Science.gov

Sample records for enhanced small molecule

  1. Enhanced Vibrational Spectroscopies as Tools for Small Molecule Biosensing

    PubMed Central

    Boujday, Souhir; Lamy de la Chapelle, Marc; Srajer, Johannes; Knoll, Wolfgang

    2015-01-01

    In this short summary we summarize some of the latest developments in vibrational spectroscopic tools applied for the sensing of (small) molecules and biomolecules in a label-free mode of operation. We first introduce various concepts for the enhancement of InfraRed spectroscopic techniques, including the principles of Attenuated Total Reflection InfraRed (ATR-IR), (phase-modulated) InfraRed Reflection Absorption Spectroscopy (IRRAS/PM-IRRAS), and Surface Enhanced Infrared Reflection Absorption Spectroscopy (SEIRAS). Particular attention is put on the use of novel nanostructured substrates that allow for the excitation of propagating and localized surface plasmon modes aimed at operating additional enhancement mechanisms. This is then be complemented by the description of the latest development in Surface- and Tip-Enhanced Raman Spectroscopies, again with an emphasis on the detection of small molecules or bioanalytes. PMID:26343666

  2. Enhanced Vibrational Spectroscopies as Tools for Small Molecule Biosensing.

    PubMed

    Boujday, Souhir; de la Chapelle, Marc Lamy; Srajer, Johannes; Knoll, Wolfgang

    2015-01-01

    In this short summary we summarize some of the latest developments in vibrational spectroscopic tools applied for the sensing of (small) molecules and biomolecules in a label-free mode of operation. We first introduce various concepts for the enhancement of InfraRed spectroscopic techniques, including the principles of Attenuated Total Reflection InfraRed (ATR-IR), (phase-modulated) InfraRed Reflection Absorption Spectroscopy (IRRAS/PM-IRRAS), and Surface Enhanced Infrared Reflection Absorption Spectroscopy (SEIRAS). Particular attention is put on the use of novel nanostructured substrates that allow for the excitation of propagating and localized surface plasmon modes aimed at operating additional enhancement mechanisms. This is then be complemented by the description of the latest development in Surface- and Tip-Enhanced Raman Spectroscopies, again with an emphasis on the detection of small molecules or bioanalytes. PMID:26343666

  3. Experimental Resonance Enhanced Multiphoton Ionization (REMPI) studies of small molecules

    NASA Technical Reports Server (NTRS)

    Dehmer, J. L.; Dehmer, P. M.; Pratt, S. T.; Ohalloran, M. A.; Tomkins, F. S.

    1987-01-01

    Resonance enhanced multiphoton ionization (REMPI) utilizes tunable dye lasers to ionize an atom or molecule by first preparing an excited state by multiphoton absorption and then ionizing that state before it can decay. This process is highly selective with respect to both the initial and resonant intermediate states of the target, and it can be extremely sensitive. In addition, the products of the REMPI process can be detected as needed by analyzing the resulting electrons, ions, fluorescence, or by additional REMPI. This points to a number of exciting opportunities for both basic and applied science. On the applied side, REMPI has great potential as an ultrasensitive, highly selective detector for trace, reactive, or transient species. On the basic side, REMPI affords an unprecedented means of exploring excited state physics and chemistry at the quantum-state-specific level. An overview of current studies of excited molecular states is given to illustrate the principles and prospects of REMPI.

  4. A small molecule enhances RNA interference and promotes microRNA processing

    PubMed Central

    Shan, Ge; Li, Yujing; Zhang, Junliang; Li, Wendi; Szulwach, Keith E; Duan, Ranhui; Faghihi, Mohammad A; Khalil, Ahmad M; Lu, Lianghua; Paroo, Zain; Chan, Anthony W S; Shi, Zhangjie; Liu, Qinghua; Wahlestedt, Claes; He, Chuan; Jin, Peng

    2010-01-01

    Small interfering RNAs (siRNAs) and microRNAs (miRNAs) are sequence-specific post-transcriptional regulators of gene expression. Although major components of the RNA interference (RNAi) pathway have been identified, regulatory mechanisms for this pathway remain largely unknown. Here we demonstrate that the RNAi pathway can be modulated intracellularly by small molecules. We have developed a cell-based assay to monitor the activity of the RNAi pathway and find that the small-molecule enoxacin (Penetrex) enhances siRNA-mediated mRNA degradation and promotes the biogenesis of endogenous miRNAs. We show that this RNAi-enhancing activity depends on the trans-activation-responsive region RNA-binding protein. Our results provide a proof-of-principle demonstration that small molecules can be used to modulate the activity of the RNAi pathway. RNAi enhancers may be useful in the development of research tools and therapeutics. PMID:18641635

  5. Enhancement of Small Molecule Delivery by Pulsed High-Intensity Focused Ultrasound: A Parameter Exploration.

    PubMed

    Zhou, Yufeng; Wang, Yak-Nam; Farr, Navid; Zia, Jasmine; Chen, Hong; Ko, Bong Min; Khokhlova, Tatiana; Li, Tong; Hwang, Joo Ha

    2016-04-01

    Chemotherapeutic drug delivery is often ineffective within solid tumors, but increasing the drug dose would result in systemic toxicity. The use of high-intensity focused ultrasound (HIFU) has the potential to enhance penetration of small molecules. However, operation parameters need to be optimized before the use of chemotherapeutic drugs in vivo and translation to clinical trials. In this study, the effects of pulsed HIFU (pHIFU) parameters (spatial-average pulse-average intensity, duty factor and pulse repetition frequency) on the penetration as well as content of small molecules were evaluated in ex vivo porcine kidneys. Specific HIFU parameters resulted in more than 40 times greater Evans blue content and 3.5 times the penetration depth compared with untreated samples. When selected parameters were applied to porcine kidneys in vivo, a 2.3-fold increase in concentration was obtained after a 2-min exposure to pHIFU. Pulsed HIFU has been found to be an effective modality to enhance both the concentration and penetration depth of small molecules in tissue using the optimized HIFU parameters. Although, performed in normal tissue, this study has the promise of translation into tumor tissue. PMID:26803389

  6. Aptamer-aptamer linkage based aptasensor for highly enhanced detection of small molecules.

    PubMed

    Nguyen, Van-Thuan; Lee, Bang Hyun; Kim, Sang Hoon; Gu, Man Bock

    2016-06-01

    The multi-target colorimetric aptasensors can be easily fabricated by using two different aptamer sequences. However, there have been no research reports about improvement or enhancing of colorimetric signals based on the aggregation properties of AuNPs. Herein, we report a simple and efficient method to control and enhance the function of the multi-target aptasensor using an aptamer-aptamer linkage method. The aptasensor was developed for highly sensitive multiple-target detection of small molecules. The extension of aptamer DNA sequences using this method resulted in the enhanced analytical sensitivity of this aptasensor in sensing applications for two small molecule targets. Furthermore, the mechanism of the interaction between DNA aptamer and AuNPs was studied by measuring the zeta potential to explain the enhancement of the sensitivity of this multi-target aptasensor. The limit of detection of this multi-target aptasensor was found to be 1 nM and 37 nM for kanamycin (KAN) and chlortetracycline (CHLOR), respectively. It is 25-fold lower than in the previous report using an AuNP-based sensor for defining the limit of detection (LOD) of KAN and five times lower than the LOD for CHLOR. This aptasensor has great potential in the simultaneous detection of a wide range of KAN and CHLOR concentrations. PMID:27221154

  7. Nanoprobe-Enhanced, Split Aptamer-Based Electrochemical Sandwich Assay for Ultrasensitive Detection of Small Molecules.

    PubMed

    Zhao, Tao; Liu, Ran; Ding, Xiaofan; Zhao, Juncai; Yu, Haixiang; Wang, Lei; Xu, Qing; Wang, Xuan; Lou, Xinhui; He, Miao; Xiao, Yi

    2015-08-01

    It is quite challenging to improve the binding affinity of antismall molecule aptamers. We report that the binding affinity of anticocaine split aptamer pairs improved by up to 66-fold by gold nanoparticles (AuNP)-attached aptamers due to the substantially increased local concentration of aptamers and multiple and simultaneous ligand interactions. The significantly improved binding affinity enables the detection of small molecule targets with unprecedented sensitivity, as demonstrated in nanoprobe-enhanced split aptamer-based electrochemical sandwich assays (NE-SAESA). NE-SAESA replaces the traditional molecular reporter probe with AuNPs conjugated to multiple reporter probes. The increased binding affinity allowed us to use 1,000-fold lower reporter probe concentrations relative to those employed in SAESA. We show that the near-elimination of background in NE-SAESA effectively improves assay sensitivity by ∼1,000-100,000-fold for ATP and cocaine detection, relative to equivalent SAESA. With the ongoing development of new strategies for the selection of aptamers, we anticipate that our sensor platform should offer a generalizable approach for the high-sensitivity detection of diverse targets. More importantly, we believe that NE-SAESA represents a novel strategy to improve the binding affinity between a small molecule and its aptamer and potentially can be extended to other detection platforms. PMID:26171721

  8. Efficiency enhancement in solution-processed organic small molecule: Fullerene solar cells via solvent vapor annealing

    NASA Astrophysics Data System (ADS)

    Miao, Jingsheng; Chen, Hui; Liu, Feng; Zhao, Baofeng; Hu, Lingyu; He, Zhicai; Wu, Hongbin

    2015-05-01

    We report highly efficient small molecule solar cells (SMSCs) by using dichloromethane solvent vapor annealing method. The resulted devices delivered a power conversion efficiency (PCE) of 8.3%, which is among the highest in SMSCs. Comparing to the control devices, the short circuit current (Jsc), fill factor, and PCE of solvent vapor annealed devices are significantly improved. Summarizing the results of optical absorption, film morphology, and charge carrier transporting properties, we see that the enhanced structure order and reduced size of phase separation are major reasons for the improved device performances, establishing a solid structure-property relationship. The solvent vapor annealing method can thus be a useful method in device fabrication to enhance performances of SMSCs.

  9. Introducing a high gravity field to enhance infiltration of small molecules into polyelectrolyte multilayers.

    PubMed

    Liu, Xiaolin; Zhao, Kun; Jiang, Chao; Wang, Yue; Shao, Lei; Zhang, Yajun; Shi, Feng

    2015-07-28

    Loading functional small molecules into nano-thin films is fundamental to various research fields such as membrane separation, molecular imprinting, interfacial reaction, drug delivery etc. Currently, a general demand for enhancing the loading rate without affecting the film structures exists in most infiltration phenomena. To handle this issue, we have introduced a process intensification method of a high gravity technique, which is a versatile energy form of mechanical field well-established in industry, into the investigations on diffusion/infiltration at the molecular level. By taking a polyelectrolyte multilayer as a model thin film and a photo-reactive molecule, 4,4'-diazostilbene-2,2'-disulfonic acid disodium salt (DAS), as a model small functional molecule, we have demonstrated remarkably accelerated adsorption/infiltration of DAS into a poly(allylamine hydrochloride) (PAH)/poly(acrylic acid) (PAA) multilayer by as high as 20-fold; meanwhile, both the film property of the multilayer and photoresponsive-crosslinking function of DAS were not disturbed. Furthermore, the infiltration of DAS and the surface morphology of the multilayer could be tuned based on their high dependence on the intensity of the high gravity field regarding different rotating speeds. The mechanism of the accelerated adsorption/infiltration under the high gravity field was interpreted by the increased turbulence of the diffusing layer with the thinned laminar boundary layer and the stepwise delivery of the local concentration gradient from the solution to the interior of the multilayer. The introduction of mechanical field provides a simple and versatile strategy to address the paradox of the contradictory loading amount and loading rate, and thus to promote applications of various membrane processes. PMID:26086776

  10. Small molecule aptamer assays based on fluorescence anisotropy signal-enhancer oligonucleotides.

    PubMed

    Perrier, Sandrine; Bouilloud, Prisca; De Oliveira Coelho, Gisella; Henry, Mickael; Peyrin, Eric

    2016-08-15

    Herein, we design novel fluorescence anisotropy (FA) aptamer sensing platforms dedicated to small molecule detection. The assay strategy relied on enhanced fluctuations of segmental motion dynamics of the aptamer tracer mediated by an unlabelled, partially complementary oligonucleotide. The signal-enhancer oligonucleotide (SEO) essentially served as a free probe fraction revealer. By targeting specific regions of the signalling functional nucleic acid, the SEO binding to the unbound aptamer triggered perturbations of both the internal DNA flexibility and the localized dye environment upon the free probe to duplex structure transition. This potentiating effect determined increased FA variations between the duplex and target bound states of the aptameric probe. FA assay responses were obtained with both pre-structured (adenosine) and unstructured (tyrosinamide) aptamers and with dyes of different photochemical properties (fluorescein and texas red). The multiplexed analysis ability was further demonstrated through the simultaneous multicolour detection of the two small targets. The FA method appears to be especially simple, sensitive and widely applicable. PMID:27085946

  11. Confined gold nanoparticles enhance the detection of small molecules in label-free impedance aptasensors

    NASA Astrophysics Data System (ADS)

    Peinetti, Ana S.; Ceretti, Helena; Mizrahi, Martín; González, Graciela A.; Ramírez, Silvana A.; Requejo, Felix G.; Montserrat, Javier M.; Battaglini, Fernando

    2015-04-01

    A controlled architecture of nanoelectrodes, of a similar size to small molecule-binding aptamers, is synthesized inside nanoporous alumina. Gold nanoparticles with a controlled size (about 2 nm) are electrogenerated in the alumina cavities, showing a fast electron transfer process toward ferrocyanide. These uncapped nanoparticles are easily modified with a thiol-containing aptamer for label-free detection of adenosine monophosphate by electrochemical impedance spectroscopy. Our results show that the use of a limited electrical conducting surface inside an insulating environment can be very sensitive to conformational changes, introducing a new approach to the detection of small molecules, exemplified here by the direct and selective detection of adenosine monophosphate at the nanomolar scale.A controlled architecture of nanoelectrodes, of a similar size to small molecule-binding aptamers, is synthesized inside nanoporous alumina. Gold nanoparticles with a controlled size (about 2 nm) are electrogenerated in the alumina cavities, showing a fast electron transfer process toward ferrocyanide. These uncapped nanoparticles are easily modified with a thiol-containing aptamer for label-free detection of adenosine monophosphate by electrochemical impedance spectroscopy. Our results show that the use of a limited electrical conducting surface inside an insulating environment can be very sensitive to conformational changes, introducing a new approach to the detection of small molecules, exemplified here by the direct and selective detection of adenosine monophosphate at the nanomolar scale. Electronic supplementary information (ESI) available. See DOI: 10.1039/c5nr01429h

  12. Proton Fingerprints Portray Molecular Structures: Enhanced Description of the 1H NMR Spectra of Small Molecules

    PubMed Central

    Napolitano, José G.; Lankin, David C.; McAlpine, James B.; Niemitz, Matthias; Korhonen, Samuli-Petrus; Chen, Shao-Nong; Pauli, Guido F.

    2013-01-01

    The characteristic signals observed in NMR spectra encode essential information on the structure of small molecules. However, extracting all of this information from complex signal patterns is not trivial. This report demonstrates how computer-aided spectral analysis enables the complete interpretation of 1D 1H NMR data. The effectiveness of this approach is illustrated with a set of organic molecules, for which replicas of their 1H NMR spectra were generated. The potential impact of this methodology on organic chemistry research is discussed. PMID:24007197

  13. Label-enhanced surface plasmon resonance applied to label-free interaction analysis of small molecules and fragments.

    PubMed

    Eng, Lars; Nygren-Babol, Linnéa; Hanning, Anders

    2016-10-01

    Surface plasmon resonance (SPR) is a well-established method for studying interactions between small molecules and biomolecules. In particular, SPR is being increasingly applied within fragment-based drug discovery; however, within this application area, the limited sensitivity of SPR may constitute a problem. This problem can be circumvented by the use of label-enhanced SPR that shows a 100-fold higher sensitivity as compared with conventional SPR. Truly label-free interaction data for small molecules can be obtained by applying label-enhanced SPR in a surface competition assay format. The enhanced sensitivity is accompanied by an increased specificity and inertness toward disturbances (e.g., bulk refractive index disturbances). Label-enhanced SPR can be used for fragment screening in a competitive assay format; the competitive format has the added advantage of confirming the specificity of the molecular interaction. In addition, label-enhanced SPR extends the accessible kinetic regime of SPR to the analysis of very fast fragment binding kinetics. In this article, we demonstrate the working principles and benchmark the performance of label-enhanced SPR in a model system-the interaction between carbonic anhydrase II and a number of small-molecule sulfonamide-based inhibitors. PMID:27325502

  14. Discovery of Small-Molecule Enhancers of Reactive Oxygen Species That are Nontoxic or Cause Genotype-Selective Cell Death

    PubMed Central

    2013-01-01

    Elevation of reactive oxygen species (ROS) levels has been observed in many cancer cells relative to nontransformed cells, and recent reports have suggested that small-molecule enhancers of ROS may selectively kill cancer cells in various in vitro and in vivo models. We used a high-throughput screening approach to identify several hundred small-molecule enhancers of ROS in a human osteosarcoma cell line. A minority of these compounds diminished the viability of cancer cell lines, indicating that ROS elevation by small molecules is insufficient to induce death of cancer cell lines. Three chemical probes (BRD5459, BRD56491, BRD9092) are highlighted that most strongly elevate markers of oxidative stress without causing cell death and may be of use in a variety of cellular settings. For example, combining nontoxic ROS-enhancing probes with nontoxic doses of l-buthionine sulfoximine, an inhibitor of glutathione synthesis previously studied in cancer patients, led to potent cell death in more than 20 cases, suggesting that even nontoxic ROS-enhancing treatments may warrant exploration in combination strategies. Additionally, a few ROS-enhancing compounds that contain sites of electrophilicity, including piperlongumine, show selective toxicity for transformed cells over nontransformed cells in an engineered cell-line model of tumorigenesis. These studies suggest that cancer cell lines are more resilient to chemically induced increases in ROS levels than previously thought and highlight electrophilicity as a property that may be more closely associated with cancer-selective cell death than ROS elevation. PMID:23477340

  15. Graphene Oxide Enhances Cellular Delivery of Hydrophilic Small Molecules by Co-incubation

    PubMed Central

    2015-01-01

    The delivery of bioactive molecules into cells has broad applications in biology and medicine. Polymer-modified graphene oxide (GO) has recently emerged as a de facto noncovalent vehicle for hydrophobic drugs. Here, we investigate a different approach using native GO to deliver hydrophilic molecules by co-incubation in culture. GO adsorption and delivery were systematically studied with a library of 15 molecules synthesized with Gd(III) labels to enable quantitation. Amines were revealed to be a key chemical group for adsorption, while delivery was shown to be quantitatively predictable by molecular adsorption, GO sedimentation, and GO size. GO co-incubation was shown to enhance delivery by up to 13-fold and allowed for a 100-fold increase in molecular incubation concentration compared to the alternative of nanoconjugation. When tested in the application of Gd(III) cellular MRI, these advantages led to a nearly 10-fold improvement in sensitivity over the state-of-the-art. GO co-incubation is an effective method of cellular delivery that is easily adoptable by researchers across all fields. PMID:25226566

  16. Enhanced performances in inverted small molecule solar cells by Ag nanoparticles.

    PubMed

    Jin, Fangming; Chu, Bei; Li, Wenlian; Su, Zisheng; Zhao, Haifeng; Lee, C S

    2014-12-15

    We demonstrate a highly efficient inverted small molecular solar cell with integration of Ag nanoparticles (NPs) into the devices. The optimized device based on thermal evaporated Ag NPs provides a power conversion efficiency (PCE) of 4.87%, which offers 33% improvement than that of the reference device without Ag NPs. Such a high efficiency is mainly attributed to the improved electrical properties by virtue of the modification of the surface of ITO with Ag NPs and the enhanced light harvesting due to localized surface plasmon resonance (LSPR). The more detail enhanced mechanism of the PCE by introduction of Ag NPs is also discussed. PMID:25607480

  17. Chitosan wound dressing with hexagonal silver nanoparticles for hyperthermia and enhanced delivery of small molecules.

    PubMed

    Levi-Polyachenko, Nicole; Jacob, Reuben; Day, Cynthia; Kuthirummal, Narayanan

    2016-06-01

    Chitosan films were synthesized with hexagonal silver nanoparticles (Ag NP). The unique shape and size of the Ag NP shift the optical absorption into the infrared. Stimulation of the nanoparticles with infrared light was used to generate heat and facilitate intracellular delivery of fluorescently-labeled dextran molecules. Chitosan films prepared with hexagonal or spherical Ag NP were characterized by optical and thermal analyses, and X-ray diffraction. There were found to be slight differences between how the chitosan molecular chains interface with the Ag NP depending upon shape of the nanoparticle. Viability of cells associated with dermal wound healing was evaluated on chitosan films prepared with hexagonal or spherical Ag NP, with both keratinocytes and fibroblasts having normal or moderately enhanced growth on films containing hexagonally-shaped nanoparticles. PMID:26970819

  18. Tetrandrine identified in a small molecule screen to activate mesenchymal stem cells for enhanced immunomodulation

    PubMed Central

    Yang, Zijiang; Concannon, John; Ng, Kelvin S.; Seyb, Kathleen; Mortensen, Luke J.; Ranganath, Sudhir; Gu, Fangqi; Levy, Oren; Tong, Zhixiang; Martyn, Keir; Zhao, Weian; Lin, Charles P.; Glicksman, Marcie A.; Karp, Jeffrey M.

    2016-01-01

    Pre-treatment or priming of mesenchymal stem cells (MSC) prior to transplantation can significantly augment the immunosuppressive effect of MSC-based therapies. In this study, we screened a library of 1402 FDA-approved bioactive compounds to prime MSC. We identified tetrandrine as a potential hit that activates the secretion of prostaglandin E2 (PGE2), a potent immunosuppressive agent, by MSC. Tetrandrine increased MSC PGE2 secretion through the NF-κB/COX-2 signaling pathway. When co-cultured with mouse macrophages (RAW264.7), tetrandrine-primed MSC attenuated the level of TNF-α secreted by RAW264.7. Furthermore, systemic transplantation of primed MSC into a mouse ear skin inflammation model significantly reduced the level of TNF-α in the inflamed ear, compared to unprimed cells. Screening of small molecules to pre-condition cells prior to transplantation represents a promising strategy to boost the therapeutic potential of cell therapy. PMID:27457881

  19. Tetrandrine identified in a small molecule screen to activate mesenchymal stem cells for enhanced immunomodulation.

    PubMed

    Yang, Zijiang; Concannon, John; Ng, Kelvin S; Seyb, Kathleen; Mortensen, Luke J; Ranganath, Sudhir; Gu, Fangqi; Levy, Oren; Tong, Zhixiang; Martyn, Keir; Zhao, Weian; Lin, Charles P; Glicksman, Marcie A; Karp, Jeffrey M

    2016-01-01

    Pre-treatment or priming of mesenchymal stem cells (MSC) prior to transplantation can significantly augment the immunosuppressive effect of MSC-based therapies. In this study, we screened a library of 1402 FDA-approved bioactive compounds to prime MSC. We identified tetrandrine as a potential hit that activates the secretion of prostaglandin E2 (PGE2), a potent immunosuppressive agent, by MSC. Tetrandrine increased MSC PGE2 secretion through the NF-κB/COX-2 signaling pathway. When co-cultured with mouse macrophages (RAW264.7), tetrandrine-primed MSC attenuated the level of TNF-α secreted by RAW264.7. Furthermore, systemic transplantation of primed MSC into a mouse ear skin inflammation model significantly reduced the level of TNF-α in the inflamed ear, compared to unprimed cells. Screening of small molecules to pre-condition cells prior to transplantation represents a promising strategy to boost the therapeutic potential of cell therapy. PMID:27457881

  20. Gold Nanoparticles Surface Plasmon Resonance Enhanced Signal for the Detection of Small Molecules on Split-Aptamer Microarrays (Small Molecules Detection from Split-Aptamers)

    PubMed Central

    Melaine, Feriel; Roupioz, Yoann; Buhot, Arnaud

    2015-01-01

    The detection of small molecules by biosensors remains a challenge for diagnostics in many areas like pharmacology, environment or homeland security. The main difficulty comes from both the low molecular weight and low concentrations of most targets, which generally requires an indirect detection with an amplification or a sandwich procedure. In this study, we combine both strategies as the amplification of Surface Plasmon Resonance imaging (SPRi) signal is obtained by the use of gold nanoparticles and the sequence engineering of split-aptamers, short oligonucleotides strands with strong affinity towards small targets, allows for a sandwich structure. Combining those two strategies, we obtained state-of-the-art results in the limit of detection (LOD = 50 nM) with the model target adenosine. Furthermore, the SPRi detection led on aptamer microarrays paves the way for potential multi-target detections thanks to the multi-probe imaging approach.

  1. Metal-assisted polyatomic SIMS and laser desorption/ionization for enhanced small molecule imaging of bacterial biofilms.

    PubMed

    Dunham, Sage J B; Comi, Troy J; Ko, Kyungwon; Li, Bin; Baig, Nameera F; Morales-Soto, Nydia; Shrout, Joshua D; Bohn, Paul W; Sweedler, Jonathan V

    2016-06-01

    Mass spectrometry imaging (MSI) has become an important analytical tool for many sectors of science and medicine. As the application of MSI expands into new areas of inquiry, existing methodologies must be adapted and improved to meet emerging challenges. Particularly salient is the need for small molecule imaging methods that are compatible with complex multicomponent systems, a challenge that is amplified by the effects of analyte migration and matrix interference. With a focus on microbial biofilms from the opportunistic pathogen Pseudomonas aeruginosa, the relative advantages of two established microprobe-based MSI techniques-polyatomic secondary ion mass spectrometry (SIMS) and laser desorption/ionization-are compared, with emphasis on exploring the effect of surface metallization on small molecule imaging. A combination of qualitative image comparison and multivariate statistical analysis demonstrates that sputtering microbial biofilms with a 2.5 nm layer of gold selectively enhances C60-SIMS ionization for several molecular classes including rhamnolipids and 2-alkyl-quinolones. Metallization also leads to the reduction of in-source fragmentation and subsequent ionization of media-specific background polymers, which improves spectral purity and image quality. These findings show that the influence of metallization upon ionization is strongly dependent on both the surface architecture and the analyte class, and further demonstrate that metal-assisted C60-SIMS is a viable method for small molecule imaging of intact molecular ions in complex biological systems. PMID:26945568

  2. Enhancement of Antiviral Immunity by Small Molecule Antagonist of Suppressor of Cytokine Signaling

    PubMed Central

    Ahmed, Chulbul M. I.; Dabelic, Rea; Martin, James P.; Jager, Lindsey D.; Haider, S. Mohammad; Johnson, Howard M.

    2011-01-01

    Suppressors of cytokine signaling (SOCSs) are negative regulators of both innate and adaptive immunity via inhibition of signaling by cytokines such as type I and type II IFNs. We have developed a small peptide antagonist of SOCS-1 that corresponds to the activation loop of JAK2. SOCS-1 inhibits both type I and type II IFN activities by binding to the kinase activation loop via the kinase inhibitory region of the SOCS. The antagonist, pJAK2(1001–1013), inhibited the replication of vaccinia virus and encephalomyocarditis virus in cell culture, suggesting that it possesses broad antiviral activity. In addition, pJAK2(1001–1013) protected mice against lethal vaccinia and encephalomyocarditis virus infection. pJAK2(1001–1013) increased the intracellular level of the constitutive IFN-β, which may play a role in the antagonist antiviral effect at the cellular level. Ab neutralization suggests that constitutive IFN-β may act intracellularly, consistent with recent findings on IFN-γ intracellular signaling. pJAK2(1001–1013) also synergizes with IFNs as per IFN-γ mimetic to exert a multiplicative antiviral effect at the level of transcription, the cell, and protection of mice against lethal viral infection. pJAK2(1001–1013) binds to the kinase inhibitory region of both SOCS-1 and SOCS-3 and blocks their inhibitory effects on the IFN-γ activation site promoter. In addition to a direct antiviral effect and synergism with IFN, the SOCS antagonist also exhibits adjuvant effects on humoral and cellular immunity as well as an enhancement of polyinosinic-polycytidylic acid activation of TLR3. The SOCS antagonist thus presents a novel and effective approach to enhancement of host defense against viruses. PMID:20543109

  3. Emerging small molecule drugs.

    PubMed

    Colin, Sophie; Chinetti-Gbaguidi, Giulia; Kuivenhoven, Jan A; Staels, Bart

    2015-01-01

    Dyslipidaemia is a major risk factor for cardiovascular diseases. Pharmacological lowering of LDL-C levels using statins reduces cardiovascular risk. However, a substantial residual risk persists especially in patients with type 2 diabetes mellitus. Because of the inverse association observed in epidemiological studies of HDL-C with the risk for cardiovascular diseases, novel therapeutic strategies to raise HDL-C levels or improve HDL functionality are developed as complementary therapy for cardiovascular diseases. However, until now most therapies targeting HDL-C levels failed in clinical trials because of side effects or absence of clinical benefits. This chapter will highlight the emerging small molecules currently developed and tested in clinical trials to pharmacologically modulate HDL-C and functionality including new CETP inhibitors (anacetrapib, evacetrapib), novel PPAR agonists (K-877, CER-002, DSP-8658, INT131 and GFT505), LXR agonists (ATI-111, LXR-623, XL-652) and RVX-208. PMID:25523004

  4. Enhancements to the Rosetta Energy Function Enable Improved Identification of Small Molecules that Inhibit Protein-Protein Interactions

    PubMed Central

    Karanicolas, John

    2015-01-01

    Protein-protein interactions are among today’s most exciting and promising targets for therapeutic intervention. To date, identifying small-molecules that selectively disrupt these interactions has proven particularly challenging for virtual screening tools, since these have typically been optimized to perform well on more “traditional” drug discovery targets. Here, we test the performance of the Rosetta energy function for identifying compounds that inhibit protein interactions, when these active compounds have been hidden amongst pools of “decoys.” Through this virtual screening benchmark, we gauge the effect of two recent enhancements to the functional form of the Rosetta energy function: the new “Talaris” update and the “pwSHO” solvation model. Finally, we conclude by developing and validating a new weight set that maximizes Rosetta’s ability to pick out the active compounds in this test set. Looking collectively over the course of these enhancements, we find a marked improvement in Rosetta’s ability to identify small-molecule inhibitors of protein-protein interactions. PMID:26484863

  5. A small molecule inhibitor for ATPase activity of Hsp70 and Hsc70 enhances the immune response to protein antigens

    NASA Astrophysics Data System (ADS)

    Baek, Kyung-Hwa; Zhang, Haiying; Lee, Bo Ryeong; Kwon, Young-Guen; Ha, Sang-Jun; Shin, Injae

    2015-12-01

    The ATPase activities of Hsp70 and Hsc70 are known to be responsible for regulation of various biological processes. However, little is known about the roles of Hsp70 and Hsc70 in modulation of immune responses to antigens. In the present study, we investigated the effect of apoptozole (Az), a small molecule inhibitor of Hsp70 and Hsc70, on immune responses to protein antigens. The results show that mice administered with both protein antigen and Az produce more antibodies than those treated with antigen alone, showing that Az enhances immune responses to administered antigens. Treatment of mice with Az elicits production of antibodies with a high IgG2c/IgG1 ratio and stimulates the release of Th1 and Th2-type cytokines, suggesting that Az activates the Th1 and Th2 immune responses. The observations made in the present study suggest that inhibition of Hsp70 and Hsc70 activities could be a novel strategy designing small molecule-based adjuvants in protein vaccines.

  6. A Bifunctional Dimethylsulfoxide Substitute Enhances the Aqueous Solubility of Small Organic Molecules

    PubMed Central

    Sprachman, Melissa M.

    2012-01-01

    Abstract An oxetane-substituted sulfoxide has demonstrated potential as a dimethylsulfoxide substitute for enhancing the dissolution of organic compounds with poor aqueous solubilities. This sulfoxide may find utility in applications of library storage and biological assays. For the model compounds studied, significant solubility enhancements were observed using the sulfoxide as a cosolvent in aqueous media. Brine shrimp, breast cancer (MDA-MB-231), and liver cell line (HepG2) toxicity data for the new additive are also presented, in addition to comparative IC50 values for a series of PKD1 inhibitors. PMID:22192308

  7. A small molecule norspermidine in combination with silver ion enhances dispersal and disinfection of multi-species wastewater biofilms.

    PubMed

    Wu, Yachuan; Quan, Xiangchun; Si, Xiurong; Wang, Xinrui

    2016-06-01

    Detrimental biofilms have become a great concern in many areas due to their strong resistance and insensitivity to traditional antimicrobial agents. Norspermidine is a potent small molecule for biofilm dispersal. In this study, silver ion, a conventional inorganic biocide, was combined with norspermidine and used for control and removal of multi-species biofilms formed by a mixed culture from wastewater treatment systems. Results showed that silver ion (0.01-1 mg/L) treatment alone failed to remove the existing wastewater biofilms. Norspermidine at the concentrations of 500-1000 μM was capable to disrupt and disperse the existing biofilms with a biofilm reduction of 21-34 % after 24-h exposure. The combined treatment with norspermidine (500 μM) and silver ion (0.01 mg/L) increased biofilm reduction to 48 % (24-h exposure). The combined treatment also enhanced biofilm disinfection ratio (82 %, 2-h exposure) by 2.0- and 2.6-folds compared to norspermidine (27 %) or silver ion (23 %) treatment alone, respectively. Confocal laser scanning microscopic (CLSM) observations found that norspermidine could disrupt biofilm matrix and promote biofilm dispersal via breaking down exopolysaccharides. The combined treatment increased the reduction in biofilm cell density and viability, possibly due to the damage of biofilm matrix, enhanced silver ion diffusion in biofilms, and increased biofilm sensitivity. These findings indicate that the combination of a small molecule norspermidine with a traditional biocide silver ion presents a novel strategy to remove and kill biofilms, which have a potential application in addressing wastewater biofilm-related issues. PMID:26894404

  8. A small molecule screen for enhanced homing of systemically infused cells

    PubMed Central

    Tong, Zhixiang; Perrault, Christelle; Benhamou, Brigitte; Zhang, Jidong; Stratton, Tara; Han, Edward; Safaee, Helia; Musabeyezu, Juliet; Yang, Zijiang; Multon, Marie-Christine; Rothblatt, Jonathan; Deleuze, Jean-Francois; Lin, Charles P.; Karp, Jeffrey M.

    2015-01-01

    SUMMARY Poor homing of systemically infused cells to disease sites may limit the success of exogenous cell-based therapy. In this study, we screened 9,000 signal transduction modulators to identify hits that increase mesenchymal stromal cell (MSC) surface expression of homing ligands that bind to ICAM-1, such as CD11a. Pretreatment of MSCs with Ro-31-8425, an identified hit from this screen, increased MSC firm adhesion to an ICAM-1-coated substrate in-vitro, and enabled targeted delivery of systemically administered MSCs to inflamed sites in-vivo in a CD11a (and other ICAM-1-binding domains)-dependent manner. This resulted in a heightened anti-inflammatory response. This represents a new strategy for engineering cell homing to enhance therapeutic efficacy and validates CD11a/ICAM-1 as potential targets. Altogether, this multi-step screening process may significantly improve clinical outcomes of cell-based therapies. PMID:25732817

  9. Comparison of light out-coupling enhancements in single-layer blue-phosphorescent organic light emitting diodes using small-molecule or polymer hosts

    SciTech Connect

    Chang, Yung-Ting; Liu, Shun-Wei; Yuan, Chih-Hsien; Lee, Chih-Chien; Ho, Yu-Hsuan; Wei, Pei-Kuen; Chen, Kuan-Yu; Lee, Yi-Ting; Wu, Min-Fei; Chen, Chin-Ti E-mail: chihiwu@cc.ee.ntu.edu.tw; Wu, Chih-I E-mail: chihiwu@cc.ee.ntu.edu.tw

    2013-11-07

    Single-layer blue phosphorescence organic light emitting diodes (OLEDs) with either small-molecule or polymer hosts are fabricated using solution process and the performances of devices with different hosts are investigated. The small-molecule device exhibits luminous efficiency of 14.7 cd/A and maximum power efficiency of 8.39 lm/W, which is the highest among blue phosphorescence OLEDs with single-layer solution process and small molecular hosts. Using the same solution process for all devices, comparison of light out-coupling enhancement, with brightness enhancement film (BEF), between small-molecule and polymer based OLEDs is realized. Due to different dipole orientation and anisotropic refractive index, polymer-based OLEDs would trap less light than small molecule-based OLEDs internally, about 37% better based simulation results. In spite of better electrical and spectroscopic characteristics, including ambipolar characteristics, higher carrier mobility, higher photoluminescence quantum yield, and larger triplet state energy, the overall light out-coupling efficiency of small molecule-based devices is worse than that of polymer-based devices without BEF. However, with BEF for light out-coupling enhancement, the improved ratio in luminous flux and luminous efficiency for small molecule based device is 1.64 and 1.57, respectively, which are significantly better than those of PVK (poly-9-vinylcarbazole) devices. In addition to the theoretical optical simulation, the experimental data also confirm the origins of differential light-outcoupling enhancement. The maximum luminous efficiency and power efficiency are enhanced from 14.7 cd/A and 8.39 lm/W to 23 cd/A and 13.2 lm/W, respectively, with laminated BEF, which are both the highest so far for single-layer solution-process blue phosphorescence OLEDs with small molecule hosts.

  10. Ligand coupling symmetry correlates with thermopower enhancement in small-molecule/nanocrystal hybrid materials.

    PubMed

    Lynch, Jared; Kotiuga, Michele; Doan-Nguyen, Vicky V T; Queen, Wendy L; Forster, Jason D; Schlitz, Ruth A; Murray, Christopher B; Neaton, Jeffrey B; Chabinyc, Michael L; Urban, Jeffrey J

    2014-10-28

    We investigate the impact of the coupling symmetry and chemical nature of organic-inorganic interfaces on thermoelectric transport in Cu2-xSe nanocrystal thin films. By coupling ligand-exchange techniques with layer-by-layer assembly methods, we are able to systematically vary nanocrystal-organic linker interfaces, demonstrating how the functionality of the polar headgroup and the coupling symmetry of the organic linkers can change the power factor (S(2)σ) by nearly 2 orders of magnitude. Remarkably, we observe that ligand-coupling symmetry has a profound effect on thermoelectric transport in these hybrid materials. We shed light on these results using intuition from a simplified model for interparticle charge transport via tunneling through the frontier orbital of a bound ligand. Our analysis indicates that ligand-coupling symmetry and binding mechanisms correlate with enhanced conductivity approaching 2000 S/cm, and we employ this concept to demonstrate among the highest power factors measured for quantum-dot based thermoelectric inorganic-organic composite materials of ∼ 30 μW/m · K(2). PMID:25211028

  11. Compact hybrid (gold nanodendrite-quantum dots) assembly: plasmon enhanced fluorescence-based platform for small molecule sensing in solution.

    PubMed

    Chen, Huide; Xia, Yunsheng

    2014-11-18

    In this study, we have presented a novel plasmon enhanced fluorescence (PEF) system for label-free sensing of small molecules in bulk solution. The amine-terminated gold nanodendrite (AuND) and carboxyl-terminated QDs directly assemble each other by amine-carboxyl attraction. Without any spacer layers, PEF can be increased by 4 times during the formation of the compact hybrid (AuND-QDs) assembly. Both experiment and finite-difference time domain calculation results indicate that the distinct solution-PEF effect is ascribed to two reasons: (1) The used AuNDs simultaneously possess four features in morphology and topology, well-defined superstructure, sharp tips and edges, moderately elongated subunits, and smaller size. (2) The hybrid (AuND-QDs) assembly has a very compact structure. So, the fluorescence is well enhanced by the effective increase of excitation and radiative decay rates with the decrease of scattering effect. The (AuND-QDs) assembly is then employed for sensing of trinitrotoluene (TNT), one of the highly explosive and environmentally detrimental substances, in bulk solution. The sensing principle is that the analytes can react with primary amines on the AuND surface and form Meisenheimer complexes, which break the preformed assemblies and result in the fluorescence recovery of the QDs. The linear range is 0-8.8 nM with 0.05 nM detection limit. The present quasi-picomole level sensitivity is one of the best results for fluorescent TNT sensing. The developed method is successfully applied to TNT sensing in real environmental samples, indicating the practical potential. PMID:25317671

  12. Solution-grown small-molecule organic semiconductor with enhanced crystal alignment and areal coverage for organic thin film transistors

    DOE PAGESBeta

    Bi, Sheng; He, Zhengran; Chen, Jihua; Li, Dawen

    2015-07-24

    Drop casting of small-molecule organic semiconductors typically forms crystals with random orientation and poor areal coverage, which leads to significant performance variations of organic thin-film transistors (OTFTs). In this study, we utilize the controlled evaporative self-assembly (CESA) method combined with binary solvent system to control the crystal growth. A small-molecule organic semiconductor,2,5-Di-(2-ethylhexyl)-3,6-bis(5"-n-hexyl-2,2',5',2"]terthiophen-5-yl)-pyrrolo[3,4-c]pyrrole-1,4-dione (SMDPPEH), is used as an example to demonstrate the effectiveness of our approach. By optimizing the double solvent ratios, well-aligned SMDPPEH crystals with significantly improved areal coverage were achieved. As a result, the SMDPPEH based OTFTs exhibit a mobility of 1.6 × 10-2 cm2/V s, which is themore » highest mobility from SMDPPEH ever reported.« less

  13. Solution-grown small-molecule organic semiconductor with enhanced crystal alignment and areal coverage for organic thin film transistors

    SciTech Connect

    Bi, Sheng; He, Zhengran; Chen, Jihua; Li, Dawen

    2015-07-24

    Drop casting of small-molecule organic semiconductors typically forms crystals with random orientation and poor areal coverage, which leads to significant performance variations of organic thin-film transistors (OTFTs). In this study, we utilize the controlled evaporative self-assembly (CESA) method combined with binary solvent system to control the crystal growth. A small-molecule organic semiconductor,2,5-Di-(2-ethylhexyl)-3,6-bis(5"-n-hexyl-2,2',5',2"]terthiophen-5-yl)-pyrrolo[3,4-c]pyrrole-1,4-dione (SMDPPEH), is used as an example to demonstrate the effectiveness of our approach. By optimizing the double solvent ratios, well-aligned SMDPPEH crystals with significantly improved areal coverage were achieved. As a result, the SMDPPEH based OTFTs exhibit a mobility of 1.6 × 10-2 cm2/V s, which is the highest mobility from SMDPPEH ever reported.

  14. Raman and surface enhanced Raman spectroscopic studies of specific, small molecule activator of histone acetyltransferase p300

    NASA Astrophysics Data System (ADS)

    Kundu, Partha P.; Pavan Kumar, G. V.; Mantelingu, Kempegowda; Kundu, Tapas K.; Narayana, Chandrabhas

    2011-07-01

    We report for the first time, the Raman and surface enhanced Raman scattering (SERS) studies of N-(4-chloro-3-trifluoromethyl-phenyl)-2-ethoxy-benzamide (CTB). This molecule is specific activator of human histone acetyltransferase (HAT), p300, and serves as lead molecule to design anti-neoplastic therapeutics. A detailed Raman and SERS band assignments have been performed for CTB, which are compared with the density functional theory calculations. The observed red shift of N sbnd H stretching frequency from the computed wavenumber indicates the weakening of N sbnd H bond resulting from proton transfer to the neighboring oxygen atom. We observe Ag sbnd N vibrational mode at 234 cm -1 in SERS of CTB. This indicates there is a metal-molecule bond leading to chemical enhancement in SERS. We also observe, enhancement in the modes pertaining to substituted benzene rings and methyl groups. Based on SERS analysis we propose the adsorption sites and the orientation of CTB on silver surface.

  15. Positron-attachment to small molecules: Vibrational enhancement of positron affinities with configuration interaction level of multi-component molecular orbital approach

    SciTech Connect

    Tachikawa, Masanori

    2015-12-31

    To theoretically demonstrate the binding of a positron to small polarized molecules, we have calculated the vibrational averaged positron affinity (PA) values along the local vibrational contribution with the configuration interaction level of multi-component molecular orbital method. This method can take the electron-positron correlation contribution into account through single electronic - single positronic excitation configurations. The PA values are enhanced by including the local vibrational contribution from vertical PA values due to the anharmonicity of the potential.

  16. Protein Scaffolding for Small Molecule Catalysts

    SciTech Connect

    Baker, David

    2014-09-14

    We aim to design hybrid catalysts for energy production and storage that combine the high specificity, affinity, and tunability of proteins with the potent chemical reactivities of small organometallic molecules. The widely used Rosetta and RosettaDesign methodologies will be extended to model novel protein / small molecule catalysts in which one or many small molecule active centers are supported and coordinated by protein scaffolding. The promise of such hybrid molecular systems will be demonstrated with the nickel-phosphine hydrogenase of DuBois et. al.We will enhance the hydrogenase activity of the catalyst by designing protein scaffolds that incorporate proton relays and systematically modulate the local environment of the catalyticcenter. In collaboration with DuBois and Shaw, the designs will be experimentally synthesized and characterized.

  17. Small Molecule Immunosensing Using Surface Plasmon Resonance

    PubMed Central

    Mitchell, John

    2010-01-01

    Surface plasmon resonance (SPR) biosensors utilize refractive index changes to sensitively detect mass changes at noble metal sensor surface interfaces. As such, they have been extensively applied to immunoassays of large molecules, where their high mass and use of sandwich immunoassay formats can result in excellent sensitivity. Small molecule immunosensing using SPR is more challenging. It requires antibodies or high-mass or noble metal labels to provide the required signal for ultrasensitive assays. Also, it can suffer from steric hindrance between the small antigen and large antibodies. However, new studies are increasingly meeting these and other challenges to offer highly sensitive small molecule immunosensor technologies through careful consideration of sensor interface design and signal enhancement. This review examines the application of SPR transduction technologies to small molecule immunoassays directed to different classes of small molecule antigens, including the steroid hormones, toxins, drugs and explosives residues. Also considered are the matrix effects resulting from measurement in chemically complex samples, the construction of stable sensor surfaces and the development of multiplexed assays capable of detecting several compounds at once. Assay design approaches are discussed and related to the sensitivities obtained. PMID:22163605

  18. Incorporation of metal-organic framework HKUST-1 into porous polymer monolithic capillary columns to enhance the chromatographic separation of small molecules.

    PubMed

    Yang, Shengchao; Ye, Fanggui; Lv, Qinghui; Zhang, Cong; Shen, Shufen; Zhao, Shulin

    2014-09-19

    Metal-organic framework (MOF) HKUST-1 nanoparticles have been incorporated into poly(glycidyl methacrylate-co-ethylene dimethacrylate) (HKUST-1-poly(GMA-co-EDMA)) monoliths to afford stationary phases with enhanced chromatographic performance of small molecules in the reversed phase capillary liquid chromatography. The effect of HKUST-1 nanoparticles in the polymerization mixture on the performance of the monolithic column was explored in detail. While the bare poly(GMA-co-EDMA) monolith exhibited poor resolution (Rs<1.0) and low efficiency (800-16,300plates/m), addition of a small amount of HKUST-1 nanoparticles to the polymerization mixture provide high increased resolution (Rs≥1.3) and high efficiency ranged from 16,300 to 44,300plates/m. Chromatographic performance of HKUST-1-poly(GMA-co-EDMA) monolith was demonstrated by separation of various analytes including polycyclic aromatic hydrocarbons, ethylbenzene and styrene, phenols and aromatic acids using a binary polar mobile phase (CH3CN/H2O). The HKUST-1-poly(GMA-co-EDMA) monolith displayed enhanced hydrophobic and π-π interaction characteristics in the reversed phase separation of test analytes compared to the bare poly(GMA-co-EDMA) monolith. The experiment results showed that HKUST-1-poly(GMA-co-EDMA) monoliths are an alternative to enhance the chromatographic separation of small molecules. PMID:25145567

  19. Antitumor activity of the protein and small molecule component fractions from Agrocybe aegerita through enhancement of cytokine production.

    PubMed

    Liang, Yi; Liu, Hong-Hong; Chen, Yi-Jie; Sun, Hui

    2014-04-01

    A water soluble extract from the medicinal mushroom Agrocybe aegerita has been shown to stimulate splenocyte proliferation, cytotoxic activity, and tumor rejection effect in tumor-bearing mouse models. In the present study, the crude extract was separated into a protein component fraction (Yp), mainly containing lectins and serine proteinase, and a small molecule component fraction (Ys), mainly containing triethylene glycol, α-bisabolol, n-hexadecanoic acid, and so on. The antitumor activity of the fractions was investigated in a tumor-bearing BALB/c mouse model. Repeat administration of Yp and Ys significantly inhibited tumor growth (P<.001), but little toxicity was observed. Moreover, the protein fraction Yp performed better than Ys in both antitumor and lifespan-prolonging activity. The cytokine expression levels in serum and splenocytes from extract-treated mice were selectively screened by enzyme-linked immunosorbent assay and quantitative real-time polymerase chain reaction, and the results showed that Yp upregulated the mRNA level of Th2 cytokine interleukin-10 (P<.01), and Ys increased the mRNA level of granulocyte-macrophage colony-stimulating factor (P<.01) and anti-inflammatory cytokine transforming growth factor-β (P<.01). All these data suggest that Yp and Ys can inhibit tumor growth via different mechanisms, which promotes the understanding of antitumor properties of medicinal fungi. PMID:24593676

  20. Enhancement of Open-Circuit Voltage by Using the 58-π Silylmethyl Fullerenes in Small-Molecule Organic Solar Cells.

    PubMed

    Jeon, Il; Delacou, Clément; Nakagawa, Takafumi; Matsuo, Yutaka

    2016-04-20

    The application of 58-π-1,4-bis(silylmethyl)[60]fullerenes, C60 (CH2 SiMe2 Ph)(CH2 SiMe2 Ar) (Ar=Ph and 2-methoxylphenyl for SIMEF-1 and SIMEF-2, respectively), in small-molecule organic solar cells with a diketopyrrolopyrrole donor (3,6-bis[5-(benzofuran-2-yl)thiophen-2-yl]-2,5-bis(2-ethylhexyl)pyrrolo[3,4-c]pyrrole-1,4-dione (DPP(TBFu)2 )) is demonstrated. With the 58-π-silylmethyl fullerene acceptor, SIMEF-1, the devices showed the highest efficiency of 4.57 % with an average of 4.10 %. They manifested an improved open-circuit voltage (1.03 V) owing to the high-lying LUMO level of SIMEF-1, while maintaining a high short-circuit density (9.91 mA cm(-2) ) through controlling the crystallinity of DPP by thermal treatment. On the other hand, despite even higher open-circuit voltage (1.05 V), SIMEF-2-based devices showed lower performances of 3.53 %, owing to a low short-circuit current density (8.33 mA cm(-2) ) and fill factor (0.40) arising from the asymmetric structure, which results in a lower mobility and immiscibility. PMID:26840629

  1. The Nonantibiotic Small Molecule Cyslabdan Enhances the Potency of β-Lactams against MRSA by Inhibiting Pentaglycine Interpeptide Bridge Synthesis

    PubMed Central

    Koyama, Nobuhiro; Tokura, Yuriko; Münch, Daniela; Sahl, Hans-Georg; Schneider, Tanja; Shibagaki, Yoshio; Ikeda, Haruo; Tomoda, Hiroshi

    2012-01-01

    The nonantibiotic small molecule cyslabdan, a labdan-type diterpene produced by Streptomyces sp. K04-0144, markedly potentiated the activity of the β-lactam drug imipenem against methicillin-resistant Staphylococcus aureus (MRSA). To study the mechanism of action of cyslabdan, the proteins that bind to cyslabdan were investigated in an MRSA lysate, which led to the identification of FemA, which is involved in the synthesis of the pentaglycine interpeptide bridge of the peptidoglycan of MRSA. Furthermore, binding assay of cyslabdan to FemB and FemX with the function similar to FemA revealed that cyslabdan had an affinity for FemB but not FemX. In an enzyme-based assay, cyslabdan inhibited FemA activity, where as did not affected FemX and FemB activities. Nonglycyl and monoglycyl murein monomers were accumulated by cyslabdan in the peptidoglycan of MRSA cell walls. These findings indicated that cyslabdan primarily inhibits FemA, thereby suppressing pentaglycine interpeptide bridge synthesis. This protein is a key factor in the determination of β-lactam resistance in MRSA, and our findings provide a new strategy for combating MRSA. PMID:23166602

  2. Enhancement of Performance and Mechanism Studies of All-Solution Processed Small-Molecule based Solar Cells with an Inverted Structure.

    PubMed

    Long, Guankui; Wu, Bo; Yang, Xuan; Kan, Bin; Zhou, Ye-Cheng; Chen, Li-Chuan; Wan, Xiangjian; Zhang, Hao-Li; Sum, Tze Chien; Chen, Yongsheng

    2015-09-30

    Both solution-processed polymers and small molecule based solar cells have achieved PCEs over 9% with the conventional device structure. However, for the practical applications of photovoltaic technology, further enhancement of both device performance and stability are urgently required, particularly for the inverted structure devices, since this architecture will probably be most promising for the possible coming commercialization. In this work, we have fabricated both conventional and inverted structure devices using the same small molecular donor/acceptor materials and compared the performance of both device structures, and found that the inverted structure based device gave significantly improved performance, the highest PCE so far for inverted structure based device using small molecules as the donor. Furthermore, the inverted device shows a remarkable stability with almost no obvious degradation after three months. Systematic device physics and charge generation dynamics studies, including optical simulation, light-intensity-dependent current-voltage experiments, photocurrent density-effective voltage analyses, transient absorption measurements, and electrical simulations, indicate that the significantly enhanced performance using inverted device is ascribed to the increasing of Jsc compared to the conventional device, which in turn is mainly attributed to the increased absorption of photons in the active layers, rather than the reduced nongeminate recombination. PMID:26352703

  3. Finding small molecules for the 'next Ebola'.

    PubMed

    Ekins, Sean; Southan, Christopher; Coffee, Megan

    2015-01-01

    The current Ebola virus epidemic may provide some suggestions of how we can better prepare for the next pathogen outbreak. We propose several cost effective steps that could be taken that would impact the discovery and use of small molecule therapeutics including: 1. text mine the literature, 2. patent assignees and/or inventors should openly declare their relevant filings, 3. reagents and assays could be commoditized, 4. using manual curation to enhance database links, 5. engage database and curation teams, 6. consider open science approaches, 7. adapt the "box" model for shareable reference compounds, and 8. involve the physician's perspective. PMID:25949804

  4. A Surface-Enhanced Raman Scattering Sensor Integrated with Battery-Controlled Fluidic Device for Capture and Detection of Trace Small Molecules

    NASA Astrophysics Data System (ADS)

    Zhou, Qitao; Meng, Guowen; Zheng, Peng; Cushing, Scott; Wu, Nianqiang; Huang, Qing; Zhu, Chuhong; Zhang, Zhuo; Wang, Zhiwei

    2015-08-01

    For surface-enhanced Raman scattering (SERS) sensors, one of the important issues is the development of substrates not only with high SERS-activity but also with strong ability to capture analytes. However, it is difficult to achieve the two goals simultaneously especially when detecting small molecules. Herein a compact battery-controlled nanostructure-assembled SERS system has been demonstrated for capture and detection of trace small molecule pollutants in water. In this SERS fluidic system, an electrical heating constantan wire covered with the vertically aligned ZnO nanotapers decorated with Ag-nanoparticles is inserted into a glass capillary. A mixture of thermo-responsive microgels, Au-nanorods colloids and analyte solution is then filled into the remnant space of the capillary. When the system is heated by switching on the battery, the thermo-responsive microgels shrink, which immobilizes the analyte and drives the Au-nanorod close to each other and close to the Ag-ZnO nanotapers. This process has also created high-density “hot spots” due to multi-type plasmonic couplings in three-dimensional space, amplifying the SERS signal. This integrated device has been successfully used to measure methyl parathion in lake water, showing a great potential in detection of aquatic pollutants.

  5. A Surface-Enhanced Raman Scattering Sensor Integrated with Battery-Controlled Fluidic Device for Capture and Detection of Trace Small Molecules

    PubMed Central

    Zhou, Qitao; Meng, Guowen; Zheng, Peng; Cushing, Scott; Wu, Nianqiang; Huang, Qing; Zhu, Chuhong; Zhang, Zhuo; Wang, Zhiwei

    2015-01-01

    For surface-enhanced Raman scattering (SERS) sensors, one of the important issues is the development of substrates not only with high SERS-activity but also with strong ability to capture analytes. However, it is difficult to achieve the two goals simultaneously especially when detecting small molecules. Herein a compact battery-controlled nanostructure-assembled SERS system has been demonstrated for capture and detection of trace small molecule pollutants in water. In this SERS fluidic system, an electrical heating constantan wire covered with the vertically aligned ZnO nanotapers decorated with Ag-nanoparticles is inserted into a glass capillary. A mixture of thermo-responsive microgels, Au-nanorods colloids and analyte solution is then filled into the remnant space of the capillary. When the system is heated by switching on the battery, the thermo-responsive microgels shrink, which immobilizes the analyte and drives the Au-nanorod close to each other and close to the Ag-ZnO nanotapers. This process has also created high-density “hot spots” due to multi-type plasmonic couplings in three-dimensional space, amplifying the SERS signal. This integrated device has been successfully used to measure methyl parathion in lake water, showing a great potential in detection of aquatic pollutants. PMID:26238799

  6. Enhance the light-harvesting capability of the ITO-free inverted small molecule solar cell by ZnO nanorods.

    PubMed

    Lin, Ming-Yi; Wu, Shang-Hsuan; Hsiao, Li-Jen; Budiawan, Widhya; Boopathi, Karunakara Moorthy; Tu, Wei-Chen; Chang, Yia-Chung; Chu, Chih-Wei

    2016-08-01

    The ITO-free inverted SMPV1:PC71BM solar cells with an Al doped ZnO (AZO) transparent electrodes are fabricated. The AZO thin film prepared by pulsed laser deposition (PLD) technique exhibits high transmission (>85%) and low sheet resistance (~30 Ω/sq) and the power conversion efficiency (PCE) of devices based on AZO electrode can reach around 4%. To further enhance the light harvesting of the absorption layer of solar cells, ZnO nanorods interlayer is grown on the AZO layer before the deposition the active layer. The absorption spectrums of devices under various conditions are also simulated by RCWA method to identify the optical saturation length of the ZnO nanorods. The PCE of ITO-free inverted small molecule solar cell improved with ZnO nanorods can reach 6.6%. PMID:27505758

  7. Quest for organic polymer-based monolithic columns affording enhanced efficiency in high performance liquid chromatography separations of small molecules in isocratic mode

    PubMed Central

    Svec, Frantisek

    2011-01-01

    The separations of small molecules using columns containing porous polymer monoliths invented two decades ago went a long way from the very modest beginnings to the current capillary columns with efficiencies approaching those featured by their silica-based counterparts. This review article presents a variety of techniques that have been used to form capillary formats of monolithic columns with enhanced separation performance in isocratic elutions. The following text first describes the traditional approaches used for the preparation of efficient monoliths comprising variations in polymerization conditions including temperature as well as composition of monomers and porogenic solvents. Encouraging results of these experiments fueled research of completely new preparation methods such as polymerization to an incomplete conversion, use of single crosslinker, hypercrosslinking, and incorporation of carbon nanotubes that are described in the second part of the text. PMID:21816401

  8. Small Molecule based Musculoskeletal Regenerative Engineering

    PubMed Central

    Lo, Kevin W.-H.; Jiang, Tao; Gagnon, Keith A.; Nelson, Clarke; Laurencin, Cato T.

    2014-01-01

    Clinicians and scientists working in the field of regenerative engineering are actively investigating a wide range of methods to promote musculoskeletal tissue regeneration. Small molecule-mediated tissue regeneration is emerging as a promising strategy for regenerating various musculoskeletal tissues and a large number of small molecule compounds have been recently discovered as potential bioactive molecules for musculoskeletal tissue repair and regeneration. In this review, we summarize the recent literature encompassing the past four years in the area of small bioactive molecule for promoting repair and regeneration of various musculoskeletal tissues including bone, muscle, cartilage, tendon, and nerve. PMID:24405851

  9. Small Molecules in the Cone Snail Arsenal.

    PubMed

    Neves, Jorge L B; Lin, Zhenjian; Imperial, Julita S; Antunes, Agostinho; Vasconcelos, Vitor; Olivera, Baldomero M; Schmidt, Eric W

    2015-10-16

    Cone snails are renowned for producing peptide-based venom, containing conopeptides and conotoxins, to capture their prey. A novel small-molecule guanine derivative with unprecedented features, genuanine, was isolated from the venom of two cone snail species. Genuanine causes paralysis in mice, indicating that small molecules and not just polypeptides may contribute to the activity of cone snail venom. PMID:26421741

  10. A PTBA small molecule enhances recovery and reduces postinjury fibrosis after aristolochic acid-induced kidney injury

    PubMed Central

    Novitskaya, Tatiana; McDermott, Lee; Zhang, Ke Xin; Chiba, Takuto; Paueksakon, Paisit; Hukriede, Neil A.

    2013-01-01

    Phenylthiobutanoic acids (PTBAs) are a new class of histone deacetylase (HDAC) inhibitors that accelerate recovery and reduce postinjury fibrosis after ischemia-reperfusion-induced acute kidney injury. However, unlike the more common scenario in which patients present with protracted and less clearly defined onset of renal injury, this model of acute kidney injury gives rise to a clearly defined injury that begins to resolve over a short period of time. In these studies, we show for the first time that treatment with the PTBA analog methyl-4-(phenylthio)butanoate (M4PTB) accelerates recovery and reduces postinjury fibrosis in a progressive model of acute kidney injury and renal fibrosis that occurs after aristolochic acid injection in mice. These effects are apparent when M4PTB treatment is delayed 4 days after the initiating injury and are associated with increased proliferation and decreased G2/M arrest of regenerating renal tubular epithelial cells. In addition, there is reduced peritubular macrophage infiltration and decreased expression of the macrophage chemokines CX3Cl1 and CCL2. Since macrophage infiltration plays a role in promoting kidney injury, and since renal tubular epithelial cells show defective repair and a marked increase in maladaptive G2/M arrest after aristolochic acid injury, these findings suggest M4PTB may be particularly beneficial in reducing injury and enhancing intrinsic cellular repair even when administered days after aristolochic acid ingestion. PMID:24370591

  11. Hydrophobic Porous Material Adsorbs Small Organic Molecules

    NASA Technical Reports Server (NTRS)

    Sharma, Pramod K.; Hickey, Gregory S.

    1994-01-01

    Composite molecular-sieve material has pore structure designed specifically for preferential adsorption of organic molecules for sizes ranging from 3 to 6 angstrom. Design based on principle that contaminant molecules become strongly bound to surface of adsorbent when size of contaminant molecules is nearly same as that of pores in adsorbent. Material used to remove small organic contaminant molecules from vacuum systems or from enclosed gaseous environments like closed-loop life-support systems.

  12. Small-molecule-dependent split aptamer ligation.

    PubMed

    Sharma, Ashwani K; Heemstra, Jennifer M

    2011-08-17

    Here we describe the first use of small-molecule binding to direct a chemical reaction between two nucleic acid strands. The reported reaction is a ligation between two fragments of a DNA split aptamer using strain-promoted azide-alkyne cycloaddition. Utilizing the split aptamer for cocaine, we demonstrate small-molecule-dependent ligation that is dose-dependent over a wide range of cocaine concentrations and is compatible with complex biological fluids such as human blood serum. Moreover, studies of split aptamer ligation at varying salt concentrations and using structurally similar analogues of cocaine have revealed new insight into the assembly and small-molecule binding properties of the cocaine split aptamer. The ability to translate the presence of a small-molecule target into the output of DNA ligation is anticipated to enable the development of new, broadly applicable small-molecule detection assays. PMID:21761903

  13. The Small Molecule Hyperphyllin Enhances Leaf Formation Rate and Mimics Shoot Meristem Integrity Defects Associated with AMP1 Deficiency.

    PubMed

    Poretska, Olena; Yang, Saiqi; Pitorre, Delphine; Rozhon, Wilfried; Zwerger, Karin; Uribe, Marcos Castellanos; May, Sean; McCourt, Peter; Poppenberger, Brigitte; Sieberer, Tobias

    2016-06-01

    ALTERED MERISTEM PROGRAM1 (AMP1) is a member of the M28 family of carboxypeptidases with a pivotal role in plant development and stress adaptation. Its most prominent mutant defect is a unique hypertrophic shoot phenotype combining a strongly increased organ formation rate with enhanced meristem size and the formation of ectopic meristem poles. However, so far the role of AMP1 in shoot development could not be assigned to a specific molecular pathway nor is its biochemical function resolved. In this work we evaluated the level of functional conservation between AMP1 and its human homolog HsGCPII, a tumor marker of medical interest. We show that HsGCPII cannot substitute AMP1 in planta and that an HsGCPII-specific inhibitor does not evoke amp1-specific phenotypes. We used a chemical genetic approach to identify the drug hyperphyllin (HP), which specifically mimics the shoot defects of amp1, including plastochron reduction and enlargement and multiplication of the shoot meristem. We assessed the structural requirements of HP activity and excluded that it is a cytokinin analog. HP-treated wild-type plants showed amp1-related tissue-specific changes of various marker genes and a significant transcriptomic overlap with the mutant. HP was ineffective in amp1 and elevated the protein levels of PHAVOLUTA, consistent with the postulated role of AMP1 in miRNA-controlled translation, further supporting an AMP1-related mode of action. Our work suggests that plant and animal members of the M28 family of proteases adopted unrelated functions. With HP we provide a tool to characterize the plant-specific functions of this important class of proteins. PMID:27208298

  14. Restoring Mitochondrial Function: A Small Molecule-mediated Approach to Enhance Glucose Stimulated Insulin Secretion in Cholesterol Accumulated Pancreatic beta cells.

    PubMed

    Asalla, Suman; Girada, Shravan Babu; Kuna, Ramya S; Chowdhury, Debabrata; Kandagatla, Bhaskar; Oruganti, Srinivas; Bhadra, Utpal; Bhadra, Manika Pal; Kalivendi, Shasi Vardhan; Rao, Swetha Pavani; Row, Anupama; Ibrahim, A; Ghosh, Partha Pratim; Mitra, Prasenjit

    2016-01-01

    Dyslipidemia, particularly the elevated serum cholesterol levels, aggravate the pathophysiology of type 2 diabetes. In the present study we explored the relationship between fasting blood sugar and serum lipid parameters in human volunteers which revealed a significant linear effect of serum cholesterol on fasting blood glucose. Short term feeding of cholesterol enriched diet to rodent model resulted in elevated serum cholesterol levels, cholesterol accumulation in pancreatic islets and hyperinsulinemia with modest increase in plasma glucose level. To explore the mechanism, we treated cultured BRIN-BD11 pancreatic beta cells with soluble cholesterol. Our data shows that cholesterol treatment of cultured pancreatic beta cells enhances total cellular cholesterol. While one hour cholesterol exposure enhances insulin exocytosis, overnight cholesterol accumulation in cultured pancreatic beta cells affects cellular respiration, and inhibits Glucose stimulated insulin secretion. We further report that (E)-4-Chloro-2-(1-(2-(2,4,6-trichlorophenyl) hydrazono) ethyl) phenol (small molecule M1) prevents the cholesterol mediated blunting of cellular respiration and potentiates Glucose stimulated insulin secretion which was abolished in pancreatic beta cells on cholesterol accumulation. PMID:27282931

  15. Restoring Mitochondrial Function: A Small Molecule-mediated Approach to Enhance Glucose Stimulated Insulin Secretion in Cholesterol Accumulated Pancreatic beta cells

    PubMed Central

    Asalla, Suman; Girada, Shravan Babu; Kuna, Ramya S.; Chowdhury, Debabrata; Kandagatla, Bhaskar; Oruganti, Srinivas; Bhadra, Utpal; Bhadra, Manika Pal; Kalivendi, Shasi Vardhan; Rao, Swetha Pavani; Row, Anupama; Ibrahim, A; Ghosh, Partha Pratim; Mitra, Prasenjit

    2016-01-01

    Dyslipidemia, particularly the elevated serum cholesterol levels, aggravate the pathophysiology of type 2 diabetes. In the present study we explored the relationship between fasting blood sugar and serum lipid parameters in human volunteers which revealed a significant linear effect of serum cholesterol on fasting blood glucose. Short term feeding of cholesterol enriched diet to rodent model resulted in elevated serum cholesterol levels, cholesterol accumulation in pancreatic islets and hyperinsulinemia with modest increase in plasma glucose level. To explore the mechanism, we treated cultured BRIN-BD11 pancreatic beta cells with soluble cholesterol. Our data shows that cholesterol treatment of cultured pancreatic beta cells enhances total cellular cholesterol. While one hour cholesterol exposure enhances insulin exocytosis, overnight cholesterol accumulation in cultured pancreatic beta cells affects cellular respiration, and inhibits Glucose stimulated insulin secretion. We further report that (E)-4-Chloro-2-(1-(2-(2,4,6-trichlorophenyl) hydrazono) ethyl) phenol (small molecule M1) prevents the cholesterol mediated blunting of cellular respiration and potentiates Glucose stimulated insulin secretion which was abolished in pancreatic beta cells on cholesterol accumulation. PMID:27282931

  16. Cellular reprogramming: a small molecule perspective

    PubMed Central

    Nie, Baoming; Wang, Haixia; Laurent, Timothy; Ding, Sheng

    2013-01-01

    The discovery that somatic cells can be reprogrammed to induced pluripotent stem cells (iPSCs) by the expression of a few transcription factors has attracted enormous interest in biomedical research and the field of regenerative medicine. iPSCs nearly identically resemble embryonic stem cells (ESCs) and can give rise to all cell types in the body, and thus have opened new opportunities for personalized regenerative medicine and new ways of modeling human diseases. Although some studies have raised concerns about genomic stability and epigenetic memory in the resulting cells, better understanding and control of the reprogramming process should enable enhanced efficiency and higher fidelity in reprogramming. Therefore, small molecules regulating reprogramming mechanisms are valuable tools to probe the process of reprogremming and harness cell fate transitions for various applications. PMID:22959962

  17. Small-molecule survivin inhibitor YM155 enhances radiosensitization in esophageal squamous cell carcinoma by the abrogation of G2 checkpoint and suppression of homologous recombination repair

    PubMed Central

    2014-01-01

    Background Survivin is overexpressed in cancer cells and plays a crucial role in apoptosis evasion. YM155, a small-molecule inhibitor of survivin, could enhance the cytotoxicity of various DNA-damaging agents. Here, we evaluated the radiosensitizaion potential of YM155 in human esophageal squamous cell carcinoma (ESCC). Methods Cell viability was determined by CCK8 assay. The radiosensitization effect of YM155 was evaluated by clonogenic survival and progression of tumor xenograft. Cell cycle progression was determined by flow cytometric analysis. Radiation-induced DNA double strand break (DSB) and homologous recombination repair (HRR) were detected by the staining of γ-H2AX and RAD51, respectively. Expression of survivin and cell cycle regulators was detected by Western blot analysis. Results YM155 induced radiosensitization in ESCC cell lines Eca109 and TE13, associated with the abrogation of radiation induced G2/M checkpoint, impaired Rad51 focus formation, and the prolongation of γ-H2AX signaling. G2/M transition markers, including the activation of cyclinB1/Cdc2 kinase and the suppression of Cdc2 Thr14/Tyr15 phosphorylation were induced by YM155 in irradiated cells. The combination of YM155 plus irradiation delayed the growth of ESCC tumor xenografts to a greater extent compared with either treatment modality alone. Conclusions Our findings suggest that the abrogation of G2 checkpoint and the inhibition of HRR contribute to radiosensitization by YM155 in ESCC cells. PMID:25139395

  18. Auxin biology revealed by small molecules.

    PubMed

    Ma, Qian; Robert, Stéphanie

    2014-05-01

    The plant hormone auxin regulates virtually every aspect of plant growth and development and unraveling its molecular and cellular modes of action is fundamental for plant biology research. Chemical genomics is the use of small molecules to modify protein functions. This approach currently rises as a powerful technology for basic research. Small compounds with auxin-like activities or affecting auxin-mediated biological processes have been widely used in auxin research. They can serve as a tool complementary to genetic and genomic methods, facilitating the identification of an array of components modulating auxin metabolism, transport and signaling. The employment of high-throughput screening technologies combined with informatics-based chemical design and organic chemical synthesis has since yielded many novel small molecules with more instantaneous, precise and specific functionalities. By applying those small molecules, novel molecular targets can be isolated to further understand and dissect auxin-related pathways and networks that otherwise are too complex to be elucidated only by gene-based methods. Here, we will review examples of recently characterized molecules used in auxin research, highlight the strategies of unraveling the mechanisms of these small molecules and discuss future perspectives of small molecule applications in auxin biology. PMID:24252105

  19. Small molecule TSHR agonists and antagonists.

    PubMed

    Neumann, S; Gershengorn, M C

    2011-04-01

    TSH activates the TSH receptor (TSHR) thereby stimulating the function of thyroid follicular cells (thyrocytes) leading to biosynthesis and secretion of thyroid hormones. Because TSHR is involved in several thyroid pathologies, there is a strong rationale for the design of small molecule "drug-like" ligands. Recombinant human TSH (rhTSH, Thyrogen(®)) has been used in the follow-up of patients with thyroid cancer to increase the sensitivity for detection of recurrence or metastasis. rhTSH is difficult to produce and must be administered by injection. A small molecule TSHR agonist could produce the same beneficial effects as rhTSH but with greater ease of oral administration. We developed a small molecule ligand that is a full agonist at TSHR. Importantly for its clinical potential, this agonist elevated serum thyroxine and stimulated thyroidal radioiodide uptake in mice after its absorption from the gastrointestinal tract following oral administration. Graves' disease (GD) is caused by persistent, unregulated stimulation of thyrocytes by thyroid-stimulating antibodies (TSAbs) that activate TSHR. We identified the first small molecule TSHR antagonists that inhibited TSH- and TSAb-stimulated signalling in primary cultures of human thyrocytes. Our results provide proof-of-principle for effectiveness of small molecule agonists and antagonists for TSHR. We suggest that these small molecule ligands are lead compounds for the development of higher potency ligands that can be used as probes of TSHR biology with therapeutic potential. PMID:21511239

  20. Electrocatalytic oxidation of small organic molecules in acid medium: enhancement of activity of noble metal nanoparticles and their alloys by supporting or modifying them with metal oxides

    PubMed Central

    Kulesza, Pawel J.; Pieta, Izabela S.; Rutkowska, Iwona A.; Wadas, Anna; Marks, Diana; Klak, Karolina; Stobinski, Leszek; Cox, James A.

    2013-01-01

    Different approaches to enhancement of electrocatalytic activity of noble metal nanoparticles during oxidation of small organic molecules (namely potential fuels for low-temperature fuel cells such as methanol, ethanol and formic acid) are described. A physical approach to the increase of activity of catalytic nanoparticles (e.g. platinum or palladium) involves nanostructuring to obtain highly dispersed systems of high surface area. Recently, the feasibility of enhancing activity of noble metal systems through the formation of bimetallic (e.g. PtRu, PtSn, and PdAu) or even more complex (e.g. PtRuW, PtRuSn) alloys has been demonstrated. In addition to possible changes in the electronic properties of alloys, specific interactions between metals as well as chemical reactivity of the added components have been postulated. We address and emphasize here the possibility of utilization of noble metal and alloyed nanoparticles supported on robust but reactive high surface area metal oxides (e.g. WO3, MoO3, TiO2, ZrO2, V2O5, and CeO2) in oxidative electrocatalysis. This paper concerns the way in which certain inorganic oxides and oxo species can act effectively as supports for noble metal nanoparticles or their alloys during electrocatalytic oxidation of hydrogen and representative organic fuels. Among important issues are possible changes in the morphology and dispersion, as well as specific interactions leading to the improved chemisorptive and catalytic properties in addition to the feasibility of long time operation of the discussed systems. PMID:24443590

  1. Small-molecule screening identifies inhibition of salt-inducible kinases as a therapeutic strategy to enhance immunoregulatory functions of dendritic cells

    PubMed Central

    Sundberg, Thomas B.; Choi, Hwan Geun; Song, Joo-Hye; Russell, Caitlin N.; Hussain, Mahmud M.; Graham, Daniel B.; Khor, Bernard; Gagnon, John; O’Connell, Daniel J.; Narayan, Kavitha; Dančík, Vlado; Perez, Jose R.; Reinecker, Hans-Christian; Gray, Nathanael S.; Schreiber, Stuart L.; Xavier, Ramnik J.; Shamji, Alykhan F.

    2014-01-01

    Genetic alterations that reduce the function of the immunoregulatory cytokine IL-10 contribute to colitis in mouse and man. Myeloid cells such as macrophages (MΦs) and dendritic cells (DCs) play an essential role in determining the relative abundance of IL-10 versus inflammatory cytokines in the gut. As such, using small molecules to boost IL-10 production by DCs–MΦs represents a promising approach to increase levels of this cytokine specifically in gut tissues. Toward this end, we screened a library of well-annotated kinase inhibitors for compounds that enhance production of IL-10 by murine bone-marrow–derived DCs stimulated with the yeast cell wall preparation zymosan. This approach identified a number of kinase inhibitors that robustly up-regulate IL-10 production including the Food and Drug Administration (FDA)-approved drugs dasatinib, bosutinib, and saracatinib that target ABL, SRC-family, and numerous other kinases. Correlating the kinase selectivity profiles of the active compounds with their effect on IL-10 production suggests that inhibition of salt-inducible kinases (SIKs) mediates the observed IL-10 increase. This was confirmed using the SIK-targeting inhibitor HG-9-91-01 and a series of structural analogs. The stimulatory effect of SIK inhibition on IL-10 is also associated with decreased production of the proinflammatory cytokines IL-1β, IL-6, IL-12, and TNF-α, and these coordinated effects are observed in human DCs–MΦs and anti-inflammatory CD11c+ CX3CR1hi cells isolated from murine gut tissue. Collectively, these studies demonstrate that SIK inhibition promotes an anti-inflammatory phenotype in activated myeloid cells marked by robust IL-10 production and establish these effects as a previously unidentified activity associated with several FDA-approved multikinase inhibitors. PMID:25114223

  2. Chapter 3: Small Molecules and Disease

    PubMed Central

    Wishart, David S.

    2012-01-01

    “Big” molecules such as proteins and genes still continue to capture the imagination of most biologists, biochemists and bioinformaticians. “Small” molecules, on the other hand, are the molecules that most biologists, biochemists and bioinformaticians prefer to ignore. However, it is becoming increasingly apparent that small molecules such as amino acids, lipids and sugars play a far more important role in all aspects of disease etiology and disease treatment than we realized. This particular chapter focuses on an emerging field of bioinformatics called “chemical bioinformatics” – a discipline that has evolved to help address the blended chemical and molecular biological needs of toxicogenomics, pharmacogenomics, metabolomics and systems biology. In the following pages we will cover several topics related to chemical bioinformatics. First, a brief overview of some of the most important or useful chemical bioinformatic resources will be given. Second, a more detailed overview will be given on those particular resources that allow researchers to connect small molecules to diseases. This section will focus on describing a number of recently developed databases or knowledgebases that explicitly relate small molecules – either as the treatment, symptom or cause – to disease. Finally a short discussion will be provided on newly emerging software tools that exploit these databases as a means to discover new biomarkers or even new treatments for disease. PMID:23300405

  3. Small Molecules in the Treatment of Psoriasis.

    PubMed

    Torres, Tiago; Filipe, Paulo

    2015-08-01

    Preclinical Research Psoriasis is an inflammatory systemic skin disease that affects various parts of the body requiring long-term management due to its chronic nature. Available treatment options include topical, systemic or biological therapies, which have long-term limitations associated to toxicity, tolerability and risk for adverse effects requiring its intermittent use and close monitoring. Small molecules modulate proinflammatory cytokines, selectively inhibit signaling pathways and showing potential to treat inflammatory diseases in patients not responding to conventional treatments. Presently, small molecules available are phosphodiesterase 4 inhibitors or Janus kinase inhibitors. Other small molecules under development for psoriasis include fumaric acid esters, amygdalin analogs, protein kinase C inhibitors, mitogen-activated protein kinase inhibitors, spleen protein kinase inhibitors, other tyrosine kinase inhibitors, sphingosine 1-phosphate receptor agonists, and A3 adenosine receptor agonists. These new treatment options represent important advances in the development of specific drugs to respond to the goals of treatment and improve patient quality of life. PMID:26255795

  4. Design of small-molecule epigenetic modulators

    PubMed Central

    Pachaiyappan, Boobalan

    2013-01-01

    The field of epigenetics has expanded rapidly to reveal multiple new targets for drug discovery. The functional elements of the epigenomic machinery can be catagorized as writers, erasers and readers, and together these elements control cellular gene expression and homeostasis. It is increasingly clear that aberrations in the epigenome can underly a variety of diseases, and thus discovery of small molecules that modulate the epigenome in a specific manner is a viable approach to the discovery of new therapeutic agents. In this Digest, the components of epigenetic control of gene expression will be briefly summarized, and efforts to identify small molecules that modulate epigenetic processes will be described. PMID:24300735

  5. Small Molecules from the Human Microbiota

    PubMed Central

    Donia, Mohamed S.; Fischbach, Michael A.

    2015-01-01

    Developments in the use of genomics to guide natural product discovery and a recent emphasis on understanding the molecular mechanisms of microbiota-host interactions have converged on the discovery of natural products from the human microbiome. Here, we review what is known about small molecules produced by the human microbiota. Numerous molecules representing each of the major metabolite classes have been found that have a variety of biological activities, including immune modulation and antibiosis. We discuss technologies that will affect how microbiota-derived molecules are discovered in the future, and consider the challenges inherent in finding specific molecules that are critical for driving microbe-host and microbe-microbe interactions and their biological relevance. PMID:26206939

  6. Small molecule control of bacterial biofilms

    PubMed Central

    Worthington, Roberta J.; Richards, Justin J.

    2012-01-01

    Bacterial biofilms are defined as a surface attached community of bacteria embedded in a matrix of extracellular polymeric substances that they have produced. When in the biofilm state, bacteria are more resistant to antibiotics and the host immune response than are their planktonic counterparts. Biofilms are increasingly recognized as being significant in human disease, accounting for 80% of bacterial infections in the body and diseases associated with bacterial biofilms include: lung infections of cystic fibrosis, colitis, urethritis, conjunctivitis, otitis, endocarditis and periodontitis. Additionally, biofilm infections of indwelling medical devices are of particular concern, as once the device is colonized infection is virtually impossible to eradicate. Given the prominence of biofilms in infectious diseases, there has been an increased effort toward the development of small molecules that will modulate bacterial biofilm development and maintenance. In this review, we highlight the development of small molecules that inhibit and/or disperse bacterial biofilms through non-microbicidal mechanisms. The review discuses the numerous approaches that have been applied to the discovery of lead small molecules that mediate biofilm development. These approaches are grouped into: 1) the identification and development of small molecules that target one of the bacterial signaling pathways involved in biofilm regulation, 2) chemical library screening for compounds with anti-biofilm activity, and 3) the identification of natural products that possess anti-biofilm activity, and the chemical manipulation of these natural products to obtain analogues with increased activity. PMID:22733439

  7. Selective functionalization: Shields for small molecules

    NASA Astrophysics Data System (ADS)

    Silverman, Scott K.

    2012-10-01

    Nucleic acid aptamers have been employed to shield small molecules so that one among many similar reactive functional groups can be modified. This provides access to new chemical entities with potentially interesting properties while avoiding the use of covalent protecting groups.

  8. Uranium-mediated activation of small molecules.

    PubMed

    Arnold, Polly L

    2011-08-28

    Molecular complexes of uranium are capable of activating a range of industrially and economically important small molecules such as CO, CO(2), and N(2); new and often unexpected reactions provide insight into an element that needs to be well-understood if future clean-energy solutions are to involve nuclear power. PMID:21614341

  9. SMPDB: The Small Molecule Pathway Database.

    PubMed

    Frolkis, Alex; Knox, Craig; Lim, Emilia; Jewison, Timothy; Law, Vivian; Hau, David D; Liu, Phillip; Gautam, Bijaya; Ly, Son; Guo, An Chi; Xia, Jianguo; Liang, Yongjie; Shrivastava, Savita; Wishart, David S

    2010-01-01

    The Small Molecule Pathway Database (SMPDB) is an interactive, visual database containing more than 350 small-molecule pathways found in humans. More than 2/3 of these pathways (>280) are not found in any other pathway database. SMPDB is designed specifically to support pathway elucidation and pathway discovery in clinical metabolomics, transcriptomics, proteomics and systems biology. SMPDB provides exquisitely detailed, hyperlinked diagrams of human metabolic pathways, metabolic disease pathways, metabolite signaling pathways and drug-action pathways. All SMPDB pathways include information on the relevant organs, organelles, subcellular compartments, protein cofactors, protein locations, metabolite locations, chemical structures and protein quaternary structures. Each small molecule is hyperlinked to detailed descriptions contained in the Human Metabolome Database (HMDB) or DrugBank and each protein or enzyme complex is hyperlinked to UniProt. All SMPDB pathways are accompanied with detailed descriptions, providing an overview of the pathway, condition or processes depicted in each diagram. The database is easily browsed and supports full text searching. Users may query SMPDB with lists of metabolite names, drug names, genes/protein names, SwissProt IDs, GenBank IDs, Affymetrix IDs or Agilent microarray IDs. These queries will produce lists of matching pathways and highlight the matching molecules on each of the pathway diagrams. Gene, metabolite and protein concentration data can also be visualized through SMPDB's mapping interface. All of SMPDB's images, image maps, descriptions and tables are downloadable. SMPDB is available at: http://www.smpdb.ca. PMID:19948758

  10. Oncogenic protein interfaces: small molecules, big challenges.

    PubMed

    Nero, Tracy L; Morton, Craig J; Holien, Jessica K; Wielens, Jerome; Parker, Michael W

    2014-04-01

    Historically, targeting protein-protein interactions with small molecules was not thought possible because the corresponding interfaces were considered mostly flat and featureless and therefore 'undruggable'. Instead, such interactions were targeted with larger molecules, such as peptides and antibodies. However, the past decade has seen encouraging breakthroughs through the refinement of existing techniques and the development of new ones, together with the identification and exploitation of unexpected aspects of protein-protein interaction surfaces. In this Review, we describe some of the latest techniques to discover modulators of protein-protein interactions and how current drug discovery approaches have been adapted to successfully target these interfaces. PMID:24622521

  11. Computational mass spectrometry for small molecules

    PubMed Central

    2013-01-01

    The identification of small molecules from mass spectrometry (MS) data remains a major challenge in the interpretation of MS data. This review covers the computational aspects of identifying small molecules, from the identification of a compound searching a reference spectral library, to the structural elucidation of unknowns. In detail, we describe the basic principles and pitfalls of searching mass spectral reference libraries. Determining the molecular formula of the compound can serve as a basis for subsequent structural elucidation; consequently, we cover different methods for molecular formula identification, focussing on isotope pattern analysis. We then discuss automated methods to deal with mass spectra of compounds that are not present in spectral libraries, and provide an insight into de novo analysis of fragmentation spectra using fragmentation trees. In addition, this review shortly covers the reconstruction of metabolic networks using MS data. Finally, we list available software for different steps of the analysis pipeline. PMID:23453222

  12. Small molecule inhibition of RISC loading.

    PubMed

    Tan, Grace S; Chiu, Chun-Hao; Garchow, Barry G; Metzler, David; Diamond, Scott L; Kiriakidou, Marianthi

    2012-02-17

    Argonaute proteins are the core components of the microRNP/RISC. The biogenesis and function of microRNAs and endo- and exo- siRNAs are regulated by Ago2, an Argonaute protein with RNA binding and nuclease activities. Currently, there are no in vitro assays suitable for large-scale screening of microRNP/RISC loading modulators. We describe a novel in vitro assay that is based on fluorescence polarization of TAMRA-labeled RNAs loaded to human Ago2. Using this assay, we identified potent small-molecule inhibitors of RISC loading, including aurintricarboxylic acid (IC(50) = 0.47 μM), suramin (IC(50) = 0.69 μM), and oxidopamine HCL (IC(50) = 1.61 μM). Small molecules identified by this biochemical screening assay also inhibited siRNA loading to endogenous Ago2 in cultured cells. PMID:22026461

  13. Organic Optoelectronic Devices Employing Small Molecules

    NASA Astrophysics Data System (ADS)

    Fleetham, Tyler Blain

    Organic optoelectronic devices have remained a research topic of great interest over the past two decades, particularly in the development of efficient organic photovoltaics (OPV) and organic light emitting diodes (OLED). In order to improve the efficiency, stability, and materials variety for organic optoelectronic devices a number of emitting materials, absorbing materials, and charge transport materials were developed and employed in a device setting. Optical, electrical, and photophysical studies of the organic materials and their corresponding devices were thoroughly carried out. Two major approaches were taken to enhance the efficiency of small molecule based OPVs: developing material with higher open circuit voltages or improved device structures which increased short circuit current. To explore the factors affecting the open circuit voltage (VOC) in OPVs, molecular structures were modified to bring VOC closer to the effective bandgap, DeltaE DA, which allowed the achievement of 1V VOC for a heterojunction of a select Ir complex with estimated exciton energy of only 1.55eV. Furthermore, the development of anode interfacial layer for exciton blocking and molecular templating provide a general approach for enhancing the short circuit current. Ultimately, a 5.8% PCE was achieved in a single heterojunction of C60 and a ZnPc material prepared in a simple, one step, solvent free, synthesis. OLEDs employing newly developed deep blue emitters based on cyclometalated complexes were demonstrated. Ultimately, a peak EQE of 24.8% and nearly perfect blue emission of (0.148,0.079) was achieved from PtON7dtb, which approaches the maximum attainable performance from a blue OLED. Furthermore, utilizing the excimer formation properties of square-planar Pt complexes, highly efficient and stable white devices employing a single emissive material were demonstrated. A peak EQE of over 20% for pure white color (0.33,0.33) and 80 CRI was achieved with the tridentate Pt complex, Pt

  14. Development of second-generation small-molecule RhoA inhibitors with enhanced water solubility, tissue potency, and significant in vivo efficacy.

    PubMed

    Ma, Sheng; Deng, Jing; Li, Baoli; Li, Xiujiang; Yan, Zhaowei; Zhu, Jin; Chen, Gang; Wang, Zhong; Jiang, Hualiang; Miao, Liyan; Li, Jian

    2015-01-01

    RhoA, a member of the Rho GTPases, is involved in a variety of cellular functions and could be a suitable therapeutic target for the treatment of cardiovascular diseases. However, few small-molecule RhoA inhibitors have been reported. Based on our previously reported lead compounds, 32 new 2-substituted quinoline (or quinoxaline) derivatives were synthesized and tested in biological assays. Six compounds showed high RhoA inhibitory activities, with IC50 values of 1.17-1.84 μM. Among these, (E)-3-(3-(ethyl(quinolin-2-yl)amino)phenyl)acrylic acid (26 b) and (E)-3-(3-(butyl(quinolin-2-yl)amino)phenyl)acrylic acid (26 d) demonstrated noticeable vasorelaxation effects against phenylephrine-induced contraction in thoracic aorta artery rings, and compound 26 b had good water solubility and showed significant in vivo efficacy, which was similar to that of 5-(1,4-diazepane-1-sulfonyl)isoquinoline (fasudil) in a subarachnoid hemorrhage-cardiovascular model. To the best of our knowledge, compound 26 b is the first example of a small- molecule RhoA inhibitor with potent in vivo efficacy, which could serve as a good lead for designing cardiovascular agents. PMID:25377276

  15. Fluorescence Polarization Assays in Small Molecule Screening

    PubMed Central

    Lea, Wendy A.; Simeonov, Anton

    2011-01-01

    Importance of the field Fluorescence polarization (FP) is a homogeneous method that allows rapid and quantitative analysis of diverse molecular interactions and enzyme activities. This technique has been widely utilized in clinical and biomedical settings, including the diagnosis of certain diseases and monitoring therapeutic drug levels in body fluids. Recent developments in the field has been symbolized by the facile adoption of FP in high-throughput screening (HTS) and small molecule drug discovery of an increasing range of target classes. Areas covered in this review The article provides a brief overview on the theoretical foundation of FP, followed by updates on recent advancements in its application for various drug target classes, including G-protein coupled receptors (GPCRs), enzymes and protein-protein interactions (PPIs). The strengths and weaknesses of this method, practical considerations in assay design, novel applications, and future directions are also discussed. What the reader will gain The reader will be informed of the most recent advancements and future directions of FP application to small molecule screening. Take home message In addition to its continued utilization in high-throughput screening, FP has expanded into new disease and target areas and has been marked by increased use of labeled small molecule ligands for receptor binding studies. PMID:22328899

  16. Combining small molecules for cell reprogramming through an interatomic analysis.

    PubMed

    Feltes, Bruno César; Bonatto, Diego

    2013-11-01

    The knowledge available about the application and generation of induced pluripotent stem cells (iPSC) has grown since their discovery, and new techniques to enhance the reprogramming process have been described. Among the new approaches to induce iPSC that have gained great attention is the use of small molecules for reprogramming. The application of small molecules, unlike genetic manipulation, provides for control of the reprogramming process through the shifting of concentrations and the combination of different molecules. However, different researchers have reported the use of "reprogramming cocktails" with variable results and drug combinations. Thus, the proper combination of small molecules for successful and enhanced reprogramming is a matter for discussion. However, testing all potential drug combinations in different cell lineages is very costly and time-consuming. Therefore, in this article, we discuss the use of already employed molecules for iPSC generation, followed by the application of systems chemo-biology tools to create different data sets of protein-protein (PPI) and chemical-protein (CPI) interaction networks based on the knowledge of already used and new reprogramming cocktail combinations. We further analyzed the biological processes associated with PPI-CPI networks and provided new potential protein targets to be inhibited or expressed for stem cell reprogramming. In addition, we applied a new interference analysis to prospective targets that could negatively affect the classical pluripotency-associated factors (SOX2, NANOG, KLF4 and OCT4) and thus potentially improve reprogramming protocols. PMID:24056910

  17. Small polaron hopping transport along DNA molecules

    NASA Astrophysics Data System (ADS)

    Triberis, G. P.; Simserides, C.; Karavolas, V. C.

    2005-05-01

    We present a small polaron hopping model for interpreting the strong temperature (T) dependence of the electrical conductivity, σ, observed at high (h) temperatures along DNA molecules. The model takes into account the one-dimensional character of the system and the presence of disorder in the DNA double helix. Percolation-theoretical considerations lead to analytical expressions for the high temperature multiphonon-assisted small polaron hopping conductivity, the hopping distance and their temperature dependence. The experimental data for lambda phage DNA (λ-DNA) and poly(dA)-poly(dT) DNA follow nicely the theoretically predicted behaviour (lnσh~T-2/3). Moreover, our model leads to realistic values of the maximum hopping distances, supporting the idea of multiphonon-assisted hopping of small polarons between next nearest neighbours of the DNA molecular 'wire'. The low temperature case is also investigated.

  18. Designing a small molecule erythropoietin mimetic.

    PubMed

    Guarnieri, Frank

    2015-01-01

    Erythropoietin (EPO) is a protein made by the kidneys in response to low red blood cell count that is secreted into the bloodstream and binds to a receptor on hematopoietic stem cells in the bone marrow inducing them to become new red blood cells. EPO made with recombinant DNA technology was brought to market in the 1980s to treat anemia caused by kidney disease and cancer chemotherapy. Because EPO infusion was able to replace blood transfusions in many cases, it rapidly became a multibillion dollar per year drug and as the first biologic created with recombinant technology it launched the biotech industry. For many years intense research was focused on creating a small molecule orally available EPO mimetic. The Robert Wood Johnson (RWJ) group seemed to definitively establish that only large peptides with a minimum of 60 residues could replace EPO, as anything less was not a full agonist. An intense study of the published work led me to hypothesize that the size of the mimetic is not the real issue, but the symmetry making and breaking of the EPO receptor induced by the ligand is the key to activating the stem cells. This analysis meant that residues in the binding site of the receptor deemed absolutely essential for ligand binding and activation from mutagenesis experiments, were probably not really that important. My fundamental hypotheses were: (a) the symmetric state of the homodimeric receptor is the most stable state and thus must be the off-state, (b) a highly localized binding site exists at a pivot point where the two halves of the receptor meet, (c) small molecules can be created that have high potency for this site that will be competitive with EPO and thus can displace the protein-protein interaction, (d) small symmetric molecules will stabilize the symmetric off-state of the receptor, and (e) a key asymmetry in the small molecule will stabilize a mirror image asymmetry in the receptor resulting in the stabilization of the on-state and proliferation of

  19. - Fourier Transform Infrared Spectroscopy of Small - Molecules

    NASA Astrophysics Data System (ADS)

    Li, G.; Bernath, P. F.

    2011-06-01

    A series of small boron-containing molecules were synthesized in the gas phase using a tube furnace. High-resolution spectra of these species were recorded in either emission or absorption in the mid-infrared region using a Bruker IFS-125HR spectrometer. Our observations contain vibration-rotation bands of BO, the V1 and V3 bands of HBO, the V1 and V3 bands of HBS, the V1 band of FBO, and the V1 band of HBF2. The vibrational bands of HOBO, BF2OH and other boron-containing molecules may also be present. Ab initio calculations were performed at the MRCI level to assist in the vibrational assignments. Preliminary assignments of the spectra for these species will be reported.

  20. Small Molecule Agonists of Cell Adhesion Molecule L1 Mimic L1 Functions In Vivo.

    PubMed

    Kataria, Hardeep; Lutz, David; Chaudhary, Harshita; Schachner, Melitta; Loers, Gabriele

    2016-09-01

    Lack of permissive mechanisms and abundance of inhibitory molecules in the lesioned central nervous system of adult mammals contribute to the failure of functional recovery after injury, leading to severe disabilities in motor functions and pain. Peripheral nerve injury impairs motor, sensory, and autonomic functions, particularly in cases where nerve gaps are large and chronic nerve injury ensues. Previous studies have indicated that the neural cell adhesion molecule L1 constitutes a viable target to promote regeneration after acute injury. We screened libraries of known drugs for small molecule agonists of L1 and evaluated the effect of hit compounds in cell-based assays in vitro and in mice after femoral nerve and spinal cord injuries in vivo. We identified eight small molecule L1 agonists and showed in cell-based assays that they stimulate neuronal survival, neuronal migration, and neurite outgrowth and enhance Schwann cell proliferation and migration and myelination of neurons in an L1-dependent manner. In a femoral nerve injury mouse model, enhanced functional regeneration and remyelination after application of the L1 agonists were observed. In a spinal cord injury mouse model, L1 agonists improved recovery of motor functions, being paralleled by enhanced remyelination, neuronal survival, and monoaminergic innervation, reduced astrogliosis, and activation of microglia. Together, these findings suggest that application of small organic compounds that bind to L1 and stimulate the beneficial homophilic L1 functions may prove to be a valuable addition to treatments of nervous system injuries. PMID:26253722

  1. Novel epithelial cell adhesion molecule antibody conjugated polyethyleneimine-capped gold nanoparticles for enhanced and targeted small interfering RNA delivery to retinoblastoma cells

    PubMed Central

    Mitra, Moutushy; Kandalam, Mallikarjuna; Rangasamy, Judith; Shankar, Balaji; Maheswari, Uma K.; Swaminathan, Sethuraman

    2013-01-01

    Background Several nanoconjugates have been designed to deliver nucleic acids such as small interfering RNA (siRNA) and DNA to cells to study silencing and expression efficacies. In the present study, we prepared novel epithelial cell adhesion molecule (EpCAM) monoclonal antibody conjugated polyethyleneimine (PEI) capped gold nanoparticles (AuNPs) loaded with EpCAM-specific siRNA molecules to knock-down the EpCAM gene in retinoblastoma (RB) cells. We chose EpCAM as a target moiety to deliver siRNA because this molecule is highly expressed in various epithelial cancers and is an ideal target as it is highly expressed in the apical surface of tumor cells while showing basolateral expression in normal cells. Methods The EpCAM antibody was conjugated to AuNP-PEI loaded with siRNA molecules to specifically deliver siRNA to EpCAM-expressing RB cells. Conjugation efficiencies were confirmed with ultraviolet-visible spectrophotometry, Fourier transform infrared spectroscopy, and agarose and SDS–polyacrylamide gel electrophoresis. The size and zeta potential were measured using a Zeta sizer analyzer. Nanoparticle internalization and uptake were studied using fluorescent microscopy and flow cytometry. Gene silencing efficacy was monitored with western blot analysis and real-time quantitative PCR. Results Optimal size and neutral zeta potential properties of the AuNP-PEI- EpCAM antibody (EpAb) antibody were achieved for the transfection studies. The AuNP-PEI nanoparticles did not show any cytotoxicity to the cells, which means these nanomaterials are suitable for intracellular delivery of siRNA for therapeutic interventions. With EpCAM antibody conjugation, PEI-capped AuNPs loaded with EpCAM siRNA were significantly internalized in the Y79 cells as observed with fluorescence microscopy and flow cytometry and induced a highly significant reduction in the cell viability of the Y79 cells. Through increased binding of EpCAM antibody–conjugated AuNP-PEI nanoparticles

  2. Carbon nanotubes for delivery of small molecule drugs.

    PubMed

    Wong, Bin Sheng; Yoong, Sia Lee; Jagusiak, Anna; Panczyk, Tomasz; Ho, Han Kiat; Ang, Wee Han; Pastorin, Giorgia

    2013-12-01

    In the realm of drug delivery, carbon nanotubes (CNTs) have gained tremendous attention as promising nanocarriers, owing to their distinct characteristics, such as high surface area, enhanced cellular uptake and the possibility to be easily conjugated with many therapeutics, including both small molecules and biologics, displaying superior efficacy, enhanced specificity and diminished side effects. While most CNT-based drug delivery system (DDS) had been engineered to combat cancers, there are also emerging reports that employ CNTs as either the main carrier or adjunct material for the delivery of various non-anticancer drugs. In this review, the delivery of small molecule drugs is expounded, with special attention paid to the current progress of in vitro and in vivo research involving CNT-based DDSs, before finally concluding with some consideration on inevitable complications that hamper successful disease intervention with CNTs. PMID:23954402

  3. Small-Molecule Target Engagement in Cells.

    PubMed

    Schürmann, Marc; Janning, Petra; Ziegler, Slava; Waldmann, Herbert

    2016-04-21

    Monitoring how, when, and where small molecules engage their targets inside living cells is a critical step in chemical biology and pharmacological research, because it enables compound efficacy and confirmation of mode of action to be assessed. In this mini-review we summarize the currently available methodologies to detect and prove direct target engagement in cells and offer a critical view of their key advantages and disadvantages. As the interest of the field shifts toward discovery and validation of high-quality agents, we expect that efforts to develop and refine these types of methodologies will also intensify in the near future. PMID:27049669

  4. Activation of small molecules by phosphorus biradicaloids.

    PubMed

    Hinz, Alexander; Kuzora, Rene; Rosenthal, Uwe; Schulz, Axel; Villinger, Alexander

    2014-11-01

    The reactivity of biradicaloid [P(μ-NTer)]2 was employed to activate small molecules bearing single, double, and triple bonds. Addition of chalcogens (O2 , S8 , Sex and Tex ) led to the formation of dichalcogen-bridged P2 N2 heterocycles, except from the reaction with molecular oxygen, which gave a P2 N2 ring featuring a dicoordinated P(III) and a four-coordinated P(V) center. In formal [2πe+2πe] addition reactions, small unsaturated compounds such as ethylene, acetylene, acetone, acetonitrile, tolane, diphenylcarbodiimide, and bis(trimethylsilyl)sulfurdiimide are readily added to the P2 N2 heterocycle of the biradicaloid [P(μ-NTer)]2 , yielding novel heteroatom cage compounds. The synthesis, reactivity, and bonding of the biradicaloid [P(μ-NTer)]2 were studied in detail as well as the synthesis, properties, and structural features of all addition products. PMID:25266101

  5. Enhancement of Radiation Sensitivity in Lung Cancer Cells by a Novel Small Molecule Inhibitor That Targets the β-Catenin/Tcf4 Interaction.

    PubMed

    Zhang, Qinghao; Gao, Mei; Luo, Guifen; Han, Xiaofeng; Bao, Wenjing; Cheng, Yanyan; Tian, Wang; Yan, Maocai; Yang, Guanlin; An, Jing

    2016-01-01

    Radiation therapy is an important treatment choice for unresectable advanced human lung cancers, and a critical adjuvant treatment for surgery. However, radiation as a lung cancer treatment remains far from satisfactory due to problems associated with radiation resistance in cancer cells and severe cytotoxicity to non-cancer cells, which arise at doses typically administered to patients. We have recently identified a promising novel inhibitor of β-catenin/Tcf4 interaction, named BC-23 (C21H14ClN3O4S), which acts as a potent cell death enhancer when used in combination with radiation. Sequential exposure of human p53-null non-small cell lung cancer (NSCLC) H1299 cells to low doses of x-ray radiation, followed 1 hour later by administration of minimally cytotoxic concentrations of BC-23, resulted in a highly synergistic induction of clonogenic cell death (combination index <1.0). Co-treatment with BC-23 at low concentrations effectively inhibits Wnt/β-catenin signaling and down-regulates c-Myc and cyclin D1 expression. S phase arrest and ROS generation are also involved in the enhancement of radiation effectiveness mediated by BC-23. BC-23 therefore represents a promising new class of radiation enhancer. PMID:27014877

  6. Enhancement of Radiation Sensitivity in Lung Cancer Cells by a Novel Small Molecule Inhibitor That Targets the β-Catenin/Tcf4 Interaction

    PubMed Central

    Luo, Guifen; Han, Xiaofeng; Bao, Wenjing; Cheng, Yanyan; Tian, Wang; Yan, Maocai; Yang, Guanlin; An, Jing

    2016-01-01

    Radiation therapy is an important treatment choice for unresectable advanced human lung cancers, and a critical adjuvant treatment for surgery. However, radiation as a lung cancer treatment remains far from satisfactory due to problems associated with radiation resistance in cancer cells and severe cytotoxicity to non-cancer cells, which arise at doses typically administered to patients. We have recently identified a promising novel inhibitor of β-catenin/Tcf4 interaction, named BC-23 (C21H14ClN3O4S), which acts as a potent cell death enhancer when used in combination with radiation. Sequential exposure of human p53-null non-small cell lung cancer (NSCLC) H1299 cells to low doses of x-ray radiation, followed 1 hour later by administration of minimally cytotoxic concentrations of BC-23, resulted in a highly synergistic induction of clonogenic cell death (combination index <1.0). Co-treatment with BC-23 at low concentrations effectively inhibits Wnt/β-catenin signaling and down-regulates c-Myc and cyclin D1 expression. S phase arrest and ROS generation are also involved in the enhancement of radiation effectiveness mediated by BC-23. BC-23 therefore represents a promising new class of radiation enhancer. PMID:27014877

  7. Small molecule phagocytosis inhibitors for immune cytopenias.

    PubMed

    Neschadim, Anton; Kotra, Lakshmi P; Branch, Donald R

    2016-08-01

    Immune cytopenias are conditions characterized by low blood cell counts, such as platelets in immune thrombocytopenia (ITP) and red blood cells in autoimmune hemolytic anemia (AIHA). Chronic ITP affects approximately 4 in 100,000 adults annually while AIHA is much less common. Extravascular phagocytosis and massive destruction of autoantibody-opsonized blood cells by macrophages in the spleen and liver are the hallmark of these conditions. Current treatment modalities for ITP and AIHA include the first-line use of corticosteroids; whereas, IVIg shows efficacy in ITP but not AIHA. One main mechanism of action by which IVIg treatment leads to the reduction in platelet destruction rates in ITP is thought to involve Fcγ receptor (FcγR) blockade, ultimately leading to the inhibition of extravascular platelet phagocytosis. IVIg, which is manufactured from the human plasma of thousands of donors, is a limited resource, and alternative treatments, particularly those based on bioavailable small molecules, are needed. In this review, we overview the pathophysiology of ITP, the role of Fcγ receptors, and the mechanisms of action of IVIg in treating ITP, and outline the efforts and progress towards developing novel, first-in-class inhibitors of phagocytosis as synthetic, small molecule substitutes for IVIg in ITP and other conditions where the pathobiology of the disease involves phagocytosis. PMID:27296447

  8. Targeting p53 by small molecules in hematological malignancies.

    PubMed

    Saha, Manujendra N; Qiu, Lugui; Chang, Hong

    2013-01-01

    p53 is a powerful tumor suppressor and is an attractive cancer therapeutic target. A breakthrough in cancer research came from the discovery of the drugs which are capable of reactivating p53 function. Most anti-cancer agents, from traditional chemo- and radiation therapies to more recently developed non-peptide small molecules exert their effects by enhancing the anti-proliferative activities of p53. Small molecules such as nutlin, RITA, and PRIMA-1 that can activate p53 have shown their anti-tumor effects in different types of hematological malignancies. Importantly, nutlin and PRIMA-1 have successfully reached the stage of phase I/II clinical trials in at least one type of hematological cancer. Thus, the pharmacological activation of p53 by these small molecules has a major clinical impact on prognostic use and targeted drug design. In the current review, we present the recent achievements in p53 research using small molecules in hematological malignancies. Anticancer activity of different classes of compounds targeting the p53 signaling pathway and their mechanism of action are discussed. In addition, we discuss how p53 tumor suppressor protein holds promise as a drug target for recent and future novel therapies in these diseases. PMID:23531342

  9. Development of novel small molecules for imaging and drug release

    NASA Astrophysics Data System (ADS)

    Cao, Yanting

    last part, a new photo-initiated fluorescent anticancer prodrug for DNA alkylating agent mechlorethamine releasing and monitoring has been developed. The theranostic prodrug consists a photolabile NPE group, an inactive form of mechlorethamine and a nonfluorescent coumarin in one small molecule. It is demonstrated that the prodrug shows negligible cytotoxicity towards normal skin cells (Hekn cells) with and without UV activation, while the original parent drug mechlorethamine can be photocontrol-released and induces effective DNA cross-linking activity. Importantly, the drug release progress can be conveniently monitored by the 'off-on' fluorescence enhancement in cells. Moreover, the selective prodrug is not only cell permeable but also nuclear permeable. Therefore, the prodrug serves as a promising drug delivery system for spatiotemporal control release and monitoring of an anticancer drug to obtain the optimal treatment efficacy.

  10. Aggregated silver nanoparticles based surface-enhanced Raman scattering enzyme-linked immunosorbent assay for ultrasensitive detection of protein biomarkers and small molecules.

    PubMed

    Liang, Jiajie; Liu, Hongwu; Huang, Caihong; Yao, Cuize; Fu, Qiangqiang; Li, Xiuqing; Cao, Donglin; Luo, Zhi; Tang, Yong

    2015-06-01

    Lowering the detection limit is critical to the design of bioassays required for medical diagnostics, environmental monitoring, and food safety regulations. The current sensitivity of standard color-based analyte detection limits the further use of enzyme-linked immunosorbent assays (ELISAs) in research and clinical diagnoses. Here, we demonstrate a novel method that uses the Raman signal as the signal-generating system of an ELISA and combines surface-enhanced Raman scattering (SERS) with silver nanoparticles aggregation for ultrasensitive analyte detection. The enzyme label of the ELISA controls the dissolution of Raman reporter-labeled silver nanoparticles through hydrogen peroxide and generates a strong Raman signal when the analyte is present. Using this assay, prostate-specific antigen (PSA) and the adrenal stimulant ractopamine (Rac) were detected in whole serum and urine at the ultralow concentrations of 10(-9) and 10(-6) ng/mL, respectively. The methodology proposed here could potentially be applied to other molecules detection as well as PSA and Rac. PMID:25928837

  11. The Small Molecule GMX1778 Is a Potent Inhibitor of NAD+ Biosynthesis: Strategy for Enhanced Therapy in Nicotinic Acid Phosphoribosyltransferase 1-Deficient Tumors▿

    PubMed Central

    Watson, Mark; Roulston, Anne; Bélec, Laurent; Billot, Xavier; Marcellus, Richard; Bédard, Dominique; Bernier, Cynthia; Branchaud, Stéphane; Chan, Helen; Dairi, Kenza; Gilbert, Karine; Goulet, Daniel; Gratton, Michel-Olivier; Isakau, Henady; Jang, Anne; Khadir, Abdelkrim; Koch, Elizabeth; Lavoie, Manon; Lawless, Michael; Nguyen, Mai; Paquette, Denis; Turcotte, Émilie; Berger, Alvin; Mitchell, Matthew; Shore, Gordon C.; Beauparlant, Pierre

    2009-01-01

    GMX1777 is a prodrug of the small molecule GMX1778, currently in phase I clinical trials for the treatment of cancer. We describe findings indicating that GMX1778 is a potent and specific inhibitor of the NAD+ biosynthesis enzyme nicotinamide phosphoribosyltransferase (NAMPT). Cancer cells have a very high rate of NAD+ turnover, which makes NAD+ modulation an attractive target for anticancer therapy. Selective inhibition by GMX1778 of NAMPT blocks the production of NAD+ and results in tumor cell death. Furthermore, GMX1778 is phosphoribosylated by NAMPT, which increases its cellular retention. The cytotoxicity of GMX1778 can be bypassed with exogenous nicotinic acid (NA), which permits NAD+ repletion via NA phosphoribosyltransferase 1 (NAPRT1). The cytotoxicity of GMX1778 in cells with NAPRT1 deficiency, however, cannot be rescued by NA. Analyses of NAPRT1 mRNA and protein levels in cell lines and primary tumor tissue indicate that high frequencies of glioblastomas, neuroblastomas, and sarcomas are deficient in NAPRT1 and not susceptible to rescue with NA. As a result, the therapeutic index of GMX1777 can be widended in the treatment animals bearing NAPRT1-deficient tumors by coadministration with NA. This provides the rationale for a novel therapeutic approach for the use of GMX1777 in the treatment of human cancers. PMID:19703994

  12. Recent advances in developing small molecules targeting RNA.

    PubMed

    Guan, Lirui; Disney, Matthew D

    2012-01-20

    RNAs are underexploited targets for small molecule drugs or chemical probes of function. This may be due, in part, to a fundamental lack of understanding of the types of small molecules that bind RNA specifically and the types of RNA motifs that specifically bind small molecules. In this review, we describe recent advances in the development and design of small molecules that bind to RNA and modulate function that aim to fill this void. PMID:22185671

  13. Small Molecule Docking from Theoretical Structural Models

    NASA Astrophysics Data System (ADS)

    Novoa, Eva Maria; de Pouplana, Lluis Ribas; Orozco, Modesto

    Structural approaches to rational drug design rely on the basic assumption that pharmacological activity requires, as necessary but not sufficient condition, the binding of a drug to one or several cellular targets, proteins in most cases. The traditional paradigm assumes that drugs that interact only with a single cellular target are specific and accordingly have little secondary effects, while promiscuous molecules are more likely to generate undesirable side effects. However, current examples indicate that often efficient drugs are able to interact with several biological targets [1] and in fact some dirty drugs, such as chlorpromazine, dextromethorphan, and ibogaine exhibit desired pharmacological properties [2]. These considerations highlight the tremendous difficulty of designing small molecules that both have satisfactory ADME properties and the ability of interacting with a limited set of target proteins with a high affinity, avoiding at the same time undesirable interactions with other proteins. In this complex and challenging scenario, computer simulations emerge as the basic tool to guide medicinal chemists during the drug discovery process.

  14. Programmable DNA-binding Small Molecules

    PubMed Central

    Blackledge, Meghan S.; Melander, Christian

    2013-01-01

    Aberrant gene expression is responsible for a myriad of human diseases from infectious diseases to cancer. Precise regulation of these genes via specific interactions with the DNA double helix could pave the way for novel therapeutics. Pyrrole-imidazole polyamides are small molecules capable of binding to pre-determined DNA sequences up to 16 base pairs with affinity and specificity comparable to natural transcription factors. In the three decades since their development, great strides have been made relating to synthetic accessibility and improved sequence specificity and binding affinity. This perspective presents a brief history of early seminal developments in the field and highlights recent reports of the utility of polyamides as both genetic modulators and molecular probes. PMID:23665141

  15. Small-Molecule Inhibitors of Urea Transporters

    PubMed Central

    Verkman, Alan S.; Esteva-Font, Cristina; Cil, Onur; Anderson, Marc O.; Li, Fei; Li, Min; Lei, Tianluo; Ren, Huiwen; Yang, Baoxue

    2015-01-01

    Urea transporter (UT) proteins, which include isoforms of UT-A in kidney tubule epithelia and UT-B in vasa recta endothelia and erythrocytes, facilitate urinary concentrating function. Inhibitors of urea transporter function have potential clinical applications as sodium-sparing diuretics, or ‘urearetics,’ in edema from different etiologies, such as congestive heart failure and cirrhosis, as well as in syndrome of inappropriate antidiuretic hormone (SIADH). High-throughput screening of drug-like small molecules has identified UT-A and UT-B inhibitors with nanomolar potency. Inhibitors have been identified with different UT-A versus UT-B selectivity profiles and putative binding sites on UT proteins. Studies in rodent models support the utility of UT inhibitors in reducing urinary concentration, though testing in clinically relevant animal models of edema has not yet been done. PMID:25298345

  16. Covalent small-molecule-RNA complex formation enables cellular profiling of small-molecule-RNA interactions

    PubMed Central

    Guan, Lirui

    2013-01-01

    Won’t let you go! A strategy is described to design small molecules that react with their cellular RNA targets. This approach not only improves the activity of compounds targeting RNA in cell culture by ≈2500-fold but also enables cell-wide profiling of its RNA targets. PMID:23913698

  17. Covalent small-molecule-RNA complex formation enables cellular profiling of small-molecule-RNA interactions.

    PubMed

    Guan, Lirui; Disney, Matthew D

    2013-09-16

    Won't let you go! A strategy is described to design small molecules that react with their cellular RNA targets. This approach not only improves the activity of compounds targeting RNA in cell culture by a factor of about 2500 but also enables cell-wide profiling of its RNA targets. PMID:23913698

  18. Captides: Rigid Junctions between Beta Sheets and Small Molecules

    PubMed Central

    Kier, Brandon L.; Andersen, Niels H.

    2014-01-01

    An extensive series of covalently linked small molecule-peptide adducts based on a terminally capped beta hairpin motif is reported. The constructs can be prepared by standard solid-phase fmoc chemistry with 1 to 4 peptide chains linked to small molecule hubs bearing carboxylic acid moieties. The key feature of interest is the precise, buried environment of the small molecule, and its rigid orientation relative to one or more short, but fully structured peptide chain(s). Most of this study employs a minimalist 9 residue “captide”, a capped β-turn, but we illustrate general applicability to peptides which can terminate in a beta strand. The non-peptide portion of these adducts can include nearly any molecule bearing one or more carboxylic acid groups. Fold-dependent rigidity sets this strategy apart from currently available bioconjugation methods, which typically engender significant flexibility between peptide and tag. Applications to catalyst enhancement, drug design, higher-order assembly, and FRET calibration rulers are discussed. PMID:24909552

  19. Using small molecules to study big questions in cellular microbiology.

    PubMed

    Ward, Gary E; Carey, Kimberly L; Westwood, Nicholas J

    2002-08-01

    High-throughput screening of small molecules is used extensively in pharmaceutical settings for the purpose of drug discovery. In the case of antimicrobials, this involves the identification of small molecules that are significantly more toxic to the microbe than to the host. Only a small percentage of the small molecules identified in these screens have been studied in sufficient detail to explain the molecular basis of their antimicrobial effect. Rarer still are small molecule screens undertaken with the explicit goal of learning more about the biology of a particular microbe or the mechanism of its interaction with its host. Recent technological advances in small molecule synthesis and high-throughput screening have made such mechanism-directed small molecule approaches a powerful and accessible experimental option. In this article, we provide an overview of the methods and technical requirements and we discuss the potential of small molecule approaches to address important and often otherwise experimentally intractable problems in cellular microbiology. PMID:12174082

  20. Two-Photon Small Molecule Enzymatic Probes.

    PubMed

    Qian, Linghui; Li, Lin; Yao, Shao Q

    2016-04-19

    Enzymes are essential for life, especially in the development of disease and on drug effects, but as we cannot yet directly observe the inside interactions and only partially observe biochemical outcomes, tools "translating" these processes into readable information are essential for better understanding of enzymes as well as for developing effective tools to fight against diseases. Therefore, sensitive small molecule probes suitable for direct in vivo monitoring of enzyme activities are ultimately desirable. For fulfilling this desire, two-photon small molecule enzymatic probes (TSMEPs) producing amplified fluorescent signals based on enzymatic conversion with better photophysical properties and deeper penetration in intact tissues and whole animals have been developed and demonstrated to be powerful in addressing the issues described above. Nonetheless, currently available TSMEPs only cover a small portion of enzymes despite the distinct advantages of two-photon fluorescence microscopy. In this Account, we would like to share design principles for TSMEPs as potential indicators of certain pathology-related biomarkers together with their applications in disease models to inspire more elegant work to be done in this area. Highlights will be addressed on how to equip two-photon fluorescent probes with features amenable for direct assessment of enzyme activities in complex pathological environments. We give three recent examples from our laboratory and collaborations in which TSMEPs are applied to visualize the distribution and activity of enzymes at cellular and organism levels. The first example shows that we could distinguish endogenous phosphatase activity in different organelles; the second illustrates that TSMEP is suitable for specific and sensitive detection of a potential Parkinson's disease marker (monoamine oxidase B) in a variety of biological systems from cells to patient samples, and the third identifies that TSMEPs can be applied to other enzyme

  1. Simulation Studies of Protein and Small Molecule Interactions and Reaction.

    PubMed

    Yang, L; Zhang, J; Che, X; Gao, Y Q

    2016-01-01

    Computational studies of protein and small molecule (protein-ligand/enzyme-substrate) interactions become more and more important in biological science and drug discovery. Computer modeling can provide molecular details of the processes such as conformational change, binding, and transportation of small molecules/proteins, which are not easily to be captured in experiments. In this chapter, we discussed simulation studies of both protein and small molecules from three aspects: conformation sampling, transportations of small molecules in enzymes, and enzymatic reactions involving small molecules. Both methodology developments and examples of simulation studies in this field were presented. PMID:27497167

  2. First-in-class small molecule potentiators of cancer virotherapy.

    PubMed

    Dornan, Mark H; Krishnan, Ramya; Macklin, Andrew M; Selman, Mohammed; El Sayes, Nader; Son, Hwan Hee; Davis, Colin; Chen, Andrew; Keillor, Kerkeslin; Le, Penny J; Moi, Christina; Ou, Paula; Pardin, Christophe; Canez, Carlos R; Le Boeuf, Fabrice; Bell, John C; Smith, Jeffrey C; Diallo, Jean-Simon; Boddy, Christopher N

    2016-01-01

    The use of engineered viral strains such as gene therapy vectors and oncolytic viruses (OV) to selectively destroy cancer cells is poised to make a major impact in the clinic and revolutionize cancer therapy. In particular, several studies have shown that OV therapy is safe and well tolerated in humans and can infect a broad range of cancers. Yet in clinical studies OV therapy has highly variable response rates. The heterogeneous nature of tumors is widely accepted to be a major obstacle for OV therapeutics and highlights a need for strategies to improve viral replication efficacy. Here, we describe the development of a new class of small molecules for selectively enhancing OV replication in cancer tissue. Medicinal chemistry studies led to the identification of compounds that enhance multiple OVs and gene therapy vectors. Lead compounds increase OV growth up to 2000-fold in vitro and demonstrate remarkable selectivity for cancer cells over normal tissue ex vivo and in vivo. These small molecules also demonstrate enhanced stability with reduced electrophilicity and are highly tolerated in animals. This pharmacoviral approach expands the scope of OVs to include resistant tumors, further potentiating this transformative therapy. It is easily foreseeable that this approach can be applied to therapeutically enhance other attenuated viral vectors. PMID:27226390

  3. First-in-class small molecule potentiators of cancer virotherapy

    PubMed Central

    Dornan, Mark H.; Krishnan, Ramya; Macklin, Andrew M.; Selman, Mohammed; El Sayes, Nader; Son, Hwan Hee; Davis, Colin; Chen, Andrew; Keillor, Kerkeslin; Le, Penny J.; Moi, Christina; Ou, Paula; Pardin, Christophe; Canez, Carlos R.; Le Boeuf, Fabrice; Bell, John C.; Smith, Jeffrey C.; Diallo, Jean-Simon; Boddy, Christopher N.

    2016-01-01

    The use of engineered viral strains such as gene therapy vectors and oncolytic viruses (OV) to selectively destroy cancer cells is poised to make a major impact in the clinic and revolutionize cancer therapy. In particular, several studies have shown that OV therapy is safe and well tolerated in humans and can infect a broad range of cancers. Yet in clinical studies OV therapy has highly variable response rates. The heterogeneous nature of tumors is widely accepted to be a major obstacle for OV therapeutics and highlights a need for strategies to improve viral replication efficacy. Here, we describe the development of a new class of small molecules for selectively enhancing OV replication in cancer tissue. Medicinal chemistry studies led to the identification of compounds that enhance multiple OVs and gene therapy vectors. Lead compounds increase OV growth up to 2000-fold in vitro and demonstrate remarkable selectivity for cancer cells over normal tissue ex vivo and in vivo. These small molecules also demonstrate enhanced stability with reduced electrophilicity and are highly tolerated in animals. This pharmacoviral approach expands the scope of OVs to include resistant tumors, further potentiating this transformative therapy. It is easily foreseeable that this approach can be applied to therapeutically enhance other attenuated viral vectors. PMID:27226390

  4. Identification of Biologically Active, HIV TAR RNA-Binding Small Molecules Using Small Molecule Microarrays

    PubMed Central

    2015-01-01

    Identifying small molecules that selectively bind to structured RNA motifs remains an important challenge in developing potent and specific therapeutics. Most strategies to find RNA-binding molecules have identified highly charged compounds or aminoglycosides that commonly have modest selectivity. Here we demonstrate a strategy to screen a large unbiased library of druglike small molecules in a microarray format against an RNA target. This approach has enabled the identification of a novel chemotype that selectively targets the HIV transactivation response (TAR) RNA hairpin in a manner not dependent on cationic charge. Thienopyridine 4 binds to and stabilizes the TAR hairpin with a Kd of 2.4 μM. Structure–activity relationships demonstrate that this compound achieves activity through hydrophobic and aromatic substituents on a heterocyclic core, rather than cationic groups typically required. Selective 2′-hydroxyl acylation analyzed by primer extension (SHAPE) analysis was performed on a 365-nucleotide sequence derived from the 5′ untranslated region (UTR) of the HIV-1 genome to determine global structural changes in the presence of the molecule. Importantly, the interaction of compound 4 can be mapped to the TAR hairpin without broadly disrupting any other structured elements of the 5′ UTR. Cell-based anti-HIV assays indicated that 4 inhibits HIV-induced cytopathicity in T lymphocytes with an EC50 of 28 μM, while cytotoxicity was not observed at concentrations approaching 1 mM. PMID:24820959

  5. Database of small molecule thermochemistry for combustion.

    PubMed

    Goldsmith, C Franklin; Magoon, Gregory R; Green, William H

    2012-09-13

    High-accuracy ab initio thermochemistry is presented for 219 small molecules relevant in combustion chemistry, including many radical, biradical, and triplet species. These values are critical for accurate kinetic modeling. The RQCISD(T)/cc-PV∞QZ//B3LYP/6-311++G(d,p) method was used to compute the electronic energies. A bond additivity correction for this method has been developed to remove systematic errors in the enthalpy calculations, using the Active Thermochemical Tables as reference values. On the basis of comparison with the benchmark data, the 3σ uncertainty in the standard-state heat of formation is 0.9 kcal/mol, or within chemical accuracy. An uncertainty analysis is presented for the entropy and heat capacity. In many cases, the present values are the most accurate and comprehensive numbers available. The present work is compared to several published databases. In some cases, there are large discrepancies and errors in published databases; the present work helps to resolve these problems. PMID:22873426

  6. Small Molecule Proteostasis Regulators for Protein Conformational Diseases

    PubMed Central

    Calamini, Barbara; Silva, Maria Catarina; Madoux, Franck; Hutt, Darren M.; Khanna, Shilpi; Chalfant, Monica A.; Saldanha, Sanjay A.; Hodder, Peter; Tait, Bradley D.; Garza, Dan; Balch, William E.; Morimoto, Richard I.

    2011-01-01

    Protein homeostasis (proteostasis) is essential for cellular and organismal health. Stress, aging, and the chronic expression of misfolded proteins, however, challenge the proteostasis machinery and the vitality of the cell. Enhanced expression of molecular chaperones, regulated by heat shock transcription factor-1 (HSF-1), has been shown to restore proteostasis in a variety of conformational disease models, suggesting a promising therapeutic approach. We describe the results of a ∼900,000 small molecule screen that identified novel classes of small molecule proteostasis regulators (PRs) that induce HSF-1-dependent chaperone expression and restore protein folding in multiple conformational disease models. The beneficial effects to proteome stability are mediated by HSF-1, DAF-16/FOXO, SKN-1/Nrf-2, and the chaperone machinery through mechanisms that are distinct from current known small molecule activators of the HSR. We suggest that modulation of the proteostasis network by PRs represents a promising therapeutic approach for the treatment of a variety of protein conformational diseases. PMID:22198733

  7. Quantum Monte Carlo studies on small molecules

    NASA Astrophysics Data System (ADS)

    Galek, Peter T. A.; Handy, Nicholas C.; Lester, William A., Jr.

    The Variational Monte Carlo (VMC) and Fixed-Node Diffusion Monte Carlo (FNDMC) methods have been examined, through studies on small molecules. New programs have been written which implement the (by now) standard algorithms for VMC and FNDMC. We have employed and investigated throughout our studies the accuracy of the common Slater-Jastrow trial wave function. Firstly, we have studied a range of sizes of the Jastrow correlation function of the Boys-Handy form, obtained using our optimization program with analytical derivatives of the central moments in the local energy. Secondly, we have studied the effects of Slater-type orbitals (STOs) that display the exact cusp behaviour at nuclei. The orbitals make up the all important trial determinant, which determines the fixed nodal surface. We report all-electron calculations for the ground state energies of Li2, Be2, H2O, NH3, CH4 and H2CO, in all cases but one with accuracy in excess of 95%. Finally, we report an investigation of the ground state energies, dissociation energies and ionization potentials of NH and NH+. Recent focus paid in the literature to these species allow for an extensive comparison with other ab initio methods. We obtain accurate properties for the species and reveal a favourable tendency for fixed-node and other systematic errors to cancel. As a result of our accurate predictions, we are able to obtain a value for the heat of formation of NH, which agrees to within less than 1 kcal mol-1 to other ab initio techniques and 0.2 kcal mol-1 of the experimental value.

  8. Small Molecule Chemical Probes of MicroRNA Function

    PubMed Central

    Velagapudi, Sai Pradeep; Vummidi, Balayeshwanth R.; Disney, Matthew D.

    2015-01-01

    MicroRNAs (miRNAs) are small, non-coding RNAs that control protein expression. Aberrant miRNA expression has been linked to various human diseases, and thus miRNAs have been explored as diagnostic markers and therapeutic targets. Although it is challenging to target RNA with small molecules in general, there have been successful campaigns that have identified small molecule modulators of miRNA function by targeting various pathways. For example, small molecules that modulate transcription and target nuclease processing sites in miRNA precursors have been identified. Herein, we describe challenges in developing chemical probes that target miRNAs and highlight aspects of miRNA cellular biology elucidated by using small molecule chemical probes. We expect that this area will expand dramatically in the near future as strides are made to understand small molecule recognition of RNA from a fundamental perspective. PMID:25500006

  9. Small molecule chemical probes of microRNA function.

    PubMed

    Velagapudi, Sai Pradeep; Vummidi, Balayeshwanth R; Disney, Matthew D

    2015-02-01

    MicroRNAs (miRNAs) are small, non-coding RNAs that control protein expression. Aberrant miRNA expression has been linked to various human diseases, and thus miRNAs have been explored as diagnostic markers and therapeutic targets. Although it is challenging to target RNA with small molecules in general, there have been successful campaigns that have identified small molecule modulators of miRNA function by targeting various pathways. For example, small molecules that modulate transcription and target nuclease processing sites in miRNA precursors have been identified. Herein, we describe challenges in developing chemical probes that target miRNAs and highlight aspects of miRNA cellular biology elucidated by using small molecule chemical probes. We expect that this area will expand dramatically in the near future as progress is made in understanding small molecule recognition of RNA. PMID:25500006

  10. Small-molecule BH3 mimetic and pan-Bcl-2 inhibitor AT-101 enhances the antitumor efficacy of cisplatin through inhibition of APE1 repair and redox activity in non-small-cell lung cancer

    PubMed Central

    Ren, Tao; Shan, Jinlu; Li, Mengxia; Qing, Yi; Qian, Chengyuan; Wang, Guangjie; Li, Qing; Lu, Guoshou; Li, Chongyi; Peng, Yu; Luo, Hao; Zhang, Shiheng; Yang, Yuxing; Cheng, Yi; Wang, Dong; Zhou, Shu-Feng

    2015-01-01

    AT-101 is a BH3 mimetic and pan-Bcl-2 inhibitor that has shown potent anticancer activity in non-small-cell lung cancer (NSCLC) in murine models, but failed to show clinical efficacy when used in combination with docetaxel in NSCLC patients. Our recent study has demonstrated that AT-101 enhanced the antitumor effect of cisplatin (CDDP) in a murine model of NSCLC via inhibition of the interleukin-6/signal transducer and activator of transcription 3 (STAT3) pathway. This study explored the underlying mechanisms for the enhanced anticancer activity of CDDP by AT-101. Our results show that, when compared with monotherapy, AT-101 significantly enhanced the inhibitory effects of CDDP on proliferation and migration of A549 cells and on tube formation and migration in human umbilical vein endothelial cells. AT-101 promoted the proapoptotic activity of CDDP in A549 cells. AT-101 also enhanced the inhibitory effect of CDDP on DNA repair and redox activities of apurinic/apyrimidinic endonuclease 1 (APE1) in A549 cells. In tumor tissues from nude mice treated with AT-101 plus CDDP or monotherapy, the combination therapy resulted in greater inhibition of angiogenesis and tumor cell proliferation than the monotherapy. These results suggest that AT-101 can enhance the antitumor activity of CDDP in NSCLC via inhibition of APE1 DNA repair and redox activities and by angiogenesis and induction of apoptosis, but other mechanisms cannot be excluded. We are now conducting a Phase II trial to examine the clinical efficacy and safety profile of combined use of AT-101 plus CDDP in advanced NSCLC patients. PMID:26089640

  11. Omnidirectional and broadband optical absorption enhancement in small molecule organic solar cells by a patterned MoO3/Ag/MoO3 transparent anode

    NASA Astrophysics Data System (ADS)

    Tian, Ximin; Hao, Yuying; Zhang, Ye; Cui, Yanxia; Ji, Ting; Wang, Hua; Wei, Bin; Huang, Wei

    2015-03-01

    We designed and calculated a novel organic solar cell (OSC) with MoO3/Ag/MoO3 (MAM) grating as transparent anode and the patterned copper phthalocyanine (CuPc)/fullerence (C60) as active layer. The numerical results indicate that a broadband, omnidirectional light absorption enhancement is realized by utilizing such a one-dimensional (1D) grating with core-shell structure. The total absorption efficiency of the active layer over the wavelength range from 400 to 900 nm is enhanced by 178.88%, 19.44% and 99.16% relative to the equivalent planar cell considering the weight of air-mass 1.5 global (AM 1.5G) solar spectrum at normally incident transverse magnetic (TM), transverse electric (TE) and TM/TE hybrid polarized light, respectively. The improved light trapping is attributed to the multiple modes hybridization of propagating surface plasmon polaritons (SPPs), localized surface plasmons (LSPs) and the strong coupling of SPP waves at TM polarization along with the Floquet modes at TE polarization. Furthermore, the proposed optimized architecture also exhibits an expected short-circuit current density (Jsc) with the value of 11.11 mA/cm2 in theory, which is increased by 116.6% compared with that of the planar control device.

  12. X-ray characterization of solid small molecule organic materials

    SciTech Connect

    Billinge, Simon; Shankland, Kenneth; Shankland, Norman; Florence, Alastair

    2014-06-10

    The present invention provides, inter alia, methods of characterizing a small molecule organic material, e.g., a drug or a drug product. This method includes subjecting the solid small molecule organic material to x-ray total scattering analysis at a short wavelength, collecting data generated thereby, and mathematically transforming the data to provide a refined set of data.

  13. Small diatomic alkali molecules at ultracold temperatures

    NASA Astrophysics Data System (ADS)

    Wang, Tout Taotao

    This thesis describes experimental work done with two of the smallest diatomic alkali molecules, 6Li2 and 23Na 6Li, each formed out of its constituent atoms at ultracold temperatures. The 23Na6Li molecule was formed for the first time at ultracold temperatures, after previous attempts failed due to an incorrect assignment of Feshbach resonances in the 6Li+23Na system. The experiment represents successful molecule formation around the most difficult Feshbach resonance ever used, and opens up the possibility of transferring NaLi to its spin-triplet ground state, which has both magnetic and electric dipole moments and is expected to be long-lived. For 6Li2, the experimental efforts in this thesis have solved a long-standing puzzle of apparently long lifetimes of closed-channel fermion pairs around a narrow Feshbach resonance, finding that the lifetime is in fact short, as expected in the absence of Pauli suppression of collisions. Moreover, measurements of collisions of Li2 with free Li atoms demonstrates a striking first example of collisions involving molecules at ultracold temperatures described by physics beyond universal long-range van der Waals interactions.

  14. Synthesis and characterization of silicon carbonitride films by plasma enhanced chemical vapor deposition (PECVD) using bis(dimethylamino)dimethylsilane (BDMADMS), as membrane for a small molecule gas separation

    NASA Astrophysics Data System (ADS)

    Kafrouni, W.; Rouessac, V.; Julbe, A.; Durand, J.

    2010-12-01

    Silicon carbonitride thin films have been deposited by plasma enhanced chemical vapor deposition (PECVD) from bis(dimethylamino)dimethylsilane (BDMADMS) as a function of X = (BDMADMS/(BDMADMS + NH 3)) between 0.1 and 1, and plasma power P (W) between 100 and 400 W. The microstructure of obtained materials has been studied by SEM, FTIR, EDS, ellipsometrie, and contact angle of water measurements. The structure of the materials is strongly depended on plasma parameters; we can pass from a material rich in carbon to a material rich in nitrogen. Single gas permeation tests have been carried out and we have obtained a helium permeance of about 10 -7 mol m -2 s -1 Pa -1 and ideal selectivity of helium over nitrogen of about 20.

  15. Advancing Biological Understanding and Therapeutics Discovery with Small Molecule Probes

    PubMed Central

    Schreiber, Stuart L.; Kotz, Joanne D.; Li, Min; Aubé, Jeffrey; Austin, Christopher P.; Reed, John C.; Rosen, Hugh; White, E. Lucile; Sklar, Larry A.; Lindsley, Craig W.; Alexander, Benjamin R.; Bittker, Joshua A.; Clemons, Paul A.; de Souza, Andrea; Foley, Michael A.; Palmer, Michelle; Shamji, Alykhan F.; Wawer, Mathias J.; McManus, Owen; Wu, Meng; Zou, Beiyan; Yu, Haibo; Golden, Jennifer E.; Schoenen, Frank J.; Simeonov, Anton; Jadhav, Ajit; Jackson, Michael R.; Pinkerton, Anthony B.; Chung, Thomas D.Y.; Griffin, Patrick R.; Cravatt, Benjamin F.; Hodder, Peter S.; Roush, William R.; Roberts, Edward; Chung, Dong-Hoon; Jonsson, Colleen B.; Noah, James W.; Severson, William E.; Ananthan, Subramaniam; Edwards, Bruce; Oprea, Tudor I.; Conn, P. Jeffrey; Hopkins, Corey R.; Wood, Michael R.; Stauffer, Shaun R.; Emmitte, Kyle A.

    2015-01-01

    Small-molecule probes can illuminate biological processes and aid in the assessment of emerging therapeutic targets by perturbing biological systems in a manner distinct from other experimental approaches. Despite the tremendous promise of chemical tools for investigating biology and disease, small-molecule probes were unavailable for most targets and pathways as recently as a decade ago. In 2005, the U.S. National Institutes of Health launched the decade-long Molecular Libraries Program with the intent of innovating in and broadening access to small-molecule science. This Perspective describes how novel small-molecule probes identified through the program are enabling the exploration of biological pathways and therapeutic hypotheses not otherwise testable. These experiences illustrate how small-molecule probes can help bridge the chasm between biological research and the development of medicines, but also highlight the need to innovate the science of therapeutic discovery. PMID:26046436

  16. Small-molecule suppressors of Candida albicans biofilm formation synergistically enhance the antifungal activity of amphotericin B against clinical Candida isolates

    PubMed Central

    You, Jianlan; Du, Lin; King, Jarrod B.; Hall, Brian E.; Cichewicz, Robert H.

    2013-01-01

    A new class of fungal biofilm inhibitors represented by shearinines D (3) and E (4) were obtained from a Penicillium sp. isolate. The inhibitory activities of 3 and 4 were characterized using a new imaging flow-cytometer technique, which enabled the rapid phenotypic analysis of Candida albicans cell types (budding yeast cells, germ tube cells, pseudohyphae, and hyphae) in biofilms populations. The results were confirmed by experimental data obtained from three-dimensional confocal laser scanning microscopy and 2,3- bis-(2-methoxy-4- nitro-5-sulfophenyl)-2H-tetrazolium-5-carboxanilide (XTT) assays. These data indicate that 3 and 4 inhibited C. albicans biofilm formation by blocking the outgrowth of hyphae at a relatively late stage of biofilm development (IC50 = 8.5 μM and 7.6 μM, respectively). However, 3 and 4 demonstrated comparatively weak activity at disrupting existing biofilms. Compounds 3 and 4 also exhibited synergistic activities with amphotericin B against C. albicans and others clinical Candida isolates by enhancing the potency of amphotericin B up to eight-fold against cells in both developing and established biofilms. These data suggest that the Candida biofilm disruption and amphotericin B potentiating effects of 3 and 4 could be mediated through multiple biological targets. The shearinines are good tools for testing the potential advantages of using adjunctive therapies in combination with antifungals. PMID:23387427

  17. Small Talk: Children's Everyday `Molecule' Ideas

    NASA Astrophysics Data System (ADS)

    Jakab, Cheryl

    2013-08-01

    This paper reports on 6-11-year-old children's `sayings and doings' (Harré 2002) as they explore molecule artefacts in dialectical-interactive teaching interviews (Fleer, Cultural Studies of Science Education 3:781-786, 2008; Hedegaard et al. 2008). This sociocultural study was designed to explore children's everyday awareness of and meaning-making with cultural molecular artefacts. Our everyday world is populated with an ever increasing range of molecular or nanoworld words, symbols, images, and games. What do children today say about these artefacts that are used to represent molecular world entities? What are the material and social resources that can influence a child's everyday and developing scientific ideas about `molecules'? How do children interact with these cognitive tools when given expert assistance? What meaning-making is afforded when children are socially and materially assisted in using molecular tools in early chemical and nanoworld thinking? Tool-dependent discursive studies show that provision of cultural artefacts can assist and direct developmental thinking across many domains of science (Schoultz et al., Human Development 44:103-118, 2001; Siegal 2008). Young children's use of molecular artefacts as cognitive tools has not received much attention to date (Jakab 2009a, b). This study shows 6-11-year-old children expressing everyday ideas of molecular artefacts and raising their own questions about the artefacts. They are seen beginning to domesticate (Erneling 2010) the words, symbols, and images to their own purposes when given the opportunity to interact with such artefacts in supported activity. Discursive analysis supports the notion that using `molecules' as cultural tools can help young children to begin `putting on molecular spectacles' (Kind 2004). Playing with an interactive game (ICT) is shown to be particularly helpful in assisting children's early meaning-making with representations of molecules, atoms, and their chemical symbols.

  18. The Small Molecule Hyperphyllin Enhances Leaf Formation Rate and Mimics Shoot Meristem Integrity Defects Associated with AMP1 Deficiency1[OPEN

    PubMed Central

    Poretska, Olena; Yang, Saiqi; Rozhon, Wilfried; Zwerger, Karin; Uribe, Marcos Castellanos; May, Sean; McCourt, Peter

    2016-01-01

    ALTERED MERISTEM PROGRAM1 (AMP1) is a member of the M28 family of carboxypeptidases with a pivotal role in plant development and stress adaptation. Its most prominent mutant defect is a unique hypertrophic shoot phenotype combining a strongly increased organ formation rate with enhanced meristem size and the formation of ectopic meristem poles. However, so far the role of AMP1 in shoot development could not be assigned to a specific molecular pathway nor is its biochemical function resolved. In this work we evaluated the level of functional conservation between AMP1 and its human homolog HsGCPII, a tumor marker of medical interest. We show that HsGCPII cannot substitute AMP1 in planta and that an HsGCPII-specific inhibitor does not evoke amp1-specific phenotypes. We used a chemical genetic approach to identify the drug hyperphyllin (HP), which specifically mimics the shoot defects of amp1, including plastochron reduction and enlargement and multiplication of the shoot meristem. We assessed the structural requirements of HP activity and excluded that it is a cytokinin analog. HP-treated wild-type plants showed amp1-related tissue-specific changes of various marker genes and a significant transcriptomic overlap with the mutant. HP was ineffective in amp1 and elevated the protein levels of PHAVOLUTA, consistent with the postulated role of AMP1 in miRNA-controlled translation, further supporting an AMP1-related mode of action. Our work suggests that plant and animal members of the M28 family of proteases adopted unrelated functions. With HP we provide a tool to characterize the plant-specific functions of this important class of proteins. PMID:27208298

  19. Small-Molecule Binding Aptamers: Selection Strategies, Characterization, and Applications

    NASA Astrophysics Data System (ADS)

    Ruscito, Annamaria; DeRosa, Maria

    2016-05-01

    Aptamers are single-stranded, synthetic oligonucleotides that fold into 3-dimensional shapes capable of binding non-covalently with high affinity and specificity to a target molecule. They are generated via an in vitro process known as the Systematic Evolution of Ligands by EXponential enrichment, from which candidates are screened and characterized, and then applied in aptamer-based biosensors for target detection. Aptamers for small molecule targets such as toxins, antibiotics, molecular markers, drugs, and heavy metals will be the focus of this review. Their accurate detection is ultimately needed for the protection and wellbeing of humans and animals. However, issues such as the drastic difference in size of the aptamer and small molecule make it challenging to select, characterize, and apply aptamers for the detection of small molecules. Thus, recent (since 2012) notable advances in small molecule aptamers, which have overcome some of these challenges, are presented here, while defining challenges that still exist are discussed

  20. Molecular Responses to Small Regulating Molecules against Huanglongbing Disease

    PubMed Central

    Martinelli, Federico; Dolan, David; Fileccia, Veronica; Reagan, Russell L.; Phu, My; Spann, Timothy M.; McCollum, Thomas G.; Dandekar, Abhaya M.

    2016-01-01

    Huanglongbing (HLB; citrus greening) is the most devastating disease of citrus worldwide. No cure is yet available for this disease and infected trees generally decline after several months. Disease management depends on early detection of symptoms and chemical control of insect vectors. In this work, different combinations of organic compounds were tested for the ability to modulate citrus molecular responses to HLB disease beneficially. Three small-molecule regulating compounds were tested: 1) L-arginine, 2) 6-benzyl-adenine combined with gibberellins, and 3) sucrose combined with atrazine. Each treatment contained K-phite mineral solution and was tested at two different concentrations. Two trials were conducted: one in the greenhouse and the other in the orchard. In the greenhouse study, responses of 42 key genes involved in sugar and starch metabolism, hormone-related pathways, biotic stress responses, and secondary metabolism in treated and untreated mature leaves were analyzed. TGA5 was significantly induced by arginine. Benzyladenine and gibberellins enhanced two important genes involved in biotic stress responses: WRKY54 and WRKY59. Sucrose combined with atrazine mainly upregulated key genes involved in carbohydrate metabolism such as sucrose-phosphate synthase, sucrose synthase, starch synthase, and α-amylase. Atrazine also affected expression of some key genes involved in systemic acquired resistance such as EDS1, TGA6, WRKY33, and MYC2. Several treatments upregulated HSP82, which might help protect protein folding and integrity. A subset of key genes was chosen as biomarkers for molecular responses to treatments under field conditions. GPT2 was downregulated by all small-molecule treatments. Arginine-induced genes involved in systemic acquired resistance included PR1, WRKY70, and EDS1. These molecular data encourage long-term application of treatments that combine these regulating molecules in field trials. PMID:27459099

  1. Molecular Responses to Small Regulating Molecules against Huanglongbing Disease.

    PubMed

    Martinelli, Federico; Dolan, David; Fileccia, Veronica; Reagan, Russell L; Phu, My; Spann, Timothy M; McCollum, Thomas G; Dandekar, Abhaya M

    2016-01-01

    Huanglongbing (HLB; citrus greening) is the most devastating disease of citrus worldwide. No cure is yet available for this disease and infected trees generally decline after several months. Disease management depends on early detection of symptoms and chemical control of insect vectors. In this work, different combinations of organic compounds were tested for the ability to modulate citrus molecular responses to HLB disease beneficially. Three small-molecule regulating compounds were tested: 1) L-arginine, 2) 6-benzyl-adenine combined with gibberellins, and 3) sucrose combined with atrazine. Each treatment contained K-phite mineral solution and was tested at two different concentrations. Two trials were conducted: one in the greenhouse and the other in the orchard. In the greenhouse study, responses of 42 key genes involved in sugar and starch metabolism, hormone-related pathways, biotic stress responses, and secondary metabolism in treated and untreated mature leaves were analyzed. TGA5 was significantly induced by arginine. Benzyladenine and gibberellins enhanced two important genes involved in biotic stress responses: WRKY54 and WRKY59. Sucrose combined with atrazine mainly upregulated key genes involved in carbohydrate metabolism such as sucrose-phosphate synthase, sucrose synthase, starch synthase, and α-amylase. Atrazine also affected expression of some key genes involved in systemic acquired resistance such as EDS1, TGA6, WRKY33, and MYC2. Several treatments upregulated HSP82, which might help protect protein folding and integrity. A subset of key genes was chosen as biomarkers for molecular responses to treatments under field conditions. GPT2 was downregulated by all small-molecule treatments. Arginine-induced genes involved in systemic acquired resistance included PR1, WRKY70, and EDS1. These molecular data encourage long-term application of treatments that combine these regulating molecules in field trials. PMID:27459099

  2. Coacervate delivery systems for proteins and small molecule drugs

    PubMed Central

    Johnson, Noah R; Wang, Yadong

    2015-01-01

    Coacervates represent an exciting new class of drug delivery vehicles, developed in the past decade as carriers of small molecule drugs and proteins. This review summarizes several well-described coacervate systems, including Elastin-like peptides for delivery of anti-cancer therapeutics,Heparin-based coacervates with synthetic polycations for controlled growth factor delivery,Carboxymethyl chitosan aggregates for oral drug delivery,Mussel adhesive protein and hyaluronic acid coacervates. Coacervates present advantages in their simple assembly and easy incorporation into tissue engineering scaffolds or as adjuncts to cell therapies. They are also amenable to functionalization such as for targeting or for enhancing the bioactivity of their cargo. These new drug carriers are anticipated to have broad applications and noteworthy impact in the near future. PMID:25138695

  3. Selection and Biosensor Application of Aptamers for Small Molecules

    PubMed Central

    Pfeiffer, Franziska; Mayer, Günter

    2016-01-01

    Small molecules play a major role in the human body and as drugs, toxins, and chemicals. Tools to detect and quantify them are therefore in high demand. This review will give an overview about aptamers interacting with small molecules and their selection. We discuss the current state of the field, including advantages as well as problems associated with their use and possible solutions to tackle these. We then discuss different kinds of small molecule aptamer-based sensors described in literature and their applications, ranging from detecting drinking water contaminations to RNA imaging. PMID:27379229

  4. Challenges and Opportunities for Small Molecule Aptamer Development

    PubMed Central

    McKeague, Maureen; DeRosa, Maria C.

    2012-01-01

    Aptamers are single-stranded oligonucleotides that bind to targets with high affinity and selectivity. Their use as molecular recognition elements has emerged as a viable approach for biosensing, diagnostics, and therapeutics. Despite this potential, relatively few aptamers exist that bind to small molecules. Small molecules are important targets for investigation due to their diverse biological functions as well as their clinical and commercial uses. Novel, effective molecular recognition probes for these compounds are therefore of great interest. This paper will highlight the technical challenges of aptamer development for small molecule targets, as well as the opportunities that exist for their application in biosensing and chemical biology. PMID:23150810

  5. Selection and Biosensor Application of Aptamers for Small Molecules.

    PubMed

    Pfeiffer, Franziska; Mayer, Günter

    2016-01-01

    Small molecules play a major role in the human body and as drugs, toxins, and chemicals. Tools to detect and quantify them are therefore in high demand. This review will give an overview about aptamers interacting with small molecules and their selection. We discuss the current state of the field, including advantages as well as problems associated with their use and possible solutions to tackle these. We then discuss different kinds of small molecule aptamer-based sensors described in literature and their applications, ranging from detecting drinking water contaminations to RNA imaging. PMID:27379229

  6. Probing translation using small molecule inhibitors

    PubMed Central

    Blanchard, Scott C.; Cooperman, Barry S.; Wilson, Daniel N.

    2010-01-01

    Summary The translational apparatus of the bacterial cell remains one of the principal targets of antibiotics for the clinical treatment of infection worldwide. Since the introduction of specific translation inhibitors into clinical practise in the late 1940’s, intense efforts have been made to understand their precise mechanisms of action. Such research has often revealed significant and sometimes unexpected insights into many fundamental aspects of the translation mechanism. Central to progress in this area, high-resolution crystal structures of the bacterial ribosome identifying the sites of antibiotic binding are now available, which, together with recent developments in single-molecule and fast-kinetic approaches, provide an integrated view of the dynamic translation process. Assays employing these approaches and focusing on specific steps of the overall translation process are amenable for drug-screening. Such assays, coupled with structural studies, have the potential not only to accelerate the discovery of novel and effective antimicrobial agents, but also to refine our understanding of the translation mechanism, since antibiotics often stabilize specific functional states of the ribosome and allow distinct translation steps to be dissected in molecular detail. PMID:20609413

  7. A Prospective Method to Guide Small Molecule Drug Design

    ERIC Educational Resources Information Center

    Johnson, Alan T.

    2015-01-01

    At present, small molecule drug design follows a retrospective path when considering what analogs are to be made around a current hit or lead molecule with the focus often on identifying a compound with higher intrinsic potency. What this approach overlooks is the simultaneous need to also improve the physicochemical (PC) and pharmacokinetic (PK)…

  8. Small Molecule Inhibitors of Anthrax Lethal Factor Toxin

    PubMed Central

    Williams, John D.; Khan, Atiyya R.; Cardinale, Steven C.; Butler, Michelle M.; Bowlin, Terry L.; Peet, Norton P.

    2014-01-01

    This manuscript describes the preparation of new small molecule inhibitors of Bacillus anthracis lethal factor. Our starting point was the symmetrical, bis-quinolinyl compound 1 (NSC 12155). Optimization of one half of this molecule led to new LF inhibitors that were desymmetrized to afford more drug-like compounds. PMID:24290062

  9. The role of small molecules in musculoskeletal regeneration

    PubMed Central

    Lo, Kevin W-H; Ashe, Keshia M; Kan, Ho Man; Laurencin, Cato T

    2015-01-01

    The uses of bone morphogenetic proteins and parathyroid hormone therapeutics are fraught with several fundamental problems, such as cost, protein stability, immunogenicity, contamination and supraphysiological dosage. These downsides may effectively limit their more universal use. Therefore, there is a clear need for alternative forms of biofactors to obviate the drawbacks of protein-based inductive factors for bone repair and regeneration. Our group has studied small molecules with the capacity to regulate osteoblast differentiation and mineralization because their inherent physical properties minimize limitations observed in protein growth factors. For instance, in general, small molecule inducers are usually more stable, highly soluble, nonimmunogenic, more affordable and require lower dosages. Small molecules with the ability to induce osteoblastic differentiation may represent the next generation of bone regenerative medicine. This review describes efforts to develop small molecule-based biofactors for induction, paying specific attention to their novel roles in bone regeneration. PMID:22817627

  10. Small molecule perimeter defense in entomopathogenic bacteria

    PubMed Central

    Crawford, Jason M.; Portmann, Cyril; Zhang, Xu; Roeffaers, Maarten B. J.; Clardy, Jon

    2012-01-01

    Two Gram-negative insect pathogens, Xenorhabdus nematophila and Photorhabdus luminescens, produce rhabduscin, an amidoglycosyl- and vinyl-isonitrile-functionalized tyrosine derivative. Heterologous expression of the rhabduscin pathway in Escherichia coli, precursor-directed biosynthesis of rhabduscin analogs, biochemical assays, and visualization using both stimulated Raman scattering and confocal fluorescence microscopy established rhabduscin’s role as a potent nanomolar-level inhibitor of phenoloxidase, a key component of the insect’s innate immune system, as well as rhabduscin’s localization at the bacterial cell surface. Stimulated Raman scattering microscopy visualized rhabduscin at the periphery of wild-type X. nematophila cells and E. coli cells heterologously expressing the rhabduscin pathway. Precursor-directed biosynthesis created rhabduscin mimics in X. nematophila pathway mutants that could be accessed at the bacterial cell surface by an extracellular bioorthogonal probe, as judged by confocal fluorescence microscopy. Biochemical assays using both wild-type and mutant X. nematophila cells showed that rhabduscin was necessary and sufficient for potent inhibition (low nM) of phenoloxidases, the enzymes responsible for producing melanin (the hard black polymer insects generate to seal off microbial pathogens). These observations suggest a model in which rhabduscin’s physical association at the bacterial cell surface provides a highly effective inhibitor concentration directly at the site of phenoloxidase contact. This class of molecules is not limited to insect pathogens, as the human pathogen Vibrio cholerae also encodes rhabduscin’s aglycone, and bacterial cell-coated immunosuppressants could be a general strategy to combat host defenses. PMID:22711807

  11. Biocatalysts and their small molecule products from metagenomic studies

    PubMed Central

    Iqbal, Hala A.; Feng, Zhiyang; Brady, Sean F.

    2012-01-01

    The vast majority of bacteria present in environmental samples have never been cultured and therefore they have not been available to exploit their ability to produce useful biocatalysts or collections of biocatalysts that can biosynthesize interesting small molecules. Metagenomic libraries constructed using DNA extracted directly from natural bacterial communities offer access to the genetic information present in the genomes of these as yet uncultured bacteria. This review highlights recent efforts to recover both discrete enzymes and small molecules from metagenomic libraries. PMID:22455793

  12. A Personal History of Quadruplex-Small Molecule Targeting.

    PubMed

    Neidle, Stephen

    2015-08-01

    The story behind some of the early studies in the laboratory of Stephen Neidle on quadruplex-binding small molecules and the structural studies on quadruplexes and their complexes is presented and discussed in the context of his earlier work on drug-DNA interactions. More recent studies and future directions in the rational design of small molecules targeting telomeric and gene promoter quadruplexes are also described. PMID:26096791

  13. Small molecule annotation for the Protein Data Bank.

    PubMed

    Sen, Sanchayita; Young, Jasmine; Berrisford, John M; Chen, Minyu; Conroy, Matthew J; Dutta, Shuchismita; Di Costanzo, Luigi; Gao, Guanghua; Ghosh, Sutapa; Hudson, Brian P; Igarashi, Reiko; Kengaku, Yumiko; Liang, Yuhe; Peisach, Ezra; Persikova, Irina; Mukhopadhyay, Abhik; Narayanan, Buvaneswari Coimbatore; Sahni, Gaurav; Sato, Junko; Sekharan, Monica; Shao, Chenghua; Tan, Lihua; Zhuravleva, Marina A

    2014-01-01

    The Protein Data Bank (PDB) is the single global repository for three-dimensional structures of biological macromolecules and their complexes, and its more than 100,000 structures contain more than 20,000 distinct ligands or small molecules bound to proteins and nucleic acids. Information about these small molecules and their interactions with proteins and nucleic acids is crucial for our understanding of biochemical processes and vital for structure-based drug design. Small molecules present in a deposited structure may be attached to a polymer or may occur as a separate, non-covalently linked ligand. During curation of a newly deposited structure by wwPDB annotation staff, each molecule is cross-referenced to the PDB Chemical Component Dictionary (CCD). If the molecule is new to the PDB, a dictionary description is created for it. The information about all small molecule components found in the PDB is distributed via the ftp archive as an external reference file. Small molecule annotation in the PDB also includes information about ligand-binding sites and about covalent and other linkages between ligands and macromolecules. During the remediation of the peptide-like antibiotics and inhibitors present in the PDB archive in 2011, it became clear that additional annotation was required for consistent representation of these molecules, which are quite often composed of several sequential subcomponents including modified amino acids and other chemical groups. The connectivity information of the modified amino acids is necessary for correct representation of these biologically interesting molecules. The combined information is made available via a new resource called the Biologically Interesting molecules Reference Dictionary, which is complementary to the CCD and is now routinely used for annotation of peptide-like antibiotics and inhibitors. PMID:25425036

  14. Computational evaluation of protein – small molecule binding

    PubMed Central

    Guvench, Olgun; MacKerell, Alexander D.

    2009-01-01

    Determining protein – small molecule binding affinity is a key component of present-day rational drug discovery. To circumvent the time, labor, and materials costs associated with experimental protein – small molecule binding assays, a variety of structure-based computational methods have been developed for determining protein – small molecule binding affinities. These methods can be placed in one of two classes: accurate but slow (Class 1), and fast but approximate (Class 2). Class 1 methods, which explicitly take into account protein flexibility and include an atomic-level description of solvation, are capable of quantitatively reproducing experimental protein – small molecule absolute binding free energies. However, Class 1 computational requirements make screening thousands to millions of small molecules against a protein, as required for rational drug design, infeasible for the foreseeable future. Class 2 methods, on the other hand, are sufficiently fast to perform such inhibitor screening, yet they suffer from limited descriptions of protein flexibility and solvation, which in turn limit their ability to select and rank-order small molecules by computed binding affinities. This review presents an overview of Class 1 and Class 2 methods, avenues of research in Class 2 methods aimed at bringing them closer to Class 1 accuracy, and intermediate approaches that incorporate features of both Class 1 and Class 2 methods. PMID:19162472

  15. Heating of interstellar gas by large molecules or small grains

    SciTech Connect

    Lepp, S.; Dalgarno, A.

    1988-12-01

    The heating of the interstellar medium by photoelectric emission from large molecules or small grains is explored. Photodetachment of large negative ions may be a significant heat source in diffuse clouds. For an abundance of large molecules relative to hydrogen greater than 2 x 10 to the -7th, the heating rate from the photoelectrons produced in the photoionization of large molecules and the photodetachment of large molecular negative ions exceeds the standard grain-heating rate. Theoretical models have been used to infer the abundances of large molecules from the C(+)/C abundance ratios in the interstellar clouds toward Zeta Oph and Zeta Per. 33 references.

  16. TMAO: A small molecule of great expectations.

    PubMed

    Ufnal, Marcin; Zadlo, Anna; Ostaszewski, Ryszard

    2015-01-01

    Trimethylamine N-oxide (TMAO) is a small organic compound whose concentration in blood increases after ingesting dietary l-carnitine and phosphatidylcholine. Recent clinical studies show a positive correlation between elevated plasma levels of TMAO and an increased risk for major adverse cardiovascular events defined as death, myocardial infarction, or stroke. Several experimental studies suggest a possible contribution of TMAO to the etiology of cardiovascular diseases by affecting lipid and hormonal homeostasis. On the other hand, TMAO-rich seafood, which is an important source of protein and vitamins in the Mediterranean diet, has been considered beneficial for the circulatory system. Although in humans TMAO is known mainly as a waste product of choline metabolism, a number of studies suggest an involvement of TMAO in important biological functions in numerous organisms, ranging from bacteria to mammals. For example, cells use TMAO to maintain cell volume under conditions of osmotic and hydrostatic pressure stresses. In this article, we reviewed well-established chemical and biological properties of TMAO and dietary sources of TMAO, as well as looked at the studies suggesting possible involvement of TMAO in the etiology of cardiovascular and other diseases, such as kidney failure, diabetes, and cancer. PMID:26283574

  17. Molecules Great and Small: The Complement System.

    PubMed

    Mathern, Douglas R; Heeger, Peter S

    2015-09-01

    The complement cascade, traditionally considered an effector arm of innate immunity required for host defense against pathogens, is now recognized as a crucial pathogenic mediator of various kidney diseases. Complement components produced by the liver and circulating in the plasma undergo activation through the classical and/or mannose-binding lectin pathways to mediate anti-HLA antibody-initiated kidney transplant rejection and autoantibody-initiated GN, the latter including membranous glomerulopathy, antiglomerular basement membrane disease, and lupus nephritis. Inherited and/or acquired abnormalities of complement regulators, which requisitely limit restraint on alternative pathway complement activation, contribute to the pathogenesis of the C3 nephropathies and atypical hemolytic uremic syndrome. Increasing evidence links complement produced by endothelial cells and/or tubular cells to the pathogenesis of kidney ischemia-reperfusion injury and progressive kidney fibrosis. Data emerging since the mid-2000s additionally show that immune cells, including T cells and antigen-presenting cells, produce alternative pathway complement components during cognate interactions. The subsequent local complement activation yields production of the anaphylatoxins C3a and C5a, which bind to their respective receptors (C3aR and C5aR) on both partners to augment effector T-cell proliferation and survival, while simultaneously inhibiting regulatory T-cell induction and function. This immune cell-derived complement enhances pathogenic alloreactive T-cell immunity that results in transplant rejection and likely contributes to the pathogenesis of other T cell-mediated kidney diseases. C5a/C5aR ligations on neutrophils have additionally been shown to contribute to vascular inflammation in models of ANCA-mediated renal vasculitis. New translational immunology efforts along with the development of pharmacologic agents that block human complement components and receptors now permit

  18. Discovery of small molecule cancer drugs: Successes, challenges and opportunities

    PubMed Central

    Hoelder, Swen; Clarke, Paul A.; Workman, Paul

    2012-01-01

    The discovery and development of small molecule cancer drugs has been revolutionised over the last decade. Most notably, we have moved from a one-size-fits-all approach that emphasized cytotoxic chemotherapy to a personalised medicine strategy that focuses on the discovery and development of molecularly targeted drugs that exploit the particular genetic addictions, dependencies and vulnerabilities of cancer cells. These exploitable characteristics are increasingly being revealed by our expanding understanding of the abnormal biology and genetics of cancer cells, accelerated by cancer genome sequencing and other high-throughput genome-wide campaigns, including functional screens using RNA interference. In this review we provide an overview of contemporary approaches to the discovery of small molecule cancer drugs, highlighting successes, current challenges and future opportunities. We focus in particular on four key steps: Target validation and selection; chemical hit and lead generation; lead optimization to identify a clinical drug candidate; and finally hypothesis-driven, biomarker-led clinical trials. Although all of these steps are critical, we view target validation and selection and the conduct of biology-directed clinical trials as especially important areas upon which to focus to speed progress from gene to drug and to reduce the unacceptably high attrition rate during clinical development. Other challenges include expanding the envelope of druggability for less tractable targets, understanding and overcoming drug resistance, and designing intelligent and effective drug combinations. We discuss not only scientific and technical challenges, but also the assessment and mitigation of risks as well as organizational, cultural and funding problems for cancer drug discovery and development, together with solutions to overcome the ‘Valley of Death’ between basic research and approved medicines. We envisage a future in which addressing these challenges will

  19. Membrane Fusion Induced by Small Molecules and Ions

    PubMed Central

    Mondal Roy, Sutapa; Sarkar, Munna

    2011-01-01

    Membrane fusion is a key event in many biological processes. These processes are controlled by various fusogenic agents of which proteins and peptides from the principal group. The fusion process is characterized by three major steps, namely, inter membrane contact, lipid mixing forming the intermediate step, pore opening and finally mixing of inner contents of the cells/vesicles. These steps are governed by energy barriers, which need to be overcome to complete fusion. Structural reorganization of big molecules like proteins/peptides, supplies the required driving force to overcome the energy barrier of the different intermediate steps. Small molecules/ions do not share this advantage. Hence fusion induced by small molecules/ions is expected to be different from that induced by proteins/peptides. Although several reviews exist on membrane fusion, no recent review is devoted solely to small moleculs/ions induced membrane fusion. Here we intend to present, how a variety of small molecules/ions act as independent fusogens. The detailed mechanism of some are well understood but for many it is still an unanswered question. Clearer understanding of how a particular small molecule can control fusion will open up a vista to use these moleucles instead of proteins/peptides to induce fusion both in vivo and in vitro fusion processes. PMID:21660306

  20. Single molecule surface enhanced resonance Raman scattering (SERRS) of the enhanced green fluorescent protein (EGFP)

    NASA Astrophysics Data System (ADS)

    Hofkens, Johan; De Schryver, Frans C.; Cotlet, Mircea; Habuchi, Satoshi

    2004-06-01

    One of the most intriguing findings in single molecule spectroscopy (SMS) is the observation of Raman spectra of individual molecules, despite the small cross section of the transitions involved. The observation of the spectra can be explained by the surface enhanced Raman scattering (SERRS) effect. At the single-molecule level, the SERRS-spectra recorded as a function of time reveal inhomogeneous behaviour such as on/off blinking, spectral diffusion, intensity fluctuations of vibrational line, and even splitting of some lines within the spectrum of one molecule. Single-molecule SERRS (SM-SERRS) spectroscopy opens up exciting opportunities in the field of biophysics and biomedical spectroscopy. The first example of single protein SERRS was performed on hemoglobin. However, the possibility of extracting the heme group by silver sols can not be excluded. Here we report on SM-SERRS spectra of enhanced green fluorescent protein (EGFP) in which the chromophore is kept in the protein. The time series of SM-SERRS spectra suggest the conversion of the EGFP chromophore between the deprotonated and the protonated form. Autocorrelation analysis of SM-SERRS trajectory reveals the presence of fast dynamics taking place in the protein. Our findings show the potential of the technique to study structural dynamics of protein molecules.

  1. Thermal Degradation of Small Molecules: A Global Metabolomic Investigation

    PubMed Central

    2015-01-01

    Thermal processes are widely used in small molecule chemical analysis and metabolomics for derivatization, vaporization, chromatography, and ionization, especially in gas chromatography mass spectrometry (GC/MS). In this study the effect of heating was examined on a set of 64 small molecule standards and, separately, on human plasma metabolite extracts. The samples, either derivatized or underivatized, were heated at three different temperatures (60, 100, and 250 °C) at different exposure times (30 s, 60 s, and 300 s). All the samples were analyzed by liquid chromatography coupled to electrospray ionization mass spectrometry (LC/MS) and the data processed by XCMS Online (xcmsonline.scripps.edu). The results showed that heating at an elevated temperature of 100 °C had an appreciable effect on both the underivatized and derivatized molecules, and heating at 250 °C created substantial changes in the profile. For example, over 40% of the molecular peaks were altered in the plasma metabolite analysis after heating (250 °C, 300s) with a significant formation of degradation and transformation products. The analysis of 64 small molecule standards validated the temperature-induced changes observed on the plasma metabolites, where most of the small molecules degraded at elevated temperatures even after minimal exposure times (30 s). For example, tri- and diorganophosphates (e.g., adenosine triphosphate and adenosine diphosphate) were readily degraded into a mono-organophosphate (e.g., adenosine monophosphate) during heating. Nucleosides and nucleotides (e.g., inosine and inosine monophosphate) were also found to be transformed into purine derivatives (e.g., hypoxanthine). A newly formed transformation product, oleoyl ethyl amide, was identified in both the underivatized and derivatized forms of the plasma extracts and small molecule standard mixture, and was likely generated from oleic acid. Overall these analyses show that small molecules and metabolites undergo

  2. Thermal Degradation of Small Molecules: A Global Metabolomic Investigation.

    PubMed

    Fang, Mingliang; Ivanisevic, Julijana; Benton, H Paul; Johnson, Caroline H; Patti, Gary J; Hoang, Linh T; Uritboonthai, Winnie; Kurczy, Michael E; Siuzdak, Gary

    2015-11-01

    Thermal processes are widely used in small molecule chemical analysis and metabolomics for derivatization, vaporization, chromatography, and ionization, especially in gas chromatography mass spectrometry (GC/MS). In this study the effect of heating was examined on a set of 64 small molecule standards and, separately, on human plasma metabolite extracts. The samples, either derivatized or underivatized, were heated at three different temperatures (60, 100, and 250 °C) at different exposure times (30 s, 60 s, and 300 s). All the samples were analyzed by liquid chromatography coupled to electrospray ionization mass spectrometry (LC/MS) and the data processed by XCMS Online ( xcmsonline.scripps.edu ). The results showed that heating at an elevated temperature of 100 °C had an appreciable effect on both the underivatized and derivatized molecules, and heating at 250 °C created substantial changes in the profile. For example, over 40% of the molecular peaks were altered in the plasma metabolite analysis after heating (250 °C, 300s) with a significant formation of degradation and transformation products. The analysis of 64 small molecule standards validated the temperature-induced changes observed on the plasma metabolites, where most of the small molecules degraded at elevated temperatures even after minimal exposure times (30 s). For example, tri- and diorganophosphates (e.g., adenosine triphosphate and adenosine diphosphate) were readily degraded into a mono-organophosphate (e.g., adenosine monophosphate) during heating. Nucleosides and nucleotides (e.g., inosine and inosine monophosphate) were also found to be transformed into purine derivatives (e.g., hypoxanthine). A newly formed transformation product, oleoyl ethyl amide, was identified in both the underivatized and derivatized forms of the plasma extracts and small molecule standard mixture, and was likely generated from oleic acid. Overall these analyses show that small molecules and metabolites undergo

  3. Application of a Small Molecule Radiopharmaceutical Concept to Improve Kinetics.

    PubMed

    Jeong, Jae Min

    2016-06-01

    Recently, large molecules or nanoparticles are actively studied as radiopharmaceuticals. However, their kinetics is problematic because of a slow penetration through the capillaries and slow distribution to the target. To improve the kinetics, a two-step targeting method can be applied by using small molecules and very rapid copper-free click reaction. Although this method might have limitations such as internalization of the first targeted conjugate, it will provide high target-to-non-target ratio imaging of radiopharmaceuticals. PMID:27275356

  4. Detecting and identifying small molecules in a nanopore flux capacitor

    NASA Astrophysics Data System (ADS)

    Bearden, Samuel; McClure, Ethan; Zhang, Guigen

    2016-02-01

    A new method of molecular detection in a metallic-semiconductor nanopore was developed and evaluated with experimental and computational methods. Measurements were made of the charging potential of the electrical double layer (EDL) capacitance as charge-carrying small molecules translocated the nanopore. Signals in the charging potential were found to be correlated to the physical properties of analyte molecules. From the measured signals, we were able to distinguish molecules with different valence charge or similar valence charge but different size. The relative magnitude of the signals from different analytes was consistent over a wide range of experimental conditions, suggesting that the detected signals are likely due to single molecules. Computational modeling of the nanopore system indicated that the double layer potential signal may be described in terms of disruption of the EDL structure due to the size and charge of the analyte molecule, in agreement with Huckel and Debye’s analysis of the electrical atmosphere of electrolyte solutions.

  5. Biased and unbiased strategies to identify biologically active small molecules.

    PubMed

    Abet, Valentina; Mariani, Angelica; Truscott, Fiona R; Britton, Sébastien; Rodriguez, Raphaël

    2014-08-15

    Small molecules are central players in chemical biology studies. They promote the perturbation of cellular processes underlying diseases and enable the identification of biological targets that can be validated for therapeutic intervention. Small molecules have been shown to accurately tune a single function of pluripotent proteins in a reversible manner with exceptional temporal resolution. The identification of molecular probes and drugs remains a worthy challenge that can be addressed by the use of biased and unbiased strategies. Hypothesis-driven methodologies employs a known biological target to synthesize complementary hits while discovery-driven strategies offer the additional means of identifying previously unanticipated biological targets. This review article provides a general overview of recent synthetic frameworks that gave rise to an impressive arsenal of biologically active small molecules with unprecedented cellular mechanisms. PMID:24811300

  6. Cancer Immunotherapy: Selected Targets and Small-Molecule Modulators.

    PubMed

    Weinmann, Hilmar

    2016-03-01

    There is a significant amount of excitement in the scientific community around cancer immunotherapy, as this approach has renewed hope for many cancer patients owing to some recent successes in the clinic. Currently available immuno-oncology therapeutics under clinical development and on the market are mostly biologics (antibodies, proteins, engineered cells, and oncolytic viruses). However, modulation of the immune system with small molecules offers several advantages that may be complementary and potentially synergistic to the use of large biologicals. Therefore, the discovery and development of novel small-molecule modulators is a rapidly growing research area for medicinal chemists working in cancer immunotherapy. This review provides a brief introduction into recent trends related to selected targets and pathways for cancer immunotherapy and their small-molecule pharmacological modulators. PMID:26836578

  7. SPLINTS: small-molecule protein ligand interface stabilizers.

    PubMed

    Fischer, Eric S; Park, Eunyoung; Eck, Michael J; Thomä, Nicolas H

    2016-04-01

    Regulatory protein-protein interactions are ubiquitous in biology, and small molecule protein-protein interaction inhibitors are an important focus in drug discovery. Remarkably little attention has been given to the opposite strategy-stabilization of protein-protein interactions, despite the fact that several well-known therapeutics act through this mechanism. From a structural perspective, we consider representative examples of small molecules that induce or stabilize the association of protein domains to inhibit, or alter, signaling for nuclear hormone, GTPase, kinase, phosphatase, and ubiquitin ligase pathways. These SPLINTS (small-molecule protein ligand interface stabilizers) drive interactions that are in some cases physiologically relevant, and in others entirely adventitious. The diverse structural mechanisms employed suggest approaches for a broader and systematic search for such compounds in drug discovery. PMID:26829757

  8. Increased Hydrogel Swelling Induced by Absorption of Small Molecules.

    PubMed

    Nam, Changwoo; Zimudzi, Tawanda J; Geise, Geoffrey M; Hickner, Michael A

    2016-06-01

    The water and small molecule uptake behavior of amphiphilic diacrylate terminated poly(dimethylsiloxane) (PDMSDA)/poly(ethylene glycol diacrylate) (PEGDA) cross-linked hydrogels were studied using attenuated total reflectance-Fourier transform infrared (ATR-FTIR) spectroscopy. These hydrogel networks absorbed more water as the PEGDA content of the network increased. In contrast to typical osmotic deswelling behavior that occurs when liquid water equilibrated hydrogels are immersed in small molecule solutions with water activities less than unity, water-swollen gels immersed in 2-acrylamido-2-methylpropanesulfonic acid (AMPS-H) solutions rapidly regained their water content within 4 min following an initial deswelling response. In situ ATR-FTIR analysis of the hydrogel film during the dynamic swelling experiment indicated that small molecule absorption into the gel played an important role in inducing gel reswelling in low water activity solutions. This aspect of polymer gel water uptake and interaction with small molecules is important for optimizing hydrogel coatings and hydrophilic polymer applications where there is an interaction between the internal chemical structure of the gel and electrolytes or other molecules in solution. PMID:27159118

  9. Novel approaches to map small molecule-target interactions.

    PubMed

    Kapoor, Shobhna; Waldmann, Herbert; Ziegler, Slava

    2016-08-01

    The quest for small molecule perturbators of protein function or a given cellular process lies at the heart of chemical biology and pharmaceutical research. Bioactive compounds need to be extensively characterized in the context of the modulated protein(s) or process(es) in living systems to unravel and confirm their mode of action. A crucial step in this workflow is the identification of the molecular targets for these small molecules, for which a generic methodology is lacking. Herein we summarize recently developed approaches for target identification spurred by advances in omics techniques and chemo- and bioinformatics analysis. PMID:27240466

  10. Recent Advances in Developing Small Molecules Targeting Nucleic Acid

    PubMed Central

    Wang, Maolin; Yu, Yuanyuan; Liang, Chao; Lu, Aiping; Zhang, Ge

    2016-01-01

    Nucleic acids participate in a large number of biological processes. However, current approaches for small molecules targeting protein are incompatible with nucleic acids. On the other hand, the lack of crystallization of nucleic acid is the limiting factor for nucleic acid drug design. Because of the improvements in crystallization in recent years, a great many structures of nucleic acids have been reported, providing basic information for nucleic acid drug discovery. This review focuses on the discovery and development of small molecules targeting nucleic acids. PMID:27248995

  11. Autophagonizer, a novel synthetic small molecule, induces autophagic cell death

    SciTech Connect

    Choi, In-Kwon; Cho, Yoon Sun; Jung, Hye Jin; Kwon, Ho Jeong

    2010-03-19

    Autophagy is an apoptosis-independent mechanism of cell death that protects the cell from environmental imbalances and infection by pathogens. We identified a novel small molecule, 2-(3-Benzyl-4-oxo-3,4,5,6,7,8-hexahydro-benzo[4,5]thieno[2,3-d] pyrimidin-2-ylsulfanylmethyl)-oxazole-4-carboxylic acid (2-pyrrolidin-1-yl-ethyl)-amide (referred as autophagonizer), using high-content cell-based screening and the autophagosome marker EGFP-LC3. Autophagonizer inhibited growth and induced cell death in the human tumor cell lines MCF7, HeLa, HCT116, A549, AGS, and HT1080 via a caspase-independent pathway. Conversion of cytosolic LC3-I to autophagosome-associated LC3-II was greatly enhanced by autophagonizer treatment. Transmission electron microscopy and acridine orange staining revealed increased autophagy in the cytoplasm of autophagonizer-treated cells. In conclusion, autophagonizer is a novel autophagy inducer with unique structure, which induces autophagic cell death in the human tumor cell lines.

  12. Small Molecule-Mediated Cleavage of RNA in Living Cells

    PubMed Central

    Guan, Lirui

    2013-01-01

    Antisense oligonucleotides and small interfering RNAs (siRNAs) control gene expression by triggering the degradation of a mRNA via recruitment of RNase H or the RNA-induced silencing complex (RISC), respectively.[1] These approaches are hampered, however, by the poor cellular permeability of oligonucleotides. A small molecule approach to cleave RNA targets could obviate uptake issues. Several compounds can induce RNA cleavage in vitro,[2] however, to the best of our knowledge no small molecules have been previously described to cleave RNA in living cells. Herein, we describe the development of a potentially general approach to design small molecules that specifically cleave an RNA in a living cell, affecting biological function. Specifically, a designed, modularly assembled small molecule that binds the RNA that causes myotonic dystrophy type 1 (DM1)[3] was appended with a moiety that generates hydroxyl radicals upon irradiation. Cleavage of the transcript improves DM1-associated defects in cell culture, and compounds are non-toxic at an efficacious dose as determined by a MTT viability assay. This approach may allow for the site-specific cleavage and inactivation of other cellular RNAs.[4] Compounds that bind to and cleave RNA have the potential to serve as chemical genetics probes of function or lead therapeutics with spatial and temporal control. PMID:23280953

  13. Design, synthesis, and evaluation of bioactive small molecules.

    PubMed

    Hua, Duy H

    2013-02-01

    Collaborative research projects between chemists, biologists, and medical scientists have inevitably produced many useful drugs, biosensors, and medical instrumentation. Organic chemistry lies at the heart of drug discovery and development. The current range of organic synthetic methodologies allows for the construction of unlimited libraries of small organic molecules for drug screening. In translational research projects, we have focused on the discovery of lead compounds for three major diseases: Alzheimer's disease (AD), breast cancer, and viral infections. In the AD project, we have taken a rational-design approach and synthesized a new class of tricyclic pyrone (TP) compounds that preserve memory and motor functions in amyloid precursor protein (APP)/presenilin-1 (PS1) mice. TPs could protect neuronal death through several possible mechanisms, including their ability to inhibit the formation of both intraneuronal and extracellular amyloid β (Aβ) aggregates, to increase cholesterol efflux, to restore axonal trafficking, and to enhance long-term potentiation (LTP) and restored LTP following treatment with Aβ oligomers. We have also synthesized a new class of gap-junction enhancers, based on substituted quinolines, that possess potent inhibitory activities against breast-cancer cells in vitro and in vivo. Although various antiviral drugs are available, the emergence of viral resistance to existing antiviral drugs and various understudied viral infections, such as norovirus and rotavirus, emphasizes the demand for the development of new antiviral agents against such infections and others. Our laboratories have undertaken these projects for the discovery of new antiviral inhibitors. The discussion of these aforementioned projects may shed light on the future development of drug candidates in the fields of AD, cancer, and viral infections. PMID:23280957

  14. Discovery of a Small Molecule that Enhances Astrocytogenesis by Activation of STAT3, SMAD1/5/8, and ERK1/2 via Induction of Cytokines in Neural Stem Cells.

    PubMed

    Lee, Ha-Rim; Farhanullah; Lee, JiSoo; Jajoo, Rahul; Kong, Sun-Young; Shin, Jae-Yeon; Kim, Jae-Ouk; Lee, Jiyoun; Lee, Jeewoo; Kim, Hyun-Jung

    2016-01-20

    Identification of small molecules that direct neural stem cells (NSCs) into specific cell types would be helpful to understand the molecular mechanisms involved in regulation of NSC fate, and facilitate the development of therapeutic applications. In the current study, we developed and screened small molecules that can modulate the fate of NSCs that are derived from rat fetal cortex. Among these compounds, compounds 5 and 6 successfully differentiated NSCs into astrocytes and neurons, respectively. Compound 5 induced astrocytogenesis by increasing expression of interleukin-6, bone morphogenetic protein 2 and leukemia inhibitory factor and through consequent phosphorylation of signal transducer and activator of transcription 3 and Sma- and Mad-related protein 1/5/8 in NSCs. In addition, compound 5 increased the expression of fibroblast growth factor (FGF) 2 and FGF8 which may regulate the branching and morphology of astrocytes. Taken together, our results suggest that these small molecules can serve as a useful tool to study cell fate determination in NSCs and be used as an inexpensive alternative to cytokines to study mechanisms of astrocytogenesis. PMID:26505647

  15. Conformational analysis of small molecules: NMR and quantum mechanics calculations.

    PubMed

    Tormena, Cláudio F

    2016-08-01

    This review deals with conformational analysis in small organic molecules, and describes the stereoelectronic interactions responsible for conformational stability. Conformational analysis is usually performed using NMR spectroscopy through measurement of coupling constants at room or low temperature in different solvents to determine the populations of conformers in solution. Quantum mechanical calculations are used to address the interactions responsible for conformer stability. The conformational analysis of a large number of small molecules is described, using coupling constant measurements in different solvents and at low temperature, as well as recent applications of through-space and through-hydrogen bond coupling constants JFH as tools for the conformational analysis of fluorinated molecules. Besides NMR parameters, stereoelectronic interactions such as conjugative, hyperconjugative, steric and intramolecular hydrogen bond interactions involved in conformational preferences are discussed. PMID:27573182

  16. Engineered kinesin motor proteins amenable to small-molecule inhibition

    PubMed Central

    Engelke, Martin F.; Winding, Michael; Yue, Yang; Shastry, Shankar; Teloni, Federico; Reddy, Sanjay; Blasius, T. Lynne; Soppina, Pushpanjali; Hancock, William O.; Gelfand, Vladimir I.; Verhey, Kristen J.

    2016-01-01

    The human genome encodes 45 kinesin motor proteins that drive cell division, cell motility, intracellular trafficking and ciliary function. Determining the cellular function of each kinesin would benefit from specific small-molecule inhibitors. However, screens have yielded only a few specific inhibitors. Here we present a novel chemical-genetic approach to engineer kinesin motors that can carry out the function of the wild-type motor yet can also be efficiently inhibited by small, cell-permeable molecules. Using kinesin-1 as a prototype, we develop two independent strategies to generate inhibitable motors, and characterize the resulting inhibition in single-molecule assays and in cells. We further apply these two strategies to create analogously inhibitable kinesin-3 motors. These inhibitable motors will be of great utility to study the functions of specific kinesins in a dynamic manner in cells and animals. Furthermore, these strategies can be used to generate inhibitable versions of any motor protein of interest. PMID:27045608

  17. Engineered kinesin motor proteins amenable to small-molecule inhibition.

    PubMed

    Engelke, Martin F; Winding, Michael; Yue, Yang; Shastry, Shankar; Teloni, Federico; Reddy, Sanjay; Blasius, T Lynne; Soppina, Pushpanjali; Hancock, William O; Gelfand, Vladimir I; Verhey, Kristen J

    2016-01-01

    The human genome encodes 45 kinesin motor proteins that drive cell division, cell motility, intracellular trafficking and ciliary function. Determining the cellular function of each kinesin would benefit from specific small-molecule inhibitors. However, screens have yielded only a few specific inhibitors. Here we present a novel chemical-genetic approach to engineer kinesin motors that can carry out the function of the wild-type motor yet can also be efficiently inhibited by small, cell-permeable molecules. Using kinesin-1 as a prototype, we develop two independent strategies to generate inhibitable motors, and characterize the resulting inhibition in single-molecule assays and in cells. We further apply these two strategies to create analogously inhibitable kinesin-3 motors. These inhibitable motors will be of great utility to study the functions of specific kinesins in a dynamic manner in cells and animals. Furthermore, these strategies can be used to generate inhibitable versions of any motor protein of interest. PMID:27045608

  18. Caenorhabditis elegans chemical biology: lessons from small molecules

    Technology Transfer Automated Retrieval System (TEKTRAN)

    How can we complement Caenorhabditis elegans genomics and proteomics with a comprehensive structural and functional annotation of its metabolome? Several lines of evidence indicate that small molecules of largely undetermined structure play important roles in C. elegans biology, including key pathw...

  19. Small Molecules Take A Big Step Against Clostridium difficile.

    PubMed

    Beilhartz, Greg L; Tam, John; Melnyk, Roman A

    2015-12-01

    Effective treatment of Clostridium difficile infections demands a shift away from antibiotics towards toxin-neutralizing agents. Work by Bender et al., using a drug that attenuates toxin action in vivo without affecting bacterial survival, demonstrates the exciting potential of small molecules as a new modality in the fight against C. difficile. PMID:26547239

  20. Small Molecule Ligands for Bulged RNA Secondary Structures

    PubMed Central

    Meyer, S. Todd; Hergenrother, Paul J.

    2016-01-01

    A class of wedge-shaped small molecules has been designed, synthesized, and shown to bind bulged RNA secondary structures. These minimally cationic ligands exhibit good affinity and selectivity for certain RNA bulges as demonstrated in a fluorescent intercalator displacement assay. PMID:19678613

  1. Design of a small molecule against an oncogenic noncoding RNA.

    PubMed

    Velagapudi, Sai Pradeep; Cameron, Michael D; Haga, Christopher L; Rosenberg, Laura H; Lafitte, Marie; Duckett, Derek R; Phinney, Donald G; Disney, Matthew D

    2016-05-24

    The design of precision, preclinical therapeutics from sequence is difficult, but advances in this area, particularly those focused on rational design, could quickly transform the sequence of disease-causing gene products into lead modalities. Herein, we describe the use of Inforna, a computational approach that enables the rational design of small molecules targeting RNA to quickly provide a potent modulator of oncogenic microRNA-96 (miR-96). We mined the secondary structure of primary microRNA-96 (pri-miR-96) hairpin precursor against a database of RNA motif-small molecule interactions, which identified modules that bound RNA motifs nearby and in the Drosha processing site. Precise linking of these modules together provided Targaprimir-96 (3), which selectively modulates miR-96 production in cancer cells and triggers apoptosis. Importantly, the compound is ineffective on healthy breast cells, and exogenous overexpression of pri-miR-96 reduced compound potency in breast cancer cells. Chemical Cross-Linking and Isolation by Pull-Down (Chem-CLIP), a small-molecule RNA target validation approach, shows that 3 directly engages pri-miR-96 in breast cancer cells. In vivo, 3 has a favorable pharmacokinetic profile and decreases tumor burden in a mouse model of triple-negative breast cancer. Thus, rational design can quickly produce precision, in vivo bioactive lead small molecules against hard-to-treat cancers by targeting oncogenic noncoding RNAs, advancing a disease-to-gene-to-drug paradigm. PMID:27170187

  2. Small molecule MALDI MS imaging: Current technologies and future challenges.

    PubMed

    Trim, Paul J; Snel, Marten F

    2016-07-15

    Imaging of specific small molecules is particularly challenging using conventional optical microscopy techniques. This has led to the development of alternative imaging modalities, including mass spectrometry (MS)-based methods. This review aims to provide an overview of the technologies, methods and future directions of laser-based mass spectrometry imaging (MSI) of small molecules. In particular it will focus on matrix-assisted laser desorption/ionization (MALDI) as the ion source, although other laser mass spectrometry methods will also be discussed to provide context, both historical and current. Small molecule MALDI MSI has been performed on a wide variety of instrument platforms: these are reviewed, as are the laser systems that are commonly used in this technique. Instrumentation and methodology cross over in the areas of achieving optimal spatial resolution, a key parameter in obtaining meaningful data. Also discussed is sample preparation, which is pivotal in maintaining sample integrity, providing a true reflection of the distribution of analytes, spatial resolution and sensitivity. Like all developing analytical techniques there are challenges to be overcome. Two of these are dealing with sample complexity and obtaining quantitative information from an imaging experiment. Both of these topics are addressed. Finally, novel experiments including non-MALDI laser ionization techniques are highlighted and a future perspective on the role of MALDI MSI in the small molecule arena is provided. PMID:26804564

  3. Graphene-Enhanced Raman Scattering from the Adenine Molecules.

    PubMed

    Dolgov, Leonid; Pidhirnyi, Denys; Dovbeshko, Galyna; Lebedieva, Tetiana; Kiisk, Valter; Heinsalu, Siim; Lange, Sven; Jaaniso, Raivo; Sildos, Ilmo

    2016-12-01

    An enhanced Raman scattering from a thin layer of adenine molecules deposited on graphene substrate was detected. The value of enhancement depends on the photon energy of the exciting light. The benzene ring in the structure of adenine molecule suggests π-stacking of adenine molecule on top of graphene. So, it is proposed that the enhancement in the adenine Raman signal is explained by the resonance electron transfer from the Fermi level of graphene to the lowest unoccupied molecular orbital (LUMO) level of adenine. PMID:27075339

  4. Graphene-Enhanced Raman Scattering from the Adenine Molecules

    NASA Astrophysics Data System (ADS)

    Dolgov, Leonid; Pidhirnyi, Denys; Dovbeshko, Galyna; Lebedieva, Tetiana; Kiisk, Valter; Heinsalu, Siim; Lange, Sven; Jaaniso, Raivo; Sildos, Ilmo

    2016-04-01

    An enhanced Raman scattering from a thin layer of adenine molecules deposited on graphene substrate was detected. The value of enhancement depends on the photon energy of the exciting light. The benzene ring in the structure of adenine molecule suggests π-stacking of adenine molecule on top of graphene. So, it is proposed that the enhancement in the adenine Raman signal is explained by the resonance electron transfer from the Fermi level of graphene to the lowest unoccupied molecular orbital (LUMO) level of adenine.

  5. Unraveling plant hormone signaling through the use of small molecules

    PubMed Central

    Rigal, Adeline; Ma, Qian; Robert, Stéphanie

    2014-01-01

    Plants have acquired the capacity to grow continuously and adjust their morphology in response to endogenous and external signals, leading to a high architectural plasticity. The dynamic and differential distribution of phytohormones is an essential factor in these developmental changes. Phytohormone perception is a fast but complex process modulating specific developmental reprogramming. In recent years, chemical genomics or the use of small molecules to modulate target protein function has emerged as a powerful strategy to study complex biological processes in plants such as hormone signaling. Small molecules can be applied in a conditional, dose-dependent and reversible manner, with the advantage of circumventing the limitations of lethality and functional redundancy inherent to traditional mutant screens. High-throughput screening of diverse chemical libraries has led to the identification of bioactive molecules able to induce plant hormone-related phenotypes. Characterization of the cognate targets and pathways of those molecules has allowed the identification of novel regulatory components, providing new insights into the molecular mechanisms of plant hormone signaling. An extensive structure-activity relationship (SAR) analysis of the natural phytohormones, their designed synthetic analogs and newly identified bioactive molecules has led to the determination of the structural requirements essential for their bioactivity. In this review, we will summarize the so far identified small molecules and their structural variants targeting specific phytohormone signaling pathways. We will highlight how the SAR analyses have enabled better interrogation of the molecular mechanisms of phytohormone responses. Finally, we will discuss how labeled/tagged hormone analogs can be exploited, as compelling tools to better understand hormone signaling and transport mechanisms. PMID:25126092

  6. Disordered Binding of Small Molecules to Aβ(12–28)*

    PubMed Central

    Convertino, Marino; Vitalis, Andreas; Caflisch, Amedeo

    2011-01-01

    In recent years, an increasing number of small molecules and short peptides have been identified that interfere with aggregation and/or oligomerization of the Alzheimer β-amyloid peptide (Aβ). Many of them possess aromatic moieties, suggesting a dominant role for those in interacting with Aβ along various stages of the aggregation process. In this study, we attempt to elucidate whether interactions of such aromatic inhibitors with monomeric Aβ(12–28) point to a common mechanism of action by performing atomistic molecular dynamics simulations at equilibrium. Our results suggest that, independently of the presence of inhibitors, monomeric Aβ(12–28) populates a partially collapsed ensemble that is largely devoid of canonical secondary structure at 300 K and neutral pH. The small molecules have different affinities for Aβ(12–28) that can be partially rationalized by the balance of aromatic and charged moieties constituting the molecules. There are no predominant binding modes, although aggregation inhibitors preferentially interact with the N-terminal portion of the fragment (residues 13–20). Analysis of the free energy landscape of Aβ(12–28) reveals differences highlighted by altered populations of a looplike conformer in the presence of inhibitors. We conclude that intrinsic disorder of Aβ persists at the level of binding small molecules and that inhibitors can significantly alter properties of monomeric Aβ via multiple routes of differing specificity. PMID:21969380

  7. Small Molecule Approach to Study the Function of Mitotic Kinesins.

    PubMed

    Al-Obaidi, Naowras; Kastl, Johanna; Mayer, Thomas U

    2016-01-01

    Mitotic motor proteins of the kinesin superfamily are critical for the faithful segregation of chromosomes and the formation of the two daughter cells during meiotic and mitotic M-phase. Of the 45 human kinesins, roughly a dozen are involved in the assembly of the bipolar spindle, alignment of chromosomes at the spindle equator, chromosome segregation, and cytokinesis. The functions of kinesins in these processes are highly diverse and include the transport of cargo molecules, sliding and bundling of microtubules, and regulation of microtubule dynamics. In light of this multitude of diverse functions and the complex functional interplay of different kinesins during M-phase, it is not surprising that one of the greatest challenges in cell biology is the functional dissection of individual motor proteins. Reversible and fast acting small molecules are powerful tools to accomplish this challenge. However, the validity of conclusions drawn from small molecule studies strictly depends on compound specificity. In this chapter, we present methods for the identification of small molecule inhibitors of a motor protein of interest. In particular, we focus on a protein-based large throughput screen to identify inhibitors of the ATPase activity of kinesins. Furthermore, we provide protocols and guidelines for secondary screens to validate hits and select for specific inhibitors. PMID:27193856

  8. Intercalation of small hydrophobic molecules in lipid bilayers containing cholesterol

    SciTech Connect

    Worcester, D.L.; Hamacher, K.; Kaiser, H.; Kulasekere, R.; Torbet, J.

    1994-12-31

    Partitioning of small hydrophobic molecules into lipid bilayers containing cholesterol has been studied using the 2XC diffractometer at the University of Missouri Research Reactor. Locations of the compounds were determined by Fourier difference methods with data from both deuterated and undeuterated compounds introduced into the bilayers from the vapor phase. Data fitting procedures were developed for determining how well the compounds were localized. The compounds were found to be localized in a narrow region at the center of the hydrophobic layer, between the two halves of the bilayer. The structures are therefore intercalated structures with the long axis of the molecules in the plane of the bilayer.

  9. Spectroscopic and dynamical studies of highly energized small polyatomic molecules

    SciTech Connect

    Field, R.W.; Silbey, R.J.

    1990-01-01

    The formyl radical and the acetylene molecule were chosen for these studies. The visible and fluorescence spectra of the formyl radical were recorded, and the spectral results are used as a basis to explain the electronic structure. Optical-optical double resonance studies of acetylene were recorded, and the spectral results are interpreted. The results of Zeeman and Stark anticrossing and quantum beat studies of acetylene are reported, and they provide an unusually detailed view of both Intersystem Crossing and Internal Conversion in small polyatomic molecules. 22 references are cited as resulting from Department of Energy sponsorship of this project.

  10. Intercalation of small hydrophobic molecules in lipid bilayers containing cholesterol.

    PubMed

    Worcester, D L; Hamacher, K; Kaiser, H; Kulasekere, R; Torbet, J

    1996-01-01

    Partitioning of small hydrophobic molecules into lipid bilayers containing cholesterol has been studied using the 2XC diffractometer at the University of Missouri Research Reactor. Locations of the compounds were determined by Fourier difference methods with data from both deuterated and undeuterated compounds introduced into the bilayers from the vapor phase. Data fitting procedures were developed for determining how well the compounds were localized. The compounds were found to be localized in a narrow region at the center of the hydrophobic layer, between the two halves of the bilayer. The structures are therefore intercalated structures with the long axis of the molecules in the plane of the bilayer. PMID:9031514

  11. Validating and understanding ring conformations using small molecule crystallographic data.

    PubMed

    Cottrell, Simon J; Olsson, Tjelvar S G; Taylor, Robin; Cole, Jason C; Liebeschuetz, John W

    2012-04-23

    Understanding the conformational preferences of ring structures is fundamental to structure-based drug design. Although the Cambridge Structural Database (CSD) provides information on the preferred conformations of small molecules, analyzing this data can be very time-consuming. In order to overcome this hurdle, tools have been developed for quickly extracting geometrical preferences from the CSD. Here we describe how the program Mogul has been extended to analyze and compare ring conformations, using a library derived from over 900 000 ring fragments in the CSD. We illustrate how these can be used to understand the conformational preferences of molecules in a crystal lattice and bound to proteins. PMID:22372622

  12. Getting Across the Cell Membrane: An Overview for Small Molecules, Peptides, and Proteins

    PubMed Central

    Yang, Nicole J.; Hinner, Marlon J.

    2016-01-01

    The ability to efficiently access cytosolic proteins is desired in both biological research and medicine. However, targeting intracellular proteins is often challenging, because to reach the cytosol, exogenous molecules must first traverse the cell membrane. This review provides a broad overview of how certain molecules are thought to cross this barrier, and what kinds of approaches are being made to enhance the intracellular delivery of those that are impermeable. We first discuss rules that govern the passive permeability of small molecules across the lipid membrane, and mechanisms of membrane transport that have evolved in nature for certain metabolites, peptides, and proteins. Then, we introduce design strategies that have emerged in the development of small molecules and peptides with improved permeability. Finally, intracellular delivery systems that have been engineered for protein payloads are surveyed. Viewpoints from varying disciplines have been brought together to provide a cohesive overview of how the membrane barrier is being overcome. PMID:25560066

  13. Small and Large Molecules in the Diffuse Interstellar Medium

    NASA Astrophysics Data System (ADS)

    Oka, Takeshi; Huang, Jane

    2014-06-01

    Although molecules with a wide range of sizes exist in dense clouds (e.g. H(C≡C)_nC≡N with n = 0 - 5), molecules identified in diffuse clouds are all small ones. Since the initial discovery of CH, CN, and CH^+, all molecules detected in the optical region are diatomics except for H_3^+ in the infrared and C_3 in the visible. Radio observations have been limited up to triatomic molecules except for H_2CO and the ubiquitous C_3H_2. The column densities of all molecules are less than 1014 cm-2 with the two exceptions of CO and H_3^+ as well as CH and C_2 in a few special sightlines. Larger molecules with many carbon atoms have been searched for but have not been detected. On the other hand, the observations of a great many diffuse interstellar bands (380 toward HD 204827 and 414 toward HD 183143) with equivalent widths from 1 to 5700 m Å indicate high column densities of many heavy molecules. If an electronic transition dipole moment of 1 Debye is assumed, the observed equivalent widths translate to column densities from 5 × 1011 cm-2 to 3 × 1015 cm-2. It seems impossible that these large molecules are formed from chemical reactions in space from small molecules. It is more likely that they are fragments of aggregates, perhaps mixed aromatic/aliphatic organic nanoparticles (MAONS). MAONS and their large fragment molecules are stable against photodissociation in the diffuse ISM because the energy of absorbed photons is divided into statistical distributions of vibrational energy and emitted in the infrared rather than breaking a chemical bond. We use a simple Rice-Ramsperger-Kassel-Marcus theory to estimate the molecular size required for the stabilization. Snow, T. P. & McCall, B. J. 2006, ARA&A, 44 367 Hobbs, L. M., York, D. G., Snow, T. P., Oka, T., Thorburn, J. A., et al. 2008, ApJ, 680 1256 Hobbs, L. M., York, D. G., Thorburn, J. A., Snow, T. P., Bishof, M., et al. 2009, ApJ, 705 32 Kwok, S. & Zhang, S. 2013, ApJ, 771 5 Freed, K. F., Oka, T., & Suzuki, H

  14. Computational design of protein-small molecule interfaces.

    PubMed

    Allison, Brittany; Combs, Steven; DeLuca, Sam; Lemmon, Gordon; Mizoue, Laura; Meiler, Jens

    2014-02-01

    The computational design of proteins that bind small molecule ligands is one of the unsolved challenges in protein engineering. It is complicated by the relatively small size of the ligand which limits the number of intermolecular interactions. Furthermore, near-perfect geometries between interacting partners are required to achieve high binding affinities. For apolar, rigid small molecules the interactions are dominated by short-range van der Waals forces. As the number of polar groups in the ligand increases, hydrogen bonds, salt bridges, cation-π, and π-π interactions gain importance. These partial covalent interactions are longer ranged, and additionally, their strength depends on the environment (e.g. solvent exposure). To assess the current state of protein-small molecule interface design, we benchmark the popular computer algorithm Rosetta on a diverse set of 43 protein-ligand complexes. On average, we achieve sequence recoveries in the binding site of 59% when the ligand is allowed limited reorientation, and 48% when the ligand is allowed full reorientation. When simulating the redesign of a protein binding site, sequence recovery among residues that contribute most to binding was 52% when slight ligand reorientation was allowed, and 27% when full ligand reorientation was allowed. As expected, sequence recovery correlates with ligand displacement. PMID:23962892

  15. A general strategy to construct small molecule biosensors in eukaryotes

    DOE PAGESBeta

    Feng, Justin; Jester, Benjamin W.; Tinberg, Christine E.; Mandell, Daniel J.; Antunes, Mauricio S.; Chari, Raj; Morey, Kevin J.; Rios, Xavier; Medford, June I.; Church, George M.; et al

    2015-12-29

    Biosensors for small molecules can be used in applications that range from metabolic engineering to orthogonal control of transcription. Here, we produce biosensors based on a ligand-binding domain (LBD) by using a method that, in principle, can be applied to any target molecule. The LBD is fused to either a fluorescent protein or a transcriptional activator and is destabilized by mutation such that the fusion accumulates only in cells containing the target ligand. We illustrate the power of this method by developing biosensors for digoxin and progesterone. Addition of ligand to yeast, mammalian, or plant cells expressing a biosensor activatesmore » transcription with a dynamic range of up to ~100-fold. We use the biosensors to improve the biotransformation of pregnenolone to progesterone in yeast and to regulate CRISPR activity in mammalian cells. This work provides a general methodology to develop biosensors for a broad range of molecules in eukaryotes.« less

  16. Systems-based discovery of tomatidine as a natural small molecule inhibitor of skeletal muscle atrophy.

    PubMed

    Dyle, Michael C; Ebert, Scott M; Cook, Daniel P; Kunkel, Steven D; Fox, Daniel K; Bongers, Kale S; Bullard, Steven A; Dierdorff, Jason M; Adams, Christopher M

    2014-05-23

    Skeletal muscle atrophy is a common and debilitating condition that lacks an effective therapy. To address this problem, we used a systems-based discovery strategy to search for a small molecule whose mRNA expression signature negatively correlates to mRNA expression signatures of human skeletal muscle atrophy. This strategy identified a natural small molecule from tomato plants, tomatidine. Using cultured skeletal myotubes from both humans and mice, we found that tomatidine stimulated mTORC1 signaling and anabolism, leading to accumulation of protein and mitochondria, and ultimately, cell growth. Furthermore, in mice, tomatidine increased skeletal muscle mTORC1 signaling, reduced skeletal muscle atrophy, enhanced recovery from skeletal muscle atrophy, stimulated skeletal muscle hypertrophy, and increased strength and exercise capacity. Collectively, these results identify tomatidine as a novel small molecule inhibitor of muscle atrophy. Tomatidine may have utility as a therapeutic agent or lead compound for skeletal muscle atrophy. PMID:24719321

  17. Inkjet printing of photopolymerizable small molecules for OLED applications

    NASA Astrophysics Data System (ADS)

    Olivier, Simon; Derue, Lionel; Geffroy, Bernard; Ishow, Eléna; Maindron, Tony

    2015-09-01

    The elaboration of organic light-emitting diodes (OLEDs) via a solution deposition process turns out to be a cheaper alternative to the vacuum evaporation technique. However the most popular spin-coating wet deposition process mainly used in the semiconductor industry is not applicable for large mother glass substrates used in display applications. The inkjet technology addresses this drawback and appears to be a good solution to produce on a large scale wet deposited OLEDs1. This process has been commonly used for polymer deposition and only a few examples2-4 have demonstrated the possibility of depositing small molecules in functional devices. Deposition of small molecules from inkjet printing is supposed to be easier than polymers because monomers do not show polydispersity and consequently the viscosity of the solution containing the monomers, the ink, is easily controllable in production. This work aims at fabricating OLEDs composed of inkjet-printed hole-transporting molecules and a new class of fluorescent molecules that have been further UV-photopolymerized right after deposition.

  18. Small molecules with antiviral activity against the Ebola virus

    PubMed Central

    Litterman, Nadia; Lipinski, Christopher; Ekins, Sean

    2015-01-01

    The recent outbreak of the Ebola virus in West Africa has highlighted the clear shortage of broad-spectrum antiviral drugs for emerging viruses. There are numerous FDA approved drugs and other small molecules described in the literature that could be further evaluated for their potential as antiviral compounds. These molecules are in addition to the few new antivirals that have been tested in Ebola patients but were not originally developed against the Ebola virus, and may play an important role as we await an effective vaccine. The balance between using FDA approved drugs versus novel antivirals with minimal safety and no efficacy data in humans should be considered. We have evaluated 55 molecules from the perspective of an experienced medicinal chemist as well as using simple molecular properties and have highlighted 16 compounds that have desirable qualities as well as those that may be less desirable. In addition we propose that a collaborative database for sharing such published and novel information on small molecules is needed for the research community studying the Ebola virus. PMID:25713700

  19. Small molecules with antiviral activity against the Ebola virus.

    PubMed

    Litterman, Nadia; Lipinski, Christopher; Ekins, Sean

    2015-01-01

    The recent outbreak of the Ebola virus in West Africa has highlighted the clear shortage of broad-spectrum antiviral drugs for emerging viruses. There are numerous FDA approved drugs and other small molecules described in the literature that could be further evaluated for their potential as antiviral compounds. These molecules are in addition to the few new antivirals that have been tested in Ebola patients but were not originally developed against the Ebola virus, and may play an important role as we await an effective vaccine. The balance between using FDA approved drugs versus novel antivirals with minimal safety and no efficacy data in humans should be considered. We have evaluated 55 molecules from the perspective of an experienced medicinal chemist as well as using simple molecular properties and have highlighted 16 compounds that have desirable qualities as well as those that may be less desirable. In addition we propose that a collaborative database for sharing such published and novel information on small molecules is needed for the research community studying the Ebola virus. PMID:25713700

  20. Probing small molecule microarrays with tagged proteins in cell lysates

    PubMed Central

    Pop, Marius S.; Wassaf, Dina; Koehler, Angela N.

    2014-01-01

    The technique of small-molecule microarray (SMM) screening is based on the ability of small molecules to bind to various soluble proteins. This type of interaction is easily detected by the presence of a fluorescence signal produced by labeled antibodies that specifically recognize a unique sequence (tag) present on the target protein. The fluorescent signal intensity values are determined based on signal-to-noise ratios (SNR). SMM screening is a high throughput, unbiased method that can rapidly identify novel direct ligands for various protein targets. This binding-based assay format is generally applicable to most proteins, but it is especially useful for protein targets that do not possess an enzymatic activity. SMMs enable screening a protein in a purified form or in the context of a cellular lysate, likely providing a more physiologically relevant screening environment. PMID:25445177

  1. Fluorous photoaffinity labeling to probe protein-small molecule interactions.

    PubMed

    Huang, Weigang; Zhang, Qisheng

    2015-01-01

    Identifying cellular targets of bioactive small molecules is essential for their applications as chemical probes or drug candidates. Of equal importance is to determine their "off-target" interactions, which usually account for unwanted properties including toxicity. Among strategies to profile small molecule-interacting proteins, photoaffinity labeling has been widely used because of its distinct advantages such as sensitivity. When combined with mass spectrometry, this approach can provide additional structural and mechanistic information, such as drug-target stoichiometry and exact interacting amino acid residues. We have described a novel fluorous photoaffinity labeling approach, in which a fluorous tag is incorporated into the photoaffinity labeling reagent to enable the enrichment of the labeled species from complex mixtures for analysis. This new feature likely makes the fluorous photoaffinity labeling approach suitable to identify transient interactions, and low-abundant, low-affinity interacting proteins in a cellular environment. PMID:25618351

  2. Zebrafish small molecule screen in reprogramming/cell fate modulation

    PubMed Central

    Munson, Kathleen M.; Yeh, Jing-Ruey J.

    2010-01-01

    Embryonic zebrafish have long been used for lineage tracing studies. In zebrafish embryos, the cell fate identities can be determined by whole-mount in situ hybridization, or by visualization of live embryos if using fluorescent reporter lines. We use embryonic zebrafish to study the effects of a leukemic oncogene AML1-ETO on modulating hematopoietic cell fate. Induced expression of AML1-ETO is able to efficiently reprogram hematopoietic progenitor cells from erythroid to myeloid cell fate. Using the zebrafish model of AML1-ETO, we performed a chemical screen to identify small molecules that suppress the cell fate switch in the presence of AML1-ETO. The methods discussed herein may be broadly applicable for identifying small molecules that modulate other cell fate decisions. PMID:20336532

  3. Improved abiotic stress tolerance of bermudagrass by exogenous small molecules.

    PubMed

    Chan, Zhulong; Shi, Haitao

    2015-01-01

    As a widely used warm-season turfgrass in landscapes and golf courses, bermudagrass encounters multiple abiotic stresses during the growth and development. Physiology analysis indicated that abiotic stresses induced the accumulation of ROS and decline of photosynthesis, resulting in increased cell damage and inhibited growth. Proteomic and metabolomic approaches showed that antioxidant enzymes and osmoprotectant contents (sugar, sucrose, dehydrin, proline) were extensively changed under abiotic stress conditions. Exogenous application of small molecules, such as ABA, NO, CaCl2, H2S, polyamine and melatonin, could effectively alleviate damages caused by multiple abiotic stresses, including drought, salt, heat and cold. Based on high through-put RNA seq analysis, genes involved in ROS, transcription factors, hormones, and carbohydrate metabolisms were largely enriched. The data indicated that small molecules induced the accumulation of osmoprotectants and antioxidants, kept cell membrane integrity, increased photosynthesis and kept ion homeostasis, which protected bermudagrass from damages caused by abiotic stresses. PMID:25757363

  4. Allosteric Small-Molecule Inhibitors of the AKT Kinase

    NASA Astrophysics Data System (ADS)

    Dalafave, D. S.

    This research addresses computational design of small druglike molecules for possible anticancer applications. AKT and SGK are kinases that control important cellular functions. They are highly homologous, having similar activators and targets. Cancers with increased SGK activity may develop resistance to AKT-specific inhibitors. Our goal was to design new molecules that would bind both AKT and SGK, thus preventing the development of drug resistance. Most kinase inhibitors target the kinase ATP-binding site. However, the high similarity in this site among kinases makes it difficult to target specifically. Furthermore, mutations in this site can cause resistance to ATP-competitive kinase inhibitors. We used existing AKT inhibitors as initial templates to design molecules that could potentially bind the allosteric sites of both AKT and SGK. Molecules with no implicit toxicities and optimal drug-like properties were used for docking studies. Binding energies of the stable complexes that the designed molecules formed with AKT and SGK were calculated. Possible applications of the designed putative inhibitors against cancers with overexpressed AKT/SGK is discussed.

  5. Automation of AMOEBA polarizable force field parameterization for small molecules

    PubMed Central

    Wu, Johnny C.; Chattree, Gaurav

    2012-01-01

    A protocol to generate parameters for the AMOEBA polarizable force field for small organic molecules has been established, and polarizable atomic typing utility, Poltype, which fully automates this process, has been implemented. For validation, we have compared with quantum mechanical calculations of molecular dipole moments, optimized geometry, electrostatic potential, and conformational energy for a variety of neutral and charged organic molecules, as well as dimer interaction energies of a set of amino acid side chain model compounds. Furthermore, parameters obtained in gas phase are substantiated in liquid-phase simulations. The hydration free energy (HFE) of neutral and charged molecules have been calculated and compared with experimental values. The RMS error for the HFE of neutral molecules is less than 1 kcal/mol. Meanwhile, the relative error in the predicted HFE of salts (cations and anions) is less than 3% with a correlation coefficient of 0.95. Overall, the performance of Poltype is satisfactory and provides a convenient utility for applications such as drug discovery. Further improvement can be achieved by the systematic study of various organic compounds, particularly ionic molecules, and refinement and expansion of the parameter database. PMID:22505837

  6. Prioritizing Cancer Therapeutic Small Molecules by Integrating Multiple OMICS Datasets

    PubMed Central

    Lv, Sali; Xu, Yanjun; Chen, Xin; Li, Yan; Li, Ronghong; Wang, Qianghu

    2012-01-01

    Abstract Drug design is crucial for the effective discovery of anti-cancer drugs. The success or failure of drug design often depends on the leading compounds screened in pre-clinical studies. Many efforts, such as in vivo animal experiments and in vitro drug screening, have improved this process, but these methods are usually expensive and laborious. In the post-genomics era, it is possible to seek leading compounds for large-scale candidate small-molecule screening with multiple OMICS datasets. In the present study, we developed a computational method of prioritizing small molecules as leading compounds by integrating transcriptomics and toxicogenomics data. This method provides priority lists for the selection of leading compounds, thereby reducing the time required for drug design. We found 11 known therapeutic small molecules for breast cancer in the top 100 candidates in our list, 2 of which were in the top 10. Furthermore, another 3 of the top 10 small molecules were recorded as closely related to cancer treatment in the DrugBank database. A comparison of the results of our approach with permutation tests and shared gene methods demonstrated that our OMICS data-based method is quite competitive. In addition, we applied our method to a prostate cancer dataset. The results of this analysis indicated that our method surpasses both the shared gene method and random selection. These analyses suggest that our method may be a valuable tool for directing experimental studies in cancer drug design, and we believe this time- and cost-effective computational strategy will be helpful in future studies in cancer therapy. PMID:22917481

  7. High resolution studies of atoms and small molecules

    SciTech Connect

    Bushaw, B.A.; Tonkyn, R.G.; Miller, R.J.

    1992-10-01

    High resolution, continuous wave lasers have been utilized successfully in studies of small molecules. Examples of two-photon excitation schemes and of multiple resonance excitation sequences will be discussed within the framework of the spectroscopy and dynamics of selected Rydberg states of nitric oxide. Initial results on the circular dichroism of angular distributions in photoelectron spectra of individual hyperfine states of cesium will also be discussed, but no data given.

  8. Polymer and small molecule based hybrid light source

    DOEpatents

    Choong, Vi-En; Choulis, Stelios; Krummacher, Benjamin Claus; Mathai, Mathew; So, Franky

    2010-03-16

    An organic electroluminescent device, includes: a substrate; a hole-injecting electrode (anode) coated over the substrate; a hole injection layer coated over the anode; a hole transporting layer coated over the hole injection layer; a polymer based light emitting layer, coated over the hole transporting layer; a small molecule based light emitting layer, thermally evaporated over the polymer based light emitting layer; and an electron-injecting electrode (cathode) deposited over the electroluminescent polymer layer.

  9. Chemical detoxification of small molecules by C. elegans

    PubMed Central

    Stupp, Gregory S.; von Reuss, Stephan H.; Izrayelit, Yevgeniy; Ajredini, Ramadan; Schroeder, Frank C.; Edison, Arthur S.

    2012-01-01

    Caenorhabditis elegans lives in compost and decaying fruit, eats bacteria and is exposed to pathogenic microbes. We show that C. elegans is able to modify diverse microbial small-molecule toxins via both O-and N-glucosylation as well as unusual 3′-O-phosphorylation of the resulting glucosides. The resulting glucosylated derivatives have significantly reduced toxicity to C. elegans, suggesting that these chemical modifications represent a general mechanism for worms to detoxify their environments. PMID:23163740

  10. Recent advances in small molecule OLED-on-silicon microdisplays

    NASA Astrophysics Data System (ADS)

    Ghosh, Amalkumar P.; Ali, Tariq A.; Khayrullin, Ilyas; Vazan, Fridrich; Prache, Olivier F.; Wacyk, Ihor

    2009-08-01

    High resolution OLED-on-silicon microdisplay technology is unique and challenging since it requires very small subpixel dimensions (~ 2-5 microns). eMagin's OLED microdisplay is based on white top emitter architecture using small molecule organic materials. The devices are fabricated using high Tg materials. The devices are hermetically sealed with vacuum deposited thin film layers. LCD-type color filters are patterned using photolithography methods to generate primary R, G, B colors. Results of recent improvements in the OLED-on-silicon microdisplay technology, with emphasis on efficiencies, lifetimes, grey scale and CIE color coordinates for SVGA and SXGA resolution microdisplays is presented.

  11. Enhanced Raman scattering of biological molecules

    NASA Astrophysics Data System (ADS)

    Montoya, Joseph R.

    The results presented in this thesis, originate from the aspiration to develop an identification algorithm for Salmonella enterica Serovar Enteritidis (S. enterica), Escherichia coli (E. coli), Bacillus globigii ( B. globigii), and Bacillus megaterium ( B. megaterium) using "enhanced" Raman scattering. We realized our goal, with a method utilizing an immunoassay process in a spectroscopic technique, and the direct use of the enhanced spectral response due to bacterial surface elements. The enhanced Raman signal originates from Surface Enhanced Raman Scattering (SERS) and/or Morphological Dependent Resonances (MDR's). We utilized a modified Lee-Meisel colloidal production method to produce a SERS active substrate, which was applied to a SERS application for the amino acid Glycine. The comparison indicates that the SERS/FRACTAL/MDR process can produce an increase of 107 times more signal than the bulk Raman signal from Glycine. In the extension of the Glycine results, we studied the use of SERS related to S. enterica, where we have shown that the aromatic amino acid contribution from Phenylalanine, Tyrosine, and Tryptophan produces a SERS response that can be used to identify the associated SERS vibrational modes of a S. enterica one or two antibody complexes. The "fingerprint" associated with the spectral signature in conjunction with an enhanced Raman signal allows conclusions to be made: (1) about the orientation of the secondary structure on the metal; (2) whether bound/unbound antibody can be neglected; (3) whether we can lower the detection limit. We have lowered the detection limit of S. enterica to 106 bacteria/ml. We also show a profound difference between S. enterica and E. coli SERS spectra even when there exists non-specific binding on E. coli indicating a protein conformation change induced by the addition of the antigen S. enterica. We confirm TEM imagery data, indicating that the source of the aromatic amino acid SERS response is originating from

  12. Examining small molecule: HIV RNA interactions using arrayed imaging reflectometry

    NASA Astrophysics Data System (ADS)

    Chaimayo, Wanaruk; Miller, Benjamin L.

    2014-03-01

    Human Immunodeficiency Virus (HIV) has been the subject of intense research for more than three decades as it causes an uncurable disease: Acquired Immunodeficiency Syndrome, AIDS. In the pursuit of a medical treatment, RNAtargeted small molecules are emerging as promising targets. In order to understand the binding kinetics of small molecules and HIV RNA, association (ka) and dissociation (kd) kinetic constants must be obtained, ideally for a large number of sequences to assess selectivity. We have developed Aqueous Array Imaged Reflectometry (Aq-AIR) to address this challenge. Using a simple light interference phenomenon, Aq-AIR provides real-time high-throughput multiplex capabilities to detect binding of targets to surface-immobilized probes in a label-free microarray format. The second generation of Aq-AIR consisting of high-sensitivity CCD camera and 12-μL flow cell was fabricated. The system performance was assessed by real-time detection of MBNL1-(CUG)10 and neomycin B - HIV RNA bindings. The results establish this second-generation Aq-AIR to be able to examine small molecules binding to RNA sequences specific to HIV.

  13. Reprogramming with Small Molecules instead of Exogenous Transcription Factors.

    PubMed

    Lin, Tongxiang; Wu, Shouhai

    2015-01-01

    Induced pluripotent stem cells (iPSCs) could be employed in the creation of patient-specific stem cells, which could subsequently be used in various basic and clinical applications. However, current iPSC methodologies present significant hidden risks with respect to genetic mutations and abnormal expression which are a barrier in realizing the full potential of iPSCs. A chemical approach is thought to be a promising strategy for safety and efficiency of iPSC generation. Many small molecules have been identified that can be used in place of exogenous transcription factors and significantly improve iPSC reprogramming efficiency and quality. Recent studies have shown that the use of small molecules results in the generation of chemically induced pluripotent stem cells from mouse embryonic fibroblast cells. These studies might lead to new areas of stem cell research and medical applications, not only human iPSC by chemicals alone, but also safe generation of somatic stem cells for cell based clinical trials and other researches. In this paper, we have reviewed the recent advances in small molecule approaches for the generation of iPSCs. PMID:25922608

  14. Small-Molecule Hormones: Molecular Mechanisms of Action

    PubMed Central

    Budzińska, Monika

    2013-01-01

    Small-molecule hormones play crucial roles in the development and in the maintenance of an adult mammalian organism. On the molecular level, they regulate a plethora of biological pathways. Part of their actions depends on their transcription-regulating properties, exerted by highly specific nuclear receptors which are hormone-dependent transcription factors. Nuclear hormone receptors interact with coactivators, corepressors, basal transcription factors, and other transcription factors in order to modulate the activity of target genes in a manner that is dependent on tissue, age and developmental and pathophysiological states. The biological effect of this mechanism becomes apparent not earlier than 30–60 minutes after hormonal stimulus. In addition, small-molecule hormones modify the function of the cell by a number of nongenomic mechanisms, involving interaction with proteins localized in the plasma membrane, in the cytoplasm, as well as with proteins localized in other cellular membranes and in nonnuclear cellular compartments. The identity of such proteins is still under investigation; however, it seems that extranuclear fractions of nuclear hormone receptors commonly serve this function. A direct interaction of small-molecule hormones with membrane phospholipids and with mRNA is also postulated. In these mechanisms, the reaction to hormonal stimulus appears within seconds or minutes. PMID:23533406

  15. Torsional sensing of small-molecule binding using magnetic tweezers.

    PubMed

    Lipfert, Jan; Klijnhout, Sven; Dekker, Nynke H

    2010-11-01

    DNA-binding small molecules are widespread in the cell and heavily used in biological applications. Here, we use magnetic tweezers, which control the force and torque applied to single DNAs, to study three small molecules: ethidium bromide (EtBr), a well-known intercalator; netropsin, a minor-groove binding anti-microbial drug; and topotecan, a clinically used anti-tumor drug. In the low-force limit in which biologically relevant torques can be accessed (<10 pN), we show that ethidium intercalation lengthens DNA ∼1.5-fold and decreases the persistence length, from which we extract binding constants. Using our control of supercoiling, we measure the decrease in DNA twist per intercalation to be 27.3±1° and demonstrate that ethidium binding delays the accumulation of torsional stress in DNA, likely via direct reduction of the torsional modulus and torque-dependent binding. Furthermore, we observe that EtBr stabilizes the DNA duplex in regimes where bare DNA undergoes structural transitions. In contrast, minor groove binding by netropsin affects neither the contour nor persistence length significantly, yet increases the twist per base of DNA. Finally, we show that topotecan binding has consequences similar to those of EtBr, providing evidence for an intercalative binding mode. These insights into the torsional consequences of ligand binding can help elucidate the effects of small-molecule drugs in the cellular environment. PMID:20624816

  16. Small-molecule inhibitors of ricin and Shiga toxins.

    PubMed

    Wahome, Paul G; Robertus, Jon D; Mantis, Nicholas J

    2012-01-01

    This review summarizes the successes and continuing challenges associated with the identification of small-molecule inhibitors of ricin and Shiga toxins, members of the RNA N-glycosidase family of toxins that irreversibly inactivate eukaryotic ribosomes through the depurination of a conserved adenosine residue within the sarcin-ricin loop (SRL) of 28S rRNA. Virtual screening of chemical libraries has led to the identification of at least three broad classes of small molecules that bind in or near the toxin's active sites and thereby interfere with RNA N-glycosidase activity. Rational design is being used to improve the specific activity and solubility of a number of these compounds. High-throughput cell-based assays have also led to the identification of small molecules that partially, or in some cases, completely protect cells from ricin- and Shiga-toxin-induced death. A number of these recently identified compounds act on cellular proteins associated with intracellular trafficking or pro-inflammatory/cell death pathways, and one was reported to be sufficient to protect mice in a ricin challenge model. PMID:22006183

  17. Small Molecule Deubiquitinase Inhibitors Promote Macrophage Anti-Infective Capacity

    PubMed Central

    Charbonneau, Marie-Eve; Gonzalez-Hernandez, Marta J.; Showalter, Hollis D.; Donato, Nicholas J.; Wobus, Christiane E.; O’Riordan, Mary X. D.

    2014-01-01

    The global spread of anti-microbial resistance requires urgent attention, and diverse alternative strategies have been suggested to address this public health concern. Host-directed immunomodulatory therapies represent one approach that could reduce selection for resistant bacterial strains. Recently, the small molecule deubiquitinase inhibitor WP1130 was reported as a potential anti-infective drug against important human food-borne pathogens, notably Listeria monocytogenes and noroviruses. Utilization of WP1130 itself is limited due to poor solubility, but given the potential of this new compound, we initiated an iterative rational design approach to synthesize new derivatives with increased solubility that retained anti-infective activity. Here, we test a small library of novel synthetic molecules based on the structure of the parent compound, WP1130, for anti-infective activity in vitro. Our studies identify a promising candidate, compound 9, which reduced intracellular growth of L. monocytogenes at concentrations that caused minimal cellular toxicity. Compound 9 itself had no bactericidal activity and only modestly slowed Listeria growth rate in liquid broth culture, suggesting that this drug acts as an anti-infective compound by modulating host-cell function. Moreover, this new compound also showed anti-infective activity against murine norovirus (MNV-1) and human norovirus, using the Norwalk virus replicon system. This small molecule inhibitor may provide a chemical platform for further development of therapeutic deubiquitinase inhibitors with broad-spectrum anti-infective activity. PMID:25093325

  18. Small-Molecule Binding Aptamers: Selection Strategies, Characterization, and Applications

    PubMed Central

    Ruscito, Annamaria; DeRosa, Maria C.

    2016-01-01

    Aptamers are single-stranded, synthetic oligonucleotides that fold into 3-dimensional shapes capable of binding non-covalently with high affinity and specificity to a target molecule. They are generated via an in vitro process known as the Systematic Evolution of Ligands by EXponential enrichment, from which candidates are screened and characterized, and then used in various applications. These applications range from therapeutic uses to biosensors for target detection. Aptamers for small molecule targets such as toxins, antibiotics, molecular markers, drugs, and heavy metals will be the focus of this review. Their accurate detection is needed for the protection and wellbeing of humans and animals. However, the small molecular weights of these targets, including the drastic size difference between the target and the oligonucleotides, make it challenging to select, characterize, and apply aptamers for their detection. Thus, recent (since 2012) notable advances in small molecule aptamers, which have overcome some of these challenges, are presented here, while defining challenges that still exist are discussed. PMID:27242994

  19. Small-Molecule Binding Aptamers: Selection Strategies, Characterization, and Applications.

    PubMed

    Ruscito, Annamaria; DeRosa, Maria C

    2016-01-01

    Aptamers are single-stranded, synthetic oligonucleotides that fold into 3-dimensional shapes capable of binding non-covalently with high affinity and specificity to a target molecule. They are generated via an in vitro process known as the Systematic Evolution of Ligands by EXponential enrichment, from which candidates are screened and characterized, and then used in various applications. These applications range from therapeutic uses to biosensors for target detection. Aptamers for small molecule targets such as toxins, antibiotics, molecular markers, drugs, and heavy metals will be the focus of this review. Their accurate detection is needed for the protection and wellbeing of humans and animals. However, the small molecular weights of these targets, including the drastic size difference between the target and the oligonucleotides, make it challenging to select, characterize, and apply aptamers for their detection. Thus, recent (since 2012) notable advances in small molecule aptamers, which have overcome some of these challenges, are presented here, while defining challenges that still exist are discussed. PMID:27242994

  20. Turning ON Caspases with Genetics and Small Molecules

    PubMed Central

    Morgan, Charles W.; Julien, Olivier; Unger, Elizabeth K.; Shah, Nirao M.; Wells, James A.

    2014-01-01

    Caspases, aspartate-specific cysteine proteases, have fate-determining roles in many cellular processes including apoptosis, differentiation, neuronal remodeling, and inflammation (for review, see Yuan & Kroemer, 2010). There are a dozen caspases in humans alone, yet their individual contributions toward these phenotypes are not well understood. Thus, there has been considerable interest in activating individual caspases or using their activity to drive these processes in cells and animals. We envision that such experimental control of caspase activity can not only afford novel insights into fundamental biological problems but may also enable new models for disease and suggest possible routes to therapeutic intervention. In particular, localized, genetic, and small-molecule-controlled caspase activation has the potential to target the desired cell type in a tissue. Suppression of caspase activation is one of the hallmarks of cancer and thus there has been significant enthusiasm for generating selective small-molecule activators that could bypass upstream mutational events that prevent apoptosis. Here, we provide a practical guide that investigators have devised, using genetics or small molecules, to activate specific caspases in cells or animals. Additionally, we show genetically controlled activation of an executioner caspase to target the function of a defined group of neurons in the adult mammalian brain. PMID:24974291

  1. Reprogramming with Small Molecules instead of Exogenous Transcription Factors

    PubMed Central

    Wu, Shouhai

    2015-01-01

    Induced pluripotent stem cells (iPSCs) could be employed in the creation of patient-specific stem cells, which could subsequently be used in various basic and clinical applications. However, current iPSC methodologies present significant hidden risks with respect to genetic mutations and abnormal expression which are a barrier in realizing the full potential of iPSCs. A chemical approach is thought to be a promising strategy for safety and efficiency of iPSC generation. Many small molecules have been identified that can be used in place of exogenous transcription factors and significantly improve iPSC reprogramming efficiency and quality. Recent studies have shown that the use of small molecules results in the generation of chemically induced pluripotent stem cells from mouse embryonic fibroblast cells. These studies might lead to new areas of stem cell research and medical applications, not only human iPSC by chemicals alone, but also safe generation of somatic stem cells for cell based clinical trials and other researches. In this paper, we have reviewed the recent advances in small molecule approaches for the generation of iPSCs. PMID:25922608

  2. Characterizing aptamer small molecule interactions with backscattering interferometry.

    PubMed

    Kammer, Michael N; Olmsted, Ian R; Kussrow, Amanda K; Morris, Mark J; Jackson, George W; Bornhop, Darryl J

    2014-11-21

    Aptamers are segments of single-strand DNA or RNA used in a wide array of applications, including sensors, therapeutics, and cellular process regulators. Aptamers can bind many target species, including proteins, peptides, and small molecules (SM) with high affinity and specificity. They are advantageous because they can be identified in vitro by SELEX, produced rapidly and relatively economically using oligonucleotide synthesis. The use of aptamers as SM probes has experienced a recent rebirth, and because of their unique properties they represent an attractive alternative to antibodies. Current assay methodology for characterizing small molecule-aptamer binding is limited by either mass sensitivity, as in biolayer interferometry (BLI) and surface plasmon resonance (SPR), or the need for using a fluorophore, as in thermophoresis. Here we report that backscattering interferometry (BSI), a label-free and free-solution sensing technique, can be used to effectively characterize SM-aptamer interactions, providing Kd values on microliter sample quantities and at low nanomolar sensitivity. To demonstrate this capability we measured the aptamer affinity for three previously reported small molecules; bisphenol A, tenofovir, and epirubicin showing BSI provided values consistent with those published previously. We then quantified the Kd values for aptamers to ampicillin, tetracycline and norepinephrine. All measurements produced R(2) values >0.95 and an excellent signal to noise ratio at target concentrations that enable true Kd values to be obtained. No immobilization or labeling chemistry was needed, expediting the assay which is also insensitive to the large relative mass difference between the interacting molecules. PMID:25229067

  3. Saccharide sensing molecules having enhanced fluorescent properties

    DOEpatents

    Satcher Jr., Joe H.; Lane, Stephen M.; Darrow, Christopher B.; Cary, Douglas R.; Tran, Joe Anh

    2004-01-06

    The present invention provides formulae for fluorescent compounds that have a number of properties which make them uniquely suited for use in sensors of analytes such as saccharides. The advantageous fluorescent properties include favorable excitation wavelengths, emission wavelengths, fluorescence lifetimes, and photostability. Additional advantageous properties include enhanced aqueous solubility, as well as temperature and pH sensitivity. The compound comprises an aryl or a substituted phenyl botonic acid that acts as a substrate recognition component, a fluorescence switch component, and a fluorophore. Fluorescent compounds are described that are excited at wavelengths greater than 400 nm and emit at wavelengths greater than 450 nm, which is advantageous for optical transmission through skin. The fluorophore is typically selected from transition metal-ligand complexes and thiazine, oxazine, oxazone, or oxazine-one as well as anthracene compounds. The fluorescent compound can be immobilized in a glucose permeable biocompatible polymer matrix that is implantable below the skin.

  4. Composite microsphere-functionalized scaffold for the controlled release of small molecules in tissue engineering.

    PubMed

    Pandolfi, Laura; Minardi, Silvia; Taraballi, Francesca; Liu, Xeuwu; Ferrari, Mauro; Tasciotti, Ennio

    2016-01-01

    Current tissue engineering strategies focus on restoring damaged tissue architectures using biologically active scaffolds. The ideal scaffold would mimic the extracellular matrix of any tissue of interest, promoting cell proliferation and de novo extracellular matrix deposition. A plethora of techniques have been evaluated to engineer scaffolds for the controlled and targeted release of bioactive molecules to provide a functional structure for tissue growth and remodeling, as well as enhance recruitment and proliferation of autologous cells within the implant. Recently, novel approaches using small molecules, instead of growth factors, have been exploited to regulate tissue regeneration. The use of small synthetic molecules could be very advantageous because of their stability, tunability, and low cost. Herein, we propose a chitosan-gelatin scaffold functionalized with composite microspheres consisting of mesoporous silicon microparticles and poly(dl-lactic-co-glycolic acid) for the controlled release of sphingosine-1-phospate, a small molecule of interest. We characterized the platform with scanning electron microscopy, Fourier transform infrared spectroscopy, and confocal microscopy. Finally, the biocompatibility of this multiscale system was analyzed by culturing human mesenchymal stem cells onto the scaffold. The presented strategy establishes the basis of a versatile scaffold for the controlled release of small molecules and for culturing mesenchymal stem cells for regenerative medicine applications. PMID:26977286

  5. Composite microsphere-functionalized scaffold for the controlled release of small molecules in tissue engineering

    PubMed Central

    Pandolfi, Laura; Minardi, Silvia; Taraballi, Francesca; Liu, Xeuwu; Ferrari, Mauro; Tasciotti, Ennio

    2016-01-01

    Current tissue engineering strategies focus on restoring damaged tissue architectures using biologically active scaffolds. The ideal scaffold would mimic the extracellular matrix of any tissue of interest, promoting cell proliferation and de novo extracellular matrix deposition. A plethora of techniques have been evaluated to engineer scaffolds for the controlled and targeted release of bioactive molecules to provide a functional structure for tissue growth and remodeling, as well as enhance recruitment and proliferation of autologous cells within the implant. Recently, novel approaches using small molecules, instead of growth factors, have been exploited to regulate tissue regeneration. The use of small synthetic molecules could be very advantageous because of their stability, tunability, and low cost. Herein, we propose a chitosan–gelatin scaffold functionalized with composite microspheres consisting of mesoporous silicon microparticles and poly(dl-lactic-co-glycolic acid) for the controlled release of sphingosine-1-phospate, a small molecule of interest. We characterized the platform with scanning electron microscopy, Fourier transform infrared spectroscopy, and confocal microscopy. Finally, the biocompatibility of this multiscale system was analyzed by culturing human mesenchymal stem cells onto the scaffold. The presented strategy establishes the basis of a versatile scaffold for the controlled release of small molecules and for culturing mesenchymal stem cells for regenerative medicine applications. PMID:26977286

  6. A New Class of Pluripotent Stem Cell Cytotoxic Small Molecules

    PubMed Central

    Goh, Gwendoline Tze Wei; Seng, Eng Khuan; Guo, Xu Ming; Tan, Cherine Mei Fong; Chan, Woon-Khiong; Lee, Joel Mun Kin

    2014-01-01

    A major concern in Pluripotent Stem Cell (PSC)-derived cell replacement therapy is the risk of teratoma formation from contaminating undifferentiated cells. Removal of undifferentiated cells from differentiated cultures is an essential step before PSC-based cell therapies can be safely deployed in a clinical setting. We report a group of novel small molecules that are cytotoxic to PSCs. Our data indicates that these molecules are specific and potent in their activity allowing rapid eradication of undifferentiated cells. Experiments utilizing mixed PSC and primary human neuronal and cardiomyocyte cultures demonstrate that up to a 6-fold enrichment for specialized cells can be obtained without adversely affecting cell viability and function. Several structural variants were synthesized to identify key functional groups and to improve specificity and efficacy. Comparative microarray analysis and ensuing RNA knockdown studies revealed involvement of the PERK/ATF4/DDIT3 ER stress pathway. Surprisingly, cell death following ER stress induction was associated with a concomitant decrease in endogenous ROS levels in PSCs. Undifferentiated cells treated with these molecules preceding transplantation fail to form teratomas in SCID mice. Furthermore, these molecules remain non-toxic and non-teratogenic to zebrafish embryos suggesting that they may be safely used in vivo. PMID:24647085

  7. A new class of pluripotent stem cell cytotoxic small molecules.

    PubMed

    Richards, Mark; Phoon, Chee Wee; Goh, Gwendoline Tze Wei; Seng, Eng Khuan; Guo, Xu Ming; Tan, Cherine Mei Fong; Chan, Woon-Khiong; Lee, Joel Mun Kin

    2014-01-01

    A major concern in Pluripotent Stem Cell (PSC)-derived cell replacement therapy is the risk of teratoma formation from contaminating undifferentiated cells. Removal of undifferentiated cells from differentiated cultures is an essential step before PSC-based cell therapies can be safely deployed in a clinical setting. We report a group of novel small molecules that are cytotoxic to PSCs. Our data indicates that these molecules are specific and potent in their activity allowing rapid eradication of undifferentiated cells. Experiments utilizing mixed PSC and primary human neuronal and cardiomyocyte cultures demonstrate that up to a 6-fold enrichment for specialized cells can be obtained without adversely affecting cell viability and function. Several structural variants were synthesized to identify key functional groups and to improve specificity and efficacy. Comparative microarray analysis and ensuing RNA knockdown studies revealed involvement of the PERK/ATF4/DDIT3 ER stress pathway. Surprisingly, cell death following ER stress induction was associated with a concomitant decrease in endogenous ROS levels in PSCs. Undifferentiated cells treated with these molecules preceding transplantation fail to form teratomas in SCID mice. Furthermore, these molecules remain non-toxic and non-teratogenic to zebrafish embryos suggesting that they may be safely used in vivo. PMID:24647085

  8. A synthetic small molecule that can walk down a track.

    PubMed

    von Delius, Max; Geertsema, Edzard M; Leigh, David A

    2010-02-01

    Although chemists have made small-molecule rotary motors, to date there have been no reports of small-molecule linear motors. Here we describe the synthesis and operation of a 21-atom two-legged molecular unit that is able to walk up and down a four-foothold molecular track. High processivity is conferred by designing the track-binding interactions of the two feet to be labile under different sets of conditions such that each foot can act as a temporarily fixed pivot for the other. The walker randomly and processively takes zero or one step along the track using a 'passing-leg' gait each time the environment is switched between acid and base. Replacing the basic step with a redox-mediated, disulfide-exchange reaction directionally transports the bipedal molecules away from the minimum-energy distribution by a Brownian ratchet mechanism. The ultimate goal of such studies is to produce artificial, linear molecular motors that move directionally along polymeric tracks to transport cargoes and perform tasks in a manner reminiscent of biological motor proteins. PMID:21124398

  9. Seeking small molecules for singlet fission: a heteroatom substitution strategy.

    PubMed

    Zeng, Tao; Ananth, Nandini; Hoffmann, Roald

    2014-09-10

    We design theoretically small molecule candidates for singlet fission chromophores, aiming to achieve a balance between sufficient diradical character and kinetic persistence. We develop a perturbation strategy based on the captodative effect to introduce diradical character into small π-systems. Specifically, this can be accomplished by replacing pairs of not necessarily adjacent C atoms with isoelectronic and isosteric pairs of B and N atoms. Three rules of thumb emerge from our studies to aid further design: (i) Lewis structures provide insight into likely diradical character; (ii) formal radical centers of the diradical must be well-separated; (iii) stabilization of radical centers by a donor (N) and an acceptor (B) is essential. Following the rules, we propose candidate molecules. Employing reliable multireference calculations for excited states, we identify three likely candidate molecules for SF chromophores. These include a benzene, a napthalene, and an azulene, where four C atoms are replaced by a pair of B and a pair of N atoms. PMID:25140824

  10. Mass Spectrometry-Based Tissue Imaging of Small Molecules

    PubMed Central

    Ferguson, Carly N.; Fowler, Joseph W.M.; Waxer, Jonathan F.; Gatti, Richard A.; Loo, Joseph A.

    2014-01-01

    Mass spectrometry imaging (MSI) of tissue samples is a promising analytical tool that has quickly become associated with biomedical and pharmacokinetic studies. It eliminates several labor-intensive protocols associated with more classical imaging techniques, and provides accurate, histological data at a rapid pace. Because mass spectrometry is used as the readout, MSI can be applied to almost any molecule, especially those that are biologically relevant. Many examples of its utility in the study of peptides and proteins have been reported; here we discuss its value in the mass range of small molecules. We explore its success and potential in the analysis of lipids, medicinals, and metal-based compounds by featuring representative studies from mass spectrometry imaging laboratories around the globe. PMID:24952187

  11. Small-molecule organic solar cells with improved stability

    NASA Astrophysics Data System (ADS)

    Song, Q. L.; Li, F. Y.; Yang, H.; Wu, H. R.; Wang, X. Z.; Zhou, W.; Zhao, J. M.; Ding, X. M.; Huang, C. H.; Hou, X. Y.

    2005-11-01

    A stable small-molecule organic photovoltaic device with structure of ITO⧹donor⧹acceptor⧹buffer⧹cathode is presented. A thin layer (˜60 Å) of tris-8-hydroxy-quinolinato aluminum (Alq 3) instead of bathocuproine (BCP) is adopted as the buffer of the device, resulting in 150 times longer lifetime. The power conversion efficiency of the device is 2.11% under 75 mW/cm 2 AM1.5G simulated illumination, and no perceptible efficiency degradation is observed for long-term storage of the device in vacuum or nitrogen-filled glove box. More effective blocking of Alq 3 than BCP against diffusion of cathode atoms and permeation of oxygen and/or water molecules is considered as the main reason for the improved performance of the new device.

  12. Capillary electrophoresis of small ssDNA molecules

    NASA Astrophysics Data System (ADS)

    Kopecka, Katerina; Slater, Gary W.; Drouin, Guy

    2004-03-01

    Recently, the electrophoretic separation of small ssDNA fragments (bellow 250 bases) has attracted a lot of attention because of applications related to Single Nucleotide Polymorphisms. In order to optimize these systems, we require a better understanding of DNA migration behavior in this size range. While the reptation model provides an excellent understanding of the dynamics of long DNA fragments in gel electrophoresis, the properties of small DNA fragments has not been studied extensively yet. At least three theoretical formulas have been proposed to explain the mobility of short ssDNA molecules in this regime. Specifically, the Ogston regime was introduced for small molecules having radii-of-gyration comparable to or smaller than the pore size of the sieving matrix. We introduce these three different formulas and discuss how their free parameters are related to actual physical parameters. We then test these formulas with new data obtained by capillary electrophoresis in our laboratory using poly(dimethylacrylamide) sieving matrices. Our results show that all three formulas provide decent fits, and that their fitting parameters are consistent with one another. This is the first step towards the development of a systematic approach to optimizing sequencing systems for this size range.

  13. Enhancement of Ultracold Molecule Formation Using Shaped Nanosecond Frequency Chirps

    NASA Astrophysics Data System (ADS)

    Carini, Jennifer; Kallush, Shimshon; Kosloff, Ronnie; Gould, Phillip

    2016-05-01

    We demonstrate that judicious shaping of a nanosecond-time-scale frequency chirp can dramatically enhance the formation rate of ultracold molecules. Starting with ultracold 87 Rb atoms, we apply pulses of frequency-chirped light to first photoassociate the atoms into excited molecules and then, later in the chirp, de-excite these molecules into a high vibrational level of the lowest triplet state. The enhancing chirp shape passes through the absorption and stimulated emission transitions relatively slowly, thus increasing their adiabaticity, but jumps quickly between them to minimize the effects of spontaneous emission. Comparisons with quantum simulations for various chirp shapes support this enhancement mechanism. Schemes for further improvements of the formation rate will also be presented. This work is supported by DOE and BSF.

  14. An autonomous chemically fuelled small-molecule motor

    NASA Astrophysics Data System (ADS)

    Wilson, Miriam R.; Solà, Jordi; Carlone, Armando; Goldup, Stephen M.; Lebrasseur, Nathalie; Leigh, David A.

    2016-06-01

    Molecular machines are among the most complex of all functional molecules and lie at the heart of nearly every biological process. A number of synthetic small-molecule machines have been developed, including molecular muscles, synthesizers, pumps, walkers, transporters and light-driven and electrically driven rotary motors. However, although biological molecular motors are powered by chemical gradients or the hydrolysis of adenosine triphosphate (ATP), so far there are no synthetic small-molecule motors that can operate autonomously using chemical energy (that is, the components move with net directionality as long as a chemical fuel is present). Here we describe a system in which a small molecular ring (macrocycle) is continuously transported directionally around a cyclic molecular track when powered by irreversible reactions of a chemical fuel, 9-fluorenylmethoxycarbonyl chloride. Key to the design is that the rate of reaction of this fuel with reactive sites on the cyclic track is faster when the macrocycle is far from the reactive site than when it is near to it. We find that a bulky pyridine-based catalyst promotes carbonate-forming reactions that ratchet the displacement of the macrocycle away from the reactive sites on the track. Under reaction conditions where both attachment and cleavage of the 9-fluorenylmethoxycarbonyl groups occur through different processes, and the cleavage reaction occurs at a rate independent of macrocycle location, net directional rotation of the molecular motor continues for as long as unreacted fuel remains. We anticipate that autonomous chemically fuelled molecular motors will find application as engines in molecular nanotechnology.

  15. An autonomous chemically fuelled small-molecule motor.

    PubMed

    Wilson, Miriam R; Solà, Jordi; Carlone, Armando; Goldup, Stephen M; Lebrasseur, Nathalie; Leigh, David A

    2016-06-01

    Molecular machines are among the most complex of all functional molecules and lie at the heart of nearly every biological process. A number of synthetic small-molecule machines have been developed, including molecular muscles, synthesizers, pumps, walkers, transporters and light-driven and electrically driven rotary motors. However, although biological molecular motors are powered by chemical gradients or the hydrolysis of adenosine triphosphate (ATP), so far there are no synthetic small-molecule motors that can operate autonomously using chemical energy (that is, the components move with net directionality as long as a chemical fuel is present). Here we describe a system in which a small molecular ring (macrocycle) is continuously transported directionally around a cyclic molecular track when powered by irreversible reactions of a chemical fuel, 9-fluorenylmethoxycarbonyl chloride. Key to the design is that the rate of reaction of this fuel with reactive sites on the cyclic track is faster when the macrocycle is far from the reactive site than when it is near to it. We find that a bulky pyridine-based catalyst promotes carbonate-forming reactions that ratchet the displacement of the macrocycle away from the reactive sites on the track. Under reaction conditions where both attachment and cleavage of the 9-fluorenylmethoxycarbonyl groups occur through different processes, and the cleavage reaction occurs at a rate independent of macrocycle location, net directional rotation of the molecular motor continues for as long as unreacted fuel remains. We anticipate that autonomous chemically fuelled molecular motors will find application as engines in molecular nanotechnology. PMID:27279219

  16. Engineered Protein Polymer-Gold Nanoparticle Hybrid Materials for Small Molecule Delivery

    PubMed Central

    Dai, Min; Frezzo, JA; Sharma, E; Chen, R; Singh, N; Yuvienco, C; Caglar, E; Xiao, S; Saxena, A; Montclare, JK

    2016-01-01

    We have fabricated protein polymer-gold nanoparticle (P-GNP) nanocomposites that exhibit enhanced binding and delivery properties of the small hydrophobic molecule drug, curcumin, to the model breast cancer cell line, MCF-7. These hybrid biomaterials are constructed via in situ GNP templated-synthesis with genetically engineered histidine tags. The P-GNP nanocomposites exhibit enhanced small molecule loading, sustained release and increased uptake by MCF-7 cells. When compared to the proteins polymers alone, the P-GNPs demonstrate a greater than 7-fold increase in curcumin binding, a nearly 50% slower release profile and more than 2-fold increase in cellular uptake of curcumin. These results suggest that P-GNP nanocomposites serve as promising candidates for drug delivery vehicles. PMID:27081576

  17. Anti-Ebola Activity of Diazachrysene Small Molecules.

    PubMed

    Selaković, Života; Soloveva, Veronica; Gharaibeh, Dima N; Wells, Jay; Šegan, Sandra; Panchal, Rekha G; Šolaja, Bogdan A

    2015-06-12

    Herein we report on a diazachrysene class of small molecules that exhibit potent antiviral activity against the Ebola (EBOV) virus. The antiviral compounds are easily synthesized, and the most active compounds have excellent in vitro activity (0.34-0.70 μM) and are significantly less lipophilic than their predecessors. The three most potent diazachrysene antivirals do not exhibit any toxicity in vivo and protected 70-90% of the mice at 10 mg/kg following EBOV challenge. Together, these studies suggest that diazachrysenes are a promising class of compounds for hit to lead optimization and as potential Ebola therapeutics. PMID:27622742

  18. Spectroscopic and dynamical studies of highly energized small polyatomic molecules

    SciTech Connect

    Field, R.W.; Silbey, R.J.

    1993-12-01

    The authors have initiated a program to perform spectroscopic and dynamic studies of small molecules. Large amplitude motions in excited acetylene were discussed along with plans to record the dispersed fluorescence (DF) and the stimulated emission pumping (SEP) spectra. SEP spectra were reported for the formyl radical. A Fourier transform spectrometer was discussed with respect to its ability to probe the structure of radicals. This instrument is capable of performing studies using various techniques such as magnetic rotation spectroscopy and sub-Doppler sideband-OODR Zeman (SOODRZ) spectroscopy.

  19. A new small molecule inhibitor of soluble guanylate cyclase

    PubMed Central

    Mota, Filipa; Gane, Paul; Hampden-Smith, Kathryn; Allerston, Charles K.; Garthwaite, John; Selwood, David L.

    2015-01-01

    Soluble guanylate cyclase (sGC) is a haem containing enzyme that regulates cardiovascular homeostasis and multiple mechanisms in the central and peripheral nervous system. Commonly used inhibitors of sGC activity act through oxidation of the haem moiety, however they also bind haemoglobin and this limits their bioavailability for in vivo studies. We have discovered a new class of small molecule inhibitors of sGC and have characterised a compound designated D12 (compound 10) which binds to the catalytic domain of the enzyme with a KD of 11 μM in a SPR assay. PMID:26264842

  20. Discovery of small molecule antagonists of TRPV1.

    PubMed

    Rami, Harshad K; Thompson, Mervyn; Wyman, Paul; Jerman, Jeffrey C; Egerton, Julie; Brough, Stephen; Stevens, Alexander J; Randall, Andrew D; Smart, Darren; Gunthorpe, Martin J; Davis, John B

    2004-07-16

    Small molecule antagonists of the vanilloid receptor 1 (TRPV1, also known as VR1) are disclosed. Ureas such as 5 (SB-452533) were used to explore the structure activity relationship with several potent analogues identified. Pharmacological studies using electrophysiological and FLIPR Ca(2+) based assays showed compound 5 was an antagonist versus capsaicin, noxious heat and acid mediated activation of TRPV1. Study of a quaternary salt of 5 supports a mode of action in which compounds from this series cause inhibition via an extracellularly accessible binding site on the TRPV1 receptor. PMID:15203132

  1. Computer Simulations of Small Molecules in Membranes: Insights from Computer Simulations into the Interactions of Small Molecules with Lipid Bilayers

    NASA Technical Reports Server (NTRS)

    Pohorille, Andrew; New, Michael H.; Schweighofer, Karl; Wilson, Michael A.; DeVincenzi, Donald L. (Technical Monitor)

    2000-01-01

    Two of Ernest Overton's lasting contributions to biology are the Meyer-Overton relationship between the potency of an anesthetic and its solubility in oil, and the Overton rule which relates the permeability of a membrane to the oil-water partition coefficient of the permeating molecule. A growing body of experimental evidence, however, cannot be reconciled with these theories. In particular, the molecular nature of membranes, unknown to Overton, needs to be included in any description of these phenomena. Computer simulations are ideally suited for providing atomic-level information about the behavior of small molecules in membranes. The authors discuss simulation studies relevant to Overton's ideas. Through simulations it was found that anesthetics tend to concentrate at interfaces and their anesthetic potency correlates better with solubility at the water-membrane interface than with solubility in oil. Simulation studies of membrane permeation revealed the anisotropic nature of the membranes, as evidenced, for example, by the highly nonuniform distribution of free volume in the bilayer. This, in turn, influences the diffusion rates of solutes, which increase with the depth in the membrane. Small solutes tend to move by hopping between voids in the bilayer, and this hopping motion may be responsible for the deviation from the Overton rule of the permeation rates of these molecules.

  2. A "roller-wheel" Pt-containing small molecule that outperforms its polymer analogs in organic solar cells

    DOE PAGESBeta

    He, Wenhan; Wu, Qin; Livshits, Maksim Y.; Dickie, Diane A.; Yang, Jianzhong; Quinnett, Rachel; Rack, Jeffrey R.; Qin, Yang

    2016-05-23

    A novel Pt-bisacetylide small molecule (Pt-SM) featuring “roller-wheel” geometry was synthesized and characterized. When compared with conventional Pt-containing polymers and small molecules having “dumbbell” shaped structures, Pt-SM displays enhanced crystallinity and intermolecular π–π interactions, as well as favorable panchromatic absorption behaviors. Furthermore, organic solar cells (OSCs) employing Pt-SM achieve power conversion efficiencies (PCEs) up to 5.9%, the highest reported so far for Pt-containing polymers and small molecules.

  3. A guest molecule-host cavity fitting algorithm to mine PDB for small molecule targets.

    PubMed

    Byrem, William C; Armstead, Stephen C; Kobayashi, Shunji; Eckenhoff, Roderic G; Eckmann, David M

    2006-08-01

    Inhaled anesthetic molecule occupancy of a protein internal cavity depends in part on the volumes of the guest molecule and the host site. Current algorithms to determine volume and surface area of cavities in proteins whose structures have been determined and cataloged make no allowance for shape or small degrees of shape adjustment to accommodate a guest. We developed an algorithm to determine spheroid dimensions matching cavity volume and surface area and applied it to screen the cavities of 6,658 nonredundant structures stored in the Protein Data Bank (PDB) for potential targets of halothane (2-bromo-2-chloro-1,1,1-trifluoroethane). Our algorithm determined sizes of prolate and oblate spheroids matching dimensions of each cavity found. If those spheroids could accommodate halothane (radius 2.91 A) as a guest, we determined the packing coefficient. 394,766 total cavities were identified. Of 58,681 cavities satisfying the fit criteria for halothane, 11,902 cavities had packing coefficients in the range of 0.46-0.64. This represents 20.3% of cavities large enough to hold halothane, 3.0% of all cavities processed, and found in 2,432 protein structures. Our algorithm incorporates shape dependence to screen guest-host relationships for potential small molecule occupancy of protein cavities. Proteins with large numbers of such cavities are more likely to be functionally altered by halothane. PMID:16904958

  4. A general strategy to construct small molecule biosensors in eukaryotes

    PubMed Central

    Feng, Justin; Jester, Benjamin W; Tinberg, Christine E; Mandell, Daniel J; Antunes, Mauricio S; Chari, Raj; Morey, Kevin J; Rios, Xavier; Medford, June I; Church, George M; Fields, Stanley; Baker, David

    2015-01-01

    Biosensors for small molecules can be used in applications that range from metabolic engineering to orthogonal control of transcription. Here, we produce biosensors based on a ligand-binding domain (LBD) by using a method that, in principle, can be applied to any target molecule. The LBD is fused to either a fluorescent protein or a transcriptional activator and is destabilized by mutation such that the fusion accumulates only in cells containing the target ligand. We illustrate the power of this method by developing biosensors for digoxin and progesterone. Addition of ligand to yeast, mammalian, or plant cells expressing a biosensor activates transcription with a dynamic range of up to ~100-fold. We use the biosensors to improve the biotransformation of pregnenolone to progesterone in yeast and to regulate CRISPR activity in mammalian cells. This work provides a general methodology to develop biosensors for a broad range of molecules in eukaryotes. DOI: http://dx.doi.org/10.7554/eLife.10606.001 PMID:26714111

  5. An in vitro selection for small molecule induced switching RNA molecules.

    PubMed

    Martini, Laura; Ellington, Andrew D; Mansy, Sheref S

    2016-08-15

    The selection of RNA and DNA aptamers now has a long history. However, the ability to directly select for conformational changes upon ligand binding has remained elusive. These difficulties have stymied attempts at making small molecule responsive strand displacement circuitry as well as synthetic riboswitches. Herein we present a detailed strand displacement based selection protocol to directly select for RNA molecules with switching activity. The library was based on a previously selected thiamine pyrophosphate riboswitch. The fully in vitro methodology gave sequences that showed strong strand displacement activity in the presence of thiamine pyrophosphate. Further, the selected sequences possessed riboswitch activity similar to that of natural riboswitches. The presented methodology should aid in the design of more complex, environmentally responsive strand displacement circuitry and in the selection of riboswitches responsive to toxic ligands. PMID:26899430

  6. Mechanism of cellular response to nanoscale aggregates of small molecules

    NASA Astrophysics Data System (ADS)

    Kuang, Yi

    This dissertation research focused on the illustration of the molecular mechanism of cellular response to nanoscale aggregates formed by small molecules. There are five chapters in this dissertation. Chapter 1 summarizes the current research on the evaluation of cell response (i.e., biocompatibility/cytotoxicity) to small molecular hydrogelators. Chapter 2 describes an interesting phenomenon that supramolecular hydrogelators consisting of N-terminated dipeptides, which exhibit selective inhibitory effects against cancer cells. This study calls for the development of a new approach for identification of protein targets of the hydrogelators. Chapter 3 describes the evaluation of interactions between cytosol proteins of a mammalian cell line and morphologically different nanoscale molecular aggregates formed by small peptidic molecules. Chapter 4 describes the research on the mechanism of a type of molecular aggregates, which cluster short microtubules to prevent the growth of microtubule. This unprecedented mechanism of "self-assembly to interfere with self-organization " contributes to inhibiting growth of cancer cells in several mammalian cell based assays and a xenograft tumor mice model. At the end, Chapter 5 reports a novel supramolecular hydrogelator, which consists of fluorene and the pentapeptide epitope (TIGYG) of potassium ion (K+) channels, to self-assemble in water to form the tunable, hierarchical nanostructures dictated by the concentration of K+. In conclusion, this dissertation research demonstrates a new approach for investigating cellular target and molecular mechanism of self-assembled aggregates formed by small peptide derivatives based hydrogelators, which will make contribution to the development of supramolecular hydrogelators as biomaterials. Moreover, the differential cytotoxicity of molecular aggregates illustrated in this research promises a new direction for developing anti-cancer drug based on interactions between molecular aggregates and

  7. Biosensor-based small molecule fragment screening with biolayer interferometry.

    PubMed

    Wartchow, Charles A; Podlaski, Frank; Li, Shirley; Rowan, Karen; Zhang, Xiaolei; Mark, David; Huang, Kuo-Sen

    2011-07-01

    Biosensor-based fragment screening is a valuable tool in the drug discovery process. This method is advantageous over many biochemical methods because primary hits can be distinguished from non-specific or non-ideal interactions by examining binding profiles and responses, resulting in reduced false-positive rates. Biolayer interferometry (BLI), a technique that measures changes in an interference pattern generated from visible light reflected from an optical layer and a biolayer containing proteins of interest, is a relatively new method for monitoring small molecule interactions. The BLI format is based on a disposable sensor that is immersed in 96-well or 384-well plates. BLI has been validated for small molecule detection and fragment screening with model systems and well-characterized targets where affinity constants and binding profiles are generally similar to those obtained with surface plasmon resonsance (SPR). Screens with challenging targets involved in protein-protein interactions including BCL-2, JNK1, and eIF4E were performed with a fragment library of 6,500 compounds, and hit rates were compared for these targets. For eIF4E, a protein containing a PPI site and a nucleotide binding site, results from a BLI fragment screen were compared to results obtained in biochemical HTS screens. Overlapping hits were observed for the PPI site, and hits unique to the BLI screen were identified. Hit assessments with SPR and BLI are described. PMID:21660516

  8. Rational design of small molecules as vaccine adjuvants.

    PubMed

    Wu, Tom Y-H; Singh, Manmohan; Miller, Andrew T; De Gregorio, Ennio; Doro, Francesco; D'Oro, Ugo; Skibinski, David A G; Mbow, M Lamine; Bufali, Simone; Herman, Ann E; Cortez, Alex; Li, Yongkai; Nayak, Bishnu P; Tritto, Elaine; Filippi, Christophe M; Otten, Gillis R; Brito, Luis A; Monaci, Elisabetta; Li, Chun; Aprea, Susanna; Valentini, Sara; Calabrό, Samuele; Laera, Donatello; Brunelli, Brunella; Caproni, Elena; Malyala, Padma; Panchal, Rekha G; Warren, Travis K; Bavari, Sina; O'Hagan, Derek T; Cooke, Michael P; Valiante, Nicholas M

    2014-11-19

    Adjuvants increase vaccine potency largely by activating innate immunity and promoting inflammation. Limiting the side effects of this inflammation is a major hurdle for adjuvant use in vaccines for humans. It has been difficult to improve on adjuvant safety because of a poor understanding of adjuvant mechanism and the empirical nature of adjuvant discovery and development historically. We describe new principles for the rational optimization of small-molecule immune potentiators (SMIPs) targeting Toll-like receptor 7 as adjuvants with a predicted increase in their therapeutic indices. Unlike traditional drugs, SMIP-based adjuvants need to have limited bioavailability and remain localized for optimal efficacy. These features also lead to temporally and spatially restricted inflammation that should decrease side effects. Through medicinal and formulation chemistry and extensive immunopharmacology, we show that in vivo potency can be increased with little to no systemic exposure, localized innate immune activation and short in vivo residence times of SMIP-based adjuvants. This work provides a systematic and generalizable approach to engineering small molecules for use as vaccine adjuvants. PMID:25411473

  9. Small molecules reveal an alternative mechanism of Bax activation

    PubMed Central

    Brahmbhatt, Hetal; Uehling, David; Al-awar, Rima; Leber, Brian; Andrews, David

    2016-01-01

    The pro-apoptotic protein Bax commits a cell to death by permeabilizing the mitochondrial outer membrane (MOM). To obtain small-molecule probes for elucidating the molecular mechanism(s) of Bax activation, we screened for compounds that induced Bax-mediated liposome permeabilization. We identified five structurally different small molecules that promoted both Bax targeting to and oligomerization at membranes. All five compounds initiated Bax oligomerization in the absence of membranes by a mechanism unlike Bax activation by Bcl-2 homology 3 domain (BH3) proteins. Some of the compounds induced Bax/Bak-dependent apoptosis in cells. Activation of Bax by the most active compound was poorly inhibited by the anti-apoptotic protein Bcl-XL and requires a cysteine residue at position 126 of Bax that is not required for activation by BH3 proteins. Our results reveal a novel pathway for Bax activation independent of pro-apoptotic BH3 proteins that may have important implications for the regulation of Bax activity in cells. PMID:26916338

  10. Discovery and development of small molecule SHIP phosphatase modulators.

    PubMed

    Viernes, Dennis R; Choi, Lydia B; Kerr, William G; Chisholm, John D

    2014-07-01

    Inositol phospholipids play an important role in the transfer of signaling information across the cell membrane in eukaryotes. These signals are often governed by the phosphorylation patterns on the inositols, which are mediated by a number of inositol kinases and phosphatases. The src homology 2 (SH2) containing inositol 5-phosphatase (SHIP) plays a central role in these processes, influencing signals delivered through the PI3K/Akt/mTOR pathway. SHIP modulation by small molecules has been implicated as a treatment in a number of human disease states, including cancer, inflammatory diseases, diabetes, atherosclerosis, and Alzheimer's disease. In addition, alteration of SHIP phosphatase activity may provide a means to facilitate bone marrow transplantation and increase blood cell production. This review discusses the cellular signaling pathways and protein-protein interactions that provide the molecular basis for targeting the SHIP enzyme in these disease states. In addition, a comprehensive survey of small molecule modulators of SHIP1 and SHIP2 is provided, with a focus on the structure, potency, selectivity, and solubility properties of these compounds. PMID:24302498

  11. Reprogramming the assembly of unmodified DNA with a small molecule

    NASA Astrophysics Data System (ADS)

    Avakyan, Nicole; Greschner, Andrea A.; Aldaye, Faisal; Serpell, Christopher J.; Toader, Violeta; Petitjean, Anne; Sleiman, Hanadi F.

    2016-04-01

    The ability of DNA to store and encode information arises from base pairing of the four-letter nucleobase code to form a double helix. Expanding this DNA ‘alphabet’ by synthetic incorporation of new bases can introduce new functionalities and enable the formation of novel nucleic acid structures. However, reprogramming the self-assembly of existing nucleobases presents an alternative route to expand the structural space and functionality of nucleic acids. Here we report the discovery that a small molecule, cyanuric acid, with three thymine-like faces, reprogrammes the assembly of unmodified poly(adenine) (poly(A)) into stable, long and abundant fibres with a unique internal structure. Poly(A) DNA, RNA and peptide nucleic acid (PNA) all form these assemblies. Our studies are consistent with the association of adenine and cyanuric acid units into a hexameric rosette, which brings together poly(A) triplexes with a subsequent cooperative polymerization. Fundamentally, this study shows that small hydrogen-bonding molecules can be used to induce the assembly of nucleic acids in water, which leads to new structures from inexpensive and readily available materials.

  12. Small molecules reveal an alternative mechanism of Bax activation.

    PubMed

    Brahmbhatt, Hetal; Uehling, David; Al-Awar, Rima; Leber, Brian; Andrews, David

    2016-04-15

    The pro-apoptotic protein Bax commits a cell to death by permeabilizing the mitochondrial outer membrane (MOM). To obtain small-molecule probes for elucidating the molecular mechanism(s) of Bax activation, we screened for compounds that induced Bax-mediated liposome permeabilization. We identified five structurally different small molecules that promoted both Bax targeting to and oligomerization at membranes. All five compounds initiated Bax oligomerization in the absence of membranes by a mechanism unlike Bax activation by Bcl-2 homology 3 domain (BH3) proteins. Some of the compounds induced Bax/Bak-dependent apoptosis in cells. Activation of Bax by the most active compound was poorly inhibited by the anti-apoptotic protein Bcl-XL and requires a cysteine residue at position 126 of Bax that is not required for activation by BH3 proteins. Our results reveal a novel pathway for Bax activation independent of pro-apoptotic BH3 proteins that may have important implications for the regulation of Bax activity in cells. PMID:26916338

  13. Reprogramming the assembly of unmodified DNA with a small molecule.

    PubMed

    Avakyan, Nicole; Greschner, Andrea A; Aldaye, Faisal; Serpell, Christopher J; Toader, Violeta; Petitjean, Anne; Sleiman, Hanadi F

    2016-04-01

    The ability of DNA to store and encode information arises from base pairing of the four-letter nucleobase code to form a double helix. Expanding this DNA 'alphabet' by synthetic incorporation of new bases can introduce new functionalities and enable the formation of novel nucleic acid structures. However, reprogramming the self-assembly of existing nucleobases presents an alternative route to expand the structural space and functionality of nucleic acids. Here we report the discovery that a small molecule, cyanuric acid, with three thymine-like faces, reprogrammes the assembly of unmodified poly(adenine) (poly(A)) into stable, long and abundant fibres with a unique internal structure. Poly(A) DNA, RNA and peptide nucleic acid (PNA) all form these assemblies. Our studies are consistent with the association of adenine and cyanuric acid units into a hexameric rosette, which brings together poly(A) triplexes with a subsequent cooperative polymerization. Fundamentally, this study shows that small hydrogen-bonding molecules can be used to induce the assembly of nucleic acids in water, which leads to new structures from inexpensive and readily available materials. PMID:27001733

  14. Neurobehavioral consequences of small molecule-drug immunosuppression.

    PubMed

    Bösche, Katharina; Weissenborn, Karin; Christians, Uwe; Witzke, Oliver; Engler, Harald; Schedlowski, Manfred; Hadamitzky, Martin

    2015-09-01

    60 years after the first successful kidney transplantation in humans, transplant patients have decent survival rates owing to a broad spectrum of immunosuppressive medication available today. Not only transplant patients, but also patients with inflammatory autoimmune diseases or cancer benefit from these life-saving immunosuppressive and anti-proliferative medications. However, this success is gained with the disadvantage of neuropsychological disturbances and mental health problems such as depression, anxiety and impaired quality of life after long-term treatment with immunosuppressive drugs. So far, surprisingly little is known about unwanted neuropsychological side effects of immunosuppressants and anti-proliferative drugs from the group of so called small molecule-drugs. This is partly due to the fact that it is difficult to disentangle whether and to what extent the observed neuropsychiatric disturbances are a direct result of the patient's medical history or of the immunosuppressive treatment. Thus, here we summarize experimental as well as clinical data of mammalian and human studies, with the focus on selected small-molecule drugs that are frequently employed in solid organ transplantation, autoimmune disorders or cancer therapy and their effects on neuropsychological functions, mood, and behavior. These data reveal the necessity to develop immunosuppressive and anti-proliferative drugs inducing fewer or no unwanted neuropsychological side effects, thereby increasing the quality of life in patients requiring long term immunosuppressive treatment. This article is part of a Special Issue entitled 'Neuroimmunology and Synaptic Function'. PMID:25529273

  15. Oral small molecule therapy for lysosomal storage diseases.

    PubMed

    Weinreb, Neal J

    2013-11-01

    For more than 20 years, "enzyme replacement therapy" (ERT) has been the prevalent treatment approach for lysosomal storage disorders (LSDs). Unfortunately, ERT, as currently administered, is ineffective for primary neuronopathic LSDs. For LSDs whose major disease burden is non-neurological, ERT efficacy is limited by uneven tissue distribution and penetration, immunological intolerance, and disturbed intracellular homeostasis associated with persistent mutant enzymes that are not "replaced" by ERT. Many of these limitations might be circumvented by oral, low molecular weight pharmaceuticals that address relevant LSD pathophysiology and distribute widely in steady state concentrations in all cells and body tissues including the CNS. Two oral small molecule drugs (miglustat and cysteamine) are currently approved for clinical use and two (eliglustat and migalastat) are in advanced stage clinical trials. Several others are in early stages of clinical or pre-clinical investigation. This article reviews current knowledge of small molecule treatment for LSDs including approaches such as substrate synthesis inhibition, pharmacological chaperones, and proteostasis modification. PMID:24380126

  16. Structural basis of AMPK regulation by small molecule activators

    NASA Astrophysics Data System (ADS)

    Xiao, Bing; Sanders, Matthew J.; Carmena, David; Bright, Nicola J.; Haire, Lesley F.; Underwood, Elizabeth; Patel, Bhakti R.; Heath, Richard B.; Walker, Philip A.; Hallen, Stefan; Giordanetto, Fabrizio; Martin, Stephen R.; Carling, David; Gamblin, Steven J.

    2013-12-01

    AMP-activated protein kinase (AMPK) plays a major role in regulating cellular energy balance by sensing and responding to increases in AMP/ADP concentration relative to ATP. Binding of AMP causes allosteric activation of the enzyme and binding of either AMP or ADP promotes and maintains the phosphorylation of threonine 172 within the activation loop of the kinase. AMPK has attracted widespread interest as a potential therapeutic target for metabolic diseases including type 2 diabetes and, more recently, cancer. A number of direct AMPK activators have been reported as having beneficial effects in treating metabolic diseases, but there has been no structural basis for activator binding to AMPK. Here we present the crystal structure of human AMPK in complex with a small molecule activator that binds at a site between the kinase domain and the carbohydrate-binding module, stabilising the interaction between these two components. The nature of the activator-binding pocket suggests the involvement of an additional, as yet unidentified, metabolite in the physiological regulation of AMPK. Importantly, the structure offers new opportunities for the design of small molecule activators of AMPK for treatment of metabolic disorders.

  17. Small molecule microarrays for drug residue detection in foodstuffs.

    PubMed

    Peng, Zuo; Bang-Ce, Ye

    2006-09-20

    Microarrays have been used as tools for analyzing biological compositions at different levels. In this study, we proposed a small molecule microarray (SMM) method for detection of three veterinary drug residues, chloramphenicol, clenbuterol, and tylosin, in foodstuffs simultaneously and quantitatively. The small drug molecules were immobilized on the surface of the modified glass slides. Then the mixture of drug corresponding antibodies and standards or samples was added to the reaction area. After incubation, the antigen-antibody binding was detected using cy5 labeled secondary antibody. The calibration curves of the residues were drawn, and they indicated the lowest detection limit the linearity range. The detectable concentrations of the three residues are lower than the maximum residue levels (MRLs). No cross reactivity was found among the three residues. The coefficient of variation of the spot intensities was below 5% in a subarray, and below 15% among subarrays. The spike sample test and the comparison of detection results by SMMs and ELISA demonstrated the accuracy of the proposed SMMs method. PMID:16968051

  18. Small-molecule SMAC mimetics as new cancer therapeutics.

    PubMed

    Bai, Longchuan; Smith, David C; Wang, Shaomeng

    2014-10-01

    Apoptosis is a tightly regulated cellular process and faulty regulation of apoptosis is a hallmark of human cancers. Targeting key apoptosis regulators with the goal to restore apoptosis in tumor cells has been pursued as a new cancer therapeutic strategy. XIAP, cIAP1, and cIAP2, members of inhibitor of apoptosis (IAP) proteins, are critical regulators of cell death and survival and are attractive targets for new cancer therapy. The SMAC/DIABLO protein is an endogenous antagonist of XIAP, cIAP1, and cIAP2. In the last decade, intense research efforts have resulted in the design and development of several small-molecule SMAC mimetics now in clinical trials for cancer treatment. In this review, we will discuss the roles of XIAP, cIAP1, and cIAP2 in regulation of cell death and survival, and the design and development of small-molecule SMAC mimetics as novel cancer treatments. PMID:24841289

  19. Structure Based Discovery of Small Molecules to Regulate the Activity of Human Insulin Degrading Enzyme

    PubMed Central

    Çakir, Bilal; Dağliyan, Onur; Dağyildiz, Ezgi; Bariş, İbrahim; Kavakli, Ibrahim Halil; Kizilel, Seda; Türkay, Metin

    2012-01-01

    Background Insulin-degrading enzyme (IDE) is an allosteric Zn+2 metalloprotease involved in the degradation of many peptides including amyloid-β, and insulin that play key roles in Alzheimer's disease (AD) and type 2 diabetes mellitus (T2DM), respectively. Therefore, the use of therapeutic agents that regulate the activity of IDE would be a viable approach towards generating pharmaceutical treatments for these diseases. Crystal structure of IDE revealed that N-terminal has an exosite which is ∼30 Å away from the catalytic region and serves as a regulation site by orientation of the substrates of IDE to the catalytic site. It is possible to find small molecules that bind to the exosite of IDE and enhance its proteolytic activity towards different substrates. Methodology/Principal Findings In this study, we applied structure based drug design method combined with experimental methods to discover four novel molecules that enhance the activity of human IDE. The novel compounds, designated as D3, D4, D6, and D10 enhanced IDE mediated proteolysis of substrate V, insulin and amyloid-β, while enhanced degradation profiles were obtained towards substrate V and insulin in the presence of D10 only. Conclusion/Significance This paper describes the first examples of a computer-aided discovery of IDE regulators, showing that in vitro and in vivo activation of this important enzyme with small molecules is possible. PMID:22355395

  20. Small and Innovative Molecules as New Strategy to Revert MDR.

    PubMed

    Zinzi, Laura; Capparelli, Elena; Cantore, Mariangela; Contino, Marialessandra; Leopoldo, Marcello; Colabufo, Nicola Antonio

    2014-01-01

    Multidrug resistance (MDR) is a complex phenomenon principally due to the overexpression of some transmembrane proteins belonging to the ATP binding cassette (ABC) transporter family. Among these transporters, P-glycoprotein (P-gp) is mostly involved in MDR and its overexpression is the major cause of cancer therapy failure. The classical approach used to overcome MDR is the co-administration of a P-gp inhibitor and the classic antineoplastic drugs, although the results were often unsatisfactory. Different classes of P-gp ligands have been developed and, among them, Tariquidar has been extensively studied both in vitro and in vivo. Although Tariquidar has been considered for several years as the lead compound for the development of P-gp inhibitors, recent studies demonstrated it to be a substrate and inhibitor, in a dose-dependent manner. Moreover, Tariquidar structure-activity relationship studies were difficult to carry out because of the complexity of the structure that does not allow establishing the role of each moiety for P-gp activity. For this purpose, SMALL molecules bearing different scaffolds such as tetralin, biphenyl, arylthiazole, furoxane, furazan have been developed. Many of these ligands have been tested both in in vitro assays and in in vivo PET studies. These preliminary evaluations lead to obtain a library of P-gp interacting agents useful to conjugate chemotherapeutic agents displaying reduced pharmacological activity and appropriate small molecules. These molecules could get over the limits due to the antineoplastic-P-gp inhibitor co-administration since pharmacokinetic and pharmacodynamic profiles are related to a dual innovative drug. PMID:24478983

  1. Small and Innovative Molecules as New Strategy to Revert MDR

    PubMed Central

    Zinzi, Laura; Capparelli, Elena; Cantore, Mariangela; Contino, Marialessandra; Leopoldo, Marcello; Colabufo, Nicola Antonio

    2013-01-01

    Multidrug resistance (MDR) is a complex phenomenon principally due to the overexpression of some transmembrane proteins belonging to the ATP binding cassette (ABC) transporter family. Among these transporters, P-glycoprotein (P-gp) is mostly involved in MDR and its overexpression is the major cause of cancer therapy failure. The classical approach used to overcome MDR is the co-administration of a P-gp inhibitor and the classic antineoplastic drugs, although the results were often unsatisfactory. Different classes of P-gp ligands have been developed and, among them, Tariquidar has been extensively studied both in vitro and in vivo. Although Tariquidar has been considered for several years as the lead compound for the development of P-gp inhibitors, recent studies demonstrated it to be a substrate and inhibitor, in a dose-dependent manner. Moreover, Tariquidar structure–activity relationship studies were difficult to carry out because of the complexity of the structure that does not allow establishing the role of each moiety for P-gp activity. For this purpose, SMALL molecules bearing different scaffolds such as tetralin, biphenyl, arylthiazole, furoxane, furazan have been developed. Many of these ligands have been tested both in in vitro assays and in in vivo PET studies. These preliminary evaluations lead to obtain a library of P-gp interacting agents useful to conjugate chemotherapeutic agents displaying reduced pharmacological activity and appropriate small molecules. These molecules could get over the limits due to the antineoplastic-P-gp inhibitor co-administration since pharmacokinetic and pharmacodynamic profiles are related to a dual innovative drug. PMID:24478983

  2. OPLS3: A Force Field Providing Broad Coverage of Drug-like Small Molecules and Proteins.

    PubMed

    Harder, Edward; Damm, Wolfgang; Maple, Jon; Wu, Chuanjie; Reboul, Mark; Xiang, Jin Yu; Wang, Lingle; Lupyan, Dmitry; Dahlgren, Markus K; Knight, Jennifer L; Kaus, Joseph W; Cerutti, David S; Krilov, Goran; Jorgensen, William L; Abel, Robert; Friesner, Richard A

    2016-01-12

    The parametrization and validation of the OPLS3 force field for small molecules and proteins are reported. Enhancements with respect to the previous version (OPLS2.1) include the addition of off-atom charge sites to represent halogen bonding and aryl nitrogen lone pairs as well as a complete refit of peptide dihedral parameters to better model the native structure of proteins. To adequately cover medicinal chemical space, OPLS3 employs over an order of magnitude more reference data and associated parameter types relative to other commonly used small molecule force fields (e.g., MMFF and OPLS_2005). As a consequence, OPLS3 achieves a high level of accuracy across performance benchmarks that assess small molecule conformational propensities and solvation. The newly fitted peptide dihedrals lead to significant improvements in the representation of secondary structure elements in simulated peptides and native structure stability over a number of proteins. Together, the improvements made to both the small molecule and protein force field lead to a high level of accuracy in predicting protein-ligand binding measured over a wide range of targets and ligands (less than 1 kcal/mol RMS error) representing a 30% improvement over earlier variants of the OPLS force field. PMID:26584231

  3. Synthetic Small-Molecule Prohormone Convertase 2 Inhibitors

    PubMed Central

    Kowalska, Dorota; Liu, Jin; Appel, Jon R.; Ozawa, Akihiko; Nefzi, Adel; Mackin, Robert B.; Houghten, Richard A.; Lindberg, Iris

    2009-01-01

    The proprotein convertases are believed to be responsible for the proteolytic maturation of a large number of peptide hormone precursors. Although potent furin inhibitors have been identified, thus far, no small-molecule prohormone convertase 1/3 or prohormone convertase 2 (PC2) inhibitors have been described. After screening 38 small-molecule positional scanning libraries against recombinant mouse PC2, two promising chemical scaffolds were identified: bicyclic guanidines, and pyrrolidine bis-piperazines. A set of individual compounds was designed from each library and tested against PC2. Pyrrolidine bis-piperazines were irreversible, time-dependent inhibitors of PC2, exhibiting noncompetitive inhibition kinetics; the most potent inhibitor exhibited a Ki value for PC2 of 0.54 μM. In contrast, the most potent bicyclic guanidine inhibitor exhibited a Ki value of 3.3 μM. Cross-reactivity with other convertases was limited: pyrrolidine bis-piperazines exhibited Ki values greater than 25 μM for PC1/3 or furin, whereas the Ki values of bicyclic guanidines for these other convertases were more than 15 μM. We conclude that pyrrolidine bis-piperazines and bicyclic guanidines represent promising initial leads for the optimization of therapeutically active PC2 inhibitors. PC2-specific inhibitors may be useful in the pharmacological blockade of PC2-dependent cleavage events, such as glucagon production in the pancreas and ectopic peptide production in small-cell carcinoma, and to study PC2-dependent proteolytic events, such as opioid peptide production. PMID:19074544

  4. Mechanisms of small molecule-DNA interactions probed by single-molecule force spectroscopy.

    PubMed

    Almaqwashi, Ali A; Paramanathan, Thayaparan; Rouzina, Ioulia; Williams, Mark C

    2016-05-19

    There is a wide range of applications for non-covalent DNA binding ligands, and optimization of such interactions requires detailed understanding of the binding mechanisms. One important class of these ligands is that of intercalators, which bind DNA by inserting aromatic moieties between adjacent DNA base pairs. Characterizing the dynamic and equilibrium aspects of DNA-intercalator complex assembly may allow optimization of DNA binding for specific functions. Single-molecule force spectroscopy studies have recently revealed new details about the molecular mechanisms governing DNA intercalation. These studies can provide the binding kinetics and affinity as well as determining the magnitude of the double helix structural deformations during the dynamic assembly of DNA-ligand complexes. These results may in turn guide the rational design of intercalators synthesized for DNA-targeted drugs, optical probes, or integrated biological self-assembly processes. Herein, we survey the progress in experimental methods as well as the corresponding analysis framework for understanding single molecule DNA binding mechanisms. We discuss briefly minor and major groove binding ligands, and then focus on intercalators, which have been probed extensively with these methods. Conventional mono-intercalators and bis-intercalators are discussed, followed by unconventional DNA intercalation. We then consider the prospects for using these methods in optimizing conventional and unconventional DNA-intercalating small molecules. PMID:27085806

  5. Influence of Lithium Additives in Small Molecule Light-Emitting Electrochemical Cells.

    PubMed

    Lin, Kuo-Yao; Bastatas, Lyndon D; Suhr, Kristin J; Moore, Matthew D; Holliday, Bradley J; Minary-Jolandan, Majid; Slinker, Jason D

    2016-07-01

    Light-emitting electrochemical cells (LEECs) utilizing small molecule emitters such as iridium complexes have great potential as low-cost emissive devices. In these devices, ions rearrange during operation to facilitate carrier injection, bringing about efficient operation from simple, single layer devices. Recent work has shown that the luminance, efficiency, and responsiveness of iridium-based LEECs are greatly enhanced by the inclusion of small amounts of lithium salts (≤0.5%/wt) into the active layer. However, the origin of this enhancement has yet to be demonstrated experimentally. Furthermore, although iridium-based devices have been the longstanding leader among small molecule LEECs, fundamental understanding of the ionic distribution in these devices under operation is lacking. Herein, we use scanning Kelvin probe microscopy to measure the in situ potential profiles and electric field distributions of planar iridium-based LEECs and clarify the role of ionic lithium additives. In pristine devices, it is found that ions do not pack densely at the cathode, and ionic redistribution is slow. Inclusion of small amounts of Li[PF6] greatly increases ionic space charge near the cathode that doubles the peak electric fields and enhances electronic injection relative to pristine devices. This study confirms and clarifies a number of longstanding hypotheses regarding iridium LEECs and recent postulates concerning optimization of their operation. PMID:27299981

  6. Evidence that small molecule enhancement of β-hexosaminidase activity corrects the behavioral phenotype in Dutch APP(E693Q) mice through reduction of ganglioside-bound Aβ.

    PubMed

    Knight, E M; Williams, H N; Stevens, A C; Kim, S H; Kottwitz, J C; Morant, A D; Steele, J W; Klein, W L; Yanagisawa, K; Boyd, R E; Lockhart, D J; Sjoberg, E R; Ehrlich, M E; Wustman, B A; Gandy, S

    2015-02-01

    Certain mutant Alzheimer's amyloid-β (Aβ) peptides (that is, Dutch mutant APP(E693Q)) form complexes with gangliosides (GAβ). These mutant Aβ peptides may also undergo accelerated aggregation and accumulation upon exposure to GM2 and GM3. We hypothesized that increasing β-hexosaminidase (β-hex) activity would lead to a reduction in GM2 levels, which in turn, would cause a reduction in Aβ aggregation and accumulation. The small molecule OT1001 is a β-hex-targeted pharmacological chaperone with good bioavailability, blood-brain barrier penetration, high selectivity for β-hex and low cytotoxicity. Dutch APP(E693Q) transgenic mice accumulate oligomeric Aβ as they age, as well as Aβ oligomer-dose-dependent anxiety and impaired novel object recognition (NOR). Treatment of Dutch APP(E693Q) mice with OT1001 caused a dose-dependent increase in brain β-hex levels up to threefold over those observed at baseline. OT1001 treatment was associated with reduced anxiety, improved learning behavior in the NOR task and dramatically reduced GAβ accumulation in the subiculum and perirhinal cortex, both of which are brain regions required for normal NOR. Pharmacological chaperones that increase β-hex activity may be useful in reducing accumulation of certain mutant species of Aβ and in preventing the associated behavioral pathology. PMID:25349165

  7. Current status of the prebiotic synthesis of small molecules

    NASA Technical Reports Server (NTRS)

    Miller, Stanley L.

    1986-01-01

    Experiments designed to simulate conditions on the primitive earth and to demonstrate how the organic compounds that made up the first living organisms were synthesized are described. Simulated atmospheres with CH4, N2, NH3, and H2O were found to be most effective for synthesis of small prebiotic molecules, although atmospheres with H2, CO, N2, and H2O, and with H2, CO2, N2, and H2O also give good yields of organic compounds provided the H2/CO and H2/CO2 ratios are above 1 and 2, respectively. The spark discharge (which is a good source of HCN) and UV light are also important. Reasonable prebiotic syntheses were worked out for the amino acids that occur in proteins (with the exception of lysine, arginine, and histidine), and for purines, pyrimidines, sugars, and nicotinic acid. Many of the molecules that have been produced in these simulated primitive-earth experiments are found in carbonaceous chondrites.

  8. Small molecule inhibitors of HCV replication from Pomegranate

    NASA Astrophysics Data System (ADS)

    Reddy, B. Uma; Mullick, Ranajoy; Kumar, Anuj; Sudha, Govindarajan; Srinivasan, Narayanaswamy; Das, Saumitra

    2014-06-01

    Hepatitis C virus (HCV) is the causative agent of end-stage liver disease. Recent advances in the last decade in anti HCV treatment strategies have dramatically increased the viral clearance rate. However, several limitations are still associated, which warrant a great need of novel, safe and selective drugs against HCV infection. Towards this objective, we explored highly potent and selective small molecule inhibitors, the ellagitannins, from the crude extract of Pomegranate (Punica granatum) fruit peel. The pure compounds, punicalagin, punicalin, and ellagic acid isolated from the extract specifically blocked the HCV NS3/4A protease activity in vitro. Structural analysis using computational approach also showed that ligand molecules interact with the catalytic and substrate binding residues of NS3/4A protease, leading to inhibition of the enzyme activity. Further, punicalagin and punicalin significantly reduced the HCV replication in cell culture system. More importantly, these compounds are well tolerated ex vivo and`no observed adverse effect level' (NOAEL) was established upto an acute dose of 5000 mg/kg in BALB/c mice. Additionally, pharmacokinetics study showed that the compounds are bioavailable. Taken together, our study provides a proof-of-concept approach for the potential use of antiviral and non-toxic principle ellagitannins from pomegranate in prevention and control of HCV induced complications.

  9. Small molecule inhibitors of HCV replication from pomegranate.

    PubMed

    Reddy, B Uma; Mullick, Ranajoy; Kumar, Anuj; Sudha, Govindarajan; Srinivasan, Narayanaswamy; Das, Saumitra

    2014-01-01

    Hepatitis C virus (HCV) is the causative agent of end-stage liver disease. Recent advances in the last decade in anti HCV treatment strategies have dramatically increased the viral clearance rate. However, several limitations are still associated, which warrant a great need of novel, safe and selective drugs against HCV infection. Towards this objective, we explored highly potent and selective small molecule inhibitors, the ellagitannins, from the crude extract of Pomegranate (Punica granatum) fruit peel. The pure compounds, punicalagin, punicalin, and ellagic acid isolated from the extract specifically blocked the HCV NS3/4A protease activity in vitro. Structural analysis using computational approach also showed that ligand molecules interact with the catalytic and substrate binding residues of NS3/4A protease, leading to inhibition of the enzyme activity. Further, punicalagin and punicalin significantly reduced the HCV replication in cell culture system. More importantly, these compounds are well tolerated ex vivo and'no observed adverse effect level' (NOAEL) was established upto an acute dose of 5000 mg/kg in BALB/c mice. Additionally, pharmacokinetics study showed that the compounds are bioavailable. Taken together, our study provides a proof-of-concept approach for the potential use of antiviral and non-toxic principle ellagitannins from pomegranate in prevention and control of HCV induced complications. PMID:24958333

  10. Catalytic in vivo protein knockdown by small-molecule PROTACs.

    PubMed

    Bondeson, Daniel P; Mares, Alina; Smith, Ian E D; Ko, Eunhwa; Campos, Sebastien; Miah, Afjal H; Mulholland, Katie E; Routly, Natasha; Buckley, Dennis L; Gustafson, Jeffrey L; Zinn, Nico; Grandi, Paola; Shimamura, Satoko; Bergamini, Giovanna; Faelth-Savitski, Maria; Bantscheff, Marcus; Cox, Carly; Gordon, Deborah A; Willard, Ryan R; Flanagan, John J; Casillas, Linda N; Votta, Bartholomew J; den Besten, Willem; Famm, Kristoffer; Kruidenier, Laurens; Carter, Paul S; Harling, John D; Churcher, Ian; Crews, Craig M

    2015-08-01

    The current predominant therapeutic paradigm is based on maximizing drug-receptor occupancy to achieve clinical benefit. This strategy, however, generally requires excessive drug concentrations to ensure sufficient occupancy, often leading to adverse side effects. Here, we describe major improvements to the proteolysis targeting chimeras (PROTACs) method, a chemical knockdown strategy in which a heterobifunctional molecule recruits a specific protein target to an E3 ubiquitin ligase, resulting in the target's ubiquitination and degradation. These compounds behave catalytically in their ability to induce the ubiquitination of super-stoichiometric quantities of proteins, providing efficacy that is not limited by equilibrium occupancy. We present two PROTACs that are capable of specifically reducing protein levels by >90% at nanomolar concentrations. In addition, mouse studies indicate that they provide broad tissue distribution and knockdown of the targeted protein in tumor xenografts. Together, these data demonstrate a protein knockdown system combining many of the favorable properties of small-molecule agents with the potent protein knockdown of RNAi and CRISPR. PMID:26075522

  11. Small molecule inhibitors of HCV replication from Pomegranate

    PubMed Central

    Reddy, B. Uma; Mullick, Ranajoy; Kumar, Anuj; Sudha, Govindarajan; Srinivasan, Narayanaswamy; Das, Saumitra

    2014-01-01

    Hepatitis C virus (HCV) is the causative agent of end-stage liver disease. Recent advances in the last decade in anti HCV treatment strategies have dramatically increased the viral clearance rate. However, several limitations are still associated, which warrant a great need of novel, safe and selective drugs against HCV infection. Towards this objective, we explored highly potent and selective small molecule inhibitors, the ellagitannins, from the crude extract of Pomegranate (Punica granatum) fruit peel. The pure compounds, punicalagin, punicalin, and ellagic acid isolated from the extract specifically blocked the HCV NS3/4A protease activity in vitro. Structural analysis using computational approach also showed that ligand molecules interact with the catalytic and substrate binding residues of NS3/4A protease, leading to inhibition of the enzyme activity. Further, punicalagin and punicalin significantly reduced the HCV replication in cell culture system. More importantly, these compounds are well tolerated ex vivo and‘no observed adverse effect level' (NOAEL) was established upto an acute dose of 5000 mg/kg in BALB/c mice. Additionally, pharmacokinetics study showed that the compounds are bioavailable. Taken together, our study provides a proof-of-concept approach for the potential use of antiviral and non-toxic principle ellagitannins from pomegranate in prevention and control of HCV induced complications. PMID:24958333

  12. Construction of DNA Hemicatenanes from Two Small Circular DNA Molecules

    PubMed Central

    Gaillard, Claire; Strauss, François

    2015-01-01

    DNA hemicatenanes, one of the simplest possible junctions between two double stranded DNA molecules, have frequently been mentioned in the literature for their possible function in DNA replication, recombination, repair, and organization in chromosomes. They have been little studied experimentally, however, due to the lack of an appropriate method for their preparation. Here we have designed a method to build hemicatenanes from two small circular DNA molecules. The method involves, first, the assembly of two linear single strands and their circularization to form a catenane of two single stranded circles, and, second, the addition and base-pairing of the two single stranded circles complementary to the first ones, followed by their annealing using DNA topoisomerase I. The product was purified by gel electrophoresis and characterized. The arrangement of strands was as expected for a hemicatenane and clearly distinct from a full catenane. In addition, each circle was unwound by an average of half a double helical turn, also in excellent agreement with the structure of a hemicatenane. It was also observed that hemicatenanes are quickly destabilized by a single cut on either of the two strands passing inside the junction, strongly suggesting that DNA strands are able to slide easily inside the hemicatenane. This method should make it possible to study the biochemical properties of hemicatenanes and to test some of the hypotheses that have been proposed about their function, including a possible role for this structure in the organization of complex genomes in loops and chromosomal domains. PMID:25799010

  13. Catalytic in vivo protein knockdown by small-molecule PROTACs

    PubMed Central

    Bondeson, Daniel P; Mares, Alina; Smith, Ian E D; Ko, Eunhwa; Campos, Sebastien; Miah, Afjal H; Mulholland, Katie E; Routly, Natasha; Buckley, Dennis L; Gustafson, Jeffrey L; Zinn, Nico; Grandi, Paola; Shimamura, Satoko; Bergamini, Giovanna; Faelth-Savitski, Maria; Bantscheff, Marcus; Cox, Carly; Gordon, Deborah A; Willard, Ryan R; Flanagan, John J; Casillas, Linda N; Votta, Bartholomew J; den Besten, Willem; Famm, Kristoffer; Kruidenier, Laurens; Carter, Paul S; Harling, John D; Churcher, Ian; Crews, Craig M

    2015-01-01

    The current predominant theapeutic paradigm is based on maximizing drug-receptor occupancy to achieve clinical benefit. This strategy, however, generally requires excessive drug concentrations to ensure sufficient occupancy, often leading to adverse side effects. Here, we describe major improvements to the proteolysis targeting chimeras (PROTACs) method, a chemical knockdown strategy in which a heterobifunctional molecule recruits a specific protein target to an E3 ubiquitin ligase, resulting in the target’s ubiquitination and degradation. These compounds behave catalytically in their ability to induce the ubiquitination of super-stoichiometric quantities of proteins, providing efficacy that is not limited by equilibrium occupancy. We present two PROTACs that are capable of specifically reducing protein levels by >90% at nanomolar concentrations. In addition, mouse studies indicate that they provide broad tissue distribution and knockdown of the targeted protein in tumor xenografts. Together, these data demonstrate a protein knockdown system combining many of the favorable properties of small-molecule agents with the potent protein knockdown of RNAi and CRISPR. PMID:26075522

  14. Identification and characterization of small-molecule inhibitors of hepsin

    PubMed Central

    Chevillet, John R.; Park, Gemma J.; Bedalov, Antonio; Simon, Julian A.; Vasioukhin, Valeri I.

    2009-01-01

    Hepsin is a type-II transmembrane serine protease overexpressed in the majority of human prostate cancers. We recently demonstrated that hepsin promotes prostate cancer progression and metastasis and thus represents a potential therapeutic target. Here we report the identification of novel small-molecule inhibitors of hepsin catalytic activity. We utilized purified human hepsin for high-throughput screening of established drug and chemical diversity libraries and identified sixteen inhibitory compounds with IC50 values against hepsin ranging from 0.23–2.31μM and relative selectivity of up to 86-fold or greater. Two compounds are orally administered drugs established for human use. Four compounds attenuated hepsin-dependent pericellular serine protease activity in a dose dependent manner with limited or no cytotoxicity to a range of cell types. These compounds may be used as leads to develop even more potent and specific inhibitors of hepsin to prevent prostate cancer progression and metastasis. PMID:18852137

  15. Coalescence during emulsification. 2. Role of small molecule surfactants.

    PubMed

    Lobo, Lloyd; Svereika, Aileen

    2003-05-15

    An oil-soluble hexadecyl pyrene (HDP) probe is used to monitor coalescence of hexadecane oil-in-water emulsions, during emulsification, in stirred systems and in a high-pressure homogenizer (microfluidizer), when small molecule surfactants are used as emulsifiers. The effect of sodium dodecyl sulfate concentration and salt concentration on the amount of coalescence and final drop size is studied. The behavior of oil-soluble surfactants and mixtures of oil-soluble and water-soluble surfactants on emulsification performance is also discussed. For high-pressure homogenizers, the drop sizes obtained are found to depend mostly on the ability of surfactants to stabilize the drops against coalescence, rather than their ability to reduce the interfacial tension. Increasing oil phase fractions increase the coalescence rate, because of the increase in collision frequency, which, in turn, impacts the drop size of the homogenized emulsion. PMID:16256561

  16. Small-Molecule-Based Lineage Reprogramming Creates Functional Astrocytes.

    PubMed

    Tian, E; Sun, Guoqiang; Sun, Guihua; Chao, Jianfei; Ye, Peng; Warden, Charles; Riggs, Arthur D; Shi, Yanhong

    2016-07-19

    Growing evidence indicates important roles for astrocytes in neurodevelopment and diseases. However, astrocytes and their roles in these processes remain poorly understood. Despite recent progress in reprogramming somatic cells into different types of neural cells, reprogramming to astrocytes has lagged. Here, we show that functional astrocytes can be generated from mammalian fibroblasts using only small molecules. Induced mouse astrocytes resemble primary astrocytes in astrocytic gene expression and epigenomic status and exhibit functional properties in promoting neuronal maturation, glutamate uptake, and calcium signaling. Moreover, these cells can recapitulate the Alexander disease phenotype of protein aggregation when expressing Gfap with a disease-causing mutation. The same compounds can also reprogram human fibroblasts into astroglial progenitor cells that can further mature into functional astrocytes. These chemically induced astrocytes may provide cellular models to uncover roles of astrocytes in normal neurodevelopment and pathogenesis of neurological diseases. PMID:27396343

  17. Small-molecule modulators of PXR and CAR.

    PubMed

    Chai, Sergio C; Cherian, Milu T; Wang, Yue-Ming; Chen, Taosheng

    2016-09-01

    Two nuclear receptors, the pregnane X receptor (PXR) and the constitutive androstane receptor (CAR), participate in the xenobiotic detoxification system by regulating the expression of drug-metabolizing enzymes and transporters in order to degrade and excrete foreign chemicals or endogenous metabolites. This review aims to expand the perceived relevance of PXR and CAR beyond their established role as master xenosensors to disease-oriented areas, emphasizing their modulation by small molecules. Structural studies of these receptors have provided much-needed insight into the nature of their binding promiscuity and the important elements that lead to ligand binding. Reports of species- and isoform-selective activation highlight the need for further scrutiny when extrapolating from animal data to humans, as animal models are at the forefront of early drug discovery. This article is part of a Special Issue entitled: Xenobiotic nuclear receptors: New Tricks for An Old Dog, edited by Dr. Wen Xie. PMID:26921498

  18. Cytoprotective small molecule modulators of endoplasmic reticulum stress.

    PubMed

    Munshi, Soumyabrata; Dahl, Russell

    2016-06-01

    Cellular health depends on the normal function of the endoplasmic reticulum (ER) to fold, assemble, and modify critical proteins to maintain viability. When the ER cannot process proteins effectively, a condition known as ER stress ensues. When this stress is excessive or prolonged, cell death via apoptotic pathways is triggered. Interestingly, most major diseases have been shown to be intimately linked to ER stress, including diabetes, stroke, neurodegeneration, and many cancers. Thus, controlling ER stress presents a significant strategy for drug development for these diseases. The goal of this review is to present various small molecules that alleviate ER stress with the intention that they may serve as useful starting points for therapeutic agent development. PMID:27091069

  19. Toward reprogramming bacteria with small molecules and RNA.

    PubMed

    Gallivan, Justin P

    2007-12-01

    A major goal of synthetic biology is to reprogram bacteria to carry out complex tasks, such as synthesizing and delivering drugs, and seeking and destroying environmental pollutants. Advances in molecular biology and bacterial genetics have made it straightforward to modify, insert, or delete genes in many bacterial strains, and advances in gene synthesis have opened the door to replacing entire genomes. However, rewriting the underlying genetic code is only part of the challenge of reprogramming cellular behavior. A remaining challenge is to control how and when the modified genes are expressed. Several recent studies have highlighted how synthetic riboswitches, which are RNA sequences that undergo a ligand-induced conformational change to alter gene expression, can be used to reprogram how bacteria respond to small molecules. PMID:17967431

  20. Virtual screening in small molecule discovery for epigenetic targets.

    PubMed

    Li, Guo-Bo; Yang, Ling-Ling; Yuan, Yiming; Zou, Jun; Cao, Yu; Yang, Sheng-Yong; Xiang, Rong; Xiang, Mingli

    2015-01-01

    Epigenetic modifications are critical mechanisms that regulate many biological processes and establish normal cellular phenotypes. Aberrant epigenetic modifications are frequently linked to the development and maintenance of several diseases including cancer, inflammation and metabolic diseases and so on. The key proteins that mediate epigenetic modifications have been thus recognized as potential therapeutic targets for these diseases. Consequently, discovery of small molecule inhibitors for epigenetic targets has received considerable attention in recent years. Here, virtual screening methods and their applications in the discovery of epigenetic target inhibitors are the focus of this review. Newly emerging approaches or strategies including rescoring methods, docking pose filtering methods, machine learning methods and 3D molecular similarity methods were also underlined. They are expected to be employed for identifying novel inhibitors targeting epigenetic regulation more efficiently. PMID:25462557

  1. Targeting Gli Transcription Activation by Small Molecule Suppresses Tumor Growth

    PubMed Central

    Bosco-Clément, Geneviève; Zhang, Fang; Chen, Zhao; Zhou, Hai-Meng; Li, Hui; Mikami, Iwao; Hirata, Tomomi; Yagui-Beltran, Adam; Lui, Natalie; Do, Hanh T.; Cheng, Tiffany; Tseng, Hsin-Hui; Choi, Helen; Fang, Li-Tai; Kim, Il-Jin; Yue, Dongsheng; Wang, Changli; Zheng, Qingfeng; Fujii, Naoaki; Mann, Michael; Jablons, David M.; He, Biao

    2014-01-01

    Targeted inhibition of Hedgehog signaling at the cell membrane has been associated with anti-cancer activity in preclinical and early clinical studies. Hedgehog signaling involves activation of Gli transcription factors that can also be induced by alternative pathways. In this study we identified an interaction between Gli proteins and a transcription co-activator TAF9, and validated its functional relevance in regulating Gli transactivation. We also describe a novel, synthetic small molecule, FN1-8, that efficiently interferes with Gli/TAF9 interaction and down-regulate Gli/TAF9 dependent transcriptional activity. More importantly, FN1-8 suppresses cancer cell proliferation in vitro and inhibits tumor growth in vivo. Our results suggest that blocking Gli transactivation, a key control point of multiple oncogenic pathways, may be an effective anti-cancer strategy. PMID:23686308

  2. Detection of small molecules with a flow immunosensor

    NASA Technical Reports Server (NTRS)

    Kusterbeck, Anne W.; Ligler, Frances S.

    1991-01-01

    We describe the development of an easy-to-use sensor with widespread applications for detecting small molecules. The flow immunosensor can analyze discrete samples in under one minute or continuously monitor a flowing stream for the presence of specific analytes. This detection system is extremely specific, and achieves a level of sensitivity which meets or exceeds the detection limits reported for rival assays. Because the system is also compact, transportable, and automated, it has the potential to impact diverse areas. For example, the flow immunosensor has successfully detected drugs of abuse and explosives, and may well address many of the needs of the environmental community with respect to continuous monitoring for pollutants. Efforts are underway to engineer a portable device in the field.

  3. Shape shifting leads to small molecule allosteric drug discovery

    PubMed Central

    Lawrence, Sarah H.; Ramirez, Ursula D.; Tang, Lei; Fazliyev, Farit; Kundrat, Lenka; Markham, George D.; Jaffe, Eileen K.

    2009-01-01

    SUMMARY Enzymes that regulate their activity by modulating an equilibrium of alternate, non-additive, functionally distinct oligomeric assemblies (morpheeins) define a novel mode of allostery (Jaffe, TiBS 30:490-7, 2005). The oligomeric equilibrium for porphobilinogen synthase (PBGS) consists of high-activity octamers, low-activity hexamers, and two dimer conformations. A phylogenetically diverse allosteric site specific to hexamers is proposed as an inhibitor binding site. Inhibitor binding is predicted to draw the oligomeric equilibrium toward the low-activity hexamer. In silico docking enriched a selection from a small molecule library for compounds predicted to bind to this allosteric site. In vitro testing of selected compounds identified one compound whose inhibition mechanism is species-specific conversion of PBGS octamers to hexamers. We propose that this novel strategy for inhibitor discovery can be applied to other proteins that use the morpheein model for allosteric regulation. PMID:18559269

  4. Probing the Probes: Fitness Factors For Small Molecule Tools

    PubMed Central

    Workman, Paul; Collins, Ian

    2010-01-01

    Chemical probes for interrogating biological processes are of considerable current interest. Cell permeable small molecule tools have a major role in facilitating the functional annotation of the human genome, understanding both physiological and pathological processes, and validating new molecular targets. To be valuable, chemical tools must satisfy necessary criteria and recent publications have suggested objective guidelines for what makes a useful chemical probe. Although recognizing that such guidelines may be valuable, we caution against overly restrictive rules that may stifle innovation in favor of a “fit-for-purpose” approach. Reviewing the literature and providing examples from the cancer field, we recommend a series of “fitness factors” to be considered when assessing chemical probes. We hope this will encourage innovative chemical biology research while minimizing the generation of poor quality and misleading biological data, thus increasing understanding of the particular biological area, to the benefit of basic research and drug discovery. PMID:20609406

  5. Toward Reprogramming Bacteria with Small Molecules and RNA

    PubMed Central

    Gallivan, Justin P.

    2007-01-01

    Summary A major goal of synthetic biology is to reprogram bacteria to carry out complex tasks, such as synthesizing and delivering drugs, and seeking and destroying environmental pollutants. Advances in molecular biology and bacterial genetics have made it straightforward to modify, insert, or delete genes in many bacterial strains, and advances in gene synthesis have opened the door to replacing entire genomes. However, rewriting the underlying genetic code is only part of the challenge of reprogramming cellular behavior. A remaining challenge is to control how and when the modified genes are expressed. Several recent studies have highlighted how synthetic riboswitches, which are RNA sequences that undergo a ligand-induced conformational change to alter gene expression, can be used to reprogram how bacteria respond to small molecules. PMID:17967431

  6. Microbial Modulation of Host Immunity with the Small Molecule Phosphorylcholine

    PubMed Central

    Clark, Sarah E.

    2013-01-01

    All microorganisms dependent on persistence in a host for survival rely on either hiding from or modulating host responses to infection. The small molecule phosphorylcholine, or choline phosphate (ChoP), is used for both of these purposes by a wide array of bacterial and parasitic microbes. While the mechanisms underlying ChoP acquisition and expression are diverse, a unifying theme is the use of ChoP to reduce the immune response to infection, creating an advantage for ChoP-expressing microorganisms. In this minireview, we discuss several benefits of ChoP expression during infection as well as how the immune system fights back against ChoP-expressing pathogens. PMID:23230294

  7. Small Molecule Inhibitors Targeting Activator Protein 1 (AP-1)

    PubMed Central

    2015-01-01

    Activator protein 1 (AP-1) is a pivotal transcription factor that regulates a wide range of cellular processes including proliferation, apoptosis, differentiation, survival, cell migration, and transformation. Accumulating evidence supports that AP-1 plays an important role in several severe disorders including cancer, fibrosis, and organ injury, as well as inflammatory disorders such as asthma, psoriasis, and rheumatoid arthritis. AP-1 has emerged as an actively pursued drug discovery target over the past decade. Excitingly, a selective AP-1 inhibitor T-5224 (51) has been investigated in phase II human clinical trials. Nevertheless, no effective AP-1 inhibitors have yet been approved for clinical use. Despite significant advances achieved in understanding AP-1 biology and function, as well as the identification of small molecules modulating AP-1 associated signaling pathways, medicinal chemistry efforts remain an urgent need to yield selective and efficacious AP-1 inhibitors as a viable therapeutic strategy for human diseases. PMID:24831826

  8. Development of a Unique Small Molecule Modulator of CXCR4

    PubMed Central

    Yoon, Younghyoun; Lin, Songbai; Sasaki, Maiko; Klapproth, Jan-Michael A.; Yang, Hua; Grossniklaus, Hans E.; Xu, Jianguo; Rojas, Mauricio; Voll, Ronald J.; Goodman, Mark M.; Arrendale, Richard F.; Liu, Jin; Yun, C. Chris; Snyder, James P.; Liotta, Dennis C.; Shim, Hyunsuk

    2012-01-01

    Background Metastasis, the spread and growth of tumor cells to distant organ sites, represents the most devastating attribute and plays a major role in the morbidity and mortality of cancer. Inflammation is crucial for malignant tumor transformation and survival. Thus, blocking inflammation is expected to serve as an effective cancer treatment. Among anti-inflammation therapies, chemokine modulation is now beginning to emerge from the pipeline. CXC chemokine receptor-4 (CXCR4) and its ligand stromal cell-derived factor-1 (CXCL12) interaction and the resulting cell signaling cascade have emerged as highly relevant targets since they play pleiotropic roles in metastatic progression. The unique function of CXCR4 is to promote the homing of tumor cells to their microenvironment at the distant organ sites. Methodology/Principal Findings We describe the actions of N,N′-(1,4-phenylenebis(methylene))dipyrimidin-2-amine (designated MSX-122), a novel small molecule and partial CXCR4 antagonist with properties quite unlike that of any other reported CXCR4 antagonists, which was prepared in a single chemical step using a reductive amination reaction. Its specificity toward CXCR4 was tested in a binding affinity assay and a ligand competition assay using 18F-labeled MSX-122. The potency of the compound was determined in two functional assays, Matrigel invasion assay and cAMP modulation. The therapeutic potential of MSX-122 was evaluated in three different murine models for inflammation including an experimental colitis, carrageenan induced paw edema, and bleomycin induced lung fibrosis and three different animal models for metastasis including breast cancer micrometastasis in lung, head and neck cancer metastasis in lung, and uveal melanoma micrometastasis in liver in which CXCR4 was reported to play crucial roles. Conclusions/Significance We developed a novel small molecule, MSX-122, that is a partial CXCR4 antagonist without mobilizing stem cells, which can be safer for

  9. Advances in structure elucidation of small molecules using mass spectrometry

    PubMed Central

    Fiehn, Oliver

    2010-01-01

    The structural elucidation of small molecules using mass spectrometry plays an important role in modern life sciences and bioanalytical approaches. This review covers different soft and hard ionization techniques and figures of merit for modern mass spectrometers, such as mass resolving power, mass accuracy, isotopic abundance accuracy, accurate mass multiple-stage MS(n) capability, as well as hybrid mass spectrometric and orthogonal chromatographic approaches. The latter part discusses mass spectral data handling strategies, which includes background and noise subtraction, adduct formation and detection, charge state determination, accurate mass measurements, elemental composition determinations, and complex data-dependent setups with ion maps and ion trees. The importance of mass spectral library search algorithms for tandem mass spectra and multiple-stage MS(n) mass spectra as well as mass spectral tree libraries that combine multiple-stage mass spectra are outlined. The successive chapter discusses mass spectral fragmentation pathways, biotransformation reactions and drug metabolism studies, the mass spectral simulation and generation of in silico mass spectra, expert systems for mass spectral interpretation, and the use of computational chemistry to explain gas-phase phenomena. A single chapter discusses data handling for hyphenated approaches including mass spectral deconvolution for clean mass spectra, cheminformatics approaches and structure retention relationships, and retention index predictions for gas and liquid chromatography. The last section reviews the current state of electronic data sharing of mass spectra and discusses the importance of software development for the advancement of structure elucidation of small molecules. Electronic supplementary material The online version of this article (doi:10.1007/s12566-010-0015-9) contains supplementary material, which is available to authorized users. PMID:21289855

  10. Targeting Th17 Cells with Small Molecules and Small Interference RNA

    PubMed Central

    Lin, Hui; Song, Pingfang; Zhao, Yi; Xue, Li-Jia; Liu, Yi; Chu, Cong-Qiu

    2015-01-01

    T helper 17 (Th17) cells play a central role in inflammatory and autoimmune diseases via the production of proinflammatory cytokines interleukin- (IL-) 17, IL-17F, and IL-22. Anti-IL-17 monoclonal antibodies show potent efficacy in psoriasis but poor effect in rheumatoid arthritis (RA) and Crohn's disease. Alternative agents targeting Th17 cells may be a better way to inhibit the development and function of Th17 cells than antibodies of blocking a single effector cytokine. Retinoic acid-related orphan receptor gamma t (RORγt) which acts as the master transcription factor of Th17 differentiation has been an attractive pharmacologic target for the treatment of Th17-mediated autoimmune disease. Recent progress in technology of chemical screen and engineering nucleic acid enable two new classes of therapeutics targeting RORγt. Chemical screen technology identified several small molecule specific inhibitors of RORγt from a small molecule library. Systematic evolution of ligands by exponential enrichment (SELEX) technology enabled target specific aptamers to be isolated from a random sequence oligonucleotide library. In this review, we highlight the development and therapeutic potential of small molecules inhibiting Th17 cells by targeting RORγt and aptamer mediated CD4+ T cell specific delivery of small interference RNA against RORγt gene expression to inhibit pathogenic effector functions of Th17 lineage. PMID:26792955

  11. A Small Molecule Inhibitor of Inducible Heat Shock Protein 70 (HSP70)

    PubMed Central

    Leu, J. I-Ju; Pimkina, Julia; Frank, Amanda; Murphy, Maureen E.; George, Donna L.

    2009-01-01

    SUMMARY The multifunctional, stress-inducible, molecular chaperone HSP70 has important roles in aiding protein folding and maintaining protein homeostasis. HSP70 expression is elevated in many cancers, contributing to tumor cell survival and resistance to therapy. We have determined that a small molecule called 2-Phenylethynesulfonamide (PES) interacts selectively with HSP70, and leads to a disruption of the association between HSP70 and several of its co-chaperones and substrate proteins. Treatment of cultured tumor cells with PES promotes cell death that is associated with protein aggregation, impaired autophagy, and inhibition of lysosomal function. Moreover, this small molecule is able to suppress tumor development and enhance survival in a mouse model of Myc-induced lymphomagenesis. The data demonstrate that PES disrupts actions of HSP70 in multiple cell signaling pathways offering an opportunity to better understand the diverse functions of this molecular chaperone, and also to aid in the development of new cancer therapies. PMID:19818706

  12. TIPS-DBC small molecule O-FETs fabricated by evaporation and solution processing

    NASA Astrophysics Data System (ADS)

    Gruszecki, Daniel; Singh, Birendra; Bown, Mark; Lewis, David

    2012-02-01

    The performance of organic field effect transistors using the small molecule, tri-isopropyl- silane-di-benzo chrysene (TIPS-DBC) is reported. The field effect mobility μFE is found to depend on the deposition conditions, which affect the morphology of the film. A mobility in the range of 1.5 × 10-6 to 2.4 × 10-4 cm2 V-1 s-1 is obtained from the evaporated films depending on the substrate treatment and deposition temperature, while films deposited by solution-processing techniques yield mobilities in the range of 0.7 × 10-3 to 1.5 × 10-3 cm2 V-1 s-1. The enhanced performance in polycrystalline solution-processed coatings and its relationship to crystallite size is an important parameter in the design of high-performance devices based on small molecules.

  13. Zirconium silicate assisted removal of residual proteins after organic solvent deproteinization of human plasma, enhancing the stability of the LC-ESI-MS response for the bioanalysis of small molecules.

    PubMed

    Hussain, Shah; Pezzei, Cornelia; Güzel, Yüksel; Rainer, Matthias; Huck, Christian W; Bonn, Günther K

    2014-12-10

    An efficient blood plasma clean-up method was developed, where methanol protein precipitation was applied, followed by zirconium silicate assisted exclusion of residual proteins. A strong binding of zirconium (IV) silicate to the proteins enabled the elimination of remaining proteins after solvent deproteinization through a rapid solid-phase extraction (SPE) procedure. Matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI/TOF MS) was used for monitoring the proteins during clean-up practice applied to human plasma samples. The proteins were quantified by colorimetric detection using the bicinchoninic acid (BCA) assay. The presented analytical strategy resulted in the depletion of >99.6% proteins from human plasma samples. Furthermore, high-performance liquid chromatography hyphenated to diode-array and electrospray ionization mass spectrometric detection (HPLC-DAD/ESI MS) was applied for qualitative and quantitative analysis of the caffeoylquinic acids (CQAs) and their metabolites in human plasma. The procedure demonstrated high recoveries for the standard compounds spiked at different concentrations. Cynarin and chlorogenic acid were recovered in the range of 81-86% and 78-83%, respectively. Caffeic acid was extracted in the excess of 89-92%, while ferulic acid and dihydroxyhydrocinnamic acid showed a recovery of 87-91% and 92-95%, respectively. The method was partially validated in accordance with FDA-Industry Guidelines for Bioanalytical Method Validation (2001). The presented scheme improves the clean-up efficacy of the methanol deproteinization, significantly reduces the matrix effects and provides a great analytical tool for the isolation of small molecules from human plasma. PMID:25441909

  14. Targeting Innate Immunity for Antiviral Therapy through Small Molecule Agonists of the RLR Pathway

    PubMed Central

    Pattabhi, Sowmya; Wilkins, Courtney R.; Dong, Ran; Knoll, Megan L.; Posakony, Jeffrey; Kaiser, Shari; Mire, Chad E.; Wang, Myra L.; Ireton, Renee C.; Geisbert, Thomas W.; Bedard, Kristin M.; Iadonato, Shawn P.

    2015-01-01

    selectively activate IRF3 for the purpose of identifying drug-like molecules that can be developed for the treatment of viral infections. Here, we report the discovery of a hydroxyquinoline family of small molecules that can activate IRF3 to promote cellular antiviral responses. These molecules can prophylactically or therapeutically control infection in cell culture by pathogenic RNA viruses, including West Nile virus, dengue virus, hepatitis C virus, influenza A virus, respiratory syncytial virus, Nipah virus, Lassa virus, and Ebola virus. Our study thus identifies a class of small molecules with a novel mechanism to enhance host immune responses for antiviral activity against a variety of RNA viruses that pose a significant health care burden and/or that are known to cause infections with high case fatality rates. PMID:26676770

  15. Small molecule screening in context: Lipid-catalyzed amyloid formation

    PubMed Central

    Hebda, James A; Magzoub, Mazin; Miranker, Andrew D

    2014-01-01

    Islet Amyloid Polypeptide (IAPP) is a 37-residue hormone cosecreted with insulin by the β-cells of the pancreas. Amyloid fiber aggregation of IAPP has been correlated with the dysfunction and death of these cells in type II diabetics. The likely mechanisms by which IAPP gains toxic function include energy independent cell membrane penetration and induction of membrane depolarization. These processes have been correlated with solution biophysical observations of lipid bilayer catalyzed acceleration of amyloid formation. Although the relationship between amyloid formation and toxicity is poorly understood, the fact that conditions promoting one also favor the other suggests related membrane active structural states. Here, a novel high throughput screening protocol is described that capitalizes on this correlation to identify compounds that target membrane active species. Applied to a small library of 960 known bioactive compounds, we are able to report identification of 37 compounds of which 36 were not previously reported as active toward IAPP fiber formation. Several compounds tested in secondary cell viability assays also demonstrate cytoprotective effects. It is a general observation that peptide induced toxicity in several amyloid diseases (such as Alzhiemer’s and Parkinson’s) involves a membrane bound, preamyloid oligomeric species. Our data here suggest that a screening protocol based on lipid-catalyzed assembly will find mechanistically informative small molecule hits in this subclass of amyloid diseases. PMID:25043951

  16. High performance photovoltaic applications using solution-processed small molecules.

    PubMed

    Chen, Yongsheng; Wan, Xiangjian; Long, Guankui

    2013-11-19

    Energy remains a critical issue for the survival and prosperity of humancivilization. Many experts believe that the eventual solution for sustainable energy is the use of direct solar energy as the main energy source. Among the options for renewable energy, photovoltaic technologies that harness solar energy offer a way to harness an unlimited resource and minimum environment impact in contrast with other alternatives such as water, nuclear, and wind energy. Currently, almost all commercial photovoltaic technologies use Si-based technology, which has a number of disadvantages including high cost, lack of flexibility, and the serious environmental impact of the Si industry. Other technologies, such as organic photovoltaic (OPV) cells, can overcome some of these issues. Today, polymer-based OPV (P-OPV) devices have achieved power conversion efficiencies (PCEs) that exceed 9%. Compared with P-OPV, small molecules based OPV (SM-OPV) offers further advantages, including a defined structure for more reproducible performance, higher mobility and open circuit voltage, and easier synthetic control that leads to more diversified structures. Therefore, while largely undeveloped, SM-OPV is an important emerging technology with performance comparable to P-OPV. In this Account, we summarize our recent results on solution-processed SM-OPV. We believe that solution processing is essential for taking full advantage of OPV technologies. Our work started with the synthesis of oligothiophene derivatives with an acceptor-donor-acceptor (A-D-A) structure. Both the backbone conjugation length and electron withdrawing terminal groups play an important role in the light absorption, energy levels and performance of the devices. Among those molecules, devices using a 7-thiophene-unit backbone and a 3-ethylrhodanine (RD) terminal unit produced a 6.1% PCE. With the optimized conjugation length and terminal unit, we borrowed from the results with P-OPV devices to optimize the backbone. Thus we

  17. Small Molecule Proprotein Convertase Inhibitors for Inhibition of Embryo Implantation

    PubMed Central

    Ho, Huiting; Singh, Harmeet; Heng, Sophea; Nero, Tracy L.; Paule, Sarah; Parker, Michael W.; Johnson, Alan T.; Jiao, Guan-Sheng; Nie, Guiying

    2013-01-01

    Uterine proprotein convertase (PC) 6 plays a critical role in embryo implantation and is pivotal for pregnancy establishment. Inhibition of PC6 may provide a novel approach for the development of non-hormonal and female-controlled contraceptives. We investigated a class of five synthetic non-peptidic small molecule compounds that were previously reported as potent inhibitors of furin, another PC member. We examined (i) the potency of these compounds in inhibiting PC6 activity in vitro; (ii) their binding modes in the PC6 active site in silico; (iii) their efficacy in inhibiting PC6-dependent cellular processes essential for embryo implantation using human cell-based models. All five compounds showed potent inhibition of PC6 activity in vitro, and in silico docking demonstrated that these inhibitors could adopt a similar binding mode in the PC6 active site. However, when these compounds were tested for their inhibition of decidualization of primary human endometrial stromal cells, a PC6-dependent cellular process critical for embryo implantation, only one (compound 1o) showed potent inhibition. The lack of activity in the cell-based assay may reflect the inability of the compounds to penetrate the cell membrane. Because compound's lipophilicity is linked to cell penetration, a measurement of lipophilicity (logP) was calculated for each compound. Compound 1o is unique as it appears the most lipophilic among the five compounds. Compound 1o also inhibited another crucial PC6-dependent process, the attachment of human trophoblast spheroids to endometrial epithelial cells (a model for human embryo attachment). We thus identified compound 1o as a potent small molecule PC6 inhibitor with pharmaceutical potential to inhibit embryo implantation. Our findings also highlight that human cell-based functional models are vital to complement the biochemical and in silico analyses in the selection of promising drug candidates. Further investigations for compound 1o are warranted in

  18. Small molecule modulators of histone acetyltransferase p300.

    PubMed

    Balasubramanyam, Karanam; Swaminathan, V; Ranganathan, Anupama; Kundu, Tapas K

    2003-05-23

    Histone acetyltransferases (HATs) are a group of enzymes that play a significant role in the regulation of gene expression. These enzymes covalently modify the N-terminal lysine residues of histones by the addition of acetyl groups from acetyl-CoA. Dysfunction of these enzymes is often associated with the manifestation of several diseases, predominantly cancer. Here we report that anacardic acid from cashew nut shell liquid is a potent inhibitor of p300 and p300/CBP-associated factor histone acetyltranferase activities. Although it does not affect DNA transcription, HAT-dependent transcription from a chromatin template was strongly inhibited by anacardic acid. Furthermore, we describe the design and synthesis of an amide derivative N-(4-chloro-3-trifluoromethyl-phenyl)-2-ethoxy-6-pentadecyl-benzamide (CTPB) using anacardic acid as a synthon, which remarkably activates p300 HAT activity but not that of p300/CBP-associated factor. Although CTPB does not affect DNA transcription, it enhances the p300 HAT-dependent transcriptional activation from in vitro assembled chromatin template. However, it has no effect on histone deacetylase activity. These compounds would be useful as biological switching molecules for probing into the role of p300 in transcriptional studies and may also be useful as new chemical entities for the development of anticancer drugs. PMID:12624111

  19. Molecular locks and keys: the role of small molecules in phytohormone research

    PubMed Central

    Fonseca, Sandra; Rosado, Abel; Vaughan-Hirsch, John; Bishopp, Anthony; Chini, Andrea

    2014-01-01

    Plant adaptation, growth and development rely on the integration of many environmental and endogenous signals that collectively determine the overall plant phenotypic plasticity. Plant signaling molecules, also known as phytohormones, are fundamental to this process. These molecules act at low concentrations and regulate multiple aspects of plant fitness and development via complex signaling networks. By its nature, phytohormone research lies at the interface between chemistry and biology. Classically, the scientific community has always used synthetic phytohormones and analogs to study hormone functions and responses. However, recent advances in synthetic and combinational chemistry, have allowed a new field, plant chemical biology, to emerge and this has provided a powerful tool with which to study phytohormone function. Plant chemical biology is helping to address some of the most enduring questions in phytohormone research such as: Are there still undiscovered plant hormones? How can we identify novel signaling molecules? How can plants activate specific hormone responses in a tissue-specific manner? How can we modulate hormone responses in one developmental context without inducing detrimental effects on other processes? The chemical genomics approaches rely on the identification of small molecules modulating different biological processes and have recently identified active forms of plant hormones and molecules regulating many aspects of hormone synthesis, transport and response. We envision that the field of chemical genomics will continue to provide novel molecules able to elucidate specific aspects of hormone-mediated mechanisms. In addition, compounds blocking specific responses could uncover how complex biological responses are regulated. As we gain information about such compounds we can design small alterations to the chemical structure to further alter specificity, enhance affinity or modulate the activity of these compounds. PMID:25566283

  20. Small-molecule control of protein degradation using split adaptors.

    PubMed

    Davis, Joseph H; Baker, Tania A; Sauer, Robert T

    2011-11-18

    Targeted intracellular degradation provides a method to study the biological function of proteins and has numerous applications in biotechnology. One promising approach uses adaptor proteins to target substrates with genetically encoded degradation tags for proteolysis. Here, we describe an engineered split-adaptor system, in which adaptor assembly and delivery of substrates to the ClpXP protease depends on a small molecule (rapamycin). This degradation system does not require modification of endogenous proteases, functions robustly over a wide range of adaptor concentrations, and does not require new synthesis of adaptors or proteases to initiate degradation. We demonstrate the efficacy of this system in E. coli by degrading tagged variants of LacI repressor and FtsA, an essential cell-division protein. In the latter case, addition of rapamycin causes pronounced filamentation because daughter cells cannot divide. Strikingly, washing rapamycin away reverses this phenotype. Our system is highly modular, with clearly defined interfaces for substrate binding, protease binding, and adaptor assembly, providing a clear path to extend this system to other degradation tags, proteases, or induction systems. Together, these new reagents should be useful in controlling protein degradation in bacteria. PMID:21866931

  1. Electrocatalytic recycling of CO2 and small organic molecules.

    PubMed

    Lee, Jaeyoung; Kwon, Youngkook; Machunda, Revocatus L; Lee, Hye Jin

    2009-10-01

    As global warming directly affects the ecosystems and humankind in the 21st century, attention and efforts are continuously being made to reduce the emission of greenhouse gases, especially carbon dioxide (CO2). In addition, there have been numerous efforts to electrochemically convert CO2 gas to small organic molecules (SOMs) and vice versa. Herein, we highlight recent advances made in the electrocatalytic recycling of CO2 and SOMs including (i) the overall trend of research activities made in this area, (ii) the relations between reduction conditions and products in the aqueous phase, (iii) the challenges in the use of gas diffusion electrodes for the continuous gas phase CO2 reduction, as well as (iv) the development of state of the art hybrid techniques for industrial applications. Perspectives geared to fully exploit the potential of zero-gap cells for CO2 reduction in the gaseous phase and the high applicability on a large scale are also presented. We envision that the hybrid system for CO2 reduction supported by sustainable solar, wind, and geothermal energies and waste heat will provide a long term reduction of greenhouse gas emissions and will allow for continued use of the abundant fossil fuels by industries and/or power plants but with zero emissions. PMID:19579251

  2. Small molecule glutaminase inhibitors block glutamate release from stimulated microglia.

    PubMed

    Thomas, Ajit G; O'Driscoll, Cliona M; Bressler, Joseph; Kaufmann, Walter; Rojas, Camilo J; Slusher, Barbara S

    2014-01-01

    Glutaminase plays a critical role in the generation of glutamate, a key excitatory neurotransmitter in the CNS. Excess glutamate release from activated macrophages and microglia correlates with upregulated glutaminase suggesting a pathogenic role for glutaminase. Both glutaminase siRNA and small molecule inhibitors have been shown to decrease excess glutamate and provide neuroprotection in multiple models of disease, including HIV-associated dementia (HAD), multiple sclerosis and ischemia. Consequently, inhibition of glutaminase could be of interest for treatment of these diseases. Bis-2-(5-phenylacetimido-1,2,4-thiadiazol-2-yl)ethyl sulfide (BPTES) and 6-diazo-5-oxo-l-norleucine (DON), two most commonly used glutaminase inhibitors, are either poorly soluble or non-specific. Recently, several new BPTES analogs with improved physicochemical properties were reported. To evaluate these new inhibitors, we established a cell-based microglial activation assay measuring glutamate release. Microglia-mediated glutamate levels were significantly augmented by tumor necrosis factor (TNF)-α, phorbol 12-myristate 13-acetate (PMA) and Toll-like receptor (TLR) ligands coincident with increased glutaminase activity. While several potent glutaminase inhibitors abrogated the increase in glutamate, a structurally related analog devoid of glutaminase activity was unable to block the increase. In the absence of glutamine, glutamate levels were significantly attenuated. These data suggest that the in vitro microglia assay may be a useful tool in developing glutaminase inhibitors of therapeutic interest. PMID:24269238

  3. Progress in Small Molecule and Biologic Therapeutics Targeting Ghrelin Signaling.

    PubMed

    McGovern, Kayleigh R; Darling, Joseph E; Hougland, James L

    2016-01-01

    Ghrelin is a circulating peptide hormone involved in regulation of a wide array of physiological processes. As an endogenous ligand for growth hormone secretagogue receptor (GHSR1a), ghrelin is responsible for signaling involved in energy homeostasis, including appetite stimulation, glucose metabolism, insulin signaling, and adiposity. Ghrelin has also been implicated in modulation of several neurological processes. Dysregulation of ghrelin signaling is implicated in diseases related to these pathways, including obesity, type II diabetes, and regulation of appetite and body weight in patients with Prader-Willi syndrome. Multiple steps in the ghrelin signaling pathway are available for targeting in the development of therapeutics for these diseases. Agonists and antagonists of GHS-R1a have been widely studied and have shown varying levels of effectiveness within ghrelin-related physiological pathways. Agents targeting ghrelin directly, either through depletion of ghrelin levels in circulation or inhibitors of ghrelin O-acyltransferase whose action is required for ghrelin to become biologically active, are receiving increasing attention as potential therapeutic options. We discuss the approaches utilized to target ghrelin signaling and highlight the current challenges toward developing small-molecule agents as potential therapeutics for ghrelin-related diseases. PMID:26202202

  4. Targeting Drivers of Melanoma with Synthetic Small Molecules and Phytochemicals

    PubMed Central

    Strickland, Leah Ray; Pal, Harish Chandra; Elmets, Craig A.; Afaq, Farrukh

    2015-01-01

    Melanoma is the least common form of skin cancer, but it is responsible for the majority of skin cancer deaths. Traditional therapeutics and immunomodulatory agents have not shown much efficacy against metastatic melanoma. Agents that target the RAS/RAF/MEK/ERK (MAPK) signaling pathway—the BRAF inhibitors vemurafenib and dabrafenib, and the MEK1/2 inhibitor trametinib—have increased survival in patients with metastatic melanoma. Further, the combination of dabrafenib and trametinib has been shown to be superior to single agent therapy for the treatment of metastatic melanoma. However, resistance to these agents develops rapidly. Studies of additional agents and combinations targeting the MAPK, PI3K/AKT/mTOR (PI3K), c-kit, and other signaling pathways are currently underway. Furthermore, studies of phytochemicals have yielded promising results against proliferation, survival, invasion, and metastasis by targeting signaling pathways with established roles in melanomagenesis. The relatively low toxicities of phytochemicals make their adjuvant use an attractive treatment option. The need for improved efficacy of current melanoma treatments calls for further investigation of each of these strategies. In this review, we will discuss synthetic small molecule inhibitors, combined therapies and current progress in the development of phytochemical therapies. PMID:25597784

  5. Small-molecule control of protein degradation using split adaptors

    PubMed Central

    Davis, Joseph H.; Baker, Tania A.; Sauer, Robert T.

    2011-01-01

    Targeted intracellular degradation provides a method to study the biological function of proteins and has numerous applications in biotechnology. One promising approach uses adaptor proteins to target substrates with genetically encoded degradation tags for proteolysis. Here, we describe an engineered split-adaptor system, in which adaptor assembly and delivery of substrates to the ClpXP protease depends on a small molecule (rapamycin). This degradation system does not require modification of endogenous proteases, functions robustly over a wide range of adaptor concentrations, and does not require new synthesis of adaptors or proteases to initiate degradation. We demonstrate the efficacy of this system in E. coli by degrading tagged variants of LacI repressor and FtsA, an essential cell-division protein. In the latter case, addition of rapamycin causes pronounced filamentation because daughter cells cannot divide. Strikingly, washing rapamycin away reverses this phenotype. Our system is highly modular, with clearly-defined interfaces for substrate binding, protease binding, and adaptor assembly, providing a clear path to extend this system to other degradation tags, proteases, or induction systems. Together, these new reagents should be useful in controlling protein degradation in bacteria. PMID:21866931

  6. Targeting signaling pathways with small molecules to treat autoimmune disorders.

    PubMed

    Kaminska, Bozena; Swiatek-Machado, Karolina

    2008-01-01

    Chronic activation of immune responses, mediated by inflammatory mediators and involving different effector cells of the innate and acquired immune system characterizes autoimmune disorders, such as rheumatoid arthritis, inflammatory bowel disease, psoriasis and septic shock syndrome. MAPKs are crucial intracellular mediators of inflammation. MAPK inhibitors are attractive anti-inflammatory drugs, because they are capable of reducing the synthesis of inflammation mediators at multiple levels and are effective in blocking proinflammatory cytokine signaling. Janus kinase (JAK)/signal transducers and activators of transcription (STAT) pathway converts cytokine signals into genomic responses regulating proliferation and differentiation of the immune cells. JAK inhibitors are a new class of immunomodulatory agents with immunosuppressive, anti-inflammatory and antiallergic properties. This review discusses the rationale behind current strategies of targeting MAPK and JAK/STAT signaling pathways, and the overall effects of signal transduction inhibitors in animal models of inflammatory disorders. Signal transduction inhibitors are small molecules that can be administered orally, and initial results of clinical trials have shown clinical benefits in patients with chronic inflammatory disorders. PMID:20477590

  7. Small-molecule PSMA ligands. Current state, SAR and perspectives.

    PubMed

    Machulkin, Alexey E; Ivanenkov, Yan A; Aladinskaya, Anastasia V; Veselov, Mark S; Aladinskiy, Vladimir A; Beloglazkina, Elena K; Koteliansky, Victor E; Shakhbazyan, Artem G; Sandulenko, Yuri B; Majouga, Alexander G

    2016-09-01

    Prostate cancer (PC) is the prevalent malignancy widespread among men in the Western World. Prostate specific membrane antigen (PSMA) is an established PC marker and has been considered as a promising biological target for anti-PC drug delivery and diagnostics. The protein was found to be overexpressed in PC cells, including metastatic, and the neovasculature of solid tumors. These properties make PSMA-based approach quite appropriate for effective PC imaging and specific drug therapy. Through the past decade, a variety of PSMA-targeted agents has been systematically evaluated. Small-molecule compounds have several advantages over other classes, such as improved pharmacokinetics and rapid blood clearance. These low-weight ligands have similar structure and can be divided into three basic categories in accordance with the type of their zinc-binding core-head. Several PSMA binders are currently undergoing clinical trials generally for PC imaging. The main goal of the present review is to describe the recent progress achieved within the title field and structure activity relationships (SAR) disclosed for different PSMA ligands. Recent in vitro and in vivo studies for each type of the compounds described have also been briefly summarized. PMID:26887438

  8. Chemiluminescence spectra of small molecules containing sulfur, selenium, and tellurium

    SciTech Connect

    Taylor, C.D. )

    1989-04-01

    To help identify a novel emission feature extending from 550 nm to 880 nm produced in the gas-phase reaction of F{sub 2} with CS{sub 2}, the reaction of F{sub 2} with CSe{sub 2} has been studied. This reaction yields a previously observed emission feature from SeF(A) extending from 500 nm to 870 nm and a banded feature between 350 and 500 nm that resembles fluorescence from Se{sub 2}(A) but requires further analysis. An apparently new, broad feature extending from 600 nm to the near IR appears by itself under certain reaction conditions. This broad feature is unresolved at 0.1 nm resolution and is not very useful in understanding the F{sub 2}/CS{sub 2} feature. Reactions of F{sub 2} with CH{sub 3}XCH{sub 3}, where X=Se, Se{sub 2}, Te, and Te{sub 2}, are being studied as sources for emission spectra of CH{sub 2}Se and CH{sub 2}Te. Fruitful chemical trends and analogies are being exploited in effort to identify new spectra of hard-to-study small molecules in chemiluminescence.

  9. Antiobesity Effect of a Small Molecule Repressor of RORγ

    PubMed Central

    Chang, Mi Ra; He, Yuanjun; Khan, Tanya M.; Kuruvilla, Dana S.; Garcia-Ordonez, Ruben; Corzo, Cesar A.; Unger, Thaddeus J.; White, David W.; Khan, Susan; Lin, Li; Cameron, Michael D.; Kamenecka, Theodore M.

    2015-01-01

    The orphan nuclear receptor RORγ is a key regulator for T helper 17 (TH17) cell differentiation, which regulates metabolic and circadian rhythm genes in peripheral tissues. Previously, it was shown that the small molecule inverse agonist of RORγ SR1555 [1-(4-((4′-(1,1,1,3,3,3-hexafluoro-2-hydroxypropan-2-yl)-[1,1′-biphenyl]-4-yl)methyl)piperazin-1-yl) ethanone] suppressed TH17 differentiation and stimulated induced T regulatory (iTreg) cells. Here, we show that treatment of cultured pre-adipocyctes with SR1555 represses the expression of RORγ while leading to increased expression of FGF21 and adipoQ. Chronic administration of SR1555 to obese diabetic mice resulted in a modest reduction in food intake accompanied with significant reduction in fat mass, resulting in reduced body weight and improved insulin sensitivity. Analysis ex vivo of treated mice demonstrates that SR1555 induced expression of the thermogenic gene program in fat depots. Further studies in cultured cells showed that SR1555 inhibited activation of hormone-sensitive lipase and increased fatty acid oxidation. Combined, these results suggest that pharmacological repression of RORγ may represent a strategy for treatment of obesity by increasing thermogenesis and fatty acid oxidation, while inhibition of hormone-sensitive lipase activity results in a reduction of serum free fatty acids, leading to improved peripheral insulin sensitivity. PMID:25904554

  10. Small Molecule Identification with MOLGEN and Mass Spectrometry

    PubMed Central

    Meringer, Markus; Schymanski, Emma L.

    2013-01-01

    This paper details the MOLGEN entries for the 2012 CASMI contest for small molecule identification to demonstrate structure elucidation using structure generation approaches. Different MOLGEN programs were used for different categories, including MOLGEN–MS/MS for Category 1, MOLGEN 3.5 and 5.0 for Category 2 and MOLGEN–MS for Categories 3 and 4. A greater focus is given to Categories 1 and 2, as most CASMI participants entered these categories. The settings used and the reasons behind them are described in detail, while various evaluations are used to put these results into perspective. As one author was also an organiser of CASMI, these submissions were not part of the official CASMI competition, but this paper provides an insight into how unknown identification could be performed using structure generation approaches. The approaches are semi-automated (category dependent) and benefit greatly from user experience. Thus, the results presented and discussed here may be better than those an inexperienced user could obtain with MOLGEN programs. PMID:24958000

  11. Studies Relevent to Catalytic Activation Co & other small Molecules

    SciTech Connect

    Ford, Peter C

    2005-02-22

    Detailed annual and triannual reports describing the progress accomplished during the tenure of this grant were filed with the Program Manager for Catalysis at the Office of Basic Energy Sciences. To avoid unnecessary duplication, the present report will provide a brief overview of the research areas that were sponsored by this grant and list the resulting publications and theses based on this DOE supported research. The scientific personnel participating in (and trained by) this grant's research are also listed. Research carried out under this DOE grant was largely concerned with the mechanisms of the homogeneous catalytic and photocatalytic activation of small molecules such as carbon monoxide, dihydrogen and various hydrocarbons. Much of the more recent effort has focused on the dynamics and mechanisms of reactions relevant to substrate carbonylations by homogeneous organometallic catalysts. A wide range of modern investigative techniques were employed, including quantitative fast reaction methodologies such as time-resolved optical (TRO) and time-resolved infrared (TRIR) spectroscopy and stopped flow kinetics. Although somewhat diverse, this research falls within the scope of the long-term objective of applying quantitative techniques to elucidate the dynamics and understand the principles of mechanisms relevant to the selective and efficient catalytic conversions of fundamental feedstocks to higher value materials.

  12. A Chemical Screen Identifies Small Molecules that Regulate Hepcidin Expression

    PubMed Central

    Gaun, Vera; Patchen, Bonnie; Volovetz, Josephine; Zhen, Aileen W.; Andreev, Aleksandr; Pollastri, Michael P.; Fraenkel, Paula G.

    2014-01-01

    Hepcidin, a peptide hormone produced in the liver, decreases intestinal iron absorption and macrophage iron release via effects on ferroportin. Bone morphogenic protein and Stat3 signaling regulate Hepcidin's transcription. Hepcidin is a potential drug target for patients with iron overload syndromes because its levels are inappropriately low in these individuals. To generate a tool for identifying small molecules that modulate Hepcidin expression, we stably transfected human hepatocytes (HepG2) cells with a reporter construct containing 2.7 kilobases of the human Hepcidin promoter upstream of a firefly reporter gene. We used high throughput methods to screen 10,169 chemicals in duplicate for their effect on Hepcidin expression and cell viability. Regulators were identified as chemicals that caused a change >3 standard deviations above or >1.5 standard deviations below the mean of the other chemicals (z-score >3 or <-1.5), while not adversely affecting cell viability, quantified by fluorescence assay. Following validation assays, we identified 16 chemicals in a broad range of functional classes that promote Hepcidin expression. All of the chemicals identified increased expression of bone morphogenic protein-dependent and/or Stat3-dependent genes, however none of them strongly increased phosphorylation of Smad1,5,8 or Stat3. PMID:24998898

  13. Small-Molecule Inhibitors of the Myc Oncoprotein

    PubMed Central

    Fletcher, Steven; Prochownik, Edward V.

    2014-01-01

    The c-Myc (Myc) oncoprotein is among the most attractive of cancer targets given that is deregulated in the majority of tumors and that its inhibition profoundly affects their growth and/or survival. However, its role as a seldom-mutated transcription factor, its lack of enzymatic activity for which suitable pharmaceutical inhibitors could be crafted and its expression by normal cells have largely been responsible for its being viewed as “undruggable”. Work over the past several years, however, has begun to reverse this idea by allowing us to view Myc within the larger context of global gene regulatory control. Thus, Myc and its obligate heterodimeric partner, Max, are integral to the coordinated recruitment and post-translational modification of components of the core transcriptional machinery. Moreover, Myc over-expression re-programs numerous critical cellular functions and alters the cell’s susceptibility to their inhibition. This new knowledge has therefore served as a framework upon which to develop new pharmaceutical approaches. These include the continuing development of small molecules which act directly to inhibit the critical Myc-Max interaction, those which act indirectly to prevent Myc-directed post-translational modifications necessary to initiate productive transcription and those which inhibit vital pathways upon which the Myc-transformed cell is particularly reliant. PMID:24657798

  14. Ion Momentum Imaging of Dissociative Electron Attachment to Small Molecules

    NASA Astrophysics Data System (ADS)

    Fogle, Michael

    2015-09-01

    In recent years, low energy dissociative electron attachment (DEA) interactions have been of interest to varying biological and technological applications. To study the dynamics resulting from DEA, we used an ion-momentum imaging apparatus based on the Cold Target Recoil Ion Momentum Spectroscopy (COLTRIMS) technique in which a molecular beam is crossed by a pulsed electron beam. The beam interaction takes place in a 4 π pulsed electrostatic spectrometer that collects the anion fragments resulting from DEA. The molecular beam is formed by a supersonic expansion which results in a well-localized and cold target. Using this apparatus we have investigated the DEA dynamics for several small molecules: CO2 at the 4 eV shape resonance and the 8 eV Feshbach resonance; N2O at the 2.3 eV shape resonance; HCCH at the 3 eV shape resonance; and CF4 near the 7 eV resonance. An overview of these experimental ion-momentum results will be compared to ab initio electronic structure and fixed-nuclei scattering calculations to gauge the resulting dynamics driven by DEA. In many cases, conical intersections play a pivotal role in driving the dynamics. Some of these systems exhibit non-axial recoil conditions indicative of a bending dynamics in the transitory negative ion state while others exhibit a direct axial recoil dissociation without any bending. This work is supported by the National Science Foundation under Contract NSF-PHYS1404366.

  15. Application of Optical Biosensors in Small-Molecule Screening Activities

    PubMed Central

    Geschwindner, Stefan; Carlsson, Johan F.; Knecht, Wolfgang

    2012-01-01

    The last two decades have seen remarkable progress and improvements in optical biosensor systems such that those are currently seen as an important and value-adding component of modern drug screening activities. In particular the introduction of microplate-based biosensor systems holds the promise to match the required throughput without compromising on data quality thus representing a sought-after complement to traditional fluidic systems. This article aims to highlight the application of the two most prominent optical biosensor technologies, namely surface plasmon resonance (SPR) and optical waveguide grating (OWG), in small-molecule screening and will present, review and discuss the advantages and disadvantages of different assay formats on these platforms. A particular focus will be on the specific advantages of the inhibition in solution assay (ISA) format in contrast to traditional direct binding assays (DBA). Furthermore we will discuss different application areas for both fluidic as well as plate-based biosensor systems by considering the individual strength of the platforms. PMID:22666031

  16. A novel small-molecule inhibitor of HIV-1 entry

    PubMed Central

    Heredia, Alonso; Latinovic, Olga S; Barbault, Florent; de Leeuw, Erik PH

    2015-01-01

    Background Antiretroviral therapy has transformed HIV-1 infection into a managed condition with near-normal life expectancy. However, a significant number of patients remain with limited therapeutic options due to HIV-1 resistance, side effects, or drug costs. Further, it is likely that current drugs will not retain efficacy, due to risks of side effects and transmitted resistance. Results We describe compound 5660386 (3-ethyl-2-[3-(1,3,3-trimethyl-1,3-dihydro-2H-indol-2-ylidene)-1-propen-1-yl]-1,3-benzothiazol-3-ium) as a novel inhibitor of HIV-1 entry. Compound 5660386 inhibits HIV-1 entry in cell lines and primary cells, binds to HIV-1 envelope protein, and inhibits the interaction of GP120 to CD4. Further, compound 5660386 showed a unique and broad-range activity against primary HIV-1 isolates from different subtypes and geographical areas. Conclusion Development of small-molecule entry inhibitors of HIV-1 such as 5660386 may lead to novel classes of anti-HIV-1 therapeutics. These inhibitors may be particularly effective against viruses resistant to current antiretroviral drugs and could have potential applications in both treatment and prevention. PMID:26491257

  17. All-electron scalar relativistic calculation of water molecule adsorption onto small gold clusters.

    PubMed

    Kuang, Xiang-Jun; Wang, Xin-Qiang; Liu, Gao-Bin

    2011-08-01

    An all-electron scalar relativistic calculation was performed on Au( n )H(2)O (n = 1-13) clusters using density functional theory (DFT) with the generalized gradient approximation at PW91 level. The calculation results reveal that, after adsorption, the small gold cluster would like to bond with oxygen and the H(2)O molecule prefers to occupy the single fold coordination site. Reflecting the strong scalar relativistic effect, Au( n ) geometries are distorted slightly but still maintain a planar structure. The Au-Au bond is strengthened and the H-O bond is weakened, as manifested by the shortening of the Au-Au bond-length and the lengthening of the H-O bond-length. The H-O-H bond angle becomes slightly larger. The enhancement of reactivity of the H(2)O molecule is obvious. The Au-O bond-lengths, adsorption energies, VIPs, HLGs, HOMO (LUMO) energy levels, charge transfers and the highest vibrational frequencies of the Au-O mode for Au( n )H(2)O clusters exhibit an obvious odd-even oscillation. The most favorable adsorption between small gold clusters and the H(2)O molecule takes place when the H(2)O molecule is adsorbed onto an even-numbered Au( n ) cluster and becomes an Au( n )H(2)O cluster with an even number of valence electrons. The odd-even alteration of magnetic moments is observed in Au( n )H(2)O clusters and may serve as material with a tunable code capacity of "0" and "1" by adsorbing a H(2)O molecule onto an odd or even-numbered small gold cluster. PMID:21140279

  18. Small-molecule trkB agonists promote axon regeneration in cut peripheral nerves

    PubMed Central

    English, Arthur W.; Liu, Kevin; Nicolini, Jennifer M.; Mulligan, Amanda M.; Ye, Keqiang

    2013-01-01

    Treatments with two-small molecule tropomyosin receptor kinase B (trkB) ligands, 7,8 dihydroxyflavone (7,8 DHF) and deoxygedunin, were evaluated for their ability to promote the regeneration of cut axons in injured peripheral nerves in mice in which sensory and motor axons are marked by YFP. Peripheral nerves were cut and repaired with grafts from strain-matched, nonfluorescent donors and secured in place with fibrin glue. Lengths of profiles of regenerating YFP+ axons were measured 2 wk later from confocal images. Axon regeneration was enhanced when the fibrin glue contained dilutions of 500-nM solution of either small-molecule trkB agonist. In mice in which the neurotrophin receptor trkB is knocked out selectively in neurons, axon regeneration is very weak, and topical treatment with 7,8 DHF had no effect on axon regeneration. Similar treatments with deoxygedunin had only a modest effect. In conditional BDNF knockout mice, topical treatments with either 7,8 DHF or deoxygedunin resulted in a reversal of the poor regeneration found in controls and produced significant enhancement of regeneration. In WT mice treated with 2 wk of daily i.p. injections of either 7,8 DHF or deoxygedunin (5 mg/kg), regenerating axon profiles were nearly twice as long as in controls. Restoration of direct muscle responses evoked by sciatic nerve stimulation to pretransection levels over an 8-wk survival period was found only in the treated mice. Treatments with either small-molecule trkB agonist enhanced axon regeneration and muscle reinnervation after peripheral nerve injuries. PMID:24043773

  19. Small-molecule trkB agonists promote axon regeneration in cut peripheral nerves.

    PubMed

    English, Arthur W; Liu, Kevin; Nicolini, Jennifer M; Mulligan, Amanda M; Ye, Keqiang

    2013-10-01

    Treatments with two-small molecule tropomyosin receptor kinase B (trkB) ligands, 7,8 dihydroxyflavone (7,8 DHF) and deoxygedunin, were evaluated for their ability to promote the regeneration of cut axons in injured peripheral nerves in mice in which sensory and motor axons are marked by YFP. Peripheral nerves were cut and repaired with grafts from strain-matched, nonfluorescent donors and secured in place with fibrin glue. Lengths of profiles of regenerating YFP(+) axons were measured 2 wk later from confocal images. Axon regeneration was enhanced when the fibrin glue contained dilutions of 500-nM solution of either small-molecule trkB agonist. In mice in which the neurotrophin receptor trkB is knocked out selectively in neurons, axon regeneration is very weak, and topical treatment with 7,8 DHF had no effect on axon regeneration. Similar treatments with deoxygedunin had only a modest effect. In conditional BDNF knockout mice, topical treatments with either 7,8 DHF or deoxygedunin resulted in a reversal of the poor regeneration found in controls and produced significant enhancement of regeneration. In WT mice treated with 2 wk of daily i.p. injections of either 7,8 DHF or deoxygedunin (5 mg/kg), regenerating axon profiles were nearly twice as long as in controls. Restoration of direct muscle responses evoked by sciatic nerve stimulation to pretransection levels over an 8-wk survival period was found only in the treated mice. Treatments with either small-molecule trkB agonist enhanced axon regeneration and muscle reinnervation after peripheral nerve injuries. PMID:24043773

  20. Phosphate binding energy and catalysis by small and large molecules.

    PubMed

    Morrow, Janet R; Amyes, Tina L; Richard, John P

    2008-04-01

    Catalysis is an important process in chemistry and enzymology. The rate acceleration for any catalyzed reaction is the difference between the activation barriers for the uncatalyzed (Delta G(HO)(#)) and catalyzed (Delta G(Me)(#)) reactions, which corresponds to the binding energy (Delta G(S)(#) = Delta G(Me)(#)-Delta G(HO)(#)) for transfer of the reaction transition state from solution to the catalyst. This transition state binding energy is a fundamental descriptor of catalyzed reactions, and its evaluation is necessary for an understanding of any and all catalytic processes. We have evaluated the transition state binding energies obtained from interactions between low molecular weight metal ion complexes or high molecular weight protein catalysts and the phosphate group of bound substrate. Work on catalysis by small molecules is exemplified by studies on the mechanism of action of Zn2(1)(H2O). A binding energy of Delta G(S)(#) = -9.6 kcal/mol was determined for Zn2(1)(H2O)-catalyzed cleavage of the RNA analogue HpPNP. The pH-rate profile for this cleavage reaction showed that there is optimal catalytic activity at high pH, where the catalyst is in the basic form [Zn2(1)(HO-)]. However, it was also shown that the active form of the catalyst is Zn2(1)(H2O) and that this recognizes the C2-oxygen-ionized substrate in the cleavage reaction. The active catalyst Zn2(1)(H2O) shows a high affinity for oxyphosphorane transition state dianions and a stable methyl phosphate transition state analogue, compared with the affinity for phosphate monoanion substrates. The transition state binding energies, Delta G(S)(#), for cleavage of HpPNP catalyzed by a variety of Zn2+ and Eu3+ metal ion complexes reflect the increase in the catalytic activity with increasing total positive charge at the catalyst. These values of Delta G(S)(#) are affected by interactions between the metal ion and its ligands, but these effects are small in comparison with Delta G(S)(#) observed for catalysis

  1. A Remote Arene-Binding Site on Prostate Specific Membrane Antigen Revealed by Antibody-Recruiting Small Molecules

    SciTech Connect

    Zhang, Andrew X.; Murelli, Ryan P.; Barinka, Cyril; Michel, Julien; Cocleaza, Alexandra; Jorgensen, William L.; Lubkowski, Jacek; Spiegel, David A.

    2010-09-27

    Prostate specific membrane antigen (PSMA) is a membrane-bound glutamate carboxypeptidase overexpressed in many forms of prostate cancer. Our laboratory has recently disclosed a class of small molecules, called ARM-Ps (antibody-recruiting molecule targeting prostate cancer) that are capable of enhancing antibody-mediated immune recognition of prostate cancer cells. Interestingly, during the course of these studies, we found ARM-Ps to exhibit extraordinarily high potencies toward PSMA, compared to previously reported inhibitors. Here, we report in-depth biochemical, crystallographic, and computational investigations which elucidate the origin of the observed affinity enhancement. These studies reveal a previously unreported arene-binding site on PSMA, which we believe participates in an aromatic stacking interaction with ARMs. Although this site is composed of only a few amino acid residues, it drastically enhances small molecule binding affinity. These results provide critical insights into the design of PSMA-targeted small molecules for prostate cancer diagnosis and treatment; more broadly, the presence of similar arene-binding sites throughout the proteome could prove widely enabling in the optimization of small molecule-protein interactions.

  2. Induction of sensory neurons from neuroepithelial stem cells by the ISX9 small molecule

    PubMed Central

    Ali, Rouknuddin Qasim; Blomberg, Evelina; Falk, Anna; Ährlund-Richter, Lars; Ulfendahl, Mats

    2016-01-01

    Hearing impairment most often involves loss of sensory hair cells and auditory neurons. As this loss is permanent in humans, a cell therapy approach has been suggested to replace damaged cells. It is thus of interest to generate lineage restricted progenitor cells appropriate for cell based therapies. Human long-term self-renewing neuroepithelial stem (lt-NES) cell lines exhibit in vitro a developmental potency to differentiate into CNS neural lineages, and importantly lack this potency in vivo, i.e do not form teratomas. Small-molecules-driven differentiation is today an established route obtain specific cell derivatives from stem cells. In this study, we have investigated the effects of three small molecules SB431542, ISX9 and Metformin to direct differentiation of lt-NES cells into sensory neurons. Exposure of lt-NES cells to Metformin or SB431542 did not induce any marked induction of markers for sensory neurons. However, a four days exposure to the ISX9 small molecule resulted in reduced expression of NeuroD1 mRNA as well as enhanced mRNA levels of GATA3, a marker and important player in auditory neuron specification and development. Subsequent culture in the presence of the neurotrophic factors BDNF and NT3 for another seven days yielded a further increase of mRNA expression for GATA3. This regimen resulted in a frequency of up to 25-30% of cells staining positive for Brn3a/Tuj1. We conclude that an approach with ISX9 small molecule induction of lt-NES cells into auditory like neurons may thus be an attractive route for obtaining safe cell replacement therapy of sensorineural hearing loss. PMID:27335699

  3. Identification of small molecule binding sites within proteins using phage display technology.

    SciTech Connect

    Rodi, D. J.; Agoston, G. E.; Manon, R.; Lapcevich, R.; Green, S. J.; Makowski, L.; Biosciences Division; EntreMed Inc.; Florida State Univ.

    2001-11-01

    Affinity selection of peptides displayed on phage particles was used as the basis for mapping molecular contacts between small molecule ligands and their protein targets. Analysis of the crystal structures of complexes between proteins and small molecule ligands revealed that virtually all ligands of molecular weight 300 Da or greater have a continuous binding epitope of 5 residues or more. This observation led to the development of a technique for binding site identification which involves statistical analysis of an affinity-selected set of peptides obtained by screening of libraries of random, phage-displayed peptides against small molecules attached to solid surfaces. A random sample of the selected peptides is sequenced and used as input for a similarity scanning program which calculates cumulative similarity scores along the length of the putative receptor. Regions of the protein sequence exhibiting the highest similarity with the selected peptides proved to have a high probability of being involved in ligand binding. This technique has been employed successfully to map the contact residues in multiple known targets of the anticancer drugs paclitaxel (Taxol), docetaxel (Taxotere) and 2-methoxyestradiol and the glycosaminoglycan hyaluronan, and to identify a novel paclitaxel receptor [1]. These data corroborate the observation that the binding properties of peptides displayed on the surface of phage particles can mimic the binding properties of peptides in naturally occurring proteins. It follows directly that structural context is relatively unimportant for determining the binding properties of these disordered peptides. This technique represents a novel, rapid, high resolution method for identifying potential ligand binding sites in the absence of three-dimensional information and has the potential to greatly enhance the speed of development of novel small molecule pharmaceuticals.

  4. Pancreas-Specific Delivery of β-Cell Proliferating Small Molecules.

    PubMed

    Hao, Xueshi; Jin, Qihui; Va, Porino; Li, Chun; Shen, Weijun; Laffitte, Bryan; Wu, Tom Y-H

    2016-06-01

    Our research groups recently described a series of small-molecule inducers of β-cell proliferation that could be used to increase β-cell mass. To mitigate the risk of nonspecific proliferation of other cell types, we devised a delivery strategy built on the tissue specificity observed in the experimental β-cell imaging agent (+)-dihydrotetrabenazine (DTBZ). The β-cell proliferator agent aminopyrazine (AP) was covalently linked with (+)-DTBZ to afford conjugates that retain both the proliferation activity and binding affinity for vesicular monoamine transporter-2 (VMAT2). In vivo mouse tissue distribution studies of a prototypical AP-DTBZ conjugate showed 15-fold pancreas exposure over plasma. Tissue-to-plasma ratios in liver and kidneys were two- and five-fold, respectively. This work is the first demonstration of enhanced delivery of β-cell-proliferating molecules to the pancreas by leveraging the intrinsic tissue specificity of a β-cell imaging agent. PMID:27095073

  5. Spectroscopic probing of recognition of the G-quadruplex in c-kit promoter by small-molecule natural products.

    PubMed

    Cui, Xiaojie; Lin, Sen; Yuan, Gu

    2012-05-01

    The c-kit oncogene plays important roles in cell growth and proliferation which is associated with many human tumors. In this study, electrospray ionization mass spectrometry (ESI-MS) and circular dichroism (CD) spectroscopy were used to evaluate the formation and recognition of the G-quadruplex by d(AGGGAGGGCGCTGGGAGGAGGG) in the promoter region of the c-kit oncogene. Among the twelve small natural molecules studied, three crescent-shaped small molecules (chelerythrine, jatrorrhizine and berberine, named as P1-P3) and one flexible cyclic small molecule (fangchinoline, named as P4) were found to bind to the G-quadruplex with high affinities. The melting experiments demonstrate that P1-P4 can significantly enhance the stability of the G-quadruplex with the ordering of P1≈P4>P3>P2. Further insight into the binding mode of small molecules with the G-quadruplex by Autodock3 analysis reveals that P1-P3 prefer the end-stacking mode with the G-quadruplex through π-π interaction and P4 prefers to insert into the groove outside the G-tetrads. Thus, our research finds that four ligands (P1-P4) from small natural molecules have high affinity to, and can significantly enhance the stability of the G-quadruplex in the promoter region of the c-kit oncogene. PMID:22405847

  6. Small molecules and Alzheimer's disease: misfolding, metabolism and imaging.

    PubMed

    Patel, Viharkumar; Zhang, Xueli; Tautiva, Nicolas A; Nyabera, Akwe N; Owa, Opeyemi O; Baidya, Melvin; Sung, Hee Chang; Taunk, Pardeep S; Abdollahi, Shahrzad; Charles, Stacey; Gonnella, Rachel A; Gadi, Nikhita; Duong, Karen T; Fawver, Janelle N; Ran, Chongzhao; Jalonen, Tuula O; Murray, Ian V J

    2015-01-01

    Small molecule interactions with amyloid proteins have had a huge impact in Alzheimer's disease (AD), especially in three specific areas: amyloid folding, metabolism and brain imaging. Amyloid plaque amelioration or prevention have, until recently, driven drug development, and only a few drugs have been advanced for use in AD. Amyloid proteins undergo misfolding and oligomerization via intermediates, eventually forming protease resistant amyloid fibrils. These fibrils accumulate to form the hallmark amyloid plaques and tangles of AD. Amyloid binding compounds can be grouped into three categories, those that: i) prevent or reverse misfolding, ii) halt misfolding or trap intermediates, and iii) accelerate the formation of stable and inert amyloid fibrils. Such compounds include hydralazine, glycosaminoglycans, curcumin, beta sheet breakers, catecholamines, and ATP. The versatility of amyloid binding compounds suggests that the amyloid structure may serve as a scaffold for the future development of sensors to detect such compounds. Metabolic dysfunction is one of the earliest pathological features of AD. In fact, AD is often referred to as type 3 diabetes due to the presence of insulin resistance in the brain. A recent study indicates that altering metabolism improves cognitive function. While metabolic reprogramming is one therapeutic avenue for AD, it is more widely used in some cancer therapies. FDA approved drugs such as metformin, dichloroacetic acid (DCA), and methylene blue can alter metabolism. These drugs can therefore be potentially applied in alleviating metabolic dysfunction in AD. Brain imaging has made enormous strides over the past decade, offering a new window to the mind. Recently, there has been remarkable development of compounds that have the ability to image both types of pathological amyloids: tau and amyloid beta. We have focused on the low cost, simple to use, near infrared fluorescence (NIRF) imaging probes for amyloid beta (Aβ), with

  7. Antidiabetic effects of glucokinase regulatory protein small-molecule disruptors

    NASA Astrophysics Data System (ADS)

    Lloyd, David J.; St Jean, David J.; Kurzeja, Robert J. M.; Wahl, Robert C.; Michelsen, Klaus; Cupples, Rod; Chen, Michelle; Wu, John; Sivits, Glenn; Helmering, Joan; Komorowski, Renée; Ashton, Kate S.; Pennington, Lewis D.; Fotsch, Christopher; Vazir, Mukta; Chen, Kui; Chmait, Samer; Zhang, Jiandong; Liu, Longbin; Norman, Mark H.; Andrews, Kristin L.; Bartberger, Michael D.; van, Gwyneth; Galbreath, Elizabeth J.; Vonderfecht, Steven L.; Wang, Minghan; Jordan, Steven R.; Véniant, Murielle M.; Hale, Clarence

    2013-12-01

    Glucose homeostasis is a vital and complex process, and its disruption can cause hyperglycaemia and type II diabetes mellitus. Glucokinase (GK), a key enzyme that regulates glucose homeostasis, converts glucose to glucose-6-phosphate in pancreatic β-cells, liver hepatocytes, specific hypothalamic neurons, and gut enterocytes. In hepatocytes, GK regulates glucose uptake and glycogen synthesis, suppresses glucose production, and is subject to the endogenous inhibitor GK regulatory protein (GKRP). During fasting, GKRP binds, inactivates and sequesters GK in the nucleus, which removes GK from the gluconeogenic process and prevents a futile cycle of glucose phosphorylation. Compounds that directly hyperactivate GK (GK activators) lower blood glucose levels and are being evaluated clinically as potential therapeutics for the treatment of type II diabetes mellitus. However, initial reports indicate that an increased risk of hypoglycaemia is associated with some GK activators. To mitigate the risk of hypoglycaemia, we sought to increase GK activity by blocking GKRP. Here we describe the identification of two potent small-molecule GK-GKRP disruptors (AMG-1694 and AMG-3969) that normalized blood glucose levels in several rodent models of diabetes. These compounds potently reversed the inhibitory effect of GKRP on GK activity and promoted GK translocation both in vitro (isolated hepatocytes) and in vivo (liver). A co-crystal structure of full-length human GKRP in complex with AMG-1694 revealed a previously unknown binding pocket in GKRP distinct from that of the phosphofructose-binding site. Furthermore, with AMG-1694 and AMG-3969 (but not GK activators), blood glucose lowering was restricted to diabetic and not normoglycaemic animals. These findings exploit a new cellular mechanism for lowering blood glucose levels with reduced potential for hypoglycaemic risk in patients with type II diabetes mellitus.

  8. Small-Molecule Fluorescent Sensors for Investigating Zinc Metalloneurochemistry

    PubMed Central

    Nolan, Elizabeth M.; Lippard, Stephen J.

    2008-01-01

    Conspectus Metal ions are involved in many neurobiological processes relevant to human health and disease. The metalloneurochemistry of Zn(II) is of substantial current interest. Zinc is the second most abundant d-block metal ion in the human brain and its distribution varies, with relatively high concentrations found in the hippocampus. Brain zinc is generally divided into two categories: protein-bound and loosely-bound. The latter pool is also referred to as histochemically observable, chelatable, labile, or mobile zinc. The neurophysiological and neuropathological significance of such mobile Zn(II) remains enigmatic. Studies of Zn(II) distribution, translocation, and function in vivo require tools for its detection. Because Zn(II) has a closed-shell d10 configuration and no convenient spectroscopic signature, fluorescence is a suitable method for monitoring Zn(II) in biological contexts. This Account summarizes work by our laboratory addressing the design, preparation, characterization, and use of small-molecule fluorescent sensors for imaging mobile Zn(II) in living cells and samples of brain tissue. These sensors provide “turn-on” or ratiometric Zn(II) detection in aqueous solution at neutral pH. By making alterations to the Zn(II)-binding unit and fluorophore platform, we have devised sensors with varied photophysical and metal-binding properties. We used several of these probes to image Zn(II) distribution, uptake, and mobilization in a variety of cell types, including neuronal cultures. Goals for the future include developing strategies for multi-color imaging, further defining the quenching and turn-on mechanisms of the sensors, and employing the probes to elucidate the functional significance of Zn(II) in neurobiology. PMID:18989940

  9. Theoretical studies of photodissociation of small molecules of astrophysical importance

    NASA Technical Reports Server (NTRS)

    Saxon, R. P.

    1983-01-01

    The radicals and ions observed in comets result from photodissociation and photoionization of molecules. According to current models, a comet is composed chiefly of a large, solid nucelus of frozen gases (parent molecules) such as H2O, HCN, and NH3. It is believed comets were formed at the same time and in the same region of space as the major planets and that their chemical composition is the same as that of the early solar system. As the comet nears the Sun, the surface heats up, liberating the frozen gases as well as dust particles. Solar radiation photodissociates the parent molecules into fragments that are observed by resonance fluorescence. Both polyatomic molecules, present in the interstellar medium, and cometary radicals were observed. Using laboratory photo-dissociation data and computer models, astronomers are attempting to identify the parent molecules that account for all observed radicals and ions.

  10. Interspecies scaling and prediction of human clearance: comparison of small- and macro-molecule drugs

    PubMed Central

    Huh, Yeamin; Smith, David E.; Feng, Meihau Rose

    2014-01-01

    Human clearance prediction for small- and macro-molecule drugs was evaluated and compared using various scaling methods and statistical analysis.Human clearance is generally well predicted using single or multiple species simple allometry for macro- and small-molecule drugs excreted renally.The prediction error is higher for hepatically eliminated small-molecules using single or multiple species simple allometry scaling, and it appears that the prediction error is mainly associated with drugs with low hepatic extraction ratio (Eh). The error in human clearance prediction for hepatically eliminated small-molecules was reduced using scaling methods with a correction of maximum life span (MLP) or brain weight (BRW).Human clearance of both small- and macro-molecule drugs is well predicted using the monkey liver blood flow method. Predictions using liver blood flow from other species did not work as well, especially for the small-molecule drugs. PMID:21892879

  11. The small-voxel tracking algorithm for simulating chemical reactions among diffusing molecules

    SciTech Connect

    Gillespie, Daniel T. Gillespie, Carol A.; Seitaridou, Effrosyni

    2014-12-21

    Simulating the evolution of a chemically reacting system using the bimolecular propensity function, as is done by the stochastic simulation algorithm and its reaction-diffusion extension, entails making statistically inspired guesses as to where the reactant molecules are at any given time. Those guesses will be physically justified if the system is dilute and well-mixed in the reactant molecules. Otherwise, an accurate simulation will require the extra effort and expense of keeping track of the positions of the reactant molecules as the system evolves. One molecule-tracking algorithm that pays careful attention to the physics of molecular diffusion is the enhanced Green's function reaction dynamics (eGFRD) of Takahashi, Tănase-Nicola, and ten Wolde [Proc. Natl. Acad. Sci. U.S.A. 107, 2473 (2010)]. We introduce here a molecule-tracking algorithm that has the same theoretical underpinnings and strategic aims as eGFRD, but a different implementation procedure. Called the small-voxel tracking algorithm (SVTA), it combines the well known voxel-hopping method for simulating molecular diffusion with a novel procedure for rectifying the unphysical predictions of the diffusion equation on the small spatiotemporal scale of molecular collisions. Indications are that the SVTA might be more computationally efficient than eGFRD for the problematic class of non-dilute systems. A widely applicable, user-friendly software implementation of the SVTA has yet to be developed, but we exhibit some simple examples which show that the algorithm is computationally feasible and gives plausible results.

  12. The small-voxel tracking algorithm for simulating chemical reactions among diffusing molecules

    NASA Astrophysics Data System (ADS)

    Gillespie, Daniel T.; Seitaridou, Effrosyni; Gillespie, Carol A.

    2014-12-01

    Simulating the evolution of a chemically reacting system using the bimolecular propensity function, as is done by the stochastic simulation algorithm and its reaction-diffusion extension, entails making statistically inspired guesses as to where the reactant molecules are at any given time. Those guesses will be physically justified if the system is dilute and well-mixed in the reactant molecules. Otherwise, an accurate simulation will require the extra effort and expense of keeping track of the positions of the reactant molecules as the system evolves. One molecule-tracking algorithm that pays careful attention to the physics of molecular diffusion is the enhanced Green's function reaction dynamics (eGFRD) of Takahashi, Tănase-Nicola, and ten Wolde [Proc. Natl. Acad. Sci. U.S.A. 107, 2473 (2010)]. We introduce here a molecule-tracking algorithm that has the same theoretical underpinnings and strategic aims as eGFRD, but a different implementation procedure. Called the small-voxel tracking algorithm (SVTA), it combines the well known voxel-hopping method for simulating molecular diffusion with a novel procedure for rectifying the unphysical predictions of the diffusion equation on the small spatiotemporal scale of molecular collisions. Indications are that the SVTA might be more computationally efficient than eGFRD for the problematic class of non-dilute systems. A widely applicable, user-friendly software implementation of the SVTA has yet to be developed, but we exhibit some simple examples which show that the algorithm is computationally feasible and gives plausible results.

  13. Harnessing Connectivity in a Large-Scale Small-Molecule Sensitivity Dataset | Office of Cancer Genomics

    Cancer.gov

    Identifying genetic alterations that prime a cancer cell to respond to a particular therapeutic agent can facilitate the development of precision cancer medicines. Cancer cell-line (CCL) profiling of small-molecule sensitivity has emerged as an unbiased method to assess the relationships between genetic or cellular features of CCLs and small-molecule response. Here, we developed annotated cluster multidimensional enrichment analysis to explore the associations between groups of small molecules and groups of CCLs in a new, quantitative sensitivity dataset.

  14. Late intervention with the small molecule BB3 mitigates postischemic kidney injury.

    PubMed

    Narayan, Prakash; Duan, Bin; Jiang, Kai; Li, Jingsong; Paka, Latha; Yamin, Michael A; Friedman, Scott L; Weir, Matthew R; Goldberg, Itzhak D

    2016-08-01

    Ischemia-reperfusion-mediated acute kidney injury can necessitate renal replacement therapy and is a major cause of morbidity and mortality. We have identified BB3, a small molecule, which when first administered at 24 h after renal ischemia in rats, improved survival, augmented urine output, and reduced the increase in serum creatinine and blood urea nitrogen. Compared with control kidneys, the kidneys of BB3-treated animals exhibited reduced levels of kidney injury molecule-1, neutrophil gelatinase-associated lipocalin, and reduced tubular apoptosis and acute tubular necrosis but enhanced tubular regeneration. Consistent with its hepatocyte growth factor-like mode of action, BB3 treatment promoted phosphorylation of renal cMet and Akt and upregulated renal expression of the survival protein Bcl-2. These data suggest that the kidney is amenable to pharmacotherapy even 24 h after ischemia-reperfusion and that activation of the hepatocyte growth factor signaling pathway with the small molecule BB3 confers interventional benefits late into ischemia-reperfusion injury. These data formed, in part, the basis for the use of BB3 in a clinical trial in kidney recipients presenting with delayed graft function. PMID:27252491

  15. Enhancing the low frequency THz resonances (< 1 THz) of organic molecules via electronegative atom substitution

    NASA Astrophysics Data System (ADS)

    Dash, Jyotirmayee; Ray, Shaumik; Pesala, Bala

    2015-03-01

    Terahertz (THz) technology is an active area of research with various applications in non-intrusive imaging and spectroscopy. Very few organic molecules have significant resonances below 1 THz. Understanding the origin of low frequency THz modes in these molecules and their absence in other molecules could be extremely important in design and engineering molecules with low frequency THz resonances. These engineered molecules can be used as THz tags for anti-counterfeiting applications. Studies show that low frequency THz resonances are commonly observed in molecules having higher molecular mass and weak intermolecular hydrogen bonds. In this paper, we have explored the possibility of enhancing the strength of THz resonances below 1 THz through electronegative atom substitution. Adding an electronegative atom helps in achieving higher hydrogen bond strength to enhance the resonances below 1 THz. Here acetanilide has been used as a model system. THz-Time Domain Spectroscopy (THz-TDS) results show that acetanilide has a small peak observed below 1 THz. Acetanilide can be converted to 2-fluoroacetanilide by adding an electronegative atom, fluorine, which doesn't have any prominent peak below 1 THz. However, by optimally choosing the position of the electronegative atom as in 4-fluoroacetanilide, a significant THz resonance at 0.86 THz is observed. The origin of low frequency resonances can be understood by carrying out Density Functional Theory (DFT) simulations of full crystal structure. These studies show that adding an electronegative atom to the organic molecules at an optimized position can result in significantly enhanced resonances below 1 THz.

  16. High performance small-molecule organic thin film transistors

    NASA Astrophysics Data System (ADS)

    Kuo, Chung-Chen

    The roadmap of developing microelectronics has a new branch: organic electronics. Organic electronics, which utilizes the electrical properties of organic materials in the active or passive layers, is an emerging technology that has received much attention. In conjunction with today's demands for new materials and devices, many technologies have emerged for developing organic electronics and consolidating applications and markets. An organic thin-film transistor is the essential device in this paradigm in addition to organic photodiodes and organic light emitting diodes. This thesis presents advances made in design and fabrication of organic thin-film transistors (OTFTs) using small-molecule organic semiconductors (pentacene, anthradithiophene, and their derivatives) as the active layer with record device performance. In this work OTFT test structures fabricated on oxidized silicon substrates were utilized to provide a convenient substrate, gate contact, and gate insulator for the processing and characterization of vapor-deposited organic materials and their transistors. By developing a gate dielectric treatment using silane coupling agents the performance and yield of pentacene OTFTs was improved and a field-effect mobility of larger than 2 cm2/V-s was achieved. Such device performance is comparable to a-Si:H TFTs and have the potential for electronic applications. In addition, the first direct photolithographic process for top contacts to pentacene OTFTs on oxidized silicon with an acceptable performance (a field-effect mobility of 0.3 cm2/V-s, an on/off current ratio of 10 7, and a subthreshold slope of 1 V/decade) was developed. The multiple layer photoresist process demonstrated the feasibility of creating source and drain metallic electrodes on vapor-deposited pentacene thin films with a resolution less than 10 mum. Subsequently, solution-processed OTFTs were then investigated and high performance transistors, with field-effect mobilities > 1 cm2/V-s and an

  17. Tailoring the interface using thiophene small molecules in TiO2/P3HT hybrid solar cells.

    PubMed

    Freitas, Flavio S; Clifford, John N; Palomares, Emilio; Nogueira, Ana F

    2012-09-14

    In this paper we focus on the effect of carboxylated thiophene small molecules as interface modifiers in TiO(2)/P3HT hybrid solar cells. Our results show that small differences in the chemical structure of these molecules, for example, the presence of the -CH(2)- group in the 2-thiopheneacetic acid (TAA), can greatly increase the TiO(2) surface wettability, improving the TiO(2)/polymer contact. This effect is important to enhance exciton splitting and charge separation. PMID:22842849

  18. Efficient polymer solar cells employing a non-conjugated small-molecule electrolyte

    NASA Astrophysics Data System (ADS)

    Ouyang, Xinhua; Peng, Ruixiang; Ai, Ling; Zhang, Xingye; Ge, Ziyi

    2015-08-01

    Polymer solar cells have drawn a great deal of attention due to the attractiveness of their use in renewable energy sources that are potentially lightweight and low in cost. Recently, numerous significant research efforts have resulted in polymer solar cells with power conversion efficiencies in excess of 9% (ref. 1). Nevertheless, further improvements in performance are sought for commercial applications. Here, we report polymer solar cells with a power conversion efficiency of 10.02% that employ a non-conjugated small-molecule electrolyte as an interlayer. The material offers good contact for photogenerated charge carrier collection and allows optimum photon harvesting in the device. Furthermore, the enhanced performance is attributed to improved electron mobility, enhanced active-layer absorption and properly active-layer microstructures with optimal horizontal phase separation and vertical phase gradation. Our discovery opens a new avenue for single-junction devices by fully exploiting the potential of various material systems with efficiency over 10%.

  19. Metamaterial-enhanced vibrational absorption spectroscopy for the detection of protein molecules.

    PubMed

    Bui, Tung S; Dao, Thang D; Dang, Luu H; Vu, Lam D; Ohi, Akihiko; Nabatame, Toshihide; Lee, YoungPak; Nagao, Tadaaki; Hoang, Chung V

    2016-01-01

    From visible to mid-infrared frequencies, molecular sensing has been a major successful application of plasmonics because of the enormous enhancement of the surface electromagnetic nearfield associated with the induced collective motion of surface free carriers excited by the probe light. However, in the lower-energy terahertz (THz) region, sensing by detecting molecular vibrations is still challenging because of low sensitivity, complicated spectral features, and relatively little accumulated knowledge of molecules. Here, we report the use of a micron-scale thin-slab metamaterial (MM) architecture, which functions as an amplifier for enhancing the absorption signal of the THz vibration of an ultrathin adsorbed layer of large organic molecules. We examined bovine serum albumin (BSA) as a prototype large protein molecule and Rhodamine 6G (Rh6G) and 3,3'-diethylthiatricarbocyanine iodide (DTTCI) as examples of small molecules. Among them, our MM significantly magnified only the signal strength of bulky BSA. On the other hand, DTTCI and Rh6G are inactive, as they lack low-frequency vibrational modes in this frequency region. The results obtained here clearly demonstrate the promise of MM-enhanced absorption spectroscopy in the THz region for detection and structural monitoring of large biomolecules such as proteins or pathogenic enzymes. PMID:27555217

  20. Metamaterial-enhanced vibrational absorption spectroscopy for the detection of protein molecules

    PubMed Central

    Bui, Tung S.; Dao, Thang D.; Dang, Luu H.; Vu, Lam D.; Ohi, Akihiko; Nabatame, Toshihide; Lee, YoungPak; Nagao, Tadaaki; Hoang, Chung V.

    2016-01-01

    From visible to mid-infrared frequencies, molecular sensing has been a major successful application of plasmonics because of the enormous enhancement of the surface electromagnetic nearfield associated with the induced collective motion of surface free carriers excited by the probe light. However, in the lower-energy terahertz (THz) region, sensing by detecting molecular vibrations is still challenging because of low sensitivity, complicated spectral features, and relatively little accumulated knowledge of molecules. Here, we report the use of a micron-scale thin-slab metamaterial (MM) architecture, which functions as an amplifier for enhancing the absorption signal of the THz vibration of an ultrathin adsorbed layer of large organic molecules. We examined bovine serum albumin (BSA) as a prototype large protein molecule and Rhodamine 6G (Rh6G) and 3,3′-diethylthiatricarbocyanine iodide (DTTCI) as examples of small molecules. Among them, our MM significantly magnified only the signal strength of bulky BSA. On the other hand, DTTCI and Rh6G are inactive, as they lack low-frequency vibrational modes in this frequency region. The results obtained here clearly demonstrate the promise of MM-enhanced absorption spectroscopy in the THz region for detection and structural monitoring of large biomolecules such as proteins or pathogenic enzymes. PMID:27555217

  1. Metal-organic frameworks with functional pores for recognition of small molecules.

    PubMed

    Chen, Banglin; Xiang, Shengchang; Qian, Guodong

    2010-08-17

    strong interactions between open metal sites within porous MOFs and gas molecules such as hydrogen and acetylene, we have developed several MOF materials with extraordinary acetylene storage capacity at room temperature. We have also immobilized Lewis acidic and basic sites into luminescent porous MOFs to recognize and sense neutral and ionic species. Using the strategy to systematically immobilize different open metal sites within porous MOFs from the metalloligand precursors, we have developed the first microporous mixed-metal-organic framework (M'MOF) with enhanced affinity for hydrogen molecules, which successfully separated D(2) from H(2) using kinetic isotope quantum molecular sieving. Because we can functionalize the pores to direct their specific recognition of small molecules, the emerging porous MOFs serve as novel functional materials for gas storage, separation, heterogeneous catalysis, and sensing. PMID:20450174

  2. Nucleic acid molecules conferring enhanced ethanol tolerance and microorganisms having enhanced tolerance to ethanol

    DOEpatents

    Brown, Steven; Guss, Adam; Yang, Shihui; Karpinets, Tatiana; Lynd, Lee; Shao, Xiongjun

    2014-01-14

    The present invention provides isolated nucleic acid molecules which encode a mutant acetaldehyde-CoA/alcohol dehydrogenase or mutant alcohol dehydrogenase and confer enhanced tolerance to ethanol. The invention also provides related expression vectors, genetically engineered microorganisms having enhanced tolerance to ethanol, as well as methods of making and using such genetically modified microorganisms for production of biofuels based on fermentation of biomass materials.

  3. Hide and seek: Identification and confirmation of small molecule protein targets.

    PubMed

    Ursu, Andrei; Waldmann, Herbert

    2015-08-15

    Target identification and confirmation for small molecules is often the rate limiting step in drug discovery. A robust method to identify proteins addressed by small molecules is affinity chromatography using chemical probes. These usually consist of the compound of interest equipped with a linker molecule and a proper tag. Recently, methods emerged that allow the identification of protein targets without prior functionalization of the small molecule of interest. The digest offers an update on the newest developments in the area of target identification with special focus on confirmation techniques. PMID:26115575

  4. Evaluation of Small Molecules as Front Cell Donor Materials for High-Efficiency Tandem Solar Cells.

    PubMed

    Zhang, Qian; Wan, Xiangjian; Liu, Feng; Kan, Bin; Li, Miaomiao; Feng, Huanran; Zhang, Hongtao; Russell, Thomas P; Chen, Yongsheng

    2016-08-01

    Three small molecules as front cell donors for tandem cells are thoroughly evaluated and a high power conversion efficiency of 11.47% is achieved, which demonstrates that the oligomer-like small molecules offer a good choice for high-performance tandem solar cells. PMID:27214707

  5. Group specific internal standard technology (GSIST) for simultaneous identification and quantification of small molecules

    DOEpatents

    Adamec, Jiri; Yang, Wen-Chu; Regnier, Fred E

    2014-01-14

    Reagents and methods are provided that permit simultaneous analysis of multiple diverse small molecule analytes present in a complex mixture. Samples are labeled with chemically identical but isotopically distince forms of the labeling reagent, and analyzed using mass spectrometry. A single reagent simultaneously derivatizes multiple small molecule analytes having different reactive functional groups.

  6. Small Talk: Children's Everyday "Molecule" Ideas

    ERIC Educational Resources Information Center

    Jakab, Cheryl

    2013-01-01

    This paper reports on 6-11-year-old children's "sayings and doings" (Harré 2002) as they explore molecule artefacts in dialectical-interactive teaching interviews (Fleer, "Cultural Studies of Science Education" 3:781-786, 2008; Hedegaard et al. 2008). This sociocultural study was designed to explore children's…

  7. Small Molecule Antagonizes Autoinhibition and Activates AMP-activated Protein Kinase in Cells*

    PubMed Central

    Pang, Tao; Zhang, Zhen-Shan; Gu, Min; Qiu, Bei-Ying; Yu, Li-Fang; Cao, Peng-Rong; Shao, Wei; Su, Ming-Bo; Li, Jing-Ya; Nan, Fa-Jun; Li, Jia

    2008-01-01

    AMP-activated protein kinase (AMPK) serves as an energy sensor and is considered a promising drug target for treatment of type II diabetes and obesity. A previous report has shown that mammalian AMPK α1 catalytic subunit including autoinhibitory domain was inactive. To test the hypothesis that small molecules can activate AMPK through antagonizing the autoinhibition in α subunits, we screened a chemical library with inactive human α1394 (α1, residues 1-394) and found a novel small-molecule activator, PT1, which dose-dependently activated AMPK α1394, α1335, α2398, and even heterotrimer α1β1γ1. Based on PT1-docked AMPK α1 subunit structure model and different mutations, we found PT1 might interact with Glu-96 and Lys-156 residues near the autoinhibitory domain and directly relieve autoinhibition. Further studies using L6 myotubes showed that the phosphorylation of AMPK and its downstream substrate, acetyl-CoA carboxylase, were dose-dependently and time-dependently increased by PT1 with-out an increase in cellular AMP:ATP ratio. Moreover, in HeLa cells deficient in LKB1, PT1 enhanced AMPK phosphorylation, which can be inhibited by the calcium/calmodulin-dependent protein kinase kinases inhibitor STO-609 and AMPK inhibitor compound C. PT1 also lowered hepatic lipid content in a dose-dependent manner through AMPK activation in HepG2 cells, and this effect was diminished by compound C. Taken together, these data indicate that this small-molecule activator may directly activate AMPK via antagonizing the autoinhibition in vitro and in cells. This compound highlights the effort to discover novel AMPK activators and can be a useful tool for elucidating the mechanism responsible for conformational change and autoinhibitory regulation of AMPK. PMID:18321858

  8. Enhancing Single Molecule Imaging in Optofluidics and Microfluidics

    PubMed Central

    Vasdekis, Andreas E.; Laporte, Gregoire P.J.

    2011-01-01

    Microfluidics and optofluidics have revolutionized high-throughput analysis and chemical synthesis over the past decade. Single molecule imaging has witnessed similar growth, due to its capacity to reveal heterogeneities at high spatial and temporal resolutions. However, both resolution types are dependent on the signal to noise ratio (SNR) of the image. In this paper, we review how the SNR can be enhanced in optofluidics and microfluidics. Starting with optofluidics, we outline integrated photonic structures that increase the signal emitted by single chromophores and minimize the excitation volume. Turning then to microfluidics, we review the compatible functionalization strategies that reduce noise stemming from non-specific interactions and architectures that minimize bleaching and blinking. PMID:21954349

  9. Advancing Biological Understanding and Therapeutics Discovery with Small-Molecule Probes.

    PubMed

    Schreiber, Stuart L; Kotz, Joanne D; Li, Min; Aubé, Jeffrey; Austin, Christopher P; Reed, John C; Rosen, Hugh; White, E Lucile; Sklar, Larry A; Lindsley, Craig W; Alexander, Benjamin R; Bittker, Joshua A; Clemons, Paul A; de Souza, Andrea; Foley, Michael A; Palmer, Michelle; Shamji, Alykhan F; Wawer, Mathias J; McManus, Owen; Wu, Meng; Zou, Beiyan; Yu, Haibo; Golden, Jennifer E; Schoenen, Frank J; Simeonov, Anton; Jadhav, Ajit; Jackson, Michael R; Pinkerton, Anthony B; Chung, Thomas D Y; Griffin, Patrick R; Cravatt, Benjamin F; Hodder, Peter S; Roush, William R; Roberts, Edward; Chung, Dong-Hoon; Jonsson, Colleen B; Noah, James W; Severson, William E; Ananthan, Subramaniam; Edwards, Bruce; Oprea, Tudor I; Conn, P Jeffrey; Hopkins, Corey R; Wood, Michael R; Stauffer, Shaun R; Emmitte, Kyle A

    2015-06-01

    Small-molecule probes can illuminate biological processes and aid in the assessment of emerging therapeutic targets by perturbing biological systems in a manner distinct from other experimental approaches. Despite the tremendous promise of chemical tools for investigating biology and disease, small-molecule probes were unavailable for most targets and pathways as recently as a decade ago. In 2005, the NIH launched the decade-long Molecular Libraries Program with the intent of innovating in and broadening access to small-molecule science. This Perspective describes how novel small-molecule probes identified through the program are enabling the exploration of biological pathways and therapeutic hypotheses not otherwise testable. These experiences illustrate how small-molecule probes can help bridge the chasm between biological research and the development of medicines but also highlight the need to innovate the science of therapeutic discovery. PMID:26046436

  10. Imaging Self-assembly Dependent Spatial Distribution of Small Molecules in Cellular Environment

    PubMed Central

    Gao, Yuan; Kuang, Yi; Du, Xuewen; Zhou, Jie; Chandran, Preethi; Horkay, Ferenc; Xu, Bing

    2014-01-01

    Self-assembly of small molecules, as a more common phenomenon than one previously thought, can be either beneficial or detrimental to cells. Despite its profound biological implications, how the self-assembly of small molecules behave in cellular environment is largely unknown and barely explored. This work studies four fluorescent molecules that consist of the same peptidic backbone (e.g., Phe-Phe-Lys) and enzyme trigger (e.g., a phosphotyrosine residue), but bear different fluorophores on the side chain of the lysine residue of the peptidic motif. These molecules, however, exhibit different ability of self-assembly before and after enzymatic transformation (e.g., dephosphorylation). Fluorescent imaging reveals that self-assembly directly affects the distribution of these small molecules in cellular environment. Moreover, cell viability tests suggest that the states and the location of the molecular assemblies in the cellular environment control the phenotypes of the cells. For example, the molecular nanofibers of one of the small molecules apparently stabilize actin filaments and alleviate the insult of an F-actin toxin (e.g., latrunculin A). Combining fluorescent imaging and enzyme-instructed self-assembly of small peptidic molecules, this work not only demonstrates that self-assembly as a key factor for dictating the spatial distribution of small molecules in cellular environment. In addition, it illustrates a useful approach, based on enzyme-instructed self-assembly of small molecules, to modulate spatiotemporal profiles of small molecules in cellular environment, which allows the use of the emergent properties of small molecules to control the fate of cells. PMID:24266765

  11. Imaging self-assembly dependent spatial distribution of small molecules in a cellular environment.

    PubMed

    Gao, Yuan; Kuang, Yi; Du, Xuewen; Zhou, Jie; Chandran, Preethi; Horkay, Ferenc; Xu, Bing

    2013-12-10

    Self-assembly of small molecules, as a more common phenomenon than one previously thought, can be either beneficial or detrimental to cells. Despite its profound biological implications, how the self-assembly of small molecules behave in a cellular environment is largely unknown and barely explored. This work studies four fluorescent molecules that consist of the same peptidic backbone (e.g., Phe-Phe-Lys) and enzyme trigger (e.g., a phosphotyrosine residue), but bear different fluorophores on the side chain of the lysine residue of the peptidic motif. These molecules, however, exhibit a different ability of self-assembly before and after enzymatic transformation (e.g., dephosphorylation). Fluorescent imaging reveals that self-assembly directly affects the distribution of these small molecules in a cellular environment. Moreover, cell viability tests suggest that the states and the locations of the molecular assemblies in the cellular environment control the phenotypes of the cells. For example, the molecular nanofibers of one of the small molecules apparently stabilize actin filaments and alleviate the insult of an F-actin toxin (e.g., latrunculin A). Combining fluorescent imaging and enzyme-instructed self-assembly of small peptidic molecules, this work demonstrates self-assembly as a key factor for dictating the spatial distribution of small molecules in a cellular environment. In addition, it illustrates a useful approach, based on enzyme-instructed self-assembly of small molecules, to modulate spatiotemporal profiles of small molecules in a cellular environment, which allows the use of the emergent properties of small molecules to control the fate of cells. PMID:24266765

  12. Small Molecule Inhibitors of BAF; A Promising Family of Compounds in HIV-1 Latency Reversal.

    PubMed

    Stoszko, Mateusz; De Crignis, Elisa; Rokx, Casper; Khalid, Mir Mubashir; Lungu, Cynthia; Palstra, Robert-Jan; Kan, Tsung Wai; Boucher, Charles; Verbon, Annelies; Dykhuizen, Emily C; Mahmoudi, Tokameh

    2016-01-01

    Persistence of latently infected cells in presence of Anti-Retroviral Therapy presents the main obstacle to HIV-1 eradication. Much effort is thus placed on identification of compounds capable of HIV-1 latency reversal in order to render infected cells susceptible to viral cytopathic effects and immune clearance. We identified the BAF chromatin remodeling complex as a key player required for maintenance of HIV-1 latency, highlighting its potential as a molecular target for inhibition in latency reversal. Here, we screened a recently identified panel of small molecule inhibitors of BAF (BAFi's) for potential to activate latent HIV-1. Latency reversal was strongly induced by BAFi's Caffeic Acid Phenethyl Ester and Pyrimethamine, two molecules previously characterized for clinical application. BAFi's reversed HIV-1 latency in cell line based latency models, in two ex vivo infected primary cell models of latency, as well as in HIV-1 infected patient's CD4 + T cells, without inducing T cell proliferation or activation. BAFi-induced HIV-1 latency reversal was synergistically enhanced upon PKC pathway activation and HDAC-inhibition. Therefore BAFi's constitute a promising family of molecules for inclusion in therapeutic combinatorial HIV-1 latency reversal. PMID:26870822

  13. Small Molecule Inhibitors of BAF; A Promising Family of Compounds in HIV-1 Latency Reversal

    PubMed Central

    Stoszko, Mateusz; De Crignis, Elisa; Rokx, Casper; Khalid, Mir Mubashir; Lungu, Cynthia; Palstra, Robert-Jan; Kan, Tsung Wai; Boucher, Charles; Verbon, Annelies; Dykhuizen, Emily C.; Mahmoudi, Tokameh

    2015-01-01

    Persistence of latently infected cells in presence of Anti-Retroviral Therapy presents the main obstacle to HIV-1 eradication. Much effort is thus placed on identification of compounds capable of HIV-1 latency reversal in order to render infected cells susceptible to viral cytopathic effects and immune clearance. We identified the BAF chromatin remodeling complex as a key player required for maintenance of HIV-1 latency, highlighting its potential as a molecular target for inhibition in latency reversal. Here, we screened a recently identified panel of small molecule inhibitors of BAF (BAFi's) for potential to activate latent HIV-1. Latency reversal was strongly induced by BAFi's Caffeic Acid Phenethyl Ester and Pyrimethamine, two molecules previously characterized for clinical application. BAFi's reversed HIV-1 latency in cell line based latency models, in two ex vivo infected primary cell models of latency, as well as in HIV-1 infected patient's CD4 + T cells, without inducing T cell proliferation or activation. BAFi-induced HIV-1 latency reversal was synergistically enhanced upon PKC pathway activation and HDAC-inhibition. Therefore BAFi's constitute a promising family of molecules for inclusion in therapeutic combinatorial HIV-1 latency reversal. PMID:26870822

  14. Proteasome activation is a mechanism for pyrazolone small molecules displaying therapeutic potential in amyotrophic lateral sclerosis.

    PubMed

    Trippier, Paul C; Zhao, Kevin Tianmeng; Fox, Susan G; Schiefer, Isaac T; Benmohamed, Radhia; Moran, Jason; Kirsch, Donald R; Morimoto, Richard I; Silverman, Richard B

    2014-09-17

    Amyotrophic lateral sclerosis (ALS) is a progressive and ultimately fatal neurodegenerative disease. Pyrazolone containing small molecules have shown significant disease attenuating efficacy in cellular and murine models of ALS. Pyrazolone based affinity probes were synthesized to identify high affinity binding partners and ascertain a potential biological mode of action. Probes were confirmed to be neuroprotective in PC12-SOD1(G93A) cells. PC12-SOD1(G93A) cell lysates were used for protein pull-down, affinity purification, and subsequent proteomic analysis using LC-MS/MS. Proteomics identified the 26S proteasome regulatory subunit 4 (PSMC1), 26S proteasome regulatory subunit 6B (PSMC4), and T-complex protein 1 (TCP-1) as putative protein targets. Coincubation with appropriate competitors confirmed the authenticity of the proteomics results. Activation of the proteasome by pyrazolones was demonstrated in the absence of exogenous proteasome inhibitor and by restoration of cellular protein degradation of a fluorogenic proteasome substrate in PC12-SOD1(G93A) cells. Importantly, supplementary studies indicated that these molecules do not induce a heat shock response. We propose that pyrazolones represent a rare class of molecules that enhance proteasomal activation in the absence of a heat shock response and may have therapeutic potential in ALS. PMID:25001311

  15. Small-Molecule Modulators of Listeria monocytogenes Biofilm Development

    PubMed Central

    Nguyen, Uyen T.; Wenderska, Iwona B.; Chong, Matthew A.; Koteva, Kalinka; Wright, Gerard D.

    2012-01-01

    Listeria monocytogenes is an important food-borne pathogen whose ability to form disinfectant-tolerant biofilms on a variety of surfaces presents a food safety challenge for manufacturers of ready-to-eat products. We developed here a high-throughput biofilm assay for L. monocytogenes and, as a proof of principle, used it to screen an 80-compound protein kinase inhibitor library to identify molecules that perturb biofilm development. The screen yielded molecules toxic to multiple strains of Listeria at micromolar concentrations, as well as molecules that decreased (≤50% of vehicle control) or increased (≥200%) biofilm formation in a dose-dependent manner without affecting planktonic cell density. Toxic molecules—including the protein kinase C antagonist sphingosine—had antibiofilm activity at sub-MIC concentrations. Structure-activity studies of the biofilm inhibitory compound palmitoyl-d,l-carnitine showed that while Listeria biofilm formation was inhibited with a 50% inhibitory concentration of 5.85 ± 0.24 μM, d,l-carnitine had no effect, whereas palmitic acid had stimulatory effects. Saturated fatty acids between C9:0 and C14:0 were Listeria biofilm inhibitors, whereas fatty acids of C16:0 or longer were stimulators, showing chain length specificity. De novo-synthesized short-chain acyl carnitines were less effective biofilm inhibitors than the palmitoyl forms. These molecules, whose activities against bacteria have not been previously established, are both useful probes of L. monocytogenes biology and promising leads for the further development of antibiofilm strategies. PMID:22194285

  16. Intraepithelial lymphocytes express junctional molecules in murine small intestine

    SciTech Connect

    Inagaki-Ohara, Kyoko . E-mail: INAGAKI@med.miyazaki-u.ac.jp; Sawaguchi, Akira; Suganuma, Tatsuo; Matsuzaki, Goro; Nawa, Yukifumi

    2005-06-17

    Intestinal intraepithelial lymphocytes (IEL) that reside at basolateral site regulate the proliferation and differentiation of epithelial cells (EC) for providing a first line of host defense in intestine. However, it remains unknown how IEL interact and communicate with EC. Here, we show that IEL express junctional molecules like EC. We identified mRNA expression of the junctional molecules in IEL such as zonula occludens (ZO)-1, occludin and junctional adhesion molecule (JAM) (tight junction), {beta}-catenin and E-cadherin (adherens junction), and connexin26 (gap junction). IEL constitutively expressed occludin and E-cadherin at protein level, while other T cells in the thymus, spleen, liver, mesenteric lymph node, and Peyer's patches did not. {gamma}{delta} IEL showed higher level of these expressions than {alpha}{beta} IEL. The expression of occludin was augmented by anti-CD3 Ab stimulation. These results suggest the possibility of a novel role of IEL concerning epithelial barrier and communication between IEL and EC.

  17. Histone deacetylase inhibitor givinostat: the small-molecule with promising activity against therapeutically challenging haematological malignancies.

    PubMed

    Ganai, Shabir Ahmad

    2016-08-01

    Histone acetyl transferases and histone deacetylases (HDACs) are counteracting epigenetic enzymes regulating the turnover of histone acetylation thereby regulating transcriptional events in a precise manner. Deregulation of histone acetylation caused by aberrant expression of HDACs plays a key role in tumour onset and progression making these enzymes as candidate targets for anticancer drugs and therapy. Small-molecules namely histone deacetylase inhibitors (HDACi) modulating the biological function of HDACs have shown multiple biological effects including differentiation, cell cycle arrest and apoptosis in tumour models. HDACi in general have been described in plethora of reviews with respect to various cancers. However, no review article is available describing thoroughly the role of inhibitor givinostat (ITF2357 or [6-(diethylaminomethyl) naphthalen-2-yl] methyl N-[4-(hydroxycarbamoyl) phenyl] carbamate) in haematological malignancies. Thus, the present review explores the intricate role of novel inhibitor givinostat in the defined malignancies including multiple myeloma, acute myelogenous leukaemia, Hodgkin's and non-Hodgkin's lymphoma apart from myeloproliferative neoplasms. The distinct molecular mechanisms triggered by this small-molecule inhibitor in these cancers to exert cytotoxic effect have also been dealt with. The article also highlights the combination strategy that can be used for enhancing the therapeutic efficiency of this inhibitor in the upcoming future. PMID:27121910

  18. Therapeutic targeting and rapid mobilization of endosteal HSC using a small molecule integrin antagonist

    PubMed Central

    Cao, Benjamin; Zhang, Zhen; Grassinger, Jochen; Williams, Brenda; Heazlewood, Chad K.; Churches, Quentin I.; James, Simon A.; Li, Songhui; Papayannopoulou, Thalia; Nilsson, Susan K.

    2016-01-01

    The inherent disadvantages of using granulocyte colony-stimulating factor (G-CSF) for hematopoietic stem cell (HSC) mobilization have driven efforts to identify alternate strategies based on single doses of small molecules. Here, we show targeting α9β1/α4β1 integrins with a single dose of a small molecule antagonist (BOP (N-(benzenesulfonyl)-L-prolyl-L-O-(1-pyrrolidinylcarbonyl)tyrosine)) rapidly mobilizes long-term multi-lineage reconstituting HSC. Synergistic engraftment augmentation is observed when BOP is co-administered with AMD3100. Impressively, HSC in equal volumes of peripheral blood (PB) mobilized with this combination effectively out-competes PB mobilized with G-CSF. The enhanced mobilization observed using BOP and AMD3100 is recapitulated in a humanized NODSCIDIL2Rγ−/− model, demonstrated by a significant increase in PB CD34+ cells. Using a related fluorescent analogue of BOP (R-BC154), we show that this class of antagonists preferentially bind human and mouse HSC and progenitors via endogenously primed/activated α9β1/α4β1 within the endosteal niche. These results support using dual α9β1/α4β1 inhibitors as effective, rapid and transient mobilization agents with promising clinical applications. PMID:26975966

  19. Pyrvinium, a Potent Small Molecule Wnt Inhibitor, Promotes Wound Repair and Post-MI Cardiac Remodeling

    PubMed Central

    Saraswati, Sarika; Alfaro, Maria P.; Thorne, Curtis A.; Atkinson, James; Lee, Ethan; Young, Pampee P.

    2010-01-01

    Wnt signaling plays an important role in developmental and stem cell biology. To test the hypothesis that temporary inhibition of Wnt signaling will enhance granulation tissue and promote angiogenesis in tissue repair, we employed a recently characterized small molecule Wnt inhibitor. Pyrvinium is an FDA-approved drug that we identified as a Wnt inhibitor in a chemical screen for small molecules that stabilize β-catenin and inhibit Axin degradation. Our subsequent characterization of pyrvinium has revealed that its critical cellular target in the Wnt pathway is Casein Kinase 1α. Daily administration of pyrvinium directly into polyvinyl alcohol (PVA) sponges implanted subcutaneously in mice generated better organized and vascularized granulation tissue; this compound also increased the proliferative index of the tissue within the sponges. To evaluate its effect in myocardial repair, we induced a myocardial infarction (MI) by coronary artery ligation and administered a single intramyocardial dose of pyrvinium. Mice were evaluated by echocardiography at 7 and 30 days post-MI and treatment; post mortem hearts were evaluated by histology at 30 days. Pyrvinium reduced adverse cardiac remodeling demonstrated by decreased left ventricular internal diameter in diastole (LVIDD) as compared to a control compound. Increased Ki-67+ cells were observed in peri-infarct and distal myocardium of pyrvinium-treated animals. These results need to be further followed-up to determine if therapeutic inhibition of canonical Wnt may avert adverse remodeling after ischemic injury and its impact on myocardial repair and regeneration. PMID:21170416

  20. Therapeutic targeting and rapid mobilization of endosteal HSC using a small molecule integrin antagonist.

    PubMed

    Cao, Benjamin; Zhang, Zhen; Grassinger, Jochen; Williams, Brenda; Heazlewood, Chad K; Churches, Quentin I; James, Simon A; Li, Songhui; Papayannopoulou, Thalia; Nilsson, Susan K

    2016-01-01

    The inherent disadvantages of using granulocyte colony-stimulating factor (G-CSF) for hematopoietic stem cell (HSC) mobilization have driven efforts to identify alternate strategies based on single doses of small molecules. Here, we show targeting α9β1/α4β1 integrins with a single dose of a small molecule antagonist (BOP (N-(benzenesulfonyl)-L-prolyl-L-O-(1-pyrrolidinylcarbonyl)tyrosine)) rapidly mobilizes long-term multi-lineage reconstituting HSC. Synergistic engraftment augmentation is observed when BOP is co-administered with AMD3100. Impressively, HSC in equal volumes of peripheral blood (PB) mobilized with this combination effectively out-competes PB mobilized with G-CSF. The enhanced mobilization observed using BOP and AMD3100 is recapitulated in a humanized NODSCIDIL2Rγ(-/-) model, demonstrated by a significant increase in PB CD34(+) cells. Using a related fluorescent analogue of BOP (R-BC154), we show that this class of antagonists preferentially bind human and mouse HSC and progenitors via endogenously primed/activated α9β1/α4β1 within the endosteal niche. These results support using dual α9β1/α4β1 inhibitors as effective, rapid and transient mobilization agents with promising clinical applications. PMID:26975966

  1. Discovery of a novel small molecule agonist scaffold for the APJ receptor.

    PubMed

    Narayanan, Sanju; Maitra, Rangan; Deschamps, Jeffery R; Bortoff, Katherine; Thomas, James B; Zhang, Yanyan; Warner, Keith; Vasukuttan, Vineetha; Decker, Ann; Runyon, Scott P

    2016-08-15

    The apelinergic system includes a series of endogenous peptides apelin, ELABELA/TODDLER and their 7-transmembrane G-protein coupled apelin receptor (APJ, AGTRL-1, APLNR). The APJ receptor is an attractive therapeutic target because of its involvement in cardiovascular diseases and potentially other disorders including liver fibrosis, obesity, diabetes, and neuroprotection. To date, pharmacological characterization of the APJ receptor has been limited due to the lack of small molecule functional agonists or antagonists. Through focused screening we identified a drug-like small molecule agonist hit 1 with a functional EC50 value of 21.5±5μM and binding affinity (Ki) of 5.2±0.5μM. Initial structure-activity studies afforded compound 22 having a 27-fold enhancement in potency and the first sub-micromolar full agonist with an EC50 value of 800±0.1nM and Ki of 1.3±0.3μM. Preliminary SAR, synthetic methodology, and in vitro pharmacological characterization indicate this scaffold will serve as a favorable starting point for further refinement of APJ potency and selectivity. PMID:27369451

  2. Small-Molecule Procaspase-3 Activation Sensitizes Cancer to Treatment with Diverse Chemotherapeutics.

    PubMed

    Botham, Rachel C; Roth, Howard S; Book, Alison P; Roady, Patrick J; Fan, Timothy M; Hergenrother, Paul J

    2016-08-24

    Conventional chemotherapeutics remain essential treatments for most cancers, but their combination with other anticancer drugs (including targeted therapeutics) is often complicated by unpredictable synergies and multiplicative toxicities. As cytotoxic anticancer chemotherapeutics generally function through induction of apoptosis, we hypothesized that a molecularly targeted small molecule capable of facilitating a central and defining step in the apoptotic cascade, the activation of procaspase-3 to caspase-3, would broadly and predictably enhance activity of cytotoxic drugs. Here we show that procaspase-activating compound 1 (PAC-1) enhances cancer cell death induced by 15 different FDA-approved chemotherapeutics, across many cancer types and chemotherapeutic targets. In particular, the promising combination of PAC-1 and doxorubicin induces a synergistic reduction in tumor burden and enhances survival in murine tumor models of osteosarcoma and lymphoma. This PAC-1/doxorubicin combination was evaluated in 10 pet dogs with naturally occurring metastatic osteosarcoma or lymphoma, eliciting a biologic response in 3 of 6 osteosarcoma patients and 4 of 4 lymphoma patients. Importantly, in both mice and dogs, coadministration of PAC-1 with doxorubicin resulted in no additional toxicity. On the basis of the mode of action of PAC-1 and the high expression of procaspase-3 in many cancers, these results suggest the combination of PAC-1 with cytotoxic anticancer drugs as a potent and general strategy to enhance therapeutic response. PMID:27610416

  3. Small-Molecule Procaspase-3 Activation Sensitizes Cancer to Treatment with Diverse Chemotherapeutics

    PubMed Central

    2016-01-01

    Conventional chemotherapeutics remain essential treatments for most cancers, but their combination with other anticancer drugs (including targeted therapeutics) is often complicated by unpredictable synergies and multiplicative toxicities. As cytotoxic anticancer chemotherapeutics generally function through induction of apoptosis, we hypothesized that a molecularly targeted small molecule capable of facilitating a central and defining step in the apoptotic cascade, the activation of procaspase-3 to caspase-3, would broadly and predictably enhance activity of cytotoxic drugs. Here we show that procaspase-activating compound 1 (PAC-1) enhances cancer cell death induced by 15 different FDA-approved chemotherapeutics, across many cancer types and chemotherapeutic targets. In particular, the promising combination of PAC-1 and doxorubicin induces a synergistic reduction in tumor burden and enhances survival in murine tumor models of osteosarcoma and lymphoma. This PAC-1/doxorubicin combination was evaluated in 10 pet dogs with naturally occurring metastatic osteosarcoma or lymphoma, eliciting a biologic response in 3 of 6 osteosarcoma patients and 4 of 4 lymphoma patients. Importantly, in both mice and dogs, coadministration of PAC-1 with doxorubicin resulted in no additional toxicity. On the basis of the mode of action of PAC-1 and the high expression of procaspase-3 in many cancers, these results suggest the combination of PAC-1 with cytotoxic anticancer drugs as a potent and general strategy to enhance therapeutic response. PMID:27610416

  4. Small molecule tolfenamic acid and dietary spice curcumin treatment enhances antiproliferative effect in pancreatic cancer cells via suppressing Sp1, disrupting NF-kB translocation to nucleus and cell cycle phase distribution.

    PubMed

    Basha, Riyaz; Connelly, Sarah F; Sankpal, Umesh T; Nagaraju, Ganji Purnachandra; Patel, Hassaan; Vishwanatha, Jamboor K; Shelake, Sagar; Tabor-Simecka, Leslie; Shoji, Mamoru; Simecka, Jerry W; El-Rayes, Bassel

    2016-05-01

    Combination of dietary/herbal spice curcumin (Cur) and COX inhibitors has been tested for improving therapeutic efficacy in pancreatic cancer (PC). The objective of this study was to identify agent with low toxicity and COX-independent mechanism to induce PC cell growth inhibition when used along with Cur. Anticancer NSAID, tolfenamic acid (TA) and Cur combination were evaluated using PC cell lines. L3.6pl and MIA PaCa-2 cells were treated with Cur (5-25μM) or TA (25-100μM) or combination of Cur (7.5μM) and TA (50μM). Cell viability was measured at 24-72h posttreatment using CellTiter-Glo kit. While both agents showed a steady/consistent effect, Cur+TA caused higher growth inhibition. Antiproliferative effect was compared with COX inhibitors, Ibuprofen and Celebrex. Cardiotoxicity was assessed using cordiomyocytes (H9C2). The expression of Sp proteins, survivin and apoptotic markers (western blot), caspase 3/7 (caspase-Glo kit), Annexin-V staining (flow cytometry), reactive oxygen species (ROS) and cell cycle phase distribution (flow cytometry) was measured. Cells were treated with TNF-α, and NF-kB translocation from cytoplasm to nucleus was evaluated (immunofluorescence). When compared to individual agents, combination of Cur+TA caused significant increase in apoptotic markers, ROS levels and inhibited NF-kB translocation to nucleus. TA caused cell cycle arrest in G0/G1, and the combination treatment showed mostly DNA synthesis phase arrest. These results suggest that combination of Cur+TA is less toxic and effectively enhance the therapeutic efficacy in PC cells via COX-independent mechanisms. PMID:27133426

  5. A small-molecule inhibitor of sarcomere contractility suppresses hypertrophic cardiomyopathy in mice

    PubMed Central

    Green, Eric M.; Wakimoto, Hiroko; Anderson, Robert L.; Evanchik, Marc J.; Gorham, Joshua M.; Harrison, Brooke C.; Henze, Marcus; Kawas, Raja; Oslob, Johan D.; Rodriguez, Hector M.; Song, Yonghong; Wan, William; Leinwand, Leslie A.; Spudich, James A.; McDowell, Robert S.; Seidman, J. G.; Seidman, Christine E.

    2016-01-01

    Hypertrophic cardiomyopathy (HCM) is an inherited disease of heart muscle that can be caused by mutations in sarcomere proteins. Clinical diagnosis depends on an abnormal thickening of the heart, but the earliest signs of disease are hyperdynamic contraction and impaired relaxation. Whereas some in vitro studies of power generation by mutant and wild-type sarcomere proteins are consistent with mutant sarcomeres exhibiting enhanced contractile power, others are not. We identified a small molecule, MYK-461, that reduces contractility by decreasing the adenosine triphosphatase activity of the cardiac myosin heavy chain. Here we demonstrate that early, chronic administration of MYK-461 suppresses the development of ventricular hypertrophy, cardiomyocyte disarray, and myocardial fibrosis and attenuates hypertrophic and profibrotic gene expression in mice harboring heterozygous human mutations in the myosin heavy chain. These data indicate that hyperdynamic contraction is essential for HCM pathobiology and that inhibitors of sarcomere contraction may be a valuable therapeutic approach for HCM. PMID:26912705

  6. A small-molecule inhibitor of sarcomere contractility suppresses hypertrophic cardiomyopathy in mice.

    PubMed

    Green, Eric M; Wakimoto, Hiroko; Anderson, Robert L; Evanchik, Marc J; Gorham, Joshua M; Harrison, Brooke C; Henze, Marcus; Kawas, Raja; Oslob, Johan D; Rodriguez, Hector M; Song, Yonghong; Wan, William; Leinwand, Leslie A; Spudich, James A; McDowell, Robert S; Seidman, J G; Seidman, Christine E

    2016-02-01

    Hypertrophic cardiomyopathy (HCM) is an inherited disease of heart muscle that can be caused by mutations in sarcomere proteins. Clinical diagnosis depends on an abnormal thickening of the heart, but the earliest signs of disease are hyperdynamic contraction and impaired relaxation. Whereas some in vitro studies of power generation by mutant and wild-type sarcomere proteins are consistent with mutant sarcomeres exhibiting enhanced contractile power, others are not. We identified a small molecule, MYK-461, that reduces contractility by decreasing the adenosine triphosphatase activity of the cardiac myosin heavy chain. Here we demonstrate that early, chronic administration of MYK-461 suppresses the development of ventricular hypertrophy, cardiomyocyte disarray, and myocardial fibrosis and attenuates hypertrophic and profibrotic gene expression in mice harboring heterozygous human mutations in the myosin heavy chain. These data indicate that hyperdynamic contraction is essential for HCM pathobiology and that inhibitors of sarcomere contraction may be a valuable therapeutic approach for HCM. PMID:26912705

  7. Antithrombotic and antiplatelet activities of small-molecule alkaloids from Scolopendra subspinipes mutilans

    PubMed Central

    Lee, Wonhwa; Lee, JungIn; Kulkarni, Roshan; Kim, Mi-Ae; Hwang, Jae Sam; Na, MinKyun; Bae, Jong-Sup

    2016-01-01

    The aim of this study was to discover small-molecule anticoagulants from Scolopendra subspinipes mutilans (SSM). A new acylated polyamine (1) and a new sulfated quinoline alkaloid (2) were isolated from SSM. Treatment with the new alkaloids 1, 2, and indole acetic acid 4 prolonged the activated partial thromboplastin time and prothrombin time and inhibited the activity and production of thrombin and activated factor X. Furthermore, compounds 1, 2, and 4 inhibited thrombin-catalyzed fibrin polymerization and platelet aggregation. In accordance with these potential in vitro antiplatelet activities, compounds 1, 2, and 4 showed enhanced antithrombotic effects in an in vivo pulmonary embolism and arterial thrombosis model. Compounds 1, 2, and 4 also elicited anticoagulant effects in mice. Collectively, this study may serve as the groundwork for commercializing SSM or compounds 1, 2, and 4 as functional food components for the prevention and treatment of pathogenic conditions and serve as new scaffolds for the development of anticoagulants. PMID:26905699

  8. Lyotropic liquid crystal engineering-ordered nanostructured small molecule amphiphile self-assembly materials by design.

    PubMed

    Fong, Celesta; Le, Tu; Drummond, Calum J

    2012-02-01

    Future nanoscale soft matter design will be guided to a large extent by the teachings of amphiphile (lipid or surfactant) self-assembly. Ordered nanostructured lyotropic liquid crystalline mesophases may form in select mixtures of amphiphile and solvent. To reproducibly engineer the low energy amphiphile self-assembly of materials for the future, we must first learn the design principles. In this critical review we discuss the evolution of these design rules and in particular discuss recent key findings regarding (i) what drives amphiphile self-assembly, (ii) what governs the self-assembly structures that are formed, and (iii) how can amphiphile self-assembly materials be used to enhance product formulations, including drug delivery vehicles, medical imaging contrast agents, and integral membrane protein crystallisation media. We focus upon the generation of 'dilutable' lyotropic liquid crystal phases with two- and three-dimensional geometries from amphiphilic small molecules (225 references). PMID:21975366

  9. Small molecule and peptide-mediated inhibition of Epstein-Barr virus nuclear antigen 1 dimerization

    SciTech Connect

    Kim, Sun Young; Song, Kyung-A; Kieff, Elliott; Kang, Myung-Soo

    2012-07-27

    Highlights: Black-Right-Pointing-Pointer Evidence that targeting EBNA1 dimer, an EBV onco-antigen, can be achievable. Black-Right-Pointing-Pointer A small molecule and a peptide as EBNA1 dimerization inhibitors identified. Black-Right-Pointing-Pointer Both inhibitors associated with EBNA1 and blocked EBNA1 DNA binding activity. Black-Right-Pointing-Pointer Also, prevented its dimerization, and repressed viral gene transcription. -- Abstract: Latent Epstein-Barr virus (EBV) infection is associated with human B cell lymphomas and certain carcinomas. EBV episome persistence, replication, and gene expression are dependent on EBV-encoded nuclear antigen 1 (EBNA1)'s DNA binding domain (DBD)/dimerization domain (DD)-mediated sequence-specific DNA binding activity. Homodimerization of EBNA1 is essential for EBNA1 DNA binding and transactivation. In this study, we characterized a novel small molecule EBNA1 inhibitor EiK1, screened from the previous high throughput screening (HTS). The EiK1 compound specifically inhibited the EBNA1-dependent, OriP-enhanced transcription, but not EBNA1-independent transcription. A Surface Plasmon Resonance Biacore assay revealed that EiK1 associates with EBNA1 amino acid 459-607 DBD/DD. Consistent with the SPR data, in vitro gel shift assays showed that EiK1 suppressed the activity of EBNA1 binding to the cognate familial repeats (FR) sequence, but not control RBP-J{kappa} binding to the J{kappa} site. Subsequently, a cross-linker-mediated in vitro multimerization assay and EBNA1 homodimerization-dependent yeast two-hybrid assay showed that EiK1 significantly inhibited EBNA1 dimerization. In an attempt to identify more highly specific peptide inhibitors, small peptides encompassing the EBNA1 DBD/DD were screened for inhibition of EBNA1 DBD-mediated DNA binding function. The small peptide P85, covering EBNA1 a.a. 560-574, significantly blocked EBNA1 DNA binding activity in vitro, prevented dimerization in vitro and in vivo, associated with

  10. Fluorescence Polarization Screening Assays for Small Molecule Allosteric Modulators of ABL Kinase Function

    PubMed Central

    Grover, Prerna; Shi, Haibin; Baumgartner, Matthew; Camacho, Carlos J.; Smithgall, Thomas E.

    2015-01-01

    The ABL protein-tyrosine kinase regulates intracellular signaling pathways controlling diverse cellular processes and contributes to several forms of cancer. The kinase activity of ABL is repressed by intramolecular interactions involving its regulatory Ncap, SH3 and SH2 domains. Small molecules that allosterically regulate ABL kinase activity through its non-catalytic domains may represent selective probes of ABL function. Here we report a screening assay for chemical modulators of ABL kinase activity that target the regulatory interaction of the SH3 domain with the SH2-kinase linker. This fluorescence polarization (FP) assay is based on a purified recombinant ABL protein consisting of the N-cap, SH3 and SH2 domains plus the SH2-kinase linker (N32L protein) and a short fluorescein-labeled probe peptide that binds to the SH3 domain. In assay development experiments, we found that the probe peptide binds to the recombinant ABL N32L protein in vitro, producing a robust FP signal that can be competed with an excess of unlabeled peptide. The FP signal is not observed with control N32L proteins bearing either an inactivating mutation in the SH3 domain or enhanced SH3:linker interaction. A pilot screen of 1200 FDA-approved drugs identified four compounds that specifically reduced the FP signal by at least three standard deviations from the untreated controls. Secondary assays showed that one of these hit compounds, the antithrombotic drug dipyridamole, enhances ABL kinase activity in vitro to a greater extent than the previously described ABL agonist, DPH. Docking studies predicted that this compound binds to a pocket formed at the interface of the SH3 domain and the linker, suggesting that it activates ABL by disrupting this regulatory interaction. These results show that screening assays based on the non-catalytic domains of ABL can identify allosteric small molecule regulators of kinase function, providing a new approach to selective drug discovery for this important

  11. [Progress in sample preparation and analytical methods for trace polar small molecules in complex samples].

    PubMed

    Zhang, Qianchun; Luo, Xialin; Li, Gongke; Xiao, Xiaohua

    2015-09-01

    Small polar molecules such as nucleosides, amines, amino acids are important analytes in biological, food, environmental, and other fields. It is necessary to develop efficient sample preparation and sensitive analytical methods for rapid analysis of these polar small molecules in complex matrices. Some typical materials in sample preparation, including silica, polymer, carbon, boric acid and so on, are introduced in this paper. Meanwhile, the applications and developments of analytical methods of polar small molecules, such as reversed-phase liquid chromatography, hydrophilic interaction chromatography, etc., are also reviewed. PMID:26753274

  12. Transferable Atomic Multipole Machine Learning Models for Small Organic Molecules.

    PubMed

    Bereau, Tristan; Andrienko, Denis; von Lilienfeld, O Anatole

    2015-07-14

    Accurate representation of the molecular electrostatic potential, which is often expanded in distributed multipole moments, is crucial for an efficient evaluation of intermolecular interactions. Here we introduce a machine learning model for multipole coefficients of atom types H, C, O, N, S, F, and Cl in any molecular conformation. The model is trained on quantum-chemical results for atoms in varying chemical environments drawn from thousands of organic molecules. Multipoles in systems with neutral, cationic, and anionic molecular charge states are treated with individual models. The models' predictive accuracy and applicability are illustrated by evaluating intermolecular interaction energies of nearly 1,000 dimers and the cohesive energy of the benzene crystal. PMID:26575759

  13. Electronic Resonance Enhancement in Raman and CARS Spectroscopy: Surface Enhanced Scattering of Highly Fluorescent Molecules

    NASA Astrophysics Data System (ADS)

    Lawhead, Carlos; Ujj, Laszlo

    2015-03-01

    Surface enhanced Raman spectroscopy (SERS) is an extremely useful tool in increasing sensitivity of Raman spectroscopy; this technique significantly increases the signal from vibrational resonances which can overcome background fluoresces. Silver nanoparticles coated substrates and the silver nanoparticles in solution were used on a variety of fluorescent molecules in order to overcome sample complexities and measure the vibrational spectra. The possible enhancement of SERS using a coherent Raman (CARS) method was investigated, but enhancement factors due to Surface Enhanced CARS have yet to be verified. The instrument used was developed in the University of West Florida Physics Department utilized the second harmonic of a Nd:YAG laser to provide the excitation wavelength at 532 nm and is capable of both transmission and reflection Raman measurements. Special thanks to the UWF Office of Undergraduate Research.

  14. Developing an Efficient and General Strategy for Immobilization of Small Molecules onto Microarrays Using Isocyanate Chemistry

    PubMed Central

    Zhu, Chenggang; Zhu, Xiangdong; Landry, James P.; Cui, Zhaomeng; Li, Quanfu; Dang, Yongjun; Mi, Lan; Zheng, Fengyun; Fei, Yiyan

    2016-01-01

    Small-molecule microarray (SMM) is an effective platform for identifying lead compounds from large collections of small molecules in drug discovery, and efficient immobilization of molecular compounds is a pre-requisite for the success of such a platform. On an isocyanate functionalized surface, we studied the dependence of immobilization efficiency on chemical residues on molecular compounds, terminal residues on isocyanate functionalized surface, lengths of spacer molecules, and post-printing treatment conditions, and we identified a set of optimized conditions that enable us to immobilize small molecules with significantly improved efficiencies, particularly for those molecules with carboxylic acid residues that are known to have low isocyanate reactivity. We fabricated microarrays of 3375 bioactive compounds on isocyanate functionalized glass slides under these optimized conditions and confirmed that immobilization percentage is over 73%. PMID:26999137

  15. Developing an Efficient and General Strategy for Immobilization of Small Molecules onto Microarrays Using Isocyanate Chemistry.

    PubMed

    Zhu, Chenggang; Zhu, Xiangdong; Landry, James P; Cui, Zhaomeng; Li, Quanfu; Dang, Yongjun; Mi, Lan; Zheng, Fengyun; Fei, Yiyan

    2016-01-01

    Small-molecule microarray (SMM) is an effective platform for identifying lead compounds from large collections of small molecules in drug discovery, and efficient immobilization of molecular compounds is a pre-requisite for the success of such a platform. On an isocyanate functionalized surface, we studied the dependence of immobilization efficiency on chemical residues on molecular compounds, terminal residues on isocyanate functionalized surface, lengths of spacer molecules, and post-printing treatment conditions, and we identified a set of optimized conditions that enable us to immobilize small molecules with significantly improved efficiencies, particularly for those molecules with carboxylic acid residues that are known to have low isocyanate reactivity. We fabricated microarrays of 3375 bioactive compounds on isocyanate functionalized glass slides under these optimized conditions and confirmed that immobilization percentage is over 73%. PMID:26999137

  16. Isomerization of one molecule observed through tip enhanced Raman spectroscopy

    NASA Astrophysics Data System (ADS)

    Zhang, Yanxing; Lee, Joonhee; Apkarian, Vartkess A.; Wu, Ruqian; Ruqian Wu, Yanxing Zhang Team; Joonhee Lee, Vartkess A. Apkarian Team

    While exploring photoisomerization of azobenzyl thiols (ABT) adsorbed on Au(111), through joint scanning tunneling microscopy (STM) and tip-enhanced Raman scattering (TERS) studies, the reversible photoisomerization of one molecule is captured in TERS trajectories. The apparently heterogeneously photo-catalyzed reaction is assigned to cis-trans isomerization of an outlier, which is chemisorbed on the silver tip of the STM. In order to clarify the role of the silver tip of the STM, we perform systematic density functional theory (DFT) calculations. The results show that compared with the case on the flat Ag(111) surface, the energy difference between trans and cis states of ABT decrease as we add one silver atom or a tetrahedron silver cluster on Ag(111) surface which mimic the geometry of a silver tip. In particular, the trans stretches away from the surface on the tetrahedral silver cluster, and the energy difference between trans and cis decreases to 0.27 eV, from ~1 eV for ABT on the flat Ag(111) surface. This significantly increases the possibility of cis-trans isomerization, as observed in our experiments. Work was supported by the National Science Foundation Center for Chemical Innovation on Chemistry at the Space-Time Limit (CaSTL) under Grant No. CHE-1414466.

  17. Matrix Infrared Spectroscopic and Computational Investigations of Novel Small Uranium Containing Molecules - Final Technical Report

    SciTech Connect

    Andrews, Lester

    2014-10-17

    Direct reactions of f-element uranium, thorium and lanthanide metal atoms were investigated with small molecules. These metal atoms were generated by laser ablation and mixed with the reagent molecules then condensed with noble gases at 4K. The products were analyzed by absorption of infrared light to measure vibrational frequencies which were confirmed by quantum chemical calculations. We have learned more about the reactivity of uranium atoms with common molecules, which will aid in the develolpment of further applications of uranium.

  18. Novel apigenin based small molecule that targets snake venom metalloproteases.

    PubMed

    Srinivasa, Venkatachalaiah; Sundaram, Mahalingam S; Anusha, Sebastian; Hemshekhar, Mahadevappa; Chandra Nayaka, Siddaiah; Kemparaju, Kempaiah; Basappa; Girish, Kesturu S; Rangappa, Kanchugarakoppal S

    2014-01-01

    The classical antivenom therapy has appreciably reduced snakebite mortality rate and thus is the only savior drug available. Unfortunately, it considerably fails to shield the viper bite complications like hemorrhage, local tissue degradation and necrosis responsible for severe morbidity. Moreover, the therapy is also tagged with limitations including anaphylaxis, serum sickness and poor availability. Over the last decade, snake venom metalloproteases (SVMPs) are reported to be the primary component responsible for hemorrhage and tissue degradation at bitten site. Thus, antivenom inability to offset viper venom-induced local toxicity has been a basis for an insistent search for SVMP inhibitors. Here we report the inhibitory effect of compound 5d, an apigenin based molecule against SVMPs both in silico and in vivo. Several apigenin analogues are synthesized using multicomponent Ugi reactions. Among them, compound 5d effectively abrogated Echis carinatus (EC) venom-induced local hemorrhage, tissue necrosis and myotoxicity in a dose dependant fashion. The histopathological study further conferred effective inhibition of basement membrane degradation, and accumulation of inflammatory leucocytes at the site of EC venom inoculation. The compound also protected EC venom-induced fibrin and fibrinogen degradation. The molecular docking of compound 5d and bothropasin demonstrated the direct interaction of hydroxyl group of compound with Glu146 present in hydrophobic pocket of active site and does not chelate Zn2+. Hence, it is concluded that compound 5d could be a potent agent in viper bite management. PMID:25184206

  19. A small-molecule dye for NIR-II imaging

    NASA Astrophysics Data System (ADS)

    Antaris, Alexander L.; Chen, Hao; Cheng, Kai; Sun, Yao; Hong, Guosong; Qu, Chunrong; Diao, Shuo; Deng, Zixin; Hu, Xianming; Zhang, Bo; Zhang, Xiaodong; Yaghi, Omar K.; Alamparambil, Zita R.; Hong, Xuechuan; Cheng, Zhen; Dai, Hongjie

    2016-02-01

    Fluorescent imaging of biological systems in the second near-infrared window (NIR-II) can probe tissue at centimetre depths and achieve micrometre-scale resolution at depths of millimetres. Unfortunately, all current NIR-II fluorophores are excreted slowly and are largely retained within the reticuloendothelial system, making clinical translation nearly impossible. Here, we report a rapidly excreted NIR-II fluorophore (~90% excreted through the kidneys within 24 h) based on a synthetic 970-Da organic molecule (CH1055). The fluorophore outperformed indocyanine green (ICG)--a clinically approved NIR-I dye--in resolving mouse lymphatic vasculature and sentinel lymphatic mapping near a tumour. High levels of uptake of PEGylated-CH1055 dye were observed in brain tumours in mice, suggesting that the dye was detected at a depth of ~4 mm. The CH1055 dye also allowed targeted molecular imaging of tumours in vivo when conjugated with anti-EGFR Affibody. Moreover, a superior tumour-to-background signal ratio allowed precise image-guided tumour-removal surgery.

  20. A small-molecule dye for NIR-II imaging.

    PubMed

    Antaris, Alexander L; Chen, Hao; Cheng, Kai; Sun, Yao; Hong, Guosong; Qu, Chunrong; Diao, Shuo; Deng, Zixin; Hu, Xianming; Zhang, Bo; Zhang, Xiaodong; Yaghi, Omar K; Alamparambil, Zita R; Hong, Xuechuan; Cheng, Zhen; Dai, Hongjie

    2016-02-01

    Fluorescent imaging of biological systems in the second near-infrared window (NIR-II) can probe tissue at centimetre depths and achieve micrometre-scale resolution at depths of millimetres. Unfortunately, all current NIR-II fluorophores are excreted slowly and are largely retained within the reticuloendothelial system, making clinical translation nearly impossible. Here, we report a rapidly excreted NIR-II fluorophore (∼90% excreted through the kidneys within 24 h) based on a synthetic 970-Da organic molecule (CH1055). The fluorophore outperformed indocyanine green (ICG)-a clinically approved NIR-I dye-in resolving mouse lymphatic vasculature and sentinel lymphatic mapping near a tumour. High levels of uptake of PEGylated-CH1055 dye were observed in brain tumours in mice, suggesting that the dye was detected at a depth of ∼4 mm. The CH1055 dye also allowed targeted molecular imaging of tumours in vivo when conjugated with anti-EGFR Affibody. Moreover, a superior tumour-to-background signal ratio allowed precise image-guided tumour-removal surgery. PMID:26595119

  1. Novel Apigenin Based Small Molecule that Targets Snake Venom Metalloproteases

    PubMed Central

    Anusha, Sebastian; Hemshekhar, Mahadevappa; Chandra Nayaka, Siddaiah; Kemparaju, Kempaiah; Basappa; Girish, Kesturu S.; Rangappa, Kanchugarakoppal S.

    2014-01-01

    The classical antivenom therapy has appreciably reduced snakebite mortality rate and thus is the only savior drug available. Unfortunately, it considerably fails to shield the viper bite complications like hemorrhage, local tissue degradation and necrosis responsible for severe morbidity. Moreover, the therapy is also tagged with limitations including anaphylaxis, serum sickness and poor availability. Over the last decade, snake venom metalloproteases (SVMPs) are reported to be the primary component responsible for hemorrhage and tissue degradation at bitten site. Thus, antivenom inability to offset viper venom-induced local toxicity has been a basis for an insistent search for SVMP inhibitors. Here we report the inhibitory effect of compound 5d, an apigenin based molecule against SVMPs both in silico and in vivo. Several apigenin analogues are synthesized using multicomponent Ugi reactions. Among them, compound 5d effectively abrogated Echis carinatus (EC) venom-induced local hemorrhage, tissue necrosis and myotoxicity in a dose dependant fashion. The histopathological study further conferred effective inhibition of basement membrane degradation, and accumulation of inflammatory leucocytes at the site of EC venom inoculation. The compound also protected EC venom-induced fibrin and fibrinogen degradation. The molecular docking of compound 5d and bothropasin demonstrated the direct interaction of hydroxyl group of compound with Glu146 present in hydrophobic pocket of active site and does not chelate Zn2+. Hence, it is concluded that compound 5d could be a potent agent in viper bite management. PMID:25184206

  2. Wnt/beta-Catenin Signaling and Small Molecule Inhibitors

    PubMed Central

    Voronkov, Andrey; Krauss, Stefan

    2012-01-01

    Wnt/β-catenin signaling is a branch of a functional network that dates back to the first metazoans and it is involved in a broad range of biological systems including stem cells, embryonic development and adult organs. Deregulation of components involved in Wnt/β-catenin signaling has been implicated in a wide spectrum of diseases including a number of cancers and degenerative diseases. The key mediator of Wnt signaling, β-catenin, serves several cellular functions. It functions in a dynamic mode at multiple cellular locations, including the plasma membrane, where β-catenin contributes to the stabilization of intercellular adhesive complexes, the cytoplasm where β-catenin levels are regulated and the nucleus where β-catenin is involved in transcriptional regulation and chromatin interactions. Central effectors of β-catenin levels are a family of cysteine-rich secreted glycoproteins, known as Wnt morphogens. Through the LRP5/6-Frizzled receptor complex, Wnts regulate the location and activity of the destruction complex and consequently intracellular β- catenin levels. However, β-catenin levels and their effects on transcriptional programs are also influenced by multiple other factors including hypoxia, inflammation, hepatocyte growth factor-mediated signaling, and the cell adhesion molecule E-cadherin. The broad implications of Wnt/β-catenin signaling in development, in the adult body and in disease render the pathway a prime target for pharmacological research and development. The intricate regulation of β-catenin at its various locations provides alternative points for therapeutic interventions. PMID:23016862

  3. β-phenylethylamine, a small molecule with a large impact

    PubMed Central

    Irsfeld, Meredith; Spadafore, Matthew; Prüß, Birgit M.

    2013-01-01

    During a screen of bacterial nutrients as inhibitors of Escherichia coli O157:H7 biofilm, the Prüß research team made an intriguing observation: among 95 carbon and 95 nitrogen sources tested, β-phenylethylamine (PEA) performed best at reducing bacterial cell counts and biofilm amounts, when supplemented to liquid beef broth medium. This review article summarizes what is known about PEA. After some starting information on the chemistry of the molecule, we focus on PEA as a neurotransmitter and then move on to its role in food processing. PEA is a trace amine whose molecular mechanism of action differs from biogenic amines, such as serotonin or dopamine. Especially low or high concentrations of PEA may be associated with specific psychological disorders. For those disorders that are characterized by low PEA levels (e.g. attention deficit hyperactivity disorder), PEA has been suggested as a ‘safe’ alternative to drugs, such as amphetamine or methylphenidate, which are accompanied by many undesirable side effects. On the food processing end, PEA can be detected in food either as a result of microbial metabolism or thermal processing. PEA's presence in food can be used as an indicator of bacterial contamination. PMID:24482732

  4. Ethylene and Metal Stress: Small Molecule, Big Impact.

    PubMed

    Keunen, Els; Schellingen, Kerim; Vangronsveld, Jaco; Cuypers, Ann

    2016-01-01

    The phytohormone ethylene is known to mediate a diverse array of signaling processes during abiotic stress in plants. Whereas many reports have demonstrated enhanced ethylene production in metal-exposed plants, the underlying molecular mechanisms are only recently investigated. Increasing evidence supports a role for ethylene in the regulation of plant metal stress responses. Moreover, crosstalk appears to exist between ethylene and the cellular redox balance, nutrients and other phytohormones. This review highlights our current understanding of the key role ethylene plays during responses to metal exposure. Moreover, particular attention is paid to the integration of ethylene within the broad network of plant responses to metal stress. PMID:26870052

  5. Ethylene and Metal Stress: Small Molecule, Big Impact

    PubMed Central

    Keunen, Els; Schellingen, Kerim; Vangronsveld, Jaco; Cuypers, Ann

    2016-01-01

    The phytohormone ethylene is known to mediate a diverse array of signaling processes during abiotic stress in plants. Whereas many reports have demonstrated enhanced ethylene production in metal-exposed plants, the underlying molecular mechanisms are only recently investigated. Increasing evidence supports a role for ethylene in the regulation of plant metal stress responses. Moreover, crosstalk appears to exist between ethylene and the cellular redox balance, nutrients and other phytohormones. This review highlights our current understanding of the key role ethylene plays during responses to metal exposure. Moreover, particular attention is paid to the integration of ethylene within the broad network of plant responses to metal stress. PMID:26870052

  6. Canonical transient receptor potential 4 and its small molecule modulators

    PubMed Central

    FU, Jie; GAO, ZhaoBing; SHEN, Bing; ZHU, Michael X.

    2015-01-01

    Canonical transient receptor potential 4 (TRPC4) forms non-selective cation channels that contribute to phospholipase C-dependent Ca2+ entry into cells following stimulation of G protein coupled receptors and receptor tyrosine kinases. More-over, the channels are regulated by pertussis toxin-sensitive Gi/o proteins, lipids, and various other signaling mechanisms. TRPC4-containing channels participate in the regulation of a variety of physiological functions, including excitability of both gastrointestinal smooth muscles and brain neurons. This review is to present recent advances in the understanding of physiology and development of small molecular modulators of TRPC4 channels. PMID:25480324

  7. Carbohydrate Recognition by Boronolectins, Small Molecules, and Lectins

    PubMed Central

    Jin, Shan; Cheng, Yunfeng; Reid, Suazette; Li, Minyong; Wang, Binghe

    2009-01-01

    Carbohydrates are known to mediate a large number of biological and pathological events. Small and macromolecules capable of carbohydrate recognition have great potentials as research tools, diagnostics, vectors for targeted delivery of therapeutic and imaging agents, and therapeutic agents. However, this potential is far from being realized. One key issue is the difficulty in the development of “binders” capable of specific recognition of carbohydrates of biological relevance. This review discusses systematically the general approaches that are available in developing carbohydrate sensors and “binders/receptors,” and their applications. The focus is on discoveries during the last five years. PMID:19291708

  8. BCL::Conf: small molecule conformational sampling using a knowledge based rotamer library.

    PubMed

    Kothiwale, Sandeepkumar; Mendenhall, Jeffrey L; Meiler, Jens

    2015-01-01

    The interaction of a small molecule with a protein target depends on its ability to adopt a three-dimensional structure that is complementary. Therefore, complete and rapid prediction of the conformational space a small molecule can sample is critical for both structure- and ligand-based drug discovery algorithms such as small molecule docking or three-dimensional quantitative structure-activity relationships. Here we have derived a database of small molecule fragments frequently sampled in experimental structures within the Cambridge Structure Database and the Protein Data Bank. Likely conformations of these fragments are stored as 'rotamers' in analogy to amino acid side chain rotamer libraries used for rapid sampling of protein conformational space. Explicit fragments take into account correlations between multiple torsion bonds and effect of substituents on torsional profiles. A conformational ensemble for small molecules can then be generated by recombining fragment rotamers with a Monte Carlo search strategy. BCL::Conf was benchmarked against other conformer generator methods including Confgen, Moe, Omega and RDKit in its ability to recover experimentally determined protein bound conformations of small molecules, diversity of conformational ensembles, and sampling rate. BCL::Conf recovers at least one conformation with a root mean square deviation of 2 Å or better to the experimental structure for 99 % of the small molecules in the Vernalis benchmark dataset. The 'rotamer' approach will allow integration of BCL::Conf into respective computational biology programs such as Rosetta.Graphical abstract:Conformation sampling is carried out using explicit fragment conformations derived from crystallographic structure databases. Molecules from the database are decomposed into fragments and most likely conformations/rotamers are used to sample correspondng sub-structure of a molecule of interest. PMID:26473018

  9. De Novo-Designed Enzymes as Small-Molecule-Regulated Fluorescence Imaging Tags and Fluorescent Reporters

    PubMed Central

    2015-01-01

    Enzyme-based tags attached to a protein-of-interest (POI) that react with a small molecule, rendering the conjugate fluorescent, are very useful for studying the POI in living cells. These tags are typically based on endogenous enzymes, so protein engineering is required to ensure that the small-molecule probe does not react with the endogenous enzyme in the cell of interest. Here we demonstrate that de novo-designed enzymes can be used as tags to attach to POIs. The inherent bioorthogonality of the de novo-designed enzyme–small-molecule probe reaction circumvents the need for protein engineering, since these enzyme activities are not present in living organisms. Herein, we transform a family of de novo-designed retroaldolases into variable-molecular-weight tags exhibiting fluorescence imaging, reporter, and electrophoresis applications that are regulated by tailored, reactive small-molecule fluorophores. PMID:25209927

  10. Methods to enable the design of bioactive small molecules targeting RNA

    PubMed Central

    Disney, Matthew D.; Yildirim, Ilyas; Childs-Disney, Jessica L.

    2014-01-01

    RNA is an immensely important target for small molecule therapeutics or chemical probes of function. However, methods that identify, annotate, and optimize RNA-small molecule interactions that could enable the design of compounds that modulate RNA function are in their infancies. This review describes recent approaches that have been developed to understand and optimize RNA motif-small molecule interactions, including Structure-Activity Relationships Through Sequencing (StARTS), quantitative structure-activity relationships (QSAR), chemical similarity searching, structure-based design and docking, and molecular dynamics (MD) simulations. Case studies described include the design of small molecules targeting RNA expansions, the bacterial A-site, viral RNAs, and telomerase RNA. These approaches can be combined to afford a synergistic method to exploit the myriad of RNA targets in the transcriptome. PMID:24357181

  11. Methods to enable the design of bioactive small molecules targeting RNA.

    PubMed

    Disney, Matthew D; Yildirim, Ilyas; Childs-Disney, Jessica L

    2014-02-21

    RNA is an immensely important target for small molecule therapeutics or chemical probes of function. However, methods that identify, annotate, and optimize RNA-small molecule interactions that could enable the design of compounds that modulate RNA function are in their infancies. This review describes recent approaches that have been developed to understand and optimize RNA motif-small molecule interactions, including structure-activity relationships through sequencing (StARTS), quantitative structure-activity relationships (QSAR), chemical similarity searching, structure-based design and docking, and molecular dynamics (MD) simulations. Case studies described include the design of small molecules targeting RNA expansions, the bacterial A-site, viral RNAs, and telomerase RNA. These approaches can be combined to afford a synergistic method to exploit the myriad of RNA targets in the transcriptome. PMID:24357181

  12. Sensors and Biosensors for the Determination of Small Molecule Biological Toxins

    PubMed Central

    Wang, Xiang-Hong; Wang, Shuo

    2008-01-01

    The following review of sensors and biosensors focuses on the determination of commonly studied small molecule biological toxins, including mycotoxins and small molecule neurotoxins. Because of the high toxicity of small molecule toxins, an effective analysis technique for determining their toxicity is indispensable. Sensors and biosensors have emerged as sensitive and rapid techniques for toxicity analysis in the past decade. Several different sensors for the determination of mycotoxins and other small molecule neurotoxins have been reported in the literature, and many of these sensors such as tissue biosensors, enzyme sensors, optical immunosensors, electrochemical sensors, quartz crystal sensors, and surface plasmon resonance biosensors are reviewed in this paper. Sensors are a practical and convenient monitoring tool in the area of routine analysis, and their specificity, sensitivity, reproducibility and analysis stability should all be improved in future work. In addition, accuracy field portable sensing devices and multiplexing analysis devices will be important requirement for the future.

  13. Laser desorption/ionization mass spectrometry for direct profiling and imaging of small molecules from raw biological materials

    SciTech Connect

    Cha, Sangwon

    2008-01-01

    Matrix-assisted laser desorption/ionization(MALDI) mass spectrometry(MS) has been widely used for analysis of biological molecules, especially macromolecules such as proteins. However, MALDI MS has a problem in small molecule (less than 1 kDa) analysis because of the signal saturation by organic matrixes in the low mass region. In imaging MS (IMS), inhomogeneous surface formation due to the co-crystallization process by organic MALDI matrixes limits the spatial resolution of the mass spectral image. Therefore, to make laser desorption/ionization (LDI) MS more suitable for mass spectral profiling and imaging of small molecules directly from raw biological tissues, LDI MS protocols with various alternative assisting materials were developed and applied to many biological systems of interest. Colloidal graphite was used as a matrix for IMS of small molecules for the first time and methodologies for analyses of small metabolites in rat brain tissues, fruits, and plant tissues were developed. With rat brain tissues, the signal enhancement for cerebroside species by colloidal graphite was observed and images of cerebrosides were successfully generated by IMS. In addition, separation of isobaric lipid ions was performed by imaging tandem MS. Directly from Arabidopsis flowers, flavonoids were successfully profiled and heterogeneous distribution of flavonoids in petals was observed for the first time by graphite-assisted LDI(GALDI) IMS.

  14. Molecular entrapment of small molecules within the interior of horse spleen ferritin.

    PubMed

    Webb, B; Frame, J; Zhao, Z; Lee, M L; Watt, G D

    1994-02-15

    A procedure for trapping small molecules inside the interior of horse spleen ferritin (HoSF) and methods for characterizing HoSF and its small entrapped molecules are described. HoSF is first dissociated into subunits by adjustment to pH 2 in the presence of the small molecules to be trapped. The pH of the dissociated HoSF is then increased to 7 at which time the dissociated subunits reassemble reforming the 24-mer HoSF, thereby trapping solvent within its interior. HoSF is then separated from unbound molecules by dialysis, ultrafiltration, and/or ammonium sulfate precipitation. Sephadex G-25 and DEAE chromatographic methods were also used to separate HoSF from unbound small molecules. Capillary electrophoresis (CE) was used to demonstrate the association of small molecules with HoSF after the pH-induced unfolding-refolding process. The pH indicator neutral red was clearly associated with HoSF and presumed trapped within the ferritin interior. Acid/base titrations suggested that the trapped indicator had a different pKa than the free indicator, a result which indicates that the ferritin interior is different than the external solution. The utility of using trapped molecules for gaining information on ferritin function is proposed and discussed. PMID:8117106

  15. Optically switchable transistors by simple incorporation of photochromic systems into small-molecule semiconducting matrices

    NASA Astrophysics Data System (ADS)

    Gemayel, Mirella El; Börjesson, Karl; Herder, Martin; Duong, Duc T.; Hutchison, James A.; Ruzié, Christian; Schweicher, Guillaume; Salleo, Alberto; Geerts, Yves; Hecht, Stefan; Orgiu, Emanuele; Samorì, Paolo

    2015-03-01

    The fabrication of multifunctional high-performance organic thin-film transistors as key elements in future logic circuits is a major research challenge. Here we demonstrate that a photoresponsive bi-functional field-effect transistor with carrier mobilities exceeding 0.2 cm2 V-1 s-1 can be developed by incorporating photochromic molecules into an organic semiconductor matrix via a single-step solution processing deposition of a two components blend. Tuning the interactions between the photochromic diarylethene system and the organic semiconductor is achieved via ad-hoc side functionalization of the diarylethene. Thereby, a large-scale phase-segregation can be avoided and superior miscibility is provided, while retaining optimal π-π stacking to warrant efficient charge transport and to attenuate the effect of photoinduced switching on the extent of current modulation. This leads to enhanced electrical performance of transistors incorporating small conjugated molecules as compared with polymeric semiconductors. These findings are of interest for the development of high-performing optically gated electronic devices.

  16. Tuning dissociation using isoelectronically doped graphene and hexagonal boron nitride: Water and other small molecules

    NASA Astrophysics Data System (ADS)

    Al-Hamdani, Yasmine S.; Alfè, Dario; von Lilienfeld, O. Anatole; Michaelides, Angelos

    2016-04-01

    Novel uses for 2-dimensional materials like graphene and hexagonal boron nitride (h-BN) are being frequently discovered especially for membrane and catalysis applications. Still however, a great deal remains to be understood about the interaction of environmentally and industrially relevant molecules such as water with these materials. Taking inspiration from advances in hybridising graphene and h-BN, we explore using density functional theory, the dissociation of water, hydrogen, methane, and methanol on graphene, h-BN, and their isoelectronic doped counterparts: BN doped graphene and C doped h-BN. We find that doped surfaces are considerably more reactive than their pristine counterparts and by comparing the reactivity of several small molecules, we develop a general framework for dissociative adsorption. From this a particularly attractive consequence of isoelectronic doping emerges: substrates can be doped to enhance their reactivity specifically towards either polar or non-polar adsorbates. As such, these substrates are potentially viable candidates for selective catalysts and membranes, with the implication that a range of tuneable materials can be designed.

  17. Tuning dissociation using isoelectronically doped graphene and hexagonal boron nitride: Water and other small molecules.

    PubMed

    Al-Hamdani, Yasmine S; Alfè, Dario; von Lilienfeld, O Anatole; Michaelides, Angelos

    2016-04-21

    Novel uses for 2-dimensional materials like graphene and hexagonal boron nitride (h-BN) are being frequently discovered especially for membrane and catalysis applications. Still however, a great deal remains to be understood about the interaction of environmentally and industrially relevant molecules such as water with these materials. Taking inspiration from advances in hybridising graphene and h-BN, we explore using density functional theory, the dissociation of water, hydrogen, methane, and methanol on graphene, h-BN, and their isoelectronic doped counterparts: BN dopedgraphene and C doped h-BN. We find that dopedsurfaces are considerably more reactive than their pristine counterparts and by comparing the reactivity of several small molecules, we develop a general framework for dissociative adsorption. From this a particularly attractive consequence of isoelectronic doping emerges: substrates can be doped to enhance their reactivity specifically towards either polar or non-polar adsorbates. As such, these substrates are potentially viable candidates for selective catalysts and membranes, with the implication that a range of tuneable materials can be designed. PMID:27389233

  18. Optically switchable transistors by simple incorporation of photochromic systems into small-molecule semiconducting matrices.

    PubMed

    Gemayel, Mirella El; Börjesson, Karl; Herder, Martin; Duong, Duc T; Hutchison, James A; Ruzié, Christian; Schweicher, Guillaume; Salleo, Alberto; Geerts, Yves; Hecht, Stefan; Orgiu, Emanuele; Samorì, Paolo

    2015-01-01

    The fabrication of multifunctional high-performance organic thin-film transistors as key elements in future logic circuits is a major research challenge. Here we demonstrate that a photoresponsive bi-functional field-effect transistor with carrier mobilities exceeding 0.2 cm(2) V(-1) s(-1) can be developed by incorporating photochromic molecules into an organic semiconductor matrix via a single-step solution processing deposition of a two components blend. Tuning the interactions between the photochromic diarylethene system and the organic semiconductor is achieved via ad-hoc side functionalization of the diarylethene. Thereby, a large-scale phase-segregation can be avoided and superior miscibility is provided, while retaining optimal π-π stacking to warrant efficient charge transport and to attenuate the effect of photoinduced switching on the extent of current modulation. This leads to enhanced electrical performance of transistors incorporating small conjugated molecules as compared with polymeric semiconductors. These findings are of interest for the development of high-performing optically gated electronic devices. PMID:25739864

  19. All-Electron Scalar Relativistic Calculations on the Adsorption of Small Gold Clusters Toward Methanol Molecule.

    PubMed

    Kuang, Xiang-Jun; Wang, Xin-Qiang; Liu, Gao-Bin

    2015-02-01

    Under the framework of DFT, an all-electron scalar relativistic calculation on the adsorption of Aun (n = 1-13) clusters toward methanol molecule has been performed with the generalized gradient approximation at PW91 level. Our calculation results reveal that the small gold cluster would like to bond with oxygen of methanol molecule at the edge of gold cluster plane. After adsorption, the chemical activities of hydroxyl group and methyl group are enhanced to some extent. The even-numbered AunCH3OH cluster with closed-shell electronic configuration is relatively more stable than the neighboring odd-numbered AunCH3OH cluster with open-shell electronic configuration. All the AunCH3OH clusters prefer low spin multiplicity (M = 1 for even-numbered AuNCH3OH clusters, M = 2 for odd-numbered AunCH3OH clusters) and the magnetic moments are mainly contributed by gold atoms. The odd-even alterations of magnetic moments and electronic configurations can be observed clearly and may be simply understood in terms of the electron pairing effect. PMID:26353643

  20. Probing model interstellar grain surfaces with small molecules

    NASA Astrophysics Data System (ADS)

    Collings, M. P.; Frankland, V. L.; Lasne, J.; Marchione, D.; Rosu-Finsen, A.; McCoustra, M. R. S.

    2015-05-01

    Temperature-programmed desorption and reflection-absorption infrared spectroscopy have been used to explore the interaction of oxygen (O2), nitrogen (N2), carbon monoxide (CO) and water (H2O) with an amorphous silica film as a demonstration of the detailed characterization of the silicate surfaces that might be present in the interstellar medium. The simple diatomic adsorbates are found to wet the silica surface and exhibit first-order desorption kinetics in the regime up to monolayer coverage. Beyond that, they exhibit zero-order kinetics as might be expected for sublimation of bulk solids. Water, in contrast, does not wet the silica surface and exhibits zero-order desorption kinetics at all coverages consistent with the formation of an islanded structure. Kinetic parameters for use in astrophysical modelling were obtained by inversion of the experimental data at sub-monolayer coverages and by comparison with models in the multilayer regime. Spectroscopic studies in the sub-monolayer regime show that the C-O stretching mode is at around 2137 cm-1 (5.43 μm), a position consistent with a linear surface-CO interaction, and is inhomogenously broadened as resulting from the heterogeneity of the surface. These studies also reveal, for the first time, direct evidence for the thermal activation of diffusion, and hence de-wetting, of H2O on the silica surface. Astrophysical implications of these findings could account for a part of the missing oxygen budget in dense interstellar clouds, and suggest that studies of the sub-monolayer adsorption of these simple molecules might be a useful probe of surface chemistry on more complex silicate materials.

  1. High-resolution mass spectrometry of small molecules bound to membrane proteins.

    PubMed

    Gault, Joseph; Donlan, Joseph A C; Liko, Idlir; Hopper, Jonathan T S; Gupta, Kallol; Housden, Nicholas G; Struwe, Weston B; Marty, Michael T; Mize, Todd; Bechara, Cherine; Zhu, Ya; Wu, Beili; Kleanthous, Colin; Belov, Mikhail; Damoc, Eugen; Makarov, Alexander; Robinson, Carol V

    2016-04-01

    Small molecules are known to stabilize membrane proteins and to modulate their function and oligomeric state, but such interactions are often hard to precisely define. Here we develop and apply a high-resolution, Orbitrap mass spectrometry-based method for analyzing intact membrane protein-ligand complexes. Using this platform, we resolve the complexity of multiple binding events, quantify small molecule binding and reveal selectivity for endogenous lipids that differ only in acyl chain length. PMID:26901650

  2. Prdm4 induction by the small molecule butein promotes white adipose tissue browning.

    PubMed

    Song, No-Joon; Choi, Seri; Rajbhandari, Prashant; Chang, Seo-Hyuk; Kim, Suji; Vergnes, Laurent; Kwon, So-Mi; Yoon, Jung-Hoon; Lee, Sukchan; Ku, Jin-Mo; Lee, Jeong-Soo; Reue, Karen; Koo, Seung-Hoi; Tontonoz, Peter; Park, Kye Won

    2016-07-01

    Increasing the thermogenic activity of adipocytes holds promise as an approach to combating human obesity and related metabolic diseases. We identified induction of mouse PR domain containing 4 (Prdm4) by the small molecule butein as a means to induce expression of uncoupling protein 1 (Ucp1), increase energy expenditure, and stimulate the generation of thermogenic adipocytes. This study highlights a Prdm4-dependent pathway, modulated by small molecules, that stimulates browning of white adipose tissue. PMID:27159578

  3. Conversion of human fibroblasts into functional cardiomyocytes by small molecules.

    PubMed

    Cao, Nan; Huang, Yu; Zheng, Jiashun; Spencer, C Ian; Zhang, Yu; Fu, Ji-Dong; Nie, Baoming; Xie, Min; Zhang, Mingliang; Wang, Haixia; Ma, Tianhua; Xu, Tao; Shi, Guilai; Srivastava, Deepak; Ding, Sheng

    2016-06-01

    Reprogramming somatic fibroblasts into alternative lineages would provide a promising source of cells for regenerative therapy. However, transdifferentiating human cells into specific homogeneous, functional cell types is challenging. Here we show that cardiomyocyte-like cells can be generated by treating human fibroblasts with a combination of nine compounds that we term 9C. The chemically induced cardiomyocyte-like cells uniformly contracted and resembled human cardiomyocytes in their transcriptome, epigenetic, and electrophysiological properties. 9C treatment of human fibroblasts resulted in a more open-chromatin conformation at key heart developmental genes, enabling their promoters and enhancers to bind effectors of major cardiogenic signals. When transplanted into infarcted mouse hearts, 9C-treated fibroblasts were efficiently converted to chemically induced cardiomyocyte-like cells. This pharmacological approach to lineage-specific reprogramming may have many important therapeutic implications after further optimization to generate mature cardiac cells. PMID:27127239

  4. Small Molecule Radiopharmaceuticals – A Review of Current Approaches

    PubMed Central

    Chaturvedi, Shubhra; Mishra, Anil K.

    2016-01-01

    Radiopharmaceuticals are an integral component of nuclear medicine and are widely applied in diagnostics and therapy. Though widely applied, the development of an “ideal” radiopharmaceutical can be challenging. Issues such as specificity, selectivity, sensitivity, and feasible chemistry challenge the design and synthesis of radiopharmaceuticals. Over time, strategies to address the issues have evolved by making use of new technological advances in the fields of biology and chemistry. This review presents the application of few advances in design and synthesis of radiopharmaceuticals. The topics covered are bivalent ligand approach and lipidization as part of design modifications for enhanced selectivity and sensitivity and novel synthetic strategies for optimized chemistry and radiolabeling of radiopharmaceuticals. PMID:26942181

  5. Elasticity Dominated Surface Segregation of Small Molecules in Polymer Mixtures

    NASA Astrophysics Data System (ADS)

    Krawczyk, Jarosław; Croce, Salvatore; McLeish, T. C. B.; Chakrabarti, Buddhapriya

    2016-05-01

    We study the phenomenon of migration of the small molecular weight component of a binary polymer mixture to the free surface using mean field and self-consistent field theories. By proposing a free energy functional that incorporates polymer-matrix elasticity explicitly, we compute the migrant volume fraction and show that it decreases significantly as the sample rigidity is increased. A wetting transition, observed for high values of the miscibility parameter can be prevented by increasing the matrix rigidity. Estimated values of the bulk modulus suggest that the effect should be observable experimentally for rubberlike materials. This provides a simple way of controlling surface migration in polymer mixtures and can play an important role in industrial formulations, where surface migration often leads to decreased product functionality.

  6. ChemBank: a small-molecule screening and cheminformatics resource database

    PubMed Central

    Seiler, Kathleen Petri; George, Gregory A.; Happ, Mary Pat; Bodycombe, Nicole E.; Carrinski, Hyman A.; Norton, Stephanie; Brudz, Steve; Sullivan, John P.; Muhlich, Jeremy; Serrano, Martin; Ferraiolo, Paul; Tolliday, Nicola J.; Schreiber, Stuart L.; Clemons, Paul A.

    2008-01-01

    ChemBank (http://chembank.broad.harvard.edu/) is a public, web-based informatics environment developed through a collaboration between the Chemical Biology Program and Platform at the Broad Institute of Harvard and MIT. This knowledge environment includes freely available data derived from small molecules and small-molecule screens and resources for studying these data. ChemBank is unique among small-molecule databases in its dedication to the storage of raw screening data, its rigorous definition of screening experiments in terms of statistical hypothesis testing, and its metadata-based organization of screening experiments into projects involving collections of related assays. ChemBank stores an increasingly varied set of measurements derived from cells and other biological assay systems treated with small molecules. Analysis tools are available and are continuously being developed that allow the relationships between small molecules, cell measurements, and cell states to be studied. Currently, ChemBank stores information on hundreds of thousands of small molecules and hundreds of biomedically relevant assays that have been performed at the Broad Institute by collaborators from the worldwide research community. The goal of ChemBank is to provide life scientists unfettered access to biomedically relevant data and tools heretofore available primarily in the private sector. PMID:17947324

  7. Small molecules as tracers in atmospheric secondary organic aerosol

    NASA Astrophysics Data System (ADS)

    Yu, Ge

    Secondary organic aerosol (SOA), formed from in-air oxidation of volatile organic compounds, greatly affects human health and climate. Although substantial research has been devoted to SOA formation and evolution, the modeled and lab-generated SOA are still low in mass and degree of oxidation compared to ambient measurements. In order to compensate for these discrepancies, the aqueous processing pathway has been brought to attention. The atmospheric waters serve as aqueous reaction media for dissolved organics to undergo further oxidation, oligomerization, or other functionalization reactions, which decreases the vapor pressure while increasing the oxidation state of carbon atoms. Field evidence for aqueous processing requires the identification of tracer products such as organosulfates. We synthesized the standards for two organosulfates, glycolic acid sulfate and lactic acid sulfate, in order to measure their aerosol-state concentration from five distinct locations via filter samples. The water-extracted filter samples were analyzed by LC-MS. Lactic acid sulfate and glycolic acid sulfate were detected in urban locations in the United States, Mexico City, and Pakistan with varied concentrations, indicating their potential as tracers. We studied the aqueous processing reaction between glyoxal and nitrogen-containing species such as ammonium and amines exclusively by NMR spectrometry. The reaction products formic acid and several imidazoles along with the quantified kinetics were reported. The brown carbon generated from these reactions were quantified optically by UV-Vis spectroscopy. The organic-phase reaction between oxygen molecule and alkenes photosensitized by alpha-dicarbonyls were studied in the same manner. We observed the fast kinetics transferring alkenes to epoxides under simulated sunlight. Statistical estimations indicate a very effective conversion of aerosol-phase alkenes to epoxides, potentially forming organosulfates in a deliquescence event and

  8. Mass amplifying probe for sensitive fluorescence anisotropy detection of small molecules in complex biological samples.

    PubMed

    Cui, Liang; Zou, Yuan; Lin, Ninghang; Zhu, Zhi; Jenkins, Gareth; Yang, Chaoyong James

    2012-07-01

    Fluorescence anisotropy (FA) is a reliable and excellent choice for fluorescence sensing. One of the key factors influencing the FA value for any molecule is the molar mass of the molecule being measured. As a result, the FA method with functional nucleic acid aptamers has been limited to macromolecules such as proteins and is generally not applicable for the analysis of small molecules because their molecular masses are relatively too small to produce observable FA value changes. We report here a molecular mass amplifying strategy to construct anisotropy aptamer probes for small molecules. The probe is designed in such a way that only when a target molecule binds to the probe does it activate its binding ability to an anisotropy amplifier (a high molecular mass molecule such as protein), thus significantly increasing the molecular mass and FA value of the probe/target complex. Specifically, a mass amplifying probe (MAP) consists of a targeting aptamer domain against a target molecule and molecular mass amplifying aptamer domain for the amplifier protein. The probe is initially rendered inactive by a small blocking strand partially complementary to both target aptamer and amplifier protein aptamer so that the mass amplifying aptamer domain would not bind to the amplifier protein unless the probe has been activated by the target. In this way, we prepared two probes that constitute a target (ATP and cocaine respectively) aptamer, a thrombin (as the mass amplifier) aptamer, and a fluorophore. Both probes worked well against their corresponding small molecule targets, and the detection limits for ATP and cocaine were 0.5 μM and 0.8 μM, respectively. More importantly, because FA is less affected by environmental interferences, ATP in cell media and cocaine in urine were directly detected without any tedious sample pretreatment. Our results established that our molecular mass amplifying strategy can be used to design aptamer probes for rapid, sensitive, and selective

  9. Nonclinical Evaluations of Small-Molecule Oncology Drugs: Integration into Clinical Dose Optimization and Toxicity Management.

    PubMed

    Dambach, Donna M; Simpson, Natalie E; Jones, Thomas W; Brennan, Richard J; Pazdur, Richard; Palmby, Todd R

    2016-06-01

    Multidisciplinary approaches that incorporate nonclinical pharmacologic and toxicologic characterization of small-molecule oncology drugs into clinical development programs may facilitate improved benefit-risk profiles and clinical toxicity management in patients. The performance of the current nonclinical safety-testing scheme was discussed, highlighting current strengths and areas for improvement. While current nonclinical testing appears to predict the clinical outcome where the prevalence of specific adverse effects are high, nonclinical testing becomes less reliable for predicting clinical adverse effects that occur infrequently, as with some kinase inhibitors. Although adverse effects associated with kinase inhibitors can often be predicted on the basis of target biology, drugs can be promiscuous and inhibit targets with poorly defined function and associated risks. Improvements in adverse effect databases and better characterization of the biologic activities of drug targets may enable better use of computational modeling approaches in predicting adverse effects with kinase inhibitors. Assessing safety of a lead candidate in parallel with other drug properties enables incorporation of a molecule's best features during chemical design, eliminates the worst molecules early, and permits timely investigation/characterization of toxicity mechanisms for identified liabilities. A safety lead optimization and candidate identification strategy that reduces intrinsic toxicity and metabolic risk and enhances selectivity can deliver selective kinase inhibitors that demonstrate on-target adverse effects identified nonclinically. Integrating clinical and nonclinical data during drug development can facilitate better identification and management of oncology drugs. Follow-up nonclinical studies may be used to better understand the risks in a given patient population and minimize or manage these risks more appropriately. Clin Cancer Res; 22(11); 2618-22. ©2016 AACR SEE ALL

  10. Novel small molecules potentiate premature termination codon readthrough by aminoglycosides.

    PubMed

    Baradaran-Heravi, Alireza; Balgi, Aruna D; Zimmerman, Carla; Choi, Kunho; Shidmoossavee, Fahimeh S; Tan, Jason S; Bergeaud, Célia; Krause, Alexandra; Flibotte, Stéphane; Shimizu, Yoko; Anderson, Hilary J; Mouly, Vincent; Jan, Eric; Pfeifer, Tom; Jaquith, James B; Roberge, Michel

    2016-08-19

    Nonsense mutations introduce premature termination codons and underlie 11% of genetic disease cases. High concentrations of aminoglycosides can restore gene function by eliciting premature termination codon readthrough but with low efficiency. Using a high-throughput screen, we identified compounds that potentiate readthrough by aminoglycosides at multiple nonsense alleles in yeast. Chemical optimization generated phthalimide derivative CDX5-1 with activity in human cells. Alone, CDX5-1 did not induce readthrough or increase TP53 mRNA levels in HDQ-P1 cancer cells with a homozygous TP53 nonsense mutation. However, in combination with aminoglycoside G418, it enhanced readthrough up to 180-fold over G418 alone. The combination also increased readthrough at all three nonsense codons in cancer cells with other TP53 nonsense mutations, as well as in cells from rare genetic disease patients with nonsense mutations in the CLN2, SMARCAL1 and DMD genes. These findings open up the possibility of treating patients across a spectrum of genetic diseases caused by nonsense mutations. PMID:27407112

  11. Integration of β-carotene molecules in small liposomes

    NASA Astrophysics Data System (ADS)

    Andreeva, Atanaska; Popova, Antoaneta

    2010-11-01

    The most typical feature of carotenoids is the long polyene chain with conjugated double bonds suggesting that they can serve as conductors of electrons, acting as ''molecular wires'', important elements in the molecular electronic devices. Carotenoids are essential components of photosynthetic systems, performing different functions as light harvesting, photoprotection and electron transfer. They act also as natural antioxidants. In addition they perform structural role stabilizing the three-dimensional organization of photosynthetic membranes. Carotenoids contribute to the stability of the lipid phase, preserving the membrane integrity under potentially harmful environmental conditions. Carotenoids can be easily integrated into model membranes, facilitating the investigation of their functional roles. In carotenoid-egg phosphatidylcholine (EPC) liposomes ß-carotene is randomly distributed in the hydrocarbon interior of the bilayer, without any preferred, well defined orientation and retains a substantial degree of mobility. Here we investigate the degree of integration of ß-carotene in small unilamellar EPC liposomes and the changes in ß-carotene absorption and Raman spectra due to the lipid-pigment interaction. All observed changes in ß-carotene absorption and Raman spectra may be regarded as a result of the lipid-pigment interactions leading to the polyene geometry distortion and increasing of the environment heterogenety in the liposomes as compared to the solutions.

  12. Efficiency enhancement in small molecular organic photovoltaic devices employing dual anode interfacial layers

    NASA Astrophysics Data System (ADS)

    Fleetham, Tyler; O'Brien, Barry; Mudrick, John P.; Xue, Jiangeng; Li, Jian

    2013-10-01

    We demonstrated enhanced efficiency in small molecule organic photovoltaic devices using dual organic interfacial layers of PEDOT:PSS followed by tetracene between the ITO anode and the organic donor material. The use of a small molecular templating layer, such as tetracene, proved to increase the molecular stacking of the subsequent phthalocyanine (Pc) based donor materials. Upon application in planar heterojunction devices of ZnPc and C60, an enhancement of over 80 percent in the donor contribution to the external quantum efficiency was observed attributed to the combination of exciton blocking by the higher band gap tetracene layer and enhanced exciton diffusion and charge transport resulting from the increased crystallinity.

  13. Combinatorics of feedback in cellular uptake and metabolism of small molecules.

    PubMed

    Krishna, Sandeep; Semsey, Szabolcs; Sneppen, Kim

    2007-12-26

    We analyze the connection between structure and function for regulatory motifs associated with cellular uptake and usage of small molecules. Based on the boolean logic of the feedback we suggest four classes: the socialist, consumer, fashion, and collector motifs. We find that the socialist motif is good for homeostasis of a useful but potentially poisonous molecule, whereas the consumer motif is optimal for nutrition molecules. Accordingly, examples of these motifs are found in, respectively, the iron homeostasis system in various organisms and in the uptake of sugar molecules in bacteria. The remaining two motifs have no obvious analogs in small molecule regulation, but we illustrate their behavior using analogies to fashion and obesity. These extreme motifs could inspire construction of synthetic systems that exhibit bistable, history-dependent states, and homeostasis of flux (rather than concentration). PMID:18093927

  14. Label-Free Detection of G Protein–SNARE Interactions and Screening for Small Molecule Modulators

    PubMed Central

    2011-01-01

    Gi/o-coupled presynaptic GPCRs are major targets in neuropsychiatric diseases. For example, presynaptic auto- or heteroreceptors include the D2 dopamine receptor, H3 histamine receptor, 5HT1 serotonin receptors, M4 acetylcholine receptors, GABAB receptors, Class II and III metabotropic glutamate receptors, opioid receptors, as well as many other receptors. These GPCRs exert their influence by decreasing exocytosis of synaptic vesicles. One mechanism by which they act is through direct interaction of the Gβγ subunit with members of the SNARE complex downstream of voltage-dependent calcium channels, and specifically with the C-terminus of SNAP25 and the H3 domain of syntaxin1A. (Gerachshenko, T., Blackmer, T., Yoon, E. J., Bartleson, C., Hamm, H. E., and Alford, S. (2005) Gβγ acts at the C terminus of SNAP-25 to mediate presynaptic inhibition, Nat. Neurosci.8, 597–605; Yoon, E. J., Gerachshenko, T., Spiegelberg, B. D., Alford, S., and Hamm, H. E. (2007) Gβγ interferes with Ca2+-dependent binding of synaptotagmin to the soluble N-ethylmaleimide-sensitive factor attachment protein receptor (SNARE) complex, Mol. Pharmacol.72, 1210–1219; Blackmer, T., Larsen, E. C., Bartleson, C., Kowalchyk, J. A., Yoon, E. J., Preininger, A. M., Alford, S., Hamm, H. E., and Martin, T. F. (2005) G protein βγ directly regulates SNARE protein fusion machinery for secretory granule exocytosis, Nat. Neurosci.8, 421–425).1−3 Small molecule inhibitors of the Gβγ–SNARE interaction would allow the study of the relative importance of this mechanism in more detail. We have utilized novel, label-free technology to detect this protein–protein interaction and screen for several small molecule compounds that perturb the interaction, demonstrating the viability of this approach. Interestingly, the screen also produced enhancers of the Gβγ–SNARE interaction. PMID:22368765

  15. Comparison of Different Time of Flight-Mass Spectrometry Modes for Small Molecule Quantitative Analysis.

    PubMed

    Chindarkar, Nandkishor S; Park, Hyung-Doo; Stone, Judith A; Fitzgerald, Robert L

    2015-01-01

    Currently, the use of time of flight (TOF)-mass spectrometry (MS) in quantitative analysis of small molecules is rare. Recently, the quantitative performance of TOF mass analyzers has improved due to the advancements in TOF technology. We evaluated a Q-TOF-MS in different modes, i.e., Q-TOF-full scan (Q-TOF-FS), Q-TOF-enhanced-full scan (Q-TOF-En-FS), MS(E), Q-TOF-targeted (Q-TOF-TGT), Q-TOF-enhanced-targeted (Q-TOF-En-TGT), and compared their quantitative performance against a unit resolution LC-MS-MS (tandem quadrupole) platform. The five modes were investigated for sensitivity, linearity, signal-to-noise ratio, recovery and precision using 11-nor-9-carboxy-Δ(9)-tetrahydrocannabinol (THC-COOH) as a model compound in electrospray ionization (ESI) with negative polarity. Preliminary studies indicated that Q-TOF-FS mode was the least linear and precise; hence, it was eliminated from further investigation. Total imprecision in remaining four modes was <10%. The Q-TOF-En-FS and Q-TOF-En-TGT showed better signal intensity than their respective modes without enhancement. Overall, peak signal intensity was the highest in MS(E) mode, whereas the signal-to-noise ratio was the best in the Q-TOF-En-TGT mode. Relatively, MS(E) and Q-TOF-En-TGT modes were the best overall performers compared with the other modes. Both MS(E) and Q-TOF-En-TGT modes showed excellent precision (coefficient of variation <6%), patient correlation (r > 0.99) and linearity (range, 5-455 ng/mL) for THC-COOH analysis when compared with LC-MS-MS. We also investigated the performance of the same four modes using methamphetamine in positive ESI. Quantitative data obtained by Q-TOF-En-TGT and MS(E), using both positive and negative ESI, suggest that these modes performed better than the other modes. While unit resolution LC-MS-MS remains the optimal technique for quantification, our data showed that Q-TOF-MS can also be used to quantify small molecules in complex biological specimens. PMID:26239972

  16. Recent advances in inorganic materials for LDI-MS analysis of small molecules.

    PubMed

    Shi, C Y; Deng, C H

    2016-05-10

    In this review, various inorganic materials were summarized for the analysis of small molecules by laser desorption/ionization mass spectrometry (LDI-MS). Due to its tremendous advantages, such as simplicity, high speed, high throughput, small analyte volumes and tolerance towards salts, LDI-MS has been widely used in various analytes. During the ionization process, a suitable agent is required to assist the ionization, such as an appropriate matrix for matrix assisted laser desorption/ionization mass spectrometry (MALDI-MS). However, it is normally difficult to analyze small molecules with the MALDI technique because conventional organic matrices may produce matrix-related peaks in the low molecular-weight region, which limits the detection of small molecules (m/z < 700 Da). Therefore, more and more inorganic materials, including carbon-based materials, silicon-based materials and metal-based materials, have been developed to assist the ionization of small molecules. These inorganic materials can transfer energy and improve the ionization efficiency of analytes. In addition, functionalized inorganic materials can act as both an adsorbent and an agent in the enrichment and ionization of small molecules. In this review, we mainly focus on present advances in inorganic materials for the LDI-MS analysis of small molecules in the last five years, which contains the synthetic protocols of novel inorganic materials and the detailed results achieved by inorganic materials. On the other hand, this review also summarizes the application of inorganic materials as adsorbents in the selective enrichment of small molecules, which provides a new field for the application of inorganic materials. PMID:27050451

  17. Small molecule screen for inhibitors of expression from canonical CREB response element-containing promoters

    PubMed Central

    Mitton, Bryan; Hsu, Katie; Dutta, Ritika; Tiu, Bruce C.; Cox, Nick; McLure, Kevin G.; Chae, Hee-Don; Smith, Mark; Eklund, Elizabeth A.; Solow-Cordero, David E.; Sakamoto, Kathleen M.

    2016-01-01

    The transcription factor CREB (cAMP Response Element Binding Protein) is an important determinant in the growth of Acute Myeloid Leukemia (AML) cells. CREB overexpression increases AML cell growth by driving the expression of key regulators of apoptosis and the cell cycle. Conversely, CREB knockdown inhibits proliferation and survival of AML cells but not normal hematopoietic cells. Thus, CREB represents a promising drug target for the treatment of AML, which carries a poor prognosis. In this study, we performed a high-throughput small molecule screen to identify compounds that disrupt CREB function in AML cells. We screened ∼114,000 candidate compounds from Stanford University's small molecule library, and identified 5 molecules that inhibit CREB function at micromolar concentrations, but are non-toxic to normal hematopoietic cells. This study suggests that targeting CREB function using small molecules could provide alternative approaches to treat AML. PMID:26840025

  18. Comparative metabolomics and structural characterizations illuminate colibactin pathway-dependent small molecules.

    PubMed

    Vizcaino, Maria I; Engel, Philipp; Trautman, Eric; Crawford, Jason M

    2014-07-01

    The gene cluster responsible for synthesis of the unknown molecule "colibactin" has been identified in mutualistic and pathogenic Escherichia coli. The pathway endows its producer with a long-term persistence phenotype in the human bowel, a probiotic activity used in the treatment of ulcerative colitis, and a carcinogenic activity under host inflammatory conditions. To date, functional small molecules from this pathway have not been reported. Here we implemented a comparative metabolomics and targeted structural network analyses approach to identify a catalog of small molecules dependent on the colibactin pathway from the meningitis isolate E. coli IHE3034 and the probiotic E. coli Nissle 1917. The structures of 10 pathway-dependent small molecules are proposed based on structural characterizations and network relationships. The network will provide a roadmap for the structural and functional elucidation of a variety of other small molecules encoded by the pathway. From the characterized small molecule set, in vitro bacterial growth inhibitory and mammalian CNS receptor antagonist activities are presented. PMID:24932672

  19. Solution processable organic polymers and small molecules for bulk-heterojunction solar cells: A review

    SciTech Connect

    Sharma, G. D.

    2011-10-20

    Solution processed bulk heterojunction (BHJ) organic solar cells (OSCs) have gained wide interest in past few years and are established as one of the leading next generation photovoltaic technologies for low cost power production. Power conversion efficiencies up to 6% and 6.5% have been reported in the literature for single layer and tandem solar cells, respectively using conjugated polymers. A recent record efficiency about 8.13% with active area of 1.13 cm{sup 2} has been reported. However Solution processable small molecules have been widely applied for photovoltaic (PV) devices in recent years because they show strong absorption properties, and they can be easily purified and deposited onto flexible substrates at low cost. Introducing different donor and acceptor groups to construct donor--acceptor (D--A) structure small molecules has proved to be an efficient way to improve the properties of organic solar cells (OSCs). The power conversion efficiency about 4.4 % has been reported for OSCs based on the small molecules. This review deals with the recent progress of solution processable D--A structure small molecules and discusses the key factors affecting the properties of OSCs based on D--A structure small molecules: sunlight absorption, charge transport and the energy level of the molecules.

  20. Nanoplasmonic chitosan nanofibers as effective SERS substrate for detection of small molecules.

    PubMed

    Severyukhina, Alexandra N; Parakhonskiy, Bogdan V; Prikhozhdenko, Ekaterina S; Gorin, Dmitry A; Sukhorukov, Gleb B; Möhwald, Helmuth; Yashchenok, Alexey M

    2015-07-22

    The use of surface enhanced Raman spectroscopy (SERS) is limited by low reproducibility and uniformity of the response. Solving these problems can turn the laboratory use of SERS into real-world application. In this regard, soft SERS-active substrates can enable portable instrumentation and reduce costs in the fabrication of SERS-based sensors. Here, plasmonic free-standing films made of biocompatible chitosan nanofibers and gold nanoparticles are engineered by a simple protocol varying the concentration of chloroauric acid. The concentration and distribution of gold nanoparticles in films are controlled in a predictable way, and SERS spectra for the standard 2-naphthalenethiol with concentration less than 10(-15) M are acquired in a reproducible way. The statistical analysis reveals a relatively high and locally uniform performance of SERS with an enhancement factor of 2 × 10(5) for 86% of the points on the imaged area of the SERS substrate. Potential SERS detection of small molecules, both Rhodamine 6G and d-Glucose, in the micromolar range is demonstrated. PMID:26126080

  1. Systematic selection of small molecules to promote differentiation of embryonic stem cells and experimental validation for generating cardiomyocytes.

    PubMed

    KalantarMotamedi, Y; Peymani, M; Baharvand, H; Nasr-Esfahani, M H; Bender, A

    2016-01-01

    Small molecules are being increasingly used for inducing the targeted differentiation of stem cells to different cell types. However, until now no systematic method for selecting suitable small molecules for this purpose has been presented. In this work, we propose an integrated and general bioinformatics- and cheminformatics-based approach for selecting small molecules which direct cellular differentiation in the desired way. The approach was successfully experimentally validated for differentiating stem cells into cardiomyocytes. All predicted compounds enhanced expression of cardiac progenitor (Gata4, Nkx2-5 and Mef2c) and mature cardiac markers (Actc1, myh6) significantly during and post-cardiac progenitor formation. The best-performing compound, Famotidine, increased the percentage of Myh6-positive cells from 33 to 56%, and enhanced the expression of Nkx2.5 and Tnnt2 cardiac progenitor and cardiac markers in protein level. The approach employed in the study is applicable to all other stem cell differentiation settings where gene expression data are available. PMID:27551501

  2. Systematic selection of small molecules to promote differentiation of embryonic stem cells and experimental validation for generating cardiomyocytes

    PubMed Central

    KalantarMotamedi, Y; Peymani, M; Baharvand, H; Nasr-Esfahani, M H; Bender, A

    2016-01-01

    Small molecules are being increasingly used for inducing the targeted differentiation of stem cells to different cell types. However, until now no systematic method for selecting suitable small molecules for this purpose has been presented. In this work, we propose an integrated and general bioinformatics- and cheminformatics-based approach for selecting small molecules which direct cellular differentiation in the desired way. The approach was successfully experimentally validated for differentiating stem cells into cardiomyocytes. All predicted compounds enhanced expression of cardiac progenitor (Gata4, Nkx2-5 and Mef2c) and mature cardiac markers (Actc1, myh6) significantly during and post-cardiac progenitor formation. The best-performing compound, Famotidine, increased the percentage of Myh6-positive cells from 33 to 56%, and enhanced the expression of Nkx2.5 and Tnnt2 cardiac progenitor and cardiac markers in protein level. The approach employed in the study is applicable to all other stem cell differentiation settings where gene expression data are available. PMID:27551501

  3. Small Molecule Microarrays Enable the Identification of a Selective, Quadruplex-Binding Inhibitor of MYC Expression

    PubMed Central

    2015-01-01

    The transcription factor MYC plays a pivotal role in cancer initiation, progression, and maintenance. However, it has proven difficult to develop small molecule inhibitors of MYC. One attractive route to pharmacological inhibition of MYC has been the prevention of its expression through small molecule-mediated stabilization of the G-quadruplex (G4) present in its promoter. Although molecules that bind globally to quadruplex DNA and influence gene expression are well-known, the identification of new chemical scaffolds that selectively modulate G4-driven genes remains a challenge. Here, we report an approach for the identification of G4-binding small molecules using small molecule microarrays (SMMs). We use the SMM screening platform to identify a novel G4-binding small molecule that inhibits MYC expression in cell models, with minimal impact on the expression of other G4-associated genes. Surface plasmon resonance (SPR) and thermal melt assays demonstrated that this molecule binds reversibly to the MYC G4 with single digit micromolar affinity, and with weaker or no measurable binding to other G4s. Biochemical and cell-based assays demonstrated that the compound effectively silenced MYC transcription and translation via a G4-dependent mechanism of action. The compound induced G1 arrest and was selectively toxic to MYC-driven cancer cell lines containing the G4 in the promoter but had minimal effects in peripheral blood mononucleocytes or a cell line lacking the G4 in its MYC promoter. As a measure of selectivity, gene expression analysis and qPCR experiments demonstrated that MYC and several MYC target genes were downregulated upon treatment with this compound, while the expression of several other G4-driven genes was not affected. In addition to providing a novel chemical scaffold that modulates MYC expression through G4 binding, this work suggests that the SMM screening approach may be broadly useful as an approach for the identification of new G4-binding small

  4. Screening for Small-Molecule Modulators of Long Noncoding RNA-Protein Interactions Using AlphaScreen

    PubMed Central

    Pedram Fatemi, Roya; Salah-Uddin, Sultan; Modarresi, Farzaneh; Khoury, Nathalie; Wahlestedt, Claes

    2015-01-01

    Long non–protein coding RNAs (lncRNAs) are an important class of molecules that help orchestrate key cellular events. Although their functional roles in cells are not well understood, thousands of lncRNAs and a number of possible mechanisms by which they act have been reported. LncRNAs can exert their regulatory function in cells by interacting with epigenetic enzymes. In this study, we developed a tool to study lncRNA-protein interactions for high-throughput screening of small-molecule modulators using AlphaScreen technology. We tested the interaction of two lncRNAs: brain-derived neurotrophic factor antisense (BDNF-AS) and Hox transcript antisense RNA (HOTAIR), with Enhancer of zeste homolog 2 (EZH2), a histone methyltransferase against a phytochemical library, to look for small-molecule inhibitors that can alter the expression of downstream target genes. We identified ellipticine, a compound that up-regulates BDNF transcription. Our study shows the feasibility of using high-throughput screening to identify modulators of lncRNA-protein interactions and paves the road for targeting lncRNAs that are dysregulated in human disorders using small-molecule therapies. PMID:26173710

  5. Synergistic Effects of Morphological Control and Complementary Absorption in Efficient All-Small-Molecule Ternary-Blend Solar Cells.

    PubMed

    Farahat, Mahmoud E; Patra, Dhananjaya; Lee, Chih-Hao; Chu, Chih-Wei

    2015-10-14

    In this study, we combined two small-molecule donors-a diketopyrrolopyrrole-based small molecule (SMD) and a benzodithiophene-based molecule (BDT6T)-with [6,6]-phenyl-C61-butyric acid methyl ester (PC61BM) to form ternary blend solar cells. The power conversion efficiency of the binary SMD:PC61BM bulk heterojunction solar cell improved from 4.57 to 6.28% after adding an appropriate amount BDT6T as a guest. We attribute this 37% improvement in device performance to the complementary absorption behavior of BDT6T and SMD, as evidenced by the increase in the short circuit current. After addition of BDT6T to form the ternary blend, the crystallinity and morphology of the active layer were enhanced. For example, the features observed in the ternary active layers were finer than those in the binary blends. This means that BDT6T as a third component in the ternary blend has effective role on both the absorption and the morphology. In addition, adding BDT6T to form the ternary blend also led to an increase in the open-circuit voltage. Our findings suggest that the preparation of such simple all-small-molecule ternary blends can be an effective means of improving the efficiency of photovoltaic devices. PMID:26389528

  6. Purification and characterization of a novel small-molecule polysaccharide from the Maitake medicinal mushroom Grifola frondosa (higher Basidiomycetes).

    PubMed

    Zhou, Changyan; Qiao, Yanru; Tang, Qingjiu; Jia, Wei; Liu, Yanfang; Wu, Aizhong

    2013-01-01

    A novel small-molecule polysaccharide with a molecular mass of 2.6 kDa, was isolated from the culinary-medicinal Maitake mushroom Grifola frondosa. GFPS is composed of fucose, rhamnose, galactose, glucose, and mannose; galactose, glucose, and mannose were the dominant monosaccharides. Absorption peaks at 1077 cm-1, 1024 cm-1, and 873 cm-1, as revealed by infrared spectrum, suggesting that GFPS consists of pyranoside. GFPS significantly enhanced the production of nitric oxide and secretion of cytokines (tumor necrosis factor-α, interleukin-1β, and interleukin-δ) from macrophages in vitro. These results indicate that this novel small-molecule polysaccharide might be beneficial for immune defense. PMID:23557366

  7. Efficient new ribozyme mimics: direct mapping of molecular design principles from small molecules to macromolecular, biomimetic catalysts

    PubMed Central

    Putnam, William C.; Daniher, Andrew T.; Trawick, Bobby N.; Bashkin, James K.

    2001-01-01

    Dramatic improvements in ribozyme mimics have been achieved by employing the principles of small molecule catalysis to the design of macromolecular, biomimetic reagents. Ribozyme mimics derived from the ligand 2,9-dimethylphenanthroline (neocuproine) show at least 30-fold improvements in efficiency at sequence-specific RNA cleavage when compared with analogous o-phenanthroline- and terpyridine-derived reagents. The suppression of hydroxide-bridged dimers and the greater activation of coordinated water by Cu(II) neocuproine (compared with the o-phananthroline and terpyridine complexes) better allow Cu(II) to reach its catalytic potential as a biomimetic RNA cleavage agent. This work demonstrates the direct mapping of molecular design principles from small-molecule cleavage to macromolecular cleavage events, generating enhanced biomimetic, sequence-specific RNA cleavage agents. PMID:11353090

  8. An aptameric graphene nanosensor for label-free detection of small-molecule biomarkers.

    PubMed

    Wang, Cheng; Kim, Jinho; Zhu, Yibo; Yang, Jaeyoung; Lee, Gwan-Hyoung; Lee, Sunwoo; Yu, Jaeeun; Pei, Renjun; Liu, Guohua; Nuckolls, Colin; Hone, James; Lin, Qiao

    2015-09-15

    This paper presents an aptameric graphene nanosensor for detection of small-molecule biomarkers. To address difficulties in direct detection of small molecules associated with their low molecular weight and electrical charge, we incorporate an aptamer-based competitive affinity assay in a graphene field effect transistor (FET), and demonstrate the utility of the nanosensor with dehydroepiandrosterone sulfate (DHEA-S), a small-molecule steroid hormone, as the target analyte. In the competitive affinity assay, DHEA-S specifically binds to aptamer molecules pre-hybridized to their complementary DNA anchor molecules immobilized on the graphene surface. This results in the competitive release of the strongly charged aptamer from the DNA anchor and hence a change in electrical properties of the graphene, which can be measured to achieve the detection of DHEA-S. We present experimental data on the label-free, specific and quantitative detection of DHEA-S at clinically appropriate concentrations with an estimated detection limit of 44.7 nM, and analyze the trend observed in the experiments using molecular binding kinetics theory. These results demonstrate the potential of our nanosensor in the detection of DHEA-S and other small molecules in biomedical applications. PMID:25912678

  9. Peering into Cells One Molecule at a Time: Single-molecule and plasmon-enhanced fluorescence super-resolution imaging

    NASA Astrophysics Data System (ADS)

    Biteen, Julie

    2013-03-01

    Single-molecule fluorescence brings the resolution of optical microscopy down to the nanometer scale, allowing us to unlock the mysteries of how biomolecules work together to achieve the complexity that is a cell. This high-resolution, non-destructive method for examining subcellular events has opened up an exciting new frontier: the study of macromolecular localization and dynamics in living cells. We have developed methods for single-molecule investigations of live bacterial cells, and have used these techniques to investigate thee important prokaryotic systems: membrane-bound transcription activation in Vibrio cholerae, carbohydrate catabolism in Bacteroides thetaiotaomicron, and DNA mismatch repair in Bacillus subtilis. Each system presents unique challenges, and we will discuss the important methods developed for each system. Furthermore, we use the plasmon modes of bio-compatible metal nanoparticles to enhance the emissivity of single-molecule fluorophores. The resolution of single-molecule imaging in cells is generally limited to 20-40 nm, far worse than the 1.5-nm localization accuracies which have been attained in vitro. We use plasmonics to improve the brightness and stability of single-molecule probes, and in particular fluorescent proteins, which are widely used for bio-imaging. We find that gold-coupled fluorophores demonstrate brighter, longer-lived emission, yielding an overall enhancement in total photons detected. Ultimately, this results in increased localization accuracy for single-molecule imaging. Furthermore, since fluorescence intensity is proportional to local electromagnetic field intensity, these changes in decay intensity and rate serve as a nm-scale read-out of the field intensity. Our work indicates that plasmonic substrates are uniquely advantageous for super-resolution imaging, and that plasmon-enhanced imaging is a promising technique for improving live cell single-molecule microscopy.

  10. Identification and biological activities of a new antiangiogenic small molecule that suppresses mitochondrial reactive oxygen species

    SciTech Connect

    Kim, Ki Hyun; Park, Ju Yeol; Jung, Hye Jin; Kwon, Ho Jeong

    2011-01-07

    Research highlights: {yields} YCG063 was screened as a new angiogenesis inhibitor which suppresses mitochondrial ROS generation in a phenotypic cell-based screening of a small molecule-focused library. {yields} The compound inhibited in vitro and in vivo angiogenesis in a dose-dependent manner. {yields} This new small molecule tool will provide a basis for a better understanding of angiogenesis driven under hypoxic conditions. -- Abstract: Mitochondrial reactive oxygen species (ROS) are associated with multiple cellular functions such as cell proliferation, differentiation, and apoptosis. In particular, high levels of mitochondrial ROS in hypoxic cells regulate many angiogenesis-related diseases, including cancer and ischemic disorders. Here we report a new angiogenesis inhibitor, YCG063, which suppressed mitochondrial ROS generation in a phenotypic cell-based screening of a small molecule-focused library with an ArrayScan HCS reader. YCG063 suppressed mitochondrial ROS generation under a hypoxic condition in a dose-dependent manner, leading to the inhibition of in vitro angiogenic tube formation and chemoinvasion as well as in vivo angiogenesis of the chorioallantoic membrane (CAM) at non-toxic doses. In addition, YCG063 decreased the expression levels of HIF-1{alpha} and its target gene, VEGF. Collectively, a new antiangiogenic small molecule that suppresses mitochondrial ROS was identified. This new small molecule tool will provide a basis for a better understanding of angiogenesis driven under hypoxic conditions.

  11. Small molecules targeting microRNA for cancer therapy: Promises and obstacles.

    PubMed

    Wen, Di; Danquah, Michael; Chaudhary, Amit Kumar; Mahato, Ram I

    2015-12-10

    Aberrant expression of miRNAs is critically implicated in cancer initiation and progression. Therapeutic approaches focused on regulating miRNAs are therefore a promising approach for treating cancer. Antisense oligonucleotides, miRNA sponges, and CRISPR/Cas9 genome editing systems are being investigated as tools for regulating miRNAs. Despite the accruing insights in the use of these tools, delivery concerns have mitigated clinical application of such systems. In contrast, little attention has been given to the potential of small molecules to modulate miRNA expression for cancer therapy. In these years, many researches proved that small molecules targeting cancer-related miRNAs might have greater potential for cancer treatment. Small molecules targeting cancer related miRNAs showed significantly promising results in different cancer models. However, there are still several obstacles hindering the progress and clinical application in this area. This review discusses the development, mechanisms and application of small molecules for modulating oncogenic miRNAs (oncomiRs). Attention has also been given to screening technologies and perspectives aimed to facilitate clinical translation for small molecule-based miRNA therapeutics. PMID:26256260

  12. Enhancing Adult Learning through Cooperative Small Groups.

    ERIC Educational Resources Information Center

    Millis, Barbara J.

    1991-01-01

    Cooperative learning is a structured form of small group work based on interdependence, accountability, group processing, and social skills. In continuing education, cooperative learning can positively affect achievement, multiethnic relationships, self-esteem, retention, and attitudes. (SK)

  13. Anti-Stokes-enhanced tunneling ionization of molecules

    NASA Astrophysics Data System (ADS)

    Kornev, Aleksei S.; Zon, Boris A.

    2012-10-01

    We consider the influence of vibrational motion of nuclei on the tunneling ionization of a molecule in a strong light field. Unlike the molecular Ammosov-Delone-Krainov (MO-ADK) model [X. M. Tong , Phys. Rev. APLRAAN1050-294710.1103/PhysRevA.66.033402 66, 033402 (2002)], the Franck-Condon factors that take into consideration the quantization of nuclear vibrations are introduced in the theory. Modification of the vibrational motion of nuclei by the external field leads to the time-dependent constant in the asymptotic form of the electronic wave function. This in turn leads to a more significant modification of the Keldysh theory for the tunnel effect in molecules as compared to the MO-ADK model. We take into account the possibility of vibrational quantum numbers changing in a neutral molecule and in a molecular ion in the process of the tunneling ionization, which in principle enables one to get molecular ions of a certain isotopic composition if the vibrational states of the neutral molecules with this isotopic composition are pumped before ionization. We present numerical results illustrating this possibility for the isotopes of a hydrogen molecule.

  14. Constructing and characterizing a bioactive small molecule and microRNA association network for Alzheimer's disease

    PubMed Central

    Meng, Fanlin; Dai, Enyu; Yu, Xuexin; Zhang, Yan; Chen, Xiaowen; Liu, Xinyi; Wang, Shuyuan; Wang, Lihua; Jiang, Wei

    2014-01-01

    Alzheimer's disease (AD) is an incurable neurodegenerative disorder. Much effort has been devoted to developing effective therapeutic agents. Recently, targeting microRNAs (miRNAs) with small molecules has become a novel therapy for human diseases. In this study, we present a systematic computational approach to construct a bioactive Small molecule and miRNA association Network in AD (SmiRN-AD), which is based on the gene expression signatures of bioactive small molecule perturbation and AD-related miRNA regulation. We also performed topological and functional analysis of the SmiRN-AD from multiple perspectives. At the significance level of p ≤ 0.01, 496 small molecule–miRNA associations, including 25 AD-related miRNAs and 275 small molecules, were recognized and used to construct the SmiRN-AD. The drugs that were connected with the same miRNA tended to share common drug targets (p = 1.72 × 10−4) and belong to the same therapeutic category (p = 4.22 × 10−8). The miRNAs that were linked to the same small molecule regulated more common miRNA targets (p = 6.07 × 10−3). Further analysis of the positive connections (quinostatin and miR-148b, amantadine and miR-15a) and the negative connections (melatonin and miR-30e-5p) indicated that our large-scale predictions afforded specific biological insights into AD pathogenesis and therapy. This study proposes a holistic strategy for deciphering the associations between small molecules and miRNAs in AD, which may be helpful for developing a novel effective miRNA-associated therapeutic strategy for AD. A comprehensive database for the SmiRN-AD and the differential expression patterns of the miRNA targets in AD is freely available at http://bioinfo.hrbmu.edu.cn/SmiRN-AD/. PMID:24352679

  15. Novel Patient Cell-Based HTS Assay for Identification of Small Molecules for a Lysosomal Storage Disease

    PubMed Central

    Ribbens, Jameson; Zheng, Wei; Southall, Noel; Hu, Xin; Marugan, Juan J.; Ferrer, Marc; Maegawa, Gustavo H. B.

    2011-01-01

    Small molecules have been identified as potential therapeutic agents for lysosomal storage diseases (LSDs), inherited metabolic disorders caused by defects in proteins that result in lysosome dysfunctional. Some small molecules function assisting the folding of mutant misfolded lysosomal enzymes that are otherwise degraded in ER-associated degradation. The ultimate result is the enhancement of the residual enzymatic activity of the deficient enzyme. Most of the high throughput screening (HTS) assays developed to identify these molecules are single-target biochemical assays. Here we describe a cell-based assay using patient cell lines to identify small molecules that enhance the residual arylsulfatase A (ASA) activity found in patients with metachromatic leukodystrophy (MLD), a progressive neurodegenerative LSD. In order to generate sufficient cell lines for a large scale HTS, primary cultured fibroblasts from MLD patients were transformed using SV40 large T antigen. These SV40 transformed (SV40t) cells showed to conserve biochemical characteristics of the primary cells. Using a specific colorimetric substrate para-nitrocatechol sulfate (pNCS), detectable ASA residual activity were observed in primary and SV40t fibroblasts from a MLD patient (ASA-I179S) cultured in multi-well plates. A robust fluorescence ASA assay was developed in high-density 1,536-well plates using the traditional colorimetric pNCS substrate, whose product (pNC) acts as “plate fluorescence quencher” in white solid-bottom plates. The quantitative cell-based HTS assay for ASA generated strong statistical parameters when tested against a diverse small molecule collection. This cell-based assay approach can be used for several other LSDs and genetic disorders, especially those that rely on colorimetric substrates which traditionally present low sensitivity for assay-miniaturization. In addition, the quantitative cell-based HTS assay here developed using patient cells creates an opportunity to

  16. Stochastic electrotransport selectively enhances the transport of highly electromobile molecules.

    PubMed

    Kim, Sung-Yon; Cho, Jae Hun; Murray, Evan; Bakh, Naveed; Choi, Heejin; Ohn, Kimberly; Ruelas, Luzdary; Hubbert, Austin; McCue, Meg; Vassallo, Sara L; Keller, Philipp J; Chung, Kwanghun

    2015-11-17

    Nondestructive chemical processing of porous samples such as fixed biological tissues typically relies on molecular diffusion. Diffusion into a porous structure is a slow process that significantly delays completion of chemical processing. Here, we present a novel electrokinetic method termed stochastic electrotransport for rapid nondestructive processing of porous samples. This method uses a rotational electric field to selectively disperse highly electromobile molecules throughout a porous sample without displacing the low-electromobility molecules that constitute the sample. Using computational models, we show that stochastic electrotransport can rapidly disperse electromobile molecules in a porous medium. We apply this method to completely clear mouse organs within 1-3 days and to stain them with nuclear dyes, proteins, and antibodies within 1 day. Our results demonstrate the potential of stochastic electrotransport to process large and dense tissue samples that were previously infeasible in time when relying on diffusion. PMID:26578787

  17. Stochastic electrotransport selectively enhances the transport of highly electromobile molecules

    PubMed Central

    Kim, Sung-Yon; Cho, Jae Hun; Murray, Evan; Bakh, Naveed; Choi, Heejin; Ohn, Kimberly; Ruelas, Luzdary; Hubbert, Austin; McCue, Meg; Vassallo, Sara L.; Keller, Philipp J.; Chung, Kwanghun

    2015-01-01

    Nondestructive chemical processing of porous samples such as fixed biological tissues typically relies on molecular diffusion. Diffusion into a porous structure is a slow process that significantly delays completion of chemical processing. Here, we present a novel electrokinetic method termed stochastic electrotransport for rapid nondestructive processing of porous samples. This method uses a rotational electric field to selectively disperse highly electromobile molecules throughout a porous sample without displacing the low-electromobility molecules that constitute the sample. Using computational models, we show that stochastic electrotransport can rapidly disperse electromobile molecules in a porous medium. We apply this method to completely clear mouse organs within 1–3 days and to stain them with nuclear dyes, proteins, and antibodies within 1 day. Our results demonstrate the potential of stochastic electrotransport to process large and dense tissue samples that were previously infeasible in time when relying on diffusion. PMID:26578787

  18. Case Study of Small Molecules As Antimalarials: 2-Amino-1-phenylethanol (APE) Derivatives

    PubMed Central

    2014-01-01

    Antiparasitic oral drugs have been associated to lipophilic molecules due to their intrinsic permeability. However, these kind of molecules are associated to numerous adverse effects, which have been extensively studied. Within the Tres Cantos Antimalarial Set (TCAMS) we have identified two small, soluble and simple hits that even presenting antiplasmodial activities in the range of 0.4–0.5 μM are able to show in vivo activity. PMID:24944739

  19. Acceptor End-Capped Oligomeric Conjugated Molecules with Broadened Absorption and Enhanced Extinction Coefficients for High-Efficiency Organic Solar Cells.

    PubMed

    Yuan, Liu; Lu, Kun; Xia, Benzheng; Zhang, Jianqi; Wang, Zhen; Wang, Zaiyu; Deng, Dan; Fang, Jin; Zhu, Lingyun; Wei, Zhixiang

    2016-07-01

    Acceptor end-capping of oligomeric conjugated molecules is found to be an effective strategy for simultaneous spectral broadening, extinction coefficient enhancement, and energy level optimization, resulting in profoundly enhanced power conversion efficiencies (of 9.25% and 8.91%) compared to the original oligomers. This strategy is effective in overcoming the absorption disadvantage of oligomers and small molecules due to conjugation limitation. PMID:27172541

  20. Protein kinase small molecule inhibitors for rheumatoid arthritis: Medicinal chemistry/clinical perspectives

    PubMed Central

    Malemud, Charles J; Blumenthal, David E

    2014-01-01

    Medicinal chemistry strategies have contributed to the development, experimental study of and clinical trials assessment of the first type of protein kinase small molecule inhibitor to target the Janus kinase/Signal Transducers and Activators of Transcription (JAK/STAT) signaling pathway. The orally administered small molecule inhibitor, tofacitinib, is the first drug to target the JAK/STAT pathway for entry into the armamentarium of the medical therapy of rheumatoid arthritis. The introduction of tofacitinib into general rheumatologic practice coupled with increasing understanding that additional cellular signal transduction pathways including the mitogen-activated protein kinase and phosphatidylinositide-3-kinase/Akt/mammalian target of rapamycin pathways as well as spleen tyrosine kinase also contribute to immune-mediated inflammatory in rheumatoid arthritis makes it likely that further development of orally administered protein kinase small molecule inhibitors for rheumatoid arthritis will occur in the near future. PMID:25232525

  1. Mapping the cellular response to small molecules using chemogenomic fitness signatures.

    PubMed

    Lee, Anna Y; St Onge, Robert P; Proctor, Michael J; Wallace, Iain M; Nile, Aaron H; Spagnuolo, Paul A; Jitkova, Yulia; Gronda, Marcela; Wu, Yan; Kim, Moshe K; Cheung-Ong, Kahlin; Torres, Nikko P; Spear, Eric D; Han, Mitchell K L; Schlecht, Ulrich; Suresh, Sundari; Duby, Geoffrey; Heisler, Lawrence E; Surendra, Anuradha; Fung, Eula; Urbanus, Malene L; Gebbia, Marinella; Lissina, Elena; Miranda, Molly; Chiang, Jennifer H; Aparicio, Ana Maria; Zeghouf, Mahel; Davis, Ronald W; Cherfils, Jacqueline; Boutry, Marc; Kaiser, Chris A; Cummins, Carolyn L; Trimble, William S; Brown, Grant W; Schimmer, Aaron D; Bankaitis, Vytas A; Nislow, Corey; Bader, Gary D; Giaever, Guri

    2014-04-11

    Genome-wide characterization of the in vivo cellular response to perturbation is fundamental to understanding how cells survive stress. Identifying the proteins and pathways perturbed by small molecules affects biology and medicine by revealing the mechanisms of drug action. We used a yeast chemogenomics platform that quantifies the requirement for each gene for resistance to a compound in vivo to profile 3250 small molecules in a systematic and unbiased manner. We identified 317 compounds that specifically perturb the function of 121 genes and characterized the mechanism of specific compounds. Global analysis revealed that the cellular response to small molecules is limited and described by a network of 45 major chemogenomic signatures. Our results provide a resource for the discovery of functional interactions among genes, chemicals, and biological processes. PMID:24723613

  2. A Unified Sensor Architecture for Isothermal Detection of Double-Stranded DNA, Oligonucleotides, and Small Molecules

    PubMed Central

    Brown, Carl W.; Lakin, Matthew R.; Fabry-Wood, Aurora; Horwitz, Eli K.; Baker, Nicholas A.; Stefanovic, Darko; Graves, Steven W.

    2015-01-01

    Pathogen detection is an important problem in many areas of medicine and agriculture, which may involve genomic or transcriptomic signatures, or small molecule metabolites. We report a unified, DNA-based sensor architecture capable of isothermal detection of double-stranded DNA targets, single-stranded oligonucleotides, and small molecules. Each sensor contains independent target detection and reporter modules, enabling rapid design. We detected gene variants on plasmids via a straightforward isothermal denaturation protocol. The sensors were highly specific, even with a randomized DNA background. We achieved a limit of detection of ~15 pM for single-stranded targets and ~5 nM for targets on denatured plasmids. By incorporating a blocked aptamer sequence, we also detected small molecules using the same sensor architecture. This work provides a starting point for multiplexed detection of multi-strain pathogens, and disease states caused by genetic variants (e.g., sickle cell anemia). PMID:25663617

  3. Mapping the Cellular Response to Small Molecules Using Chemogenomic Fitness Signatures

    PubMed Central

    Lee, Anna Y.; St.Onge, Robert P.; Proctor, Michael J.; Wallace, Iain M.; Nile, Aaron H.; Spagnuolo, Paul A.; Jitkova, Yulia; Gronda, Marcela; Wu, Yan; Kim, Moshe K.; Cheung-Ong, Kahlin; Torres, Nikko P.; Spear, Eric D.; Han, Mitchell K. L.; Schlecht, Ulrich; Suresh, Sundari; Duby, Geoffrey; Heisler, Lawrence E.; Surendra, Anuradha; Fung, Eula; Urbanus, Malene L.; Gebbia, Marinella; Lissina, Elena; Miranda, Molly; Chiang, Jennifer H.; Aparicio, Ana Maria; Zeghouf, Mahel; Davis, Ronald W.; Cherfils, Jacqueline; Boutry, Marc; Kaiser, Chris A.; Cummins, Carolyn L.; Trimble, William S.; Brown, Grant W.; Schimmer, Aaron D.; Bankaitis, Vytas A.; Nislow, Corey; Bader, Gary D.; Giaever, Guri

    2014-01-01

    Genome-wide characterization of the in vivo cellular response to perturbation is fundamental to understanding how cells survive stress. Identifying the proteins and pathways perturbed by small molecules affects biology and medicine by revealing the mechanisms of drug action. We used a yeast chemogenomics platform that quantifies the requirement for each gene for resistance to a compound in vivo to profile 3250 small molecules in a systematic and unbiased manner. We identified 317 compounds that specifically perturb the function of 121 genes and characterized the mechanism of specific compounds. Global analysis revealed that the cellular response to small molecules is limited and described by a network of 45 major chemogenomic signatures. Our results provide a resource for the discovery of functional interactions among genes, chemicals, and biological processes. PMID:24723613

  4. In situ hybridization assay-based small molecule screening in zebrafish

    PubMed Central

    Jing, Lili; Durand, Ellen M.; Ezzio, Catherine; Pagliuca, Stephanie M.; Zon, Leonard I.

    2012-01-01

    In vitro biochemical and cell-based small molecule screens have been widely used to identify compounds that target specific signaling pathways. But the identified compounds frequently fail at the animal testing stage, largely due to the in vivo absorption, metabolism and toxicity of chemicals. Zebrafish has recently emerged as a vertebrate whole organism model for small molecule screening. The in vivo bioactivity and specificity of compounds are examined from the very beginning of zebrafish screens. In addition, zebrafish is suitable for chemical screens at a large scale similar to cellular assays. This protocol describes an approach for in situ hybridization (ISH)-based chemical screening in zebrafish, which, in principle, can be used to screen any gene product. The described protocol has been used to identify small molecules affecting specific molecular pathways and biological processes. It can also be adapted to zebrafish screens with different readouts. PMID:23001521

  5. Synthesis and applications of 2,4-disubstituted thiazole derivatives as small molecule modulators of cellular development.

    PubMed

    Zhou, Garr-Layy; Tams, Daniel M; Marder, Todd B; Valentine, Roy; Whiting, Andrew; Przyborski, Stefan A

    2013-04-14

    Understanding how the structure of molecules relates to their function and biological activity is essential in the development of new analogues with targeted activity. This is especially relevant in mediating developmental processes in mammalian cells and the regulation of stem cell differentiation. In this study, thiazole-containing small molecules were synthesised and investigated for their ability to induce the differentiation of human pluripotent stem cells and their derivatives. Analyses of cell morphology, cell viability, expression of cell surface markers and ability to induce cell differentiation and regulate neurite formation identified the analogue with the longest and most bulky hydrophobic side chain as possessing comparable or enhanced activity to all-trans-retinoic acid (ATRA). Interestingly, a shorter, less bulky, known thiazole compound reported to be isoform selective for the retinoic acid receptor β2 (RARβ2) agonist did not mediate differentiation under the conditions tested; however, activity could be restored by adjusting the structure to a longer, more bulky molecule. These data provide further insight into the complexity of compound design in terms of developing small molecules with specific biological activities to control the development and differentiation of mammalian cells. PMID:23429427

  6. Detection of Protein–Small Molecule Binding Using a Self-Referencing External Cavity Laser Biosensor

    PubMed Central

    2015-01-01

    High-throughput screening has enabled the identification of small molecule modulators of important drug targets via well-established colorimetric or fluorimetric activity assays. However, existing methods to identify small molecule binders of nonenzymatic protein targets lack either the simplicity (e.g., require labeling one of the binding partners with a reporter) or throughput inherent in enzymatic assays widely used for HTS. Thus, there is intense interest in the development of high-throughput technologies for label-free detection of protein–small molecule interactions. Here we describe a novel self-referencing external cavity laser (ECL) biosensor approach that achieves high resolution and high sensitivity, while eliminating thermal noise with subpicometer wavelength accuracy. Using the self-referencing ECL biosensor, we demonstrate detection of binding between small molecules and a variety of immobilized protein targets, pairs that have binding affinities or inhibition constants ranging from subnanomolar to low micromolar. Finally, a “needle-in-the-haystack” screen for inhibitors against carbonic anhydrase isozyme II is performed, in which known inhibitors are clearly differentiated from inactive molecules within a compound library. PMID:24720510

  7. Discovery of Small Molecules that Inhibit the Disordered Protein, p27Kip1

    DOE PAGESBeta

    Iconaru, Luigi I.; Ban, David; Bharatham, Kavitha; Ramanathan, Arvind; Zhang, Weixing; Shelat, Anang A.; Zuo, Jian; Kriwacki, Richard W.

    2015-10-28

    In disordered proteins we see that they are highly prevalent in biological systems. They control myriad signaling and regulatory processes, and their levels and/or cellular localization are often altered in human disease. In contrast to folded proteins, disordered proteins, due to conformational heterogeneity and dynamics, are not considered viable drug targets. We challenged this paradigm by identifying through NMR-based screening small molecules that bound specifically, albeit weakly, to the disordered cell cycle regulator, p27Kip1 (p27). Moreover, two groups of molecules bound to sites created by transient clusters of aromatic residues within p27. Conserved chemical features within these two groups ofmore » small molecules exhibited complementarity to their binding sites within p27, establishing structure-activity relationships for small molecule: disordered protein interactions. Finally, one compound counteracted the Cdk2/cyclin A inhibitory function of p27 in vitro, providing proof-of- principle that small molecules can inhibit the function of a disordered protein (p27) through sequestration in a conformation incapable of folding and binding to a natural regulatory target (Cdk2/cyclin A).« less

  8. Discovery of Small Molecules that Inhibit the Disordered Protein, p27Kip1

    PubMed Central

    Iconaru, Luigi I.; Ban, David; Bharatham, Kavitha; Ramanathan, Arvind; Zhang, Weixing; Shelat, Anang A.; Zuo, Jian; Kriwacki, Richard W.

    2015-01-01

    Disordered proteins are highly prevalent in biological systems, they control myriad signaling and regulatory processes, and their levels and/or cellular localization are often altered in human disease. In contrast to folded proteins, disordered proteins, due to conformational heterogeneity and dynamics, are not considered viable drug targets. We challenged this paradigm by identifying through NMR-based screening small molecules that bound specifically, albeit weakly, to the disordered cell cycle regulator, p27Kip1 (p27). Two groups of molecules bound to sites created by transient clusters of aromatic residues within p27. Conserved chemical features within these two groups of small molecules exhibited complementarity to their binding sites within p27, establishing structure-activity relationships for small molecule:disordered protein interactions. Finally, one compound counteracted the Cdk2/cyclin A inhibitory function of p27 in vitro, providing proof-of-principle that small molecules can inhibit the function of a disordered protein (p27) through sequestration in a conformation incapable of folding and binding to a natural regulatory target (Cdk2/cyclin A). PMID:26507530

  9. Concentration-related response potentiometric titrations to study the interaction of small molecules with large biomolecules.

    PubMed

    Hamidi-Asl, Ezat; Daems, Devin; De Wael, Karolien; Van Camp, Guy; Nagels, Luc J

    2014-12-16

    In the present paper, the utility of a special potentiometric titration approach for recognition and calculation of biomolecule/small-molecule interactions is reported. This approach is fast, sensitive, reproducible, and inexpensive in comparison to the other methods for the determination of the association constant values (Ka) and the interaction energies (ΔG). The potentiometric titration measurement is based on the use of a classical polymeric membrane indicator electrode in a solution of the small-molecule ligand. The biomolecule is used as a titrant. The potential is measured versus a reference electrode and transformed into a concentration-related signal over the entire concentration interval, also at low concentrations, where the millivolt (y-axis) versus log canalyte (x-axis) potentiometric calibration curve is not linear. In the procedure, Ka is calculated for the interaction of cocaine with a cocaine binding aptamer and with an anticocaine antibody. To study the selectivity and cross-reactivity, other oligonucleotides and aptamers are tested, as well as other small ligand molecules such as tetrakis(4-chlorophenyl)borate, metergoline, lidocaine, and bromhexine. The calculated Ka compared favorably to the value reported in the literature using surface plasmon resonance. The potentiometric titration approach called "concentration-related response potentiometry" is used to study molecular interaction for seven macromolecular target molecules and four small-molecule ligands. PMID:25390494

  10. Discovery of Small Molecules that Inhibit the Disordered Protein, p27Kip1

    SciTech Connect

    Iconaru, Luigi I.; Ban, David; Bharatham, Kavitha; Ramanathan, Arvind; Zhang, Weixing; Shelat, Anang A.; Zuo, Jian; Kriwacki, Richard W.

    2015-10-28

    In disordered proteins we see that they are highly prevalent in biological systems. They control myriad signaling and regulatory processes, and their levels and/or cellular localization are often altered in human disease. In contrast to folded proteins, disordered proteins, due to conformational heterogeneity and dynamics, are not considered viable drug targets. We challenged this paradigm by identifying through NMR-based screening small molecules that bound specifically, albeit weakly, to the disordered cell cycle regulator, p27Kip1 (p27). Moreover, two groups of molecules bound to sites created by transient clusters of aromatic residues within p27. Conserved chemical features within these two groups of small molecules exhibited complementarity to their binding sites within p27, establishing structure-activity relationships for small molecule: disordered protein interactions. Finally, one compound counteracted the Cdk2/cyclin A inhibitory function of p27 in vitro, providing proof-of- principle that small molecules can inhibit the function of a disordered protein (p27) through sequestration in a conformation incapable of folding and binding to a natural regulatory target (Cdk2/cyclin A).

  11. Detection of protein-small molecule binding using a self-referencing external cavity laser biosensor.

    PubMed

    Zhang, Meng; Peh, Jessie; Hergenrother, Paul J; Cunningham, Brian T

    2014-04-23

    High-throughput screening has enabled the identification of small molecule modulators of important drug targets via well-established colorimetric or fluorimetric activity assays. However, existing methods to identify small molecule binders of nonenzymatic protein targets lack either the simplicity (e.g., require labeling one of the binding partners with a reporter) or throughput inherent in enzymatic assays widely used for HTS. Thus, there is intense interest in the development of high-throughput technologies for label-free detection of protein-small molecule interactions. Here we describe a novel self-referencing external cavity laser (ECL) biosensor approach that achieves high resolution and high sensitivity, while eliminating thermal noise with subpicometer wavelength accuracy. Using the self-referencing ECL biosensor, we demonstrate detection of binding between small molecules and a variety of immobilized protein targets, pairs that have binding affinities or inhibition constants ranging from subnanomolar to low micromolar. Finally, a "needle-in-the-haystack" screen for inhibitors against carbonic anhydrase isozyme II is performed, in which known inhibitors are clearly differentiated from inactive molecules within a compound library. PMID:24720510

  12. Utilizing Yeast Surface Human Proteome Display Libraries to Identify Small Molecule-Protein Interactions

    PubMed Central

    Bidlingmaier, Scott; Liu, Bin

    2016-01-01

    The identification of proteins that interact with small bioactive molecules is a critical but often difficult and time-consuming step in understanding cellular signaling pathways or molecular mechanisms of drug action. Numerous methods for identifying small molecule-interacting proteins have been developed and utilized, including affinity-based purification followed by mass spectrometry analysis, protein microarrays, phage display, and three-hybrid approaches. Although all these methods have been used successfully, there remains a need for additional techniques for analyzing small molecule-protein interactions. A promising method for identifying small molecule-protein interactions is affinity-based selection of yeast surface-displayed human proteome libraries. Large and diverse libraries displaying human protein fragments on the surface of yeast cells have been constructed and subjected to FACS-based enrichment followed by comprehensive exon microarray-based output analysis to identify protein fragments with affinity for small molecule ligands. In a recent example, a proteome-wide search has been successfully carried out to identify cellular proteins binding to the signaling lipids PtdIns(4,5)P2 and PtdIns(3,4,5)P3. Known phosphatidylinositide-binding proteins such as pleckstrin homology domains were identified, as well as many novel interactions. Intriguingly, many novel nuclear phosphatidylinositide-binding proteins were discovered. Although the existence of an independent pool of nuclear phosphatidylinositides has been known about for some time, their functions and mechanism of action remain obscure. Thus, the identification and subsequent study of nuclear phosphatidylinositide-binding proteins is expected to bring new insights to this important biological question. Based on the success with phosphatidylinositides, it is expected that the screening of yeast surface-displayed human proteome libraries will be of general use for the discovery of novel small

  13. Utilizing Yeast Surface Human Proteome Display Libraries to Identify Small Molecule-Protein Interactions.

    PubMed

    Bidlingmaier, Scott; Liu, Bin

    2015-01-01

    The identification of proteins that interact with small bioactive molecules is a critical but often difficult and time-consuming step in understanding cellular signaling pathways or molecular mechanisms of drug action. Numerous methods for identifying small molecule-interacting proteins have been developed and utilized, including affinity-based purification followed by mass spectrometry analysis, protein microarrays, phage display, and three-hybrid approaches. Although all these methods have been used successfully, there remains a need for additional techniques for analyzing small molecule-protein interactions. A promising method for identifying small molecule-protein interactions is affinity-based selection of yeast surface-displayed human proteome libraries. Large and diverse libraries displaying human protein fragments on the surface of yeast cells have been constructed and subjected to FACS-based enrichment followed by comprehensive exon microarray-based output analysis to identify protein fragments with affinity for small molecule ligands. In a recent example, a proteome-wide search has been successfully carried out to identify cellular proteins binding to the signaling lipids PtdIns(4,5)P2 and PtdIns(3,4,5)P3. Known phosphatidylinositide-binding proteins such as pleckstrin homology domains were identified, as well as many novel interactions. Intriguingly, many novel nuclear phosphatidylinositide-binding proteins were discovered. Although the existence of an independent pool of nuclear phosphatidylinositides has been known about for some time, their functions and mechanism of action remain obscure. Thus, the identification and subsequent study of nuclear phosphatidylinositide-binding proteins is expected to bring new insights to this important biological question. Based on the success with phosphatidylinositides, it is expected that the screening of yeast surface-displayed human proteome libraries will be of general use for the discovery of novel small

  14. Small molecule screening with laser cytometry can be used to identify pro-survival molecules in human embryonic stem cells.

    PubMed

    Sherman, Sean P; Pyle, April D

    2013-01-01

    Differentiated cells from human embryonic stem cells (hESCs) provide an unlimited source of cells for use in regenerative medicine. The recent derivation of human induced pluripotent cells (hiPSCs) provides a potential supply of pluripotent cells that avoid immune rejection and could provide patient-tailored therapy. In addition, the use of pluripotent cells for drug screening could enable routine toxicity testing and evaluation of underlying disease mechanisms. However, prior to establishment of patient specific cells for cell therapy it is important to understand the basic regulation of cell fate decisions in hESCs. One critical issue that hinders the use of these cells is the fact that hESCs survive poorly upon dissociation, which limits genetic manipulation because of poor cloning efficiency of individual hESCs, and hampers production of large-scale culture of hESCs. To address the problems associated with poor growth in culture and our lack of understanding of what regulates hESC signaling, we successfully developed a screening platform that allows for large scale screening for small molecules that regulate survival. In this work we developed the first large scale platform for hESC screening using laser scanning cytometry and were able to validate this platform by identifying the pro-survival molecule HA-1077. These small molecules provide targets for both improving our basic understanding of hESC survival as well as a tool to improve our ability to expand and genetically manipulate hESCs for use in regenerative applications. PMID:23383009

  15. Harnessing Chaperones to Generate Small-Molecule Inhibitors of Amyloid β Aggregation

    NASA Astrophysics Data System (ADS)

    Gestwicki, Jason E.; Crabtree, Gerald R.; Graef, Isabella A.

    2004-10-01

    Protein aggregation is involved in the pathogenesis of neurodegenerative diseases and hence is considered an attractive target for therapeutic intervention. However, protein-protein interactions are exceedingly difficult to inhibit. Small molecules lack sufficient steric bulk to prevent interactions between large peptide surfaces. To yield potent inhibitors of β-amyloid (Aβ) aggregation, we synthesized small molecules that increase their steric bulk by binding to chaperones but also have a moiety available for interaction with Aβ. This strategy yields potent inhibitors of Aβ aggregation and could lead to therapeutics for Alzheimer's disease and other forms of neurodegeneration.

  16. Small-Molecule CD4-Mimics: Structure-Based Optimization of HIV-1 Entry Inhibition.

    PubMed

    Melillo, Bruno; Liang, Shuaiyi; Park, Jongwoo; Schön, Arne; Courter, Joel R; LaLonde, Judith M; Wendler, Daniel J; Princiotto, Amy M; Seaman, Michael S; Freire, Ernesto; Sodroski, Joseph; Madani, Navid; Hendrickson, Wayne A; Smith, Amos B

    2016-03-10

    The optimization, based on computational, thermodynamic, and crystallographic data, of a series of small-molecule ligands of the Phe43 cavity of the envelope glycoprotein gp120 of human immunodeficiency virus (HIV) has been achieved. Importantly, biological evaluation revealed that the small-molecule CD4 mimics (4-7) inhibit HIV-1 entry into target cells with both significantly higher potency and neutralization breadth than previous congeners, while maintaining high selectivity for the target virus. Their binding mode was characterized via thermodynamic and crystallographic studies. PMID:26985324

  17. Effective Long-Range Attraction between Protein Molecules in Solutions Studied by Small Angle Neutron Scattering

    SciTech Connect

    Liu Yun; Chen, W.-R.; Chen, S.-H.; Fratini, Emiliano; Baglioni, Piero

    2005-09-09

    Small angle neutron scattering intensity distributions taken from cytochrome C and lysozyme protein solutions show a rising intensity at a very small wave vector Q, which can be interpreted in terms of the presence of a weak long-range attraction between protein molecules. This interaction has a range several times that of the diameter of the protein molecule, much greater than the range of the screened electrostatic repulsion. We show evidence that this long-range attraction is closely related to the type of anion present and ion concentration in the solution.

  18. The Connectivity Map: using gene-expression signatures to connect small molecules, genes, and disease.

    PubMed

    Lamb, Justin; Crawford, Emily D; Peck, David; Modell, Joshua W; Blat, Irene C; Wrobel, Matthew J; Lerner, Jim; Brunet, Jean-Philippe; Subramanian, Aravind; Ross, Kenneth N; Reich, Michael; Hieronymus, Haley; Wei, Guo; Armstrong, Scott A; Haggarty, Stephen J; Clemons, Paul A; Wei, Ru; Carr, Steven A; Lander, Eric S; Golub, Todd R

    2006-09-29

    To pursue a systematic approach to the discovery of functional connections among diseases, genetic perturbation, and drug action, we have created the first installment of a reference collection of gene-expression profiles from cultured human cells treated with bioactive small molecules, together with pattern-matching software to mine these data. We demonstrate that this "Connectivity Map" resource can be used to find connections among small molecules sharing a mechanism of action, chemicals and physiological processes, and diseases and drugs. These results indicate the feasibility of the approach and suggest the value of a large-scale community Connectivity Map project. PMID:17008526

  19. Following the nanostructural molecular orientation guidelines for sulfur versus thiophene units in small molecule photovoltaic cells

    NASA Astrophysics Data System (ADS)

    Kim, Yu Jin; Park, Chan Eon

    2016-03-01

    In bulk heterojunction (BHJ) organic photovoltaics, particularly those using small molecules, electron donor and/or electron acceptor materials form a distributed network in the photoactive layer where critical photo-physical processes occur. Extensive research has recently focused on the importance of sulfur atoms in the small molecules. Little is known about the three-dimensional orientation of these sulfur atom-containing molecules. Herein, we report on our research concerning the heterojunction textures of the crystalline molecular orientation of small compounds having sulfur-containing units in the side chains, specifically, compounds known as DR3TSBDT that contain the alkylthio group and DR3TBDTT that does not. The improved performance of the DR3TBDTT-based devices, particularly in the photocurrent and the fill factor, was attributed to the large population of donor compound crystallites with a favorable face-on orientation along the perpendicular direction. This orientation resulted in efficient charge transport and a reduction in charge recombination. These findings underscore the great potential of small-molecule solar cells and suggest that even higher efficiencies can be achieved through materials development and molecular orientation control.In bulk heterojunction (BHJ) organic photovoltaics, particularly those using small molecules, electron donor and/or electron acceptor materials form a distributed network in the photoactive layer where critical photo-physical processes occur. Extensive research has recently focused on the importance of sulfur atoms in the small molecules. Little is known about the three-dimensional orientation of these sulfur atom-containing molecules. Herein, we report on our research concerning the heterojunction textures of the crystalline molecular orientation of small compounds having sulfur-containing units in the side chains, specifically, compounds known as DR3TSBDT that contain the alkylthio group and DR3TBDTT that does not

  20. Bond-forming reactions of small triply charged cations with neutral molecules.

    PubMed

    Fletcher, James D; Parkes, Michael A; Price, Stephen D

    2013-08-12

    Time-of-flight mass spectrometry reveals that atomic and small molecular triply charged cations exhibit extensive bond-forming chemistry, following gas-phase collisions with neutral molecules. These experiments show that at collision energies of a few eV, I(3+) reacts with a variety of small molecules to generate molecular monocations and molecular dications containing iodine. Xe(3+) and CS2(3+) react in a similar manner to I(3+), undergoing bond-forming reactions with neutrals. A simple model, involving relative product energetics and electrostatic interaction potentials, is used to account for the observed reactivity. PMID:23843367

  1. Small Molecule Inhibitors in Acute Myeloid Leukemia: From the Bench to the Clinic

    PubMed Central

    Al-Hussaini, Muneera; DiPersio, John F.

    2014-01-01

    Many patients with acute myeloid leukemia (AML) will eventually develop refractory or relapsed disease. In the absence of standard therapy for this population, there is currently an urgent unmet need for novel therapeutic agents. Targeted therapy with small molecule inhibitors (SMIs) represents a new therapeutic intervention that has been successful for the treatment of multiple tumors (e.g., gastrointestinal stromal tumors, chronic myelogenous leukemia). Hence, there has been great interest in generating selective small molecule inhibitors targeting critical pathways of proliferation and survival in AML. This review highlights a selective group of intriguing therapeutic agents and their presumed targets in both preclinical models and in early human clinical trials. PMID:25025370

  2. Small-Molecule High-Throughput Screening Utilizing Xenopus Egg Extract

    PubMed Central

    Broadus, Matthew R.; Yew, P. Renee; Hann, Stephen R.; Lee, Ethan

    2015-01-01

    Screens for small-molecule modulators of biological pathways typically utilize cultured cell lines, purified proteins, or, recently, model organisms (e.g., zebrafish, Drosophila, C. elegans). Herein, we describe a method for using Xenopus laevis egg extract, a biologically active and highly tractable cell-free system that recapitulates a legion of complex chemical reactions found in intact cells. Specifically, we focus on the use of a luciferase-based fusion system to identify small-molecule modulators that affect protein turnover. PMID:25618336

  3. Rational Design of Diketopyrrolopyrrole-Based Small Molecules as Donating Materials for Organic Solar Cells

    PubMed Central

    Jin, Ruifa; Wang, Kai

    2015-01-01

    A series of diketopyrrolopyrrole-based small molecules have been designed to explore their optical, electronic, and charge transport properties as organic solar cell (OSCs) materials. The calculation results showed that the designed molecules can lower the band gap and extend the absorption spectrum towards longer wavelengths. The designed molecules own the large longest wavelength of absorption spectra, the oscillator strength, and absorption region values. The optical, electronic, and charge transport properties of the designed molecules are affected by the introduction of different π-bridges and end groups. We have also predicted the mobility of the designed molecule with the lowest total energies. Our results reveal that the designed molecules are expected to be promising candidates for OSC materials. Additionally, the designed molecules are expected to be promising candidates for electron and/or hole transport materials. On the basis of our results, we suggest that molecules under investigation are suitable donors for [6,6]-phenyl-C61-butyric acid methyl ester (PCBM) and its derivatives as acceptors of OSCs. PMID:26343640

  4. A small-molecule inducer of PDX1 expression identified by high-throughput screening

    PubMed Central

    Yuan, Yuan; Hartland, Kate; Boskovic, Zarko; Wang, Yikai; Walpita, Deepika; Lysy, Philippe A.; Zhong, Cheng; Young, Damian W.; Kim, Young-kwon; Tolliday, Nicola J; Sokal, Etienne M.; Schreiber, Stuart L.; Wagner, Bridget K.

    2014-01-01

    SUMMARY Pancreatic and duodenal homeobox 1 (PDX1), a member of the homedomain-containing transcription factor family, is a key transcription factor important for both pancreas development and mature beta-cell function. The ectopic overexpression of Pdx1, Neurog3, and MafA in mice reprograms acinar cells to insulin-producing cells. We developed a qPCR-based gene-expression assay to screen >60,000 compounds for expression of each of these genes in the human PANC-1 ductal carcinoma cell line. We identified BRD7552, which up-regulated PDX expression in both primary human islets and ductal cells, and induced epigenetic changes in the PDX1 promoter consistent with transcriptional activation. Prolonged compound treatment induced insulin mRNA and protein, and enhanced insulin expression induced by the three-gene combination. These results provide a proof of principle for identifying small molecules that induce expression of transcription factors to control cellular reprogramming. PMID:24290880

  5. Dissecting allosteric effects of activator–coactivator complexes using a covalent small molecule ligand

    PubMed Central

    Wang, Ningkun; Lodge, Jean M.; Fierke, Carol A.; Mapp, Anna K.

    2014-01-01

    Allosteric binding events play a critical role in the formation and stability of transcriptional activator–coactivator complexes, perhaps in part due to the often intrinsically disordered nature of one or more of the constituent partners. The kinase-inducible domain interacting (KIX) domain of the master coactivator CREB binding protein/p300 is a conformationally dynamic domain that complexes with transcriptional activators at two discrete binding sites in allosteric communication. The complexation of KIX with the transcriptional activation domain of mixed-lineage leukemia protein leads to an enhancement of binding by the activation domain of CREB (phosphorylated kinase-inducible domain of CREB) to the second site. A transient kinetic analysis of the ternary complex formation aided by small molecule ligands that induce positive or negative cooperative binding reveals that positive cooperativity is largely governed by stabilization of the bound complex as indicated by a decrease in koff. Thus, this suggests the increased binding affinity for the second ligand is not due to an allosteric creation of a more favorable binding interface by the first ligand. This is consistent with data from us and from others indicating that the on rates of conformationally dynamic proteins approach the limits of diffusion. In contrast, negative cooperativity is manifested by alterations in both kon and koff, suggesting stabilization of the binary complex. PMID:25049401

  6. Human Sarcoma growth is sensitive to small-molecule mediated AXIN stabilization.

    PubMed

    De Robertis, Alessandra; Mennillo, Federica; Rossi, Marco; Valensin, Silvia; Tunici, Patrizia; Mori, Elisa; Caradonna, Nicola; Varrone, Maurizio; Salerno, Massimiliano

    2014-01-01

    Sarcomas are mesenchymal tumors showing high molecular heterogeneity, reflected at the histological level by the existence of more than fifty different subtypes. Genetic and epigenetic evidences link aberrant activation of the Wnt signaling to growth and progression of human sarcomas. This phenomenon, mainly accomplished by autocrine loop activity, is sustained by gene amplification, over-expression of Wnt ligands and co-receptors or epigenetic silencing of endogenous Wnt antagonists. We previously showed that pharmacological inhibition of Wnt signaling mediated by Axin stabilization produced in vitro and in vivo antitumor activity in glioblastoma tumors. Here, we report that targeting different sarcoma cell lines with the Wnt inhibitor/Axin stabilizer SEN461 produces a less transformed phenotype, as supported by modulation of anchorage-independent growth in vitro. At the molecular level, SEN461 treatment enhanced the stability of the scaffold protein Axin1, a key negative regulator of the Wnt signaling with tumor suppressor function, resulting in downstream effects coherent with inhibition of canonical Wnt signaling. Genetic phenocopy of small molecule Axin stabilization, through Axin1 over-expression, coherently resulted in strong impairment of soft-agar growth. Importantly, sarcoma growth inhibition through pharmacological Axin stabilization was also observed in a xenograft model in vivo in female CD-1 nude mice. Our findings suggest the usefulness of Wnt inhibitors with Axin stabilization activity as a potentialyl clinical relevant strategy for certain types of sarcomas. PMID:24842792

  7. Human Sarcoma Growth Is Sensitive to Small-Molecule Mediated AXIN Stabilization

    PubMed Central

    Rossi, Marco; Valensin, Silvia; Tunici, Patrizia; Mori, Elisa; Caradonna, Nicola; Varrone, Maurizio; Salerno, Massimiliano

    2014-01-01

    Sarcomas are mesenchymal tumors showing high molecular heterogeneity, reflected at the histological level by the existence of more than fifty different subtypes. Genetic and epigenetic evidences link aberrant activation of the Wnt signaling to growth and progression of human sarcomas. This phenomenon, mainly accomplished by autocrine loop activity, is sustained by gene amplification, over-expression of Wnt ligands and co-receptors or epigenetic silencing of endogenous Wnt antagonists. We previously showed that pharmacological inhibition of Wnt signaling mediated by Axin stabilization produced in vitro and in vivo antitumor activity in glioblastoma tumors. Here, we report that targeting different sarcoma cell lines with the Wnt inhibitor/Axin stabilizer SEN461 produces a less transformed phenotype, as supported by modulation of anchorage-independent growth in vitro. At the molecular level, SEN461 treatment enhanced the stability of the scaffold protein Axin1, a key negative regulator of the Wnt signaling with tumor suppressor function, resulting in downstream effects coherent with inhibition of canonical Wnt signaling. Genetic phenocopy of small molecule Axin stabilization, through Axin1 over-expression, coherently resulted in strong impairment of soft-agar growth. Importantly, sarcoma growth inhibition through pharmacological Axin stabilization was also observed in a xenograft model in vivo in female CD-1 nude mice. Our findings suggest the usefulness of Wnt inhibitors with Axin stabilization activity as a potentialyl clinical relevant strategy for certain types of sarcomas. PMID:24842792

  8. Metabolic targeting of malignant tumors: small-molecule inhibitors of bioenergetic flux.

    PubMed

    Mathupala, Saroj P

    2011-01-01

    Metabolism in tumors deviates significantly from that of normal tissues. Increasingly, the underlying aberrant metabolic pathways are being considered as novel targets for cancer therapy. Denoted "metabolic targeting", small molecule drugs are under investigation for focused inhibition of key metabolic steps that are utilized by tumors, since such inhibitors should harbor minimal toxicity towards surrounding normal tissues. This review will examine the primary biochemical pathways that tumors harness to enhance their bioenergetic capacity, which in turn, help their rapid proliferation and metastasis within the host. It is hoped that "metabolite-mimetic" drugs can be utilized to interfere with metabolic flux pathways active within the tumor, and across tumor-microenvironment boundary. In fact, the major pathways of mammalian metabolism, i.e., the carbohydrate, amino-acid, and fatty-acid metabolic pathways have been examined as putative targets for drug development, with some drug candidates advancing to phase II/III stages. In this regard, glucose metabolism, i.e., the glycolytic pathway - that predominates the bio-energetic flux in tumors, and the associated mitochondrial metabolism have received the most attention as suitable "druggable" targets, focused either at the pathway enzymes or at the plasma-membrane-bound metabolite transporters. Outlined in this review are pre-clinical studies that have led to the discovery of promising drug candidates to target tumor-metabolic flux, and ensuing patents, with descriptions of the biochemical rationale for the combinatorial strategy of a particular metabolic pathway-drug candidate pair. PMID:21110820

  9. Polymorphic Phase-Dependent Optical and Electrical Properties of a Diketopyrrolopyrrole-Based Small Molecule.

    PubMed

    Thankaraj Salammal, Shabi; Zhang, Zhongqiang; Chen, Jiehuan; Chattopadhyay, Basab; Wu, Jiake; Fu, Lei; Fan, Congcheng; Chen, Hongzheng

    2016-08-17

    Four different polymorphic conformations of diethyl 5,5'-[5,5'-[2,5-bis(2-ethylhexyl)-3,6-dioxo-2,3,5,6-tetrahydropyrrolo[3,4-c]pyrrole-1,4-diyl]bis(thiophene-5,2-diyl)]difuran-2-carboxylate (DPP-(CF)2), namely, DPP-(CF)2-α, DPP-(CF)2-β, DPP-(CF)2-γ, and DPP-(CF)2-ω, were identified from X-ray diffraction analysis conducted on their thin films and single crystals. Highly crystalline and well-textured thin films of these four polymorphs were successfully prepared via postgrowth solvent vapor and thermal annealing treatments to investigate the polymorphic phase-dependent optical and electrical properties of DPP-(CF)2. Interestingly, during the phase transition from DPP-(CF)2-α to DPP-(CF)2-ω, the optical band gap decreases from 1.75 to 1.5 eV because of the enhanced π-π interaction between the neighboring molecules. Except for DPP-(CF)2-γ, the other three phases show ambipolar charge transport. Although DPP-(CF)2-β and DPP-(CF)2-γ exhibit a similar way of packing, a small increment in the π-π-stacking distance (0.006 Å) and twist conformation of the grafted electron-donating moieties of DPP-(CF)2-γ are found to reduce its hole mobility. PMID:27434658

  10. Functional Rescue of F508del-CFTR Using Small Molecule Correctors

    PubMed Central

    Molinski, Steven; Eckford, Paul D. W.; Pasyk, Stan; Ahmadi, Saumel; Chin, Stephanie; Bear, Christine E.

    2012-01-01

    High-throughput screens for small molecules that are effective in “correcting” the functional expression of F508del-CFTR have yielded several promising hits. Two such compounds are currently in clinical trial. Despite this success, it is clear that further advances will be required in order to restore 50% or greater of wild-type CFTR function to the airways of patients harboring the F508del-CFTR protein. Progress will be enhanced by our better understanding of the molecular and cellular defects caused by the F508del mutation, present in 90% of CF patients. The goal of this chapter is to review the current understanding of defects caused by F508del in the CFTR protein and in CFTR-mediated interactions important for its biosynthesis, trafficking, channel function, and stability at the cell surface. Finally, we will discuss the gaps in our knowledge regarding the mechanism of action of existing correctors, the unmet need to discover compounds which restore proper CFTR structure and function in CF affected tissues and new strategies for therapy development. PMID:23055971

  11. Cardioprotective Potentials of Plant-Derived Small Molecules against Doxorubicin Associated Cardiotoxicity

    PubMed Central

    Ojha, Shreesh; Al Taee, Hasan; Goyal, Sameer; Mahajan, Umesh B.; Patil, Chandrgouda R.; Arya, D. S.; Rajesh, Mohanraj

    2016-01-01

    Doxorubicin (DOX) is a potent and widely used anthracycline antibiotic for the treatment of several malignancies. Unfortunately, the clinical utility of DOX is often restricted due to the elicitation of organ toxicity. Particularly, the increased risk for the development of dilated cardiomyopathy by DOX among the cancer survivors warrants major attention from the physicians as well as researchers to develop adjuvant agents to neutralize the noxious effects of DOX on the healthy myocardium. Despite these pitfalls, the use of traditional cytotoxic drugs continues to be the mainstay treatment for several types of cancer. Recently, phytochemicals have gained attention for their anticancer, chemopreventive, and cardioprotective activities. The ideal cardioprotective agents should not compromise the clinical efficacy of DOX and should be devoid of cumulative or irreversible toxicity on the naïve tissues. Furthermore, adjuvants possessing synergistic anticancer activity and quelling of chemoresistance would significantly enhance the clinical utility in combating DOX-induced cardiotoxicity. The present review renders an overview of cardioprotective effects of plant-derived small molecules and their purported mechanisms against DOX-induced cardiotoxicity. Phytochemicals serve as the reservoirs of pharmacophore which can be utilized as templates for developing safe and potential novel cardioprotective agents in combating DOX-induced cardiotoxicity. PMID:27313831

  12. Triple quadrupole linear ion trap mass spectrometer for the analysis of small molecules and macromolecules.

    PubMed

    Hopfgartner, Gérard; Varesio, Emmanuel; Tschäppät, Viviane; Grivet, Chantal; Bourgogne, Emmanuel; Leuthold, Luc Alexis

    2004-08-01

    Recently, linear ion traps (LITs) have been combined with quadrupole (Q), time-of-flight (TOF) and Fourier transform ion cyclotron resonance (FT-ICR) mass spectrometry (MS). LITs can be used either as ion accumulation devices or as commercially available, stand-alone mass spectrometers with MSn capabilities. The combination of triple quadrupole MS with LIT technology in the form of an instrument of configuration QqLIT, using axial ejection, is particularly interesting, because this instrument retains the classical triple quadrupole scan functions such as selected reaction monitoring (SRM), product ion (PI), neutral loss (NL) and precursor ion (PC) while also providing access to sensitive ion trap experiments. For small molecules, quantitative and qualitative analysis can be performed using the same instrument. In addition, for peptide analysis, the enhanced multiply charged (EMC) scan allows an increase in selectivity, while the time-delayed fragmentation (TDF) scan provides additional structural information. Various methods of operating the hybrid instrument are described for the case of the commercial Q TRAP (AB/MDS Sciex) and applications to drug metabolism analysis, quantitative confirmatory analysis, peptides analysis and automated nanoelectrospray (ESI-chip-MS) analysis are discussed. PMID:15329837

  13. The artificial control of enhanced optical processes in fluorescent molecules on high-emittance metasurfaces

    NASA Astrophysics Data System (ADS)

    Iwanaga, Masanobu; Choi, Bongseok; Miyazaki, Hideki T.; Sugimoto, Yoshimasa

    2016-05-01

    Plasmon-enhanced optical processes in molecules have been extensively but individually explored for Raman scattering, fluorescence, and infrared light absorption. In contrast to recent progress in the interfacial control of hot electrons in plasmon-semiconductor hybrid systems, plasmon-molecule hybrid systems have remained to be a conventional scheme, mainly assuming electric-field enhancement. This was because it was difficult to control the plasmon-molecule interface in a well-controlled manner. We here experimentally substantiate an obvious change in artificially enhanced optical processes of fluorescence/Raman scattering in fluorescent molecules on high-emittance plasmo-photonic metasurfaces with/without a self-assembled monolayer of sub-nm thickness. These results indicate that the enhanced optical processes were successfully selected under artificial configurations without any additional chemical treatment that modifies the molecules themselves. Although Raman-scattering efficiency is generally weak in high-fluorescence-yield molecules, it was found that Raman scattering becomes prominent around the molecular fingerprint range on the metasurfaces, being enhanced by more than 2000 fold at the maximum for reference signals. In addition, the highly and uniformly enhancing metasurfaces are able to serve as two-way functional, reproducible, and wavelength-tunable platforms to detect molecules at very low densities, being distinct from other platforms reported so far. The change in the enhanced signals suggests that energy diagrams in fluorescent molecules are changed in the configuration that includes the metal-molecule interface, meaning that plasmon-molecule hybrid systems are rich in the phenomena beyond the conventional scheme.Plasmon-enhanced optical processes in molecules have been extensively but individually explored for Raman scattering, fluorescence, and infrared light absorption. In contrast to recent progress in the interfacial control of hot electrons

  14. Fluorescence Enhancement of Molecules Inside a Gold Nanomatryoshka

    PubMed Central

    2015-01-01

    Metallic nanoparticles exhibiting plasmonic Fano resonances can provide large enhancements of their internal electric near field. Here we show that nanomatryoshkas, nanoparticles consisting of an Au core, an interstitial nanoscale SiO2 layer, and an Au shell layer, can selectively provide either a strong enhancement or a quenching of the spontaneous emission of fluorophores dispersed within their internal dielectric layer. This behavior can be understood by taking into account the near-field enhancement induced by the Fano resonance of the nanomatryoshka, which is responsible for enhanced absorption of the fluorophores incorporated into the nanocomplex. The combination of compact size and enhanced light emission with internal encapsulation of the fluorophores for increased biocompatibility suggests outstanding potential for this type of nanoparticle complex in biomedical applications. PMID:24738706

  15. Dextran hydrogel coated surface plasmon resonance imaging (SPRi) sensor for sensitive and label-free detection of small molecule drugs

    NASA Astrophysics Data System (ADS)

    Li, Shaopeng; Yang, Mo; Zhou, Wenfei; Johnston, Trevor G.; Wang, Rui; Zhu, Jinsong

    2015-11-01

    The label-free and sensitive detection of small molecule drugs on SPRi is still a challenging task, mainly due to the limited surface immobilization capacity of the sensor. In this research, a dextran hydrogel-coated gold sensor chip for SPRi was successfully fabricated via photo-cross-linking for enhanced surface immobilization capacity. The density of the dextran hydrogel was optimized for protein immobilization and sensitive small molecule detection. The protein immobilization capacity of the hydrogel was 10 times greater than a bare gold surface, and 20 times greater than an 11-mercaptoundecanoic acid (MUA) surface. Such a drastic improvement in immobilization capacity allowed the SPRi sensor to detect adequate response signals when probing small molecule binding events. The binding signal of 4 nM liquid-phase biotin to streptavidin immobilized on the dextran surface reached 435 RU, while no response was observed on bare gold or MUA surfaces. The dextran hydrogel-coated SPRi sensor was also applied in a kinetic study of the binding between an immunosuppressive drug (FK506) and its target protein (FKBP12) in a high-throughput microarray format. The measured binding affinity was shown to be consistent with reported literature values, and a detection limit of 0.5 nM was achieved.

  16. The artificial control of enhanced optical processes in fluorescent molecules on high-emittance metasurfaces.

    PubMed

    Iwanaga, Masanobu; Choi, Bongseok; Miyazaki, Hideki T; Sugimoto, Yoshimasa

    2016-06-01

    Plasmon-enhanced optical processes in molecules have been extensively but individually explored for Raman scattering, fluorescence, and infrared light absorption. In contrast to recent progress in the interfacial control of hot electrons in plasmon-semiconductor hybrid systems, plasmon-molecule hybrid systems have remained to be a conventional scheme, mainly assuming electric-field enhancement. This was because it was difficult to control the plasmon-molecule interface in a well-controlled manner. We here experimentally substantiate an obvious change in artificially enhanced optical processes of fluorescence/Raman scattering in fluorescent molecules on high-emittance plasmo-photonic metasurfaces with/without a self-assembled monolayer of sub-nm thickness. These results indicate that the enhanced optical processes were successfully selected under artificial configurations without any additional chemical treatment that modifies the molecules themselves. Although Raman-scattering efficiency is generally weak in high-fluorescence-yield molecules, it was found that Raman scattering becomes prominent around the molecular fingerprint range on the metasurfaces, being enhanced by more than 2000 fold at the maximum for reference signals. In addition, the highly and uniformly enhancing metasurfaces are able to serve as two-way functional, reproducible, and wavelength-tunable platforms to detect molecules at very low densities, being distinct from other platforms reported so far. The change in the enhanced signals suggests that energy diagrams in fluorescent molecules are changed in the configuration that includes the metal-molecule interface, meaning that plasmon-molecule hybrid systems are rich in the phenomena beyond the conventional scheme. PMID:27227964

  17. Discovery and Development of Small Molecule Allosteric Modulators of Glycoprotein Hormone Receptors

    PubMed Central

    Nataraja, Selvaraj G.; Yu, Henry N.; Palmer, Stephen S.

    2015-01-01

    Glycoprotein hormones, follicle-stimulating hormone (FSH), luteinizing hormone (LH), and thyroid-stimulating hormone (TSH) are heterodimeric proteins with a common α-subunit and hormone-specific β-subunit. These hormones are dominant regulators of reproduction and metabolic processes. Receptors for the glycoprotein hormones belong to the family of G protein-coupled receptors. FSH receptor (FSHR) and LH receptor are primarily expressed in somatic cells in ovary and testis to promote egg and sperm production in women and men, respectively. TSH receptor is expressed in thyroid cells and regulates the secretion of T3 and T4. Glycoprotein hormones bind to the large extracellular domain of the receptor and cause a conformational change in the receptor that leads to activation of more than one intracellular signaling pathway. Several small molecules have been described to activate/inhibit glycoprotein hormone receptors through allosteric sites of the receptor. Small molecule allosteric modulators have the potential to be administered orally to patients, thus improving the convenience of treatment. It has been a challenge to develop a small molecule allosteric agonist for glycoprotein hormones that can mimic the agonistic effects of the large natural ligand to activate similar signaling pathways. However, in the past few years, there have been several promising reports describing distinct chemical series with improved potency in preclinical models. In parallel, proposal of new structural model for FSHR and in silico docking studies of small molecule ligands to glycoprotein hormone receptors provide a giant leap on the understanding of the mechanism of action of the natural ligands and new chemical entities on the receptors. This review will focus on the current status of small molecule allosteric modulators of glycoprotein hormone receptors, their effects on common signaling pathways in cells, their utility for clinical application as demonstrated in preclinical models

  18. Kinetics of small molecule interactions with membrane proteins in single cells measured with mechanical amplification

    PubMed Central

    Guan, Yan; Shan, Xiaonan; Zhang, Fenni; Wang, Shaopeng; Chen, Hong-Yuan; Tao, Nongjian

    2015-01-01

    Measuring small molecule interactions with membrane proteins in single cells is critical for understanding many cellular processes and for screening drugs. However, developing such a capability has been a difficult challenge. We show that molecular interactions with membrane proteins induce a mechanical deformation in the cellular membrane, and real-time monitoring of the deformation with subnanometer resolution allows quantitative analysis of small molecule–membrane protein interaction kinetics in single cells. This new strategy provides mechanical amplification of small binding signals, making it possible to detect small molecule interactions with membrane proteins. This capability, together with spatial resolution, also allows the study of the heterogeneous nature of cells by analyzing the interaction kinetics variability between different cells and between different regions of a single cell. PMID:26601298

  19. Highly Crystalline Films of Organic Small Molecules with Alkyl Chains Fabricated by Weak Epitaxy Growth.

    PubMed

    Zhu, Yangjie; Chen, Weiping; Wang, Tong; Wang, Haibo; Wang, Yue; Yan, Donghang

    2016-05-12

    Because side-chain engineering of organic conjugated molecules has been widely utilized to tune organic solid-state optoelectronic properties, the achievement of their high-quality films is important for realizing high-performance devices. Here, highly crystalline films of an organic molecule with short alkyl chains, 5,8,15,18-tetrabutyl-5,8,15,18-tetrahydroindolo[3,2-a]indole[30,20:5,6]quinacridone (C4-IDQA), are fabricated by weak epitaxy growth, and highly oriented, large-area, and continuous films are obtained. Because of the soft matter properties, the C4-IDQA molecules can adjust themselves to realize commensurate epitaxy growth on the inducing layers and exhibited good lattice matching in the thin film phase. The crystalline phase is also observed in thicker C4-IDQA films. The growth behavior of C4-IDQA on the inducing layer is further investigated, including the strong dependence of film morphologies on substrate temperatures and deposition rates due to the poor diffusion ability of C4-IDQA molecules. Moreover, highly crystalline films and high electron field-effect mobility are also obtained for the small molecule N,N'-dioctyl-3,4:9,10-perylene tetracarboxylic diimide (C8-PTCDI), which demonstrate that the weak epitaxy growth method could be an effective way to fabricate highly crystalline films of organic small molecules with flexible side chains. PMID:27116036

  20. UV and VUV spectroscopy and photochemistry of small molecules in a supersonic jet

    NASA Technical Reports Server (NTRS)

    Ruehl, E.; Vaida, V.

    1990-01-01

    UV and VUV absorption and emission spectroscopy is used to probe jet cooled molecules, free radicals, and clusters in the gas phase. Due to efficient cooling inhomogeneous effects on spectral line widths are eliminated. Therefore from these spectra, both structural and dynamical information is obtained. The photoproducts of these reactions are probed by resonance enhanced multiphoton ionization.

  1. Whispering gallery microresonators for second harmonic light generation from a low number of small molecules

    PubMed Central

    Dominguez-Juarez, J.L.; Kozyreff, G.; Martorell, Jordi

    2011-01-01

    Unmarked sensitive detection of molecules is needed in environmental pollution monitoring, disease diagnosis, security screening systems and in many other situations in which a substance must be identified. When molecules are attached or adsorbed onto an interface, detecting their presence is possible using second harmonic light generation, because at interfaces the inversion symmetry is broken. However, such light generation usually requires either dense matter or a large number of molecules combined with high-power laser sources. Here we show that using high-Q spherical microresonators and low average power, between 50 and 100 small non-fluorescent molecules deposited on the outer surface of the microresonator can generate a detectable change in the second harmonic light. This generation requires phase matching in the whispering gallery modes, which we achieved using a new procedure to periodically pattern, with nanometric precision, a molecular surface monolayer. PMID:21448153

  2. Identification and optimization of small-molecule agonists of the human relaxin hormone receptor RXFP1.

    PubMed

    Xiao, Jingbo; Huang, Zaohua; Chen, Catherine Z; Agoulnik, Irina U; Southall, Noel; Hu, Xin; Jones, Raisa E; Ferrer, Marc; Zheng, Wei; Agoulnik, Alexander I; Marugan, Juan J

    2013-01-01

    The anti-fibrotic, vasodilatory and pro-angiogenic therapeutic properties of recombinant relaxin peptide hormone have been investigated in several diseases, and recent clinical trial data has shown benefit in treating acute heart failure. However, the remodelling capacity of these peptide hormones is difficult to study in chronic settings because of their short half-life and the need for intravenous administration. Here we present the first small-molecule series of human relaxin/insulin-like family peptide receptor 1 agonists. These molecules display similar efficacy as the natural hormone in several functional assays. Mutagenesis studies indicate that the small molecules activate relaxin receptor through an allosteric site. These compounds have excellent physical and in vivo pharmacokinetic properties to support further investigation of relaxin biology and animal efficacy studies of the therapeutic benefits of relaxin/insulin-like family peptide receptor 1 activation. PMID:23764525

  3. Identification and optimization of small-molecule agonists of the human relaxin hormone receptor RXFP1

    PubMed Central

    Xiao, Jingbo; Huang, Zaohua; Chen, Catherine Z.; Agoulnik, Irina U.; Southall, Noel; Hu, Xin; Jones, Raisa E.; Ferrer, Marc; Zheng, Wei; Agoulnik, Alexander I.; Marugan, Juan J.

    2016-01-01

    The anti-fibrotic, vasodilatory, and pro-angiogenic therapeutic properties of recombinant relaxin peptide hormone have been investigated in several diseases and recent clinical trial data has shown benefit in treating acute heart failure. However, the remodeling capacity of these peptide hormones is difficult to study in chronic settings due to their short half-life and the need for intravenous administration. Here we present the first small-molecule series of human relaxin receptor 1 (RXFP1) agonists. These molecules display similar efficacy as the natural hormone in several functional assays. Mutagenesis studies indicate that the small molecules activate relaxin receptor through an allosteric site. These compounds have excellent physical and in vivo pharmacokinetic properties to support further investigation of relaxin biology and animal efficacy studies of the therapeutic benefits of RXFP1 activation. PMID:23764525

  4. Self-assembled nanoparticle of common food constituents that carries a sparingly soluble small molecule.

    PubMed

    Bhopatkar, Deepak; Feng, Tao; Chen, Feng; Zhang, Genyi; Carignano, Marcelo; Park, Sung Hyun; Zhuang, Haining; Campanella, Osvaldo H; Hamaker, Bruce R

    2015-05-01

    A previously reported nanoparticle formed through the self-assembly of common food constituents (amylose, protein, and fatty acids) was shown to have the capacity to carry a sparingly soluble small molecule (1-naphthol) in a dispersed system. Potentiometric titration showed that 1-naphthol locates in the lumen of the amylose helix of the nanoparticle. This finding was further supported by calorimetric measurements, showing higher enthalpies of dissociation and reassociation in the presence of 1-naphthol. Visually, the 1-naphthol-loaded nanoparticle appeared to be well-dispersed in aqueous solution. Molecular dynamics simulation showed that the self-assembly was favorable, and at 500 ns, the 1-naphthol molecule resided in the helix of the amylose lumen in proximity to the hydrophobic tail of the fatty acid. Thus, sparingly soluble small molecules, such as some nutraceuticals or drugs, could be incorporated and delivered by this soft nanoparticle carrier. PMID:25880884

  5. Transcriptional analysis of antiviral small molecule therapeutics as agonists of the RLR pathway

    PubMed Central

    Green, R.R.; Wilkins, C.; Pattabhi, S.; Dong, R.; Loo, Y.; Gale, M.

    2016-01-01

    The recognition of pathogen associated molecular patterns (PAMPs) by pattern recognition receptors (PRR) during viral infection initiates the induction of antiviral signaling pathways, including activation of the Interferon Regulator Factor 3 (IRF3). We identified small molecule compounds that activate IRF3 through MAVS, thereby inhibiting infection by viruses of the families Flaviviridae (West Nile virus, dengue virus and hepatitis C virus), Filoviridae (Ebola virus), Orthomyxoviridae (influenza A virus), Arenaviridae (Lassa virus) and Paramyxoviridae (respiratory syncytial virus, Nipah virus) (1). In this study, we tested a lead compound along with medicinal chemistry-derived analogs to compare the gene transcriptional profiles induced by these molecules to that of other known MAVS-dependent IRF3 agonists. Transcriptional analysis of these small molecules revealed the induction of specific antiviral genes and identified a novel module of host driven immune regulated genes that suppress infection of a range of RNA viruses. Microarray data can be found in Gene Expression Omnibus (GSE74047). PMID:26981429

  6. Transcriptional analysis of antiviral small molecule therapeutics as agonists of the RLR pathway.

    PubMed

    Green, R R; Wilkins, C; Pattabhi, S; Dong, R; Loo, Y; Gale, M

    2016-03-01

    The recognition of pathogen associated molecular patterns (PAMPs) by pattern recognition receptors (PRR) during viral infection initiates the induction of antiviral signaling pathways, including activation of the Interferon Regulator Factor 3 (IRF3). We identified small molecule compounds that activate IRF3 through MAVS, thereby inhibiting infection by viruses of the families Flaviviridae (West Nile virus, dengue virus and hepatitis C virus), Filoviridae (Ebola virus), Orthomyxoviridae (influenza A virus), Arenaviridae (Lassa virus) and Paramyxoviridae (respiratory syncytial virus, Nipah virus) (1). In this study, we tested a lead compound along with medicinal chemistry-derived analogs to compare the gene transcriptional profiles induced by these molecules to that of other known MAVS-dependent IRF3 agonists. Transcriptional analysis of these small molecules revealed the induction of specific antiviral genes and identified a novel module of host driven immune regulated genes that suppress infection of a range of RNA viruses. Microarray data can be found in Gene Expression Omnibus (GSE74047). PMID:26981429

  7. Design of a bioactive small molecule that targets r(AUUCU) repeats in spinocerebellar ataxia 10.

    PubMed

    Yang, Wang-Yong; Gao, Rui; Southern, Mark; Sarkar, Partha S; Disney, Matthew D

    2016-01-01

    RNA is an important target for chemical probes of function and lead therapeutics; however, it is difficult to target with small molecules. One approach to tackle this problem is to identify compounds that target RNA structures and utilize them to multivalently target RNA. Here we show that small molecules can be identified to selectively bind RNA base pairs by probing a library of RNA-focused small molecules. A small molecule that selectively binds AU base pairs informed design of a dimeric compound (2AU-2) that targets the pathogenic RNA, expanded r(AUUCU) repeats, that causes spinocerebellar ataxia type 10 (SCA10) in patient-derived cells. Indeed, 2AU-2 (50 nM) ameliorates various aspects of SCA10 pathology including improvement of mitochondrial dysfunction, reduced activation of caspase 3, and reduction of nuclear foci. These studies provide a first-in-class chemical probe to study SCA10 RNA toxicity and potentially define broadly applicable compounds targeting RNA AU base pairs in cells. PMID:27248057

  8. Release of Small Molecules during Germination of Spores of Bacillus Species▿

    PubMed Central

    Setlow, Barbara; Wahome, Paul G.; Setlow, Peter

    2008-01-01

    Free amino acids, dipicolinic acid, and unidentified small molecules were released early in Bacillus spore germination before hydrolysis of the peptidoglycan cortex, but adenine nucleotides and 3-phosphoglycerate were not. These results indicate that early in germination there is a major selective change in the permeability of the spore's inner membrane. PMID:18469112

  9. Small-Molecule-Directed Hepatocyte-Like Cell Differentiation of Human Pluripotent Stem Cells.

    PubMed

    Mathapati, Santosh; Siller, Richard; Impellizzeri, Agata A R; Lycke, Max; Vegheim, Karianne; Almaas, Runar; Sullivan, Gareth J

    2016-01-01

    Hepatocyte-like cells (HLCs) generated in vitro from human pluripotent stem cells (hPSCs) provide an invaluable resource for basic research, regenerative medicine, drug screening, toxicology, and modeling of liver disease and development. This unit describes a small-molecule-driven protocol for in vitro differentiation of hPSCs into HLCs without the use of growth factors. hPSCs are coaxed through a developmentally relevant route via the primitive streak to definitive endoderm (DE) using the small molecule CHIR99021 (a Wnt agonist), replacing the conventional growth factors Wnt3A and activin A. The small-molecule-derived DE is then differentiated to hepatoblast-like cells in the presence of dimethyl sulfoxide. The resulting hepatoblasts are then differentiated to HLCs with N-hexanoic-Tyr, Ile-6 aminohexanoic amide (Dihexa, a hepatocyte growth factor agonist) and dexamethasone. The protocol provides an efficient and reproducible procedure for differentiation of hPSCs into HLCs utilizing small molecules. © 2016 by John Wiley & Sons, Inc. PMID:27532814

  10. A physicist's view of biotechnology. [small molecule crystal growth in space

    NASA Technical Reports Server (NTRS)

    Kroes, Roger L.

    1987-01-01

    Theories and techniques for small molecule crystal growth are reviewed, with emphasis on space processing possibilities, particularly for protein crystal growth. The general principles of nucleation, growth, and mass and heat transport are first discussed. Optical systems using schlieren, shadowgraph, and holographic techniques are considered, and are illustrated with the example of the NASA developed Fluids Experiment System flow aboard Spacelab 3.

  11. In vitro selection and amplification protocols for isolation of aptameric sensors for small molecules.

    PubMed

    Yang, Kyung-Ae; Pei, Renjun; Stojanovic, Milan N

    2016-08-15

    We recently optimized a procedure that directly yields aptameric sensors for small molecules in so-called structure-switching format. The protocol has a high success rate, short time, and is sufficiently simple to be readily implemented in a non-specialist laboratory. We provide a stepwise guide to this selection protocol. PMID:27155227

  12. Small Molecule-Assisted Exfoliation of Layered Zirconium Phosphate Nanoplatelets by Ionic Liquids.

    PubMed

    Xia, Fangqing; Yong, Huaisong; Han, Xiao; Sun, Dazhi

    2016-12-01

    Exfoliation of layered inorganic nanomaterials into single-layered sheets has been widely interested in materials chemistry and composite fabrication. Here, we report the exfoliation of layered zirconium phosphate nanoplatelets by using small molecule intercalating agents in ionic liquids, which opens a new platform for fabricating single-layered inorganic materials from synthetic layered compounds. PMID:27460596

  13. Design of a bioactive small molecule that targets r(AUUCU) repeats in spinocerebellar ataxia 10

    PubMed Central

    Yang, Wang-Yong; Gao, Rui; Southern, Mark; Sarkar, Partha S.; Disney, Matthew D.

    2016-01-01

    RNA is an important target for chemical probes of function and lead therapeutics; however, it is difficult to target with small molecules. One approach to tackle this problem is to identify compounds that target RNA structures and utilize them to multivalently target RNA. Here we show that small molecules can be identified to selectively bind RNA base pairs by probing a library of RNA-focused small molecules. A small molecule that selectively binds AU base pairs informed design of a dimeric compound (2AU-2) that targets the pathogenic RNA, expanded r(AUUCU) repeats, that causes spinocerebellar ataxia type 10 (SCA10) in patient-derived cells. Indeed, 2AU-2 (50 nM) ameliorates various aspects of SCA10 pathology including improvement of mitochondrial dysfunction, reduced activation of caspase 3, and reduction of nuclear foci. These studies provide a first-in-class chemical probe to study SCA10 RNA toxicity and potentially define broadly applicable compounds targeting RNA AU base pairs in cells. PMID:27248057

  14. Small molecule-assisted fabrication of black phosphorus quantum dots with a broadband nonlinear optical response.

    PubMed

    Gao, Lin-Feng; Xu, Jing-Yin; Zhu, Zhi-Yuan; Hu, Chen-Xia; Zhang, Lei; Wang, Qiang; Zhang, Hao-Li

    2016-08-18

    Ultrathin BP QDs with a uniform size of ∼3.4 nm were prepared via small molecule-assisted liquid phase exfoliation and they exhibited superior broadband nonlinear saturable absorption promising for nonlinear optical applications. Laser photolysis measurement implied that the nonlinear response origin was related to the long-lived electron-hole pairs delocalized within the BP QDs. PMID:27491959

  15. TNF Superfamily Protein–Protein Interactions: Feasibility of Small-Molecule Modulation

    PubMed Central

    Song, Yun; Buchwald, Peter

    2015-01-01

    The tumor necrosis factor (TNF) superfamily (TNFSF) contains about thirty structurally related receptors (TNFSFRs) and about twenty protein ligands that bind to one or more of these receptors. Almost all of these cell surface protein-protein interactions (PPIs) represent high-value therapeutic targets for inflammatory or immune modulation in autoimmune diseases, transplant recipients, or cancers, and there are several biologics including antibodies and fusion proteins targeting them that are in various phases of clinical development. Small-molecule inhibitors or activators could represent possible alternatives if the difficulties related to the targeting of protein-protein interactions by small molecules can be addressed. Compounds proving the feasibility of such approaches have been identified through different drug discovery approaches for a number of these TNFSFR-TNFSF type PPIs including CD40-CD40L, BAFFR-BAFF, TRAIL-DR5, and OX40-OX40L. Corresponding structural, signaling, and medicinal chemistry aspects are briefly reviewed here. While none of these small-molecule modulators identified so far seems promising enough to be pursued for clinical development, they provide proof-of-principle evidence that these interactions are susceptible to small-molecule modulation and can serve as starting points toward the identification of more potent and selective candidates. PMID:25706111

  16. A Direct, Competitive Enzyme-Linked Immunosorbent Assay (ELISA) as a Quantitative Technique for Small Molecules

    ERIC Educational Resources Information Center

    Powers, Jennifer L.; Rippe, Karen Duda; Imarhia, Kelly; Swift, Aileen; Scholten, Melanie; Islam, Naina

    2012-01-01

    ELISA (enzyme-linked immunosorbent assay) is a widely used technique with applications in disease diagnosis, detection of contaminated foods, and screening for drugs of abuse or environmental contaminants. However, published protocols with a focus on quantitative detection of small molecules designed for teaching laboratories are limited. A…

  17. Conformational Heat Capacity of Interacting Systems of Polymers and Small Molecules

    NASA Astrophysics Data System (ADS)

    Pyda, M.; Bartkowiak, M.; Wunderlich, B.

    1998-03-01

    The total heat capacity of systems of macromolecules interacting with small molecules is estimated as a sum of the vibrational, external and conformational contributions. The conformational contribution is calculated using a simple model in which monolayers or clusters of small molecules (such as polar or dispersive solvents) are assumed to interact with the flexible liner chains of the macromolecules. The conformational states of the chain are described by Ising variables. The interaction influences the conformational states energies, and the resulting one-dimensional model is solved exactly using the transfer matrix method. Depending on the model parameters, the presence of the small molecules can lead to a double-peaked structure of the heat capacity as a function of temperature. The interaction causes an increase of the heat capacity in the low temperature region. Formation of cluster of small molecules leads to a significant conformational heat capacity contribution for high temperatures. Specific results for polyethylene (PE), poly(oxyethylene) (POE), poly(oxymethylene) (POM) and polytetrafluoroethylene (PTFE) are presented as examples. The proposed approach can also be used to provide a more realistic description of heat capacities of protein-water, cellulose-water or starch-water systems.

  18. Identification of a small molecule [beta]-secretase inhibitor that binds without catalytic aspartate engagement

    SciTech Connect

    Steele, Thomas G.; Hills, Ivory D.; Nomland, Ashley A.; de León, Pablo; Allison, Timothy; McGaughey, Georgia; Colussi, Dennis; Tugusheva, Katherine; Haugabook, Sharie J.; Espeseth, Amy S.; Zuck, Paul; Graham, Samuel L.; Stachel, Shawn J.

    2010-09-02

    A small molecule inhibitor of beta-secretase with a unique binding mode has been developed. Crystallographic determination of the enzyme-inhibitor complex shows the catalytic aspartate residues in the active site are not engaged in inhibitor binding. This unprecedented binding mode in the field of aspartyl protease inhibition is described.

  19. Computational Approaches to Analyze and Predict Small Molecule Transport and Distribution at Cellular and Subcellular Levels

    PubMed Central

    Ah Min, Kyoung; Zhang, Xinyuan; Yu, Jing-yu; Rosania, Gus R.

    2013-01-01

    Quantitative structure-activity relationship (QSAR) studies and mechanistic mathematical modeling approaches have been independently employed for analyzing and predicting the transport and distribution of small molecule chemical agents in living organisms. Both of these computational approaches have been useful to interpret experiments measuring the transport properties of small molecule chemical agents, in vitro and in vivo. Nevertheless, mechanistic cell-based pharmacokinetic models have been especially useful to guide the design of experiments probing the molecular pathways underlying small molecule transport phenomena. Unlike QSAR models, mechanistic models can be integrated from microscopic to macroscopic levels, to analyze the spatiotemporal dynamics of small molecule chemical agents from intracellular organelles to whole organs, well beyond the experiments and training data sets upon which the models are based. Based on differential equations, mechanistic models can also be integrated with other differential equations-based systems biology models of biochemical networks or signaling pathways. Although the origin and evolution of mathematical modeling approaches aimed at predicting drug transport and distribution has occurred independently from systems biology, we propose that the incorporation of mechanistic cell-based computational models of drug transport and distribution into a systems biology modeling framework is a logical next-step for the advancement of systems pharmacology research. PMID:24218242

  20. Blu-ray based optomagnetic aptasensor for detection of small molecules.

    PubMed

    Yang, Jaeyoung; Donolato, Marco; Pinto, Alessandro; Bosco, Filippo Giacomo; Hwu, En-Te; Chen, Ching-Hsiu; Alstrøm, Tommy Sonne; Lee, Gwan-Hyoung; Schäfer, Thomas; Vavassori, Paolo; Boisen, Anja; Lin, Qiao; Hansen, Mikkel Fougt

    2016-01-15

    This paper describes an aptamer-based optomagnetic biosensor for detection of a small molecule based on target binding-induced inhibition of magnetic nanoparticle (MNP) clustering. For the detection of a target small molecule, two mutually exclusive binding reactions (aptamer-target binding and aptamer-DNA linker hybridization) are designed. An aptamer specific to the target and a DNA linker complementary to a part of the aptamer sequence are immobilized onto separate MNPs. Hybridization of the DNA linker and the aptamer induces formation of MNP clusters. The target-to-aptamer binding on MNPs prior to the addition of linker-functionalized MNPs significantly hinders the hybridization reaction, thus reducing the degree of MNP clustering. The clustering state, which is thus related to the target concentration, is then quantitatively determined by an optomagnetic readout technique that provides the hydrodynamic size distribution of MNPs and their clusters. A commercial Blu-ray optical pickup unit is used for optical signal acquisition, which enables the establishment of a low-cost and miniaturized biosensing platform. Experimental results show that the degree of MNP clustering correlates well with the concentration of a target small molecule, adenosine triphosphate (ATP) in this work, in the range between 10µM and 10mM. This successful proof-of-concept indicates that our optomagnetic aptasensor can be further developed as a low-cost biosensing platform for detection of small molecule biomarkers in an out-of-lab setting. PMID:26342583

  1. Multi-small molecule conjugations as new targeted delivery carriers for tumor therapy

    PubMed Central

    Shan, Lingling; Liu, Ming; Wu, Chao; Zhao, Liang; Li, Siwen; Xu, Lisheng; Cao, Wengen; Gao, Guizhen; Gu, Yueqing

    2015-01-01

    In response to the challenges of cancer chemotherapeutics, including poor physicochemical properties, low tumor targeting ability, and harmful side effects, we developed a new tumor-targeted multi-small molecule drug delivery platform. Using paclitaxel (PTX) as a model therapeutic, we prepared two prodrugs, ie, folic acid-fluorescein-5(6)-isothiocyanate-arginine-paclitaxel (FA-FITC-Arg-PTX) and folic acid-5-aminofluorescein-glutamic-paclitaxel (FA-5AF-Glu-PTX), composed of folic acid (FA, target), amino acids (Arg or Glu, linker), and fluorescent dye (fluorescein in vitro or near-infrared fluorescent dye in vivo) in order to better understand the mechanism of PTX prodrug targeting. In vitro and acute toxicity studies demonstrated the low toxicity of the prodrug formulations compared with the free drug. In vitro and in vivo studies indicated that folate receptor-mediated uptake of PTX-conjugated multi-small molecule carriers induced high antitumor activity. Notably, compared with free PTX and with PTX-loaded macromolecular carriers from our previous study, this multi-small molecule-conjugated strategy improved the water solubility, loading rate, targeting ability, antitumor activity, and toxicity profile of PTX. These results support the use of multi-small molecules as tumor-targeting drug delivery systems. PMID:26366078

  2. A blend of small molecules regulates both mating and development in Caenorhabditis elegans

    Technology Transfer Automated Retrieval System (TEKTRAN)

    In many organisms, population density sensing and sexual attraction rely on small molecule-based signaling systems. In the nematode Caenorhabditis elegans, population density is monitored via specific glycosides of the dideoxysugar ascarylose that promote entry into an alternate larval stage, the no...

  3. Treatment of Prostate Cancer using Anti-androgen Small Molecules | NCI Technology Transfer Center | TTC

    Cancer.gov

    The National Cancer Institute seeks parties interested in collaborative research to co-develop and commercialize a new class of small molecules for the treatment of prostate cancer. General information on co-development research collaborations, can be found on our web site (http://ttc.nci.nih.gov/forms).

  4. Comparison of small molecules and oligonucleotides that target a toxic, non-coding RNA.

    PubMed

    Costales, Matthew G; Rzuczek, Suzanne G; Disney, Matthew D

    2016-06-01

    Potential RNA targets for chemical probes and therapeutic modalities are pervasive in the transcriptome. Oligonucleotide-based therapeutics are commonly used to target RNA sequence. Small molecules are emerging as a modality to target RNA structures selectively, but their development is still in its infancy. In this work, we compare the activity of oligonucleotides and several classes of small molecules that target the non-coding r(CCUG) repeat expansion (r(CCUG)(exp)) that causes myotonic dystrophy type 2 (DM2), an incurable disease that is the second-most common cause of adult onset muscular dystrophy. Small molecule types investigated include monomers, dimers, and multivalent compounds synthesized on-site by using RNA-templated click chemistry. Oligonucleotides investigated include phosphorothioates that cleave their target and vivo-morpholinos that modulate target RNA activity via binding. We show that compounds assembled on-site that recognize structure have the highest potencies amongst small molecules and are similar in potency to a vivo-morpholino modified oligonucleotide that targets sequence. These studies are likely to impact the design of therapeutic modalities targeting other repeats expansions that cause fragile X syndrome and amyotrophic lateral sclerosis, for example. PMID:27117425

  5. Following the nanostructural molecular orientation guidelines for sulfur versus thiophene units in small molecule photovoltaic cells.

    PubMed

    Kim, Yu Jin; Park, Chan Eon

    2016-03-31

    In bulk heterojunction (BHJ) organic photovoltaics, particularly those using small molecules, electron donor and/or electron acceptor materials form a distributed network in the photoactive layer where critical photo-physical processes occur. Extensive research has recently focused on the importance of sulfur atoms in the small molecules. Little is known about the three-dimensional orientation of these sulfur atom-containing molecules. Herein, we report on our research concerning the heterojunction textures of the crystalline molecular orientation of small compounds having sulfur-containing units in the side chains, specifically, compounds known as that contain the alkylthio group and that does not. The improved performance of the -based devices, particularly in the photocurrent and the fill factor, was attributed to the large population of donor compound crystallites with a favorable face-on orientation along the perpendicular direction. This orientation resulted in efficient charge transport and a reduction in charge recombination. These findings underscore the great potential of small-molecule solar cells and suggest that even higher efficiencies can be achieved through materials development and molecular orientation control. PMID:26987868

  6. Cellular reprogramming for pancreatic β-cell regeneration: clinical potential of small molecule control

    PubMed Central

    2014-01-01

    Recent scientific breakthroughs in stem cell biology suggest that a sustainable treatment approach to cure diabetes mellitus (DM) can be achieved in the near future. However, the transplantation complexities and the difficulty in obtaining the stem cells from adult cells of pancreas, liver, bone morrow and other cells is a major concern. The epoch-making strategy of transcription-factor based cellular reprogramming suggest that these barriers could be overcome, and it is possible to reprogram any cells into functional β cells. Contemporary biological and analytical techniques help us to predict the key transcription factors needed for β-cell regeneration. These β cell-specific transcription factors could be modulated with diverse reprogramming protocols. Among cellular reprogramming strategies, small molecule approach gets proclaimed to have better clinical prospects because it does not involve genetic manipulation. Several small molecules targeting certain epigenetic enzymes and/or signaling pathways have been successful in helping to induce pancreatic β-cell specification. Recently, a synthetic DNA-based small molecule triggered targeted transcriptional activation of pancreas-related genes to suggest the possibility of achieving desired cellular phenotype in a precise mode. Here, we give a brief overview of treating DM by regenerating pancreatic β-cells from various cell sources. Through a comprehensive overview of the available transcription factors, small molecules and reprogramming strategies available for pancreatic β-cell regeneration, this review compiles the current progress made towards the generation of clinically relevant insulin-producing β-cells. PMID:24679123

  7. High-resolution electrohydrodynamic jet printing of small-molecule organic light-emitting diodes

    NASA Astrophysics Data System (ADS)

    Kim, Kukjoo; Kim, Gyeomuk; Lee, Bo Ram; Ji, Sangyoon; Kim, So-Yun; An, Byeong Wan; Song, Myoung Hoon; Park, Jang-Ung

    2015-08-01

    The development of alternative organic light-emitting diode (OLED) fabrication technologies for high-definition and low-cost displays is an important research topic as conventional fine metal mask-assisted vacuum evaporation has reached its limit to reduce pixel sizes and manufacturing costs. Here, we report an electrohydrodynamic jet (e-jet) printing method to fabricate small-molecule OLED pixels with high resolution (pixel width of 5 μm), which significantly exceeds the resolutions of conventional inkjet or commercial OLED display pixels. In addition, we print small-molecule emitting materials which provide a significant advantage in terms of device efficiency and lifetime compared to those with polymers.The development of alternative organic light-emitting diode (OLED) fabrication technologies for high-definition and low-cost displays is an important research topic as conventional fine metal mask-assisted vacuum evaporation has reached its limit to reduce pixel sizes and manufacturing costs. Here, we report an electrohydrodynamic jet (e-jet) printing method to fabricate small-molecule OLED pixels with high resolution (pixel width of 5 μm), which significantly exceeds the resolutions of conventional inkjet or commercial OLED display pixels. In addition, we print small-molecule emitting materials which provide a significant advantage in terms of device efficiency and lifetime compared to those with polymers. Electronic supplementary information (ESI) available. See DOI: 10.1039/c5nr03034j

  8. Small Molecules Take a Big Step by Converting Fibroblasts into Neurons.

    PubMed

    Babos, Kimberley; Ichida, Justin K

    2015-08-01

    Direct lineage conversion could provide a rich source of somatic cell types for translational medicine, but concerns over the use of transgenic reprogramming factors have limited its potential. In this issue of Cell Stem Cell, Li et al. (2015) and Hu et al. (2015) identify small-molecule cocktails that can convert fibroblasts into functional neurons without exogenous genetic factors. PMID:26253195

  9. Small Molecule-Assisted Exfoliation of Layered Zirconium Phosphate Nanoplatelets by Ionic Liquids

    NASA Astrophysics Data System (ADS)

    Xia, Fangqing; Yong, Huaisong; Han, Xiao; Sun, Dazhi

    2016-07-01

    Exfoliation of layered inorganic nanomaterials into single-layered sheets has been widely interested in materials chemistry and composite fabrication. Here, we report the exfoliation of layered zirconium phosphate nanoplatelets by using small molecule intercalating agents in ionic liquids, which opens a new platform for fabricating single-layered inorganic materials from synthetic layered compounds.

  10. Design and synthesis of small molecule-sulfotyrosine mimetics that inhibit HIV-1 entry.

    PubMed

    Dogo-Isonagie, Cajetan; Lee, Su-Lin; Lohith, Katheryn; Liu, Hongbing; Mandadapu, Sivakoteswara R; Lusvarghi, Sabrina; O'Connor, Robert D; Bewley, Carole A

    2016-04-15

    In the absence of a cure or vaccine for HIV/AIDS, small molecule inhibitors remain an attractive choice for antiviral therapeutics. Recent structural and functional studies of the HIV-1 surface envelope glycoprotein gp120 have revealed sites of vulnerability that can be targeted by small molecule and peptide inhibitors, thereby inhibiting HIV-1 infection. Here we describe a series of small molecule entry inhibitors that were designed to mimic the sulfated N-terminal peptide of the HIV-1 coreceptor CCR5. From a panel of hydrazonothiazolyl pyrazolinones, we demonstrate that compounds containing naphthyl di- and tri-sulfonic acids inhibit HIV-1 infection in single round infectivity assays with the disulfonic acids being the most potent. Molecular docking supports the observed structure activity relationship, and SPR confirmed binding to gp120. In infectivity assays treatment with a representative naphthyl disulfonate and a disulfated CCR5 N-terminus peptide results in competitive inhibition, with combination indices >2. In total this work shows that gp120 and HIV-1 infection can be inhibited by small molecules that mimic the function of, and are competitive with the natural sulfated CCR5 N-terminus. PMID:26968647

  11. Water and Small-Molecule Permeation of Dormant Bacillus subtilis Spores

    PubMed Central

    Cermak, Nathan; Feijó Delgado, Francisco; Setlow, Barbara; Setlow, Peter

    2015-01-01

    ABSTRACT We use a suspended microchannel resonator to characterize the water and small-molecule permeability of Bacillus subtilis spores based on spores' buoyant mass in different solutions. Consistent with previous results, we found that the spore coat is not a significant barrier to small molecules, and the extent to which small molecules may enter the spore is size dependent. We have developed a method to directly observe the exchange kinetics of intraspore water with deuterium oxide, and we applied this method to wild-type spores and a panel of congenic mutants with deficiencies in the assembly or structure of the coat. Compared to wild-type spores, which exchange in approximately 1 s, several coat mutant spores were found to have relatively high water permeability with exchange times below the ∼200-ms temporal resolution of our assay. In addition, we found that the water permeability of the spore correlates with the ability of spores to germinate with dodecylamine and with the ability of TbCl3 to inhibit germination with l-valine. These results suggest that the structure of the coat may be necessary for maintaining low water permeability. IMPORTANCE Spores of Bacillus species cause food spoilage and disease and are extremely resistant to standard decontamination methods. This hardiness is partly due to spores' extremely low permeability to chemicals, including water. We present a method to directly monitor the uptake of molecules into B. subtilis spores by weighing spores in fluid. The results demonstrate the exchange of core water with subsecond resolution and show a correlation between water permeability and the rate at which small molecules can initiate or inhibit germination in coat-damaged spores. The ability to directly measure the uptake of molecules in the context of spores with known structural or genetic deficiencies is expected to provide insight into the determinants of spores' extreme resistance. PMID:26483518

  12. Targeting of the MYCN Protein with Small Molecule c-MYC Inhibitors

    PubMed Central

    Müller, Inga; Larsson, Karin; Frenzel, Anna; Oliynyk, Ganna; Zirath, Hanna; Prochownik, Edward V.; Westwood, Nicholas J.; Henriksson, Marie Arsenian

    2014-01-01

    Members of the MYC family are the most frequently deregulated oncogenes in human cancer and are often correlated with aggressive disease and/or poorly differentiated tumors. Since patients with MYCN-amplified neuroblastoma have a poor prognosis, targeting MYCN using small molecule inhibitors could represent a promising therapeutic approach. We have previously demonstrated that the small molecule 10058-F4, known to bind to the c-MYC bHLHZip dimerization domain and inhibiting the c-MYC/MAX interaction, also interferes with the MYCN/MAX dimerization in vitro and imparts anti-tumorigenic effects in neuroblastoma tumor models with MYCN overexpression. Our previous work also revealed that MYCN-inhibition leads to mitochondrial dysfunction resulting in accumulation of lipid droplets in neuroblastoma cells. To expand our understanding of how small molecules interfere with MYCN, we have now analyzed the direct binding of 10058-F4, as well as three of its analogs; #474, #764 and 10058-F4(7RH), one metabolite C-m/z 232, and a structurally unrelated c-MYC inhibitor 10074-G5, to the bHLHZip domain of MYCN. We also assessed their ability to induce apoptosis, neurite outgrowth and lipid accumulation in neuroblastoma cells. Interestingly, all c-MYC binding molecules tested also bind MYCN as assayed by surface plasmon resonance. Using a proximity ligation assay, we found reduced interaction between MYCN and MAX after treatment with all molecules except for the 10058-F4 metabolite C-m/z 232 and the non-binder 10058-F4(7RH). Importantly, 10074-G5 and 10058-F4 were the most efficient in inducing neuronal differentiation and lipid accumulation in MYCN-amplified neuroblastoma cells. Together our data demonstrate MYCN-binding properties for a selection of small molecules, and provide functional information that could be of importance for future development of targeted therapies against MYCN-amplified neuroblastoma. PMID:24859015

  13. High-throughput single-molecule screen for small-molecule perturbation of splicing and transcription kinetics.

    PubMed

    Day, Christopher R; Chen, Huimin; Coulon, Antoine; Meier, Jordan L; Larson, Daniel R

    2016-03-01

    In eukaryotes, mRNA synthesis is catalyzed by RNA polymerase II and involves several distinct steps, including transcript initiation, elongation, cleavage, and transcript release. Splicing of RNA can occur during (co-transcriptional) or after (post-transcriptional) RNA synthesis. Thus, RNA synthesis and processing occurs through the concerted activity of dozens of enzymes, each of which is potentially susceptible to perturbation by small molecules. However, there are few, if any, high-throughput screening strategies for identifying drugs which perturb a specific step in RNA synthesis and processing. Here we have developed a high-throughput fluorescence microscopy approach in single cells to screen for inhibitors of specific enzymatic steps in RNA synthesis and processing. By utilizing the high affinity interaction between bacteriophage capsid proteins (MS2, PP7) and RNA stem loops, we are able to fluorescently label the intron and exon of a β-globin reporter gene in human cells. This approach allows one to measure the kinetics of transcription, splicing and release in both fixed and living cells using a tractable, genetically encoded assay in a stable cell line. We tested this reagent in a targeted screen of molecules that target chromatin readers and writers and identified three compounds that slow transcription elongation without changing transcription initiation. PMID:26655523

  14. A single-molecule platform for investigation of interactions between G-quadruplexes and small-molecule ligands

    NASA Astrophysics Data System (ADS)

    Koirala, Deepak; Dhakal, Soma; Ashbridge, Beth; Sannohe, Yuta; Rodriguez, Raphaël; Sugiyama, Hiroshi; Balasubramanian, Shankar; Mao, Hanbin

    2011-10-01

    Ligands that stabilize the formation of telomeric DNA G-quadruplexes have potential as cancer treatments, because the G-quadruplex structure cannot be extended by telomerase, an enzyme over-expressed in many cancer cells. Understanding the kinetic, thermodynamic and mechanical properties of small-molecule binding to these structures is therefore important, but classical ensemble assays are unable to measure these simultaneously. Here, we have used a laser tweezers method to investigate such interactions. With a force jump approach, we observe that pyridostatin promotes the folding of telomeric G-quadruplexes. The increased mechanical stability of pyridostatin-bound G-quadruplex permits the determination of a dissociation constant Kd of 490 ± 80 nM. The free-energy change of binding obtained from a Hess-like process provides an identical Kd for pyridostatin and a Kd of 42 ± 3 µM for a weaker ligand RR110. We anticipate that this single-molecule platform can provide detailed insights into the mechanical, kinetic and thermodynamic properties of liganded bio-macromolecules, which have biological relevance.

  15. A chemical screen for biological small molecule-RNA conjugates reveals CoA-linked RNA.

    PubMed

    Kowtoniuk, Walter E; Shen, Yinghua; Heemstra, Jennifer M; Agarwal, Isha; Liu, David R

    2009-05-12

    Compared with the rapidly expanding set of known biological roles for RNA, the known chemical diversity of cellular RNA has remained limited primarily to canonical RNA, 3'-aminoacylated tRNAs, nucleobase-modified RNAs, and 5'-capped mRNAs in eukaryotes. We developed two methods to detect in a broad manner chemically labile cellular small molecule-RNA conjugates. The methods were validated by the detection of known tRNA and rRNA modifications. The first method analyzes small molecules cleaved from RNA by base or nucleophile treatment. Application to Escherichia coli and Streptomyces venezuelae RNA revealed an RNA-linked hydroxyfuranone or succinyl ester group, in addition to a number of other putative small molecule-RNA conjugates not previously reported. The second method analyzes nuclease-generated mononucleotides before and after treatment with base or nucleophile and also revealed a number of new putative small molecule-RNA conjugates, including 3'-dephospho-CoA and its succinyl-, acetyl-, and methylmalonyl-thioester derivatives. Subsequent experiments established that these CoA species are attached to E. coli and S. venezuelae RNA at the 5' terminus. CoA-linked RNA cannot be generated through aberrant transcriptional initiation by E. coli RNA polymerase in vitro, and CoA-linked RNA in E. coli is only found among smaller (approximately < 200 nucleotide) RNAs that have yet to be identified. These results provide examples of small molecule-RNA conjugates and suggest that the chemical diversity of cellular RNA may be greater than previously understood. PMID:19416889

  16. Quantum mechanical computations and spectroscopy: from small rigid molecules in the gas phase to large flexible molecules in solution.

    PubMed

    Barone, Vincenzo; Improta, Roberto; Rega, Nadia

    2008-05-01

    Interpretation of structural properties and dynamic behavior of molecules in solution is of fundamental importance to understand their stability, chemical reactivity, and catalytic action. While information can be gained, in principle, by a variety of spectroscopic techniques, the interpretation of the rich indirect information that can be inferred from the analysis of experimental spectra is seldom straightforward because of the subtle interplay of several different effects, whose specific role is not easy to separate and evaluate. In such a complex scenario, theoretical studies can be very helpful at two different levels: (i) supporting and complementing experimental results to determine the structure of the target molecule starting from its spectral properties; (ii) dissecting and evaluating the role of different effects in determining the observed spectroscopic properties. This is the reason why computational spectroscopy is rapidly evolving from a highly specialized research field into a versatile and widespread tool for the assignment of experimental spectra and their interpretation in terms of chemical physical effects. In such a situation, it becomes important that both computationally and experimentally oriented chemists are aware that new methodological advances and integrated computational strategies are available, providing reliable estimates of fundamental spectral parameters not only for relatively small molecules in the gas phase but also for large and flexible molecules in condensed phases. In this Account, we review the most significant methodological contributions from our research group in this field, and by exploiting some recent results of their application to the computation of IR, UV-vis, NMR, and EPR spectral parameters, we discuss the microscopic mechanisms underlying solvent and vibrational effects on the spectral parameters. After reporting some recent achievements for the study of excited states by first principle quantum mechanical

  17. Identification of a small molecule that stabilizes lipoprotein lipase in vitro and lowers triglycerides in vivo.

    PubMed

    Larsson, Mikael; Caraballo, Rémi; Ericsson, Madelene; Lookene, Aivar; Enquist, Per-Anders; Elofsson, Mikael; Nilsson, Stefan K; Olivecrona, Gunilla

    2014-07-25

    Patients at increased cardiovascular risk commonly display high levels of plasma triglycerides (TGs), elevated LDL cholesterol, small dense LDL particles and low levels of HDL-cholesterol. Many remain at high risk even after successful statin therapy, presumably because TG levels remain high. Lipoprotein lipase (LPL) maintains TG homeostasis in blood by hydrolysis of TG-rich lipoproteins. Efficient clearance of TGs is accompanied by increased levels of HDL-cholesterol and decreased levels of small dense LDL. Given the central role of LPL in lipid metabolism we sought to find small molecules that could increase LPL activity and serve as starting points for drug development efforts against cardiovascular disease. Using a small molecule screening approach we have identified small molecules that can protect LPL from inactivation by the controller protein angiopoietin-like protein 4 during incubations in vitro. One of the selected compounds, 50F10, was directly shown to preserve the active homodimer structure of LPL, as demonstrated by heparin-Sepharose chromatography. On injection to hypertriglyceridemic apolipoprotein A-V deficient mice the compound ameliorated the postprandial response after an olive oil gavage. This is a potential lead compound for the development of drugs that could reduce the residual risk associated with elevated plasma TGs in dyslipidemia. PMID:24984153

  18. Protein-Observed Fluorine NMR: A Bioorthogonal Approach for Small Molecule Discovery.

    PubMed

    Arntson, Keith E; Pomerantz, William C K

    2016-06-01

    The (19)F isotope is 100% naturally abundant and is the second most sensitive and stable NMR-active nucleus. Unlike the ubiquitous hydrogen atom, fluorine is nearly absent in biological systems, making it a unique bioorthogonal atom for probing molecular interactions in biology. Over 73 fluorinated proteins have been studied by (19)F NMR since the seminal studies of Hull and Sykes in 1974. With advances in cryoprobe production and fluorinated amino acid incorporation strategies, protein-based (19)F NMR offers opportunities to the medicinal chemist for characterizing and ultimately discovering new small molecule protein ligands. This review will highlight new advances using (19)F NMR for characterizing small molecule interactions with both small and large proteins as well as detailing NMR resonance assignment challenges and amino acid incorporation approaches. PMID:26599421

  19. Phage Anti-Immune complex Assay (PHAIA): a general strategy for noncompetitive immunodetection of small molecules

    PubMed Central

    González-Techera, A; Vanrell, L; Last, J.; Hammock, B.D; González-Sapienza, G.

    2008-01-01

    Due to their size, small molecules can not be simultaneously bound by two antibodies precluding their detection by noncompetitive two-site immunoassays, which are superior to competitive ones in terms of sensitivity, kinetics, and working range. This has prompted the development of anti-immune complex antibodies, but these are difficult to produce, and often exhibit high cross-reactivity with the unliganded primary antibody. This work demonstrates that anti-immune complex antibodies can be substituted by phage particles isolated from phage display peptide libraries. Phages bearing specific small peptide loops allowed to focus the recognition to changes in the binding area of the immune complex. The concept was tested using environmental and drug analytes; with improved sensitivity and ready adaptation into onsite formats. Peptides specific for different immune complexes can be isolated from different peptide libraries in a simple and systematic fashion allowing the rapid development of noncompetitive assays for small molecules PMID:17845007

  20. Small-molecule agonists and antagonists of F-box protein–substrate interactions in auxin perception and signaling

    PubMed Central

    Hayashi, Ken-ichiro; Tan, Xu; Zheng, Ning; Hatate, Tatsuya; Kimura, Yoshio; Kepinski, Stefan; Nozaki, Hiroshi

    2008-01-01

    The regulation of gene expression by the hormone auxin is a crucial mechanism in plant development. We have shown that the Arabidopsis F-box protein TIR1 is a receptor for auxin, and our recent structural work has revealed the molecular mechanism of auxin perception. TIR1 is the substrate receptor of the ubiquitin–ligase complex SCFTIR1. Auxin binding enhances the interaction between TIR1 and its substrates, the Aux/IAA repressors, thereby promoting the ubiquitination and degradation of Aux/IAAs, altering the expression of hundreds of genes. TIR1 is the prototype of a new class of hormone receptor and the first example of an SCF ubiquitin-ligase modulated by a small molecule. Here, we describe the design, synthesis, and characterization of a series of auxin agonists and antagonists. We show these molecules are specific to TIR1-mediated events in Arabidopsis, and their mode of action in binding to TIR1 is confirmed by x-ray crystallographic analysis. Further, we demonstrate the utility of these probes for the analysis of TIR1-mediated auxin signaling in the moss Physcomitrella patens. Our work not only provides a useful tool for plant chemical biology but also demonstrates an example of a specific small-molecule inhibitor of F-box protein–substrate recruitment. Substrate recognition and subsequent ubiquitination by SCF-type ubiquitin ligases are central to many cellular processes in eukaryotes, and ubiquitin-ligase function is affected in several human diseases. Our work supports the idea that it may be possible to design small-molecule agents to modulate ubiquitin-ligase function therapeutically. PMID:18391211