Science.gov

Sample records for encoding lipoic acid

  1. Diabetes and Alpha Lipoic Acid

    PubMed Central

    Golbidi, Saeid; Badran, Mohammad; Laher, Ismail

    2011-01-01

    Diabetes mellitus is a multi-faceted metabolic disorder where there is increased oxidative stress that contributes to the pathogenesis of this debilitating disease. This has prompted several investigations into the use of antioxidants as a complementary therapeutic approach. Alpha lipoic acid, a naturally occurring dithiol compound which plays an essential role in mitochondrial bioenergetic reactions, has gained considerable attention as an antioxidant for use in managing diabetic complications. Lipoic acid quenches reactive oxygen species, chelates metal ions, and reduces the oxidized forms of other antioxidants such as vitamin C, vitamin E, and glutathione. It also boosts antioxidant defense system through Nrf-2-mediated antioxidant gene expression and by modulation of peroxisome proliferator activated receptors-regulated genes. ALA inhibits nuclear factor kappa B and activates AMPK in skeletal muscles, which in turn have a plethora of metabolic consequences. These diverse actions suggest that lipoic acid acts by multiple mechanisms, many of which have only been uncovered recently. In this review we briefly summarize the known biochemical properties of lipoic acid and then discussed the oxidative mechanisms implicated in diabetic complications and the mechanisms by which lipoic acid may ameliorate these reactions. The findings of some of the clinical trials in which lipoic acid administration has been tested in diabetic patients during the last 10 years are summarized. It appears that the clearest benefit of lipoic acid supplementation is in patients with diabetic neuropathy. PMID:22125537

  2. Lipoic Acid Metabolism in Microbial Pathogens

    PubMed Central

    Spalding, Maroya D.; Prigge, Sean T.

    2010-01-01

    Summary: Lipoic acid [(R)-5-(1,2-dithiolan-3-yl)pentanoic acid] is an enzyme cofactor required for intermediate metabolism in free-living cells. Lipoic acid was discovered nearly 60 years ago and was shown to be covalently attached to proteins in several multicomponent dehydrogenases. Cells can acquire lipoate (the deprotonated charge form of lipoic acid that dominates at physiological pH) through either scavenging or de novo synthesis. Microbial pathogens implement these basic lipoylation strategies with a surprising variety of adaptations which can affect pathogenesis and virulence. Similarly, lipoylated proteins are responsible for effects beyond their classical roles in catalysis. These include roles in oxidative defense, bacterial sporulation, and gene expression. This review surveys the role of lipoate metabolism in bacterial, fungal, and protozoan pathogens and how these organisms have employed this metabolism to adapt to niche environments. PMID:20508247

  3. A new regulatory mechanism for bacterial lipoic acid synthesis

    PubMed Central

    Zhang, Huimin; Luo, Qixia; Gao, Haichun; Feng, Youjun

    2015-01-01

    Lipoic acid, an essential enzyme cofactor, is required in three domains of life. In the past 60 years since its discovery, most of the pathway for lipoic acid synthesis and metabolism has been elucidated. However, genetic control of lipoic acid synthesis remains unclear. Here, we report integrative evidence that bacterial cAMP-dependent signaling is linked to lipoic acid synthesis in Shewanella species, the certain of unique marine-borne bacteria with special ability of metal reduction. Physiological requirement of protein lipoylation in γ-proteobacteria including Shewanella oneidensis was detected using Western blotting with rabbit anti-lipoyl protein primary antibody. The two genes (lipB and lipA) encoding lipoic acid synthesis pathway were proved to be organized into an operon lipBA in Shewanella, and the promoter was mapped. Electrophoretic mobility shift assays confirmed that the putative CRP-recognizable site (AAGTGTGATCTATCTTACATTT) binds to cAMP-CRP protein with origins of both Escherichia coli and Shewanella. The native lipBA promoter of Shewanella was fused to a LacZ reporter gene to create a chromosome lipBA-lacZ transcriptional fusion in E. coli and S. oneidensis, allowing us to directly assay its expression level by β-galactosidase activity. As anticipated, the removal of E. coli crp gene gave above fourfold increment of lipBA promoter-driven β-gal expression. The similar scenario was confirmed by both the real-time quantitative PCR and the LacZ transcriptional fusion in the crp mutant of Shewanella. Furthermore, the glucose effect on the lipBA expression of Shewanella was evaluated in the alternative microorganism E. coli. As anticipated, an addition of glucose into media effectively induces the transcriptional level of Shewanella lipBA in that the lowered cAMP level relieves the repression of lipBA by cAMP-CRP complex. Therefore, our finding might represent a first paradigm mechanism for genetic control of bacterial lipoic acid synthesis. PMID

  4. Effects of Lipoic Acid on Acrylamide Induced Testicular Damage

    PubMed Central

    Lebda, Mohamed; Gad, Shereen; Gaafar, Hossam

    2014-01-01

    Introduction: Acrylamide is very toxic to various organs and associated with significant increase of oxidative stress and depletion of antioxidants. Alpha-lipoic acid enhances cellular antioxidant defense capacity, thereby protecting cells from oxidative stress. Aim of the study: This study aimed to evaluate the protective role of alpha-lipoic acid on the oxidative damage induced by acrylamide in testicular and epididymal tissues. Material and methods: Forty adult male rats were divided into four groups (10 rats each). Control group; acrylamide treated group administered acrylamide 0.05% (w/v) in drinking water for 21 days; alpha-lipoic acid group received basal diet supplemented with 1% alpha-lipoic acid and forth group was exposed to acrylamide and treated with alpha-lipoic acid at the same doses and treatment regimen mentioned before. Results: The administration of acrylamide resulted in significant elevation in testicular and epididymal malondialdehyde level (MDA) and significant reduction in the level of reduced glutathione (GSH) and the activities of glutathione-S-transferase (GST), glutathione peroxidase (GPX) and glutathione reductase (GR). Also, acrylamide significantly reduced serum total testosterone and progesterone but increased estradiol (E2) levels. Treatment with alpha-lipoic acid prior to acrylamide induced protective effects and attenuated these biochemical changes. Conclusion: Alpha-lipoic acid has been shown to possess antioxidant properties offering promising efficacy against oxidative stress induced by acrylamide administration. PMID:25126019

  5. Antioxidant capacity and stability of liposomes containing a triglyceride derivative of lipoic acid

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The multi-functional nutritional agent lipoic acid offers numerous beneficial effects to oxidatively stressed tissues. Lipoic acid was enzymatically incorporated into a triglyceride in conjunction with oleic acid, creating lipoyl dioleoylglycerol, and then chemically reduced to form dihydrolipoyl d...

  6. Lipoic acid - biological activity and therapeutic potential.

    PubMed

    Gorąca, Anna; Huk-Kolega, Halina; Piechota, Aleksandra; Kleniewska, Paulina; Ciejka, Elżbieta; Skibska, Beata

    2011-01-01

    α-Lipoic acid (LA; 5-(1,2-dithiolan-3-yl)pentanoic acid) was originally isolated from bovine liver by Reed et al. in 1951. LA was once considered a vitamin. Subsequently, it was found that LA is not a vitamin and is synthesized by plants and animals. LA is covalently bound to the ε-amino group of lysine residues and functions as a cofactor for mitochondrial enzymes by catalyzing the oxidative decarboxylation of pyruvate, α-ketoglutarate and branched-chain α-keto acids. LA and its reduced form - dihydrolipoic acid (DHLA), meet all the criteria for an ideal antioxidant because they can easily quench radicals, can chelate metals, have an amphiphlic character and they do not exhibit any serious side effects. They interact with other antioxidants and can regenerate them. For this reason, LA is called an antioxidant of antioxidants. LA has an influence on the second messenger nuclear factor κB (NF-κB) and attenuates the release of free radicals and cytotoxic cytokines. The therapeutic action of LA is based on its antioxidant properties. Current studies support its use in the ancillary treatment of many diseases, such as diabetes, cardiovascular, neurodegenerative, autoimmune diseases, cancer and AIDS. This review was undertaken to gather the most recent information regarding the therapeutic properties of LA and its possible utility in disease treatment. PMID:22001972

  7. Lipoic acid attenuates Aroclor 1260-induced hepatotoxicity in adult rats.

    PubMed

    Aly, Hamdy A A; Mansour, Ahmed M; Hassan, Memy H; Abd-Ellah, Mohamed F

    2016-08-01

    The present study was aimed to investigate the mechanistic aspect of Aroclor 1260-induced hepatotoxicity and its protection by lipoic acid. The adult male Albino rats were divided into six groups. Group I served as control. Group II received lipoic acid (35 mg/kg/day). Aroclor 1260 was given to rats by oral gavage at doses 20, 40, or 60 mg/kg/day (Groups III, IV, and V, respectively). Group VI was pretreated with lipoic acid (35 mg/kg/day) 24 h before Aroclor 1260 (40 mg/kg/day). Treatment in all groups was continued for further 15 consecutive days. Serum alanine aminotransferase, aspartate aminotransferase, alkaline phosphatase, and lactate dehydrogenase activities and total bilirubin, total cholesterol, and triglycerides were significantly increased while total protein, total albumin, and high-density lipoprotein were significantly decreased. Hydrogen peroxide production and lipid peroxidation were significantly increased while superoxide dismutase and catalase activities and reduced glutathione (GSH) content was significantly decreased in liver. Caspase-3 & -9 activities were significantly increased in liver. Lipoic acid pretreatment significantly reverted all these abnormalities toward their normal levels. In conclusion, Aroclor 1260 induced liver dysfunction, at least in part, by induction of oxidative stress. Apoptotic effect of hepatic cells is involved in Aroclor 1260-induced liver injury. Lipoic acid could protect rats against Aroclor 1260-induced hepatotoxicity. © 2014 Wiley Periodicals, Inc. Environ Toxicol 31: 913-922, 2016. PMID:25533183

  8. A Novel Two-Gene Requirement for the Octanoyltransfer Reaction of Bacillus subtilis Lipoic Acid Biosynthesis

    PubMed Central

    Martin, Natalia; Christensen, Quin H.; Mansilla, María C.; Cronan, John E.; de Mendoza, Diego

    2011-01-01

    SUMMARY The Bacillus subtilis genome encodes three apparent lipoyl ligase homologues: yhfJ, yqhM, and ywfL which we have renamed lplJ, lipM and lipL, respectively. We show that LplJ encodes the sole lipoyl ligase of this bacterium. Physiological and biochemical characterization of a ΔlipM strain showed that LipM is absolutely required for the endogenous lipoylation of all lipoate-dependent proteins, confirming its role as the B. subtilis octanoyltransferase. However, we also report that in contrast to E. coli, B. subtilis requires a third protein for lipoic acid assembly, LipL. B. subtilis ΔlipL strains are unable to synthesize lipoic acid despite the presence of LipM and the sulfur insertion enzyme, LipA, which should suffice for lipoic acid biosynthesis based on the E. coli model. LipM is only required for the endogenous lipoylation pathway, whereas LipL also plays a role in lipoic acid scavenging. Expression of E. coli lipB allows growth of B. subtilis ΔlipL or ΔlipM strains in the absence of supplements. In contrast, growth of an E. coli ΔlipB strain can be complemented with lipM, but not lipL. These data together with those of the companion paper (Christensen et al., 2011) provide evidence that LipM and LipL catalyze sequential reactions in a novel pathway for lipoic acid biosynthesis. PMID:21338420

  9. Lipoic Acid Metabolism of Plasmodium - A Suitable Drug Target

    PubMed Central

    Storm, Janet; Müller, Sylke

    2012-01-01

    α-Lipoic acid (6,8-thioctic acid; LA) is a vital co-factor of α-ketoacid dehydrogenase complexes and the glycine cleavage system. In recent years it was shown that biosynthesis and salvage of LA in Plasmodium are necessary for the parasites to complete their complex life cycle. LA salvage requires two lipoic acid protein ligases (LplA1 and LplA2). LplA1 is confined to the mitochondrion while LplA2 is located in both the mitochondrion and the apicoplast. LplA1 exclusively uses salvaged LA and lipoylates α-ketoglutarate dehydrogenase, branched chain α-ketoacid dehydrogenase and the H-protein of the glycine cleavage system. LplA2 cannot compensate for the loss of LplA1 function during blood stage development suggesting a specific function for LplA2 that has yet to be elucidated. LA salvage is essential for the intra-erythrocytic and liver stage development of Plasmodium and thus offers great potential for future drug or vaccine development. LA biosynthesis, comprising octanoyl-acyl carrier protein (ACP) : protein N-octanoyltransferase (LipB) and lipoate synthase (LipA), is exclusively found in the apicoplast of Plasmodium where it generates LA de novo from octanoyl-ACP, provided by the type II fatty acid biosynthesis (FAS II) pathway also present in the organelle. LA is the co-factor of the acetyltransferase subunit of the apicoplast located pyruvate dehydrogenase (PDH), which generates acetyl-CoA, feeding into FAS II. LA biosynthesis is not vital for intra-erythrocytic development of Plasmodium, but the deletion of several genes encoding components of FAS II or PDH was detrimental for liver stage development of the parasites indirectly suggesting that the same applies to LA biosynthesis. These data provide strong evidence that LA salvage and biosynthesis are vital for different stages of Plasmodium development and offer potential for drug and vaccine design against malaria. PMID:22607141

  10. Lipoic acid metabolism of Plasmodium--a suitable drug target.

    PubMed

    Storm, Janet; Müller, Sylke

    2012-01-01

    α-Lipoic acid (6,8-thioctic acid; LA) is a vital co-factor of α-ketoacid dehydrogenase complexes and the glycine cleavage system. In recent years it was shown that biosynthesis and salvage of LA in Plasmodium are necessary for the parasites to complete their complex life cycle. LA salvage requires two lipoic acid protein ligases (LplA1 and LplA2). LplA1 is confined to the mitochondrion while LplA2 is located in both the mitochondrion and the apicoplast. LplA1 exclusively uses salvaged LA and lipoylates α-ketoglutarate dehydrogenase, branched chain α-ketoacid dehydrogenase and the H-protein of the glycine cleavage system. LplA2 cannot compensate for the loss of LplA1 function during blood stage development suggesting a specific function for LplA2 that has yet to be elucidated. LA salvage is essential for the intra-erythrocytic and liver stage development of Plasmodium and thus offers great potential for future drug or vaccine development. LA biosynthesis, comprising octanoyl-acyl carrier protein (ACP) : protein N-octanoyltransferase (LipB) and lipoate synthase (LipA), is exclusively found in the apicoplast of Plasmodium where it generates LA de novo from octanoyl-ACP, provided by the type II fatty acid biosynthesis (FAS II) pathway also present in the organelle. LA is the co-factor of the acetyltransferase subunit of the apicoplast located pyruvate dehydrogenase (PDH), which generates acetyl-CoA, feeding into FAS II. LA biosynthesis is not vital for intra-erythrocytic development of Plasmodium, but the deletion of several genes encoding components of FAS II or PDH was detrimental for liver stage development of the parasites indirectly suggesting that the same applies to LA biosynthesis. These data provide strong evidence that LA salvage and biosynthesis are vital for different stages of Plasmodium development and offer potential for drug and vaccine design against malaria. PMID:22607141

  11. Physicochemical Profiling of α-Lipoic Acid and Related Compounds.

    PubMed

    Mirzahosseini, Arash; Szilvay, András; Noszál, Béla

    2016-07-01

    Lipoic acid, the biomolecule of vital importance following glycolysis, shows diversity in its thiol/disulfide equilibria and also in its eight different protonation forms of the reduced molecule. In this paper, lipoic acid, lipoamide, and their dihydro derivatives were studied to quantify their solubility, acid-base, and lipophilicity properties at a submolecular level. The acid-base properties are characterized in terms of six macroscopic, 12 microscopic protonation constants, and three interactivity parameters. The species-specific basicities, the pH-dependent distribution of the microspecies, and lipophilicity parameters are interpreted by various intramolecular effects, and contribute to understanding the antioxidant, chelate-forming, and enzyme cofactor behavior of the molecules observed. PMID:27272749

  12. alpha-Lipoic acid as a biological antioxidant.

    PubMed

    Packer, L; Witt, E H; Tritschler, H J

    1995-08-01

    alpha-Lipoic acid, which plays an essential role in mitochondrial dehydrogenase reactions, has recently gained considerable attention as an antioxidant. Lipoate, or its reduced form, dihydrolipoate, reacts with reactive oxygen species such as superoxide radicals, hydroxyl radicals, hypochlorous acid, peroxyl radicals, and singlet oxygen. It also protects membranes by interacting with vitamin C and glutathione, which may in turn recycle vitamin E. In addition to its antioxidant activities, dihydrolipoate may exert prooxidant actions through reduction of iron. alpha-Lipoic acid administration has been shown to be beneficial in a number of oxidative stress models such as ischemia-reperfusion injury, diabetes (both alpha-lipoic acid and dihydrolipoic acid exhibit hydrophobic binding to proteins such as albumin, which can prevent glycation reactions), cataract formation, HIV activation, neurodegeneration, and radiation injury. Furthermore, lipoate can function as a redox regulator of proteins such as myoglobin, prolactin, thioredoxin and NF-kappa B transcription factor. We review the properties of lipoate in terms of (1) reactions with reactive oxygen species; (2) interactions with other antioxidants; (3) beneficial effects in oxidative stress models or clinical conditions. PMID:7649494

  13. Nonlinear Optical Properties of Au-Nanoparticles Conjugated with Lipoic Acid in Water

    NASA Astrophysics Data System (ADS)

    Trejo-Durán, M.; Cornejo-Monroy, D.; Alvarado-Méndez, E.; Olivares-Vargas, A.; Castano, V. M.

    2014-08-01

    Gold nanoparticles were chemically conjugated with lipoic acid to control their optical properties. Z-scan and other optical techniques were used to characterize the non-linear behavior of the resulting nanostructured materials. The results show that the nonlinearity is of thermal origin, which can be controlled by the use of lipoic acid as well as other organic molecules conjugated onto metal nanoparticles. In particular, the presence of lipoic acid increases n_2 and dn/dT.

  14. Comparison of antioxidant effectiveness of lipoic acid and dihydrolipoic acid.

    PubMed

    Zhao, Feng; Liu, Zai-Qun

    2011-01-01

    The abilities of dihydrolipoic acid (DHLA) to scavenge peroxynitrite (ONOO(-) ), galvinoxyl radical, 2,2'-azinobis(3-ethylbenzothiazoline-6-sulfonate) cation radical (ABTS(+•) ), and 2,2'-diphenyl-1-picrylhydrazyl radical (DPPH) were higher than those of lipoic acid (LA). The effectiveness of DHLA to protect methyl linoleate against 2,2'-azobis(2-amidinopropane hydrochloride) (AAPH)-induced oxidation was about 2.2-fold higher than that of LA, and DHLA can retard the autoxidation of linoleic acid (LH) in the β-carotene-bleaching test. DHLA can also trap ∼0.6 radicals in AAPH-induced oxidation of LH. Moreover, DHLA can scavenge ∼2.0 radicals in AAPH-induced oxidation of DNA and AAPH-induced hemolysis of erythrocytes, whereas LA can scavenge ∼1.5 radicals at the same experimental conditions. DHLA can protect erythrocytes against hemin-induced hemolysis, but accelerate the degradation of DNA in the presence of Cu(2+) . Therefore, the antioxidant capacity of -SH in DHLA is higher than S-S in LA. PMID:21812071

  15. Biotin and Lipoic Acid: Synthesis, Attachment and Regulation

    PubMed Central

    Cronan, John E.

    2014-01-01

    Summary Two vitamins, biotin and lipoic acid, are essential in all three domains of life. Both coenzymes function only when covalently attached to key metabolic enzymes. There they act as “swinging arms” that shuttle intermediates between two active sites (= covalent substrate channeling) of key metabolic enzymes. Although biotin was discovered over 100 years ago and lipoic acid 60 years ago, it was not known how either coenzyme is made until recently. In Escherichia coli the synthetic pathways for both coenzymes have now been worked out for the first time. The late steps of biotin synthesis, those involved in assembling the fused rings, were well-described biochemically years ago, although recent progress has been made on the BioB reaction, the last step of the pathway in which the biotin sulfur moiety is inserted. In contrast, the early steps of biotin synthesis, assembly of the fatty acid-like “arm” of biotin were unknown. It has now been demonstrated that the arm is made by using disguised substrates to gain entry into the fatty acid synthesis pathway followed by removal of the disguise when the proper chain length is attained. The BioC methyltransferase is responsible for introducing the disguise and the BioH esterase for its removal. In contrast to biotin, which is attached to its cognate proteins as a finished molecule, lipoic acid is assembled on its cognate proteins. An octanoyl moiety is transferred from the octanoyl-ACP of fatty acid synthesis to a specific lysine residue of a cognate protein by the LipB octanoyl transferase followed by sulfur insertion at carbons C6 and C8 by the LipA lipoyl synthetase. Assembly on the cognate proteins regulates the amount of lipoic acid synthesized and thus there is no transcriptional control of the synthetic genes. In contrast transcriptional control of the biotin synthetic genes is wielded by a remarkably sophisticated, yet simple, system, exerted through BirA a dual function protein that both represses

  16. Biotin and Lipoic Acid: Synthesis, Attachment, and Regulation.

    PubMed

    Cronan, John E

    2014-05-01

    Two vitamins, biotin and lipoic acid, are essential in all three domains of life. Both coenzymes function only when covalently attached to key metabolic enzymes. There they act as "swinging arms" that shuttle intermediates between two active sites (= covalent substrate channeling) of key metabolic enzymes. Although biotin was discovered over 100 years ago and lipoic acid 60 years ago, it was not known how either coenzyme is made until recently. In Escherichia coli the synthetic pathways for both coenzymes have now been worked out for the first time. The late steps of biotin synthesis, those involved in assembling the fused rings, were well described biochemically years ago, although recent progress has been made on the BioB reaction, the last step of the pathway in which the biotin sulfur moiety is inserted. In contrast, the early steps of biotin synthesis, assembly of the fatty acid-like "arm" of biotin were unknown. It has now been demonstrated that the arm is made by using disguised substrates to gain entry into the fatty acid synthesis pathway followed by removal of the disguise when the proper chain length is attained. The BioC methyltransferase is responsible for introducing the disguise, and the BioH esterase is responsible for its removal. In contrast to biotin, which is attached to its cognate proteins as a finished molecule, lipoic acid is assembled on its cognate proteins. An octanoyl moiety is transferred from the octanoyl acyl carrier protein of fatty acid synthesis to a specific lysine residue of a cognate protein by the LipB octanoyltransferase followed by sulfur insertion at carbons C-6 and C-8 by the LipA lipoyl synthetase. Assembly on the cognate proteins regulates the amount of lipoic acid synthesized, and, thus, there is no transcriptional control of the synthetic genes. In contrast, transcriptional control of the biotin synthetic genes is wielded by a remarkably sophisticated, yet simple, system, exerted through BirA, a dual-function protein

  17. Biotin and Lipoic Acid: Synthesis, Attachment, and Regulation.

    PubMed

    Cronan, John E

    2008-09-01

    Two vitamins, biotin and lipoic acid, are essential in all three domains of life. Both coenzymes function only when covalently attached to key metabolic enzymes. There they act as "swinging arms" that shuttle intermediates between two active sites (= covalent substrate channeling) of key metabolic enzymes. Although biotin was discovered over 100 years ago and lipoic acid was discovered 60 years ago, it was not known how either coenzyme is made until recently. In Escherichia coli the synthetic pathways for both coenzymes have now been worked out for the first time. The late steps of biotin synthesis, those involved in assembling the fused rings, were well described biochemically years ago, although recent progress has been made on the BioB reaction, the last step of the pathway, in which the biotin sulfur moiety is inserted. In contrast, the early steps of biotin synthesis, assembly of the fatty acid-like "arm" of biotin, were unknown. It has now been demonstrated that the arm is made by using disguised substrates to gain entry into the fatty acid synthesis pathway followed by removal of the disguise when the proper chain length is attained. The BioC methyltransferase is responsible for introducing the disguise and the BioH esterase for its removal. In contrast to biotin, which is attached to its cognate proteins as a finished molecule, lipoic acid is assembled on its cognate proteins. An octanoyl moiety is transferred from the octanoyl-ACP of fatty acid synthesis to a specific lysine residue of a cognate protein by the LipB octanoyl transferase, followed by sulfur insertion at carbons C6 and C8 by the LipA lipoyl synthetase. Assembly on the cognate proteins regulates the amount of lipoic acid synthesized, and thus there is no transcriptional control of the synthetic genes. In contrast, transcriptional control of the biotin synthetic genes is wielded by a remarkably sophisticated, yet simple, system exerted through BirA, a dual-function protein that both represses

  18. Possible involvement of lipoic acid in binding protein-dependent transport systems in Escherichia coli.

    PubMed

    Richarme, G

    1985-04-01

    We describe the properties of the binding protein dependent-transport of ribose, galactose, and maltose and of the lactose permease, and the phosphoenolpyruvate-glucose phosphotransferase transport systems in a strain of Escherichia coli which is deficient in the synthesis of lipoic acid, a cofactor involved in alpha-keto acid dehydrogenation. Such a strain can grow in the absence of lipoic acid in minimal medium supplemented with acetate and succinate. Although the lactose permease and the phosphoenolypyruvate-glucose phosphotransferase are not affected by lipoic acid deprivation, the binding protein-dependent transports are reduced by 70% in conditions of lipoic acid deprivation when compared with their activity in conditions of lipoic acid supply. The remaining transport is not affected by arsenate but is inhibited by the uncoupler carbonylcyanide-m-chlorophenylhydrazone; however the lipoic acid-dependent transport is completely inhibited by arsenate and only weakly inhibited by carbonylcyanide-m-chlorophenylhydrazone. The known inhibitor of alpha-keto acid dehydrogenases, 5-methoxyindole-2-carboxylic acid, completely inhibits all binding protein-dependent transports whether in conditions of lipoic supply or deprivation; the results suggest a possible relation between binding protein-dependent transport and alpha-keto acid dehydrogenases and shed light on the inhibition of these transports by arsenicals and uncouplers. PMID:3920206

  19. Long-term physical and oxidative stability of liposomes containing glycerides of lipoic acid

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The acyl glycerides of lipoic and dihydrolipoic acids may serve as slow-release sources for cutaneous delivery of these antioxidants when formulated in a liposomal vehicle. Accelerated storage testing was conducted to determine the storage stability of the lipoic derivatives and of the soybean phosp...

  20. Effect of alpha-lipoic acid on memory, oxidation, and lifespan in SAMP8 mice.

    PubMed

    Farr, Susan A; Price, Tulin O; Banks, William A; Ercal, Nuran; Morley, John E

    2012-01-01

    Oxidative damage is associated with neurodegenerative disorders such as Alzheimer's disease (AD). The antioxidant alpha-lipoic acid has been found to improve memory in mouse models of AD. Here, we administered alpha-lipoic acid daily to SAMP8 mice starting at 11 months of age and continuing until death. We found that treatment with alpha-lipoic acid decreased survival from 34 weeks in those receiving vehicle to 20 weeks. A subset of 18 month old mice given alpha-lipoic acid for two weeks and then tested in an object-place recognition paradigm had improved memory. A second subset of 18 month old mice given alpha-lipoic acid for two weeks and tested in the Barnes maze had improved learning. After testing, the mice were sacrificed and indices of oxidative damage were measured in the brain tissue. The mice that received alpha-lipoic acid had significantly increased glutathione and decreased glutathione peroxidase and malondialdehyde indicating reversal of oxidative stress. These results indicate that alpha-lipoic acid improves memory and reverses indices of oxidative stress in extremely old SAMP8 mice, but decreases lifespan. These findings are similar to studies using other types of antioxidants. PMID:22785389

  1. [Role of lipoic acid in health and disease].

    PubMed

    Huk-Kolega, Halina; Skibska, Beata; Kleniewska, Paulina; Piechota, Aleksandra; Michalski, Łukasz; Goraca, Anna

    2011-09-01

    Oxidative stress disturbs organism's homeostasis and leads to excessive reactive oxygen species (ROS) production. Researchers are still focused on antioxidants that help to reduce oxidative stress level and are helpful in treatment of diseases were ROS overproduction is observed. Among those antioxidants is lipoic acid (LA). When applied systemically LA accumulates in tissues and is converted to dihyrolipoic acid (DHLA) by lipoamide dehydrogenase. Both LA and DHLA are biologically active. LA scavenges hydroxyl radical, subchloric acid and singlet oxygen. Moreover, LA is able to chelate transient ions. Therefore, LA is used in diabetic nephropaties, fungi or heavy metal intoxication, liver diseases, neurodegenerative and cardiovascular diseases. This review surveys the antioxidant ability of LA and its role in pathological states where increased concentration of ROS is observed. PMID:21991851

  2. Alpha-lipoic acid supplementation: a tool for obesity therapy?

    PubMed

    Carbonelli, M G; Di Renzo, L; Bigioni, M; Di Daniele, N; De Lorenzo, A; Fusco, M A

    2010-01-01

    Lipid peroxidation has supposed as the major biochemical alteration underling oxidant-induced cell injury in stress including numerous diseases. One of the natural molecules know to prevent or retard oxidation is alpha-lipoic acid (LA) and, therefore, the lipoic acid/dihydrolipoic acid (LA/DHLA) redox couple has received considerable attention. Recent studies have highlighted the potential of free LA and DHLA as powerful metabolic antioxidants that are able to scavenge the reactive oxygen species, to recycle other antioxidants. Our aim was to investigate the beneficial effects of LA in the treatment of Italian pre-obese and obese subjects. We screened 1612 subjects for enrollment; of these, 1127 subjects (445 men and 682 women, 18-60 age) met enrolment criteria and were enrolled in the study. According to body mass index (BMI) the 53% was obese and the 43% was pre-obese. The subjects were treated for 4 month with 800 mg/day of LA. In pre-obese subject significant reduction (p<0.001) of weight (8%, both gender), BMI (2 points), blood pressure, and abdominal circumference (female 6 cm, male 7 cm) were observed. In obese subjects significant reductions (p<0.001) of weight (9%, both gender), BMI (female 3 point, male 4 point), blood pressure and abdominal circumference (female 9 cm, male 11 cm) were observed. Our study indicated that LA is an ideal antioxidant candidate for the therapy of obesity related diseases. Further clinical studies should be considered to highlight the role and efficacy of LA treatment. PMID:20388095

  3. Effects of lipoic acid and dihydrolipoic acid on 4-aminophenol-mediated erythrocytic toxicity in vitro.

    PubMed

    Coleman, Michael D; Williams, Charlotte; Haenen, Guido R M M

    2006-09-01

    The effects of the antioxidant lipoic acid and its reduced form, dihydrolipoic acid (DHLA), were studied on the process of the erythrocytic toxicity of 4-aminophenol in human erythrocytes in vitro. 4-Aminophenol alone caused a stepwise increase in methaemoglobin formation, along with a commensurate decrease in total thiols. At 10 min., in the presence of lipoic acid alone and the thiol depletor 1-chloro-2,4-dinitrobenzene (CDNB) alone, 4-aminophenol-mediated methaemoglobin formation was significantly increased, whilst thiol levels were significantly reduced compared with the 4-aminophenol alone. At 10 min., with DHLA and CDNB alone, 4-aminophenol was associated with significantly increased methaemoglobin formation. However, thiol levels were not significantly different in the presence of DHLA compared with 4-aminophenol alone, although thiol levels were different compared with control (4-aminophenol alone) in the incubations with CDNB alone. At 15 min., only CDNB/4-aminophenol methaemoglobin formation differed from control, whilst thiol levels were significantly lower in the presence of CDNB alone compared with 4-aminophenol alone. Lipoic acid enhanced the toxicity of 4-aminophenol in terms of increased methaemoglobin formation coupled with increased thiol depletion, whilst DHLA showed increased 4-aminophenol-mediated methaemoglobin formation without thiol depletion. Lipoic acid, and to a lesser extent its reduced derivative DHLA, acted as a prooxidant in the presence of 4-aminophenol, enhancing the oxidative stress effects of the amine in human erythrocytes. PMID:16930295

  4. Yeast display evolution of a kinetically efficient 13-amino acid substrate for lipoic acid ligase

    PubMed Central

    Puthenveetil, Sujiet; Liu, Daniel S.; White, Katharine A.; Thompson, Samuel; Ting, Alice Y.

    2009-01-01

    E. coli lipoic acid ligase (LplA) catalyzes ATP-dependent covalent ligation of lipoic acid onto specific lysine sidechains of three acceptor proteins involved in oxidative metabolism. Our lab has shown that LplA and engineered mutants can ligate useful small-molecule probes such as alkyl azides (Nat. Biotechnol. 2007, 25, 1483–1487) and photocrosslinkers (Angew. Chem Int. Ed Engl. 2008, 47, 7018–7021) in place of lipoic acid, facilitating imaging and proteomic studies. Both to further our understanding of lipoic acid metabolism, and to improve LplA’s utility as a biotechnological platform, we have engineered a novel 13-amino acid peptide substrate for LplA. LplA’s natural protein substrates have a conserved β-hairpin structure, a conformation that is difficult to recapitulate in a peptide, and thus we performed in vitro evolution to engineer the LplA peptide substrate, called “LplA Acceptor Peptide” (LAP). A ~107 library of LAP variants was displayed on the surface of yeast cells, labeled by LplA with either lipoic acid or bromoalkanoic acid, and the most efficiently labeled LAP clones were isolated by fluorescence activated cell sorting. Four rounds of evolution followed by additional rational mutagenesis produced a “LAP2” sequence with a kcat/Km of 0.99 μM−1min−1, >70-fold better than our previous rationally-designed 22-amino acid LAP1 sequence (Nat. Biotechnol. 2007, 25, 1483–1487), and only 8-fold worse than the kcat/Km values of natural lipoate and biotin acceptor proteins. The kinetic improvement over LAP1 allowed us to rapidly label cell surface peptide-fused receptors with quantum dots. PMID:19863063

  5. Lipoic acid: energy metabolism and redox regulation of transcription and cell signaling

    PubMed Central

    Packer, Lester; Cadenas, Enrique

    2011-01-01

    The role of R-α-lipoic acid as a cofactor (lipoyllysine) in mitochondrial energy metabolism is well established. Lipoic acid non-covalently bound and exogenously administered to cells or supplemented in the diet is a potent modulator of the cell’s redox status. The diversity of beneficial effects of lipoic acid in a variety of tissues can be mechanistically viewed in terms of thiol/disulfide exchange reactions that modulate the environment’s redox and energy status. Lipoic acid-driven thiol/disulfide exchange reactions appear critical for the modulation of proteins involved in cell signaling and transcription factors. This review emphasizes the effects of lipoic acid on PI3K and AMPK signaling and related transcriptional pathways that are integrated by PGC-1α, a critical regulator of energy homoestasis. The effects of lipoic acid on the neuronal energy-redox axis are largely reviewed in terms of their outcomes for aging and age-related neurodegenerative diseases. PMID:21297908

  6. Lipoic Acid Exerts Antioxidant and Anti-inflammatory Effects in Response to Heat Shock in C2C12 Myotubes.

    PubMed

    Lee, Cheng-Tse; Chang, Li-Ching; Wu, Pei-Fung

    2016-06-01

    This study explored that lipoic acid treatment for 24 h significantly upregulated and promoted heat shock-induced catalase expression and downregulated GPx1 messenger RNA (mRNA) expression, indicating that lipoic acid exhibits antioxidant activity in the decomposition of hydrogen peroxide by upregulating catalase expression. Moreover, lipoic acid treatment for 3 h increased and promoted heat shock-induced interleukin (IL)-6 mRNA and protein levels and that for 24 h downregulated IL-6 mRNA expression, suggesting a dual effect of lipoic acid on IL-6 regulation. Lipoic acid alone failed to increase or reduce tumor necrosis factor (TNF)-α mRNA and protein levels, whereas heat shock alone downregulated TNF-α mRNA and protein expression. These data suggest that lipoic acid does not have a proinflammatory role and that heat shock acts as an anti-inflammatory agent by downregulating TNF-α expression in C2C12 myotubes. Moreover, lipoic acid or heat shock alone upregulated the IL-6 receptor (IL-6R-α) and glycoprotein 130 (gp130) mRNA expression followed by IL-6 expression; these data indicate that the regulation of lipoic acid or heat shock is mediated by IL-6R signaling, thus suggesting that C2C12 myotubes possesses a mechanism for regulating IL-6R and gp130 expression following lipoic acid treatment or heat shock. PMID:27086282

  7. THE COMBINATION OF α-LIPOIC ACID INTAKE WITH ECCENTRIC EXERCISE MODULATES ERYTHROPOIETIN RELEASE

    PubMed Central

    Morawin, B.; Turowski, D.; Naczk, M.; Siatkowski, I.

    2014-01-01

    The generation of reactive nitrogen/oxygen species (RN/OS) represents an important mechanism in erythropoietin (EPO) expression and skeletal muscle adaptation to physical and metabolic stress. RN/OS generation can be modulated by intense exercise and nutrition supplements such as α-lipoic acid, which demonstrates both anti- and pro-oxidative action. The study was designed to show the changes in the haematological response through the combination of α-lipoic acid intake with running eccentric exercise. Sixteen healthy young males participated in the randomised and placebo-controlled study. The exercise trial involved a 90-min run followed by a 15-min eccentric phase at 65% VO2max (-10% gradient). It significantly increased serum concentrations of nitric oxide (NO), hydrogen peroxide (H2O2) and pro-oxidative products such as 8-isoprostanes (8-iso), lipid peroxides (LPO) and protein carbonyls (PC). α-Lipoic acid intake (Thiogamma: 1200 mg daily for 10 days prior to exercise) resulted in a 2-fold elevation of serum H2O2 concentration before exercise, but it prevented the generation of NO, 8-iso, LPO and PC at 20 min, 24 h, and 48 h after exercise. α-Lipoic acid also elevated serum EPO level, which highly correlated with NO/H2O2 ratio (r = 0.718, P < 0.01). Serum total creatine kinase (CK) activity, as a marker of muscle damage, reached a peak at 24 h after exercise (placebo 732 ± 207 IU · L-1, α-lipoic acid 481 ± 103 IU · L-1), and correlated with EPO (r = 0.478, P < 0.01) in the α-lipoic acid group. In conclusion, the intake of high α-lipoic acid modulates RN/OS generation, enhances EPO release and reduces muscle damage after running eccentric exercise. PMID:25177095

  8. Analysis of Reaction between α-Lipoic Acid and 2-Chloro-1-methylquinolinium Tetrafluoroborate Used as a Precolumn Derivatization Technique in Chromatographic Determination of α-Lipoic Acid

    PubMed Central

    Godlewska, Magdalena; Odachowska, Angelika; Turkowicz, Monika; Karpinska, Joanna

    2015-01-01

    The present study offers results of analysis concerning the course of reaction between reduced α-lipoic acid (LA) and 2-chloro-1-methylquinolinium tetrafluoroborate (CMQT). In water environments, the reaction between CMQT and hydrophilic thiols proceeds very rapidly and the resultant products are stable. For the described analysis, optimum reaction conditions, such as concentration of the reducing agent, environment pH, and concentration of the reagent were carefully selected. The spectrophotometric assay was carried out measuring absorbance at λ = 348 nm (i.e., the spectral band of the obtained reaction product). Furthermore, the calibration curve of lipoic acid was registered. It was concluded that the Lambert-Beer law was observed within the range 1–10 μmol L−1. Later, the reaction between LA and CMQT was used as precolumn derivatization in a chromatographic determination of the lipoic acid in the range 2.5–50 μmol L−1. Practical applicability of the designed methods was evaluated by determining lipoic acid in Revitanerv pharmaceutical preparation which contains 300 mg LA in a single capsule. The error of the determination did not exceed 0.5% in relation to the declared value. PMID:26504616

  9. Analysis of Reaction between α-Lipoic Acid and 2-Chloro-1-methylquinolinium Tetrafluoroborate Used as a Precolumn Derivatization Technique in Chromatographic Determination of α-Lipoic Acid.

    PubMed

    Godlewska, Magdalena; Odachowska, Angelika; Turkowicz, Monika; Karpinska, Joanna

    2015-01-01

    The present study offers results of analysis concerning the course of reaction between reduced α-lipoic acid (LA) and 2-chloro-1-methylquinolinium tetrafluoroborate (CMQT). In water environments, the reaction between CMQT and hydrophilic thiols proceeds very rapidly and the resultant products are stable. For the described analysis, optimum reaction conditions, such as concentration of the reducing agent, environment pH, and concentration of the reagent were carefully selected. The spectrophotometric assay was carried out measuring absorbance at λ = 348 nm (i.e., the spectral band of the obtained reaction product). Furthermore, the calibration curve of lipoic acid was registered. It was concluded that the Lambert-Beer law was observed within the range 1-10 μmol L(-1). Later, the reaction between LA and CMQT was used as precolumn derivatization in a chromatographic determination of the lipoic acid in the range 2.5-50 μmol L(-1). Practical applicability of the designed methods was evaluated by determining lipoic acid in Revitanerv pharmaceutical preparation which contains 300 mg LA in a single capsule. The error of the determination did not exceed 0.5% in relation to the declared value. PMID:26504616

  10. Lipoic acid suppression of neutrophil respiratory burst: effect of NADPH.

    PubMed

    O'Neill, Heidi C; Rancourt, Raymond C; White, Carl W

    2008-02-01

    Lipoic acid (LA) and its reduced product dihydrolipoic acid (DHLA) are potent antioxidants with capacity to scavenge reactive oxygen species (ROS) and recycle endogenous antioxidants. LA may increase cellular glutathione (GSH), an antioxidant lacking in the lung's epithelial lining fluid in lung disorders such as idiopathic pulmonary fibrosis (IPF). Neutrophils (PMN) are key innate responders and are pivotal in clearing bacterial infection, therefore it is crucial to understand the impact LA may have on their function. Circulating neutrophils were isolated from healthy volunteers and pretreated with LA or diluent. Cells were subsequently activated with phorbol 12-myristate 13-acetate (PMA, 100 ng/ml) to induce ROS production. SOD-inhibitable reduction of acetylated cytochrome c demonstrated the PMA-dependent respiratory burst was suppressed by LA. Oxygen consumption also was diminished when PMA-stimulated cells were pretreated with LA. PMN respiratory burst was partially restored by addition of NADPH but not other pyridine nucleotides. LA did not inhibit glucose-6-phosphate dehydrogenase activity of PMN. These data together suggest that the reduction of LA to DHLA using cellular NADPH may limit the capacity of the PMN NADPH oxidase to produce superoxide. Further studies will be required to determine if LA can diminish excessive superoxide produced by PMN and/or alveolar macrophages in IPF or relevant disease models in vivo. PMID:18158760

  11. The Effects of α-Lipoic Acid against Testicular Ischemia-Reperfusion Injury in Rats

    PubMed Central

    Ozbal, Seda; Ergur, Bekir Ugur; Erbil, Guven; Tekmen, Isıl; Bagrıyanık, Alper; Cavdar, Zahide

    2012-01-01

    Testicular torsion is one of the urologic emergencies occurring frequently in neonatal and adolescent period. Testis is sensitive to ischemia-reperfusion injury, and, therefore, ischemia and consecutive reperfusion cause an enhanced formation of reactive oxygen species that result in testicular cell damage and apoptosis. α-lipoic acid is a free radical scavenger and a biological antioxidant. It is widely used in the prevention of oxidative stress and cellular damage. We aimed to investigate the protective effect of α-lipoic acid on testicular damage in rats subjected to testicular ischemia-reperfusion injury. 35 rats were randomly divided into 5 groups: control, sham operated, ischemia, ischemia-reperfusion, and ischemia-reperfusion +lipoic acid groups, 2 h torsion and 2 h detorsion of the testis were performed. Testicular cell damage was examined by H-E staining. TUNEL and active caspase-3 immunostaining were used to detect germ cell apoptosis. GPx , SOD activity, and MDA levels were evaluated. Histological evaluation showed that α-lipoic acid pretreatment reduced testicular cell damage and decreased TUNEL and caspase-3-positive cells. Additionally, α-lipoic acid administration decreased the GPx and SOD activity and increased the MDA levels. The present results suggest that LA is a potentially beneficial agent in protecting testicular I/R in rats. PMID:23193380

  12. α-Lipoic acid as a triglyceride-lowering nutraceutical.

    PubMed

    Pashaj, Anjeza; Xia, Mengna; Moreau, Régis

    2015-12-01

    Considering the current obesity epidemic in the United States (>100 million adults are overweight or obese), the prevalence of hypertriglyceridemia is likely to grow beyond present statistics of ∼30% of the population. Conventional therapies for managing hypertriglyceridemia include lifestyle modifications such as diet and exercise, pharmacological approaches, and nutritional supplements. It is critically important to identify new strategies that would be safe and effective in lowering hypertriglyceridemia. α-Lipoic acid (LA) is a naturally occurring enzyme cofactor found in the human body in small quantities. A growing body of evidence indicates a role of LA in ameliorating metabolic dysfunction and lipid anomalies primarily in animals. Limited human studies suggest LA is most efficacious in situations where blood triglycerides are markedly elevated. LA is commercially available as dietary supplements and is clinically shown to be safe and effective against diabetic polyneuropathies. LA is described as a potent biological antioxidant, a detoxification agent, and a diabetes medicine. Given its strong safety record, LA may be a useful nutraceutical, either alone or in combination with other lipid-lowering strategies, when treating severe hypertriglyceridemia and diabetic dyslipidemia. This review examines the current evidence regarding the use of LA as a means of normalizing blood triglycerides. Also presented are the leading mechanisms of action of LA on triglyceride metabolism. PMID:26235242

  13. Impact evaluation of α-lipoic acid in gamma-irradiated erythrocytes

    NASA Astrophysics Data System (ADS)

    Desouky, Omar S.; Selim, Nabila S.; Elbakrawy, Eman M.; Rezk, Rezk A.

    2011-03-01

    This work is intended to study in vitro the ability of lipoic acid to protect erythrocytes against the oxidative damage resulting from exposure to gamma radiation through measurement of their rheological properties and to study the effects of detergent on their membrane solubility and permeability. Different doses of gamma radiation were applied: the most recommended and applied dose (25 Gy), and two higher doses, namely 50 and 100 Gy. The effect of addition of lipoic acid as well as its effect as a radioprotector was tested. The obtained results show changes in structural integrity of the erythrocyte cell membrane components as a result of oxidative damage due to gamma radiation that could be improved by pre-treatment with the antioxidant lipoic acid.

  14. Treatment of carpal tunnel syndrome with alpha-lipoic acid.

    PubMed

    Di Geronimo, G; Caccese, A Fonzone; Caruso, L; Soldati, A; Passaretti, U

    2009-01-01

    Carpal Tunnel Syndrome (CTS) is the most common peripheral mononeuropathy; its symptoms and functional limitations significantly penalize the daily activities and quality of life of many people. While surgery is reserved to most severe cases, the earlier stages of disease may be controlled by a pharmacological treatment aimed to "neuroprotection", i.e. to limiting and correcting the nerve damage. Our study was aimed to compare the efficacy of a fixed association of alpha-lipoic acid (ALA) 600 mg/die and gamma-linolenic acid (GLA) 360 mg/die, and a multivitamin B preparation (Vit B6 150 mg, Vit B1 100 mg, Vit B12 500 microg daily) for 90 days in 112 subjects with moderately severe CTS. Demographic, case-history and treatment efficacy data were collected; the Boston questionnaire was administered and the patients were evaluated by Hi-Ob scale and electro-myography. A significant reduction in both symptoms scores and functional impairment (Boston questionnaire) was observed in ALA/GLA group, while the multivitamin group experienced a slight improvement of symptoms and a deterioration of functional scores. Electromyography showed a statistically significant improvement with ALA/GLA, but not with the multivitamin product. The Hi-Ob scale showed significant efficacy of ALA/GLA in improving symptoms and functional impairment, while in the multivitamin group the improvement was significant, but less marked than in the ALA/GLA group. In conclusion, the fixed association of ALA and GLA proved to be a useful tool and may be proposed for controlling symptoms and improving the evolution of CTS, especially in the earlier stages of disease. PMID:19499849

  15. Electrooxidation of pyrrole-terminated self-assembled lipoic acid derivatives

    NASA Astrophysics Data System (ADS)

    Cabrita, Joana F.; Viana, Ana S.; Eberle, Christoph; Montforts, Franz-Peter; Mourato, Ana; Abrantes, Luisa M.

    2009-08-01

    New pyrrole derivatives, pyrrolyl lipoic acid (Py-LA 3) and dipyrrolyl lipoic acid (Py 2-LA 2) have been used for surface attachment and immobilisation on gold surfaces, by self-assembly. The electrooxidation of the surface-confined pyrroles was analysed by cyclic voltammetry and the modified electrodes morphological and thickness changes addressed by scanning probe microscopy and ellipsometry. The data support the formation of oligomers as a result of the pendant-pyrrolyl units ease oxidation but provide no evidence of an effective subsequent polymerisation.

  16. Wheat germ oil and α-lipoic acid predominantly improve the lipid profile of broiler meat.

    PubMed

    Arshad, Muhammad Sajid; Anjum, Faqir Muhammad; Khan, Muhammad Issa; Shahid, Muhammad

    2013-11-20

    In response to recent assertions that synthetic antioxidants may have the potential to cause toxic effects and to consumers' increased attention to consuming natural products, the poultry industry has been seeking sources of natural antioxidants, alone or in combination with synthetic antioxidants that are currently being used by the industry. The present study was conducted to determine the effect of α-lipoic acid, α-tocopherol, and wheat germ oil on the status of antioxidant enzymes, fatty acid profile, and serum biochemical profile of broiler blood. One-day-old (180) broiler birds were fed six different feeds varying in their antioxidant content: no addition (T1), natural α-tocopherol (wheat germ oil, T2), synthetic α-tocopherol (T3), α-lipoic acid (T4), α-lipoic acid together with natural α-tocopherol (T5), and α-lipoic acid together with synthetic α-tocopherol (T6). The composition of saturated and unsaturated fatty acids in the breast and leg meat was positively influenced by the different dietary supplements. The content of fatty acid was significantly greater in broilers receiving T2 both in breast (23.92%) and in leg (25.82%) meat, whereas lower fatty acid levels was found in broilers receiving diets containing T6 in the breast (19.57%) and leg (21.30%) meat. Serum total cholesterol (113.42 mg/dL) and triglycerides (52.29 mg/dL) were lowest in the group given natural α-tocopherol and α-lipoic acid. Wheat germ oil containing natural α-tocopherol alone or with α-lipoic acid was more effective than synthetic α-tocopherol in raising levels of antioxidant enzymes superoxide dismutase, catalase, and glutathione reductase while lowering plasma total cholesterol, low-density lipoprotein, and triglycerides and raising high-density lipoprotein and plasma protein significantly. It was concluded that the combination of wheat germ oil and α-lipoic acid is helpful in improving the lipid profile of broilers. PMID:24191686

  17. Comparison of the Protective Effects of Radix Astragali, α-Lipoic Acid, and Vitamin E on Acute Acoustic Trauma

    PubMed Central

    Xiong, Min; Lai, Huangwen; Yang, Chuanhong; Huang, Weiyi; Wang, Jian; Fu, Xiaoyan; He, Qinglian

    2012-01-01

    Objective Oxidative damage is a critical role which involves hearing loss induced by impulse noise. That exogenous antioxidant agents reduce noise induced hearing loss (NIHL) has been well demonstrated in both animal studies and clinical practices. Choosing a stronger and more effective antioxidant is very important for treatment of NIHL. Vitamin E, α-lipoic acid, and radix astragali are the most commonly used anti-oxidants for cochlear oxidative damage from acoustic trauma. In this study, the protective effects of radix astragali, α-lipoic acid, and vitamin E on acute acoustic trauma are investigated. Methods Guinea pigs in the experimental groups were intragastrically administered vitamin E, α-lipoic acid, and radix astragali. Auditory thresholds were assessed by sound-evoked auditory brainstem response (ABR) at click and tone bursts of 8, 16 and 32 kHz, 24 hours before and 72 hours after exposure to impulse noise. Cochlear malondialdehyde (MDA) concentrations were detected. Hair cell damage was analyzed by scanning electron microscopy. Results Vitamin E, α-lipoic acid, and radix astragali significantly reduced ABR deficits, reduced hair cell damage, and decreased the concentrations of MDA. α-lipoic acid and radix astragali were better than vitamin E, and there were no significant differences between α-lipoic acid and radix astragali. Conclusions α-lipoic acid or radix astragali are recommended for treatment of NIHL. PMID:24179406

  18. [Use of alpha-lipoic acid and omega-3 in postpartum pain treatment].

    PubMed

    Costantino, D; Guaraldi, C; Costantino, M; Bounous, V E

    2015-10-01

    Postpartum pain is a frequent condition that negatively affects women's quality of life, interferring with everyday life. Analgesic drugs and surgery are often contraindicated in pregnancy and during breast feeding. This review of the literature aims to evaluate the rational of the association of lipoic acid and omega-3 employ in the management of postpartum pain. Lipoic acid is a cofactor essential in mitochondrial metabolism with antioxidant and anti-inflammatory activity. Lipoic acid has been shown to be effective in neuropatic pain treatment in patients with sciatica, carpal tunnel syndrome and diabetic neuropathy. Omega-3 are known for their anti-inflammatory and neurotrophic activity. The peripheral and central activity of both substances allows to act on neuroinflammation mechanisms thus reducing cronicization of pain and also determining a potential improvement of women's emotional status. The preliminary data here presented confirm the positive effect of this association on the treatment of postpartum perineal pain. The supplementation of lipoic acid in association with omega-3 seems effective and safe for the treatment of chronic postpartum pain, allowing a pathogenetic approach to neuroinflammation, thus reducing the consumption of analgesic drugs, often contraindicated during breast-feeding. PMID:26491825

  19. Oxidative modification of lipoic acid by HNE in Alzheimer disease brain☆

    PubMed Central

    Hardas, Sarita S.; Sultana, Rukhsana; Clark, Amy M.; Beckett, Tina L.; Szweda, Luke I.; Murphy, M. Paul; Butterfield, D. Allan

    2013-01-01

    Alzheimer disease (AD) is an age-related neurodegenerative disease characterized by the presence of three pathological hallmarks: synapse loss, extracellular senile plaques (SP) and intracellular neurofibrillary tangles (NFTs). The major component of SP is amyloid β-peptide (Aβ), which has been shown to induce oxidative stress. The AD brain shows increased levels of lipid peroxidation products, including 4-hydroxy-2-nonenal (HNE). HNE can react covalently with Cys, His, or Lys residues on proteins, altering structure and function of the latter. In the present study we measured the levels of the HNE-modified lipoic acid in brain of subjects with AD and age-matched controls. Lipoic acid is a key co-factor for a number of proteins including pyruvate dehydrogenase and α-ketoglutarate dehydrogenase, key complexes for cellular energetics. We observed a significant decrease in the levels of HNE-lipoic acid in the AD brain compared to that of age-matched controls. To investigate this phenomenon further, the levels and activity of lipoamide dehydrogenase (LADH) were measured in AD and control brains. Additionally, LADH activities were measured after in-vitro HNE-treatment to mice brains. Both LADH levels and activities were found to be significantly reduced in AD brain compared to age-matched control. HNE-treatment also reduced the LADH activity in mice brain. These data are consistent with a two-hit hypothesis of AD: oxidative stress leads to lipid peroxidation that, in turn, causes oxidative dysfunction of key energy-related complexes in mitochondria, triggering neurodegeneration. This study is consonant with the notion that lipoic acid supplementation could be a potential treatment for the observed loss of cellular energetics in AD and potentiate the antioxidant defense system to prevent or delay the oxidative stress in and progression of this devastating dementing disorder. PMID:24024140

  20. Effect of alpha-lipoic acid on boar spermatozoa quality during freezing-thawing

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Alpha-lipoic acid (ALA) is known as a natural antioxidant. The aim of the present study was to evaluate the cryoprotective effect of ALA on the motility of boar sperm and the antioxidant effect of ALA on boar sperm during freezing-thawing. Different concentrations (2.0, 4.0, 6.0, 8.0, and 10.0, mg/m...

  1. Lipid Lowering Effect of Antioxidant Alpha-Lipoic Acid in Experimental Atherosclerosis

    PubMed Central

    Amom, Zulkhairi; Zakaria, Zaiton; Mohamed, Jamaluddin; Azlan, Azrina; Bahari, Hasnah; Taufik Hidayat Baharuldin, Mohd; Aris Moklas, Mohd; Osman, Khairul; Asmawi, Zanariyah; Kamal Nik Hassan, Mohd

    2008-01-01

    Accumulating data demonstrated that hypercholesterolemia and oxidative stress play an important role in the development of atherosclerosis. In the present study, a protective activity of alpha-lipoic acid; a metabolic antioxidant in hypercholesterolemic-induced animals was investigated. Eighteen adult male New Zealand White (NZW) rabbit were segregated into three groups labelled as group N, HCD and ALA (n = 6). Group N (normal control) was fed with normal chow, the rest (HCD and ALA) were fed with 100 g/head/day of 1% cholesterol rich diet to induce hypercholesterolemia. Four point two mg/body weight of alpha lipoic acid was concomintantly supplemented to the ALA group. Drinking water was given ad-libitum. The study was designed for 10 weeks. Blood sampling was taken from the ear lobe vein at the beginning, week 5 and week 10. Plasma was prepared for lipid profile estimation and microsomal lipid peroxidation index indicated with malondialdehyde (MDA) formation. At the end of the experiment, the animals were sacrificed and the aorta were excised for intimal lesion analysis. The plasma total cholesterol (TC) and low density lipoprotein (LDL) levels were found to be significantly low in ALA group compared to that of the HCD group (p<0.05). Similarly, low level of MDA (p<0.05) in ALA group was observed compared to that of the HCD group showing a significant reduction of lipid peroxidation activity. Histomorphometric intimal lesion analysis of the aorta showing less of atheromatous plaque formation in alpha lipoic acid supplemented group (p<0.05) compared to HCD group. These findings suggested that alpha lipoic acid posses a dual lipid lowering and anti-atherosclerotic properties indicated with low plasma TC and LDL levels and reduction of athero-lesion formation in hypercholesterolemic-induced rabbits. PMID:18818758

  2. Alpha-lipoic acid loaded in chitosan conduit enhances sciatic nerve regeneration in rat

    PubMed Central

    Azizi, Saeed; Heshmatian, Behnam; Amini, Keyvan; Raisi, Abbas; Azimzadeh, Mohammad

    2015-01-01

    Objective(s): To investigate the effect of topical administration of alpha-lipoic acid into chitosan conduit on peripheral nerve regeneration using a rat sciatic nerve transection model. Materials and Methods: Forty five Wistar rats were divided into three experimental groups randomly. A 10-mm gap of sciatic nerve was bridged with a chitosan conduit following surgical preparation and anesthesia. In treatment group, the conduit was filled with 30 µl alpha-lipoic acid (10 mg/kg/bw).It was filled with 30 µl phosphate buffered saline solution in control group. In Sham group sciatic nerve was just exposed. Results: The recovery of nerve function was faster in treatment group than in control, at 4 and 8 weeks after surgery (P-value<0.05). Conduction velocity was better in treatment group than in control group at 4 and 12 weeks (P-value<0.05). Recovery index was higher in treatment group than the control group, 8 weeks after surgery (P-value <0.05). Greater nerve fiber diameter, axon diameter, and myelin sheath thickness were observed in treatment group compared to control group at 8 and 12 weeks after surgery (P-value<0.05). The immunoreactivity of regenerated axons and myelin sheath in treatment group were far more similar to sham group. Conclusion: Alpha-lipoic acid when loaded in a chitosan conduit could improve transected sciatic nerve regeneration in rat. PMID:25945234

  3. Investigation of Enantioselective Membrane Permeability of α-Lipoic Acid in Caco-2 and MDCKII Cell.

    PubMed

    Uchida, Ryota; Okamoto, Hinako; Ikuta, Naoko; Terao, Keiji; Hirota, Takashi

    2016-01-01

    α-Lipoic acid (LA) contains a chiral carbon and exists as two enantiomers (R-α-lipoic acid (RLA) and S-α-lipoic acid (SLA)). We previously demonstrated that oral bioavailability of RLA is better than that of SLA. This difference arose from the fraction absorbed multiplied by gastrointestinal availability (F(a) × F(g)) and hepatic availability (F(h)) in the absorption phase. However, it remains unclear whether F(a) and/or F(g) are involved in enantioselectivity. In this study, Caco-2 cells and Madin-Darby canine kidney strain II cells were used to assess the enantioselectivity of membrane permeability. LA was actively transported from the apical side to basal side, regardless of the differences in its steric structure. Permeability rates were proportionally increased in the range of 10-250 µg LA/mL, and the permeability coefficient did not differ significantly between enantiomers. Hence, we conclude that enantioselective pharmacokinetics arose from the metabolism (F(h) or F(g) × F(h)), and definitely not from the membrane permeation (F(a)) in the absorption phase. PMID:26821014

  4. Alpha-lipoic acid as a pleiotropic compound with potential therapeutic use in diabetes and other chronic diseases.

    PubMed

    Gomes, Marilia Brito; Negrato, Carlos Antonio

    2014-01-01

    Alpha-lipoic acid is a naturally occurring substance, essential for the function of different enzymes that take part in mitochondria's oxidative metabolism. It is believed that alpha-lipoic acid or its reduced form, dihydrolipoic acid have many biochemical functions acting as biological antioxidants, as metal chelators, reducers of the oxidized forms of other antioxidant agents such as vitamin C and E, and modulator of the signaling transduction of several pathways. These above-mentioned actions have been shown in experimental studies emphasizing the use of alpha-lipoic acid as a potential therapeutic agent for many chronic diseases with great epidemiological as well economic and social impact such as brain diseases and cognitive dysfunctions like Alzheimer disease, obesity, nonalcoholic fatty liver disease, burning mouth syndrome, cardiovascular disease, hypertension, some types of cancer, glaucoma and osteoporosis. Many conflicting data have been found concerning the clinical use of alpha-lipoic acid in the treatment of diabetes and of diabetes-related chronic complications such as retinopathy, nephropathy, neuropathy, wound healing and diabetic cardiovascular autonomic neuropathy. The most frequent clinical condition in which alpha-lipoic acid has been studied was in the management of diabetic peripheral neuropathy in patients with type 1 as well type 2 diabetes. Considering that oxidative stress, a imbalance between pro and antioxidants with excessive production of reactive oxygen species, is a factor in the development of many diseases and that alpha-lipoic acid, a natural thiol antioxidant, has been shown to have beneficial effects on oxidative stress parameters in various tissues we wrote this article in order to make an up-to-date review of current thinking regarding alpha-lipoic acid and its use as an antioxidant drug therapy for a myriad of diseases that could have potential benefits from its use. PMID:25104975

  5. Inhibition of Pseudomonas aeruginosa biofilm formation by 2,2’-bipyridyl, lipoic, kojic and picolinic acids

    PubMed Central

    Çevik, Kübra; Ulusoy, Seyhan

    2015-01-01

    Objective(s): The inhibitory effects of iron chelators, and FeCl3 chelation on biofilm formation and swarming motility were investigated against an opportunistic human pathogen Pseudomonas aeruginosa. Materials and Methods: The inhibitory activity of 2,2’-bipyridyl, lipoic acid, kojic acid and picolinic acid on biofilm formation of P. aeruginosa strain PAO1 and three clinical isolates (P. aeruginosa PAK01, P. aeruginosa PAK02 and P. aeruginosa PAK03) were investigated, based on crystal violet assay, and swarming motility test. Results: The kojic, lipoic and picolinic acid inhibited biofilm formation by 5-33% in all tested P. aeruginosa isolates. When chelated iron was added, biofilm inhibition rates were determined to be 39-57%. Among the tested chelators against P. aeruginosa, lipoic acid (84%) and kojic acid (68%) presented the highest inhibition of swarming motility. This is the first study to report the inhibitory effect of lipoic acid on biofilm formation and swarming motility of P. aeruginosa. Conclusion: It is considered that lipoic and picolinic acids can serve as alternatives for the treatment of the P. aeruginosa infections by inhibiting biofilm formation. PMID:26557964

  6. Prevention of chromate induced oxidative stress by alpha-lipoic acid.

    PubMed

    Budhwar, Roli; Kumar, Sushil

    2005-06-01

    The parenteral administration of alpha-lipoic acid (LA) protected against chromate induced oxidative stress in mouse liver. A shift in Cr induced pro-oxidant state to antioxidant-state by LA was noteworthy. The degree of protection was significant and similar in different LA administration regimens (prior-, co- and post- parenteral Cr exposure) explored. An improved status of the tissue antioxidants by LA appeared to be the mechanism of mitigation. The results are of chemopreventive value and suggest a possible alternative to ascorbic acid for abrogation of Cr toxicity. PMID:15997482

  7. The effect of biothiol on UV irradiated alpha-lipoic acid.

    PubMed

    Wada, Naoki; Wakami, Hirotaka; Konishi, Tetsuya; Matsugo, Seiichi

    2008-01-01

    alpha-Lipoic acid (LA) and its reduced form dihydrolipoic acid (DHLA) are well known as strong antioxidants. LA has the characteristic distorted five membered 1,2-dithiolane ring, which is quite vulnerable to UV irradiation. The UV induced decomposition of LA and the effect of the following addition of biothiols to the photoirradiated solution of LA were investigated by UV-vis spectrometry and (1)H NMR spectral analysis. The mechanism of UV irradiated LA decomposition was proposed based on the results obtained from NMR and GPC measurements. PMID:19850983

  8. Lipoic acid and dihydrolipoic acid. A comprehensive theoretical study of their antioxidant activity supported by available experimental kinetic data.

    PubMed

    Castañeda-Arriaga, Romina; Alvarez-Idaboy, J Raul

    2014-06-23

    The free radical scavenging activity of lipoic acid (LA) and dihydrolipoic acid (DHLA) has been studied in nonpolar and aqueous solutions, using the density functional theory and several oxygen centered radicals. It was found that lipoic acid is capable of scavenging only very reactive radicals, while the dehydrogenated form is an excellent scavenger via a hydrogen transfer mechanism. The environment plays an important role in the free radical scavenging activity of DHLA because in water it is deprotonated, and this enhances its activity. In particular, the reaction rate constant of DHLA in water with an HOO(•) radical is close to the diffusion limit. This has been explained on the basis of the strong H-bonding interactions found in the transition state, which involve the carboxylate moiety, and it might have implications for other biological systems in which this group is present. PMID:24881907

  9. Synthesis, pulse radiolysis, and in vitro radioprotection studies of melatoninolipoamide, a novel conjugate of melatonin and alpha-lipoic acid.

    PubMed

    Venkatachalam, S R; Salaskar, A; Chattopadhyay, A; Barik, A; Mishra, B; Gangabhagirathi, R; Priyadarsini, K I

    2006-09-15

    A novel conjugate of melatonin 2 and alpha-lipoic acid 4 has been prepared using DCC mediated coupling. The conjugate named melatoninolipoamide has been assigned its structure 1 on the basis of spectral analysis (UV, IR, NMR, and EI-MS). Pulse radiolysis studies of the conjugate were carried out in aqueous solutions with both oxidizing and reducing radicals. The results indicate that the melatonin moiety of the conjugate reacts preferably with oxidizing radicals and the lipoic acid moiety exhibits preferential reaction with reducing radicals. The in vitro radioprotection ability of 1 was examined by gamma-radiation induced lipid peroxidation in liposomes and hemolysis of erythrocytes, and compared the results with those of melatonin and alpha-lipoic acid. The studies suggest that the conjugate can be explored as a probable radioprotector. PMID:16766192

  10. CUTANEOUS DELIVERY OF α-TOCOPHEROL AND LIPOIC ACID USING MICROEMULSIONS: INFLUENCE OF COMPOSITION AND CHARGE

    PubMed Central

    Cichewicz, Allie; Pacleb, Chelsea; Connors, Ashley; Hass, Martha A.; Lopes, Luciana B.

    2013-01-01

    Objectives To assess whether the composition and charge of microemulsions affect their ability to simultaneously deliver α-tocopherol and lipoic acid into viable skin layers. Methods α-tocopherol and lipoic acid were added (1.1 and 0.5% w/w, respectively) to decylglucoside-based microemulsions containing mono-dicaprylin. Microemulsions containing surfactant:oil:water (w/w/w) at 60:30:10 (ME-O) and 46:23:31 (ME-W), as well as a cationic form of ME-W containing 1% phytosphingosine (ME-Wphy) were characterized, and their ability to disrupt the skin barrier and deliver the antioxidants in vitro in the skin was evaluated. Antioxidant activity in ME-Wphy-treated skin was assessed using the thiobarbituric acid-reactive substances (TBARS) assay. Key findings internal phase diameters of microemulsions ranged between 47.0–53.2 nm; phytosphingosine addition and pH adjustment to 5.0 increased zeta potential from −4.3 to +29.1 mV. ME-O displayed w/o structure, whereas ME-W and ME-Wphy were consistent with o/w. Microemulsions affected skin electrical resistance and transepidermal water loss, but did not affect lipoic acid penetration. α-Tocopherol delivery increased following the order ME-O

  11. The anticonvulant effect of cooling in comparison to α-lipoic acid: a neurochemical study.

    PubMed

    Khadrawy, Yasser A; Aboulezz, Heba S; Ahmed, Nawal A; Mohammed, Haitham S

    2013-05-01

    Brain cooling has pronounced effects on seizures and epileptic activity. The aim of the present study is to evaluate the anticonvulsant effect of brain cooling on the oxidative stress and changes in Na(+), K(+)-ATPase and acetylcholinesterase (AchE) activities during status epilepticus induced by pilocarpine in the hippocampus of adult male rat in comparison with α-lipoic acid. Rats were divided into four groups: control, rats treated with pilocarpine for induction of status epilepticus, rats treated for 3 consecutive days with α-lipoic acid before pilocarpine and rats subjected to whole body cooling for 30 min before pilocarpine. The present findings indicated that pilocarine-induced status epilepticus was accompanied by a state of oxidative stress as clear from the significant increase in lipid peroxidation (MDA) and superoxide dismutase (SOD) and significant decrease in reduced glutathione and nitric oxide (NO) levels and the activities of catalase, AchE and Na(+), K(+)-ATPase. Pretreatment with α-lipoic acid ameliorated the state of oxidative stress and restored AchE to nearly control activity. However, Na(+), K(+)-ATPase activity showed a significant decrease. Rats exposed to cooling for 30 min before the induction of status epilepticus revealed significant increases in MDA and NO levels and SOD activity. AchE returned to control value while the significant decrease in Na(+), K(+)-ATPase persisted. The present data suggest that cooling may have an anticonvulsant effect which may be mediated by the elevated NO level. However, brain cooling may have drastic unwanted insults such as oxidative stress and the decrease in Na(+), K(+)-ATPase activity. PMID:23389664

  12. Lipoic acid reduces inflammation in a mouse focal cortical experimental autoimmune encephalomyelitis model.

    PubMed

    Chaudhary, Priya; Marracci, Gail; Galipeau, Danielle; Pocius, Edvinas; Morris, Brooke; Bourdette, Dennis

    2015-12-15

    Cortical lesions are a crucial part of MS pathology and it is critical to determine that new MS therapies have the ability to alter cortical inflammatory lesions given the differences between white and gray matter lesions. We tested lipoic acid (LA) in a mouse focal cortical EAE model. Brain sections were stained with antibodies against CD4, CD11b and galectin-3. Compared with vehicle, treatment with LA significantly decreased CD4+ and galectin-3+ immune cells in the brain. LA treated mice had fewer galectin-3+ cells with no projections indicating decrease in the number of infiltrating monocytes. LA significantly reduces inflammation in a focal cortical model of MS. PMID:26616873

  13. Synthesis and effects of 3-methylthiopropanoyl thiolesters of lipoic acid, methional metabolite mimics.

    PubMed

    Courvoisier, Celine; Paret, Marie Julie; Chantepie, Jacqueline; Goré, Jacques; Fournet, Guy; Quash, Gerard

    2006-02-01

    6S,8S-Bis(3-methylthiopropanoyl) thiolesters of lipoic acid were synthesized with the carboxyl moiety of lipoate modified as methyl or water soluble choline esters. Evaluation on different cell lines in culture showed that they possessed modest antiproliferative activity. However, the 6-fold decrease in IC50 (from 270 to 45 microM) observed with the water soluble 6S,8S-bis(3-methylthiopropenoyl) thiolester dehydro derivative on a human epithelial prostate cancer cell line (DU145) argues in favor of 3-methylthiopropanoyl metabolites as endogenous growth regulatory (apoptogenic) compounds derived from methionine. PMID:16387348

  14. Pro-oxidant actions of alpha-lipoic acid and dihydrolipoic acid.

    PubMed

    Cakatay, Ufuk

    2006-01-01

    There is strong accumulating evidence that a alpha-lipoic acid (LA) supplement is good insurance, and would markedly improve human health. LA is readily absorbed from the diet, transported to cells and reduced to dihydrolipoic acid (DHLA). Of the two compounds, DHLA evidently has greater antioxidant activity. Much research has focused on the antioxidant properties of these compounds. Aside from its antioxidant role, in vitro and in vivo studies suggest that LA and its reduced form DHLA also act as a pro-oxidant properties. Limited number of studies concerning the pro-oxidant potential of LA and DHLA were performed only in recent years. The ability of LA and/or DHLA to function as either anti- or pro-oxidants, at least in part, is determined by the type of oxidant stress and the physiological circumstances. These pro-oxidant actions suggest that LA and DHLA act by multiple mechanisms, many of which are only now being explored. LA has been reported to have a number of potentially beneficial effects in both prevention and treatment of oxygen-related diseases. Selection of appropriate pharmacological doses of LA for use in oxygen-related diseases is critical. On the other hand, much of the discussion in clinical studies has been devoted to the pro-oxidant role of LA. This aspect remains to be elucidated. In further studies, careful evaluation will be necessary for the decision in the biological system whether LA administration is beneficial or harmful. PMID:16165311

  15. Physiological and Histopathological Investigations on the Effects of α-Lipoic Acid in Rats Exposed to Malathion

    PubMed Central

    Al-Attar, Atef M.

    2010-01-01

    The present study was designed to evaluate the influence of α-lipoic acid treatment in rats exposed to malathion. Forty adult male rats were used in this study and distributed into four groups. Animals of group 1 were untreated and served as control. Rats of group 2 were orally given malathion at a dose level of 100 mg/kg body weight (BW) for a period of one month. Experimental animals of group 3 were orally given α-lipoic acid at a dose level of 20 mg/kg BW and after 3 hours exposed to malathion at the same dose given to group 2. Rats of group 4 were supplemented with α-lipoic acid at the same dose given to group 3. The activities of serum glutamic oxaloacetic acid transaminase (GOT), glutamic pyruvic acid transaminase (GPT), alkaline phosphatase (ALP), and acid phosphatase (ACP), and the values of creatinine, urea, and uric acid were statistically increased, while the values of total protein and total albumin were significantly decreased in rats exposed to malathion. Moreover, administration of malathion for one month resulted in damage of liver and kidney structures. Administration of α-lipoic acid before malathion exposure to rat can prevent severe alterations of hematobiochemical parameters and disruptions of liver and kidney structures. In conclusion, this study obviously demonstrated that pretreatment with α-lipoic acid significantly attenuated the physiological and histopathological alterations induced by malathion. Also, the present study identifies new areas of research for development of better therapeutic agents for liver, kidney, and other organs' dysfunctions and diseases. PMID:20454535

  16. Alpha lipoic acid efficacy in burning mouth syndrome. A controlled clinical trial

    PubMed Central

    Palacios-Sánchez, Begoña; Cerero-Lapiedra, Rocío; Llamas-Martínez, Silvia; Esparza-Gómez, Germán

    2015-01-01

    Background A double-blind placebo-controlled trial was conducted in order to evaluate the efficacy of alpha lipoic acid (ALA) and determine the statistical significance of the outcome variables. Burning mouth syndrome (BMS) is defined as an oral burning sensation in the absence of clinical signs which could justify the syndrome. Recent studies suggest the existence of neurological factors as a possible cause of the disease. Material and Methods 60 patients with BMS, in two groups: case group with 600 mg/day and placebo as control group; with follow up of 2 months. Results 64% of ALA patients reported some level of improvement, with a level of maintenance of 68.75% one month after treatment. 27.6% of the placebo group also demonstrated some reduction in BMS symptoms. Conclusions Long-term evolution and the intensity of symptoms are variables that reduce the probability of improvement with ALA treatment. Key words: Burning mouth syndrome, neuropathy, alpha lipoic acid. PMID:26034927

  17. Preparation of aqueous alpha-lipoic acid dispersions with octenylsuccinylated high amylose starch.

    PubMed

    Li, Yi-Xuan; Lim, Seung-Taik

    2016-04-20

    Aqueous dispersions prepared with OSA-modified high amylose starch were investigated in comparison with native high amylose starch and beta-cyclodextrin using alpha-lipoic acid as a model substance. Alpha-lipoic acid (ALA), a lipophilic antioxidant essential for energy metabolism in human, was dispersed in gelatinized starch solutions (1.0% w/v) at different temperatures (50-90°C) and times (3-12h). High amylose starch modified with 3% OSA (dry starch base) was most favored in maximizing the dispersibility of ALA (84% recovery) under mild heating (70°C for 3h). The optimally prepared dispersion was milky white and contained particles with a narrow size distribution (200-300nm). The precipitate isolated from the dispersion contained crystalline V-complexes of ALA and amylose while the supernatant contained free ALA accounting for 1/3 of total ALA, indicating OSA-modified high amylose starch stabilized ALA either by complexing with amylose or by retarding aggregation of ALA. PMID:26876852

  18. Direct and indirect antioxidant properties of α-lipoic acid and therapeutic potential.

    PubMed

    Rochette, Luc; Ghibu, Stéliana; Richard, Carole; Zeller, Marianne; Cottin, Yves; Vergely, Catherine

    2013-01-01

    Diabetes has emerged as a major threat to worldwide health. The exact mechanisms underlying the disease are unknown; however, there is growing evidence that the excess generation of reactive oxygen species (ROS) associated with hyperglycemia, causes oxidative stress in a variety of tissues. In this context, various natural compounds with pleiotropic actions like α-lipoic acid (LA) are of interest, especially in metabolic diseases such as diabetes. LA, either as a dietary supplement or a therapeutic agent, modulates redox potential because of its ability to match the redox status between different subcellular compartments as well as extracellularly. Both the oxidized (disulfide) and reduced (di-thiol: dihydro-lipoic acid, DHLA) forms of LA show antioxidant properties. LA exerts antioxidant effects in biological systems through ROS quenching but also via an action on transition metal chelation. Dietary supplementation with LA has been successfully employed in a variety of in vivo models of disease associated with an imbalance of redox status: diabetes and cardiovascular diseases. The complex and intimate association between increased oxidative stress and increased inflammation in related disorders such as diabetes, makes it difficult to establish the temporal sequence of the relationship. PMID:23293044

  19. Redox homeostasis of albumin in relation to alpha-lipoic acid and dihydrolipoic acid.

    PubMed

    Atukeren, Pinar; Aydin, Seval; Uslu, Ezel; Gumustas, M Koray; Cakatay, Ufuk

    2010-01-01

    Albumin represents the predominant circulating antioxidant agent in plasma exposed to continuous oxidative stress and a change in serum albumin structure accounts for its antioxidant properties. Alterations in the redox status of albumin may result in impairments of its biological properties. Alpha-lipoic acid (LA), a naturally occurring thiol compound found in virtually all species, is a potent antioxidant with high efficacy which is also involved in the chelation of metal ions, regeneration of antioxidants, and repair of oxidatively damaged proteins. In human body LA is rapidly reduced to dihydrolipoic acid (DHLA) after intake into the cell. Both, LA and DHLA are amphipathic molecules which act as antioxidants both in hydrophilic and lipophilic environments. The present study aimed to investigate the antioxidant/pro-oxidant effects of LA and DHLA due to their concentrations in metal-catalyzed protein oxidation (MCO) of human serum albumin (HSA). Progressive oxidative modification of albumin was found in MCO system by an increased content of protein hydroperoxides (POOH), protein carbonyl groups (PCO) which is the former's major breakdown product, and other protein oxidation markers such as advanced oxidized protein products (AOPP) and protein thiol groups (P-SH). The possible antioxidant protective effects of LA and DHLA were observed with 25 microM and 50 microM; DHLA being more influential. Protein oxidation parameters were found to be lower and P-SH levels seemed higher. However, prooxidant effects of both LA and DHLA came on the scene with increased concentrations of 75 microM and 100 microM where the latter seemed the most hazardous with contradicted results. It is clear that the loss of biological activity of human serum albumin by MCO system appears of medical relevance and if LA exerts similar effects seen in the present study, it is possible that cellular prooxidant activity can also result consuming this unique antioxidant in certain doses. PMID

  20. A combination of alpha lipoic acid and calcium hydroxycitrate is efficient against mouse cancer models: preliminary results.

    PubMed

    Schwartz, Laurent; Abolhassani, Mohammad; Guais, Adeline; Sanders, Edward; Steyaert, Jean-Marc; Campion, Frederic; Israël, Maurice

    2010-05-01

    The impact of metabolic dysregulation on tumor development has long been established. We have targeted two enzymes that are altered during carcinogenesis: pyruvate dehydrogenase (PDH), which is down-regulated, and ATP citrate lyase, which is overexpressed in cancer cells. Alpha lipoic acid is a cofactor of PDH, while hydroxycitrate is a known inhibitor of ATP citrate lyase. Our hypothesis is that a combination of these drugs may have antitumoral potential. The efficacy of these molecules was screened in vitro by treatment of different human cancer and murine cell lines. Lipoic acid reduced the cell number by 10-50% depending on concentrations (0.1-10 microM) and cell types. Calcium hydroxycitrate reduced the cell number by 5-60% at different concentrations (10-500 microM). When hydroxycitrate and lipoic acid were used together, there was a major cytotoxic effect: complete cell death was seen following 8 microM lipoic acid and 300 microM hydroxycitrate treatment for 72 h. The combination of alpha lipoic acid and hydroxycitrate was administered to healthy mice, at doses currently utilized for other indications than cancer; no demonstrable toxicity was observed. The combination was used to treat mouse syngenic cancer models: MBT-2 bladder transitional cell carcinoma, B16-F10 melanoma and LL/2 Lewis lung carcinoma. The efficacy of this combination appears similar to conventional chemotherapy (cisplatin or 5-fluorouracil) as it resulted in significant tumor growth retardation and enhanced survival. This preliminary study suggests that this combination of drugs is efficient against cancer cell proliferation both in vitro and in vivo. A clinical trial is warranted. PMID:20372858

  1. Grafting of 4-aminomethylbenzensulfonamide-lipoic acid conjugate on gold nanoparticles

    NASA Astrophysics Data System (ADS)

    Stiti, M.; Bouzit, H.; Abdaoui, M.; Winum, J. Y.

    2012-02-01

    In this paper, we describe the synthesis of goldnanoparticles bearing aminomethylbenzensulfonamide via a lipoyl moiety. The resulting stable nanoparticles with an average size of 4.0 nm have been achieved by a facile and high-yielding one phase method, by the action of 4-aminomethylbenzensulfonamide-lipoic acid bioconjugate on chloroauric acide, using dimethylsulfoxide (DMSO) as the solvent and sodium tetrahydridoborate (NaBH4) as the reducing agent. UV-vis absorption, transmission electron microscopy (TEM) and X-ray diffraction were used to analyse the morphology and the structure of the obtained nanoparticles. Preliminary study shows that these new nanoparticles are endowed with highly and specific inhibitory activity for the isoform (IX) of carbonic anhydrase over expressed in many cancers, and are therefore attractive candidate to be used both in diagnosis and in treatment of tumours.

  2. The photochemistry of lipoic acid: photoionization and observation of a triplet excited state of a disulfide.

    PubMed

    Bucher, Götz; Lu, Changyuan; Sander, Wolfram

    2005-12-01

    Under short-wavelength UV irradiation, lipoic acid (LipSS) and its reduced form, dihydrolipoic acid (DHLA), undergo photoionization processes through a bi- or monophotonic pathway. After ionization, the LipSS radical cation (LipSS*+) and radical anion (LipSS*-) are generated. LipSS*- can be converted to equimolar amounts of LipSS and DHLA through second-order decay. Triplet acetone can be quenched by LipSS and DHLA with a rate close to the diffusion-controlled limit. The mechanism was further confirmed by continuous irradiation experiments. When LipSS is directly irradiated with UVA light, the first excited triplet state of LipSS is observed, with a lifetime tau=75 ns. Characteristic reactions include triplet energy transfer to oxygen and beta-carotene and addition to isoprene. The lifetime of triplet LipSS is also shortened by addition of water and methanol. PMID:16331730

  3. Alpha-lipoic acid exhibits anti-amyloidogenicity for beta-amyloid fibrils in vitro.

    PubMed

    Ono, Kenjiro; Hirohata, Mie; Yamada, Masahito

    2006-03-24

    Inhibition of the formation of beta-amyloid fibrils (fAbeta), as well as the destabilization of preformed fAbeta in the CNS would be attractive therapeutic targets for the treatment of Alzheimer's disease (AD). Using fluorescence spectroscopic analysis with thioflavin T and electron microscopic studies, we examined the effects of alpha-lipoic acid (LA) and the metabolic product of LA, dihydrolipoic acid (DHLA), on the formation, extension, and destabilization of fAbeta at pH 7.5 at 37 degrees C in vitro. LA and DHLA dose-dependently inhibited fAbeta formation from amyloid beta-protein, as well as their extension. Moreover, they destabilized preformed fAbetas. LA and DHLA could be key molecules for the development of therapeutics for AD. PMID:16460684

  4. {alpha}-Lipoic acid exhibits anti-amyloidogenicity for {beta}-amyloid fibrils in vitro

    SciTech Connect

    Ono, Kenjiro; Hirohata, Mie; Yamada, Masahito . E-mail: m-yamada@med.kanazawa-u.ac.jp

    2006-03-24

    Inhibition of the formation of {beta}-amyloid fibrils (fA{beta}), as well as the destabilization of preformed fA{beta} in the CNS would be attractive therapeutic targets for the treatment of Alzheimer's disease (AD). Using fluorescence spectroscopic analysis with thioflavin T and electron microscopic studies, we examined the effects of {alpha}-lipoic acid (LA) and the metabolic product of LA, dihydrolipoic acid (DHLA), on the formation, extension, and destabilization of fA{beta} at pH 7.5 at 37 {sup o}C in vitro. LA and DHLA dose-dependently inhibited fA{beta} formation from amyloid {beta}-protein, as well as their extension. Moreover, they destabilized preformed fA{beta}s. LA and DHLA could be key molecules for the development of therapeutics for AD.

  5. Assembly of Lipoic Acid on Its Cognate Enzymes: an Extraordinary and Essential Biosynthetic Pathway.

    PubMed

    Cronan, John E

    2016-06-01

    Although the structure of lipoic acid and its role in bacterial metabolism were clear over 50 years ago, it is only in the past decade that the pathways of biosynthesis of this universally conserved cofactor have become understood. Unlike most cofactors, lipoic acid must be covalently bound to its cognate enzyme proteins (the 2-oxoacid dehydrogenases and the glycine cleavage system) in order to function in central metabolism. Indeed, the cofactor is assembled on its cognate proteins rather than being assembled and subsequently attached as in the typical pathway, like that of biotin attachment. The first lipoate biosynthetic pathway determined was that of Escherichia coli, which utilizes two enzymes to form the active lipoylated protein from a fatty acid biosynthetic intermediate. Recently, a more complex pathway requiring four proteins was discovered in Bacillus subtilis, which is probably an evolutionary relic. This pathway requires the H protein of the glycine cleavage system of single-carbon metabolism to form active (lipoyl) 2-oxoacid dehydrogenases. The bacterial pathways inform the lipoate pathways of eukaryotic organisms. Plants use the E. coli pathway, whereas mammals and fungi probably use the B. subtilis pathway. The lipoate metabolism enzymes (except those of sulfur insertion) are members of PFAM family PF03099 (the cofactor transferase family). Although these enzymes share some sequence similarity, they catalyze three markedly distinct enzyme reactions, making the usual assignment of function based on alignments prone to frequent mistaken annotations. This state of affairs has possibly clouded the interpretation of one of the disorders of human lipoate metabolism. PMID:27074917

  6. Protective effect of α-lipoic acid against radiation-induced fibrosis in mice.

    PubMed

    Ryu, Seung-Hee; Park, Eun-Young; Kwak, Sungmin; Heo, Seung-Ho; Ryu, Je-Won; Park, Jin-Hong; Choi, Kyung-Chul; Lee, Sang-Wook

    2016-03-29

    Radiation-induced fibrosis (RIF) is one of the most common late complications of radiation therapy. We found that α-lipoic acid (α-LA) effectively prevents RIF. In RIF a mouse model, leg contracture assay was used to test the in vivo efficacy of α-LA. α-LA suppressed the expression of pro-fibrotic genes after irradiation, both in vivo and in vitro, and inhibited the up-regulation of TGF-β1-mediated p300/CBP activity. Thus, α-LA prevents radiation-induced fibrosis (RIF) by inhibiting the transcriptional activity of NF-κB through inhibition of histone acetyltransferase activity. α-LA is a new therapeutic methods that can be used in the prevention-treatment of RIF. PMID:26799284

  7. Alpha-lipoic acid protects against indomethacin-induced gastric oxidative toxicity by modulating antioxidant system.

    PubMed

    Kaplan, Kursat Ali; Odabasoglu, Fehmi; Halici, Zekai; Halici, Mesut; Cadirci, Elif; Atalay, Fadime; Aydin, Ozlem; Cakir, Ahmet

    2012-11-01

    Gastroprotective effects of α-lipoic acid (ALA) against oxidative gastric damage induced by indomethacin (IND) have been investigated. All doses (50, 75, 100, 150, 200, and 300 mg/kg body weight) of ALA reduced the ulcer index with 88.2% to 96.1% inhibition ratio. In biochemical analyses of stomach tissues, ALA administration decreased the level of lipid peroxidation (LPO) and activities of myeloperoxidase (MPO) and catalase (CAT) in gastric tissues, which were increased after IND application. ALA also increased the level of glutathione (GSH) and activities of superoxide dismutase (SOD) and glutathione S-transferase (GST) that were decreased in gastric damaged stomach tissues. In conclusion, the gastroprotective effect of ALA could be attributed to its ameliorating effect on the antioxidant defense systems. PMID:23057764

  8. Protective effect of α-lipoic acid against radiation-induced fibrosis in mice

    PubMed Central

    Ryu, Seung-Hee; Park, Eun-Young; Kwak, Sungmin; Heo, Seung-Ho; Ryu, Je-Won; Park, Jin-hong

    2016-01-01

    Radiation-induced fibrosis (RIF) is one of the most common late complications of radiation therapy. We found that α-lipoic acid (α-LA) effectively prevents RIF. In RIF a mouse model, leg contracture assay was used to test the in vivo efficacy of α-LA. α-LA suppressed the expression of pro-fibrotic genes after irradiation, both in vivo and in vitro, and inhibited the up-regulation of TGF-β1-mediated p300/CBP activity. Thus, α-LA prevents radiation-induced fibrosis (RIF) by inhibiting the transcriptional activity of NF-κB through inhibition of histone acetyltransferase activity. α-LA is a new therapeutic methods that can be used in the prevention-treatment of RIF. PMID:26799284

  9. Alpha-Lipoic Acid Attenuates Oxidative Damage in Organs After Sepsis.

    PubMed

    Petronilho, Fabricia; Florentino, Drielly; Danielski, Lucinéia Gainski; Vieira, Luiz Carlos; Martins, Maryane Modolon; Vieira, Andriele; Bonfante, Sandra; Goldim, Mariana Pereira; Vuolo, Francieli

    2016-02-01

    Sepsis progression is linked with the imbalance between reactive oxygen species and antioxidant enzymes. Thus, the aim of this study was to evaluate the effect of alpha-lipoic acid (ALA), a powerful antioxidant, in organs of rats submitted to sepsis. Male Wistar rats were subjected to sepsis by cecal ligation puncture (CLP) and treated with ALA or vehicle. After CLP (12 and 24 h), the myeloperoxidase (MPO) activity, protein and lipid oxidative damage, and antioxidant enzymes in the liver, kidney, heart, and lung were evaluated. ALA was effective in reducing MPO activity, lipid peroxidation in the liver, and protein carbonylation only in the kidney in 12 h after CLP. In 12 h, SOD activity increased in the kidney and CAT activity in the liver and kidney with ALA treatment. Thus, ALA was able to reduce the inflammation and oxidative stress in the liver and kidney after sepsis in rats. PMID:26431839

  10. Role of α-lipoic acid in dextran sulfate sodium-induced ulcerative colitis in mice: studies on inflammation, oxidative stress, DNA damage and fibrosis.

    PubMed

    Trivedi, P P; Jena, G B

    2013-09-01

    Ulcerative colitis affects many people worldwide. Inflammation and oxidative stress play a vital role in its pathogenesis. Previously, we reported that ulcerative colitis leads to systemic genotoxicity in mice. The present study was aimed at elucidating the role of α-lipoic acid in ulcerative colitis-associated local and systemic damage in mice. Experimental colitis was induced using 3%w/v dextran sulfate sodium in drinking water for 2 cycles. α-Lipoic acid was administered in a co-treatment (20, 40, 80 mg/kg bw) and post-treatment (80 mg/kg bw) schedule. Various biochemical parameters, histological evaluation, comet and micronucleus assays, immunohistochemistry and western blot analysis were employed to evaluate the effect of α-lipoic acid in mice with ulcerative colitis. The protective effect of α-lipoic acid was mediated through the modulation of nuclear factor kappa B, cyclooxygenase-2, interleukin 17, signal transducer and activator of transcription 3, nuclear erythroid 2-related factor 2, NADPH: quinone oxidoreductase-1, matrix metalloproteinase-9 and connective tissue growth factor. Further, ulcerative colitis led to an increased gut permeability, plasma lipopolysaccharide level, systemic inflammation and genotoxicity in mice, which was reduced with α-lipoic acid treatment. The present study identifies the underlying mechanisms involved in α-lipoic acid-mediated protection against ulcerative colitis and the associated systemic damage in mice. PMID:23793040

  11. The Protective Effects of Alpha-Lipoic Acid and Coenzyme Q10 Combination on Ovarian Ischemia-Reperfusion Injury: An Experimental Study

    PubMed Central

    Bozkurt, Mehmet Fatih; Koken, Tulay; Dogan, Nurhan; Pektaş, Mine Kanat; Baskin Embleton, Didem

    2016-01-01

    Objective. This study aims to evaluate whether alpha-lipoic acid and/or coenzyme Q10 can protect the prepubertal ovarian tissue from ischemia-reperfusion injury in an experimental rat model of ovarian torsion. Materials and Methods. Forty-two female preadolescent Wistar-Albino rats were divided into 6 equal groups randomly. The sham group had laparotomy without torsion; the other groups had torsion/detorsion procedure. After undergoing torsion, group 2 received saline, group 3 received olive oil, group 4 received alpha-lipoic acid, group 5 received coenzyme Q10, and group 6 received both alpha-lipoic acid and coenzyme Q10 orally. The oxidant-antioxidant statuses of these groups were compared using biochemical measurement of oxidized/reduced glutathione, glutathione peroxidase and malondialdehyde, pathological evaluation of damage and apoptosis within the ovarian tissue, and immunohistochemical assessment of nitric oxide synthase. Results. The left ovaries of the alpha-lipoic acid + coenzyme Q10 group had significantly lower apoptosis scores and significantly higher nitric oxide synthase content than the left ovaries of the control groups. The alpha-lipoic acid + coenzyme Q10 group had significantly higher glutathione peroxidase levels and serum malondialdehyde concentrations than the sham group. Conclusions. The combination of alpha-lipoic acid and coenzyme Q10 has beneficial effects on oxidative stress induced by ischemia-reperfusion injury related to ovarian torsion. PMID:27597986

  12. The Protective Effects of Alpha-Lipoic Acid and Coenzyme Q10 Combination on Ovarian Ischemia-Reperfusion Injury: An Experimental Study.

    PubMed

    Tuncer, Ahmet Ali; Bozkurt, Mehmet Fatih; Koken, Tulay; Dogan, Nurhan; Pektaş, Mine Kanat; Baskin Embleton, Didem

    2016-01-01

    Objective. This study aims to evaluate whether alpha-lipoic acid and/or coenzyme Q10 can protect the prepubertal ovarian tissue from ischemia-reperfusion injury in an experimental rat model of ovarian torsion. Materials and Methods. Forty-two female preadolescent Wistar-Albino rats were divided into 6 equal groups randomly. The sham group had laparotomy without torsion; the other groups had torsion/detorsion procedure. After undergoing torsion, group 2 received saline, group 3 received olive oil, group 4 received alpha-lipoic acid, group 5 received coenzyme Q10, and group 6 received both alpha-lipoic acid and coenzyme Q10 orally. The oxidant-antioxidant statuses of these groups were compared using biochemical measurement of oxidized/reduced glutathione, glutathione peroxidase and malondialdehyde, pathological evaluation of damage and apoptosis within the ovarian tissue, and immunohistochemical assessment of nitric oxide synthase. Results. The left ovaries of the alpha-lipoic acid + coenzyme Q10 group had significantly lower apoptosis scores and significantly higher nitric oxide synthase content than the left ovaries of the control groups. The alpha-lipoic acid + coenzyme Q10 group had significantly higher glutathione peroxidase levels and serum malondialdehyde concentrations than the sham group. Conclusions. The combination of alpha-lipoic acid and coenzyme Q10 has beneficial effects on oxidative stress induced by ischemia-reperfusion injury related to ovarian torsion. PMID:27597986

  13. Effect of treatment with the antioxidant alpha-lipoic (thioctic) acid on heart and kidney microvasculature in spontaneously hypertensive rats.

    PubMed

    Tayebati, Seyed Khosrow; Tomassoni, Daniele; Di Cesare Mannelli, Lorenzo; Amenta, Francesco

    2016-01-01

    Endothelial cells represent an important vascular site of signaling and development of damage during ischemia, inflammation and other pathological conditions. Excessive reactive oxygen species production causes pathological activation of endothelium including exposure of cell to adhesion molecules. Intercellular adhesion molecule-1 (ICAM-1), vascular cell adhesion molecule-1 (VCAM-1) and platelet-endothelial cell adhesion molecule-1 (PECAM-1) are members of the immunoglobulin super-family which are present on the surface of endothelial cells. These molecules represent important markers of endothelial inflammation. The present study was designed to investigate, with immunochemical and immunohistochemical techniques, the effect of treatment with (+/-)-alpha lipoic (thioctic) acid and its enantiomers on heart and kidney endothelium in spontaneously hypertensive rats (SHR). Arterial hypertension is accompanied by an increased oxidative stress status in the heart characterized by thiobarbituric acid reactive substances (TBARS) and nucleic acid oxidation increase. The higher oxidative stress also modifies adhesion molecules expression. In the heart VCAM-1, which was higher than ICAM-1 and PECAM-1, was increased in SHR. ICAM-1, VCAM-1 and PECAM-1 expression was significantly greater in the renal endothelium of SHR. (+/-)-Alpha lipoic acid and (+)-alpha lipoic acid treatment significantly decreased TBARS levels, the nucleic acid oxidation and prevented adhesion molecules expression in cardiac and renal vascular endothelium. These data suggest that endothelial molecules may be used for studying the mechanisms of vascular injury on target organs of hypertension. The effects observed after treatment with (+)-alpha lipoic acid could open new perspectives for countering heart and kidney microvascular injury which represent a common feature in hypertensive end-organs damage. PMID:26207883

  14. [An endogenous dithiol with antioxidant properties: alpha-lipoic acid, potential uses in cardiovascular diseases].

    PubMed

    Ghibu, S; Richard, C; Delemasure, S; Vergely, C; Mogosan, C; Muresan, A

    2008-06-01

    Alpha-Lipoic acid (ALA) is a natural compound, chemically named 1,2-dithiolane-3-pentanoic acid, also referred to as thioctic acid. In humans, ALA is synthetized by the liver and other tissues with high metabolic activity: heart, kidney. ALA is both water and fat soluble and therefore, is widely distributed in both cellular membranes and cytosol. Recently, a greater deal of attention has been given to antioxidant function for ALA and its reduced formed: dihydrolipoic acid (DHLA). ALA scavenges hydroxyl radicals, hypochlorous acid and singlet oxygen. It may also exert antioxidant effects in biological systems through transitional metal chelation. Dihydrolipoic acid has been shown to have antioxidant but also pro-oxidant properties in systems in which hydroxyl radical was generated. ALA/DHLA ratio has the capacity to recycle endogenous antioxidants such as vitamin E. A number of experimental as well as clinical studies point to the usefulness of ALA as a therapeutic agent for such diverse conditions as diabetes, atherosclerosis, insulin resistance, neuropathy, neurodegenerative diseases and ischemia-reperfusion injury. ALA represents a potential agent on the vascular endothelium, recording to ALA/DHLA redox couple is one of the most powerful biological antioxidant systems. PMID:18571145

  15. Simultaneous determination of lipoic acid (LA) and dihydrolipoic acid (DHLA) in human plasma using high-performance liquid chromatography coupled with electrochemical detection.

    PubMed

    Khan, Abad; Iqbal, Zafar; Watson, David G; Khan, Amirzada; Khan, Inamullah; Muhammad, Naveed; Muhammad, Salar; Nasib, Hashmat Ara; Iqbal, Naveed; Faiz-Ur-Rehman; Kashif, Muhammad

    2011-06-15

    A fast, simple, and a reliable high-performance liquid chromatography linked with electrochemical detector (HPLC-ECD) method for the assessment of lipoic acid (LA) and dihydrolipoic acid (DHLA) in plasma was developed using naproxen sodium as an internal standard (IS) and validated according to standard guidelines. Extraction of both analytes and IS from plasma (250 μl) was carried out with a single step liquid-liquid extraction applying dichloromethane. The separated organic layer was dried under stream of nitrogen at 40°C and the residue was reconstituted with the mobile phase. Complete separation of both compounds and IS at 30°C on Discovery HS C18 RP column (250 mm × 4.6 mm, 5 μm) was achieved in 9 min using acetonitrile: 0.05 M phosphate buffer (pH 2.4 adjusted with phosphoric acid) (52:48, v/v) as a mobile phase pumped at flow rate of 1.5 ml min(-1) using electrochemical detector in DC mode at the detector potential of 1.0 V. The limit of detection and limit of quantification for lipoic acid were 500 pg/ml and 3 ng/ml, and for dihydrolipoic acid were 3 ng/ml and 10 ng/ml, respectively. The absolute recoveries of lipoic acid and dihydrolipoic acid determined on three nominal concentrations were in the range of 93.40-97.06, and 93.00-97.10, respectively. Similarly coefficient of variations (% CV) for both intra-day and inter-day were between 0.829 and 3.097% for lipoic acid and between 1.620 and 5.681% for dihydrolipoic acid, respectively. This validated method was applied for the analysis of lipoic acid/dihydrolipoic acid in the plasma of human volunteers and will be used for the quantification of these compounds in patients with oxidative stress induced pathologies. PMID:21550862

  16. Lipoic acid entrains the hepatic circadian clock and lipid metabolic proteins that have been desynchronized with advanced age

    SciTech Connect

    Keith, Dove; Finlay, Liam; Butler, Judy; Gómez, Luis; Smith, Eric; Moreau, Régis; Hagen, Tory

    2014-07-18

    Highlights: • 24 month old rats were supplemented with 0.2% lipoic acid in the diet for 2 weeks. • Lipoic acid shifts phase of core circadian clock proteins. • Lipoic acid corrects age-induced desynchronized lipid metabolism rhythms. - Abstract: It is well established that lipid metabolism is controlled, in part, by circadian clocks. However, circadian clocks lose temporal precision with age and correlates with elevated incidence in dyslipidemia and metabolic syndrome in older adults. Because our lab has shown that lipoic acid (LA) improves lipid homeostasis in aged animals, we hypothesized that LA affects the circadian clock to achieve these results. We fed 24 month old male F344 rats a diet supplemented with 0.2% (w/w) LA for 2 weeks prior to sacrifice and quantified hepatic circadian clock protein levels and clock-controlled lipid metabolic enzymes. LA treatment caused a significant phase-shift in the expression patterns of the circadian clock proteins Period (Per) 2, Brain and Muscle Arnt-Like1 (BMAL1), and Reverse Erythroblastosis virus (Rev-erb) β without altering the amplitude of protein levels during the light phase of the day. LA also significantly altered the oscillatory patterns of clock-controlled proteins associated with lipid metabolism. The level of peroxisome proliferator-activated receptor (PPAR) α was significantly increased and acetyl-CoA carboxylase (ACC) and fatty acid synthase (FAS) were both significantly reduced, suggesting that the LA-supplemented aged animals are in a catabolic state. We conclude that LA remediates some of the dyslipidemic processes associated with advanced age, and this mechanism may be at least partially through entrainment of circadian clocks.

  17. Molecular aspects of lipoic acid in the prevention of diabetes complications.

    PubMed

    Packer, L; Kraemer, K; Rimbach, G

    2001-10-01

    Alpha-lipoic acid (LA) and its reduced form, dihydrolipoic acid, are powerful antioxidants. LA scavenges hydroxyl radicals, hypochlorous acid, peroxynitrite, and singlet oxygen. Dihydrolipoic acid also scavenges superoxide and peroxyl radicals and can regenerate thioredoxin, vitamin C, and glutathione, which in turn can recycle vitamin E. There are several possible sources of oxidative stress in diabetes including glycation reactions, decompartmentalization of transition metals, and a shift in the reduced-oxygen status of the diabetic cells. Diabetics have increased levels of lipid hydroperoxides, DNA adducts, and protein carbonyls. Available data strongly suggest that LA, because of its antioxidant properties, is particularly suited to the prevention and/or treatment of diabetic complications that arise from an overproduction of reactive oxygen and nitrogen species. In addition to its antioxidant properties, LA increases glucose uptake through recruitment of the glucose transporter-4 to plasma membranes, a mechanism that is shared with insulin-stimulated glucose uptake. Further, recent trials have demonstrated that LA improves glucose disposal in patients with type II diabetes. In experimental and clinical studies, LA markedly reduced the symptoms of diabetic pathologies, including cataract formation, vascular damage, and polyneuropathy. To develop a better understanding of the preventative and therapeutic potentials of LA, much of the current interest is focused on elucidating its molecular mechanisms in redox dependent gene expression. PMID:11684397

  18. Alpha lipoic acid possess dual antioxidant and lipid lowering properties in atherosclerotic-induced New Zealand White rabbit.

    PubMed

    Zulkhairi, A; Zaiton, Z; Jamaluddin, M; Sharida, F; Mohd, T H B; Hasnah, B; Nazmi, H M; Khairul, O; Zanariyah, A

    2008-12-01

    There is accumulating data demonstrated hypercholesterolemia and oxidative stress play an important role in the development of atherosclerosis. In the present study, a protective activity of alpha-lipoic acid; a metabolic antioxidant in hypercholesterolemic-induced animals was investigated. Eighteen adult male New Zealand White (NZW) rabbit were segregated into three groups labelled as group K, AT and ALA (n=6). While group K was fed with normal chow and acted as a control, the rest fed with 100 g/head/day with 1% high cholesterol diet to induce hypercholesterolemia. 4.2 mg/body weight of alpha lipoic acid was supplemented daily to the ALA group. Drinking water was given ad-libitum. The study was designed for 10 weeks. Blood sampling was taken from the ear lobe vein at the beginning of the study, week 5 and week 10 and plasma was prepared for lipid profile estimation and microsomal lipid peroxidation index indicated with malondialdehyde (MDA) formation. Animals were sacrificed at the end of the study and the aortas were excised for intimal lesion analysis. The results showed a significant reduction of lipid peroxidation index indicated with low MDA level (p<0.05) in ALA group compared to that of the AT group. The blood total cholesterol (TCHOL) and low density lipoprotein (LDL) levels were found to be significantly low in ALA group compared to that of the AT group (p<0.05). Histomorphometric intimal lesion analysis of the aorta showing less of atheromatous plaque formation in alpha lipoic acid supplemented group (p<0.05) compared to that of AT group. These findings suggested that apart from its antioxidant activity, alpha lipoic acid may also posses a lipid lowering effect indicated with low plasma TCHOL and LDL levels and reduced the athero-lesion formation in rabbits fed a high cholesterol diet. PMID:18538528

  19. Alpha-lipoic acid as a new treatment option for Alzheimer's disease--a 48 months follow-up analysis.

    PubMed

    Hager, K; Kenklies, M; McAfoose, J; Engel, J; Münch, G

    2007-01-01

    Oxidative stress and neuronal energy depletion are characteristic biochemical hallmarks of Alzheimer's disease (AD). It is therefore conceivable that pro-energetic and antioxidant drugs such as alpha-lipoic acid might delay the onset or slow down the progression of the disease. In a previous study, 600mg alpha-lipoic acid was given daily to nine patients with AD (receiving a standard treatment with choline-esterase inhibitors) in an open-label study over an observation period of 12 months. The treatment led to a stabilization of cognitive functions in the study group, demonstrated by constant scores in two neuropsychological tests (the mini mental state exam, MMSE and the Alzheimer's disease assessment score cognitive subscale, ADAScog). In this report, we have extended the analysis to 43 patients over an observation period of up to 48 months. In patients with mild dementia (ADAScog < 15), the disease progressed extremely slowly (ADAScog: +1.2 points/year, MMSE: -0.6 points/year), in patients with moderate dementia at approximately twice the rate. However, the progression appears dramatically lower than data reported for untreated patients or patients on choline-esterase inhibitors in the second year of long-term studies. Despite the fact that this study was not double-blinded, placebo-controlled and randomized, our data suggest that treatment with alpha-lipoic acid might be a successful 'neuroprotective' therapy option for AD. However, a state-of-the-art phase II trial is needed urgently. PMID:17982894

  20. Effect of α -Lipoic Acid on Oxidative Stress in End-Stage Renal Disease Patients Receiving Intravenous Iron.

    PubMed

    Showkat, Arif; Bastnagel, William R; Hudson, Joanna Q

    2014-01-01

    Oxidative stress is associated with increased risk of cardiovascular disease in end-stage renal disease (ESRD) patients. Intravenous (IV) iron has been shown to increase oxidative stress. The aim of the study was to evaluate changes in oxidative stress markers following administration of IV sodium ferric gluconate (SFG) to ESRD patients with and without administration of the antioxidant, α -lipoic acid. This is an open-label, crossover study. 125 mg of IV SFG was administered during control (C) and intervention (I) visits. During the I visit, 600 mg of α -lipoic acid was given orally prior to IV SFG. Blood samples were collected at defined time periods for F2-isoprostane (FIP), lipid hydroperoxide (LHP), malondialdehyde (MDA), and iron indices. We recruited ten African-American ESRD subjects: 50% male; mean age 45 ± 9 years; mean hemoglobin 13 ± 1 g/dL; ferritin 449 ± 145 ng/mL; transferrin saturation 27 ± 4%. There were no significant differences in iron indices between the two visits after IV SFG. MDA, FIP, and LHP increased significantly for both C and I visits with a greater increase in the I group. Administration of IV SFG results in an acute rise in oxidative stress in ESRD patients. In contrast to previous studies, administration of α -lipoic acid was associated with a greater increase in oxidative stress. PMID:24967245

  1. Effect of α-Lipoic Acid on Oxidative Stress in End-Stage Renal Disease Patients Receiving Intravenous Iron

    PubMed Central

    Showkat, Arif; Bastnagel, William R.; Hudson, Joanna Q.

    2014-01-01

    Oxidative stress is associated with increased risk of cardiovascular disease in end-stage renal disease (ESRD) patients. Intravenous (IV) iron has been shown to increase oxidative stress. The aim of the study was to evaluate changes in oxidative stress markers following administration of IV sodium ferric gluconate (SFG) to ESRD patients with and without administration of the antioxidant, α-lipoic acid. This is an open-label, crossover study. 125 mg of IV SFG was administered during control (C) and intervention (I) visits. During the I visit, 600 mg of α-lipoic acid was given orally prior to IV SFG. Blood samples were collected at defined time periods for F2-isoprostane (FIP), lipid hydroperoxide (LHP), malondialdehyde (MDA), and iron indices. We recruited ten African-American ESRD subjects: 50% male; mean age 45 ± 9 years; mean hemoglobin 13 ± 1 g/dL; ferritin 449 ± 145 ng/mL; transferrin saturation 27 ± 4%. There were no significant differences in iron indices between the two visits after IV SFG. MDA, FIP, and LHP increased significantly for both C and I visits with a greater increase in the I group. Administration of IV SFG results in an acute rise in oxidative stress in ESRD patients. In contrast to previous studies, administration of α-lipoic acid was associated with a greater increase in oxidative stress. PMID:24967245

  2. α-Lipoic acid inhibits sevoflurane-induced neuronal apoptosis through PI3K/Akt signalling pathway.

    PubMed

    Ma, Rong; Wang, Xiang; Peng, Peipei; Xiong, Jingwei; Dong, Hongquan; Wang, Lixia; Ding, Zhengnian

    2016-01-01

    Sevoflurane is a widely used anaesthetic agent, including in anaesthesia of children and infants. Recent studies indicated that the general anaesthesia might cause the cell apoptosis in the brain. This issue raises the concerns about the neuronal toxicity induced by the application of anaesthetic agents, especially in the infants and young children. In this study, we used Morris water maze, western blotting and immunohistochemistry to elucidate the role of α-lipoic acid in the inhibition of neuronal apoptosis. We found that sevoflurane led to the long-term cognitive impairment in the young rats. This adverse effect may be caused by the neuronal death in the hippocampal region, mediated through PI3K/Akt signalling pathway. We also showed that α-lipoic acid offset the effect of sevoflurane on the neuronal apoptosis and cognitive dysfunction. This study elucidated the potential clinical role of α-lipoic acid, providing a promising way in the prevention and treatment of long-term cognitive impairment induced by sevoflurane general anesthesia. PMID:26781804

  3. BACE1 activity impairs neuronal glucose oxidation: rescue by beta-hydroxybutyrate and lipoic acid

    PubMed Central

    Findlay, John A.; Hamilton, David L.; Ashford, Michael L. J.

    2015-01-01

    Glucose hypometabolism and impaired mitochondrial function in neurons have been suggested to play early and perhaps causative roles in Alzheimer's disease (AD) pathogenesis. Activity of the aspartic acid protease, beta-site amyloid precursor protein (APP) cleaving enzyme 1 (BACE1), responsible for beta amyloid peptide generation, has recently been demonstrated to modify glucose metabolism. We therefore examined, using a human neuroblastoma (SH-SY5Y) cell line, whether increased BACE1 activity is responsible for a reduction in cellular glucose metabolism. Overexpression of active BACE1, but not a protease-dead mutant BACE1, protein in SH-SY5Y cells reduced glucose oxidation and the basal oxygen consumption rate, which was associated with a compensatory increase in glycolysis. Increased BACE1 activity had no effect on the mitochondrial electron transfer process but was found to diminish substrate delivery to the mitochondria by inhibition of key mitochondrial decarboxylation reaction enzymes. This BACE1 activity-dependent deficit in glucose oxidation was alleviated by the presence of beta hydroxybutyrate or α-lipoic acid. Consequently our data indicate that raised cellular BACE1 activity drives reduced glucose oxidation in a human neuronal cell line through impairments in the activity of specific tricarboxylic acid cycle enzymes. Because this bioenergetic deficit is recoverable by neutraceutical compounds we suggest that such agents, perhaps in conjunction with BACE1 inhibitors, may be an effective therapeutic strategy in the early-stage management or treatment of AD. PMID:26483636

  4. Site-Specific Radiofluorination of Biomolecules with 8-[(18)F]-Fluorooctanoic Acid Catalyzed by Lipoic Acid Ligase.

    PubMed

    Drake, Christopher R; Sevillano, Natalia; Truillet, Charles; Craik, Charles S; VanBrocklin, Henry F; Evans, Michael J

    2016-06-17

    New methodologies for site-specifically radiolabeling proteins with (18)F are required to generate high quality radiotracers for preclinical and clinical applications with positron emission tomography. Herein, we report an approach by which we use lipoic acid ligase (LplA) to conjugate [(18)F]-fluorooctanoic acid to an antibody fragment bearing the peptide substrate of LplA. The mild conditions of the reaction preserve antibody immunoreactivity, and the efficiency of LplA allows for >90% yield even with very small amounts of peptidic precursor (1-10 nmol). These features are advantageous compared to the current gold standard in the field. Moreover, the methodology introduces a new application for an important tool in chemical biology. PMID:27008570

  5. A randomized placebo-controlled pilot trial of omega-3 fatty acids and alpha lipoic acid in Alzheimer's disease.

    PubMed

    Shinto, Lynne; Quinn, Joseph; Montine, Thomas; Dodge, Hiroko H; Woodward, William; Baldauf-Wagner, Sara; Waichunas, Dana; Bumgarner, Lauren; Bourdette, Dennis; Silbert, Lisa; Kaye, Jeffrey

    2014-01-01

    Oxidative stress, inflammation, and increased cholesterol levels are all mechanisms that have been associated with Alzheimer's disease (AD) pathology. Several epidemiologic studies have reported a decreased risk of AD with fish consumption. This pilot study was designed to evaluate the effects of supplementation with omega-3 fatty acids alone (ω-3) or omega-3 plus alpha lipoic acid (ω-3 + LA) compared to placebo on oxidative stress biomarkers in AD. The primary outcome measure was peripheral F2-isoprostane levels (oxidative stress measure). Secondary outcome measures included performance on: Mini-Mental State Examination (MMSE), Activities of Daily Living/Instrumental Activities of Daily Living (ADL/IADL), and Alzheimer Disease Assessment Scale-cognitive subscale (ADAS-cog). Thirty-nine AD subjects were randomized to one of three groups: 1) placebo, 2) ω-3, or 3) ω-3 + LA for a treatment duration of 12 months. Eighty seven percent (34/39) of the subjects completed the 12-month intervention. There was no difference between groups at 12 months in peripheral F2-isoprostane levels (p = 0.83). The ω-3 + LA and ω-3 were not significantly different than the placebo group in ADAS-cog (p = 0.98, p = 0.86) and in ADL (p = 0.15, p = 0.82). Compared to placebo, the ω-3 + LA showed less decline in MMSE (p < 0.01) and IADL (p = 0.01) and the ω-3 group showed less decline in IADL (p < 0.01). The combination of ω-3 + LA slowed cognitive and functional decline in AD over 12 months. Because the results were generated from a small sample size, further evaluation of the combination of omega-3 fatty acids plus alpha-lipoic acid as a potential treatment in AD is warranted. PMID:24077434

  6. Combination of inositol and alpha lipoic acid in metabolic syndrome-affected women: a randomized placebo-controlled trial

    PubMed Central

    2013-01-01

    Background Inositol has been reported to improve insulin sensitivity since it works as a second messenger achieving insulin-like effects on metabolic enzymes. The aim of this study was to evaluate the inositol and alpha lipoic acid combination effectiveness on metabolic syndrome features in postmenopausal women at risk of breast cancer. Methods A six-month prospective, randomized placebo-controlled trial was carried out on a total of 155 postmenopausal women affected by metabolic syndrome at risk of breast cancer, the INOSIDEX trial. All women were asked to follow a low-calorie diet and were assigned randomly to daily consumption of a combination of inositol and alpha lipoic acid (77 pts) or placebo (78 pts) for six months. Primary outcomes we wanted to achieve were both reduction of more than 20% of the HOMA-IR index and of triglycerides serum levels. Secondary outcomes expected were both the improvement of high-density lipoprotein cholesterol levels and the reduction of anthropometric features such as body mass index and waist-hip ratio. Results A significant HOMA-IR reduction of more than 20% was evidenced in 66.7% (P <0.0001) of patients, associated with a serum insulin level decrease in 89.3% (P <0.0000). A decrease in triglycerides was evidenced in 43.2% of patients consuming the supplement (P <0.0001). An increase in HDL cholesterol (48.6%) was found in the group consuming inositol with respect to the placebo group. A reduction in waist circumference and waist-hip ratio was found in the treated group with respect to the placebo group. Conclusions Inositol combined with alpha lipoic acid can be used as a dietary supplement in insulin-resistant patients in order to increase their insulin sensitiveness. Daily consumption of inositol combined with alpha lipoic acid has a significant bearing on metabolic syndrome. As metabolic syndrome is considered a modifiable risk factor of breast tumorigenesis, further studies are required to assess whether inositol combined

  7. The effects of the antioxidant lipoic acid on beef longissimus bloom time.

    PubMed

    Rentfrow, G; Linville, M L; Stahl, C A; Olson, K C; Berg, E P

    2004-10-01

    The objective of this study was to evaluate the influence of lipoic acid (LA) on beef LM steak bloom time, as well-as to characterize bloom time in the CIE L*, a*, and b* color space over a 93-min period. Thirty-two Simmental steers were supplemented with LA for 21 d immediately before slaughter at levels of 0, 8, 16, or 24 mg of LA/kg BW (eight steers per treatment). Lipoic acid was mixed with liquid paraffin, allowed to solidify, prilled, and top-dressed over a standard finishing diet. Steers were slaughtered at the University of Missouri abattoir in four groups of eight (two steers per treatment) over a 2-wk period. After a 24-h chill at 4 degrees C, the right LM was removed from each carcass. One 2.54cm steak was removed from the anterior portion of the LM, and its color characteristics (CIE L*, a*, and b*) were measured immediately with a standardized spectrocolorimeter. Color measurements were taken every 3 min thereafter for a total of 93-min. Hue angle (true red) and chroma (color saturation) were calculated from the color measurements. Addition of LA to the diet had no effect on bloom time (P = 0.67). When treatment means were analyzed, the addition of 24 mg of LA/kg BW to the diet resulted in higher (lighter) L* values (P < 0.05) compared with other treatments, whereas the addition of 16 mg of LA/kg BW to the diet caused lower hue angles (more true red; P < 0.05) when compared with other treatments. Addition of LA to the diet did not affect a* (P = 0.13) and b* (P = 0.18) values or chroma (P = 0.62). In the absence of treatment effects, bloom times for all treatments were pooled, and L* values did not change (P > 0.05) during the 93-min bloom time; however, a* and chroma values increased for 9 min and plateaued after 12 min (P < 0.01). Similarly, b* values increased (P < 0.01) for the first 6 min, and after 9 min, no further increase in yellowness was detected. Bloom time had little effect on hue angle, which stabilized after 3 min. Supplementing steers

  8. Is it time to reassess alpha lipoic acid and niacinamide therapy in schizophrenia?

    PubMed

    Seybolt, Sheila E J

    2010-12-01

    As sulfur containing thiols, alpha lipoic acid (ALA) and its reduced form dihydrolipoic acid (DHLA) are powerful antioxidants and free radical scavengers capable of performing many of the same functions as glutathione (GSH). ALA supplementation may help protect mitochondria from oxidative stress, a possible mechanism contributing to certain forms of brain diseases called schizophrenia. Shortly before the advent of antipsychotic medications, two small studies found ALA relieved psychiatric symptoms in schizophrenia. More recently, animal studies have shown ALA augmentation improves mitochondrial function. At pharmaceutical levels, niacinamide helps preserve mitochondrial membrane integrity and acts as an antioxidant. ALA is a precursor for lipoamide, an essential mitochondrial coenzyme and niacinamide is a component of niacinamide adenine dinucleotide (NAD). NADH, the reduced form of NAD, is involved in the reduction of ALA to DHLA within the mitochondria. This is relevant to contemporary research because DHLA increases GSH and low GSH levels contribute to mitochondrial dysfunction and oxidative stress which have been implicated in the pathophysiology of schizophrenia. PMID:20708342

  9. Alpha-lipoic acid: molecular mechanisms and therapeutic potential in diabetes.

    PubMed

    Rochette, Luc; Ghibu, Steliana; Muresan, Adriana; Vergely, Catherine

    2015-12-01

    Diabetes is a chronic metabolic disease with a high prevalence worldwide. Diabetes and insulin resistance are associated with the development of cardiovascular and nervous diseases. The development of these disorders reflects complex pathological processes in which the oxidative stress caused by reactive oxygen species (ROS) and reactive nitrogen species (RNS) plays a pivotal role. It is widely accepted that diabetes impairs endothelial nitric oxide synthase (eNOS) activity and increases the production of ROS, thus resulting in diminished NO bioavailability and increased oxidative stress. Alpha-lipoic acid (LA) possesses beneficial effects both in the prevention and in the treatment of diabetes. LA is a potent antioxidant with insulin-mimetic and anti-inflammatory activity. LA in the diet is quickly absorbed, transported to the intracellular compartments, and reduced to dihydrolipoic acid (DHLA) under the action of enzymes. LA, which plays an essential role in mitochondrial bioenergetic reactions, has drawn considerable attention as an antioxidant for use in managing diabetic complications such as retinopathy, neuropathy and other vascular diseases. PMID:26406389

  10. Bioavailability of an R-α-Lipoic Acid/γ-Cyclodextrin Complex in Healthy Volunteers

    PubMed Central

    Ikuta, Naoko; Okamoto, Hinako; Furune, Takahiro; Uekaji, Yukiko; Terao, Keiji; Uchida, Ryota; Iwamoto, Kosuke; Miyajima, Atsushi; Hirota, Takashi; Sakamoto, Norihiro

    2016-01-01

    R-α-lipoic acid (R-LA) is a cofactor of mitochondrial enzymes and a very strong antioxidant. R-LA is available as a functional food ingredient but is unstable against heat or acid. Stabilized R-LA was prepared through complexation with γ-cyclodextrin (CD), yielding R-LA/CD. R-LA/CD was orally administered to six healthy volunteers and showed higher plasma levels with an area under the plasma concentration-time curve that was 2.5 times higher than that after oral administration of non-complexed R-LA, although the time to reach the maximum plasma concentration and half-life did not differ. Furthermore, the plasma glucose level after a single oral administration of R-LA/CD or R-LA was not affected and no side effects were observed. These results indicate that R-LA/CD could be easily absorbed in the intestine. In conclusion, γ-CD complexation is a promising technology for delivering functional but unstable ingredients like R-LA. PMID:27314343

  11. Inhibitory effects of indole α-lipoic acid derivatives on nitric oxide production in LPS/IFNγ activated RAW 264.7 macrophages.

    PubMed

    Karabay, Arzu Zeynep; Koc, Aslı; Gurkan-Alp, A Selen; Buyukbingol, Zeliha; Buyukbingol, Erdem

    2015-04-01

    Alpha-lipoic acid (α-lipoic acid) is a potent antioxidant compound that has been shown to possess anti-inflammatory effects. RAW 264.7 macrophages produce various inflammatory mediators such as nitric oxide, IL-1β, IL-6 and TNF-alpha upon activation with LPS (Lipopolysaccharide) and IFNγ (interferon gamma). In this study, the effect of 12 synthetic indole α-lipoic acid derivatives on nitric oxide production and iNOS (inducible nitric oxide synthase) protein expression in LPS/IFNγ activated RAW 264.7 macrophages was determined. Cell proliferation, nitric oxide levels and iNOS protein expression were examined with thiazolyl blue tetrazolium blue test, griess assay and western blot, respectively. Our results showed that all of the indole α-lipoic acid derivatives showed significant inhibitory effects on nitric oxide production and iNOS protein levels (p < 0.05). The most active compounds were identified as compound I-4b, I-4e and II-3b. In conclusion, these indole α-lipoic acid derivatives may have the potential for treatment of inflammatory conditions related with high nitric oxide production. PMID:25727912

  12. Protective effect of alpha-lipoic acid on cypermethrin-induced oxidative stress in Wistar rats.

    PubMed

    Mignini, F; Nasuti, C; Fedeli, D; Mattioli, L; Cosenza, M; Artico, M; Gabbianelli, R

    2013-01-01

    Cypermethrin (CY), a class II pyrethroid pesticide, is globally used to control insects in the household and in agriculture. Despite beneficial roles, its uncontrolled and repetitive application leads to unintended effects in non-target organisms. In light of the relevant anti-oxidant properties of alpha-lipoic acid (ALA), in the work described herein we tested the effect of a commercially available ALA formulation on cypermethrin CY)-induced oxidative stress in Wistar rats. The rats were orally administered with 53.14 mg/kg of ALA and 35.71 mg/kg of CY for 60 days. The treatment with CY did not induce changes in either locomotor activities or in body weight. Differences were observed on superoxide dismutase (SOD), catalase (CAT) and lipid peroxidation that were re-established by ALA treatment at similar levels of the placebo group. Furthermore, ALA formulation increased glutathione (GSH) level and glutathione peroxidase (GPx) activity. Because of the widespread use of CY, higher amounts of pesticide residues are present in food, and a diet supplementation with ALA could be an active free radical scavenger protecting against diseases associated with oxidative stress. PMID:24355222

  13. Alpha-lipoic acid enhances DMSO-induced cardiomyogenic differentiation of P19 cells.

    PubMed

    Shen, Xinghua; Yang, Qinghui; Jin, Peng; Li, Xueqi

    2014-09-01

    Alpha-lipoic acid (α-LA) is a potent antioxidant that acts as an essential cofactor in mitochondrial dehydrogenase reactions. α-LA has been shown to possess anti-inflammatory and cytoprotective properties, and is used to improve symptoms of diabetic neuropathy. However, the role of α-LA in stem cell differentiation and the underlying molecular mechanisms remain unknown. In the present study, we showed that α-LA significantly promoted dimethyl sulfoxide (DMSO)-induced cardiomyogenic differentiation of mouse embryonic carcinoma P19 cells. α-LA dose dependently increased beating embryonic body (EB) percentages of DMSO-differentiated P19 cells. The expressions of cardiac specific genes TNNT2, Nkx2.5, GATA4, MEF2C, and MLC2V and cardiac isoform of troponin T (cTnT)-positively stained cell population were significantly up-regulated by the addition of α-LA. We also demonstrated that the differentiation time after EB formation was critical for α-LA to take effect. Interestingly, without DMSO treatment, α-LA did not stimulate the cardiomyogenic differentiation of P19 cells. Further investigation indicated that collagen synthesis-enhancing activity, instead of the antioxidative property, plays a significant role in the cardiomyogenic differentiation-promoting function of α-LA. These findings highlight the potential use of α-LA for regenerative therapies in heart diseases. PMID:25112287

  14. Lipoic acid suppresses compound 48/80-induced anaphylaxis-like reaction

    PubMed Central

    Choi, Yun Ho; Chai, Ok Hee; Han, Eui-Hyeog; Choi, Su-Young; Kim, Hyoung Tae

    2010-01-01

    Alpha-lipoic acid (LA), a naturally occurring dithiol compound, is an essential cofactor in metabolic reactions involved in energy utilization. LA improves glycemic control, reduces diabetic polyneuropathies, atherosclerosis, and allergic inflammation. The effects of LA on mast cell-mediated anaphylactic reactions, however, are unknown. LA dose-dependently inhibited systemic and passive cutaneous anaphylaxis-like reactions in mice induced by compound 48/80, a condensation product of N-methyl-p-methoxyphenethylamine and formaldehyde. Pretreatment with LA, prior to induction of the systemic anaphylaxis-like reaction with compound 48/80, reduced plasma histamine levels in a dose-dependent manner. In our in vitro study, LA decreased histamine release from rat peritoneal mast cells (RPMCs) triggered by compound 48/80. Moreover, an increase in calcium uptake activated by compound 48/80 was inhibited by LA. LA also significantly elevated intracellular cyclic adenosine-3',5' monophosphate (cAMP) levels in RPMCs. This inhibition of mediator release from RPMCs may be due to inhibition of calcium uptake and augmentation of intracellular cAMP levels. Based on these results, we suggest that LA may be a potential remedy for allergy-related diseases. PMID:21267406

  15. Effect of alpha-lipoic acid on radiation-induced small intestine injury in mice

    PubMed Central

    Jeong, Bae Kwon; Song, Jin Ho; Jeong, Hojin; Choi, Hoon Sik; Jung, Jung Hwa; Hahm, Jong Ryeal; Woo, Seung Hoon; Jung, Myeong Hee; Choi, Bong-Hoi; Kim, Jin Hyun; Kang, Ki Mun

    2016-01-01

    Purpose Radiation therapy is a highly effective treatment for patients with solid tumors. However, it can cause damage and inflammation in normal tissues. Here, we investigated the effects of alpha-lipoic acid (ALA) as radioprotection agent for the small intestine in a mouse model. Materials and Methods Whole abdomen was evenly irradiated with total a dose of 15 Gy. Mice were treated with either ALA (100 mg/kg, intraperitoneal injection [i.p.]) or saline (equal volume, i.p.) the prior to radiation as 100 mg/kg/day for 3 days. Body weight, food intake, histopathology, and biochemical parameters were evaluated. Results Significant differences in body weight and food intake were observed between the radiation (RT) and ALA + RT groups. Moreover, the number of crypt cells was higher in the ALA + RT group. Inflammation was decreased and recovery time was shortened in the ALA + RT group compared with the RT group. The levels of inflammation-related factors (i.e., phosphorylated nuclear factor kappa B and matrix metalloproteinase-9) and mitogen-activated protein kinases were significantly decreased in the ALA + RT group compared with those in the RT group. Conclusions ALA treatment prior to radiation decreases the severity and duration of radiation-induced enteritis by reducing inflammation, oxidative stress, and cell death. PMID:26943777

  16. Aqueous Growth of Gold Clusters with Tunable Fluorescence Using Photochemically Modified Lipoic Acid-Based Ligands.

    PubMed

    Mishra, Dinesh; Aldeek, Fadi; Lochner, Eric; Palui, Goutam; Zeng, Birong; Mackowski, Sebastian; Mattoussi, Hedi

    2016-06-28

    We report a one-phase aqueous growth of fluorescent gold nanoclusters (AuNCs) with tunable emission in the visible spectrum, using a ligand scaffold that is made of poly(ethylene glycol) segment appended with a metal coordinating lipoic acid at one end and a functional group at the other end. This synthetic scheme exploits the ability of the UV-induced photochemical transformation of LA-based ligands to provide DHLA and other thiol byproducts that exhibit great affinity to metal nanoparticles, obviating the need for chemical reduction of the dithiolane ring using classical reducing agents. The influence of various experimental conditions, including the photoirradiation time, gold precursor-to-ligand molar ratios, time of reaction, temperature, and the medium pH, on the growth of AuNCs has been systematically investigated. The photophysical properties, size, and structural characterization were carried out using UV-vis absorption and fluorescence spectroscopy, TEM, DOSY-NMR, and X-ray photoelectron spectroscopy. The hydrodynamic size (RH) obtained by DOSY-NMR indicates that the size of these clusters follows the trend anticipated from the absorption and PL data, with RH(red) > RH(yellow) > RH(blue). The tunable emission and size of these gold nanoclusters combined with their high biocompatibility would make them greatly promising for potential use in imaging and sensing applications. PMID:27254320

  17. Lipoic Acid Decreases Inflammation and Confers Neuroprotection in Experimental Autoimmune Optic Neuritis

    PubMed Central

    Chaudhary, Priya; Marracci, Gail; Yu, Xiaolin; Galipeau, Danielle; Morris, Brooke; Bourdette, Dennis

    2016-01-01

    Lipoic acid (LA) is an antioxidant that is effective in treating experimental autoimmune encephalomyelitis (EAE), a model for multiple sclerosis (MS). C57BL/6 mice with EAE develop experimental autoimmune optic neuritis (EAON), which models acute optic neuritis in humans. Here we determined whether LA is therapeutically effective in EAON. We immunized C57BL/6 mice with MOG 35–55 peptide. Mice received either daily subcutaneous injections of LA (100 mg/kg) or saline in early or late suppression paradigms. In the early suppression paradigm, optic nerve cross sections showed 14.9 ± 3.8% (mean ± SEM) damage in mice receiving saline (n = 7) and 2.0 ± 0.4 % damage in mice given LA (n = 7, p = 0.001). In the late suppression paradigm, optic nerve sections showed 24.6 ± 3.5% damage in mice treated with saline (n = 7) and 8.4 ± 2.5% in mice treated with LA (n = 7, p = 0.004). Thus a dramatic reduction in axonal injury was seen after LA administration in both experimental paradigms. Compared with saline treated mice with EAON, optic nerves from mice receiving LA had significantly fewer CD4+ and CD11b+ cells in both paradigms. This study provides a rationale for investigating the therapeutic efficacy of LA in acute optic neuritis in humans. PMID:21215462

  18. Near-Infrared Electrogenerated Chemiluminescence from Aqueous Soluble Lipoic Acid Au Nanoclusters.

    PubMed

    Wang, Tanyu; Wang, Dengchao; Padelford, Jonathan W; Jiang, Jie; Wang, Gangli

    2016-05-25

    Strong electrogenerated chemiluminescence (ECL) is detected from dithiolate Au nanoclusters (AuNCs) in aqueous solution under ambient conditions. A novel mechanism to drastically enhance the ECL is established by covalent attachment of coreactants N,N-diethylethylenediamine (DEDA) onto lipoic acid stabilized Au (Au-LA) clusters with matching redox activities. The materials design reduces the complication of mass transport between the reactants during the lifetime of radical intermediates involved in conventional ECL generation pathway. The intracluster reactions are highly advantageous for applications by eliminating additional and high excess coreactants otherwise needed. The enhanced ECL efficiency also benefits uniquely from the multiple energy states per Au cluster and multiple DEDA ligands in the monolayer. Potential step and sweeping experiments reveal an onset potential of 0.78 V for oxidative-reduction ECL generation. Multifolds higher efficiency is found for the Au clusters alone in reference to the standard Rubpy with high excess TPrA. The ECL in near-IR region (beyond 700 nm) is highly advantageous with drastically reduced interference signals over visible ones. The features of ECL intensity responsive to electrode potential and solution pH under ambient conditions make Au-LA-DEDA clusters promising ECL reagents for broad applications. The strategy to attach coreactants on Au clusters is generalizable for other nanomaterials. PMID:27172252

  19. A novel fullerene lipoic acid derivative: Synthesis and preparation of self-assembled monolayers on gold

    NASA Astrophysics Data System (ADS)

    Viana, A. S.; Leupold, S.; Eberle, C.; Shokati, T.; Montforts, F.-P.; Abrantes, L. M.

    2007-11-01

    Synthesis and preparation of self-assembled monolayers of a novel fullerene lipoic acid derivative on gold are reported. The presence of densely packed SAMs was confirmed by ellipsometry and cyclic voltammetry. The electrochemical response of the modified electrode in organic media exhibits the first two redox peaks characteristic of the extended π-electron system of fullerene. C 60 surface coverage (1.4 × 10 -10 mol cm -2) has been electrochemically determined by the redox process of the adsorbed fullerene moiety and by reductive desorption of the SAM in strong alkaline solution. Electrochemical data indicate that all four sulphur atoms are involved in the self-assembly process, providing an increase of SAM stability in comparison to mono or di-thiolated appended molecules. Visualisation of discrete fullerene molecules by scanning tunnelling microscopy supplied further evidence for gold modification and molecular distribution on the surface. Mixed monolayers of hexanethiol and fullerene derivatives in a proportion of 1:2 have been also studied with the purpose of controlling the amount and distribution of fullerene units on the gold surface.

  20. {alpha}-Lipoic acid prevents lipotoxic cardiomyopathy in acyl CoA-synthase transgenic mice

    SciTech Connect

    Lee, Young; Naseem, R. Haris; Park, Byung-Hyun; Garry, Daniel J.; Richardson, James A.; Schaffer, Jean E.; Unger, Roger H. . E-mail: roger.unger@utsouthwestern.edu

    2006-05-26

    {alpha}-Lipoic acid ({alpha}-LA) mimics the hypothalamic actions of leptin on food intake, energy expenditure, and activation of AMP-activated protein kinase (AMPK). To determine if, like leptin, {alpha}-LA protects against cardiac lipotoxicity, {alpha}-LA was fed to transgenic mice with cardiomyocyte-specific overexpression of the acyl CoA synthase (ACS) gene. Untreated ACS-transgenic mice died prematurely with increased triacylglycerol content and dilated cardiomyopathy, impaired systolic function and myofiber disorganization, apoptosis, and interstitial fibrosis on microscopy. In {alpha}-LA-treated ACS-transgenic mice heart size, echocardiogram and TG content were normal. Plasma TG fell 50%, hepatic-activated phospho-AMPK rose 6-fold, sterol regulatory element-binding protein-1c declined 50%, and peroxisome proliferator-activated receptor-{gamma} cofactor-1{alpha} mRNA rose 4-fold. Since food restriction did not prevent lipotoxicity, we conclude that {alpha}-LA treatment, like hyperleptinemia, protects the heart of ACS-transgenic mice from lipotoxicity.

  1. Alpha-lipoic acid protects cardiomyocytes against hypoxia/reoxygenation injury by inhibiting autophagy

    SciTech Connect

    Cao, Xueming; Chen, Aihua Yang, Pingzhen; Song, Xudong; Liu, Yingfeng; Li, Zhiliang; Wang, Xianbao; Wang, Lizi; Li, Yunpeng

    2013-11-29

    Highlights: •We observed the cell viability and death subjected to H/R in H9c2 cardiomyocytes. •We observed the degree of autophagy subjected to H/R in H9c2 cardiomyocytes. •LA inhibited the degree of autophagy in parallel to the enhanced cell survival. •LA inhibited the autophagy in parallel to the decreased total cell death. •We concluded that LA protected cardiomyocytes against H/R by inhibiting autophagy. -- Abstract: Hypoxia/reoxygenation (H/R) is an important in vitro model for exploring the molecular mechanisms and functions of autophagy during myocardial ischemia/reperfusion (I/R). Alpha-lipoic acid (LA) plays an important role in the etiology of cardiovascular disease. Autophagy is widely implicated in myocardial I/R injury. We assessed the degree of autophagy by pretreatment with LA exposed to H/R in H9c2 cell based on the expression levels of Beclin-1, LC3II/LC3I, and green fluorescent protein-labeled LC3 fusion proteins. Autophagic vacuoles were confirmed in H9c2 cells exposed to H/R using transmission electron microscopy. Our findings indicated that pretreatment with LA inhibited the degree of autophagy in parallel to the enhanced cell survival and decreased total cell death in H9c2 cells exposed to H/R. We conclude that LA protects cardiomyocytes against H/R injury by inhibiting autophagy.

  2. Neuronal mitochondrial amelioration by feeding acetyl-L-carnitine and lipoic acid to aged rats

    PubMed Central

    Aliev, Gjumrakch; Liu, Jiankang; Shenk, Justin C; Fischbach, Kathryn; Pacheco, Gerardo J; Chen, Shu G; Obrenovich, Mark E; Ward, Walter F; Richardson, Arlan G; Smith, Mark A; Gasimov, Eldar; Perry, George; Ames, Bruce N

    2009-01-01

    Abstract Brain function declines with age and is associated with diminishing mitochondrial integrity. The neuronal mitochondrial ultrastructural changes of young (4 months) and old (21 months) F344 rats supplemented with two mitochondrial metabolites, acetyl-L-carnitine (ALCAR, 0.2%[wt/vol] in the drinking water) and R-α-lipoic acid (LA, 0.1%[wt/wt] in the chow), were analysed using qualitative and quantitative electron microscopy techniques. Two independent morphologists blinded to sample identity examined and scored all electron micrographs. Mitochondria were examined in each micrograph, and each structure was scored according to the degree of injury. Controls displayed an age-associated significant decrease in the number of intact mitochondria (P = 0.026) as well as an increase in mitochondria with broken cristae (P < 0.001) in the hippocampus as demonstrated by electron microscopic observations. Neuronal mitochondrial damage was associated with damage in vessel wall cells, especially vascular endothelial cells. Dietary supplementation of young and aged animals increased the proliferation of intact mitochondria and reduced the density of mitochondria associated with vacuoles and lipofuscin. Feeding old rats ALCAR and LA significantly reduced the number of severely damaged mitochondria (P = 0.02) and increased the number of intact mitochondria (P < 0.001) in the hippocampus. These results suggest that feeding ALCAR with LA may ameliorate age-associated mitochondrial ultrastructural decay and are consistent with previous studies showing improved brain function. PMID:18373733

  3. Neuronal mitochondrial amelioration by feeding acetyl-L-carnitine and lipoic acid to aged rats.

    PubMed

    Aliev, Gjumrakch; Liu, Jiankang; Shenk, Justin C; Fischbach, Kathryn; Pacheco, Gerardo J; Chen, Shu G; Obrenovich, Mark E; Ward, Walter F; Richardson, Arlan G; Smith, Mark A; Gasimov, Eldar; Perry, George; Ames, Bruce N

    2009-02-01

    Brain function declines with age and is associated with diminishing mitochondrial integrity. The neuronal mitochondrial ultrastructural changes of young (4 months) and old (21 months) F344 rats supplemented with two mitochondrial metabolites, acetyl-L-carnitine (ALCAR, 0.2%[wt/vol] in the drinking water) and R-alpha-lipoic acid (LA, 0.1%[wt/wt] in the chow), were analysed using qualitative and quantitative electron microscopy techniques. Two independent morphologists blinded to sample identity examined and scored all electron micrographs. Mitochondria were examined in each micrograph, and each structure was scored according to the degree of injury. Controls displayed an age-associated significant decrease in the number of intact mitochondria (P = 0.026) as well as an increase in mitochondria with broken cristae (P < 0.001) in the hippocampus as demonstrated by electron microscopic observations. Neuronal mitochondrial damage was associated with damage in vessel wall cells, especially vascular endothelial cells. Dietary supplementation of young and aged animals increased the proliferation of intact mitochondria and reduced the density of mitochondria associated with vacuoles and lipofuscin. Feeding old rats ALCAR and LA significantly reduced the number of severely damaged mitochondria (P = 0.02) and increased the number of intact mitochondria (P < 0.001) in the hippocampus. These results suggest that feeding ALCAR with LA may ameliorate age-associated mitochondrial ultrastructural decay and are consistent with previous studies showing improved brain function. PMID:18373733

  4. Effect of alpha-lipoic acid on boar spermatozoa quality during freezing-thawing.

    PubMed

    Shen, Tao; Jiang, Zhong-Liang; Li, Cong-Jun; Hu, Xiao-Chen; Li, Qing-Wang

    2016-04-01

    Alpha-lipoic acid (ALA) is known to be a natural antioxidant. The aim of the present study was to evaluate the cryoprotective effect of ALA on the motility of boar spermatozoa and its antioxidant effect on boar spermatozoa during freezing-thawing. Different concentrations (2.0, 4.0, 6.0, 8.0 or 10.0 mg/ml) of ALA were added to the extender used to freeze boar semen, and the effects on the quality and endogenous antioxidant enzyme activities of frozen-thawed spermatozoa were assessed. The results indicated that the addition of ALA to the extender resulted in a higher percentage of motile spermatozoa post-thaw (P < 0.05). The activities of superoxide dismutase, lactate dehydrogenase, glutamic-oxaloacetic transaminase and catalase improved after adding ALA to the extender (P < 0.05). Artificial insemination results showed that pregnancy rate and litter size were significantly higher at 6.0 mg/ml in the ALA group than in the control group (P < 0.05). In conclusion, ALA conferred a cryoprotective capacity to the extender used for boar semen during the process of freezing-thawing, and the optimal concentration of ALA for the frozen extender was 6.0 mg/ml. PMID:26099848

  5. [Oxidative homeostasis and functional parameters of rats at high altitudes with alpha-lipoic acid correction].

    PubMed

    Vishnevskiĭ, A A; Dzhantaeva, G A; Zhaparalieva, Ch O

    2011-01-01

    Oxidative and functional effects of alpha-lipoic acid (a-LA) were studied in the course of 45-day adaptation to high altitudes (3200 m in the Central Tien Shan, June - August). Comparison of a-LA with mildronate stated similarity of their antioxidant and membrane effects on the third (stable) phase of adaptation (day 45), as both substances demonstrated a distinct lyso-PL-limiting effect and did not change dramatically concentration of diene conjugates (primary products of lipid peroxidation) in brain tissue. a-LA surpassed mildronate in the rate of the compensating effect in respect of behavior disorders and anxiety in rats. Besides, the substances contributed equally to physical performance increment by the end of adaptation. The positive effect of a-LA on the functional characteristics was hand in hand with minimization of the consequences of oxidative stress. These experimental data imply that a-LA can be effective in controlling the long process of adaptation to high altitude conditions. PMID:21916251

  6. Effect of αlipoic acid and silymarin on bladder outlet obstruction.

    PubMed

    Yildirim, Abidin; Başeskioğlu, Barbaros; Temel, Halide E; Erkasap, Nilüfer; Yenilmez, Aydin; Uslu, Sema; Ozer, Caner; Ozkurt, Mete; Dönmez, Turgut

    2013-02-01

    The aim of the present study was to determine whether the treatment of obstructed rat bladders with αlipoic acid (ALA) and silymarin reverses the biochemical and physiological responses to bladder outlet obstruction (BOO). A total of 32 adult Sprague Dawley rats were divided into four groups (n=8 per group): sham (placebo surgery) animals with no treatment (group 1); control animals with surgically induced BOO (group 2); obstructed rats treated with ALA (group 3); and obstructed rats treated with silymarin (group 4). Histological evaluation, bladder weights, collagen structure, TdT-mediated biotin nick end-labeling (TUNEL), inducible nitric oxide sentase (iNOS) mRNA levels, malondialdehyde (MDA) levels and tumor necrosis factor (TNF) levels were investigated. The ALA-treated group had similar bladder weights, collagen levels and TUNEL positivity and decreased iNOS levels compared with the control group, while the silymarin group exhibited further differences. Serum MDA and TNF-α levels were both decreased in the ALA and silymarin groups. ALA treatment reduced the increased oxidative stress and bladder inflammation caused by BOO and may contribute to the protection of bladder function. PMID:23403734

  7. Ginger and alpha lipoic acid ameliorate age-related ultrastructural changes in rat liver.

    PubMed

    Mahmoud, Y I; Hegazy, H G

    2016-01-01

    Because of the important role that oxidative stress is thought to play in the aging process, antioxidants could be candidates for preventing its related pathologies. We investigated the ameliorative effects of two antioxidant supplements, ginger and alpha lipoic acid (ALA), on hepatic ultrastructural alterations in old rats. Livers of young (4 months) and old (24 months) Wistar rats were studied using transmission electron microscopy. Livers of old rats showed sinusoidal collapse and congestion, endothelial thickening and defenestration, and inconsistent perisinusoidal extracellular matrix deposition. Aged hepatocytes were characterized by hypertrophy, cytoplasmic vacuolization and a significant increase in the volume densities of the nuclei, mitochondria and dense bodies. Lipofuscin accumulation and decreased microvilli in bile canaliculi and space of Disse also were observed. The adverse alterations were ameliorated significantly by both ginger and ALA supplementation; ALA was more effective than ginger. Ginger and ALA appear to be promising anti-aging agents based on their amelioration of ultrastructural alterations in livers of old rats. PMID:26528730

  8. Behavioral and Neurochemical Effects of Alpha-Lipoic Acid in the Model of Parkinson's Disease Induced by Unilateral Stereotaxic Injection of 6-Ohda in Rat

    PubMed Central

    de Araújo, Dayane Pessoa; De Sousa, Caren Nádia Soares; Araújo, Paulo Victor Pontes; Menezes, Carlos Eduardo de Souza; Sousa Rodrigues, Francisca Taciana; Escudeiro, Sarah Souza; Lima, Nicole Brito Cortez; Patrocínio, Manoel Claúdio Azevedo; Aguiar, Lissiana Magna Vasconcelos; Viana, Glauce Socorro de Barros; Vasconcelos, Silvânia Maria Mendes

    2013-01-01

    This study aimed to investigate behavioral and neurochemical effects of α-lipoic acid (100 mg/kg or 200 mg/kg) alone or associated with L-DOPA using an animal model of Parkinson's disease induced by stereotaxic injection of 6-hydroxydopamine (6-OHDA) in rat striatum. Motor behavior was assessed by monitoring body rotations induced by apomorphine, open field test and cylinder test. Oxidative stress was accessed by determination of lipid peroxidation using the TBARS method, concentration of nitrite and evaluation of catalase activity. α-Lipoic acid decreased body rotations induced by apomorphine, as well as caused an improvement in motor performance by increasing locomotor activity in the open field test and use of contralateral paw (in the opposite side of the lesion produced by 6-OHDA) at cylinder test. α-lipoic acid showed antioxidant effects, decreasing lipid peroxidation and nitrite levels and interacting with antioxidant system by decreasing of endogenous catalase activity. Therefore, α-lipoic acid prevented the damage induced by 6-OHDA or by chronic use of L-DOPA in dopaminergic neurons, suggesting that α-lipoic could be a new therapeutic target for Parkinson's disease prevention and treatment. PMID:24023579

  9. The impact of high fructose on cardiovascular system: Role of α-lipoic acid.

    PubMed

    Saygin, M; Asci, H; Cankara, F N; Bayram, D; Yesilot, S; Candan, I A; Alp, H H

    2016-02-01

    The aim of this study was to evaluate the role of α-lipoic acid (α-LA) on oxidative damage and inflammation that occur in endothelium of aorta and heart while constant consumption of high-fructose corn syrup (HFCS). The rats were randomly divided into three groups with each group containing eight rats. The groups include HFCS, HFCS + α-LA treatment, and control. HFCS was given to the rats at a ratio of 30% of F30 corn syrup in drinking water for 10 weeks. α-LA treatment was given to the rats at a dose of 100 mg/kg/day orally for the last 6 weeks. At the end of the experiment, the rats were killed by cervical dislocation. The blood samples were collected for biochemical studies, and the aortic and cardiac tissues were collected for evaluation of oxidant-antioxidant system, tissue bath, and pathological examination. HFCS had increased the levels of malondialdehyde, creatine kinase MB, lactate dehydrogenase, and uric acid and showed significant structural changes in the heart of the rats by histopathology. Those changes were improved by α-LA treatment as it was found in this treatment group. Immunohistochemical expressions of tumor necrosis factor α and inducible nitric oxide synthase were increased in HFCS group, and these receptor levels were decreased by α-LA treatment. All the tissue bath studies supported these findings. Chronic consumption of HFCS caused several problems like cardiac and endothelial injury of aorta by hyperuricemia and induced oxidative stress and inflammation. α-LA treatment reduced uric acid levels, oxidative stress, and corrected vascular responses. α-LA can be added to cardiac drugs due to its cardiovascular protective effects against the cardiovascular diseases. PMID:25825413

  10. Lipoic acid as a novel treatment for Alzheimer's disease and related dementias.

    PubMed

    Holmquist, Lina; Stuchbury, Grant; Berbaum, Katrin; Muscat, Sonja; Young, Simon; Hager, Klaus; Engel, Jürgen; Münch, Gerald

    2007-01-01

    Alzheimer's disease (AD) is a progressive neurodegenerative disorder that destroys patient memory and cognition, communication ability with the social environment and the ability to carry out daily activities. Despite extensive research into the pathogenesis of AD, a neuroprotective treatment - particularly for the early stages of disease - remains unavailable for clinical use. In this review, we advance the suggestion that lipoic acid (LA) may fulfil this therapeutic need. A naturally occurring precursor of an essential cofactor for mitochondrial enzymes, including pyruvate dehydrogenase (PDH) and alpha-ketoglutarate dehydrogenase (KGDH), LA has been shown to have a variety of properties which can interfere with pathogenic principles of AD. For example, LA increases acetylcholine (ACh) production by activation of choline acetyltransferase and increases glucose uptake, thus supplying more acetyl-CoA for the production of ACh. LA chelates redox-active transition metals, thus inhibiting the formation of hydroxyl radicals and also scavenges reactive oxygen species (ROS), thereby increasing the levels of reduced glutathione. Via the same mechanisms, downregulation redox-sensitive inflammatory processes is also achieved. Furthermore, LA can scavenge lipid peroxidation products such as hydroxynonenal and acrolein. The reduced form of LA, dihydrolipoic acid (DHLA), is the active compound responsible for most of these beneficial effects. R-alpha-LA can be applied instead of DHLA, as it is reduced by mitochondrial lipoamide dehydrogenase, a part of the PDH complex. In this review, the properties of LA are explored with particular emphasis on how this agent, particularly the R-alpha-enantiomer, may be effective to treat AD and related dementias. PMID:16989905

  11. Dihydrolipoic but not alpha-lipoic acid affects susceptibility of eukaryotic cells to bacterial invasion.

    PubMed

    Bozhokina, Ekaterina; Khaitlina, Sofia; Gamaley, Irina

    2015-05-01

    Sensitivity of eukaryotic cells to facultative pathogens can depend on physiological state of host cells. Previously we have shown that pretreatment of HeLa cells with N-acetylcysteine (NAC) makes the cells 2-3-fold more sensitive to invasion by the wild-type Serratia grimesii and recombinant Escherichia coli expressing gene of actin-specific metalloprotease grimelysin [1]. To evaluate the impact of chemically different antioxidants, in the present work we studied the effects of α-Lipoic acid (LA) and dihydrolipoic acid (DHLA) on efficiency of S. grimesii and recombinant E. coli expressing grimelysin gene to penetrate into HeLa and CaCo cells. Similarly to the effect of NAC, pretreatment of HeLa and CaCo cells with 0.6 or 1.25 mM DHLA increased the entry of grimelysin producing bacteria by a factor of 2.5 and 3 for the wild-type S. grimesii and recombinant E. coli, respectively. In contrast, pretreatment of the cells with 0.6 or 1.25 mM LA did not affect the bacteria uptake. The increased invasion of HeLa and CaCo cells correlated with the enhanced expression of E-cadherin and β-catenin genes, whereas expression of these genes in the LA-treated cells was not changed. Comparison of these results suggests that it is sulfhydryl group of DHLA that promotes efficient modification of cell properties assisting bacterial uptake. We assume that the NAC- and DHLA-induced stimulation of the E-cadherin-catenin pathway contributes to the increased internalization of the grimelysin producing bacteria within transformed cells. PMID:25817791

  12. Alpha lipoic acid inhibits proliferation and epithelial mesenchymal transition of thyroid cancer cells.

    PubMed

    Jeon, Min Ji; Kim, Won Gu; Lim, Seonhee; Choi, Hyun-Jeung; Sim, Soyoung; Kim, Tae Yong; Shong, Young Kee; Kim, Won Bae

    2016-01-01

    The naturally occurring short-chain fatty acid, α-lipoic acid (ALA) is a powerful antioxidant which is clinically used for treatment of diabetic neuropathy. Recent studies suggested the possibility of ALA as a potential anti-cancer agent, because it could activate adenosine monophosphate activated protein kinase (AMPK) and inhibit transforming growth factor-β (TGFβ) pathway. In this study, we evaluate the effects of ALA on thyroid cancer cell proliferation, migration and invasion. We performed in vitro cell proliferation analysis using BCPAP, HTH-83, CAL-62 and FTC-133 cells. ALA suppressed thyroid cancer cell proliferation through activation of AMPK and subsequent down-regulation of mammalian target of rapamycin (mTOR)-S6 signaling pathway. Low-dose ALA, which had minimal effects on cell proliferation, also decreased cell migration and invasion of BCPAP, CAL-62 and HTH-83 cells. ALA inhibited epithelial mesenchymal transition (EMT) evidently by increase of E-cadherin and decreases of activated β-catenin, vimentin, snail, and twist in these cells. ALA suppressed TGFβ production and inhibited induction of p-Smad2 and twist by TGFβ1 or TGFβ2. These findings indicate that ALA reduces cancer cell migration and invasion through suppression of TGFβ production and inhibition of TGFβ signaling pathways in thyroid cancer cells. ALA also significantly suppressed tumor growth in mouse xenograft model using BCPAP and FTC-133 cells. This is the first study to show anti-cancer effect of ALA on thyroid cancer cells. ALA could be a potential therapeutic agent for treatment of advanced thyroid cancer, possibly as an adjuvant therapy with other systemic therapeutic agents. PMID:26463583

  13. Effect of myo-inositol and alpha-lipoic acid on oocyte quality in polycystic ovary syndrome non-obese women undergoing in vitro fertilization: a pilot study.

    PubMed

    Rago, R; Marcucci, I; Leto, G; Caponecchia, L; Salacone, P; Bonanni, P; Fiori, C; Sorrenti, G; Sebastianelli, A

    2015-01-01

    The aim of the present study was to evaluate the effectiveness of the combined administration of myo-inositol and α-lipoic acid in polycystic ovary syndrome (PCOS) patients with normal body mass index (BMI), who had previously undergone intracytoplasmic sperm injection (ICSI) and received myo-inositol alone. Thirty-six of 65 normal-weight patients affected by PCOS who did not achieve pregnancy and one patient who had a spontaneous abortion were re-enrolled and given a cycle of treatment with myo-inositol and α-lipoic acid. For all female partners of the treated couples, the endocrine-metabolic and ultrasound parameters, ovarian volume, oocyte and embryo quality, and pregnancy rates were assessed before and after three months of treatment and compared with those of previous in vitro fertilization (IVF) cycle(s). After supplementation of myo-inositol with α-lipoic acid, insulin levels, BMI and ovarian volume were significantly reduced compared with myo-inositol alone. No differences were found in the fertilization and cleavage rate or in the mean number of transferred embryos between the two different treatments, whereas the number of grade 1 embryos was significantly increased, with a significant reduction in the number of grade 2 embryos treated with myo-inositol plus α-lipoic acid. Clinical pregnancy was not significantly different with a trend for a higher percentage for of myo-inositol and α-lipoic acid compared to the myo-inositol alone group. Our preliminary data suggest that the supplementation of myo-inositol and α-lipoic acid in PCOS patients undergoing an IVF cycle can help to improve their reproductive outcome and also their metabolic profiles, opening potential for their use in long-term prevention of PCOS. PMID:26753656

  14. Stability, cutaneous delivery and antioxidant potential of a lipoic acid and α-tocopherol co-drug incorporated in microemulsions

    PubMed Central

    Thomas, Siji; Vieira, Camila S.; Hass, Martha A.; Lopes, Luciana B.

    2014-01-01

    The aim of this study was to assess the skin penetration, stability and antioxidant effects of a α-tocopherol-lipoic acid co-drug. To enhance penetration, we evaluated three microemulsions varying in water content and composition of the oil phase (isopropyl myristate with either monocaprylin or oleic acid). The co-drug was incorporated at 1% (w/w). Co-drug hydrolysis in the microemulsion increased with increases in time (up to 48 h) and formulation water content (10–30%, w/w). Microemulsions increased the co-drug delivery into viable layers of porcine ear skin by 2.9–7.8–fold compared to a control formulation (20% monocaprylin in isopropyl myristate) after 24 h. Penetration enhancement was influenced by the oil phase, with the formulation containing monocaprylin displaying the most pronounced effect. Antioxidant activity, assessed in skin bioequivalents using the thiobarbituric acid-reactive substances (TBARS) assay, demonstrated that TBARS levels decreased by 39% after treatment with the co-drug-containing microemulsion compared to the unloaded formulation. In addition to the co-drug, tocopherol (8.2 ± 0.6 μg/cm2) was detected in the viable bioequivalent tissues, suggesting that the co-drug was partly hydrolyzed after 12 h. Taken together, these results support the potential of nanodispersed formulations containing a tocopherol-lipoic acid co-drug to improve skin antioxidant activity. PMID:24961388

  15. Effects of lipoic acid on lipolysis in 3T3-L1 adipocytes[S

    PubMed Central

    Fernández-Galilea, Marta; Pérez-Matute, Patricia; Prieto-Hontoria, Pedro L; Martinez, J Alfredo; Moreno-Aliaga, Maria J

    2012-01-01

    Lipoic acid (LA) is a naturally occurring compound with beneficial effects on obesity. The aim of this study was to evaluate its effects on lipolysis in 3T3-L1 adipocytes and the mechanisms involved. Our results revealed that LA induced a dose- and time-dependent lipolytic action, which was reversed by pretreatment with the c-Jun N-terminal kinase inhibitor SP600125, the PKA inhibitor H89, and the AMP-activated protein kinase activator AICAR. In contrast, the PI3K/Akt inhibitor LY294002 and the PDE3B antagonist cilostamide enhanced LA-induced lipolysis. LA treatment for 1 h did not modify total protein content of hormone-sensitive lipase (HSL) but significantly increased the phosphorylation of HSL at Ser563 and at Ser660, which was reversed by H89. LA treatment also induced a marked increase in PKA-mediated perilipin phosphorylation. LA did not significantly modify the protein levels of adipose triglyceride lipase or its activator comparative gene identification 58 (CGI-58) and inhibitor G(0)/G(1) switch gene 2 (G0S2). Furthermore, LA caused a significant inhibition of adipose-specific phospholipase A2 (AdPLA) protein and mRNA levels in parallel with a decrease in the amount of prostaglandin E2 released and an increase in cAMP content. Together, these data suggest that the lipolytic actions of LA are mainly mediated by phosphorylation of HSL through cAMP-mediated activation of protein kinase A probably through the inhibition of AdPLA and prostaglandin E2. PMID:22941773

  16. Bio-active nanoemulsions enriched with gold nanoparticle, marigold extracts and lipoic acid: In vitro investigations.

    PubMed

    Guler, Emine; Barlas, F Baris; Yavuz, Murat; Demir, Bilal; Gumus, Z Pinar; Baspinar, Yucel; Coskunol, Hakan; Timur, Suna

    2014-09-01

    A novel and efficient approach for the preparation of enriched herbal formulations was described and their potential applications including wound healing and antioxidant activity (cell based and cell free) were investigated via in vitro cell culture studies. Nigella sativa oil was enriched with Calendula officinalis extract and lipoic acid capped gold nanoparticles (AuNP-LA) using nanoemulsion systems. The combination of these bio-active compounds was used to design oil in water (O/W) and water in oil (W/O) emulsions. The resulted emulsions were characterized by particle size measurements. The phenolic content of each nanoemulsion was examined by using both colorimetric assay and chromatographic analyses. Two different methods containing cell free chemical assay (1-diphenyl-2-picrylhydrazyl method) and cell based antioxidant activity test were used to evaluate the antioxidant capacities. In order to investigate the bio-activities of the herbal formulations, in vitro cell culture experiments, including cytotoxicity, scratch assay, antioxidant activity and cell proliferation were carried out using Vero cell line as a model cell line. Furthermore, to monitor localization of the nanoemulsions after application of the cell culture, the cell images were monitored via fluorescence microscope after FITC labeling. All data confirmed that the enriched N. sativa formulations exhibited better antioxidant and wound healing activity than N. sativa emulsion without any enrichment. In conclusion, the incorporation of AuNP-LA and C. officinalis extract into the N. sativa emulsions significantly increased the bio-activities. The present work may support further studies about using the other bio-active agents for the enrichment of herbal preparations to strengthen their activities. PMID:25009101

  17. Protective effects of L-carnitine and alpha-lipoic acid in rats with adjuvant arthritis.

    PubMed

    Tastekin, Nurettin; Aydogdu, Nurettin; Dokmeci, Dikmen; Usta, Ufuk; Birtane, Murat; Erbas, Hakan; Ture, Mevlut

    2007-10-01

    Free radicals play an important role in the pathophysiology of adjuvant arthritis. The purpose of this study was to assess the efficacy of L-carnitine (LC) and alpha-lipoic acid (alpha-LA) which are known to have antioxidant effects, in the treatment of adjuvant arthritis. Arthritis model was created by the administration of complete Freund's adjuvant (CFA) in 32 of 40 male Sprague-Dawley rats. The rats were divided into five groups. Rats in Group I served as controls and received 0.1 ml kg(-1) saline. Group II received only 0.1 ml of CFA and served as the CFA-control for the other groups. Groups III-V, after being injected with CFA, were treated with LC, alpha-LA or diclofenac, respectively. Levels of malondialdehyde (MDA) and glutathione (GSH) were measured in plasma samples. Enzyme activities of superoxide dismutase (SOD) and glutathione peroxidase (GPx) were measured. The paws of rats were evaluated histopathologically to investigate the anti-inflammatory effects. TNF-alpha levels were measured for the evaluation of inflammation. In Group II plasma MDA increased, levels of glutathione decreased, enzyme activities of SOD and GPx decreased. Histopathological damage increased in the paws of the rats in this group. MDA levels decreased in Groups III-V when compared with Group II. GSH levels significantly increased in Group III and IV than Group V. SOD activity of Group IV was higher than Group III and V. TNF-alpha levels were significantly lower in Group IV and V. LC and alpha-LA seemed to have protective effects against oxidative damage in adjuvant arthritis model. PMID:17826175

  18. Reduction of Conjunctival Fibrosis After Trabeculectomy Using Topical α-Lipoic Acid in Rabbit Eyes

    PubMed Central

    Çagatay, Halil Hüseyin; Ceylan, Erdinç; Keles, Sadullah; Koban, Yaran; Gokce, Gökçen; Huseyinoğlu, Urfettin; Ozcan, Ece; Oba, Mehmet E.

    2014-01-01

    Purpose: To evaluate the efficacy of α-lipoic acid (ALA) in reducing scarring after trabeculectomy. Materials and Methods: Eighteen adult New Zealand white rabbits underwent trabeculectomy. During trabeculectomy, thin sponges were placed between the sclera and Tenon’s capsule for 3 minutes, saline solution, mitomycin-C (MMC) and ALA was applied to the control group (CG) (n=6 eyes), MMC group (MMCG) (n=6 eyes), and ALA group (ALAG) (n=6 eyes), respectively. After surgery, topical saline and ALA was applied for 28 days to the control and ALAGs, respectively. Filtrating bleb patency was evaluated by using 0.1% trepan blue. Hematoxylin and eosin and Masson trichrome staining for toxicity, total cellularity, and collagen organization; α-smooth muscle actin immunohistochemistry staining performed for myofibroblast phenotype identification. Results: Clinical evaluation showed that all 6 blebs (100%) of the CG had failed, whereas there were only 2 failures (33%) in the ALAG and no failures in the MMCG on day 28. Histologic evaluation showed significantly lower inflammatory cell infiltration in the ALAGs and CGs than the MMCG. Toxicity change was more significant in the MMCG than the control and ALAGs. Collagen was better organized in the ALAG than control and MMCGs. In immunohistochemistry evaluation, ALA significantly reduced the population of cells expressing α-smooth muscle action. Conclusions: ΑLA prevents and/or reduces fibrosis by inhibition of inflammation pathways, revascularization, and accumulation of extracellular matrix. It can be used as an agent for delaying tissue regeneration and for providing a more functional-permanent fistula. PMID:25055213

  19. α-Lipoic Acid Antioxidant Treatment Limits Glaucoma-Related Retinal Ganglion Cell Death and Dysfunction

    PubMed Central

    Calkins, David J.; Horner, Philip J.

    2013-01-01

    Oxidative stress has been implicated in neurodegenerative diseases, including glaucoma. However, due to the lack of clinically relevant models and expense of long-term testing, few studies have modeled antioxidant therapy for prevention of neurodegeneration. We investigated the contribution of oxidative stress to the pathogenesis of glaucoma in the DBA/2J mouse model of glaucoma. Similar to other neurodegenerative diseases, we observed lipid peroxidation and upregulation of oxidative stress-related mRNA and protein in DBA/2J retina. To test the role of oxidative stress in disease progression, we chose to deliver the naturally occurring, antioxidant α-lipoic acid (ALA) to DBA/2J mice in their diet. We used two paradigms for ALA delivery: an intervention paradigm in which DBA/2J mice at 6 months of age received ALA in order to intervene in glaucoma development, and a prevention paradigm in which DBA/2J mice were raised on a diet supplemented with ALA, with the goal of preventing glaucoma development. At 10 and 12 months of age (after 4 and 11 months of dietary ALA respectively), we measured changes in genes and proteins related to oxidative stress, retinal ganglion cell (RGC) number, axon transport, and axon number and integrity. Both ALA treatment paradigms showed increased antioxidant gene and protein expression, increased protection of RGCs and improved retrograde transport compared to control. Measures of lipid peroxidation, protein nitrosylation, and DNA oxidation in retina verified decreased oxidative stress in the prevention and intervention paradigms. These data demonstrate the utility of dietary therapy for reducing oxidative stress and improving RGC survival in glaucoma. PMID:23755225

  20. Attenuation of uremia by orally feeding alpha-lipoic acid on acetaminophen induced uremic rats.

    PubMed

    Pradhan, Shrabani; Mandal, Shreya; Roy, Suchismita; Mandal, Arpita; Das, Koushik; Nandi, Dilip K

    2013-04-01

    Uremia means excess nitrogenous waste products in the blood & their toxic effects. An acute acetaminophen (paracetamol, N-acetyl p-aminophenol; APAP) overdose may result into potentially fatal hepatic and renal necrosis in humans and experimental animals. The aims of this present study were to investigate the protective effect of alpha-lipoic acid (ALA) on oxidative stress & uremia on male albino rats induced by acetaminophen. The study was performed by 24 albino male Wister strain rats which were randomly divided into four groups: Group I, control - receives normal food and water, Groups II, III & IV receive acetaminophen interperitoneally at the dose of 500 mg/kg/day for 10 days, from 11th day Groups III & IV were treated with ALA at the dose of 5 mg & 10 mg/100 g/day for 15 days, respectively. After 25 days of treatment, it was observed that there was a significant increase in plasma urea, creatinine, sodium and malondialdehyde (MDA) levels (p < 0.05) but a significant decrease in super oxide dismutase (SOD) & catalase activity & potassium level in uremic group is compared with control group & there was a significant increase in SOD & catalase (p < 0.05) & a significant decrease in serum urea, creatinine & Na and MDA (p < 0.05) in Group III & Group IV is compared with Group II & significant changes were observed in high ALA dose group. In conclusion it was observed that the ALA has nephroprotective activities by biochemical observations against acetaminophen induced uremic rats. PMID:23960834

  1. Spectroscopic studies of R(+)-α-lipoic acid--cyclodextrin complexes.

    PubMed

    Ikuta, Naoko; Tanaka, Akira; Otsubo, Ayako; Ogawa, Noriko; Yamamoto, Hiromitsu; Mizukami, Tomoyuki; Arai, Shoji; Okuno, Masayuki; Terao, Keiji; Matsugo, Seiichi

    2014-01-01

    α-Lipoic acid (ALA) has a chiral center at the C6 position, and exists as two enantiomers, R(+)-ALA (RALA) and S(-)-ALA (SALA). RALA is naturally occurring, and is a cofactor for mitochondrial enzymes, therefore playing a major role in energy metabolism. However, RALA cannot be used for pharmaceuticals or nutraceuticals because it readily polymerizes via a 1,2-dithiolane ring-opening when exposed to light or heat. So, it is highly desired to find out the method to stabilize RALA. The purpose of this study is to provide the spectroscopic information of stabilized RALA and SALA through complexation with cyclodextrins (CDs), α-CD, β-CD and γ-CD and to examine the physical characteristics of the resultant complexes in the solid state. The RALA-CD structures were elucidated based on the micro fourier transform infrared (FT-IR) and Raman analyses. The FT-IR results showed that the C=O stretching vibration of RALA appeared at 1717 cm⁻¹ and then shifted on formation of the RALA-CD complexes. The Raman spectra showed that the S-S and C-S stretching vibrations for RALA at 511 cm⁻¹ (S-S), 631 cm⁻¹ (C-S) and 675 cm⁻¹ (C-S) drastically weakened and almost disappeared upon complexation with CDs. Several peaks indicative of O-H vibrations also shifted or changed in intensity. These results indicate that RALA and CDs form host-guest complexes by interacting with one another. PMID:25387076

  2. Interaction of α-Lipoic Acid with the Human Na+/Multivitamin Transporter (hSMVT).

    PubMed

    Zehnpfennig, Britta; Wiriyasermkul, Pattama; Carlson, David A; Quick, Matthias

    2015-06-26

    The human Na(+)/multivitamin transporter (hSMVT) has been suggested to transport α-lipoic acid (LA), a potent antioxidant and anti-inflammatory agent used in therapeutic applications, e.g. in the treatment of diabetic neuropathy and Alzheimer disease. However, the molecular basis of the cellular delivery of LA and in particular the stereospecificity of the transport process are not well understood. Here, we expressed recombinant hSMVT in Pichia pastoris and used affinity chromatography to purify the detergent-solubilized protein followed by reconstitution of hSMVT in lipid bilayers. Using a combined approach encompassing radiolabeled LA transport and equilibrium binding studies in conjunction with the stabilized R-(+)- and S-(-)-enantiomers and the R,S-(+/-) racemic mixture of LA or lipoamide, we identified the biologically active form of LA, R-LA, to be the physiological substrate of hSMVT. Interaction of R-LA with hSMVT is strictly dependent on Na(+). Under equilibrium conditions, hSMVT can simultaneously bind ~2 molecules of R-LA in a biphasic binding isotherm with dissociation constants (Kd) of 0.9 and 7.4 μm. Transport of R-LA in the oocyte and reconstituted system is exclusively dependent on Na(+) and exhibits an affinity of ~3 μm. Measuring transport with known amounts of protein in proteoliposomes containing hSMVT in outside-out orientation yielded a catalytic turnover number (kcat) of about 1 s(-1), a value that is well in agreement with other Na(+)-coupled transporters. Our data suggest that hSMVT-mediated transport is highly specific for R-LA at our tested concentration range, a finding with wide ramifications for the use of LA in therapeutic applications. PMID:25971966

  3. The Protective Effects of 5-Methoxytryptamine-α-lipoic Acid on Ionizing Radiation-Induced Hematopoietic Injury

    PubMed Central

    Li, Deguan; Tian, Zhenyuan; Tang, Weisheng; Zhang, Junling; Lu, Lu; Sun, Zhaojin; Zhou, Zewei; Fan, Feiyue

    2016-01-01

    Antioxidants are prospective radioprotectors because of their ability to scavenge radiation-induced reactive oxygen species (ROS). The hematopoietic system is widely studied in radiation research because of its high radiosensitivity. In the present study, we describe the beneficial effects of 5-methoxytryptamine-α-lipoic acid (MLA), which was synthesized from melatonin and α-lipoic acid, against radiation-induced hematopoietic injury. MLA administration significantly enhanced the survival rate of mice after 7.2 Gy total body irradiation. The results showed that MLA not only markedly increased the numbers and clonogenic potential of hematopoietic cells but also decreased DNA damage, as determined by flow cytometric analysis of histone H2AX phosphorylation. In addition, MLA decreased the levels of ROS in hematopoietic cells by inhibiting NOX4 expression. These data demonstrate that MLA prevents radiation-induced hematopoietic syndrome by increasing the number and function of and by inhibiting DNA damage and ROS production in hematopoietic cells. These data suggest MLA is beneficial for the protection of radiation injuries. PMID:27314327

  4. Novel Conjugates of 1,3-Diacylglycerol and Lipoic Acid: Synthesis, DPPH Assay, and RP-LC-MS-APCI Analysis

    PubMed Central

    Madawala, Samanthi R. P.; Andersson, Rolf E.; Jastrebova, Jelena A.; Almeida, Maria; Dutta, Paresh C.

    2011-01-01

    1,3-Diacylglycerol is known to reduce body weight and fat deposits in humans. α-Lipoic acid is a potent antioxidant and effective against many pathological conditions, including obesity and related metabolic syndromes. The present work is based on the hypothesis that the hybrid molecules of 1,3-diacylglycerol and lipoic acid possess synergistic and/or additive effects compared with the parent compounds against obesity, overweight, and related metabolic syndromes. Laboratory scale synthesis of 1,3-dioleoyl-2-lipoyl-sn-glycerol (yield 80%) and 1,3-dioleoyl-2-dihydrolipoyl-sn-glycerol (yield 70%) was performed for the first time and supported by NMR and MS data. Free radical scavenging capacity of the conjugates was assayed using DPPH test. A remarkably high in vitro free radical scavenging capacity was demonstrated for the 1,3-dioleoyl-2-dihydrolipoyl-sn-glycerol (EC50 value 0.21). RP-HPLC-MS-APCI analysis showed satisfactory separation between the conjugates (R~1). Protonated molecular ion of the conjugates at m/z 809 and m/z at 811, respectively, and their characteristic fragment ions were abundant. PMID:21966595

  5. The disulfide compound α-lipoic acid and its derivatives: A novel class of anticancer agents targeting mitochondria.

    PubMed

    Dörsam, Bastian; Fahrer, Jörg

    2016-02-01

    The endogenous disulfide α-lipoic acid (LA) is an essential mitochondrial co-factor. In addition, LA and its reduced counterpart dihydro lipoic acid form a potent redox couple with antioxidative functions, for which it is used as dietary supplement and therapeutic. Recently, it has gained attention due to its cytotoxic effects in cancer cells, which is the key aspect of this review. We initially recapitulate the dietary occurrence, gastrointestinal absorption and pharmacokinetics of LA, illustrating its diverse antioxidative mechanisms. We then focus on its mode of action in cancer cells, in which it triggers primarily the mitochondrial pathway of apoptosis, whereas non-transformed primary cells are hardly affected. Furthermore, LA impairs oncogenic signaling and displays anti-metastatic potential. Novel LA derivatives such as CPI-613, which target mitochondrial energy metabolism, are described and recent pre-clinical studies are presented, which demonstrate that LA and its derivatives exert antitumor activity in vivo. Finally, we highlight clinical studies currently performed with the LA analog CPI-613. In summary, LA and its derivatives are promising candidates to complement the arsenal of established anticancer drugs due to their mitochondria-targeted mode of action and non-genotoxic properties. PMID:26604131

  6. The Protective Effects of 5-Methoxytryptamine-α-lipoic Acid on Ionizing Radiation-Induced Hematopoietic Injury.

    PubMed

    Li, Deguan; Tian, Zhenyuan; Tang, Weisheng; Zhang, Junling; Lu, Lu; Sun, Zhaojin; Zhou, Zewei; Fan, Feiyue

    2016-01-01

    Antioxidants are prospective radioprotectors because of their ability to scavenge radiation-induced reactive oxygen species (ROS). The hematopoietic system is widely studied in radiation research because of its high radiosensitivity. In the present study, we describe the beneficial effects of 5-methoxytryptamine-α-lipoic acid (MLA), which was synthesized from melatonin and α-lipoic acid, against radiation-induced hematopoietic injury. MLA administration significantly enhanced the survival rate of mice after 7.2 Gy total body irradiation. The results showed that MLA not only markedly increased the numbers and clonogenic potential of hematopoietic cells but also decreased DNA damage, as determined by flow cytometric analysis of histone H2AX phosphorylation. In addition, MLA decreased the levels of ROS in hematopoietic cells by inhibiting NOX4 expression. These data demonstrate that MLA prevents radiation-induced hematopoietic syndrome by increasing the number and function of and by inhibiting DNA damage and ROS production in hematopoietic cells. These data suggest MLA is beneficial for the protection of radiation injuries. PMID:27314327

  7. Increasing bioavailability of (R)-alpha-lipoic acid to boost antioxidant activity in the treatment of neuropathic pain.

    PubMed

    Maglione, Emilia; Marrese, Cinzia; Migliaro, Elisa; Marcuccio, Fortuna; Panico, Claudia; Salvati, Carmine; Citro, Giuseppe; Quercio, Marco; Roncagliolo, Federico; Torello, Carlo; Brufani, Mario

    2015-01-01

    a-lipoic acid (a-LA) is a potent natural antioxidant because it has a broad spectrum of action towards a great many free radical species and boosts the endogenous antioxidant systems.Although it is a multi-functional molecule, its pharmacokinetic characteristics pose restrictions to its use in the treatment of oxidative stress-dependent illnesses. Formulations that increase the bioavailability of a-LA have a better potential efficacy as adjuvants for the treatment of these conditions.This objective was achieved with a liquid formulation for oral use containing only R-aLA, the natural enantiomeric and most active form of a-lipoic acid.For the first time, the effects of this formulation were evaluated on neuropathic pain, a symptom caused by an increase in oxidative stress, regardless of the underlying cause. Neuropathic patients who have used this dietary supplement noticed an improvement in their quality of life and a significant reduction was observed in a number of certain descriptive pain parameters (intensity, burning, unpleasantness, superficial pain).Undoubtedly further, more in-depth, studies need to be conducted; however, this first investigation confirms the role of R-aLA as an anti-oxidant for the aetiological treatment of peripheral neuropathy. Increasing its plasma bioavailability even after a non-invasive administration through the oral route is a good starting point for proposing a valid adjuvant for the treatment of pain symptoms. PMID:26694149

  8. Alpha-lipoic acid: an inhibitor of secretory phospholipase A2 with anti-inflammatory activity.

    PubMed

    Jameel, Noor Mohamed; Shekhar, Mysore A; Vishwanath, Bannikuppe S

    2006-12-14

    Alpha-lipoic acid (ALA) and its reduced form dihydrolipoic acid (DHLA) are powerful antioxidants both in hydrophilic and lipophylic environments with diverse pharmacological properties including anti-inflammatory activity. The mechanism of anti-inflammatory activity of ALA and DHALA is not known. The present study describes the interaction of ALA and DHALA with pro-inflammatory secretory PLA(2) enzymes from inflammatory fluids and snake venoms. In vitro enzymatic inhibition of sPLA(2) from Vipera russellii, Naja naja and partially purified sPLA(2) enzymes from human ascitic fluid (HAF), human pleural fluid (HPF) and normal human serum (HS) by ALA and DHLA was studied using (14)C-oleate labeled Escherichia coli as the substrate. Biophysical interaction of ALA with sPLA(2) was studied by fluorescent spectral analysis and circular dichroism studies. In vivo anti-inflammatory activity was checked using sPLA(2) induced mouse paw edema model. ALA but not DHLA inhibited purified sPLA(2) enzymes from V. russellii, N. naja and partially purified HAF, HPF and HS in a dose dependent manner. This data indicated that ALA is critical for inhibition. IC(50) value calculated for these enzymes ranges from 0.75 to 3.0 microM. The inhibition is independent of calcium and substrate concentration. Inflammatory sPLA(2) enzymes are more sensitive to inhibition by ALA than snake venom sPLA(2) enzymes. ALA quenched the fluorescence intensity of sPLA(2) enzyme in a dose dependent manner. Apparent shift in the far UV-CD spectra of sPLA(2) with ALA indicated change in its alpha-helical confirmation and these results suggest its direct interaction with the enzyme. ALA inhibits the sPLA(2) induced mouse paw edema in a dose dependent manner and confirms the sPLA(2) inhibitory activity in vivo also. These data suggest that ALA may act as an endogenous regulator of sPLA(2) enzyme activity and suppress inflammatory reactions. PMID:17011589

  9. [Changes in antioxidant capacity of the guinea pig exposed to noise and the protective effect of alpha-lipoic acid against acoustic trauma].

    PubMed

    Diao, Ming-Fang; Liu, Hai-Ying; Zhang, Yan-Min; Gao, Wen-Yuan

    2003-12-25

    The study was aimed at exploring the effect of noise on total antioxidant capacity (TAC) in serum, nitric oxide (NO) level in the cochlea and the protective action of alpha-lipoic acid against noise-induced hearing loss (NIHL). Sixty guinea pigs (350-400 g) were divided randomly into three groups (control group, noise+saline group and noise+alpha-lipoic acid group). Serum and cochlear tissue were treated immediately after noise exposure (4-kHz octave band, 115 dB SPL 5 h) to determine the level of TAC and NO, respectively. Auditory brainstem responses (ABRs) were measured before and immediately after exposure. The threshold of hearing in the control group was relatively stable, while the hearing threshold in the noise+saline group was significantly higher than those in the noise+alpha-lipoic acid group (P<0.05). TAC level of the noise+saline group was significantly lower than that of the control group P<0.05 . TAC level of the noise+alpha-lipoic acid group was significantly higher than that of the noise+saline group P<0.05 , while there was no significant difference in the levels between the noise+alpha-lipoic acid group and the control group (P>0.05). The NO level of the cochlear tissue in the noise+saline group was significantly higher than that of the control group (P<0.05). Cochlear NO level in the noise+alpha-lipoic acid group was significantly lower than that of the noise+saline group (P<0.05), while there was no significant difference in cochlear NO levels between the noise+alpha-lipoic acid group and the control group (P>0.05). The results obtained indicate that noise exposure causes a decrease in serum TAC and an increase in NO in cochlea. alpha-Lipoid acid exerts a protective effect against hearing loss in acoustic trauma through its antioxidant effects. PMID:14695484

  10. Age-dependent modulation of synaptic plasticity and insulin mimetic effect of lipoic acid on a mouse model of Alzheimer's disease.

    PubMed

    Sancheti, Harsh; Akopian, Garnik; Yin, Fei; Brinton, Roberta D; Walsh, John P; Cadenas, Enrique

    2013-01-01

    Alzheimer's disease is a progressive neurodegenerative disease that entails impairments of memory, thinking and behavior and culminates into brain atrophy. Impaired glucose uptake (accumulating into energy deficits) and synaptic plasticity have been shown to be affected in the early stages of Alzheimer's disease. This study examines the ability of lipoic acid to increase brain glucose uptake and lead to improvements in synaptic plasticity on a triple transgenic mouse model of Alzheimer's disease (3xTg-AD) that shows progression of pathology as a function of age; two age groups: 6 months (young) and 12 months (old) were used in this study. 3xTg-AD mice fed 0.23% w/v lipoic acid in drinking water for 4 weeks showed an insulin mimetic effect that consisted of increased brain glucose uptake, activation of the insulin receptor substrate and of the PI3K/Akt signaling pathway. Lipoic acid supplementation led to important changes in synaptic function as shown by increased input/output (I/O) and long term potentiation (LTP) (measured by electrophysiology). Lipoic acid was more effective in stimulating an insulin-like effect and reversing the impaired synaptic plasticity in the old mice, wherein the impairment of insulin signaling and synaptic plasticity was more pronounced than those in young mice. PMID:23875003

  11. Alpha-Lipoic Acid and Antioxidant Diet Help to Improve Endothelial Dysfunction in Adolescents with Type 1 Diabetes: A Pilot Trial

    PubMed Central

    Scaramuzza, Andrea; Giani, Elisa; Redaelli, Francesca; Ungheri, Saverio; Macedoni, Maddalena; Giudici, Valentina; Bosetti, Alessandra; Ferrari, Matteo; Zuccotti, Gian Vincenzo

    2015-01-01

    After evaluating the prevalence of early endothelial dysfunction, as measured by means of reactive hyperemia in adolescents with type 1 diabetes, we started a 6-month, double-blind, randomized trial to test the efficacy of an antioxidant diet (± alpha-lipoic acid supplementation) to improve endothelial dysfunction. Seventy-one children and adolescents, ages 17 ± 3.9 yrs, with type 1 diabetes since 9.5 ± 5.3 yrs, using intensified insulin therapy, were randomized into 3 arms: (a) antioxidant diet 10.000 ORAC + alpha-lipoic acid; (b) antioxidant diet 10.000 ORAC + placebo; (c) controls. BMI, blood pressure, fasting lipid profile, HbA1c, insulin requirement, dietary habits, and body composition were determined in each patient. An antioxidant diet significantly improved endothelial dysfunction when supplemented with alpha-lipoic acid, unlike diet with placebo or controls. A significant reduction in bolus insulin was also observed. We speculate that alpha-lipoic acid might have an antioxidant effect in pediatric diabetes patients by reducing insulin. PMID:26171398

  12. Effect of the Administration of Alpha-Lipoic Acid on Contrast Sensitivity in Patients with Type 1 and Type 2 Diabetes

    PubMed Central

    Gębka, Anna; Raczyńska, Dorota

    2014-01-01

    The aim of this study was to estimate the effects of oral supplementation of alpha-lipoic acid (ALA) on contrast sensitivity (CS) in patients with type 1 diabetes mellitus (T1DM) and type 2 diabetes mellitus (T2DM). The study included 12 patients with T1DM aged 43±12 years, 48 patients with T2DM aged 59±10 years, and 20 control subjects aged 33±8 years. Patients from each studied group, including the control group, were randomly assigned to receive 300 mg of ALA orally once daily for 3 months. CS was evaluated with the Functional Acuity Contrast Test (FACT, Stereo Optical). In the group of patients with T1DM receiving ALA for 3 months CS remained stable and improved in those with T2DM. Reduction of CS in both T1DM and T2DM patients without alpha-lipoic acid supplementation was observed. In the control group on alpha-lipoic acid supplementation, CS improvement was noticed at one spatial frequency. Changes in the CS were observed, despite stable visual acuity and eye fundus image in all studied subjects. Our study demonstrated that oral administration of alpha-lipoic acid had influence on CS in both T1DM and T2DM patients. PMID:24665163

  13. Development of Sensitive Analytical Approach for the Quantification of α-Lipoic Acid Using Boron Doped Diamond Electrode.

    PubMed

    Stankovic, Dalibor M; Mehmeti, Eda; Kalcher, Kurt

    2016-01-01

    A boron doped diamond (BDD) electrode was investigated for use as an electrochemical sensor for α-lipoic acid (LA) using amperometric and differential pulse voltammetric detection. LA displays a well expressed oxidation peak at +0.9 V vs. Ag/AgCl in solutions with a pH value of 3. It was found that signals obtained are linearly related to the concentration range from 0.3 to 105 μM with detection limit of 0.088 μM. Interferences by common compounds such as ascorbic acid, uric acid and dopamine were tested and the method was successfully applied to the determination of LA in human body fluids where it gave recoveries in the range from 95 to 97%. PMID:27506710

  14. Alpha Lipoic Acid Attenuates Radiation-Induced Thyroid Injury in Rats

    PubMed Central

    Jung, Jung Hwa; Jung, Jaehoon; Kim, Soo Kyoung; Woo, Seung Hoon; Kang, Ki Mun; Jeong, Bae-Kwon; Jung, Myeong Hee; Kim, Jin Hyun; Hahm, Jong Ryeal

    2014-01-01

    Exposure of the thyroid to radiation during radiotherapy of the head and neck is often unavoidable. The present study aimed to investigate the protective effect of α-lipoic acid (ALA) on radiation-induced thyroid injury in rats. Rats were randomly assigned to four groups: healthy controls (CTL), irradiated (RT), received ALA before irradiation (ALA + RT), and received ALA only (ALA, 100 mg/kg, i.p.). ALA was treated at 24 h and 30 minutes prior to irradiation. The neck area including the thyroid gland was evenly irradiated with 2 Gy per minute (total dose of 18 Gy) using a photon 6-MV linear accelerator. Greater numbers of abnormal and unusually small follicles in the irradiated thyroid tissues were observed compared to the controls and the ALA group on days 4 and 7 after irradiation. However, all pathologies were decreased by ALA pretreatment. The quantity of small follicles in the irradiated rats was greater on day 7 than day 4 after irradiation. However, in the ALA-treated irradiated rats, the numbers of small and medium follicles were significantly decreased to a similar degree as in the control and ALA-only groups. The PAS-positive density of the colloid in RT group was decreased significantly compared with all other groups and reversed by ALA pretreatment. The high activity index in the irradiated rats was lowered by ALA treatment. TGF-ß1 immunoreactivity was enhanced in irradiated rats and was more severe on the day 7 after radiation exposure than on day 4. Expression of TGF-ß1 was reduced in the thyroid that had undergone ALA pretreatment. Levels of serum pro-inflammatory cytokines (TNF-α, IL-1ß and IL-6) did not differ significantly between the all groups. This study provides that pretreatment with ALA decreased the severity of radiation-induced thyroid injury by reducing inflammation and fibrotic infiltration and lowering the activity index. Thus, ALA could be used to ameliorate radiation-induced thyroid injury. PMID:25401725

  15. Α‑lipoic acid protects against cerebral ischemia/reperfusion-induced injury in rats.

    PubMed

    Deng, Houliang; Zuo, Xialin; Zhang, Jingjing; Liu, Xiaoxia; Liu, Li; Xu, Qian; Wu, Zhuomin; Ji, Aimin

    2015-05-01

    It is well established that the brain is sensitive to ischemia/reperfusion (I/R)‑induced injury. α‑lipoic acid (LA), a free radical scavenger and antioxidant, has a neuroprotective effect against cerebral I/R‑induced injury, however, the underlying mechanisms remain to be elucidated. Therefore, the present study was undertaken to evaluate whether LA was able to protect against cerebral I/R‑induced injury and to examine the potential mechanisms. The neuroprotective effects of LA were investigated in a rat model of transient focal ischemia induced by middle cerebral artery occlusion (MCAO) followed by reperfusion. Adult male Sprague‑Dawley rats were randomly assigned into the sham, cerebral I/R injury model and model plus LA groups. Cerebral I/R injury was induced by 90 min MCAO followed by reperfusion for 24 h. Cerebral infarct size was detected by 2,3,5‑triphenyltetrazolium chloride staining. Neurological deficit score (NDS), brain water content and oxidative parameters, including malondialdehyde (MDA), nitric oxide (NO), total antioxidant capacity (T‑AOC) and superoxide dismutase (SOD) were measured. The expression of cleaved caspase‑3, brain‑derived neurotrophic factor (BDNF), phosphatidylinositol‑4,5‑bisphosphate 3‑kinase (PI3K), p‑Akt and phosphorylated extracellular signal‑regulated kinase 1/2 (p‑ERK1/2) were also analyzed using western blotting. The present study demonstrated that pretreatment with LA significantly decreased the infarction size, brain water content and improved NDS. LA reversed the levels of oxidative parameters, including MDA, NO, T‑AOC and SOD to their normal state in rat brains following cerebral I/R. Furthermore, the expression of cleaved caspase‑3 markedly decreased and the expression of BDNF, PI3K, p‑Akt and p‑ERK1/2 significantly increased following administration of LA. On the basis of these findings, it was concluded that LA protected the brain from cerebral I/R damage by attenuation of

  16. Short-Term Continuous Subcutaneous Insulin Infusion Combined with Insulin Sensitizers Rosiglitazone, Metformin, or Antioxidant α-Lipoic Acid in Patients with Newly Diagnosed Type 2 Diabetes Mellitus

    PubMed Central

    Huang, Zhimin; Wan, Xuesi; Liu, Juan; Deng, Wanping; Chen, Ailing; Liu, Liehua; Liu, Jianbin; Wei, Guohong; Li, Hai; Fang, Donghong

    2013-01-01

    Abstract Background Short-term continuous subcutaneous insulin infusion (CSII) in patients with newly diagnosed type 2 diabetes has been proved effective in improving metabolic control and β-cell function, thus inducing long-term drug-free remission. A randomized controlled trial was conducted to investigate whether CSII in combination with rosiglitazone, metformin, or α-lipoic acid separately brings about extra benefits. Patients and Methods One hundred sixty patients with newly diagnosed type 2 diabetes were randomized to one of four treatment groups: CSII alone, CSII in combination with rosiglitazone or metformin for 3 months, or CSII with α-lipoic acid intravenous infusion for 2 weeks. Duration of CSII treatment was identical in the four groups. Glucose and lipid profiles, homeostasis model assessment (HOMA) indices, acute insulin response (AIR), intramyocellular lipid (IMCL) level, and malondialdehyde level were compared before and after intervention. Results The near-normoglycemia rate at the third month in CSII alone and that in combination with rosiglitazone, metformin, or α-lipoic acid was 72.5%, 87.5%, 90%, and 75%, respectively (metformin group vs. CSII alone, P=0.045). The metformin group achieved euglycemia in a shorter time (2.6±1.3 vs. 3.7±1.8 days, P=0.020) with less daily insulin dosage and was more powerful in lowering total cholesterol, increasing AIR and HOMA β-cell function, whereas reduction of IMCL in the soleus was more obvious in the rosiglitazone group but not in the metformin group. The efficacy of combination with α-lipoic acid was similar to that of CSII alone. Conclusions Short-term CSII in combination with rosiglitazone or metformin is superior to CSII alone, yet the efficacy of the two differs in some way, whereas that with α-lipoic acid might not have an additive effect. PMID:23991629

  17. Lipoic acid stimulates cAMP production via G protein-coupled receptor-dependent and -independent mechanisms.

    PubMed

    Salinthone, Sonemany; Schillace, Robynn V; Tsang, Catherine; Regan, John W; Bourdette, Dennis N; Carr, Daniel W

    2011-07-01

    Lipoic acid (LA) is a naturally occurring fatty acid that exhibits anti-oxidant and anti-inflammatory properties and is being pursued as a therapeutic for many diseases including multiple sclerosis, diabetic polyneuropathy and Alzheimer's disease. We previously reported on the novel finding that racemic LA (50:50 mixture of R-LA and S-LA) stimulates cAMP production, activates prostanoid EP2 and EP4 receptors and adenylyl cyclases (AC), and suppresses activation and cytotoxicity in NK cells. In this study, we present evidence that furthers our understanding of the mechanisms of action of LA. Using various LA derivatives, such as dihydrolipoic acid (DHLA), S,S-dimethyl lipoic acid (DMLA) and lipoamide (LPM), we discovered that only LA is capable of stimulating cAMP production in NK cells. Furthermore, there is no difference in cAMP production after stimulation with either R-LA, S-LA or racemic LA. Competition and synergistic studies indicate that LA may also activate AC independent of the EP2 and EP4 receptors. Pretreatment of PBMCs with KH7 (a specific peptide inhibitor of soluble AC) and the calcium inhibitor (Bapta) prior to LA treatment resulted in reduced cAMP levels, suggesting that soluble AC and calcium signaling mediate LA stimulation of cAMP production. In addition, pharmacological inhibitor studies demonstrate that LA also activates other G protein-coupled receptors, including histamine and adenosine but not the β-adrenergic receptors. These novel findings provide information to better understand the mechanisms of action of LA, which can help facilitate the use of LA as a therapeutic for various diseases. PMID:21036588

  18. Wheat germ oil enrichment in broiler feed with α-lipoic acid to enhance the antioxidant potential and lipid stability of meat

    PubMed Central

    2013-01-01

    Background Lipid peroxidation is the cause of declining the meat quality. Natural antioxidants plays a vital role in enhancing the stability and quality of meat. The supplementation of natural antioxidants in feed decreases lipid peroxidation and improves the stability of meat. Methods The present research was conducted to determine the effect of α-lipoic acid, α-tocopherol and wheat germ oil on the status of antioxidants, quality and lipid stability of broiler meat. One day old male broilers were fed with different feeds containing antioxidants i.e. natural (wheat germ oil) and synthetic α-tocopherol and α-lipoic acid during the two experimental years. Results The feed treatments have significant variation on the body weight and feed conversion ratio (FCR) while having no influence on the feed intake. The broilers fed on wheat germ oil (natural α-tocopherol) gained maximum body weight (2451.97 g & 2466.07 g) in the experimental years 2010–11 & 2011–12, respectively. The higher total phenolic contents were found in the broilers fed on wheat germ oil plus α-lipoic acid in breast (162.73±4.8 mg Gallic acid equivalent/100 g & 162.18±4.5 mg Gallic acid equivalent/100 g) and leg (149.67±3.3 mg Gallic acid equivalent/100 g & 146.07±3.2 mg Gallic acid equivalent/100 g) meat during both experimental years. Similar trend was observed for the 2,2-diphenyl-1-picrylhydrazyl (DPPH) and ferric reducing antioxidant power assay (FRAP). The production of malondialdehydes in the breast and leg meat increased with progressive increase in the time period. The deposition of α-tocopherol (AT) and α-lipoic acid (ALA) contents were found to be higher in the broilers fed on wheat germ oil plus α-lipoic acid in breast and leg meat during the both experimental years. Conclusion In conclusion, the combination of wheat germ oil and α-lipoic acid has more beneficial for stability and the quality of the broiler meat and more work should be needed in future for the bio

  19. α-Lipoic acid attenuates LPS-induced liver injury by improving mitochondrial function in association with GR mitochondrial DNA occupancy.

    PubMed

    Liu, Zhiqing; Guo, Jun; Sun, Hailin; Huang, Yanping; Zhao, Ruqian; Yang, Xiaojing

    2015-09-01

    α-Lipoic acid (LA) has been demonstrated to be a key regulator of energy metabolism. However, whether LA can protect the liver from inflammation, as well as the underlying mechanism involved, are still largely unclear. In the present study, mice treated with lipopolysaccharide (LPS) and injected with LA were used as a model. Liver injury, energy metabolism and mitochondrial regulation were investigated to assess the protective effect of LA on the liver and explore the possible mechanisms involved. Our results showed that LA attenuated liver injury, as evidenced by the decreased plasma alanine aminotransferase (ALT) and aspartate aminotransferase (AST) levels after LA treatment compared with the LPS-treated group. The hepatic ATP and NADH levels, expression levels of most mitochondrial DNA (mtDNA)-encoded genes as well as mitochondrial complex I, IV and V activities were all significantly increased in the LA-treated group compared with the LPS-treated group. Levels of Sirt3 protein, which is essential for the regulation of mitochondrial metabolism, were also increased in the LA-treated group. Regarding the regulation of mtDNA-encoded genes expression, we observed no obvious change in the methylation status of the mtDNA D-loop region. However, compared to the LPS-treated group, LA treatment increased glucocorticoid receptor (GR) protein expression in the liver, as well as the level of GR occupancy on the mtDNA D-loop region. Our study demonstrates that LA exerts a liver-protective effect in an inflammation state by improving mitochondrial function. Furthermore, to the best of our knowledge, we demonstrate for the first time that GR may be involved in this effect via an enhanced binding to the mtDNA transcriptional control region, thereby regulating the expression of mtDNA-encoded genes. PMID:26133658

  20. Alpha-Lipoic acid increases energy expenditure by enhancing adenosine monophosphate-activated protein kinase-peroxisome proliferator-activated receptor-gamma coactivator-1alpha signaling in the skeletal muscle of aged mice

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Skeletal muscle mitochondrial dysfunction is associated with aging and diabetes, which decreases respiratory capacity and increases reactive oxygen species. Lipoic acid (LA) possesses antioxidative and antidiabetic properties. Metabolic action of LA is mediated by activation of adenosine monophospha...

  1. Bioprotective carnitinoids: lipoic acid, butyrate, and mitochondria-targeting to treat radiation injury: mitochondrial drugs come of age.

    PubMed

    Steliou, Kosta; Faller, Douglas V; Pinkert, Carl A; Irwin, Michael H; Moos, Walter H

    2015-06-01

    Preclinical Research Given nuclear-power-plant incidents such as the 2011 Japanese Fukushima-Daiichi disaster, an urgent need for effective medicines to protect against and treat the harmful biological effects of radiation is evident. To address such a challenge, we describe potential strategies herein including mitochondrial and epigenetic-driven methods using lipoic and butyric acid ester conjugates of carnitine. The antioxidant and other therapeutically beneficial properties of this class of agents may protect against ionizing radiation and resultant mitochondrial dysfunction. Recent studies of the compounds described herein reveal the potential-although further research and development is required to prove the effectiveness of this approach-to provide field-ready radiation-protective drugs. PMID:26109467

  2. Mitochondrial decay in the brains of old rats: ameliorating effect of alpha-lipoic acid and acetyl-L-carnitine.

    PubMed

    Long, Jiangang; Gao, Feng; Tong, Liqi; Cotman, Carl W; Ames, Bruce N; Liu, Jiankang

    2009-04-01

    To investigate the mitochondrial decay and oxidative damage resulting from aging, the activities/kinetics of the mitochondrial complexes were examined in the brains of young and old rats as well as in old rats fed R-alpha-lipoic acid plus acetyl-L-carnitine (LA/ALC). The brain mitochondria of old rats, compared with young rats, had significantly decreased endogenous antioxidants and superoxide dismutase activity; more oxidative damage to lipids and proteins; and decreased activities of complex I, IV and V. Complex I showed a decrease in binding affinity (increase in K(m)) for substrates. Feeding LA/ALC to old rats partially restored age-associated mitochondrial dysfunction to the levels of the young rats. These results indicate that oxidative mitochondrial decay plays an important role in brain aging and that a combination of nutrients targeting mitochondria, such as LA/ALC, could ameliorate mitochondrial decay through preventing mitochondrial oxidative damage. PMID:18846423

  3. The Protective Effect of Lipoic Acid on Selected Cardiovascular Diseases Caused by Age-Related Oxidative Stress

    PubMed Central

    Goraca, Anna

    2015-01-01

    Oxidative stress is considered to be the primary cause of many cardiovascular diseases, including endothelial dysfunction in atherosclerosis and ischemic heart disease, hypertension, and heart failure. Oxidative stress increases during the aging process, resulting in either increased reactive oxygen species (ROS) production or decreased antioxidant defense. The increase in the incidence of cardiovascular disease is directly related to age. Aging is also associated with oxidative stress, which in turn leads to accelerated cellular senescence and organ dysfunction. Antioxidants may help lower the incidence of some pathologies of cardiovascular diseases and have antiaging properties. Lipoic acid (LA) is a natural antioxidant which is believed to have a beneficial effect on oxidative stress parameters in relation to diseases of the cardiovascular system. PMID:25949771

  4. Mitochondrial Decay in the Brains of Old Rats: Ameliorating Effect of Alpha-Lipoic Acid and Acetyl-L-carnitine

    PubMed Central

    Long, Jiangang; Gao, Feng; Tong, Liqi; Cotman, Carl W.; Ames, Bruce N.

    2009-01-01

    To investigate the mitochondrial decay and oxidative damage resulting from aging, the activities/kinetics of the mitochondrial complexes were examined in the brains of young and old rats as well as in old rats fed R-α-lipoic acid plus acetyl-L-carnitine (LA/ALC). The brain mitochondria of old rats, compared with young rats, had significantly decreased endogenous antioxidants and superoxide dismutase activity; more oxidative damage to lipids and proteins; and decreased activities of complex I, IV and V. Complex I showed a decrease in binding affinity (increase in Km) for substrates. Feeding LA/ALC to old rats partially restored age-associated mitochondrial dysfunction to the levels of the young rats. These results indicate that oxidative mitochondrial decay plays an important role in brain aging and that a combination of nutrients targeting mitochondria, such as LA/ALC, could ameliorate mitochondrial decay through preventing mitochondrial oxidative damage. PMID:18846423

  5. Thermoregulatory and cardiovascular responses to creatine, glycerol and alpha lipoic acid in trained cyclists

    PubMed Central

    2012-01-01

    Background It has been shown that supplementation with creatine (Cr) and glycerol (Gly), when combined with glucose (Glu) necessary for the enhancement of Cr uptake by skeletal muscle, induces significant improvements in thermoregulatory and cardiovascular responses during exercise in the heat. Purpose To determine whether Cr/Gly-induced thermoregulatory and cardiovascular responses are maintained when the majority (~75%) of the Glu in the Cr/Gly supplement is replaced with the insulintropic agent alpha lipoic acid (Ala). Methods 22 healthy endurance trained cyclists were randomly assigned to receive either 20 g/day (4 × 5 g/day) of Cr, 2 g .kg-1 BM per day (4 × 0.5 g .kg-1 BM per day) of Gly and 150 g/day (4 × 37.5 g/day) of Glu or 20 g/day (4 × 5 g/day) of Cr monohydrate, 2 g .kg-1 BM per day (4 × 0.5 g .kg-1 BM per day) of Gly (100 g/day (4 × 25 g/day) of Glu and 1000 mg/day (4 × 250 mg/day) of Ala for 7 days for 7 days. Exercise trials were conducted pre- and post-supplementation and involved 40 min of constant-load cycling exercise at 70% O2 max by a self-paced 16.1 km time trial at 30°C and 70% relative humidity. Results Median and range values of TBW increased significantly by 2.1 (1.3-3.3) L and 1.8 (0.2-4.6) L in Cr/Gly/Glu and Cr/Gly/Glu/Ala groups respectively (P = 0.03) and of BM not significantly by 1.8 (0.2-3.0) kg and 1.2 (0.5-2.1) kg in Cr/Gly/Glu and in Cr/Gly/Glu/Ala, respectively (P = 0.75). During constant load exercise, heart rate (HR) and core temperature (Tcore) were significantly lower post-supplementation: HR was reduced on average by 3.3 ± 2.1 beats/min and by 4.8 ± 3.3 beats/min (mean ± SD) and Tcore by 0.2 ± 0.1 (mean ± SD) in the Cr/Gly/Glu and Cr/Gly/Glu/Ala, respectively The reduction in HR and Tcore was not significantly different between the supplementation groups. Conclusions In comparison to the established hyper hydrating Cr

  6. Reversal of metabolic deficits by lipoic acid in a triple transgenic mouse model of Alzheimer's disease: a 13C NMR study.

    PubMed

    Sancheti, Harsh; Kanamori, Keiko; Patil, Ishan; Díaz Brinton, Roberta; Ross, Brian D; Cadenas, Enrique

    2014-02-01

    Alzheimer's disease is an age-related neurodegenerative disease characterized by deterioration of cognition and loss of memory. Several clinical studies have shown Alzheimer's disease to be associated with disturbances in glucose metabolism and the subsequent tricarboxylic acid (TCA) cycle-related metabolites like glutamate (Glu), glutamine (Gln), and N-acetylaspartate (NAA). These metabolites have been viewed as biomarkers by (a) assisting early diagnosis of Alzheimer's disease and (b) evaluating the efficacy of a treatment regimen. In this study, 13-month-old triple transgenic mice (a mouse model of Alzheimer's disease (3xTg-AD)) were given intravenous infusion of [1-(13)C]glucose followed by an ex vivo (13)C NMR to determine the concentrations of (13)C-labeled isotopomers of Glu, Gln, aspartate (Asp), GABA, myo-inositol, and NAA. Total ((12)C+(13)C) Glu, Gln, and Asp were quantified by high-performance liquid chromatography to calculate enrichment. Furthermore, we examined the effects of lipoic acid in modulating these metabolites, based on its previously established insulin mimetic effects. Total (13)C labeling and percent enrichment decreased by ∼50% in the 3xTg-AD mice. This hypometabolism was partially or completely restored by lipoic acid feeding. The ability of lipoic acid to restore glucose metabolism and subsequent TCA cycle-related metabolites further substantiates its role in overcoming the hypometabolic state inherent in early stages of Alzheimer's disease. PMID:24220168

  7. Antioxidant properties of an endogenous thiol: Alpha-lipoic acid, useful in the prevention of cardiovascular diseases.

    PubMed

    Ghibu, Stéliana; Richard, Carole; Vergely, Catherine; Zeller, Marianne; Cottin, Yves; Rochette, Luc

    2009-11-01

    In the past few years, a growing interest has been given to the possible antioxidant functions of a natural acid, synthesized in human tissues: alpha-lipoic acid (ALA). Both the oxidized (disulfide) and reduced (dithiol: dihydrolipoic acid, DHLA) forms of ALA show antioxidant properties. ALA administered in the diet accumulates in tissues, and a substantial part is converted to DHLA via a lipoamide dehydrogenase. Commercial ALA is usually a racemic mixture of the R and S forms. Chemical studies have indicated that ALA scavenges hydroxyl radicals, hypochlorous acid, and singlet oxygen. ALA exerts antioxidant effects in biological systems not only through direct ROS quenching but also via transition metal chelation. ALA has been shown to possess a number of beneficial effects both in the prevention and treatment of diabetes in experimental conditions. ALA presents beneficial effects in the management of symptomatic diabetic neuropathy and has been used in this context in Germany for more than 30 years. In cardiovascular disease, dietary supplementation with ALA has been successfully employed in a variety of in vivo models: ischemia-reperfusion, heart failure, and hypertension. More mechanistic and human in vivo studies are needed to determine whether optimizing the dietary intake of ALA can help to decrease cardiovascular diseases. A more complete understanding of cellular biochemical events that influence oxidative damage is required to guide future therapeutic advances. PMID:19998523

  8. Quantum dot targeting with lipoic acid ligase and HaloTag for single-molecule imaging on living cells.

    PubMed

    Liu, Daniel S; Phipps, William S; Loh, Ken H; Howarth, Mark; Ting, Alice Y

    2012-12-21

    We present a methodology for targeting quantum dots to specific proteins on living cells in two steps. In the first step, Escherichia coli lipoic acid ligase (LplA) site-specifically attaches 10-bromodecanoic acid onto a 13 amino acid recognition sequence that is genetically fused to a protein of interest. In the second step, quantum dots derivatized with HaloTag, a modified haloalkane dehalogenase, react with the ligated bromodecanoic acid to form a covalent adduct. We found this targeting method to be specific, fast, and fully orthogonal to a previously reported and analogous quantum dot targeting method using E. coli biotin ligase and streptavidin. We used these two methods in combination for two-color quantum dot visualization of different proteins expressed on the same cell or on neighboring cells. Both methods were also used to track single molecules of neurexin, a synaptic adhesion protein, to measure its lateral diffusion in the presence of neuroligin, its trans-synaptic adhesion partner. PMID:23181687

  9. Coenzyme Q10 and α-lipoic acid: antioxidant and pro-oxidant effects in plasma and peripheral blood lymphocytes of supplemented subjects

    PubMed Central

    Silvestri, Sonia; Orlando, Patrick; Armeni, Tatiana; Padella, Lucia; Brugè, Francesca; Seddaiu, Giovanna; Littarru, Gian Paolo; Tiano, Luca

    2015-01-01

    Reactive oxygen species not only cause damage but also have a physiological role in the protection against pathogens and in cell signalling. Mitochondrial nutrients, such as coenzyme Q10 and α-lipoic acid, beside their acknowledged antioxidant activities, show interesting features in relation to their redox state and consequent biological activity. In this study, we tested whether oral supplementation with 200 mg/day of coenzyme Q10 alone or in association with 200 mg/die of α-lipoic acid for 15 days on 16 healthy subjects was able to modulate the oxidative status into different compartments (plasma and cells), in basal condition and following an oxidative insult in peripheral blood lymphocytes exposed in vitro to H2O2. Data have shown that tested compounds produced antioxidant and bioenergetic effects improving oxidative status of the lipid compartment and mitochondrial functionality in peripheral blood lymphocytes. Simultaneously, an increased intracellular reactive oxygen species level was observed, although they did not lead to enhanced DNA oxidative damage. Coenzyme Q10 and α-lipoic acid produced beneficial effects also steering intracellular redox poise toward a pro-oxidant environment. In contrast with other antioxidant molecules, pro-oxidant activities of tested mitochondrial nutrients and consequent oxidant mediated signalling, could have important implications in promoting adaptive response to oxidative stress. PMID:26236096

  10. Inhibition of Peripheral TNF-α and Downregulation of Microglial Activation by Alpha-Lipoic Acid and Etanercept Protect Rat Brain Against Ischemic Stroke.

    PubMed

    Wu, Ming-Hsiu; Huang, Chao-Ching; Chio, Chung-Ching; Tsai, Kuen-Jer; Chang, Ching-Ping; Lin, Nan-Kai; Lin, Mao-Tsun

    2016-09-01

    Ischemic stroke, caused by obstruction of blood flow to the brain, would initiate microglia activation which contributes to neuronal damage. Therefore, inhibition of microglia-mediated neuroinflammation could be a therapeutic strategy for ischemic stroke. This study was aimed to elucidate the anti-inflammatory effects of alpha-lipoic acid and etanercept given either singly or in combination in rats subjected to middle cerebral artery occlusion. Both α-lipoic acid and etanercept markedly reduced cerebral infarct, blood-brain barrier disruption, and neurological motor deficits with the former drug being more effective with the dosage used. Furthermore, when used in combination, the reduction was more substantial. Remarkably, a greater diminution in the serum levels of tumor necrosis factor-alpha as well as the brain levels of microglial activation (e.g., microgliosis, amoeboid microglia, and microglial overexpression of tumor necrosis factor-α) was observed with the combined drug treatment as compared to the drugs given separately. We conclude that inhibition of peripheral tumor necrosis factor-alpha as well as downregulation of brain microglial activation by alpha-lipoic acid or etanercept protect rat brain against ischemic stroke. Moreover, when both drugs were used in combination, the stroke recovery was promoted more extensively. PMID:26374550

  11. Reversal of Lead-Induced Acute Toxicity by Lipoic Acid with Nutritional Supplements in Male Wistar Rats.

    PubMed

    Shukla, Sangeeta; Sharma, Yamini; Shrivastava, Sadhana

    2016-01-01

    Lead (Pb) is a pleiotropic toxicant. The potential role of oxidative stress injury that is associated with Pb poisoning suggests that antioxidants may enhance the efficacy of treatment designed to mitigate Pb-induced toxicity. The aim of this study is to investigate the comparative ameliorative potential of lipoic acid (LA) alone or in combination with calcium (Ca) and zinc (Zn). Pb acetate (50 mg/kg, intraperitoneally) was administered for 3 d. After 24 h of the last toxicant dose, LA (100 mg/kg, orally [po]) alone or in conjuction with Ca (50 mg/kg, po) and Zn (10 mg/kg, po) was administered for 3 d. Significant alterations in the concentration of urea, uric acid, triglycerides, cholesterol, aspartate amino transferase, alanine amino transferase, lipid peroxidation, and reduced glutathione as well as alterations in enzyme activity of δ-aminolevulinic acid (ALA) dehydratase were observed following acute Pb exposure. These findings were also supported by elevated mean DNA damage and Pb body burden in blood and soft tissues compared to controls (p ≤ 0.05). Three d posttreatment with LA along with Zn and Ca could significantly restore the biochemical parameters and Pb body burden to near-normal status through antioxidant activity or by preventing bioaccumulation of Pb within the blood and tissues of experimental rats. PMID:27481494

  12. Function of heterologous Mycobacterium tuberculosis InhA, a type 2 fatty acid synthase enzyme involved in extending C20 fatty acids to C60-to-C90 mycolic acids, during de novo lipoic acid synthesis in Saccharomyces cerevisiae.

    PubMed

    Gurvitz, Aner; Hiltunen, J Kalervo; Kastaniotis, Alexander J

    2008-08-01

    We describe the physiological function of heterologously expressed Mycobacterium tuberculosis InhA during de novo lipoic acid synthesis in yeast (Saccharomyces cerevisiae) mitochondria. InhA, representing 2-trans-enoyl-acyl carrier protein reductase and the target for the front-line antituberculous drug isoniazid, is involved in the activity of dissociative type 2 fatty acid synthase (FASII) that extends associative type 1 fatty acid synthase (FASI)-derived C(20) fatty acids to form C(60)-to-C(90) mycolic acids. Mycolic acids are major constituents of the protective layer around the pathogen that contribute to virulence and resistance to certain antimicrobials. Unlike FASI, FASII is thought to be incapable of de novo biosynthesis of fatty acids. Here, the genes for InhA (Rv1484) and four similar proteins (Rv0927c, Rv3485c, Rv3530c, and Rv3559c) were expressed in S. cerevisiae etr1Delta cells lacking mitochondrial 2-trans-enoyl-thioester reductase activity. The phenotype of the yeast mutants includes the inability to produce sufficient levels of lipoic acid, form mitochondrial cytochromes, respire, or grow on nonfermentable carbon sources. Yeast etr1Delta cells expressing mitochondrial InhA were able to respire, grow on glycerol, and produce lipoic acid. Commensurate with a role in mitochondrial de novo fatty acid biosynthesis, InhA could accept in vivo much shorter acyl-thioesters (C(4) to C(8)) than was previously thought (>C(12)). Moreover, InhA functioned in the absence of AcpM or protein-protein interactions with its native FASII partners KasA, KasB, FabD, and FabH. None of the four proteins similar to InhA complemented the yeast mutant phenotype. We discuss the implications of our findings with reference to lipoic acid synthesis in M. tuberculosis and the potential use of yeast FASII mutants for investigating the physiological function of drug-targeted pathogen enzymes involved in fatty acid biosynthesis. PMID:18552191

  13. Lipoic acid: a novel therapeutic approach for multiple sclerosis and other chronic inflammatory diseases of the CNS.

    PubMed

    Salinthone, Sonemany; Yadav, Vijayshree; Bourdette, Dennis N; Carr, Daniel W

    2008-06-01

    The naturally occurring antioxidant lipoic acid (LA) was first described as an essential cofactor for the conversion of pyruvate to Acetyl-CoA, a critical step in respiration. LA is now recognized as a compound that has many biological functions. Along with its reduced form dihydrolipoic acid (DHLA), LA reduces and recycles cellular antioxidants such as glutathione, and chelates zinc, copper and other transition metal ions in addition to heavy metals. LA can also act as a scavenger of reactive oxygen and nitrogen species. By acting as an insulin mimetic agent, LA stimulates glucose uptake in many different cell types and can also modulate insulin signaling. The p38 and ERK MAP kinase pathways, AKT and NFkappaB are all regulated by LA. In addition, LA activates the prostaglandin EP2 and EP4 receptors to stimulate the production of the small molecule cyclic adenosine 5' monophosphate (cAMP). These diverse actions suggest that LA may be therapeutically effective in treating oxidative stress associated diseases. This review discusses the known biochemical properties of LA, its antioxidant properties, its ability to modulate signal transduction pathways, and the recent progress made in the utilization of LA as a therapeutic alternative for multiple sclerosis, Alzheimer's disease and diabetic neuropathy. PMID:18537699

  14. Effect of γ-Cyclodextrin Inclusion Complex on the Absorption of R-α-Lipoic Acid in Rats

    PubMed Central

    Uchida, Ryota; Iwamoto, Kosuke; Nagayama, Suetada; Miyajima, Atsushi; Okamoto, Hinako; Ikuta, Naoko; Fukumi, Hiroshi; Terao, Keiji; Hirota, Takashi

    2015-01-01

    R-α-lipoic acid (RLA) is an endogenous organic acid, and works as a cofactor for mitochondrial enzymes and as a kind of antioxidant. Inclusion complexes of RLA with α-, β- or γ-cyclodextrins (CD) were prepared and orally administered as a suspension to rats. Among them, RLA/γ-CD showed the highest plasma exposure, and its area under the plasma concentration-time curve (AUC) of RLA was 2.2 times higher than that after oral administration of non-inclusion RLA. On the other hand, the AUC after oral administration of non-inclusion RLA and RLA/γ-CD to pylorus-ligated rats did not differ. However, the AUC after intraduodenal administration of RLA/γ-CD was 5.1 times higher than that of non-inclusion RLA, and was almost comparable to the AUC after intraduodenal administration of RLA-Na solution. Furthermore, the AUC after intraduodenal administration of RLA/γ-CD was not affected by biliary ligation or co-administration of an amylase inhibitor. These findings demonstrated that RLA was absorbed from the small intestine effectively when orally administered as a γ-CD inclusion complex, which could be easily dissolved in the lumen of the intestine. In conclusion, γ-CD inclusion complex is an appropriate formulation for supplying RLA as a drug or nutritional supplement with respect to absorption. PMID:25946345

  15. Lipoic acid entrains the hepatic circadian clock and lipid metabolic proteins that have been desynchronized with advanced age.

    PubMed

    Keith, Dove; Finlay, Liam; Butler, Judy; Gómez, Luis; Smith, Eric; Moreau, Régis; Hagen, Tory

    2014-07-18

    It is well established that lipid metabolism is controlled, in part, by circadian clocks. However, circadian clocks lose temporal precision with age and correlates with elevated incidence in dyslipidemia and metabolic syndrome in older adults. Because our lab has shown that lipoic acid (LA) improves lipid homeostasis in aged animals, we hypothesized that LA affects the circadian clock to achieve these results. We fed 24 month old male F344 rats a diet supplemented with 0.2% (w/w) LA for 2 weeks prior to sacrifice and quantified hepatic circadian clock protein levels and clock-controlled lipid metabolic enzymes. LA treatment caused a significant phase-shift in the expression patterns of the circadian clock proteins Period (Per) 2, Brain and Muscle Arnt-Like1 (BMAL1), and Reverse Erythroblastosis virus (Rev-erb) β without altering the amplitude of protein levels during the light phase of the day. LA also significantly altered the oscillatory patterns of clock-controlled proteins associated with lipid metabolism. The level of peroxisome proliferator-activated receptor (PPAR) α was significantly increased and acetyl-CoA carboxylase (ACC) and fatty acid synthase (FAS) were both significantly reduced, suggesting that the LA-supplemented aged animals are in a catabolic state. We conclude that LA remediates some of the dyslipidemic processes associated with advanced age, and this mechanism may be at least partially through entrainment of circadian clocks. PMID:24944020

  16. Prophylactic action of lipoic acid on oxidative stress and growth performance in broilers at risk of developing ascites syndrome.

    PubMed

    Díaz-Cruz, Antonio; Serret, Maurilio; Ramírez, Guadalupe; Avila, Ernesto; Guinzberg, Raquel; Piña, Enrique

    2003-12-01

    The objective of this study was to assess the effects of dietary supplementation with lipoic acid (LA) on broilers maintained at 2235 m above sea level with high risk to develop ascites syndrome (AS). A total of 2040 chicks were fed under commercial conditions with water and specific diets ad libitum during 7 weeks in two consecutive experiments. Mortality and indicators of performance and oxidative stress were compared weekly in broilers fed a basal diet plus 0, 10, 20, or 40 parts/10(6) LA. The effects of LA at 40 parts/10(6) were also studied during the initial 3 weeks or the last 4 weeks of the production cycle. Diets supplemented with 40 parts/10(6) of LA during 7 weeks significantly improved feed conversion, decreased general mortality and mortality attributable to AS, and lowered thiobarbituric acid reactive substances and hydroxyl radicals in liver, and increased total glutathione pool. Smaller doses or shorter periods of exposure to LA were partially effective. In conclusion, LA under our experimental conditions has a prophylactic action in broilers with high risk to develop AS due to oxygen availability limitation. PMID:14676017

  17. Nucleic acid compositions and the encoding proteins

    DOEpatents

    Preston, III, James F.; Chow, Virginia; Nong, Guang; Rice, John D.; St. John, Franz J.

    2014-09-02

    The subject invention provides at least one nucleic acid sequence encoding an aldouronate-utilization regulon isolated from Paenibacillus sp. strain JDR-2, a bacterium which efficiently utilizes xylan and metabolizes aldouronates (methylglucuronoxylosaccharides). The subject invention also provides a means for providing a coordinately regulated process in which xylan depolymerization and product assimilation are coupled in Paenibacillus sp. strain JDR-2 to provide a favorable system for the conversion of lignocellulosic biomass to biobased products. Additionally, the nucleic acid sequences encoding the aldouronate-utilization regulon can be used to transform other bacteria to form organisms capable of producing a desired product (e.g., ethanol, 1-butanol, acetoin, 2,3-butanediol, 1,3-propanediol, succinate, lactate, acetate, malate or alanine) from lignocellulosic biomass.

  18. Crosslinked Redox-Responsive Micelles Based on Lipoic Acid-Derived Amphiphiles for Enhanced siRNA Delivery.

    PubMed

    Tschiche, Ariane; Thota, Bala N S; Neumann, Falko; Schäfer, Andreas; Ma, Nan; Haag, Rainer

    2016-06-01

    Successful application of gene silencing approaches critically depends on systems that are able to safely and efficiently deliver genetic material such as small interfering RNA (siRNA). Due to their beneficial well-defined dendritic nanostructure, self-assembling dendrimers are emerging as promising nanovectors for siRNA delivery. However, these kinds of vectors are plagued with stability issues, especially when considered for in vivo applications. Therefore, in the present study, disulfide-based temporarily fixed micelles are developed that can degrade upon reductive conditions, and thus lead to efficient cargo release. In detail, lipoic acid-derived crosslinked micelles are synthesized based on small polymerizable dendritic amphiphiles. Particularly, one candidate out of this series is able to efficiently release siRNA due to its redox-responsive biodegradable profile when exposed to simulated intracellular environments. As a result, the reduction-triggered disassembly leads to potent gene silencing. In contrast, noncrosslinkable, structurally related constructs fails under the tested assay conditions, thereby confirming the applied rational design approach and demonstrating its large potential for future in vivo applications. PMID:26847397

  19. Pre-clinical and Clinical Safety Studies of CMX-2043: A Cytoprotective Lipoic Acid Analogue for Ischaemia–Reperfusion Injury

    PubMed Central

    Kates, Steven A; Lader, Alan S; Casale, Ralph; Beeuwkes, Reinier

    2014-01-01

    CMX-2043 is an α-lipoic acid analogue targeted to reduction of cellular injury and organ damage due to ischaemia–reperfusion injury (IRI). It has been shown to be effective in a rat model of cardiac IRI. The studies here reported evaluate its safety and pharmacokinetic profile in preparation for human clinical studies in procedures associated with IRI. Safety and tolerability were tested in standard pre-clinical in vitro and animal models and in a Phase 1 human clinical trial. CMX-2043 did not bind to a wide range of receptors and specific targets at approximately 4 μg/mL (10 μM). It was not mutagenic by Ames assay, did not produce chromosome aberrations in Chinese hamster ovary (CHO) cells, and was negative for clastogenic potential. Toxicological studies in rats including both single and 14-day repeat intravenous doses and in dogs (single intravenous dose) with a 2-week recovery period were conducted. The NOAEL in rats and dogs was 30 and >10 mg/kg, respectively. No serious adverse events were reported in a placebo-controlled, sequential dose escalation Phase 1 clinical trial. The low toxicity in the pre-clinical studies and the absence of adverse events in the Phase 1 trial have supported investigation of CMX-2043 in a human efficacy trial. PMID:24751172

  20. α-Lipoic acid promotes α-tubulin hyperacetylation and blocks the turnover of mitochondria through mitophagy.

    PubMed

    Stoner, Michael W; Thapa, Dharendra; Zhang, Manling; Gibson, Gregory A; Calderon, Michael J; St Croix, Claudette M; Scott, Iain

    2016-06-15

    Lysine acetylation is tightly coupled to the nutritional status of the cell, as the availability of its cofactor, acetyl-CoA, fluctuates with changing metabolic conditions. Recent studies have demonstrated that acetyl-CoA levels act as an indicator of cellular nourishment, and increased abundance of this metabolite can block the induction of cellular recycling programmes. In the present study we investigated the cross-talk between mitochondrial metabolic pathways, acetylation and autophagy, using chemical inducers of mitochondrial acetyl-CoA production. Treatment of cells with α-lipoic acid (αLA), a cofactor of the pyruvate dehydrogenase complex, led to the unexpected hyperacetylation of α-tubulin in the cytosol. This acetylation was blocked by pharmacological inhibition of mitochondrial citrate export (a source for mitochondria-derived acetyl-CoA in the cytosol), was dependent on the α-tubulin acetyltransferase (αTAT) and was coupled to a loss in function of the cytosolic histone deacetylase, HDAC6. We further demonstrate that αLA slows the flux of substrates through autophagy-related pathways, and severely limits the ability of cells to remove depolarized mitochondria through PTEN-associated kinase 1 (PINK1)-mediated mitophagy. PMID:27099338

  1. Ammonia-induced oxidative damage in neurons is prevented by resveratrol and lipoic acid with participation of heme oxygenase 1.

    PubMed

    Bobermin, Larissa Daniele; Wartchow, Krista Minéia; Flores, Marianne Pires; Leite, Marina Concli; Quincozes-Santos, André; Gonçalves, Carlos-Alberto

    2015-07-01

    Ammonia is a metabolite that, at high concentrations, is implicated in neurological disorders, such as hepatic encephalopathy (HE), which is associated with acute or chronic liver failure. Astrocytes are considered the primary target of ammonia toxicity in the central nervous system (CNS) because glutamine synthetase (GS), responsible for ammonia metabolism in CNS, is an astrocytic enzyme. Thus, neuronal dysfunction has been associated as secondary to astrocytic impairment. However, we demonstrated that ammonia can induce direct effects on neuronal cells. The cell viability was decreased by ammonia in SH-SY5Y cells and cerebellar granule neurons. In addition, ammonia induced increased reactive oxygen species (ROS) production and decreased GSH intracellular content, the main antioxidant in CNS. As ammonia neurotoxicity is strongly associated with oxidative stress, we also investigated the potential neuroprotective roles of the antioxidants, resveratrol (RSV) and lipoic acid (LA), against ammonia toxicity in cerebellar granule neurons. RSV and LA were able to prevent the oxidative damage induced by ammonia, maintaining the levels of ROS production and GSH close to basal values. Both antioxidants also decreased ROS production and increased GSH content under basal conditions (in the absence of ammonia). Moreover, we showed that heme oxygenase 1 (HO1), a protein associated with protection against stress conditions, is involved in the beneficial effects of RSV and LA in cerebellar granule neurons. Thus, this study reinforces the neuroprotective effects of RSV and LA. Although more studies in vivo are required, RSV and LA could represent interesting therapeutic strategies for the management of HE. PMID:26003724

  2. Lipoic acid does not improve renal function markers in 5/6 nephrectomy model: possible role of Nrf2 inactivation.

    PubMed

    Lo, Sze M; Dal Lin, Fernando T; Soares, Maria F; Hauser, Aline B; Pecoits-Filho, Roberto; Nakao, Lia S

    2016-05-01

    Chronic kidney disease (CKD) progression and complications are associated with increased oxidative stress, as well as with Nrf2 inactivation. Lipoic acid (LA) has been considered an inducer of Nrf2 antioxidant response. We tested whether oral administration of LA provides beneficial effects in experimental CKD in rats. Wistar rats underwent 5/6 nephrectomy (CKD group) or sham laparotomy. Seven days later, CKD group was divided into three subgroups that received: (i) LA continuously in the drinking water (100 mg/kg/day), (ii) LA by gavage every other day (100 mg/kg), or (iii) no LA treatment. LA treatment lasted until day 60. Plasma urea and creatinine, 24 h-proteinuria, glomerulosclerosis, interstitial fibrosis/tubular atrophy, and Nrf2 activation were analyzed. All parameters measured were significantly altered in the untreated CKD group, compared with the sham group, as expected. Oral LA administration, either in the drinking water or by gavage, did not improve significantly any parameter, comparing the treated-groups with the untreated CKD group. These results indicate that oral LA administration for 53 days was ineffective to reactivate Nrf2 in the remnant kidney of uremic rats, likely preventing improvements in biochemical and histopathological markers of renal function. PMID:26904958

  3. Simultaneous determination of alpha-lipoic acid and its reduced form by high-performance liquid chromatography with fluorescence detection.

    PubMed

    Satoh, Soichiro; Toyo'oka, Toshimasa; Fukushima, Takeshi; Inagaki, Shinsuke

    2007-07-01

    The simultaneous determination of alpha-lipoic acid (LA) and DHLA (reduced form of LA) was carried out by HPLC with fluorescence detection. DHLA in the sample was first labeled with ABD-F at room temperature for 10 min and then the LA was labeled with SBD-F at 50 degrees C for 1 h after conversion to DHLA using the reducing agent, TCEP. The resulting fluorophores, ABD-DHLA and SBD-DHLA, were separated by reversed-phase chromatography and detected at 510 nm (excitation at 380 nm). Both fluorophors were completely separated without any interference of endogenous thiols and disulfides in the sample and sensitively detected by fluorimetry. The proposed method was applied to the assay of the LA supplement and the determination in human plasma after the oral administration of LA tablets. The concentration (%) of LA in the tablet was reasonable to the stated amount. Furthermore, the result of a time course study in the plasma after the administration of LA did not differ from a previous report. Thus, the present method seems to be applicable to the simultaneous determination of LA and DHLA in various biological specimens. PMID:17462965

  4. Molecular Mechanisms of Lipoic Acid Protection against Aflatoxin B1-Induced Liver Oxidative Damage and Inflammatory Responses in Broilers

    PubMed Central

    Ma, Qiugang; Li, Yan; Fan, Yu; Zhao, Lihong; Wei, Hua; Ji, Cheng; Zhang, Jianyun

    2015-01-01

    Alpha-lipoic acid (α-LA) was evaluated in this study for its molecular mechanisms against liver oxidative damage and inflammatory responses induced by aflatoxin B1 (AFB1). Birds were randomly allocated into four groups with different diets for three weeks: a basal diet, a 300 mg/kg α-LA supplementation in a basal diet, a diet containing 74 μg/kg AFB1, and 300 mg/kg α-LA supplementation in a diet containing 74 μg/kg AFB1. In the AFB1 group, the expression of GSH-PX mRNA was down-regulated (p < 0.05), and the levels of lipid peroxide and nitric oxide were increased (p < 0.05) in the chicken livers compared to those of the control group. Additionally, the mRNA level of the pro-inflammatory factor interleukin-6 was up-regulated significantly (p < 0.05), the protein expressions of both the nuclear factor kappa B (NF-κB) p65 and the inducible nitric oxide synthase were enhanced significantly (p < 0.05) in the AFB1 group. All of these negative effects were inhibited by α-LA. These results indicate that α-LA may be effective in preventing hepatic oxidative stress, down-regulating the expression of hepatic pro-inflammatory cytokines, as well as inhibiting NF-κB expression. PMID:26694462

  5. Fast quantification of α-lipoic acid in biological samples and dietary supplements using batch injection analysis with amperometric detection.

    PubMed

    Santos Pereira, Laise Nayra Dos; da Silva, Iranaldo Santos; Araújo, Thaylan Pinheiro; Tanaka, Auro Atsushi; Angnes, Lúcio

    2016-07-01

    Batch injection analysis (BIA) with amperometric detection, using a pyrolytic graphite electrode modified with cobalt phthalocyanine (PG/CoPc), was employed for determination of α-lipoic acid (ALA) in pharmaceutical product and in synthetic urine samples. The proposed BIA method is based on the application of a potential of +0.9V vs. Ag/AgCl, KCl sat, enabling quantification of ALA over a concentration range from 1.3×10(-6) to 1.0×10(-4)molL(-1), with a detection limit of 1.5×10(-8)molL(-1). A sampling rate of 180 injections per hour was attained and measurements of the reproducibility of successive injections (100µmolL(-1) ALA on the same electrode) showed a RSD of 2.11% for 40 successive injections. The new sensor was utilised for ALA quantification in a dietary pharmaceutical supplement and in synthetic urine and the results obtained for both samples were compared with parallel analysis using high performance liquid chromatography (HPLC), the method recommended by the United States Pharmacopeia. The results obtained were similar (at a 95% confidence level) and in the case of the synthetic urine sample (prepared with a known amount of ALA) the recovery was situated between 98.0% and 102.6%. PMID:27154671

  6. α-Lipoic Acid in Soluplus(®) Polymeric Nanomicelles for Ocular Treatment of Diabetes-Associated Corneal Diseases.

    PubMed

    Alvarez-Rivera, Fernando; Fernández-Villanueva, David; Concheiro, Angel; Alvarez-Lorenzo, Carmen

    2016-09-01

    α-Lipoic acid (ALA) is a powerful antioxidant valuable for prevention and treatment of ophthalmic complications such as diabetic keratopathy and retinopathy. The aim of this work was to develop micelle-based formulations that can enhance the solubility, stability, and corneal permeability of ALA. Compared to a conventional surfactant (sodium dioctylsulfosuccinate), Soluplus(®) (polyvinyl caprolactam-polyvinyl acetate-polyethylene glycol copolymer) led to smaller micelles (70-80 vs. 240-528 nm) with improved ability to solubilize ALA, maintaining ocular compatibility (Hens Egg Test on the Chorio-Allantoic Membrane). Soluplus nanomicelles enhanced more than 10-fold ALA solubility compared to common eye drops and withstood strong dilution in lachrymal fluid, filtration through sterilizing membranes, and freeze-drying. Interestingly, Soluplus nanomicelle formulation prepared with 1 or 2 mM block copolymer concentration exhibited in situ gelling capability and transformed into weak gels at 35°C, which is expected to increase corneal residence time. Bovine corneal permeability revealed that Soluplus nanomicelles notably enhanced ALA accumulation into the cornea as well as flux of drug toward the receptor chamber. Overall, these findings point out Soluplus nanomicelles as suitable carriers of ALA that may exhibit improved performance compared to currently available eye drop solutions. PMID:27103010

  7. Biochemical responses over time in common carp Cyprinus carpio (Teleostei, Cyprinidae) during fed supplementation with α-lipoic acid.

    PubMed

    Enamorado, Alain D; Martins, Atila C; Flores, Juliana A; Tesser, Marcelo Borges; Caldas, Sergiane S; Primel, Ednei G; Monserrat, José Maria

    2015-10-01

    The current study aimed to evaluate the influence of lipoic acid (LA) supplementation (439.84±6.71 mg LA/kg feed) on antioxidants responses throughout the time in intestine, liver and muscle of juvenile common carp Cyprinus carpio. Two experimental groups were fed during four weeks with a diet with or without LA. Glutathione-S-transferase (GST) activity, glutathione (GSH) content, antioxidant capacity against peroxyl radicals (ACAP) and lipid peroxidation (TBARS) were evaluated in these organs. Also, a technique to measure protein disulfide bonds and sulfhydryl groups was optimized for intestine samples. GST activity was significantly higher (p<0.05) in intestine after two weeks of supplementation. GSH content was also significantly higher (p<0.05) in intestine, liver and muscle of fish fed with LA after two and three weeks, respectively. Total capacity antioxidant against peroxyl radicals was significantly increased (p<0.05) in the muscle of animals fed with LA after the fourth week. Concentration of disulfide bonds was higher in the intestine of fish fed with LA but this group also showed higher concentration of sulfhydryl groups (p<0.05). It is concluded that supplementation with LA is a safe strategy to induce antioxidant responses and improves the antioxidant status in different organs of common carp. Two week of supplementation are required to induce antioxidant responses in intestine and liver and three week for muscle. PMID:26037328

  8. Molecular Mechanisms of Lipoic Acid Protection against Aflatoxin B₁-Induced Liver Oxidative Damage and Inflammatory Responses in Broilers.

    PubMed

    Ma, Qiugang; Li, Yan; Fan, Yu; Zhao, Lihong; Wei, Hua; Ji, Cheng; Zhang, Jianyun

    2015-12-01

    Alpha-lipoic acid (α-LA) was evaluated in this study for its molecular mechanisms against liver oxidative damage and inflammatory responses induced by aflatoxin B₁ (AFB₁). Birds were randomly allocated into four groups with different diets for three weeks: a basal diet, a 300 mg/kg α-LA supplementation in a basal diet, a diet containing 74 μg/kg AFB₁, and 300 mg/kg α-LA supplementation in a diet containing 74 μg/kg AFB₁. In the AFB₁ group, the expression of GSH-PX mRNA was down-regulated (p < 0.05), and the levels of lipid peroxide and nitric oxide were increased (p < 0.05) in the chicken livers compared to those of the control group. Additionally, the mRNA level of the pro-inflammatory factor interleukin-6 was up-regulated significantly (p < 0.05), the protein expressions of both the nuclear factor kappa B (NF-κB) p65 and the inducible nitric oxide synthase were enhanced significantly (p < 0.05) in the AFB₁ group. All of these negative effects were inhibited by α-LA. These results indicate that α-LA may be effective in preventing hepatic oxidative stress, down-regulating the expression of hepatic pro-inflammatory cytokines, as well as inhibiting NF-κB expression. PMID:26694462

  9. Quantification of lipoic acid from skin samples by HPLC using ultraviolet, electrochemical and evaporative light scattering detectors.

    PubMed

    Campos, Patrícia Mazureki; Praça, Fabíola Silva Garcia; Bentley, Maria Vitória Lopes Badra

    2016-04-15

    Lipoic acid (LA) is an endogenous organosulfur compound with potent antioxidant property. LA is often used as a drug for the treatment of skin disorders. For the accomplishment of topical applications of LA appropriate drug quantification methods are essential. Thus far, no HPLC methods have been reported for the measurement of LA extracted from skin. In this article we report on the development and validation of three sensitive and specific HPLC methods for LA and dihydrolipoic acid (DHLA) using ultraviolet (UV), electrochemical (EC) or evaporative light scattering (ELS) detection. These methods demonstrate different linearity ranges. The chromatographic separations were performed by RP-HPLC (250×4mm, 5μm) with isocratic elution using an acidic mobile phase for the three detection techniques. The lower limits of detection and quantification were 0.04 and 0.08ng LA, respectively, for HPLC coupled to ELS, an innovative detector for LA with high sensitivity. The extraction of LA from skin samples showed recoveries greater than 71%. The recovered LA concentrations from stratum corneum and epidermis+dermis layers were: 5.41±0.56 and 4.92±0.33μg/mL, respectively for HPLC/UV and 6.52±0.49 and 5.01±0.41μg/mL, respectively, for HPLC/EC for the added LA concentration (6.67μg/mL), and 8.88±0.46 and 8.95±0.08μg/mL, respectively, for HPLC/ELS for the added LA concentration (10μg/mL). These three optimized HPLC methods allowed for a simple, rapid and reliable determination of LA in human skin. They should be useful for the development of drug delivery systems for topical applications of LA. PMID:26307348

  10. Effect of combination therapy consisting of enalapril, α-lipoic acid, and menhaden oil on diabetic neuropathy in a high fat/low dose streptozotocin treated rat.

    PubMed

    Davidson, Eric P; Holmes, Amey; Coppey, Lawrence J; Yorek, Mark A

    2015-10-15

    We have previously demonstrated that treating diabetic rats with enalapril, an angiotensin converting enzyme (ACE) inhibitor, α-lipoic acid, an antioxidant, or menhaden oil, a natural source of omega-3 fatty acids can partially improve diabetic peripheral neuropathy. In this study we sought to determine the efficacy of combining these three treatments on vascular and neural complications in a high fat fed low dose streptozotocin treated rat, a model of type 2 diabetes. Rats were fed a high fat diet for 8 weeks followed by a 30 mg/kg dose of streptozotocin. Eight weeks after the onset of hyperglycemia diabetic rats were treated with a combination of enalapril, α-lipoic acid and menhaden oil. Diabetic rats not receiving treatment were continued on the high fat diet. Glucose clearance was impaired in diabetic rats and significantly improved with treatment. Diabetes caused steatosis, elevated serum lipid levels, slowing of motor and sensory nerve conduction, thermal hypoalgesia, reduction in intraepidermal nerve fiber profiles, decrease in cornea sub-basal nerve fiber length and corneal sensitivity and impairment in vascular relaxation to acetylcholine and calcitonin gene-related peptide in epineurial arterioles of the sciatic nerve. Treating diabetic rats with the combination of enalapril, α-lipoic acid and menhaden oil reversed all these deficits to near control levels except for motor nerve conduction velocity which was also significantly improved compared to diabetic rats but remained significantly decreased compared to control rats. These studies suggest that a combination therapeutic approach may be most effective for treating vascular and neural complications of type 2 diabetes. PMID:26291662

  11. Complementary Cholesterol-Lowering Response of a Phytosterol/α-Lipoic Acid Combination in Obese Zucker Rats

    PubMed Central

    Rideout, Todd C.; Carrier, Bradley; Wen, Shin; Raslawsky, Amy; Browne, Richard W.; Harding, Scott V.

    2015-01-01

    To investigate the cholesterol-lowering effectiveness of a phytosterol/α-lipoic acid (PS/αLA) therapy, thirty-two male Zucker rats were randomly assigned to 1 of 4 diets for 30 days: (i) high fat diet (HF, 40% energy from fat); (ii) HF diet supplemented with 3% phytosterols; (iii) HF diet supplemented with 0.25% αLA; or (iv) HF diet supplemented with PS (3%) and αLA (0.25%, PS/αLA). Compared with the HF diet, combination PS/αLA proved more effective in reducing non-HDL cholesterol (−55%) than either the PS (−24%) or the αLA (−25%) therapies alone. PS supplementation did not affect LDL particle number, however, αLA supplementation reduced LDL particle number when supplemented alone (−47%) or in combination with PS (−54%). Compared with the HF-fed animals, evidence of increased HDL-particle number was evident in all treatment groups to a similar extent (21–22%). PS-mediated interruption of intestinal cholesterol absorption was evident by increased fecal cholesterol loss (52%) and compensatory increase in HMG-CoA reductase mRNA (1.6 fold of HF), however, αLA supplementation did not affect fecal cholesterol loss. Hepatic mRNA and protein expression patterns suggested that αLA modulated multiple aspects of cholesterol homeostasis including reduced synthesis (HMG-CoA reductase mRNA, 0.7 fold of HF), reduced bile acid synthesis (CYP7a1 expression, 0.17 of HF), and increased cholesterol clearance (reduced PCSK9 mRNA, 0.5 fold of HF; increased LDLr protein, 2 fold of HF). Taken together, this data suggests that PS and αLA work through unique and complementary mechanisms to provide a superior and more comprehensive cholesterol lowering response than either therapy alone. PMID:25664679

  12. Mice with heterozygous deficiency of lipoic acid synthase have an increased sensitivity to lipopolysaccharide-induced tissue injury

    PubMed Central

    Yi, Xianwen; Kim, Kuikwon; Yuan, Weiping; Xu, Longquan; Kim, Hyung-Suk; Homeister, Jonathon W.; Key, Nigel S.; Maeda, Nobuyo

    2009-01-01

    α-Lipoic acid (1, 2-dithiolane-3-pentanoic acid; LA), synthesized in mitochondria by LA synthase (Lias), is a potent antioxidant and a cofactor for metabolic enzyme complexes. In this study, we examined the effect of genetic reduction of LA synthesis on its antioxidant and anti-inflammatory properties using a model of LPS-induced inflammation in Lias+/– mice. The increase of plasma proinflammatory cytokine, TNF-α, and NF-κB at an early phase following LPS injection was greater in Lias+/– mice compared with Lias+/+ mice. The circulating blood white blood cell (WBC) and platelet counts dropped continuously during the initial 4 h. The counts subsequently recovered partially in Lias+/+ mice, but the recovery was impaired totally in Lias+/– mice. Administration of exogenous LA normalized the recovery of WBC counts in Lias+/– mice but not platelets. Enhanced neutrophil sequestration in the livers of Lias+/– mice was associated with increased hepatocyte injury and increased gene expression of growth-related oncogene, E-selectin, and VCAM-1 in the liver and/or lung. Lias gene expression in tissues was 50% of normal expression in Lias+/– mice and reduced further by LPS treatment. Decreased Lias expression was associated with diminished hepatic LA and tissue oxidative stress. Finally, Lias+/– mice displayed enhanced mortality when exposed to LPS-induced sepsis. These data demonstrate the importance of endogenously produced LA for preventing leukocyte accumulation and tissue injury that result from LPS-induced inflammation. PMID:18845616

  13. Complementary Cholesterol-Lowering Response of a Phytosterol/α-Lipoic Acid Combination in Obese Zucker Rats.

    PubMed

    Rideout, Todd C; Carrier, Bradley; Wen, Shin; Raslawsky, Amy; Browne, Richard W; Harding, Scott V

    2016-01-01

    To investigate the cholesterol-lowering effectiveness of a phytosterol/α-lipoic acid (PS/αLA) therapy, thirty-two male Zucker rats were randomly assigned to 1 of 4 diets for 30 days: (i) high fat diet (HF, 40% energy from fat); (ii) HF diet supplemented with 3% phytosterols; (iii) HF diet supplemented with 0.25% αLA; or (iv) HF diet supplemented with PS (3%) and αLA (0.25%, PS/αLA). Compared with the HF diet, combination PS/αLA proved more effective in reducing non-HDL cholesterol (-55%) than either the PS (-24%) or the αLA (-25%) therapies alone. PS supplementation did not affect LDL particle number, however, αLA supplementation reduced LDL particle number when supplemented alone (-47%) or in combination with PS (-54%). Compared with the HF-fed animals, evidence of increased HDL-particle number was evident in all treatment groups to a similar extent (21-22%). PS-mediated interruption of intestinal cholesterol absorption was evident by increased fecal cholesterol loss (+52%) and compensatory increase in HMG-CoA reductase mRNA (1.6 fold of HF), however, αLA supplementation did not affect fecal cholesterol loss. Hepatic mRNA and protein expression patterns suggested that αLA modulated multiple aspects of cholesterol homeostasis including reduced synthesis (HMG-CoA reductase mRNA, 0.7 fold of HF), reduced bile acid synthesis (CYP7a1 expression, 0.17 of HF), and increased cholesterol clearance (reduced PCSK9 mRNA, 0.5 fold of HF; increased LDLr protein, 2 fold of HF). Taken together, this data suggests that PS and αLA work through unique and complementary mechanisms to provide a superior and more comprehensive cholesterol lowering response than either therapy alone. PMID:25664679

  14. Nucleic acids encoding human trithorax protein

    DOEpatents

    Evans, Glen A.; Djabali, Malek; Selleri, Licia; Parry, Pauline

    2001-01-01

    In accordance with the present invention, there is provided an isolated peptide having the characteristics of human trithorax protein (as well as DNA encoding same, antisense DNA derived therefrom and antagonists therefor). The invention peptide is characterized by having a DNA binding domain comprising multiple zinc fingers and at least 40% amino acid identity with respect to the DNA binding domain of Drosophila trithorax protein and at least 70% conserved sequence with respect to the DNA binding domain of Drosophila trithorax protein, and wherein said peptide is encoded by a gene located at chromosome 11 of the human genome at q23. Also provided are methods for the treatment of subject(s) suffering from immunodeficiency, developmental abnormality, inherited disease, or cancer by administering to said subject a therapeutically effective amount of one of the above-described agents (i.e., peptide, antagonist therefor, DNA encoding said peptide or antisense DNA derived therefrom). Also provided is a method for the diagnosis, in a subject, of immunodeficiency, developmental abnormality, inherited disease, or cancer associated with disruption of chromosome 11 at q23.

  15. Curcumin, Silybin Phytosome(®) and α-R-Lipoic Acid Mitigate Chronic Hepatitis in Rat by Inhibiting Oxidative Stress and Inflammatory Cytokines Production.

    PubMed

    Ali, Shimaa O; Darwish, Hebatallah A; Ismail, Nabila A

    2016-05-01

    Chronic hepatitis is recognized as a worldwide health problem that gradually progresses towards cirrhosis and hepatocellular carcinoma. Despite the large number of experiments using animal models for allergic hepatitis, it is still difficult to produce a picture of chronic hepatitis. Therefore, this study was conducted to introduce an animal model approximating to the mechanism of chronicity in human hepatitis. The study also aimed to examine the hepatoprotective effects of curcumin, silybin phytosome(®) and α-R-lipoic acid against thioacetamide (TAA)-induced chronic hepatitis in rat model. TAA was administered intraperitoneally at a dose of 200 mg/kg three times weekly for 4 weeks. At the end of this period, a group of rats was killed to assess the development of chronic hepatitis in comparison with their respective control group. TAA administration was then discontinued, and the remaining animals were subsequently allocated into four groups. Group 1 was left untreated, whereas groups 2-4 were allowed to receive daily oral doses of curcumin, silybin phytosome(®) or α-R-lipoic acid, respectively, for 7 weeks. Increases in hepatic levels of malondialdehyde associated with TAA administration were inhibited in groups receiving supplements. Furthermore, glutathione depletion, collagen deposition, macrophage activation and nuclear factor κappa-B expression as well as tumour necrosis factor-α and interleukin-6 levels were significantly decreased in response to supplements administration. Serological analysis of liver function and liver histopathological examination reinforced the results. The above evidence collectively indicates that the antioxidant and anti-inflammatory activities of curcumin, silybin phytosome(®) and α-R-lipoic acid may confer therapeutic efficacy against chronic hepatitis. PMID:26457982

  16. Mapping the response of human fibroblast growth factor 21 (FGF21) promoter to serum availability and lipoic acid in HepG2 hepatoma cells.

    PubMed

    Xia, Mengna; Erickson, Anjeza; Yi, Xiaohua; Moreau, Régis

    2016-03-01

    The hormone-like polypeptide, fibroblast growth factor 21 (FGF21), is a major modulator of lipid and glucose metabolism and an exploratory treatment strategy for obesity related metabolic disorders. The costs of recombinant FGF21 and mode of delivery by injection are important constraints to its wide therapeutic use. The stimulation of endogenous FGF21 production through diet is being explored as an alternative approach. To that end, we examined the mechanism(s) by which serum manipulation and lipoic acid (a dietary activator of FGF21) induce FGF21 in human hepatocellular carcinoma HepG2 cells. Serum withdrawal markedly induced FGF21 mRNA levels (88 fold) and FGF21 secreted in the media (19 fold). Lipoic acid induced FGF21 mRNA 7 fold above DMSO-treated control cells and FGF21 secretion 3 fold. These effects were several-fold greater than those of PPARα agonist, Wy14643, which failed to induce FGF21 above and beyond the induction seen with serum withdrawal. The use of transcription inhibitor, actinomycin D, revealed that de novo mRNA synthesis drives FGF21 secretion in response to serum starvation. Four previously unrecognized loci in FGF21 promoter were nucleosome depleted and enriched in acetylated histone H3 revealing their role as transcriptional enhancers and putative transcription factor binding sites. FGF21 did not accumulate to a significant degree in induced HepG2 cells, which secreted FGF21 time dependently in media. We conclude that lipoic acid cell signaling connects with the transcriptional upregulation of FGF21 and it may prove to be a safe and affordable means to stimulate FGF21 production. PMID:26691139

  17. Correlation of α-Lipoic Acid and S. Glutathione Level with Free Radical Excess in Tobacco Consumers

    PubMed Central

    Kaur, Manjinder; Suhalka, M.L.; Shrivastav, Chanchal

    2016-01-01

    Introduction Tobacco consumption is a serious health hazard and most important avoidable cause of death worldwide. Tobacco is recognized as lethal toxin, ripping off 7-11 minutes of human life with each cigarette through harmful compounds and inducing free radical synthesis and a high rate of lipid peroxidation. These free radicals are scavenged by the endogenous antioxidants viz. S. Glutathione (S.GSH) and S. α-Lipoic acid (S. α-LA), thus preventing the endothelial damage. Aim The present study was designed with an aim to find out the lipid peroxidative stress through S. Malondialdehyde (S.MDA) and its correlation with antioxidant levels like S. Glutathione (S. GSH) and S. α- Lipoic acid (S. α- LA) among tobacco users (in both smokers and chewers). Materials and Methods A case control cross-sectional study was carried out in the Department of Physiology among 200 subjects; aged 18-50 years of both sexes which were chosen randomly from institutional campus and healthy volunteers. The subjects were broadly divided into two groups (A & B); group A comprised of tobacco users (n=150) with history of smoking cigarette/biddies and chewing tobacco daily, for at least one year and group B had controls (non tobacco users) (n=50). S. MDA, S.GSH and S. α-LA levels were estimated by standardized methods. The data was analysed by unpaired student t-test and Pearson’s correlation coefficient (r) for finding the correlation between antioxidants and S.MDA in group-A and group-B. Results The present study reports the significantly higher (p<0.0001) levels of S.MDA and lower (p<0.0001) levels of S.GSH and S. α-LA in tobacco users as compared to nontobacco users. The observed value of S.MDA was (2.72±0.87, 1.39±0.47) nmol/ml, S. α-LA was (9.94±5.96, 14.24 ± 4.34) μg/ml and S.GSH was (23.24±7.04, 32.82±2.95) mg/dl respectively in group-A and group-B. A significant (p<0.01) strong negative correlation was observed between S. MDA and antioxidants (S.GSH and S.

  18. Protective Efficacy of Alpha-lipoic Acid against AflatoxinB1-induced Oxidative Damage in the Liver

    PubMed Central

    Li, Y.; Ma, Q. G.; Zhao, L. H.; Guo, Y. Q.; Duan, G. X.; Zhang, J. Y.; Ji, C.

    2014-01-01

    Alpha-lipoic acid (α-LA) is not only involved in energy metabolism, but is also a powerful antioxidant that can protect against hepatic oxidative stress induced by some drugs, toxins, or under various physiological and pathophysiological conditions. Here, we investigated the effect of α-LA against liver oxidative damage in broilers exposed to aflatoxin B1 (AFB1). Birds were randomly divided into four groups and assigned different diets: basal diet, 300 mg/kg α-LA supplementation in basal diet, diet containing 74 μg/kg AFB1, and 300 mg/kg α-LA supplementation in diet containing 74 μg/kg AFB1, for 3 weeks. The results revealed that the addition of 300 mg/kg α-LA protected against the liver function damage of broilers induced by chronic low dose of AFB1 as estimated by a significant (p<0.05) change in levels of plasma total protein, albumin, alkaline phosphatase and the activities of liver glutamic-oxalacetic transaminase and glutamic-pyruvic transaminase. The histopathological analysis also showed that liver tissues were injured in the AFB1 diet, but this effect was alleviated by the addition of 300 mg/kg α-LA. Additionally, AFB1 induced a profound elevation of oxidative stress in birds, as indicated by an increase in malondialdehyde level, a decrease in glutathione peroxidase activity and a depletion of the glutathione content in the liver. All of these negative effects were inhibited by treatment with α-LA. Our results suggest that the inhibition of AFB1-induced excess production of lipid peroxides and the maintenance of intracellular antioxidant status may play important roles in the protective effects of α-LA against AFB1-induced oxidative damage in the liver. PMID:25050030

  19. Alpha-lipoic acid-mediated activation of muscarinic receptors improves hippocampus- and amygdala-dependent memory.

    PubMed

    Mahboob, Aamra; Farhat, Syeda Mehpara; Iqbal, Ghazala; Babar, Mustafeez Mujtaba; Zaidi, Najam-us-Sahar Sadaf; Nabavi, Seyed Mohammad; Ahmed, Touqeer

    2016-04-01

    Aluminum (Al) is a neurotoxic agent which readily crosses the blood-brain-barrier (BBB) and accumulates in the brain leading to neurodegenerative disorders, characterised by cognitive impairment. Alpha-lipoic acid (ALA) is an antioxidant and has a potential to improve cognitive functions. This study aimed to evaluate the neuroprotective effect of ALA in AlCl3-induced neurotoxicity mouse model. Effect of ALA (25mg/kg/day) was evaluated in the AlCl3-induced neurotoxicity (AlCl3 150 mg/kg/day) mouse model on learning and memory using behaviour tests and on the expression of muscarinic receptor genes (using RT-PCR), in hippocampus and amygdala. Following ALA treatment, the expression of muscarinic receptor genes M1, M2 and choline acetyltransferase (ChaT) were significantly improved (p<0.05) relative to AlCl3-treated group. ALA enhanced fear memory (p<0.01) and social novelty preference (p<0.001) comparative to the AlCl3-treated group. Fear extinction memory was remarkably restored (p<0.001) in ALA-treated group demonstrated by reduced freezing response as compared to the AlCl3-treated group which showed higher freezing. In-silico analysis showed that racemic mixture of ALA has higher binding affinity for M1 and M2 compared to acetylcholine. These novel findings highlight the potential role of ALA in cognitive functions and cholinergic system enhancement thus presenting it an enviable therapeutic candidate for the treatment of neurodegenerative disorders. PMID:26912408

  20. Structural Analysis of Crystalline R(+)-α-Lipoic Acid-α-cyclodextrin Complex Based on Microscopic and Spectroscopic Studies

    PubMed Central

    Ikuta, Naoko; Endo, Takatsugu; Hosomi, Shota; Setou, Keita; Tanaka, Shiori; Ogawa, Noriko; Yamamoto, Hiromitsu; Mizukami, Tomoyuki; Arai, Shoji; Okuno, Masayuki; Takahashi, Kenji; Terao, Keiji; Matsugo, Seiichi

    2015-01-01

    R(+)-α-lipoic acid (RALA) is a naturally-occurring substance, and its protein-bound form plays significant role in the energy metabolism in the mitochondria. RALA is vulnerable to a variety of physical stimuli, including heat and UV light, which prompted us to study the stability of its complexes with cyclodextrins (CDs). In this study, we have prepared and purified a crystalline RALA-αCD complex and evaluated its properties in the solid state. The results of 1H NMR and PXRD analyses indicated that the crystalline RALA-αCD complex is a channel type complex with a molar ratio of 2:3 (RALA:α-CD). Attenuated total reflection/Fourier transform infrared analysis of the complex showed the shift of the C=O stretching vibration of RALA due to the formation of the RALA-αCD complex. Raman spectroscopic analysis revealed the significant weakness of the S–S and C–S stretching vibrations of RALA in the RALA-αCD complex implying that the dithiolane ring of RALA is almost enclosed in glucose ring of α-CD. Extent of this effect was dependent on the direction of the excitation laser to the hexagonal morphology of the crystal. Solid-state NMR analysis allowed for the chemical shift of the C=O peak to be precisely determined. These results suggested that RALA was positioned in the α-CD cavity with its 1,2-dithiolane ring orientated perpendicular to the plane of the α-CD ring. PMID:26501268

  1. Evidence for protective effect of lipoic acid and desvenlafaxine on oxidative stress in a model depression in mice.

    PubMed

    Silva, Márcia Calheiros Chaves; de Sousa, Caren Nádia Soares; Gomes, Patrícia Xavier Lima; de Oliveira, Gersilene Valente; Araújo, Fernanda Yvelize Ramos; Ximenes, Naiara Coelho; da Silva, Jéssica Calheiros; Vasconcelos, Germana Silva; Leal, Luzia Kalyne Almeida Moreira; Macêdo, Danielle; Vasconcelos, Silvânia Maria Mendes

    2016-01-01

    Oxidative stress is implicated in the neurobiology of depression. Here we investigated oxidative alterations in brain areas of animals submitted to the model of depression induced by corticosterone (CORT) and the effects of the antioxidant compound alpha-lipoic acid (ALA) alone or associated with the antidepressant desvenlafaxine (DVS) in these alterations. Female mice received vehicle or CORT (20 mg/kg) during 14 days. From the 15th to 21st days different animals received further administrations of: vehicle, DVS (10 or 20 mg/kg), ALA (100 or 200 mg/kg), or the combinations of DVS10+ALA100, DVS20+ALA100, DVS10+ALA200, or DVS20+ALA200. Twenty-four hours after the last drug administration prefrontal cortex (PFC), hippocampus (HC) and striatum (ST) were dissected for the determination of the activity of superoxide dismutase (SOD), reduced glutathione (GSH) and lipid peroxidation (LP) levels. CORT significantly increased SOD activity in the PFC and HC, decreased GSH levels in the HC and increased LP in all brain areas studied when compared to saline-treated animals. Decrements of SOD activity were observed in all groups and brain areas studied when compared to controls and CORT. The hippocampal decrease in GSH was reversed by ALA100, DVS10+ALA100, DVS20+ALA100 and DVS20+ALA200. The same DVS+ALA combination groups presented increased levels of GSH in the PFC and ST. The greater GSH levels were observed in the PFC, HC and ST of DVS20+ALA200 mice. LP was reversed in the groups ALA200 (PFC), DVS10+ALA100, DVS20+ALA100 (PFC, HC and ST), and DVS20+ALA200 (PFC, HC). Our findings contribute to the previous preclinical evidences implicating ALA as a promising agent for augmentation therapy in depression. PMID:26265141

  2. Alpha-lipoic acid affects the oxidative stress in various brain structures in mice with methionine and choline deficiency.

    PubMed

    Veskovic, Milena; Mladenovic, Dusan; Jorgacevic, Bojan; Stevanovic, Ivana; de Luka, Silvio; Radosavljevic, Tatjana

    2015-04-01

    Deficiency in methionine or choline can induce oxidative stress in various organs such as liver, kidney, heart, and brain. This study was to examine the effects of alpha-lipoic acid (LA) on oxidative stress induced by methionine and choline deficiency (MCD) in several brain structures. Male mice C57BL/6 (n = 28) were divided into four groups: (1) control - continuously fed with standard chow; (2) LA - fed with standard chow and receiving LA; (3) MCD2 - fed with MCD diet for two weeks, and (4) MCD2+LA - fed with MCD diet for two weeks and receiving LA (100 mg/kg/day intraperitonealy [i.p.]). Brain tissue (cortex, hypothalamus, striatum and hippocampus) was taken for determination of oxidative stress parameters. MCD diet induced a significant increase in malondialdehyde and NOx concentration in all brain regions, while LA restored their content to normal values. Similar to this, in MCD2 group, activity of total SOD, MnSOD, and Cu/ZnSOD was reduced by MCD diet, while LA treatment improved their activities in all brain structures. Besides, in MCD2 group a decrease in catalase activity in cortex and GSH content in hypothalamus was evident, while LA treatment induced an increase in catalase activity in cortex and striatum and GSH content in hypothalamus. LA treatment can significantly reduce lipid peroxidation and nitrosative stress, caused by MCD diet, in all brain regions by restoring antioxidant enzymes activities, predominantly total SOD, MnSOD, and Cu/ZnSOD, and to a lesser extent by modulating catalase activity and GSH content. LA supplementation may be used in order to prevent brain oxidative injury induced by methionine and choline deficiency. PMID:25193852

  3. Efficacy and safety of prostaglandin E1 plus lipoic acid combination therapy versus monotherapy for patients with diabetic peripheral neuropathy.

    PubMed

    Jiang, De-Qi; Li, Ming-Xing; Ma, Yan-Jiao; Wang, Yan; Wang, Yong

    2016-05-01

    The aim of this report was to evaluate the efficacy and safety of prostaglandin E1 (PGE1) plus lipoic acid (LA) for the treatment of diabetic peripheral neuropathy (DPN) compared with that of PGE1 or LA monotherapy. Randomized controlled trials (RCT) published up to 3 August 2014 were reviewed. A random or fixed effect model was used to analyze outcomes expressed as risk ratios (RR) or mean difference (MD) with a 95% confidence interval (CI). I(2) statistic was used to assess heterogeneity. Subgroup and sensitivity analyses were performed. The outcomes measured were as follows: clinical efficacy, median motor nerve conduction velocity (MNCV), median sensory nerve conduction velocity (SNCV), peroneal MNCV, peroneal SNCV and adverse effects. Thirty-one RCT with 2676 participants were included. Clinical efficacy of PGE1+LA combination therapy was significantly better than monotherapy (p<0.00001, RR=1.32, 95% CI 1.26 to 1.38). Compared with monotherapy, PGE1+LA combination therapy led to significant improvements in median MNCV (p<0.00001, MD=4.69, 95% CI 3.16 to 6.23), median SNCV (p<0.00001, MD=5.46, 95% CI 4.04 to 6.88), peroneal MNCV (p<0.00001, MD=5.19, 95% CI 3.71 to 6.67) and peroneal SNCV (p<0.00001, MD=5.50, 95% CI 3.30 to 7.70). There were no serious adverse events associated with drug intervention. PGE1+LA combination therapy is superior to PGE1 or LA monotherapy for improvement of neuropathic symptoms and nerve conduction velocities in patients with DPN. These findings should be further validated by larger well-designed and high-quality RCT. PMID:26775115

  4. Bacteriological analysis of water by potentiometric measurement of lipoic acid reduction: preliminary assays for selective detection of indicator organisms.

    PubMed Central

    Charriere, G; Jouenne, T; Lemeland, J F; Selegny, E; Junter, G A

    1984-01-01

    The practical task of adapting an original potentiometric technique to the bacteriological analysis of water is discussed. Various laboratory strains of organisms belonging to the usual aquatic flora were inoculated one by one in a minimal lactose broth supplied with lipoic (thioctic) acid. The time evolution of the redox potential of the cultures was followed during incubation by combined gold versus reference electrodes. When the incubation temperature was regulated at 36 degrees C, most organisms were able to grow and to reduce the coenzyme, generating changes in the redox potential of the culture. However, very few organisms developed significant reductive activity when the temperature was increased to 41 degrees C and when the broth was provided with sodium deoxycholate. Among the fecal coliform organisms, only Escherichia coli and Klebsiella pneumoniae exhibited early but reproducible potential-time responses. Positive potentiometric responses were also recorded with Acinetobacter calcoaceticus. E. coli showed rapid potentiometric signals as compared with K. pneumoniae. The time required for 100-mV shift of potential to be detected was related to the logarithm of the initial concentration of E. coli or K. pneumoniae in the culture broth. Experiments on natural surface water samples showed the the potentiometric method, associated with the selective incubation conditions, mainly detected E. coli among the bacterial flora of the tested environmental water. The calibration curve relating the time required for a 100-mV shift of potential to be detected to the number of fecal coliforms, as determined by control fecal coliform-selective plate counts, was consistent with the composite standard curve of detection times obtained with six different laboratory strains of E. coli.(ABSTRACT TRUNCATED AT 250 WORDS) PMID:6421230

  5. Flaxseed oil and alpha-lipoic acid combination ameliorates hepatic oxidative stress and lipid accumulation in comparison to lard

    PubMed Central

    2013-01-01

    Background Intake of high-fat diet is associated with increased non-alcoholic fatty liver disease (NAFLD). Hepatic lipid accumulation and oxidative stress are key pathophysiological mechanisms in NAFLD. Both flaxseed oil (FO) and α-lipoic acid (LA) exert potential benefit to NAFLD. The aim of this study was to determine the effect of the combination of FO and LA on hepatic lipid accumulation and oxidative stress in rats induced by high-fat diet. Methods LA was dissolved in flaxseed oil to a final concentration of 8 g/kg (FO + LA). The rodent diet contained 20% fat. One-fifth of the fat was soybean oil and the others were lard (control group), or 75% lard and 25% FO + LA (L-FO + LA group), or 50% lard and 50% FO + LA (M-FO + LA group), or FO + LA (H-FO + LA group). Male Sprague–Dawley rats were fed for 10 weeks and then killed for liver collection. Results Intake of high-fat lard caused a significant hepatic steatosis. Replacement with FO + LA was effective in reducing steatosis as well as total triglyceride and total cholesterol contents in liver. The combination of FO and LA also significantly elevated hepatic antioxidant defense capacities, as evaluated by the remarkable increase in the activities of SOD, CAT and GPx as well as the level of GSH, and the significant decline in lipid peroxidation. Conclusion The combination of FO and LA may contribute to prevent fatty livers such as NAFLD by ameliorating hepatic lipid accumulation and oxidative stress. PMID:23634883

  6. Age and gender dependent bioavailability of R- and R,S-α-lipoic acid: A pilot study

    PubMed Central

    Keith, Dove J.; Butler, Judy A.; Bemer, Brett; Dixon, Brian; Johnson, Shawn; Garrard, Mary; Sudakin, Daniel L.; Christensen, J. Mark; Pereira, Cliff; Hagen, Tory M.

    2014-01-01

    Lipoic acid (LA) shows promise as a beneficial micronutrient toward improving elder health. Studies using old rats show that (R)-α-LA (R-LA) significantly increases low molecular weight antioxidants that otherwise decline with age. Despite this rationale for benefiting human health, little is known about age-associated alterations in absorption characteristics of LA, or whether the commercially available racemic mixture of LA (R,S-LA) is equally as bioavailable as the naturally occurring R-enantiomer. To address these discrepancies, a pilot study was performed to establish which form of LA is most effectively absorbed in older subjects relative to young volunteers. Young adults (average age = 32 years) and older adults (average age = 79 years) each received 500 mg of either R- or R,S-LA. Blood samples were collected for 3 h after supplementation. After a washout period they were given the other chiral form of LA not originally ingested. Results showed that 2 out of 6 elder males exhibited greater maximal plasma LA and area under the curve for the R-form of LA versus the racemic mixture. The elder subjects also demonstrated a reduced time to reach maximal plasma LA concentration following R-LA supplementation than for the racemic mixture. In contrast, young males had a tendency for increased bioavailability of R,S-LA. Overall, bioavailability for either LA isoform was much more variable between older subjects compared to young adults. Plasma glutathione levels were not altered during the sampling period. Thus subject age, and potential for varied response, should be considered when determining an LA supplementation regimen. PMID:22609537

  7. Age and gender dependent bioavailability of R- and R,S-α-lipoic acid: a pilot study.

    PubMed

    Keith, Dove J; Butler, Judy A; Bemer, Brett; Dixon, Brian; Johnson, Shawn; Garrard, Mary; Sudakin, Daniel L; Christensen, J Mark; Pereira, Cliff; Hagen, Tory M

    2012-09-01

    Lipoic acid (LA) shows promise as a beneficial micronutrient toward improving elder health. Studies using old rats show that (R)-α-LA (R-LA) significantly increases low molecular weight antioxidants that otherwise decline with age. Despite this rationale for benefiting human health, little is known about age-associated alterations in absorption characteristics of LA, or whether the commercially available racemic mixture of LA (R,S-LA) is equally as bioavailable as the naturally occurring R-enantiomer. To address these discrepancies, a pilot study was performed to establish which form of LA is most effectively absorbed in older subjects relative to young volunteers. Young adults (average age=32 years) and older adults (average age=79 years) each received 500 mg of either R- or R,S-LA. Blood samples were collected for 3h after supplementation. After a washout period they were given the other chiral form of LA not originally ingested. Results showed that 2 out of 6 elder males exhibited greater maximal plasma LA and area under the curve for the R-form of LA versus the racemic mixture. The elder subjects also demonstrated a reduced time to reach maximal plasma LA concentration following R-LA supplementation than for the racemic mixture. In contrast, young males had a tendency for increased bioavailability of R,S-LA. Overall, bioavailability for either LA isoform was much more variable between older subjects compared to young adults. Plasma glutathione levels were not altered during the sampling period. Thus subject age, and potential for varied response, should be considered when determining an LA supplementation regimen. PMID:22609537

  8. Effects of α-lipoic acid on endothelial function in aged diabetic and high-fat fed rats

    PubMed Central

    Sena, C M; Nunes, E; Louro, T; Proença, T; Fernandes, R; Boarder, M R; Seiça, R M

    2007-01-01

    Background and purpose: This study was conducted to investigate the effects of α-lipoic acid (α-LA) on endothelial function in diabetic and high-fat fed animal models and elucidate the potential mechanism underlying the benefits of α-LA. Experimental approach: Plasma metabolites reflecting glucose and lipid metabolism, endothelial function, urinary albumin excretion (UAE), plasma and aortic malondialdehyde (MDA) and urinary 8-hydroxydeoxyguanosine (8-OHdG) were assessed in non-diabetic controls (Wistar rats), untreated Goto-Kakizaki (GK) diabetic and high-fat fed GK rats (fed with atherogenic diet only, treated with α-LA and treated with vehicle, for 3 months). Vascular eNOS, nitrotyrosine, carbonyl groups and superoxide anion were also assessed in the different groups. Key results: α-LA and soybean oil significantly reduced both total and non-HDL serum cholesterol and triglycerides induced by atherogenic diet. MDA, carbonyl groups, vascular superoxide and 8-OHdG levels were higher in GK and high-fat fed GK groups and fully reversed with α-LA treatment. High-fat fed GK diabetic rats showed significantly reduced endothelial function and increased UAE, effects ameliorated with α-LA. This endothelial dysfunction was associated with decreased NO production, decreased expression of eNOS and increased vascular superoxide production and nitrotyrosine expression. Conclusions and implications: α-LA restores endothelial function and significantly improves systemic and local oxidative stress in high-fat fed GK diabetic rats. Improved endothelial function due to α-LA was at least partially attributed to recoupling of eNOS and increased NO bioavailability and represents a pharmacological approach to prevent major complications associated with type 2 diabetes. PMID:17906683

  9. Effects of alpha-lipoic acid on chemerin secretion in 3T3-L1 and human adipocytes.

    PubMed

    Prieto-Hontoria, Pedro L; Pérez-Matute, Patricia; Fernández-Galilea, Marta; López-Yoldi, Miguel; Sinal, Christopher J; Martínez, J Alfredo; Moreno-Aliaga, María J

    2016-03-01

    Chemerin is a novel adipokine associated with obesity and insulin resistance. α-Lipoic acid (α-LA) has shown beneficial properties on diabetes and obesity. The aim of this study was to examine the effects of α-LA on chemerin production in adipocytes in absence or presence of TNF-α, insulin and AICAR. The potential signaling pathways involved in α-LA effects on chemerin were also analyzed. α-LA actions on chemerin were tested in differentiated 3T3-L1 adipocytes and in some cases in human subcutaneous and omental adipocytes. Chemerin mRNA levels were measured by RT-PCR and the amount of chemerin secreted to culture media was determined by ELISA. α-LA induced a concentration-dependent inhibition on both chemerin secretion and mRNA levels in 3T3-L1 adipocytes. The AMPK activator AICAR and the PI3K inhibitor LY294002 dramatically abrogated both chemerin secretion and gene expression, and further potentiated the inhibitory effect of α-LA on chemerin secretion. Insulin was able to partially reverse the inhibitory action of α-LA on chemerin secretion. α-LA also reduced basal chemerin secretion in both subcutaneous and omental adipocytes from overweight/obese subjects. Moreover, α-LA was able to abolish the stimulatory effects of the pro-inflammatory cytokine TNF-α on chemerin secretion. Our data demonstrated the ability of α-LA to inhibit chemerin production, an adipokine associated to obesity and metabolic syndrome, suggesting that the reduction of chemerin could contribute to the antiobesity/antidiabetic properties described for α-LA. PMID:26721419

  10. Clinical Usefulness of Oral Supplementation with Alpha-Lipoic Acid, Curcumin Phytosome, and B-Group Vitamins in Patients with Carpal Tunnel Syndrome Undergoing Surgical Treatment

    PubMed Central

    Pajardi, Giorgio; Bortot, Paola; Ponti, Veronica; Novelli, Chiara

    2014-01-01

    We investigated the clinical usefulness of oral supplementation with a combination product containing alpha-lipoic acid, curcumin phytosome, and B-group vitamins in 180 patients with carpal tunnel syndrome (CTS), scheduled to undergo surgical decompression of the median nerve. Patients in Group A (n = 60) served as controls and did not receive any treatment either before or after surgery. Patients in Group B (n = 60) received oral supplementation twice a day for 3 months both before and after surgery (totaling 6 months of supplementation). Patients in Group C (n = 60) received oral supplementation twice a day for 3 months before surgery only. Patients in Group B showed significantly lower nocturnal symptoms scores compared with Group A subjects at both 40 days and 3 months after surgery (both P values <0.05). Moreover, patients in Group B had a significantly lower number of positive Phalen's tests at 3 months compared with the other study groups (P < 0.05). We conclude that oral supplementation with alpha-lipoic acid, curcumin phytosome, and B-group vitamins twice a day both before and after surgery is safe and effective in CTS patients scheduled to undergo surgical decompression of the median nerve. PMID:24563654

  11. Modulatory effects of curcumin, silybin-phytosome and alpha-R-lipoic acid against thioacetamide-induced liver cirrhosis in rats.

    PubMed

    Ali, Shimaa Omar; Darwish, Hebatallah Abd El-moeti; Ismail, Nabila Abd El-fattah

    2014-06-01

    Liver cirrhosis is the final consequence of a progressive fibrotic process characterized by excessive collagen deposition and destruction of the normal liver architecture. This study aimed to investigate the protective effects of curcumin, silybin-phytosome and alpha-R-lipoic acid against thioacetamide-induced cirrhosis. Male rats were allocated into five groups of which one group received saline and served as normal control. Animals from groups 2-5 were treated with thioacetamide administered intraperitoneally at a dose of 200 mg/kg 3 times per week for 7 weeks. Group 2 was left untreated while groups from 3 to 5 were given a daily oral dose of curcumin, silybin-phytosome or alpha-R-lipoic acid simultaneously with thioacetamide. Increases in hepatic levels of malondialdehyde (MDA) and protein carbonyls (Pr Co) associated with thioacetamide administration were partially blocked in those groups receiving supplements. Glutathione (GSH) depletion, collagen deposition, matrix metalloproteinase-2 (MMP-2) activity, transforming growth factor-β1 (TGF-β1) level as well as α-smooth muscle actin (α-SMA) and heat shock protein-47 (HSP-47) gene expressions were also decreased in response to supplements administration. Serological analysis of liver function and histopathological examination reinforced the results. In conclusion, the present study highlights the antioxidant and the antifibrotic potentials of these supplements against chronic liver diseases caused by ongoing hepatic damage. PMID:24704557

  12. Clinical usefulness of oral supplementation with alpha-lipoic Acid, curcumin phytosome, and B-group vitamins in patients with carpal tunnel syndrome undergoing surgical treatment.

    PubMed

    Pajardi, Giorgio; Bortot, Paola; Ponti, Veronica; Novelli, Chiara

    2014-01-01

    We investigated the clinical usefulness of oral supplementation with a combination product containing alpha-lipoic acid, curcumin phytosome, and B-group vitamins in 180 patients with carpal tunnel syndrome (CTS), scheduled to undergo surgical decompression of the median nerve. Patients in Group A (n = 60) served as controls and did not receive any treatment either before or after surgery. Patients in Group B (n = 60) received oral supplementation twice a day for 3 months both before and after surgery (totaling 6 months of supplementation). Patients in Group C (n = 60) received oral supplementation twice a day for 3 months before surgery only. Patients in Group B showed significantly lower nocturnal symptoms scores compared with Group A subjects at both 40 days and 3 months after surgery (both P values <0.05). Moreover, patients in Group B had a significantly lower number of positive Phalen's tests at 3 months compared with the other study groups (P < 0.05). We conclude that oral supplementation with alpha-lipoic acid, curcumin phytosome, and B-group vitamins twice a day both before and after surgery is safe and effective in CTS patients scheduled to undergo surgical decompression of the median nerve. PMID:24563654

  13. Rheology as a Tool to Predict the Release of Alpha-Lipoic Acid from Emulsions Used for the Prevention of Skin Aging

    PubMed Central

    Isaac, Vera Lucia Borges; Chiari-Andréo, Bruna Galdorfini; Marto, Joana Marques; Moraes, Jemima Daniela Dias; Leone, Beatriz Alves; Corrêa, Marcos Antonio; Ribeiro, Helena Margarida

    2015-01-01

    The availability of an active substance through the skin depends basically on two consecutive steps: the release of this substance from the vehicle and its subsequent permeation through the skin. Hence, studies on the specific properties of vehicles, such as their rheological behavior, are of great interest in the field of dermatological products. Recent studies have shown the influence of the rheological features of a vehicle on the release of drugs and active compounds from the formulation. In this context, the aim of this study was to evaluate the influence of the rheological features of two different emulsion formulations on the release of alpha-lipoic acid. Alpha-lipoic acid (ALA) was chosen for this study because of its antioxidant characteristics, which could be useful for the prevention of skin diseases and aging. The rheological and mechanical behavior and the in vitro release profile were assayed. The results showed that rheological features, such as viscosity, thixotropy, and compliance, strongly influenced the release of ALA from the emulsion and that the presence of a hydrophilic polymer in one of the emulsions was an important factor affecting the rheology and, therefore, the release of ALA. PMID:26788510

  14. Effect of stents coated with a combination of sirolimus and alpha-lipoic acid in a porcine coronary restenosis model.

    PubMed

    Lim, Kyung Seob; Park, Jun-Kyu; Jeong, Myung Ho; Bae, In-Ho; Nah, Jae-Woon; Park, Dae Sung; Kim, Jong Min; Kim, Jung Ha; Lee, So Youn; Jang, Eun Jae; Jang, Suyoung; Kim, Hyun Kuk; Sim, Doo Sun; Park, Keun-Ho; Hong, Young Joon; Ahn, Youngkeun; Kang, Jung Chaee

    2016-04-01

    The aim of this study was to evaluate antiproliferative sirolimus- and antioxidative alpha-lipoic acid (ALA)-eluting stents using biodegradable polymer [poly-L-lactic acid (PLA)] in a porcine coronary overstretch restenosis model. Forty coronary arteries of 20 pigs were randomized into four groups in which the coronary arteries had a bare metal stent (BMS, n = 10), ALA-eluting stent with PLA (AES, n = 10), sirolimus-eluting stent with PLA (SES, n = 10), or sirolimus- and ALA-eluting stent with PLA (SAS, n = 10). A histopathological analysis was performed 28 days after the stenting. The ALA and sirolimus released slowly over 30 days. There were no significant differences between groups in the injury or inflammation score; however, there were significant differences in the percent area of stenosis (56.2 ± 11.78% in BMS vs. 51.5 ± 12.20% in AES vs. 34.7 ± 7.23% in SES vs. 28.7 ± 7.30% in SAS, P < 0.0001) and fibrin score [1.0 (range 1.0-1.0) in BMS vs. 1.0 (range 1.0-1.0) in AES vs. 2.0 (range 2.0-2.0) in SES vs. 2.0 (range 2.0-2.0) in SAS, P < 0.0001] between the four groups. The percent area of stenosis based on micro-computed tomography corresponded with the restenosis rates based on histopathological stenosis in different proportions in the four groups (54.8 ± 7.88% in BMS vs. 50.4 ± 14.87% in AES vs. 34.5 ± 7.22% in SES vs. 28.9 ± 7.22% in SAS, P < 0.05). SAS showed a better neointimal inhibitory effect than BMS, AES, and SES at 1 month after stenting in a porcine coronary restenosis model. Therefore, SAS with PLA can be a useful drug combination for coronary stent coating to suppress neointimal hyperplasia. PMID:26886814

  15. Comparison of shock wave therapy and nutraceutical composed of Echinacea angustifolia, alpha lipoic acid, conjugated linoleic acid and quercetin (perinerv) in patients with carpal tunnel syndrome.

    PubMed

    Notarnicola, Angela; Maccagnano, Giuseppe; Tafuri, Silvio; Fiore, Alessandra; Pesce, Vito; Moretti, Biagio

    2015-06-01

    Even though the initial treatment of carpal tunnel syndrome (CTS) is conservative, knowledge of the clinical effects of supplements and of some methods of physiotherapy is still preliminary. Many biological mechanisms can support the administration of shock wave therapy (ESWT) or of alpha lipoic acid (ALA) based nutraceutical, conjugated linoleic acid (GLA), anti-oxidants and Echinacea angustifolia for CTS. The shock waves reduce the nerve compression, produce an anti-inflammatory action, and accelerate the regeneration of neuropathy. ALA and GLA induce antioxidant protective actions, reduce inflammation, promote neuroregeneration, and decrease pain. The Echinacea modulates the endogenous cannabinoid system.The aim of study is to verify the efficiency of shock wave therapy versus nutraceutical composed of ALA, GLA, and Echinacea in CTS. Sixty patients were enrolled in this study and they were randomly assigned to one of two treatments. Both groups showed significant improvements in pain, symptoms' severity and functional scores, and electrodiagnostic results until the sixth month. We verified a trend to a better pain regression in the nutraceutical group. The presence of the medicinal Echinacea represents an added value to the antioxidant effect in ALA and GLA, which can justify this result. ESWT or the association of ALA, GLA, and Echinacea proved to be two effective treatments for controlling symptoms and improving the evolution of CTS. PMID:25953494

  16. The clinical efficacy of cosmeceutical application of liquid crystalline nanostructured dispersions of alpha lipoic acid as anti-wrinkle.

    PubMed

    Sherif, Saly; Bendas, Ehab R; Badawy, Sabry

    2014-02-01

    Topical 5% alpha lipoic acid (ALA) has shown efficacy in treatment of photo-damaged skin. The aim of this work was to evaluate the potential of poloxamer (P407) gel as a vehicle for the novel lipid base particulate system (cubosome dispersions) of ALA. Cubosome dispersions were formulated by two different approaches, emulsification of glyceryl monoolein (GMO) and poloxamer (P407) in water followed by ultrasonication, and the dilution method using a hydrotrope. Three different concentrations of GMO were used to formulate the cubosome dispersions using the first method, 5% (D1), 10% (D2) and 15% w/w (D3). In the second technique an isotropic liquid was produced by combining GMO with ethanol, and this isotropic liquid was then diluted with a P407 solution (D4). The dispersions were characterized by zeta potential, light scattering techniques, optical and transmission electron microscopy, encapsulation efficiency and in vitro drug release. Results showed that D4 was not a uniform dispersion and that D1, D2 and D3 were uniform dispersions, in which by increasing the GMO content in the dispersion, the size of the cubosomes decreased, zeta potential became more negative, encapsulation efficiency increased up to 86.48% and the drug release rate was slower. P407 gels were prepared using the cold method. Two concentrations of P407 gel were fabricated, 20 and 30% w/w. P407 gels were loaded with either ALA or dispersions containing ALA cubosomes. P407 gels were characterized by critical gelation temperature, rheological measurements and in vitro drug release studies. Results suggested that by increasing P407 concentration, the gelation temperature decreases and viscosity increases. Drug release in both cases was found to follow the Higuchi square root model. Gel loaded with ALA cubosomes provided a significantly lower release rate than the gel loaded with the un-encapsulated ALA. A double blinded placebo controlled clinical study was conducted, aiming to evaluate the efficacy

  17. Selective deposition of dietary α-Lipoic acid in mitochondrial fraction and its synergistic effect with α-Tocoperhol acetate on broiler meat oxidative stability

    PubMed Central

    2013-01-01

    The use of bioactive antioxidants in feed of broiler to mitigate reactive oxygen species (ROS) in biological systems is one of promising nutritional strategies. The aim of present study was to alleviate ROS production in mitochondrial fraction (MF) of meat by supplemented dietary antioxidant in feed of broiler. For this purpose, mitochondria specific antioxidant: α-lipoic acid (25 mg, 75 mg and 150 mg) with or without combination of α-tocopherol acetate (200 mg) used in normal and palm olein oxidized oil (4%) supplemented feed. One hundred and eighty one day old broiler birds were randomly divided into six treatments and provided the mentioned feed from third week. Feed intake, feed conversion ratio (FCR) remained statistically same in all groups while body weight decreased in supplemented groups accordingly at the end of study. The broiler meat MF antioxidant potential was significantly improved by feeding supplemented feed estimated as 1,1-di phenyl-2-picrylhydrazyl (DPPH) free radical scavenging activity, 2,2-azinobis-(3- ethylbenzothiazoline-6-sulphonic acid) (ABTS+) and thiobarbituric acid reactive substances (TBARS). The maximum antioxidant activity was depicted in group fed on 150 mg/kg α-lipoic acid (ALA) and 200 mg/kg α-tocopherol acetate (ATA) (T4) in both breast and leg MF. Moreover, TBARS were higher in leg as compared to breast MF. Although, oxidized oil containing feed reduced the growth, lipid stability and antioxidant potential of MF whilst these traits were improved by receiving feed containing ALA and ATA. ALA and ATA showed higher deposition in T4 group while least in group received oxidized oil containing feed (T5). Positive correlation exists between DPPH free radical scavenging activity and the ABTS + reducing activity. In conclusion, ALA and ATA supplementation in feed had positive effect on antioxidant status of MF that consequently diminished the oxidative stress in polyunsaturated fatty acid enriched meat. PMID:23617815

  18. Selective deposition of dietary α-lipoic acid in mitochondrial fraction and its synergistic effect with α-tocoperhol acetate on broiler meat oxidative stability.

    PubMed

    Parveen, Rashida; Asghar, Ali; Anjum, Faqir M; Khan, Muhammad I; Arshad, Muhammad Sajid; Yasmeen, Ammara

    2013-01-01

    The use of bioactive antioxidants in feed of broiler to mitigate reactive oxygen species (ROS) in biological systems is one of promising nutritional strategies. The aim of present study was to alleviate ROS production in mitochondrial fraction (MF) of meat by supplemented dietary antioxidant in feed of broiler. For this purpose, mitochondria specific antioxidant: α-lipoic acid (25 mg, 75 mg and 150 mg) with or without combination of α-tocopherol acetate (200 mg) used in normal and palm olein oxidized oil (4%) supplemented feed. One hundred and eighty one day old broiler birds were randomly divided into six treatments and provided the mentioned feed from third week. Feed intake, feed conversion ratio (FCR) remained statistically same in all groups while body weight decreased in supplemented groups accordingly at the end of study. The broiler meat MF antioxidant potential was significantly improved by feeding supplemented feed estimated as 1,1-di phenyl-2-picrylhydrazyl (DPPH) free radical scavenging activity, 2,2-azinobis-(3- ethylbenzothiazoline-6-sulphonic acid) (ABTS+) and thiobarbituric acid reactive substances (TBARS). The maximum antioxidant activity was depicted in group fed on 150 mg/kg α-lipoic acid (ALA) and 200 mg/kg α-tocopherol acetate (ATA) (T4) in both breast and leg MF. Moreover, TBARS were higher in leg as compared to breast MF. Although, oxidized oil containing feed reduced the growth, lipid stability and antioxidant potential of MF whilst these traits were improved by receiving feed containing ALA and ATA. ALA and ATA showed higher deposition in T4 group while least in group received oxidized oil containing feed (T5). Positive correlation exists between DPPH free radical scavenging activity and the ABTS + reducing activity. In conclusion, ALA and ATA supplementation in feed had positive effect on antioxidant status of MF that consequently diminished the oxidative stress in polyunsaturated fatty acid enriched meat. PMID:23617815

  19. Lead induced oxidative damage and its response to combined administration of alpha-lipoic acid and succimers in rats.

    PubMed

    Pande, Manisha; Flora, S J S

    2002-08-15

    Alpha-lipoic acid (LA) has been reported to be highly effective in improving the thiol capacity of the cells and in reducing lead induced oxidative stress. These results suggested its possible role as a therapeutic intervention of lead poisoning in combination with a chelator. We investigated the effects of LA, either alone or when administered in combination with succimer (meso 2,3-dimercaptosuccinic acid; DMSA or one of its analogue monoisoamyl DMSA), in influencing the lead induced alterations in haem synthesis pathway, hepatic, renal and brain oxidative stress and lead concentration from blood and soft tissues. The results suggest a significant lead induced inhibition of delta-aminolevulinic acid dehydratase (ALAD), reduction in glutathione (GSH) and an increased zinc protoporphyrin (ZPP) level in blood, indicating altered heme synthesis pathway. Both the thiol chelators were able to increase blood ALAD activity and GSH level towards normal. The most prominent effect on blood ALAD activity was however observed when monoisoamyl DMSA (MiADMSA) was co-administered with LA. Lead exposure produced significant depletion of hepatic GSH, while, oxidized glutahione (GSSG), thiobarbituric acid reactive substances (TBARS) and catalase activity increased significantly, suggesting hepatic oxidative stress. All the treatments were able to increase hepatic GSH and reduce GSSG levels, while, TBARS level reduced significantly in animals administered LA and MiADMSA, individually or in combination. Lead induced increase in renal GSSG, TBARS levels and catalase activity, were effectively reduced by LA, while, the two chelators when administered alone were effective only in reducing GSSG and catalase activity. The most prominent beneficial effects, however, were observed in animals treated concomitantly with LA and one of the chelators (DMSA or MiADMSA). Brain GSH and GSSG levels decreased moderately while superoxide dismutase (SOD) activity remained statistically unaltered on lead

  20. The Effects of α-Lipoic Acid on Liver Oxidative Stress and Free Fatty Acid Composition in Methionine–Choline Deficient Diet-Induced NAFLD

    PubMed Central

    Stanković, Milena N.; Mladenović, Dušan; Ninković, Milica; Ðuričić, Ivana; Šobajić, Slađana; Jorgačević, Bojan; de Luka, Silvio; Vukicevic, Rada Jesic

    2014-01-01

    Abstract Development of nonalcoholic fatty liver disease (NAFLD) occurs through initial steatosis and subsequent oxidative stress. The aim of this study was to examine the effects of α-lipoic acid (LA) on methionine–choline deficient (MCD) diet-induced NAFLD in mice. Male C57BL/6 mice (n=21) were divided into three groups (n=7 per group): (1) control fed with standard chow, (2) MCD2 group—fed with MCD diet for 2 weeks, and (3) MCD2+LA group—2 weeks on MCD receiving LA i.p. 100 mg/kg/day. After the treatment, liver samples were taken for pathohistology, oxidative stress parameters, antioxidative enzymes, and liver free fatty acid (FFA) composition. Mild microvesicular hepatic steatosis was found in MCD2 group, while it was reduced to single fat droplets evident in MCD2+LA group. Lipid peroxidation and nitrosative stress were increased by MCD diet, while LA administration induced a decrease in liver malondialdehyde and nitrates+nitrites level. Similary, LA improved liver antioxidative capacity by increasing total superoxide dismutase (tSOD), manganese SOD (MnSOD), and copper/zinc-SOD (Cu/ZnSOD) activity as well as glutathione (GSH) content. Liver FFA profile has shown a significant decrease in saturated acids, arachidonic, and docosahexaenoic acid (DHA), while LA treatment increased their proportions. It can be concluded that LA ameliorates lipid peroxidation and nitrosative stress in MCD diet-induced hepatic steatosis through an increase in SOD activity and GSH level. In addition, LA increases the proportion of palmitic, stearic, arachidonic, and DHA in the fatty liver. An increase in DHA may be a potential mechanism of anti-inflammatory and antioxidant effects of LA in MCD diet-induced NAFLD. PMID:24325457

  1. Is alpha-lipoic acid a scavenger of reactive oxygen species in vivo? Evidence for its initiation of stress signaling pathways that promote endogenous antioxidant capacity.

    PubMed

    Petersen Shay, Kate; Moreau, Régis F; Smith, Eric J; Hagen, Tory M

    2008-06-01

    The chemical reduction and oxidation (redox) properties of alpha-lipoic acid (LA) suggest that it may have potent antioxidant potential. A significant number of studies now show that LA and its reduced form, dihydrolipoic acid (DHLA), directly scavenge reactive oxygen species (ROS) and reactive nitrogen species (RNS) species and protect cells against a host of insults where oxidative stress is part of the underlying etiology. However, owing to its limited and transient accumulation in tissues following oral intake, the efficacy of nonprotein-bound LA to function as a physiological antioxidant has been questioned. Herein, we review the evidence that the micronutrient functions of LA may be more as an effector of important cellular stress response pathways that ultimately influence endogenous cellular antioxidant levels and reduce proinflammatory mechanisms. This would promote a sustained improvement in cellular resistance to pathologies where oxidative stress is involved, which would not be forthcoming if LA solely acted as a transient ROS scavenger. PMID:18409172

  2. Hypermetabolic state in the 7-month-old triple transgenic mouse model of Alzheimer's disease and the effect of lipoic acid: a 13C-NMR study

    PubMed Central

    Sancheti, Harsh; Patil, Ishan; Kanamori, Keiko; Díaz Brinton, Roberta; Zhang, Wei; Lin, Ai-Ling; Cadenas, Enrique

    2014-01-01

    Alzheimer's disease (AD) is characterized by age-dependent biochemical, metabolic, and physiologic changes. These age-dependent changes ultimately converge to impair cognitive functions. This study was carried out to examine the metabolic changes by probing glucose and tricarboxylic acid cycle metabolism in a 7-month-old triple transgenic mouse model of AD (3xTg-AD). The effect of lipoic acid, an insulin-mimetic agent, was also investigated to examine its ability in modulating age-dependent metabolic changes. Seven-month-old 3xTg-AD mice were given intravenous infusion of [1-13C]glucose followed by an ex vivo 13C nuclear magnetic resonance to determine the concentrations of 13C-labeled isotopomers of glutamate, glutamine, aspartate, gamma aminobutyric acid, and N-acetylaspartate. An intravenous infusion of [1-13C]glucose+[1,2-13C]acetate was given for different periods of time to distinguish neuronal and astrocytic metabolism. Enrichments of glutamate, glutamine, and aspartate were calculated after quantifying the total (12C+13C) concentrations by high-performance liquid chromatography. A hypermetabolic state was clearly evident in 7-month-old 3xTg-AD mice in contrast to the hypometabolic state reported earlier in 13-month-old mice. Hypermetabolism was evidenced by prominent increase of 13C labeling and enrichment in the 3xTg-AD mice. Lipoic acid feeding to the hypermetabolic 3xTg-AD mice brought the metabolic parameters to the levels of nonTg mice. PMID:25099753

  3. Hypermetabolic state in the 7-month-old triple transgenic mouse model of Alzheimer's disease and the effect of lipoic acid: a 13C-NMR study.

    PubMed

    Sancheti, Harsh; Patil, Ishan; Kanamori, Keiko; Díaz Brinton, Roberta; Zhang, Wei; Lin, Ai-Ling; Cadenas, Enrique

    2014-11-01

    Alzheimer's disease (AD) is characterized by age-dependent biochemical, metabolic, and physiologic changes. These age-dependent changes ultimately converge to impair cognitive functions. This study was carried out to examine the metabolic changes by probing glucose and tricarboxylic acid cycle metabolism in a 7-month-old triple transgenic mouse model of AD (3xTg-AD). The effect of lipoic acid, an insulin-mimetic agent, was also investigated to examine its ability in modulating age-dependent metabolic changes. Seven-month-old 3xTg-AD mice were given intravenous infusion of [1-(13)C]glucose followed by an ex vivo (13)C nuclear magnetic resonance to determine the concentrations of (13)C-labeled isotopomers of glutamate, glutamine, aspartate, gamma aminobutyric acid, and N-acetylaspartate. An intravenous infusion of [1-(13)C]glucose+[1,2-(13)C]acetate was given for different periods of time to distinguish neuronal and astrocytic metabolism. Enrichments of glutamate, glutamine, and aspartate were calculated after quantifying the total ((12)C+(13)C) concentrations by high-performance liquid chromatography. A hypermetabolic state was clearly evident in 7-month-old 3xTg-AD mice in contrast to the hypometabolic state reported earlier in 13-month-old mice. Hypermetabolism was evidenced by prominent increase of (13)C labeling and enrichment in the 3xTg-AD mice. Lipoic acid feeding to the hypermetabolic 3xTg-AD mice brought the metabolic parameters to the levels of nonTg mice. PMID:25099753

  4. EGVI endoglucanase and nucleic acids encoding the same

    DOEpatents

    Dunn-Coleman, Nigel; Goedegebuur, Frits; Ward, Michael; Yao, Jian

    2008-04-01

    The present invention provides a novel endoglucanase nucleic acid sequence, designated egl6, and the corresponding EGVI amino acid sequence. The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding EGVI, recombinant EGVI proteins and methods for producing the same.

  5. EGVII endoglucanase and nucleic acids encoding the same

    DOEpatents

    Dunn-Coleman, Nigel; Goedegebuur, Frits; Ward, Michael; Yao, Jian

    2009-05-05

    The present invention provides an endoglucanase nucleic acid sequence, designated egl7, and the corresponding EGVII amino acid sequence. The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding EGVII, recombinant EGVII proteins and methods for producing the same.

  6. EGVII endoglucanase and nucleic acids encoding the same

    DOEpatents

    Dunn-Coleman, Nigel; Goedegebuur, Frits; Ward, Michael; Yao, Jian

    2008-11-11

    The present invention provides a novel endoglucanase nucleic acid sequence, designated egl7, and the corresponding EGVII amino acid sequence. The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding EGVII, recombinant EGVII proteins and methods for producing the same.

  7. EGVII endoglucanase and nucleic acids encoding the same

    SciTech Connect

    Dunn-Coleman, Nigel; Goedegebuur, Frits; Ward, Michael; Yao, Jian

    2014-02-25

    The present invention provides a novel endoglucanase nucleic acid sequence, designated egl7, and the corresponding EGVII amino acid sequence. The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding EGVII, recombinant EGVII proteins and methods for producing the same.

  8. EGVII endoglucanase and nucleic acids encoding the same

    SciTech Connect

    Dunn-Coleman, Nigel; Goedegebuur, Frits; Ward, Michael; Yao, Jian

    2015-04-14

    The present invention provides a novel endoglucanase nucleic acid sequence, designated egl7, and the corresponding EGVII amino acid sequence. The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding EGVII, recombinant EGVII proteins and methods for producing the same.

  9. EGVII endoglucanase and nucleic acids encoding the same

    SciTech Connect

    Dunn-Coleman, Nigel; Goedegebuur, Frits; Ward, Michael; Yao, Jian

    2013-07-16

    The present invention provides a novel endoglucanase nucleic acid sequence, designated egl7, and the corresponding EGVII amino acid sequence. The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding EGVII, recombinant EGVII proteins and methods for producing the same.

  10. EGVII endoglucanase and nucleic acids encoding the same

    SciTech Connect

    Dunn-Coleman, Nigel; Goedegebuur, Frits; Ward, Michael; Yao, Jian

    2012-02-14

    The present invention provides a novel endoglucanase nucleic acid sequence, designated egl7, and the corresponding EGVII amino acid sequence. The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding EGVII, recombinant EGVII proteins and methods for producing the same.

  11. EGVI endoglucanase and nucleic acids encoding the same

    DOEpatents

    Dunn-Coleman, Nigel; Goedegebuur, Frits; Ward, Michael; Yao, Jian

    2010-10-05

    The present invention provides a novel endoglucanase nucleic acid sequence, designated egl6, and the corresponding EGVI amino acid sequence. The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding EGVI, recombinant EGVI proteins and methods for producing the same.

  12. EGVI endoglucanase and nucleic acids encoding the same

    DOEpatents

    Dunn-Coleman, Nigel; Goedegebuur, Frits; Ward, Michael; Yao, Jian

    2010-10-12

    The present invention provides a novel endoglucanase nucleic acid sequence, designated egl6, and the corresponding EGVI amino acid sequence. The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding EGVI, recombinant EGVI proteins and methods for producing the same.

  13. Isolated menthone reductase and nucleic acid molecules encoding same

    DOEpatents

    Croteau, Rodney B; Davis, Edward M; Ringer, Kerry L

    2013-04-23

    The present invention provides isolated menthone reductase proteins, isolated nucleic acid molecules encoding menthone reductase proteins, methods for expressing and isolating menthone reductase proteins, and transgenic plants expressing elevated levels of menthone reductase protein.

  14. Genetically encoded fluorescent coumarin amino acids

    DOEpatents

    Wang, Jiangyun; Xie, Jianming; Schultz, Peter G.

    2010-10-05

    The invention relates to orthogonal pairs of tRNAs and aminoacyl-tRNA synthetases that can incorporate the coumarin unnatural amino acid L-(7-hydroxycoumarin-4-yl) ethylglycine into proteins produced in eubacterial host cells such as E. coli. The invention provides, for example but not limited to, novel orthogonal synthetases, methods for identifying and making the novel synthetases, methods for producing proteins containing the unnatural amino acid L-(7-hydroxycoumarin-4-yl)ethylglycine and related translation systems.

  15. Genetically encoded fluorescent coumarin amino acids

    DOEpatents

    Wang, Jiangyun; Xie, Jianming; Schultz, Peter G.

    2012-06-05

    The invention relates to orthogonal pairs of tRNAs and aminoacyl-tRNA synthetases that can incorporate the coumarin unnatural amino acid L-(7-hydroxycoumarin-4-yl)ethylglycine into proteins produced in eubacterial host cells such as E. coli. The invention provides, for example but not limited to, novel orthogonal synthetases, methods for identifying and making the novel synthetases, methods for producing proteins containing the unnatural amino acid L-(7-hydroxycoumarin-4-yl)ethylglycine and related translation systems.

  16. Extraordinarily Adaptive Properties of the Genetically Encoded Amino Acids

    NASA Astrophysics Data System (ADS)

    Ilardo, Melissa; Meringer, Markus; Freeland, Stephen; Rasulev, Bakhtiyor; Cleaves, H. James, II

    2015-03-01

    Using novel advances in computational chemistry, we demonstrate that the set of 20 genetically encoded amino acids, used nearly universally to construct all coded terrestrial proteins, has been highly influenced by natural selection. We defined an adaptive set of amino acids as one whose members thoroughly cover relevant physico-chemical properties, or ``chemistry space.'' Using this metric, we compared the encoded amino acid alphabet to random sets of amino acids. These random sets were drawn from a computationally generated compound library containing 1913 alternative amino acids that lie within the molecular weight range of the encoded amino acids. Sets that cover chemistry space better than the genetically encoded alphabet are extremely rare and energetically costly. Further analysis of more adaptive sets reveals common features and anomalies, and we explore their implications for synthetic biology. We present these computations as evidence that the set of 20 amino acids found within the standard genetic code is the result of considerable natural selection. The amino acids used for constructing coded proteins may represent a largely global optimum, such that any aqueous biochemistry would use a very similar set.

  17. Extraordinarily Adaptive Properties of the Genetically Encoded Amino Acids

    PubMed Central

    Ilardo, Melissa; Meringer, Markus; Freeland, Stephen; Rasulev, Bakhtiyor; Cleaves II, H. James

    2015-01-01

    Using novel advances in computational chemistry, we demonstrate that the set of 20 genetically encoded amino acids, used nearly universally to construct all coded terrestrial proteins, has been highly influenced by natural selection. We defined an adaptive set of amino acids as one whose members thoroughly cover relevant physico-chemical properties, or “chemistry space.” Using this metric, we compared the encoded amino acid alphabet to random sets of amino acids. These random sets were drawn from a computationally generated compound library containing 1913 alternative amino acids that lie within the molecular weight range of the encoded amino acids. Sets that cover chemistry space better than the genetically encoded alphabet are extremely rare and energetically costly. Further analysis of more adaptive sets reveals common features and anomalies, and we explore their implications for synthetic biology. We present these computations as evidence that the set of 20 amino acids found within the standard genetic code is the result of considerable natural selection. The amino acids used for constructing coded proteins may represent a largely global optimum, such that any aqueous biochemistry would use a very similar set. PMID:25802223

  18. Nucleic acids encoding metal uptake transporters and their uses

    DOEpatents

    Schroeder, Julian I.; Antosiewicz, Danuta M.; Schachtman, Daniel P.; Clemens, Stephan

    1999-01-01

    The invention provides LCT1 nucleic acids which encode metal ion uptake transporters. The invention also provides methods of modulating heavy metal and alkali metal uptake in plants. The methods involve producing transgenic plants comprising a recombinant expression cassette containing an LCT1 nucleic acid linked to a plant promoter.

  19. α-Lipoic Acid Inhibits Expression of IL-8 by Suppressing Activation of MAPK, Jak/Stat, and NF-κB in H. pylori-Infected Gastric Epithelial AGS Cells.

    PubMed

    Choi, Ji Hyun; Cho, Soon Ok; Kim, Hyeyoung

    2016-01-01

    The epithelial cytokine response, associated with reactive oxygen species (ROS), is important in Helicobacter pylori (H. pylori)-induced inflammation. H. pylori induces the production of ROS, which may be involved in the activation of mitogen-activated protein kinases (MAPK), janus kinase/signal transducers and activators of transcription (Jak/Stat), and oxidant-sensitive transcription factor, nuclear factor kappa-light-chain-enhancer of activated B cells (NF-κB), and thus, expression of interleukin-8 (IL-8) in gastric epithelial cells. α-lipoic acid, a naturally occurring thiol compound, is a potential antioxidant. It shows beneficial effects in treatment of oxidant-associated diseases including diabetes. The present study is purposed to investigate whether α-lipoic acid inhibits expression of inflammatory cytokine IL-8 by suppressing activation of MAPK, Jak/Stat, and NF-κB in H. pylori-infected gastric epithelial cells. Gastric epithelial AGS cells were pretreated with or without α-lipoic acid for 2 h and infected with H. pylori in a Korean isolate (HP99) at a ratio of 300:1. IL-8 mRNA expression was analyzed by RT-PCR analysis. IL-8 levels in the medium were determined by enzyme-linked immunosorbent assay. NF-κB-DNA binding activity was determined by electrophoretic mobility shift assay. Phospho-specific and total forms of MAPK and Jak/Stat were assessed by Western blot analysis. ROS levels were determined using dichlorofluorescein fluorescence. As a result, H. pylori induced increases in ROS levels, mRNA, and protein levels of IL-8, as well as the activation of MAPK [extracellular signal-regulated kinase 1/2 (ERK1/2), c-Jun NH2-terminal kinase 1/2 (JNK1/2), p38], Jak/Stat (Jak1/2, Stat3), and NF-κB in AGS cells, which was inhibited by α-lipoic acid. In conclusion, α-lipoic acid may be beneficial for prevention and/or treatment of H. pylori infection-associated gastric inflammation. PMID:26632410

  20. α-Lipoic Acid Inhibits Expression of IL-8 by Suppressing Activation of MAPK, Jak/Stat, and NF-κB in H. pylori-Infected Gastric Epithelial AGS Cells

    PubMed Central

    Choi, Ji Hyun; Cho, Soon Ok

    2016-01-01

    The epithelial cytokine response, associated with reactive oxygen species (ROS), is important in Helicobacter pylori (H. pylori)-induced inflammation. H. pylori induces the production of ROS, which may be involved in the activation of mitogen-activated protein kinases (MAPK), janus kinase/signal transducers and activators of transcription (Jak/Stat), and oxidant-sensitive transcription factor, nuclear factor kappa-light-chain-enhancer of activated B cells (NF-κB), and thus, expression of interleukin-8 (IL-8) in gastric epithelial cells. α-lipoic acid, a naturally occurring thiol compound, is a potential antioxidant. It shows beneficial effects in treatment of oxidant-associated diseases including diabetes. The present study is purposed to investigate whether α-lipoic acid inhibits expression of inflammatory cytokine IL-8 by suppressing activation of MAPK, Jak/Stat, and NF-κB in H. pylori-infected gastric epithelial cells. Gastric epithelial AGS cells were pretreated with or without α-lipoic acid for 2 h and infected with H. pylori in a Korean isolate (HP99) at a ratio of 300:1. IL-8 mRNA expression was analyzed by RT-PCR analysis. IL-8 levels in the medium were determined by enzyme-linked immunosorbent assay. NF-κB-DNA binding activity was determined by electrophoretic mobility shift assay. Phospho-specific and total forms of MAPK and Jak/Stat were assessed by Western blot analysis. ROS levels were determined using dichlorofluorescein fluorescence. As a result, H. pylori induced increases in ROS levels, mRNA, and protein levels of IL-8, as well as the activation of MAPK [extracellular signal-regulated kinase 1/2 (ERK1/2), c-Jun NH2-terminal kinase 1/2 (JNK1/2), p38], Jak/Stat (Jak1/2, Stat3), and NF-κB in AGS cells, which was inhibited by α-lipoic acid. In conclusion, α-lipoic acid may be beneficial for prevention and/or treatment of H. pylori infection-associated gastric inflammation. PMID:26632410

  1. Modulatory effects of vitamin E, acetyl-L-carnitine and α-lipoic acid on new potential biomarkers for Alzheimer's disease in rat model.

    PubMed

    Ahmed, Hanaa H

    2012-09-01

    Alzheimer's disease (AD) is the most common chronic neurodegenerative disorder associated with aging. This study aimed to explore new markers for AD as total homocysteine (tHcy), insulin, insulin like growth factor-1 (IGF-1), interlukin-1β (IL-1β) and tumor necrosis factor-α (TNF-α); to determine the modulatory effects of vitamin E (VE), acetyl-L-carnitine (ALC) and α-lipoic acid (LA) on the investigated parameters and to evaluate the possible therapeutic role of these nutraceutical in AD-induced in rats. Our results revealed that brain acetylcholine esterase (AChE) activity and tHcy levels were significantly increased in AD model. Folic acid, vitamin B(12) levels and Na(+)/K(+) ATPase activity were markedly reduced. Plasma insulin and IGF-1 levels were noticeably decreased but plasma TNF-α and IL-1β concentrations were significantly increased, confirming that abnormal inflammatory response is associated with AD. Treatment by VE, ALC and LA restored the above mentioned parameters to about normal levels comparable to those of donepezil, indicating that tHcy, insulin, IGF-1, IL-1β and TNF-α may be considered as new biomarkers for AD. The study points to the potential restoring effects of VE, ALC and LA in AD model. Our study provides evidence for the importance of dietary supplementation in delaying the progression of age-related neurodegenerative diseases. PMID:21183322

  2. Plasma malondialdehyde levels and opiate withdrawal signs observed in rats treated with morphine plus naloxone: effects of alpha-lipoic acid administration.

    PubMed

    Pinelli, Arnaldo; Cighetti, Giuliana; Trivulzio, Silvio

    2008-08-01

    A number of experimental studies have found that reactive oxygen species are involved during morphine treatment or withdrawal. The aims of this study were to analyse whether morphine administration and/or removal are related to peroxide generation and/or signs of withdrawal in rats, and whether the changes in antioxidant status induced by the administration of an antioxidant may modify peroxide levels and behavioural signs. We injected morphine or morphine and naloxone into rats and evaluated the plasma levels of peroxide malondialdehyde (MDA) and the appearance of withdrawal signs. We also investigated the effects on these parameters induced by the administration of the antioxidant alpha-lipoic acid (LA). Morphine treatment increased MDA levels. Abrupt naloxone-induced morphine withdrawal caused a further and significant increase in MDA, and the appearance of withdrawal signs such as abnormal fecal excretion, shortened latency times and jumping. The administration of LA lowered MDA levels in the rats treated with morphine or morphine plus naloxone, and also decreased MDA values and abstinence signs in the animals treated with morphine plus naloxone. The effects of LA were attributed to its capacity to scavenge peroxides and interfere with the biogenesis of the arachidonic acid metabolites involved in the expression of abstinence symptoms. PMID:18705754

  3. α-Lipoic acid inhibits liver fibrosis through the attenuation of ROS-triggered signaling in hepatic stellate cells activated by PDGF and TGF-β.

    PubMed

    Foo, Ning-Ping; Lin, Shu-Huei; Lee, Yu-Hsuan; Wu, Ming-Jiuan; Wang, Ying-Jan

    2011-03-28

    Reactive oxygen species (ROS) have been implicated in hepatic stellate cell activation and liver fibrosis. We previously reported that α-lipoic acid (LA) and its reduced form dihydrolipoic acid (DHLA) inhibited toxicant-induced inflammation and ROS generation. In the present study, we further examined the effects of LA/DHLA on thioacetamide (TAA)-induced liver fibrosis in rats and the possible underlying mechanisms in hepatic stellate cells in vitro. We found that co-administration of LA to rats chronically treated with TAA inhibited the development of liver cirrhosis, as indicated by reductions in cirrhosis incidence, hepatic fibrosis, and AST/ALT activities. We also found that DHLA inhibited TGF-β/PDGF-stimulated HSC-T6 activation and ROS generation. These effects could be mediated by the MAPK and PI3K/Akt pathways. According to our current results, LA may have a beneficial role in the treatment of chronic liver diseases caused by ongoing hepatic damage. PMID:21251946

  4. Geranyl diphosphate synthase molecules, and nucleic acid molecules encoding same

    SciTech Connect

    Croteau, Rodney Bruce; Burke, Charles Cullen

    2008-06-24

    In one aspect, the present invention provides isolated nucleic acid molecules that each encode a geranyl diphosphate synthase protein, wherein each isolated nucleic acid molecule hybridizes to a nucleic acid molecule consisting of the sequence set forth in SEQ ID NO:1 under conditions of 5.times.SSC at 45.degree. C. for one hour. The present invention also provides isolated geranyl diphosphate synthase proteins, and methods for altering the level of expression of geranyl diphosphate synthase protein in a host cell.

  5. Nucleic acids encoding antifungal polypeptides and uses thereof

    DOEpatents

    Altier, Daniel J.; Ellanskaya, I. A.; Gilliam, Jacob T.; Hunter-Cevera, Jennie; Presnail, James K; Schepers, Eric; Simmons, Carl R.; Torok, Tamas; Yalpani, Nasser

    2010-11-02

    Compositions and methods for protecting a plant from a pathogen, particularly a fungal pathogen, are provided. Compositions include an amino acid sequence, and variants and fragments thereof, for an antipathogenic polypeptide that was isolated from a fungal fermentation broth. Nucleic acid molecules that encode the antipathogenic polypeptides of the invention, and antipathogenic domains thereof, are also provided. A method for inducing pathogen resistance in a plant using the nucleotide sequences disclosed herein is further provided. The method comprises introducing into a plant an expression cassette comprising a promoter operably linked to a nucleotide sequence that encodes an antipathogenic polypeptide of the invention. Compositions comprising an antipathogenic polypeptide or a transformed microorganism comprising a nucleic acid of the invention in combination with a carrier and methods of using these compositions to protect a plant from a pathogen are further provided. Transformed plants, plant cells, seeds, and microorganisms comprising a nucleotide sequence that encodes an antipathogenic polypeptide of the invention are also disclosed.

  6. Isolated nucleic acids encoding antipathogenic polypeptides and uses thereof

    DOEpatents

    Altier, Daniel J.; Crane, Virginia C.; Ellanskaya, Irina; Ellanskaya, Natalia; Gilliam, Jacob T.; Hunter-Cevera, Jennie; Presnail, James K.; Schepers, Eric J.; Simmons, Carl R.; Torok, Tamas; Yalpani, Nasser

    2010-04-20

    Compositions and methods for protecting a plant from a pathogen, particularly a fungal pathogen, are provided. Compositions include amino acid sequences, and variants and fragments thereof, for antipathogenic polypeptides that were isolated from fungal fermentation broths. Nucleic acids that encode the antipathogenic polypeptides are also provided. A method for inducing pathogen resistance in a plant using the nucleotide sequences disclosed herein is further provided. The method comprises introducing into a plant an expression cassette comprising a promoter operably linked to a nucleotide sequence that encodes an antipathogenic polypeptide of the invention. Compositions comprising an antipathogenic polypeptide or a transformed microorganism comprising a nucleic acid of the invention in combination with a carrier and methods of using these compositions to protect a plant from a pathogen are further provided. Transformed plants, plant cells, seeds, and microorganisms comprising a nucleotide sequence that encodes an antipathogenic polypeptide of the invention are also disclosed.

  7. Human jagged polypeptide, encoding nucleic acids and methods of use

    DOEpatents

    Li, Linheng; Hood, Leroy

    2000-01-01

    The present invention provides an isolated polypeptide exhibiting substantially the same amino acid sequence as JAGGED, or an active fragment thereof, provided that the polypeptide does not have the amino acid sequence of SEQ ID NO:5 or SEQ ID NO:6. The invention further provides an isolated nucleic acid molecule containing a nucleotide sequence encoding substantially the same amino acid sequence as JAGGED, or an active fragment thereof, provided that the nucleotide sequence does not encode the amino acid sequence of SEQ ID NO:5 or SEQ ID NO:6. Also provided herein is a method of inhibiting differentiation of hematopoietic progenitor cells by contacting the progenitor cells with an isolated JAGGED polypeptide, or active fragment thereof. The invention additionally provides a method of diagnosing Alagille Syndrome in an individual. The method consists of detecting an Alagille Syndrome disease-associated mutation linked to a JAGGED locus.

  8. Effects of Lipoic Acid on Immune Function, the Antioxidant Defense System, and Inflammation-Related Genes Expression of Broiler Chickens Fed Aflatoxin Contaminated Diets

    PubMed Central

    Li, Yan; Ma, Qiu-Gang; Zhao, Li-Hong; Wei, Hua; Duan, Guo-Xiang; Zhang, Jian-Yun; Ji, Cheng

    2014-01-01

    This study was designed to evaluate the effect of low level of Aflatoxin B1 (AFB1) on oxidative stress, immune reaction and inflammation response and the possible ameliorating effects of dietary alpha-lipoic acid (α-LA) in broilers. Birds were randomly allocated into three groups and assigned to receive different diets: basal diet, diet containing 74 μg/kg AFB1, and 300 mg/kg α-LA supplementation in diet containing 74 μg/kg AFB1 for three weeks. The results showed that the serum levels of malondialdehyde, tumor necrosis factor alpha (TNFα) and interferon gamma (IFNγ) in the AFB1-treated group were significantly increased than the control group. In addition, the increased expressions of interleukin 6 (IL6), TNFα and IFNγ were observed in birds exposed to the AFB1-contaminated diet. These degenerative changes were inhibited by α-LA-supplement. The activities of total superoxide dismutase and glutathione peroxidase, the levels of humoral immunity, and the expressions of nuclear factor-κB p65 and heme oxygenase-1, however, were not affected by AFB1. The results suggest that α-LA alleviates AFB1 induced oxidative stress and immune changes and modulates the inflammatory response at least partly through changes in the expression of proinflammatory cytokines of spleen such as IL6 and TNFα in broiler chickens. PMID:24699046

  9. Reversal of corticosterone-induced BDNF alterations by the natural antioxidant alpha-lipoic acid alone and combined with desvenlafaxine: Emphasis on the neurotrophic hypothesis of depression.

    PubMed

    de Sousa, Caren Nádia Soares; Meneses, Lucas Nascimento; Vasconcelos, Germana Silva; Silva, Márcia Calheiros Chaves; da Silva, Jéssica Calheiros; Macêdo, Danielle; de Lucena, David Freitas; Vasconcelos, Silvânia Maria Mendes

    2015-12-15

    Brain derived neurotrophic factor (BDNF) is linked to the pathophysiology of depression. We hypothesized that BDNF is one of the neurobiological pathways related to the augmentation effect of alpha-lipoic acid (ALA) when associated with antidepressants. Female mice were administered vehicle or CORT 20mg/kg during 14 days. From the 15th to 21st days the animals were divided in groups that were further administered: vehicle, desvenlafaxine (DVS) 10 or 20mg/kg, ALA 100 or 200mg/kg or the combinations of DVS10+ALA100, DVS20+ALA100, DVS10+ALA200 or DVS20+ALA200. ALA or DVS alone or in combination reversed CORT-induced increase in immobility time in the forced swimming test and decrease in sucrose preference, presenting, thus, an antidepressant-like effect. DVS10 alone reversed CORT-induced decrease in BDNF in the prefrontal cortex (PFC), hippocampus (HC) and striatum (ST). The same was observed in the HC and ST of ALA200 treated animals. The combination of DVS and ALA200 reversed CORT-induced alterations in BDNF and even, in some cases, increased the levels of this neurotrophin when compared to vehicle-treated animals in HC and ST. Taken together, these results suggest that the combination of the DVS+ALA may be valuable for treating conditions in which BDNF levels are decreased, such as depression. PMID:26350703

  10. Comparative analysis of the effects combined physical procedures and alpha-lipoic acid on the electroneurographic parameters of patients with distal sensorimotor diabetic polyneuropathy

    PubMed Central

    Grbovic, Vesna; Jurisic-Skevin, Aleksandra; Djukic, Svetlana; Stefanović, Srdjan; Nurkovic, Jasmin

    2016-01-01

    [Purpose] Painful diabetic polyneuropathy occurs as a complication in 16% of all patients with diabetes mellitus. [Subjects and Methods] A clinical, prospective open-label randomized intervention study was conducted of 60 adult patients, with distal sensorimotor diabetic neuropathy two groups of 30 patients, with diabetes mellitus type 2 with distal sensorimotor diabetic neuropathy. Patients in group A were treated with combined physical procedures, and patients in group B were treated with alpha lipoic acid. [Results] There where a statistically significant improvements in terminal latency and the amplitude of the action potential in group A patients, while group B patients showed a statistically significant improvements in conduction velocity and terminal latency of n. peroneus. Group A patients showed a statistically significant improvements in conduction velocity and terminal latency, while group B patients also showed a statistically significant improvements in conduction velocity and terminal latency. This was reflected in a significant improvements in electrophysiological parameters (conduction velocity, amplitude and latency) of the motor and sensory nerves (n. peroneus, n. suralis). [Conclusion] These results present further evidence justifying of the use of physical agents in the treatment of diabetic sensorimotor polyneuropathy. PMID:27065527

  11. Glutaredoxin S15 Is Involved in Fe-S Cluster Transfer in Mitochondria Influencing Lipoic Acid-Dependent Enzymes, Plant Growth, and Arsenic Tolerance in Arabidopsis1[OPEN

    PubMed Central

    2016-01-01

    Glutaredoxins (Grxs) are small proteins that function as oxidoreductases with roles in deglutathionylation of proteins, reduction of antioxidants, and assembly of iron-sulfur (Fe-S) cluster-containing enzymes. Which of the 33 Grxs in Arabidopsis (Arabidopsis thaliana) perform roles in Fe-S assembly in mitochondria is unknown. We have examined in detail the function of the monothiol GrxS15 in plants. Our results show its exclusive mitochondrial localization, and we are concluding it is the major or only Grx in this subcellular location. Recombinant GrxS15 has a very low deglutathionylation and dehydroascorbate reductase activity, but it binds a Fe-S cluster. Partially removing GrxS15 from mitochondria slowed whole plant growth and respiration. Native GrxS15 is shown to be especially important for lipoic acid-dependent enzymes in mitochondria, highlighting a putative role in the transfer of Fe-S clusters in this process. The enhanced effect of the toxin arsenic on the growth of GrxS15 knockdown plants compared to wild type highlights the role of mitochondrial glutaredoxin Fe-S-binding in whole plant growth and toxin tolerance. PMID:26672074

  12. Alpha-lipoic acid supplementation reduces mTORC1 signaling in skeletal muscle from high fat fed, obese Zucker rats.

    PubMed

    Li, Zhuyun; Dungan, Cory M; Carrier, Bradley; Rideout, Todd C; Williamson, David L

    2014-12-01

    The mammalian target of rapamycin (mTOR) signaling pathway is hyperactive in liver, adipose and skeletal muscle tissues of obese rodents. Alpha-lipoic acid (αLA) has been well accepted as a weight-loss treatment, though there are limited studies on its effect on mTOR signaling in high-fat fed, obese rodents. Therefore, the goal of this study was to determine mTOR signaling and oxidative protein alterations in skeletal muscle of high-fat fed, obese rats after αLA supplementation. Phosphorylation of the mTOR substrate, eukaryotic initiation factor (eIF) 4E-binding protein 1 (4E-BP1) and eIF4B were significantly reduced (p < 0.05) in muscle from αLA supplemented rats. Activation of AMP-activated protein kinase (AMPK), an mTOR inhibitory kinase, was higher (p < 0.05) in the αLA group. Protein expression of markers of oxidative metabolism, acetyl CoA carboxylase (ACC), cytochrome c oxidase IV (COX IV), peroxisome proliferator-activated receptor (PPAR), and PPAR gamma coactivator 1-alpha (PGC-1α) were significantly higher (p < 0.05) after αLA supplementation compared to non-supplemented group. Our findings show that αLA supplementation limits the negative ramifications of consuming a high fat diet on skeletal muscle markers of oxidative metabolism and mTORC1 signaling. PMID:25366515

  13. α-Lipoic Acids Promote the Protein Synthesis of C2C12 Myotubes by the TLR2/PI3K Signaling Pathway.

    PubMed

    Jing, Yuanyuan; Cai, Xingcai; Xu, Yaqiong; Zhu, Canjun; Wang, Lina; Wang, Songbo; Zhu, Xiaotong; Gao, Ping; Zhang, Yongliang; Jiang, Qingyan; Shu, Gang

    2016-03-01

    Skeletal muscle protein turnover is regulated by endocrine hormones, nutrients, and inflammation. α-Lipoic acid (ALA) plays an important role in energy homeostasis. Therefore, the aim of this study was to investigate the effects of ALA on protein synthesis in skeletal muscles and reveal the underlying mechanism. ALA (25 μM) significantly increased the protein synthesis and phosphorylation of Akt, mTOR, and S6 in C2C12 myotubes with attenuated phosphorylation of AMPK, Ikkα/β, and eIF2α. Intraperitoneal injection of 50 mg/kg ALA also produced the same results in mouse gastrocnemius. Both the PI3K (LY294002) and mTOR (rapamycin) inhibitors abolished the effects of ALA on protein synthesis in the C2C12 myotubes. However, AICAR (AMPK agonist) failed to block the activation of mTOR and S6 by ALA. ALA increased TLR2 and MyD88 mRNA expression in the C2C12 myotubes. TLR2 knockdown by siRNA almost eliminated the effects of ALA on protein synthesis and the Akt/mTOR pathway in the C2C12 myotubes. Immunoprecipitation data showed that ALA enhanced the p85 subunit of PI3K binding to MyD88. These findings indicate that ALA induces protein synthesis and the PI3K/Akt signaling pathway by TLR2. PMID:26855124

  14. Glutaredoxin S15 Is Involved in Fe-S Cluster Transfer in Mitochondria Influencing Lipoic Acid-Dependent Enzymes, Plant Growth, and Arsenic Tolerance in Arabidopsis.

    PubMed

    Ströher, Elke; Grassl, Julia; Carrie, Chris; Fenske, Ricarda; Whelan, James; Millar, A Harvey

    2016-03-01

    Glutaredoxins (Grxs) are small proteins that function as oxidoreductases with roles in deglutathionylation of proteins, reduction of antioxidants, and assembly of iron-sulfur (Fe-S) cluster-containing enzymes. Which of the 33 Grxs in Arabidopsis (Arabidopsis thaliana) perform roles in Fe-S assembly in mitochondria is unknown. We have examined in detail the function of the monothiol GrxS15 in plants. Our results show its exclusive mitochondrial localization, and we are concluding it is the major or only Grx in this subcellular location. Recombinant GrxS15 has a very low deglutathionylation and dehydroascorbate reductase activity, but it binds a Fe-S cluster. Partially removing GrxS15 from mitochondria slowed whole plant growth and respiration. Native GrxS15 is shown to be especially important for lipoic acid-dependent enzymes in mitochondria, highlighting a putative role in the transfer of Fe-S clusters in this process. The enhanced effect of the toxin arsenic on the growth of GrxS15 knockdown plants compared to wild type highlights the role of mitochondrial glutaredoxin Fe-S-binding in whole plant growth and toxin tolerance. PMID:26672074

  15. The Influence of α-Lipoic Acid and Garlic Administration on Biomarkers of Oxidative Stress and Inflammation in Rabbits Exposed to Oxidized Nutrition Oils

    PubMed Central

    Zalejska-Fiolka, Jolanta; Wielkoszyński, Tomasz; Rokicki, Wojciech; Dąbrowska, Natalia; Strzelczyk, Joanna Katarzyna; Kasperczyk, Aleksandra; Owczarek, Aleksander; Błaszczyk, Urszula; Kasperczyk, Sławomir; Stawiarska-Pięta, Barbara; Birkner, Ewa; Gamian, Andrzej

    2015-01-01

    We hypothesized that addition of substances with antioxidant activity could decrease the concentrations of biomarkers of oxidative stress and inflammatory process, thus inhibiting nonalcoholic steatohepatitis development. We investigated the influence of α-lipoic acid (ALA) and garlic administration on the development of adverse changes in rabbit liver and serum under oxidative stress conditions induced with HFD from oxidized oils. We determined 8-hydroxy-2′-deoxyguanosine (8OHdG) and malondialdehyde (MDA) in liver homogenates, total oxidant status (TOS), lipid peroxides (LOO) and tumor necrosis factor alpha (TNFα) in blood serum, and TNFα and IL-1α genes expression in liver. The results indicate that the intake of dietary ALA and garlic was significantly associated with decreases of 8OHdG and MDA levels in rabbits' liver tissue as well as TOS and LOO levels in rabbits' serum. Similarly, TNFα and IL-1α gene expressions were suppressed due to ALA and garlic supplementation. The histopathological analysis confirmed that HFD results in liver disorder leading to steatosis. This adverse effect of HFD was ameliorated by the supplementation of ALA and garlic. The obtained results indicate a beneficial effect of ALA and garlic administration by reducing the oxidative stress intensity and the levels of some proinflammatory cytokines in rabbits fed HFD. PMID:26634212

  16. Gas-saturated solution process to obtain microcomposite particles of alpha lipoic acid/hydrogenated colza oil in supercritical carbon dioxide.

    PubMed

    Mishima, Kenji; Honjo, Masatoshi; Sharmin, Tanjina; Ito, Shota; Kawakami, Ryo; Kato, Takafumi; Misumi, Makoto; Suetsugu, Tadashi; Orii, Hideaki; Kawano, Hiroyuki; Irie, Keiichi; Sano, Kazunori; Mishima, Kenichi; Harada, Takunori; Ouchi, Mikio

    2016-09-01

    Alpha lipoic acid (ALA), an active substance in anti-aging products and dietary supplements, need to be masked with an edible polymer to obscure its unpleasant taste. However, the high viscosity of the ALA molecules prevents them from forming microcomposites with masking materials even in supercritical carbon dioxide (scCO2). Therefore, the purpose of this study was to investigate and develop a novel production method for microcomposite particles for ALA in hydrogenated colza oil (HCO). Microcomposite particles of ALA/HCO were prepared by using a novel gas-saturated solution (PGSS) process in which the solid-dispersion method is used along with stepwise temperature control (PGSS-STC). Its high viscosity prevents the formation of microcomposites in the conventional PGSS process even under strong agitation. Here, we disperse the solid particles of ALA and HCO in scCO2 at low temperatures and change the temperature stepwise in order to mix the melted ALA and HCO in scCO2. As a result, a homogeneous dispersion of the droplets of ALA in melted HCO saturated with CO2 is obtained at high temperatures. After the rapid expansion of the saturated solution through a nozzle, microcomposite particles of ALA/HCO several micrometers in diameter are obtained. PMID:26024240

  17. Treatment with α-Lipoic Acid over 16 Weeks in Type 2 Diabetic Patients with Symptomatic Polyneuropathy Who Responded to Initial 4-Week High-Dose Loading

    PubMed Central

    Garcia-Alcala, Hector; Santos Vichido, Celia Isabel; Islas Macedo, Silverio; Genestier-Tamborero, Christelle Nathalie; Minutti-Palacios, Marissa; Hirales Tamez, Omara; García, Carlos; Ziegler, Dan

    2015-01-01

    Effective treatment of diabetic sensorimotor polyneuropathy remains a challenge. To assess the efficacy and safety of α-lipoic acid (ALA) over 20 weeks, we conducted a multicenter randomized withdrawal open-label study, in which 45 patients with type 2 diabetes and symptomatic polyneuropathy were initially treated with ALA (600 mg tid) for 4 weeks (phase 1). Subsequently, responders were randomized to receive ALA (600 mg qd; n = 16) or to ALA withdrawal (n = 17) for 16 weeks (phase 2). During phase 1, the Total Symptom Score (TSS) decreased from 8.9 ± 1.8 points to 3.46 ± 2.0 points. During phase 2, TSS improved from 3.7 ± 1.9 points to 2.5 ± 2.5 points in the ALA treated group (p < 0.05) and remained unchanged in the ALA withdrawal group. The use of analgesic rescue medication was higher in the ALA withdrawal group than ALA treated group (p < 0.05). In conclusion, in type 2 diabetic patients with symptomatic polyneuropathy who responded to initial 4-week high-dose (600 mg tid) administration of ALA, subsequent treatment with ALA (600 mg qd) over 16 weeks improved neuropathic symptoms, whereas ALA withdrawal was associated with a higher use of rescue analgesic drugs. This trial is registered with ClinicalTrials.gov Identifier: NCT02439879. PMID:26345602

  18. The effect of acetyl-L-Carnitine and Lipoic acid treatment in ApoE4 mouse as a model of human Alzheimer’s disease

    PubMed Central

    Shenk, Justin C.; Liu, Jiankang; Fischbach, Kathryn; Xu, Kui; Puchowicz, Michel; Obrenovich, Mark E.; Gasimov, Eldar; Alvarez, Ludis Morales; Ames, Bruce N.; LaManna, Joseph C.; Aliev, Gjumrakch

    2009-01-01

    We measured age-dependent effects of the human ApoE4 on cerebral blood flow (CBF) using ApoE4 transgenic mice compared to age-matched wild-type (WT) mice by use of [14C] iodoantipyrene autoradiography. ApoE4 associated factors reduce CBF gradually to create brain hypoperfusion when compared to WT and the differences in CBF are greatest as animals age from 6-weeks to 12-months. Transmission electron microscopy with colloidal gold immunocytochemistry showed structural damage in young and aged microvessel endothelium of ApoE4 animals extended to the cytoplasm of perivascular cells, perivascular nerve terminals and hippocampal neurons and glial cells. These abnormalities coexist with mitochondrial structural alteration and mitochondrial DNA overproliferation and/or deletion in all brain cellular compartments. Spatial memory and temporal memory tests showed a trend in improving cognitive function in ApoE4 mice fed selective mitochondrial antioxidants acetyl-L-Carnitine and R-Lipoic acid. Our findings indicate that ApoE4 genotype-induced mitochondrial changes and associated structural damage may explain age-dependent pathology seen in AD, indicating potential for novel treatment strategies in the near future. PMID:19342064

  19. The effect of acetyl-L-carnitine and R-alpha-lipoic acid treatment in ApoE4 mouse as a model of human Alzheimer's disease.

    PubMed

    Shenk, Justin C; Liu, Jiankang; Fischbach, Kathryn; Xu, Kui; Puchowicz, Michel; Obrenovich, Mark E; Gasimov, Eldar; Alvarez, Ludis Morales; Ames, Bruce N; Lamanna, Joseph C; Aliev, Gjumrakch

    2009-08-15

    We measured age-dependent effects of human ApoE4 on cerebral blood flow (CBF) using ApoE4 transgenic mice compared to age-matched wild-type (WT) mice by use of [(14)C] iodoantipyrene autoradiography. ApoE4 associated factors reduce CBF gradually to create brain hypoperfusion when compared to WT, and the differences in CBF are greatest as animals age from 6-weeks to 12-months. Transmission electron microscopy with colloidal gold immunocytochemistry showed structural damage in young and aged microvessel endothelium of ApoE4 animals extended to the cytoplasm of perivascular cells, perivascular nerve terminals and hippocampal neurons and glial cells. These abnormalities coexist with mitochondrial structural alteration and mitochondrial DNA overproliferation and/or deletion in all brain cellular compartments. Spatial memory and temporal memory tests showed a trend in improving cognitive function in ApoE4 mice fed selective mitochondrial antioxidants acetyl-l-carnitine and R-alpha-lipoic acid. Our findings indicate that ApoE4 genotype-induced mitochondrial changes and associated structural damage may explain age-dependent pathology seen in AD, indicating potential for novel treatment strategies in the near future. PMID:19342064

  20. Alpha-lipoic acid attenuates endoplasmic reticulum stress-induced insulin resistance by improving mitochondrial function in HepG2 cells.

    PubMed

    Lei, Lin; Zhu, Yiwei; Gao, Wenwen; Du, Xiliang; Zhang, Min; Peng, Zhicheng; Fu, Shoupeng; Li, Xiaobing; Zhe, Wang; Li, Xinwei; Liu, Guowen

    2016-10-01

    Alpha-lipoic acid (ALA) has been reported to have beneficial effects for improving insulin sensitivity. However, the underlying molecular mechanism of the beneficial effects remains poorly understood. Endoplasmic reticulum (ER) stress and mitochondrial dysfunction are considered causal factors that induce insulin resistance. In this study, we investigated the effect of ALA on the modulation of insulin resistance in ER-stressed HepG2 cells, and we explored the potential mechanism of this effect. HepG2 cells were incubated with tunicamycin (Tun) for 6h to establish an ER stress cell model. Tun treatment induced ER stress, mitochondrial dysfunction and insulin resistance. Interestingly, ALA had no significant effect on ER stress signals. Pretreatment of the ER stress cell model with ALA for 24h improved insulin sensitivity, restored the expression levels of mitochondrial oxidative phosphorylation (OXPHOS) complexes and increased intracellular ATP production. Moreover, ALA augmented the β-oxidation capacity of the mitochondria. Importantly, ALA treatment could decrease oligomycin-induced mitochondrial dysfunction and then improved insulin resistance. Taken together, our data suggest that ALA prevents ER stress-induced insulin resistance by enhancing mitochondrial function. PMID:27377964

  1. Treatment with α-Lipoic Acid over 16 Weeks in Type 2 Diabetic Patients with Symptomatic Polyneuropathy Who Responded to Initial 4-Week High-Dose Loading.

    PubMed

    Garcia-Alcala, Hector; Santos Vichido, Celia Isabel; Islas Macedo, Silverio; Genestier-Tamborero, Christelle Nathalie; Minutti-Palacios, Marissa; Hirales Tamez, Omara; García, Carlos; Ziegler, Dan

    2015-01-01

    Effective treatment of diabetic sensorimotor polyneuropathy remains a challenge. To assess the efficacy and safety of α-lipoic acid (ALA) over 20 weeks, we conducted a multicenter randomized withdrawal open-label study, in which 45 patients with type 2 diabetes and symptomatic polyneuropathy were initially treated with ALA (600 mg tid) for 4 weeks (phase 1). Subsequently, responders were randomized to receive ALA (600 mg qd; n = 16) or to ALA withdrawal (n = 17) for 16 weeks (phase 2). During phase 1, the Total Symptom Score (TSS) decreased from 8.9 ± 1.8 points to 3.46 ± 2.0 points. During phase 2, TSS improved from 3.7 ± 1.9 points to 2.5 ± 2.5 points in the ALA treated group (p < 0.05) and remained unchanged in the ALA withdrawal group. The use of analgesic rescue medication was higher in the ALA withdrawal group than ALA treated group (p < 0.05). In conclusion, in type 2 diabetic patients with symptomatic polyneuropathy who responded to initial 4-week high-dose (600 mg tid) administration of ALA, subsequent treatment with ALA (600 mg qd) over 16 weeks improved neuropathic symptoms, whereas ALA withdrawal was associated with a higher use of rescue analgesic drugs. This trial is registered with ClinicalTrials.gov Identifier: NCT02439879. PMID:26345602

  2. Synergistic ameliorative effects of sesame oil and alpha-lipoic acid against subacute diazinon toxicity in rats: hematological, biochemical, and antioxidant studies.

    PubMed

    Abdel-Daim, Mohamed M; Taha, Ramadan; Ghazy, Emad W; El-Sayed, Yasser S

    2016-01-01

    Diazinon (DZN) is a common organophosphorus insecticide extensively used for agriculture and veterinary purposes. DZN toxicity is not limited to insects; it also induces harmful effects in mammals and birds. Our experiment evaluated the protective and antioxidant potential of sesame oil (SO) and (or) alpha-lipoic acid (ALA) against DZN toxicity in male Wistar albino rats. DZN-treated animals exhibited macrocytic hypochromic anemia and significant increases in serum biochemical parameters related to liver injury, including aspartate aminotransferase (AST), alanine aminotransferase (ALT), alkaline phosphatase (ALP), γ-glutamyl transferase (γGT), cholesterol, and triglycerides. They also had elevated levels of markers related to cardiac injury, such as lactate dehydrogenase (LDH) and creatine phosphokinase (CPK), and increased biomarkers of renal injury, urea and creatinine. DZN also increased hepatic, renal, and cardiac lipid peroxidation and decreased antioxidant biomarker levels. SO and (or) ALA supplementation ameliorated the deleterious effects of DZN intoxication. Treatment improved hematology and serum parameters, enhanced endogenous antioxidant status, and reduced lipid peroxidation. Importantly, they exerted synergistic hepatoprotective, nephroprotective, and cardioprotective effects. Our findings demonstrate that SO and (or) ALA supplementation can alleviate the toxic effects of DZN via their potent antioxidant and free radical-scavenging activities. PMID:26550680

  3. Comparative analysis of the effects combined physical procedures and alpha-lipoic acid on the electroneurographic parameters of patients with distal sensorimotor diabetic polyneuropathy.

    PubMed

    Grbovic, Vesna; Jurisic-Skevin, Aleksandra; Djukic, Svetlana; Stefanović, Srdjan; Nurkovic, Jasmin

    2016-01-01

    [Purpose] Painful diabetic polyneuropathy occurs as a complication in 16% of all patients with diabetes mellitus. [Subjects and Methods] A clinical, prospective open-label randomized intervention study was conducted of 60 adult patients, with distal sensorimotor diabetic neuropathy two groups of 30 patients, with diabetes mellitus type 2 with distal sensorimotor diabetic neuropathy. Patients in group A were treated with combined physical procedures, and patients in group B were treated with alpha lipoic acid. [Results] There where a statistically significant improvements in terminal latency and the amplitude of the action potential in group A patients, while group B patients showed a statistically significant improvements in conduction velocity and terminal latency of n. peroneus. Group A patients showed a statistically significant improvements in conduction velocity and terminal latency, while group B patients also showed a statistically significant improvements in conduction velocity and terminal latency. This was reflected in a significant improvements in electrophysiological parameters (conduction velocity, amplitude and latency) of the motor and sensory nerves (n. peroneus, n. suralis). [Conclusion] These results present further evidence justifying of the use of physical agents in the treatment of diabetic sensorimotor polyneuropathy. PMID:27065527

  4. Restoration of Dioxin-Induced Damage to Fetal Steroidogenesis and Gonadotropin Formation by Maternal Co-Treatment with α-Lipoic Acid

    PubMed Central

    Koga, Takayuki; Ishida, Takumi; Takeda, Tomoki; Ishii, Yuji; Uchi, Hiroshi; Tsukimori, Kiyomi; Yamamoto, Midori; Himeno, Masaru; Furue, Masutaka; Yamada, Hideyuki

    2012-01-01

    2,3,7,8-Tetrachlorodibenzo-p-dioxin (TCDD), an endocrine disruptor, causes reproductive and developmental toxic effects in pups following maternal exposure in a number of animal models. Our previous studies have demonstrated that TCDD imprints sexual immaturity by suppressing the expression of fetal pituitary gonadotropins, the regulators of gonadal steroidogenesis. In the present study, we discovered that all TCDD-produced damage to fetal production of pituitary gonadotropins as well as testicular steroidogenesis can be repaired by co-treating pregnant rats with α-lipoic acid (LA), an obligate co-factor for intermediary metabolism including energy production. While LA also acts as an anti-oxidant, other anti-oxidants; i.e., ascorbic acid, butylated hydroxyanisole and edaravone, failed to exhibit any beneficial effects. Neither wasting syndrome nor CYP1A1 induction in the fetal brain caused through the activation of aryl hydrocarbon receptor (AhR) could be attenuated by LA. These lines of evidence suggest that oxidative stress makes only a minor contribution to the TCDD-induced disorder of fetal steroidogenesis, and LA has a restorative effect by targeting on mechanism(s) other than AhR activation. Following a metabolomic analysis, it was found that TCDD caused a more marked change in the hypothalamus, a pituitary regulator, than in the pituitary itself. Although the components of the tricarboxylic acid cycle and the ATP content of the fetal hypothalamus were significantly changed by TCDD, all these changes were again rectified by exogenous LA. We also provided evidence that the fetal hypothalamic content of endogenous LA is significantly reduced following maternal exposure to TCDD. Thus, the data obtained strongly suggest that TCDD reduces the expression of fetal pituitary gonadotropins to imprint sexual immaturity or disturb development by suppressing the level of LA, one of the key players serving energy production. PMID:22911699

  5. Alpha-Lipoic Acid Reduces LDL-Particle Number and PCSK9 Concentrations in High-Fat Fed Obese Zucker Rats

    PubMed Central

    Carrier, Bradley; Wen, Shin; Zigouras, Sophia; Browne, Richard W.; Li, Zhuyun; Patel, Mulchand S.; Williamson, David L.; Rideout, Todd C.

    2014-01-01

    We characterized the hypolipidemic effects of alpha-lipoic acid (LA, R-form) and examined the associated molecular mechanisms in a high fat fed Zucker rat model. Rats (n = 8) were assigned to a high fat (HF) diet or the HF diet with 0.25% LA (HF-LA) for 30 days and pair fed to remove confounding effects associated with the anorectic properties of LA. Compared with the HF controls, the HF-LA group was protected against diet-induced obesity (102.5±3.1 vs. 121.5±3.6,% change BW) and hypercholesterolemia with a reduction in total-C (−21%), non-HDL-C (−25%), LDL-C (−16%), and total LDL particle number (−46%) and an increase in total HDL particles (∼22%). This cholesterol-lowering response was associated with a reduction in plasma PCSK9 concentration (−70%) and an increase in hepatic LDLr receptor protein abundance (2 fold of HF). Compared with the HF-fed animals, livers of LA-supplemented animals were protected against TG accumulation (−46%), likely through multiple mechanisms including: a suppressed lipogenic response (down-regulation of hepatic acetyl-CoA carboxylase and fatty acid synthase expression); enhanced hepatic fat oxidation (increased carnitine palmitoyltransferase Iα expression); and enhanced VLDL export (increased hepatic diacylglycerol acyltransferase and microsomal triglyceride transfer protein expression and elevated plasma VLDL particle number). Study results also support an enhanced fatty acid uptake (2.8 fold increase in total lipase activity) and oxidation (increased CPT1β protein abundance) in muscle tissue in LA-supplemented animals compared with the HF group. In summary, in the absence of a change in caloric intake, LA was effective in protecting against hypercholesterolemia and hepatic fat accumulation under conditions of strong genetic and dietary predisposition toward obesity and dyslipidemia. PMID:24595397

  6. Polypeptides having cellulolytic enhancing activity and nucleic acids encoding same

    DOEpatents

    Brown, Kimberly; Harris, Paul; Zaretsky, Elizabeth; Re, Edward; Vlasenko, Elena; McFarland, Keith; Lopez de Leon, Alfredo

    2016-08-09

    The present invention relates to isolated polypeptides having cellulolytic enhancing activity and isolated polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods for producing and using the polypeptides.

  7. Nucleic acid encoding TGF-. beta. and its uses

    SciTech Connect

    Derynck, R.M.A.; Goeddel, D.V.

    1989-12-12

    This patent describes a method. It comprises: constructing a vector which includes nucleic acid encoding biologically active TGF-{beta}, transforming a host eukaryotic cell with the vector, culturing the transformed cell and recovering mature TGF-{beta} from the culture medium.

  8. Polypeptides having cellulolytic enhancing activity and nucleic acids encoding same

    SciTech Connect

    Brown, Kimberly; Harris, Paul; Zaretsky, Elizabeth; Re, Edward; Vlasenko, Elena; McFarland, Keith; Lopez de Leon, Alfredo

    2014-09-30

    The present invention relates to isolated polypeptides having cellulolytic enhancing activity and isolated polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods for producing and using the polypeptides.

  9. Polypeptides having cellulolytic enhancing activity and nucleic acids encoding same

    SciTech Connect

    Brown, Kimberly; Harris, Paul; Zaretsky, Elizabeth; Re, Edward; Vlasenko, Elena; McFarland, Keith; Lopez de Leon, Alfredo

    2012-10-16

    The present invention relates to isolated polypeptides having cellulolytic enhancing activity and isolated polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods for producing and using the polypeptides.

  10. Method for Enzyme Design with Genetically Encoded Unnatural Amino Acids.

    PubMed

    Hu, C; Wang, J

    2016-01-01

    We describe the methodologies for the design of artificial enzymes with genetically encoded unnatural amino acids. Genetically encoded unnatural amino acids offer great promise for constructing artificial enzymes with novel activities. In our studies, the designs of artificial enzyme were divided into two steps. First, we considered the unnatural amino acids and the protein scaffold separately. The scaffold is designed by traditional protein design methods. The unnatural amino acids are inspired by natural structure and organic chemistry methods, and synthesized by either organic chemistry methods or enzymatic conversion. With the increasing number of published unnatural amino acids with various functions, we described an unnatural amino acids toolkit containing metal chelators, redox mediators, and click chemistry reagents. These efforts enable a researcher to search the toolkit for appropriate unnatural amino acids for the study, rather than design and synthesize the unnatural amino acids from the beginning. After the first step, the model enzyme was optimized by computational methods and directed evolution. Lastly, we describe a general method for evolving aminoacyl-tRNA synthetase and expressing unnatural amino acids incorporated into a protein. PMID:27586330