA fragment containing blaOXA-18 was cloned from P. aeruginosa MUS. Although most oxacillinases are located in integrons, blaOXA-18 lacked gene cassette-specific features. It was bracketed by two duplicated sequences containing ISCR19, a novel insertion sequence of the ISCR family of mobile elements; ΔintI1, a truncated integrase gene; and a truncated Δaac6′-Ib gene cassette. It is likely that ISCR19 was at the origin of the blaOXA-18 gene mobilization by a rolling-circle transposition event followed by homologous recombination. Furthermore, analysis of the cloned genomic DNA fragment revealed the presence of the integron-containing blaOXA-20 gene. Concomitantly, three P. aeruginosa clinical isolates, displaying a synergy image as determined by double-disk diffusion tests on cloxacillin-containing plates, were isolated from three patients hospitalized in different wards over a 9-month period at the Saint-Luc University hospital (Brussels, Belgium). These isolates were positive by PCR for blaOXA-18 and blaOXA-20 genes, genetically related to P. aeruginosa MUS as determined by pulsed-field gel electrophoresis, and carried the same blaOXA-18/blaOXA-20-associated genetic structures. This report characterized the genetic elements likely at the origin of blaOXA-18 gene mobilization in P. aeruginosa and suggests the spread of oxacillin-type extended-spectrum β-lactamases in P. aeruginosa at the Saint-Luc University hospital of Brussels, Belgium. PMID:18663027

  14. The Acid Phosphatase-Encoding Gene GmACP1 Contributes to Soybean Tolerance to Low-Phosphorus Stress

    PubMed Central

    Hao, Derong; Wang, Hui; Kan, Guizhen; Jin, Hangxia; Yu, Deyue

    2014-01-01

    Phosphorus (P) is essential for all living cells and organisms, and low-P stress is a major factor constraining plant growth and yield worldwide. In plants, P efficiency is a complex quantitative trait involving multiple genes, and the mechanisms underlying P efficiency are largely unknown. Combining linkage analysis, genome-wide and candidate-gene association analyses, and plant transformation, we identified a soybean gene related to P efficiency, determined its favorable haplotypes and developed valuable functional markers. First, six major genomic regions associated with P efficiency were detected by performing genome-wide associations (GWAs) in various environments. A highly significant region located on chromosome 8, qPE8, was identified by both GWAs and linkage mapping and explained 41% of the phenotypic variation. Then, a regional mapping study was performed with 40 surrounding markers in 192 diverse soybean accessions. A strongly associated haplotype (P = 10−7) consisting of the markers Sat_233 and BARC-039899-07603 was identified, and qPE8 was located in a region of approximately 250 kb, which contained a candidate gene GmACP1 that encoded an acid phosphatase. GmACP1 overexpression in soybean hairy roots increased P efficiency by 11–20% relative to the control. A candidate-gene association analysis indicated that six natural GmACP1 polymorphisms explained 33% of the phenotypic variation. The favorable alleles and haplotypes of GmACP1 associated with increased transcript expression correlated with higher enzyme activity. The discovery of the optimal haplotype of GmACP1 will now enable the accurate selection of soybeans with higher P efficiencies and improve our understanding of the molecular mechanisms underlying P efficiency in plants. PMID:24391523

  15. Formation of indigo and related compounds from indolecarboxylic acids by aromatic acid-degrading bacteria: chromogenic reactions for cloning genes encoding dioxygenases that act on aromatic acids.

    PubMed Central

    Eaton, R W; Chapman, P J

    1995-01-01

    The p-cumate-degrading strain Pseudomonas putida F1 and the m- and p-toluate-degrading strain P. putida mt-2 transform indole-2-carboxylate and indole-3-carboxylate to colored products identified here as indigo, indirubin, and isatin. A mechanism by which these products could be formed spontaneously following dioxygenase-catalyzed dihydroxylation of the indolecarboxylates is proposed. Indolecarboxylates were employed as chromogenic substrates for identifying recombinant bacteria carrying genes encoding p-cumate dioxygenase and toluate dioxygenase. Dioxygenase gene-carrying bacteria could be readily distinguished as dark green-blue colonies among other colorless recombinant Escherichia coli colonies on selective agar plates containing either indole-2-carboxylate or indole-3-carboxylate. PMID:7592495

  16. Streptomyces coelicolor A3(2) CYP102 Protein, a Novel Fatty Acid Hydroxylase Encoded as a Heme Domain without an N-Terminal Redox Partner▿

    PubMed Central

    Lamb, David C.; Lei, Li; Zhao, Bin; Yuan, Hang; Jackson, Colin J.; Warrilow, Andrew G. S.; Skaug, Tove; Dyson, Paul J.; Dawson, Eric S.; Kelly, Steven L.; Hachey, David L.; Waterman, Michael R.

    2010-01-01

    The gene from Streptomyces coelicolor A3(2) encoding CYP102B1, a recently discovered CYP102 subfamily which exists solely as a single P450 heme domain, has been cloned, expressed in Escherichia coli, purified, characterized, and compared to its fusion protein family members. Purified reconstitution metabolism experiments with spinach ferredoxin, ferredoxin reductase, and NADPH revealed differences in the regio- and stereoselective metabolism of arachidonic acid compared to that of CYP102A1, exclusively producing 11,12-epoxyeicosa-5,8,14-trienoic acid in addition to the shared metabolites 18-hydroxy arachidonic acid and 14,15-epoxyeicosa-5,8,11-trienoic acid. Consequently, in order to elucidate the physiological function of CYP102B1, transposon mutagenesis was used to generate an S. coelicolor A3(2) strain lacking CYP102B1 activity and the phenotype was assessed. PMID:20097805

  17. Isolation of the braZ gene encoding the carrier for a novel branched-chain amino acid transport system in Pseudomonas aeruginosa PAO.

    PubMed

    Hoshino, T; Kose-Terai, K; Uratani, Y

    1991-03-01

    The braZ gene for a novel branched-chain amino acid transport system in Pseudomonas aeruginosa PAO was isolated and characterized. Determination of the nucleotide sequence showed that the braZ gene comprises 1,311 nucleotides specifying a protein of 437 amino acids. Hydropathy analysis suggested that the product is an integral membrane protein with 12 membrane-spanning segments. The amino acid sequence showed extensive homology to those of the braB and brnQ gene products, branched-chain amino acid carriers of P. aeruginosa and Salmonella typhimurium, respectively. By using the T7 RNA polymerase-promoter system, the braZ gene product was identified as a protein of an apparent Mr of 34,000 on a sodium dodecyl sulfate-polyacrylamide gel. Properties of the transport system encoded by braZ were studied by using P. aeruginosa PAO3537, defective in both the high- and low-affinity branched-chain amino acid transport systems (LIV-I and LIV-II, respectively). The transport system encoded by braZ was found to be another effective branched-chain amino acid transport system in P. aeruginosa PAO and was thus designated as LIV-III. This system is specific for isoleucine and valine, giving the same Km value of 12 microM for these amino acids. The system was found, however, to have a very low affinity for leucine, with a Km value of 150 microM, which contrasts with the substrate specificities of LIV-I and LIV-II. PMID:1900503

  18. Identification of a novel operon in Lactococcus lactis encoding three enzymes for lactic acid synthesis: phosphofructokinase, pyruvate kinase, and lactate dehydrogenase.

    PubMed Central

    Llanos, R M; Harris, C J; Hillier, A J; Davidson, B E

    1993-01-01

    The discovery of a novel multicistronic operon that encodes phosphofructokinase, pyruvate kinase, and lactate dehydrogenase in the lactic acid bacterium Lactococcus lactis is reported. The three genes in the operon, designated pfk, pyk, and ldh, contain 340, 502, and 325 codons, respectively. The intergenic distances are 87 bp between pfk and pyk and 117 bp between pyk and ldh. Plasmids containing pfk and pyk conferred phosphofructokinase and pyruvate kinase activity, respectively, on their host. The identity of ldh was established previously by the same approach (R. M. Llanos, A. J. Hillier, and B. E. Davidson, J. Bacteriol. 174:6956-6964, 1992). Each of the genes is preceded by a potential ribosome binding site. The operon is expressed in a 4.1-kb transcript. The 5' end of the transcript was determined to be a G nucleotide positioned 81 bp upstream from the pfk start codon. The pattern of codon usage within the operon is highly biased, with 11 unused amino acid codons. This degree of bias suggests that the operon is highly expressed. The three proteins encoded on the operon are key enzymes in the Embden-Meyerhoff pathway, the central pathway of energy production and lactic acid synthesis in L. lactis. For this reason, we have called the operon the las (lactic acid synthesis) operon. Images PMID:8478320

  19. A mutation in the Arabidopsis HYL1 gene encoding a dsRNA binding protein affects responses to abscisic acid, auxin, and cytokinin

    NASA Technical Reports Server (NTRS)

    Lu, C.; Fedoroff, N.

    2000-01-01

    Both physiological and genetic evidence indicate interconnections among plant responses to different hormones. We describe a pleiotropic recessive Arabidopsis transposon insertion mutation, designated hyponastic leaves (hyl1), that alters the plant's responses to several hormones. The mutant is characterized by shorter stature, delayed flowering, leaf hyponasty, reduced fertility, decreased rate of root growth, and an altered root gravitropic response. It also exhibits less sensitivity to auxin and cytokinin and hypersensitivity to abscisic acid (ABA). The auxin transport inhibitor 2,3,5-triiodobenzoic acid normalizes the mutant phenotype somewhat, whereas another auxin transport inhibitor, N-(1-naph-thyl)phthalamic acid, exacerbates the phenotype. The gene, designated HYL1, encodes a 419-amino acid protein that contains two double-stranded RNA (dsRNA) binding motifs, a nuclear localization motif, and a C-terminal repeat structure suggestive of a protein-protein interaction domain. We present evidence that the HYL1 gene is ABA-regulated and encodes a nuclear dsRNA binding protein. We hypothesize that the HYL1 protein is a regulatory protein functioning at the transcriptional or post-transcriptional level.

  20. The first seven amino acids encoded by the v-src oncogene act as a myristylation signal: Lysine 7 is a critical determinant

    SciTech Connect

    Kaplan, J.M.; Mardon, G.; Bishop, J.M.; Varmus, H.E.

    1988-06-01

    The transforming protein of Rous sarcoma virus, pp60/sup v-src/, is covalently coupled to myristic acid by an amide linkage to glycine 2. Myristylation promotes the association of pp60/sup v-src/ with cellular membranes, and this subcellular location is essential for transforming activity. The findings presented here, in conjunction with the previous reports of others, imply that the seventh amino acid encoded by v-src might be important in the myristlyation reaction. Replacement of lysine 7 by asparagine greatly reduced the myristylation, membrane association, and transforming activity of pp60/sup v-src/. In contrast, substitution of arginine at residue 7 had no effect on any of these properties of pp60/sup v-src/. Addition of amino acids 1 to 7 encoded by v-src was sufficient to cause myristylation of a src-pyruvate kinase function protein. The authors conclude that the recognition sequence for myristylation of pp60/sup v-src/ comprises amino acids 1 to 7 and that lysine 7 is a critical component of this sequence.

  1. Characterization of the Streptomyces clavuligerus argC gene encoding N-acetylglutamyl-phosphate reductase: expression in Streptomyces lividans and effect on clavulanic acid production.

    PubMed Central

    Ludovice, M; Martin, J F; Carrachas, P; Liras, P

    1992-01-01

    The argC gene of Streptomyces clavuligerus encoding N-acetylglutamyl-phosphate reductase (AGPR) has been cloned by complementation of argC mutants Streptomyces lividans 1674 and Escherichia coli XC33. The gene is contained in an open reading frame of 1,023 nucleotides which encodes a protein of 340 amino acids with a deduced molecular mass of 35,224 Da. The argC gene is linked to argE, as shown by complementation of argE mutants of E. coli. Expression of argC from cloned DNA fragments carrying the gene leads to high levels of AGPR in wild-type S. lividans and in the argC mutant S. lividans 1674. Formation of AGPR is repressed by addition of arginine to the culture medium. The protein encoded by the argC gene is very similar to the AGPRs of Streptomyces coelicolor, Bacillus subtilis, and E. coli and, to a lesser degree, to the homologous enzymes of Saccharomyces cerevisiae and Anabaena spp. A conserved PGCYPT domain present in all the AGPR sequences suggests that this may be the active center of the protein. Transformation of S. clavuligerus 328, an argC auxotroph deficient in clavulanic acid biosynthesis, with plasmid pULML30, carrying the cloned argC gene, restored both prototrophy and antibiotic production. Images PMID:1339424

  2. Selective heterogeneous acid catalyzed esterification of N-terminal sulfyhdryl fatty acids

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Our interest in thiol fatty acids lies in their antioxidative, free radical scavenging, and metal ion scavenging capabilities as applied to cosmeceutical and skin care formulations. The retail market is filled with products containing the disulfide-containing free fatty acid, lipoic acid. These pr...

  3. Edwardsiella ictaluri Encodes an Acid Activated Urease that is Required for Intracellular Replication in Channel Catfish Ictalurus punctatus Macrophages

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Genomic analysis indicated that Edwardsiella ictaluri encodes a putative ureasepathogenicity island containing 9 open reading frames, including urea and ammonium transporters. In vitro studies with the wild-type E. ictaluri and a ureG::kan urease mutant strain indicated that E. ictaluri is significa...

  4. Cloning, nucleotide sequences, and identification of products of the Pseudomonas aeruginosa PAO bra genes, which encode the high-affinity branched-chain amino acid transport system.

    PubMed Central

    Hoshino, T; Kose, K

    1990-01-01

    A DNA fragment of Pseudomonas aeruginosa PAO containing genes specifying the high-affinity branched-chain amino acid transport system (LIV-I) was isolated. The fragment contained the braC gene, encoding the binding protein for branched-chain amino acids, and the 4-kilobase DNA segment adjacent to 3' of braC. The nucleotide sequence of the 4-kilobase DNA fragment was determined and found to contain four open reading frames, designated braD, braE, braF, and braG. The braD and braE genes specify very hydrophobic proteins of 307 and 417 amino acid residues, respectively. The braD gene product showed extensive homology (67% identical) to the livH gene product, a component required for the Escherichia coli high-affinity branched-chain amino acid transport systems. The braF and braG genes encode proteins of 255 and 233 amino acids, respectively, both containing amino acid sequences typical of proteins with ATP-binding sites. By using a T7 RNA polymerase/promoter system together with plasmids having various deletions in the braDEFG region, the braD, braE, braF, and braG gene products were identified as proteins with apparent Mrs of 25,500, 34,000, 30,000, and 27,000, respectively. These proteins were found among cell membrane proteins on a sodium dodecyl sulfate-polyacrylamide gel stained with Coomassie blue. Images PMID:2120183

  5. Encoding Dictionaries.

    ERIC Educational Resources Information Center

    Ide, Nancy

    1995-01-01

    Describes problems in devising a Text Encoding Initiative (TEI) encoding format for dictionaries. Asserts that the high degree of structuring and compression of information are among the most complex text types treated in the TEI. Concludes that the source of some TEI problems lies in the design of Standard Generalized Markup Language (SGML). (CFR)

  6. Arabidopsis Deficient in Cutin Ferulate Encodes a Transferase Required for Feruloylation of ω-Hydroxy Fatty Acids in Cutin Polyester1[W][OA

    PubMed Central

    Rautengarten, Carsten; Ebert, Berit; Ouellet, Mario; Nafisi, Majse; Baidoo, Edward E.K.; Benke, Peter; Stranne, Maria; Mukhopadhyay, Aindrila; Keasling, Jay D.; Sakuragi, Yumiko; Scheller, Henrik Vibe

    2012-01-01

    The cuticle is a complex aliphatic polymeric layer connected to the cell wall and covers surfaces of all aerial plant organs. The cuticle prevents nonstomatal water loss, regulates gas exchange, and acts as a barrier against pathogen infection. The cuticle is synthesized by epidermal cells and predominantly consists of an aliphatic polymer matrix (cutin) and intracuticular and epicuticular waxes. Cutin monomers are primarily C16 and C18 unsubstituted, ω-hydroxy, and α,ω-dicarboxylic fatty acids. Phenolics such as ferulate and p-coumarate esters also contribute to a minor extent to the cutin polymer. Here, we present the characterization of a novel acyl-coenzyme A (CoA)-dependent acyl-transferase that is encoded by a gene designated Deficient in Cutin Ferulate (DCF). The DCF protein is responsible for the feruloylation of ω-hydroxy fatty acids incorporated into the cutin polymer of aerial Arabidopsis (Arabidopsis thaliana) organs. The enzyme specifically transfers hydroxycinnamic acids using ω-hydroxy fatty acids as acyl acceptors and hydroxycinnamoyl-CoAs, preferentially feruloyl-CoA and sinapoyl-CoA, as acyl donors in vitro. Arabidopsis mutant lines carrying DCF loss-of-function alleles are devoid of rosette leaf cutin ferulate and exhibit a 50% reduction in ferulic acid content in stem insoluble residues. DCF is specifically expressed in the epidermis throughout all green Arabidopsis organs. The DCF protein localizes to the cytosol, suggesting that the feruloylation of cutin monomers takes place in the cytoplasm. PMID:22158675

  7. Identification of the OsOPR7 gene encoding 12-oxophytodienoate reductase involved in the biosynthesis of jasmonic acid in rice.

    PubMed

    Tani, Tomoyuki; Sobajima, Hiroyuki; Okada, Kazunori; Chujo, Tetsuya; Arimura, Shin-Ichi; Tsutsumi, Nobuhiro; Nishimura, Mikio; Seto, Hideharu; Nojiri, Hideaki; Yamane, Hisakazu

    2008-02-01

    Enzyme 12-oxophytodienoate (OPDA) reductase (EC1.3.1.42), which is involved in the biosynthesis of jasmonic acid (JA), catalyses the reduction of 10, 11-double bonds of OPDA to yield 3-oxo-2-(2'-pentenyl)-cyclopentane-1-octanoic acid (OPC-8:0). The rice OsOPR1 gene encodes OPDA reductase (OPR) converting (-)-cis-OPDA preferentially, rather than (+)-cis-OPDA, a natural precursor of JA. Here, we provide evidence that an OPR family gene in rice chromosome 8, designated OsOPR7, encodes the enzyme involved in the JA biosynthesis. Recombinant OsOPR7-His protein efficiently catalysed the reduction of both enantiomers of cis-OPDA, similar to the OPR3 protein in Arabidopsis thaliana (L.) Heynh. The expression of OsOPR7 mRNA was induced and reached maximum levels within 0.5 h of mechanical wounding and drought stress, and the endogenous JA level started to increase in accordance with the increase in OsOPR7 expression. The GFP-OsOPR7 fusion protein was detected exclusively in peroxisomes in onion epidermal cells. Furthermore, complementation analysis using an Arabidopsis opr3 mutant indicated that the OsOPR7 gene, but not OsOPR1, was able to complement the phenotypes of male sterility in the mutant caused by JA deficiency, and that JA production in the opr3 mutant was also restored by the expression of the OsOPR7 gene. We conclude that the OsOPR7 gene encodes the enzyme catalysing the reduction of natural (+)-cis-OPDA for the JA biosynthesis in rice. PMID:17938955

  8. Diversity of acid stress resistant variants of Listeria monocytogenes and the potential role of ribosomal protein S21 encoded by rpsU

    PubMed Central

    Metselaar, Karin I.; den Besten, Heidy M. W.; Boekhorst, Jos; van Hijum, Sacha A. F. T.; Zwietering, Marcel H.; Abee, Tjakko

    2015-01-01

    The dynamic response of microorganisms to environmental conditions depends on the behavior of individual cells within the population. Adverse environments can select for stable stress resistant subpopulations. In this study, we aimed to get more insight in the diversity within Listeria monocytogenes LO28 populations, and the genetic basis for the increased resistance of stable resistant fractions isolated after acid exposure. Phenotypic cluster analysis of 23 variants resulted in three clusters and four individual variants and revealed multiple-stress resistance, with both unique and overlapping features related to stress resistance, growth, motility, biofilm formation, and virulence indicators. A higher glutamate decarboxylase activity correlated with increased acid resistance. Whole genome sequencing revealed mutations in rpsU, encoding ribosomal protein S21 in the largest phenotypic cluster, while mutations in ctsR, which were previously shown to be responsible for increased resistance of heat and high hydrostatic pressure resistant variants, were not found in the acid resistant variants. This underlined that large population diversity exists within one L. monocytogenes strain and that different adverse conditions drive selection for different variants. The finding that acid stress selects for rpsU variants provides potential insights in the mechanisms underlying population diversity of L. monocytogenes. PMID:26005439

  9. Cross-species conservation of complementary amino acid-ribonucleobase interactions and their potential for ribosome-free encoding

    PubMed Central

    Cannon, John G. D.; Sherman, Rachel M.; Wang, Victoria M. Y.; Newman, Grace A.

    2015-01-01

    The role of amino acid-RNA nucleobase interactions in the evolution of RNA translation and protein-mRNA autoregulation remains an open area of research. We describe the inference of pairwise amino acid-RNA nucleobase interaction preferences using structural data from known RNA-protein complexes. We observed significant matching between an amino acid’s nucleobase affinity and corresponding codon content in both the standard genetic code and mitochondrial variants. Furthermore, we showed that knowledge of nucleobase preferences allows statistically significant prediction of protein primary sequence from mRNA using purely physiochemical information. Interestingly, ribosomal primary sequences were more accurately predicted than non-ribosomal sequences, suggesting a potential role for direct amino acid-nucleobase interactions in the genesis of amino acid-based ribosomal components. Finally, we observed matching between amino acid-nucleobase affinities and corresponding mRNA sequences in 35 evolutionarily diverse proteomes. We believe these results have important implications for the study of the evolutionary origins of the genetic code and protein-mRNA cross-regulation. PMID:26656258

  10. Large-Scale Conformational Transitions and Dimerization Are Encoded in the Amino-Acid Sequences of Hsp70 Chaperones

    PubMed Central

    Malinverni, Duccio; Marsili, Simone; Barducci, Alessandro; De Los Rios, Paolo

    2015-01-01

    Hsp70s are a class of ubiquitous and highly conserved molecular chaperones playing a central role in the regulation of proteostasis in the cell. Hsp70s assist a myriad of cellular processes by binding unfolded or misfolded substrates during a complex biochemical cycle involving large-scale structural rearrangements. Here we show that an analysis of coevolution at the residue level fully captures the characteristic large-scale conformational transitions of this protein family, and predicts an evolutionary conserved–and thus functional–homo-dimeric arrangement. Furthermore, we highlight that the features encoding the Hsp70 dimer are more conserved in bacterial than in eukaryotic sequences, suggesting that the known Hsp70/Hsp110 hetero-dimer is a eukaryotic specialization built on a pre-existing template. PMID:26046683

  11. cpc-3, the Neurospora crassa homologue of yeast GCN2, encodes a polypeptide with juxtaposed eIF2alpha kinase and histidyl-tRNA synthetase-related domains required for general amino acid control.

    PubMed

    Sattlegger, E; Hinnebusch, A G; Barthelmess, I B

    1998-08-01

    Based on characteristic amino acid sequences of kinases that phosphorylate the alpha subunit of eukaryotic translation initiation factor 2 (eIF2alpha kinases), degenerate oligonucleotide primers were constructed and used to polymerase chain reaction-amplify from genomic DNA of Neurospora crassa a sequence encoding part of a putative protein kinase. With this sequence an open reading frame was identified encoding a predicted polypeptide with juxtaposed eIF2alpha kinase and histidyl-tRNA synthetase-related domains. The 1646 amino acid sequence of this gene, called cpc-3, showed 35% positional identity over almost the entire sequence with GCN2 of yeast, which stimulates translation of the transcriptional activator of amino acid biosynthetic genes encoded by GCN4. Strains disrupted for cpc-3 were unable to induce increased transcription and derepression of amino acid biosynthetic enzymes in amino acid-deprived cells. The cpc-3 mutation did not affect the ability to up-regulate mRNA levels of cpc-1, encoding the GCN4 homologue and transcriptional activator of amino acid biosynthetic genes in N. crassa, but the mutation abolished the dramatic increase of CPC1 protein level in response to amino acid deprivation. These findings suggest that cpc-3 is the functional homologue of GCN2, being required for increased translation of cpc-1 mRNA in amino acid-starved cells. PMID:9685394

  12. Expression cloning in yeast of a cDNA encoding a broad specificity amino acid permease from Arabidopsis thaliana.

    PubMed Central

    Frommer, W B; Hummel, S; Riesmeier, J W

    1993-01-01

    To study amino acid transport in plants at the molecular level, we have isolated an amino acid permease cDNA from Arabidopsis thaliana by complementation of a yeast mutant defective in proline uptake with a cDNA. The predicted polypeptide of 53 kDa is highly hydrophobic with 12 putative membrane-spanning regions and shows no significant homologies to other known transporters. Expression of the cDNA enables the yeast mutant to take up L-[14C]proline. Competition studies argue for a broad but stereospecific substrate recognition by the permease, which resembles neutral or general amino acid transport systems from Chlorella and higher plants. Both pH dependence and inhibition by protonophores are consistent with a proton symport mechanism. Images Fig. 1 PMID:8327465

  13. Ectopic expression of Arabidopsis genes encoding salicylic acid- and jasmonic acid-related proteins confers partial resistance to soybean cyst nematode (Heterodera glycines) in transgenic soybean roots

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Background. Extensive studies using the model system Arabidopsis thaliana to elucidate plant defense signaling and pathway networks indicate that salicylic acid (SA) is the key hormone triggering the plant defense response against biotrophic and hemi-biotrophic pathogens, while jasmonic acid (JA) an...

  14. The brown midrib3 (bm3) mutation in maize occurs in the gene encoding caffeic acid O-methyltransferase.

    PubMed Central

    Vignols, F; Rigau, J; Torres, M A; Capellades, M; Puigdomènech, P

    1995-01-01

    The brown midrib mutations are among the earliest described in maize. Plants containing a brown midrib mutation exhibit a reddish brown pigmentation of the leaf midrib starting when there are four to six leaves. These mutations are known to alter lignin composition and digestibility of plants and therefore constitute prime candidates in the breeding of silage maize. Here, we show that two independent brown midrib3 (bm3) mutations have resulted from structural changes in the COMT gene, which encodes the enzyme O-methyltransferase (COMT; EC 2.1.1.6), involved in lignin biosynthesis. Our results indicate that the bm3-1 allele (the reference mutant allele) has arisen from an insertional event producing a COMT mRNA altered in both size and amount. By sequencing a COMT cDNA clone obtained from bm3-1 maize, a retrotransposon with homology to the B5 element has been found to be inserted near the junction of the 3' coding region of the COMT gene intron. The second bm3 allele, bm3-2, has resulted from a deletion of part of the COMT gene. These alterations of the COMT gene were confirmed by DNA gel blot and polymerase chain reaction amplification analyses. These results clearly demonstrate that mutations at the COMT gene give a brown midrib3 phenotype. Thus, the gene genetically recognized as bm3 is the same as the one coding for COMT. PMID:7773015

  15. Isolation and characterization of a gene specific to lager brewing yeast that encodes a branched-chain amino acid permease.

    PubMed

    Kodama, Y; Omura, F; Ashikari, T

    2001-08-01

    We found two types of branched-chain amino acid permease gene (BAP2) in the lager brewing yeast Saccharomyces pastorianus BH-225 and cloned one type of BAP2 gene (Lg-BAP2), which is identical to that of Saccharomyces bayanus (by-BAP2-1). The other BAP2 gene of the lager brewing yeast (cer-BAP2) is very similar to the Saccharomyces cerevisiae BAP2 gene. This result substantiates the notion that lager brewing yeast is a hybrid of S. cerevisiae and S. bayanus. The amino acid sequence homology between S. cerevisiae Bap2p and Lg-Bap2p was 88%. The transcription of Lg-BAP2 was not induced by the addition of leucine to the growth medium, while that of cer-BAP2 was induced. The transcription of Lg-BAP2 was repressed by the presence of ethanol and weak organic acid, while that of cer-BAP2 was not affected by these compounds. Furthermore, Northern analysis during beer fermentation revealed that the transcription of Lg-BAP2 was repressed at the beginning of the fermentation, while cer-BAP2 was highly expressed throughout the fermentation. These results suggest that the transcription of Lg-BAP2 is regulated differently from that of cer-BAP2 in lager brewing yeasts. PMID:11472919

  16. Hartnup disorder is caused by mutations in the gene encoding the neutral amino acid transporter SLC6A19.

    PubMed

    Seow, Heng F; Bröer, Stefan; Bröer, Angelika; Bailey, Charles G; Potter, Simon J; Cavanaugh, Juleen A; Rasko, John E J

    2004-09-01

    Hartnup disorder (OMIM 234500) is an autosomal recessive abnormality of renal and gastrointestinal neutral amino acid transport noted for its clinical variability. We localized a gene causing Hartnup disorder to chromosome 5p15.33 and cloned a new gene, SLC6A19, in this region. SLC6A19 is a sodium-dependent and chloride-independent neutral amino acid transporter, expressed predominately in kidney and intestine, with properties of system B(0). We identified six mutations in SLC6A19 that cosegregated with disease in the predicted recessive manner, with most affected individuals being compound heterozygotes. The disease-causing mutations that we tested reduced neutral amino acid transport function in vitro. Population frequencies for the most common mutated SLC6A19 alleles are 0.007 for 517G --> A and 0.001 for 718C --> T. Our findings indicate that SLC6A19 is the long-sought gene that is mutated in Hartnup disorder; its identification provides the opportunity to examine the inconsistent multisystemic features of this disorder. PMID:15286788

  17. Identification and sequence analysis of pWcMBF8-1, a bacteriocin-encoding plasmid from the lactic acid bacterium Weissella confusa.

    PubMed

    Malik, Amarila; Sumayyah, Sumayyah; Yeh, Chia-Wen; Heng, Nicholas C K

    2016-04-01

    Members of the Gram-positive lactic acid bacteria (LAB) are well-known for their beneficial properties as starter cultures and probiotics. Many LAB species produce ribosomally synthesized proteinaceous antibiotics (bacteriocins). Weissella confusa MBF8-1 is a strain isolated from a fermented soybean product that not only produces useful exopolysaccharides but also exhibits bacteriocin activity, which we call weissellicin MBF. Here, we show that bacteriocin production by W. confusa MBF8-1 is specified by a large plasmid, pWcMBF8-1. Plasmid pWcMBF8-1 (GenBank accession number KR350502), which was identified from the W. confusa MBF8-1 draft genome sequence, is 17 643 bp in length with a G + C content of 34.8% and contains 25 open reading frames (ORFs). Six ORFs constitute the weissellicin MBF locus, encoding three putative double-glycine-motif peptides (Bac1, Bac2, Bac3), an ABC transporter complex (BacTE) and a putative immunity protein (BacI). Two ORFs encode plasmid partitioning and mobilization proteins, suggesting that pWcMBF8-1 is transferable to other hosts. To the best of our knowledge, plasmid pWcMBF8-1 not only represents the first large Weissella plasmid to be sequenced but also the first to be associated with bacteriocin production in W. confusa. PMID:26976853

  18. Enhanced Efficacy of an AAV Vector Encoding Chimeric, Highly-Secreted Acid α-glucosidase in Glycogen Storage Disease Type II

    PubMed Central

    Sun, Baodong; Zhang, Haoyue; Benjamin, Daniel K.; Brown, Talmage; Bird, Andrew; Young, Sarah P.; McVie-Wylie, Alison; Chen, Y-T; Koeberl, Dwight D.

    2009-01-01

    Glycogen storage disease type II (GSD-II; Pompe disease; MIM 232300) is an inherited muscular dystrophy caused by deficiency in the activity of the lysosomal enzyme acid α-glucosidase (GAA). We hypothesized that chimeric GAA containing an alternative signal peptide could increase the secretion of GAA from transduced cells and enhance the receptor-mediated uptake of GAA in striated muscle. The relative secretion of chimeric GAA from transfected 293 cells increased up to 26-fold. Receptor-mediated uptake of secreted, chimeric GAA corrected cultured GSD-II patient cells. High-level hGAA was sustained in the plasma of GSD-II mice for 24 weeks following administration of an AAV2/8 vector encoding chimeric GAA; furthermore, GAA activity was increased and glycogen content was significantly reduced in striated muscle and in the brain. Administration of only 1×1010 vector particles increased GAA activity in the heart and diaphragm for >18 weeks, whereas 3×1010 vector particles increased GAA activity and reduced glycogen content in the heart, diaphragm, and quadriceps. Furthermore, an AAV2/2 vector encoding chimeric GAA produced secreted hGAA for >12 weeks in the majority of treated GSD-II mice. Thus, chimeric, highly secreted GAA enhanced the efficacy of AAV vector-mediated gene therapy in GSD-II mice. PMID:16987711

  19. Deciphering ENCODE.

    PubMed

    Diehl, Adam G; Boyle, Alan P

    2016-04-01

    The ENCODE project represents a major leap from merely describing and comparing genomic sequences to surveying them for direct indicators of function. The astounding quantity of data produced by the ENCODE consortium can serve as a map to locate specific landmarks, guide hypothesis generation, and lead us to principles and mechanisms underlying genome biology. Despite its broad appeal, the size and complexity of the repository can be intimidating to prospective users. We present here some background about the ENCODE data, survey the resources available for accessing them, and describe a few simple principles to help prospective users choose the data type(s) that best suit their needs, where to get them, and how to use them to their best advantage. PMID:26962025

  20. Spectroscopic Studies of R(+)-α-Lipoic Acid—Cyclodextrin Complexes

    PubMed Central

    Ikuta, Naoko; Tanaka, Akira; Otsubo, Ayako; Ogawa, Noriko; Yamamoto, Hiromitsu; Mizukami, Tomoyuki; Arai, Shoji; Okuno, Masayuki; Terao, Keiji; Matsugo, Seiichi

    2014-01-01

    α-Lipoic acid (ALA) has a chiral center at the C6 position, and exists as two enantiomers, R(+)-ALA (RALA) and S(−)-ALA (SALA). RALA is naturally occurring, and is a cofactor for mitochondrial enzymes, therefore playing a major role in energy metabolism. However, RALA cannot be used for pharmaceuticals or nutraceuticals because it readily polymerizes via a 1,2-dithiolane ring-opening when exposed to light or heat. So, it is highly desired to find out the method to stabilize RALA. The purpose of this study is to provide the spectroscopic information of stabilized RALA and SALA through complexation with cyclodextrins (CDs), α-CD, β-CD and γ-CD and to examine the physical characteristics of the resultant complexes in the solid state. The RALA-CD structures were elucidated based on the micro fourier transform infrared (FT-IR) and Raman analyses. The FT-IR results showed that the C=O stretching vibration of RALA appeared at 1717 cm−1 and then shifted on formation of the RALA-CD complexes. The Raman spectra showed that the S–S and C–S stretching vibrations for RALA at 511 cm−1 (S–S), 631 cm−1 (C–S) and 675 cm−1 (C–S) drastically weakened and almost disappeared upon complexation with CDs. Several peaks indicative of O–H vibrations also shifted or changed in intensity. These results indicate that RALA and CDs form host-guest complexes by interacting with one another. PMID:25387076

  1. Dissection of the erythroid-specific transcriptional promoter used by the gene encoding aminolevulinic acid dehydratase (ALAD)

    SciTech Connect

    Bishop, T.R.; Schaffer, T.; Pien, B.

    1994-09-01

    The gene encoding delta-aminolevulinate dehydratase (ALAD), the second enzyme of the heme biosynthetic pathway, exists as a single gene in most mammalian genomes and we have sequenced over 12 kb from overlapping lambda clones containing the murine ALAD gene. The gene has a dual promoter driving expression of two different first exons; exon1A is expressed in all tissues and exon1B only in erythroid cells, where heme production is induced to exceptionally high levels for hemoglobin synthesis. Erythroid-specific expression of the ALAD gene is presumably accomplished by using the exon1B promoter which we hypothesize is responsive to erythroid-specific transcriptional activators. In order to test this, we have used gel mobility shift assays and DNase footprint analyses to dissect and identify the critical upstream regulatory elements. Nuclear extracts, prepared from murine erythroleukemia cells (MELC), human chronic myelogenous leukemia cell line (K562) and human fibroblast cell line (HeLa), were used as sources of proteins to analyze DNA binding sites in the ALAD erythroid-specific promoter from -307 to +1. In this region, there are three potential GATA1 sites, two CACCC boxes, a CCAAT box and a GGTGG box. NF-E2 sites were explored by using in vitro translation products of cloned p18 and p45, the two heterologous components of NF-E2, and successfully gel-shifted a 29 bp double-stranded oligo found at 2.6 kb in front of the ALAD gene. Thus, the ALAD gene utilizes both a housekeeping and a tissue-specific promoter.

  2. Evolution of a Genome-Encoded Bias in Amino Acid Biosynthetic Pathways Is a Potential Indicator of Amino Acid Dynamics in the Environment

    PubMed Central

    Fasani, Rick A.; Savageau, Michael A.

    2014-01-01

    Overcoming the stress of starvation is one of an organism’s most challenging phenotypic responses. Those organisms that frequently survive the challenge, by virtue of their fitness, will have evolved genomes that are shaped by their specific environments. Understanding this genotype–environment–phenotype relationship at a deep level will require quantitative predictive models of the complex molecular systems that link these aspects of an organism’s existence. Here, we treat one of the most fundamental molecular systems, protein synthesis, and the amino acid biosynthetic pathways involved in the stringent response to starvation. These systems face an inherent logical dilemma: Building an amino acid biosynthetic pathway to synthesize its product—the cognate amino acid of the pathway—may require that very amino acid when it is no longer available. To study this potential “catch-22,” we have created a generic model of amino acid biosynthesis in response to sudden starvation. Our mathematical analysis and computational results indicate that there are two distinctly different outcomes: Partial recovery to a new steady state, or full system failure. Moreover, the cell’s fate is dictated by the cognate bias, the number of cognate amino acids in the corresponding biosynthetic pathway relative to the average number of that amino acid in the proteome. We test these implications by analyzing the proteomes of over 1,800 sequenced microbes, which reveals statistically significant evidence of low cognate bias, a genetic trait that would avoid the biosynthetic quandary. Furthermore, these results suggest that the pattern of cognate bias, which is readily derived by genome sequencing, may provide evolutionary clues to an organism’s natural environment. PMID:25118252

  3. Asparagusic acid.

    PubMed

    Mitchell, Stephen C; Waring, Rosemary H

    2014-01-01

    Asparagusic acid (1,2-dithiolane-4-carboxylic acid) is a simple sulphur-containing 5-membered heterocyclic compound that appears unique to asparagus, though other dithiolane derivatives have been identified in non-food species. This molecule, apparently innocuous toxicologically to man, is the most probable culprit responsible for the curious excretion of odorous urine following asparagus ingestion. The presence of the two adjacent sulphur atoms leads to an enhanced chemical reactivity, endowing it with biological properties including the ability to substitute potentially for α-lipoic acid in α-keto-acid oxidation systems. This brief review collects the scattered data available in the literature concerning asparagusic acid and highlights its properties, intermediary metabolism and exploratory applications. PMID:24099657

  4. In Candida parapsilosis the ATC1 Gene Encodes for an Acid Trehalase Involved in Trehalose Hydrolysis, Stress Resistance and Virulence

    PubMed Central

    Sánchez-Fresneda, Ruth; Martínez-Esparza, María; Maicas, Sergi; Argüelles, Juan-Carlos; Valentín, Eulogio

    2014-01-01

    An ORF named CPAR2-208980 on contig 005809 was identified by screening a Candida parapsilosis genome data base. Its 67% identity with the acid trehalase sequence from C. albicans (ATC1) led us to designate it CpATC1. Homozygous mutants that lack acid trehalase activity were constructed by gene disruption at the two CpATC1 chromosomal alleles. Phenotypic characterization showed that atc1Δ null cells were unable to grow on exogenous trehalose as carbon source, and also displayed higher resistance to environmental challenges, such as saline exposure (1.2 M NaCl), heat shock (42°C) and both mild and severe oxidative stress (5 and 50 mM H2O2). Significant amounts of intracellular trehalose were specifically stored in response to the thermal upshift in both wild type and mutant strains. Analysis of their antioxidant activities revealed that catalase was only triggered in response to heat shock in atc1Δ cells, whereas glutathione reductase was activated upon mild oxidative stress in wild type and reintegrant strains, and in response to the whole set of stress treatments in the homozygous mutant. Furthermore, yeast cells with double CpATC1 deletion were significantly attenuated in non-mammalian infection models, suggesting that CpATC1 is required for the pathobiology of the fungus. Our results demonstrate the involvement of CpAtc1 protein in the physiological hydrolysis of external trehalose in C. parapsilosis, where it also plays a major role in stress resistance and virulence. PMID:24922533

  5. Bombyx mori nucleopolyhedrovirus orf8 encodes a nucleic acid binding protein that colocalizes with IE1 during infection.

    PubMed

    Imai, N; Kurihara, M; Matsumoto, S; Kang, W-K

    2004-08-01

    This report describes the characterization of the Bombyx mori nucleopolyhedrovirus (BmNPV) orf8 gene. Immunoblot analyses demonstrated that orf8 was expressed as an early gene. The ORF8 protein accumulated in the nucleus, and was maintained at relatively constant levels from 4 to 24 h postinfection. Immunoblot analysis failed to detect ORF8 protein associated with budded virus and occlusion derived virus. In addition, immunohistochemical analysis by confocal microscopy showed that ORF8 protein colocalized with IE1 to specific nuclear foci throughout infection. To further examine the function of ORF8, a reporter gene was inserted into the orf8 reading frame. One orf8 disruption mutant (BmD8), which expressed the N-terminal half of ORF8, was isolated. However, it was not possible to isolate a null mutant, suggesting that orf8 may have an important role during viral infection. Single-step growth curves showed that BV production was reduced in BmD8 infected cells. Biochemical analyses indicated that ORF8 bound to nucleic acids. Together, these results suggest that BmNPV ORF8 may be involved in viral DNA replication and/or transcription. PMID:15290382

  6. Retinoic Acid Induces Embryonic Stem Cell Differentiation by Altering Both Encoding RNA and microRNA Expression

    PubMed Central

    Yu, Mengying; Wu, Haibo; Ai, Zhiying; Wu, Yongyan; Liu, Hongliang; Du, Juan; Guo, Zekun; Zhang, Yong

    2015-01-01

    Retinoic acid (RA) is a vitamin A metabolite that is essential for early embryonic development and promotes stem cell neural lineage specification; however, little is known regarding the impact of RA on mRNA transcription and microRNA levels on embryonic stem cell differentiation. Here, we present mRNA microarray and microRNA high-output sequencing to clarify how RA regulates gene expression. Using mRNA microarray analysis, we showed that RA repressed pluripotency-associated genes while activating ectoderm markers in mouse embryonic stem cells (mESCs). Moreover, RA modulated the DNA methylation of mESCs by altering the expression of epigenetic-associated genes such as Dnmt3b and Dnmt3l. Furthermore, H3K4me2, a pluripotent histone modification, was repressed by RA stimulation. From microRNA sequence data, we identified two downregulated microRNAs, namely, miR-200b and miR-200c, which regulated the pluripotency of stem cells. We found that miR-200b or miR-200c deficiency suppressed the expression of pluripotent genes, including Oct4 and Nanog, and activated the expression of the ectodermal marker gene Nestin. These results demonstrate that retinoid induces mESCs to differentiate by regulating miR-200b/200c. Our findings provide the landscapes of mRNA and microRNA gene networks and indicate the crucial role of miR-200b/200c in the RA-induced differentiation of mESCs. PMID:26162091

  7. Suppression of 9-cis-Epoxycarotenoid Dioxygenase, Which Encodes a Key Enzyme in Abscisic Acid Biosynthesis, Alters Fruit Texture in Transgenic Tomato1[W][OA

    PubMed Central

    Sun, Liang; Sun, Yufei; Zhang, Mei; Wang, Ling; Ren, Jie; Cui, Mengmeng; Wang, Yanping; Ji, Kai; Li, Ping; Li, Qian; Chen, Pei; Dai, Shengjie; Duan, Chaorui; Wu, Yan; Leng, Ping

    2012-01-01

    Cell wall catabolism during fruit ripening is under complex control and is key for fruit quality and shelf life. To examine the role of abscisic acid (ABA) in tomato (Solanum lycopersicum) fruit ripening, we suppressed SlNCED1, which encodes 9-cis-epoxycarotenoid dioxygenase (NCED), a key enzyme in the biosynthesis of ABA. To suppress SlNCED1 specifically in tomato fruits, and thus avoid the pleiotropic phenotypes associated with ABA deficiency, we used an RNA interference construct driven by the fruit-specific E8 promoter. ABA accumulation and SlNCED1 transcript levels in the transgenic fruit were down-regulated to between 20% and 50% of the levels measured in the control fruit. This significant reduction in NCED activity led to a down-regulation in the transcription of genes encoding major cell wall catabolic enzymes, specifically polygalacturonase (SlPG), pectin methyl esterase (SlPME), β-galactosidase precursor mRNA (SlTBG), xyloglucan endotransglycosylase (SlXET), endo-1,4-β-cellulose (SlCels), and expansin (SlExp). This resulted in an increased accumulation of pectin during ripening. In turn, this led to a significant extension of the shelf life to 15 to 29 d compared with a shelf life of only 7 d for the control fruit and an enhancement of fruit firmness at the mature stage by 30% to 45%. In conclusion, ABA affects cell wall catabolism during tomato fruit ripening via down-regulation of the expression of major catabolic genes (SlPG, SlPME, SlTBG, SlXET, SlCels, and SlExp). PMID:22108525

  8. ScChi, Encoding an Acidic Class III Chitinase of Sugarcane, Confers Positive Responses to Biotic and Abiotic Stresses in Sugarcane

    PubMed Central

    Su, Yachun; Xu, Liping; Fu, Zhiwei; Yang, Yuting; Guo, Jinlong; Wang, Shanshan; Que, Youxiong

    2014-01-01

    Chitinases (EC 3.2.2.14), expressed during the plant-pathogen interaction, are associated with plant defense against pathogens. In the present study, a positive correlation between chitinase activity and sugarcane smut resistance was found. ScChi (GenBank accession no. KF664180), a Class III chitinase gene, encoded a 31.37 kDa polypeptide, was cloned and identified. Subcellular localization revealed ScChi targeting to the nucleus, cytoplasm and the plasma membrane. Real-time quantitative PCR (RT-qPCR) results showed that ScChi was highly expressed in leaf and stem epidermal tissues. The ScChi transcript was both higher and maintained longer in the resistance cultivar during challenge with Sporisorium scitamineum. The ScChi also showed an obvious induction of transcription after treatment with SA (salicylic acid), H2O2, MeJA (methyl jasmonate), ABA (abscisic acid), NaCl, CuCl2, PEG (polyethylene glycol) and low temperature (4 °C). The expression levels of ScChi and six immunity associated marker genes were upregulated by the transient overexpression of ScChi. Besides, histochemical assay of Nicotiana benthamiana leaves overexpressing pCAMBIA 1301-ScChi exhibited deep DAB (3,3′-diaminobenzidinesolution) staining color and high conductivity, indicating the high level of H2O2 accumulation. These results suggest a close relationship between the expression of ScChi and plant immunity. In conclusion, the positive responses of ScChi to the biotic and abiotic stimuli reveal that this gene is a stress-related gene of sugarcane. PMID:24552874

  9. Deletion of a gene encoding an amino acid transporter in the midgut membrane causes resistance to a Bombyx parvo-like virus.

    PubMed

    Ito, Katsuhiko; Kidokoro, Kurako; Sezutsu, Hideki; Nohata, Junko; Yamamoto, Kimiko; Kobayashi, Isao; Uchino, Keiro; Kalyebi, Andrew; Eguchi, Ryokitsu; Hara, Wajiro; Tamura, Toshiki; Katsuma, Susumu; Shimada, Toru; Mita, Kazuei; Kadono-Okuda, Keiko

    2008-05-27

    Bombyx mori densovirus type 2 (BmDNV-2), a parvo-like virus, replicates only in midgut columnar cells and causes fatal disease. The resistance expressed in some silkworm strains against the virus is determined by a single gene, nsd-2, which is characterized as nonsusceptibility irrespective of the viral dose. However, the responsible gene has been unknown. We isolated the nsd-2 gene by positional cloning. The virus resistance is caused by a 6-kb deletion in the ORF of a gene encoding a 12-pass transmembrane protein, a member of an amino acid transporter family, and expressed only in midgut. Germ-line transformation with a wild-type transgene expressed in the midgut restores susceptibility, showing that the defective membrane protein is responsible for resistance. Cumulatively, our data show that the membrane protein is a functional receptor for BmDNV-2. This is a previously undescribed report of positional cloning of a mutant gene in Bombyx and isolation of an absolute virus resistance gene in insects. PMID:18495929

  10. Differential regulation of genes encoding 1-aminocyclopropane-1-carboxylate (ACC) synthase in etiolated pea seedlings: effects of indole-3-acetic acid, wounding, and ethylene.

    PubMed

    Peck, S C; Kende, H

    1998-12-01

    Treatment of 5- to 6-day-old etiolated pea (Pisum sativum L.) seedlings with indole-3-acetic acid (IAA) induced within 15 min an increase in the transcript levels of two genes encoding 1-aminocyclopropane-1-carboxylate (ACC) synthase, Ps-ACS1 and Ps-ACS2. Simultaneous treatment with ethylene inhibited this increase and also caused a decrease in ACC synthase enzyme activity as compared to that of seedlings treated with IAA alone. These results indicate that ethylene inhibits its own biosynthesis by decreasing ACC synthase transcript levels via a negative feedback loop. Wounding of pea stems had no effect on the expression of Ps-ACS1, but led within 10 min to an increase in the mRNA levels of Ps-ACS2. This increase was also inhibited by ethylene. The wound signal was transmitted over a distance of at least 4 cm through the stem with no delay in induction or response intensity. The rapid transmission of the wound response is consistent with the possibility that a hydraulic or electric signal is responsible for the spread of the wound response. PMID:9869404

  11. Saponin Biosynthesis in Saponaria vaccaria. cDNAs Encoding β-Amyrin Synthase and a Triterpene Carboxylic Acid Glucosyltransferase1[OA

    PubMed Central

    Meesapyodsuk, Dauenpen; Balsevich, John; Reed, Darwin W.; Covello, Patrick S.

    2007-01-01

    Saponaria vaccaria (Caryophyllaceae), a soapwort, known in western Canada as cowcockle, contains bioactive oleanane-type saponins similar to those found in soapbark tree (Quillaja saponaria; Rosaceae). To improve our understanding of the biosynthesis of these saponins, a combined polymerase chain reaction and expressed sequence tag approach was taken to identify the genes involved. A cDNA encoding a β-amyrin synthase (SvBS) was isolated by reverse transcription-polymerase chain reaction and characterized by expression in yeast (Saccharomyces cerevisiae). The SvBS gene is predominantly expressed in leaves. A S. vaccaria developing seed expressed sequence tag collection was developed and used for the isolation of a full-length cDNA bearing sequence similarity to ester-forming glycosyltransferases. The gene product of the cDNA, classified as UGT74M1, was expressed in Escherichia coli, purified, and identified as a triterpene carboxylic acid glucosyltransferase. UGT74M1 is expressed in roots and leaves and appears to be involved in monodesmoside biosynthesis in S. vaccaria. PMID:17172290

  12. FcLDP1, a Gene Encoding a Late Embryogenesis Abundant (LEA) Domain Protein, Responds to Brassinosteroids and Abscisic Acid during the Development of Fruits in Fragaria chiloensis.

    PubMed

    Espinoza, Analía; Contreras, Rodrigo; Zúñiga, Gustavo E; Herrera, Raúl; Moya-León, María Alejandra; Norambuena, Lorena; Handford, Michael

    2016-01-01

    White Chilean strawberries (Fragaria chiloensis) are non-climacteric fruits, with an exotic color and aroma. In order to discover genes involved in the development of these fruits, we identified a fragment of a gene encoding a late embryogenesis abundant domain protein, FcLDP1, that was expressed in early stages of fruit development, particularly in receptacles. Hormones play key roles in regulating the development of non-climacteric fruits. We show that the brassinosteroid content of the white strawberry varies during development. Additionally, FcLDP1 as well as the closest ortholog in the woodland strawberry, F. vesca (FvLDP1) possess multiple brassinosteroid, as well as abscisic acid (ABA) response motifs in the promoter region, consistent with the response of transiently expressed FcLDP1 promoter-GFP fusions to these hormones, and the rise in FcLDP1 transcript levels in white strawberry fruits treated with brassinosteroids or ABA. These findings suggest that both hormones regulate FcLDP1 expression during the development of white strawberries. PMID:27379111

  13. FcLDP1, a Gene Encoding a Late Embryogenesis Abundant (LEA) Domain Protein, Responds to Brassinosteroids and Abscisic Acid during the Development of Fruits in Fragaria chiloensis

    PubMed Central

    Espinoza, Analía; Contreras, Rodrigo; Zúñiga, Gustavo E.; Herrera, Raúl; Moya-León, María Alejandra; Norambuena, Lorena; Handford, Michael

    2016-01-01

    White Chilean strawberries (Fragaria chiloensis) are non-climacteric fruits, with an exotic color and aroma. In order to discover genes involved in the development of these fruits, we identified a fragment of a gene encoding a late embryogenesis abundant domain protein, FcLDP1, that was expressed in early stages of fruit development, particularly in receptacles. Hormones play key roles in regulating the development of non-climacteric fruits. We show that the brassinosteroid content of the white strawberry varies during development. Additionally, FcLDP1 as well as the closest ortholog in the woodland strawberry, F. vesca (FvLDP1) possess multiple brassinosteroid, as well as abscisic acid (ABA) response motifs in the promoter region, consistent with the response of transiently expressed FcLDP1 promoter-GFP fusions to these hormones, and the rise in FcLDP1 transcript levels in white strawberry fruits treated with brassinosteroids or ABA. These findings suggest that both hormones regulate FcLDP1 expression during the development of white strawberries. PMID:27379111

  14. Pectobacterium atrosepticum and Pectobacterium carotovorum Harbor Distinct, Independently Acquired Integrative and Conjugative Elements Encoding Coronafacic Acid that Enhance Virulence on Potato Stems.

    PubMed

    Panda, Preetinanda; Vanga, Bhanupratap R; Lu, Ashley; Fiers, Mark; Fineran, Peter C; Butler, Ruth; Armstrong, Karen; Ronson, Clive W; Pitman, Andrew R

    2016-01-01

    Integrative and conjugative elements (ICEs) play a central role in the evolution of bacterial virulence, their transmission between bacteria often leading to the acquisition of virulence factors that alter host range or aggressiveness. Much is known about the functions of the virulence determinants that ICEs harbor, but little is understood about the cryptic effects of ICEs on their host cell. In this study, the importance of horizontally acquired island 2 (HAI2), an ICE in the genome of Pectobacterium atrosepticum SCRI1043, was studied using a strain in which the entire ICE had been removed by CRISPR-Cas-mediated genome editing. HAI2 encodes coronafacic acid, a virulence factor that enhances blackleg disease of potato stems caused by P. atrosepticum SCRI1043. As expected, deletion of HAI2 resulted in reduced blackleg symptoms in potato stems. A subsequent screen for HAI2-related ICEs in other strains of the Pectobacterium genus revealed their ubiquitous nature in P. atrosepticum. Yet, HAI2-related ICEs were only detected in the genomes of a few P. carotovorum strains. These strains were notable as blackleg causing strains belonging to two different subspecies of P. carotovorum. Sequence analysis of the ICEs in different strains of both P. atrosepticum and P. carotovorum confirmed that they were diverse and were present in different locations on the genomes of their bacterial host, suggesting that the cfa cluster was probably acquired independently on a number of occasions via chromosomal insertion of related ICEs. Excision assays also demonstrated that the ICEs in both P. atrosepticum and P. carotovorum are mobilized from the host chromosome. Thus, the future spread of these ICEs via lateral gene transfer might contribute to an increase in the prevalence of blackleg-causing strains of P. carotovorum. PMID:27065965

  15. Pectobacterium atrosepticum and Pectobacterium carotovorum Harbor Distinct, Independently Acquired Integrative and Conjugative Elements Encoding Coronafacic Acid that Enhance Virulence on Potato Stems

    PubMed Central

    Panda, Preetinanda; Vanga, Bhanupratap R.; Lu, Ashley; Fiers, Mark; Fineran, Peter C.; Butler, Ruth; Armstrong, Karen; Ronson, Clive W.; Pitman, Andrew R.

    2016-01-01

    Integrative and conjugative elements (ICEs) play a central role in the evolution of bacterial virulence, their transmission between bacteria often leading to the acquisition of virulence factors that alter host range or aggressiveness. Much is known about the functions of the virulence determinants that ICEs harbor, but little is understood about the cryptic effects of ICEs on their host cell. In this study, the importance of horizontally acquired island 2 (HAI2), an ICE in the genome of Pectobacterium atrosepticum SCRI1043, was studied using a strain in which the entire ICE had been removed by CRISPR-Cas-mediated genome editing. HAI2 encodes coronafacic acid, a virulence factor that enhances blackleg disease of potato stems caused by P. atrosepticum SCRI1043. As expected, deletion of HAI2 resulted in reduced blackleg symptoms in potato stems. A subsequent screen for HAI2-related ICEs in other strains of the Pectobacterium genus revealed their ubiquitous nature in P. atrosepticum. Yet, HAI2-related ICEs were only detected in the genomes of a few P. carotovorum strains. These strains were notable as blackleg causing strains belonging to two different subspecies of P. carotovorum. Sequence analysis of the ICEs in different strains of both P. atrosepticum and P. carotovorum confirmed that they were diverse and were present in different locations on the genomes of their bacterial host, suggesting that the cfa cluster was probably acquired independently on a number of occasions via chromosomal insertion of related ICEs. Excision assays also demonstrated that the ICEs in both P. atrosepticum and P. carotovorum are mobilized from the host chromosome. Thus, the future spread of these ICEs via lateral gene transfer might contribute to an increase in the prevalence of blackleg-causing strains of P. carotovorum. PMID:27065965

  16. The dapE-encoded N-succinyl-L,L-Diaminopimelic Acid Desuccinylase from Haemophilus influenzae Contains two Active Site Histidine Residues

    PubMed Central

    Gillner, Danuta M.; Bienvenue, David L.; Nocek, Boguslaw P.; Joachimiak, Andrzej; Zachary, Vincentos; Bennett, Brian; Holz, Richard C.

    2009-01-01

    The catalytic and structural properties of the H67A and H349A altered dapE-encoded N-succinyl-l,l-diaminopimelic acid desuccinylase (DapE) from H. influenzae were investigated. Based on sequence alignment with CPG2 both H67 and H349 were predicted to be Zn(II) ligands. Catalytic activity was observed for the H67A altered DapE enzyme which exhibited kcat = 1.5 ± 0.5 sec−1 and Km = 1.4 ± 0.3 mM. No catalytic activity was observed for H349A under the experimental conditions used. The EPR and electronic absorption data indicate that the Co(II) ion bound to H349A-DapE is analogous to WT DapE after the addition of a single Co(II) ion. The addition of one equivalent of Co(II) to H67A altered DapE provides spectra that are very different from the first Co(II) binding site of the WT enzyme, but similar to the second binding site. The EPR and electronic absorption data, in conjunction with the kinetic data, are consistent with the assignment of H67 and H349 as active site metal ligands for the DapE from H. influenzae. Furthermore, the data suggest that H67 is a ligand in the first metal binding site while H349 resides in the second metal binding site. A three-dimensional homology structure of the DapE from H. influenzae was generated using the X-ray crystal structure of the DapE from N. meningitidis as a template and superimposed on the structure of AAP. This homology structure confirms the assignment of H67 and H349 as active site ligands. The superimposition of the homology model of DapE with the dizinc(II) structure of AAP indicates that within 4.0 Å of the Zn(II) binding sites of AAP, all of the amino acid residues of DapE are nearly identical. PMID:18712420

  17. Cloning and nucleotide sequences of livB and livC, the structural genes encoding binding proteins of the high-affinity branched-chain amino acid transport in Salmonella typhimurium.

    PubMed

    Ohnishi, K; Nakazima, A; Matsubara, K; Kiritani, K

    1990-02-01

    The liv gene cluster responsible for encoding the high-affinity branched-chain amino acid transport proteins in Salmonella typhimurium was mapped in the 7.6-kilobase HindIII-SacI segment of plasmid pMN12 by utilizing the gene dosage effect. By subcloning and biochemical analysis, the livB and livC structural genes encoding the leucine-, isoleucine-, valine-, threonine-binding protein (LIVT-BP) and the leucine-specific binding protein (L-BP), respectively, were localized within the 3,617-base HindIII-BstEII segment. Upon determining the nucleotide sequence of the 3,617 bases, we found that the coding sequence of the livB gene (1,095 base pairs) starts at the position 355 and specifies the precursor LIVT-BP of 365 amino acid residues, and the livC gene (1,107 base pairs) starts at the position 2,452 and encodes the precursor L-BP of 369 amino acid residues. The two genes, separated by a 1-kilobase intergenic region, each possess potential promoters and rho-independent transcriptional terminators. The mature LIVT-BP and L-BP are produced by removing the putative 21 and 23 signal peptides from the respective precursors. In comparison with the analogous two binding proteins from Escherichia coli K-12, strong homologies are observed. PMID:2193932

  18. Conjugated linoleic acid-enriched butter improved memory and up-regulated phospholipase A2 encoding-genes in rat brain tissue.

    PubMed

    Gama, Marco A S; Raposo, Nádia R B; Mury, Fábio B; Lopes, Fernando C F; Dias-Neto, Emmanuel; Talib, Leda L; Gattaz, Wagner F

    2015-10-01

    Reduced phospholipase A2 (PLA2) activity has been reported in blood cells and in postmortem brains of patients with Alzheimer disease (AD), and there is evidence that conjugated linoleic acid (CLA) modulates the activity of PLA2 groups in non-brain tissues. As CLA isomers were shown to be actively incorporated and metabolized in the brains of rats, we hypothesized that feeding a diet naturally enriched in CLA would affect the activity and expression of Pla 2 -encoding genes in rat brain tissue, with possible implications for memory. To test this hypothesis, Wistar rats were trained for the inhibitory avoidance task and fed a commercial diet (control) or experimental diets containing either low CLA- or CLA-enriched butter for 4 weeks. After this period, the rats were tested for memory retrieval and killed for tissue collection. Hippocampal expression of 19 Pla 2 genes was evaluated by qPCR, and activities of PLA2 groups (cPLA2, iPLA2, and sPLA2) were determined by radioenzymatic assay. Rats fed the high CLA diet had increased hippocampal mRNA levels for specific PLA2 isoforms (iPla 2 g6γ; cPla 2 g4a, sPla 2 g3, sPla 2 g1b, and sPla 2 g12a) and higher enzymatic activity of all PLA2 groups as compared to those fed the control and the low CLA diet. The increment in PLA2 activities correlated significantly with memory enhancement, as assessed by increased latency in the step-down inhibitory avoidance task after 4 weeks of treatment (rs = 0.69 for iPLA2, P < 0.001; rs = 0.81 for cPLA2, P < 0.001; and rs = 0.69 for sPLA2, P < 0.001). In face of the previous reports showing reduced PLA2 activity in AD brains, the present findings suggest that dairy products enriched in cis-9, trans-11 CLA may be useful in the treatment of this disease. PMID:25913570

  19. Down-regulation of messenger ribonucleic acid encoding an importer of sulfoconjugated steroids during human chorionic gonadotropin-induced follicular luteinization in vivo.

    PubMed

    Brown, Kristy A; Bouchard, Nadine; Lussier, Jacques G; Sirois, Jean

    2007-01-01

    Members of the organic anion transporting polypeptide (SLCO/OATP) superfamily are capable of importing anionic compounds across the lipid bilayer in a sodium-independent manner. Member 2B1 has been shown to transport few substrates, two of which are dihydroepiandrosterone-3-sulfate (DHEA-S) and estrone-3-sulfate. Steroid sulfatase (STS) catalyses the hydrolysis of these steroids into their unconjugated counterparts. The objective of this study was to investigate the regulation of SLCO2B1 and STS mRNAs during human chorionic gonadotropin (hCG)-induced ovulation/luteinization. The equine SLCO2B1 cDNA was cloned and shown to encode a 709-amino acid protein (OATP2B1) that is highly conserved when compared to mammalian orthologs. RT-PCR/Southern blot analyses were performed to study the regulation of SLCO2B1 and STS transcripts in equine preovulatory follicles isolated between 0 and 39h after hCG treatment. Results showed high levels of SLCO2B1 mRNA expression before hCG, with a marked decrease observed in follicles obtained 24-39h post-hCG (P<0.05). Analyses of isolated granulosa and theca interna cells identified high mRNA expression in both cell types prior to hCG treatment, with granulosa cells showing a more rapid SLCO2B1 mRNA down-regulation. No significant change in STS mRNA was observed in intact follicle walls. However, when both cell types were isolated, a significant decrease in STS mRNA was observed in granulosa cells 24-39h post-hCG. Collectively, these results demonstrate that the hCG-dependent induction of follicular luteinization is accompanied by the down-regulation of SLCO2B1 and STS transcripts. Considering that OATP2B1 can import sulfoconjugated DHEA and estrogens, and that STS can remove the sulfonate moiety from these steroids, their down-regulation in luteinizing preovulatory follicles may provide an additional biochemical basis for the decrease in ovarian 17beta-estradiol biosynthesis after the LH surge. PMID:17049229

  20. Intersection of RNA Processing and the Type II Fatty Acid Synthesis Pathway in Yeast Mitochondria▿

    PubMed Central

    Schonauer, Melissa S.; Kastaniotis, Alexander J.; Hiltunen, J. Kalervo; Dieckmann, Carol L.

    2008-01-01

    Distinct metabolic pathways can intersect in ways that allow hierarchical or reciprocal regulation. In a screen of respiration-deficient Saccharomyces cerevisiae gene deletion strains for defects in mitochondrial RNA processing, we found that lack of any enzyme in the mitochondrial fatty acid type II biosynthetic pathway (FAS II) led to inefficient 5′ processing of mitochondrial precursor tRNAs by RNase P. In particular, the precursor containing both RNase P RNA (RPM1) and tRNAPro accumulated dramatically. Subsequent Pet127-driven 5′ processing of RPM1 was blocked. The FAS II pathway defects resulted in the loss of lipoic acid attachment to subunits of three key mitochondrial enzymes, which suggests that the octanoic acid produced by the pathway is the sole precursor for lipoic acid synthesis and attachment. The protein component of yeast mitochondrial RNase P, Rpm2, is not modified by lipoic acid in the wild-type strain, and it is imported in FAS II mutant strains. Thus, a product of the FAS II pathway is required for RNase P RNA maturation, which positively affects RNase P activity. In addition, a product is required for lipoic acid production, which is needed for the activity of pyruvate dehydrogenase, which feeds acetyl-coenzyme A into the FAS II pathway. These two positive feedback cycles may provide switch-like control of mitochondrial gene expression in response to the metabolic state of the cell. PMID:18779316

  1. Cloning and characterization of brnQ, a gene encoding a low-affinity, branched-chain amino acid carrier in Lactobacillus delbrückii subsp. lactis DSM7290.

    PubMed

    Stucky, K; Hagting, A; Klein, J R; Matern, H; Henrich, B; Konings, W N; Plapp, R

    1995-12-20

    A gene (brnQ), encoding a carrier for branched-chain amino acids in Lactobacillus delbrückii subsp. lactis DSM7290 was cloned in the low-copy-number vector pLG339 by complementation of a transport-deficient Escherichia coli strain. The plasmid carrying the cloned gene restored growth of an E. coli strain mutated in 4 different branched-chain amino acid transport genes at low concentrations of isoleucine, and increased its sensitivity to valine. Transport assays showed that leucine, isoleucine and valine are transported by this carrier and that transport is driven by the proton motive force. Nucleotide sequence analysis revealed an open reading frame of 1338 bp encoding a hydrophobic protein of 446 amino acids with a calculated molecular mass of 47864 Daltons. The start site of brnQ transcription was determined by primer extension analysis using mRNA from Lactobacillus delbrückii subsp. lactis DSM7290. The hydropathy profile suggests the existence of at least 12 hydrophobic domains that probably form membrane-associated alpha-helices. Comparisons of the nucleotide sequence of brnQ from Lactobacillus delbrückii subsp. lactis DSM7290, the amino acid sequence of its product and the topology of the hydrophobic domains with those of the respective carrier genes and proteins of Salmonella typhimurium and Pseudomonas aeruginosa revealed extensive homology. PMID:8544834

  2. Molecular mechanisms for protein-encoded inheritance

    SciTech Connect

    Wiltzius, Jed J.W.; Landau, Meytal; Nelson, Rebecca; Sawaya, Michael R.; Apostol, Marcin I.; Goldschmidt, Lukasz; Soriaga, Angela B.; Cascio, Duilio; Rajashankar, Kanagalaghatta; Eisenberg, David

    2009-12-01

    In prion inheritance and transmission, strains are phenotypic variants encoded by protein 'conformations'. However, it is unclear how a protein conformation can be stable enough to endure transmission between cells or organisms. Here we describe new polymorphic crystal structures of segments of prion and other amyloid proteins, which offer two structural mechanisms for the encoding of prion strains. In packing polymorphism, prion strains are encoded by alternative packing arrangements (polymorphs) of {beta}-sheets formed by the same segment of a protein; in segmental polymorphism, prion strains are encoded by distinct {beta}-sheets built from different segments of a protein. Both forms of polymorphism can produce enduring conformations capable of encoding strains. These molecular mechanisms for transfer of protein-encoded information into prion strains share features with the familiar mechanism for transfer of nucleic acid-encoded information into microbial strains, including sequence specificity and recognition by noncovalent bonds.

  3. Cellobiohydrolase variants and polynucleotides encoding same

    SciTech Connect

    Wogulis, Mark

    2014-10-14

    The present invention relates to variants of a parent cellobiohydrolase II. The present invention also relates to polynucleotides encoding the variants; nucleic acid constructs, vectors, and host cells comprising the polynucleotides; and methods of using the variants.

  4. Cellobiohydrolase variants and polynucleotides encoding same

    DOEpatents

    Wogulis, Mark

    2013-09-24

    The present invention relates to variants of a parent cellobiohydrolase II. The present invention also relates to polynucleotides encoding the variants; nucleic acid constructs, vectors, and host cells comprising the polynucleotides; and methods of using the variants.

  5. Cellobiohydrolase variants and polynucleotides encoding the same

    DOEpatents

    Wogulis, Mark

    2014-09-09

    The present invention relates to variants of a parent cellobiohydrolase. The present invention also relates to polynucleotides encoding the cellobiohydrolase variants; nucleic acid constructs, vectors, and host cells comprising the polynucleotides; and methods of using the cellobiohydrolase variants.

  6. Hyaluronic acid lipoate: synthesis and physicochemical properties.

    PubMed

    Picotti, Fabrizio; Fabbian, Matteo; Gianni, Rita; Sechi, Alessandra; Stucchi, Luca; Bosco, Marco

    2013-03-01

    The synthesis and physicochemical characterisation of mixed lipoic and formic esters of hyaluronan (Lipohyal) are presented in this paper. The synthesis was conducted by activating lipoic acid with 1,1'-carbonyldiimidazole to obtain lipoyl imidazolide, which reacted with hyaluronan (HA) in formamide under basic conditions. This procedure allows researchers to modulate easily the degree of substitution over a range of 0.05-1.8. Radical scavenger properties were analysed by UV-vis spectroscopy, where improved performance was demonstrated for Lipohyal with respect to the HA row material and lipoic acid. The chemical modification also causes HA to show an improved resistance to hyaluronidase digestion. These findings show that Lipohyal is a highly interesting derivative for applications in the tricological and dermo-cosmetic field and as an anti-aging ingredient. Moreover, Lipohyal can be easily crosslinked by UV irradiation, resulting in an innovative hydrogel with distinctive viscoelastic properties that is suitable as both a dermal-filler and as an intra-articular medical device. PMID:23465930

  7. The cpc-2 gene of Neurospora crassa encodes a protein entirely composed of WD-repeat segments that is involved in general amino acid control and female fertility.

    PubMed

    Müller, F; Krüger, D; Sattlegger, E; Hoffmann, B; Ballario, P; Kanaan, M; Barthelmess, I B

    1995-07-28

    Phenotypic and molecular studies of the mutation U142 indicate that the cpc-2+ gene is required to activate general amino acid control under conditions of amino acid limitation in the vegetative growth phase, and for formation of protoperithecia in preparation for the sexual phase of the life cycle of Neurospora crassa. The cpc-2 gene was cloned by complementation of the cpc-2 mutation in a his-2ts bradytrophic background. Genomic and cDNA sequence analysis indicated a 1636 bp long open reading frame interrupted by four introns. The deduced 316 amino acid polypeptide reveals 70% positional identity over its full length with G-protein beta-subunit-related polypeptides found in humans, rat (RACK1), chicken, tobacco and Chlamydomonas. With the exception of RACK1 the function of these proteins is obscure. All are entirely made up of seven WD-repeats. Expression studies of cpc-2 revealed one abundant transcript in the wild type; in the mutant its level is drastically reduced. In mutant cells transformed with the complementing sequence, the transcript level, enzyme regulation and female fertility are restored. In the wild type the cpc-2 transcript is down-regulated under conditions of amino acid limitation. With cpc-2 a new element involved in general amino acid control has been identified, indicating a function for a WD-repeat protein that belongs to a class that is conserved throughout the evolution of eukaryotes. PMID:7651339

  8. Arabidopsis VTC2 Encodes a GDP-l-Galactose Phosphorylase, the Last Unknown Enzyme in the Smirnoff-Wheeler Pathway to Ascorbic Acid in Plants*

    PubMed Central

    Linster, Carole L.; Gomez, Tara A.; Christensen, Kathryn C.; Adler, Lital N.; Young, Brian D.; Brenner, Charles; Clarke, Steven G.

    2008-01-01

    The first committed step in the biosynthesis of l-ascorbate from d-glucose in plants requires conversion of GDP-l-galactose to l-galactose 1-phosphate by a previously unidentified enzyme. Here we show that the protein encoded by VTC2, a gene mutated in vitamin C-deficient Arabidopsis thaliana strains, is a member of the GalT/Apa1 branch of the histidine triad protein superfamily that catalyzes the conversion of GDP-l-galactose to l-galactose 1-phosphate in a reaction that consumes inorganic phosphate and produces GDP. In characterizing recombinant VTC2 from Arabidopsis thaliana as a specific GDP-l-galactose/GDP-d-glucose phosphorylase, we conclude that enzymes catalyzing each of the ten steps of the Smirnoff-Wheeler pathway from glucose to ascorbate have been identified. Finally, we identify VTC2 homologs in plants, invertebrates, and vertebrates, suggesting that a similar reaction is used widely in nature. PMID:17462988

  9. Molecular cloning and stress-dependent expression of a gene encoding Delta(12)-fatty acid desaturase in the Antarctic microalga Chlorella vulgaris NJ-7.

    PubMed

    Lu, Yandu; Chi, Xiaoyuan; Yang, Qingli; Li, Zhaoxin; Liu, Shaofang; Gan, Qinhua; Qin, Song

    2009-11-01

    The psychrotrophic Antarctic alga, Chlorella vulgaris NJ-7, grows under an extreme environment of low temperature and high salinity. In an effort to better understand the correlation between fatty acid metabolism and acclimation to Antarctic environment, we analyzed its fatty acid compositions. An extremely high amount of Delta(12) unsaturated fatty acids was identified which prompted us to speculate about the involvement of Delta(12) fatty acid desaturase in the process of acclimation. A full-length cDNA sequence, designated CvFAD2, was isolated from C. vulgaris NJ-7 via reverse transcription polymerase chain reaction (RT-PCR) and RACE methods. Sequence alignment and phylogenetic analysis showed that the gene was homologous to known microsomal Delta(12)-FADs with the conserved histidine motifs. Heterologous expression in yeast was used to confirm the regioselectivity and the function of CvFAD2. Linoleic acid (18:2), normally not present in wild-type yeast cells, was detected in transformants of CvFAD2. The induction of CvFAD2 at an mRNA level under cold stress and high salinity is detected by real-time PCR. The results showed that both temperature and salinity motivated the upregulation of CvFAD2 expression. The accumulation of CvFAD2 increased 2.2-fold at 15 degrees C and 3.9-fold at 4 degrees C compared to the alga at 25 degrees C. Meanwhile a 1.7- and 8.5-fold increase at 3 and 6% NaCl was detected. These data suggest that CvFAD2 is the enzyme responsible for the Delta(12) fatty acids desaturation involved in the adaption to cold and high salinity for Antarctic C. vugaris NJ-7. PMID:19728010

  10. Alpha-lipoic acid protects mitochondrial enzymes and attenuates lipopolysaccharide-induced hypothermia in mice

    EPA Science Inventory

    Abstract: Hypothermia is a key symptom of sepsis and the mechanism(s) leading to hypothermia during sepsis is largely unknown. To investigate a potential mechanism and find an effective treatment for hypothermia in sepsis, we induced hypothermia in mice by lipopolysaccharide (LP...

  11. The structural and energetic aspects of substrate binding and the mechanism of action of the DapE-encoded N-succinyl-L,L-diaminopimelic acid desuccinylase (DapE) investigated using a hybrid QM/MM method.

    PubMed

    Dutta, Debodyuti; Mishra, Sabyashachi

    2014-12-21

    With increasing cases of fatal bacterial infections and growing antibiotic resistance, unrelenting efforts are necessary for identification of novel antibiotic targets and new drug molecules. The dapE-encoded N-succinyl-L,L-diaminopimelic acid desuccinylase (DapE) is a di-nuclear Zn containing enzyme in the lysine biosynthetic pathway which is indispensable for bacterial survival and absent in the human host, thus a potential antibiotic target. The DapE enzyme catalyzes the hydrolysis of N-succinyl-L,L-diaminopimelic acid (SDAP) to give rise to succinic acid and L,L-diaminopimelic acid. The mechanism of action of the DapE catalyzed SDAP hydrolysis is investigated employing a hybrid QM/MM computational method. The DapE side chains, such as, Arg178, Thr325, Asn345, are found to play a role in substrate identification and stabilization of the enzyme active site. Furthermore, a glycine rich loop (Gly322-Ser326) is found to facilitate tight binding of the substrate in the enzyme active site. The catalytic reaction progresses via a general acid-base hydrolysis mechanism where Glu134 first acts as a Lewis base by activating the catalytic water molecule in the active site, followed by guiding the resulting hydroxyl ion for a nucleophilic attack on the substrate, and finally acts as a Lewis acid by donating a proton to the substrate. The intermediates and transition states along the reaction pathway have been structurally and energetically characterized. A conformational change in the side chain of Asp100, which bridges the two Zn centers of the enzyme, is observed which facilitates the enzymatic action by lowering the activation energy and leads to the formation of a new intermediate during the catalytic reaction. The nucleophilic attack is found to be the rate determining step. PMID:25367594

  12. ENCODE data at the ENCODE portal.

    PubMed

    Sloan, Cricket A; Chan, Esther T; Davidson, Jean M; Malladi, Venkat S; Strattan, J Seth; Hitz, Benjamin C; Gabdank, Idan; Narayanan, Aditi K; Ho, Marcus; Lee, Brian T; Rowe, Laurence D; Dreszer, Timothy R; Roe, Greg; Podduturi, Nikhil R; Tanaka, Forrest; Hong, Eurie L; Cherry, J Michael

    2016-01-01

    The Encyclopedia of DNA Elements (ENCODE) Project is in its third phase of creating a comprehensive catalog of functional elements in the human genome. This phase of the project includes an expansion of assays that measure diverse RNA populations, identify proteins that interact with RNA and DNA, probe regions of DNA hypersensitivity, and measure levels of DNA methylation in a wide range of cell and tissue types to identify putative regulatory elements. To date, results for almost 5000 experiments have been released for use by the scientific community. These data are available for searching, visualization and download at the new ENCODE Portal (www.encodeproject.org). The revamped ENCODE Portal provides new ways to browse and search the ENCODE data based on the metadata that describe the assays as well as summaries of the assays that focus on data provenance. In addition, it is a flexible platform that allows integration of genomic data from multiple projects. The portal experience was designed to improve access to ENCODE data by relying on metadata that allow reusability and reproducibility of the experiments. PMID:26527727

  13. ENCODE data at the ENCODE portal

    PubMed Central

    Sloan, Cricket A.; Chan, Esther T.; Davidson, Jean M.; Malladi, Venkat S.; Strattan, J. Seth; Hitz, Benjamin C.; Gabdank, Idan; Narayanan, Aditi K.; Ho, Marcus; Lee, Brian T.; Rowe, Laurence D.; Dreszer, Timothy R.; Roe, Greg; Podduturi, Nikhil R.; Tanaka, Forrest; Hong, Eurie L.; Cherry, J. Michael

    2016-01-01

    The Encyclopedia of DNA Elements (ENCODE) Project is in its third phase of creating a comprehensive catalog of functional elements in the human genome. This phase of the project includes an expansion of assays that measure diverse RNA populations, identify proteins that interact with RNA and DNA, probe regions of DNA hypersensitivity, and measure levels of DNA methylation in a wide range of cell and tissue types to identify putative regulatory elements. To date, results for almost 5000 experiments have been released for use by the scientific community. These data are available for searching, visualization and download at the new ENCODE Portal (www.encodeproject.org). The revamped ENCODE Portal provides new ways to browse and search the ENCODE data based on the metadata that describe the assays as well as summaries of the assays that focus on data provenance. In addition, it is a flexible platform that allows integration of genomic data from multiple projects. The portal experience was designed to improve access to ENCODE data by relying on metadata that allow reusability and reproducibility of the experiments. PMID:26527727

  14. Characterization of 19 Genes Encoding Membrane-Bound Fatty Acid Desaturases and their Expression Profiles in Gossypium raimondii Under Low Temperature.

    PubMed

    Liu, Wei; Li, Wei; He, Qiuling; Daud, Muhammad Khan; Chen, Jinhong; Zhu, Shuijin

    2015-01-01

    To produce unsaturated fatty acids, membrane-bound fatty acid desaturases (FADs) can be exploited to introduce double bonds into the acyl chains of fatty acids. In this study, 19 membrane-bound FAD genes were identified in Gossypium raimondii through database searches and were classified into four different subfamilies based on phylogenetic analysis. All 19 membrane-bound FAD proteins shared three highly conserved histidine boxes, except for GrFAD2.1, which lost the third histidine box in the C-terminal region. In the G. raimondii genome, tandem duplication might have led to the increasing size of the FAD2 cluster in the Omega Desaturase subfamily, whereas segmental duplication appeared to be the dominant mechanism for the expansion of the Sphingolipid and Front-end Desaturase subfamilies. Gene expression analysis showed that seven membrane-bound FAD genes were significantly up-regulated and that five genes were greatly suppressed in G. raimondii leaves exposed to low temperature conditions. PMID:25894196

  15. Characterization of 19 Genes Encoding Membrane-Bound Fatty Acid Desaturases and their Expression Profiles in Gossypium raimondii Under Low Temperature

    PubMed Central

    He, Qiuling; Daud, Muhammad Khan; Chen, Jinhong; Zhu, Shuijin

    2015-01-01

    To produce unsaturated fatty acids, membrane-bound fatty acid desaturases (FADs) can be exploited to introduce double bonds into the acyl chains of fatty acids. In this study, 19 membrane-bound FAD genes were identified in Gossypium raimondii through database searches and were classified into four different subfamilies based on phylogenetic analysis. All 19 membrane-bound FAD proteins shared three highly conserved histidine boxes, except for GrFAD2.1, which lost the third histidine box in the C-terminal region. In the G. raimondii genome, tandem duplication might have led to the increasing size of the FAD2 cluster in the Omega Desaturase subfamily, whereas segmental duplication appeared to be the dominant mechanism for the expansion of the Sphingolipid and Front-end Desaturase subfamilies. Gene expression analysis showed that seven membrane-bound FAD genes were significantly up-regulated and that five genes were greatly suppressed in G. raimondii leaves exposed to low temperature conditions. PMID:25894196

  16. The neutrophil alloantigen HNA-3a (5b) is located on choline transporter-like protein 2 and appears to be encoded by an R>Q154 amino acid substitution

    PubMed Central

    Cox, Nancy J.; Sullivan, Mia J.; Konkashbaev, Anuar; Bowens, Krista; Hansen, Kirk; Aster, Richard H.

    2010-01-01

    The molecular basis of the HNA-3a/b (5b/a) leukocyte antigen system has not yet been defined despite evidence that HNA-3a–specific antibodies are particularly prone to cause severe, often fatal, transfusion-related lung injury. We used genome-wide single nucleotide polymorphism scanning and sequencing of DNA from persons of different HNA-3a/b phenotypes to identify a single single nucleotide polymorphism in exon 7 of the CLT2 gene (SLC44A2) that predicts an amino acid substitution in the first extracellular loop of choline transporter-like protein 2, a member of the choline transporter-like protein family of membrane glycoproteins, and correlates perfectly with HNA-3a/b phenotypes (R154 encodes HNA-3a; Q154 encodes HNA-3b). Mass spectrometric analysis of proteins immunoprecipitated from leukocytes by anti–HNA-3a provided direct evidence that anti–HNA-3a recognizes choline transporter-like protein 2. These findings will enable large-scale genotyping for HNA-3a/b to identify blood donors at risk to have HNA-3a–specific antibodies and should facilitate development of practical methods to detect such antibodies and prevent transfusion-related lung injury. PMID:20040764

  17. The Vibrio cholerae Fatty Acid Regulatory Protein, FadR, Represses Transcription of plsB, the Gene Encoding the First Enzyme of Membrane Phospholipid Biosynthesis

    PubMed Central

    Feng, Youjun; Cronan, John E.

    2011-01-01

    SUMMARY Glycerol-3-phosphate (sn-glycerol-3-P, G3P) acyltransferase catalyzes the first committed step in the biosynthesis of membrane phospholipids, the acylation of G3P to form 1-acyl G3P (lysophosphatidic acid). The paradigm G3P acyltransferase is the Escherichia coli plsB gene product which acylates position-1 of G3P using fatty acids in thioester linkage to either acyl carrier protein (ACP) or CoA as acyl-donors. Although the Escherichia coli plsB gene was discovered about 30 years ago, no evidence for transcriptional control of its expression has been reported. However Kazakov and coworkers (Kazakov, A. E. et al. (2009) J Bacteriol, 191, 52–64) reported the presence of a putative FadR-binding site upstream of the candidate plsB genes of V. cholerae and three other Vibrio species suggesting that plsB might be regulated by FadR, a GntR-family transcription factor thus far known only to regulate fatty acid synthesis and degradation. We report that the V. cholerae plsB homologue restored growth of E. coli strain BB26-36 which is a G3P auxotroph due to an altered G3P acyltransferase activity. The plsB promoter was also mapped and the predicted FadR-binding palindrome was found to span positions -19 to -35, upstream of the transcription start site. Gel shift assays confirmed that both V. cholerae FadR and E. coli FadR bound the V. cholerae plsB promoter region and binding was reversed upon addition of long chain fatty acyl-CoA thioesters. The expression level of the V. cholerae plsB gene was elevated 2–3 fold in an E. coli fadR null mutant strain indicating that FadR acts as a repressor of V. cholerae plsB expression. In both E. coli and V. cholerae the β-galactosidase activity of transcriptional fusions of the V. cholerae plsB promoter to lacZ increased 2–3 fold upon supplementation of growth media with oleic acid. Therefore, V. cholerae coordinates fatty acid metabolism with 1-acyl G3P synthesis. PMID:21771112

  18. Genetically Encoded Azide Containing Amino Acid in Mammalian Cells Enables Site-Specific Antibody-Drug Conjugates Using Click Cycloaddition Chemistry.

    PubMed

    VanBrunt, Michael P; Shanebeck, Kurt; Caldwell, Zachary; Johnson, Jeffrey; Thompson, Pamela; Martin, Thomas; Dong, Huifang; Li, Gary; Xu, Hengyu; D'Hooge, Francois; Masterson, Luke; Bariola, Pauline; Tiberghien, Arnaud; Ezeadi, Ebele; Williams, David G; Hartley, John A; Howard, Philip W; Grabstein, Kenneth H; Bowen, Michael A; Marelli, Marcello

    2015-11-18

    Antibody-drug conjugates (ADC) have emerged as potent antitumor drugs that provide increased efficacy, specificity, and tolerability over chemotherapy for the treatment of cancer. ADCs generated by targeting cysteines and lysines on the antibody have shown efficacy, but these products are heterogeneous, and instability may limit their dosing. Here, a novel technology is described that enables site-specific conjugation of toxins to antibodies using chemistry to produce homogeneous, potent, and highly stable conjugates. We have developed a cell-based mammalian expression system capable of site-specific integration of a non-natural amino acid containing an azide moiety. The azide group enables click cycloaddition chemistry that generates a stable heterocyclic triazole linkage. Antibodies to Her2/neu were expressed to contain N6-((2-azidoethoxy)carbonyl)-l-lysine at four different positions. Each site allowed over 95% conjugation efficacy with the toxins auristatin F or a pyrrolobenzodiazepine (PBD) dimer to generate ADCs with a drug to antibody ratio of >1.9. The ADCs were potent and specific in in vitro cytotoxicity assays. An anti Her2/neu conjugate demonstrated stability in vivo and a PBD containing ADC showed potent efficacy in a mouse tumor xenograph model. This technology was extended to generate fully functional ADCs with four toxins per antibody. The high stability of the azide-alkyne linkage, combined with the site-specific nature of the expression system, provides a means for the generation of ADCs with optimized pharmacokinetic, biological, and biophysical properties. PMID:26332743

  19. YPR139c/LOA1 encodes a novel lysophosphatidic acid acyltransferase associated with lipid droplets and involved in TAG homeostasis

    PubMed Central

    Ayciriex, Sophie; Le Guédard, Marina; Camougrand, Nadine; Velours, Gisèle; Schoene, Mario; Leone, Sebastien; Wattelet-Boyer, Valerie; Dupuy, Jean-William; Shevchenko, Andrej; Schmitter, Jean-Marie; Lessire, René; Bessoule, Jean-Jacques; Testet, Eric

    2012-01-01

    For many years, lipid droplets (LDs) were considered to be an inert store of lipids. However, recent data showed that LDs are dynamic organelles playing an important role in storage and mobilization of neutral lipids. In this paper, we report the characterization of LOA1 (alias VPS66, alias YPR139c), a yeast member of the glycerolipid acyltransferase family. LOA1 mutants show abnormalities in LD morphology. As previously reported, cells lacking LOA1 contain more LDs. Conversely, we showed that overexpression results in fewer LDs. We then compared the lipidome of loa1Δ mutant and wild-type strains. Steady-state metabolic labeling of loa1Δ revealed a significant reduction in triacylglycerol content, while phospholipid (PL) composition remained unchanged. Interestingly, lipidomic analysis indicates that both PLs and glycerolipids are qualitatively affected by the mutation, suggesting that Loa1p is a lysophosphatidic acid acyltransferase (LPA AT) with a preference for oleoyl-CoA. This hypothesis was tested by in vitro assays using both membranes of Escherichia coli cells expressing LOA1 and purified proteins as enzyme sources. Our results from purification of subcellular compartments and proteomic studies show that Loa1p is associated with LD and active in this compartment. Loa1p is therefore a novel LPA AT and plays a role in LD formation. PMID:22090344

  20. Two-dimensional IR spectroscopy of protein dynamics using two vibrational labels: a site-specific genetically encoded unnatural amino acid and an active site ligand.

    PubMed

    Thielges, Megan C; Axup, Jun Y; Wong, Daryl; Lee, Hyun Soo; Chung, Jean K; Schultz, Peter G; Fayer, Michael D

    2011-09-29

    Protein dynamics and interactions in myoglobin (Mb) were characterized via two vibrational dynamics labels (VDLs): a genetically incorporated site-specific azide (Az) bearing unnatural amino acid (AzPhe43) and an active site CO ligand. The Az-labeled protein was studied using ultrafast two-dimensional infrared (2D IR) vibrational echo spectroscopy. CO bound at the active site of the heme serves as a second VDL located nearby. Therefore, it was possible to use Fourier transform infrared (FT-IR) and 2D IR spectroscopic experiments on the Az in unligated Mb and in Mb bound to CO (MbAzCO) and on the CO in MbCO and MbAzCO to investigate the environment and motions of different states of one protein from the perspective of two spectrally resolved VDLs. A very broad bandwidth 2D IR spectrum, encompassing both the Az and CO spectral regions, found no evidence of direct coupling between the two VDLs. In MbAzCO, both VDLs reported similar time scale motions: very fast homogeneous dynamics, fast, ∼1 ps dynamics, and dynamics on a much slower time scale. Therefore, each VDL reports independently on the protein dynamics and interactions, and the measured dynamics are reflective of the protein motions rather than intrinsic to the chemical nature of the VDL. The AzPhe VDL also permitted study of oxidized Mb dynamics, which could not be accessed previously with 2D IR spectroscopy. The experiments demonstrate that the combined application of 2D IR spectroscopy and site-specific incorporation of VDLs can provide information on dynamics, structure, and interactions at virtually any site throughout any protein. PMID:21823631

  1. Two-Dimensional IR Spectroscopy of Protein Dynamics Using Two Vibrational Labels: A Site-Specific Genetically Encoded Unnatural Amino Acid and an Active Site Ligand

    PubMed Central

    Thielges, Megan C.; Axup, Jun Y.; Wong, Daryl; Lee, Hyun Soo; Chung, Jean K.; Schultz, Peter G.; Fayer, Michael D.

    2012-01-01

    Protein dynamics and interactions in myoglobin (Mb) were characterized via two vibrational dynamics labels (VDLs): a genetically incorporated site-specific azide (Az) bearing unnatural amino acid (AzPhe43) and an active site CO ligand. The Az-labeled protein was studied using ultrafast two-dimensional infrared (2D IR) vibrational echo spectroscopy. CO bound at the active site of the heme serves as a second VDL located nearby. Therefore, it was possible to use Fourier transform infrared (FT-IR) and 2D IR spectroscopic experiments on the Az in unligated Mb and in Mb bound to CO (MbAzCO) and on the CO in MbCO and MbAzCO to investigate the environment and motions of different states of one protein from the perspective of two spectrally resolved VDLs. A very broad bandwidth 2D IR spectrum, encompassing both the Az and CO spectral regions, found no evidence of direct coupling between the two VDLs. In MbAzCO, both VDLs reported similar time scale motions: very fast homogeneous dynamics, fast, ~1 ps dynamics, and dynamics on a much slower time scale. Therefore, each VDL reports independently on the protein dynamics and interactions, and the measured dynamics are reflective of the protein motions rather than intrinsic to the chemical nature of the VDL. The AzPhe VDL also permitted study of oxidized Mb dynamics, which could not be accessed previously with 2D IR spectroscopy. The experiments demonstrate that the combined application of 2D IR spectroscopy and site-specific incorporation of VDLs can provide information on dynamics, structure, and interactions at virtually any site throughout any protein. PMID:21823631

  2. Functional analysis and transcriptional regulation of two orthologs of ARO10, encoding broad-substrate-specificity 2-oxo-acid decarboxylases, in the brewing yeast Saccharomyces pastorianus CBS1483.

    PubMed

    Bolat, Irina; Romagnoli, Gabriele; Zhu, Feibai; Pronk, Jack T; Daran, Jean-Marc

    2013-09-01

    The hybrid genomes of Saccharomyces pastorianus consist of subgenomes similar to those of S. cerevisiae and S. eubayanus, and impact of the genome structure on flavour production and its regulation is poorly understood. This study focuses on ARO10, a 2-oxo-acid decarboxylase involved in production of higher alcohols. In S. pastorianus CBS1483, four ARO10 copies were identified, three resembled S. cerevisiae ARO10 and one S. eubayanus ARO10. Substrate specificities of lager strain (Lg)ScAro10 and LgSeubAro10 were compared by individually expressing them in a pdc1Δ-pdc5Δ-pdc6Δ-aro10Δ-thi3Δ S. cerevisiae strain. Both isoenzymes catalysed decarboxylation of the 2-oxo-acids derived from branched-chain, sulphur-containing amino acids and preferably phenylpyruvate. Expression of both alleles was induced by phenylalanine, however in contrast to the S. cerevisiae strain, the two genes were not induced by leucine. Additionally, LgSeubARO10 showed higher basal expression levels during growth with ammonia. ARO80, which encodes ARO10 transcriptional activator, is located on CHRIV and counts three Sc-like and one Seub-like copies. Deletion of LgSeubARO80 did not affect LgSeubARO10 phenylalanine induction, revealing 'trans' regulation across the subgenomes. ARO10 transcript levels showed a poor correlation with decarboxylase activities. These results provide insights into flavour formation in S. pastorianus and illustrate the complexity of functional characterization in aneuploid strains. PMID:23692465

  3. Concordance between isolated cleft palate in mice and alterations within a region including the gene encoding the [beta][sub 3] subunit of the type A [gamma]-aminobutyric acid receptor

    SciTech Connect

    Culiat, C.T.; Stubbs, L.; Nicholls, R.D.; Montgomery, C.S.; Russell, L.B.; Johnson, D.K. ); Rinchik, E.M. Univ. of Florida, Gainesville )

    1993-06-01

    Genetic and molecular analyses of a number of radiation-induced deletion mutations of the pink-eyed dilution (p) locus in mouse chromosome 7 have identified a specific interval on the genetic map associated with a neonatally lethal mutation that results in cleft palate. This interval, closely linked and distal to p, and bracketed by the genes encoding the [alpha][sub 5] and [beta][sub 3] subunits of the type A [gamma]-aminobutyric acid receptor (Gabra5 and Gabrb3, respectively), contains a gene(s) (cp1; cleft palate 1) necessary for normal palate development. The cp1 interval extends from the distal breakpoint of the prenatally lethal p[sup 83FBFo] deletion to the Gabrb3 locus. Among 20 p deletions tested, there was complete concordance between alterations at the Gabrb3 transcription unit and inability to complement the cleft-palate defect. These mapping data, along with previously described in vivo and in vitro teratological effects of [gamma]-aminobutyric acid or its agonists on palate development, suggest the possibility that a particular type A [gamma]-aminobutyric acid receptor that includes the [beta][sub 3] subunit may be necessary for normal palate development. The placement of the cp1 gene within a defined segment of the larger D15S12h (p)-D15S9h-1 interval in the mouse suggests that the highly homologous region of the human genome, 15q11-q13, be evaluated for a role(s) in human fetal facial development. 29 refs., 4 figs., 1 tab.

  4. ZAP1-mediated modulation of triacylglycerol levels in yeast by transcriptional control of mitochondrial fatty acid biosynthesis.

    PubMed

    Singh, Neelima; Yadav, Kamlesh Kumar; Rajasekharan, Ram

    2016-04-01

    The transcriptional activator Zap1p maintains zinc homeostasis in Saccharomyces cerevisiae. In this study, we examined the role of Zap1p in triacylglycerol (TAG) metabolism. The expression of ETR1 is reduced in zap1Δ. The altered expression of ETR1 results in reduced mitochondrial fatty acid biosynthesis and reduction in lipoic acid content in zap1Δ. The transcription factor Zap1 positively regulates ETR1 expression. Deletion of ETR1 also causes the accumulation of TAG, and the introduction of ETR1 in zap1Δ strain rescues the TAG level. These results demonstrated that the compromised mitochondrial fatty acid biosynthesis causes a reduction in lipoic acid and loss of mitochondrial function in zap1Δ. Functional mitochondria are required for the ATP production and defect in mitochondria slow down the process which may channeled carbon towards lipid biosynthesis and stored in the form of TAG. PMID:26711224

  5. Gene encoding acetyl-coenzyme A carboxylase

    DOEpatents

    Roessler, P.G.; Ohlrogge, J.B.

    1996-09-24

    A DNA encoding an acetyl-coenzyme A carboxylase (ACCase) from a photosynthetic organism and functional derivatives are disclosed which are resistant to inhibition from certain herbicides. This gene can be placed in organisms to increase their fatty acid content or to render them resistant to certain herbicides. 5 figs.

  6. Gene encoding acetyl-coenzyme A carboxylase

    DOEpatents

    Roessler, Paul G.; Ohlrogge, John B.

    1996-01-01

    A DNA encoding an acetyl-coenzyme A carboxylase (ACCase) from a photosynthetic organism and functional derivatives thereof which are resistant to inhibition from certain herbicides. This gene can be placed in organisms to increase their fatty acid content or to render them resistant to certain herbicides.

  7. ZmPUMP encodes a fully functional monocot plant uncoupling mitochondrial protein whose affinity to fatty acid is increased with the introduction of a His pair at the second matrix loop

    SciTech Connect

    Favaro, Regiane Degan; Borecky, Jiri; Colombi, Debora; Maia, Ivan G. . E-mail: igmaia@ibb.unesp.br

    2006-05-26

    Uncoupling proteins (UCPs) are specialized mitochondrial transporter proteins that uncouple respiration from ATP synthesis. In this study, cDNA encoding maize uncoupling protein (ZmPUMP) was expressed in Escherichia coli and recombinant ZmPUMP reconstituted in liposomes. ZmPUMP activity was associated with a linoleic acid (LA)-mediated H{sup +} efflux with K {sub m} of 56.36 {+-} 0.27 {mu}M and V {sub max} of 66.9 {mu}mol H{sup +} min{sup -1} (mg prot){sup -1}. LA-mediated H{sup +} fluxes were sensitive to ATP inhibition with K {sub i} of 2.61 {+-} 0.36 mM (at pH 7.2), a value similar to those for dicot UCPs. ZmPUMP was also used to investigate the importance of a histidine pair present in the second matrix loop of mammalian UCP1 and absent in plant UCPs. ZmPUMP with introduced His pair (Lys155His and Ala157His) displayed a 1.55-fold increase in LA-affinity while its activity remained unchanged. Our data indicate conserved properties of plant UCPs and suggest an enhancing but not essential role of the histidine pair in proton transport mechanism.

  8. Alignment system for encoders

    NASA Technical Reports Server (NTRS)

    Villani, Daniel D. (Inventor)

    1988-01-01

    An improved encoder alignment system is disclosed which provides an indication of the extent of misalignment and a measure of the rate at which the misalignment may be changing. The invention is adapted for use with a conventional encoder which provides a digital coarse word having at least significant bit and a digital fine word having a least significant bit and a most significant bit. The invention generates the exclusive or of the least significant bit of the coarse digital signal and the least significant bit of the fine digital signal to provide a first signal. The invention then generates the exclusive or of the first signal and the complement of the most significant bit of the fine digital signal to provide an output signal which represents the misalignment of the encoder.

  9. Nucleic acids encoding a cellulose binding domain

    DOEpatents

    Shoseyov, Oded; Shpiegl, Itai; Goldstein, Marc A.; Doi, Roy H.

    1996-01-01

    A cellulose binding domain (CBD) having a high affinity for crystalline cellulose and chitin is disclosed, along with methods for the molecular cloning and recombinant production thereof. Fusion products comprising the CBD and a second protein are likewise described. A wide range of applications are contemplated for both the CBD and the fusion products, including drug delivery, affinity separations, and diagnostic techniques.

  10. Nucleic acids encoding a cellulose binding domain

    DOEpatents

    Shoseyov, O.; Shpiegl, I.; Goldstein, M.A.; Doi, R.H.

    1996-03-05

    A cellulose binding domain (CBD) having a high affinity for crystalline cellulose and chitin is disclosed, along with methods for the molecular cloning and recombinant production. Fusion products comprising the CBD and a second protein are likewise described. A wide range of applications are contemplated for both the CBD and the fusion products, including drug delivery, affinity separations, and diagnostic techniques. 15 figs.

  11. Identification of an NADH-Cytochrome b5 Reductase Gene from an Arachidonic Acid-Producing Fungus, Mortierella alpina 1S-4, by Sequencing of the Encoding cDNA and Heterologous Expression in a Fungus, Aspergillus oryzae

    PubMed Central

    Sakuradani, Eiji; Kobayashi, Michihiko; Shimizu, Sakayu

    1999-01-01

    Based on the sequence information for bovine and yeast NADH-cytochrome b5 reductases (CbRs), a DNA fragment was cloned from Mortierella alpina 1S-4 after PCR amplification. This fragment was used as a probe to isolate a cDNA clone with an open reading frame encoding 298 amino acid residues which show marked sequence similarity to CbRs from other sources, such as yeast (Saccharomyces cerevisiae), bovine, human, and rat CbRs. These results suggested that this cDNA is a CbR gene. The results of a structural comparison of the flavin-binding β-barrel domains of CbRs from various species and that of the M. alpina enzyme suggested that the overall barrel-folding patterns are similar to each other and that a specific arrangement of three highly conserved amino acid residues (i.e., arginine, tyrosine, and serine) plays a role in binding with the flavin (another prosthetic group) through hydrogen bonds. The corresponding genomic gene, which was also cloned from M. alpina 1S-4 by means of a hybridization method with the above probe, had four introns of different sizes. These introns had GT at the 5′ end and AG at the 3′ end, according to a general GT-AG rule. The expression of the full-length cDNA in a filamentous fungus, Aspergillus oryzae, resulted in an increase (4.7 times) in ferricyanide reduction activity involving the use of NADH as an electron donor in the microsomes. The M. alpina CbR was purified by solubilization of microsomes with cholic acid sodium salt, followed by DEAE-Sephacel, Mono-Q HR 5/5, and AMP-Sepharose 4B affinity column chromatographies; there was a 645-fold increase in the NADH-ferricyanide reductase specific activity. The purified CbR preferred NADH over NADPH as an electron donor. This is the first report of an analysis of this enzyme in filamentous fungi. PMID:10473389

  12. Neutron-encoded mass signatures for multiplexed proteome quantification.

    PubMed

    Hebert, Alexander S; Merrill, Anna E; Bailey, Derek J; Still, Amelia J; Westphall, Michael S; Strieter, Eric R; Pagliarini, David J; Coon, Joshua J

    2013-04-01

    We describe a protein quantification method called neutron encoding that exploits the subtle mass differences caused by nuclear binding energy variation in stable isotopes. These mass differences are synthetically encoded into amino acids and incorporated into yeast and mouse proteins via metabolic labeling. Mass spectrometry analysis with high mass resolution (>200,000) reveals the isotopologue-embedded peptide signals, permitting quantification. Neutron encoding will enable highly multiplexed proteome analysis with excellent dynamic range and accuracy. PMID:23435260

  13. Polarization encoded color camera.

    PubMed

    Schonbrun, Ethan; Möller, Guðfríður; Di Caprio, Giuseppe

    2014-03-15

    Digital cameras would be colorblind if they did not have pixelated color filters integrated into their image sensors. Integration of conventional fixed filters, however, comes at the expense of an inability to modify the camera's spectral properties. Instead, we demonstrate a micropolarizer-based camera that can reconfigure its spectral response. Color is encoded into a linear polarization state by a chiral dispersive element and then read out in a single exposure. The polarization encoded color camera is capable of capturing three-color images at wavelengths spanning the visible to the near infrared. PMID:24690806

  14. Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same

    DOEpatents

    Dotson, William D.; Greenier, Jennifer; Ding, Hanshu

    2009-05-19

    The present invention relates to isolated polypeptides having cellulolytic enhancing activity and isolated nucleic acids encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the nucleic acids as well as methods for producing and using the polypeptides.

  15. Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same

    DOEpatents

    Dotson, William D.; Greenier, Jennifer; Ding, Hanshu

    2007-09-18

    The present invention relates to isolated polypeptides having cellulolytic enhancing activity and isolated nucleic acids encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the nucleic acids as well as methods for producing and using the polypeptides.

  16. Time-Encoded Imagers.

    SciTech Connect

    Marleau, Peter; Brubaker, Erik

    2014-11-01

    This report provides a short overview of the DNN R&D funded project, Time-Encoded Imagers. The project began in FY11 and concluded in FY14. The Project Description below provides the overall motivation and objectives for the project as well as a summary of programmatic direction. It is followed by a short description of each task and the resulting deliverables.

  17. Video Time Encoding Machines

    PubMed Central

    Lazar, Aurel A.; Pnevmatikakis, Eftychios A.

    2013-01-01

    We investigate architectures for time encoding and time decoding of visual stimuli such as natural and synthetic video streams (movies, animation). The architecture for time encoding is akin to models of the early visual system. It consists of a bank of filters in cascade with single-input multi-output neural circuits. Neuron firing is based on either a threshold-and-fire or an integrate-and-fire spiking mechanism with feedback. We show that analog information is represented by the neural circuits as projections on a set of band-limited functions determined by the spike sequence. Under Nyquist-type and frame conditions, the encoded signal can be recovered from these projections with arbitrary precision. For the video time encoding machine architecture, we demonstrate that band-limited video streams of finite energy can be faithfully recovered from the spike trains and provide a stable algorithm for perfect recovery. The key condition for recovery calls for the number of neurons in the population to be above a threshold value. PMID:21296708

  18. Plasmids encoding therapeutic agents

    DOEpatents

    Keener, William K.

    2007-08-07

    Plasmids encoding anti-HIV and anti-anthrax therapeutic agents are disclosed. Plasmid pWKK-500 encodes a fusion protein containing DP178 as a targeting moiety, the ricin A chain, an HIV protease cleavable linker, and a truncated ricin B chain. N-terminal extensions of the fusion protein include the maltose binding protein and a Factor Xa protease site. C-terminal extensions include a hydrophobic linker, an L domain motif peptide, a KDEL ER retention signal, another Factor Xa protease site, an out-of-frame buforin II coding sequence, the lacZ.alpha. peptide, and a polyhistidine tag. More than twenty derivatives of plasmid pWKK-500 are described. Plasmids pWKK-700 and pWKK-800 are similar to pWKK-500 wherein the DP178-encoding sequence is substituted by RANTES- and SDF-1-encoding sequences, respectively. Plasmid pWKK-900 is similar to pWKK-500 wherein the HIV protease cleavable linker is substituted by a lethal factor (LF) peptide-cleavable linker.

  19. Reed-Solomon Encoder

    NASA Technical Reports Server (NTRS)

    Troung, T. K.; Reed, I. S.; Deutsch, L. J.; Hsu, I. S.; Wang, K.; Yeh, C. S.

    1985-01-01

    Report presents mathematical principles of Berlekamp bit serial multiplier algorithm and its application to design of very-large-scale integrated (VLSI) encoders for Reed-Solomon error-correcting codes. Structure made readily on single chip of negatively doped channel metal oxide semiconductor.

  20. Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same

    DOEpatents

    Zhang, Yu; Tang, Lan; Henriksen, Svend Hostgaard Bang

    2016-05-17

    The present invention provides isolated polypeptides having cellulolytic enhancing activity and isolated polynucleotides encoding the polypeptides. The invention also provides nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

  1. Polypeptides having cellobiohydrolase activity and polynucleotides encoding same

    SciTech Connect

    Spodsberg, Nikolaj

    2015-07-14

    The present invention relates to isolated polypeptides having cellobiohydrolase activity and polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

  2. Polypeptides having cellobiohydrolase activity and polynucleotides encoding same

    SciTech Connect

    Liu, Ye; Tang, Lan

    2015-07-14

    The present invention provides isolated polypeptides having cellobiohydrolase activity and isolated polynucleotides encoding the polypeptides. The invention also provides nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

  3. Polypeptides having endoglucanase activity and polynucleotides encoding same

    DOEpatents

    Spodsberg, Nikolaj

    2015-11-17

    The present invention relates to isolated polypeptides having endoglucanase activity and polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

  4. Polypeptides having cellobiohydrolase activity and polynucleotides encoding same

    DOEpatents

    Spodsberg, Nikolaj

    2015-11-17

    The present invention relates to isolated polypeptides having cellobiohydrolase activity and polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

  5. Polypeptides having xylanase activity and polynucleotides encoding same

    DOEpatents

    Spodsberg, Nikolaj

    2015-10-27

    The present invention relates to isolated polypeptides having xylanase activity and polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

  6. Polypeptides having cellobiohydrolase activity and polynucleotides encoding same

    DOEpatents

    Spodsberg, Nikolaj

    2015-03-10

    The present invention relates to isolated polypeptides having cellobiohydrolase activity and polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

  7. Polypeptides having cellobiohydrolase activity and polynucleotides encoding same

    DOEpatents

    Spodsberg, Nikolaj

    2014-07-15

    The present invention relates to isolated polypeptides having cellobiohydrolase activity and polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

  8. Polypeptides having xylanase activity and polynucleotides encoding same

    DOEpatents

    Spodsberg, Nikolaj

    2014-10-14

    The present invention relates to isolated polypeptides having xylanase activity and polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

  9. Polypeptides having endoglucanase activity and polynucleotides encoding same

    DOEpatents

    Spodsberg, Nikolaj

    2015-07-14

    The present invention relates to isolated polypeptides having endoglucanase activity and polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

  10. Polypeptides having endoglucanase activity and polynucleotides encoding same

    DOEpatents

    Spodsberg, Nikolaj

    2015-02-10

    The present invention relates to isolated polypeptides having endoglucanase activity and polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

  11. Polypeptides having cellobiohydrolase activity and polynucleotides encoding same

    DOEpatents

    Spodsberg, Nikolaj

    2015-03-31

    The present invention relates to isolated polypeptides having cellobiohydrolase activity and polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

  12. Polypeptides having xylanase activity and polynucleotides encoding same

    DOEpatents

    Spodsberg, Nikolaj

    2015-08-18

    The present invention relates to isolated polypeptides having xylanase activity and polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

  13. Polypeptides having cellobiohydrolase activity and polynucleotides encoding same

    DOEpatents

    Spodsberg, Nikolaj

    2014-06-24

    The present invention relates to isolated polypeptides having cellobiohydrolase activity and polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

  14. Polypeptides having endoglucanse activity and polynucleotides encoding same

    DOEpatents

    Spodsberg, Nikolaj

    2014-07-08

    The present invention relates to isolated polypeptides having endoglucanase activity and polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

  15. Polypeptides having cellobiohydrolase activity and polynucleotides encoding same

    DOEpatents

    Spodsberg, Nikolaj

    2014-07-08

    The present invention relates to isolated polypeptides having cellobiohydrolase activity and polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

  16. Polypeptides having xylanase activity and polynucleotides encoding same

    DOEpatents

    Spodsberg, Nikolaj

    2014-06-24

    The present invention relates to isolated polypeptides having xylanase activity and polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

  17. Polypeptides having endoglucanase activity and polynucleotides encoding same

    DOEpatents

    Spodsberg, Nikolaj

    2014-07-15

    The present invention relates to isolated polypeptides having endoglucanase activity and polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

  18. Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same

    DOEpatents

    Zhang, Yu; Duan, Junxin; Tang, Lan; Wu, Wenping

    2015-06-09

    Provided are isolated polypeptides having cellulolytic enhancing activity and isolated polynucleotides encoding the polypeptides. Also provided are nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

  19. Polypeptides having endoglucanase activity and polynucleotides encoding same

    SciTech Connect

    Liu, Ye; Duan, Junxin; Tang, Lan

    2015-09-22

    The present invention provides isolated polypeptides having endoglucanase activity and isolated polynucleotides encoding the polypeptides. The invention also provides nucleic acid constructs, vectors, and host cell comprising the polynucleotides as well as methods of producing and using the polypeptides.

  20. Polypeptides having cellobiohydrolase activitiy and polynucleotides encoding same

    SciTech Connect

    Liu, Ye; Tang, Lan; Duan, Junxin

    2015-12-15

    The present invention provides isolated polypeptides having cellobiohydrolase activity and isolated polynucleotides encoding the polypeptides. The invention also provides nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

  1. Polypeptides having cellobiohydrolase activity and polynucleotides encoding same

    DOEpatents

    Spodsberg, Nikolaj

    2016-06-28

    The present invention relates to isolated polypeptides having cellobiohydrolase activity and polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

  2. Characterization of the critical amino acids of an Aspergillus parasiticus cytochrome P-450 monooxygenase encoded by ordA that is involved in the biosynthesis of aflatoxins B1, G1, B2, and G2.

    PubMed

    Yu, J; Chang, P K; Ehrlich, K C; Cary, J W; Montalbano, B; Dyer, J M; Bhatnagar, D; Cleveland, T E

    1998-12-01

    The conversion of O-methylsterigmatocystin (OMST) and dihydro-O-methylsterigmatocystin to aflatoxins B1, G1, B2, and G2 requires a cytochrome P-450 type of oxidoreductase activity. ordA, a gene adjacent to the omtA gene, was identified in the aflatoxin-biosynthetic pathway gene cluster by chromosomal walking in Aspergillus parasiticus. The ordA gene was a homolog of the Aspergillus flavus ord1 gene, which is involved in the conversion of OMST to aflatoxin B1. Complementation of A. parasiticus SRRC 2043, an OMST-accumulating strain, with the ordA gene restored the ability to produce aflatoxins B1, G1, B2, and G2. The ordA gene placed under the control of the GAL1 promoter converted exogenously supplied OMST to aflatoxin B1 in Saccharomyces cerevisiae. In contrast, the ordA gene homolog in A. parasiticus SRRC 2043, ordA1, was not able to carry out the same conversion in the yeast system. Sequence analysis revealed that the ordA1 gene had three point mutations which resulted in three amino acid changes (His-400-->Leu-400, Ala-143-->Ser-143, and Ile-528-->Tyr-528). Site-directed mutagenesis studies showed that the change of His-400 to Leu-400 resulted in a loss of the monooxygenase activity and that Ala-143 played a significant role in the catalytic conversion. In contrast, Ile-528 was not associated with the enzymatic activity. The involvement of the ordA gene in the synthesis of aflatoxins G1, and G2 in A. parasiticus suggests that enzymes required for the formation of aflatoxins G1 and G2 are not present in A. flavus. The results showed that in addition to the conserved heme-binding and redox reaction domains encoded by ordA, other seemingly domain-unrelated amino acid residues are critical for cytochrome P-450 catalytic activity. The ordA gene has been assigned to a new cytochrome P-450 gene family named CYP64 by The Cytochrome P450 Nomenclature Committee. PMID:9835571

  3. The Text Encoding Initiative: Flexible and Extensible Document Encoding.

    ERIC Educational Resources Information Center

    Barnard, David T.; Ide, Nancy M.

    1997-01-01

    The Text Encoding Initiative (TEI), an international collaboration aimed at producing a common encoding scheme for complex texts, examines the requirement for generality versus the requirement to handle specialized text types. Discusses how documents and users tax the limits of fixed schemes requiring flexible extensible encoding to support…

  4. Gene encoding herbicide safener binding protein

    SciTech Connect

    Walton, J.D.; Scott-Craig, J.S.

    1999-10-26

    The cDNA encoding safener binding protein (SafBP), also referred to as SBP1, is presented. The deduced amino acid sequence is provided. Methods of making and using SBP1 and SafBP to alter a plant's sensitivity to certain herbicides or a plant's responsiveness to certain safeners are also provided, as well as expression vectors, transgenic plants or other organisms transfected with vectors and seeds from the plants.

  5. Assessing the allelotypic effect of two aminocyclopropane carboxylic acid synthase-encoding genes MdACS1 and MdACS3a on fruit ethylene production and softening in Malus

    PubMed Central

    Dougherty, Laura; Zhu, Yuandi; Xu, Kenong

    2016-01-01

    Phytohormone ethylene largely determines apple fruit shelf life and storability. Previous studies demonstrated that MdACS1 and MdACS3a, which encode 1-aminocyclopropane-1-carboxylic acid synthases (ACS), are crucial in apple fruit ethylene production. MdACS1 is well-known to be intimately involved in the climacteric ethylene burst in fruit ripening, while MdACS3a has been regarded a main regulator for ethylene production transition from system 1 (during fruit development) to system 2 (during fruit ripening). However, MdACS3a was also shown to have limited roles in initiating the ripening process lately. To better assess their roles, fruit ethylene production and softening were evaluated at five time points during a 20-day post-harvest period in 97 Malus accessions and in 34 progeny from 2 controlled crosses. Allelotyping was accomplished using an existing marker (ACS1) for MdACS1 and two markers (CAPS866 and CAPS870) developed here to specifically detect the two null alleles (ACS3a-G289V and Mdacs3a) of MdACS3a. In total, 952 Malus accessions were allelotyped with the three markers. The major findings included: The effect of MdACS1 was significant on fruit ethylene production and softening while that of MdACS3a was less detectable; allele MdACS1–2 was significantly associated with low ethylene and slow softening; under the same background of the MdACS1 allelotypes, null allele Mdacs3a (not ACS3a-G289V) could confer a significant delay of ethylene peak; alleles MdACS1–2 and Mdacs3a (excluding ACS3a-G289V) were highly enriched in M. domestica and M. hybrid when compared with those in M. sieversii. These findings are of practical implications in developing apples of low and delayed ethylene profiles by utilizing the beneficial alleles MdACS1-2 and Mdacs3a. PMID:27231553

  6. Assessing the allelotypic effect of two aminocyclopropane carboxylic acid synthase-encoding genes MdACS1 and MdACS3a on fruit ethylene production and softening in Malus.

    PubMed

    Dougherty, Laura; Zhu, Yuandi; Xu, Kenong

    2016-01-01

    Phytohormone ethylene largely determines apple fruit shelf life and storability. Previous studies demonstrated that MdACS1 and MdACS3a, which encode 1-aminocyclopropane-1-carboxylic acid synthases (ACS), are crucial in apple fruit ethylene production. MdACS1 is well-known to be intimately involved in the climacteric ethylene burst in fruit ripening, while MdACS3a has been regarded a main regulator for ethylene production transition from system 1 (during fruit development) to system 2 (during fruit ripening). However, MdACS3a was also shown to have limited roles in initiating the ripening process lately. To better assess their roles, fruit ethylene production and softening were evaluated at five time points during a 20-day post-harvest period in 97 Malus accessions and in 34 progeny from 2 controlled crosses. Allelotyping was accomplished using an existing marker (ACS1) for MdACS1 and two markers (CAPS866 and CAPS870) developed here to specifically detect the two null alleles (ACS3a-G289V and Mdacs3a) of MdACS3a. In total, 952 Malus accessions were allelotyped with the three markers. The major findings included: The effect of MdACS1 was significant on fruit ethylene production and softening while that of MdACS3a was less detectable; allele MdACS1-2 was significantly associated with low ethylene and slow softening; under the same background of the MdACS1 allelotypes, null allele Mdacs3a (not ACS3a-G289V) could confer a significant delay of ethylene peak; alleles MdACS1-2 and Mdacs3a (excluding ACS3a-G289V) were highly enriched in M. domestica and M. hybrid when compared with those in M. sieversii. These findings are of practical implications in developing apples of low and delayed ethylene profiles by utilizing the beneficial alleles MdACS1-2 and Mdacs3a. PMID:27231553

  7. VLSI Reed-Solomon Encoder

    NASA Technical Reports Server (NTRS)

    Liu, K. Y.

    1983-01-01

    Modular Reed-solomon encoder uses identical custom VLSI chips called "symbol slices." By cascading and properly interconnecting group of these chips, encoder is made for any desired error-correcting capability and interleaving level. VLSI encoder requires only one-tenth the number of chips required by conventional Reed-Solomon Circuit implemented with discrete IC's.

  8. [Effect of the B-group vitamin complex on the blood content of saturated and unsaturated fatty acids in patients with ischemic heart disease and hypertension].

    PubMed

    Vodoevich, V P; Buko, V U

    1986-01-01

    Gas-liquid chromatography was used to study the blood content of saturated and unsaturated fatty acids, under the influence of the functionally-associated vitamin-B complex, in 45 patients with coronary heart disease and essential hypertension. The vitamins were given daily in the following doses: thiamine diphosphate 50 mg, riboflavine 40 mg, calcium pantothenate 200 mg, nicotinic acid 200 mg and lipoic acid 50 mg. Favourable shifts leading to positive clinical effects were recorded in the fatty acid metabolism after 10-day taking the vitamin-B complex: the content of unsaturated (linoleic and arachidonic) fatty acids increased while that of saturated (stearic and palmitic) fatty acids decreased. PMID:3705551

  9. Plant fatty acid hydroxylases

    DOEpatents

    Somerville, Chris; Broun, Pierre; van de Loo, Frank

    2001-01-01

    This invention relates to plant fatty acyl hydroxylases. Methods to use conserved amino acid or nucleotide sequences to obtain plant fatty acyl hydroxylases are described. Also described is the use of cDNA clones encoding a plant hydroxylase to produce a family of hydroxylated fatty acids in transgenic plants. In addition, the use of genes encoding fatty acid hydroxylases or desaturases to alter the level of lipid fatty acid unsaturation in transgenic plants is described.

  10. Time encoded radiation imaging

    DOEpatents

    Marleau, Peter; Brubaker, Erik; Kiff, Scott

    2014-10-21

    The various technologies presented herein relate to detecting nuclear material at a large stand-off distance. An imaging system is presented which can detect nuclear material by utilizing time encoded imaging relating to maximum and minimum radiation particle counts rates. The imaging system is integrated with a data acquisition system that can utilize variations in photon pulse shape to discriminate between neutron and gamma-ray interactions. Modulation in the detected neutron count rates as a function of the angular orientation of the detector due to attenuation of neighboring detectors is utilized to reconstruct the neutron source distribution over 360 degrees around the imaging system. Neutrons (e.g., fast neutrons) and/or gamma-rays are incident upon scintillation material in the imager, the photons generated by the scintillation material are converted to electrical energy from which the respective neutrons/gamma rays can be determined and, accordingly, a direction to, and the location of, a radiation source identified.

  11. Rotary encoding device

    NASA Technical Reports Server (NTRS)

    Leviton, Douglas B. (Inventor)

    1993-01-01

    A device for position encoding of a rotating shaft in which a polygonal mirror having a number of facets is mounted to the shaft and a light beam is directed towards the facets is presented. The facets of the polygonal mirror reflect the light beam such that a light spot is created on a linear array detector. An analog-to-digital converter is connected to the linear array detector for reading the position of the spot on the linear array detector. A microprocessor with memory is connected to the analog-to-digital converter to hold and manipulate the data provided by the analog-to-digital converter on the position of the spot and to compute the position of the shaft based upon the data from the analog-to-digital converter.

  12. Linear encoding device

    NASA Technical Reports Server (NTRS)

    Leviton, Douglas B. (Inventor)

    1993-01-01

    A Linear Motion Encoding device for measuring the linear motion of a moving object is disclosed in which a light source is mounted on the moving object and a position sensitive detector such as an array photodetector is mounted on a nearby stationary object. The light source emits a light beam directed towards the array photodetector such that a light spot is created on the array. An analog-to-digital converter, connected to the array photodetector is used for reading the position of the spot on the array photodetector. A microprocessor and memory is connected to the analog-to-digital converter to hold and manipulate data provided by the analog-to-digital converter on the position of the spot and to compute the linear displacement of the moving object based upon the data from the analog-to-digital converter.

  13. Apoferritin-Templated Synthesis of Encoded Metallic Phosphate Nanoparticle Tags

    SciTech Connect

    Liu, Guodong; Wu, Hong; Dohnalkova, Alice; Lin, Yuehe

    2007-07-31

    Encoded metallic-phosphate nanoparticle tags, with distinct encoding patterns, have been prepared using an apoferritin template. A center-cavity structure as well as the disassociation and reconstructive characteristics of apoferritin at different pH environments provide a facile route for preparing such encoded nanoparticle tags. Encapsulation and diffusion approaches have been investigated during the preparation. The encapsulation approach, which is based on the dissociation and reconstruction of apoferritin at different pHs, exhibits an effective route to prepare such encoded metallic-phosphate nanoparticle tags. The compositionally encoded nanoparticle tag leads to a high coding capacity with a large number of distinguishable voltammetric signals, reflecting the predetermined composition of the metal mixture solution (and hence the nanoparticle composition). Releasing the metal components from the nanoparticle tags at pH 4.6 acetate buffer avoids harsh dissolution conditions, such as strong acids. Such a synthesis of encoded nanoparticle tags, including single-component and compositionally encoded nanoparticle tags, is substantially simple, fast, and convenient compared to that of encoded metal nanowires and semiconductor nanoparticle (CdS, PbS, and ZnS) incorporated polystyrene beads. The encoded metallic-phosphate nanoparticle tags thus show great promise for bioanalytical or product-tracking/identification/protection applications.

  14. Space vehicle onboard command encoder

    NASA Technical Reports Server (NTRS)

    1975-01-01

    A flexible onboard encoder system was designed for the space shuttle. The following areas were covered: (1) implementation of the encoder design into hardware to demonstrate the various encoding algorithms/code formats, (2) modulation techniques in a single hardware package to maintain comparable reliability and link integrity of the existing link systems and to integrate the various techniques into a single design using current technology. The primary function of the command encoder is to accept input commands, generated either locally onboard the space shuttle or remotely from the ground, format and encode the commands in accordance with the payload input requirements and appropriately modulate a subcarrier for transmission by the baseband RF modulator. The following information was provided: command encoder system design, brassboard hardware design, test set hardware and system packaging, and software.

  15. N-Consecutive-Phase Encoder

    NASA Technical Reports Server (NTRS)

    Divsalar, Dariush; Lee, Ho-Kyoung; Weber, Charles

    1995-01-01

    N-consecutive-phase encoder (NCPE) is conceptual encoder for generating alphabet of N consecutive full-response continuous-phase-modulation (CPM) signals. Enables use of binary preencoder of higher rate than used with simple continuous-phase encoder (CPE). NCPE makes possible to achieve power efficiencies and bandwidth efficiencies greater than conventional trellis coders with continuous-phase frequency-shift keying (CPFSK).

  16. Asymmetric synthesis using chiral-encoded metal

    PubMed Central

    Yutthalekha, Thittaya; Wattanakit, Chularat; Lapeyre, Veronique; Nokbin, Somkiat; Warakulwit, Chompunuch; Limtrakul, Jumras; Kuhn, Alexander

    2016-01-01

    The synthesis of chiral compounds is of crucial importance in many areas of society and science, including medicine, biology, chemistry, biotechnology and agriculture. Thus, there is a fundamental interest in developing new approaches for the selective production of enantiomers. Here we report the use of mesoporous metal structures with encoded geometric chiral information for inducing asymmetry in the electrochemical synthesis of mandelic acid as a model molecule. The chiral-encoded mesoporous metal, obtained by the electrochemical reduction of platinum salts in the presence of a liquid crystal phase and the chiral template molecule, perfectly retains the chiral information after removal of the template. Starting from a prochiral compound we demonstrate enantiomeric excess of the (R)-enantiomer when using (R)-imprinted electrodes and vice versa for the (S)-imprinted ones. Moreover, changing the amount of chiral cavities in the material allows tuning the enantioselectivity. PMID:27562028

  17. Asymmetric synthesis using chiral-encoded metal.

    PubMed

    Yutthalekha, Thittaya; Wattanakit, Chularat; Lapeyre, Veronique; Nokbin, Somkiat; Warakulwit, Chompunuch; Limtrakul, Jumras; Kuhn, Alexander

    2016-01-01

    The synthesis of chiral compounds is of crucial importance in many areas of society and science, including medicine, biology, chemistry, biotechnology and agriculture. Thus, there is a fundamental interest in developing new approaches for the selective production of enantiomers. Here we report the use of mesoporous metal structures with encoded geometric chiral information for inducing asymmetry in the electrochemical synthesis of mandelic acid as a model molecule. The chiral-encoded mesoporous metal, obtained by the electrochemical reduction of platinum salts in the presence of a liquid crystal phase and the chiral template molecule, perfectly retains the chiral information after removal of the template. Starting from a prochiral compound we demonstrate enantiomeric excess of the (R)-enantiomer when using (R)-imprinted electrodes and vice versa for the (S)-imprinted ones. Moreover, changing the amount of chiral cavities in the material allows tuning the enantioselectivity. PMID:27562028

  18. Prosodic Encoding in Silent Reading.

    ERIC Educational Resources Information Center

    Wilkenfeld, Deborah

    In silent reading, short-memory tasks, such as semantic and syntactic processing, require a stage of phonetic encoding between visual representation and the actual extraction of meaning, and this encoding includes prosodic as well as segmental features. To test for this suprasegmental coding, an experiment was conducted in which subjects were…

  19. Peri-encoding predictors of memory encoding and consolidation.

    PubMed

    Cohen, Noga; Pell, Liat; Edelson, Micah G; Ben-Yakov, Aya; Pine, Alex; Dudai, Yadin

    2015-03-01

    We review reports of brain activations that occur immediately prior to the onset or following the offset of to-be-remembered information and can predict subsequent mnemonic success. Memory-predictive pre-encoding processes, occurring from fractions of a second to minutes prior to event onset, are mainly associated with activations in the medial temporal lobe (MTL), amygdala and midbrain, and with enhanced theta oscillations. These activations may be considered as the neural correlates of one or more cognitive operations, including contextual processing, attention, and the engagement of distinct computational modes associated with prior encoding or retrieval. Post-encoding activations that correlate with subsequent memory performance are mainly observed in the MTL, sensory cortices and frontal regions. These activations may reflect binding of elements of the encoded information and initiation of memory consolidation. In all, the findings reviewed here illustrate the importance of brain states in the immediate peri-encoding time windows in determining encoding success. Understanding these brain states and their specific effects on memory may lead to optimization of the encoding of desired memories and mitigation of undesired ones. PMID:25446944

  20. Information encoder/decoder using chaotic systems

    DOEpatents

    Miller, Samuel Lee; Miller, William Michael; McWhorter, Paul Jackson

    1997-01-01

    The present invention discloses a chaotic system-based information encoder and decoder that operates according to a relationship defining a chaotic system. Encoder input signals modify the dynamics of the chaotic system comprising the encoder. The modifications result in chaotic, encoder output signals that contain the encoder input signals encoded within them. The encoder output signals are then capable of secure transmissions using conventional transmission techniques. A decoder receives the encoder output signals (i.e., decoder input signals) and inverts the dynamics of the encoding system to directly reconstruct the original encoder input signals.