Structure of the non-redox-active tungsten/[4Fe:4S] enzyme acetylene hydratase.
Seiffert, Grazyna B; Ullmann, G Matthias; Messerschmidt, Albrecht; Schink, Bernhard; Kroneck, Peter M H; Einsle, Oliver
2007-02-27
The tungsten-iron-sulfur enzyme acetylene hydratase stands out from its class because it catalyzes a nonredox reaction, the hydration of acetylene to acetaldehyde. Sequence comparisons group the protein into the dimethyl sulfoxide reductase family, and it contains a bis-molybdopterin guanine dinucleotide-ligated tungsten atom and a cubane-type [4Fe:4S] cluster. The crystal structure of acetylene hydratase at 1.26 A now shows that the tungsten center binds a water molecule that is activated by an adjacent aspartate residue, enabling it to attack acetylene bound in a distinct, hydrophobic pocket. This mechanism requires a strong shift of pK(a) of the aspartate, caused by a nearby low-potential [4Fe:4S] cluster. To access this previously unrecognized W-Asp active site, the protein evolved a new substrate channel distant from where it is found in other molybdenum and tungsten enzymes.
Rosner, B M; Schink, B
1995-10-01
Acetylene hydratase of the mesophilic fermenting bacterium Pelobacter acetylenicus catalyzes the hydration of acetylene to acetaldehyde. Growth of P. acetylenicus with acetylene and specific acetylene hydratase activity depended on tungstate or, to a lower degree, molybdate supply in the medium. The specific enzyme activity in cell extract was highest after growth in the presence of tungstate. Enzyme activity was stable even after prolonged storage of the cell extract or of the purified protein under air. However, enzyme activity could be measured only in the presence of a strong reducing agent such as titanium(III) citrate or dithionite. The enzyme was purified 240-fold by ammonium sulfate precipitation, anion-exchange chromatography, size exclusion chromatography, and a second anion-exchange chromatography step, with a yield of 36%. The protein was a monomer with an apparent molecular mass of 73 kDa, as determined by sodium dodecyl sulfate-polyacrylamide gel electrophoresis. The isoelectric point was at pH 4.2. Per mol of enzyme, 4.8 mol of iron, 3.9 mol of acid-labile sulfur, and 0.4 mol of tungsten, but no molybdenum, were detected. The Km for acetylene as assayed in a coupled photometric test with yeast alcohol dehydrogenase and NADH was 14 microM, and the Vmax was 69 mumol.min-1.mg of protein-1. The optimum temperature for activity was 50 degrees C, and the apparent pH optimum was 6.0 to 6.5. The N-terminal amino acid sequence gave no indication of resemblance to any enzyme protein described so far.
Rosner, B M; Schink, B
1995-01-01
Acetylene hydratase of the mesophilic fermenting bacterium Pelobacter acetylenicus catalyzes the hydration of acetylene to acetaldehyde. Growth of P. acetylenicus with acetylene and specific acetylene hydratase activity depended on tungstate or, to a lower degree, molybdate supply in the medium. The specific enzyme activity in cell extract was highest after growth in the presence of tungstate. Enzyme activity was stable even after prolonged storage of the cell extract or of the purified protein under air. However, enzyme activity could be measured only in the presence of a strong reducing agent such as titanium(III) citrate or dithionite. The enzyme was purified 240-fold by ammonium sulfate precipitation, anion-exchange chromatography, size exclusion chromatography, and a second anion-exchange chromatography step, with a yield of 36%. The protein was a monomer with an apparent molecular mass of 73 kDa, as determined by sodium dodecyl sulfate-polyacrylamide gel electrophoresis. The isoelectric point was at pH 4.2. Per mol of enzyme, 4.8 mol of iron, 3.9 mol of acid-labile sulfur, and 0.4 mol of tungsten, but no molybdenum, were detected. The Km for acetylene as assayed in a coupled photometric test with yeast alcohol dehydrogenase and NADH was 14 microM, and the Vmax was 69 mumol.min-1.mg of protein-1. The optimum temperature for activity was 50 degrees C, and the apparent pH optimum was 6.0 to 6.5. The N-terminal amino acid sequence gave no indication of resemblance to any enzyme protein described so far. PMID:7592321
Boll, Matthias; Einsle, Oliver; Ermler, Ulrich; Kroneck, Peter M H; Ullmann, G Matthias
2016-01-01
In biology, tungsten (W) is exclusively found in microbial enzymes bound to a bis-pyranopterin cofactor (bis-WPT). Previously known W enzymes catalyze redox oxo/hydroxyl transfer reactions by directly coordinating their substrates or products to the metal. They comprise the W-containing formate/formylmethanofuran dehydrogenases belonging to the dimethyl sulfoxide reductase (DMSOR) family and the aldehyde:ferredoxin oxidoreductase (AOR) families, which form a separate enzyme family within the Mo/W enzymes. In the last decade, initial insights into the structure and function of two unprecedented W enzymes were obtained: the acetaldehyde forming acetylene hydratase (ACH) belongs to the DMSOR and the class II benzoyl-coenzyme A (CoA) reductase (BCR) to the AOR family. The latter catalyzes the reductive dearomatization of benzoyl-CoA to a cyclic diene. Both are key enzymes in the degradation of acetylene (ACH) or aromatic compounds (BCR) in strictly anaerobic bacteria. They are unusual in either catalyzing a nonredox reaction (ACH) or a redox reaction without coordinating the substrate or product to the metal (BCR). In organic chemical synthesis, analogous reactions require totally nonphysiological conditions depending on Hg2+ (acetylene hydration) or alkali metals (benzene ring reduction). The structural insights obtained pave the way for biological or biomimetic approaches to basic reactions in organic chemistry. © 2016 S. Karger AG, Basel.
Mechanism of tungsten-dependent acetylene hydratase from quantum chemical calculations.
Liao, Rong-Zhen; Yu, Jian-Guo; Himo, Fahmi
2010-12-28
Acetylene hydratase is a tungsten-dependent enzyme that catalyzes the nonredox hydration of acetylene to acetaldehyde. Density functional theory calculations are used to elucidate the reaction mechanism of this enzyme with a large model of the active site devised on the basis of the native X-ray crystal structure. Based on the calculations, we propose a new mechanism in which the acetylene substrate first displaces the W-coordinated water molecule, and then undergoes a nucleophilic attack by the water molecule assisted by an ionized Asp13 residue at the active site. This is followed by proton transfer from Asp13 to the newly formed vinyl anion intermediate. In the subsequent isomerization, Asp13 shuttles a proton from the hydroxyl group of the vinyl alcohol to the α-carbon. Asp13 is thus a key player in the mechanism, but also W is directly involved in the reaction by binding and activating acetylene and providing electrostatic stabilization to the transition states and intermediates. Several other mechanisms are also considered but the energetic barriers are found to be very high, ruling out these possibilities.
Acetylene hydratase: a non-redox enzyme with tungsten and iron-sulfur centers at the active site.
Kroneck, Peter M H
2016-03-01
In living systems, tungsten is exclusively found in microbial enzymes coordinated by the pyranopterin cofactor, with additional metal coordination provided by oxygen and/or sulfur, and/or selenium atoms in diverse arrangements. Prominent examples are formate dehydrogenase, formylmethanofuran dehydrogenase, and aldehyde oxidoreductase all of which catalyze redox reactions. The bacterial enzyme acetylene hydratase (AH) stands out of its class as it catalyzes the conversion of acetylene to acetaldehyde, clearly a non-redox reaction and a reaction distinct from the reduction of acetylene to ethylene by nitrogenase. AH harbors two pyranopterins bound to W, and a [4Fe-4S] cluster. W is coordinated by four dithiolene sulfur atoms, one cysteine sulfur, and one oxygen ligand. AH activity requires a strong reductant suggesting W(IV) as the active oxidation state. Two different types of reaction pathways have been proposed. The 1.26 Å structure reveals a water molecule coordinated to W which could gain a partially positive net charge by the adjacent protonated Asp-13, enabling a direct attack of C2H2. To access the W-Asp site, a substrate channel was evolved distant from where it is found in other members of the DMSOR family. Computational studies of this second shell mechanism led to unrealistically high energy barriers, and alternative pathways were proposed where C2H2 binds directly to W. The architecture of the catalytic cavity, the specificity for C2H2 and the results from site-directed mutagenesis do not support this first shell mechanism. More investigations including structural information on the binding of C2H2 are needed to present a conclusive answer.
Is the tungsten(IV) complex (NEt4)2[WO(mnt)2] a functional analogue of acetylene hydratase?
Schreyer, Matthias
2017-01-01
The tungsten(IV) complex (Et4N)2[W(O)(mnt)2] (1; mnt = maleonitriledithiolate) was proposed (Sarkar et al., J. Am. Chem. Soc. 1997, 119, 4315) to be a functional analogue of the active center of the enzyme acetylene hydratase from Pelobacter acetylenicus, which hydrates acetylene (ethyne; 2) to acetaldehyde (ethanal; 3). In the absence of a satisfactory mechanistic proposal for the hydration reaction, we considered the possibility of a metal–vinylidene type activation mode, as it is well established for ruthenium-based alkyne hydration catalysts with anti-Markovnikov regioselectivity. To validate the hypothesis, the regioselectivity of tungsten-catalyzed alkyne hydration of a terminal, higher alkyne had to be determined. However, complex 1 was not a competent catalyst for the hydration of 1-octyne under the conditions tested. Furthermore, we could not observe the earlier reported hydration activity of complex 1 towards acetylene. A critical assessment of, and a possible explanation for the earlier reported results are offered. The title question is answered with "no". PMID:29181113
Exploring the Active Site of the Tungsten, Iron-Sulfur Enzyme Acetylene Hydratase▿ †
tenBrink, Felix; Schink, Bernhard; Kroneck, Peter M. H.
2011-01-01
The soluble tungsten, iron-sulfur enzyme acetylene hydratase (AH) from mesophilic Pelobacter acetylenicus is a member of the dimethyl sulfoxide (DMSO) reductase family. It stands out from its class as it catalyzes a nonredox reaction, the addition of H2O to acetylene (H—C☰C—H) to form acetaldehyde (CH3CHO). Caught in its active W(IV) state, the high-resolution three-dimensional structure of AH offers an excellent starting point to tackle its unique chemistry and to identify catalytic amino acid residues within the active site cavity: Asp13 close to W(IV) coordinated to two molybdopterin-guanosine-dinucleotide ligands, Lys48 which couples the [4Fe-4S] cluster to the W site, and Ile142 as part of a hydrophobic ring at the end of the substrate access channel designed to accommodate the substrate acetylene. A protocol was developed to express AH in Escherichia coli and to produce active-site variants which were characterized with regard to activity and occupancy of the tungsten and iron-sulfur centers. By this means, fusion of the N-terminal chaperone binding site of the E. coli nitrate reductase NarG to the AH gene improved the yield and activity of AH and its variants significantly. Results from site-directed mutagenesis of three key residues, Asp13, Lys48, and Ile142, document their important role in catalysis of this unusual tungsten enzyme. PMID:21193613
Oremland, Ronald S; Voytek, Mary A
2008-02-01
Acetylene occurs, by photolysis of methane, in the atmospheres of jovian planets and Titan. In contrast, acetylene is only a trace component of Earth's current atmosphere. Nonetheless, a methane-rich atmosphere has been hypothesized for early Earth; this atmosphere would also have been rich in acetylene. This poses a paradox, because acetylene is a potent inhibitor of many key anaerobic microbial processes, including methanogenesis, anaerobic methane oxidation, nitrogen fixation, and hydrogen oxidation. Fermentation of acetylene was discovered approximately 25 years ago, and Pelobacter acetylenicus was shown to grow on acetylene by virtue of acetylene hydratase, which results in the formation of acetaldehyde. Acetaldehyde subsequently dismutates to ethanol and acetate (plus some hydrogen). However, acetylene hydratase is specific for acetylene and does not react with any analogous compounds. We hypothesize that microbes with acetylene hydratase played a key role in the evolution of Earth's early biosphere by exploiting an available source of carbon from the atmosphere and in so doing formed protective niches that allowed for other microbial processes to flourish. Furthermore, the presence of acetylene in the atmosphere of a planet or planetoid could possibly represent evidence for an extraterrestrial anaerobic ecosystem.
Oremland, R.S.; Voytek, M.A.
2008-01-01
Acetylene occurs, by photolysis of methane, in the atmospheres of jovian planets and Titan. In contrast, acetylene is only a trace component of Earth's current atmosphere. Nonetheless, a methane-rich atmosphere has been hypothesized for early Earth; this atmosphere would also have been rich in acetylene. This poses a paradox, because acetylene is a potent inhibitor of many key anaerobic microbial processes, including methanogenesis, anaerobic methane oxidation, nitrogen fixation, and hydrogen oxidation. Fermentation of acetylene was discovered 25 years ago, and Pelobacter acetylenicus was shown to grow on acetylene by virtue of acetylene hydratase, which results in the formation of acetaldehyde. Acetaldehyde subsequently dismutates to ethanol and acetate (plus some hydrogen). However, acetylene hydratase is specific for acetylene and does not react with any analogous compounds. We hypothesize that microbes with acetylene hydratase played a key role in the evolution of Earth's early biosphere by exploiting an available source of carbon from the atmosphere and in so doing formed protective niches that allowed for other microbial processes to flourish. Furthermore, the presence of acetylene in the atmosphere of a planet or planetoid could possibly represent evidence for an extraterrestrial anaerobic ecosystem. ?? Mary Ann Liebert, Inc.
Detection of diazotrophy in the acetylene-fermenting anaerobe Pelobacter sp. strain SFB93
Akob, Denise M.; Baesman, Shaun; Sutton, John M.; Fierst, Janna L.; Mumford, Adam; Shrestha, Yesha; Poret-Peterson, Amisha T.; Bennett, Stacy; Dunlap, Darren S.; Haase, Karl B.; Oremland, Ronald S.
2017-01-01
Acetylene (C2H2) is a trace constituent of the present Earth's oxidizing atmosphere, reflecting a mixture of terrestrial and marine emissions from anthropogenic, biomass-burning, and unidentified biogenic sources. Fermentation of acetylene was serendipitously discovered during C2H2 block assays of N2O reductase, and Pelobacter acetylenicus was shown to grow on C2H2 via acetylene hydratase (AH). AH is a W-containing, catabolic, low-redox-potential enzyme that, unlike nitrogenase (N2ase), is specific for acetylene. Acetylene fermentation is a rare metabolic process that is well characterized only in P. acetylenicus DSM3246 and DSM3247 and Pelobacter sp. strain SFB93. To better understand the genetic controls for AH activity, we sequenced the genomes of the three acetylene-fermenting Pelobacter strains. Genome assembly and annotation produced three novel genomes containing gene sequences for AH, with two copies being present in SFB93. In addition, gene sequences for all five compulsory genes for iron-molybdenum N2ase were also present in the three genomes, indicating the cooccurrence of two acetylene transformation pathways. Nitrogen fixation growth assays showed that DSM3426 could ferment acetylene in the absence of ammonium, but no ethylene was produced. However, SFB93 degraded acetylene and, in the absence of ammonium, produced ethylene, indicating an active N2ase. Diazotrophic growth was observed under N2 but not in experimental controls incubated under argon. SFB93 exhibits acetylene fermentation and nitrogen fixation, the only known biochemical mechanisms for acetylene transformation. Our results indicate complex interactions between N2ase and AH and suggest novel evolutionary pathways for these relic enzymes from early Earth to modern days.
Kushwaha, Madhulika; Kumar, Virender; Mahajan, Rishi; Bhalla, Tek Chand; Chatterjee, Subhankar; Akhter, Yusuf
2018-05-09
The present study provides molecular insights into the activity and mechanism of cyanide hydratase enzyme associated with degradation of cyanide compounds, using Serratia marcescens RL2b as a model organism. Resting cells harvested after 20 h achieved complete degradation of 12 mmol l - 1 cyanide in approximately 10 h. High-performance liquid chromatography analysis of reaction samples revealed formation of formamide as the only end product, which confirmed the presence of cyanide hydratase activity in S. marcescens RL2b. Comparative structural analysis with the other nitrilase family proteins, which was carried out using a sequence of cyanide hydratase from a phylogenetically related strain S. marcescens WW4, also revealed subtle but significant differences in amino acid residues of the substrate-binding pocket and catalytic triad (Cys-Lys-Glu).
NASA Astrophysics Data System (ADS)
Oremland, R. S.; Baesman, S. M.; Miller, L. G.
2013-12-01
Acetylene is a highly reactive component of planet(oid)s with anoxic, methane-rich atmospheres, such as Jupiter, Saturn, Titan, and perhaps the primordial Earth. Included in this group is Enceladus, although it is not clear if the acetylene detected within its jets by Cassini was formed by photolysis of methane, from thermo-catalysis of organic matter in the orb's interior, or a fragmentation artifact of the mass spectrum of a larger hydrocarbon. Acetylene inhibits many microbial processes (e.g., methanogenesis, methane oxidation, hydrogen metabolism, denitrification) yet a number of anaerobes can use it as a carbon and energy source to support growth. The best studied is Pelobacter acetylenicus, which carries out a two-step reaction involving the enzymes acetylene hydratase and acetaldehyde dismutase. The former, a low potential W-containing enzyme, forms acetaldehyde while the latter produces ethanol and acetate. Metabolism of acetylene by mixed microbial communities (sediments and/or enrichment cultures) produces these intermediates, and when coupled with sulfate-reduction or methanogenesis respectively forms CO2 or an equal mixtures of CO2 plus CH4. It is not inconceivable that such an anaerobic, microbial food chain could exist in the waters beneath the ice cap of Enceladus, Titan, or even in the mesothermal atmospheric regions of the gas giants. Detection of the identified intermediate products of acetylene fermentation, namely acetaldehyde, ethanol, acetate and formate in the atmospheres of these planet(oid)s would constitute evidence for a microbial life signature. This evidence would be strongly reinforced if a stable carbon isotope fractionation was identified as well, whereby the products of acetylene fermentation were enriched in 12C relative to 13C (i.e., had a lighter δ13C signal) when compared to that of the starting acetylene. The most practical target to test this hypothesis would be Enceladus (if the detected acetylene is shown to be a real
NASA Astrophysics Data System (ADS)
Schramm, D. U.; Sthel, M. S.; Carneiro, L. O.; Franco, A. A.; Campos, A. C.; Vargas, H.
2005-06-01
Nitrogenase is an enzyme responsible for the reduction of the atmospheric N2 into NH4^+, which represents the key entry point of the molecular nitrogen into the biogeochemical cycle of nitrogen. This enzyme is present in the rhizobial bacteroids, which are symbionts in a Leguminosae plant (Acacia Holosericea), and also reduces acetylene into ethylene at the same rate as the nitrogen reduction. Therefore, a CO2 Laser Photoacoustic system was used for detecting and monitoring the ethylene emission by the nitrogenase activity, in the rhizobial symbionts in Acacia Holosericea, when they are confined in test tubes with acetylene at two different volumes (0.1 and 0.5 ml). Ethylene concentrations are also determined in the ppm range.
Acetylene fermentation: An Earth-based analog of biological carbon cycling on Titan
NASA Astrophysics Data System (ADS)
Miller, L. G.; Baesman, S. M.; Hoeft, S. E.; Kirshtein, J.; Wolf, K.; Voytek, M. A.; Oremland, R. S.
2009-12-01
Acetylene (C2H2) is present in part per million quantities in the atmosphere of Titan; conceivably as an intermediate product of methane photolysis. Currently, Earth’s atmosphere contains only trace amounts of C2H2 (~40 pptv), however higher concentrations likely prevailed during the Hadean and early Archean eons (4.5 - 3.5 Ga). We isolated C2H2-fermenting microbes from various aquatic and sedimentary environments. Acetylene fermentation proceeds via acetylene hydratase (AH) through acetaldehyde, which dismutates to ethanol and acetate, and if oxidants are present (e.g., sulfate) eventually to CO2. Thus, the remnants of a C2H2 cycle exists today on Earth but may also occur on Titan and/or Enceladus, both being planetary bodies hypothesized to have liquid water underlying their frozen surfaces. We developed a molecular method for AH by designing PCR primers to target the functional gene in Pelobacter acetylenicus. We used this method to scan new environments for the presence of AH and we employed DNA sequencing of the 16S rRNA gene in order to positively identify pelobacters in environmental samples. Acetylene fermentation was documented in five diverse salt-, fresh-, and ground-water sites. Pelobacter was identified as the genus responsible for acetylene fermentation in some, but not all, of these sites. Successful probing for AH preceded the discovery of acetylene consumption in a contaminated groundwater site, demonstrating the utility of functional gene probing. A pure culture of a C2H2-fermenting pelobacter was obtained from an intertidal mudflat. We also obtained an enrichment culture (co-cultured with a sulfate reducer) from freshwater lake sediments, but neither was pelobacter nor AH detected in this sample, suggesting that an alternative pathway may be involved here. Slurry experiments using these lake sediments either with or without added C2H2 or sulfate showed that sulfate reduction and acetylene fermentation were independent processes. In general, the
NASA Astrophysics Data System (ADS)
Miller, L. G.; Baesman, S. M.; Oremland, R. S.
2014-12-01
The search for biosignatures of life on Earth includes measurement of the stable isotope fractionation of reactants and products attributed to enzymatic processes and comparison with the often smaller chemical (abiotic) fractionation. We propose that this approach might be applied to study the origin and fate of organic compounds contained in water vapor plumes emanating from Enceladus or other icy bodies, perhaps revealing information about the potential for biology occurring within a sub-surface "habitable" zone. Methanol and C2-hydrocarbons including ethylene, ethane and acetylene (C2H2) have been identified in the plumes of Enceladus. Biological degradation of acetylene proceeds by anaerobic fermentation via acetylene hydratase through acetaldehyde, with a second enzyme (acetaldehyde dismutase) forming acetate and ethanol. We found that incubation of cultures of acetylene-fermenting bacteria exhibit a kinetic isotope effect (KIE) associated with the net removal of C2H2. Consumption of acetylene by both growing and washed-cell cultures of bacteria closely related to Pelobacter acetylenicus (e.g, strain SFB93) was accompanied by a carbon isotopic fractionation of about 2 per mil (KIE = 1.8-2.7 ‰), a result we are examining with other cultures of acetylene fermenters. In addition, we are measuring the carbon isotopic composition of acetaldehyde, ethanol and acetate during fermentation to learn whether these products are fractionated sufficiently, relative to their substrate, to warrant measurement of their isotopic composition in Enceladus (or Europa) plumes to indicate enzymatic activity in liquid environments below the crust of these moons.
Borjian, Farshad; Johnsen, Ulrike; Schönheit, Peter; Berg, Ivan A
2017-01-01
Growth on acetate or other acetyl-CoA-generating substrates as a sole source of carbon requires an anaplerotic pathway for the conversion of acetyl-CoA into cellular building blocks. Haloarchaea (class Halobacteria ) possess two different anaplerotic pathways, the classical glyoxylate cycle and the novel methylaspartate cycle. The methylaspartate cycle was discovered in Haloarcula spp. and operates in ∼40% of sequenced haloarchaea. In this cycle, condensation of one molecule of acetyl-CoA with oxaloacetate gives rise to citrate, which is further converted to 2-oxoglutarate and then to glutamate. The following glutamate rearrangement and deamination lead to mesaconate (methylfumarate) that needs to be activated to mesaconyl-C1-CoA and hydrated to β-methylmalyl-CoA. The cleavage of β-methylmalyl-CoA results in the formation of propionyl-CoA and glyoxylate. The carboxylation of propionyl-CoA and the condensation of glyoxylate with another acetyl-CoA molecule give rise to two C 4 -dicarboxylic acids, thus regenerating the initial acetyl-CoA acceptor and forming malate, its final product. Here we studied two enzymes of the methylaspartate cycle from Haloarcula hispanica , succinyl-CoA:mesaconate CoA-transferase (mesaconate CoA-transferase, Hah_1336) and mesaconyl-CoA hydratase (Hah_1340). Their genes were heterologously expressed in Haloferax volcanii , and the corresponding enzymes were purified and characterized. Mesaconate CoA-transferase was specific for its physiological substrates, mesaconate and succinyl-CoA, and produced only mesaconyl-C1-CoA and no mesaconyl-C4-CoA. Mesaconyl-CoA hydratase had a 3.5-fold bias for the physiological substrate, mesaconyl-C1-CoA, compared to mesaconyl-C4-CoA, and virtually no activity with other tested enoyl-CoA/3-hydroxyacyl-CoA compounds. Our results further prove the functioning of the methylaspartate cycle in haloarchaea and suggest that mesaconate CoA-transferase and mesaconyl-CoA hydratase can be regarded as
Stereochemical Consequences of Vinylpyruvate Hydratase-Catalyzed Reactions.
Johnson, William H; Stack, Tyler M M; Taylor, Stephanie M; Burks, Elizabeth A; Whitman, Christian P
2016-07-26
A stereochemical analysis has been carried out on two vinylpyruvate hydratases (VPH), which convert 2-hydroxy-2,4-pentadienoate to 2-keto-4S-hydroxypentanoate in meta-fission pathways. Bacterial strains with this pathway can use aromatic compounds as sole sources of energy and carbon. The analysis was carried out using the 5-methyl and 5-chloro derivatives of 2-hydroxy-2,4-pentadienoate with the enzymes from Pseudomonas putida mt-2 (Pp) and Leptothrix cholodnii SP-6 (Lc). In both organisms, VPH is in a complex with the preceding enzyme in the pathway, 4-oxalocrotonate decarboxylase (4-OD). In D2O, a deuteron is incorporated stereospecifically at the C-3 and C-5 positions of product by both Pp and Lc enzymes. Accordingly, the complexes generate (3S,5S)-3,5-[di-D]-2-keto-4S-hydroxyhexanoate and (3S,5R)-3,5-[di-D]-2-keto-4R-hydroxy-5-chloropentanoate (4R and 5R due to a priority numbering change). The substitution at C-5 (CH3 or Cl) or the source of the enzyme (Pp or Lc) does not change the stereochemical outcome. One mechanism that can account for the results is the ketonization of the 5-substituted dienol to the α,β-unsaturated ketone (placing a deuteron at C-5 in D2O), followed by the conjugate addition of water (placing a deuteron at C-3). The stereochemical outcome for VPH (from Pp and Lc) is the same as that reported for a related enzyme, 2-oxo-hept-4-ene-1,7-dioate hydratase, from Escherichia coli C. The combined observations suggest similar mechanisms for these three enzymes that could possibly be common to this group of enzymes.
Kim, Kyoung-Rok; Oh, Hye-Jin; Park, Chul-Soon; Hong, Seung-Hye; Park, Ji-Young; Oh, Deok-Kun
2015-11-01
The aim of this study is the first time demonstration of cis-12 regio-selective linoleate double-bond hydratase. Hydroxylation of fatty acids, abundant feedstock in nature, is an emerging alternative route for many petroleum replaceable products thorough hydroxy fatty acids, carboxylic acids, and lactones. However, chemical route for selective hydroxylation is still quite challenging owing to low selectivity and many environmental concerns. Hydroxylation of fatty acids by hydroxy fatty acid forming enzymes is an important route for selective biocatalytic oxyfunctionalization of fatty acids. Therefore, novel fatty acid hydroxylation enzymes should be discovered. The two hydratase genes of Lactobacillus acidophilus were identified by genomic analysis, and the expressed two recombinant hydratases were identified as cis-9 and cis-12 double-bond selective linoleate hydratases by in vitro functional validation, including the identification of products and the determination of regio-selectivity, substrate specificity, and kinetic parameters. The two different linoleate hydratases were the involved enzymes in the 10,13-dihydroxyoctadecanoic acid biosynthesis. Linoleate 13-hydratase (LHT-13) selectively converted 10 mM linoleic acid to 13S-hydroxy-9(Z)-octadecenoic acid with high titer (8.1 mM) and yield (81%). Our study will expand knowledge for microbial fatty acid-hydroxylation enzymes and facilitate the designed production of the regio-selective hydroxy fatty acids for useful chemicals from polyunsaturated fatty acid feedstocks. © 2015 Wiley Periodicals, Inc.
Feliciano, Patricia R; Drennan, Catherine L; Nonato, M Cristina
2016-08-30
Fumarate hydratases (FHs) are essential metabolic enzymes grouped into two classes. Here, we present the crystal structure of a class I FH, the cytosolic FH from Leishmania major, which reveals a previously undiscovered protein fold that coordinates a catalytically essential [4Fe-4S] cluster. Our 2.05 Å resolution data further reveal a dimeric architecture for this FH that resembles a heart, with each lobe comprised of two domains that are arranged around the active site. Besides the active site, where the substrate S-malate is bound bidentate to the unique iron of the [4Fe-4S] cluster, other binding pockets are found near the dimeric enzyme interface, some of which are occupied by malonate, shown here to be a weak inhibitor of this enzyme. Taken together, these data provide a framework both for investigations of the class I FH catalytic mechanism and for drug design aimed at fighting neglected tropical diseases.
Wang, Huizheng; Zhang, Kai; Zhu, Jie; Song, Weiwei; Zhao, Li; Zhang, Xiuguo
2013-01-01
Polyhydroxyalkanoates (PHAs) have attracted increasing attention as "green plastic" due to their biodegradable, biocompatible, thermoplastic, and mechanical properties, and considerable research has been undertaken to develop low cost/high efficiency processes for the production of PHAs. MaoC-like hydratase (MaoC), which belongs to (R)-hydratase involved in linking the β-oxidation and the PHA biosynthetic pathways, has been identified recently. Understanding the regulatory mechanisms of (R)-hydratase catalysis is critical for efficient production of PHAs that promise synthesis an environment-friendly plastic. We have determined the crystal structure of a new MaoC recognized from Phytophthora capsici. The crystal structure of the enzyme was solved at 2.00 Å resolution. The structure shows that MaoC has a canonical (R)-hydratase fold with an N-domain and a C-domain. Supporting its dimerization observed in structure, MaoC forms a stable homodimer in solution. Mutations that disrupt the dimeric MaoC result in a complete loss of activity toward crotonyl-CoA, indicating that dimerization is required for the enzymatic activity of MaoC. Importantly, structure comparison reveals that a loop unique to MaoC interacts with an α-helix that harbors the catalytic residues of MaoC. Deletion of the loop enhances the enzymatic activity of MaoC, suggesting its inhibitory role in regulating the activity of MaoC. The data in our study reveal the regulatory mechanism of an (R)-hydratase, providing information on enzyme engineering to produce low cost PHAs.
Duca, Daiana; Rose, David R; Glick, Bernard R
2014-08-01
Indole-3-acetic acid (IAA) is a fundamental phytohormone with the ability to control many aspects of plant growth and development. Pseudomonas sp. strain UW4 is a rhizospheric plant growth-promoting bacterium that produces and secretes IAA. While several putative IAA biosynthetic genes have been reported in this bacterium, the pathways leading to the production of IAA in strain UW4 are unclear. Here, the presence of the indole-3-acetamide (IAM) and indole-3-acetaldoxime/indole-3-acetonitrile (IAOx/IAN) pathways of IAA biosynthesis is described, and the specific role of two of the enzymes (nitrilase and nitrile hydratase) that mediate these pathways is assessed. The genes encoding these two enzymes were expressed in Escherichia coli, and the enzymes were isolated and characterized. Substrate-feeding assays indicate that the nitrilase produces both IAM and IAA from the IAN substrate, while the nitrile hydratase only produces IAM. The two nitrile-hydrolyzing enzymes have very different temperature and pH optimums. Nitrilase prefers a temperature of 50°C and a pH of 6, while nitrile hydratase prefers 4°C and a pH of 7.5. Based on multiple sequence alignments and motif analyses, physicochemical properties and enzyme assays, it is concluded that the UW4 nitrilase has an aromatic substrate specificity. The nitrile hydratase is identified as an iron-type metalloenzyme that does not require the help of a P47K activator protein to be active. These data are interpreted in terms of a preliminary model for the biosynthesis of IAA in this bacterium.
Identification of enzymes involved in oxidation of phenylbutyrate.
Palir, Neža; Ruiter, Jos P N; Wanders, Ronald J A; Houtkooper, Riekelt H
2017-05-01
In recent years the short-chain fatty acid, 4-phenylbutyrate (PB), has emerged as a promising drug for various clinical conditions. In fact, PB has been Food and Drug Administration-approved for urea cycle disorders since 1996. PB is more potent and less toxic than its metabolite, phenylacetate (PA), and is not just a pro-drug for PA, as was initially assumed. The metabolic pathway of PB, however, has remained unclear. Therefore, we set out to identify the enzymes involved in the β-oxidation of PB. We used cells deficient in specific steps of fatty acid β-oxidation and ultra-HPLC to measure which enzymes were able to convert PB or its downstream products. We show that the first step in PB oxidation is catalyzed solely by the enzyme, medium-chain acyl-CoA dehydrogenase. The second (hydration) step can be catalyzed by all three mitochondrial enoyl-CoA hydratase enzymes, i.e., short-chain enoyl-CoA hydratase, long-chain enoyl-CoA hydratase, and 3-methylglutaconyl-CoA hydratase. Enzymes involved in the third step include both short- and long-chain 3-hydroxyacyl-CoA dehydrogenase. The oxidation of PB is completed by only one enzyme, i.e., long-chain 3-ketoacyl-CoA thiolase. Taken together, the enzymatic characteristics of the PB degradative pathway may lead to better dose finding and limiting the toxicity of this drug. Copyright © 2017 by the American Society for Biochemistry and Molecular Biology, Inc.
NASA Astrophysics Data System (ADS)
Oremland, R. S.; Mao, X.; Mahandra, C.; Baesman, S. M.; Gushgari, S.; Alvarez-Cohen, L.; Liu, T.
2015-12-01
Groundwater contamination by trichloroethene (TCE) poses a threat to health and leads to the generation of vinyl chloride (VC), a carcinogen. Dehalococcoides mccartyi is the only bacterium that can completely dechlorinate TCE to ethene (C2H4). Acetylene (C2H2) occurs in TCE-contaminated sites as a consequence of chemical degradation of TCE. Yet acetylene inhibits a variety of microbial processes including methanogesis and reductive dechlorination. Pelobacter acetylenicus and related species can metabolize acetylene via acetylene hydratase and acetaldehyde dismutatse thereby generating acetate and H2 as endproducts, which could serve as electron donor and carbon source for growth of D. mccartyi. We found that 1mM acetylene (aqueous) inhibits growth of D. mccartyi strain 195 on 0.3 mM TCE, but that the inhibition was removed after 12 days with the addition of an acetylene-utilizing isolate from San Francisco Bay, Pelobacter strain SFB93. TCE did not inhibit the growth of this Pelobacter at the concentrations tested (0.1-0.5 mM) and TCE was not consumed by strain SFB93. Co-cultures of strain 195 with strain SFB93 at 5% inoculation were established in 120 mL serum bottles containing 40 mL defined medium. TCE was supplied at a liquid concentration of 0.1 mM, with 0.1 mM acetylene and N2/CO2 (90:10 v/v) headspace at 34 °C. Co-cultures were subsequently transferred (5% vol/vol inoculation) to generate subcultures after 20 μmol TCE was reduced to VC and 36 μmol acetylene was depleted. Aqueous H2 ranged from 114 to 217 nM during TCE-dechlorination, and the cell yield of strain 195 was 3.7 ±0.3 × 107 cells μmol-1 Cl- released. In a D. mccartyi-containing enrichment culture (ANAS) under the same conditions as above, it was found that inhibition of dechlorination by acetylene was reversed after 19 days by adding SFB93. Thus we showed that a co-culture of Pelobacter SFB93 and D. mccartyi 195 could be maintained with C2H2 as the electron donor and carbon source while TCE
DOE Office of Scientific and Technical Information (OSTI.GOV)
Pavlovcak, J.T.
1994-12-31
Acetylene continues to be the most widely used fuel in the oxyfuel cutting and welding industry. It displays properties that enhance its benefits to the industry, but at the same time, present potential hazards that have to be addressed. The presentation explores the main properties or characteristics of acetylene -- odor, toxicity, flammability, composition, and manufacture. it expands on those properties that are unique to acetylene and which account for its main value to the user or which constitute the chief concern for safe use of acetylene. The presentation explains characteristics such as anosmia, flammable or explosive range, ignition energy,more » autoignition temperature, and flame temperature, comparing these values for acetylene to other common gaseous fuels. it explains the unique property of acetylene to decompose explosively in the absence of air or oxygen. The toxicological aspects of acetylene is discussed, including anesthetic effect and simple asphyxiant, showing the increasing severity of symptoms to increasing levels of oxygen deficiency. The main value of this basic review of the properties of acetylene is to remind people of the benefits of acetylene due to its unique properties, and to realert them to the potential hazards that also have to be addressed to control the properties of acetylene.« less
Miller, Laurence G.; Baesman, Shaun M.; Kirshtein, Julie; Voytek, Mary A.; Oremland, Ronald S.
2013-01-01
Anoxic samples (sediment and groundwater) from 13 chemically diverse field sites were assayed for their ability to consume acetylene (C2H2). Over incubation periods ranging from ˜ 10 to 80 days, selected samples from 7 of the 13 tested sites displayed significant C2H2 removal. No significant formation of ethylene was noted in these incubations; therefore, C2H2 consumption could be attributed to acetylene hydratase (AH) rather than nitrogenase activity. This putative AH (PAH) activity was observed in only 21% of the total of assayed samples, while amplification of AH genes from extracted DNA using degenerate primers derived from Pelobacter acetylenicus occurred in even fewer (9.8%) samples. Acetylene-fermenting bacteria were isolated as a pure culture from the sediments of a tidal mudflat in San Francisco Bay (SFB93) and as an enrichment culture from freshwater Searsville Lake (SV7). Comparison of 16S rDNA clone libraries revealed that SFB93 was closely related to P. carbolinicus, while SV7 consisted of several unrelated bacteria. AH gene was amplified from SFB93 but not SV7. The inability of the primers to generate amplicons in the SV7 enrichment, as well as from several of the environmental samples that displayed PAH activity, implied that either the primers were too highly constrained in their specificity or that there was a different type of AH gene in these environmental samples than occurs in P. acetylenicus. The significance of this work with regard to the search for life in the outer Solar System, where C2HL2 is abundant, is discussed.
2010-01-01
Background A new family of natural products has been described in which cysteine, serine and threonine from ribosomally-produced peptides are converted to thiazoles, oxazoles and methyloxazoles, respectively. These metabolites and their biosynthetic gene clusters are now referred to as thiazole/oxazole-modified microcins (TOMM). As exemplified by microcin B17 and streptolysin S, TOMM precursors contain an N-terminal leader sequence and C-terminal core peptide. The leader sequence contains binding sites for the posttranslational modifying enzymes which subsequently act upon the core peptide. TOMM peptides are small and highly variable, frequently missed by gene-finders and occasionally situated far from the thiazole/oxazole forming genes. Thus, locating a substrate for a particular TOMM pathway can be a challenging endeavor. Results Examination of candidate TOMM precursors has revealed a subclass with an uncharacteristically long leader sequence closely related to the enzyme nitrile hydratase. Members of this nitrile hydratase leader peptide (NHLP) family lack the metal-binding residues required for catalysis. Instead, NHLP sequences display the classic Gly-Gly cleavage motif and have C-terminal regions rich in heterocyclizable residues. The NHLP family exhibits a correlated species distribution and local clustering with an ABC transport system. This study also provides evidence that a separate family, annotated as Nif11 nitrogen-fixing proteins, can serve as natural product precursors (N11P), but not always of the TOMM variety. Indeed, a number of cyanobacterial genomes show extensive N11P paralogous expansion, such as Nostoc, Prochlorococcus and Cyanothece, which replace the TOMM cluster with lanthionine biosynthetic machinery. Conclusions This study has united numerous TOMM gene clusters with their cognate substrates. These results suggest that two large protein families, the nitrile hydratases and Nif11, have been retailored for secondary metabolism. Precursors
Hernáez, M J; Floriano, B; Ríos, J J; Santero, E
2002-10-01
Two new genes whose products are involved in biodegradation of the organic solvent tetralin were identified. These genes, designated thnE and thnF, are located downstream of the previously identified thnD gene and code for a hydratase and an aldolase, respectively. A sequence comparison of enzymes similar to ThnE showed the significant similarity of hydratases involved in biodegradation pathways to 4-oxalocrotonate decarboxylases and established four separate groups of related enzymes. Consistent with the sequence information, characterization of the reaction catalyzed by ThnE showed that it hydrated a 10-carbon dicarboxylic acid. The only reaction product detected was the enol tautomer, 2,4-dihydroxydec-2-ene-1,10-dioic acid. The aldolase ThnF showed significant similarity to aldolases involved in different catabolic pathways whose substrates are dihydroxylated dicarboxylic acids and which yield pyruvate and a semialdehyde. The reaction products of the aldol cleavage reaction catalyzed by ThnF were identified as pyruvate and the seven-carbon acid pimelic semialdehyde. ThnF and similar aldolases showed conservation of the active site residues identified by the crystal structure of 2-dehydro-3-deoxy-galactarate aldolase, a class II aldolase with a novel reaction mechanism, suggesting that these similar enzymes are class II aldolases. In contrast, ThnF did not show similarity to 4-hydroxy-2-oxovalerate aldolases of other biodegradation pathways, which are significantly larger and apparently are class I aldolases.
Martínková, Ludmila; Chmátal, Martin
2016-10-01
The aim of this study was to design an effective method for the bioremediation of coking wastewaters, specifically for the concurrent elimination of their highly toxic components - cyanide and phenols. Almost full degradation of free cyanide (0.32-20 mM; 8.3-520 mg L(-1)) in the model and the real coking wastewaters was achieved by using a recombinant cyanide hydratase in the first step. The removal of cyanide, a strong inhibitor of tyrosinase, enabled an effective degradation of phenols by this enzyme in the second step. Phenol (16.5 mM, 1,552 mg L(-1)) was completely removed from a real coking wastewater within 20 h and cresols (5.0 mM, 540 mg L(-1)) were removed by 66% under the same conditions. The integration of cyanide hydratase and tyrosinase open up new possibilities for the bioremediation of wastewaters with complex pollution. Copyright © 2016 Elsevier Ltd. All rights reserved.
A Role for Cytosolic Fumarate Hydratase in Urea Cycle Metabolism and Renal Neoplasia
Adam, Julie; Yang, Ming; Bauerschmidt, Christina; Kitagawa, Mitsuhiro; O’Flaherty, Linda; Maheswaran, Pratheesh; Özkan, Gizem; Sahgal, Natasha; Baban, Dilair; Kato, Keiko; Saito, Kaori; Iino, Keiko; Igarashi, Kaori; Stratford, Michael; Pugh, Christopher; Tennant, Daniel A.; Ludwig, Christian; Davies, Benjamin; Ratcliffe, Peter J.; El-Bahrawy, Mona; Ashrafian, Houman; Soga, Tomoyoshi; Pollard, Patrick J.
2013-01-01
Summary The identification of mutated metabolic enzymes in hereditary cancer syndromes has established a direct link between metabolic dysregulation and cancer. Mutations in the Krebs cycle enzyme, fumarate hydratase (FH), predispose affected individuals to leiomyomas, renal cysts, and cancers, though the respective pathogenic roles of mitochondrial and cytosolic FH isoforms remain undefined. On the basis of comprehensive metabolomic analyses, we demonstrate that FH1-deficient cells and tissues exhibit defects in the urea cycle/arginine metabolism. Remarkably, transgenic re-expression of cytosolic FH ameliorated both renal cyst development and urea cycle defects associated with renal-specific FH1 deletion in mice. Furthermore, acute arginine depletion significantly reduced the viability of FH1-deficient cells in comparison to controls. Our findings highlight the importance of extramitochondrial metabolic pathways in FH-associated oncogenesis and the urea cycle/arginine metabolism as a potential therapeutic target. PMID:23643539
Code of Federal Regulations, 2010 CFR
2010-07-01
.... (b) The piped systems for the in-plant transfer and distribution of acetylene shall be designed..., Vapors, Fumes, Dusts, and Mists § 50-204.66 Acetylene. (a) The in-plant transfer, handling, storage, and...) Plants for the generation of acetylene and the charging (filling) of acetylene cylinders shall be...
Cheng, Zhongyi; Peplowski, Lukasz; Cui, Wenjing; Xia, Yuanyuan; Liu, Zhongmei; Zhang, Jialei; Kobayashi, Michihiko; Zhou, Zhemin
2018-03-01
Optically pure compounds are important in the synthesis of fine chemicals. Using directed evolution of enzymes to obtain biocatalysts that can selectively produce high-value chiral chemicals is often time-, money-, and resource-intensive; traditional semi-rational designs based on structural data and docking experiments are still limited due to the lack of accurate selection of hot-spot residues. In this study, through ligand-protein collision counts based on steered molecular dynamics simulation, we accurately identified four residues related to improving nitrile hydratase stereoselectivity toward rac-mandelonitrile (MAN). All the four selected residues had numerous collisions with rac-MAN. Five mutants significantly shifting stereoselectivity towards (S)-MAN were obtained from site-saturation mutagenesis, one of them, at position βPhe37, exhibiting efficient production of (S)-MAN with 96.8% ee p , was isolated and further analyzed. The increased pulling force observed during SMD simulation was found to be in good coincidence with the formation of hydrogen bonds between (R)-MAN and residue βHis37. (R)-MAN had to break these barriers to enter the active site of nitrile hydratase and S selectivity was thus improved. The results indicated that combining steered molecular dynamics simulation with a traditional semi-rational design significantly reduced the select range of hot-spot residues for the evolution of NHase stereoselectivity, which could serve as an alternative for the modulation of enzyme stereoselectivity. © 2017 Wiley Periodicals, Inc.
A role for cytosolic fumarate hydratase in urea cycle metabolism and renal neoplasia.
Adam, Julie; Yang, Ming; Bauerschmidt, Christina; Kitagawa, Mitsuhiro; O'Flaherty, Linda; Maheswaran, Pratheesh; Özkan, Gizem; Sahgal, Natasha; Baban, Dilair; Kato, Keiko; Saito, Kaori; Iino, Keiko; Igarashi, Kaori; Stratford, Michael; Pugh, Christopher; Tennant, Daniel A; Ludwig, Christian; Davies, Benjamin; Ratcliffe, Peter J; El-Bahrawy, Mona; Ashrafian, Houman; Soga, Tomoyoshi; Pollard, Patrick J
2013-05-30
The identification of mutated metabolic enzymes in hereditary cancer syndromes has established a direct link between metabolic dysregulation and cancer. Mutations in the Krebs cycle enzyme, fumarate hydratase (FH), predispose affected individuals to leiomyomas, renal cysts, and cancers, though the respective pathogenic roles of mitochondrial and cytosolic FH isoforms remain undefined. On the basis of comprehensive metabolomic analyses, we demonstrate that FH1-deficient cells and tissues exhibit defects in the urea cycle/arginine metabolism. Remarkably, transgenic re-expression of cytosolic FH ameliorated both renal cyst development and urea cycle defects associated with renal-specific FH1 deletion in mice. Furthermore, acute arginine depletion significantly reduced the viability of FH1-deficient cells in comparison to controls. Our findings highlight the importance of extramitochondrial metabolic pathways in FH-associated oncogenesis and the urea cycle/arginine metabolism as a potential therapeutic target. Copyright © 2013 The Authors. Published by Elsevier Inc. All rights reserved.
Genetics Home Reference: 3-methylglutaconyl-CoA hydratase deficiency
... down a protein building block ( amino acid ) called leucine to provide energy for cells. This amino acid ... activity. Without any functional 3-methylglutaconyl-CoA hydratase, leucine is not properly broken down, which leads to ...
Shak, S; Reich, N O; Goldstein, I M; Ortiz de Montellano, P R
1985-10-25
Human polymorphonuclear leukocytes (PMN) not only generate and respond to leukotriene B4 (LTB4), but also catabolize this mediator of inflammation rapidly and specifically by omega-oxidation (probably due to the action of a cytochrome P-450 enzyme). To develop pharmacologically useful inhibitors of the LTB4 omega-hydroxylase in human PMN, we devised a general scheme for synthesizing terminal acetylenic fatty acids based on the "acetylenic zipper" reaction. We found that the LTB4 omega-hydroxylase in intact PMN and in PMN sonicates is inactivated in a concentration-dependent fashion by terminal acetylenic analogues of lauric, palmitic, and stearic acids (i.e. 11-dodecynoic, 15-hexadecynoic, and 17-octadecynoic acids). Consistent with a suicidal process, inactivation of the LTB4 omega-hydroxylase requires molecular oxygen and NADPH, is time-dependent, and follows pseudo-first-order kinetics. Inactivation of the omega-hydroxylase by acetylenic fatty acids also is dependent on the terminal acetylenic moiety and the carbon chain length. Saturated fatty acids lacking a terminal acetylenic moiety do not inactivate the omega-hydroxylase. In addition, the two long-chain (C16, C18) acetylenic fatty acids inactivate the omega-hydroxylase at much lower concentrations (less than 5.0 microM) than those required for inactivation by the short-chain (C12) terminal acetylenic fatty acid (100 microM). Potent suicidal inhibitors of the LTB4 omega-hydroxylase in human PMN will help elucidate the roles played by LTB4 and its omega-oxidation products in regulating PMN function and in mediating inflammation.
Lagow, R.J.
1998-02-10
A fourth allotrope of carbon, an acetylenic carbon allotrope, is described. The acetylenic carbon allotropes of the present invention are more soluble than the other known carbon allotropes in many common organic solvents and possesses other desirable characteristics, e.g. high electron density, ability to burn cleanly, and electrical conductive properties. Many uses for this fourth allotrope are described herein. 17 figs.
Lagow, Richard J.
1998-01-01
A fourth allotrope of carbon, an acetylenic carbon allotrope, is described. The acetylenic carbon allotropes of the present invention are more soluble than the other known carbon allotropes in many common organic solvents and possesses other desirable characteristics, e.g. high electron density, ability to burn cleanly, and electrical conductive properties. Many uses for this fourth allotrope are described herein.
Lagow, Richard J.
1999-01-01
A fourth allotrope of carbon, an acetylenic carbon allotrope, is described. The acetylenic carbon allotropes of the present invention are more soluble than the other known carbon allotropes in many common organic solvents and possesses other desirable characteristics, e.g. high electron density, ability to burn cleanly, and electrical conductive properties. Many uses for this fourth allotrope are described herein.
Acetylene terminated aspartimides and resins therefrom
NASA Technical Reports Server (NTRS)
Hergenrother, Paul M. (Inventor); Connell, John W. (Inventor); Havens, Stephen J. (Inventor)
1989-01-01
Acetylene terminated aspartimides are prepared using two methods. In the first, an amino-substituted aromatic acetylene is reacted with an aromatic bismaleimide in a solvent of glacial acetic acid and/or m-cresol. In the second method, an aromatic diamine is reacted with an ethynyl containing maleimide, such an N-(3-ethynyl phenyl) maleimide, in a solvent of glacial acetic acid and/or m-cresol. In addition, acetylene terminated aspartimides are blended with various acetylene terminated oligomers and polymers to yield composite materials exhibiting improved mechanical properties.
Martínková, Ludmila; Veselá, Alicja Barbara; Rinágelová, Anna; Chmátal, Martin
2015-11-01
The purpose of this study is to summarize the current knowledge of the enzymes which are involved in the hydrolysis of cyanide, i.e., cyanide hydratases (CHTs; EC 4.2.1.66) and cyanide dihydratases (CynD; EC 3.5.5.1). CHTs are probably exclusively produced by filamentous fungi and widely occur in these organisms; in contrast, CynDs were only found in a few bacterial genera. CHTs differ from CynDs in their reaction products (formamide vs. formic acid and ammonia, respectively). Several CHTs were also found to transform nitriles but with lower relative activities compared to HCN. Mutants of CynDs and CHTs were constructed to study the structure-activity relationships in these enzymes or to improve their catalytic properties. The effect of the C-terminal part of the protein on the enzyme activity was determined by constructing the corresponding deletion mutants. CynDs are less active at alkaline pH than CHTs. To improve its bioremediation potential, CynD from Bacillus pumilus was engineered by directed evolution combined with site-directed mutagenesis, and its operation at pH 10 was thus enabled. Some of the enzymes have been tested for their potential to eliminate cyanide from cyanide-containing wastewaters. CynDs were also used to construct cyanide biosensors.
Lalwani, N D; Reddy, M K; Mangkornkanok-Mark, M; Reddy, J K
1981-07-15
The hypolipidaemic drugs methyl clofenapate, BR-931, Wy-14643 and procetofen induced a marked proliferation of peroxisomes in the parenchymal cells of liver and the proximal-convoluted-tubular epithelium of mouse kidney. The proliferation of peroxisomes was associated with 6-12-fold increase in the peroxisomal palmitoyl-CoA oxidizing capacity of the mouse liver. Enhanced activity of the peroxisomal palmitoyl-CoA oxidation system was also found in the renal-cortical homogenates of hypolipidaemic-drug-treated mice. The activity of enoyl-CoA hydratase in the mouse liver increased 30-50-fold and in the kidney cortex 3-5-fold with hypolipidaemic-drug-induced peroxisome proliferation in these tissues, and over 95% of this induced activity was found to be heat-labile peroxisomal enzyme in both organs. Sodium dodecyl sulphate/polyacrylamide-gel-electrophoretic analysis of large-particle and microsomal fractions obtained from the liver and kidney cortex of mice treated with hypolipidaemic peroxisome proliferators demonstrated a substantial increase in the quantity of an 80000-mol.wt. peroxisome-proliferation-associated polypeptide (polypeptide PPA-80). The heat-labile peroxisomal enoyl-CoA hydratase was purified from the livers of mice treated with the hypolipidaemic drug methyl clofenapate; the antibodies raised against this electrophoretically homogeneous protein yielded a single immunoprecipitin band with purified mouse liver enoyl-CoA hydratase and with liver and kidney cortical extracts of normal and hypolipidaemic-drug-treated mice. These anti-(mouse liver enoyl-CoA hydratase) antibodies also cross-reacted with purified rat liver enoyl-CoA hydratase and with the polypeptide PPA-80 obtained from rat and mouse liver. Immunofluorescence studies with anti-(polypeptide PPA-80) and anti-(peroxisomal enoyl-CoA hydratase) provided visual evidence for the localization and induction of polypeptide PPA-80 and peroxisomal enoyl-CoA hydratase in the liver and kidney respectively
Prediction of distal residue participation in enzyme catalysis
Brodkin, Heather R; DeLateur, Nicholas A; Somarowthu, Srinivas; Mills, Caitlyn L; Novak, Walter R; Beuning, Penny J; Ringe, Dagmar; Ondrechen, Mary Jo
2015-01-01
A scoring method for the prediction of catalytically important residues in enzyme structures is presented and used to examine the participation of distal residues in enzyme catalysis. Scores are based on the Partial Order Optimum Likelihood (POOL) machine learning method, using computed electrostatic properties, surface geometric features, and information obtained from the phylogenetic tree as input features. Predictions of distal residue participation in catalysis are compared with experimental kinetics data from the literature on variants of the featured enzymes; some additional kinetics measurements are reported for variants of Pseudomonas putida nitrile hydratase (ppNH) and for Escherichia coli alkaline phosphatase (AP). The multilayer active sites of P. putida nitrile hydratase and of human phosphoglucose isomerase are predicted by the POOL log ZP scores, as is the single-layer active site of P. putida ketosteroid isomerase. The log ZP score cutoff utilized here results in over-prediction of distal residue involvement in E. coli alkaline phosphatase. While fewer experimental data points are available for P. putida mandelate racemase and for human carbonic anhydrase II, the POOL log ZP scores properly predict the previously reported participation of distal residues. PMID:25627867
Johnson, William H; Wang, Susan C; Stanley, Thanuja M; Czerwinski, Robert M; Almrud, Jeffrey J; Poelarends, Gerrit J; Murzin, Alexey G; Whitman, Christian P
2004-08-17
A series of 2-fluoro-4-alkene and 2-fluoro-4-alkyne substrate analogues were synthesized and examined as potential inhibitors of three enzymes: 4-oxalocrotonate tautomerase (4-OT) and vinylpyruvate hydratase (VPH) from the catechol meta-fission pathway and a closely related 4-OT homologue found in Bacillus subtilis designated YwhB. All of the compounds were potent competitive inhibitors of 4-OT with the monocarboxylated 2E-fluoro-2,4-pentadienoate and the dicarboxylated 2E-fluoro-2-en-4-ynoate being the most potent. Despite the close mechanistic and structural similarities between 4-OT and YwhB, these compounds were significantly less potent inhibitors of YwhB with K(i) values ranging from 5- to 633-fold lower than those determined for 4-OT. The study of VPH is complicated by the fact that the enzyme is only active as a complex with the metal-dependent 4-oxalocrotonate decarboxylase (4-OD), the enzyme following 4-OT in the catechol meta-fission pathway. A structure-based sequence analysis identified 4-OD as a member of the fumarylacetoacetate hydrolase (FAH) superfamily and implicated Glu-109 and Glu-111 as potential metal-binding ligands. Changing these residues to a glutamine verified their importance for enzymatic activity and enabled the production of soluble E109Q4-OD/VPH or E111Q4-OD/VPH complexes, which retained full hydratase activity but had little decarboxylase activity. Subsequent incubation of the E109Q4-OD/VPH complex with the substrate analogues identified the 2E and 2Z isomers of the monocarboxylated 2-fluoropent-2-en-4-ynoate as competitive inhibitors. The combined results set the stage for crystallographic studies of 4-OT, YwhB, and VPH using these inhibitors as ligands.
Acetylene terminated matrix resins
NASA Technical Reports Server (NTRS)
Goldfarb, I. J.; Lee, Y. C.; Arnold, F. E.; Helminiak, T. E.
1985-01-01
The synthesis of resins with terminal acetylene groups has provided a promising technology to yield high performance structural materials. Because these resins cure through an addition reaction, no volatile by-products are produced during the processing. The cured products have high thermal stability and good properties retention after exposure to humidity. Resins with a wide variety of different chemical structures between the terminal acetylene groups are synthesized and their mechanical properties studied. The ability of the acetylene cured polymers to give good mechanical properties is demonstrated by the resins with quinoxaline structures. Processibility of these resins can be manipulated by varying the chain length between the acetylene groups or by blending in different amounts of reactive deluents. Processing conditions similar to the state-of-the-art epoxy can be attained by using backbone structures like ether-sulfone or bis-phenol-A. The wide range of mechanical properties and processing conditions attainable by this class of resins should allow them to be used in a wide variety of applications.
Code of Federal Regulations, 2012 CFR
2012-07-01
... 29 Labor 5 2012-07-01 2012-07-01 false Acetylene. 1910.102 Section 1910.102 Labor Regulations Relating to Labor (Continued) OCCUPATIONAL SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR OCCUPATIONAL SAFETY AND HEALTH STANDARDS Hazardous Materials § 1910.102 Acetylene. (a) Cylinders. Employers...
Prediction of distal residue participation in enzyme catalysis.
Brodkin, Heather R; DeLateur, Nicholas A; Somarowthu, Srinivas; Mills, Caitlyn L; Novak, Walter R; Beuning, Penny J; Ringe, Dagmar; Ondrechen, Mary Jo
2015-05-01
A scoring method for the prediction of catalytically important residues in enzyme structures is presented and used to examine the participation of distal residues in enzyme catalysis. Scores are based on the Partial Order Optimum Likelihood (POOL) machine learning method, using computed electrostatic properties, surface geometric features, and information obtained from the phylogenetic tree as input features. Predictions of distal residue participation in catalysis are compared with experimental kinetics data from the literature on variants of the featured enzymes; some additional kinetics measurements are reported for variants of Pseudomonas putida nitrile hydratase (ppNH) and for Escherichia coli alkaline phosphatase (AP). The multilayer active sites of P. putida nitrile hydratase and of human phosphoglucose isomerase are predicted by the POOL log ZP scores, as is the single-layer active site of P. putida ketosteroid isomerase. The log ZP score cutoff utilized here results in over-prediction of distal residue involvement in E. coli alkaline phosphatase. While fewer experimental data points are available for P. putida mandelate racemase and for human carbonic anhydrase II, the POOL log ZP scores properly predict the previously reported participation of distal residues. 2015 The Authors Protein Science published by Wiley Periodicals, Inc. on behalf of The Protein Society.
Code of Federal Regulations, 2012 CFR
2012-10-01
... 46 Shipping 5 2012-10-01 2012-10-01 false Acetylene. 147.70 Section 147.70 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) DANGEROUS CARGOES HAZARDOUS SHIPS' STORES Stowage and Other Special Requirements for Particular Materials § 147.70 Acetylene. (a) Seventeen cubic meters (600 standard...
Code of Federal Regulations, 2010 CFR
2010-10-01
... 46 Shipping 5 2010-10-01 2010-10-01 false Acetylene. 147.70 Section 147.70 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) DANGEROUS CARGOES HAZARDOUS SHIPS' STORES Stowage and Other Special Requirements for Particular Materials § 147.70 Acetylene. (a) Seventeen cubic meters (600 standard...
Code of Federal Regulations, 2011 CFR
2011-10-01
... 46 Shipping 5 2011-10-01 2011-10-01 false Acetylene. 147.70 Section 147.70 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) DANGEROUS CARGOES HAZARDOUS SHIPS' STORES Stowage and Other Special Requirements for Particular Materials § 147.70 Acetylene. (a) Seventeen cubic meters (600 standard...
Code of Federal Regulations, 2013 CFR
2013-10-01
... 46 Shipping 5 2013-10-01 2013-10-01 false Acetylene. 147.70 Section 147.70 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) DANGEROUS CARGOES HAZARDOUS SHIPS' STORES Stowage and Other Special Requirements for Particular Materials § 147.70 Acetylene. (a) Seventeen cubic meters (600 standard...
Code of Federal Regulations, 2014 CFR
2014-10-01
... 46 Shipping 5 2014-10-01 2014-10-01 false Acetylene. 147.70 Section 147.70 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) DANGEROUS CARGOES HAZARDOUS SHIPS' STORES Stowage and Other Special Requirements for Particular Materials § 147.70 Acetylene. (a) Seventeen cubic meters (600 standard...
Kobayashi, M; Suzuki, T; Fujita, T; Masuda, M; Shimizu, S
1995-01-01
The occurrence of a hitherto unknown pathway involving the action of two enzymes, a nitrile hydratase and an amidase for the biosynthesis of indole-3-acetic acid was discovered in phytopathogenic bacteria Agrobacterium tumefaciens and in leguminous bacteria Rhizobium. The nitrile hydratase acting on indole-3-acetonitrile was purified to homogeneity through only two steps from the cell-free extract of A. tumefaciens. The molecular mass of the purified enzyme estimated by HPLC was about 102 kDa, and the enzyme consisted of four subunits identical in molecular mass. The enzyme exhibited a broad absorption spectrum in the visible range with absorption maxima at 408 nm and 705 nm, and it contained cobalt and iron. The enzyme stoichiometrically catalyzed the hydration of indole-3-acetonitrile into indole-3-acetamide with a specific activity of 13.7 mol per min per mg and a Km of 7.9 microM. Images Fig. 1 PMID:11607511
Research in acetylene containing monomers
NASA Technical Reports Server (NTRS)
Ogliaruso, M. A.
1976-01-01
The preparation of precursor bisbenzils with pendant acetylene linkages for use in the synthesis of new aromatic poly (phenyl quinoxalines) was investigated. Attempts to condense para, para prime-dibromo benzil and potassium acetylide in liquid ammonia and in toluene, to prepare 4-phenyl acetyl phenyl ether, 4-(paraacetylphenyl) acetyl phenyl ether, 4-phenyl acetyl-4 primeacetyl phenyl acetyl phenyl ether, the reaction of 4-phenyl acetyl phenyl ether with Villsmeier reagent to prepare 4-(beta-chloro cinnamaldehyde) phenyl ether, the reaction of 4-(para-acetyl phenyl) acetyl phenyl ether with Villsmeier reagent, and the oxidation of bibenzil to prepare benzil are described. The reactions of phenyl acetylene with oxidizing agent, of phenyl acetylene with bromine, of 1,1,2,2-tetrabromo ethyl benzene with zinc and with oxidizing agent are described.
Measurements of acetylene in air extracted from polar ice cores
NASA Astrophysics Data System (ADS)
Nicewonger, M. R.; Aydin, M.; Montzka, S. A.; Saltzman, E. S.
2016-12-01
Acetylene (ethyne) is a non-methane hydrocarbon emitted during combustion of fossil fuels, biofuels, and biomass. The major atmospheric loss pathway of acetylene is oxidation by hydroxyl radical with a lifetime estimated at roughly two weeks. The mean annual acetylene levels over Greenland and Antarctica are 250 ppt and 20 ppt, respectively. Firn air measurements suggest atmospheric acetylene is preserved unaltered in polar snow and firn. Atmospheric reconstructions based on firn air measurements indicate acetylene levels rose significantly during the twentieth century, peaked near 1980, then declined to modern day levels. This historical trend is similar to that of other fossil fuel-derived non-methane hydrocarbons. In the preindustrial atmosphere, acetylene levels should primarily reflect emissions from biomass burning. In this study, we present the first measurements of acetylene in preindustrial air extracted from polar ice cores. Air from fluid and dry-drilled ice cores from Summit, Greenland and WAIS-Divide Antarctica is extracted using a wet-extraction technique. The ice core air is analyzed using gas chromatography and high-resolution mass spectrometry. Between 1400 to 1800 C.E., acetylene levels over Greenland and Antarctica varied between roughly 70-120 ppt and 10-30 ppt, respectively. The preindustrial Greenland acetylene levels are significantly lower than modern levels, reflecting the importance of northern hemisphere fossil fuel sources today. The preindustrial Antarctic acetylene levels are comparable to modern day levels, indicating similar emissions in the preindustrial atmosphere, likely from biomass burning. The implications of the preindustrial atmospheric acetylene records from both hemispheres will be discussed.
Improved Graphite Fiber/Acetylene Terminated Matrix Resin Prepreg Products
1988-03-01
AFWAL-TR-80-4151, "The Synthesis of Polymer Precursor and Exploratory Research Based on Acetylene Displacement Reaction," E.T. Sabourin , Gulf...Acetylene Terminated Quinoxalines," E.T. Sabourin , Gulf Research and Development Co., July 1982. ACETYLENE TERMINATED TECHNOLOGY BIBLIOGRAPHY SYNTHESIS AND
Initiation reactions in acetylene pyrolysis
Zador, Judit; Fellows, Madison D.; Miller, James A.
2017-05-10
In gas-phase combustion systems the interest in acetylene stems largely from its role in molecular weight growth processes. The consensus is that above 1500 K acetylene pyrolysis starts mainly with the homolytic fission of the C–H bond creating an ethynyl radical and an H atom. However, below ~1500 K this reaction is too slow to initiate the chain reaction. It has been hypothesized that instead of dissociation, self-reaction initiates this process. Nevertheless, rigorous theoretical or direct experimental evidence is lacking, to an extent that even the molecular mechanism is debated in the literature. In this work we use rigorous abmore » initio transition-state theory master equation methods to calculate pressure- and temperature-dependent rate coefficients for the association of two acetylene molecules and related reactions. We establish the role of vinylidene, the high-energy isomer of acetylene in this process, compare our results with available experimental data, and assess the competition between the first-order and second-order initiation steps. As a result, we also show the effect of the rapid isomerization among the participating wells and highlight the need for time-scale analysis when phenomenological rate coefficients are compared to observed time scales in certain experiments.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hoefler, G.; Forstner, M.; Hulla, W.
1994-01-01
Enoyl-CoA hydratase:3-hydroxyacyl-CoA dehydrogenase bifunctional enzyme is one of the four enzymes of the peroxisomal, [beta]-oxidation pathway. Here, the authors report the full-length human cDNA sequence and the localization of the corresponding gene on chromosome 3q26.3-3q28. The cDNA sequence spans 3779 nucleotides with an open reading frame of 2169 nucleotides. The tripeptide SKL at the carboxy terminus, known to serve as a peroxisomal targeting signal, is present. DNA sequence comparison of the coding region showed an 80% homology between human and rat bifunctional enzyme cDNA. The 3[prime] noncoding sequence contains 117 nucleotides homologous to an Alu repeat. Based on sequence comparison,more » they propose that these nucleotides are a free left Alu arm with 86% homology to the Alu-J family. RNA analysis shows one band with highest intensity in liver and kidney. This cDNA will allow in-depth studies of molecular defects in patients with defective peroxisomal bifunctional enzyme. Moreover, it will also provide a means for studying the regulation of peroxisomal [beta]-oxidation in humans. 33 refs., 5 figs.« less
NASA Astrophysics Data System (ADS)
Verma, Kanupriya; Viswanathan, K. S.; Majumder, Moumita; Sathyamurthy, N.
2017-11-01
The 1:1 dimer of borazine-acetylene has been studied for the first time, both experimentally and computationally. The borazine-acetylene dimer was trapped in Ar and N2 matrices, and studied using infrared spectroscopy. Our experiments clearly revealed two isomers of the borazine-acetylene complex, one in which the N-H of borazine interacted with the carbon of acetylene, and another in which the C-H of acetylene formed a hydrogen bond with a nitrogen atom of borazine. The formation of both isomers in the matrix was evidenced by shifts in the vibrational frequencies of the appropriate modes. Reassuringly, the experimental observations were corroborated by our computations using the second-order Møller-Plesset perturbation theoretic method and coupled-cluster singles, doubles and perturbative triples method in conjunction with different Dunning basis sets, which indicated both these isomers to be stable minima, with the N-HṡṡṡC complex being the global minimum. Atoms-in-molecules and energy decomposition analysis were also carried out for the different isomers of the dimer. These studies reveal that replacing the three C-C linkages in benzene with three B-N linkages in borazine modifies the interaction in the dimer sufficiently, to result in a different potential energy landscape for the borazine-acetylene system when compared with the benzene-acetylene system.
Chemistry of acetylene on platinum (111) and (100) surfaces
Muetterties, E. L.; Tasi, M.-C.; Kelemen, S. R.
1981-01-01
An ultra-high vacuum experimental study of acetylene chemisorption on Pt(111) and Pt(100) and of the reaction of hydrogen with the acetylene adsorbate has established distinguishing features of carbon-hydrogen bond breaking and making processes as a function of pressure, temperature, and surface crystallography. The rates for both processes are substantially higher on the Pt(100) surface. Net acetylene-hydrogen processes, in the temperature range of 20°C to ≈130°C, are distinctly different on the two surfaces: on Pt(100) the net reaction is hydrogen exchange (1H-2H exchange) and on Pt(111) the only detectable reaction is hydrogenation. Stereochemical differences in the acetylene adsorbate structure are considered to be a contributing factor to the differences in acetylene chemistry on these two surfaces. Images PMID:16593110
Vapor pressures of acetylene at low temperatures
NASA Technical Reports Server (NTRS)
Masterson, C. M.; Allen, John E., Jr.; Kraus, G. F.; Khanna, R. K.
1990-01-01
The atmospheres of many of the outer planets and their satellites contain a large number of hydrocarbon species. In particular, acetylene (C2H2) has been identified at Jupiter, Saturn and its satellite Titan, Uranus and Neptune. In the lower atmospheres of these planets, where colder temperatures prevail, the condensation and/or freezing of acetylene is probable. In order to obtain accurate models of the acetylene in these atmospheres, it is necessary to have a complete understanding of its vapor pressures at low temperatures. Vapor pressures at low temperatures for acetylene are being determined. The vapor pressures are measured with two different techniques in order to cover a wide range of temperatures and pressures. In the first, the acetylene is placed in a sample tube which is immersed in a low temperature solvent/liquid nitrogen slush bath whose temperature is measured with a thermocouple. The vapor pressure is then measured directly with a capacitance manometer. For lower pressures, a second technique which was called the thin-film infrared method (TFIR) was developed. It involves measuring the disappearance rate of a thin film of acetylene at a particular temperature. The spectra are then analyzed using previously determined extinction coefficient values, to determine the disappearance rate R (where R = delta n/delta t, the number of molecules that disappear per unit time). This can be related to the vapor pressure directly. This technique facilitates measurement of the lower temperatures and pressures. Both techniques have been calibrated using CO2, and have shown good agreement with the existing literature data.
NASA Astrophysics Data System (ADS)
Oremland, R. S.
2016-12-01
Acetylene (C2H2) fermentation was a serendipitous find of conducting C2H2-block assays of N2O reductase. Pelobacter acetylenicus grows on C2H2 via C2H2 hydratase (AH). AH is W-containing, exothermic, witha low redox potential. Unlike nitrogenase (N2ase), AH is specific for C2H2. When hydrated it forms acetaldehyde which is dismutated to ethanol, acetate providing energy plus carbon not only for P. acetylenicus but also for satellite anaerobes (e.g., sulfate-reducers, methanogens). But is there a larger significance to organisms that express AH? C2H2 is formed in the atmospheres of anoxic planet(oid)s by photolytic reactions of methane. Hence, the methane rich gas giants (e.g., Jupiter) and Titan have C2H2. It is also appears present in the Enceladus jets. Primordial Earth likely had a methane-rich atmosphere. Perhaps AH had a role in the evolution of primordial food chains in as much as C2H2 is easily metabolized when compared to methane? Akin to an ancient pablum for infant microbes that crawled out of the primordial soup. If so, it could also be a target substrate when searching for life on planet(oid)s of the outer Solar System. With regard to bioremediation, AH activity is relatively rare in assayed anoxic sediments. The exception was ground-waters contaminated with trichloroethylene (TCE), where dehalogenation gives rise to C2H2. Hence, there is an anthropogenic niche for pelobacter-like organisms in subsurface TCE-contaminated sites. Recent genomic sequencing suggests that P. acetylenicus contains not only AH, but N2ase as well, making it the only microbe that has the facility to metabolize C2H2 by either of the only two enzymes known that can achieve this feat. Both N2ase and AH are thought to be relic enzymes of Earth's transition from a pre-biotic to a biotic state where they were first employed to cleanse the primordial soup of nasty toxicants (e.g., cyanide). If so, why have they persisted, and what regulates their expression are questions we hope to
Kawashima, Yui; Cheng, Wen; Mifune, Jun; Orita, Izumi; Nakamura, Satoshi
2012-01-01
A genome survey of polyhydroxyalkanoate (PHA)-producing Ralstonia eutropha H16 detected the presence of 16 orthologs of R-specific enoyl coenzyme A (enoyl-CoA) hydratase, among which three proteins shared high homologies with the enzyme specific to enoyl-CoAs of medium chain length encoded by phaJ4 from Pseudomonas aeruginosa (phaJ4Pa). The recombinant forms of the three proteins, termed PhaJ4aRe to PhaJ4cRe, actually showed enoyl-CoA hydratase activity with R specificity, and the catalytic efficiencies were elevated as the substrate chain length increased from C4 to C8. PhaJ4aRe and PhaJ4bRe showed >10-fold-higher catalytic efficiency than PhaJ4cRe. The functions of the new PhaJ4 proteins were investigated using previously engineered R. eutropha strains as host strains; these strains are capable of synthesizing poly((R)-3-hydroxybutyrate-co-(R)-3-hydroxyhexanoate) [P(3HB-co-3HHx)] from soybean oil. Deletion of phaJ4aRe from the chromosome resulted in significant decrease of 3HHx composition in the accumulated copolyester, whereas no change was observed with deletion of phaJ4bRe or phaJ4cRe, indicating that only PhaJ4aRe was one of the major enzymes supplying the (R)-3HHx-CoA monomer through β-oxidation. Introduction of phaJ4aRe or phaJ4bRe into the R. eutropha strains using a broad-host-range vector enhanced the 3HHx composition of the copolyesters, but the introduction of phaJ4cRe did not. The two genes were then inserted into the pha operon on chromosome 1 of the engineered R. eutropha by homologous recombination. These modifications enabled the biosynthesis of P(3HB-co-3HHx) composed of a larger 3HHx fraction without a negative impact on cell growth and PHA production on soybean oil, especially when phaJ4aRe or phaJ4bRe was tandemly introduced with phaJAc from Aeromonas caviae. PMID:22081565
46 CFR 56.50-103 - Fixed oxygen-acetylene distribution piping.
Code of Federal Regulations, 2011 CFR
2011-10-01
... 46 Shipping 2 2011-10-01 2011-10-01 false Fixed oxygen-acetylene distribution piping. 56.50-103... oxygen-acetylene distribution piping. (a) This section applies to fixed piping installed for the distribution of oxygen and acetylene carried in cylinders as vessels stores. (b) The distribution piping shall...
46 CFR 56.50-103 - Fixed oxygen-acetylene distribution piping.
Code of Federal Regulations, 2014 CFR
2014-10-01
... 46 Shipping 2 2014-10-01 2014-10-01 false Fixed oxygen-acetylene distribution piping. 56.50-103... oxygen-acetylene distribution piping. (a) This section applies to fixed piping installed for the distribution of oxygen and acetylene carried in cylinders as vessels stores. (b) The distribution piping shall...
46 CFR 56.50-103 - Fixed oxygen-acetylene distribution piping.
Code of Federal Regulations, 2010 CFR
2010-10-01
... 46 Shipping 2 2010-10-01 2010-10-01 false Fixed oxygen-acetylene distribution piping. 56.50-103... oxygen-acetylene distribution piping. (a) This section applies to fixed piping installed for the distribution of oxygen and acetylene carried in cylinders as vessels stores. (b) The distribution piping shall...
46 CFR 56.50-103 - Fixed oxygen-acetylene distribution piping.
Code of Federal Regulations, 2012 CFR
2012-10-01
... 46 Shipping 2 2012-10-01 2012-10-01 false Fixed oxygen-acetylene distribution piping. 56.50-103... oxygen-acetylene distribution piping. (a) This section applies to fixed piping installed for the distribution of oxygen and acetylene carried in cylinders as vessels stores. (b) The distribution piping shall...
46 CFR 56.50-103 - Fixed oxygen-acetylene distribution piping.
Code of Federal Regulations, 2013 CFR
2013-10-01
... 46 Shipping 2 2013-10-01 2013-10-01 false Fixed oxygen-acetylene distribution piping. 56.50-103... oxygen-acetylene distribution piping. (a) This section applies to fixed piping installed for the distribution of oxygen and acetylene carried in cylinders as vessels stores. (b) The distribution piping shall...
Liu, Yi; Liu, Ping; Lin, Lu; Zhao, Yueqin; Zhong, Wenjuan; Wu, Lunjie; Zhou, Zhemin; Sun, Weifeng
2016-09-01
The maturation mechanism of nitrile hydratase (NHase) of Pseudomonas putida NRRL-18668 was discovered and named as "self-subunit swapping." Since the NHase of Bordetella petrii DSM 12804 is similar to that of P. putida, the NHase maturation of B. petrii is proposed to be the same as that of P. putida. However, there is no further information on the application of NHase according to these findings. We successfully rapidly purified NHase and its activator through affinity his tag, and found that the cell extracts of NHase possessed multiple types of protein ingredients including α, β, α2β2, and α(P14K)2 who were in a state of chemical equilibrium. Furthermore, the activity was significantly enhanced through adding extra α(P14K)2 to the cell extracts of NHase according to the chemical equilibrium. Our findings are useful for the activity enhancement of multiple-subunit enzyme and for the first time significantly increased the NHase activity according to the chemical equilibrium.
Acetylenes and dichloroanisoles from Psathyrella scobinacea.
Taha, A A
2000-12-01
The Et2O extract from Psathyrella scobinacea culture fluids contained three new acetylenic alcohols: deca-5,7,9-triynol, (-)hepta-4,6-diyne-2,3-diol, and (-)hept-cis 4-en-6-yne-2,3-diol; two known dichloroanisoles: 3,5-dichloro-4-methoxybenzaldehyde and 3,5-dichloro-4-methoxybenzyl alcohol; and three known acetylenic acids: octa-2,4,6-triynoic acid, dec-trans-2-ene-4,6,8-triynoic acid and its cis-isomer.
Acetylene-sourced CVD-synthesised catalytically active graphene for electrochemical biosensing.
Osikoya, Adeniyi Olugbenga; Parlak, Onur; Murugan, N Arul; Dikio, Ezekiel Dixon; Moloto, Harry; Uzun, Lokman; Turner, Anthony Pf; Tiwari, Ashutosh
2017-03-15
In this study, we have demonstrated the use of chemical vapour deposition (CVD) grown-graphene to develop a highly-ordered graphene-enzyme electrode for electrochemical biosensing. The graphene sheets were deposited on 1.00mm thick copper sheet at 850°C using acetylene (C 2 H 2 ) as carbon source in an argon (Ar) and nitrogen (N 2 ) atmosphere. An anionic surfactant was used to increase wettability and hydrophilicity of graphene; thereby facilitating the assembly of biomolecules on the electrode surface. Meanwhile, the theoretical calculations confirmed the successful modification of hydrophobic nature of graphene through the anionic surface assembly, which allowed high-ordered immobilisation of glucose oxidase (GOx) on the graphene. The electrochemical sensing activities of the graphene-electrode was explored as a model for bioelectrocatalysis. The bioelectrode exhibited a linear response to glucose concentration ranging from 0.2 to 9.8mM, with sensitivity of 0.087µA/µM/cm 2 and a detection limit of 0.12µM (S/N=3). This work sets the stage for the use of acetylene-sourced CVD-grown graphene as a fundamental building block in the fabrication of electrochemical biosensors and other bioelectronic devices. Copyright © 2016 Elsevier B.V. All rights reserved.
Acetylene around Jupiter Poles
2010-12-29
This graphic shows the distribution of the organic molecule acetylene at the north and south poles of Jupiter, based on data obtained by NASA Cassini spacecraft in early January 2001. Movie is available at the Photojournal.
Hirata, Akiko; Kishino, Shigenobu; Park, Si-Bum; Takeuchi, Michiki; Kitamura, Nahoko; Ogawa, Jun
2015-01-01
Hydroxy FAs, one of the gut microbial metabolites of PUFAs, have attracted much attention because of their various bioactivities. The purpose of this study was to identify lactic acid bacteria with the ability to convert linoleic acid (LA) to hydroxy FAs. A screening process revealed that a gut bacterium, Lactobacillus acidophilus NTV001, converts LA mainly into 13-hydroxy-cis-9-octadecenoic acid and resulted in the identification of the hydratase responsible, fatty acid hydratase 1 (FA-HY1). Recombinant FA-HY1 was purified, and its enzymatic characteristics were investigated. FA-HY1 could convert not only C18 PUFAs but also C20 and C22 PUFAs. C18 PUFAs with a cis carbon-carbon double bond at the Δ12 position were converted into the corresponding 13-hydroxy FAs. Arachidonic acid and DHA were converted into the corresponding 15-hydroxy FA and 14-hydroxy FA, respectively. To the best of our knowledge, this is the first report of a bacterial FA hydratase that can convert C20 and C22 PUFAs into the corresponding hydroxy FAs. These novel hydroxy FAs produced by using FA-HY1 should contribute to elucidating the bioactivities of hydroxy FAs. PMID:25966711
Recent New Methodologies for Acetylenic Polymers with Advanced Functionalities.
Qiu, Zijie; Han, Ting; Lam, Jacky W Y; Tang, Ben Zhong
2017-08-01
Polymers synthesized from acetylenic monomers often possess electronically unsaturated fused rings and thus show versatile optoelectronic properties and advanced functionalities. To expand the family of acetylenic polymers, development of new catalyst systems and synthetic routes is critically important. We summarize herein recent research progress on development of new methodologies towards functional polymers using alkyne building blocks since 2014. The polymerizations are categorized by the number of monomer components, namely homopolymerizations, two-component polymerizations, and multicomponent polymerizations. The properties and applications of acetylenic polymers, such as aggregation-induced emission, fluorescent photopatterning, light refraction, chemosensing, mechanochromism, chain helicity, etc., are also discussed.
46 CFR 151.50-79 - Methyl acetylene-propadiene mixture.
Code of Federal Regulations, 2011 CFR
2011-10-01
... suction line. (c) The piping system, including the cargo refrigeration system, for tanks to be loaded with methyl acetylene-propadiene mixture must be completely separate from piping and refrigeration systems for other tanks. If the piping system for the tanks to be loaded with methyl acetylene-propadiene mixture is...
46 CFR 151.50-79 - Methyl acetylene-propadiene mixture.
Code of Federal Regulations, 2010 CFR
2010-10-01
... suction line. (c) The piping system, including the cargo refrigeration system, for tanks to be loaded with methyl acetylene-propadiene mixture must be completely separate from piping and refrigeration systems for other tanks. If the piping system for the tanks to be loaded with methyl acetylene-propadiene mixture is...
Hüller, Cornelia; Grunow, Norbert; Nadler, Torsten; Bär, Michael
2011-01-01
We report on an exceedingly rare case of cutaneous and uterine leiomyomatosis in a 58-year-old Caucasian woman associated with ovarian cystadenoma and complete deletion of the fumarate hydratase gene. All patients and their family members with verified mutation have to be regularly screened for associated neoplasms, in particular papillary renal cell carcinoma (HLRCC, hereditary leiomyomatosis and renal cell cancer). PMID:24396716
Tropospheric and lower stratospheric vertical profiles of ethane and acetylene
NASA Technical Reports Server (NTRS)
Cronn, D.; Robinson, E.
1979-01-01
The first known vertical distributions of ethane and acetylene which extend into the lower stratosphere are reported. The average upper tropospheric concentrations, between 20,000 ft and 35,000 ft, near 37 deg N-123 deg W were 1.2 micrograms/cu m (1.0 ppb) for ethane and 0.24 micrograms /cu m (0.23 ppb) for acetylene while the values near 9 N-80 W were 0.95 micrograms/cu m (0.77 ppb) and 0.09 micrograms/cu m (0.09 ppb), respectively. Detectable quantities of both ethane and acetylene are present in the lower stratosphere. There is a sharp decrease in the levels of these two compounds as one crosses the tropopause and ascends into the lower stratosphere. The observed levels of ethane and acetylene may allow some impact on the background chemistry of the troposphere and stratosphere.
Interstitial pneumonitis after acetylene welding: a case report.
Brvar, Miran
2014-01-01
Acetylene is a colorless gas commonly used for welding. It acts mainly as a simple asphyxiant. In this paper, however, we present a patient who developed a severe interstitial pneumonitis after acetylene exposure during aluminum welding. A 44-year old man was welding with acetylene, argon and aluminum electrode sticks in a non-ventilated aluminum tank for 2 h. Four hours after welding dyspnea appeared and 22 h later he was admitted at the Emergency Department due to severe respiratory insufficiency with pO2 = 6.7 kPa. Chest X-ray showed diffuse interstitial infiltration. Pulmonary function and gas diffusion tests revealed a severe restriction (55% of predictive volume) and impaired diffusion capacity (47% of predicted capacity). Toxic interstitial pneumonitis was diagnosed and high-dose systemic corticosteroid methylprednisolone and inhalatory corticosteroid fluticasone therapy was started. Computed Tomography (CT) of the lungs showed a diffuse patchy ground-glass opacity with no signs of small airway disease associated with interstitial pneumonitis. Corticosteroid therapy was continued for the next 8 weeks gradually reducing the doses. The patient's follow-up did not show any deterioration of respiratory function. In conclusion, acetylene welding might result in severe toxic interstitial pneumonitis that improves after an early systemic and inhalatory corticosteroid therapy.
KISS: Kinetics and Structure of Superagglomerates Produced by Silane and Acetylene
NASA Technical Reports Server (NTRS)
Mulholland, G. W.; Yang, J. C.; Scott, J. H.; Sivithanu, Y.
2001-01-01
The objective of this study is to understand the process of gas phase agglomeration leading to superagglomerates and a gel-like structure for microgravity (0-g) silane and acetylene flames. Ultimately one would apply this understanding to predicting flame conditions that could lead to the gas phase production of an aero-gel. The approach is to burn acetylene and silane and to analyze the evolution of the soot and silica agglomerates. Acetylene is chosen because it has one of the highest soot volume fractions and there is evidence of super agglomerates being formed in laminar acetylene flames. Silane has the advantage that silica particles are the major combustion product resulting in a particle volume fraction a factor of ten greater than that for a carbonaceous smoke.
Design and experimental investigations on six-stroke SI engine using acetylene with water injection.
Gupta, Keshav; Suthar, Kishanlal; Jain, Sheetal Kumar; Agarwal, Ghanshyam Das; Nayyar, Ashish
2018-06-02
In the present study, a four-stroke cycle gasoline engine is redesigned and converted into a six-stroke cycle engine and experimental study has been conducted using gasoline and acetylene as fuel with water injection at the end of the recompression stroke. Acetylene has been used as an alternative fuel along with gasoline and performance of the six-stroke spark ignition (SI) engine with these two fuels has been studied separately and compared. Brake power and thermal efficiency are found to be 5.18 and 1.55% higher with acetylene as compared to gasoline in the six-stroke engine. However, thermal efficiency is found to be 45% higher with acetylene in the six-stroke engine as compared to four-stroke SI engine. The CO and HC emissions were found to be reduced by 13.33 and 0.67% respectively with acetylene as compared to gasoline due to better combustion of acetylene. The NO x emission was reduced by 5.65% with acetylene due to lower peak temperature by water injection. The experimental results showed better engine performance and emissions with acetylene as fuel in the six-stroke engine.
Assessing the long-term variability of acetylene and ethane in the stratosphere of Jupiter
NASA Astrophysics Data System (ADS)
Melin, Henrik; Fletcher, L. N.; Donnelly, P. T.; Greathouse, T. K.; Lacy, J. H.; Orton, G. S.; Giles, R. S.; Sinclair, J. A.; Irwin, P. G. J.
2018-05-01
Acetylene (C2H2) and ethane (C2H6) are both produced in the stratosphere of Jupiter via photolysis of methane (CH4). Despite this common source, the latitudinal distribution of the two species is radically different, with acetylene decreasing in abundance towards the pole, and ethane increasing towards the pole. We present six years of NASA IRTF TEXES mid-infrared observations of the zonally-averaged emission of methane, acetylene and ethane. We confirm that the latitudinal distributions of ethane and acetylene are decoupled, and that this is a persistent feature over multiple years. The acetylene distribution falls off towards the pole, peaking at ∼ 30°N with a volume mixing ratio (VMR) of ∼ 0.8 parts per million (ppm) at 1 mbar and still falling off at ± 70° with a VMR of ∼ 0.3 ppm. The acetylene distributions are asymmetric on average, but as we move from 2013 to 2017, the zonally-averaged abundance becomes more symmetric about the equator. We suggest that both the short term changes in acetylene and its latitudinal asymmetry is driven by changes to the vertical stratospheric mixing, potentially related to propagating wave phenomena. Unlike acetylene, ethane has a symmetric distribution about the equator that increases toward the pole, with a peak mole fraction of ∼ 18 ppm at about ± 50° latitude, with a minimum at the equator of ∼ 10 ppm at 1 mbar. The ethane distribution does not appear to respond to mid-latitude stratospheric mixing in the same way as acetylene, potentially as a result of the vertical gradient of ethane being much shallower than that of acetylene. The equator-to-pole distributions of acetylene and ethane are consistent with acetylene having a shorter lifetime than ethane that is not sensitive to longer advective timescales, but is augmented by short-term dynamics, such as vertical mixing. Conversely, the long lifetime of ethane allows it to be transported to higher latitudes faster than it can be chemically depleted.
Acetylene as a substrate in the development of primordial bacterial communities
Culbertson, C.W.; Strohmaier, F.E.; Oremland, R.S.
1988-01-01
The fermentation of atmospheric acetylene by anaerobic bacteria is proposed as the basis of a primordial heterotrophic food chain. The accumulation of fermentation products (acetaldehyde, ethanol, acetate and hydrogen) would create niches for sulfate-respiring bacteria as well as methanogens. Formation of acetylene-free environments in soils and sediments would also alter the function of nitrogenase from detoxification to nitrogen-fixation. The possibility of an acetylene-based anaerobic food chain in Jovian-type atmospheres is discussed. ?? 1988 Kluwer Academic Publishers.
Ethane and acetylene abundances in the Jovian atmosphere
NASA Technical Reports Server (NTRS)
Tokunaga, A.; Knacke, R. F.; Owen, T.
1976-01-01
The paper reports spectra of Jupiter in the spectral region from 755 to 850 kaysers, which covers the nu-9 fundamental of ethane and contains lines from the R branch of the nu-5 fundamental of acetylene. The monochromatic absorption coefficient of the central Q branch of the nu-9 fundamental of ethane, which was determined in the laboratory, is applied in a radiative-transfer calculation to evaluate the ethane mixing ratio in the Jovian atmosphere; the present data are also used to place an upper limit on the acetylene mixing ratio. For the radiative-transfer calculation, emission intensity is computed for the region above the 0.02-atm level assuming both an isothermal inversion layer and a previously reported temperature profile. The resulting maximum mixing ratios consistent with the observations are 0.00003 for ethane and 7.5 by 10 to the -8th power for acetylene.
Gosling, J. P.; Duggan, P. F.
1971-01-01
Bakers' yeast oxidizes acetate at a high rate only after an adaptation period during which the capacity of the glyoxylate cycle is found to increase. There was apparently no necessity for the activity of acetyl-coenzyme A synthetase, the capacity of the tricarboxylic acid cycle, or the concentrations of the cytochromes to increase for this adaptation to occur. Elevation of fructose 1,6 diphosphatase occurred only when acetate oxidation was nearly maximal. Cycloheximide almost completely inhibited adaptation as well as increases in the activities of isocitrate lyase and aconitate hydratase, the only enzymes assayed. p-Fluorophenylalanine was partially effective and chloramphenicol did not inhibit at all. The presence of ammonium, which considerably delayed adaptation of the yeast to acetate oxidation, inhibited the increases in the activities of the glyoxylate cycle enzymes to different degrees, demonstrating noncoordinate control of these enzymes. Under the various conditions, the only enzyme activity increase consistently related to the rising oxygen uptake rate was that of isocitrate lyase which apparently limited the activity of the cycle. PMID:5557595
Complete genome sequences of two acetylene-fermenting Pelobacter acetylenicus strains
Sutton, John M.; Baesman, Shaun; Fierst, Janna L.; Poret-Peterson, Amisha T.; Oremland, Ronald S.; Dunlap, Darren S.; Akob, Denise M.
2017-01-01
Acetylene fermentation is a rare metabolism that was serendipitously discovered during C2H2-block assays of N2O reductase. Here, we report the genome sequences of two type strains of acetylene-fermenting Pelobacter acetylenicus, the freshwater bacterium DSM 3246 and the estuarine bacterium DSM 3247.
NASA Astrophysics Data System (ADS)
Zhai, Yunfeng; St-Pierre, Jean
2017-12-01
Realistically, proton exchange membrane fuel cells (PEMFCs) are operated under varying operating conditions that potentially impact the acetylene contamination reactions. In this paper, the effects of the cell operating conditions on the acetylene contamination in PEMFCs are investigated under different current densities and temperatures with different acetylene concentrations in the cathode. Electrochemical impedance spectroscopy is applied during the constant-current operation to analyze the impacts of the operating conditions on the acetylene electrochemical reactions. The experimental results indicate that higher acetylene concentrations, higher current densities and lower cell temperatures decrease the cell performance more. In particular, cathode poisoning becomes more severe at medium cell current densities. The cell cathode potentials at such current densities are not sufficient to completely oxidize the intermediate or sufficiently low to completely reduce the adsorbed acetylene. Based on these investigations, the possible condition-dependent limitations of the acetylene concentration and cell operating voltage are proposed for insight into the acetylene contamination mitigation stratagem. Regarding the barrier conditions, the acetylene reactions change abruptly, and adjusting the cell operation parameters to change the acetylene adsorbate and intermediate accumulation conditions to induce complete oxidation or reduction conditions may mitigate the severe acetylene contamination effects on PEMFCs.
Anaerobic oxidation of acetylene by estuarine sediments and enrichment cultures
Culbertson, Charles W.; Zehnder, Alexander J. B.; Oremland, Ronald S.
1981-01-01
Acetylene disappeared from the gas phase of anaerobically incubated estuarine sediment slurries, and loss was accompanied by increased levels of carbon dioxide. Acetylene loss was inhibited by chloramphenicol, air, and autoclaving. Addition of 14C2H2 to slurries resulted in the formation of 14CO2 and the transient appearance of 14C-soluble intermediates, of which acetate was a major component. Acetylene oxidation stimulated sulfate reduction; however, sulfate reduction was not required for the loss of C2H2 to occur. Enrichment cultures were obtained which grew anaerobically at the expense of C2H2.
Latimer, Scott; Li, Yubing; Nguyen, Thuong T H; Soubeyrand, Eric; Fatihi, Abdelhak; Elowsky, Christian G; Block, Anna; Pichersky, Eran; Basset, Gilles J
2018-05-09
The proteinogenic branched-chain amino acids (BCAAs) leucine, isoleucine and valine are essential nutrients for mammals. In plants, BCAAs double as alternative energy sources when carbohydrates become limiting, the catabolism of BCAAs providing electrons to the respiratory chain and intermediates to the tricarboxylic acid cycle. Yet, the actual architecture of the degradation pathways of BCAAs is not well understood. In this study, gene network modeling in Arabidopsis and rice, and plant-prokaryote comparative genomics detected candidates for 3-methylglutaconyl-CoA hydratase (4.2.1.18), one of the missing plant enzymes of leucine catabolism. Alignments of these protein candidates sampled from various spermatophytes revealed non-homologous N-terminal extensions that are lacking in their bacterial counterparts, and green fluorescent protein-fusion experiments demonstrated that the Arabidopsis protein, product of gene At4g16800, is targeted to mitochondria. Recombinant At4g16800 catalyzed the dehydration of 3-hydroxymethylglutaryl-CoA into 3-methylglutaconyl-CoA, and displayed kinetic features similar to those of its prokaryotic homolog. When at4g16800 knockout plants were subjected to dark-induced carbon starvation, their rosette leaves displayed accelerated senescence as compared with control plants, and this phenotype was paralleled by a marked increase in the accumulation of free and total leucine, isoleucine and valine. The seeds of the at4g16800 mutant showed a similar accumulation of free BCAAs. These data suggest that 3-methylglutaconyl-CoA hydratase is not solely involved in the degradation of leucine, but is also a significant contributor to that of isoleucine and valine. Furthermore, evidence is shown that unlike the situation observed in Trypanosomatidae, leucine catabolism does not contribute to the formation of the terpenoid precursor mevalonate. © 2018 The Authors The Plant Journal © 2018 John Wiley & Sons Ltd.
Nitrogen Fixation (Acetylene Reduction) Associated with Duckweed (Lemnaceae) Mats
Zuberer, D. A.
1982-01-01
Duckweed (Lemnaceae) mats in Texas and Florida were investigated, using the acetylene reduction assay, to determine whether nitrogen fixation occurred in these floating aquatic macrophyte communities. N2-fixing microorganisms were enumerated by plating or most-probable-number techniques, using appropriate N-free media. Results of the investigations indicated that substantial N2-fixation (C2H2) was associated with duckweed mats in Texas and Florida. Acetylene reduction values ranged from 1 to 18 μmol of C2H4 g (dry weight)−1 day−1 for samples incubated aerobically in light. Dark N2 fixation was always two- to fivefold lower. 3-(3,4-Dichlorophenyl)-1,1-dimethylurea (7 to 10 μM) reduced acetylene reduction to levels intermediate between light and dark incubation. Acetylene reduction was generally greatest for samples incubated anaerobically in the light. It was estimated that 15 to 20% of the N requirement of the duckweed could be supplied through biological nitrogen fixation. N2-fixing heterotrophic bacteria (105 cells g [wet weight]−1 and cyanobacteria (105 propagules g [wet weight]−1 were associated with the duckweed mats. Azotobacter sp. was not detected in these investigations. One diazotrophic isolate was classified as Klebsiella. PMID:16345992
Siloxane containing addition polyimides. II - Acetylene terminated polyimides
NASA Technical Reports Server (NTRS)
Maudgal, S.; St. Clair, T. L.
1984-01-01
Acetylene terminated polyimide oligomers having a range of molecular weights have been synthesized by reacting bis (gamma-aminopropyl) tetramethyldisiloxane, aminophenylacetylene and 3, 3', 4, 4' benzophenonetetracarboxylic dianhydride in different molar ratios. The prepolymers were isolated and characterized for melt flow and cure properties. They show promise as adhesives for bonding titanium to titanium and as matrix resins for graphite cloth reinforced composites. The most promising system has been blended in varying proportions with Thermid 600, a commercially available acetylene terminated polyimide oligomer, and the mixtures have been tested for application as composite matrix resins.
The aconitate hydratase family from Citrus
2010-01-01
Background Research on citrus fruit ripening has received considerable attention because of the importance of citrus fruits for the human diet. Organic acids are among the main determinants of taste and organoleptic quality of fruits and hence the control of fruit acidity loss has a strong economical relevance. In citrus, organic acids accumulate in the juice sac cells of developing fruits and are catabolized thereafter during ripening. Aconitase, that transforms citrate to isocitrate, is the first step of citric acid catabolism and a major component of the citrate utilization machinery. In this work, the citrus aconitase gene family was first characterized and a phylogenetic analysis was then carried out in order to understand the evolutionary history of this family in plants. Gene expression analyses of the citrus aconitase family were subsequently performed in several acidic and acidless genotypes to elucidate their involvement in acid homeostasis. Results Analysis of 460,000 citrus ESTs, followed by sequencing of complete cDNA clones, identified in citrus 3 transcription units coding for putatively active aconitate hydratase proteins, named as CcAco1, CcAco2 and CcAco3. A phylogenetic study carried on the Aco family in 14 plant species, shows the presence of 5 Aco subfamilies, and that the ancestor of monocot and dicot species shared at least one Aco gene. Real-time RT-PCR expression analyses of the three aconitase citrus genes were performed in pulp tissues along fruit development in acidic and acidless citrus varieties such as mandarins, oranges and lemons. While CcAco3 expression was always low, CcAco1 and CcAco2 genes were generally induced during the rapid phase of fruit growth along with the maximum in acidity and the beginning of the acid reduction. Two exceptions to this general pattern were found: 1) Clemenules mandarin failed inducing CcAco2 although acid levels were rapidly reduced; and 2) the acidless "Sucreña" orange showed unusually high levels
Gorbenko, M V; Popova, T N; Shul'gin, K K; Popov, S S; Agarkov, A A
2014-01-01
The influence of melaxen and valdoxan on the biochemiluminescence parameters, aconitate hydratase activity and citrate level in rats heart and liver during development of experimental hyperthyroidism has been investigated. Administration of these substances promoted a decrease of biochemiluminescence parameters, which had been increased in tissues of rats in response to the development of oxidative stress under hyperthyroidism. Aconitate hydratase activity and citrate concentration in rats liver and heart, growing at pathological conditions, changed towards control value after administration of the drugs correcting melatonin level. The results indicate the positive effect of valdoxan and melaxen on oxidative status of the organism under the development of experimental hyperthyroidism that is associated with antioxidant action of melatonin.
Evaluation of Sorbents for Acetylene Separation in Atmosphere Revitalization Loop Closure
NASA Technical Reports Server (NTRS)
Abney, Morgan B.; Miller, Lee A.; Barton, Katherine
2012-01-01
State-of-the-art carbon dioxide reduction technology uses a Sabatier reactor to recover water from metabolic carbon dioxide. In order to maximize oxygen loop closure, a byproduct of the system, methane, must be reduced to recover hydrogen. NASA is currently exploring a microwave plasma methane pyrolysis system for this purpose. The resulting product stream of this technology includes unreacted methane, product hydrogen, and acetylene. The hydrogen and the small amount of unreacted methane resulting from the pyrolysis process can be returned to the Sabatier reactor thereby substantially improving the overall efficiency of the system. However, the acetylene is a waste product that must be removed from the pyrolysis product. Two materials have been identified as potential sorbents for acetylene removal: zeolite 4A, a commonly available commercial sorbent, and HKUST-1, a newly developed microporous metal. This paper provides an explanation of the rationale behind acetylene removal and the results of separation testing with both materials
Evaluation of Sorbents for Acetylene Separation in Atmosphere Revitalization Loop Closure
NASA Technical Reports Server (NTRS)
Abney, Morgan B.; Miller, Lee A.; Barton, Katherine
2011-01-01
State-of-the-art carbon dioxide reduction technology uses a Sabatier reactor to recover water from metabolic carbon dioxide. In order to maximize oxygen loop closure, a byproduct of the system, methane, must be reduced to recover hydrogen. NASA is currently exploring a microwave plasma methane pyrolysis system for this purpose. The resulting product stream of this technology includes unreacted methane, product hydrogen, and acetylene. The hydrogen and the small amount of unreacted methane resulting from the pyrolysis process can be returned to the Sabatier reactor thereby substantially improving the overall efficiency of the system. However, the acetylene is a waste product that must be removed from the pyrolysis product. Two materials have been identified as potential sorbents for acetylene removal: zeolite 4A, a commonly available commercial sorbent, and HKUST-1, a newly developed microporous metal. This paper provides an explanation of the rationale behind acetylene removal and the results of separation testing with both materials.
Acetylene measurement in flames by chirp-based quantum cascade laser spectrometry.
Quine, Zachary R; McNesby, Kevin L
2009-06-01
We have designed and characterized a mid-IR spectrometer built around a pulsed distributed-feedback quantum cascade laser using the characteristic frequency down-chirp to scan through the spectral region 6.5 cm(-1) spectral region. The behavior of this chirp is extensively measured. The accuracy and detection limits of the system as an absorption spectrometer are demonstrated first by measuring spectra of acetylene through a single pass 16 cm absorption cell in real time at low concentrations and atmospheric pressure. The smallest detectable peak is measured to be approximately 1.5 x 10(-4) absorbance units, yielding a minimum detectable concentration length product of 2.4 parts per million meter at standard temperature and pressure. This system is then used to detect acetylene within an ethylene-air opposed flow flame. Measurements of acetylene content as a function of height above the fuel source are presented, as well as measurements of acetylene produced in fuel breakdown as a function of preinjection fuel temperature.
Detection of acetylene in the Saturnian atmosphere, using the IUE satellite
NASA Technical Reports Server (NTRS)
Moos, H. W.; Clarke, J. T.
1979-01-01
Direct evidence for the presence of acetylene in the upper part of the Saturnian atmosphere is reported. This evidence consists of two spectra of Saturn obtained by using the low-dispersion mode of the short-wavelength spectrograph on the IUE satellite. A series of distinct absorption bands in the reflected solar radiation at 1750 A is attributed to acetylene. The reciprocal of the acetylene cross section at 1750 A is shown to imply 7 x 10 to the 17th molecules/sq cm in the reflecting layer. It is concluded that the radiation at 1750 A originates from less than 2.3 km-amagat within the atmosphere.
Lowe, D J; Eady, R R; Thorneley, N F
1978-01-01
Klebsiella pneumoniae nitrogenase exhibited four new electron-paramagnetic-resonance signals during turnover at 10 degrees C, pH7.4, which were assigned to intermediates present in low concentrations in the steady state. 57Fe-substituted Mo--Fe protein showed that they arose from Fe--S clusters in the Mo--Fe protein of nitrogenase. The new signals are designated: Ic, g values at 4.67, 3.37 and approx. 2.0; VI, g values at 2.125, 2.000 and 2.000; VII, g values at 5.7 and 5.4; VIII, g values at 2.092, 1.974 and 1.933. The sharp axial signal VI arises from a Fe4S4 cluster at the --1 oxidation level. This signal was only detected in the presence of ethylene and provides the first evidence of an enzyme--product complex for nitrogenase. [13C]Acetylene and [13C]ethylene provided no evidence for direct binding of this substrate and product to the Fe--S clusters giving rise to these signals. The dependence of signal intensities on acetylene concentration indicated two types of binding site, with apparent dissociation constants K less than 16 micron and K approximately 13mM. A single binding site for ethylene (K=1.5mM) was detected. A scheme is proposed for the mechanism of reduction of acetylene to ethylene and inhibition of this reaction by CO. PMID:210766
Nitrogen Fixation (Acetylene Reduction) by Epiphytes of Freshwater Macrophytes
Finke, Linda R.; Seeley, H. W.
1978-01-01
The involvement of epiphytic microorganisms in nitrogen fixation was investigated in a shallow freshwater pond near Ithaca, N.Y. The acetylene reduction technique was used to follow diel and seasonal cycles of nitrogen fixation by epiphytes of Myriophyllum spicatum. Acetylene-reducing activity was maximal between noon and 6 p.m., but substantial levels of activity relative to daytime rates continued through the night. Experiments with the seasonal course of activity showed a gradual decline during the autumn months and no activity in January or February. Activity commenced in May, with an abrupt increase to levels between 0.45 and 0.95 nmol of ethylene formed per mg (dry weight) of plant per h. Through most of the summer months, mean rates of acetylene reduction remained between 0.15 and 0.60 nmol/mg (dry weight) per h. It was calculated from diel and seasonal cycles that, in the pond areas studied, epiphytes were capable of adding from 7.5 to 12.5 μg of N per mg of plant per year to the pond. This amount is significant relative to the total amount of nitrogen incorporated into the plant. Blue-green algae (cyanobacteria), particularly Gloeotrichia, appeared to bear prime responsibility for nitrogen fixation, but photosynthetic bacteria of the genus Rhodopseudomonas were isolated from M. spicatum and shown to support high rates of acetylene reduction. PMID:16345301
Inhibition of existing denitrification enzyme activity by chloramphenicol
Brooks, M.H.; Smith, R.L.; Macalady, D.L.
1992-01-01
Chloramphenicol completely inhibited the activity of existing denitrification enzymes in acetylene-block incubations with (i) sediments from a nitrate-contaminated aquifer and (ii) a continuous culture of denitrifying groundwater bacteria. Control flasks with no antibiotic produced significant amounts of nitrous oxide in the same time period. Amendment with chloramphenicol after nitrous oxide production had begun resulted in a significant decrease in the rate of nitrous oxide production. Chloramphenicol also decreased (>50%) the activity of existing denitrification enzymes in pure cultures of Pseudomonas denitrificans that were harvested during log- phase growth and maintained for 2 weeks in a starvation medium lacking electron donor. Short-term time courses of nitrate consumption and nitrous oxide production in the presence of acetylene with P. denitrificans undergoing carbon starvation were performed under optimal conditions designed to mimic denitrification enzyme activity assays used with soils. Time courses were linear for both chloramphenicol and control flasks, and rate estimates for the two treatments were significantly different at the 95% confidence level. Complete or partial inhibition of existing enzyme activity is not consistent with the current understanding of the mode of action of chloramphenicol or current practice, in which the compound is frequently employed to inhibit de novo protein synthesis during the course of microbial activity assays. The results of this study demonstrate that chloramphenicol amendment can inhibit the activity of existing denitrification enzymes and suggest that caution is needed in the design and interpretation of denitrification activity assays in which chloramphenicol is used to prevent new protein synthesis.
Complete genome sequence of the acetylene-fermenting Pelobacter sp. strain SFB93
Sutton, John M.; Baesman, Shaun; Fierst, Janna L.; Poret-Peterson, Amisha T.; Oremland, Ronald S.; Dunlap, Darren S.; Akob, Denise M.
2017-01-01
Acetylene fermentation is a rare metabolism that was previously reported as being unique to Pelobacter acetylenicus. Here, we report the genome sequence of Pelobacter sp. strain SFB93, an acetylene-fermenting bacterium isolated from sediments collected in San Francisco Bay, CA.
A Nitrile Hydratase in the Eukaryote Monosiga brevicollis
Foerstner, Konrad U.; Doerks, Tobias; Muller, Jean; Raes, Jeroen; Bork, Peer
2008-01-01
Bacterial nitrile hydratase (NHases) are important industrial catalysts and waste water remediation tools. In a global computational screening of conventional and metagenomic sequence data for NHases, we detected the two usually separated NHase subunits fused in one protein of the choanoflagellate Monosiga brevicollis, a recently sequenced unicellular model organism from the closest sister group of Metazoa. This is the first time that an NHase is found in eukaryotes and the first time it is observed as a fusion protein. The presence of an intron, subunit fusion and expressed sequence tags covering parts of the gene exclude contamination and suggest a functional gene. Phylogenetic analyses and genomic context imply a probable ancient horizontal gene transfer (HGT) from proteobacteria. The newly discovered NHase might open biotechnological routes due to its unconventional structure, its new type of host and its apparent integration into eukaryotic protein networks. PMID:19096720
Acetylene-based pathways for prebiotic evolution on Titan
NASA Astrophysics Data System (ADS)
Abbas, O.; Schulze-Makuch, D.
2002-11-01
Due to Titan's reducing atmosphere and lack of an ozone shield, ionizing radiation penetrates the atmosphere creating ions, radicals and electrons that are highly reactive producing versatile chemical species on Titan's surface. We propose that the catalytic hydrogenation of photochemically produced acetylene may be used as simple metabolic pathway by organisms at or near Titan's surface. While the acetylene may undergo this reaction, it can also undertake several other multi-step synthetic schemes that eventually lead to the production of amino acids or other biologically important molecules. Four model synthetic schemes will be described, and their relevance in relation to prebiotic evolution on Earth is discussed.
The abundances of ethane and acetylene in the atmospheres of Jupiter and Saturn
NASA Technical Reports Server (NTRS)
Noll, K. S.; Knacke, R. F.; Tokunaga, A. T.; Lacy, J. H.; Beck, S.
1986-01-01
The present determination of the stratospheric abundances of ethane and acetylene on Jupiter and Saturn on the basis of IR spectra near 780/cm uses atmospheric models whose thermal and density profiles have constant mixing ratios. The ratio of ethane to acetylene is noted to be insensitive to model atmosphere assumptions; it is 55 + or - 31 for Jupiter and 23 + or - 12 where model mixing ratios are uniform. Atmospheric model density profiles adapted from theoretical photochemical models are noted to also yield a higher ethane/acetylene ratios for Jupiter.
The abundances of ethane to acetylene in the atmospheres of Jupiter and Saturn
NASA Technical Reports Server (NTRS)
Noll, K. S.; Knacke, R. F.; Tokunaga, A. T.; Lacy, J. H.; Beck, S.; Serabyn, E.
1986-01-01
The present determination of the stratospheric abundances of ethane and acetylene on Jupiter and Saturn on the basis of IR spectra near 780/cm uses atmospheric models whose thermal and density profiles have constant mixing ratios. The ratio of ethane to acetylene is noted to be insensitive to model atmosphere assumptions; it is 55 + or - 31 for Jupiter and 23 + or - 12 where model mixing ratios are uniform. Atmospheric model density profiles adapted from theoretical photochemical models are noted to also yield a higher ethane/acetylene ratios for Jupiter.
Nagata, Reiko; Kawaji, Satoko; Mori, Yasuyuki
2013-10-01
Johne's disease (JD), caused by Mycobacterium avium subspecies paratuberculosis (MAP), remains difficult to control because of the lack of specific and sensitive diagnostic tests. In order to improve the specificity of sero-diagnosis for JD, the phage display library derived from genomic DNA of MAP was immunoscreened to identify novel antigenic targets. We selected a clone using antibodies from MAP experimentally infected cattle, and annotated its coding sequence as MAP1197 in the MAP genome, which encoded "echA12_2" in the MAP protein (Map-echA) belonging to Enoyl-CoA hydratase, known as a crotonase enzyme. The Map-echA was expressed in Esherichia coli and purified as a histidine-tag recombinant protein (rMap-echA), and the diagnostic potential of the protein was further evaluated by enzyme-linked immunosorbent assays (ELISA). Antibody responses to rMap-echA were higher in MAP-infected cattle than in uninfected cattle. The specificity of the Map-echA ELISA was also confirmed by evaluation with hyper-immune sera against various kinds of Mycobacterium species. Furthermore, in all experimentally infected cattle the antibody against rMap-echA was detected 2-7months earlier than by a commercially available ELISA kit. These results suggested that Map-echA can be used as a specific and sensitive serological diagnostic antigen for the detection of MAP infection. Copyright © 2013 Elsevier B.V. All rights reserved.
Yin, Tan Tzy; Pin, Ui Li; Ghazali, Amir Hamzah Ahmad
2015-04-01
The production of nitrogenase enzyme and auxins by free living diazotrophs has the potential to influence the growth of host plants. In this study, diazotrophs were grown in the presence of various concentrations of nitogen (N) to determine the optimal concentration of N for microbial growth stimulation, promotion of gaseous N (N2) fixation, and phytohormone production. Therefore, we investigate whether different levels of N supplied to Herbaspirillum seropedicae (Z78) have significant effects on nitrogenase activity and auxin production. The highest nitrogenase activity and the lowest auxin production of H. seropedicae (Z78) were both recorded at 0 gL(-1) of NH4Cl. Higher levels of external N caused a significant decrease in the nitrogenase activity and an increased production of auxins. In a subsequent test, two different inoculum sizes of Z78 (10(6) and 10(12) cfu/ml) were used to study the effect of different percentages of acetylene on nitrogenase activity of the inoculum via the acetylene reduction assay (ARA). The results showed that the optimal amount of acetylene required for nitrogenase enzyme activity was 5% for the 10(6) cfu/ml inoculum, whereas the higher inoculum size (10(12) cfu/ml) required at least 10% of acetylene for optimal nitrogenase activity. These findings provide a clearer understanding of the effects of N levels on diazotrophic nitrogenase activity and auxin production, which are important factors influencing plant growth.
Yin, Tan Tzy; Pin, Ui Li; Ghazali, Amir Hamzah Ahmad
2015-01-01
The production of nitrogenase enzyme and auxins by free living diazotrophs has the potential to influence the growth of host plants. In this study, diazotrophs were grown in the presence of various concentrations of nitogen (N) to determine the optimal concentration of N for microbial growth stimulation, promotion of gaseous N (N2) fixation, and phytohormone production. Therefore, we investigate whether different levels of N supplied to Herbaspirillum seropedicae (Z78) have significant effects on nitrogenase activity and auxin production. The highest nitrogenase activity and the lowest auxin production of H. seropedicae (Z78) were both recorded at 0 gL−1 of NH4Cl. Higher levels of external N caused a significant decrease in the nitrogenase activity and an increased production of auxins. In a subsequent test, two different inoculum sizes of Z78 (106 and 1012 cfu/ml) were used to study the effect of different percentages of acetylene on nitrogenase activity of the inoculum via the acetylene reduction assay (ARA). The results showed that the optimal amount of acetylene required for nitrogenase enzyme activity was 5% for the 106 cfu/ml inoculum, whereas the higher inoculum size (1012 cfu/ml) required at least 10% of acetylene for optimal nitrogenase activity. These findings provide a clearer understanding of the effects of N levels on diazotrophic nitrogenase activity and auxin production, which are important factors influencing plant growth. PMID:26868594
Detonation engine fed by acetylene-oxygen mixture
NASA Astrophysics Data System (ADS)
Smirnov, N. N.; Betelin, V. B.; Nikitin, V. F.; Phylippov, Yu. G.; Koo, Jaye
2014-11-01
The advantages of a constant volume combustion cycle as compared to constant pressure combustion in terms of thermodynamic efficiency has focused the search for advanced propulsion on detonation engines. Detonation of acetylene mixed with oxygen in various proportions is studied using mathematical modeling. Simplified kinetics of acetylene burning includes 11 reactions with 9 components. Deflagration to detonation transition (DDT) is obtained in a cylindrical tube with a section of obstacles modeling a Shchelkin spiral; the DDT takes place in this section for a wide range of initial mixture compositions. A modified ka-omega turbulence model is used to simulate flame acceleration in the Shchelkin spiral section of the system. The results of numerical simulations were compared with experiments, which had been performed in the same size detonation chamber and turbulent spiral ring section, and with theoretical data on the Chapman-Jouguet detonation parameters.
NASA Technical Reports Server (NTRS)
Walch, Stephen P.; Taylor, Peter R.
1995-01-01
The reaction of vinylidene (CH2C) with acetylene may be an initiating reaction in soot formation. We report minimum energy paths and accurate energetics for a pathway leading to vinyl-acetylene and for a number of isomers of C4H4. The calculations use complete active space self-consistent field (CASSCF) derivative methods to characterize the stationary points and internally contacted configuration interaction (ICCI) and/or coupled cluster singles and doubles with a perturbational estimate of triple excitations (CCSD(T)) to determine the energetics. We find an entrance channel barrier of about 5 kcal/mol for the addition of vinylidene to acetylene, but no barriers above reactants for the reaction pathway leading to vinyl-acetylene.
NASA Astrophysics Data System (ADS)
Abdollahi, Tahereh; Farmanzadeh, Davood
2018-03-01
In this work, by density functional theory, the palladium nanoclusters were investigated in order to design new catalysts for the selective hydrogenation of acetylene present in olefin feeds. At first, the palladium nanoclusters were studied using PBE-G functional with DNP-ECP basis set. According to the performed calculations, among all the Pdn (n = 2-15) nanoclusters, two Pd12 and Pd2 nanoclusters can be used as catalysts in the reactions of hydrogenation of acetylene and ethylene. The adsorption energy of hydrogen on the Pd12 nanocluster is higher than that of acetylene and ethylene, and therefore, the Pd12 nanocluster is more appropriate for the hydrogenation of acetylene and ethylene. However, the calculated activation energy barriers for the reactions of hydrogenation of acetylene and ethylene showed that the Pd2 nanocluster has more selectivity in comparison to the Pd12 nanocluster. According to our results, the activation energy of the hydrogenation of acetylene to vinyl on the Pd2 nanocluster is 23.96 kJ/mol lower than that on the Pd12 nanocluster. Also, the activation energy of the hydrogenation of ethylene to ethyl on the Pd2 nanocluster is higher than that on the Pd12 nanocluster Therefore, it seems that the Pd2 surface can be used as a catalyst for the selective hydrogenation of acetylene.
Ashrafian, Houman; O'Flaherty, Linda; Adam, Julie; Steeples, Violetta; Chung, Yuen-Li; East, Phil; Vanharanta, Sakari; Lehtonen, Heli; Nye, Emma; Hatipoglu, Emine; Miranda, Melroy; Howarth, Kimberley; Shukla, Deepa; Troy, Helen; Griffiths, John; Spencer-Dene, Bradley; Yusuf, Mohammed; Volpi, Emanuela; Maxwell, Patrick H; Stamp, Gordon; Poulsom, Richard; Pugh, Christopher W; Costa, Barbara; Bardella, Chiara; Di Renzo, Maria Flavia; Kotlikoff, Michael I; Launonen, Virpi; Aaltonen, Lauri; El-Bahrawy, Mona; Tomlinson, Ian; Pollard, Patrick J
2010-11-15
Hereditary leiomyomatosis and renal cell carcinoma (HLRCC) is caused by mutations in the Krebs cycle enzyme fumarate hydratase (FH). It has been proposed that "pseudohypoxic" stabilization of hypoxia-inducible factor-α (HIF-α) by fumarate accumulation contributes to tumorigenesis in HLRCC. We hypothesized that an additional direct consequence of FH deficiency is the establishment of a biosynthetic milieu. To investigate this hypothesis, we isolated primary mouse embryonic fibroblast (MEF) lines from Fh1-deficient mice. As predicted, these MEFs upregulated Hif-1α and HIF target genes directly as a result of FH deficiency. In addition, detailed metabolic assessment of these MEFs confirmed their dependence on glycolysis, and an elevated rate of lactate efflux, associated with the upregulation of glycolytic enzymes known to be associated with tumorigenesis. Correspondingly, Fh1-deficient benign murine renal cysts and an advanced human HLRCC-related renal cell carcinoma manifested a prominent and progressive increase in the expression of HIF-α target genes and in genes known to be relevant to tumorigenesis and metastasis. In accord with our hypothesis, in a variety of different FH-deficient tissues, including a novel murine model of Fh1-deficient smooth muscle, we show a striking and progressive upregulation of a tumorigenic metabolic profile, as manifested by increased PKM2 and LDHA protein. Based on the models assessed herein, we infer that that FH deficiency compels cells to adopt an early, reversible, and progressive protumorigenic metabolic milieu that is reminiscent of that driving the Warburg effect. Targets identified in these novel and diverse FH-deficient models represent excellent potential candidates for further mechanistic investigation and therapeutic metabolic manipulation in tumors. Copyright © 2010 AACR.
Kumar, Pravin; Ghosh Sachan, Shashwati; Poddar, Raju
2017-10-01
Improving the industrial enzyme for better yield of the product is important and a challenging task. One of such important industrial enzymes is microbial Hydroxycinnamoyl-CoA hydratase-lyase (HCHL). It converts feruloyl-CoA to vanillin. We place our efforts towards the improvement of its catalytic activity with comprehensive computational investigation. Catalytic core of the HCHL was explored with molecular modeling and docking approaches. Site-directed mutations were introduced in the catalytic site of HCHL in a sequential manner to generate different mutants of HCHL. Basis of mutation is to increase the interaction between HCHL and substrate feruloyl-CoA through interatomic forces and hydrogen bond formation. A rigorous molecular dynamics (MD) simulation was performed to check the stability of mutant's structure. Root mean square deviation (RMSD), root mean square fluctuation (RMSF), dynamic cross correlation (DCCM) and principal component analysis (PCA) were also performed to analyze flexibility and stability of structures. Docking studies were carried out between different mutants of HCHL and feruloyl-CoA. Investigation of the different binding sites and the interactions with mutant HCHLs and substrate allowed us to highlight the improved performance of mutants than wild type HCHL. This was further validated with MD simulation of complex consisting of different mutants and substrate. It further confirms all the structures are stable. However, mutant-2 showed better affinity towards substrate by forming hydrogen bond between active site and feruloyl-CoA. We propose that increase in hydrogen bond formation might facilitate in dissociation of vanillin from feruloyl-CoA. The current work may be useful for the future development of 'tailor-made' enzymes for better yield of vanillin. Copyright © 2017 Elsevier Inc. All rights reserved.
Oremland, Ronald S.; Taylor, Barrie F.
1975-01-01
Methanogenesis was irreversibly inhibited in sediments by concentrations of acetylene employed in nitrogen fixation assays (1 to 20%, vol/vol). Ethylene, but not ethane, also stopped methane production, and the inhibition was reversed by gassing with hydrogen. PMID:1190767
Identification and characterization of an oleate hydratase-encoding gene from Bifidobacterium breve.
O'Connell, Kerry Joan; Motherway, Mary O'Connell; Hennessey, Alan A; Brodhun, Florian; Ross, R Paul; Feussner, Ivo; Stanton, Catherine; Fitzgerald, Gerald F; van Sinderen, Douwe
2013-01-01
Bifidobacteria are common commensals of the mammalian gastrointestinal tract. Previous studies have suggested that a bifidobacterial myosin cross reactive antigen (MCRA) protein plays a role in bacterial stress tolerance, while this protein has also been linked to the biosynthesis of conjugated linoleic acid (CLA) in bifidobacteria. In order to increase our understanding on the role of MCRA in bifidobacteria we created and analyzed an insertion mutant of the MCRA-encoding gene of B. breve NCFB 2258. Our results demonstrate that the MCRA protein of B. breve NCFB 2258 does not appear to play a role in CLA production, yet is an oleate hydratase, which contributes to bifidobacterial solvent stress protection.
Matsumoto, Kana; Udaka, Naoko; Hasumi, Hisashi; Nakaigawa, Noboru; Nagashima, Yoji; Tanaka, Reiko; Kato, Ikuma; Yao, Masahiro; Furuya, Mitsuko
2018-05-24
Hereditary leiomyomatosis and renal cell cancer (HLRCC) is a rare genetic disorder characterized by cutaneous and uterine leiomyomatosis with RCC. This disorder is caused by a germline mutation in the fumarate hydratase (FH) gene, which encodes an important enzyme of the tricarboxylic acid (TCA) cycle. This mutation distinguishes HLRCC from sporadic RCCs. Herein, we investigated a case of HLRCC in a 32-year-old man who underwent nephrectomy for treatment of a solid-cystic tumor in the left kidney. Histopathology demonstrated a variegated architecture of papillary, tubulocystic and cribriform patterns composed of high-grade tumor cells with enlarged nuclei and eosinophilic nucleoli. Immunostaining and western blotting revealed no FH expression in the tumor. Genomic DNA sequencing identified a heterozygous mutation involving deletion of the 3' end of exon 2 and intron 2 of the FH gene (c.251_267+7delTGACAGAACGCATGCCAGTAAGTG), and RT-PCR confirmed exon 2 skipping in FH mRNA. The somatic FH gene status of the tumor showed only the mutated allele, indicating loss of heterozygosity as the "second hit" of tumor suppressor gene inactivation. These data support that an FH mutation involving the splice site causes exon skipping, changing the conformation of the protein and accelerating carcinogenic cascades under impaired FH functioning in the TCA cycle. © 2018 Japanese Society of Pathology and John Wiley & Sons Australia, Ltd.
[Photodissociation of Acetylene and Acetone using Step-Scan Time-Resolved FTIR Emission Spectroscopy
NASA Technical Reports Server (NTRS)
McLaren, Ian A.; Wrobel, Jacek D.
1997-01-01
The photodissociation of acetylene and acetone was investigated as a function of added quenching gas pressures using step-scan time-resolved FTIR emission spectroscopy. Its main components consist of Bruker IFS88, step-scan Fourier Transform Infrared (FTIR) spectrometer coupled to a flow cell equipped with Welsh collection optics. Vibrationally excited C2H radicals were produced from the photodissociation of acetylene in the unfocused experiments. The infrared (IR) emission from these excited C2H radicals was investigated as a function of added argon pressure. Argon quenching rate constants for all C2H emission bands are of the order of 10(exp -13)cc/molecule.sec. Quenching of these radicals by acetylene is efficient, with a rate constant in the range of 10(exp -11) cc/molecule.sec. The relative intensity of the different C2H emission bands did not change with the increasing argon or acetylene pressure. However, the overall IR emission intensity decreased, for example, by more than 50% when the argon partial pressure was raised from 0.2 to 2 Torr at fixed precursor pressure of 160mTorr. These observations provide evidence for the formation of a metastable C2H2 species, which are collisionally quenched by argon or acetylene. Problems encountered in the course of the experimental work are also described.
Kinetics and Structure of Superagglomerates Produced by Silane and Acetylene
NASA Technical Reports Server (NTRS)
Mulholland, G. W.; Hamins, A.; Sivathanu, Y.
1999-01-01
The evolution of smoke in a laminar diffusion flame involves several steps. The first step is particle inception/nucleation in the high-temperature fuel-rich region of the flame followed by surface growth and coagulation/coalescence of the small particles. As the primary spheres grow in size and lose hydrogen, the colliding particles no longer coalesce but retain their identity as a cluster of primary spheres, termed an agglomerate. Finally, in the upper portion of the flame, the particles enter an oxidizing environment which may lead to partial or complete burnout of the agglomerates. Currently there is no quantitative model for describing the growth of smoke agglomerates up to superagglomerates with an overall dimension of 10 microns and greater. Such particles are produced during the burning of acetylene and fuels containing benzene rings such as toluene and polystyrene. In the case of polystyrene, smoke agglomerates in excess of 1 mm have been observed "raining" out from large fires. Evidence of the formation of superagglomerates in a laminar acetylene/air diffusion flame has been recently reported. Acetylene was chosen as the fuel since the particulate loading in acetylene/air diffusion flames is very high. Photographs were obtained by Sorensen using a microsecond xenon lamp of the "stream" of soot just above the flame. For low flow rates of acetylene, only submicrometer soot clusters are produced and they give rise to the homogeneous appearance of the soot stream. When the flow rate is increased to 1.7 cu cm/s, soot clusters up to 10 microns are formed and they are responsible for the graininess and at a flow rate of 3.4 cu cm/s, a web of interconnected clusters as large as the width of the flame is seen. This interconnecting web of superagglomerates is described as a gel state by Sorensen et al (1998). This is the first observation of a gel for a gas phase system. It was observed that this gel state immediately breaks up into agglomerates due to buoyancy
Acetylene from the co-pyrolysis of biomass and waste tires or coal in the H{sub 2}/Ar plasma
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bao, W.; Cao, Q.; Lv, Y.
Acetylene from carbon-containing materials via plasma pyrolysis is not only simple but also environmentally friendly. In this article, the acetylene produced from co-pyrolyzing biomass with waste tire or coal under the conditions of H{sub 2}/Ar DC arc plasma jet was investigated. The experimental results showed that the co-pyrolysis of mixture with biomass and waste tire or coal can improve largely the acetylene relative volume fraction (RVF) in gaseous products and the corresponding yield of acetylene. The change trends for the acetylene yield of plasma pyrolysis from mixture with raw sample properties were the same as relevant RVF. But the yieldmore » change trend with feeding rate is different from its RVF. The effects of the feeding rate of raw materials and the electric current of plasmatron on acetylene formation are also discussed.« less
Identification and characterization of an oleate hydratase-encoding gene from Bifidobacterium breve
O'Connell, Kerry Joan; Motherway, Mary O'Connell; Hennessey, Alan A; Brodhun, Florian; Ross, R Paul; Feussner, Ivo; Stanton, Catherine; Fitzgerald, Gerald F; van Sinderen, Douwe
2013-01-01
Bifidobacteria are common commensals of the mammalian gastrointestinal tract. Previous studies have suggested that a bifidobacterial myosin cross reactive antigen (MCRA) protein plays a role in bacterial stress tolerance, while this protein has also been linked to the biosynthesis of conjugated linoleic acid (CLA) in bifidobacteria. In order to increase our understanding on the role of MCRA in bifidobacteria we created and analyzed an insertion mutant of the MCRA-encoding gene of B. breve NCFB 2258. Our results demonstrate that the MCRA protein of B. breve NCFB 2258 does not appear to play a role in CLA production, yet is an oleate hydratase, which contributes to bifidobacterial solvent stress protection. PMID:23851389
Park, Ji-Young; Lee, Seon-Hwa; Kim, Kyoung-Rok; Park, Jin-Byung; Oh, Deok-Kun
2015-08-20
Linoleate 13-hydratase from Lactobacillus acidophilus LMG 11470 converted linoleic acid to hydroxyl fatty acid, which was identified as 13S-hydroxy-9(Z)-octadecenoic acid (13-HOD) by GC-MS and NMR. The expression of linoleate 13-hydratase gene in Escherichia coli was maximized by using pACYC plasmid and super optimal broth with catabolite repression (SOC) medium containing 40mM Mg(2+). To optimize induction conditions, recombinant cells were cultivated at 37°C, 1mM isopropyl-β-d-thiogalactopyranoside was added at 2h, and the culture was further incubated at 16°C for 18h. Recombinant cells expressing linoleate 13-hydratase from L. acidophilus were obtained under the optimized expression conditions and used for 13-HOD production from linoleic acid. The optimal reaction conditions were pH 6.0, 40°C, 0.25% (v/v) Tween 40, 25gl(-1) cells, and 100gl(-1) linoleic acid, and under these conditions, whole recombinant cells produced 79gl(-1) 13-HOD for 3h with a conversion yield of 79% (w/w), a volumetric productivity of 26.3gl(-1)h(-1), and a specific productivity of 1.05g g-cells(-1)h(-1). To the best of our knowledge, the recombinant cells produced hydroxy fatty acid with the highest concentration and productivity reported so far. Crown Copyright © 2015. Published by Elsevier B.V. All rights reserved.
A review of acetylene, ethylene and ethane molecular spectroscopy for planetary applications
NASA Technical Reports Server (NTRS)
Maguire, W. C.
1982-01-01
Spectroscopic work in acetylene, ethylene and ethane, are of particular interest since the Voyager IRIS observations of Jupiter. Acetylene and ethane but not ethylene were observed in the Jovian spectrum. Two fundamental bands of the observed gases are used to determine the spatial distribution of these hydrocarbons on Jupiter and to illuminate the photochemistry of these species. The 100 to 1000 cm region is discussed and selected examples of current laboratory work are given.
Mechanism-based inactivation of benzo(a)pyrene hydroxylase by aryl acetylenes and aryl olefins
DOE Office of Scientific and Technical Information (OSTI.GOV)
Gan, L.S.; Lu, J.Y.L.; Alworth, W.L.
A series of aryl acetylenes and aryl olefins have been examined as substrates and inhibitors of cytochrome P-450 dependent monooxgenases in liver microsomes from 5,6-benzoflavone or phenobarbital pretreated rats. 1-Ethynylpyrene, 3-ethynylperylene, 2-ethynylfluorene, methyl 1-pyrenyl acetylene, cis- and trans-1-(2-bromovinyl)pyrene, and 1-allylpyrene serve as mechanism-based irreversible inactivators (suicide inhibitors) of benzo(a)pyrene hydroxylase, while 1-vinylpyrene and phenyl 1-pyrenyl acetylene do not cause a detectable suicide inhibition of benzo(a)pyrene hydroxylase. The mechanism-based loss of benzo(a)pyrene hydroxylase caused by the aryl acetylenes is not accompanied by a corresponding loss of the P-450 content of the microsomes (suicide destruction). The suicide inhibition by these aryl acetylenesmore » therefore does not involve covalent binding to the heme moiety of the monooxygenase. Nevertheless, in the presence of NADPH, /sup 3/H-labeled 1-ethynylpyrene becomes covalently attached to the cytochrome P-450 protein; the measured stoichiometry of binding is one 1-ethynylpyrene per P-450 heme unit. The authors conclude that the inhibition of benzo(a)pyrene hydroxylase produced by 1-ethynylpyrene may be related to the mechanism of suicide inhibition of P-450 activity by chloramphenicol rather than the mechanism of suicide destruction of P-450 previously described for acetylene and propyne.« less
Kihara, Takahiro; Hiroe, Ayaka; Ishii-Hyakutake, Manami; Mizuno, Kouhei; Tsuge, Takeharu
2017-08-01
Bacillus cereus and Bacillus megaterium both accumulate polyhydroxyalkanoate (PHA) but their PHA biosynthetic gene (pha) clusters that code for proteins involved in PHA biosynthesis are different. Namely, a gene encoding MaoC-like protein exists in the B. cereus-type pha cluster but not in the B. megaterium-type pha cluster. MaoC-like protein has an R-specific enoyl-CoA hydratase (R-hydratase) activity and is referred to as PhaJ when involved in PHA metabolism. In this study, the pha cluster of B. cereus YB-4 was characterized in terms of PhaJ's function. In an in vitro assay, PhaJ from B. cereus YB-4 (PhaJ YB4 ) exhibited hydration activity toward crotonyl-CoA. In an in vivo assay using Escherichia coli as a host for PHA accumulation, the recombinant strain expressing PhaJ YB4 and PHA synthase led to increased PHA accumulation, suggesting that PhaJ YB4 functioned as a monomer supplier. The monomer composition of the accumulated PHA reflected the substrate specificity of PhaJ YB4 , which appeared to prefer short chain-length substrates. The pha cluster from B. cereus YB-4 functioned to accumulate PHA in E. coli; however, it did not function when the phaJ YB4 gene was deleted. The B. cereus-type pha cluster represents a new example of a pha cluster that contains the gene encoding PhaJ.
Arakawa, Takatoshi; Kawano, Yoshiaki; Kataoka, Shingo; Katayama, Yoko; Kamiya, Nobuo; Yohda, Masafumi; Odaka, Masafumi
2007-03-09
Thiocyanate hydrolase (SCNase) of Thiobacillus thioparus THI115 is a cobalt(III)-containing enzyme catalyzing the degradation of thiocyanate to carbonyl sulfide and ammonia. We determined the crystal structures of the apo- and native SCNases at a resolution of 2.0 A. SCNases in both forms had a conserved hetero-dodecameric structure, (alphabetagamma)(4). Four alphabetagamma hetero-trimers were structurally equivalent. One alphabetagamma hetero-trimer was composed of the core domain and the betaN domain, which was located at the center of the molecule and linked the hetero-trimers with novel quaternary interfaces. In both the apo- and native SCNases, the core domain was structurally conserved between those of iron and cobalt-types of nitrile hydratase (NHase). Native SCNase possessed the post-translationally modified cysteine ligands, gammaCys131-SO(2)H and gammaCys133-SOH like NHases. However, the low-spin cobalt(III) was found to be in the distorted square-pyramidal geometry, which had not been reported before in any protein. The size as well as the electrostatic properties of the substrate-binding pocket was totally different from NHases with respect to the charge distribution and the substrate accessibility, which rationally explains the differences in the substrate preference between SCNase and NHase.
Sudarshan, Sunil; Shanmugasundaram, Karthigayan; Naylor, Susan L; Lin, Shu; Livi, Carolina B; O'Neill, Christine F; Parekh, Dipen J; Yeh, I-Tien; Sun, Lu-Zhe; Block, Karen
2011-01-01
Germline mutations of FH, the gene that encodes for the tricarboxylic acid TCA (TCA) cycle enzyme fumarate hydratase, are associated with an inherited form of cancer referred to as Hereditary Leiomyomatosis and Renal Cell Cancer (HLRCC). Individuals with HLRCC are predisposed to the development of highly malignant and lethal renal cell carcinoma (RCC). The mechanisms of tumorigenesis proposed have largely focused on the biochemical consequences of loss of FH enzymatic activity. While loss of the tumor suppressor gene von Hippel Lindau (VHL) is thought to be an initiating event for the majority of RCCs, a role for FH in sporadic renal cancer has not been explored. Here we report that FH mRNA and protein expression are reduced in clear cell renal cancer, the most common histologic variant of kidney cancer. Moreover, we demonstrate that reduced FH leads to the accumulation of hypoxia inducible factor- 2α (HIF-2α), a transcription factor known to promote renal carcinogenesis. Finally, we demonstrate that overexpression of FH in renal cancer cells inhibits cellular migration and invasion. These data provide novel insights into the tumor suppressor functions of FH in sporadic kidney cancer.
Hydration of Acetylene: A 125th Anniversary
ERIC Educational Resources Information Center
Ponomarev, Dmitry A.; Shevchenko, Sergey M.
2007-01-01
The year 2006 is the 125th anniversary of a chemical reaction, the discovery of which by Mikhail Kucherov had a profound effect on the development of industrial chemistry in the 19-20th centuries. This was the hydration of alkynes catalyzed by mercury ions that made possible industrial production of acetaldehyde from acetylene. Historical…
Nanocomposite vacuum-Arc TiC/a-C:H coatings prepared using an additional ionization of acetylene
NASA Astrophysics Data System (ADS)
Trakhtenberg, I. Sh.; Gavrilov, N. V.; Emlin, D. R.; Plotnikov, S. A.; Vladimirov, A. B.; Volkova, E. G.; Rubshtein, A. P.
2014-07-01
The composition, structure, and properties of TiC/a-C:H coatings obtained by simultaneous vacuum-arc deposition of titanium and carbon in a low-pressure argon-acetylene medium additionally activated by a low-energy (a few hundreds of electron-volts) electron beam. The creation of conditions under which the decomposition of acetylene is provided by the ionization and dissociation of molecules due to electron impacts and by the recharging of molecules through titanium and argon ions with subsequent dissociation should favor the most complete decomposition of acetylene in a wide range of pressures. With increasing acetylene pressure, the structure of the nanocomposite coating changes: the size of TiC crystallites decreases, and the fraction of interfaces (or the fraction of regions with a disordered (amorphous) structure) increases. The application of a bias voltage leads to an increase in the sizes of TiC nanocrystallites. The coatings with a maximum microhardness (˜40 GPa) have been obtained without the action of an electron beam under an acetylene pressure of ˜0.05-0.08 Pa and the atomic ratio Ti: C ˜ 0.9: 1.1 in the coating.
NASA Astrophysics Data System (ADS)
Oremland, R. S.; Baesman, S. M.; Miller, L. G.
2014-02-01
Acetylene supports the growth of some terrestrial anaerobes. The reaction is highly exothermic. The abundance of acetylene in the methane-rich planet(oid)s of the outer solar system could represent a means of nourishment for resident alien microbes.
Neumann, Jennifer; Pawlik, Magdalena; Bryniok, Dieter; Thöming, Jorg; Stolte, Stefan
2014-01-01
Biodegradation tests with bacteria from activated sludge revealed the probable persistence of cyano-based ionic liquid anions when these leave waste water treatment plants. A possible biological treatment using bacteria capable of biodegrading similar compounds, namely cyanide and cyano-complexes, was therefore examined. With these bacteria from the genera Cupriavidus, the ionic liquid anions B(CN)₄(-), C(CN)₃(-), N(CN)₂(-) combined with alkaline cations were tested in different growth media using ion chromatography for the examination of their primary biodegradability. However, no enhanced biodegradability of the tested cyano-based ionic liquids was observed. Therefore, an in vitro enzymatic hydrolysis test was additionally run showing that all tested ionic liquid (IL) anions can be hydrolysed to their corresponding amides by nitrile hydratase, but not by nitrilase under the experimental conditions. The biological stability of the cyano-based anions is an advantage in technological application, but the occurrence of enzymes that are able to hydrolyse the parent compound gives a new perspective on future cyano-based IL anion treatment.
Association Mechanisms of Unsaturated C2 Hydrocarbons with Their Cations: Acetylene and Ethylene
NASA Technical Reports Server (NTRS)
Bera, Partha P.; Head-Gordon, Martin; Lee, Timothy J.
2013-01-01
The ion-molecule association mechanism of acetylene and ethylene with their cations is investigated by ab initio quantum chemical methods to understand the structures, association energies, and the vibrational and electronic spectra of the products. Stable puckered cyclic isomers are found as the result of first forming less stable linear and bridge isomers. The puckered cyclic complexes are calculated to be strongly bound, by 87, 35 and 56 kcal/mol for acetylene-acetylene cation, ethylene-ethylene cation and acetylene-ethylene cation, respectively. These stable complexes may be intermediates that participate in further association reactions. There are no association barriers, and no significant inter-conversion barriers, so the initial linear and bridge encounter complexes are unlikely to be observable. However, the energy gap between the bridged and cyclic puckered isomers greatly differs from complex to complex: it is 44 kcal/mol in C4H4 +, but only 6 kcal/mol in C4H8 +. The accurate CCSD(T) calculations summarized above are also compared against less computationally expensive MP2 and density functional theory (DFT) calculations for structures, relative energies, and vibrational spectra. Calculated vibrational spectra are compared against available experiments for cyclobutadiene cation. Electronic spectra are also calculated using time-dependent DFT.
The purpose of the research was to study gas-chromatographic separation of impurities of acetylene and difluoroethane in vinyl fluoride obtained by...and difluoroethane . All the components are separated, and the criteria of separation of acetylene-vinyl fluoride and vinyl fluoride- difluoroethane
46 CFR 154.1735 - Methyl acetylene-propadiene mixture.
Code of Federal Regulations, 2011 CFR
2011-10-01
... mixture must have a refrigeration system without vapor compression or have a refrigeration system with the... separate cargo piping, vent piping, and refrigeration equipment for methyl acetylene-propadiene that are segregated from other cargo piping, vent piping and refrigeration equipment on the vessel. [CGD 74-289, 44 FR...
46 CFR 154.1735 - Methyl acetylene-propadiene mixture.
Code of Federal Regulations, 2014 CFR
2014-10-01
... mixture must have a refrigeration system without vapor compression or have a refrigeration system with the... separate cargo piping, vent piping, and refrigeration equipment for methyl acetylene-propadiene that are segregated from other cargo piping, vent piping and refrigeration equipment on the vessel. [CGD 74-289, 44 FR...
46 CFR 154.1735 - Methyl acetylene-propadiene mixture.
Code of Federal Regulations, 2013 CFR
2013-10-01
... mixture must have a refrigeration system without vapor compression or have a refrigeration system with the... separate cargo piping, vent piping, and refrigeration equipment for methyl acetylene-propadiene that are segregated from other cargo piping, vent piping and refrigeration equipment on the vessel. [CGD 74-289, 44 FR...
46 CFR 154.1735 - Methyl acetylene-propadiene mixture.
Code of Federal Regulations, 2012 CFR
2012-10-01
... mixture must have a refrigeration system without vapor compression or have a refrigeration system with the... separate cargo piping, vent piping, and refrigeration equipment for methyl acetylene-propadiene that are segregated from other cargo piping, vent piping and refrigeration equipment on the vessel. [CGD 74-289, 44 FR...
46 CFR 154.1735 - Methyl acetylene-propadiene mixture.
Code of Federal Regulations, 2010 CFR
2010-10-01
... mixture must have a refrigeration system without vapor compression or have a refrigeration system with the... separate cargo piping, vent piping, and refrigeration equipment for methyl acetylene-propadiene that are segregated from other cargo piping, vent piping and refrigeration equipment on the vessel. [CGD 74-289, 44 FR...
Cryosolution infrared study of hydrogen bonded halothane acetylene complex
NASA Astrophysics Data System (ADS)
Melikova, S. M.; Rutkowski, K. S.; Rospenk, M.
2018-05-01
The interactions between halothane (2-bromo-2-chloro-1,1,1-trifluoroethane) and acetylene (C2H2) are studied by FTIR spectroscopy. Results obtained in liquid cryosolutions in Kr suggest weak complex formation stabilized by H - bond. The complexation enthalpy (∼11 kJ/mol) is evaluated in a series of temperature measurements (T ∼ 120-160 K) of integrated intensity of selected bands performed in liquefied Kr. The quantum chemical MP2/6-311++G(2d,2p) calculations predict four different structures of the complex. The most stable and populated (94% at T∼120 K) structure corresponds to the H - bond between H atom of halothane and pi-electron of triple bond between C atoms of acetylene. Wave numbers of vibrational bands of the most stable structure are calculated in anharmonic approximation implemented in Gaussian program.
NASA Astrophysics Data System (ADS)
Nicewonger, M. R.; Aydin, M.; Prather, M. J.; Saltzman, E. S.
2017-12-01
This study examines ethane (C2H6) and acetylene (C2H2) in polar ice cores in order to reconstruct variations in the atmospheric levels of these trace gases over the past 2,000 years. Both of these non-methane hydrocarbons are released from fossil fuel, biofuel, and biomass burning. Ethane, but not acetylene, is also emitted from natural geologic outgassing of hydrocarbons. In an earlier study, we reported ethane levels in Greenland and Antarctic ice cores showing roughly equal contributions from biomass burning and geologic emissions to preindustrial atmospheric ethane levels (Nicewonger et al., 2016). Here we introduce acetylene as an additional constraint to better quantify preindustrial variations in the emissions from these natural hydrocarbon sources. Here we present 30 new measurements of ethane and acetylene from the WDC-06A ice core from WAIS Divide and the newly drilled South Pole ice core (SPICECORE). Ethane results display a gradual decline from peak levels of 110 ppt at 1400 CE to a minimum of 60-80 ppt during 1700-1875 CE. Acetylene correlates with ethane (r2 > 0.4), dropping from peak levels of 35 ppt at 1400 CE to 15-20 ppt at 1875 CE. The covariance between the two trace gases implies that the observed changes are likely caused by decreasing emissions from low latitude biomass burning. We will discuss results from chemical transport modeling and sensitivity tests and the implications for the preindustrial ethane and acetylene budgets.
A three-enzyme cascade reaction through positional assembly of enzymes in a polymersome nanoreactor.
van Dongen, Stijn F M; Nallani, Madhavan; Cornelissen, Jeroen J L M; Nolte, Roeland J M; van Hest, Jan C M
2009-01-01
Porous polymersomes based on block copolymers of isocyanopeptides and styrene have been used to anchor enzymes at three different locations, namely, in their lumen (glucose oxidase, GOx), in their bilayer membrane (Candida antarctica lipase B, CalB) and on their surface (horseradish peroxidase, HRP). The surface coupling was achieved by click chemistry between acetylene-functionalised anchors on the surface of the polymersomes and azido functions of HRP, which were introduced by using a direct diazo transfer reaction to lysine residues of the enzyme. To determine the encapsulation and conjugation efficiency of the enzymes, they were decorated with metal-ion labels and analysed by mass spectrometry. This revealed an almost quantitative immobilisation efficiency of HRP on the surface of the polymersomes and a more than statistical incorporation efficiency for CalB in the membrane and for GOx in the aqueous compartment. The enzyme-decorated polymersomes were studied as nanoreactors in which glucose acetate was converted by CalB to glucose, which was oxidised by GOx to gluconolactone in a second step. The hydrogen peroxide produced was used by HRP to oxidise 2,2'-azinobis(3-ethylbenzothiazoline-6-sulfonic acid) (ABTS) to ABTS(.+). Kinetic analysis revealed that the reaction step catalysed by HRP is the fastest in the cascade reaction.
Acetylene-Based Materials in Organic Photovoltaics
Silvestri, Fabio; Marrocchi, Assunta
2010-01-01
Fossil fuel alternatives, such as solar energy, are moving to the forefront in a variety of research fields. Organic photovoltaic systems hold the promise of a lightweight, flexible, cost-effective solar energy conversion platform, which could benefit from simple solution-processing of the active layer. The discovery of semiconductive polyacetylene by Heeger et al. in the late 1970s was a milestone towards the use of organic materials in electronics; the development of efficient protocols for the palladium catalyzed alkynylation reactions and the new conception of steric and conformational advantages of acetylenes have been recently focused the attention on conjugated triple-bond containing systems as a promising class of semiconductors for OPVs applications. We review here the most important and representative (poly)arylacetylenes that have been used in the field. A general introduction to (poly)arylacetylenes, and the most common synthetic approaches directed toward making these materials will be firstly given. After a brief discussion on working principles and critical parameters of OPVs, we will focus on molecular arylacetylenes, (co)polymers containing triple bonds, and metallopolyyne polymers as p-type semiconductor materials. The last section will deal with hybrids in which oligomeric/polymeric structures incorporating acetylenic linkages such as phenylene ethynylenes have been attached onto C60, and their use as the active materials in photovoltaic devices. PMID:20480031
Matrix Isolation and ab initio study of the noncovalent complexes between formamide and acetylene.
Mardyukov, Artur; Sánchez-García, Elsa; Sander, Wolfram
2009-02-12
Matrix isolation spectroscopy in combination with ab initio calculations is a powerful technique for the identification of weakly bound intermolecular complexes. Here, weak complexes between formamide and acetylene are studied, and three 1:1 complexes with binding energies of -2.96, -2.46, and -1.79 kcal/mol have been found at the MP2 level of theory (MP2/cc-pVTZ + ZPE + BSSE). The two most stable dimers A and B are identified in argon and nitrogen matrices by comparison between the experimental and calculated infrared frequencies. Both complexes are stabilized by the formamide C=O...HC acetylene and H...pi interactions. Large shifts have been observed experimentally for the C-H stretching vibrations of the acetylene molecule, in very good agreement with the calculated values. Eight 1:2 FMA-acetylene trimers (T-A to T-H) with binding energies between -5.44 and -2.62 kcal/mol (MP2/aug-cc-pVDZ + ZPE + BSSE) were calculated. The two most stable trimers T-A and T-B are very close in energy and have similar infrared spectra. Several weak bands that are in agreement with the calculated frequencies of the trimers T-A and T-B are observed under matrix isolation conditions. However, the differences are too small for a definitive assignment.
Rotation of a Single Acetylene Molecule on Cu(001) by Tunneling Electrons in STM
NASA Astrophysics Data System (ADS)
Shchadilova, Yulia E.; Tikhodeev, Sergei G.; Paulsson, Magnus; Ueba, Hiromu
2013-11-01
We study the elementary processes behind one of the pioneering works on scanning tunneling microscope controlled reactions of single molecules [Stipe et al., Phys. Rev. Lett. 81, 1263 (1998)]. Using the Keldysh-Green function approach for the vibrational generation rate in combination with density functional theory calculations to obtain realistic parameters we reproduce the experimental rotation rate of an acetylene molecule on a Cu(100) surface as a function of bias voltage and tunneling current. This combined approach allows us to identify the reaction coordinate mode of the acetylene rotation and its anharmonic coupling with the C-H stretch mode. We show that three different elementary processes, the excitation of C-H stretch, the overtone ladder climbing of the hindered rotational mode, and the combination band excitation together explain the rotation of the acetylene molecule on Cu(100).
New Acetylene-Terminated Quinoxaline Oligomers
1982-03-01
3 Br, 20.97 Found: C, 62.88; *H, 3.50; Br, 20.83. ( 2 ) (4-Phenylethynyl- 3 ’- bromo )diphenyl ether (6.98 g, 0.02 mol) was dissolved in 150 ml of...I 2 . Govt Accession No. 3 . Recipient’s Catalog Number AFWAL-TR-82-4006 4. Title (and Subtitle) 5. Type of Report & Period Coverec NEW ACETYLENE...displacement of the nitro group of p-nitrobenzil by treatment with the sodium 3 -ethynylphenolate. 1O-CO-Ar-CO-CO-1 + 2 NH2 ) -- H2 > SNHQ2f \\NH2 NH2
Bahnson, Brian J; Anderson, Vernon E; Petsko, Gregory A
2002-02-26
We have determined the crystal structure of the enzyme enoyl-CoA hydratase (ECH) from rat liver with the bound substrate 4-(N,N-dimethylamino)cinnamoyl-CoA using X-ray diffraction data to a resolution of 2.3 A. In addition to the thiolester substrate, the catalytic water, which is added in the hydration reaction, has been modeled into well-defined electron density in each of the six active sites of the physiological hexamer within the crystallographic asymmetric unit. The catalytic water bridges Glu(144) and Glu(164) of the enzyme and has a lone pair of electrons poised to react with C(3) of the enzyme-bound alpha,beta-unsaturated thiolester. The water molecule, which bridges two glutamate residues, is reminiscent of the enolase active site. However, unlike enolase, which has a lysine available to donate a proton, there are no other sources of protons available from other active site residues in ECH. Furthermore, an analysis of the hydrogen-bonding network of the active site suggests that both Glu(144) and Glu(164) are ionized and carry a negative charge with no reasonable place to have a protonated carboxylate. This lack of hydrogen-bonding acceptors that could accommodate a source of a proton, other than from the water molecule, leads to a hypothesis that the three atoms from a single water molecule are added across the double bond to form the hydrated product. The structural results are discussed in connection with details of the mechanism, which have been elucidated from kinetics, site-directed mutagenesis, and spectroscopy of enzyme-substrate species, in presenting an atomic-resolution mechanism of the reaction. Contrary to the previous interpretation, the structure of the E-S complex together with previously determined kinetic isotope effects is consistent with either a concerted mechanism or an E1cb stepwise mechanism.
NASA Astrophysics Data System (ADS)
Sajid, M. B.; Javed, T.; Farooq, A.
2015-04-01
The mid-infrared wavelength region near 8 μm contains absorption bands of several molecules such as water vapor, hydrogen peroxide, nitrous oxide, methane and acetylene. A new laser absorption sensor based on the ν4 band of methane and the ν4+ν5 band of acetylene is reported for interference-free, time-resolved measurements under combustion-relevant conditions. A detailed line-selection procedure was used to identify optimum transitions. Methane and acetylene were measured at the line centers of Q12 (1303.5 cm-1) and P23 (1275.5 cm-1) transitions, respectively. High-temperature absorption cross sections of methane and acetylene were measured at peaks (on-line) and valleys (off-line) of the selected absorption transitions. The differential absorption strategy was employed to eliminate interference absorption from large hydrocarbons. Experiments were performed behind reflected shock waves over a temperature range of 1200-2200 K, between pressures of 1-4 atm. The diagnostics were then applied to measure the respective species time-history profiles during the shock-heated pyrolysis of n-pentane.
Cho, Tae-Yeon; Han, Chi-Whan; Jun, Yongseok; Yoon, Soon-Gil
2013-01-01
Acetylene-black paste without a light scattering layer was applied to meso-porous TiO2 photo-electrode films with a crystalline framework, a low residual carbon, and a tunable morphological pore size. The thermal-treated TiO2 photo-electrode films had an increased acetylene-black concentration with an increase in artificial pores and a decrease in residual carbon. The performance of dye-sensitized solar cells (DSSCs) was enhanced by the use of the TiO2 photo-anode pastes at various acetylene-black concentrations. The photo-conversion efficiency of the DSSCs using TiO2 photo-electrode films with 1.5 wt% acetylene-black was enhanced from 7.98 (no acetylene-black) to 9.75% without the integration of a light- scattering layer. PMID:23511122
Tracing Acetylene Dissolved in Transformer Oil by Tunable Diode Laser Absorption Spectrum.
Ma, Guo-Ming; Zhao, Shu-Jing; Jiang, Jun; Song, Hong-Tu; Li, Cheng-Rong; Luo, Ying-Ting; Wu, Hao
2017-11-02
Dissolved gas analysis (DGA) is widely used in monitoring and diagnosing of power transformer, since the insulation material in the power transformer decomposes gases under abnormal operation condition. Among the gases, acetylene, as a symbol of low energy spark discharge and high energy electrical faults (arc discharge) of power transformer, is an important monitoring parameter. The current gas detection method used by the online DGA equipment suffers from problems such as cross sensitivity, electromagnetic compatibility and reliability. In this paper, an optical gas detection system based on TDLAS technology is proposed to detect acetylene dissolved in transformer oil. We selected a 1530.370 nm laser in the near infrared wavelength range to correspond to the absorption peak of acetylene, while using the wavelength modulation strategy and Herriott cell to improve the detection precision. Results show that the limit of detection reaches 0.49 ppm. The detection system responds quickly to changes of gas concentration and is easily to maintenance while has no electromagnetic interference, cross-sensitivity, or carrier gas. In addition, a complete detection process of the system takes only 8 minutes, implying a practical prospect of online monitoring technology.
Kocyigit, Umit M; Taşkıran, Ahmet Şevki; Taslimi, Parham; Yokuş, Ahmet; Temel, Yusuf; Gulçin, İlhami
2017-11-01
The aim of this study was to investigate the effects of oxytocin (OT), atosiban, which is an OT receptor antagonist, and OT-atosiban chemicals injected to rats on the activities of carbonic anhydrase (CA) and acetylcholinesterase (AChE) enzymes in liver and kidney tissues of rats. For this purpose, four different groups, each consisting of six rats (n = 6), were formed (control group, OT administered group, atosiban administered group, and both OT and atosiban administered group). The rats were necropsied 60 min after intraperitoneal injection of chemicals into the rats. Liver tissues of rats were extracted. CA and AChE enzyme activities were measured for each tissue by using hydratase, esterase, and acetylcholiniodide methods. Activity values for each enzyme obtained were statistically calculated. © 2017 Wiley Periodicals, Inc.
46 CFR 151.50-79 - Methyl acetylene-propadiene mixture.
Code of Federal Regulations, 2014 CFR
2014-10-01
... acetylene-propadiene mixture must have a refrigeration system that does not compress the cargo vapor or have a refrigeration system with the following features: (1) A vapor compressor that does not raise the... suction line. (c) The piping system, including the cargo refrigeration system, for tanks to be loaded with...
46 CFR 151.50-79 - Methyl acetylene-propadiene mixture.
Code of Federal Regulations, 2013 CFR
2013-10-01
... acetylene-propadiene mixture must have a refrigeration system that does not compress the cargo vapor or have a refrigeration system with the following features: (1) A vapor compressor that does not raise the... suction line. (c) The piping system, including the cargo refrigeration system, for tanks to be loaded with...
46 CFR 151.50-79 - Methyl acetylene-propadiene mixture.
Code of Federal Regulations, 2012 CFR
2012-10-01
... acetylene-propadiene mixture must have a refrigeration system that does not compress the cargo vapor or have a refrigeration system with the following features: (1) A vapor compressor that does not raise the... suction line. (c) The piping system, including the cargo refrigeration system, for tanks to be loaded with...
Improved Performance of an Optically Pumped Mid-Infrared Acetylene-Filled Hollow-Core Fiber Laser
NASA Astrophysics Data System (ADS)
Dadashzadeh, Neda
The focus of this research is improving the pulse output energy of a mid-IR pulsed acetylene-filled Hollow-core Optical Fiber Gas LASer (HOFGLAS) system. Pump pulses and acetylene molecules interact with each other inside hollow-core photonic crystal fiber that effectively confines light and allows for strong gain. This results in lasing at 3.11 mum and 3.17 mum lines based on population inversion of acetylene molecules, which are optically pumped at rotational-vibrational overtones near 1.5 mum using 1 ns pulse duration from an optical parametric amplifier (OPA). This acetylene laser operates with no cavity mirrors because of a high gain in a single pass configuration. There are few laser sources in the mid-IR region while there are many applications for having a laser source in this range such as remote sensing, hazardous chemical detection, and breath analysis. This adds to the importance of the acetylene-filled HOFGLAS system. Some of the applications like remote sensing require high power. So, we moved toward power scaling this laser system by optimizing the laser operation through maximizing the OPA alignment to improve its modal content using longer length of fiber to increase the interaction length and improving the beam quality of the mid-IR emissions. The highest pulse energy ever obtained in the 3 microm mid-IR region from the acetylene-filled HOFGLAS after applying the improvements is reported here (1.4 muJ). Higher mid-IR pulse energies can be achieved by improving the pulse energy achievable from the OPA pump source and working with longer pulse duration to decrease the bandwidth of the OPA. This operation demonstrates many novel properties of acetylene-filled pulsed mid-IR hollow-core fiber lasers. The excellent spatial beam quality at highest power and phenomenological scaling of saturation power and efficiency with pressure that we observe point to the promise of power scaling and motivate further development of numerical models of the laser for
Characterization of the Minimum Energy Paths for the Ring Closure Reactions of C4H3 with Acetylene
NASA Technical Reports Server (NTRS)
Walch, Stephen P.
1995-01-01
The ring closure reaction of C4H3 with acetylene to give phenyl radical is one proposed mechanism for the formation of the first aromatic ring in hydrocarbon combustion. There are two low-lying isomers of C4H3; 1-dehydro-buta-l-ene-3-yne (n-C4H3) and 2-dehydro-buta-l-ene-3-yne (iso-C4H3). It has been proposed that only n-C4H3 reacts with acetylene to give phenyl radical, and since iso-C4H3 is more stable than n-C4H3, formation of phenyl radical by this mechanism is unlikely. We report restricted Hartree-Fock (RHF) plus singles and doubles configuration interaction calculations with a Davidson's correction (RHF+1+2+Q) using the Dunning correlation consistent polarized valence double zeta basis set (cc-pVDZ) for stationary point structures along the reaction pathway for the reactions of n-C4H3 and iso-C4H3 with acetylene. n-C4H3 plus acetylene (9.4) has a small entrance channel barrier (17.7) (all energetics in parentheses are in kcal/mol with respect to iso-C4H3 plus acetylene) and the subsequent closure steps leading to phenyl radical (-91.9) are downhill with respect to the entrance channel barrier. Iso-C4H3 Plus acetylene also has an entrance channel barrier (14.9) and there is a downhill pathway to 1-dehydro-fulvene (-55.0). 1-dehydro-fulvene can rearrange to 6-dehydro-fulvene (-60.3) by a 1,3-hydrogen shift over a barrier (4.0), which is still below the entrance channel barrier, from which rearrangement to phenyl radical can occur by a downhill pathway. Thus, both n-C4H3 and iso-C4H3 can react with acetylene to give phenyl radical with small barriers.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Thomson, A.D.; Webb, K.L.
1984-03-01
Annual acetylene reduction rates associated with intertidal communities in a chronically oil polluted Virgina salt marsh were compared to rates measured in an undisturbed marsh. Chronic oil treatment resulted in visible damage to the higher plants of the Spartina alterniflora zones; however, vegetation-associated acetylene reduction was not different from the untreated control. Sediment rates generally were affected little by oil application, except during the summer when rates in the median tidal elevation zones were considerably higher than those of the control. Acetylene reduction occurred in all transects, each of which extended from upper mudflat to the Spartina patens zone. Intertidalmore » sediment acetylene reduction was patchy, both spatially and seasonally. Estimated rates were greatest near the surface; free-living bacterial N/sub 2/ fixation activity averaged 2.23 mg N per m/sup 2/ per d (range = undetectable to 365 mg N per m/sup 2/ per d) in the untreated and 3.17 mg N per m/sup 2/ per d (range = undetectable to 564 mg N per m/sup 2/ per d) in the oil-treated marsh during the year. Vegetation-associated N/sub 2/ fixation activity yielded highest overall mean rates (156 mg N per M/sub 2/ per d). The seasonal pattern of sediment and vegetation-associated fixation may be controlled by temperature and availability of oxidizable substrates. 39 references, 2 figures, 5 tables.« less
Sub-cycle steering of the deprotonation of acetylene by intense few-cycle mid-infrared laser fields.
Li, H; Kling, Nora G; Gaumnitz, T; Burger, C; Siemering, R; Schötz, J; Liu, Q; Ban, L; Pertot, Y; Wu, J; Azzeer, A M; de Vivie-Riedle, R; Wörner, H J; Kling, M F
2017-06-26
Directional breaking of the C-H/C-D molecular bond is manipulated in acetylene (C 2 H 2 ) and deuterated acetylene (C 2 D 2 ) by waveform controlled few-cycle mid-infrared laser pulses with a central wavelength around 1.6 μm at an intensity of about 8 × 10 13 W/cm 2 . The directionality of the deprotonation of acetylene is controlled by changing the carrier-envelope phase (CEP). The CEP-control can be attributed to the laser-induced superposition of vibrational modes, which is sensitive to the sub-cycle evolution of the laser waveform. Our experiments and simulations indicate that near-resonant, intense mid-infrared pulses permit a higher degree of control of the directionality of the reaction compared to those obtained in near-infrared fields, in particular for the deuterated species.
Acetylene Fuels TCE Reductive Dechlorination by Defined Dehalococcoides/Pelobacter Consortia.
Mao, Xinwei; Oremland, Ronald S; Liu, Tong; Gushgari, Sara; Landers, Abigail A; Baesman, Shaun M; Alvarez-Cohen, Lisa
2017-02-21
Acetylene (C 2 H 2 ) can be generated in contaminated groundwater sites as a consequence of chemical degradation of trichloroethene (TCE) by in situ minerals, and C 2 H 2 is known to inhibit bacterial dechlorination. In this study, we show that while high C 2 H 2 (1.3 mM) concentrations reversibly inhibit reductive dechlorination of TCE by Dehalococcoides mccartyi isolates as well as enrichment cultures containing D. mccartyi sp., low C 2 H 2 (0.4 mM) concentrations do not inhibit growth or metabolism of D. mccartyi. Cocultures of Pelobacter SFB93, a C 2 H 2 -fermenting bacterium, with D. mccartyi strain 195 or with D. mccartyi strain BAV1 were actively sustained by providing acetylene as the electron donor and carbon source while TCE or cis-DCE served as the electron acceptor. Inhibition by acetylene of reductive dechlorination and methanogenesis in the enrichment culture ANAS was observed, and the inhibition was removed by adding Pelobacter SFB93 into the consortium. Transcriptomic analysis of D. mccartyi strain 195 showed genes encoding for reductive dehalogenases (e.g., tceA) were not affected during the C 2 H 2 -inhibition, while genes encoding for ATP synthase, biosynthesis, and Hym hydrogenase were down-regulated during C 2 H 2 inhibition, consistent with the physiological observation of lower cell yields and reduced dechlorination rates in strain 195. These results will help facilitate the optimization of TCE-bioremediation at contaminated sites containing both TCE and C 2 H 2 .
Acetylene fuels TCE reductive dechlorination by defined Dehalococcoides/Pelobacter consortia
Mao, Xinwei; Oremland, Ronald S.; Liu, Tong; Landers, Abigail A; Baesman, Shaun; Alvarez-Cohen, Lisa
2017-01-01
Acetylene (C2H2) can be generated in contaminated groundwater sites as a consequence of chemical degradation of trichloroethene (TCE) by in situ minerals, and C2H2 is known to inhibit bacterial dechlorination. In this study, we show that while high C2H2 (1.3 mM) concentrations reversibly inhibit reductive dechlorination of TCE by Dehalococcoides mccartyi isolates as well as enrichment cultures containing D. mccartyi sp., low C2H2 (0.4 mM) concentrations do not inhibit growth or metabolism of D. mccartyi. Cocultures of Pelobacter SFB93, a C2H2-fermenting bacterium, with D. mccartyi strain 195 or with D. mccartyi strain BAV1 were actively sustained by providing acetylene as the electron donor and carbon source while TCE or cis-DCE served as the electron acceptor. Inhibition by acetylene of reductive dechlorination and methanogenesis in the enrichment culture ANAS was observed, and the inhibition was removed by adding Pelobacter SFB93 into the consortium. Transcriptomic analysis of D. mccartyi strain 195 showed genes encoding for reductive dehalogenases (e.g., tceA) were not affected during the C2H2-inhibition, while genes encoding for ATP synthase, biosynthesis, and Hym hydrogenase were down-regulated during C2H2 inhibition, consistent with the physiological observation of lower cell yields and reduced dechlorination rates in strain 195. These results will help facilitate the optimization of TCE-bioremediation at contaminated sites containing both TCE and C2H2.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Stein, Tamar; Bandyopadhyay, Biswajit; Troy, Tyler P.
The growth mechanism of hydrocarbons in ionizing environments, such as the interstellar medium (ISM), and some combustion conditions remains incompletely understood. Ab initio molecular dynamics (AIMD) simulations and molecular beam vacuum-UV (VUV) photoionization mass spectrometry experiments were performed to understand the ion-molecule growth mechanism of small acetylene clusters (up to hexamers). A dramatic dependence of product distribution on the ionization conditions is demonstrated experimentally and understood from simulations. The products change from reactive fragmentation products in a higher temperature, higher density gas regime toward a very cold collision-free cluster regime that is dominated by products whose empirical formula is (Cmore » 2H 2) n +, just like ionized acetylene clusters. The fragmentation products result from reactive ion- molecule collisions in a comparatively higher pressure and temperature regime followed by unimolecular decomposition. The isolated ionized clusters display rich dynamics that contain bonded C 4H 4 + and C 6H 6 + structures solvated with one or more neutral acetylene molecules. Such species contain large amounts ( > 2 eV) of excess internal energy. The role of the solvent acetylene molecules is to affect the barrier crossing dynamics in the potential energy surface (PES) between (C 2H 2) n + isomers and provide evaporative cooling to dissipate the excess internal energy and stabilize products including the aromatic ring of the benzene cation. Formation of the benzene cation is demonstrated in AIMD simulations of acetylene clusters with n > 3, as well as other metastable C 6H 6 + isomers. Lastly, these results suggest a path for aromatic ring formation in cold acetylene-rich environments such as parts of the ISM.« less
Stein, Tamar; Bandyopadhyay, Biswajit; Troy, Tyler P.; Fang, Yigang; Kostko, Oleg
2017-01-01
The growth mechanism of hydrocarbons in ionizing environments, such as the interstellar medium (ISM), and some combustion conditions remains incompletely understood. Ab initio molecular dynamics (AIMD) simulations and molecular beam vacuum-UV (VUV) photoionization mass spectrometry experiments were performed to understand the ion–molecule growth mechanism of small acetylene clusters (up to hexamers). A dramatic dependence of product distribution on the ionization conditions is demonstrated experimentally and understood from simulations. The products change from reactive fragmentation products in a higher temperature, higher density gas regime toward a very cold collision-free cluster regime that is dominated by products whose empirical formula is (C2H2)n+, just like ionized acetylene clusters. The fragmentation products result from reactive ion–molecule collisions in a comparatively higher pressure and temperature regime followed by unimolecular decomposition. The isolated ionized clusters display rich dynamics that contain bonded C4H4+ and C6H6+ structures solvated with one or more neutral acetylene molecules. Such species contain large amounts (>2 eV) of excess internal energy. The role of the solvent acetylene molecules is to affect the barrier crossing dynamics in the potential energy surface (PES) between (C2H2)n+ isomers and provide evaporative cooling to dissipate the excess internal energy and stabilize products including the aromatic ring of the benzene cation. Formation of the benzene cation is demonstrated in AIMD simulations of acetylene clusters with n > 3, as well as other metastable C6H6+ isomers. These results suggest a path for aromatic ring formation in cold acetylene-rich environments such as parts of the ISM. PMID:28484019
Stein, Tamar; Bandyopadhyay, Biswajit; Troy, Tyler P; Fang, Yigang; Kostko, Oleg; Ahmed, Musahid; Head-Gordon, Martin
2017-05-23
The growth mechanism of hydrocarbons in ionizing environments, such as the interstellar medium (ISM), and some combustion conditions remains incompletely understood. Ab initio molecular dynamics (AIMD) simulations and molecular beam vacuum-UV (VUV) photoionization mass spectrometry experiments were performed to understand the ion-molecule growth mechanism of small acetylene clusters (up to hexamers). A dramatic dependence of product distribution on the ionization conditions is demonstrated experimentally and understood from simulations. The products change from reactive fragmentation products in a higher temperature, higher density gas regime toward a very cold collision-free cluster regime that is dominated by products whose empirical formula is (C 2 H 2 ) n + , just like ionized acetylene clusters. The fragmentation products result from reactive ion-molecule collisions in a comparatively higher pressure and temperature regime followed by unimolecular decomposition. The isolated ionized clusters display rich dynamics that contain bonded C 4 H 4 + and C 6 H 6 + structures solvated with one or more neutral acetylene molecules. Such species contain large amounts (>2 eV) of excess internal energy. The role of the solvent acetylene molecules is to affect the barrier crossing dynamics in the potential energy surface (PES) between (C 2 H 2 ) n + isomers and provide evaporative cooling to dissipate the excess internal energy and stabilize products including the aromatic ring of the benzene cation. Formation of the benzene cation is demonstrated in AIMD simulations of acetylene clusters with n > 3, as well as other metastable C 6 H 6 + isomers. These results suggest a path for aromatic ring formation in cold acetylene-rich environments such as parts of the ISM.
Stein, Tamar; Bandyopadhyay, Biswajit; Troy, Tyler P.; ...
2017-05-08
The growth mechanism of hydrocarbons in ionizing environments, such as the interstellar medium (ISM), and some combustion conditions remains incompletely understood. Ab initio molecular dynamics (AIMD) simulations and molecular beam vacuum-UV (VUV) photoionization mass spectrometry experiments were performed to understand the ion-molecule growth mechanism of small acetylene clusters (up to hexamers). A dramatic dependence of product distribution on the ionization conditions is demonstrated experimentally and understood from simulations. The products change from reactive fragmentation products in a higher temperature, higher density gas regime toward a very cold collision-free cluster regime that is dominated by products whose empirical formula is (Cmore » 2H 2) n +, just like ionized acetylene clusters. The fragmentation products result from reactive ion- molecule collisions in a comparatively higher pressure and temperature regime followed by unimolecular decomposition. The isolated ionized clusters display rich dynamics that contain bonded C 4H 4 + and C 6H 6 + structures solvated with one or more neutral acetylene molecules. Such species contain large amounts ( > 2 eV) of excess internal energy. The role of the solvent acetylene molecules is to affect the barrier crossing dynamics in the potential energy surface (PES) between (C 2H 2) n + isomers and provide evaporative cooling to dissipate the excess internal energy and stabilize products including the aromatic ring of the benzene cation. Formation of the benzene cation is demonstrated in AIMD simulations of acetylene clusters with n > 3, as well as other metastable C 6H 6 + isomers. Lastly, these results suggest a path for aromatic ring formation in cold acetylene-rich environments such as parts of the ISM.« less
OZONE PRODUCTION FROM IRRADIATION OF ACETYLENE/CHLORINE MIXTURES IN AIR
The reaction of chlorine radicals with acetylene in air in the absence of oxides of nitrogen result In the formation of ozone. o ozone is observed when chlorine radicals react with methylacetylene or ethylacetylene under similar conditions. ormyl chloride is observed in all syste...
Degradation of the metal-cyano complex tetracyanonickelate (II) by Fusarium oxysporum N-10.
Yanase, H; Sakamoto, A; Okamoto, K; Kita, K; Sato, Y
2000-03-01
A fungus with the ability to utilize a metalcyano compound, tetracyanonickelate (II) ¿K2[Ni (CN)4]; TCN¿, as its sole source of nitrogen was isolated from soil and identified as Fusarium oxysporum N-10. Both intact mycelia and cell-free extract of the strain catalyzed hydrolysis of TCN to formate and ammonia and produced formamide as an intermediate, thereby indicating that a hydratase and an amidase sequentially participated in the degradation of TCN. The enzyme catalyzing the hydration of TCN was purified approximately ten-fold from the cell-free extract of strain N-10 with a yield of 29%. The molecular mass of the active enzyme was estimated to be 160 kDa. The enzyme appears to exist as a homotetramer, each subunit having a molecular mass of 40 kDa. The enzyme also catalyzed the hydration of KCN, with a cyanide-hydrating activity 2 x 10(4) times greater than for TCN. The kinetic parameters for TCN and KCN indicated that hydratase isolated from F. oxysporum was a cyanide hydratase able to utilize a broad range of cyano compounds and nitriles as substrates.
Zubimendi, Juan P; Martinatto, Andrea; Valacco, Maria P; Moreno, Silvia; Andreo, Carlos S; Drincovich, María F; Tronconi, Marcos A
2018-06-01
Arabidopsis thaliana possesses two fumarase genes (FUM), AtFUM1 (At2g47510) encoding for the mitochondrial Krebs cycle-associated enzyme and AtFUM2 (At5g50950) for the cytosolic isoform required for fumarate massive accumulation. Here, the comprehensive biochemical studies of AtFUM1 and AtFUM2 shows that they are active enzymes with similar kinetic parameters but differential regulation. For both enzymes, fumarate hydratase (FH) activity is favored over the malate dehydratase (MD) activity; however, MD is the most regulated activity with several allosteric activators. Oxalacetate, glutamine, and/or asparagine are modulators causing the MD reaction to become preferred over the FH reaction. Activity profiles as a function of pH suggest a suboptimal FUM activity in Arabidopsis cells; moreover, the direction of the FUM reaction is sensitive to pH changes. Under mild oxidation conditions, AtFUMs form high mass molecular aggregates, which present both FUM activities decreased to a different extent. The biochemical properties of oxidized AtFUMs (oxAtFUMs) were completely reversed by NADPH-supplied Arabidopsis leaf extracts, suggesting that the AtFUMs redox regulation can be accomplished in vivo. Mass spectrometry analyses indicate the presence of an active site-associated intermolecular disulfide bridge in oxAtFUMs. Finally, a phylogenetic approach points out that other plant species may also possess cytosolic FUM2 enzymes mainly encoded by paralogous genes, indicating that the evolutionary history of this trait has been drawn through a process of parallel evolution. Overall, according to our results, a multilevel regulatory pattern of FUM activities emerges, supporting the role of this enzyme as a carbon flow monitoring point through the organic acid metabolism in plants. © 2018 Federation of European Biochemical Societies.
Fumarate is an epigenetic modifier that elicits epithelial-to-mesenchymal transition.
Sciacovelli, Marco; Gonçalves, Emanuel; Johnson, Timothy Isaac; Zecchini, Vincent Roberto; da Costa, Ana Sofia Henriques; Gaude, Edoardo; Drubbel, Alizee Vercauteren; Theobald, Sebastian Julian; Abbo, Sandra Riekje; Tran, Maxine Gia Binh; Rajeeve, Vinothini; Cardaci, Simone; Foster, Sarah; Yun, Haiyang; Cutillas, Pedro; Warren, Anne; Gnanapragasam, Vincent; Gottlieb, Eyal; Franze, Kristian; Huntly, Brian; Maher, Eamonn Richard; Maxwell, Patrick Henry; Saez-Rodriguez, Julio; Frezza, Christian
2016-08-31
Mutations of the tricarboxylic acid cycle enzyme fumarate hydratase cause hereditary leiomyomatosis and renal cell cancer. Fumarate hydratase-deficient renal cancers are highly aggressive and metastasize even when small, leading to a very poor clinical outcome. Fumarate, a small molecule metabolite that accumulates in fumarate hydratase-deficient cells, plays a key role in cell transformation, making it a bona fide oncometabolite. Fumarate has been shown to inhibit α-ketoglutarate-dependent dioxygenases that are involved in DNA and histone demethylation. However, the link between fumarate accumulation, epigenetic changes, and tumorigenesis is unclear. Here we show that loss of fumarate hydratase and the subsequent accumulation of fumarate in mouse and human cells elicits an epithelial-to-mesenchymal-transition (EMT), a phenotypic switch associated with cancer initiation, invasion, and metastasis. We demonstrate that fumarate inhibits Tet-mediated demethylation of a regulatory region of the antimetastatic miRNA cluster mir-200ba429, leading to the expression of EMT-related transcription factors and enhanced migratory properties. These epigenetic and phenotypic changes are recapitulated by the incubation of fumarate hydratase-proficient cells with cell-permeable fumarate. Loss of fumarate hydratase is associated with suppression of miR-200 and the EMT signature in renal cancer and is associated with poor clinical outcome. These results imply that loss of fumarate hydratase and fumarate accumulation contribute to the aggressive features of fumarate hydratase-deficient tumours.
77 FR 13969 - Revising Standards Referenced in the Acetylene Standard
Federal Register 2010, 2011, 2012, 2013, 2014
2012-03-08
.... OSHA-2011-0183] RIN 1218-AC64 Revising Standards Referenced in the Acetylene Standard AGENCY: Occupational Safety and Health Administration (OSHA), Department of Labor. ACTION: Final rule; confirmation of effective date. SUMMARY: OSHA is confirming the effective date of its direct final rule that revises the...
Vanillin formation from ferulic acid in Vanilla planifolia is catalysed by a single enzyme.
Gallage, Nethaji J; Hansen, Esben H; Kannangara, Rubini; Olsen, Carl Erik; Motawia, Mohammed Saddik; Jørgensen, Kirsten; Holme, Inger; Hebelstrup, Kim; Grisoni, Michel; Møller, Birger Lindberg
2014-06-19
Vanillin is a popular and valuable flavour compound. It is the key constituent of the natural vanilla flavour obtained from cured vanilla pods. Here we show that a single hydratase/lyase type enzyme designated vanillin synthase (VpVAN) catalyses direct conversion of ferulic acid and its glucoside into vanillin and its glucoside, respectively. The enzyme shows high sequence similarity to cysteine proteinases and is specific to the substitution pattern at the aromatic ring and does not metabolize caffeic acid and p-coumaric acid as demonstrated by coupled transcription/translation assays. VpVAN localizes to the inner part of the vanilla pod and high transcript levels are found in single cells located a few cell layers from the inner epidermis. Transient expression of VpVAN in tobacco and stable expression in barley in combination with the action of endogenous alcohol dehydrogenases and UDP-glucosyltransferases result in vanillyl alcohol glucoside formation from endogenous ferulic acid. A gene encoding an enzyme showing 71% sequence identity to VpVAN was identified in another vanillin-producing plant species Glechoma hederacea and was also shown to be a vanillin synthase as demonstrated by transient expression in tobacco.
Vanillin formation from ferulic acid in Vanilla planifolia is catalysed by a single enzyme
Gallage, Nethaji J.; Hansen, Esben H.; Kannangara, Rubini; Olsen, Carl Erik; Motawia, Mohammed Saddik; Jørgensen, Kirsten; Holme, Inger; Hebelstrup, Kim; Grisoni, Michel; Møller, Birger Lindberg
2014-01-01
Vanillin is a popular and valuable flavour compound. It is the key constituent of the natural vanilla flavour obtained from cured vanilla pods. Here we show that a single hydratase/lyase type enzyme designated vanillin synthase (VpVAN) catalyses direct conversion of ferulic acid and its glucoside into vanillin and its glucoside, respectively. The enzyme shows high sequence similarity to cysteine proteinases and is specific to the substitution pattern at the aromatic ring and does not metabolize caffeic acid and p-coumaric acid as demonstrated by coupled transcription/translation assays. VpVAN localizes to the inner part of the vanilla pod and high transcript levels are found in single cells located a few cell layers from the inner epidermis. Transient expression of VpVAN in tobacco and stable expression in barley in combination with the action of endogenous alcohol dehydrogenases and UDP-glucosyltransferases result in vanillyl alcohol glucoside formation from endogenous ferulic acid. A gene encoding an enzyme showing 71% sequence identity to VpVAN was identified in another vanillin-producing plant species Glechoma hederacea and was also shown to be a vanillin synthase as demonstrated by transient expression in tobacco. PMID:24941968
Jiang, Chuanxing; Yin, Nailiang; Yao, Yao; Shaymurat, Talgar; Zhou, Xiaoyan
2017-01-01
This paper demonstrates an acetylene gas sensor based on an Ag-decorated tin dioxide/reduced graphene oxide (Ag–SnO2/rGO) nanocomposite film, prepared by layer-by-layer (LbL) self-assembly technology. The as-prepared Ag–SnO2/rGO nanocomposite was characterized by scanning electron microscopy (SEM), transmission electron microscopy (TEM), X-ray diffraction (XRD) and Raman spectrum. The acetylene sensing properties were investigated using different working temperatures and gas concentrations. An optimal temperature of 90 °C was determined, and the Ag–SnO2/rGO nanocomposite sensor exhibited excellent sensing behaviors towards acetylene, in terms of response, repeatability, stability and response/recovery characteristics, which were superior to the pure SnO2 and SnO2/rGO film sensors. The sensing mechanism of the Ag–SnO2/rGO sensor was attributed to the synergistic effect of the ternary nanomaterials, and the heterojunctions created at the interfaces between SnO2 and rGO. This work indicates that the Ag–SnO2/rGO nanocomposite is a good candidate for constructing a low-temperature acetylene sensor. PMID:28927021
Rosberg-Cody, Eva; Liavonchanka, Alena; Göbel, Cornelia; Ross, R Paul; O'Sullivan, Orla; Fitzgerald, Gerald F; Feussner, Ivo; Stanton, Catherine
2011-02-17
The aim of this study was to determine the catalytic activity and physiological role of myosin-cross-reactive antigen (MCRA) from Bifidobacterium breve NCIMB 702258. MCRA from B. breve NCIMB 702258 was cloned, sequenced and expressed in heterologous hosts (Lactococcus and Corynebacterium) and the recombinant proteins assessed for enzymatic activity against fatty acid substrates. MCRA catalysed the conversion of palmitoleic, oleic and linoleic acids to the corresponding 10-hydroxy fatty acids, but shorter chain fatty acids were not used as substrates, while the presence of trans-double bonds and double bonds beyond the position C12 abolished hydratase activity. The hydroxy fatty acids produced were not metabolised further. We also found that heterologous Lactococcus and Corynebacterium expressing MCRA accumulated increasing amounts of 10-HOA and 10-HOE in the culture medium. Furthermore, the heterologous cultures exhibited less sensitivity to heat and solvent stresses compared to corresponding controls. MCRA protein in B. breve can be classified as a FAD-containing double bond hydratase, within the carbon-oxygen lyase family, which may be catalysing the first step in conjugated linoleic acid (CLA) production, and this protein has an additional function in bacterial stress protection.
Growth of ammonia-oxidizing archaea in soil microcosms is inhibited by acetylene.
Offre, Pierre; Prosser, James I; Nicol, Graeme W
2009-10-01
Autotrophic ammonia-oxidizing bacteria were considered to be responsible for the majority of ammonia oxidation in soil until the recent discovery of the autotrophic ammonia-oxidizing archaea. To assess the relative contributions of bacterial and archaeal ammonia oxidizers to soil ammonia oxidation, their growth was analysed during active nitrification in soil microcosms incubated for 30 days at 30 degrees C, and the effect of an inhibitor of ammonia oxidation (acetylene) on their growth and soil nitrification kinetics was determined. Denaturing gradient gel electrophoresis (DGGE) analysis of bacterial ammonia oxidizer 16S rRNA genes did not detect any change in their community composition during incubation, and quantitative PCR (qPCR) analysis of bacterial amoA genes indicated a small decrease in abundance in control and acetylene-containing microcosms. DGGE fingerprints of archaeal amoA and 16S rRNA genes demonstrated changes in the relative abundance of specific crenarchaeal phylotypes during active nitrification. Growth was also indicated by increases in crenarchaeal amoA gene copy number, determined by qPCR. In microcosms containing acetylene, nitrification and growth of the crenarchaeal phylotypes were suppressed, suggesting that these crenarchaea are ammonia oxidizers. Growth of only archaeal but not bacterial ammonia oxidizers occurred in microcosms with active nitrification, indicating that ammonia oxidation was mostly due to archaea in the conditions of the present study.
Zhang, B; Marcus, S L; Sajjadi, F G; Alvares, K; Reddy, J K; Subramani, S; Rachubinski, R A; Capone, J P
1992-01-01
Ciprofibrate, a hypolipidemic drug that acts as a peroxisome proliferator, induces the transcription of genes encoding peroxisomal beta-oxidation enzymes. To identify cis-acting promoter elements involved in this induction, 5.8 kilobase pairs of promoter sequence from the gene encoding rat peroxisomal enoyl-CoA hydratase/3-hydroxyacyl-CoA dehydrogenase (EC 4.2.1.17/EC 1.1.1.35) was inserted upstream of a luciferase reporter gene. Transfection of this expression vector into rat hepatoma H4IIEC3 cells in the presence of ciprofibrate resulted in a 5- to 10-fold, cell type-specific increase in luciferase activity as compared to cells transfected in the absence of drug. A peroxisome proliferator-responsive element (PPRE) was localized to a 196-nucleotide region centered at position -2943 from the transcription start site. This PPRE conferred ciprofibrate responsiveness on a heterologous promoter and functioned independently of orientation or position. Gel retardation analysis with nuclear extracts demonstrated that ciprofibrate-treated or untreated H4IIEC3 cells, but not HeLa cells or monkey kidney cells, contained sequence-specific DNA binding factors that interact with the PPRE. These results have implications for understanding the mechanisms of coordinated transcriptional induction of genes encoding peroxisomal proteins by hypolipidemic agents and other peroxisome proliferators. Images PMID:1502166
Isotope effect in normal-to-local transition of acetylene bending modes
Ma, Jianyi; Xu, Dingguo; Guo, Hua; ...
2012-01-01
The normal-to-local transition for the bending modes of acetylene is considered a prelude to its isomerization to vinylidene. Here, such a transition in fully deuterated acetylene is investigated using a full-dimensional quantum model. It is found that the local benders emerge at much lower energies and bending quantum numbers than in the hydrogen isotopomer HCCH. This is accompanied by a transition to a second kind of bending mode called counter-rotator, again at lower energies and quantum numbers than in HCCH. These transitions are also investigated using bifurcation analysis of two empirical spectroscopic fitting Hamiltonians for pure bending modes, which helpsmore » to understand the origin of the transitions semiclassically as branchings or bifurcations out of the trans and normal bend modes when the latter become dynamically unstable. The results of the quantum model and the empirical bifurcation analysis are in very good agreement.« less
Musalova, Maria V; Potapov, Vladimir A; Amosova, Svetlana V
2012-05-15
The reaction of tellurium tetrachloride with acetylene proceeds in a stereospecific anti-addition manner to afford the novel products E-2-chlorovinyltellurium trichloride and E,E-bis(2-chlorovinyl)tellurium dichloride. Reaction conditions for the selective preparation of each of these products were found. The latter was obtained in 90% yield in CHCl(3) under a pressure of acetylene of 10-15 atm, whereas the former product was formed in up to 72% yield in CCl(4) under a pressure of acetylene of 1-3 atm. Synthesis of the previously unknown E,E-bis(2-chlorovinyl) telluride, E,E-bis(2-chlorovinyl) ditelluride, E-2-chlorovinyl 1,2,2-trichloroethyl telluride and E,E-bis(2-chlorovinyl)-tellurium dibromide is described.
NASA Astrophysics Data System (ADS)
Han, Huixian; Li, Anyang; Guo, Hua
2014-12-01
A new full-dimensional global potential energy surface (PES) for the acetylene-vinylidene isomerization on the ground (S0) electronic state has been constructed by fitting ˜37 000 high-level ab initio points using the permutation invariant polynomial-neural network method with a root mean square error of 9.54 cm-1. The geometries and harmonic vibrational frequencies of acetylene, vinylidene, and all other stationary points (two distinct transition states and one secondary minimum in between) have been determined on this PES. Furthermore, acetylene vibrational energy levels have been calculated using the Lanczos algorithm with an exact (J = 0) Hamiltonian. The vibrational energies up to 12 700 cm-1 above the zero-point energy are in excellent agreement with the experimentally derived effective Hamiltonians, suggesting that the PES is approaching spectroscopic accuracy. In addition, analyses of the wavefunctions confirm the experimentally observed emergence of the local bending and counter-rotational modes in the highly excited bending vibrational states. The reproduction of the experimentally derived effective Hamiltonians for highly excited bending states signals the coming of age for the ab initio based PES, which can now be trusted for studying the isomerization reaction.
Fatal carbon monoxide intoxication after acetylene gas welding of pipes.
Antonsson, Ann-Beth; Christensson, Bengt; Berge, Johan; Sjögren, Bengt
2013-06-01
Acetylene gas welding of district heating pipes can result in exposure to high concentrations of carbon monoxide. A fatal case due to intoxication is described. Measurements of carbon monoxide revealed high levels when gas welding a pipe with closed ends. This fatality and these measurements highlight a new hazard, which must be promptly prevented.
Groundwater remediation engineering sparging using acetylene--study on the flow distribution of air.
Zheng, Yan-Mei; Zhang, Ying; Huang, Guo-Qiang; Jiang, Bin; Li, Xin-Gang
2005-01-01
Air sparging (AS) is an emerging method to remove VOCs from saturated soils and groundwater. Air sparging performance highly depends on the air distribution resulting in the aquifer. In order to study gas flow characterization, a two-dimensional experimental chamber was designed and installed. In addition, the method by using acetylene as the tracer to directly image the gas distribution results of AS process has been put forward. Experiments were performed with different injected gas flow rates. The gas flow patterns were found to depend significantly on the injected gas flow rate, and the characterization of gas flow distributions in porous media was very different from the acetylene tracing study. Lower and higher gas flow rates generally yield more irregular in shape and less effective gas distributions.
Pulsed-induced electromagnetically induced transparency in the acetylene-filled hollow-core fibers
NASA Astrophysics Data System (ADS)
Rodríguez, Nayeli Casillas; Stepanov, Serguei; Miramontes, Manuel Ocegueda; Hernández, Eliseo Hernández
2017-06-01
Experimental results on pulsed excitation of electromagnetically induced transparency (EIT) in the acetylene-filled hollow-core photonic crystal fiber (HC-PCF) at pressures 0.1-0.4 Torr are reported. The EIT was observed both in Λ and V interaction configurations with the continuous probe wave tuned to R9 (1520.08 nm) acetylene absorption line and with the control pulses tuned to P11 (1531.58 nm) and P9 (1530.37 nm) lines, respectively. The utilized control pulses were of up to 40 ns duration with <2.5 ns fronts and with maximum input power 1 W. The maximum modulation depth of the initial probe wave absorption via EIT was up to 40 and 15% for the co- and counter-propagation of the probe and control waves, respectively, and importance of the waves polarization matching was demonstrated. For a qualitative explanation of reduction in the counter-propagation EIT efficiency a simple model of the accelerated mismatch of the two-frequency EIT resonance with deviation of the molecule thermal velocity from the resonance value was utilized. It was shown experimentally that the EIT efficiencies in both configurations do not depend on the longitudinal velocity of the molecules. The characteristic relaxation time of the of the EIT response was found to be about 9 ns, i.e., is close to the relaxation times T 1,2 of the acetylene molecules under the utilized experimental conditions.
NASA Astrophysics Data System (ADS)
Ma, Ling-Ling; Lv, Cun-Qin; Wang, Gui-Chang
2017-07-01
Semi-hydrogenation of acetylene in a hydrogen-rich stream is an industrially important process. Inspired by the recent experiments that Cu(111) surface doped by a small number of Pd atoms can exhibit excellent catalytic performance toward the dissociation of H2 molecule as well as the high selective hydrogenation of acetylene as compared with pure Cu and Pd metal alone at low-temperature, here we performed systematic first-principles calculations to investigate the corresponding reaction mechanism related to the acetylene hydrogenation processes on single atom alloys (SAAs) and monolayer Pd/Cu(111) (i.e.,1.00 ML Pd/Cu(111)) model catalysts in detail, and to explore the possible factors controlling the high selectivity on SAAs. Our results clearly demonstrate that the SAA catalyst has higher selectivity for the ethylene formation than that of 1.00 ML Pd/Cu(111), and lower activity for the acetylene conversion compared with that of 1.00 ML Pd/Cu(111). The relatively high selectivity on SAA is mainly due to the facile desorption of ethylene and moderate activity in the dissociation of molecular H2. The main factor which lowers the selectivity towards the ethylene formation on 1.00 ML Pd/Cu(111) is that this system has a higher capacity to promote the breaking of Csbnd H/Csbnd C bonds, which leads to the formation of carbonaceous deposits and polymers such as benzene, and thus reduces the selectivity for the ethylene formation. Meanwhile, it was found that the desorption energy of ethylene on these two surfaces was smaller than the energy barrier of further hydrogenation, which results in the absence of ethane on these two systems. Micro-kinetic model analysis provides a further valuable insight into the evidence for the key factors controlling the catalytic activity and selectivity towards the selective hydrogenation of acetylene. Our findings may help people to design a highly selective hydrogenation catalyst by controlling the balance between the H2 dissociation and
Fumarate hydratase is a critical metabolic regulator of hematopoietic stem cell functions.
Guitart, Amelie V; Panagopoulou, Theano I; Villacreces, Arnaud; Vukovic, Milica; Sepulveda, Catarina; Allen, Lewis; Carter, Roderick N; van de Lagemaat, Louie N; Morgan, Marcos; Giles, Peter; Sas, Zuzanna; Gonzalez, Marta Vila; Lawson, Hannah; Paris, Jasmin; Edwards-Hicks, Joy; Schaak, Katrin; Subramani, Chithra; Gezer, Deniz; Armesilla-Diaz, Alejandro; Wills, Jimi; Easterbrook, Aaron; Coman, David; So, Chi Wai Eric; O'Carroll, Donal; Vernimmen, Douglas; Rodrigues, Neil P; Pollard, Patrick J; Morton, Nicholas M; Finch, Andrew; Kranc, Kamil R
2017-03-06
Strict regulation of stem cell metabolism is essential for tissue functions and tumor suppression. In this study, we investigated the role of fumarate hydratase (Fh1), a key component of the mitochondrial tricarboxylic acid (TCA) cycle and cytosolic fumarate metabolism, in normal and leukemic hematopoiesis. Hematopoiesis-specific Fh1 deletion (resulting in endogenous fumarate accumulation and a genetic TCA cycle block reflected by decreased maximal mitochondrial respiration) caused lethal fetal liver hematopoietic defects and hematopoietic stem cell (HSC) failure. Reexpression of extramitochondrial Fh1 (which normalized fumarate levels but not maximal mitochondrial respiration) rescued these phenotypes, indicating the causal role of cellular fumarate accumulation. However, HSCs lacking mitochondrial Fh1 (which had normal fumarate levels but defective maximal mitochondrial respiration) failed to self-renew and displayed lymphoid differentiation defects. In contrast, leukemia-initiating cells lacking mitochondrial Fh1 efficiently propagated Meis1 / Hoxa9 -driven leukemia. Thus, we identify novel roles for fumarate metabolism in HSC maintenance and hematopoietic differentiation and reveal a differential requirement for mitochondrial Fh1 in normal hematopoiesis and leukemia propagation. © 2017 Guitart et al.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Han, Huixian; School of Physics, Northwest University, Xi’an, Shaanxi 710069; Li, Anyang
2014-12-28
A new full-dimensional global potential energy surface (PES) for the acetylene-vinylidene isomerization on the ground (S{sub 0}) electronic state has been constructed by fitting ∼37 000 high-level ab initio points using the permutation invariant polynomial-neural network method with a root mean square error of 9.54 cm{sup −1}. The geometries and harmonic vibrational frequencies of acetylene, vinylidene, and all other stationary points (two distinct transition states and one secondary minimum in between) have been determined on this PES. Furthermore, acetylene vibrational energy levels have been calculated using the Lanczos algorithm with an exact (J = 0) Hamiltonian. The vibrational energies upmore » to 12 700 cm{sup −1} above the zero-point energy are in excellent agreement with the experimentally derived effective Hamiltonians, suggesting that the PES is approaching spectroscopic accuracy. In addition, analyses of the wavefunctions confirm the experimentally observed emergence of the local bending and counter-rotational modes in the highly excited bending vibrational states. The reproduction of the experimentally derived effective Hamiltonians for highly excited bending states signals the coming of age for the ab initio based PES, which can now be trusted for studying the isomerization reaction.« less
A novel metal-organic framework for high storage and separation of acetylene at room temperature
DOE Office of Scientific and Technical Information (OSTI.GOV)
Duan, Xing, E-mail: star1987@hdu.edu.cn; Wang, Huizhen; Ji, Zhenguo
2016-09-15
A novel 3D microporous metal-organic framework with NbO topology, [Cu{sub 2}(L)(H{sub 2}O){sub 2}]∙(DMF){sub 6}·(H{sub 2}O){sub 2} (ZJU-10, ZJU = Zhejiang University; H{sub 4}L =2′-hydroxy-[1,1′:4′,1″-terphenyl]-3,3″,5,5″-tetracarboxylic acid; DMF =N,N-dimethylformamide), has been synthesized and structurally characterized. With suitable pore sizes and open Cu{sup 2+} sites, ZJU-10a exhibits high BET surface area of 2392 m{sup 2}/g, as well as moderately high C{sub 2}H{sub 2} volumetric uptake capacity of 132 cm{sup 3}/cm{sup 3}. Meanwhile, ZJU-10a is a promising porous material for separation of acetylene from methane and carbon dioxide gas mixtures at room temperature. - Graphical abstract: A new NbO-type microporous metal-organic framework ZJU-10 withmore » suitable pore size and open Cu{sup 2+} sites was synthesized to realize the strong interaction with acetylene molecules, which can separate the acetylene from methane and carbon dioxane gas mixtures at room temperature. Display Omitted - Highlights: • A novel 3D NbO-type microporous metal-organic framework ZJU-10 was solvothermally synthesized and structurally characterized. • ZJU-10a exhibits high BET surface area of 2392 m{sup 2}/g. • ZJU-10a shows a moderately high C{sub 2}H{sub 2} gravimetric (volumetric) uptake capacity of 174 (132) cm{sup 3}/g at 298 K and 1 bar. • ZJU-10a can separate acetylene from methane and carbon dioxide gas mixtures at room temperature.« less
A density functional theory study on the acetylene cyclotrimerization on Pd-modified Au(111) surface
NASA Astrophysics Data System (ADS)
Ren, Bohua; Dong, Xiuqin; Yu, Yingzhe; Zhang, Minhua
2017-10-01
Calculations based on the first-principle density functional theory were carried out to study the possible acetylene cyclotrimerization reactions on Pd-Au(111) surface and to investigate the effect of Au atom alloying with Pd. The adsorption of C2H2, C4H4, C6H6 and the PDOS of 4d orbitals of surface Pd and Au atoms were studied. The comparison of d-band center of Pd and Au atom before and after C2H2 or C4H4 adsorption suggests that these molecules affect the activity of Pd-Au(111) surface to some degree due to the high binding energy of the adsorption. In our study, the second neighboring Pd ensembles on Pd-Au(111) surface can adsorb two acetylene molecules on parallel-bridge site of two Au atoms and one Pd atom, respectively. Csbnd C bonds are parallel to each other and two acetylenes are adsorbed face to face to produce four-membered ring C4H4 firstly. The geometric effect and electronic effect of Pd-Au(111) surface with the second neighboring Pd ensembles both help to reduce this activation barrier.
49 CFR 173.303 - Charging of cylinders with compressed gas in solution (acetylene).
Code of Federal Regulations, 2010 CFR
2010-10-01
... with acetylene must be successfully tested in accordance with CGA C-12. (b) Filling limits. For DOT... conform to ISO 3807-2 (IBR, see § 171.7 of this subchapter), have a homogeneous monolithic porous mass...
Structure, Stabilities, Thermodynamic Properties, and IR Spectra of Acetylene Clusters (C2H2)n=2-5.
Karthikeyan, S; Lee, Han Myoung; Kim, Kwang S
2010-10-12
There are no clear conclusions over the structures of the acetylene clusters. In this regard, we have carried out high-level calculations for acetylene clusters (C2H2)2-5 using dispersion-corrected density functional theory (DFT-D), Møller-Plesset second-order perturbation theory (MP2); and coupled-cluster theory with single, double, and perturbative triple excitations [CCSD(T)] at the complete basis set limit. The lowest energy structure of the acetylene dimer has a T-shaped structure of C2v symmetry, but it is nearly isoenergetic to the displaced stacked structure of C2h symmetry. We find that the structure shows the quantum statistical distribution for configurations between the T-shaped and displaced stacked structures for which the average angle (|θ̃|) between two acetylene molecules would be 53-78°, close to the T-shaped structure. The trimer has a triangular structure of C3h symmetry. The tetramer has two lowest energy isomers of S4 and C2h symmetry in zero-point energy (ZPE)-uncorrected energy (ΔEe), but one lowest energy isomer of C2v symmetry in ZPE-corrected energy (ΔE0). For the pentamer, the global minimum structure is C1 symmetry with eight sets of T-type π-H interactions and a set of π-π interactions. Our high-level ab initio calculations are consistent with available experimental data.
Ponce-Pérez, R; Cocoletzi, Gregorio H; Takeuchi, Noboru
2017-11-28
Spin-polarized first-principles total-energy calculations have been performed to investigate the possible chain reaction of acetylene molecules mediated by hydrogen abstraction on hydrogenated hexagonal boron nitride monolayers. Calculations have been done within the periodic density functional theory (DFT), employing the PBE exchange correlation potential, with van der Waals corrections (vdW-DF). Reactions at two different sites have been considered: hydrogen vacancies on top of boron and on top of nitrogen atoms. As previously calculated, at the intermediate state of the reaction, when the acetylene molecule is attached to the surface, the adsorption energy is of the order of -0.82 eV and -0.20 eV (measured with respect to the energy of the non interacting molecule-substrate system) for adsorption on top of boron and nitrogen atoms, respectively. After the hydrogen abstraction takes place, the system gains additional energy, resulting in adsorption energies of -1.52 eV and -1.30 eV, respectively. These results suggest that the chain reaction is energetically favorable. The calculated minimum energy path (MEP) for hydrogen abstraction shows very small energy barriers of the order of 5 meV and 22 meV for the reaction on top of boron and nitrogen atoms, respectively. Finally, the density of states (DOS) evolution study helps to understand the chain reaction mechanism. Graphical abstract Acetylene chain reaction on hydrogenated boron nitride monolayers.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Mackenzie, Rebecca B.; Dewberry, Christopher T.; Leopold, Kenneth R., E-mail: A.C.Legon@bristol.ac.uk, E-mail: david.tew@bristol.ac.uk, E-mail: kleopold@umn.edu
2015-09-14
a-type rotational spectra of the hydrogen-bonded complex formed from pyridine and acetylene are reported. Rotational and {sup 14}N hyperfine constants indicate that the complex is planar with an acetylenic hydrogen directed toward the nitrogen. However, unlike the complexes of pyridine with HCl and HBr, the acetylene moiety in HCCH—NC{sub 5}H{sub 5} does not lie along the symmetry axis of the nitrogen lone pair, but rather, forms an average angle of 46° with the C{sub 2} axis of the pyridine. The a-type spectra of HCCH—NC{sub 5}H{sub 5} and DCCD—NC{sub 5}H{sub 5} are doubled, suggesting the existence of a low lying pairmore » of tunneling states. This doubling persists in the spectra of HCCD—NC{sub 5}H{sub 5}, DCCH—NC{sub 5}H{sub 5}, indicating that the underlying motion does not involve interchange of the two hydrogens of the acetylene. Single {sup 13}C substitution in either the ortho- or meta-position of the pyridine eliminates the doubling and gives rise to separate sets of spectra that are well predicted by a bent geometry with the {sup 13}C on either the same side (“inner”) or the opposite side (“outer”) as the acetylene. High level ab initio calculations are presented which indicate a binding energy of 1.2 kcal/mol and a potential energy barrier of 44 cm{sup −1} in the C{sub 2v} configuration. Taken together, these results reveal a complex with a bent hydrogen bond and large amplitude rocking of the acetylene moiety. It is likely that the bent equilibrium structure arises from a competition between a weak hydrogen bond to the nitrogen (an n-pair hydrogen bond) and a secondary interaction between the ortho-hydrogens of the pyridine and the π electron density of the acetylene.« less
Promising SiC support for Pd catalyst in selective hydrogenation of acetylene to ethylene
NASA Astrophysics Data System (ADS)
Guo, Zhanglong; Liu, Yuefeng; Liu, Yan; Chu, Wei
2018-06-01
In this study, SiC supported Pd nanoparticles were found to be an efficient catalyst in acetylene selective hydrogenation reaction. The ethylene selectivity can be about 20% higher than that on Pd/TiO2 catalyst at the same acetylene conversion at 90%. Moreover, Pd/SiC catalyst showed a stable catalytic life at 65 °C with 80% ethylene selectivity. With the detailed characterization using temperature-programmed reduction (H2-TPR), powder X-ray diffraction (XRD), X-ray photoelectron spectroscopy (XPS), N2 adsorption/desorption analysis, CO-chemisorption and thermo-gravimetric analysis (TGA), it was found that SiC owns a lower surface area (22.9 m2/g) and a broad distribution of meso-/macro-porosity (from 5 to 65 nm), which enhanced the mass transfer during the chemical process at high reaction rate and decreased the residence time of ethylene on catalyst surface. Importantly, SiC support has the high thermal conductivity, which favored the rapid temperature homogenization through the catalyst bed and inhabited the over-hydrogenation of acetylene. The surface electronic density of Pd on Pd/SiC catalyst was higher than that on Pd/TiO2, which could promote desorption of ethylene from surface of the catalyst. TGA results confirmed a much less coke deposition on Pd/SiC catalyst.
NASA Technical Reports Server (NTRS)
Walch, Stephen P.; Taylor, Peter R.
1995-01-01
The reaction of vinylidene (CH2C) with acetylene may be an initiating reaction in soot formation. We report minimum energy paths and accurate energetics for a pathway leading to vinylacetylene and for a number of isomers Of C4H4. The calculations use complete active space self-consistent field (CASSCF) derivative methods to characterize the stationary points and internally contacted configuration interaction (ICCI) and/or coupled cluster singles and doubles with a perturbational estimate of triple excitations (CCSD(T)) to determine the energetics. We find an entrance channel barrier of about 5 kcal/mol for the addition of vinylidene to acetylene, but no barriers above reactants for the reaction pathway leading to vinylacetylene.
Computational Screening of MOFs for Acetylene Separation
NASA Astrophysics Data System (ADS)
Nemati Vesali Azar, Ayda; Keskin, Seda
2018-02-01
Efficient separation of acetylene (C2H2) from CO2 and CH4 is important to meet the requirement of high-purity acetylene in various industrial applications. Metal organic frameworks (MOFs) are great candidates for adsorption-based C2H2/CO2 and C2H2/CH4 separations due to their unique properties such as wide range of pore sizes and tunable chemistries. Experimental studies on the limited number of MOFs revealed that MOFs offer remarkable C2H2/CO2 and C2H2/CH4 selectivities based on single-component adsorption data. We performed the first large-scale molecular simulation study to investigate separation performances of 174 different MOF structures for C2H2/CO2 and C2H2/CH4 mixtures. Using the results of molecular simulations, several adsorbent performance evaluation metrics, such as selectivity, working capacity, adsorbent performance score, sorbent selection parameter and regenerability were computed for each MOF. Based on these metrics, the best adsorbent candidates were identified for both separations. Results showed that the top three most promising MOF adsorbents exhibit C2H2/CO2 selectivities of 49, 47, 24 and C2H2/CH4 selectivities of 824, 684, 638 at 1 bar, 298 K and these are the highest C2H2 selectivities reported to date in the literature. Structure-performance analysis revealed that the best MOF adsorbents have pore sizes between 4-11 Å, surface areas in the range of 600-1,200 m2/g and porosities between 0.4-0.6 for selective separation of C2H2 from CO2 and CH4. These results will guide the future studies for the design of new MOFs with high C2H2 separation potentials.
Computational Screening of MOFs for Acetylene Separation
Nemati Vesali Azar, Ayda; Keskin, Seda
2018-01-01
Efficient separation of acetylene (C2H2) from CO2 and CH4 is important to meet the requirement of high-purity acetylene in various industrial applications. Metal organic frameworks (MOFs) are great candidates for adsorption-based C2H2/CO2 and C2H2/CH4 separations due to their unique properties such as wide range of pore sizes and tunable chemistries. Experimental studies on the limited number of MOFs revealed that MOFs offer remarkable C2H2/CO2 and C2H2/CH4 selectivities based on single-component adsorption data. We performed the first large-scale molecular simulation study to investigate separation performances of 174 different MOF structures for C2H2/CO2 and C2H2/CH4 mixtures. Using the results of molecular simulations, several adsorbent performance evaluation metrics, such as selectivity, working capacity, adsorbent performance score, sorbent selection parameter, and regenerability were computed for each MOF. Based on these metrics, the best adsorbent candidates were identified for both separations. Results showed that the top three most promising MOF adsorbents exhibit C2H2/CO2 selectivities of 49, 47, 24 and C2H2/CH4 selectivities of 824, 684, 638 at 1 bar, 298 K and these are the highest C2H2 selectivities reported to date in the literature. Structure-performance analysis revealed that the best MOF adsorbents have pore sizes between 4 and 11 Å, surface areas in the range of 600–1,200 m2/g and porosities between 0.4 and 0.6 for selective separation of C2H2 from CO2 and CH4. These results will guide the future studies for the design of new MOFs with high C2H2 separation potentials. PMID:29536004
NASA Technical Reports Server (NTRS)
Ferris, James P.; Jacobson, Richard R.; Guillemin, Jean C.
1992-01-01
An NMR spectral study is presently conducted of NH3 photolysis in the presence of substituted acetylenes with NMR spectra and gas chromatography. Quantum yields and percentage conversions to products are reported. It is shown that acetylenic hydrocarbons generated during methane photolysis in Jupiter's stratosphere can react with radicals formed by NH3 photolysis to yield nonvolatile, yellow-brown polymers, alkylnitriles, and in due course, HCN, as observed on Jupiter.
Boonruang, Supattra; Prakobsri, Khanistha; Pouyfung, Phisit; Srisook, Ekaruth; Prasopthum, Aruna; Rongnoparut, Pornpimol; Sarapusit, Songklod
2017-12-01
The human liver cytochrome P450 (CYP) 2A6 and the respiratory CYP2A13 enzymes play role in nicotine metabolism and activation of tobacco-specific nitrosamine carcinogens. Inhibition of both enzymes could offer a strategy for smoking abstinence and decreased risks of respiratory diseases and lung cancer. In this study, activity-guided isolation identified four flavonoids 1-4 (apigenin, luteolin, chrysoeriol, quercetin) from Vernonia cinerea and Pluchea indica, four hirsutinolide-type sesquiterpene lactones 5-8 from V. cinerea, and acetylenic thiophenes 9-11 from P. indica that inhibited CYP2A6- and CYP2A13-mediated coumarin 7-hydroxylation. Flavonoids were most effective in inhibition against CYP2A6 and CYP2A13, followed by thiophenes, and hirsutinolides. Hirsutinolides and thiophenes exhibited mechanism-based inhibition and in irreversible mode against both enzymes. The inactivation kinetic K I values of hirsutinolides against CYP2A6 and CYP2A13 were 5.32-15.4 and 0.92-8.67 µM, respectively, while those of thiophenes were 0.11-1.01 and 0.67-0.97 µM, respectively.
Jimenez-Orozco, Carlos; Florez, Elizabeth; Moreno, Andres; ...
2016-12-06
A comprehensive study of acetylene adsorption on δ-MoC(001), TiC(001) and ZrC(001) surfaces was carried out by means of calculations based on periodic density functional theory, using the Perdew–Burke–Ernzerhof exchange–correlation functional. It was found that the bonding of acetylene was significantly affected by the electronic and structural properties of the carbide surfaces. The adsorbate interacted with metal and/or carbon sites of the carbide. The interaction of acetylene with the TiC(001) and ZrC(001) surfaces was strong (binding energies higher than $-$3.5 eV), while moderate acetylene adsorption energies were observed on δ-MoC(001) ($-$1.78 eV to –0.66 eV). Adsorption energies, charge density difference plotsmore » and Mulliken charges suggested that the binding of the hydrocarbon to the surface had both ionic and covalent contributions. According to the C–C bond lengths obtained, the adsorbed molecule was modified from acetylene-like into ethylene-like on the δ-MoC(001) surface (desired behavior for hydrogenation reactions) but into ethane-like on TiC(001) and ZrC(001). The obtained results suggest that the δ-MoC(001) surface is expected to have the best performance in selective hydrogenation reactions to convert alkynes into alkenes. Another advantage of δ-MoC(001) is that, after C 2H 2 adsorption, surface carbon sites remain available, which are necessary for H 2 dissociation. Furthermore, these sites were occupied when C 2H 2 was adsorbed on TiC(001) and ZrC(001), limiting their application in the hydrogenation of alkynes.« less
Swit_4259, an acetoacetate decarboxylase-like enzyme from Sphingomonas wittichii RW1
DOE Office of Scientific and Technical Information (OSTI.GOV)
Mydy, Lisa S.; Mashhadi, Zahra; Knight, T. William
The Gram-negative bacteriumSphingomonas wittichiiRW1 is notable for its ability to metabolize a variety of aromatic hydrocarbons. Not surprisingly, theS. wittichiigenome contains a number of putative aromatic hydrocarbon-degrading gene clusters. One of these includes an enzyme of unknown function, Swit_4259, which belongs to the acetoacetate decarboxylase-like superfamily (ADCSF). Here, it is reported that Swit_4259 is a small (28.8 kDa) tetrameric ADCSF enzyme that, unlike the prototypical members of the superfamily, does not have acetoacetate decarboxylase activity. Structural characterization shows that the tertiary structure of Swit_4259 is nearly identical to that of the true decarboxylases, but there are important differences in themore » fine structure of the Swit_4259 active site that lead to a divergence in function. In addition, it is shown that while it is a poor substrate, Swit_4259 can catalyze the hydration of 2-oxo-hex-3-enedioate to yield 2-oxo-4-hydroxyhexanedioate. It is also demonstrated that Swit_4259 has pyruvate aldolase-dehydratase activity, a feature that is common to all of the family V ADCSF enzymes studied to date. The enzymatic activity, together with the genomic context, suggests that Swit_4259 may be a hydratase with a role in the metabolism of an as-yet-unknown hydrocarbon. These data have implications for engineering bioremediation pathways to degrade specific pollutants, as well as structure–function relationships within the ADCSF in general.« less
NASA Astrophysics Data System (ADS)
Cremer, Dieter; Kraka, Elfi; Crehuet, Ramon; Anglada, Josep; Gräfenstein, Jürgen
2001-10-01
The ozone-acetylene reaction is found to proceed via an intermediate van der Waals complex (rather than a biradical), which is the precursor for a concerted symmetry-allowed [4+2] cycloaddition reaction leading to 1,2,3-trioxolene. CCSD(T)/6-311G+(2d, 2p) and CCSD(T)/CBS (complete basis set) calculations predict the ozone-acetylene van der Waals complex to be stable by 2.2 kcal mol -1, the calculated activation enthalpy for the cycloaddition reaction is 9.6 kcal mol -1 and the reaction enthalpy -55.5 kcal mol -1. Calculated kinetic data for the overall reaction ( k=0.8 l mol -1 s-1, A=1.71×10 6 l mol -1 s-1, E a=8.6 kcal mol -1) suggest that there is a need for refined kinetic measurements.
Enoyl-CoA hydratase mediates polyhydroxyalkanoate mobilization in Haloferax mediterranei
Liu, Guiming; Cai, Shuangfeng; Hou, Jing; Zhao, Dahe; Han, Jing; Zhou, Jian; Xiang, Hua
2016-01-01
Although polyhydroxyalkanoate (PHA) accumulation and mobilization are one of the most general mechanisms for haloarchaea to adapt to the hypersaline environments with changeable carbon sources, the PHA mobilization pathways are still not clear for any haloarchaea. In this study, the functions of five putative (R)-specific enoyl-CoA hydratases (R-ECHs) in Haloferax mediterranei, named PhaJ1 to PhaJ5, respectively, were thoroughly investigated. Through gene deletion and complementation, we demonstrated that only certain of these ECHs had a slight contribution to poly(3-hydroxybutyrate-co-3-hydroxyvalerate) (PHBV) biosynthesis. But significantly, PhaJ1, the only R-ECH that is associated with PHA granules, was shown to be involved in PHA mobilization in this haloarchaeon. PhaJ1 catalyzes the dehydration of (R)-3-hydroxyacyl-CoA, the common product of PHA degradation, to enoyl-CoA, the intermediate of the β-oxidation cycle, thus could link PHA mobilization to β-oxidation pathway in H. mediterranei. This linkage was further indicated from the up-regulation of the key genes of β-oxidation under the PHA mobilization condition, as well as the obvious inhibition of PHA degradation upon inhibition of the β-oxidation pathway. Interestingly, 96% of phaJ-containing haloarchaeal species possess both phaC (encoding PHA synthase) and the full set genes of β-oxidation, implying that the mobilization of carbon storage in PHA through the β-oxidation cycle would be general in haloarchaea. PMID:27052994
Enoyl-CoA hydratase mediates polyhydroxyalkanoate mobilization in Haloferax mediterranei.
Liu, Guiming; Cai, Shuangfeng; Hou, Jing; Zhao, Dahe; Han, Jing; Zhou, Jian; Xiang, Hua
2016-04-07
Although polyhydroxyalkanoate (PHA) accumulation and mobilization are one of the most general mechanisms for haloarchaea to adapt to the hypersaline environments with changeable carbon sources, the PHA mobilization pathways are still not clear for any haloarchaea. In this study, the functions of five putative (R)-specific enoyl-CoA hydratases (R-ECHs) in Haloferax mediterranei, named PhaJ1 to PhaJ5, respectively, were thoroughly investigated. Through gene deletion and complementation, we demonstrated that only certain of these ECHs had a slight contribution to poly(3-hydroxybutyrate-co-3-hydroxyvalerate) (PHBV) biosynthesis. But significantly, PhaJ1, the only R-ECH that is associated with PHA granules, was shown to be involved in PHA mobilization in this haloarchaeon. PhaJ1 catalyzes the dehydration of (R)-3-hydroxyacyl-CoA, the common product of PHA degradation, to enoyl-CoA, the intermediate of the β-oxidation cycle, thus could link PHA mobilization to β-oxidation pathway in H. mediterranei. This linkage was further indicated from the up-regulation of the key genes of β-oxidation under the PHA mobilization condition, as well as the obvious inhibition of PHA degradation upon inhibition of the β-oxidation pathway. Interestingly, 96% of phaJ-containing haloarchaeal species possess both phaC (encoding PHA synthase) and the full set genes of β-oxidation, implying that the mobilization of carbon storage in PHA through the β-oxidation cycle would be general in haloarchaea.
Soot Formation in Laminar Acetylene/Air Diffusion Flames at Atmospheric Pressure. Appendix C
NASA Technical Reports Server (NTRS)
Xu, F.; Faeth, G. M.; Urban, D. L. (Technical Monitor); Yuan, Z.-G. (Technical Monitor)
2000-01-01
The flame structure and soot-formation (soot nucleation and growth) properties of axisymmetric laminar coflowing jet diffusion flames were studied experimentally. Test conditions involved acetylene-nitrogen jets burning in coflowing air at atmospheric pressure. Measurements were limited to the axes of the flames and included soot concentrations, soot temperatures, soot structure, major gas species concentrations, radical species (H, OH, and O) concentrations, and gas velocities. The results show that as distance increases along the axes of the flames, detectable soot formation begins when significant H concentrations are present, and ends when acetylene concentrations become small. Species potentially associated with soot oxidation-O2, CO2, H2O, O, and OH-are present throughout the soot-formation region so that soot formation and oxidation proceed at the same time. Strong rates of soot growth compared to soot nucleation early in the soot-formation process, combined with increased rates of soot nucleation and oxidation as soot formation proceeds, causes primary soot particle diameters to reach a maximum relatively early in the soot-formation process. Aggregation of primary soot particles proceeds, however, until the final stages of soot oxidation. Present measurements of soot growth (corrected for soot oxidation) in laminar diffusion flames were consistent with earlier measurements of soot growth in laminar premixed flames and exhibited encouraging agreement with existing hydrogen-abstraction/carbon-addition (HACA) soot growth mechanisms in the literature that were developed based on measurements within laminar premixed flames. Measured primary soot particle nucleation rates in the present laminar diffusion flames also were consistent with corresponding rates measured in laminar premixed flames and yielded a crude correlation in terms of acetylene and H concentrations and the temperature.
Soot Formation in Laminar Acetylene/Air Diffusion Flames at Atmospheric Pressure. Appendix H
NASA Technical Reports Server (NTRS)
Xu, F.; Faeth, G. M.; Yuan, Z.-G. (Technical Monitor); Urban, D. L. (Technical Monitor); Yuan, Z.-G. (Technical Monitor)
2001-01-01
The flame structure and soot-formation (soot nucleation and growth) properties of axisymmetric laminar coflowing jet diffusion flames were studied experimentally. Test conditions involved acetylene-nitrogen jets burning in coflowing air at atmospheric pressure. Measurements were limited to the axes of the flames and included soot concentrations, soot temperatures, soot structure, major gas species concentrations, radical species (H, OH, and O) concentrations, and gas velocities. The results show that as distance increases along the axes of the flames, detectable soot formation begins when significant H concentrations are present, and ends when acetylene concentrations become small. Species potentially associated with soot oxidation-O2, CO2, H2O, O, and OH-are present throughout the soot-formation region so that soot formation and oxidation proceed at the same time. Strong rates of soot growth compared to soot nucleation early in the soot-formation process, combined with increased rates of soot nucleation and oxidation as soot formation proceeds, causes primary soot particle diameters to reach a maximum relatively early in the soot-formation process. Aggregation of primary soot particles proceeds, however, until the final stages of soot oxidation. Present measurements of soot growth (corrected for soot oxidation) in laminar diffusion flames were consistent with earlier measurements of soot growth in laminar premixed flames and exhibited encouraging agreement with existing hydrogen-abstraction/carbon-addition (HACA) soot growth mechanisms in the literature that were developed based on measurements within laminar premixed flames. Measured primary soot particle nucleation rates in the present laminar diffusion flames also were consistent with corresponding rates measured in laminar premixed flames and yielded a crude correlation in terms of acetylene and H concentrations and the temperature.
Soot Formation in Laminar Acetylene/Air Diffusion Flames at Atmospheric Pressure. Appendix J
NASA Technical Reports Server (NTRS)
Xu, F.; Faeth, G. M.; Urban, D. L. (Technical Monitor); Yuan, Z.-G. (Technical Monitor)
2001-01-01
The flame structure and soot-formation (soot nucleation and growth) properties of axisymmetric laminar coflowing jet diffusion flames were studied experimentally. Test conditions involved acetylene-nitrogen jets burning in coflowing air at atmospheric pressure. Measurements were limited to the axes of the flames and included soot concentrations, soot temperatures, soot structure, major gas species concentrations, radical species (H, OH, and O) concentrations, and gas velocities. The results show that as distance increases along the axes of the flames, detectable soot formation begins when significant H concentrations are present, and ends when acetylene concentrations become small. Species potentially associated with soot oxidation--O2, CO2, H2O, O, and OH-are present throughout the soot-formation region so that soot formation and oxidation proceed at the same time. Strong rates of soot growth compared to soot nucleation early in the soot-formation process, combined with increased rates of soot nucleation and oxidation as soot formation proceeds, causes primary soot particle diameters to reach a maximum relatively early in the soot-formation process. Aggregation of primary soot particles proceeds, however, until the final stages of soot oxidation. Present measurements of soot growth (corrected for soot oxidation) in laminar diffusion flames were consistent with earlier measurements of soot growth in laminar premixed flames and exhibited encouraging agreement with existing hydrogen-abstraction/carbon-addition (HACA) soot growth mechanisms in the literature that were developed based on measurements within laminar premixed flames. Measured primary soot particle nucleation rates in the present laminar diffusion flames also were consistent with corresponding rates measured in laminar premixed flames and yielded a crude correlation in terms of acetylene and H concentrations and the temperature.
Popov, S S; Pashkov, A N; Popova, T N; Zoloedov, V I; Semenikhina, A V; Rakhmanova, T I
2007-08-01
Biochemiluminescence increased, while aconitate hydratase activity and citrate accumulation in tissues of the liver and heart and blood decreased in rats with experimental hyperthyroidism. These changes reflect activation of free radical oxidation, damage to enzyme molecules with reactive oxygen species, and impaired utilization of citrate under pathological conditions. Melatonin treatment during hyperthyroidism normalized aconitate hydratase activity and citrate concentration. Biochemiluminescence study showed that the effect of melatonin is related to antioxidant activity of this hormone, inhibition of free radical oxidation, and suppression of reactive oxygen species generation.
The Synthesis and Isothermal Aging Behavior of Oxygen-Free Acetylene Terminated Quinoxalines
1981-05-01
Sabourin (Reference 10), to the acetylene-terminated quinoxalines which were purified by chromatog- raphy on silica gel. Overall yields, Tg values, onset and...10. E. J. Sabourin , ACS Petroleum Chem. Prep., 24 (1), 233 (1979). 8 AFWAL-TR-81-4004 KEY TO FIGURES 1, 2 AND 3 HCrCC 0 0= 0 W r0 CECH 0 0 N ý IN HCC-N
The 96-h LC50 values for 16 acetylenic alcohols in the fathead minnow (Pimephales promelas) were determined using continuous-flow diluters. The measured LC50 values for seven tertiary propargylic alcohols agreed closely with the QSAR predictions based upon data for other organic ...
NASA Technical Reports Server (NTRS)
Stiegman, A. E.; Graham, Eva; Khundkar, Lutfur R.; Perry, Joseph W.; Cheng, L.-T.; Perry, Kelly J.
1991-01-01
A series of donor-acceptor acetylene compounds was synthesized in which systematic changes in both the conjugation length and the donor-acceptor strength were made. The effect of these structural changes on the spectroscopic and electronic properties of the molecules and, ultimately, on the measured second-order molecular hyperpolarizabilities (beta) was investigated. It was found that increases in the donor-acceptor strength resulted in increases in the magnitude of beta. For this class of molecules, the increase is dominated by the energy of the intramolecular charge-transfer transition, while factors such as the ground to excited-state dipole moment change and the transition-moment integral are much less important. Increasing the conjugation length from one to two acetylene linkers did not result in an increase in the value of beta; however, beta increased sharply in going from two acetylenes to three. This increase is attributed to the superposition of several nearly isoenergetic excited states.
Conformational polymorphs of a novel TCNQ derivative carrying an acetylene group
NASA Astrophysics Data System (ADS)
Iida, Yuki; Kataoka, Makoto; Okuno, Tsunehisa
2018-01-01
TCNQ is one of the most important organic acceptors and lots of its derivatives have been prepared. However the reports on their crystal polymorphs are limited to their complexes, and simple polymorphs of TCNQ derivatives are uncommon. We succeeded in preparation of a novel TCNQ derivative, 2,2'-(2-(prop-2-yn-1-yloxy)cyclohexa-2,5-diene-1,4-diylidene)dimalononitrile, having a propynyloxy group on a substituent. This compound was found to have two crystal polymorphs depending on a solvent for recrystallization. In polymorph I, dimeric hydrogen bonds are formed between acetylenic hydrogens and cyano nitrogens with the molecule in an inversion symmetry. While, in polymorph II, the molecules make intermolecular hydrogen bonds between acetylenic hydrogens and cyano nitrogens with the molecule in 21 symmetry, forming a hydrogen bonded molecular helix along the b axis. Besides patterns of the intermolecular hydrogen bonds, difference was recognized in conformation of propynyloxy group. The molecule has an anti conformation in polymorph I and a gauche conformation in polymorph II. DFT calculation indicates that the anti conformer is less stable than the gauche one. But a solvation model suggests the anti conformer is estimated to be more stable in a toluene solution.
Taple-top imaging of the non-adiabatically driven isomerization in the acetylene cation
NASA Astrophysics Data System (ADS)
Beaulieu, Samuel; Ibrahim, Heide; Wales, Benji; Schmidt, Bruno E.; Thiré, Nicolas; Bisson, Éric; Hebeisen, Christoph T.; Wanie, Vincent; Giguere, Mathieu; Kieffer, Jean-Claude; Sanderson, Joe; Schuurman, Michael S.; Légaré, François
2014-05-01
One of the primary goals of modern ultrafast science is to follow nuclear and electronic evolution of molecules as they undergo a photo-chemical reaction. Most of the interesting dynamics phenomena in molecules occur when an electronically excited state is populated. When the energy difference between electronic ground and excited states is large, Free Electron Laser (FEL) and HHG-based VUV sources were, up to date, the only light sources able to efficiently initiate those non-adiabatic dynamics. We have developed a simple table-top approach to initiate those rich dynamics via multiphoton absorption. As a proof of principle, we studied the ultrafast isomerization of the acetylene cation. We have chosen this model system for isomerization since the internal conversion mechanism which leads to proton migration is still under debate since decades. Using 266 nm multiphoton absorption as a pump and 800 nm induced Coulomb Explosion as a probe, we have shoot the first high-resolution molecular movie of the non-adiabatically driven proton migration in the acetylene cation. The experimental results are in excellent agreement with high level ab initio trajectory simulations.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Fowler, J.S.
A two-step reaction process is reported for the synthesis of /sup 11/C, /sup 13/C, or /sup 14/C-labelled propargylamines in moderate yields. The propargylamines were prepared by a modified Mannich scheme without the use of acetylene. The reaction scheme involved the use of 2-methyl-3-butyn-2-ol followed by KOH-catalyzed elimination of acetone from the acetylenic carbinols. (BLM)
Methane emissions measured at two California landfills by OTM-10 and an acetylene tracer method
Methane emissions were measured at two municipal solid waste landfills in California using static flux chambers, an optical remote sensing approach known as vertical radial plume mapping (VRPM) using a tunable diode laser (TDL) and a novel acetylene tracer method. The tracer meth...
Interpenetrating polymer networks from acetylene terminated materials
NASA Technical Reports Server (NTRS)
Connell, J. W.; Hergenrother, P. M.
1989-01-01
As part of a program to develop high temperature/high performance structural resins for aerospace applications, the chemistry and properties of a novel class of interpenetrating polymer networks (IPNs) were investigated. These IPNs consist of a simple diacetylenic compound (aspartimide) blended with an acetylene terminated arylene ether oligomer. Various compositional blends were prepared and thermally cured to evaluate the effect of crosslink density on resin properties. The cured IPNs exhibited glass transition temperatures ranging from 197 to 254 C depending upon the composition and cure temperature. The solvent resistance, fracture toughness and coefficient of thermal expansion of the cured blends were related to the crosslink density. Isothermal aging of neat resin moldings, adhesive and composite specimens showed a postcure effect which resulted in improved elevated temperature properties. The chemistry, physical and mechanical properties of these materials will be discussed.
USDA-ARS?s Scientific Manuscript database
6-Nonadecynoic acid (6-NDA), a plant-derived acetylenic acid, exhibits strong inhibitory activity against the human fungal pathogens Candida albicans, Aspergillus fumigatus, and Trichophyton mentagrophytes. In the present study, transcriptional profiling coupled with mutant and biochemical analyses...
DOE Office of Scientific and Technical Information (OSTI.GOV)
Gan, L.S.
A series of aryl acetylenes and aryl olefins have been examined as substrates and inhibitors of cytochrome P-450 dependent monooxygenases in liver microsomes from 5,6-benzoflavone or phenobarbital pretreated rats. 1-Ethynylpyrene (EP), 3-ethynylperylene (EPL), cis- and trans-1-(2-bromo-vinyl)pyrene (c-BVP and t-BVP), and 1-allylpyrene (AP) serve as mechanism-based irreversible inactivators (suicide inhibitors) of benzo(a)pyrene (BP) hydroxylase, while 1-vinyl-pyrene (VP) and phenyl 1-pyrenyl acetylene (PPA) do not cause a detectable suicide inhibition of the BP hydroxylase. The mechanism-based loss of BP hydroxylase activity caused by the aryl acetylenes is not accompanied by a corresponding loss of the P-450 content of the microsomes. In themore » presence of NADPH, /sup 3/H-labeled EP covalently attached to P-450 isozymes with a measured stoichiometry of one mole of EP per mole of the P-450 heme. The results of the effects of these aryl derivatives in the mammalian cell-mediated mutagenesis assay and toxicity assay show that none of the compounds examined nor any of the their metabolites produced in the incubation system are cytotoxic to V79 cells.« less
Excited-state dynamics of acetylene excited to individual rotational level of the V04K01 subband
NASA Astrophysics Data System (ADS)
Makarov, Vladimir I.; Kochubei, Sergei A.; Khmelinskii, Igor V.
2006-01-01
Dynamics of the IR emission induced by excitation of the acetylene molecule using the (32Ka0,1,2,ÃAu1←41la1,X˜Σg+1) transition was investigated. The observed IR emission was assigned to transitions between the ground-state vibrational levels. Acetylene fluorescence quenching induced by external electric and magnetic fields acting upon the system prepared using the (34Ka1,ÃAu1←00la0,X˜Σg+1) excitation was also studied. External electric field creates an additional radiationless pathway to the ground-state levels, coupling levels of the ÃAu1 excited state to the quasiresonant levels of the X˜Σg+1 ground state. The level density of the ground state in the vicinity of the excited state is very high, thus the electric-field-induced transition is irreversible, with the rate constant described by the Fermi rule. Magnetic field alters the decay profile without changing the fluorescence quantum yield in collisionless conditions. IR emission from the CCH transient was detected, and was also affected by the external electric and magnetic fields. Acetylene predissociation was demonstrated to proceed by the direct S1→S0 mechanism. The results were explained using the previously developed theoretical approach, yielding values of the relevant model parameters.
Gao, Detian; Back, Thomas G
2012-11-12
A versatile new synthesis of indoles was achieved by the conjugate addition of N-formyl-2-haloanilines to acetylenic sulfones, ketones, and esters followed by a copper-catalyzed intramolecular C-arylation. The conjugate addition step was conducted under exceptionally mild conditions at room temperature in basic, aqueous DMF. Surprisingly, the C-arylation was performed most effectively by employing copper(II) acetate as the catalyst in the absence of external ligands, without the need for protection from air or water. An unusual feature of this process, for the case of acetylenic ketones, is the ability of the initial conjugate-addition product to serve as a ligand for the catalyst, which enables it to participate in the catalysis of its further transformation to the final indole product. Mechanistic studies, including EPR experiments, indicated that copper(II) is reduced to the active copper(I) species by the formate ion that is produced by the base-catalyzed hydrolysis of DMF. This process also served to recycle any copper(II) that was produced by the adventitious oxidation of copper(I), thereby preventing deactivation of the catalyst. Several examples of reactions involving acetylenic sulfones attached to a modified Merrifield resin demonstrated the feasibility of solid-phase synthesis of indoles by using this protocol, and tricyclic products were obtained in one pot by employing acetylenic sulfones that contain chloroalkyl substituents. Copyright © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Acetylene fuel from atmospheric CO2 on Mars
NASA Technical Reports Server (NTRS)
Landis, Geoffrey A.; Linne, Diane L.
1992-01-01
The Mars mission scenario proposed by Baker and Zubrin (1990) intended for an unmanned preliminary mission is extended to maximize the total impulse of fuel produced with a minimum mass of hydrogen from Earth. The hydrogen along with atmospheric carbon dioxide is processed into methane and oxygen by the exothermic reaction in an atmospheric processing module. Use of simple chemical reactions to produce acetylene/oxygen rocket fuel on Mars from hydrogen makes it possible to produce an amount of fuel that is nearly 100 times the mass of hydrogen brought from earth. If such a process produces the return propellant for a manned Mars mission, the required mission mass in LEO is significantly reduced over a system using all earth-derived propellants.
Taskinen, Jukka P; Kiema, Tiila R; Hiltunen, J Kalervo; Wierenga, Rik K
2006-01-27
The 1.9 A structure of the C-terminal dehydrogenase part of the rat peroxisomal monomeric multifunctional enzyme type 1 (MFE-1) has been determined. In this construct (residues 260-722 and referred to as MFE1-DH) the N-terminal hydratase part of MFE-1 has been deleted. The structure of MFE1-DH shows that it consists of an N-terminal helix, followed by a Rossmann-fold domain (domain C), followed by two tightly associated helical domains (domains D and E), which have similar topology. The structure of MFE1-DH is compared with the two known homologous structures: human mitochondrial 3-hydroxyacyl-CoA dehydrogenase (HAD; sequence identity is 33%) (which is dimeric and monofunctional) and with the dimeric multifunctional alpha-chain (alphaFOM; sequence identity is 28%) of the bacterial fatty acid beta-oxidation alpha2beta2-multienzyme complex. Like MFE-1, alphaFOM has an N-terminal hydratase part and a C-terminal dehydrogenase part, and the structure comparisons show that the N-terminal helix of MFE1-DH corresponds to the alphaFOM linker helix, located between its hydratase and dehydrogenase part. It is also shown that this helix corresponds to the C-terminal helix-10 of the hydratase/isomerase superfamily, suggesting that functionally it belongs to the N-terminal hydratase part of MFE-1.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wang, H.; Frenklach, M.
1997-07-01
A computational study was performed for the formation and growth of polycyclic aromatic hydrocarbons (PAHs) in laminar premixed acetylene and ethylene flames. A new detailed reaction mechanism describing fuel pyrolysis and oxidation, benzene formation, and PAH mass growth and oxidation is presented and critically tested. It is shown that the reaction model predicts reasonably well the concentration profiles of major and intermediate species and aromatic molecules in a number of acetylene and ethylene flames reported in the literature. It is demonstrated that reactions of n-C{sub 4}H{sub x} + C{sub 2}H{sub 2} leading to the formation of one-ring aromatics are asmore » important as the propargyl recombination, and hence must be included in kinetic modeling of PAH formation in hydrocarbon flames. It is further demonstrated that the mass growth of PAHs can be accounted for by the previously proposed H-abstraction-C{sub 2}H{sub 2}-addiction mechanism.« less
Lee, Jaechul; Chuah, Chong Yang; Kim, Jaheon; Kim, Youngsuk; Ko, Nakeun; Seo, Younggyu; Kim, Kimoon; Bae, Tae Hyun; Lee, Eunsung
2018-04-24
Separation of acetylene from carbon dioxide and ethylene is challenging in view of their similar sizes and physical properties. Metal-organic frameworks (MOFs) in general are strong candidates for these separations owing to the presence of functional pore surfaces that can selectively capture a specific target molecule. Here, we report a novel 3D microporous cationic framework named JCM-1. This structure possesses imidazolium functional groups on the pore surfaces and pyrazolate as a metal binding group, which is well known to form strong metal-to-ligand bonds. The selective sorption of acetylene over carbon dioxide and ethylene in JCM-1 was successfully demonstrated by equilibrium gas adsorption analysis as well as dynamic breakthrough measurement. Furthermore, its excellent hydrolytic stability makes the separation processes highly recyclable without a substantial loss in acetylene uptake capacity. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Aromatic ring generation as a dust precursor in acetylene discharges
NASA Astrophysics Data System (ADS)
De Bleecker, Kathleen; Bogaerts, Annemie; Goedheer, Wim
2006-04-01
Production of aromatic hydrocarbon compounds as an intermediate step for particle formation in low-pressure acetylene discharges is investigated via a kinetic approach. The detailed chemical reaction mechanism contains 140 reactions among 55 species. The cyclic hydrocarbon chemistry is mainly based on studies of polycyclic aromatic hydrocarbon formation in cosmic environments. The model explicitly includes organic chain, cyclic molecules, radicals, and ions up to a size of 12 carbon atoms. The calculated density profiles show that the aromatic formation yields are quite significant, suggesting that aromatic compounds play a role in the underlying mechanisms of particle formation in hydrocarbon plasmas.
Srivastava, Anmesh Kumar; Soni, Shyam Lal; Sharma, Dilip; Jain, Narayan Lal
2018-03-01
In this paper, the effect of injection pressure on the performance, emission, and combustion characteristics of a diesel-acetylene fuelled single cylinder, four-stroke, direct injection (DI) diesel engine with a rated power of 3.5 kW at a rated speed of 1500 rpm was studied. Experiments were performed in dual-fuel mode at four different injection pressures of 180, 190, 200, and 210 bar with a flow rate of 120 LPH of acetylene and results were compared with that of baseline diesel operation. Experimental results showed that highest brake thermal efficiency of 27.57% was achieved at injection pressure of 200 bar for diesel-acetylene dual-fuel mode which was much higher than 23.32% obtained for baseline diesel. Carbon monoxide, hydrocarbon, and smoke emissions were also measured and found to be lower, while the NO x emissions were higher at 200 bar in dual fuel mode as compared to those in other injection pressures in dual fuel mode and also for baseline diesel mode. Peak cylinder pressure, net heat release rate, and rate of pressure rise were also calculated and were higher at 200 bar injection pressure in dual fuel mode.
Quintella, Cristina M; Meira, Marilena; Silva, Weidson Leal; Filho, Rogério G D; Araújo, André L C; Júnior, Elias T S; Sales, Lindolfo J O
2013-12-15
Power transformers are essential for a functioning electrical system and therefore require special attention by maintenance programs because a fault can harm both the company and society. The temperature inside a power transformer and the dissolved gases, which are primarily composed of acetylene, are the two main parameters monitored when detecting faults. This paper describes the development of a device for analyzing the acetylene content in insulating oil using spectrofluorimetry. Using this device introduces a new methodology for the maintaining and operating power transformers. The prototype is currently operating in a substation. The results presented by this system were satisfactory; when compared to chromatographic data, the errors did not exceed 15%. This prototype may be used to confirm the quality of an insulating oil sample to detect faults in power transformers. © 2013 Elsevier B.V. All rights reserved.
NASA Astrophysics Data System (ADS)
Chao, Songlin; Zou, Fang; Wan, Fanfan; Dong, Xiaobin; Wang, Yanlin; Wang, Yuxuan; Guan, Qingxin; Wang, Guichang; Li, Wei
2017-01-01
Acetylene hydrochlorination is a major industrial technology for manufacturing vinyl chloride monomer in regions with abundant coal resources; however, it is plagued by the use of mercury(II) chloride catalyst. The development of a nonmercury catalyst has been extensively explored. Herein, we report a N-doped carbon catalyst derived from ZIF-8 with both high activity and quite good stability. The acetylene conversion reached 92% and decreased slightly during a 200 h test at 220 °C and atmospheric pressure. Experimental studies and theoretical calculations indicate that C atoms adjacent to the pyridinic N are the active sites, and coke deposition covering pyridinic N is the main reason for catalyst deactivation. The performance of those N-doped carbons makes it possible for practical applications with further effort. Furthermore, the result also provides guidance for designing metal-free catalysts for similar reactions.
NASA Astrophysics Data System (ADS)
Sinclair, J. A.; Irwin, P. G. J.; Fletcher, L. N.; Moses, J. I.; Greathouse, T. K.; Friedson, A. J.; Hesman, B.; Hurley, J.; Merlet, C.
2013-07-01
Acetylene (C2H2) and ethane (C2H6) are by-products of complex photochemistry in the stratosphere of Saturn. Both hydrocarbons are important to the thermal balance of Saturn's stratosphere and serve as tracers of vertical motion in the lower stratosphere. Earlier studies of Saturn's hydrocarbons using Cassini-CIRS observations have provided only a snapshot of their behaviour. Following the vernal equinox in August 2009, Saturn's northern and southern hemispheres have entered spring and autumn, respectively, however the response of Saturn's hydrocarbons to this seasonal shift remains to be determined. In this paper, we investigate how the thermal structure and concentrations of acetylene and ethane have evolved with the changing season on Saturn. We retrieve the vertical temperature profiles and acetylene and ethane volume mixing ratios from Δν˜=15.5cm-1 Cassini-CIRS observations. In comparing 2005 (solar longitude, Ls ˜ 308°), 2009 (Ls ˜ 3°) and 2010 (Ls ˜ 15°) results, we observe the disappearance of Saturn's warm southern polar hood with cooling of up to 17.1 K ± 0.8 K at 1.1 mbar at high-southern latitudes. Comparison of the derived temperature trend in this region with a radiative climate model (Section 4 of Fletcher et al., 2010 and Greathouse et al. (2013, in preparation)) indicates that this cooling is radiative although dynamical changes in this region cannot be ruled out. We observe a 21 ± 12% enrichment of acetylene and a 29 ± 11% enrichment of ethane at 25°N from 2005 to 2009, suggesting downwelling at this latitude. At 15°S, both acetylene and ethane exhibit a decrease in concentration of 6 ± 11% and 17 ± 9% from 2005 to 2010, respectively, which suggests upwelling at this latitude (though a statistically significant change is only exhibited by ethane). These implied vertical motions at 15°S and 25°N are consistent with a recently-developed global circulation model of Saturn's tropopause and stratosphere(Friedson and Moses, 2012), which
NASA Astrophysics Data System (ADS)
Brestkin, A. P.; Vikhreva, L. A.; Godovikov, Nikolai N.; Zhukovskii, Yu G.; Kabachnik, Martin I.; Moralev, S. N.; Rosengart, V. I.; Sherstobitov, O. E.
1991-08-01
Data are given in the review on the anticholinesterase activity of 58 specially synthesised esters of phosphorus thioacids containing an acetylenic bond in the thioester group. It was established that compounds containing an acetylenic group in the β and especially in the α position of the thioester residue display an inhibitory action many times greater than that of their saturated analogues. A phosphorylated enzyme is formed by the reaction of the acetylenic organophosphorus inhibitors (OPIs) with the enzymes as in the case of reaction with the saturated analogues. It was shown that the acetylenic organophosphorus inhibitors possess high biological activity both for mammals and for arthropods. On replacing the phosphoryl oxygen (P=O) by sulphur (P=S) the toxicity of the acetylenic organophosphorus inhibitors for mammals was sharply reduced but was little changed for arthropods. This raises the possibility of obtaining highly selective insecto-acaricides. The mechanism of the antienzymic action of the acetylenic OPIs and the mechanism of detoxication of diethyl S-hexynyl dithiophosphate are considered. The bibliography includes 44 references.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wang, Jian -Tao; Chen, Changfeng; Li, Han -Dong
Here, we here identify by ab initio calculations a new type of three-dimensional (3D) carbon allotropes that consist of phenyl rings connected by linear acetylenic chains in sp+ sp 2 bonding networks. These structures are constructed by inserting acetylenic or diacetylenic bonds into an all sp 2-hybridized rhombohedral polybenzene lattice, and the resulting 3D phenylacetylene and phenyldiacetylene nets comprise a 12-atom and 18-atom rhombohedral primitive unit cells R - 3m symmetry, which are characterized as the 3D chiral crystalline modification of 2D graphyne and graphdiyne, respectively. Simulated phonon spectra reveal that these structures are dynamically stable. Electronic band calculations indicatemore » that phenylacetylene is metallic, while phenyldiacetylene is a semiconductor with an indirect band gap of 0.58 eV. The present results establish a new type of carbon phases and offer insights into their outstanding structural and electronic properties.« less
Wang, Jian -Tao; Chen, Changfeng; Li, Han -Dong; ...
2016-04-18
Here, we here identify by ab initio calculations a new type of three-dimensional (3D) carbon allotropes that consist of phenyl rings connected by linear acetylenic chains in sp+ sp 2 bonding networks. These structures are constructed by inserting acetylenic or diacetylenic bonds into an all sp 2-hybridized rhombohedral polybenzene lattice, and the resulting 3D phenylacetylene and phenyldiacetylene nets comprise a 12-atom and 18-atom rhombohedral primitive unit cells R - 3m symmetry, which are characterized as the 3D chiral crystalline modification of 2D graphyne and graphdiyne, respectively. Simulated phonon spectra reveal that these structures are dynamically stable. Electronic band calculations indicatemore » that phenylacetylene is metallic, while phenyldiacetylene is a semiconductor with an indirect band gap of 0.58 eV. The present results establish a new type of carbon phases and offer insights into their outstanding structural and electronic properties.« less
Identification of non-heme diiron proteins that catalyze triple bond and epoxy group formation.
Lee, M; Lenman, M; Banaś, A; Bafor, M; Singh, S; Schweizer, M; Nilsson, R; Liljenberg, C; Dahlqvist, A; Gummeson, P O; Sjödahl, S; Green, A; Stymne, S
1998-05-08
Acetylenic bonds are present in more than 600 naturally occurring compounds. Plant enzymes that catalyze the formation of the Delta12 acetylenic bond in 9-octadecen-12-ynoic acid and the Delta12 epoxy group in 12,13-epoxy-9-octadecenoic acid were characterized, and two genes, similar in sequence, were cloned. When these complementary DNAs were expressed in Arabidopsis thaliana, the content of acetylenic or epoxidated fatty acids in the seeds increased from 0 to 25 or 15 percent, respectively. Both enzymes have characteristics similar to the membrane proteins containing non-heme iron that have histidine-rich motifs.
Transient quantum coherent effects in the acetylene-filled hollow-core photonic crystal fiber
NASA Astrophysics Data System (ADS)
Stepanov, S.; Rodríguez Casillas, N.; Ocegueda Miramontes, M.; Hernández Hernández, E.
2017-02-01
Low-pressure acetylene in the hollow-core photonic crystal structure fibers is an excellent medium for the room-temperature investigation of the coherent quantum effects in communication wavelength region. Pulsed excitation enables observation of new coherent phenomena like optical nutation or photon echo and evaluation of important temporal characteristics of the light-molecule interactions. We also report original experimental results on the pulsed excitation of the electromagnetically induced transparency in co- and counter-propagation configurations.
Adhesive and composite evaluation of acetylene-terminated phenylquinoxaline resins
NASA Technical Reports Server (NTRS)
Hergenrother, P. M.
1981-01-01
A series of acetylene-terminated phenylquinoxaline (ATPQ) oligomers of various molecular weights were prepared and subsequently chain extended by the thermally induced reaction of the ethynyl groups. The processability and thermal properties of these oligomers and their cured resins were compared with that of a relatively high molecular weight linear polyphenylquinoxaline (PPQ) with the same chemical backbone. The ATPQ oligomers exhibited significantly better processability than the linear PPQ but the PPQ displayed substantially better thermooxidative stability. Adhesive (Ti/Ti) and composite (graphite filament reinforcement) work was performed to evaluate the potential of these materials for structural applications. The PPQ exhibited better retention of adhesive and laminate properties than the ATPQ resins at 260 C after aging for 500 hr at 260 C in circulating air.
Highly oxygenated bisabolenes and an acetylene from Matricaria aurea.
Ahmed, A A; Abou Elela, M
1999-06-01
Reinvestigation of the aerial parts of Matricaria aurea led to the isolation of three new bisabolenes and a new acetylene. The structures of the four compounds, namely (1R*,2R*,3R*,6R*,7R*)1,2,3,6,7- pentahydroxy-bisabol-10(11)-ene, (1R*,2R*,3R*,6R*,7R*)1,2,3,6,7-pentahydroxy-1-acetoxy-bisabol-10(1 1)-ene, (1R*,2R*,3R*,6R*,7R*)1,2,3,6,7-pentahydroxy-2-acetoxy-bisabol-10(1 1)-ene and (3S*,4S*,5R*)-(E)-3,4-dihydroxy-2-(hexa-2,4-diynyliden)-1,6- dioxaspiro-(4,5)decane, were deduced from the high field NMR studies.
NASA Astrophysics Data System (ADS)
Weerasinghe, H. W. Kushan; Dadashzadeh, Neda; Thirugnanasambandam, Manasadevi P.; Debord, Benoît.; Chafer, Matthieu; Gérôme, Frédéric; Benabid, Fetah; Corwin, Kristan L.; Washburn, Brian R.
2018-02-01
The effect of gas pressure, fiber length, and optical pump power on an acetylene mid-infrared hollow-core optical fiber gas laser (HOFGLAS) is experimentally determined in order to scale the laser to higher powers. The absorbed optical power and threshold power are measured for different pressures providing an optimum pressure for a given fiber length. We observe a linear dependence of both absorbed pump energy and lasing threshold for the acetylene HOFGLAS, while maintaining a good mode quality with an M-squared of 1.15. The threshold and mode behavior are encouraging for scaling to higher pressures and pump powers.
An Empirical Spectroscopic Database for Acetylene in the Regions of 5850-9415 CM^{-1}
NASA Astrophysics Data System (ADS)
Campargue, Alain; Lyulin, Oleg
2017-06-01
Six studies have been recently devoted to a systematic analysis of the high-resolution near infrared absorption spectrum of acetylene recorded by Cavity Ring Down spectroscopy (CRDS) in Grenoble and by Fourier-transform spectroscopy (FTS) in Brussels and Hefei. On the basis of these works, in the present contribution, we construct an empirical database for acetylene in the 5850 - 9415 \\wn region excluding the 6341-7000 \\wn interval corresponding to the very strong νb{1}+ νb{3} manifold. The database gathers and extends information included in our CRDS and FTS studies. In particular, the intensities of about 1700 lines measured by CRDS in the 7244-7920 \\wn are reported for the first time together with those of several bands of ^{12}C^{13}CH_{2} present in natural isotopic abundance in the acetylene sample. The Herman-Wallis coefficients of most of the bands are derived from a fit of the measured intensity values. A recommended line list is provided with positions calculated using empirical spectroscopic parameters of the lower and upper energy vibrational levels and intensities calculated using the derived Herman-Wallis coefficients. This approach allows completing the experimental list by adding missing lines and improving poorly determined positions and intensities. As a result the constructed line list includes a total of 10973 lines belonging to 146 bands of ^{12}C_{2}H_{2} and 29 bands of ^{12}C^{13}CH_{2}. For comparison the HITRAN2012 database in the same region includes 869 lines of 14 bands, all belonging to ^{12}C_{2}H_{2}. Our weakest lines have an intensity on the order of 10^{-29} cm/molecule,about three orders of magnitude smaller than the HITRAN intensity cut off. Line profile parameters are added to the line list which is provided in HITRAN format. The comparison to the HITRAN2012 line list or to results obtained using the global effective operator approach is discussed in terms of completeness and accuracy.
NASA Astrophysics Data System (ADS)
Lyulin, O. M.; Campargue, A.
2017-12-01
Six studies have been recently devoted to a systematic analysis of the high-resolution near infrared absorption spectrum of acetylene recorded by Cavity Ring Down spectroscopy (CRDS) in Grenoble and by Fourier-transform spectroscopy (FTS) in Brussels and Hefei. On the basis of these works, in the present contribution, we construct an empirical database for acetylene in the 5850-9415 cm-1 region excluding the 6341-7000 cm-1 interval corresponding to the very strong ν1+ν3 manifold. Our database gathers and extends information included in our CRDS and FTS studies. In particular, the intensities of about 1700 lines measured by CRDS in the 7244-7920 cm-1 region are reported for the first time together with those of several bands of 12C13CH2 present in natural isotopic abundance in the acetylene sample. The Herman-Wallis coefficients of most of the bands are derived from a fit of the measured intensity values. A recommended line list is provided with positions calculated using empirical spectroscopic parameters of the lower and upper energy vibrational levels and intensities calculated using the derived Herman-Wallis coefficients. This approach allows completing the experimental list by adding missing lines and improving poorly determined positions and intensities. As a result the constructed line list includes a total of 11113 transitions belonging to 150 bands of 12C2H2 and 29 bands of 12C13CH2. For comparison the HITRAN database in the same region includes 869 transitions of 14 bands, all belonging to 12C2H2. Our weakest lines have an intensity on the order of 10-29 cm/molecule, about three orders of magnitude smaller than the HITRAN intensity cut off. Line profile parameters are added to the line list which is provided in HITRAN format. The comparison of the acetylene database to the HITRAN2012 line list or to results obtained using the global effective operator approach is discussed in terms of completeness and accuracy.
Characterization of two Streptomyces enzymes that convert ferulic acid to vanillin.
Yang, Wenwen; Tang, Hongzhi; Ni, Jun; Wu, Qiulin; Hua, Dongliang; Tao, Fei; Xu, Ping
2013-01-01
Production of flavors from natural substrates by microbial transformation has become a growing and expanding field of study over the past decades. Vanillin, a major component of vanilla flavor, is a principal flavoring compound used worldwide. Streptomyces sp. strain V-1 is known to be one of the most promising microbial producers of natural vanillin from ferulic acid. Although identification of the microbial genes involved in the biotransformation of ferulic acid to vanillin has been previously reported, purification and detailed characterization of the corresponding enzymes with important functions have rarely been studied. In this study, we isolated and identified 2 critical genes, fcs and ech, encoding feruloyl-CoA synthetase and enoyl-CoA hydratase/aldolase, respectively, which are involved in the vanillin production from ferulic acid. Both genes were heterologously expressed in Escherichia coli, and the resting cell reactions for converting ferulic acid to vanillin were performed. The corresponding crucial enzymes, Fcs and Ech, were purified for the first time and the enzymatic activity of each purified protein was studied. Furthermore, Fcs was comprehensively characterized, at an optimal pH of 7.0 and temperature of 30°C. Kinetic constants for Fcs revealed the apparent Km, kcat, and Vmax values to be 0.35 mM, 67.7 s(-1), and 78.2 U mg(-1), respectively. The catalytic efficiency (kcat/Km) value of Fcs was 193.4 mM(-1) s(-1) for ferulic acid. The characterization of Fcs and Ech may be helpful for further research in the field of enzymatic engineering and metabolic regulation.
Dubinin-Astakhov model for acetylene adsorption on metal-organic frameworks
NASA Astrophysics Data System (ADS)
Cheng, Peifu; Hu, Yun Hang
2016-07-01
Acetylene (C2H2) is explosive at a pressure above 29 psi, causing a safety issue for its storage and applications. C2H2 adsorption on metal-organic frameworks (MOFs) has been explored to solve the issue. However, a suitable isotherm equation for C2H2 adsorption on various MOFs has not been found. In this paper, it was demonstrated that Dubinin-Astakhov equation can be exploited as a general isotherm model to depict C2H2 adsorption on MOF-5, ZIF-8, HKUST-1, and MIL-53. In contrast, commonly used Langmuir and BET models exhibited their inapplicability for C2H2 adsorption on those MOFs.
Haataja, Tatu J K; Koski, M Kristian; Hiltunen, J Kalervo; Glumoff, Tuomo
2011-05-01
All of the peroxisomal β-oxidation pathways characterized thus far house at least one MFE (multifunctional enzyme) catalysing two out of four reactions of the spiral. MFE type 2 proteins from various species display great variation in domain composition and predicted substrate preference. The gene CG3415 encodes for Drosophila melanogaster MFE-2 (DmMFE-2), complements the Saccharomyces cerevisiae MFE-2 deletion strain, and the recombinant protein displays both MFE-2 enzymatic activities in vitro. The resolved crystal structure is the first one for a full-length MFE-2 revealing the assembly of domains, and the data can also be transferred to structure-function studies for other MFE-2 proteins. The structure explains the necessity of dimerization. The lack of substrate channelling is proposed based on both the structural features, as well as by the fact that hydration and dehydrogenation activities of MFE-2, if produced as separate enzymes, are equally efficient in catalysis as the full-length MFE-2.
NASA Astrophysics Data System (ADS)
Malla, Pavani
Ethylene is used as a starting point for many chemical intermediates in the petrochemical industry. It is predominantly produced through steam cracking of higher hydrocarbons (ethane, propane, butane, naphtha, and gas oil). During the cracking process, a small amount of acetylene is produced as a side product. However, acetylene must be removed since it acts as a poison for ethylene polymerization catalysts at even ppm concentrations (>5 ppm). Thus, the selective hydrogenation of acetylene to ethylene is an important process for the purification of ethylene. Conventional, low weight loading Pd catalysts are used for this selective reaction in high concentration ethylene streams. Gold was initially considered to be catalytically inactive for a long time. This changed when gold was seen in the context of the nanometric scale, which has indeed shown it to have excellent catalytic activity as a homogeneous or a heterogeneous catalyst. Gold is proved to have high selectivity to ethylene but poor at conversion. Bimetallic Au and Pd catalysts have exhibited superior activity as compared to Pd particles in semi-hydrogenation. Hydrogenation of acetylene was tested using this bimetallic combination. The Pd-on-Au bimetallic catalyst structure provides a new synthesis approach in improving the catalytic properties of monometallic Pd materials. TiO 2 as a support material and 0.05%Pd loading on 1%Au on titania support and used different treatment methods like washing plasma and reduction between the two metal loadings and was observed under 2:1 ratio. In my study there were two set of catalysts which were prepared by a modified incipient wetness impregnation technique. Out of all the reaction condition the catalyst which was reduced after impregnating gold and then impregnating palladium which was further treated in non-thermal hydrogen plasma and then pretreated in hydrogen till 250°C for 1 hour produced the best activity of 76% yield at 225°C. Stability tests were conducted
Acetylene-chromene terminated resins as high temperature thermosets
NASA Technical Reports Server (NTRS)
Godschalx, J. P.; Inbasekaran, M. N.; Bartos, B. R.; Scheck, D. M.; Laman, S. A.
1990-01-01
A novel phase transfer catalyzed process for the preparation of propargyl ethers has been developed. The propargyl ethers serve as precursors to a new class of thermosetting resins called acetylene-chromene terminated (ACT) resins. Heat treatment of a solution of propargyl ethers with various catalysts, followed by removal of solvent leads to the ACT resins via partial conversion of the propargyl ether groups to chromenes. This process reduces the energy content of the resin systems and reduces the amount of shrinkage found during cure. Due to the presence of the solvent the process is safe and gives rise to low viscosity products suitable for resin transfer molding and filament winding type applications. Due to the high glass transition temperature, high modulus, and low moisture uptake the cured resins display better than 232 C/wet performance. The thermal stability of the ACT resins in air at 204 C is superior to that of conventional bismaleimide resins. The resins also display excellent electrical properties.
NASA Astrophysics Data System (ADS)
Kung, Irene Yuk Man
Part I. A series of novel cobalt dithiolate complexes with mixed imine/amine ligand systems is presented here as electronic and structural models for the active site in the bacterial enzyme class, nitrile hydratase (NHase). Pentadentate cobalt(II) complexes with S2N 3 ligand environments are first studied as precursors to the more relevant cobalt(III) complexes. Adjustment of the backbone length by removal of a methylene group increases the reactivity of the system; whereas reduction of the two backbone imine bonds to allow free rotation about those bonds may decrease reactivity. Reactivity change due to the replacement of the backbone amine proton with a more sterically challenging methyl group is not yet clear. Upon oxidation, the monocationic pentadentate cobalt(III) complex, 1b, shows promising reactivity similar to that of NHase. The metal's open coordination site allows reversible binding of the endogenous, monoanionic ligands, N 3- and NCS-. Oxygenation of the thiolate sulfur atoms by exposure to O2 and H2O 2 produces sulfenate and sulfinate ligands in complex 8, which resembles the crystal structure of "deactivated" Fe NHase. However, its lack of reactivity argues against the oxygenated enzyme structure as the active form. Six-coordinate cobalt(III) complexes with S2N4 amine/amine ligand systems are also presented as analogues of previously reported iron(III) compounds, which mimic the spectroscopic properties of Fe NHase. The cobalt complexes do not seem to similarly model Co NHase. However, the S = 0 cobalt(III) center can be spectroscopically silent and difficult to detect, making comparison with synthetic models using common techniques hard. Part II. Dodecameric Escherichia coli glutamine synthetase mutant, E165C, stacks along its six-fold axis to produce tubular nanostructures in the presence of some divalent metal ions, as does the wild type enzyme. The centrally located, engineered Cys-165 residues appear to bind to various species and may serve as
Yue, Dawei; Yao, Tuanli; Larock, Richard C
2006-01-06
[reaction: see text] 3-Iodoindoles have been prepared in excellent yields by coupling terminal acetylenes with N,N-dialkyl-o-iodoanilines in the presence of a Pd/Cu catalyst, followed by an electrophilic cyclization of the resulting N,N-dialkyl-o-(1-alkynyl)anilines using I2 in CH2Cl2. Aryl-, vinylic-, alkyl-, and silyl-substituted terminal acetylenes undergo this process to produce excellent yields of 3-iodoindoles. The reactivity of the carbon-nitrogen bond cleavage during cyclization follows the following order: Me > n-Bu, Me > Ph, and cyclohexyl > Me. Subsequent palladium-catalyzed Sonogashira, Suzuki, and Heck reactions of the resulting 3-iodoindoles proceed smoothly in good yields.
Qin, Y M; Marttila, M S; Haapalainen, A M; Siivari, K M; Glumoff, T; Hiltunen, J K
1999-10-01
The yeast peroxisomal (3R)-hydroxyacyl-CoA dehydrogenase/2-enoyl-CoA hydratase 2 (multifunctional enzyme type 2; MFE-2) has two N-terminal domains belonging to the short chain alcohol dehydrogenase/reductase superfamily. To investigate the physiological roles of these domains, here called A and B, Saccharomyces cerevisiae fox-2 cells (devoid of Sc MFE-2) were taken as a model system. Gly(16) and Gly(329) of the S. cerevisiae A and B domains, corresponding to Gly(16), which is mutated in the human MFE-2 deficiency, were mutated to serine and cloned into the yeast expression plasmid pYE352. In oleic acid medium, fox-2 cells transformed with pYE352:: ScMFE-2(aDelta) and pYE352::ScMFE-2(bDelta) grew slower than cells transformed with pYE352::ScMFE-2, whereas cells transformed with pYE352::ScMFE-2(aDeltabDelta) failed to grow. Candida tropicalis MFE-2 with a deleted hydratase 2 domain (Ct MFE- 2(h2Delta)) and mutational variants of the A and B domains (Ct MFE- 2(h2DeltaaDelta), Ct MFE- 2(h2DeltabDelta), and Ct MFE- 2(h2DeltaaDeltabDelta)) were overexpressed and characterized. All proteins were dimers with similar secondary structure elements. Both wild type domains were enzymatically active, with the B domain showing the highest activity with short chain and the A domain with medium and long chain (3R)-hydroxyacyl-CoA substrates. The data show that the dehydrogenase domains of yeast MFE-2 have different substrate specificities required to allow the yeast to propagate optimally on fatty acids as the carbon source.
Reactions of gas phase H atoms with ethylene, acetylene and ethane adsorbed on Ni( 1 1 1 )
NASA Astrophysics Data System (ADS)
Bürgi, T.; Trautman, T. R.; Gostein, M.; Lahr, D. L.; Haug, K. L.; Ceyer, S. T.
2002-03-01
The products of the reaction of the most energetic form of hydrogen, gas phase H atoms, with ethylene, acetylene and ethane adsorbed on a Ni(1 1 1) surface at 60 K are probed. Adsorbed ethylidyne (CCH 3) is identified by high resolution electron energy loss spectroscopy to be the major product (30% yield) in all three cases. Adsorbed acetylene is a minor product (3% yield) and arises as a consequence of a dynamic equilibrium between CCH 3 and C 2H 2 in the presence of gas phase H atoms. The observation of the same product for the reaction of H atoms with all three hydrocarbons implies that CCH 3 is the most stable C 2 species in the presence of coadsorbed hydrogen. The rates of CCH 3 production are measured as a function of the time of exposure of H atoms to each hydrocarbon. A simple kinetic model treating each reaction as a pseudo-first order reaction in the hydrocarbon coverage is fit to these data. A mechanism for the formation of CCH 3 via a CHCH 2 intermediate common to all three reactants is proposed to describe this model. The observed instability of the CH 2CH 3 species relative to C 2H 4 plays a role in the formulation of this mechanism as does the observed stability of CHCH 2 species in the presence of coadsorbed hydrogen. The CH 2CH 3 and the CHCH 2 species are produced by the translational activation of ethane and the dissociative ionization of ethane and ethylene, respectively. In addition, the binding energy and the vibrational spectrum of ethane adsorbed on Ni(1 1 1) are determined and exceptionally high resolution vibrational spectra of adsorbed ethylene and acetylene are presented.
NASA Astrophysics Data System (ADS)
Esrafili, Mehdi D.; Dinparast, Leila
2018-06-01
In this work, quantum chemical calculations are performed to compare adsorption behavior of ethylene and acetylene molecules over Al- or Si-decorated graphene oxide (Al/Si-GO). The corresponding adsorption energies, geometrical parameters and net charge-transfer values are calculated using the dispersion-corrected DFT calculations. The obtained large adsorption energies of the Al and Si atoms over GO suggest that both Al-GO and Si-GO are stable enough to be used as a stable substrate to capture and activate ethylene or acetylene. The results show that the adsorption of C2H4 or C2H2 on Al-GO is more favorable than over Si-GO surface, mainly due to the orbital interactions between the adsorbate and surface. Also, the DFT calculations reveal that the interaction of C2H2 with both surfaces is stronger than that of C2H4. Our findings are applicable for future theoretical and experimental studies about the interaction of hydrocarbons with light metal decorated graphene-based materials as well as heterogeneous catalysis.
Characterization of Two Streptomyces Enzymes That Convert Ferulic Acid to Vanillin
Yang, Wenwen; Tang, Hongzhi; Ni, Jun; Wu, Qiulin; Hua, Dongliang; Tao, Fei; Xu, Ping
2013-01-01
Production of flavors from natural substrates by microbial transformation has become a growing and expanding field of study over the past decades. Vanillin, a major component of vanilla flavor, is a principal flavoring compound used worldwide. Streptomyces sp. strain V-1 is known to be one of the most promising microbial producers of natural vanillin from ferulic acid. Although identification of the microbial genes involved in the biotransformation of ferulic acid to vanillin has been previously reported, purification and detailed characterization of the corresponding enzymes with important functions have rarely been studied. In this study, we isolated and identified 2 critical genes, fcs and ech, encoding feruloyl-CoA synthetase and enoyl-CoA hydratase/aldolase, respectively, which are involved in the vanillin production from ferulic acid. Both genes were heterologously expressed in Escherichia coli, and the resting cell reactions for converting ferulic acid to vanillin were performed. The corresponding crucial enzymes, Fcs and Ech, were purified for the first time and the enzymatic activity of each purified protein was studied. Furthermore, Fcs was comprehensively characterized, at an optimal pH of 7.0 and temperature of 30°C. Kinetic constants for Fcs revealed the apparent K m, k cat, and V max values to be 0.35 mM, 67.7 s−1, and 78.2 U mg−1, respectively. The catalytic efficiency (k cat/K m) value of Fcs was 193.4 mM−1 s−1 for ferulic acid. The characterization of Fcs and Ech may be helpful for further research in the field of enzymatic engineering and metabolic regulation. PMID:23840666
NASA Astrophysics Data System (ADS)
Lue, Christopher J.; Sullivan, Michael N.; Draganjac, Mark E.; Reeve, Scott W.
2011-06-01
About five years ago, Arkansas State University created the Arkansas Center for Laser Applications and Science (ArCLAS) with the intention of making it a state-of-the-art facility for laser-based research and optical spectroscopy in the midSouth. Since that time, University and DoD support has lead to the acquisition of numerous laser based spectrometers including a novel three color picosecond system utilized primarily for STIRAP measurements of bulk gas samples. Over the past few months, we have begun collecting near infrared overtone and combination band spectra for the acetylene molecule with a pulsed cavity ringdown laser absorption spectrometer (CRDLAS) as part of the STIRAP support effort. Certainly acetylene has been extensively studied by a number of different spectroscopic methods. During these CRDLAS investigations a 13C_2H_2 band was discovered which we believe has not been previously reported. Here a complete rovibrational analysis of this band will be presented. See for example, Michel Herman, Jacques lievin, Jean Vander Auwera, and Alain Campargue, in Global and Accurate Vibration Hamiltonians from High Resolution Molecular Spectroscopy, Advances in Chemical Physics Volume 108, John Wiley and Sons, NY, NY (1999) and references therein.
CO2-broadening and shift coefficients in the ν3 and ν2 + (ν4 +ν5)+0 bands of acetylene
NASA Astrophysics Data System (ADS)
Lyulin, O. M.; Petrova, T. M.; Solodov, A. M.; Solodov, A. A.; Perevalov, V. I.
2018-03-01
The absorption spectra of the mixture of C2H2 and CO2 at different partial pressures of both gases have been recorded at room temperature in the 3 μm region using the Bruker IFS 125 HR FTIR spectrometer. The multispectrum fitting procedure has been applied to these spectra to recover the broadening and shift parameters of the acetylene spectral lines. The CO2 broadening and pressure induced shift coefficients for 119 lines of the ν3 and ν2 + (ν4 +ν5)+0 bands of acetylene have been derived. The rotational dependence of the values of these coefficients is discussed. The comparison of the obtained coefficients to those published by other authors for the ν1 + ν3 and (ν4 +ν5)+0 bands is performed.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Singh, S.; McCord, T. B.; Combe, J-Ph.
2016-09-01
Titan’s atmosphere is opaque in the near-infrared due to gaseous absorptions, mainly by methane, and scattering by aerosols, except in a few “transparency windows.” Thus, the composition of Titan’s surface remains difficult to access from space and is still poorly constrained. Photochemical models suggest that most of the organic compounds formed in the atmosphere are heavy enough to condense and build up at the surface in liquid and solid states over geological timescales. Acetylene (C{sub 2}H{sub 2}) net production in the atmosphere is predicted to be larger than any other compound and C{sub 2}H{sub 2} has been speculated to existmore » on the surface of Titan. C{sub 2}H{sub 2} was detected as a trace gas sublimated/evaporated from the surface using the Gas Chromatograph Mass Spectrometer after the landing of the Huygens probe. Here we show evidence of C{sub 2}H{sub 2} on the surface of Titan by detecting absorption bands at 1.55 and 4.93 μ m using the Cassini Visual and Infrared Mapping Spectrometer at three different equatorial areas—Tui Regio, eastern Shangri La, and Fensal–Aztlan/Quivira. We found that C{sub 2}H{sub 2} is preferentially detected in low-albedo areas, such as sand dunes and near the Huygens landing site. The specific location of the C{sub 2}H{sub 2} detections suggests that C{sub 2}H{sub 2} is mobilized by surface processes, such as surface weathering by liquids through dissolution/evaporation processes.« less
An improved processible acetylene-terminated polyimide for composites
NASA Technical Reports Server (NTRS)
Landis, A. L.; Naselow, A. B.
1985-01-01
The newest member of a family of thermosetting acetylene-substituted polyimide oligomers is HR600P. This oligomer is the isoimide version of the oligomer known as HR600P and Thermid 600. Although both types of material yield the same heat resistant end products after cure, HR600P has much superior processing characteristics. This attributed to its lower melting temperature (160 + or - 10 C, 320 + or - 20 F) in contrast to 202 C (396 F) for Thermid MC-600, its longer gel time at its processing temperature (16 to 30 minutes bvs 3 minutes), and its excellent solubility in low boiling solvents such as tetrahydrofuran, glymes, or 4:1 methyl ethyl ketone/toluene mixtures. These advantages provide more acceptable coating and impregnation procedures, allow for more complete removal at lower temperatures, provide a longer pot life or working time, and allow composite structure fabrication in conventional autoclaves used for epoxy composite curing. The excellent processing characteristics of HR600P allow its use in large area laminated structures, structural composites, and molding compositions.
Frequency metrology of the acetylene lines near 789 nm from lamb-dip measurements
NASA Astrophysics Data System (ADS)
Tao, Lei-Gang; Hua, Tian-Peng; Sun, Yu R.; Wang, Jin; Liu, An-Wen; Hu, Shui-Ming
2018-05-01
Lamb-dips of the ro-vibrational lines of 12C2H2 near 789 nm were recorded using cavity ring-down saturation spectroscopy. Calibrated by an optical frequency comb, frequencies of 45 acetylene lines were determined with an accuracy of 1.1 ×10-7 cm-1 (δν / ν = 8 ×10-12), which is over two orders of magnitude more accurate than previous Doppler-limited studies. An averaged shift of about 0.01 cm-1 were found by comparing the upper energies obtained in this work to those recently presented by Chubb et al. from a MARVEL analysis.
NASA Astrophysics Data System (ADS)
Guan, Jiwen; Daljeet, Roshan; Kieran, Arielle; Song, Yang
2018-06-01
Conjugated polymers are prominent semiconductors that have unique electric conductivity and photoluminescence. Synthesis of conjugated polymers under high pressure is extremely appealing because it does not require a catalyst or solvent used in conventional chemical methods. Transformation of acetylene and many of its derivatives to conjugated polymers using high pressure has been successfully achieved, but not with dimethyl acetylene (DMA). In this work, we present a high-pressure study on solid DMA using a diamond anvil cell up to 24.4 GPa at room temperature characterized by in situ Fourier transform infrared and Raman spectroscopy. Our results show that solid DMA exists in a phase II crystal structure and is stable up to 12 GPa. Above this pressure, amorphization was initiated and the process was completed at 24.4 GPa. The expected polymeric transformation was not evident upon compression, but only observed upon decompression from a threshold compression pressure (e.g. 14.4 GPa). In situ florescence measurements suggest excimer formation via crystal defects, which induces the chemical reactions. The vibrational spectral analysis suggests the products contain the amorphous poly(DMA) and possibly additional amorphous hydrogenated carbon material.
Guan, Jiwen; Daljeet, Roshan; Kieran, Arielle; Song, Yang
2018-06-06
Conjugated polymers are prominent semiconductors that have unique electric conductivity and photoluminescence. Synthesis of conjugated polymers under high pressure is extremely appealing because it does not require a catalyst or solvent used in conventional chemical methods. Transformation of acetylene and many of its derivatives to conjugated polymers using high pressure has been successfully achieved, but not with dimethyl acetylene (DMA). In this work, we present a high-pressure study on solid DMA using a diamond anvil cell up to 24.4 GPa at room temperature characterized by in situ Fourier transform infrared and Raman spectroscopy. Our results show that solid DMA exists in a phase II crystal structure and is stable up to 12 GPa. Above this pressure, amorphization was initiated and the process was completed at 24.4 GPa. The expected polymeric transformation was not evident upon compression, but only observed upon decompression from a threshold compression pressure (e.g. 14.4 GPa). In situ florescence measurements suggest excimer formation via crystal defects, which induces the chemical reactions. The vibrational spectral analysis suggests the products contain the amorphous poly(DMA) and possibly additional amorphous hydrogenated carbon material.
NASA Astrophysics Data System (ADS)
Osborn, David; Savee, John; Selby, Talitha; Welz, Oliver; Taatjes, Craig
The reaction of acetylene (HCCH) with a resonance-stabilized free radical is a commonly invoked mechanism for the generation of polycyclic aromatic hydrocarbons (PAH), which are likely precursors of soot particles in combustion. In this work, we examine the sequential addition of acetylene to the propargyl radical (H2CCCH) at temperatures of 800 and 1000 K. Using time-resolved multiplexed photoionization mass spectrometry with tunable ionizing radiation, we identified the isomeric forms of the C5H5 and C7H7 intermediates in this reaction sequence, and confirmed that the final C9H8 product is the two-ring aromatic compound indene. We identified two different resonance-stabilized C5H5 intermediates, with different temperature dependencies. Furthermore, the C7H7 intermediate is the tropyl radical (c-C7H7) , not the benzyl radical (C6H5CH2) , as is usually assumed in combustion environments. These experimental results are in general agreement with the latest electronic structure / master equation results of da Silva et al. This work shows a pathway for PAH formation that bypasses benzene / benzyl intermediates.
Lomond, Jasmine S; Tong, Anthony Z
2011-01-01
Analysis of dissolved methane, ethylene, acetylene, and ethane in water is crucial in evaluating anaerobic activity and investigating the sources of hydrocarbon contamination in aquatic environments. A rapid chromatographic method based on phase equilibrium between water and its headspace is developed for these analytes. The new method requires minimal sample preparation and no special apparatus except those associated with gas chromatography. Instead of Henry's Law used in similar previous studies, partition coefficients are used for the first time to calculate concentrations of dissolved hydrocarbon gases, which considerably simplifies the calculation involved. Partition coefficients are determined to be 128, 27.9, 1.28, and 96.3 at 30°C for methane, ethylene, acetylene, and ethane, respectively. It was discovered that the volume ratio of gas-to-liquid phase is critical to the accuracy of the measurements. The method performance can be readily improved by reducing the volume ratio of the two phases. Method validation shows less than 6% variation in accuracy and precision except at low levels of methane where interferences occur in ambient air. Method detection limits are determined to be in the low ng/L range for all analytes. The performance of the method is further tested using environmental samples collected from various sites in Nova Scotia.
Schaefer, Inga-Marie; Hornick, Jason L; Bovée, Judith V M G
2018-04-01
The discovery of mutations in genes encoding the metabolic enzymes isocitrate dehydrogenase (IDH), succinate dehydrogenase (SDH), and fumarate hydratase (FH) has expanded our understanding not only of altered metabolic pathways but also epigenetic dysregulation in cancer. IDH1/2 mutations occur in enchondromas and chondrosarcomas in patients with the non-hereditary enchondromatosis syndromes Ollier disease and Maffucci syndrome and in sporadic tumors. IDH1/2 mutations result in excess production of the oncometabolite (D)-2-hydroxyglutarate. In contrast, SDH and FH act as tumor suppressors and genomic inactivation results in succinate and fumarate accumulation, respectively. SDH deficiency may result from germline SDHA, SDHB, SDHC, or SDHD mutations and is found in autosomal-dominant familial paraganglioma/pheochromocytoma and Carney-Stratakis syndrome, describing the combination of paraganglioma and gastrointestinal stromal tumor (GIST). In contrast, patients with the non-hereditary Carney triad, including paraganglioma, GIST, and pulmonary chondroma, usually lack germline SDH mutations and instead show epigenetic SDH complex inactivation through SDHC promoter methylation. Inactivating FH germline mutations are found in patients with hereditary leiomyomatosis and renal cell cancer (HLRCC) syndrome comprising benign cutaneous/uterine leiomyomas and renal cell carcinoma. Mutant IDH, SDH, and FH share common inhibition of α-ketoglutarate-dependent oxygenases such as the TET family of 5-methylcytosine hydroxylases preventing DNA demethylation, and Jumonji domain histone demethylases increasing histone methylation, which together inhibit cell differentiation. Ongoing studies aim to better characterize these complex alterations in cancer, the different clinical phenotypes, and variable penetrance of inherited and sporadic cancer predisposition syndromes. A better understanding of the roles of metabolic enzymes in cancer may foster the development of therapies that
Heat of Combustion of the Product Formed by the Reaction of Acetylene, Ethylene, and Diborane
NASA Technical Reports Server (NTRS)
Tannenbaum, Stanley
1957-01-01
The net heat of combustion of the product formed by the reaction of diborane with a mixture of acetylene and ethylene was found to be 20,440 +/- 150 Btu per pound for the reaction of liquid fuel to gaseous carbon dioxide, gaseous water, and solid boric oxide. The measurements were made in a Parr oxygen-bomb calorimeter, and the combustion was believed to be 98 percent complete. The estimated net-heat of combustion for complete combustion would therefore be 20,850 +/- 150 Btu per pound.
Positron collisions with acetylene calculated using the R-matrix with pseudo-states method
NASA Astrophysics Data System (ADS)
Zhang, Rui; Galiatsatos, Pavlos G.; Tennyson, Jonathan
2011-10-01
Eigenphase sums, total cross sections and differential cross sections are calculated for low-energy collisions of positrons with C2H2. The calculations demonstrate that the use of appropriate pseudo-state expansions very significantly improves the representation of this process giving both realistic eigenphases and cross sections. Differential cross sections are strongly forward peaked in agreement with the measurements. These calculations are computationally very demanding; even with improved procedures for matrix diagonalization, fully converged calculations are too expensive with current computer resources. Nonetheless, the calculations show clear evidence for the formation of a virtual state but no indication that acetylene actually binds a positron at its equilibrium geometry.
Soot Volume Fraction Maps for Normal and Reduced Gravity Laminar Acetylene Jet Diffusion Flames
NASA Technical Reports Server (NTRS)
Greenberg, Paul S.; Ku, Jerry C.
1997-01-01
The study of soot particulate distribution inside gas jet diffusion flames is important to the understanding of fundamental soot particle and thermal radiative transport processes, as well as providing findings relevant to spacecraft fire safety, soot emissions, and radiant heat loads for combustors used in air-breathing propulsion systems. Compared to those under normal gravity (1-g) conditions, the elimination of buoyancy-induced flows is expected to significantly change the flow field in microgravity (O g) flames, resulting in taller and wider flames with longer particle residence times. Work by Bahadori and Edelman demonstrate many previously unreported qualitative and semi-quantitative results, including flame shape and radiation, for sooting laminar zas jet diffusion flames. Work by Ku et al. report soot aggregate size and morphology analyses and data and model predictions of soot volume fraction maps for various gas jet diffusion flames. In this study, we present the first 1-g and 0-g comparisons of soot volume fraction maps for laminar acetylene and nitrogen-diluted acetylene jet diffusion flames. Volume fraction is one of the most useful properties in the study of sooting diffusion flames. The amount of radiation heat transfer depends directly on the volume fraction and this parameter can be measured from line-of-sight extinction measurements. Although most Soot aggregates are submicron in size, the primary particles (20 to 50 nm in diameter) are in the Rayleigh limit, so the extinction absorption) cross section of aggregates can be accurately approximated by the Rayleigh solution as a function of incident wavelength, particles' complex refractive index, and particles' volume fraction.
NASA Astrophysics Data System (ADS)
Zolot, A. M.; Giorgetta, F. R.; Baumann, E.; Swann, W. C.; Coddington, I.; Newbury, N. R.
2013-03-01
The Doppler-limited spectra of methane between 176 THz and 184 THz (5870-6130 cm-1) and acetylene between 193 THz and 199 THz (6430-6630 cm-1) are acquired via comb-tooth resolved dual comb spectroscopy with frequency accuracy traceable to atomic standards. A least squares analysis of the measured absorbance and phase line shapes provides line center frequencies with absolute accuracy of 0.2 MHz, or less than one thousandth of the room temperature Doppler width. This accuracy is verified through comparison with previous saturated absorption spectroscopy of 37 strong isolated lines of acetylene. For the methane spectrum, the center frequencies of 46 well-isolated strong lines are determined with similar high accuracy, along with the center frequencies for 1107 non-isolated lines at lower accuracy. The measured methane line-center frequencies have an uncertainty comparable to the few available laser heterodyne measurements in this region but span a much larger optical bandwidth, marking the first broad-band measurements of the methane 2ν3 region directly referenced to atomic frequency standards. This study demonstrates the promise of dual comb spectroscopy to obtain high resolution broadband spectra that are comparable to state-of-the-art Fourier-transform spectrometer measurements but with much improved frequency accuracy.Work of the US government, not subject to US copyright.
Raji Reddy, Chada; Kumaraswamy, Paridala; Singarapu, Kiran K
2014-09-05
An efficient approach for the construction of novel bicyclic fused cyclopentenones starting from Morita-Baylis-Hillman (MBH) acetates of acetylenic aldehydes with flexible scaffold diversity has been achieved using a two-step reaction sequence involving allylic substitution and the Pauson-Khand reaction. This strategy provided a facile access to various bicyclic cyclopentenones fused with either a carbocyclic or a heterocyclic ring system in good yield.
Dissociative Excitation of Acetylene Induced by Electron Impact: Excitation-emission Cross-sections
DOE Office of Scientific and Technical Information (OSTI.GOV)
Országh, Juraj; Danko, Marián; Čechvala, Peter
The optical emission spectrum of acetylene excited by monoenergetic electrons was studied in the range of 190–660 nm. The dissociative excitation and dissociative ionization associated with excitation of the ions initiated by electron impact were dominant processes contributing to the spectrum. The spectrum was dominated by the atomic lines (hydrogen Balmer series, carbon) and molecular bands (CH(A–X), CH(B–X), CH{sup +}(B–A), and C{sub 2}). Besides the discrete transitions, we have detected the continuum emission radiation of ethynyl radical C{sub 2}H(A–X). For most important lines and bands of the spectrum we have measured absolute excitation-emission cross sections and determined the energy thresholdsmore » of the particular dissociative channels.« less
NASA Astrophysics Data System (ADS)
Stytsenko, V. D.; Mel'nikov, D. P.; Tkachenko, O. P.; Savel'eva, E. V.; Semenov, A. P.; Kustov, L. M.
2018-05-01
The selective hydrogenation of acetylene on Pd-Fe/Al2O3 catalysts prepared by decomposition of ferrocene on reduced Pd/Al2O3 was studied. The effect of the conditions of treatment of the Pd-ferrocene/ Al2O3 precursor on the catalyst activity and selectivity was investigated, and the optimum conditions were determined at which the Pd-Fe/Al2O3 catalyst has higher selectivity than Pd/Al2O3 without any loss of activity.
Infrared Spectra and Optical Constants of Astronomical Ices: I. Amorphous and Crystalline Acetylene
NASA Technical Reports Server (NTRS)
Hudson, R. L.; Ferrante, R. F.; Moore, M. H.
2013-01-01
Here we report recent measurements on acetylene (C2H2) ices at temperatures applicable to the outer Solar System and the interstellar medium. New near- and mid-infrared data, including optical constants (n, k), absorption coefficients (alpha), and absolute band strengths (A), are presented for both amorphous and crystalline phases of C2H2 that exist below 70 K. Comparisons are made to earlier work. Electronic versions of the data are made available, as is a computer routine to use our reported n and k values to simulate the observed IR spectra. Suggestions are given for the use of the data and a comparison to a spectrum of Makemake is made.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Shi, Xuetao; Li, Wen; Schlegel, H. Bernhard, E-mail: hbs@chem.wayne.edu
2016-08-28
The hydrogens in protonated acetylene are very mobile and can easily migrate around the C{sub 2} core by moving between classical and non-classical structures of the cation. The lowest energy structure is the T-shaped, non-classical cation with a hydrogen bridging the two carbons. Conversion to the classical H{sub 2}CCH{sup +} ion requires only 4 kcal/mol. The effect of circularly polarized light on the migration of hydrogens in oriented C{sub 2}H{sub 3}{sup +} has been simulated by Born-Oppenheimer molecular dynamics. Classical trajectory calculations were carried out with the M062X/6-311+G(3df,2pd) level of theory using linearly and circularly polarized 32 cycle 7 μmmore » cosine squared pulses with peak intensity of 5.6 × 10{sup 13} W/cm{sup 2} and 3.15 × 10{sup 13} W/cm{sup 2}, respectively. These linearly and circularly polarized pulses transfer similar amounts of energy and total angular momentum to C{sub 2}H{sub 3}{sup +}. The average angular momentum vectors of the three hydrogens show opposite directions of rotation for right and left circularly polarized light, but no directional preference for linearly polarized light. This difference results in an appreciable amount of angular displacement of the three hydrogens relative to the C{sub 2} core for circularly polarized light, but only an insignificant amount for linearly polarized light. Over the course of the simulation with circularly polarized light, this corresponds to a propeller-like motion of the three hydrogens around the C{sub 2} core of protonated acetylene.« less
ERIC Educational Resources Information Center
Sharpless, William D.; Peng Wu; Hansen, Trond Vidar; Lindberg, James G.
2005-01-01
The click chemistry uses only the most reliable reactions to build complex molecules from olefins, electrophiles and heteroatom linkers. A variation on Huisgen's azide-alkyne 1,2,3-triazole synthesis, the addition of the copper (I), the premium example of the click reaction, catalyst strongly activates terminal acetylenes towards the 1,3-dipole in…
Wang, Ye; Lim, Lynette; Madilao, Lina; Lah, Ljerka; Bohlmann, Joerg; Breuil, Colette
2014-08-01
To successfully colonize and eventually kill pine trees, Grosmannia clavigera (Gs cryptic species), the main fungal pathogen associated with the mountain pine beetle (Dendroctonus ponderosae), has developed multiple mechanisms to overcome host tree chemical defenses, of which terpenoids are a major component. In addition to a monoterpene efflux system mediated by a recently discovered ABC transporter, Gs has genes that are highly induced by monoterpenes and that encode enzymes that modify or utilize monoterpenes [especially (+)-limonene]. We showed that pine-inhabiting Ophiostomale fungi are tolerant to monoterpenes, but only a few, including Gs, are known to utilize monoterpenes as a carbon source. Gas chromatography-mass spectrometry (GC-MS) revealed that Gs can modify (+)-limonene through various oxygenation pathways, producing carvone, p-mentha-2,8-dienol, perillyl alcohol, and isopiperitenol. It can also degrade (+)-limonene through the C-1-oxygenated pathway, producing limonene-1,2-diol as the most abundant intermediate. Transcriptome sequencing (RNA-seq) data indicated that Gs may utilize limonene 1,2-diol through beta-oxidation and then valine and tricarboxylic acid (TCA) metabolic pathways. The data also suggested that at least two gene clusters, located in genome contigs 108 and 161, were highly induced by monoterpenes and may be involved in monoterpene degradation processes. Further, gene knockouts indicated that limonene degradation required two distinct Baeyer-Villiger monooxygenases (BVMOs), an epoxide hydrolase and an enoyl coenzyme A (enoyl-CoA) hydratase. Our work provides information on enzyme-mediated limonene utilization or modification and a more comprehensive understanding of the interaction between an economically important fungal pathogen and its host's defense chemicals.
Identification of Acetylene on Titan's Surface
NASA Astrophysics Data System (ADS)
Singh, S.; McCord, T. B.; Rodriguez, S.; Combe, J. P.; Cornet, T.; Le Mouelic, S.; Maltagliati, L.; Chevrier, V.; Clark, R. N.
2015-12-01
Titan's atmosphere is opaque in the near infrared due to gaseous absorptions, mainly by methane, and scattering by aerosols, except in a few "transparency windows" (e.g., Sotin et al., 2005). Thus, the composition of Titan surface remains difficult to access from space and is still poorly constrained, limited to ethane in the polar lakes (Brown et al., 2008) and a few possible organic molecules on the surface (Clark et al., 2010). Photochemical models suggest that most of the organic compounds formed in the atmosphere are heavy enough to condense and build up at the surface in liquid and solid states over geological timescale (Cordier et al., 2009, 2011). Acetylene (C2H2) is one of the most abundant organic molecules in the atmosphere and thus thought to present on the surface as well. Here we report direct evidence of solid C2H2 on Titan's surface using Cassini Visual and Infrared Mapping Spectrometer (VIMS) data. By comparing VIMS observations and laboratory measurements of solid and liquid C2H2, we identify a specific absorption at 1.55 µm that is widespread over Titan but is particularly strong in the brightest terrains. This surface variability suggests that C2H2 is mobilized by surface processes, such as surface weathering, topography, and dissolution/evaporation. The detection of C2H2 on the surface of Titan opens new paths to understand and constrain Titan's surface activity. Since C2H2 is highly soluble in Titan liquids (Singh et al. 2015), it can easily dissolve in methane/ethane and may play an important role in carving of fluvial channels and existence of karstic lakes at higher latitudes on Titan. These processes imply the existence of a dynamic surface with a continued history of erosion and deposition of C2H2 on Titan.
Heat of Combustion of the Product Formed by the Reaction of Acetylene and Diborane (LFPL-CZ-3)
NASA Technical Reports Server (NTRS)
Allen, Harrison, Jr.; Tannenbaum, Stanley
1957-01-01
The heat of combustion of the product formed by the reaction acetylene and diborane was found to be 20,100 +/- 100 Btu per pound for the reaction of liquid fuel to gaseous carbon dioxide, gaseous water, and solid boric oxide. The measurements were made in a Parr oxygen-bomb calorimeter, and chemical analyses both of the sample and of the combustion products indicated combustion in the bomb calorimeter to have been 97 percent complete. The estimated net heat of combustion for complete combustion would therefore be 20,700 +/- 100 Btu per pound.
ASD-1000: High-resolution, high-temperature acetylene spectroscopic databank
NASA Astrophysics Data System (ADS)
Lyulin, O. M.; Perevalov, V. I.
2017-11-01
We present a high-resolution, high-temperature version of the Acetylene Spectroscopic Databank called ASD-1000. The databank contains the line parameters (position, intensity, Einstein coefficient for spontaneous emission, term value of the lower states, self- and air-broadening coefficients, temperature dependence exponents of the self- and air-broadening coefficients) of the principal isotopologue of C2H2. The reference temperature for line intensity is 296 K and the intensity cutoff is 10-27 cm-1/(molecule cm-2) at 1000 K. The databank has 33,890,981 entries and covers the 3-10,000 cm-1 spectral range. The databank is based on the global modeling of the line positions and intensities performed within the framework of the method of effective operators. The parameters of the effective Hamiltonian and the effective dipole moment operator have been fitted to the observed values of the line positions and intensities collected from the literature. The broadening coefficients as well as their temperature dependence exponents were calculated using the empirical equations. The databank is useful for studying high-temperature radiative properties of C2H2. ASD-1000 is freely accessible via the Internet site of V.E. Zuev Institute of Atmospheric Optics SB RAS ftp://ftp.iao.ru/pub/ASD1000/.
NASA Technical Reports Server (NTRS)
Blass, William E.; Daunt, Stephen J.; Peters, Antoni V.; Weber, Mark C.
1990-01-01
Combining broadband Fourier transform spectrometers (FTS) from the McMath facility at NSO and from NRC in Ottawa and narrow band TDL data from the laboratories with computational physics techniques has produced a broad range of results for the study of planetary atmospheres. Motivation for the effort flows from the Voyager/IRIS observations and the needs of Voyager analysis for laboratory results. In addition, anticipation of the Cassini mission adds incentive to pursue studies of observed and potentially observable constituents of planetary atmospheres. Current studies include cyanoacetylene, acetylene, propane, and ethane. Particular attention is devoted to cyanoacetylen (H3CN) which is observed in the atmosphere of Titan. The results of a high resolution infrared laboratory study of the line positions of the 663, 449, and 22.5/cm fundamental bands are presented. Line position, reproducible to better than 5 MHz for the first two bands, are available for infrared astrophysical searches. Intensity and broadening studies are in progress. Acetylene is a nearly ubiquitous atmospheric constituent of the outer planets and Titan due to the nature of methane photochemistry. Results of ambient temperature absolute intensity measurements are presented for the fundamental and two two-quantum hotband in the 730/cm region. Low temperature hotband intensity and linewidth measurements are planned.
NASA Astrophysics Data System (ADS)
Primo, Ana; Neatu, Florentina; Florea, Mihaela; Parvulescu, Vasile; Garcia, Hermenegildo
2014-10-01
Catalysis makes possible a chemical reaction by increasing the transformation rate. Hydrogenation of carbon-carbon multiple bonds is one of the most important examples of catalytic reactions. Currently, this type of reaction is carried out in petrochemistry at very large scale, using noble metals such as platinum and palladium or first row transition metals such as nickel. Catalysis is dominated by metals and in many cases by precious ones. Here we report that graphene (a single layer of one-atom-thick carbon atoms) can replace metals for hydrogenation of carbon-carbon multiple bonds. Besides alkene hydrogenation, we have shown that graphenes also exhibit high selectivity for the hydrogenation of acetylene in the presence of a large excess of ethylene.
NASA Astrophysics Data System (ADS)
Cho, Han-Gook; Andrews, Lester
2015-04-01
The π- and Csbnd H insertion products (M-η2-C2H2 and HMsbnd CCH) are identified in the matrix infrared spectra from reactions of laser-ablated Fe and Os atoms with acetylene isotopomers, but the vinylidene product (H2CCM) is not, in contrast to the recently studied Ru case. The π-complex is produced in deposition and annealing, and it converts to the insertion complex during photolysis. While the vinylidene product is energetically comparable with the two primary products, the energy barrier is considerably higher in contrast to the Ru case. The relatively short Csbnd C bonds of the π-complexes indicate weak back-donations from the group 8 metals to the acetylene π∗ orbitals. The highly bent structure of HOssbnd CCH evidently originates from the high d contributions to the Csbnd Os and Ossbnd H bonds. The C2v structures of the vinylidene products arise from the p-d π bonding between C and M.
NASA Technical Reports Server (NTRS)
Pater, R. H.; Soucek, M. D.; Chang, A. C.; Partos, R. D.
1991-01-01
Recently, the concept and demonstration of a new versatile synthetic reaction for making a large number of high-performance addition-type thermoplastics (ATTs) were reported. The synthesis shows promise for providing polymers having an attractive combination of easy processability, good toughness, respectable high temperature mechanical performance, and excellent thermo-oxidative stability. The new chemistry involves the reaction of an acetylene-terminated material with a bismaleimide or benzoquinone. In order to clarify the reaction mechanism, model compound studies were undertaken in solutions as well as in the solid state. The reaction products were purified by flash chromatography and characterized by conventional analytical techniques including NMR, FT-IR, UV-visible, mass spectroscopy, and high pressure liquid chromatography. The results are presented of the model compound studies which strongly support the formation of a Diels-Alder adduct in the reaction of an acetylene-terminated compound and a bismaleimide or benzoquinone.
High-order harmonic generation from highly excited states in acetylene
NASA Astrophysics Data System (ADS)
Mulholland, Peter; Dundas, Daniel
2018-04-01
High-order harmonic generation (HHG) from aligned acetylene molecules interacting with mid infra-red (IR), linearly polarized laser pulses is studied theoretically using a mixed quantum-classical approach in which the electrons are described using time-dependent density-functional theory while the ions are treated classically. We find that for molecules aligned perpendicular to the laser polarization axis, HHG arises from the highest-occupied molecular orbital (HOMO), while for molecules aligned along the laser polarization axis, HHG is dominated by the HOMO-1. In the parallel orientation we observe a double plateau with an inner plateau that is produced by ionization from and recombination back to an autoionizing state. Two pieces of evidence support this idea. First, by choosing a suitably tuned vacuum ultraviolet pump pulse that directly excites the autoionizing state we observe a dramatic enhancement of all harmonics in the inner plateau. Second, in certain circumstances, the position of the inner plateau cutoff does not agree with the classical three-step model. We show that this discrepancy can be understood in terms of a minimum in the dipole recombination matrix element from the continuum to the autoionizing state.
NASA Astrophysics Data System (ADS)
Liu, B. C.; Lee, T. J.; Lee, S. H.; Park, C. Y.; Lee, C. J.
2003-08-01
Well-aligned carbon nanotubes (CNTs) with high purity have been produced by pyrolysis of iron(II) phthalocyanine and acetylene at 800 °C. The synthesized CNTs have a length of 75 μm and diameters ranging from 20 to 60 nm. The CNTs have a bamboo-like structure and exhibit good crystallinity of graphite sheets. The growth rate of the CNTs was rapidly increased with adding C 2H 2. Our results demonstrate that the proposed growth method is suitable to large-scale synthesis of high-purity well-aligned CNTs on various substrates.
Rodríguez, Ricardo I; Ramírez, Elsie; Yuste, Francisco; Sánchez-Obregón, Rubén; Alemán, José
2018-02-16
The generation of diastereomerically enriched secondary benzyl propargyl alcohols by the asymmetric addition of ortho-sulfinylbenzyl carbanions to sulfonylacetylene derivatives via formation of a Csp-Csp 3 bond is described. This reaction proceeds through an unusual α-attack (anti-Michael addition) of the ortho-sulfinylbenzyl carbanions, followed by elimination of the arylsulfonyl moiety. The scope of this alkynylation reaction is also discussed. Moreover, the development of a new approach for the synthesis of optically active tertiary benzylpropargyl alcohols is described, discussing the possible stereocourse of the reaction so as the influence of the ether 18-crown-6 and steric importance of acetylenic substituent.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Sherrill, C. David; Byrd, Edward F. C.; Head-Gordon, Martin
2000-07-22
A recent study by Ahmed, Peterka, and Suits [J. Chem. Phys. 110, 4248 (1999)] has presented the first experimentally derived estimate of the singlet-triplet gap in the simplest alkyne, acetylene. Their value, T{sub 0}(a(tilde sign) {sup 3}B{sub 2})=28 900 cm{sup -1}, does not agree with previous theoretical predictions using the coupled-cluster singles, doubles, and perturbative triples [CCSD(T)] method and a triple-{zeta} plus double polarization plus f-function basis set (TZ2P f ), which yields 30 500{+-}1000 cm{sup -1}. This discrepancy has prompted us to investigate possible deficiencies in this usually-accurate theoretical approach. Employing extrapolations to the complete basis set limit alongmore » with corrections for full connected triple excitations, core correlation, and even relativistic effects, we obtain a value of 30 900 cm-1 (estimated uncertainty {+-}230 cm-1), demonstrating that the experimental value is underestimated. To assist in the interpretation of anticipated future experiments, we also present highly accurate excitation energies for the other three low-lying triplet states of acetylene, a(tilde sign) {sup 3}B{sub u}(33 570{+-}230 cm{sup -1}), b(tilde sign) {sup 3}A{sub u}(36 040{+-}260 cm{sup -1}), and b(tilde sign) {sup 3}A{sub 2}(38 380{+-}260 cm{sup -1}), and the three lowest-lying states of vinylidene, X(tilde sign) {sup 1}A{sub 1}(15 150{+-}230 cm{sup -1}), a(tilde sign) {sup 3}B{sub 2}(31 870{+-}230 cm{sup -1}), and b(tilde sign) {sup 3}A{sub 2}(36 840{+-}350 cm{sup -1}). Finally, we assess the ability of density functional theory (DFT) and the Gaussian-3 method to match our benchmark results for adiabatic excitation energies of C{sub 2}H{sub 2}. (c) 2000 American Institute of Physics.« less
Wang, Ye; Lim, Lynette; Madilao, Lina; Lah, Ljerka; Bohlmann, Joerg
2014-01-01
To successfully colonize and eventually kill pine trees, Grosmannia clavigera (Gs cryptic species), the main fungal pathogen associated with the mountain pine beetle (Dendroctonus ponderosae), has developed multiple mechanisms to overcome host tree chemical defenses, of which terpenoids are a major component. In addition to a monoterpene efflux system mediated by a recently discovered ABC transporter, Gs has genes that are highly induced by monoterpenes and that encode enzymes that modify or utilize monoterpenes [especially (+)-limonene]. We showed that pine-inhabiting Ophiostomale fungi are tolerant to monoterpenes, but only a few, including Gs, are known to utilize monoterpenes as a carbon source. Gas chromatography-mass spectrometry (GC-MS) revealed that Gs can modify (+)-limonene through various oxygenation pathways, producing carvone, p-mentha-2,8-dienol, perillyl alcohol, and isopiperitenol. It can also degrade (+)-limonene through the C-1-oxygenated pathway, producing limonene-1,2-diol as the most abundant intermediate. Transcriptome sequencing (RNA-seq) data indicated that Gs may utilize limonene 1,2-diol through beta-oxidation and then valine and tricarboxylic acid (TCA) metabolic pathways. The data also suggested that at least two gene clusters, located in genome contigs 108 and 161, were highly induced by monoterpenes and may be involved in monoterpene degradation processes. Further, gene knockouts indicated that limonene degradation required two distinct Baeyer-Villiger monooxygenases (BVMOs), an epoxide hydrolase and an enoyl coenzyme A (enoyl-CoA) hydratase. Our work provides information on enzyme-mediated limonene utilization or modification and a more comprehensive understanding of the interaction between an economically important fungal pathogen and its host's defense chemicals. PMID:24837377
Miller, Laurence G; Baesman, Shaun M; Oremland, Ronald S
2015-11-01
We report the first study of stable carbon isotope fractionation during microbial fermentation of acetylene (C2H2) in sediments, sediment enrichments, and bacterial cultures. Kinetic isotope effects (KIEs) averaged 3.7 ± 0.5‰ for slurries prepared with sediment collected at an intertidal mudflat in San Francisco Bay and 2.7 ± 0.2‰ for a pure culture of Pelobacter sp. isolated from these sediments. A similar KIE of 1.8 ± 0.7‰ was obtained for methanogenic enrichments derived from sediment collected at freshwater Searsville Lake, California. However, C2H2 uptake by a highly enriched mixed culture (strain SV7) obtained from Searsville Lake sediments resulted in a larger KIE of 9.0 ± 0.7‰. These are modest KIEs when compared with fractionation observed during oxidation of C1 compounds such as methane and methyl halides but are comparable to results obtained with other C2 compounds. These observations may be useful in distinguishing biologically active processes operating at distant locales in the Solar System where C2H2 is present. These locales include the surface of Saturn's largest moon Titan and the vaporous water- and hydrocarbon-rich jets emanating from Enceladus. Acetylene-Fermentation-Isotope fractionation-Enceladus-Life detection.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lim, J.S.; Lee, Y.W.; Kim, J.D.
1996-09-01
Isothermal vapor-liquid equilibria for 1,1-difluoroethane (HFC-152a) + acetylene and 1,1-difluoroethane + 1,1-dichloroethane (HCC-150a) were measured in a circulation type apparatus at 303.2 K and 323.2 K. The experimental data were correlated with the Peng-Robinson equation of state using the Wong and Sandler mixing rule, and the relevant parameters are presented.
NASA Astrophysics Data System (ADS)
Ibrahim, Heide; Wales, Benji; Beaulieu, Samuel; Schmidt, Bruno E.; Thiré, Nicolas; Fowe, Emmanuel P.; Bisson, Éric; Hebeisen, Christoph T.; Wanie, Vincent; Giguére, Mathieu; Kieffer, Jean-Claude; Spanner, Michael; Bandrauk, André D.; Sanderson, Joseph; Schuurman, Michael S.; Légaré, François
2014-07-01
The introduction of femto-chemistry has made it a primary goal to follow the nuclear and electronic evolution of a molecule in time and space as it undergoes a chemical reaction. Using Coulomb Explosion Imaging, we have shot the first high-resolution molecular movie of a to and fro isomerization process in the acetylene cation. So far, this kind of phenomenon could only be observed using vacuum ultraviolet light from a free-electron laser. Here we show that 266 nm ultrashort laser pulses are capable of initiating rich dynamics through multiphoton ionization. With our generally applicable tabletop approach that can be used for other small organic molecules, we have investigated two basic chemical reactions simultaneously: proton migration and C=C bond breaking, triggered by multiphoton ionization. The experimental results are in excellent agreement with the timescales and relaxation pathways predicted by new and quantitative ab initio trajectory simulations.
NASA Astrophysics Data System (ADS)
Bębenek, Ewa; Chrobak, Elwira; Wietrzyk, Joanna; Kadela, Monika; Chrobak, Artur; Kusz, Joachim; Książek, Maria; Jastrzębska, Maria; Boryczka, Stanisław
2016-02-01
A series of acetylenic derivatives of betulonic and betulinic acids has been synthesized and characterized by 1H and 13C NMR, IR and MS spectroscopy. The structure of propargyl betulonate 4 and propargyl betulinate-DMF solvate 8A was solved by X-ray diffraction. Thermal properties were examined using a DSC technique. The resulting alkynyl derivatives, as well as betulin 1 and betulinic acid 3, were evaluated in vitro for their cytotoxic activity against human T47D breast cancer, CCRF/CEM leukemia, SW707 colorectal, murine P388 leukemia and BALB3T3 normal fibroblasts cell lines. Several of the obtained compounds have a favorable cytotoxic profile than betulin 1. Propargyl betulinate 8 was the most active derivative, being up to 3-fold more potent than betulin 1 against the human leukemia (CCRF/CEM) cell line, with an IC50 value of 3.9 μg/mL.
Menor-Salván, César; Marín-Yaseli, Margarita R
2013-05-10
The origin of nucleobases and other heterocycles is a classic question in the chemistry of the origins of life. The construction of laboratory models for the abiotic synthesis of nitrogen heterocycles in plausible natural conditions also aids the understanding and prediction of chemical species in the Solar System. Here, we report a new explanation for the origin of hydantoins, purines, and pyrimidines in eutectic water/ice/urea solutions driven by ultraviolet irradiation (in the 185-254 nm range, UVC) of acetylene under anoxic conditions. An analysis of the products indicates the synthesis of hydantoin and 5-hydroxyhydantoin, the purines uric acid, xanthine, and guanine, and the pyrimidines uracil and cytosine. The synthesis occurred together with the photo-oxidation of bases in a complex process for which possible pathways are proposed. In conclusion, an acetylene-containing atmosphere could contribute to the origin of nucleobases in the presence of a urea/water system by an HCN-independent mechanism. The presence of ice has a dual role as a favorable medium for the synthesis of nucleobases and protection against degradation and as a source of free radicals for the synthesis of highly oxidized heterocycles. A mechanism for the origin of hydantoins and uracil from urea in plausible conditions for prebiotic chemistry is also proposed. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Winger, A M; Heazlewood, J L; Chan, L J G; Petzold, C J; Permaul, K; Singh, S
2014-11-01
Thermomyces lanuginosus is a thermophilic fungus known for its ability to produce industrially important enzymes including large amounts of xylanase, the key enzyme in hemicellulose hydrolysis. The secretome of T. lanuginosus SSBP was profiled by shotgun proteomics to elucidate important enzymes involved in hemicellulose saccharification and to characterise the presence of other industrially interesting enzymes. This study reproducibly identified a total of 74 proteins in the supernatant following growth on corn cobs. An analysis of proteins revealed nine glycoside hydrolase (GH) enzymes including xylanase GH11, β-xylosidase GH43, β-glucosidase GH3, α-galactosidase GH36 and trehalose hydrolase GH65. Two commercially produced Thermomyces enzymes, lipase and amylase, were also identified. In addition, other industrially relevant enzymes not currently explored in Thermomyces were identified including glutaminase, fructose-bisphosphate aldolase and cyanate hydratase. Overall, these data provide insight into the novel ability of a cellulase-free fungus to utilise lignocellulosic material, ultimately producing a number of enzymes important to various industrial processes.
Takeuchi, M; Kishino, S; Park, S-B; Hirata, A; Kitamura, N; Saika, A; Ogawa, J
2016-05-01
This study aims to produce hydroxy fatty acids efficiently. Escherichia coli overexpressing linoleic acid Δ9 hydratase from Lactobacillus plantarum AKU 1009a was employed to produce hydroxy fatty acids with industrial potential. We found that 280 g l(-1) of linoleic acid (1 mol l(-1)) was converted into (S)-10-hydoxy-cis-12-octadecenoic acid (HYA) with a high conversion rate of 98% (mol/mol) and more than 99·9% enantiomeric excess (e.e.) by recombinant E. coli cells in the presence of FAD and NADH. In the same way, many kinds of C18 unsaturated fatty acids with Δ9 carbon double bond (280 g l(-1)) were converted into corresponding 10-hydroxy fatty acids with the conversion rates over 95% (mol/mol). We also produced HYA at a high rate of accumulation (289 g l(-1) ) with a high yield (97 mol%) in a reaction mixture that contained glucose instead of NADH. We developed a process for producing several types of hydroxy fatty acids with high accumulation rates and high yields. Hydroxy fatty acids are important materials for the chemical, food, cosmetic and pharmaceutical industries, and thus they have recently attracted much interest in a variety of research fields. However, the mass production of hydroxy fatty acids has been limited. This method of hydroxy fatty acids production will facilitate the widespread application of hydroxy fatty acids in various industries. © 2016 The Society for Applied Microbiology.
Serafín-López, J.; Talavera-Paulin, M.; Amador-Molina, J. C.; Alvarado-Riverón, M.; Vilchis-Landeros, M. M.; Méndez-Ortega, P.; Fafutis-Morris, M.; Paredes-Cervantes, V.; López-Santiago, R.; León, C. I.; Guerrero, M. I.; Ribas-Aparicio, R. M.; Mendoza-Hernández, G.; Carreño-Martínez, C.; Estrada-Parra, S.; Estrada-García, I.
2011-01-01
Leprosy is an infectious disease caused by Mycobacterium leprae, which is a noncultivable bacterium. One of the principal goals of leprosy research is to develop serological tests that will allow identification and early treatment of leprosy patients. M. habana is a cultivable nonpathogenic mycobacterium and candidate vaccine for leprosy, and several antigens that cross-react between M. leprae and M. habana have been discovered. The aim of the present study was to extend the identification of cross-reactive antigens by identifying M. habana proteins that reacted by immunoblotting with antibodies in serum samples from leprosy patients but not with antibodies in sera from tuberculosis (TB) patients or healthy donors (HDs). A 28-kDa antigen that specifically reacted with sera from leprosy patients was identified. To further characterize this antigen, protein spots were aligned in two-dimensional polyacrylamide gels and Western blots. Spots cut out from the gels were then analyzed by mass spectrometry. Two proteins were identified: enoyl-coenzyme A hydratase (lipid metabolism; ML2498) and antigen 85B (Ag85B; mycolyltransferase; ML2028). These proteins represent promising candidates for the design of a reliable tool for the serodiagnosis of lepromatous leprosy, which is the most frequent form in Mexico. PMID:21613461
Chen, Weigen; Peng, Shudi; Zeng, Wen
2014-01-01
Various morphologies of low dimensional ZnO nanostructures, including spheres, rods, sheets, and wires, were successfully synthesized using a simple and facile hydrothermal method assisted with different surfactants. Zinc acetate dihydrate was chosen as the precursors of ZnO nanostructures. We found that polyethylene glycol (PEG), polyvinylpyrrolidone (PVP), glycine, and ethylene glycol (EG) play critical roles in the morphologies and microstructures of the synthesized nanostructures, and a series of possible growth processes were discussed in detail. Gas sensors were fabricated using screen-printing technology, and their sensing properties towards acetylene gas (C2H2), one of the most important arc discharge characteristic gases dissolved in oil-filled power equipments, were systematically measured. The ZnO nanowires based sensor exhibits excellent C2H2 sensing behaviors than those of ZnO nanosheets, nanorods, and nanospheres, indicating a feasible way to develop high-performance C2H2 gas sensor for practical application. PMID:24672324
Tasdemir, Deniz; Sanabria, David; Lauinger, Ina L; Tarun, Alice; Herman, Rob; Perozzo, Remo; Zloh, Mire; Kappe, Stefan H; Brun, Reto; Carballeira, Néstor M
2010-11-01
Acetylenic fatty acids are known to display several biological activities, but their antimalarial activity has remained unexplored. In this study, we synthesized the 2-, 5-, 6-, and 9-hexadecynoic acids (HDAs) and evaluated their in vitro activity against erythrocytic (blood) stages of Plasmodium falciparum and liver stages of Plasmodium yoelii infections. Since the type II fatty acid biosynthesis pathway (PfFAS-II) has recently been shown to be indispensable for liver stage malaria parasites, the inhibitory potential of the HDAs against multiple P. falciparum FAS-II (PfFAS-II) elongation enzymes was also evaluated. The highest antiplasmodial activity against blood stages of P. falciparum was displayed by 5-HDA (IC(50) value 6.6 μg/ml), whereas the 2-HDA was the only acid arresting the growth of liver stage P. yoelii infection, in both flow cytometric assay (IC(50) value 2-HDA 15.3 μg/ml, control drug atovaquone 2.5 ng/ml) and immunofluorescence analysis (IC(50) 2-HDA 4.88 μg/ml, control drug atovaquone 0.37 ng/ml). 2-HDA showed the best inhibitory activity against the PfFAS-II enzymes PfFabI and PfFabZ with IC(50) values of 0.38 and 0.58 μg/ml (IC(50) control drugs 14 and 30 ng/ml), respectively. Enzyme kinetics and molecular modeling studies revealed valuable insights into the binding mechanism of 2-HDA on the target enzymes. All HDAs showed in vitro activity against Trypanosoma brucei rhodesiense (IC(50) values 3.7-31.7 μg/ml), Trypanosoma cruzi (only 2-HDA, IC(50) 20.2 μg/ml), and Leishmania donovani (IC(50) values 4.1-13.4 μg/ml) with generally low or no significant toxicity on mammalian cells. This is the first study to indicate therapeutic potential of HDAs against various parasitic protozoa. It also points out that the malarial liver stage growth inhibitory effect of the 2-HDA may be promoted via PfFAS-II enzymes. The lack of cytotoxicity, lipophilic nature, and calculated pharmacokinetic properties suggests that 2-HDA could be a useful compound to
Tasdemir, Deniz; Sanabria, David; Lauinger, Ina L.; Tarun, Alice; Herman, Rob; Perozzo, Remo; Zloh, Mire; Kappe, Stefan H.; Brun, Reto; Carballeira, Néstor M.
2010-01-01
Acetylenic fatty acids are known to display several biological activities, but their antimalarial activity has remained unexplored. In this study, we synthesized the 2-, 5-, 6-, and 9-hexadecynoic acids (HDAs) and evaluated their in vitro activity against erythrocytic (blood) stages of Plasmodium falciparum and liver stages of P. yoelii infections. Since the type II fatty acid biosynthesis pathway (PfFAS-II) has recently been shown to be indispensable for liver stage malaria parasites, the inhibitory potential of the HDAs against multiple P. falciparum FAS-II (PfFAS-II) elongation enzymes was also evaluated. The highest antiplasmodial activity against blood stages of P. falciparum was displayed by 5-HDA (IC50 value 6.6. μg/ml), whereas the 2-HDA was the only acid arresting the growth of liver stage P. yoelii infection, in both flow cytometric assay (IC50 value 2-HDA 15.3 μg/ml, control drug atovaquone 2.5 ng/ml) and immunofluorescense analysis (IC50 2-HDA 4.88 μg/ml, control drug atovaquone 0.37 ng/ml). 2-HDA showed the best inhibitory against the PfFAS-II enzymes PfFabI and PfFabZ with IC50 values of 0.38 and 0.58 μg/ml (IC50 control drugs 14 and 30 ng/ml) respectively. Enzyme kinetics and molecular modeling studies revealed valuable insights into the binding mechanism of 2-HDA on the target enzymes. All HDAs showed in vitro activity against Trypanosoma brucei rhodesiense (IC50 values 3.7–31.7 μg/ml), Trypanosoma cruzi (only 2-HDA, IC50 20.2 μg/ml), and Leishmania donovani (IC50 values 4.1–13.4 μg/ml) with generally low or no significant toxicity on mammalian cells. This is the first study to indicate therapeutic potential of HDAs against various parasitic protozoa. It also points out that the malarial liver stage growth inhibitory effect of the 2-HDA may be promoted via PfFAS-II enzymes. The lack of cytotoxicity, lipophilic nature and calculated pharmacokinetic properties suggest that 2-HDA could be a useful compound to study the interaction of fatty
Analysis of Effluent Gases During the CCVD Growth of Multi Wall Carbon Nanotubes from Acetylene
NASA Technical Reports Server (NTRS)
Schmitt, T. C.; Biris, A. S.; Miller, D. W.; Biris, A. R.; Lupu, D.; Trigwell, S.; Rahman, Z. U.
2005-01-01
Catalytic chemical vapor deposition was used to grow multi-walled carbon nanotubes on a Fe:Co:CaCO3 catalyst from acetylene. The influent and effluent gases were analyzed by gas chromatography and mass spectrometry at different time intervals during the nanotubes growth process in order to better understand and optimize the overall reaction. A large number of byproducts were identified and it was found that the number and the level for some of the carbon byproducts significantly increased over time. The CaCO3 catalytic support thermally decomposed into CaO and CO2 resulting in a mixture of two catalysts for growing the nanotubes, which were found to have outer diameters belonging to two main groups 8 to 35 nm and 40 to 60 nm, respectively.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Jimenez-Orozco, Carlos; Florez, Elizabeth; Moreno, Andres
Mo 2C catalysts are widely used in hydrogenation reactions; however, the role of the C and Mo terminations in these catalysts is not clear. Understanding the binding of adsorbates is key for explaining the activity of Mo 2C. The adsorption of acetylene and ethylene, probe molecules representing alkynes and olefins, respectively, was studied in this paper on a β-Mo 2C(100) surface with C and Mo terminations using calculations based on periodic density functional theory. Moreover, the role of the C/Mo molar ratio was investigated to compare the catalytic potential of cubic (δ-MoC) and orthorhombic (β-Mo 2C) surfaces. The geometry andmore » electronic properties of the clean δ-MoC(001) and β-Mo 2C(100) surfaces have a strong influence on the binding of unsaturated hydrocarbons. The adsorption of ethylene is weaker than that of acetylene on the surfaces of the cubic and orthorhombic systems; adsorption of the hydrocarbons was stronger on β-Mo 2C(100) than on δ-MoC(001). The C termination in β-Mo 2C(100) actively participates in both acetylene and ethylene adsorption and is not merely a spectator. Finally, the results of this work suggest that the β-Mo 2C(100)-C surface could be the one responsible for the catalytic activity during the hydrogenation of unsaturated C≡C and C=C bonds, while the Mo-terminated surface could be poisoned or transformed by the strong adsorption of C and CH x fragments.« less
Jimenez-Orozco, Carlos; Florez, Elizabeth; Moreno, Andres; ...
2017-08-18
Mo 2C catalysts are widely used in hydrogenation reactions; however, the role of the C and Mo terminations in these catalysts is not clear. Understanding the binding of adsorbates is key for explaining the activity of Mo 2C. The adsorption of acetylene and ethylene, probe molecules representing alkynes and olefins, respectively, was studied in this paper on a β-Mo 2C(100) surface with C and Mo terminations using calculations based on periodic density functional theory. Moreover, the role of the C/Mo molar ratio was investigated to compare the catalytic potential of cubic (δ-MoC) and orthorhombic (β-Mo 2C) surfaces. The geometry andmore » electronic properties of the clean δ-MoC(001) and β-Mo 2C(100) surfaces have a strong influence on the binding of unsaturated hydrocarbons. The adsorption of ethylene is weaker than that of acetylene on the surfaces of the cubic and orthorhombic systems; adsorption of the hydrocarbons was stronger on β-Mo 2C(100) than on δ-MoC(001). The C termination in β-Mo 2C(100) actively participates in both acetylene and ethylene adsorption and is not merely a spectator. Finally, the results of this work suggest that the β-Mo 2C(100)-C surface could be the one responsible for the catalytic activity during the hydrogenation of unsaturated C≡C and C=C bonds, while the Mo-terminated surface could be poisoned or transformed by the strong adsorption of C and CH x fragments.« less
Sun, Jiangman; Dong, Xiao; Wang, Yajie; ...
2017-05-02
Geometric isomerism in polyacetylene is a basic concept in chemistry textbooks. Polymerization to cis-isomer is kinetically preferred at low temperature, not only in the classic catalytic reaction in solution but also, unexpectedly, in the crystalline phase when it is driven by external pressure without a catalyst. Until now, no perfect reaction route has been proposed for this pressure-induced polymerization. Using in situ neutron diffraction and meta-dynamic simulation, we discovered that under high pressure, acetylene molecules react along a specific crystallographic direction that is perpendicular to those previously proposed. Moreover, following this route produces a pure cis-isomer and more surprisingly, predictsmore » that graphane is the final product. Experimentally, polycyclic polymers with a layered structure were identified in the recovered product by solid-state nuclear magnetic resonance and neutron pair distribution functions, which indicates the possibility of synthesizing graphane under high pressure.« less
Fang, B; Zhang, M; Ge, K S; Xing, H Z; Ren, F Z
2018-06-01
Previous studies have demonstrated that the anti-tumor α-lactalbumin-oleic acid complex (α-LA-OA) may target the glycolysis of tumor cells. However, few data are available regarding the effects of α-LA-OA on energy metabolism. In this study, we measured glycolysis and mitochondrial functions in HeLa cells in response to α-LA-OA using the XF flux analyzer (Seahorse Bioscience, North Billerica, MA). The gene expression of enzymes involved in glycolysis, tricarboxylic acid cycle, electron transfer chain, and ATP synthesis were also evaluated. Our results show that α-LA-OA significantly enhanced the basal glycolysis and glycolytic capacity. Mitochondrial oxidative phosphorylation, including the basal respiration, maximal respiration, spare respiratory capacity and ATP production were also improved in response to α-LA-OA. The enhanced mitochondrial functions maybe partly due to the increased capacity of utilizing fatty acids and glutamine as the substrate. However, the gene expressions of pyruvate kinase M2, lactate dehydrogenase A, aconitate hydratase, and isocitrate dehydrogenase 1 were inhibited, suggesting an insufficient ability for the glycolysis process and the tricarboxylic acid cycle. The increased expression of acetyl-coenzyme A acyltransferase 2, a central enzyme involved in the β-oxidation of fatty acids, would enhance the unbalance due to the decreased expression of electron transfer flavoprotein β subunit, which acts as the electron acceptor. These results indicated that α-LA-OA may induce oxidative stress due to conditions in which the ATP production is exceeding the energy demand. Our results may help clarify the mechanism of apoptosis induced by reactive oxygen species and mitochondrial destruction. Copyright © 2018 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.
Cahoon, E B; Ripp, K G; Hall, S E; Kinney, A J
2001-01-26
Divergent forms of the plant Delta(12)-oleic-acid desaturase (FAD2) have previously been shown to catalyze the formation of acetylenic bonds, epoxy groups, and conjugated Delta(11),Delta(13)-double bonds by modification of an existing Delta(12)-double bond in C(18) fatty acids. Here, we report a class of FAD2-related enzymes that modifies a Delta(9)-double bond to produce the conjugated trans-Delta(8),trans-Delta(10)-double bonds found in calendic acid (18:3Delta(8trans,10trans,12cis)), the major component of the seed oil of Calendula officinalis. Using an expressed sequence tag approach, cDNAs for two closely related FAD2-like enzymes, designated CoFADX-1 and CoFADX-2, were identified from a C. officinalis developing seed cDNA library. The deduced amino acid sequences of these polypeptides share 40-50% identity with those of other FAD2 and FAD2-related enzymes. Expression of either CoFADX-1 or CoFADX-2 in somatic soybean embryos resulted in the production of calendic acid. In embryos expressing CoFADX-2, calendic acid accumulated to as high as 22% (w/w) of the total fatty acids. In addition, expression of CoFADX-1 and CoFADX-2 in Saccharomyces cerevisiae was accompanied by calendic acid accumulation when induced cells were supplied exogenous linoleic acid (18:2Delta(9cis,12cis)). These results are thus consistent with a route of calendic acid synthesis involving modification of the Delta(9)-double bond of linoleic acid. Regiospecificity for Delta(9)-double bonds is unprecedented among FAD2-related enzymes and further expands the functional diversity found in this family of enzymes.
Kumar, Davinder; Nguyen, Tho N; Grapperhaus, Craig A
2014-12-01
Kinetic investigations inspired by the metalloenzyme nitrile hydratase were performed on a series of ruthenium(II) complexes to determine the effect of sulfur oxidation on catalytic nitrile hydration. The rate of benzonitrile hydration was quantified as a function of catalyst, nitrile, and water concentrations. Precatalysts L(n)RuPPh3 (n = 1-3; L(1) = 4,7-bis(2'-methyl-2'-mercapto-propyl)-1-thia-4,7-diazacyclononane; L(2) = 4-(2'-methyl-2'-sulfinatopropyl)-7-(2'-methyl-2'-mercapto-propyl)-1-thia-4,7-diazacyclononane; L(3) = 4-(2'-methyl-2'-sulfinatopropyl)-7-(2'-methyl-2'-sulfenato-propyl)-1-thia-4,7-diazacyclononane) were activated by substitution of triphenylphosphine with substrate in hot dimethylformamide solution. Rate measurements are consistent with a dynamic equilibrium between inactive aqua (L(n)Ru-OH2) and active nitrile (L(n)Ru-NCR) derivatives with K = 21 ± 1, 9 ± 0.9, and 23 ± 3 for L(1) to L(3), respectively. Subsequent hydration of the L(n)Ru-NCR intermediate yields the amide product with measured hydration rate constants (k's) of 0.37 ± 0.01, 0.82 ± 0.07, and 1.59 ± 0.12 M(-1) h(-1) for L(1) to L(3), respectively. Temperature dependent studies reveal that sulfur oxidation lowers the enthalpic barrier by 27 kJ/mol, but increases the entropic barrier by 65 J/(mol K). Density functional theory (DFT) calculations (B3LYP/LanL2DZ (Ru); 6-31G(d) (all other atoms)) support a nitrile bound catalytic cycle with lowering of the reaction barrier as a consequence of sulfur oxidation through enhanced nitrile binding and attack of the water nucleophile through a highly organized transition state.
Disposition and biotransformation of the acetylenic retinoid tazarotene in humans.
Attar, Mayssa; Yu, Dale; Ni, Jinsong; Yu, Zhiling; Ling, Kah-Hiing John; Tang-Liu, Diane D-S
2005-10-01
Oral tazarotene, an acetylenic retinoid, is in clinical development for the treatment of psoriasis. The disposition and biotransformation of tazarotene were investigated in six healthy male volunteers, following a single oral administration of a 6 mg (100 microCi) dose of [14C]tazarotene, in a gelatin capsule. Blood levels of radioactivity peaked 2 h postdose and then rapidly declined. Total recovery of radioactivity was 89.2+/-8.0% of the administered dose, with 26.1+/-4.2% in urine and 63.0+/-7.0% in feces, within 7 days of dosing. Only tazarotenic acid, the principle active metabolite formed via esterase hydrolysis of tazarotene, was detected in blood. One major urinary oxidative metabolite, tazarotenic acid sulfoxide, accounted for 19.2+/-3.0% of the dose. The majority of radioactivity recovered in the feces was attributed to tazarotenic acid representing 46.9+/-9.9% of the dose and only 5.82+/-3.84% of dose was excreted as unchanged tazarotene. Thus following oral administration, tazarotene was rapidly absorbed and underwent extensive hydrolysis to tazarotenic acid, the major circulating species in the blood that was then excreted unchanged in feces. A smaller fraction of tazarotenic acid was further metabolized to an inactive sulfoxide that was excreted in the urine. Copyright (c) 2005 Wiley-Liss, Inc. and the American Pharmacists Association
Huang, Xian; Xie, Meihua
2002-12-13
beta-Phenylseleno-alpha-tolylsulfonyl-substituted alkenes were synthesized via the three-component conjugate-nucleophilic addition of acetylenic sulfones, phenylselenomagnesium bromide, and carbonyl compounds, such as aldehydes, aliphatic ketones, or alpha,beta-unsaturated enals or enones. The reaction is highly regio- and stereoselective with moderate to good yields. Functionalized allylic alcohols were obtained in the case of aldehydes and aliphatic ketones. In the case of alpha,beta-unsaturated enones, functionalized allylic alcohols or functionalized gamma,delta-unsaturated ketones were obtained, depending on the structures of the ketones.
Zhou, Xiaojie; Chen, Mohua; Zhou, Mingfei
2013-07-03
Reactions of vanadium dioxide molecules with acetylene have been studied by matrix isolation infrared spectroscopy. Reaction intermediates and products are identified on the basis of isotopic substitutions as well as density functional frequency calculations. Ground state vanadium dioxide molecule reacts with acetylene in forming the side-on-bonded VO2(η(2)-C2H2) and VO2(η(2)-C2H2)2 complexes spontaneously on annealing in solid neon. The VO2(η(2)-C2H2) complex is characterized to have a (2)B2 ground state with C2v symmetry, whereas the VO2(η(2)-C2H2)2 complex has a (2)A ground state with C2 symmetry. The VO2(η(2)-C2H2) and VO2(η(2)-C2H2)2 complexes are photosensitive. The VO2(η(2)-C2H2) complex rearranges to the OV(OH)CCH molecule upon UV-vis light excitation.
NASA Technical Reports Server (NTRS)
Yung, E.
1974-01-01
Mar Vel Black is a revolutionary new extremely low reflectivity anodized coating developed by Martin Marietta of Denver. It is of great interest in optics in general, and in star trackers specifically because it can reduce extraneous light reflections. A sample of Mar Vel Black was evaluated. Mar Vel Black looks much like a super black surface with many small peaks and very steep sides so that any light incident upon the surface will tend to reflect many times before exiting that surface. Even a high reflectivity surface would thus appear to have a very low reflectivity under such conditions. Conversely, acetylene soot does not have the magnified surface appearance of a super black surface. Its performance is, however, predictable from the surface structure, considering the known configuration of virtually pure carbon.
Sun, Jiangman; Dong, Xiao; Wang, Yajie; Li, Kuo; Zheng, Haiyan; Wang, Lijuan; Cody, George D; Tulk, Christopher A; Molaison, Jamie J; Lin, Xiaohuan; Meng, Yufei; Jin, Changqing; Mao, Ho-Kwang
2017-06-01
Geometric isomerism in polyacetylene is a basic concept in chemistry textbooks. Polymerization to cis-isomer is kinetically preferred at low temperature, not only in the classic catalytic reaction in solution but also, unexpectedly, in the crystalline phase when it is driven by external pressure without a catalyst. Until now, no perfect reaction route has been proposed for this pressure-induced polymerization. Using in situ neutron diffraction and meta-dynamic simulation, we discovered that under high pressure, acetylene molecules react along a specific crystallographic direction that is perpendicular to those previously proposed. Following this route produces a pure cis-isomer and more surprisingly, predicts that graphane is the final product. Experimentally, polycyclic polymers with a layered structure were identified in the recovered product by solid-state nuclear magnetic resonance and neutron pair distribution functions, which indicates the possibility of synthesizing graphane under high pressure. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
NASA Astrophysics Data System (ADS)
Altun, Zikri; Bleda, Erdi; Trindle, Carl
2017-09-01
Gas phase conversion of acetylene to benzene, assisted by a single metal cation such as Fe(+), Ru(+) and Rh(+), offers an attractive prospect for application of computational modelling techniques to catalytic processes. Gas phase processes are not complicated by environmental effects and the participation of a single metal atom is a significant simplification. Still the process is complex, owing to the possibility of several low-energy spin states and the abundance of alternative structures. By density functional theory modelling using recently developed models with range and dispersion corrections, we locate and characterise a number of extreme points on the FeC6H6(+) surface, some of which have not been described previously. These include eta-1, eta-2 and eta-3 complexes of Fe(+) with the C4H4 ring. We identify new FeC6H6(+) structures as well, which may be landmarks for the Fe(+)-catalysed production of benzene from acetylene. The Fe(+) benzene complex is the most stable species on the FeC6H6 cation surface. With the abundant energy of complexation available in the isolated gas phase species, detachment of the Fe(+) and production of benzene can be efficient. We address the issue raised by other investigators whether multi-configurational self-consistent field methods are essential to the proper description of these systems. We find that the relative energy of intrinsically multi-determinant doublets is strongly affected, but judge that the density functional theory (DFT) description provides more accurate estimates of energetics and a more plausible reaction path.
NASA Astrophysics Data System (ADS)
Bhalla, Tek Chand; Sharma, Monica; Sharma, Nitya Nand
Nitriles and amides are widely distributed in the biotic and abiotic components of our ecosystem. Nitrile form an important group of organic compounds which find their applications in the synthesis of a large number of compounds used as/in pharmaceutical, cosmetics, plastics, dyes, etc>. Nitriles are mainly hydro-lyzed to corresponding amide/acid in organic chemistry. Industrial and agricultural activities have also lead to release of nitriles and amides into the environment and some of them pose threat to human health. Biocatalysis and biotransformations are increasingly replacing chemical routes of synthesis in organic chemistry as a part of ‘green chemistry’. Nitrile metabolizing organisms or enzymes thus has assumed greater significance in all these years to convert nitriles to amides/ acids. The nitrile metabolizing enzymes are widely present in bacteria, fungi and yeasts. Yeasts metabolize nitriles through nitrilase and/or nitrile hydratase and amidase enzymes. Only few yeasts have been reported to possess aldoxime dehydratase. More than sixty nitrile metabolizing yeast strains have been hither to isolated from cyanide treatment bioreactor, fermented foods and soil. Most of the yeasts contain nitrile hydratase-amidase system for metabolizing nitriles. Transformations of nitriles to amides/acids have been carried out with free and immobilized yeast cells. The nitrilases of Torulopsis candida>and Exophiala oligosperma>R1 are enantioselec-tive and regiospecific respectively. Geotrichum>sp. JR1 grows in the presence of 2M acetonitrile and may have potential for application in bioremediation of nitrile contaminated soil/water. The nitrilase of E. oligosperma>R1 being active at low pH (3-6) has shown promise for the hydroxy acids. Immobilized yeast cells hydrolyze some additional nitriles in comparison to free cells. It is expected that more focus in future will be on purification, characterization, cloning, expression and immobilization of nitrile metabolizing
Westover, J B; Goodman, S I; Frerman, F E
2001-11-20
Glutaconyl-coenzyme A (CoA) is the presumed enzyme-bound intermediate in the oxidative decarboxylation of glutaryl-CoA that is catalyzed by glutaryl-CoA dehydrogenase. We demonstrated glutaconyl-CoA bound to glutaryl-CoA dehydrogenase after anaerobic reduction of the dehydrogenase with glutaryl-CoA. Glutaryl-CoA dehydrogenase also has intrinsic enoyl-CoA hydratase activity, a property of other members of the acyl-CoA dehydrogenase family. The enzyme rapidly hydrates glutaconyl-CoA at pH 7.6 with a k(cat) of 2.7 s(-1). The k(cat) in the overall oxidation-decarboxylation reaction at pH 7.6 is about 9 s(-1). The binding of glutaconyl-CoA was quantitatively assessed from the K(m) in the hydratase reaction, 3 microM, and the K(i), 1.0 microM, as a competitive inhibitor of the dehydrogenase. These values compare with K(m) and K(i) of 4.0 and 12.9 microM, respectively, for crotonyl-CoA. Glu370 is the general base catalyst in the dehydrogenase that abstracts an alpha-proton of the substrate to initiate the catalytic pathway. The mutant dehydrogenase, Glu370Gln, is inactive in the dehydrogenation and the hydratase reactions. However, this mutant dehydrogenase decarboxylates glutaconyl-CoA to crotonyl-CoA without oxidation-reduction reactions of the dehydrogenase flavin. Addition of glutaconyl-CoA to this mutant dehydrogenase results in a rapid, transient increase in long-wavelength absorbance (lambda(max) approximately 725 nm), and crotonyl-CoA is found as the sole product. We propose that this 725 nm-absorbing species is the delocalized crotonyl-CoA anion that follows decarboxylation and that the decay is the result of slow protonation of the anion in the absence of the general acid catalyst, Glu370(H(+)). In the absence of detectable oxidation-reduction, the data indicate that oxidation-reduction of the dehydrogenase flavin is not essential for decarboxylation of glutaconyl-CoA.
Brunel, Marc; Vallet, Marc
2007-02-19
We show that modulating the diode-pump power of a microchip solid-state laser enables to lock its wavelength to a reference molecular line. The method is applied to two different types of Er,Yb:glass monolithic microchip lasers operating at 1.53 microm. First, wavelength locking of a continuous-wave dual-polarization microchip laser to acetylene absorption lines is demonstrated, without using any additional modulator, internal or external. We then show that, remarkably, this simple method is also suitable for stabilizing a passively Q-switched microchip laser. A pulsed wavelength stability of 10(-8) over 1 hour is readily observed. Applications to lidars and to microwave photonics are discussed.
de Groot, Mattijs; Field, Robert W.; Buma, Wybren J.
2009-01-01
We report on an experimental approach that reveals crucial details of the composition of singlet-triplet mixed eigenstates in acetylene. Intersystem crossing in this prototypical polyatomic molecule embodies the mixing of the lowest excited singlet state (S1) with 3 triplet states (T1, T2, and T3). Using high-energy (157-nm) photons from an F2 laser to record excited-state photoelectron spectra, we have decomposed the mixed eigenstates into their S1, T3, T2, and T1 constituent parts. One example of the interpretive power that ensues from the selective sensitivity of the experiment to the individual electronic state characters is the discovery and examination of destructive interference between two doorway-mediated intersystem crossing pathways. This observation of an interference effect in nonradiative decay opens up possibilities for rational coherent control over molecular excited state dynamics. PMID:19179288
DOE Office of Scientific and Technical Information (OSTI.GOV)
Blackbourn, R.L.; Hupp, J.T.
1990-03-08
Intervalence charge-transfer data for acetylene-bridged biferrocene monocation (Bf{sup +}) have been collected in five solvents in the presence and absence of excess electrolyte and in the limit of infinite chromophore dilution. The study was motivated by earlier work which demonstrated that the intervalence absorption maximum for Bf{sup +} in methylene chloride could vary substantially with both chromophore concentration and added electrolyte concentration. In the present study similar (but smaller) variations are found in other solvents.
NASA Astrophysics Data System (ADS)
Hashemi, Robab; Rozario, Hoimonti; Povey, Chad; Garber, Jolene; Derksen, Mark; Predoi-Cross, Adriana
2014-06-01
The line positions for transitions in the ν1 +ν3 band are often used as a frequency standard by the telecom industry and also needed for planetary atmospheric studies. Four relevant studies have been recently carried out in our group and will be discussed briefly below. (1) N2-broadened line widths and N2-pressure induced line shifts have been measured for transitions in the ν1 +ν3 band of acetylene at seven temperatures in the range 213333K to obtain the temperature dependences of broadening and shift coefficients. The Voigt and hard-collision line profile models were used to retrieve the line parameters. This study has been published in Molecular Physics, 110 Issue 21/22 (2012) 2645-2663. (2) Six nitrogen perturbed transitions of acetylene within the ν1 +ν3 absorption band have been recorded using a 3-channel diode laser spectrometer. We have examined C2H2 spectra using a hard collision (Rautian) profile over a range of five temperatures (213 K-333 K). From these fits we have obtained the N2-broadening and narrowing coefficients of C2H2 and examined their temperature dependence. The experimentally measured narrowing coefficients have been used to estimate the nitrogen diffusion coefficients. The broadening coefficients and corresponding temperature dependence exponents have also been compared to that of calculations completed using a classical impact approach on an ab initio potential energy surface. We have observed a good agreement between our theoretical and experimental results. This study was published in Canadian Journal of Physics 91(11) 896-905 (2013). (3) An extension of the previous study was to analyze the room temperature for the same six transitions using the Voigt, Rautian, Galatry, RautianGalatry and Correlated Rautian profiles. For the entire pressure range, we have tested the applicability of these line-shape models. Except for Voigt profile, Dicke narrowing effect has been considered in all mentioned line-shape models. The experimental
The Synthesis of Phenyl Acetylene Phenols for Development of New Explosives
NASA Astrophysics Data System (ADS)
Chikhradze, Nikoloz; Nadirashvili, Merab; Khomeriki, Sergo; Varshanidze, Iasha
2017-12-01
The purpose of this research is to produce derivatives of simple phenols as “raw material” for the synthesis of new phenolic explosives. A big number of valuable products is synthesized from phenol and its homologues including well-known explosives - picric acid, methyl picrate, cresolite, etc. In general, a structural modification of well-known explosives’ molecules is the most important among the methods for the synthesis of new explosives. This method can be used in certain modifications. For example, the synthesis of methyl picrate is possible not only to replace picric acid’s hydroxyl with metoxyl, but with nitration of anisole as well, i. e, by the reciprocating synthesis. Thus, to produce the new analogues of well-known phenolic explosives, the preliminary modification of simple phenols’ molecules and further nitration, presumably by a formation of dinitro derivatives may be performed. The alkylation of phenol, anisole and m - cresol by the secondary phenyl acetylene alcohols in the presence of concentrated phosphoric acid was carried out. Para-substituted alkynyl phenols with high yields were developed. The chemical transformations were carried out by a participation of their molecules’ active centres. The corresponding ethers, esters and saturated isologues have been synthesized. The article describes the conditions of a synthesis of 14 new phenyl acetylenes’ substances that may be used as substrates in a nitration reaction.
Pagano, Justin Kane; Scott, Brian Lindley; Kiplinger, Jaqueline Loetsch
2018-06-09
Two new uranium metallacyclopropenes, (C 5Me 4R) 2U(η 2-Ph 2PC=CPPh 2) (R = Me, Et) were prepared by reducing the corresponding (C 5Me 4R) 2UCl 2 complexes with KC 8 in the presence of 1,2-bis(diphenylphosphino)acetylene (Ph 2P–C≡C–PPh 2). Both compounds were fully characterized by a combination of elemental analysis and multinuclear NMR, UV–visible–NIR, and IR spectroscopies. Differences in the electronic spectra of these novel compounds and the known (C 5Me 5) 2U(η 2-Me 3SiC=CSiMe 3) are discussed. Finally, also presented is the solid-state structure of (C 5Me 4Et) 2U(η 2-Ph 2PC=CPPh 2), which reveals significant distortions of the coordinated 1,2-bis(diphenylphosphino)acetylenemore » (Ph 2P–C≡C–PPh 2) ligand.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Pagano, Justin Kane; Scott, Brian Lindley; Kiplinger, Jaqueline Loetsch
Two new uranium metallacyclopropenes, (C 5Me 4R) 2U(η 2-Ph 2PC=CPPh 2) (R = Me, Et) were prepared by reducing the corresponding (C 5Me 4R) 2UCl 2 complexes with KC 8 in the presence of 1,2-bis(diphenylphosphino)acetylene (Ph 2P–C≡C–PPh 2). Both compounds were fully characterized by a combination of elemental analysis and multinuclear NMR, UV–visible–NIR, and IR spectroscopies. Differences in the electronic spectra of these novel compounds and the known (C 5Me 5) 2U(η 2-Me 3SiC=CSiMe 3) are discussed. Finally, also presented is the solid-state structure of (C 5Me 4Et) 2U(η 2-Ph 2PC=CPPh 2), which reveals significant distortions of the coordinated 1,2-bis(diphenylphosphino)acetylenemore » (Ph 2P–C≡C–PPh 2) ligand.« less
Daly, John W.; Karle, Isabella; Myers, Charles W.; Tokuyama, Takashi; Waters, James A.; Witkop, Bernhard
1971-01-01
The structures and absolute configuration of two unique alkaloids isolated from the Colombian frog, Dendrobates histrionicus, have been elucidated by Roentgen-ray (x-ray) crystallography. Histrionicotoxin is (2pR, 6S, 7pS, 8aS)-7-(cis-1-buten-3-ynyl)-8-hydroxy-2-(cis-2-penten-4- ynyl)-1-azaspiro[5.5] undecane, while in dihydro-isohistrionicotoxin the acetylenic 2-pentenynyl side chain is replaced by an allenic 2-(3,4 pentadienyl) substituent. Dendrobates histrionicus exhibits remarkable interpopulational variations in amounts and composition of skin toxins, in behavior, and in phenotypic characters, aspects of which are illustrated in a color plate. The histrionico-toxins are the third class of alkaloids isolated from the defensive skin secretions of Neotropical (Dendrobatidae) frogs. Images PMID:5288773
NASA Astrophysics Data System (ADS)
Okubo, Sho; Iwakuni, Kana; Yamada, Koichi M. T.; Inaba, Hajime; Onae, Atsushi; Hong, Feng-Lei; Sasada, Hiroyuki
2017-11-01
The ν1 +ν3 vibration band of acetylene (C2H2) in the near infrared region was recorded with a dual-comb Fourier-transform spectrometer. We observed 56 transitions from P (26) to R (29) at six different column densities. The integral line intensity was determined for each recorded absorption line by fitting the line profile to Lambert-Beer's law with a Voigt function. Thanks to the outstanding capability of dual-comb spectroscopy to cover a broad spectrum in a relatively short time with high resolution and high frequency precision, we determined the reliable line strength for each ro-vibrational transition as well as the transition dipole moment for this band.
Biochemical changes in rat liver after 18.5 days of spaceflight (41566)
NASA Technical Reports Server (NTRS)
Abraham, S.; Lin, C.Y.; Volkmann, C. M.; Klein, H. P.
1983-01-01
The effect of weightlessness on liver metabolism was investigated using tissue from rats flown in earth orbit for 18.5 days on the Soviet Cosmos 936 biosatellite and the changes in the activities of 28 carbohydrate and lipid enzymes were determined. The activities of two enzymes, palmitoyl-CoA desaturase and lactate dehydrogenase, increased, while the activities of five, glycogen phosphorylase, 6-phosphogluconate dehydrogenase, both acyltransferases which act on alpha-glycerolphosphate and diglycerides, and and aconitate hydratase decreased. The other enzyme activities were found to be unchanged. In addition, increased levels of liver glycogen and palmitoleate were detected which probably resulted from the lowered glycogen phosphorylase and increased palmitoyl-CoA desaturase activities, respectively, in those animals that experienced weightlessness. All of the changes observed in the rats after 18.5 days of spaceflight disappear by 25 days after the flight.
NASA Technical Reports Server (NTRS)
Woon, David E.
2007-01-01
Addition-elimination reactions of S atom in its P-3 ground state with acetylene (C2H2) and ethylene (C2H4) were characterized with both molecular orbital and density functional theory calculations employing correlation consistent basis sets in order to assess the likelihood either reaction might play a general role in astrochemistry or a specific role in the formation of S2 (X (sup 3 SIGMA (sub g) (sup -)) via a mechanism proposed by Saxena and Misra (Mon. Not. R. Astron. Soc. 1995, 272, 89). The acetylene and ethylene reactions proceed through C2H2S ((sup 3)A")) and C2H4S ((sup 3)A")) intermediates, respectively, to yield HCCS ((sup 2)II)) and C2H3S ((sup 2)A')). Substantial barriers were found in the exit channels for every combination of method and basis set considered in this work, which effectively precludes hydrogen elimination pathways for both S + C2H2 and S + C2H4 in the ultracold interstellar medium where only very modest barriers can be surmounted and processes without barriers tend to predominate. However, if one or both intermediates is formed and stabilized efficiently under cometary or dense interstellar cloud conditions, they could serve as temporary reservoirs for S atom and participate in reactions such as S + C2H2S (right arrow) S2 = C2H2 or S + C2H4S (right arrow) S2 + C2H4. For formation and stabilization to be efficient, the reaction must possess a barrier height small enough to be surmountable at low temperatures yet large enough to prevent redissociation to reactants. Barrier heights computed with B3LYP and large basis sets are very low, but more rigorous QCISD(T) and RCCSD(T) results indicate that the barrier heights are closer to 3-4 kcal/mol. The calculations therefore indicate that S + C2H2 or S + C2H4 could contribute to the formation of S2 in comets and may serve as a means to gauge coma temperature. The energetics of the ethylene reaction are more favorable.
NASA Astrophysics Data System (ADS)
Sabri, Siti Noorzidah Mohd; Othman, Rohaya; Othman, Anuar
2017-12-01
Precipitated calcium carbonate (PCC) is also known as synthetic calcium carbonate. In this paper, PCC was synthesized from carbide lime, which is the by-product from acetylene gas industry. The method used to produce PCC from carbide lime waste was ionic sucrose precipitation technique. The experiments were performed by varying the stirring rate. In this technique, carbide lime was first dissolved in ionic sucrose solution and then chilled at 10 °C for 24 hours before carbon dioxide gasses was introduced into the solution. The carbonation and precipitation process was took place and PCC was formed. The PCC was further filtered to obtain the solid PCC. The sample was then further characterised by using FESEM and XRD to determine the morphology and to identify the phase that exists in the synthesized compound respectively. The XRD and FESEM results clearly shown that the PCC obtained has mixed phases of calcite and vaterite, with mixtures of spherical and irregular shape morphologies formed. The irregular shapes corresponded to vaterite formation, meanwhile spherical shapes corresponded to calcite formation.
Enzymes are complex proteins that cause a specific chemical change in all parts of the body. For ... use them. Blood clotting is another example of enzymes at work. Enzymes are needed for all body ...
Mercimek-Mahmutoglu, Saadet; Tucker, Tracy; Casey, Brett
2011-11-01
We describe two siblings with 3-methylglutaconic aciduria type I with phenotypic heterogeneity. The index case was a 14-year-old female with learning disability, attention deficit-hyperactivity and early onset subclinical leukoencephalopathy. Her 9-year-old brother had severe expressive speech delay and delay in speech sound development with normal cognitive functions. The diagnosis was confirmed by a demonstration of 3-methylglutaconyl-CoA hydratase enzyme deficiency in the cultured skin fibroblasts and homozygous deletion of exons 1-3 within the AUH gene. Copyright © 2011. Published by Elsevier Inc.
NASA Astrophysics Data System (ADS)
Jacquemart, David; Lyulin, Oleg; Perevalov, Valery I.
2017-12-01
A new recommended 12C2H2 line list for the 13-248 cm-1 and 390-634 cm-1 regions is presented. It is based on the results of the global modeling of the line positions and intensities performed in Tomsk within the framework of the method of effective operators. To validate the Tomsk calculations new measurements of both line positions and intensities were performed using acetylene spectra recorded between 25 and 680 cm-1 with the AILES-A beamline of SOLEIL synchrotron. Line positions and intensities of 627 transitions belonging to 9 bands have been measured for the first time in this region. Using the results of these new measurements and the published results of the measurements in the 13-248 cm-1 and 390-634 cm-1 regions performed with the same facilities new fittings of the line intensities for the ΔP=0 and ΔP=1 series of transitions have been performed. Here P=5v1+3v2+5v3+v4+v5 is a polyad number, where v1, v2, v3, v4, and v5 are the principal quantum numbers of the acetylene harmonic oscillators. These new sets of the effective dipole moment parameters were used to generate the line list which contains the line positions and intensities of 39 and 29 bands, respectively for the ΔP=0 and ΔP=1 series of transitions. None of these bands is present in the HITRAN 2012 [8] and GEISA 2015 [9] databases. This paper presents the first part of a global work on the validation of Tomsk calculations.
Bate, Paul; Warwicker, Jim
2004-07-02
Calculations of charge interactions complement analysis of a characterised active site, rationalising pH-dependence of activity and transition state stabilisation. Prediction of active site location through large DeltapK(a)s or electrostatic strain is relevant for structural genomics. We report a study of ionisable groups in a set of 20 enzymes, finding that false positives obscure predictive potential. In a larger set of 156 enzymes, peaks in solvent-space electrostatic properties are calculated. Both electric field and potential match well to active site location. The best correlation is found with electrostatic potential calculated from uniform charge density over enzyme volume, rather than from assignment of a standard atom-specific charge set. Studying a shell around each molecule, for 77% of enzymes the potential peak is within that 5% of the shell closest to the active site centre, and 86% within 10%. Active site identification by largest cleft, also with projection onto a shell, gives 58% of enzymes for which the centre of the largest cleft lies within 5% of the active site, and 70% within 10%. Dielectric boundary conditions emphasise clefts in the uniform charge density method, which is suited to recognition of binding pockets embedded within larger clefts. The variation of peak potential with distance from active site, and comparison between enzyme and non-enzyme sets, gives an optimal threshold distinguishing enzyme from non-enzyme. We find that 87% of the enzyme set exceeds the threshold as compared to 29% of the non-enzyme set. Enzyme/non-enzyme homologues, "structural genomics" annotated proteins and catalytic/non-catalytic RNAs are studied in this context.
2006-09-05
NA NA no yes BMAA1128 ABC Transporter 3 GGGAAACGCGAAAC 6 5 yes no BMAA1873 Hypothetical protein 4 No (-C) NA NA no yes BMAA1868 Aconitate hydratase 5...no yes BMAA1868 Aconitate hydratase 3 GTGCTGTC 21 22 no yes BMAA0375 Transcriptional regulator Human Blood 1 TTGGCGC 111 109 no no BMAA1866 Conserved...NA NA no yes BMAA1128 ABC transporter 5 No (-C) NA NA no yes BMAA1868 Aconitate hydratase NA: Not applicable.Page 3 of 11 (page number not for
Microgravity Superagglomerates Produced By Silane And Acetylene
NASA Technical Reports Server (NTRS)
Gokoglu, Suleyman (Technical Monitor); Bundy, Matthew; Mulholland, George W.; Manzello, Samuel; Yang, Jiann; Scott, John Henry; Sivathanu, Yudaya
2003-01-01
The size of the agglomerates produced in the upper portion of a flame is important for a variety of applications. Soot particle size and density effect the amount of radiative heat transfer from a fire to its surroundings. Particle size determines the lifetime of smoke in a building or in the atmosphere, and exposure hazard for smoke inhaled and deposited in the lungs. The visibility through a smoke layer and dectectability of the smoke are also greatly affected by agglomerate size. Currently there is limited understanding of soot growth with an overall dimension of 10 m and larger. In the case of polystyrene, smoke agglomerates in excess of 1 mm have been observed raining out from large fires. Unlike hydrocarbon fuels, silane has the advantage that silica particles are the major combustion product resulting in a particle volume fraction a factor of ten greater than that for a carbonaceous smoke. There are two very desirable properties of silica aero-gels that are important for both space and earth based applications. The first important property is its inertness to most oxidizing and reducing atmospheres. Therefore, silica aero-gels make excellent fire ablatives and can be used in very demanding applications. The second important property is that silica aero-gels are expected to have very high porosity (greater than 0.999), making them lightweight and ideal for aerospace applications. The added benefit of the high porosity is that they can be used as extremely efficient filters for many earth based applications as well. Evidence of the formation of superagglomerates in a laminar acetylene/air diffusion flame was found by Sorensen et al. [1]. An interconnecting web of super-agglomerates was observed to span the width of the soot plume in the region just above the flame tip and described as a gel state. It was observed that this gel state immediately breaks up into agglomerates as larges as 100 m due to buoyancy induced turbulence. Large soot agglomerates were
Ohe, Chisato; Smith, Steven C; Sirohi, Deepika; Divatia, Mukul; de Peralta-Venturina, Mariza; Paner, Gladell P; Agaimy, Abbas; Amin, Mitual B; Argani, Pedram; Chen, Ying-Bei; Cheng, Liang; Colecchia, Maurizio; Compérat, Eva; Werneck da Cunha, Isabela; Epstein, Jonathan I; Gill, Anthony J; Hes, Ondřej; Hirsch, Michelle S; Jochum, Wolfram; Kunju, Lakshmi P; Maclean, Fiona; Magi-Galluzzi, Cristina; McKenney, Jesse K; Mehra, Rohit; Nesi, Gabriella; Osunkoya, Adeboye O; Picken, Maria M; Rao, Priya; Reuter, Victor E; de Oliveira Salles, Paulo Guilherme; Schultz, Luciana; Tickoo, Satish K; Tomlins, Scott A; Trpkov, Kiril; Amin, Mahul B
2018-03-01
Renal medullary carcinomas (RMCs) and collecting duct carcinomas (CDCs) are rare subsets of lethal high-stage, high-grade distal nephron-related adenocarcinomas with a predilection for the renal medullary region. Recent findings have established an emerging group of fumarate hydratase (FH)-deficient tumors related to hereditary leiomyomatosis and renal cell carcinoma (HLRCC-RCCs) syndrome within this morphologic spectrum. Recently developed, reliable ancillary testing has enabled consistent separation between these tumor types. Here, we present the clinicopathologic features and differences in the morphologic patterns between RMC, CDC, and FH-deficient RCC in consequence of these recent developments. This study included a total of 100 cases classified using contemporary criteria and ancillary tests. Thirty-three RMCs (SMARCB1/INI1-deficient, hemoglobinopathy), 38 CDCs (SMARCB1/INI1-retained), and 29 RCCs defined by the FH-deficient phenotype (FH/2SC or FH/2SC with FH mutation, regardless of HLRCC syndromic stigmata/history) were selected. The spectrum of morphologic patterns was critically evaluated, and the differences between the morphologic patterns present in the 3 groups were analyzed statistically. Twenty-five percent of cases initially diagnosed as CDC were reclassified as FH-deficient RCC on the basis of our contemporary diagnostic approach. Among the different overlapping morphologic patterns, sieve-like/cribriform and reticular/yolk sac tumor-like patterns favored RMCs, whereas intracystic papillary and tubulocystic patterns favored FH-deficient RCC. The tubulopapillary pattern favored both CDCs and FH-deficient RCCs, and the multinodular infiltrating papillary pattern favored CDCs. Infiltrating glandular and solid sheets/cords/nested patterns were not statistically different among the 3 groups. Viral inclusion-like macronucleoli, considered as a hallmark of HLRCC-RCCs, were observed significantly more frequently in FH-deficient RCCs. Despite the
NASA Technical Reports Server (NTRS)
Dunder, T.; Miller, R. E.
1990-01-01
A method is described for forming and spectroscopically characterizing cryogenic aerosols formed in a low temperature gas cell. By adjusting the cell pressure, gas composition and flow rate, the size distribution of aerosol particles can be varied over a wide range. The combination of pressure and flow rate determine the residence time of the aerosols in the cell and hence the time available for the particles to grow. FTIR spectroscopy, over the range from 600/cm to 6000/cm, is used to characterize the aerosols. The particle size distribution can be varied so that, at one extreme, the spectra show only absorption features associated with the infrared active vibrational bands and, at the other, they display both absorption and Mie scattering. In the latter case, Mie scattering theory is used to obtain semiquantitative aerosol size distributions, which can be understood in terms of the interplay between nucleation and condensation. In the case of acetylene aerosols, the infrared spectra suggest that the particles exist in the high temperature cubic phase of the solid.
Kaspar, H F; Tiedje, J M
1981-03-01
15N tracer methods and gas chromatography coupled to an electron capture detector were used to investigate dissimilatory reduction of nitrate and nitrite by the rumen microbiota of a fistulated cow. Ammonium was the only 15N-labeled end product of quantitative significance. Only traces of nitrous oxide were detected as a product of nitrate reduction; but in experiments with nitrite, up to 0.3% of the added nitrogen accumulated as nitrous oxide, but it was not further reduced. Furthermore, when 13NO3- was incubated with rumen microbiota virtually no [13N]N2 was produced. Acetylene partially inhibited the reduction of nitrite to ammonium as well as the formation of nitrous oxide. It is suggested that in the rumen ecosystem nitrous oxide is a byproduct of dissimilatory nitrite reduction to ammonium rather than a product of denitrification and that the latter process is absent from the rumen habitat.
Saunders, G.C.
1982-03-04
The disclosure relates to the quantitation of a primary enzyme concentration by utilizing a substrate for the primary enzyme labeled with a second enzyme which is an indicator enzyme. Enzyme catalysis of the substrate occurs and results in release of the indicator enzyme in an amount directly proportional to the amount of primary enzyme present. By quantifying the free indicator enzyme one determines the amount of primary enzyme present.
Alderson, Rosanna G.; Ferrari, Luna De; Mavridis, Lazaros; McDonagh, James L.; Mitchell, John B. O.; Nath, Neetika
2012-01-01
Over the last 50 years, sequencing, structural biology and bioinformatics have completely revolutionised biomolecular science, with millions of sequences and tens of thousands of three dimensional structures becoming available. The bioinformatics of enzymes is well served by, mostly free, online databases. BRENDA describes the chemistry, substrate specificity, kinetics, preparation and biological sources of enzymes, while KEGG is valuable for understanding enzymes and metabolic pathways. EzCatDB, SFLD and MACiE are key repositories for data on the chemical mechanisms by which enzymes operate. At the current rate of genome sequencing and manual annotation, human curation will never finish the functional annotation of the ever-expanding list of known enzymes. Hence there is an increasing need for automated annotation, though it is not yet widespread for enzyme data. In contrast, functional ontologies such as the Gene Ontology already profit from automation. Despite our growing understanding of enzyme structure and dynamics, we are only beginning to be able to design novel enzymes. One can now begin to trace the functional evolution of enzymes using phylogenetics. The ability of enzymes to perform secondary functions, albeit relatively inefficiently, gives clues as to how enzyme function evolves. Substrate promiscuity in enzymes is one example of imperfect specificity in protein-ligand interactions. Similarly, most drugs bind to more than one protein target. This may sometimes result in helpful polypharmacology as a drug modulates plural targets, but also often leads to adverse side-effects. Many cheminformatics approaches can be used to model the interactions between druglike molecules and proteins in silico. We can even use quantum chemical techniques like DFT and QM/MM to compute the structural and energetic course of enzyme catalysed chemical reaction mechanisms, including a full description of bond making and breaking. PMID:23116471
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kostov, Rumen V.; Knatko, Elena V.; McLaughlin, Lesley A.
The acetylenic tricyclic bis(cyanoenone) TBE-31 is a highly potent cysteine targeting compound with a reversible covalent mode of action; its best-characterized target being Kelch-like ECH-associated protein-1 (Keap1), the cellular sensor for oxidants and electrophiles. TBE-31 reacts with cysteines of Keap1, impairing its ability to target nuclear factor-erythroid 2 p45-related factor 2 (Nrf2) for degradation. Consequently, Nrf2 accumulates and orchestrates cytoprotective gene expression. In this study we investigated the pharmacokinetic and pharmacodynamic properties of TBE-31 in C57BL/6 mice. After a single oral dose of 10 μmol/kg (∼200 nmol/animal), the concentration of TBE-31 in blood exhibited two peaks, at 22.3 nM and at 15.5 nM, 40 minmore » and 4 h after dosing, respectively, as determined by a quantitative stable isotope dilution LC-MS/MS method. The AUC{sub 0–24h} was 195.5 h/nmol/l, the terminal elimination half-life was 10.2 h, and the k{sub el} was 0.068 h{sup −1}. To assess the pharmacodynamics of Nrf2 activation by TBE-31, we determined the enzyme activity of its prototypic target, NAD(P)H:quinone oxidoreductase 1 (NQO1) and found it elevated by 2.4- and 1.5-fold in liver and heart, respectively. Continuous feeding for 18 days with diet delivering the same daily doses of TBE-31 under conditions of concurrent treatment with the immunosuppressive agent azathioprine had a similar effect on Nrf2 activation without any indications of toxicity. Together with previous reports showing the cytoprotective effects of TBE-31 in animal models of carcinogenesis, our results demonstrate the high potency, efficacy and suitability for chronic administration of cysteine targeting reversible covalent drugs. - Highlights: • TBE-31 is a cysteine targeting compound with a reversible covalent mode of action. • After a single oral dose, the blood concentration of TBE-31 exhibits two peaks. • Oral TBE-31 is a potent activator of Nrf2-dependent enzymes
Aouad, Mohamed R
2014-11-18
A series of Schiff and Mannich bases derived from 4-amino-5-(3-fluoro-phenyl)-2,4-dihydro-3H-1,2,4-triazole-3-thione were synthesized. The alkylation of 4-phenyl-5-(3-fluorophenyl)-2,4-dihydro-3H-1,2,4-triazole-3-thione with propargyl bromide afforded the corresponding thiopropargylated derivative which upon treatment with the appropriate secondary amines in the presence of CuCl2 furnished the desired acetylenic Mannich bases. The synthesized compounds were characterized on the basis of their spectral (IR, 1H- and 13C-NMR) data and evaluated for their biological activities. Some of the compounds were found to exhibit significant antimicrobial activity.
Li, Xupeng; Meng, Xianhong; Luo, Kun; Luan, Sheng; Cao, Baoxiang; Kong, Jie
2017-04-01
In the present study a cDNA encoding a phosphopyruvate hydratase (enolase) was cloned from the muscle of the Chinese shrimp (Fenneropenaeus chinensis) and named as FcEnolase. The cDNA of FcEnolase encoded a protein of 434 amino acid residues with a molecular mass 47.22 kDa. The residues 342-355 constituted the signature motif "LLLKVNQIGSVTES". A SNP locus (C96T) in the ORF at 96 bp was identified. The results showed that the FcEnolase was a conserved gene. In the normal F. chinensis, the mRNA level in the muscle was much higher (P < 0.05) than the mRNA level in the gill and hepatopancreas. To verify the mRNA level of FcEnolase in the F. chinensis post WSSV infection, a real-time RT-PCR was performed. In the WSSV-infected F. chinensis, the FcEnolase mRNA level was significantly (P < 0.05) up-regulated in the muscle at 12 and 24 h post challenge (hpc) to approximately 2.7-fold and 2.7-fold the mRNA level in the controls, respectively. The FcEnolase mRNA level in the gill was significantly (P < 0.05) down-regulated at 6 hpc to approximately 0.3-fold the mRNA level in the control, followed by a significant (P < 0.05) up-regulation at 12 hpc to approximately 2.8-fold the mRNA level in the control. There was no obvious change of FcEnolase mRNA level in the hepatopancreas during the infection process. The expression profile coincided with the fact that WSSV primarily infects the tissues of muscle and gill, but hardly infects hepatopancreas. To verify the protein level of FcEnolase post WSSV infection, a Western blot was performed. The FcEnolase protein level in the muscle at 24 hpc significantly (P < 0.05) increased to approximately 2.1-fold the level in the control. These results showed the characterization of FcEnolase and suggested that the FcEnolase might be involved in the response of F. chinensis to WSSV infection. Copyright © 2017 Elsevier Ltd. All rights reserved.
Enzyme nanoparticle fabrication: magnetic nanoparticle synthesis and enzyme immobilization.
Johnson, Patrick A; Park, Hee Joon; Driscoll, Ashley J
2011-01-01
Immobilized enzymes are drawing significant attention for potential commercial applications as biocatalysts by reducing operational expenses and by increasing process utilization of the enzymes. Typically, immobilized enzymes have greater thermal and operational stability at various pH values, ionic strengths and are more resistant to denaturation that the soluble native form of the enzyme. Also, immobilized enzymes can be recycled by utilizing the physical or chemical properties of the supporting material. Magnetic nanoparticles provide advantages as the supporting material for immobilized enzymes over competing materials such as: higher surface area that allows for greater enzyme loading, lower mass transfer resistance, less fouling effect, and selective, nonchemical separation from the reaction mixture by an applied a magnetic field. Various surface modifications of magnetic nanoparticles, such as silanization, carbodiimide activation, and PEG or PVA spacing, aid in the binding of single or multienzyme systems to the particles, while cross-linking using glutaraldehyde can also stabilize the attached enzymes.
Dai, Yumin; Kizjakina, Karina; Campbell, Ashley C; Korasick, David A; Tanner, John J; Sobrado, Pablo
2018-01-04
The flavin-dependent enzyme 2-haloacrylate hydratase (2-HAH) catalyzes the conversion of 2-chloroacrylate, a major component in the manufacture of acrylic polymers, to pyruvate. The enzyme was expressed in Escherichia coli, purified, and characterized. 2-HAH was shown to be monomeric in solution and contained a non-covalent, yet tightly bound, flavin adenine dinucleotide (FAD). Although the catalyzed reaction was redox-neutral, 2-HAH was active only in the reduced state. A covalent flavin-substrate intermediate, consistent with the flavin-acrylate iminium ion, was trapped with cyanoborohydride and characterized by mass spectrometry. Small-angle X-ray scattering was consistent with 2-HAH belonging to the succinate dehydrogenase/fumarate reductase family of flavoproteins. These studies establish 2-HAH as a novel noncanonical flavoenzyme. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Kaspar, H F; Tiedje, J M
1981-01-01
15N tracer methods and gas chromatography coupled to an electron capture detector were used to investigate dissimilatory reduction of nitrate and nitrite by the rumen microbiota of a fistulated cow. Ammonium was the only 15N-labeled end product of quantitative significance. Only traces of nitrous oxide were detected as a product of nitrate reduction; but in experiments with nitrite, up to 0.3% of the added nitrogen accumulated as nitrous oxide, but it was not further reduced. Furthermore, when 13NO3- was incubated with rumen microbiota virtually no [13N]N2 was produced. Acetylene partially inhibited the reduction of nitrite to ammonium as well as the formation of nitrous oxide. It is suggested that in the rumen ecosystem nitrous oxide is a byproduct of dissimilatory nitrite reduction to ammonium rather than a product of denitrification and that the latter process is absent from the rumen habitat. PMID:7224631
Isotope effect in acetylene C2H2 and C2D2 rotations on Cu(001)
NASA Astrophysics Data System (ADS)
Shchadilova, Yulia E.; Tikhodeev, Sergei G.; Paulsson, Magnus; Ueba, Hiromu
2014-04-01
A comprehensive analysis of the elementary processes behind the scanning tunneling microscope controlled rotation of C2H2 and C2D2, isotopologues of a single acetylene molecule adsorbed on the Cu(001) surface, is given, with a focus on the isotope effects. With the help of density-functional theory we calculate the vibrational modes of C2H2 and C2D2 on Cu(001) and estimate the anharmonic couplings between them, using a simple strings-on-rods model. The probability of the elementary processes, nonlinear and combination band, is estimated using the Keldysh diagram technique. This allows us to clarify the main peculiarities and the isotope effects of the C2H2 and C2D2 on Cu(001) rotation, discovered in the pioneering work [B. C. Stipe et al., Phys. Rev. Lett. 81, 1263 (1998), 10.1103/PhysRevLett.81.1263], which have not been previously understood.
Influence of resonant collisions on the self-broadening of acetylene
NASA Astrophysics Data System (ADS)
Lehmann, Kevin K.
2017-03-01
Iwakuni et al. [Phys. Rev. Lett. 117, 143902 (2016)] have reported an ortho-para alternation of ˜10% in the self pressure broadening coefficients for ro-vibrational lines of the C2H2 transitions in the ν1+ν3 C-H (local mode) overtone band near 197 THz (1.52 μm). These authors attributed this effect to the contribution of resonant collisions, where the rotational energy change of one molecule is exactly compensated by the rotational energy change of its collision partner. Resonant collisions are known to be important in the case of self pressure broadening of highly polar molecules, such as HCN, but have not previously been invoked in the case of nonpolar molecules, such as acetylene, where the long range potential is dominated by the quadrupole-quadrupole electrostatic interaction. In the present work, the simple semiclassical Anderson-theory approach is used to estimate the rates of C2H2-C2H2 rotationally inelastic collisions and these used to predict pressure broadening rates, ignoring other contributions to the broadening, which should not have resonant enhancements. It is found that exactly resonant collisions do not make a major contribution to the broadening and these calculations predict an ortho-para alternation of the pressure broadening coefficients far below what was inferred by Iwakuni et al. The present results are consistent with a large body of published work that reported self-broadening coefficients of C2H2 ro-vibrational transitions that found negligible dependence on the vibrational transition and no even-odd alternation, even for Q and S branch transitions where any such effect is predicted to be much larger than for the P and R branch transitions studied by Iwakuni et al.
An Experimental and Theoretical Study of Nitrogen-Broadened Acetylene Lines
NASA Technical Reports Server (NTRS)
Thibault, Franck; Martinez, Raul Z.; Bermejo, Dionisio; Ivanov, Sergey V.; Buzykin, Oleg G.; Ma, Qiancheng
2014-01-01
We present experimental nitrogen-broadening coefficients derived from Voigt profiles of isotropic Raman Q-lines measured in the 2 band of acetylene (C2H2) at 150 K and 298 K, and compare them to theoretical values obtained through calculations that were carried out specifically for this work. Namely, full classical calculations based on Gordon's approach, two kinds of semi-classical calculations based on Robert Bonamy method as well as full quantum dynamical calculations were performed. All the computations employed exactly the same ab initio potential energy surface for the C2H2N2 system which is, to our knowledge, the most realistic, accurate and up-to-date one. The resulting calculated collisional half-widths are in good agreement with the experimental ones only for the full classical and quantum dynamical methods. In addition, we have performed similar calculations for IR absorption lines and compared the results to bibliographic values. Results obtained with the full classical method are again in good agreement with the available room temperature experimental data. The quantum dynamical close-coupling calculations are too time consuming to provide a complete set of values and therefore have been performed only for the R(0) line of C2H2. The broadening coefficient obtained for this line at 173 K and 297 K also compares quite well with the available experimental data. The traditional Robert Bonamy semi-classical formalism, however, strongly overestimates the values of half-width for both Qand R-lines. The refined semi-classical Robert Bonamy method, first proposed for the calculations of pressure broadening coefficients of isotropic Raman lines, is also used for IR lines. By using this improved model that takes into account effects from line coupling, the calculated semi-classical widths are significantly reduced and closer to the measured ones.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Spanjers, Charles S.; Sim, Richard S.; Sturgis, Nicholas P.
2015-10-30
The structures of ZnO-supported Ni catalysts were explored with in situ X-ray absorption spectroscopy, temperature-programmed reduction, X-ray diffraction, high-resolution transmission electron microscopy (HRTEM), scanning transmission electron microscopy, and electron energy loss spectroscopy. Calcination of nickel nitrate on a nanoparticulate ZnO support at 450 °C results in the formation of Zn-doped NiO (ca. N₀̣̣₈₅ Zn₀̣̣₁₅O) nanoparticles with the rock salt crystal structure. Subsequent in situ reduction monitored by X-ray absorption near-edge structure (XANES) at the Ni K edge reveals a direct transformation of the Zn-doped NiO nanoparticles to a face-centered cubic alloy, Ni 1-xZn x, at ~400 °C with x increasingmore » with increasing temperature. Both in situ XANES and ex situ HRTEM provide evidence for intermetallic β₁-NiZn formation at ~550 °C. In comparison to a Ni/SiO₂ catalyst, Ni/ZnO necessitates a higher temperature for the reduction of Ni II to Ni⁰, which highlights the strong interaction between Ni and the ZnO support. The catalytic activity for acetylene removal from an ethylene feed stream is decreased by a factor of 20 on Ni/ZnO in comparison to Ni/SiO₂. The decrease in catalytic activity of Ni/ZnO is accompanied by a reduced absolute selectivity to ethylene. H–D exchange measurements demonstrate a reduced ability of Ni/ZnO to dissociate hydrogen in comparison to Ni/SiO₂.These results of the catalytic experiments suggest that the catalytic properties are controlled, in part, by the zinc oxide support and stress the importance of reporting absolute ethylene selectivity for the catalytic semihydrogenation of acetylene in excess ethylene.« less
Huang, Mao Dong; Becker-Ross, Helmut; Florek, Stefan; Heitmann, Uwe; Okruss, Michael
2005-08-01
Determination of sulfur in wine is an important analytical task, particularly with regard to food safety legislation, wine trade, and oenology. Hitherto existing methods for sulfur determination all have specific drawbacks, for example high cost and time consumption, poor precision or selectivity, or matrix effects. In this paper a new method, with low running costs, is introduced for direct, reliable, rapid, and accurate determination of the total sulfur content of wine samples. The method is based on measurement of the molecular absorption of carbon monosulfide (CS) in an ordinary air-acetylene flame by using a high-resolution continuum-source atomic-absorption spectrometer including a novel high-intensity short-arc xenon lamp. First results for total sulfur concentrations in different wine samples were compared with data from comparative ICP-MS measurements. Very good agreement within a few percent was obtained.
NASA Astrophysics Data System (ADS)
Carlson, R. W.; Baines, K. H.; Anderson, M. S.; Filacchione, G.; Simon, A. A.
2016-08-01
The high altitude of Jupiter's Great Red Spot (GRS) may enhance the upward flux of gaseous ammonia (NH3) into the high troposphere, where NH3 molecules can be photodissociated and initiate a chain of chemical reactions with downwelling acetylene molecules (C2H2). These reactions, experimentally studied earlier by (Ferris and Ishikawa [1987] Nature 326, 777-778) and (Ferris and Ishikawa [1988] J. Amer. Chem. Soc. 110, 4306-4312), produce chromophores that absorb in the visible and ultraviolet regions. In this work we photolyzed mixtures of NH3 and C2H2 using ultraviolet radiation with a wavelength of 214 nm and measured the spectral transmission of the deposited films in the visible region (400-740 nm). From these transmission data we estimated the imaginary indices of refraction. Assuming that ammonia grains at the top of the GRS clouds are coated with this material, we performed layered sphere and radiative transfer calculations to predict GRS reflection spectra. Comparison of those results with observed and previously unreported Cassini visible spectra and with true-color images of the GRS show that the unknown GRS chromophore is spectrally consistent with the coupled NH3-C2H2 photochemical products produced in our laboratory experiments. Using high-resolution mass spectrometry and infrared spectroscopy we infer that the chromophore-containing residue is composed of aliphatic azine, azo, and diazo compounds.
Chromophores from photolyzed ammonia reacting with acetylene: Application to Jupiters Great Red Spot
NASA Technical Reports Server (NTRS)
Carlson, Robert W.; Baines, Kevin H.; Anderson, M. S.; Filacchione, G.; Simon, A. A.
2016-01-01
The high altitude of Jupiter's Great Red Spot (GRS) may enhance the upward flux of gaseous ammonia (NH3 ) into the high troposphere, where NH3 molecules can be photodissociated and initiate a chain of chemical reactions with downwelling acetylene molecules (C2H2 ). These reactions, experimentally studied earlier by (Ferris and Ishikawa [1987] Nature 326, 777-778) and (Ferris and Ishikawa [1988] J. Amer. Chem. Soc. 110, 4306-4312), produce chromophores that absorb in the visible and ultraviolet regions. In this work we photolyzed mixtures of NH3 and C2H2 using ultraviolet radiation with a wavelength of 214 nm and measured the spectral transmission of the deposited films in the visible region (400-740 nm). From these transmission data we estimated the imaginary indices of refraction. Assuming that ammonia grains at the top of the GRS clouds are coated with this material, we performed layered sphere and radiative transfer calculations to predict GRS reflection spectra. Comparison of those results with observed and previously unreported Cassini visible spectra and with true-color images of the GRS show that the unknown GRS chromophore is spectrally consistent with the coupled NH3-C2H2 photochemical products produced in our laboratory experiments. Using high-resolution mass spectrometry and infrared spectroscopy we infer that the chromophore-containing residue is composed of aliphatic azine, azo, and diazo compounds.
NASA Astrophysics Data System (ADS)
Jamroz, P.; Zyrnicki, W.
2002-09-01
The dc and 100 kHz low pressure discharges in acetylene-nitrogen mixture have been studied here. Optical emission spectroscopy was used for identification of active plasma components and to determine plasma temperature. Relative concentrations of H, CH and CN were investigated versus experimental conditions by optical actinometry techniques. Emission intensities of N2 and N2^+ normalized to intensity of argon line were also monitored as a function of experimental parameters. The rotational temperatures from the N2^+ B^2Σ_u^+-X^2Σ_g^+ (0-0) and CN B^2Σ^+-X^2Σ^+ (0-0) bands and vibrational temperatures from the CN (B^2Σ^+-X^2Σ^+) and N2 (C^3Pi_u-B^3Pi_g) spectra were determined. Plasma processes and plasma equilibrium state were discussed.
Time- and isomer-resolved measurements of sequential addition of acetylene to the propargyl radical
Savee, John D.; Selby, Talitha M.; Welz, Oliver; ...
2015-10-06
Soot formation in combustion is a complex process in which polycyclic aromatic hydrocarbons (PAHs) are believed to play a critical role. Recent works concluded that three consecutive additions of acetylene (C 2H 2) to propargyl (C 3H 3) create a facile route to the PAH indene (C 9H 8). However, the isomeric forms of C 5H 5 and C 7H 7 intermediates in this reaction sequence are not known. We directly investigate these intermediates using time- and isomer-resolved experiments. Both the resonance stabilized vinylpropargyl ( vp-C 5H 5) and 2,4-cyclopentadienyl ( c-C 5H 5) radical isomers of C 5H 5more » are produced, with substantially different intensities at 800 K vs 1000 K. In agreement with literature master equation calculations, we find that c-C 5H 5 + C 2H 2 produces only the tropyl isomer of C 7H 7 ( tp-C 7H 7) below 1000 K, and that tp-C 7H 7 + C 2H 2 terminates the reaction sequence yielding C 9H 8 (indene) + H. Lastly, this work demonstrates a pathway for PAH formation that does not proceed through benzene.« less
[Human drug metabolizing enzymes. II. Conjugation enzymes].
Vereczkey, L; Jemnitz, K; Gregus, Z
1998-09-01
In this review we focus on human conjugation enzymes (UDP-glucuronyltransferases, methyl-trasferases, N-acetyl-transferases, O-acetyl-transferases, Amidases/carboxyesterases, sulfotransferases, Glutation-S-transferases and the enzymes involved in the conjugation with amino acids) that participate in the metabolism of xenobiotics. Although conjugation reactions in most of the cases result in detoxication, more and more publications prove that the reactions catalysed by these enzymes very often lead to activated molecules that may attack macromolecules (proteins, RNAs, DNAs), resulting in toxicity (liver, neuro-, embryotoxicity, allergy, carcinogenecity). We have summarised the data available on these enzymes concerning their catalytic profile and specificity, inhibition, induction properties, their possible role in the generation of toxic compounds, their importance in clinical practice and drug development.
Addabbo, Francesco; Ratliff, Brian; Park, Hyeong-Cheon; Kuo, Mei-Chuan; Ungvari, Zoltan; Csiszar, Anna; Ciszar, Anna; Krasnikov, Boris; Krasnikof, Boris; Sodhi, Komal; Zhang, Fung; Nasjletti, Alberto; Goligorsky, Michael S
2009-01-01
Endothelial cell dysfunction is associated with bioavailable nitric oxide deficiency and an excessive generation of reactive oxygen species. We modeled this condition by chronically inhibiting nitric oxide generation with subpressor doses of N(G)-monomethyl-L-arginine (L-NMMA) in C57B6 and Tie-2/green fluorescent protein mouse strains. L-NMMA-treated mice exhibited a slight reduction in vasorelaxation ability, as well as detectable abnormalities in soluble adhesion molecules (soluble intercellular adhesion molecule-1 and vascular cellular adhesion molecule-1, and matrix metalloproteinase 9), which represent surrogate indicators of endothelial dysfunction. Proteomic analysis of the isolated microvasculature using 2-dimensional gel electrophoresis and matrix-assisted laser desorption/ionization time-of-flight mass spectroscopy revealed abnormal expression of a cluster of mitochondrial enzymes, which was confirmed using immunodetection. Aconitase-2 and enoyl-CoA-hydratase-1 expression levels were decreased in L-NMMA-treated animals; this phenotype was absent in nitric oxide synthase-1 and -3 knockout mice. Depletion of aconitase-2 and enoyl-CoA-hydratase-1 resulted in the inhibition of the Krebs cycle and enhanced pyruvate shunting toward the glycolytic pathway. To assess mitochondrial mass in vivo, co-localization of green fluorescent protein and MitoTracker fluorescence was detected by intravital microscopy. Quantitative analysis of fluorescence intensity showed that L-NMMA-treated animals exhibited lower fluorescence of MitoTracker in microvascular endothelia as a result of reduced mitochondrial mass. These findings provide conclusive and unbiased evidence that mitochondriopathy represents an early manifestation of endothelial dysfunction, shifting cell metabolism toward "metabolic hypoxia" through the selective depletion of both aconitase-2 and enoyl-CoA-hydratase-1. These findings may contribute to an early preclinical diagnosis of endothelial dysfunction.
Merali, Zara; Mayer, Melinda J; Parker, Mary L; Michael, Anthony J; Smith, Andrew C; Waldron, Keith W
2012-06-01
Tobacco plants (Nicotiana tabacum cv XHFD 8) were genetically modified to express a bacterial 4-hydroxycinnamoyl-CoA hydratase/lyase (HCHL) enzyme which is active with intermediates of the phenylpropanoid pathway. We have previously shown that HCHL expression in tobacco stem resulted in various pleiotropic effects, indicative of a reduction in the carbon flux through the phenylpropanoid pathway, accompanied by an abnormal phenotype. Here, we report that in addition to the reduction in lignin and phenolic biosynthesis, HCHL expression also resulted in several gross morphological changes in poorly lignified tissue, such as abnormal mesophyll and palisade. The effect of HCHL expression was also noted in lignin-free single cells, with suspension cultures displaying an altered shape and different growth patterns. Poorly/non-lignified cell walls also exhibited a greater ease of alkaline extractability of simple phenolics and increased levels of incorporation of vanillin and vanillic acid. However, HCHL expression had no significant effect on the cell wall carbohydrate chemistry of these tissues. Evidence from this study suggests that changes in the transgenic lines result from a reduction in phenolic intermediates which have an essential role in maintaining structural integrity of low-lignin or lignin-deprived cell walls. These results emphasize the importance of the intermediates and products of phenylpropanoid pathway in modulating aspects of normal growth and development of tobacco. Analysis of these transgenic plants also shows the plasticity of the lignification process and reveals the potential to bioengineer plants with reduced phenolics (without deleterious effects) which could enhance the bioconversion of lignocellulose for industrial applications. Copyright © Physiologia Plantarum 2012.
Measuring the Enzyme Activity of Arabidopsis Deubiquitylating Enzymes.
Kalinowska, Kamila; Nagel, Marie-Kristin; Isono, Erika
2016-01-01
Deubiquitylating enzymes, or DUBs, are important regulators of ubiquitin homeostasis and substrate stability, though the molecular mechanisms of most of the DUBs in plants are not yet understood. As different ubiquitin chain types are implicated in different biological pathways, it is important to analyze the enzyme characteristic for studying a DUB. Quantitative analysis of DUB activity is also important to determine enzyme kinetics and the influence of DUB binding proteins on the enzyme activity. Here, we show methods to analyze DUB activity using immunodetection, Coomassie Brilliant Blue staining, and fluorescence measurement that can be useful for understanding the basic characteristic of DUBs.
Nanomaterials with enzyme-like characteristics (nanozymes): next-generation artificial enzymes.
Wei, Hui; Wang, Erkang
2013-07-21
Over the past few decades, researchers have established artificial enzymes as highly stable and low-cost alternatives to natural enzymes in a wide range of applications. A variety of materials including cyclodextrins, metal complexes, porphyrins, polymers, dendrimers and biomolecules have been extensively explored to mimic the structures and functions of naturally occurring enzymes. Recently, some nanomaterials have been found to exhibit unexpected enzyme-like activities, and great advances have been made in this area due to the tremendous progress in nano-research and the unique characteristics of nanomaterials. To highlight the progress in the field of nanomaterial-based artificial enzymes (nanozymes), this review discusses various nanomaterials that have been explored to mimic different kinds of enzymes. We cover their kinetics, mechanisms and applications in numerous fields, from biosensing and immunoassays, to stem cell growth and pollutant removal. We also summarize several approaches to tune the activities of nanozymes. Finally, we make comparisons between nanozymes and other catalytic materials (other artificial enzymes, natural enzymes, organic catalysts and nanomaterial-based catalysts) and address the current challenges and future directions (302 references).
Enzyme linked immunoassay with stabilized polymer saccharide enzyme conjugates
Callstrom, Matthew R.; Bednarski, Mark D.; Gruber, Patrick R.
1997-01-01
An improvement in enzyme linked immunoassays is disclosed wherein the enzyme is in the form of a water soluble polymer saccharide conjugate which is stable in hostile environments. The conjugate comprises the enzyme which is linked to the polymer at multiple points through saccharide linker groups.
[Advances on enzymes and enzyme inhibitors research based on microfluidic devices].
Hou, Feng-Hua; Ye, Jian-Qing; Chen, Zuan-Guang; Cheng, Zhi-Yi
2010-06-01
With the continuous development in microfluidic fabrication technology, microfluidic analysis has evolved from a concept to one of research frontiers in last twenty years. The research of enzymes and enzyme inhibitors based on microfluidic devices has also made great progress. Microfluidic technology improved greatly the analytical performance of the research of enzymes and enzyme inhibitors by reducing the consumption of reagents, decreasing the analysis time, and developing automation. This review focuses on the development and classification of enzymes and enzyme inhibitors research based on microfluidic devices.
Llamas-Velasco, Mar; Requena, Luis; Adam, Julie; Frizzell, Norma; Hartmann, Arndt; Mentzel, Thomas
2016-12-01
Hereditary leiomyomatosis and renal cell cancer (HLRCC) syndrome is an autosomal dominant disorder caused by heterozygotic germline mutations in fumarate hydratase (FH) with incomplete penetrance, and clinically challenging to diagnose. Immunohistochemical stainings may favor an earlier diagnosis. The authors have tested 31 smooth muscle neoplasms. Ten of the 13 lesions from patients with HLRCC syndrome showed negative FH staining. Most sporadic piloleiomyomas presented strongly positive FH staining although 5 cases were negative. Sensitivity of FH staining in our series is 83.3% but specificity is 75%. Anti-S-(2-succino)-cysteine (2SC) showed the opposite intensity staining pattern and showed great correlation with anti-FH (rho spearman = -0.797). Anti-2SC staining increased the diagnostic accuracy in 19% of the cases. The main limitation of this study is the lack additional clinical data to further classify the cases as the case inclusion was histopathological. Negative FH staining could indicate a high risk of HLRCC but it could also suggest the presence of a syndrome in up to 25% of sporadic cases. Thus, when there is a doubtful case, anti-2SC may be added to exclude the syndrome if a negative staining is found.
In vitro activation of ammonia monooxygenase from Nitrosomonas europaea by copper.
Ensign, S A; Hyman, M R; Arp, D J
1993-01-01
The effect of copper on the in vivo and in vitro activity of ammonia monooxygenase (AMO) from the nitrifying bacterium Nitrosomonas europaea was investigated. The addition of CuCl2 to cell extracts resulted in 5- to 15-fold stimulation of ammonia-dependent O2 consumption, ammonia-dependent nitrite production, and hydrazine-dependent ethane oxidation. AMO activity was further stimulated in vitro by the presence of stabilizing agents, including serum albumins, spermine, or MgCl2. In contrast, the addition of CuCl2 and stabilizing agents to whole-cell suspensions did not result in any stimulation of AMO activity. The use of the AMO-specific suicide substrate acetylene revealed two populations of AMO in cell extracts. The low, copper-independent (residual) AMO activity was completely inactivated by acetylene in the absence of exogenously added copper. In contrast, the copper-dependent (activable) AMO activity was protected against acetylene inactivation in the absence of copper. However, in the presence of copper both populations of AMO were inactivated by acetylene. [14C]acetylene labelling of the 27-kDa polypeptide of AMO revealed the same extent of label incorporation in both whole cells and optimally copper-stimulated cell extracts. In the absence of copper, the label incorporation in cell extracts was proportional to the level of residual AMO activity. Other metal ions tested, including Zn2+, Co2+, Ni2+, Fe2+, Fe3+, Ca2+, Mg2+, Mn2+, Cr3+, and Ag+, were ineffective at stimulating AMO activity or facilitating the incorporation of 14C label from [14C]acetylene into the 27-kDa polypeptide. On the basis of these results, we propose that loss of AMO activity upon lysis of N. europaea results from the loss of copper from AMO, generating a catalytically inactive, yet stable and activable, form of the enzyme. Images PMID:8458839
Enzyme linked immunoassay with stabilized polymer saccharide enzyme conjugates
Callstrom, M.R.; Bednarski, M.D.; Gruber, P.R.
1997-11-25
An improvement in enzyme linked immunoassays is disclosed wherein the enzyme is in the form of a water soluble polymer saccharide conjugate which is stable in hostile environments. The conjugate comprises the enzyme which is linked to the polymer at multiple points through saccharide linker groups. 19 figs.
Computational enzyme design: transitioning from catalytic proteins to enzymes.
Mak, Wai Shun; Siegel, Justin B
2014-08-01
The widespread interest in enzymes stem from their ability to catalyze chemical reactions under mild and ecologically friendly conditions with unparalleled catalytic proficiencies. While thousands of naturally occurring enzymes have been identified and characterized, there are still numerous important applications for which there are no biological catalysts capable of performing the desired chemical transformation. In order to engineer enzymes for which there is no natural starting point, efforts using a combination of quantum chemistry and force-field based protein molecular modeling have led to the design of novel proteins capable of catalyzing chemical reactions not catalyzed by naturally occurring enzymes. Here we discuss the current status and potential avenues to pursue as the field of computational enzyme design moves forward. Published by Elsevier Ltd.
Li, Hai-Fang; Jiang, Li-Xue; Zhao, Yan-Xia; Liu, Qing-Yu; Zhang, Ting; He, Sheng-Gui
2018-03-01
The underlying mechanism for non-oxidative methane aromatization remains controversial owing to the lack of experimental evidence for the formation of the first C-C bond. For the first time, the elementary reaction of methane with atomic clusters (FeC 3 - ) under high-temperature conditions to produce C-C coupling products has been characterized by mass spectrometry. With the elevation of temperature from 300 K to 610 K, the production of acetylene, the important intermediate proposed in a monofunctional mechanism of methane aromatization, was significantly enhanced, which can be well-rationalized by quantum chemistry calculations. This study narrows the gap between gas-phase and condensed-phase studies on methane conversion and suggests that the monofunctional mechanism probably operates in non-oxidative methane aromatization. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Agaimy, Abbas; Amin, Mahul B; Gill, Anthony J; Popp, Bernt; Reis, André; Berney, Daniel M; Magi-Galluzzi, Cristina; Sibony, Mathilde; Smith, Steven C; Suster, Saul; Trpkov, Kiril; Hes, Ondřej; Hartmann, Arndt
2018-04-21
Fumarate hydratase-deficient renal cell carcinoma (FH-RCC) is a rare, aggressive RCC type, originally described in the setting of hereditary leiomyomatosis and renal cell carcinoma (HLRCC) syndrome which is defined by germline FH gene inactivation. Inactivation of components of the SWI/SNF chromatin remodelling complex is involved in renal medullary carcinoma (SMARCB1/INI1 loss), clear cell RCC (PBRM1 loss) and in subsets of dedifferentiated RCC of clear cell, chromophobe and papillary types (loss of different SWI/SNF components). FH-RCC and SWI/SNF-deficient RCC share anaplastic nuclear features and highly aggressive course. We analysed 32 FH-RCCs from 28 patients using seven commercially available SWI/SNF antibodies (SMARCB1/INI1, SMARCA2, SMARCA4, SMARCC1, SMARCC2, PBRM1 and ARID1A). Variable loss of SMARCB1, ARID1A and SMARCC1 was observed in 1/31, 2/31 and 1/29 evaluable cases, respectively; three of these four SWI/SNF-deficient tumors had confirmed FH mutations. No correlation of SWI/SNF loss with solid or sarcomatoid features was observed. Two tumors with SMARCB1 and ARID1A deficiency had available SWI/SNF molecular data; both lacked SMARCB1 and ARID1A mutations. The remaining five SWI/SNF components were intact in all cases. Especially PBRM1 seems not to be involved in the pathogenesis or progression of FH-deficient RCC. Our data showed that, a subset of FH-RCC (12%) have a variable loss of SWI/SNF complex subunits, likely as secondary genetic events. This should not be confused with SWI/SNF-deficient RCC of other types. Evaluation of FH and SWI/SNF together with comprehensive molecular-genetic profiling is needed to explore possible prognostic implications of FH/SWI-SNF double deficiency and to better understand the somatic mutation landscape in high-grade RCC. Copyright © 2018. Published by Elsevier Inc.
Stabilization of enzymes in ionic liquids via modification of enzyme charge.
Nordwald, Erik M; Kaar, Joel L
2013-09-01
Due to the propensity of ionic liquids (ILs) to inactivate enzymes, the development of strategies to improve enzyme utility in these solvents is critical to fully exploit ILs for biocatalysis. We have developed a strategy to broadly improve enzyme utility in ILs based on elucidating the effect of charge modifications on the function of enzymes in IL environments. Results of stability studies in aqueous-IL mixtures indicated a clear connection between the ratio of enzyme-containing positive-to-negative sites and enzyme stability in ILs. Stability studies of the effect of [BMIM][Cl] and [EMIM][EtSO4 ] on chymotrypsin specifically found an optimum ratio of positively-charged amine-to-negatively-charged acid groups (0.39). At this ratio, the half-life of chymotrypsin was increased 1.6- and 4.3-fold relative to wild-type chymotrypsin in [BMIM][Cl] and [EMIM][EtSO4 ], respectively. The half-lives of lipase and papain were similarly increased as much as 4.0 and 2.4-fold, respectively, in [BMIM][Cl] by modifying the ratio of positive-to-negative sites of each enzyme. More generally, the results of stability studies found that modifications that reduce the ratio of enzyme-containing positive-to-negative sites improve enzyme stability in ILs. Understanding the impact of charge modification on enzyme stability in ILs may ultimately be exploited to rationally engineer enzymes for improved function in IL environments. Copyright © 2013 Wiley Periodicals, Inc.
Acetylene reduction (nitrogen fixation) associated with corn inoculated with Spirillum.
Barber, L E; Tjepkema, J D; Russell, S A; Evans, H J
1976-07-01
Sorghum and corn breeding lines were grown in soil in field and greenhouse experiments with and without an inoculum of N2-fixing in Spirillum strains from Brazil. Estimated rates of N2 fixation associated with field-grown corn and sorghum plants were less than 4 g of N2/ha per day. The mean estimated N2-fixation rates determined on segments of roots from corn inoculated with Spirillum and grown in the greenhouse at 24 to 27 degrees C were 15 g of N2/ha per day (16 inbreds), 25 g of N2/ha per day (six hybrids), and 165 g of N2/ha per day for one hybird which was heavily inoculated. The corresponding mean rates determined from measurements of in situ cultures of the same series of corn plants (i.e., 16 inbreds, six hybrids, and one heavily inoculated hybrid) were 0.4, 2.3, and 1.1 g of N2/ha per day, respectively. Lower rates of C2H2 reduction were associated with control corn cultures which had been treated with autoclaved Spirillum than with cultures inoculated with live Spirillum. No C2H2 reduction was detected in plant cultures treated with ammonium nitrate. Numbers of nitrogen-fixing bacteria on excised roots of corn plants increased an average of about 30-fold during an overnight preincubation period, and as a result acetylene reduction assays of root samples after preincubation failed to serve as a valid basis for estimating N2 fixation by corn in pot cultures. Plants grown without added nitrogen either with or without inoculum exhibited severe symptoms of nitrogen deficiency and in most cases produced significantly less dry weight than those supplied with fixed nitrogen. Although substantial rates of C2H2 reduction by excised corn roots were observed after preincubation under limited oxygen, the yield and nitrogen content of inoculated plants and the C2H2-reduction rates by inoculated pot cultures of corn, in situ, provided no evidence of appreciable N2 fixation.
Carbohydrates as efficient catalysts for the hydration of α-amino nitriles.
Chitale, Sampada; Derasp, Joshua S; Hussain, Bashir; Tanveer, Kashif; Beauchemin, André M
2016-11-01
Directed hydration of α-amino nitriles was achieved under mild conditions using simple carbohydrates as catalysts exploiting temporary intramolecularity. A broadly applicable procedure using both formaldehyde and NaOH as catalysts efficiently hydrated a variety of primary and secondary susbtrates, and allowed the hydration of enantiopure substrates to proceed without racemization. This work also provides a rare comparison of the catalytic activity of carbohydrates, and shows that the simple aldehydes at the basis of chemical evolution are efficient organocatalysts mimicking the function of hydratase enzymes. Optimal catalytic efficiency was observed with destabilized aldehydes, and with difficult substrates only simple carbohydrates such as formaldehyde and glycolaldehyde proved reliable.
Evidence for Formation of a Radical-Mediated Flavin-N5 Covalent Intermediate.
Dai, Yumin; Valentino, Hannah R; Sobrado, Pablo
2018-05-18
The redox-neutral reaction catalyzed by 2-haloacrylate hydratase (2-HAH) leads to the conversion of 2-chloroacrylate to pyruvate. Previous mechanistic studies demonstrated formation of a flavin-iminium ion as an important intermediate in the 2-HAH catalytic cycle. Time-resolved flavin absorbance studies were performed in this study and the data showed that the enzyme is capable of stabilizing both anionic and neutral flavin semiquinone species. The presence of a radical scavenger decreases the activity in a concentration-dependent manner. These data are consistent with the flavin iminium intermediate occurring via radical recombination. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
7 CFR 58.436 - Rennet, pepsin, other milk clotting enzymes and flavor enzymes.
Code of Federal Regulations, 2013 CFR
2013-01-01
... 7 Agriculture 3 2013-01-01 2013-01-01 false Rennet, pepsin, other milk clotting enzymes and flavor enzymes. 58.436 Section 58.436 Agriculture Regulations of the Department of Agriculture (Continued... clotting enzymes and flavor enzymes. Enzyme preparations used in the manufacture of cheese shall be safe...
7 CFR 58.436 - Rennet, pepsin, other milk clotting enzymes and flavor enzymes.
Code of Federal Regulations, 2014 CFR
2014-01-01
... 7 Agriculture 3 2014-01-01 2014-01-01 false Rennet, pepsin, other milk clotting enzymes and flavor enzymes. 58.436 Section 58.436 Agriculture Regulations of the Department of Agriculture (Continued... clotting enzymes and flavor enzymes. Enzyme preparations used in the manufacture of cheese shall be safe...
7 CFR 58.436 - Rennet, pepsin, other milk clotting enzymes and flavor enzymes.
Code of Federal Regulations, 2012 CFR
2012-01-01
... 7 Agriculture 3 2012-01-01 2012-01-01 false Rennet, pepsin, other milk clotting enzymes and flavor enzymes. 58.436 Section 58.436 Agriculture Regulations of the Department of Agriculture (Continued... clotting enzymes and flavor enzymes. Enzyme preparations used in the manufacture of cheese shall be safe...
7 CFR 58.436 - Rennet, pepsin, other milk clotting enzymes and flavor enzymes.
Code of Federal Regulations, 2010 CFR
2010-01-01
... 7 Agriculture 3 2010-01-01 2010-01-01 false Rennet, pepsin, other milk clotting enzymes and flavor enzymes. 58.436 Section 58.436 Agriculture Regulations of the Department of Agriculture (Continued... clotting enzymes and flavor enzymes. Enzyme preparations used in the manufacture of cheese shall be safe...
7 CFR 58.436 - Rennet, pepsin, other milk clotting enzymes and flavor enzymes.
Code of Federal Regulations, 2011 CFR
2011-01-01
... 7 Agriculture 3 2011-01-01 2011-01-01 false Rennet, pepsin, other milk clotting enzymes and flavor enzymes. 58.436 Section 58.436 Agriculture Regulations of the Department of Agriculture (Continued... clotting enzymes and flavor enzymes. Enzyme preparations used in the manufacture of cheese shall be safe...
Symptoms Elevated liver enzymes By Mayo Clinic Staff Elevated liver enzymes may indicate inflammation or damage to cells in the liver. Inflamed or ... than normal amounts of certain chemicals, including liver enzymes, into the bloodstream, which can result in elevated ...
Zawodzinski, Thomas A.; Wilson, Mahlon S.; Rishpon, Judith; Gottesfeld, Shimshon
1993-01-01
An enzyme electrode is prepared with a composite coating on an electrical conductor. The composite coating is formed from a casting solution of a perfluorosulfonic acid polymer, an enzyme, and a carbon supported catalyst. The solution may be cast directly on the conductor surface or may be formed as a membrane and applied to the surface. The perfluorosulfonic acid ionomer formed from the casting solution provides an insoluble biocompatible protective matrix for the enzyme and acts to retain the enzyme for long term availability in the electrode structure. The carbon supported catalyst provides catalytic sites throughout the layer for the oxidation of hydrogen peroxide from the enzyme reactions. The carbon support then provides a conductive path for establishing an electrical signal to the electrical conductor. In one embodiment, the electrical conductor is a carbon cloth that permits oxygen or other gas to be introduced to the perfluorosulfonic polymer to promote the enzyme reaction independent of oxygen in the solution being tested.
NASA Astrophysics Data System (ADS)
Saroha, Rakesh; Panwar, Amrish K.
2017-06-01
The intention of this work is to study the effect of in situ pyrolysis of acetylene (C2H2) gas used as a carbon source on the physicochemical and electrochemical performance of pristine LiFePO4 (LFP). Acetylene gas, which decomposed to carbon and methane along with some side products when exposed to high temperature (>625 °C), is used as a carbon source for coating over the surface of LFP particles. Thermogravimetric (TGA) measurements were performed in an air atmosphere, primarily to estimate the exact amount of carbon deposited on the surface of the olivine cathode material due to the decomposition of C2H2 gas. Raman and TGA results confirm the presence of carbon as coated on the surface of the prepared compositions. Among all the synthesized samples, LFP with 10 min C2H2 treatment (LFPC10) shows the highest discharge capacity at all C-rates and exhibits excellent rate performance. LFPC10 delivers a specific discharge capacity of 144 (±5) mAh g-1 (~85% of the theoretical capacity of 170 mAh g-1) at 0.1C rate. LFPC10 demonstrates the best cycling performance as it offers an initial discharge capacity of about 117 (±5) mAh g-1 (~69% of the theoretical capacity) at 1C-rate and has 97% capacity retention even after 100 charge/discharge cycles.
Lee, Charles K; Monk, Colin R; Daniel, Roy M
2013-01-01
Of the two independent processes by which enzymes lose activity with increasing temperature, irreversible thermal inactivation and rapid reversible equilibration with an inactive form, the latter is only describable by the Equilibrium Model. Any investigation of the effect of temperature upon enzymes, a mandatory step in rational enzyme engineering and study of enzyme temperature adaptation, thus requires determining the enzymes' thermodynamic parameters as defined by the Equilibrium Model. The necessary data for this procedure can be collected by carrying out multiple isothermal enzyme assays at 3-5°C intervals over a suitable temperature range. If the collected data meet requirements for V max determination (i.e., if the enzyme kinetics are "ideal"), then the enzyme's Equilibrium Model parameters (ΔH eq, T eq, ΔG (‡) cat, and ΔG (‡) inact) can be determined using a freely available iterative model-fitting software package designed for this purpose.Although "ideal" enzyme reactions are required for determination of all four Equilibrium Model parameters, ΔH eq, T eq, and ΔG (‡) cat can be determined from initial (zero-time) rates for most nonideal enzyme reactions, with substrate saturation being the only requirement.
Immobilized enzymes: understanding enzyme - surface interactions at the molecular level.
Hoarau, Marie; Badieyan, Somayesadat; Marsh, E Neil G
2017-11-22
Enzymes immobilized on solid supports have important and industrial and medical applications. However, their uses are limited by the significant reductions in activity and stability that often accompany the immobilization process. Here we review recent advances in our understanding of the molecular level interactions between proteins and supporting surfaces that contribute to changes in stability and activity. This understanding has been facilitated by the application of various surface-sensitive spectroscopic techniques that allow the structure and orientation of enzymes at the solid/liquid interface to be probed, often with monolayer sensitivity. An appreciation of the molecular interactions between enzyme and surface support has allowed the surface chemistry and method of enzyme attachement to be fine-tuned such that activity and stability can be greatly enhanced. These advances suggest that a much wider variety of enzymes may eventually be amenable to immobilization as green catalysts.
Grabowski, Sławomir J
2015-06-19
MP2/aug-cc-pVTZ calculations were performed on complexes of aluminium and boron trihydrides and trihalides with acetylene and ethylene. These complexes are linked through triel bonds where the triel center (B or Al) is characterized by the Lewis acid properties through its π-hole region while π-electrons of C2H2 or C2H4 molecule play the role of the Lewis base. Some of these interactions possess characteristics of covalent bonds, i.e., the Al-π-electrons links as well as the interaction in the BH3-C2H2 complex. The triel-π-electrons interactions are classified sometimes as the 3c-2e bonds. In the case of boron trihydrides, these interactions are often the preliminary stages of the hydroboration reaction. The Quantum Theory of "Atoms in Molecules" as well as the Natural Bond Orbitals approach are applied here to characterize the π-hole-π-electrons interactions.
Schallmey, Marcus; Koopmeiners, Julia; Wells, Elizabeth; Wardenga, Rainer; Schallmey, Anett
2014-12-01
Halohydrin dehalogenases are very rare enzymes that are naturally involved in the mineralization of halogenated xenobiotics. Due to their catalytic potential and promiscuity, many biocatalytic reactions have been described that have led to several interesting and industrially important applications. Nevertheless, only a few of these enzymes have been made available through recombinant techniques; hence, it is of general interest to expand the repertoire of these enzymes so as to enable novel biocatalytic applications. After the identification of specific sequence motifs, 37 novel enzyme sequences were readily identified in public sequence databases. All enzymes that could be heterologously expressed also catalyzed typical halohydrin dehalogenase reactions. Phylogenetic inference for enzymes of the halohydrin dehalogenase enzyme family confirmed that all enzymes form a distinct monophyletic clade within the short-chain dehydrogenase/reductase superfamily. In addition, the majority of novel enzymes are substantially different from previously known phylogenetic subtypes. Consequently, four additional phylogenetic subtypes were defined, greatly expanding the halohydrin dehalogenase enzyme family. We show that the enormous wealth of environmental and genome sequences present in public databases can be tapped for in silico identification of very rare but biotechnologically important biocatalysts. Our findings help to readily identify halohydrin dehalogenases in ever-growing sequence databases and, as a consequence, make even more members of this interesting enzyme family available to the scientific and industrial community. Copyright © 2014, American Society for Microbiology. All Rights Reserved.
Oxy-acetylene driven laboratory scale shock tubes for studying blast wave effects
NASA Astrophysics Data System (ADS)
Courtney, Amy C.; Andrusiv, Lubov P.; Courtney, Michael W.
2012-04-01
This paper describes the development and characterization of modular, oxy-acetylene driven laboratory scale shock tubes. Such tools are needed to produce realistic blast waves in a laboratory setting. The pressure-time profiles measured at 1 MHz using high-speed piezoelectric pressure sensors have relevant durations and show a true shock front and exponential decay characteristic of free-field blast waves. Descriptions are included for shock tube diameters of 27-79 mm. A range of peak pressures from 204 kPa to 1187 kPa (with 0.5-5.6% standard error of the mean) were produced by selection of the driver section diameter and distance from the shock tube opening. The peak pressures varied predictably with distance from the shock tube opening while maintaining both a true blast wave profile and relevant pulse duration for distances up to about one diameter from the shock tube opening. This shock tube design provides a more realistic blast profile than current compression-driven shock tubes, and it does not have a large jet effect. In addition, operation does not require specialized personnel or facilities like most blast-driven shock tubes, which reduces operating costs and effort and permits greater throughput and accessibility. It is expected to be useful in assessing the response of various sensors to shock wave loading; assessing the reflection, transmission, and absorption properties of candidate armor materials; assessing material properties at high rates of loading; assessing the response of biological materials to shock wave exposure; and providing a means to validate numerical models of the interaction of shock waves with structures. All of these activities have been difficult to pursue in a laboratory setting due in part to lack of appropriate means to produce a realistic blast loading profile.
Sorokina, Maria; Stam, Mark; Médigue, Claudine; Lespinet, Olivier; Vallenet, David
2014-06-06
The emergence of Next Generation Sequencing generates an incredible amount of sequence and great potential for new enzyme discovery. Despite this huge amount of data and the profusion of bioinformatic methods for function prediction, a large part of known enzyme activities is still lacking an associated protein sequence. These particular activities are called "orphan enzymes". The present review proposes an update of previous surveys on orphan enzymes by mining the current content of public databases. While the percentage of orphan enzyme activities has decreased from 38% to 22% in ten years, there are still more than 1,000 orphans among the 5,000 entries of the Enzyme Commission (EC) classification. Taking into account all the reactions present in metabolic databases, this proportion dramatically increases to reach nearly 50% of orphans and many of them are not associated to a known pathway. We extended our survey to "local orphan enzymes" that are activities which have no representative sequence in a given clade, but have at least one in organisms belonging to other clades. We observe an important bias in Archaea and find that in general more than 30% of the EC activities have incomplete sequence information in at least one superkingdom. To estimate if candidate proteins for local orphans could be retrieved by homology search, we applied a simple strategy based on the PRIAM software and noticed that candidates may be proposed for an important fraction of local orphan enzymes. Finally, by studying relation between protein domains and catalyzed activities, it appears that newly discovered enzymes are mostly associated with already known enzyme domains. Thus, the exploration of the promiscuity and the multifunctional aspect of known enzyme families may solve part of the orphan enzyme issue. We conclude this review with a presentation of recent initiatives in finding proteins for orphan enzymes and in extending the enzyme world by the discovery of new activities.
Kelly, M.
1968-01-01
1. Nitrogen-fixing preparations from Azotobacter chroococcum reduced substrates with the following Km values: methyl isocyanide, 1·8×10−4m; ethyl isocyanide, 2·5×10−2m; cyanide ion, 1·4×10−3m; acetylene, 1·2×10−4m. 2. Nitrogen, carbon monoxide or hydrogen competitively inhibited isocyanide reduction with the following Ki values: hydrogen, 1·3×10−3m; carbon monoxide, 6·8×10−6m; nitrogen, 4·3×10−4m. 3. Living nitrogen-fixing bacteria, and isolated clover nodules, formed methane from methyl isocyanide. 4. These results are discussed in relation to other work and possible mechanisms of nitrogen fixation. PMID:5642620
NASA Technical Reports Server (NTRS)
Lindh, Roland; Rice, Julia E.; Lee, Timothy J.
1991-01-01
The energy separation between the classical and nonclassical forms of protonated acetylene has been reinvestigated in light of the recent experimentally deduced lower bound to this value of 6.0 kcal/mol. The objective of the present study is to use state-of-the-art ab initio quantum mechanical methods to establish this energy difference to within chemical accuracy (i.e., about 1 kcal/mol). The one-particle basis sets include up to g-type functions and the electron correlation methods include single and double excitation coupled-cluster (CCSD), the CCSD(T) extension, multireference configuration interaction, and the averaged coupled-pair functional methods. A correction for zero-point vibrational energies has also been included, yielding a best estimate for the energy difference between the classical and nonclassical forms of 3.7 + or - 1.3 kcal/mol.
Metagenomics as a Tool for Enzyme Discovery: Hydrolytic Enzymes from Marine-Related Metagenomes.
Popovic, Ana; Tchigvintsev, Anatoly; Tran, Hai; Chernikova, Tatyana N; Golyshina, Olga V; Yakimov, Michail M; Golyshin, Peter N; Yakunin, Alexander F
2015-01-01
This chapter discusses metagenomics and its application for enzyme discovery, with a focus on hydrolytic enzymes from marine metagenomic libraries. With less than one percent of culturable microorganisms in the environment, metagenomics, or the collective study of community genetics, has opened up a rich pool of uncharacterized metabolic pathways, enzymes, and adaptations. This great untapped pool of genes provides the particularly exciting potential to mine for new biochemical activities or novel enzymes with activities tailored to peculiar sets of environmental conditions. Metagenomes also represent a huge reservoir of novel enzymes for applications in biocatalysis, biofuels, and bioremediation. Here we present the results of enzyme discovery for four enzyme activities, of particular industrial or environmental interest, including esterase/lipase, glycosyl hydrolase, protease and dehalogenase.
Bedoyan, Jirair K; Yang, Samuel P; Ferdinandusse, Sacha; Jack, Rhona M; Miron, Alexander; Grahame, George; DeBrosse, Suzanne D; Hoppel, Charles L; Kerr, Douglas S; Wanders, Ronald J A
2017-04-01
Mutations in ECHS1 result in short-chain enoyl-CoA hydratase (SCEH) deficiency which mainly affects the catabolism of various amino acids, particularly valine. We describe a case compound heterozygous for ECHS1 mutations c.836T>C (novel) and c.8C>A identified by whole exome sequencing of proband and parents. SCEH deficiency was confirmed with very low SCEH activity in fibroblasts and nearly absent immunoreactivity of SCEH. The patient had a severe neonatal course with elevated blood and cerebrospinal fluid lactate and pyruvate concentrations, high plasma alanine and slightly low plasma cystine. 2-Methyl-2,3-dihydroxybutyric acid was markedly elevated as were metabolites of the three branched-chain α-ketoacids on urine organic acids analysis. These urine metabolites notably decreased when lactic acidosis decreased in blood. Lymphocyte pyruvate dehydrogenase complex (PDC) activity was deficient, but PDC and α-ketoglutarate dehydrogenase complex activities in cultured fibroblasts were normal. Oxidative phosphorylation analysis on intact digitonin-permeabilized fibroblasts was suggestive of slightly reduced PDC activity relative to control range in mitochondria. We reviewed 16 other cases with mutations in ECHS1 where PDC activity was also assayed in order to determine how common and generalized secondary PDC deficiency is associated with primary SCEH deficiency. For reasons that remain unexplained, we find that about half of cases with primary SCEH deficiency also exhibit secondary PDC deficiency. The patient died on day-of-life 39, prior to establishing his diagnosis, highlighting the importance of early and rapid neonatal diagnosis because of possible adverse effects of certain therapeutic interventions, such as administration of ketogenic diet, in this disorder. There is a need for better understanding of the pathogenic mechanisms and phenotypic variability in this relatively recently discovered disorder. Copyright © 2017 Elsevier Inc. All rights reserved.
Evolutionary dynamics of enzymes.
Demetrius, L
1995-08-01
This paper codifies and rationalizes the large diversity in reaction rates and substrate specificity of enzymes in terms of a model which postulates that the kinetic properties of present-day enzymes are the consequence of the evolutionary force of mutation and selection acting on a class of primordial enzymes with poor catalytic activity and broad substrate specificity. Enzymes are classified in terms of their thermodynamic parameters, activation enthalpy delta H* and activation entropy delta S*, in their kinetically significant transition states as follows: type 1, delta H* > 0, delta S* < 0; type 2, delta H* < or = 0, delta S* < or = 0; type 3, delta H* > 0, delta S* > 0. We study the evolutionary dynamics of these three classes of enzymes subject to mutation, which acts at the level of the gene which codes for the enzyme and selection, which acts on the organism that contains the enzyme. Our model predicts the following evolutionary trends in the reaction rate and binding specificity for the three classes of molecules. In type 1 enzymes, evolution results in random, non-directional changes in the reaction rate and binding specificity. In type 2 and 3 enzymes, evolution results in a unidirectional increase in both the reaction rate and binding specificity. We exploit these results in order to codify the diversity in functional properties of present-day enzymes. Type 1 molecules will be described by intermediate reaction rates and broad substrate specificity. Type 2 enzymes will be characterized by diffusion-controlled rates and absolute substrate specificity. The type 3 catalysts can be further subdivided in terms of their activation enthalpy into two classes: type 3a (delta H* small) and type 3b (delta H* large). We show that type 3a will be represented by the same functional properties that identify type 2, namely, diffusion-controlled rates and absolute substrate specificity, whereas type 3b will be characterized by non-diffusion-controlled rates and absolute
Smith, Steven C; Trpkov, Kiril; Chen, Ying-Bei; Mehra, Rohit; Sirohi, Deepika; Ohe, Chisato; Cani, Andi K; Hovelson, Daniel H; Omata, Kei; McHugh, Jonathan B; Jochum, Wolfram; Colecchia, Maurizio; Amin, Mitual; Divatia, Mukul K; Hes, Ondřej; Menon, Santosh; da Cunha, Isabela Werneck; Tripodi, Sergio; Brimo, Fadi; Gill, Anthony J; Osunkoya, Adeboye O; Magi-Galluzzi, Cristina; Sibony, Mathilde; Williamson, Sean R; Nesi, Gabriella; Picken, Maria M; Maclean, Fiona; Agaimy, Abbas; Cheng, Liang; Epstein, Jonathan I; Reuter, Victor E; Tickoo, Satish K; Tomlins, Scott A; Amin, Mahul B
2017-01-01
An emerging group of high grade renal cell carcinomas (RCCs), particularly carcinomas arising in the hereditary leiomyomatosis renal cell carcinoma syndrome (HLRCC), show fumarate hydratase (FH) gene mutation and loss of function. Based on similar cytomorphology and clinicopathologic features between these tumors and cases described as tubulocystic carcinomas with poorly differentiated foci of infiltrative adenocarcinoma (TC-PD), we hypothesized a relationship between these entities. First, 29 RCCs with morphology of TC-PD were identified retrospectively and assessed for FH expression and aberrant succination (2SC) by immunohistochemistry (IHC), with targeted next generation sequencing (NGS) of 409 genes—including FH—performed on a subset. The 29 TC-PD RCCs included 21 males and 8 females, aged 16-86 years (median 46), with tumors measuring 3-21 cm (median 9) arising in the right (n=16) and left (n=13) kidneys. Family history or stigmata of HLRCC were identified in only 3 (12%). These tumors were aggressive, with 79% showing perinephric extension, nodal involvement in 41%, and metastasis in 86%. Of these, 16 (55%) demonstrated loss of FH by IHC (14/14 with positive 2SC). In contrast, 5 (17%) showed a wild type immunoprofile of FH+/2SC-. An intriguing group of 8 (28%) showed variable FH± positivity, but with strong/diffuse 2SC+. NGS revealed 8 cases with FH mutations, including 5 FH-/2SC+ and 3 FH±/2SC+ cases, but none in FH+/2SC- cases. Secondly, we retrospectively reviewed the morphology of two well-characterized cohorts of RCCs with FH-deficiency determined by IHC or sequencing (n=23 and n=9), unselected for TC-PD pattern, identifying the TC-PD morphology in 10 (31%). We conclude that RCCs with TC-PD morphology are enriched for FH deficiency, and we recommend additional work up, including referral to genetic counseling, for prospective cases. Additionally, based on these and other observations, we propose the term “FH-deficient RCC” as a provisional
Titan haze: structure and properties of cyanoacetylene and cyanoacetylene-acetylene photopolymers
NASA Technical Reports Server (NTRS)
Clarke, D. W.; Ferris, J. P.
1997-01-01
The structure and morphological properties of polymers produced photochemically from the UV irradiation of cyanoacetylene and cyanoacetylene mixtures have been examined to evaluate their possible contribution to the haze layers found on Titan. A structural analysis of these polymers may contribute to our understanding of the data returned from the Huygens probe of the Cassini mission that will pass through the atmosphere of Titan in the year 2004. Infrared analysis, elemental analysis, and thermal methods (thermogravimetric analysis, thermolysis, pyrolysis) were used to examine structures of polycyanoacetylenes produced by irradiation of the gas phase HC3N at 185 and 254 nm. The resulting brown to black polymer, which exists as small particles, is believed to be a branched chain of conjugated carbon-carbon double bonds, which, on exposure to heat, cyclizes to form a graphitic structure. Similar methods of analysis were used to show that when HC3N is photolyzed in the presence of Titan's other atmospheric constituents (CH4, C2H6, C2H2, and CO), a copolymer is formed in which the added gases are incorporated as substituents on the polymer chain. Of special significance is the copolymer of HC3N and acetylene (C2H2). Even in experiments where C2H2 was absorbing nearly all of the incident photons, the ratio of C2H2 to HC3N found in the resulting polymer was only 2:1. Scanning electron microscopy was used to visually examine the polymer particles. While pure polyacetylene particles are amorphous spheres roughly 1 micrometer in diameter, polycyanoacetylenes appear to be strands of rough, solid particles slightly smaller in size. The copolymer of HC3N and C2H2 exhibits characteristics of both pure polymers. This is particularly important as pure polyacetylenes do not match the optical constants measured for Titan's atmospheric hazes. The copolymers produced by the incorporation of other minor atmospheric constituents, like HC3N, into the polyacetylenes are expected to have
Enzymes and Enzyme Activity Encoded by Nonenveloped Viruses.
Azad, Kimi; Banerjee, Manidipa; Johnson, John E
2017-09-29
Viruses are obligate intracellular parasites that rely on host cell machineries for their replication and survival. Although viruses tend to make optimal use of the host cell protein repertoire, they need to encode essential enzymatic or effector functions that may not be available or accessible in the host cellular milieu. The enzymes encoded by nonenveloped viruses-a group of viruses that lack any lipid coating or envelope-play vital roles in all the stages of the viral life cycle. This review summarizes the structural, biochemical, and mechanistic information available for several classes of enzymes and autocatalytic activity encoded by nonenveloped viruses. Advances in research and development of antiviral inhibitors targeting specific viral enzymes are also highlighted.
Insolubilization process increases enzyme stability
NASA Technical Reports Server (NTRS)
Billingham, J.; Lyn, J.
1971-01-01
Enzymes complexed with polymeric matrices contain properties suggesting application to enzyme-controlled reactions. Stability of insolubilized enzyme derivatives is markedly greater than that of soluble enzymes and physical form of insolubilized enzymes is useful in column and batch processes.
Nano-Biotechnology in Using Enzymes for Environmental Remediation: Single-Enzyme Nanoparticles
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kim, Jungbae; Grate, Jay W.
2005-01-01
We have developed armored single-enzyme nanoparticles (SENs), which dramatically stabilize a protease (a-chymotrypsin, CT) by surrounding each enzyme molecule with a porous composite organic/inorganic shell of less than a few nanometers thick. The armored enzymes show no decrease in CT activity at 30°C for a day while free CT activity is rapidly reduced by orders of magnitude. The armored shell around CT is sufficiently thin and porous that it does not place any serious mass-transfer limitation of substrate. This unique approach will have a great impact in using enzymes in various fields, including environmental remediation.
Succinate links TCA cycle dysfunction to oncogenesis by inhibiting HIF-alpha prolyl hydroxylase.
Selak, Mary A; Armour, Sean M; MacKenzie, Elaine D; Boulahbel, Houda; Watson, David G; Mansfield, Kyle D; Pan, Yi; Simon, M Celeste; Thompson, Craig B; Gottlieb, Eyal
2005-01-01
Several mitochondrial proteins are tumor suppressors. These include succinate dehydrogenase (SDH) and fumarate hydratase, both enzymes of the tricarboxylic acid (TCA) cycle. However, to date, the mechanisms by which defects in the TCA cycle contribute to tumor formation have not been elucidated. Here we describe a mitochondrion-to-cytosol signaling pathway that links mitochondrial dysfunction to oncogenic events: succinate, which accumulates as a result of SDH inhibition, inhibits HIF-alpha prolyl hydroxylases in the cytosol, leading to stabilization and activation of HIF-1alpha. These results suggest a mechanistic link between SDH mutations and HIF-1alpha induction, providing an explanation for the highly vascular tumors that develop in the absence of VHL mutations.
Kantsadi, Anastassia L; Bokor, Éva; Kun, Sándor; Stravodimos, George A; Chatzileontiadou, Demetra S M; Leonidas, Demetres D; Juhász-Tóth, Éva; Szakács, Andrea; Batta, Gyula; Docsa, Tibor; Gergely, Pál; Somsák, László
2016-11-10
C-β-d-Glucopyranosyl pyrrole derivatives were prepared in the reactions of pyrrole, 2-, and 3-aryl-pyrroles with O-peracetylated β-d-glucopyranosyl trichloroacetimidate, while 2-(β-d-glucopyranosyl) indole was obtained by a cross coupling of O-perbenzylated β-d-glucopyranosyl acetylene with N-tosyl-2-iodoaniline followed by spontaneous ring closure. An improved synthesis of O-perbenzoylated 2-(β-d-glucopyranosyl) imidazoles was achieved by reacting C-glucopyranosyl formimidates with α-aminoketones. The deprotected compounds were assayed with isoforms of glycogen phosphorylase (GP) to show no activity of the pyrroles against rabbit muscle GPb. The imidazoles proved to be the best known glucose derived inhibitors of not only the muscle enzymes (both a and b) but also of the pharmacologically relevant human liver GPa (Ki = 156 and 26 nM for the 4(5)-phenyl and -(2-naphthyl) derivatives, respectively). An X-ray crystallographic study of the rmGPb-imidazole complexes revealed structural features of the strong binding, and also allowed to explain the absence of inhibition for the pyrrole derivatives. Copyright © 2016 Elsevier Masson SAS. All rights reserved.
Giyatmi; Irianto, H E
Fermented fish products are very popular particularly in Southeast Asian countries. These products have unique characteristics, especially in terms of aroma, flavor, and texture developing during fermentation process. Proteolytic enzymes have a main role in hydrolyzing protein into simpler compounds. Fermentation process of fish relies both on naturally occurring enzymes (in the muscle or the intestinal tract) as well as bacteria. Fermented fish products processed using the whole fish show a different characteristic compared to those prepared from headed and gutted fish. Endogenous enzymes like trypsin, chymotrypsin, elastase, and aminopeptidase are the most involved in the fermentation process. Muscle tissue enzymes like cathepsins, peptidases, transaminases, amidases, amino acid decarboxylases, glutamic dehydrogenases, and related enzymes may also play a role in fish fermentation. Due to the decreased bacterial number during fermentation, contribution of microbial enzymes to proteolysis may be expected prior to salting of fish. Commercial enzymes are supplemented during processing for specific purposes, such as quality improvement and process acceleration. In the case of fish sauce, efforts to accelerate fermentation process and to improve product quality have been studied by addition of enzymes such as papain, bromelain, trypsin, pepsin, and chymotrypsin. © 2017 Elsevier Inc. All rights reserved.
2014-01-01
The emergence of Next Generation Sequencing generates an incredible amount of sequence and great potential for new enzyme discovery. Despite this huge amount of data and the profusion of bioinformatic methods for function prediction, a large part of known enzyme activities is still lacking an associated protein sequence. These particular activities are called “orphan enzymes”. The present review proposes an update of previous surveys on orphan enzymes by mining the current content of public databases. While the percentage of orphan enzyme activities has decreased from 38% to 22% in ten years, there are still more than 1,000 orphans among the 5,000 entries of the Enzyme Commission (EC) classification. Taking into account all the reactions present in metabolic databases, this proportion dramatically increases to reach nearly 50% of orphans and many of them are not associated to a known pathway. We extended our survey to “local orphan enzymes” that are activities which have no representative sequence in a given clade, but have at least one in organisms belonging to other clades. We observe an important bias in Archaea and find that in general more than 30% of the EC activities have incomplete sequence information in at least one superkingdom. To estimate if candidate proteins for local orphans could be retrieved by homology search, we applied a simple strategy based on the PRIAM software and noticed that candidates may be proposed for an important fraction of local orphan enzymes. Finally, by studying relation between protein domains and catalyzed activities, it appears that newly discovered enzymes are mostly associated with already known enzyme domains. Thus, the exploration of the promiscuity and the multifunctional aspect of known enzyme families may solve part of the orphan enzyme issue. We conclude this review with a presentation of recent initiatives in finding proteins for orphan enzymes and in extending the enzyme world by the discovery of new
Micellar Polymer Encapsulation of Enzymes.
Besic, Sabina; Minteer, Shelley D
2017-01-01
Although enzymes are highly efficient and selective catalysts, there have been problems incorporating them into fuel cells. Early enzyme-based fuel cells contained enzymes in solution rather than immobilized on the electrode surface. One problem utilizing an enzyme in solution is an issue of transport associated with long diffusion lengths between the site of bioelectrocatalysis and the electrode. This issue drastically decreases the theoretical overall power output due to the poor electron conductivity. On the other hand, enzymes immobilized at the electrode surface have eliminated the issue of poor electron conduction due to close proximity of electron transfer between electrode and the biocatalyst. Another problem is inefficient and short term stability of catalytic activity within the enzyme that is suspended in free flowing solution. Enzymes in solutions are only stable for hours to days, whereas immobilized enzymes can be stable for weeks to months and now even years. Over the last decade, there has been substantial research on immobilizing enzymes at electrode surfaces for biofuel cell and sensor applications. The most commonly used techniques are sandwich or wired. Sandwich techniques are powerful and successful for enzyme immobilization; however, the enzymes optimal activity is not retained due to the physical distress applied by the polymer limiting its applications as well as the non-uniform distribution of the enzyme and the diffusion of analyte through the polymer is slowed significantly. Wired techniques have shown to extend the lifetime of an enzyme at the electrode surface; however, this technique is very hard to master due to specific covalent bonding of enzyme and polymer which changes the three-dimensional configuration of enzyme and with that decreases the optimal catalytic activity. This chapter details encapsulation techniques where an enzyme will be immobilized within the pores/pockets of the hydrophobically modified micellar polymers such as
Li, Bin; Cui, Xili; O'Nolan, Daniel; Wen, Hui-Min; Jiang, Mengdie; Krishna, Rajamani; Wu, Hui; Lin, Rui-Biao; Chen, Yu-Sheng; Yuan, Daqiang; Xing, Huabin; Zhou, Wei; Ren, Qilong; Qian, Guodong; Zaworotko, Michael J; Chen, Banglin
2017-12-01
Realization of ideal molecular sieves, in which the larger gas molecules are completely blocked without sacrificing high adsorption capacities of the preferred smaller gas molecules, can significantly reduce energy costs for gas separation and purification and thus facilitate a possible technological transformation from the traditional energy-intensive cryogenic distillation to the energy-efficient, adsorbent-based separation and purification in the future. Although extensive research endeavors are pursued to target ideal molecular sieves among diverse porous materials, over the past several decades, ideal molecular sieves for the separation and purification of light hydrocarbons are rarely realized. Herein, an ideal porous material, SIFSIX-14-Cu-i (also termed as UTSA-200), is reported with ultrafine tuning of pore size (3.4 Å) to effectively block ethylene (C 2 H 4 ) molecules but to take up a record-high amount of acetylene (C 2 H 2 , 58 cm 3 cm -3 under 0.01 bar and 298 K). The material therefore sets up new benchmarks for both the adsorption capacity and selectivity, and thus provides a record purification capacity for the removal of trace C 2 H 2 from C 2 H 4 with 1.18 mmol g -1 C 2 H 2 uptake capacity from a 1/99 C 2 H 2 /C 2 H 4 mixture to produce 99.9999% pure C 2 H 4 (much higher than the acceptable purity of 99.996% for polymer-grade C 2 H 4 ), as demonstrated by experimental breakthrough curves. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Direct Electron Transfer of Enzymes in a Biologically Assembled Conductive Nanomesh Enzyme Platform.
Lee, Seung-Woo; Lee, Ki-Young; Song, Yong-Won; Choi, Won Kook; Chang, Joonyeon; Yi, Hyunjung
2016-02-24
Nondestructive assembly of a nanostructured enzyme platform is developed in combination of the specific biomolecular attraction and electrostatic coupling for highly efficient direct electron transfer (DET) of enzymes with unprecedented applicability and versatility. The biologically assembled conductive nanomesh enzyme platform enables DET-based flexible integrated biosensors and DET of eight different enzyme with various catalytic activities. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Origin of Bacteriochlorophyll a and the Early Diversification of Photosynthesis.
Cardona, Tanai
2016-01-01
Photosynthesis originated in the domain Bacteria billions of years ago; however, the identity of the last common ancestor to all phototrophic bacteria remains undetermined and speculative. Here I present the evolution of BchF or 3-vinyl-bacteriochlorophyll hydratase, an enzyme exclusively found in bacteria capable of synthetizing bacteriochlorophyll a. I show that BchF exists in two forms originating from an early divergence, one found in the phylum Chlorobi, including its paralogue BchV, and a second form that was ancestral to the enzyme found in the remaining anoxygenic phototrophic bacteria. The phylogeny of BchF is consistent with bacteriochlorophyll a evolving in an ancestral phototrophic bacterium that lived before the radiation event that gave rise to the phylum Chloroflexi, Chlorobi, Acidobacteria, Proteobacteria, and Gemmatimonadetes, but only after the divergence of Type I and Type II reaction centers. Consequently, it is suggested that the lack of phototrophy in many groups of extant bacteria is a derived trait.
Magnetically responsive enzyme powders
NASA Astrophysics Data System (ADS)
Pospiskova, Kristyna; Safarik, Ivo
2015-04-01
Powdered enzymes were transformed into their insoluble magnetic derivatives retaining their catalytic activity. Enzyme powders (e.g., trypsin and lipase) were suspended in various liquid media not allowing their solubilization (e.g., saturated ammonium sulfate and highly concentrated polyethylene glycol solutions, ethanol, methanol, 2-propanol) and subsequently cross-linked with glutaraldehyde. Magnetic modification was successfully performed at low temperature in a freezer (-20 °C) using magnetic iron oxides nano- and microparticles prepared by microwave-assisted synthesis from ferrous sulfate. Magnetized cross-linked enzyme powders were stable at least for two months in water suspension without leakage of fixed magnetic particles. Operational stability of magnetically responsive enzymes during eight repeated reaction cycles was generally without loss of enzyme activity. Separation of magnetically modified cross-linked powdered enzymes from reaction mixtures was significantly simplified due to their magnetic properties.
Burney, Patrick R; Nordwald, Erik M; Hickman, Katie; Kaar, Joel L; Pfaendtner, Jim
2015-04-01
Molecular simulations of the enzymes Candida rugosa lipase and Bos taurus α-chymotrypsin in aqueous ionic liquids 1-butyl-3-methylimidazolium chloride and 1-ethyl-3-methylimidazolium ethyl sulfate were used to study the change in enzyme-solvent interactions induced by modification of the enzyme surface charge. The enzymes were altered by randomly mutating lysine surface residues to glutamate, effectively decreasing the net surface charge by two for each mutation. These mutations resemble succinylation of the enzyme by chemical modification, which has been shown to enhance the stability of both enzymes in ILs. After establishing that the enzymes were stable on the simulated time scales, we focused the analysis on the organization of the ionic liquid substituents about the enzyme surface. Calculated solvent charge densities show that for both enzymes and in both solvents that changing positively charged residues to negative charge does indeed increase the charge density of the solvent near the enzyme surface. The radial distribution of IL constituents with respect to the enzyme reveals decreased interactions with the anion are prevalent in the modified systems when compared to the wild type, which is largely accompanied by an increase in cation contact. Additionally, the radial dependence of the charge density and ion distribution indicates that the effect of altering enzyme charge is confined to short range (≤1 nm) ordering of the IL. Ultimately, these results, which are consistent with that from prior experiments, provide molecular insight into the effect of enzyme surface charge on enzyme stability in ILs. © 2015 Wiley Periodicals, Inc.
NASA Astrophysics Data System (ADS)
Matsumoto, Yoshiteru; Yoshiura, Ryuto; Honma, Kenji
2017-07-01
We investigated the crystalline structures of jet-cooled acetylene (C2H2) large clusters by laser spectroscopy and chemometrics. The CH stretching vibrations of the C2H2 large clusters were observed by infrared (IR) cavity ringdown spectroscopy. The IR spectra of C2H2 clusters were measured under the conditions of various concentrations of C2H2/He mixture gas for supersonic jets. Upon increasing the gas concentration from 1% to 10%, we observed a rapid intensity enhancement for a band in the IR spectra. The strong dependence of the intensity on the gas concentration indicates that the band was assigned to CH stretching vibrations of the large clusters. An analysis of the IR spectra by two-dimensional correlation spectroscopy revealed that the IR absorption due to the C2H2 large cluster is decomposed into two CH stretching vibrations. The vibrational frequencies of the two bands are almost equivalent to the IR absorption of the pure- and poly-crystalline orthorhombic structures in the aerosol particles. The characteristic temperature behavior of the IR spectra implies the existence of the other large cluster, which is discussed in terms of the phase transition of a bulk crystal.
NASA Astrophysics Data System (ADS)
Maleki, Farahnaz; Schlexer, Philomena; Pacchioni, Gianfranco
2018-02-01
Oxide-supported Cu nanoparticles and clusters catalyze a variety of important reactions, such as CO/CO2 hydrogenation to methanol. Recent studies demonstrate that also sub-nanometer clusters consisting of only a few atoms can actively catalyze chemical reactions. In this study, we investigate the interaction between Cu4 clusters and silica-surfaces, considering the de-hydroxylated and the fully hydroxylated α-quartz surfaces. We also considered various dopants such as Ti- and Nb-ions substitutional to Si, respectively, in order to see if an electronic change of the support has an effect on the reaction of the supported cluster. We find that hydroxyl groups can enhance the adsorption energy of the cluster, whereas the dopants have only little effects on the adsorption mode of the Cu cluster. On the fully hydroxylated surface, the cluster may react with the hydroxyl groups via reverse hydrogen spillover. Finally, we explore the reactivity of the silica-supported Cu4 cluster in terms of acetylene trimerization, for which extended Cu surfaces have shown catalytic activity. We find that this reaction should occur with activation barriers below 0.8 eV; Nb-doping of the support does not seem to produce any direct effect on the reactivity of the Cu tetramer.
Enzymes for improved biomass conversion
Brunecky, Roman; Himmel, Michael E.
2016-02-02
Disclosed herein are enzymes and combinations of the enzymes useful for the hydrolysis of cellulose and the conversion of biomass. Methods of degrading cellulose and biomass using enzymes and cocktails of enzymes are also disclosed.
Läufer, Albrecht
2017-03-07
Nature uses enzymes to build and convert biomass; mankind uses the same enzymes and produces them on a large scale to make optimum use of biomass in biorefineries. Bacterial α-amylases and fungal glucoamylases have been the workhorses of starch biorefineries for many decades. Pullulanases were introduced in the 1980s. Proteases, cellulases, hemicellulases, and phytases have been on the market for a few years as process aids, improving yields, performance, and costs. Detailed studies of the complex chemical structures of biomass and of the physicochemical limitations of industrial biorefineries have led enzyme developers to produce novel tailor-made solutions for improving yield and profitability in the industry. This chapter reviews the development of enzyme applications in the major starch biorefining processes.
Effects of gasoline components on MTBE and TBA cometabolism by Mycobacterium austroafricanum JOB5.
House, Alan J; Hyman, Michael R
2010-07-01
In this study we have examined the effects of individual gasoline hydrocarbons (C(5-10,12,14) n-alkanes, C(5-8) isoalkanes, alicyclics [cyclopentane and methylcyclopentane] and BTEX compounds [benzene, toluene, ethylbenzene, m-, o-, and p-xylene]) on cometabolism of methyl tertiary butyl ether (MTBE) and tertiary butyl alcohol (TBA) by Mycobacterium austroafricanum JOB5. All of the alkanes tested supported growth and both MTBE and TBA oxidation. Growth on C(5-8) n-alkanes and isoalkanes was inhibited by acetylene whereas growth on longer chain n-alkanes was largely unaffected by this gas. However, oxidation of both MTBE and TBA by resting cells was consistently inhibited by acetylene, irrespective of the alkane used as growth-supporting substrate. A model involving two separate but co-expressed alkane-oxidizing enzyme systems is proposed to account for these observations. Cyclopentane, methylcyclopentane, benzene and ethylbenzene did not support growth but these compounds all inhibited MTBE and TBA oxidation by alkane-grown cells. In the case of benzene, the inhibition was shown to be due to competitive interactions with both MTBE and TBA. Several aromatic compounds (p-xylene > toluene > m-xylene) did support growth and cells previously grown on these substrates also oxidized MTBE and TBA. Low concentrations of toluene (<10 microM) stimulated MTBE and TBA oxidation by alkane-grown cells whereas higher concentrations were inhibitory. The effects of acetylene suggest strain JOB5 also has two distinct toluene-oxidizing activities. These results have been discussed in terms of their impact on our understanding of MTBE and TBA cometabolism and the enzymes involved in these processes in mycobacteria and other bacteria.
Mohamad, Nur Royhaila; Marzuki, Nur Haziqah Che; Buang, Nor Aziah; Huyop, Fahrul; Wahab, Roswanira Abdul
2015-01-01
The current demands of sustainable green methodologies have increased the use of enzymatic technology in industrial processes. Employment of enzyme as biocatalysts offers the benefits of mild reaction conditions, biodegradability and catalytic efficiency. The harsh conditions of industrial processes, however, increase propensity of enzyme destabilization, shortening their industrial lifespan. Consequently, the technology of enzyme immobilization provides an effective means to circumvent these concerns by enhancing enzyme catalytic properties and also simplify downstream processing and improve operational stability. There are several techniques used to immobilize the enzymes onto supports which range from reversible physical adsorption and ionic linkages, to the irreversible stable covalent bonds. Such techniques produce immobilized enzymes of varying stability due to changes in the surface microenvironment and degree of multipoint attachment. Hence, it is mandatory to obtain information about the structure of the enzyme protein following interaction with the support surface as well as interactions of the enzymes with other proteins. Characterization technologies at the nanoscale level to study enzymes immobilized on surfaces are crucial to obtain valuable qualitative and quantitative information, including morphological visualization of the immobilized enzymes. These technologies are pertinent to assess efficacy of an immobilization technique and development of future enzyme immobilization strategies. PMID:26019635
Targeted enzyme prodrug therapies.
Schellmann, N; Deckert, P M; Bachran, D; Fuchs, H; Bachran, C
2010-09-01
The cure of cancer is still a formidable challenge in medical science. Long-known modalities including surgery, chemotherapy and radiotherapy are successful in a number of cases; however, invasive, metastasized and inaccessible tumors still pose an unresolved and ongoing problem. Targeted therapies designed to locate, detect and specifically kill tumor cells have been developed in the past three decades as an alternative to treat troublesome cancers. Most of these therapies are either based on antibody-dependent cellular cytotoxicity, targeted delivery of cytotoxic drugs or tumor site-specific activation of prodrugs. The latter is a two-step procedure. In the first step, a selected enzyme is accumulated in the tumor by guiding the enzyme or its gene to the neoplastic cells. In the second step, a harmless prodrug is applied and specifically converted by this enzyme into a cytotoxic drug only at the tumor site. A number of targeting systems, enzymes and prodrugs were investigated and improved since the concept was first envisioned in 1974. This review presents a concise overview on the history and latest developments in targeted therapies for cancer treatment. We cover the relevant technologies such as antibody-directed enzyme prodrug therapy (ADEPT), gene-directed enzyme prodrug therapy (GDEPT) as well as related therapies such as clostridial- (CDEPT) and polymer-directed enzyme prodrug therapy (PDEPT) with emphasis on prodrug-converting enzymes, prodrugs and drugs.
AN ENZYME-IMMOBILIZATION PROCEDURE FOR THE ANALYSIS OF ENZYME-INHIBITING CHEMICALS IN WATER
The enzymes cholinesterase and urease were mixed individually with gelatin and immobilized onto the inside surface of glass capillary tubes. After the gelatin-enzyme mixture had dried, water samples containing various enzyme inhibiting test chemicals were pumped through the tubes...
Single-step azide introduction in proteins via an aqueous diazo transfer.
van Dongen, Stijn F M; Teeuwen, Rosalie L M; Nallani, Madhavan; van Berkel, Sander S; Cornelissen, Jeroen J L M; Nolte, Roeland J M; van Hest, Jan C M
2009-01-01
The controlled introduction of azides in proteins provides targetable handles for selective protein manipulation. We present here an efficient diazo transfer protocol that can be applied in an aqueous solution, leading to the facile introduction of azides in the side chains of lysine residues and at the N-terminus of enzymes, e.g. horseradish peroxidase (HRP) and the red fluorescent protein DsRed. The effective introduction of azides was verified by mass spectrometry, after which the azido-proteins were used in Cu(I)-catalyzed [3 + 2] cycloaddition reactions. Azido-HRP retained its catalytic activity after conjugation of a small molecule. This modified protein could also be successfully immobilized on the surface of an acetylene-covered polymersome. Azido-DsRed was coupled to an acetylene-bearing protein allowing it to act as a fluorescent label, demonstrating the wide applicability of the diazo transfer procedure.
Enzyme-MOF (metal-organic framework) composites.
Lian, Xizhen; Fang, Yu; Joseph, Elizabeth; Wang, Qi; Li, Jialuo; Banerjee, Sayan; Lollar, Christina; Wang, Xuan; Zhou, Hong-Cai
2017-06-06
The ex vivo application of enzymes in various processes, especially via enzyme immobilization techniques, has been extensively studied in recent years in order to enhance the recyclability of enzymes, to minimize enzyme contamination in the product, and to explore novel horizons for enzymes in biomedical applications. Possessing remarkable amenability in structural design of the frameworks as well as almost unparalelled surface tunability, Metal-Organic Frameworks (MOFs) have been gaining popularity as candidates for enzyme immobilization platforms. Many MOF-enzyme composites have achieved unprecedented results, far outperforming free enzymes in many aspects. This review summarizes recent developments of MOF-enzyme composites with special emphasis on preparative techniques and the synergistic effects of enzymes and MOFs. The applications of MOF-enzyme composites, primarily in transferation, catalysis and sensing, are presented as well. The enhancement of enzymatic activity of the composites over free enzymes in biologically incompatible conditions is emphasized in many cases.
NASA Technical Reports Server (NTRS)
Bosco, S. R.; Nava, D. F.; Brobst, W. D.; Stief, L. J.
1984-01-01
The absolute rate constants for the reaction between the NH2 free radical and acetylene and ethylene is measured experimentally using a flash photolysis technique. The constant is considered to be a function of temperature and pressure. At each temperature level of the experiment, the observed pseudo-first-order rate constants were assumed to be independent of flash intensity. The results of the experiment indicate that the bimolecular rate constant for the NH2 + C2H2 reaction increases with pressure at 373 K and 459 K but not at lower temperatures. Results near the pressure limit conform to an Arrhenius expression of 1.11 (+ or -) 0.36 x 10 to the -13th over the temperature range from 241 to 459 K. For the reaction NH2 + C2H4, a smaller rate of increase in the bimolecular rate constant was observed over the temperature range 250-465 K. The implications of these results for current theoretical models of NH2 + C2H2 (or H4) reactions in the atmospheres of Jupiter and Saturn are discussed.
NASA Technical Reports Server (NTRS)
Shinn, J. L.
1981-01-01
Absorption spectroscopy of carbon and hydrocarbon species has been performed in a shock tube at an incident shock condition for a wavelength range of 135-220 nm, in order to obtain information needed for calculating radiation blockage ahead of a planetary probe. Instrumentation consisted of high frequency response pressure transducers, thin-film heat transfer gages, or photomultipliers coupled by light pipes. Two test-gas mixtures, one with acetylene and the other with methane, both diluted with argon, were used to provide a reliable variation of C3 and C2H concentration ratio. Comparison of tests results of the two mixtures, in the temperature range of 3750 + or - 100 K, showed the main absorbing species to be C3. The wavelength for maximum absorption agrees well with the theoretical values of 7.68 eV and 8.03 eV for the vertical excitation energy, and a value of 0.90 for the electronic oscillator strength, obtained from the measured absorption band, is also in good agreement with the predicted value of 0.92.
Jones, Hannah B L; Wells, Stephen A; Prentice, Erica J; Kwok, Anthony; Liang, Liyin L; Arcus, Vickery L; Pudney, Christopher R
2017-09-01
Our understanding of how enzymes work is coloured by static structure depictions where the enzyme scaffold is presented as either immobile, or in equilibrium between well-defined static conformations. Proteins, however, exhibit a large degree of motion over a broad range of timescales and magnitudes and this is defined thermodynamically by the enzyme free energy landscape (FEL). The role and importance of enzyme motion is extremely contentious. Much of the challenge is in the experimental detection of so called 'conformational sampling' involved in enzyme turnover. Herein we apply combined pressure and temperature kinetics studies to elucidate the full suite of thermodynamic parameters defining an enzyme FEL as it relates to enzyme turnover. We find that the key thermodynamic parameters governing vibrational modes related to enzyme turnover are the isobaric expansivity term and the change in heat capacity for enzyme catalysis. Variation in the enzyme FEL affects these terms. Our analysis is supported by a range of biophysical and computational approaches that specifically capture information on protein vibrational modes and the FEL (all atom flexibility calculations, red edge excitation shift spectroscopy and viscosity studies) that provide independent evidence for our findings. Our data suggest that restricting the enzyme FEL may be a powerful strategy when attempting to rationally engineer enzymes, particularly to alter thermal activity. Moreover, we demonstrate how rational predictions can be made with a rapid computational approach. © 2017 Federation of European Biochemical Societies.
The vanadium nitrogenase of Azotobacter chroococcum. Reduction of acetylene and ethylene to ethane.
Dilworth, M J; Eady, R R; Eldridge, M E
1988-01-01
1. The vanadium (V-) nitrogenase of Azobacter chroococcum transfers up to 7.4% of the electrons used in acetylene (C2H2) reduction for the formation of ethane (C2H6). The apparent Km for C2H2 (6 kPa) is the same for either ethylene (C2H4) or ethane (C2H6) formation and much higher than the reported Km values for C2H2 reduction to C2H4 by molybdenum (Mo-) nitrogenases. Reduction of C2H2 in 2H2O yields predominantly [cis-2H2]ethylene. 2. The ratio of electron flux yielding C2H6 to that yielding C2H4 (the C2H6/C2H4 ratio) is increased by raising the ratio of Fe protein to VFe protein and by increasing the assay temperature up to at least 40 degrees C. pH values above 7.5 decrease the C2H6/C2H4 ratio. 3. C2H4 and C2H6 formation from C2H2 by V-nitrogenase are not inhibited by H2. CO inhibits both processes much less strongly than it inhibits C2H4 formation from C2H2 with Mo-nitrogenase. 4. Although V-nitrogenase also catalyses the slow CO-sensitive reduction of C2H4 to C2H6, free C2H4 is not an intermediate in C2H6 formation from C2H2. 5. Propyne (CH3C identical to CH) is not reduced by the V-nitrogenase. 6. Some implications of these results for the mechanism of C2H6 formation by the V-nitrogenase are discussed. PMID:3162672
NASA Astrophysics Data System (ADS)
Anh, Trinh Tuan; Thuan, Vu Manh; Thang, Doan Ha; Hang, Bui Thi
2017-06-01
In an effort to find the best anode material for Fe/air batteries, a Fe2O3/AB (Acetylene Black) composite was prepared by dry-type ball milling using Fe2O3 nanoparticles and AB as the active and additive materials, respectively. The effects of various binders and Fe2O3 content on the electrochemical properties of Fe2O3/AB electrodes in alkaline solution were investigated. It was found that the content of Fe2O3 strongly affected the electrochemical behavior of Fe2O3/AB electrodes; with Fe2O3 nanopowder content reaching 70 wt.% for the electrode and showing improvement of the cyclability. When the electrode binder polytetrafluoroethylene (PTFE) was used, clear redox peaks were observed via cyclic voltammetry (CV), while polyvinylidene fluoride-containing electrodes provided CV curves with unobservable redox peaks. Increasing either binder content in the electrode showed a negative effect in terms of the cyclability of the Fe2O3/AB electrode.
An update on the Enzyme Portal: an integrative approach for exploring enzyme knowledge
Onwubiko, J.; Zaru, R.; Rosanoff, S.; Antunes, R.; Bingley, M.; Watkins, X.; O'Donovan, C.; Martin, M. J.
2017-01-01
Abstract Enzymes are a key part of life processes and are increasingly important for various areas of research such as medicine, biotechnology, bioprocessing and drug research. The goal of the Enzyme Portal is to provide an interface to all European Bioinformatics Institute (EMBL-EBI) data about enzymes (de Matos, P., et al., (2013), BMC Bioinformatics, 14 (1), 103). These data include enzyme function, sequence features and family classification, protein structure, reactions, pathways, small molecules, diseases and the associated literature. The sources of enzyme data are: the UniProt Knowledgebase (UniProtKB) (UniProt Consortium, 2015), the Protein Data Bank in Europe (PDBe), (Valenkar, S., et al., Nucleic Acids Res.2016; 44, D385–D395) Rhea—a database of enzyme-catalysed reactions (Morgat, A., et al., Nucleic Acids Res. 2015; 43, D459-D464), Reactome—a database of biochemical pathways (Fabregat, A., et al., Nucleic Acids Res. 2016; 44, D481–D487), IntEnz—a resource with enzyme nomenclature information (Fleischmann, A., et al., Nucleic Acids Res. 2004 32, D434–D437) and ChEBI (Hastings, J., et al., Nucleic Acids Res. 2013) and ChEMBL (Bento, A. P., et al., Nucleic Acids Res. 201442, 1083–1090)—resources which contain information about small-molecule chemistry and bioactivity. This article describes the redesign of Enzyme Portal and the increased functionality added to maximise integration and interpretation of these data. Use case examples of the Enzyme Portal and the versatile workflows its supports are illustrated. We welcome the suggestion of new resources for integration. PMID:28158609
An update on the Enzyme Portal: an integrative approach for exploring enzyme knowledge.
Pundir, S; Onwubiko, J; Zaru, R; Rosanoff, S; Antunes, R; Bingley, M; Watkins, X; O'Donovan, C; Martin, M J
2017-03-01
Enzymes are a key part of life processes and are increasingly important for various areas of research such as medicine, biotechnology, bioprocessing and drug research. The goal of the Enzyme Portal is to provide an interface to all European Bioinformatics Institute (EMBL-EBI) data about enzymes (de Matos, P., et al. , (2013), BMC Bioinformatics , (1), 103). These data include enzyme function, sequence features and family classification, protein structure, reactions, pathways, small molecules, diseases and the associated literature. The sources of enzyme data are: the UniProt Knowledgebase (UniProtKB) (UniProt Consortium, 2015), the Protein Data Bank in Europe (PDBe), (Valenkar, S., et al ., Nucleic Acids Res. 2016; , D385-D395) Rhea-a database of enzyme-catalysed reactions (Morgat, A., et al ., Nucleic Acids Res. 2015; , D459-D464), Reactome-a database of biochemical pathways (Fabregat, A., et al ., Nucleic Acids Res. 2016; , D481-D487), IntEnz-a resource with enzyme nomenclature information (Fleischmann, A., et al ., Nucleic Acids Res. 2004 , D434-D437) and ChEBI (Hastings, J., et al ., Nucleic Acids Res. 2013) and ChEMBL (Bento, A. P., et al ., Nucleic Acids Res. 2014 , 1083-1090)-resources which contain information about small-molecule chemistry and bioactivity. This article describes the redesign of Enzyme Portal and the increased functionality added to maximise integration and interpretation of these data. Use case examples of the Enzyme Portal and the versatile workflows its supports are illustrated. We welcome the suggestion of new resources for integration. © The Author 2017. Published by Oxford University Press. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com
Omelchenko, Marina V; Galperin, Michael Y; Wolf, Yuri I; Koonin, Eugene V
2010-04-30
Evolutionarily unrelated proteins that catalyze the same biochemical reactions are often referred to as analogous - as opposed to homologous - enzymes. The existence of numerous alternative, non-homologous enzyme isoforms presents an interesting evolutionary problem; it also complicates genome-based reconstruction of the metabolic pathways in a variety of organisms. In 1998, a systematic search for analogous enzymes resulted in the identification of 105 Enzyme Commission (EC) numbers that included two or more proteins without detectable sequence similarity to each other, including 34 EC nodes where proteins were known (or predicted) to have distinct structural folds, indicating independent evolutionary origins. In the past 12 years, many putative non-homologous isofunctional enzymes were identified in newly sequenced genomes. In addition, efforts in structural genomics resulted in a vastly improved structural coverage of proteomes, providing for definitive assessment of (non)homologous relationships between proteins. We report the results of a comprehensive search for non-homologous isofunctional enzymes (NISE) that yielded 185 EC nodes with two or more experimentally characterized - or predicted - structurally unrelated proteins. Of these NISE sets, only 74 were from the original 1998 list. Structural assignments of the NISE show over-representation of proteins with the TIM barrel fold and the nucleotide-binding Rossmann fold. From the functional perspective, the set of NISE is enriched in hydrolases, particularly carbohydrate hydrolases, and in enzymes involved in defense against oxidative stress. These results indicate that at least some of the non-homologous isofunctional enzymes were recruited relatively recently from enzyme families that are active against related substrates and are sufficiently flexible to accommodate changes in substrate specificity.
Digestive Enzyme Supplementation in Gastrointestinal Diseases.
Ianiro, Gianluca; Pecere, Silvia; Giorgio, Valentina; Gasbarrini, Antonio; Cammarota, Giovanni
2016-01-01
Digestive enzymes are able to break down proteins and carbohydrates and lipids, and their supplementation may play a role in the management of digestive disorders, from lactose intolerance to cystic fibrosis. To date, several formulations of digestive enzymes are available on the market, being different each other in terms of enzyme type, source and origin, and dosage. This review, performed through a non-systematic search of the available literature, will provide an overview of the current knowledge of digestive enzyme supplementation in gastrointestinal disorders, discussion of the use of pancreatic enzymes, lactase (β-galactosidase) and conjugated bile acids, and also exploring the future perspective of digestive enzyme supplementation. Currently, the animal-derived enzymes represent an established standard of care, however the growing study of plant-based and microbe-derived enzymes offers great promise in the advancement of digestive enzyme therapy. New frontiers of enzyme replacement are being evaluated also in the treatment of diseases not specifically related to enzyme deficiency, whereas the combination of different enzymes might constitute an intriguing therapeutic option in the future.
NASA Astrophysics Data System (ADS)
Carlson, Robert W.; Baines, K. H.; Anderson, M. S.; Filacchione, G.
2012-10-01
The production mechanisms of chromophores at Jupiter, and notably at the Great Red Spot (GRS), have been long-standing puzzles. A clue to the formation of the GRS coloring agent may be the great height of this storm, which can upwell ammonia to pressure levels of a few hundred mbar where solar photons capable of dissociating NH3 penetrate. Acetylene formed at higher altitudes can diffuse down and react with the NH3 photodissociation products, forming a deposit that absorbs in the ultraviolet and visible region (Ferris and Ishikawa, J. Amer. Chem. Soc. 110, 4306-4312, 1988). We have investigated the system NH3 + C2H2 + CH4 using a Zn lamp emitting at 214 nm to produce NH2 + H and subsequent reaction products. The deposits produced in these reactions were analyzed by optical and infrared spectroscopy and soft-ionization (He*) time-of-flight mass spectroscopy. The combination of NH3 + CH4 produced no visibly absorbing material, but NH3 + C2H2 and NH3 + C2H2 + CH4 mixtures both produced a yellow-orange film whose transmission spectra are similar to that of the GRS obtained by Cassini VIMS. Infrared spectra show a strong band at 2056 wavenumbers which may arise from nitrile (-CN), isonitrile (-NC), or diazide (-CNN) functional groups. The high-resolution mass spectra are consistent with compounds of the form CnH2n+1Nm, similar to the products formed in NH3 + CH4 spark discharges (Molton and Ponnamperuma, Icarus 21, 166-174, 1974). We thank NASA's Planetary Atmospheres Program for support.
Bi, Xiaodong; Liu, Zhen
2014-12-16
Enzyme activity assay is an important method in clinical diagnostics. However, conventional enzyme activity assay suffers from apparent interference from the sample matrix. Herein, we present a new format of enzyme activity assay that can effectively eliminate the effects of the sample matrix. The key is a 96-well microplate modified with molecularly imprinted polymer (MIP) prepared according to a newly proposed method called boronate affinity-based oriented surface imprinting. Alkaline phosphatase (ALP), a glycoprotein enzyme that has been routinely used as an indicator for several diseases in clinical tests, was taken as a representative target enzyme. The prepared MIP exhibited strong affinity toward the template enzyme (with a dissociation constant of 10(-10) M) as well as superb tolerance for interference. Thus, the enzyme molecules in a complicated sample matrix could be specifically captured and cleaned up for enzyme activity assay, which eliminated the interference from the sample matrix. On the other hand, because the boronate affinity MIP could well retain the enzymatic activity of glycoprotein enzymes, the enzyme captured by the MIP was directly used for activity assay. Thus, additional assay time and possible enzyme or activity loss due to an enzyme release step required by other methods were avoided. Assay of ALP in human serum was successfully demonstrated, suggesting a promising prospect of the proposed method in real-world applications.
Dissipative Dynamics of Enzymes
NASA Astrophysics Data System (ADS)
Ariyaratne, Amila; Wu, Chenhao; Tseng, Chiao-Yu; Zocchi, Giovanni
2014-11-01
We explore enzyme conformational dynamics at sub-Å resolution, specifically, temperature effects. The ensemble-averaged mechanical response of the folded enzyme is viscoelastic in the whole temperature range between the warm and cold denaturation transitions. The dissipation parameter γ of the viscoelastic description decreases by a factor of 2 as the temperature is raised from 10 to 45 °C ; the elastic parameter K shows a similar decrease. Thus, when probed dynamically, the enzyme softens for increasing temperature. Equilibrium mechanical experiments with the DNA spring (and a different enzyme) also show, qualitatively, a small softening for increasing temperature.
Dissipative Dynamics of Enzymes
NASA Astrophysics Data System (ADS)
Ariyaratne, Amila; Wu, Chenhao; Tseng, Chiao-Yu; Zocchi, Giovanni; Zocchi LabMolecular Biophysics Team
2015-03-01
We explore enzyme conformational dynamics at sub - Å resolution, specifically temperature effects. The ensemble averaged mechanical response of the folded enzyme is viscoelastic in the whole temperature range between the warm and cold denaturation transitions. The dissipation parameter γ of the viscoelastic description decreases by a factor 2 as the temperature is raised from 10 C to 45 C; the elastic parameter K shows a similar decrease. Thus when probed dynamically, the enzyme softens for increasing temperature. Equilibrium mechanical experiments with the DNA spring (and a different enzyme) also show, qualitatively, a small softening for increasing temperature.
Dissipative dynamics of enzymes.
Ariyaratne, Amila; Wu, Chenhao; Tseng, Chiao-Yu; Zocchi, Giovanni
2014-11-07
We explore enzyme conformational dynamics at sub-Å resolution, specifically, temperature effects. The ensemble-averaged mechanical response of the folded enzyme is viscoelastic in the whole temperature range between the warm and cold denaturation transitions. The dissipation parameter γ of the viscoelastic description decreases by a factor of 2 as the temperature is raised from 10 to 45 °C; the elastic parameter K shows a similar decrease. Thus, when probed dynamically, the enzyme softens for increasing temperature. Equilibrium mechanical experiments with the DNA spring (and a different enzyme) also show, qualitatively, a small softening for increasing temperature.
Enzyme Mimics: Advances and Applications.
Kuah, Evelyn; Toh, Seraphina; Yee, Jessica; Ma, Qian; Gao, Zhiqiang
2016-06-13
Enzyme mimics or artificial enzymes are a class of catalysts that have been actively pursued for decades and have heralded much interest as potentially viable alternatives to natural enzymes. Aside from having catalytic activities similar to their natural counterparts, enzyme mimics have the desired advantages of tunable structures and catalytic efficiencies, excellent tolerance to experimental conditions, lower cost, and purely synthetic routes to their preparation. Although still in the midst of development, impressive advances have already been made. Enzyme mimics have shown immense potential in the catalysis of a wide range of chemical and biological reactions, the development of chemical and biological sensing and anti-biofouling systems, and the production of pharmaceuticals and clean fuels. This Review concerns the development of various types of enzyme mimics, namely polymeric and dendrimeric, supramolecular, nanoparticulate and proteinic enzyme mimics, with an emphasis on their synthesis, catalytic properties and technical applications. It provides an introduction to enzyme mimics and a comprehensive summary of the advances and current standings of their applications, and seeks to inspire researchers to perfect the design and synthesis of enzyme mimics and to tailor their functionality for a much wider range of applications. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Várnai, Anikó; Viikari, Liisa; Marjamaa, Kaisa; Siika-aho, Matti
2011-01-01
The adsorption of purified Trichoderma reesei cellulases (TrCel7A, TrCel6A and TrCel5A) and xylanase TrXyn11 and Aspergillus niger β-glucosidase AnCel3A was studied in enzyme mixture during hydrolysis of two pretreated lignocellulosic materials, steam pretreated and catalytically delignified spruce, along with microcrystalline cellulose (Avicel). The enzyme mixture was compiled to resemble the composition of commercial cellulase preparations. The hydrolysis was carried out at 35 °C to mimic the temperature of the simultaneous saccharification and fermentation (SSF). Enzyme adsorption was followed by analyzing the activity and the protein amount of the individual free enzymes in the hydrolysis supernatant. Most enzymes adsorbed quickly at early stages of the hydrolysis and remained bound throughout the hydrolysis, although the conversion reached was fairly high. Only with the catalytically oxidized spruce samples, the bound enzymes started to be released as the hydrolysis degree reached 80%. The results based on enzyme activities and protein assay were in good accordance. Copyright © 2010 Elsevier Ltd. All rights reserved.
Characterising Complex Enzyme Reaction Data
Rahman, Syed Asad; Thornton, Janet M.
2016-01-01
The relationship between enzyme-catalysed reactions and the Enzyme Commission (EC) number, the widely accepted classification scheme used to characterise enzyme activity, is complex and with the rapid increase in our knowledge of the reactions catalysed by enzymes needs revisiting. We present a manual and computational analysis to investigate this complexity and found that almost one-third of all known EC numbers are linked to more than one reaction in the secondary reaction databases (e.g., KEGG). Although this complexity is often resolved by defining generic, alternative and partial reactions, we have also found individual EC numbers with more than one reaction catalysing different types of bond changes. This analysis adds a new dimension to our understanding of enzyme function and might be useful for the accurate annotation of the function of enzymes and to study the changes in enzyme function during evolution. PMID:26840640
Sirisha, V L; Jain, Ankita; Jain, Amita
Immobilized enzymes can be used in a wide range of processes. In recent years, a variety of new approaches have emerged for the immobilization of enzymes that have greater efficiency and wider usage. During the course of the last two decades, this area has rapidly expanded into a multidisciplinary field. This current study is a comprehensive review of a variety of literature produced on the different enzymes that have been immobilized on various supporting materials. These immobilized enzymes have a wide range of applications. These include applications in the sugar, fish, and wine industries, where they are used for removing organic compounds from waste water. This study also reviews their use in sophisticated biosensors for metabolite control and in situ measurements of environmental pollutants. Immobilized enzymes also find significant application in drug metabolism, biodiesel and antibiotic production, bioremediation, and the food industry. The widespread usage of immobilized enzymes is largely due to the fact that they are cheaper, environment friendly, and much easier to use when compared to equivalent technologies. © 2016 Elsevier Inc. All rights reserved.
Phylogenomic reconstruction of archaeal fatty acid metabolism
Dibrova, Daria V.; Galperin, Michael Y.; Mulkidjanian, Armen Y.
2014-01-01
While certain archaea appear to synthesize and/or metabolize fatty acids, the respective pathways still remain obscure. By analyzing the genomic distribution of the key lipid-related enzymes, we were able to identify the likely components of the archaeal pathway of fatty acid metabolism, namely, a combination of the enzymes of bacterial-type β-oxidation of fatty acids (acyl-CoA-dehydrogenase, enoyl-CoA hydratase, and 3-hydroxyacyl-CoA dehydrogenase) with paralogs of the archaeal acetyl-CoA C-acetyltransferase, an enzyme of the mevalonate biosynthesis pathway. These three β-oxidation enzymes working in the reverse direction could potentially catalyze biosynthesis of fatty acids, with paralogs of acetyl-CoA C-acetyltransferase performing addition of C2 fragments. The presence in archaea of the genes for energy-transducing membrane enzyme complexes, such as cytochrome bc complex, cytochrome c oxidase, and diverse rhodopsins, was found to correlate with the presence of the proposed system of fatty acid biosynthesis. We speculate that because these membrane complexes functionally depend on fatty acid chains, their genes could have been acquired via lateral gene transfer from bacteria only by those archaea that already possessed a system of fatty acid biosynthesis. The proposed pathway of archaeal fatty acid metabolism operates in extreme conditions and therefore might be of interest in the context of biofuel production and other industrial applications. PMID:24818264
Mak, Chi H; Pham, Phuong; Afif, Samir A; Goodman, Myron F
2015-09-01
Enzymes that rely on random walk to search for substrate targets in a heterogeneously dispersed medium can leave behind complex spatial profiles of their catalyzed conversions. The catalytic signatures of these random-walk enzymes are the result of two coupled stochastic processes: scanning and catalysis. Here we develop analytical models to understand the conversion profiles produced by these enzymes, comparing an intrusive model, in which scanning and catalysis are tightly coupled, against a loosely coupled passive model. Diagrammatic theory and path-integral solutions of these models revealed clearly distinct predictions. Comparison to experimental data from catalyzed deaminations deposited on single-stranded DNA by the enzyme activation-induced deoxycytidine deaminase (AID) demonstrates that catalysis and diffusion are strongly intertwined, where the chemical conversions give rise to new stochastic trajectories that were absent if the substrate DNA was homogeneous. The C→U deamination profiles in both analytical predictions and experiments exhibit a strong contextual dependence, where the conversion rate of each target site is strongly contingent on the identities of other surrounding targets, with the intrusive model showing an excellent fit to the data. These methods can be applied to deduce sequence-dependent catalytic signatures of other DNA modification enzymes, with potential applications to cancer, gene regulation, and epigenetics.
Mak, Chi H.; Pham, Phuong; Afif, Samir A.; Goodman, Myron F.
2015-01-01
Enzymes that rely on random walk to search for substrate targets in a heterogeneously dispersed medium can leave behind complex spatial profiles of their catalyzed conversions. The catalytic signatures of these random-walk enzymes are the result of two coupled stochastic processes: scanning and catalysis. Here we develop analytical models to understand the conversion profiles produced by these enzymes, comparing an intrusive model, in which scanning and catalysis are tightly coupled, against a loosely coupled passive model. Diagrammatic theory and path-integral solutions of these models revealed clearly distinct predictions. Comparison to experimental data from catalyzed deaminations deposited on single-stranded DNA by the enzyme activation-induced deoxycytidine deaminase (AID) demonstrates that catalysis and diffusion are strongly intertwined, where the chemical conversions give rise to new stochastic trajectories that were absent if the substrate DNA was homogeneous. The C → U deamination profiles in both analytical predictions and experiments exhibit a strong contextual dependence, where the conversion rate of each target site is strongly contingent on the identities of other surrounding targets, with the intrusive model showing an excellent fit to the data. These methods can be applied to deduce sequence-dependent catalytic signatures of other DNA modification enzymes, with potential applications to cancer, gene regulation, and epigenetics. PMID:26465508
NASA Astrophysics Data System (ADS)
Mak, Chi H.; Pham, Phuong; Afif, Samir A.; Goodman, Myron F.
2015-09-01
Enzymes that rely on random walk to search for substrate targets in a heterogeneously dispersed medium can leave behind complex spatial profiles of their catalyzed conversions. The catalytic signatures of these random-walk enzymes are the result of two coupled stochastic processes: scanning and catalysis. Here we develop analytical models to understand the conversion profiles produced by these enzymes, comparing an intrusive model, in which scanning and catalysis are tightly coupled, against a loosely coupled passive model. Diagrammatic theory and path-integral solutions of these models revealed clearly distinct predictions. Comparison to experimental data from catalyzed deaminations deposited on single-stranded DNA by the enzyme activation-induced deoxycytidine deaminase (AID) demonstrates that catalysis and diffusion are strongly intertwined, where the chemical conversions give rise to new stochastic trajectories that were absent if the substrate DNA was homogeneous. The C →U deamination profiles in both analytical predictions and experiments exhibit a strong contextual dependence, where the conversion rate of each target site is strongly contingent on the identities of other surrounding targets, with the intrusive model showing an excellent fit to the data. These methods can be applied to deduce sequence-dependent catalytic signatures of other DNA modification enzymes, with potential applications to cancer, gene regulation, and epigenetics.
Phage lytic enzymes: a history.
Trudil, David
2015-02-01
There are many recent studies regarding the efficacy of bacteriophage-related lytic enzymes: the enzymes of 'bacteria-eaters' or viruses that infect bacteria. By degrading the cell wall of the targeted bacteria, these lytic enzymes have been shown to efficiently lyse Gram-positive bacteria without affecting normal flora and non-related bacteria. Recent studies have suggested approaches for lysing Gram-negative bacteria as well (Briersa Y, et al., 2014). These enzymes include: phage-lysozyme, endolysin, lysozyme, lysin, phage lysin, phage lytic enzymes, phageassociated enzymes, enzybiotics, muralysin, muramidase, virolysin and designations such as Ply, PAE and others. Bacteriophages are viruses that kill bacteria, do not contribute to antimicrobial resistance, are easy to develop, inexpensive to manufacture and safe for humans, animals and the environment. The current focus on lytic enzymes has been on their use as anti-infectives in humans and more recently in agricultural research models. The initial translational application of lytic enzymes, however, was not associated with treating or preventing a specific disease but rather as an extraction method to be incorporated in a rapid bacterial detection assay (Bernstein D, 1997).The current review traces the translational history of phage lytic enzymes-from their initial discovery in 1986 for the rapid detection of group A streptococcus in clinical specimens to evolving applications in the detection and prevention of disease in humans and in agriculture.
NASA Astrophysics Data System (ADS)
Poon, Ray W. Y.; Ho, Joan P. Y.; Liu, Xuanyong; Chung, C. Y.; Chu, Paul K.; Yeung, Kelvin W. K.; Lu, William W.; Cheung, Kenneth M. C.
2005-08-01
Nickel-titanium shape memory alloys (NiTi) are useful materials in orthopedics and orthodontics due to their unique super-elasticity and shape memory effects. However, the problem associated with the release of harmful Ni ions to human tissues and fluids has been raising safety concern. Hence, it is necessary to produce a surface barrier to impede the out-diffusion of Ni ions from the materials. We have conducted acetylene, nitrogen and oxygen plasma immersion ion implantation (PIII) into NiTi alloys in an attempt to improve the surface properties. All the implanted and annealed samples surfaces exhibit outstanding corrosion and Ni out-diffusion resistance. Besides, the implanted layers are mechanically stronger than the substrate underneath. XPS analyses disclose that the layer formed by C2H2 PIII is composed of mainly TiCx with increasing Ti to C concentration ratios towards the bulk. The nitrogen PIII layer is observed to be TiN, whereas the oxygen PIII layer is composed of oxides of Ti4+, Ti3+ and Ti2+.
Probing the Intermediacy of Covalent RNA Enzyme Complexes in RNA Modification Enzymes
Chervin, Stephanie M.; Kittendorf, Jeffrey D.; Garcia, George A.
2009-01-01
Within the large and diverse group of RNA-modifying enzymes, a number of enzymes seem to form stable covalent linkages to their respective RNA substrates. A complete understanding of the chemical and kinetic mechanisms of these enzymes, some of which have identified pathological roles, is lacking. As part of our ongoing work studying the posttranscriptional modification of tRNA with queuine, we wish to understand fully the chemical and kinetic mechanisms involved in this key transglycosylation reaction. In our previous investigations, we have used a gel mobility-shift assay to characterize an apparent covalent enzyme-RNA intermediate believed to be operative in the catalytic pathway. However, the simple observation of a covalent complex is not sufficient to prove intermediacy. To be a true intermediate, the complex must be both chemically and kinetically competent. As a case study for the proof of intermediacy, we report the use of this gel-shift assay under mildly denaturing conditions to probe the kinetic competency of the covalent association between RNA and the tRNA modifying enzyme tRNA-guanine transglycosylase (TGT). PMID:17673081
Leurs, Melanie; Tiller, Joerg C
2017-01-01
The properties of enzymes can be altered significantly by modification with polymers. Numerous different methods are known to obtain such polymer-enzyme conjugates (PECs). However, there is no universal method to render enzymes into PECs that are fully soluble in organic solvents. Here, we present a method, which achieves such high degree of modification of proteins that the majority of modified enzymes will be soluble in organic solvents. This is achieved by preparing poly(2-alkyloxazoline)s (POx) with an NH 2 end group and coupling this functional polymer via pyromellitic acid dianhydride onto the amino groups of the respective protein. The resulting PECs are capable of serving as surfactants for unmodified proteins, rendering the whole mixture organosoluble. Depending on the nature of the POx and the molecular weight and the nature of the enzyme, the PECs are soluble in chloroform or even toluene. Another advantage of this method is that the poly(2-alkyloxazoline) can be activated with the coupling agent and used for the enzyme conjugation without further purification. The POx-enzyme conjugates generated by this modification strategy show modulated catalytic activity in both, aqueous and organic, systems. © 2017 Elsevier Inc. All rights reserved.
Engineering Cellulase Enzymes for Bioenergy
NASA Astrophysics Data System (ADS)
Atreya, Meera Elizabeth
Sustainable energy sources, such as biofuels, offer increasingly important alternatives to fossil fuels that contribute less to global climate change. The energy contained within cellulosic biofuels derives from sunlight energy stored in the form of carbon-carbon bonds comprising sugars such as glucose. Second-generation biofuels are produced from lignocellulosic biomass feedstocks, including agricultural waste products and non-food crops like Miscanthus, that contain lignin and the polysaccharides hemicellulose and cellulose. Cellulose is the most abundant biological material on Earth; it is a polymer of glucose and a structural component of plant cell walls. Accessing the sugar is challenging, as the crystalline structure of cellulose resists degradation; biochemical and thermochemical means can be used to depolymerize cellulose. Cellulase enzymes catalyze the biochemical depolymerization of cellulose into glucose. Glucose can be used as a carbon source for growth of a biofuel-producing microorganism. When it converts glucose to a hydrocarbon fuel, this microbe completes the biofuels process of transforming sunlight energy into accessible, chemical energy capable of replacing non-renewable transportation fuels. Due to strong intermolecular interactions between polymer chains, cellulose is significantly more challenging to depolymerize than starch, a more accessible polymer of glucose utilized in first-generation biofuels processes (often derived from corn). While most mammals cannot digest cellulose (dietary fiber), certain fungi and bacteria produce cellulase enzymes capable of hydrolyzing it. These organisms secrete a wide variety of glycoside hydrolase and other classes of enzymes that work in concert. Because cellulase enzymes are slow-acting and expensive to produce, my aim has been to improve the properties of these enzymes as a means to make a cellulosic biofuels process possible that is more efficient and, consequently, more economical than current
Samaratunga, Ashani; Kudina, Olena; Nahar, Nurun; Zakharchenko, Andrey; Minko, Sergiy; Voronov, Andriy; Pryor, Scott W
2015-03-01
Cellulase and β-glucosidase were adsorbed on a polyacrylic acid polymer brush grafted on silica nanoparticles to produce enzymogels as a form of enzyme immobilization. Enzyme loading on the enzymogels was increased to a saturation level of approximately 110 μg (protein) mg(-1) (particle) for each enzyme. Enzymogels with varied enzyme loadings were then used to determine the impact on hydrolysis rate and enzyme recovery. Soluble sugar concentrations during the hydrolysis of filter paper and Solka-Floc with the enzymogels were 45 and 53%, respectively, of concentrations when using free cellulase. β-Glucosidase enzymogels showed lower performance; hydrolyzate glucose concentrations were just 38% of those using free enzymes. Increasing enzyme loading on the enzymogels did not reduce net efficacy for cellulase and improved efficacy for β-glucosidase. The use of free cellulases and cellulase enzymogels resulted in hydrolyzates with different proportions of cellobiose and glucose, suggesting differential attachment or efficacy of endoglucanases, exoglucanases, and β-glucosidases present in cellulase mixtures. When loading β-glucosidase individually, higher enzyme loadings on the enzymogels produced higher hydrolyzate glucose concentrations. Approximately 96% of cellulase and 66 % of β-glucosidase were recovered on the enzymogels, while enzyme loading level did not impact recovery for either enzyme.
Lu, Tu-lin; Su, Lian-lin; Ji, De; Gu, Wei; Mao, Chun-qin
2015-09-01
Drugs are exogenous compounds for human bodies, and will be metabolized by many enzymes after administration. CYP450 enzyme, as a major metabolic enzyme, is an important phase I drug metabolizing enzyme. In human bodies, about 75% of drug metabolism is conducted by CYP450 enzymes, and CYP450 enzymes is the key factor for drug interactions between traditional Chinese medicine( TCM) -TCM, TCM-medicine and other drug combination. In order to make clear the interaction between metabolic enzymes and TCM metabolism, we generally chose the enzymatic activity as an evaluation index. That is to say, the enhancement or reduction of CYP450 enzyme activity was used to infer the inducing or inhibitory effect of active ingredients and extracts of traditional Chinese medicine on enzymes. At present, the common method for measuring metabolic enzyme activity is Cocktail probe drugs, and it is the key to select the suitable probe substrates. This is of great significance for study drug's absorption, distribution, metabolism and excretion (ADME) process in organisms. The study focuses on the interaction between TCMs, active ingredients, herbal extracts, cocktail probe substrates as well as CYP450 enzymes, in order to guide future studies.
Hrycay, E G; Bandiera, S M
2009-12-01
The present review focuses on the expression, function and regulation of mouse cytochrome P450 (Cyp) enzymes. Information compiled for mouse Cyp enzymes is compared with data collected for human CYP enzymes. To date, approximately 40 pairs of orthologous mouse-human CYP genes have been identified that encode enzymes performing similar metabolic functions. Recent knowledge concerning the tissue expression of mouse Cyp enzymes from families 1 to 51 is summarized. The catalytic activities of microsomal, mitochondrial and recombinant mouse Cyp enzymes are discussed and their involvement in the metabolism of exogenous and endogenous compounds is highlighted. The role of nuclear receptors, such as the aryl hydrocarbon receptor, constitutive androstane receptor and pregnane X receptor, in regulating the expression of mouse Cyp enzymes is examined. Targeted disruption of selected Cyp genes has generated numerous Cyp null mouse lines used to decipher the role of Cyp enzymes in metabolic, toxicological and biological processes. In conclusion, the laboratory mouse is an indispensable model for exploring human CYP-mediated activities.
The enzymic hydrolysis of amygdalin
Haisman, D. R.; Knight, D. J.
1967-01-01
Chromatographic examination has shown that the enzymic hydrolysis of amygdalin by an almond β-glucosidase preparation proceeds consecutively: amygdalin was hydrolysed to prunasin and glucose; prunasin to mandelonitrile and glucose; mandelonitrile to benzaldehyde and hydrocyanic acid. Gentiobiose was not formed during the enzymic hydrolysis. The kinetics of the production of mandelonitrile and hydrocyanic acid from amygdalin by the action of the β-glucosidase preparation favour the probability that three different enzymes are involved, each specific for one hydrolytic stage, namely, amygdalin lyase, prunasin lyase and hydroxynitrile lyase. Cellulose acetate electrophoresis of the enzyme preparation showed that it contained a number of enzymically active components. PMID:4291788
Hirao, Hajime; Cheong, Zhi Hao; Wang, Xiaoqing
2012-07-12
The importance of the mechanism-based inactivation (MBI) of enzymes, which has a variety of physiological effects and therapeutic implications, has been garnering appreciation. Density functional theory calculations were undertaken to gain a clear understanding of the MBI of a cytochrome P450 enzyme (CYP2B4) by tert-butylphenylacetylene (tBPA). The results of calculations suggest that, in accordance with previous proposals, the reaction proceeds via a ketene-type metabolic intermediate. Once an oxoiron(IV) porphyryn π-cation radical intermediate (compound I) of P450 is generated at the heme reaction site, ketene formation is facile, as the terminal acetylene of tBPA can form a C-O bond with the oxo unit of compound I with a relatively low reaction barrier (14.1 kcal/mol). Unexpectedly, it was found that the ketene-type intermediate was not very reactive. Its reaction with the hydroxyl group of a threonine (Thr302) to form an ester bond required a substantial barrier (38.2 kcal/mol). The high barrier disfavored the mechanism by which these species react directly. However, the introduction of a water molecule in the reaction center led to its active participation in the reaction. The water was capable of donating its proton to the tBPA molecule, while accepting the proton of threonine. This water-mediated mechanism lowered the reaction barrier for the formation of an ester bond by about 20 kcal/mol. Therefore, our study suggests that a water molecule, which can easily gain access to the threonine residue through the proton-relay channel, plays a critical role in enhancing the covalent modification of threonine by terminal acetylene compounds. Another type of MBI by acetylenes, N-alkylation of the heme prosthetic group, was less favorable than the threonine modification pathway.
Nonclassical Kinetics of Clonal yet Heterogeneous Enzymes.
Park, Seong Jun; Song, Sanggeun; Jeong, In-Chun; Koh, Hye Ran; Kim, Ji-Hyun; Sung, Jaeyoung
2017-07-06
Enzyme-to-enzyme variation in the catalytic rate is ubiquitous among single enzymes created from the same genetic information, which persists over the lifetimes of living cells. Despite advances in single-enzyme technologies, the lack of an enzyme reaction model accounting for the heterogeneous activity of single enzymes has hindered a quantitative understanding of the nonclassical stochastic outcome of single enzyme systems. Here we present a new statistical kinetics and exactly solvable models for clonal yet heterogeneous enzymes with possibly nonergodic state dynamics and state-dependent reactivity, which enable a quantitative understanding of modern single-enzyme experimental results for the mean and fluctuation in the number of product molecules created by single enzymes. We also propose a new experimental measure of the heterogeneity and nonergodicity for a system of enzymes.
The Catalytic Function of Enzymes.
ERIC Educational Resources Information Center
Splittgerber, Allan G.
1985-01-01
Discusses: structure of the enzyme molecule; active site; reaction mechanism; transition state; factors affecting enzyme reaction rates, concentration of enzyme; concentration of substrate; product concentration; temperature effects and pH effects; factors causing a lowering of activation energy; proximity and orientation effects; substrate strain…
Measurement of Enzyme Isotope Effects.
Kholodar, Svetlana A; Ghosh, Ananda K; Kohen, Amnon
2017-01-01
Enzyme isotope effects, or the kinetic effects of "heavy" enzymes, refer to the effect of isotopically labeled protein residues on the enzyme's activity or physical properties. These effects are increasingly employed in the examination of the possible contributions of protein dynamics to enzyme catalysis. One hypothesis assumed that isotopic substitution of all 12 C, 14 N, and nonexchangeable 1 H by 13 C, 15 N, and 2 H, would slow down protein picosecond to femtosecond dynamics without any effect on the system's electrostatics following the Born-Oppenheimer approximation. It was suggested that reduced reaction rates reported for several "heavy" enzymes accords with that hypothesis. However, numerous deviations from the predictions of that hypothesis were also reported. Current studies also attempt to test the role of individual residues by site-specific labeling or by labeling a pattern of residues on activity. It appears that in several systems the protein's fast dynamics are indeed reduced in "heavy" enzymes in a way that reduces the probability of barrier crossing of its chemical step. Other observations, however, indicated that slower protein dynamics are electrostatically altered in isotopically labeled enzymes. Interestingly, these effects appear to be system dependent, thus it might be premature to suggest a general role of "heavy" enzymes' effect on catalysis. © 2017 Elsevier Inc. All rights reserved.
Virulence-Associated Enzymes of Cryptococcus neoformans
Almeida, Fausto; Wolf, Julie M.
2015-01-01
Enzymes play key roles in fungal pathogenesis. Manipulation of enzyme expression or activity can significantly alter the infection process, and enzyme expression profiles can be a hallmark of disease. Hence, enzymes are worthy targets for better understanding pathogenesis and identifying new options for combatting fungal infections. Advances in genomics, proteomics, transcriptomics, and mass spectrometry have enabled the identification and characterization of new fungal enzymes. This review focuses on recent developments in the virulence-associated enzymes from Cryptococcus neoformans. The enzymatic suite of C. neoformans has evolved for environmental survival, but several of these enzymes play a dual role in colonizing the mammalian host. We also discuss new therapeutic and diagnostic strategies that could be based on the underlying enzymology. PMID:26453651
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kim, Moon Il; Kim, Jungbae; Lee, Jinwoo
2007-02-01
alpha-chymotrypsin (CT) and lipase (LP) were immobilized in hierarchically-ordered mesocellular mesoporous silica (HMMS) in a simple but effective way for the enzyme stabilization, which was achieved by the enzyme adsorption followed by glutaraldehyde (GA) crosslinking. This resulted in the formation of nanometer scale crosslinked enzyme aggregates (CLEAs) entrapped in the mesocellular pores of HMMS (37 nm), which did not leach out of HMMS through narrow mesoporous channels (13 nm). CLEA of alpha-chymotrypsin (CLEA-CT) in HMMS showed a high enzyme loading capacity and significantly increased enzyme stability. No activity decrease of CLEA-CT was observed for two weeks under even rigorously shakingmore » condition, while adsorbed CT in HMMS and free CT showed a rapid inactivation due to the enzyme leaching and presumably autolysis, respectively. With the CLEA-CT in HMMS, however, there was no tryptic digestion observed suggesting that the CLEA-CT is not susceptible to autolysis. Moreover, CLEA of lipase (CLEA-LP) in HMMS retained 30% specific activity of free lipase with greatly enhanced stability. This work demonstrates that HMMS can be efficiently employed as host materials for enzyme immobilization leading to highly enhanced stability of the immobilized enzymes with high enzyme loading and activity.« less
Ward, Keeran; Xi, Jingshu; Stuckey, David C
2015-12-01
The use of non-ionic colloidal liquid aphrons (CLAs) as a support for enzyme immobilisation was investigated. Formulation required the mixing of an aqueous-surfactant solution with a relatively non-polar solvent-surfactant solution, forming a solvent droplet surrounded by a thin stabilised aqueous film (soapy shell). Studies utilising anionic surfactants have showed increased retention, however, very little have been understood about the forces governing immobilisation. This study seeks to determine the effects of enzyme properties on CLA immobilisation by examining a non-ionic/non-polar solvent system comprised of two non-ionic surfactants, Tween 20 and 80, mineral oil and the enzymes lipase, aprotinin and α-chymotrypsin. From these results it was deduced that hydrophobic interactions strongly governed immobilisation. Confocal Scanning Laser Microscopy (CSLM) revealed that immobilisation was predominantly achieved by surface adsorption attributed to hydrophobic interactions between the enzyme and the CLA surface. Enzyme surface affinity was found to increase when added directly to the formulation (pre-manufacture addition), as opposed to the bulk continuous phase (post-manufacture addition), with α-chymotrypsin and aprotinin being the most perturbed, while lipase was relatively unaffected. The effect of zeta potential on immobilisation showed that enzymes adsorbed better closer to their pI, indicating that charge minimisation was necessary for immobilisation. Finally, the effect of increasing enzyme concentration in the aqueous phase resulted in an increase in adsorption for all enzymes due to cooperativity between protein molecules, with saturation occurring faster at higher adsorption rates. Copyright © 2015 Elsevier B.V. All rights reserved.
Allosteric regulation of epigenetic modifying enzymes.
Zucconi, Beth E; Cole, Philip A
2017-08-01
Epigenetic enzymes including histone modifying enzymes are key regulators of gene expression in normal and disease processes. Many drug development strategies to target histone modifying enzymes have focused on ligands that bind to enzyme active sites, but allosteric pockets offer potentially attractive opportunities for therapeutic development. Recent biochemical studies have revealed roles for small molecule and peptide ligands binding outside of the active sites in modulating the catalytic activities of histone modifying enzymes. Here we highlight several examples of allosteric regulation of epigenetic enzymes and discuss the biological significance of these findings. Copyright © 2017 Elsevier Ltd. All rights reserved.
DGAT enzymes and triacylglycerol biosynthesis
Yen, Chi-Liang Eric; Stone, Scot J.; Koliwad, Suneil; Harris, Charles; Farese, Robert V.
2008-01-01
Triacylglycerols (triglycerides) (TGs) are the major storage molecules of metabolic energy and FAs in most living organisms. Excessive accumulation of TGs, however, is associated with human diseases, such as obesity, diabetes mellitus, and steatohepatitis. The final and the only committed step in the biosynthesis of TGs is catalyzed by acyl-CoA:diacylglycerol acyltransferase (DGAT) enzymes. The genes encoding two DGAT enzymes, DGAT1 and DGAT2, were identified in the past decade, and the use of molecular tools, including mice deficient in either enzyme, has shed light on their functions. Although DGAT enzymes are involved in TG synthesis, they have distinct protein sequences and differ in their biochemical, cellular, and physiological functions. Both enzymes may be useful as therapeutic targets for diseases. Here we review the current knowledge of DGAT enzymes, focusing on new advances since the cloning of their genes, including possible roles in human health and diseases. PMID:18757836
de novo computational enzyme design.
Zanghellini, Alexandre
2014-10-01
Recent advances in systems and synthetic biology as well as metabolic engineering are poised to transform industrial biotechnology by allowing us to design cell factories for the sustainable production of valuable fuels and chemicals. To deliver on their promises, such cell factories, as much as their brick-and-mortar counterparts, will require appropriate catalysts, especially for classes of reactions that are not known to be catalyzed by enzymes in natural organisms. A recently developed methodology, de novo computational enzyme design can be used to create enzymes catalyzing novel reactions. Here we review the different classes of chemical reactions for which active protein catalysts have been designed as well as the results of detailed biochemical and structural characterization studies. We also discuss how combining de novo computational enzyme design with more traditional protein engineering techniques can alleviate the shortcomings of state-of-the-art computational design techniques and create novel enzymes with catalytic proficiencies on par with natural enzymes. Copyright © 2014 Elsevier Ltd. All rights reserved.
Taking the Mystery Out of Enzymes.
ERIC Educational Resources Information Center
DeYoung, H. Garrett
1984-01-01
Discusses structure and function of enzymes, design of new enzymes and enzyme substitutes, and enzyme uses in industry, medicine, and wastewater treatment. The latter is a low-cost method which can remove as much as 99 percent of toxic substances found in many industrial wastewater streams. (JN)
Thermodynamics of Enzyme-Catalyzed Reactions Database
National Institute of Standards and Technology Data Gateway
SRD 74 Thermodynamics of Enzyme-Catalyzed Reactions Database (Web, free access) The Thermodynamics of Enzyme-Catalyzed Reactions Database contains thermodynamic data on enzyme-catalyzed reactions that have been recently published in the Journal of Physical and Chemical Reference Data (JPCRD). For each reaction the following information is provided: the reference for the data, the reaction studied, the name of the enzyme used and its Enzyme Commission number, the method of measurement, the data and an evaluation thereof.
NASA Astrophysics Data System (ADS)
Schoonen, Lise; Nolte, Roeland J. M.; van Hest, Jan C. M.
2016-07-01
The study of enzyme behavior in small nanocompartments is crucial for the understanding of biocatalytic processes in the cellular environment. We have developed an enzymatic conjugation strategy to attach a model enzyme to the interior of a cowpea chlorotic mottle virus capsid. It is shown that with this methodology high encapsulation efficiencies can be achieved. Additionally, we demonstrate that the encapsulation does not affect the enzyme performance in terms of a decreased activity or a hampered substrate diffusion. Finally, it is shown that the encapsulated enzymes are protected against proteases. We believe that our strategy can be used to study enzyme kinetics in an environment that approaches physiological conditions.The study of enzyme behavior in small nanocompartments is crucial for the understanding of biocatalytic processes in the cellular environment. We have developed an enzymatic conjugation strategy to attach a model enzyme to the interior of a cowpea chlorotic mottle virus capsid. It is shown that with this methodology high encapsulation efficiencies can be achieved. Additionally, we demonstrate that the encapsulation does not affect the enzyme performance in terms of a decreased activity or a hampered substrate diffusion. Finally, it is shown that the encapsulated enzymes are protected against proteases. We believe that our strategy can be used to study enzyme kinetics in an environment that approaches physiological conditions. Electronic supplementary information (ESI) available: Experimental procedures for the cloning, expression, and purification of all proteins, as well as supplementary figures and calculations. See DOI: 10.1039/c6nr04181g
DNA-Based Enzyme Reactors and Systems
Linko, Veikko; Nummelin, Sami; Aarnos, Laura; Tapio, Kosti; Toppari, J. Jussi; Kostiainen, Mauri A.
2016-01-01
During recent years, the possibility to create custom biocompatible nanoshapes using DNA as a building material has rapidly emerged. Further, these rationally designed DNA structures could be exploited in positioning pivotal molecules, such as enzymes, with nanometer-level precision. This feature could be used in the fabrication of artificial biochemical machinery that is able to mimic the complex reactions found in living cells. Currently, DNA-enzyme hybrids can be used to control (multi-enzyme) cascade reactions and to regulate the enzyme functions and the reaction pathways. Moreover, sophisticated DNA structures can be utilized in encapsulating active enzymes and delivering the molecular cargo into cells. In this review, we focus on the latest enzyme systems based on novel DNA nanostructures: enzyme reactors, regulatory devices and carriers that can find uses in various biotechnological and nanomedical applications. PMID:28335267
NASA Astrophysics Data System (ADS)
Georlette, D.; Bentahir, M.; Claverie, P.; Collins, T.; D'amico, S.; Delille, D.; Feller, G.; Gratia, E.; Hoyoux, A.; Lonhienne, T.; Meuwis, M.-a.; Zecchinon, L.; Gerday, Ch.
In the last few years, increased attention has been focused on enzymes produced by cold-adapted micro-organisms. It has emerged that psychrophilic enzymes represent an extremely powerful tool in both protein folding investigations and for biotechnological purposes. Such enzymes are characterised by an increased thermosensitivity and, most of them, by a higher catalytic efficiency at low and moderate temperatures, when compared to their mesophilic counterparts. The high thermosensitivity probably originates from an increased flexibility of either a selected area of the molecular edifice or the overall protein structure, providing enhanced abilities to undergo conformational changes during catalysis at low temperatures. Structure modelling and recent crystallographic data have allowed to elucidate the structural parameters that could be involved in this higher resilience. It was demonstrated that each psychrophilic enzyme adopts its own adaptive strategy. It appears, moreover, that there is a continuum in the strategy of protein adaptation to temperature, as the previously mentioned structural parameters are implicated in the stability of thermophilic proteins. Additional 3D crystal structures, site-directed and random mutagenesis experiments should now be undertaken to further investigate the stability-flexibility-activity relationship.
Enzyme Engineering for In Situ Immobilization.
Rehm, Fabian B H; Chen, Shuxiong; Rehm, Bernd H A
2016-10-14
Enzymes are used as biocatalysts in a vast range of industrial applications. Immobilization of enzymes to solid supports or their self-assembly into insoluble particles enhances their applicability by strongly improving properties such as stability in changing environments, re-usability and applicability in continuous biocatalytic processes. The possibility of co-immobilizing various functionally related enzymes involved in multistep synthesis, conversion or degradation reactions enables the design of multifunctional biocatalyst with enhanced performance compared to their soluble counterparts. This review provides a brief overview of up-to-date in vitro immobilization strategies while focusing on recent advances in enzyme engineering towards in situ self-assembly into insoluble particles. In situ self-assembly approaches include the bioengineering of bacteria to abundantly form enzymatically active inclusion bodies such as enzyme inclusions or enzyme-coated polyhydroxyalkanoate granules. These one-step production strategies for immobilized enzymes avoid prefabrication of the carrier as well as chemical cross-linking or attachment to a support material while the controlled oriented display strongly enhances the fraction of accessible catalytic sites and hence functional enzymes.
Enzyme Analysis to Determine Glucose Content
NASA Astrophysics Data System (ADS)
Carpenter, Charles; Ward, Robert E.
Enzyme analysis is used for many purposes in food science and technology. Enzyme activity is used to indicate adequate processing, to assess enzyme preparations, and to measure constituents of foods that are enzyme substrates. In this experiment, the glucose content of corn syrup solids is determined using the enzymes, glucose oxidase and peroxidase. Glucose oxidase catalyzes the oxidation of glucose to form hydrogen peroxide (H2O2), which then reacts with a dye in the presence of peroxidase to give a stable colored product.
Enzyme reactor design under thermal inactivation.
Illanes, Andrés; Wilson, Lorena
2003-01-01
Temperature is a very relevant variable for any bioprocess. Temperature optimization of bioreactor operation is a key aspect for process economics. This is especially true for enzyme-catalyzed processes, because enzymes are complex, unstable catalysts whose technological potential relies on their operational stability. Enzyme reactor design is presented with a special emphasis on the effect of thermal inactivation. Enzyme thermal inactivation is a very complex process from a mechanistic point of view. However, for the purpose of enzyme reactor design, it has been oversimplified frequently, considering one-stage first-order kinetics of inactivation and data gathered under nonreactive conditions that poorly represent the actual conditions within the reactor. More complex mechanisms are frequent, especially in the case of immobilized enzymes, and most important is the effect of catalytic modulators (substrates and products) on enzyme stability under operation conditions. This review focuses primarily on reactor design and operation under modulated thermal inactivation. It also presents a scheme for bioreactor temperature optimization, based on validated temperature-explicit functions for all the kinetic and inactivation parameters involved. More conventional enzyme reactor design is presented merely as a background for the purpose of highlighting the need for a deeper insight into enzyme inactivation for proper bioreactor design.
Marden, James H
2013-12-01
Metabolic enzyme loci were some of the first genes accessible for molecular evolution and ecology research. New technologies now make the whole genome, transcriptome or proteome readily accessible, allowing unbiased scans for loci exhibiting significant differences in allele frequency or expression level and associated with phenotypes and/or responses to natural selection. With surprising frequency and in many cases in proportions greater than chance relative to other genes, glycolysis and TCA cycle enzyme loci appear among the genes with significant associations in these studies. Hence, there is an ongoing need to understand the basis for fitness effects of metabolic enzyme polymorphisms. Allele-specific effects on the binding affinity and catalytic rate of individual enzymes are well known, but often of uncertain significance because metabolic control theory and in vivo studies indicate that many individual metabolic enzymes do not affect pathway flux rate. I review research, so far little used in evolutionary biology, showing that metabolic enzyme substrates affect signalling pathways that regulate cell and organismal biology, and that these enzymes have moonlighting functions. To date there is little knowledge of how alleles in natural populations affect these phenotypes. I discuss an example in which alleles of a TCA enzyme locus associate with differences in a signalling pathway and development, organismal performance, and ecological dynamics. Ultimately, understanding how metabolic enzyme polymorphisms map to phenotypes and fitness remains a compelling and ongoing need for gaining robust knowledge of ecological and evolutionary processes. © 2013 John Wiley & Sons Ltd.
Positron emitter labeled enzyme inhibitors
DOE Office of Scientific and Technical Information (OSTI.GOV)
Fowler, J.S.; MacGregor, R.R.; Wolf, A.P.
This invention involves a new strategy for imaging and mapping enzyme activity in the living human and animal body using positron emitter-labeled suicide enzyme inactivators or inhibitors which become covalently bound to the enzyme as a result of enzymatic catalysis. Two such suicide inactivators for monoamine oxidase have been labeled with carbon-11 and used to map the enzyme subtypes in the living human and animal body using PET. By using positron emission tomography to image the distribution of radioactivity produced by the body penetrating radiation emitted by carbon-11, a map of functionally active monoamine oxidase activity is obtained. Clorgyline andmore » L-deprenyl are suicide enzyme inhibitors and irreversibly inhibit monoamine oxidase. When these inhibitors are labeled with carbon-11 they provide selective probes for monoamine oxidase localization and reactivity in vivo using positron emission tomography.« less
Positron emitter labeled enzyme inhibitors
Fowler, J.S.; MacGregor, R.R.; Wolf, A.P.
1987-05-22
This invention involved a new strategy for imaging and mapping enzyme activity in the living human and animal body using positron emitter-labeled suicide enzyme inactivators or inhibitors which become covalently bound to the enzyme as a result of enzymatic catalysis. Two such suicide in activators for monoamine oxidase have been labeled with carbon-11 and used to map the enzyme subtypes in the living human and animal body using PET. By using positron emission tomography to image the distribution of radioactivity produced by the body penetrating radiation emitted by carbon-11, a map of functionally active monoamine oxidase activity is obtained. Clorgyline and L-deprenyl are suicide enzyme inhibitors and irreversibly inhibit monoamine oxidase. When these inhibitors are labeled with carbon-11 they provide selective probes for monoamine oxidase localization and reactivity in vivo using positron emission tomography. 2 figs.
Positron emitter labeled enzyme inhibitors
Fowler, Joanna S.; MacGregor, Robert R.; Wolf, Alfred P.; Langstrom, Bengt
1990-01-01
This invention involves a new strategy for imaging and mapping enzyme activity in the living human and animal body using positron emitter-labeled suicide enzyme inactivators or inhibitors which become covalently bound to the enzyme as a result of enzymatic catalysis. Two such suicide inactivators for monoamine oxidase have been labeled with carbon-11 and used to map the enzyme subtypes in the living human and animal body using PET. By using positron emission tomography to image the distribution of radioactivity produced by the body penetrating radiation emitted by carbon-11, a map of functionally active monoamine oxidase activity is obtained. Clorgyline and L-deprenyl are suicide enzyme inhibitors and irreversibly inhibit monoamine oxidase. When these inhibitors are labeled with carbon-11 they provide selective probes for monoamine oxidase localization and reactivity in vivo using positron emission tomography.
Compounds from silicones alter enzyme activity in curing barnacle glue and model enzymes.
Rittschof, Daniel; Orihuela, Beatriz; Harder, Tilmann; Stafslien, Shane; Chisholm, Bret; Dickinson, Gary H
2011-02-17
Attachment strength of fouling organisms on silicone coatings is low. We hypothesized that low attachment strength on silicones is, in part, due to the interaction of surface available components with natural glues. Components could alter curing of glues through bulk changes or specifically through altered enzyme activity. GC-MS analysis of silicone coatings showed surface-available siloxanes when the coatings were gently rubbed with a cotton swab for 15 seconds or given a 30 second rinse with methanol. Mixtures of compounds were found on 2 commercial and 8 model silicone coatings. The hypothesis that silicone components alter glue curing enzymes was tested with curing barnacle glue and with commercial enzymes. In our model, barnacle glue curing involves trypsin-like serine protease(s), which activate enzymes and structural proteins, and a transglutaminase which cross-links glue proteins. Transglutaminase activity was significantly altered upon exposure of curing glue from individual barnacles to silicone eluates. Activity of purified trypsin and, to a greater extent, transglutaminase was significantly altered by relevant concentrations of silicone polymer constituents. Surface-associated silicone compounds can disrupt glue curing and alter enzyme properties. Altered curing of natural glues has potential in fouling management.
21 CFR 184.1287 - Enzyme-modified fats.
Code of Federal Regulations, 2014 CFR
2014-04-01
... 21 Food and Drugs 3 2014-04-01 2014-04-01 false Enzyme-modified fats. 184.1287 Section 184.1287... GRAS § 184.1287 Enzyme-modified fats. (a) Enzyme-modified refined beef fat, enzyme-modified butterfat, and enzyme-modified steam-rendered chicken fat are prepared from refined beef fat; butterfat or...
21 CFR 184.1287 - Enzyme-modified fats.
Code of Federal Regulations, 2012 CFR
2012-04-01
... 21 Food and Drugs 3 2012-04-01 2012-04-01 false Enzyme-modified fats. 184.1287 Section 184.1287... Listing of Specific Substances Affirmed as GRAS § 184.1287 Enzyme-modified fats. (a) Enzyme-modified refined beef fat, enzyme-modified butterfat, and enzyme-modified steam-rendered chicken fat are prepared...
21 CFR 184.1287 - Enzyme-modified fats.
Code of Federal Regulations, 2013 CFR
2013-04-01
... 21 Food and Drugs 3 2013-04-01 2013-04-01 false Enzyme-modified fats. 184.1287 Section 184.1287... Listing of Specific Substances Affirmed as GRAS § 184.1287 Enzyme-modified fats. (a) Enzyme-modified refined beef fat, enzyme-modified butterfat, and enzyme-modified steam-rendered chicken fat are prepared...
21 CFR 184.1287 - Enzyme-modified fats.
Code of Federal Regulations, 2010 CFR
2010-04-01
... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Enzyme-modified fats. 184.1287 Section 184.1287... Listing of Specific Substances Affirmed as GRAS § 184.1287 Enzyme-modified fats. (a) Enzyme-modified refined beef fat, enzyme-modified butterfat, and enzyme-modified steam-rendered chicken fat are prepared...
21 CFR 184.1287 - Enzyme-modified fats.
Code of Federal Regulations, 2011 CFR
2011-04-01
... 21 Food and Drugs 3 2011-04-01 2011-04-01 false Enzyme-modified fats. 184.1287 Section 184.1287... Listing of Specific Substances Affirmed as GRAS § 184.1287 Enzyme-modified fats. (a) Enzyme-modified refined beef fat, enzyme-modified butterfat, and enzyme-modified steam-rendered chicken fat are prepared...
Artificial enzymes based on supramolecular scaffolds.
Dong, Zeyuan; Luo, Quan; Liu, Junqiu
2012-12-07
Enzymes are nanometer-sized molecules with three-dimensional structures created by the folding and self-assembly of polymeric chain-like components through supramolecular interactions. They are capable of performing catalytic functions usually accompanied by a variety of conformational states. The conformational diversities and complexities of natural enzymes exerted in catalysis seriously restrict the detailed understanding of enzymatic mechanisms in molecular terms. A supramolecular viewpoint is undoubtedly helpful in understanding the principle of enzyme catalysis. The emergence of supramolecular artificial enzymes therefore provides an alternative way to approach the structural complexity and thus to unravel the mystery of enzyme catalysis. This critical review covers the recent development of artificial enzymes designed based on supramolecular scaffolds ranging from the synthetic macrocycles to self-assembled nanometer-sized objects. Such findings are anticipated to facilitate the design of supramolecular artificial enzymes as well as their potential uses in important fields, such as manufacturing and food industries, environmental biosensors, pharmaceutics and so on.
Therapeutic Enzymes: Applications and Approaches to Pharmacological Improvement.
Yari, Maryam; Ghoshoon, Mohammad B; Vakili, Bahareh; Ghasemi, Younes
2017-01-01
Among therapeutic proteins, enzymes represent small and of course profitable market. They can be used to treat important, rare, and deadly diseases. Enzyme therapy is the only available treatment for certain disorders. Here, pharmaceutical enzymes are reviewed. They are categorized in four main groups, enzymes in replacement therapy, enzymes in cancer treatment, enzymes for fibrinolysis, and finally enzymes that are used topically for various treatments. Furthermore, enzyme gene therapy and future perspective of therapeutic enzymes are mentioned in brief. There are many important approved enzymes in pharmaceutical market. Several approaches such as point mutation, fusion protein designing, glycoengineering, and PEGylation were used to achieve improved enzymes. Although sometimes enzymes were engineered to facilitate production and purification process, appropriate delivery to target sites, extending half-life, and reducing immunogenicity are among the main goals of engineering approaches. Overall, enzymes play a critical role in treatment of common and rare diseases. Evaluation of new enzymes as well as improvement of approved enzymes are of the most important challenges in biotechnology. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.
NASA Astrophysics Data System (ADS)
Zeng, Pan; Huang, Liwu; Zhang, Xinling; Han, Yamiao; Chen, Yungui
2018-01-01
Lithium-sulfur (Li-S) batteries are considered as one of the most promising chemistries in secondary energy storage field owing to their high energy density. However, the poor electrochemical performance mainly associated with the polysulfides shuttle has greatly hampered their practical application. Herein, a simple acetylene black (AB)-CoS2 coated separator is first designed to suppress the migration of polysulfides. The AB-CoS2 modified separator can not only efficiently capture the polysulfides by forming strong chemical bonding but also guarantee the rapid lithium ions diffusion. Moreover, the AB-CoS2 coating could serve as an upper current collector to accelerate electron transport for reinforcing the utilization of sulfur and ensuring the reactivation of the trapped active material. Consequently, the Li-S cell using AB-CoS2 modified separator shows a long-term cycling stability with an extremely low decay rate (0.09% per cycle) up to 450 cycles at a high rate of 2 C (3350 mA g-1). It also exhibits excellent rate capabilities, which maintains a capacity of 475 mAh g-1 even at 4.0 C rate.
Positron emitter labeled enzyme inhibitors
DOE Office of Scientific and Technical Information (OSTI.GOV)
Fowler, J.S.; MacGregor, R.R.; Wolf, A.P.
This invention involved a new strategy for imaging and mapping enzyme activity in the living human and animal body using positron emitter-labeled suicide enzyme inactivators or inhibitors which become covalently bound to the enzyme as a result of enzymatic catalysis. Two such suicide in activators for monoamine oxidase have been labeled with carbon-11 and used to map the enzyme subtypes in the living human and animal body using PET. By using positron emission tomography to image the distribution of radioactivity produced by the body penetrating radiation emitted by carbon-11, a map of functionally active monoamine oxidase activity is obtained. Clorgylinemore » and L-deprenyl are suicide enzyme inhibitors and irreversibly inhibit monoamine oxidase. When these inhibitors are labeled with carbon-11 they provide selective probes for monoamine oxidase localization and reactivity in vivo using positron emission tomography. 2 figs.« less
Enzymes in Fish and Seafood Processing
Fernandes, Pedro
2016-01-01
Enzymes have been used for the production and processing of fish and seafood for several centuries in an empirical manner. In recent decades, a growing trend toward a rational and controlled application of enzymes for such goals has emerged. Underlying such pattern are, among others, the increasingly wider array of enzyme activities and enzyme sources, improved enzyme formulations, and enhanced requirements for cost-effective and environmentally friendly processes. The better use of enzyme action in fish- and seafood-related application has had a significant impact on fish-related industry. Thus, new products have surfaced, product quality has improved, more sustainable processes have been developed, and innovative and reliable analytical techniques have been implemented. Recent development in these fields are presented and discussed, and prospective developments are suggested. PMID:27458583
Virus scaffolds as enzyme nano-carriers.
Cardinale, Daniela; Carette, Noëlle; Michon, Thierry
2012-07-01
The cooperative organization of enzymes by cells is a key feature for the efficiency of living systems. In the field of nanotechnologies, effort currently aims at mimicking this natural organization. Nanoscale resolution and high-registration alignment are necessary to control enzyme distribution in nano-containers or on the surface of solid supports. Virus capsid self-assembly is driven by precise supramolecular combinations of protein monomers, which have made them attractive building blocks to engineer enzyme nano-carriers (ENCs). We discuss some examples of what in our opinion constitute the latest advances in the use of plant viruses, bacteriophages and virus-like particles (VLPs) as nano-scaffolds for enzyme selection, enzyme confinement and patterning, phage therapy, raw material processing, and single molecule enzyme kinetics studies. Copyright © 2012 Elsevier Ltd. All rights reserved.
Production of Enzymes from Marine Actinobacteria.
Zhao, X Q; Xu, X N; Chen, L Y
Marine actinobacteria are well recognized for their capabilities to produce valuable natural products, which have great potential for applications in medical, agricultural, and fine chemical industries. In addition to producing unique enzymes responsible for biosynthesis of natural products, many marine actinobacteria also produce hydrolytic enzymes which are able to degrade various biopolymers, such as cellulose, xylan, and chitin. These enzymes are important to produce biofuels and biochemicals of interest from renewable biomass. In this chapter, the recent reports of novel enzymes produced by marine actinobacteria are reviewed, and advanced technologies that can be applied to search for novel marine enzymes as well as for improved enzyme production by marine actinobacteria are summarized, which include ribosome engineering, genome mining, as well as synthetic biology studies. © 2016 Elsevier Inc. All rights reserved.
Modified kinetics of enzymes interacting with nanoparticles
NASA Astrophysics Data System (ADS)
Díaz, Sebastián. A.; Breger, Joyce C.; Malanoski, Anthony; Claussen, Jonathan C.; Walper, Scott A.; Ancona, Mario G.; Brown, Carl W.; Stewart, Michael H.; Oh, Eunkeu; Susumu, Kimihiro; Medintz, Igor L.
2015-08-01
Enzymes are important players in multiple applications, be it bioremediation, biosynthesis, or as reporters. The business of catalysis and inhibition of enzymes is a multibillion dollar industry and understanding the kinetics of commercial enzymes can have a large impact on how these systems are optimized. Recent advances in nanotechnology have opened up the field of nanoparticle (NP) and enzyme conjugates and two principal architectures for NP conjugate systems have been developed. In the first example the enzyme is bound to the NP in a persistent manner, here we find that key factors such as directed enzyme conjugation allow for enhanced kinetics. Through controlled comparative experiments we begin to tease out specific mechanisms that may account for the enhancement. The second system is based on dynamic interactions of the enzymes with the NP. The enzyme substrate is bound to the NP and the enzyme is free in solution. Here again we find that there are many variables , such as substrate positioning and NP selection, that modify the kinetics.
Different enzyme kinetic models.
Seibert, Eleanore; Tracy, Timothy S
2014-01-01
As described in Chapter 2 , a large number of enzymatic reactions can be adequately described by Michaelis-Menten kinetics. The Michaelis-Menten equation represents a rectangular hyperbola, with a y-asymptote at the V max value. In many cases, more complex kinetic models are required to explain the observed data. Atypical kinetic profiles are believed to arise from the simultaneous binding of multiple molecules within the active site of the enzyme (Tracy and Hummel, Drug Metab Rev 36:231-242, 2004). Several cytochromes P450 have large active sites that enable binding of multiple molecules (Wester et al. J Biol Chem 279:35630-35637, 2004; Yano et al. J Biol Chem 279:38091-38094, 2004). Thus, atypical kinetics are not uncommon in in vitro drug metabolism studies. This chapter covers enzyme kinetic reactions in which a single enzyme has multiple binding sites for substrates and/or inhibitors as well as reactions catalyzed by multiple enzymes.
Enzyme leaps fuel antichemotaxis
Jee, Ah-Young; Dutta, Sandipan; Cho, Yoon-Kyoung
2018-01-01
There is mounting evidence that enzyme diffusivity is enhanced when the enzyme is catalytically active. Here, using superresolution microscopy [stimulated emission-depletion fluorescence correlation spectroscopy (STED-FCS)], we show that active enzymes migrate spontaneously in the direction of lower substrate concentration (“antichemotaxis”) by a process analogous to the run-and-tumble foraging strategy of swimming microorganisms and our theory quantifies the mechanism. The two enzymes studied, urease and acetylcholinesterase, display two families of transit times through subdiffraction-sized focus spots, a diffusive mode and a ballistic mode, and the latter transit time is close to the inverse rate of catalytic turnover. This biochemical information-processing algorithm may be useful to design synthetic self-propelled swimmers and nanoparticles relevant to active materials. Executed by molecules lacking the decision-making circuitry of microorganisms, antichemotaxis by this run-and-tumble process offers the biological function to homogenize product concentration, which could be significant in situations when the reactant concentration varies from spot to spot. PMID:29255047
Liu, Lin; Lee, Wang-Sik; Doray, Balraj; Kornfeld, Stuart
2017-06-16
Several lysosomal enzymes currently used for enzyme replacement therapy in patients with lysosomal storage diseases contain very low levels of mannose 6-phosphate, limiting their uptake via mannose 6-phosphate receptors on the surface of the deficient cells. These enzymes are produced at high levels by mammalian cells and depend on endogenous GlcNAc-1-phosphotransferase α/β precursor to phosphorylate the mannose residues on their glycan chains. We show that co-expression of an engineered truncated GlcNAc-1-phosphotransferase α/β precursor and the lysosomal enzyme of interest in the producing cells resulted in markedly increased phosphorylation and cellular uptake of the secreted lysosomal enzyme. This method also results in the production of highly phosphorylated acid β-glucocerebrosidase, a lysosomal enzyme that normally has just trace amounts of this modification.
Gropp, Cornelius; Trapp, Nils
2018-04-25
Single crystal X-ray diffraction is a powerful method to unambiguously characterize the structure of molecules with atomic resolution. Herein, we review the molecular recognition of the (di)axial conformers of Mono- and (±)-trans-1,2-disubstituted cyclohexanes by enantiopure alleno-acetylenic cage receptors in solution and in the solid state. Single crystals of the host-guest complexes suitable for X-ray diffraction allow for the first time to study the dihedral angles of a series of Mono- and (±)-trans-1,2-disubstituted cyclohexanes in their (di)axial chair conformation. Theoretical studies indicate negligible influence of the host structure on the guest conformation, suggesting that the structural information obtained from the host-guest complexes give insight into the innate structures of Mono- and (±)-trans-1,2-disubstituted cyclohexanes. Strong deviation of the dihedral angles a,a(X-C(1)-C(2)-X) from the idealized 180° are observed, accompanied by substantial flattening of the ring dihedral angles ρ(X-C(1)-C(2)-C(3)).
Compounds from Silicones Alter Enzyme Activity in Curing Barnacle Glue and Model Enzymes
Rittschof, Daniel; Orihuela, Beatriz; Harder, Tilmann; Stafslien, Shane; Chisholm, Bret; Dickinson, Gary H.
2011-01-01
Background Attachment strength of fouling organisms on silicone coatings is low. We hypothesized that low attachment strength on silicones is, in part, due to the interaction of surface available components with natural glues. Components could alter curing of glues through bulk changes or specifically through altered enzyme activity. Methodology/Principal Findings GC-MS analysis of silicone coatings showed surface-available siloxanes when the coatings were gently rubbed with a cotton swab for 15 seconds or given a 30 second rinse with methanol. Mixtures of compounds were found on 2 commercial and 8 model silicone coatings. The hypothesis that silicone components alter glue curing enzymes was tested with curing barnacle glue and with commercial enzymes. In our model, barnacle glue curing involves trypsin-like serine protease(s), which activate enzymes and structural proteins, and a transglutaminase which cross-links glue proteins. Transglutaminase activity was significantly altered upon exposure of curing glue from individual barnacles to silicone eluates. Activity of purified trypsin and, to a greater extent, transglutaminase was significantly altered by relevant concentrations of silicone polymer constituents. Conclusions/Significance Surface-associated silicone compounds can disrupt glue curing and alter enzyme properties. Altered curing of natural glues has potential in fouling management. PMID:21379573
Nanoporous Gold for Enzyme Immobilization.
Stine, Keith J; Jefferson, Kenise; Shulga, Olga V
2017-01-01
Nanoporous gold (NPG) is a material of emerging interest for immobilization of biomolecules, especially enzymes. The material provides a high surface area form of gold that is suitable for physisorption or for covalent modification by self-assembled monolayers. The material can be used as a high surface area electrode and with immobilized enzymes can be used for amperometric detection schemes. NPG can be prepared in a variety of formats from alloys containing between 20 and 50 % atomic composition of gold and less noble element(s) by dealloying procedures. Materials resembling NPG can be prepared by hydrothermal and electrodeposition methods. Related high surface area gold structures have been prepared using templating approaches. Covalent enzyme immobilization can be achieved by first forming a self-assembled monolayer on NPG bearing a terminal reactive functional group followed by conjugation to the enzyme through amide linkages to lysine residues. Enzymes can also be entrapped by physisorption or immobilized by electrostatic interactions.
Papaleo, Elena; Tiberti, Matteo; Invernizzi, Gaetano; Pasi, Marco; Ranzani, Valeria
2011-11-01
The identification of molecular mechanisms underlying enzyme cold adaptation is a hot-topic both for fundamental research and industrial applications. In the present contribution, we review the last decades of structural computational investigations on cold-adapted enzymes in comparison to their warm-adapted counterparts. Comparative sequence and structural studies allow the definition of a multitude of adaptation strategies. Different enzymes carried out diverse mechanisms to adapt to low temperatures, so that a general theory for enzyme cold adaptation cannot be formulated. However, some common features can be traced in dynamic and flexibility properties of these enzymes, as well as in their intra- and inter-molecular interaction networks. Interestingly, the current data suggest that a family-centered point of view is necessary in the comparative analyses of cold- and warm-adapted enzymes. In fact, enzymes belonging to the same family or superfamily, thus sharing at least the three-dimensional fold and common features of the functional sites, have evolved similar structural and dynamic patterns to overcome the detrimental effects of low temperatures.
Merz, Michael; Eisele, Thomas; Berends, Pieter; Appel, Daniel; Rabe, Swen; Blank, Imre; Stressler, Timo; Fischer, Lutz
2015-06-17
Flavourzyme is sold as a peptidase preparation from Aspergillus oryzae. The enzyme preparation is widely and diversely used for protein hydrolysis in industrial and research applications. However, detailed information about the composition of this mixture is still missing due to the complexity. The present study identified eight key enzymes by mass spectrometry and partially by activity staining on native polyacrylamide gels or gel zymography. The eight enzymes identified were two aminopeptidases, two dipeptidyl peptidases, three endopeptidases, and one α-amylase from the A. oryzae strain ATCC 42149/RIB 40 (yellow koji mold). Various specific marker substrates for these Flavourzyme enzymes were ascertained. An automated, time-saving nine-step protocol for the purification of all eight enzymes within 7 h was designed. Finally, the purified Flavourzyme enzymes were biochemically characterized with regard to pH and temperature profiles and molecular sizes.
A virus-based single-enzyme nanoreactor
NASA Astrophysics Data System (ADS)
Comellas-Aragonès, Marta; Engelkamp, Hans; Claessen, Victor I.; Sommerdijk, Nico A. J. M.; Rowan, Alan E.; Christianen, Peter C. M.; Maan, Jan C.; Verduin, Benedictus J. M.; Cornelissen, Jeroen J. L. M.; Nolte, Roeland J. M.
2007-10-01
Most enzyme studies are carried out in bulk aqueous solution, at the so-called ensemble level, but more recently studies have appeared in which enzyme activity is measured at the level of a single molecule, revealing previously unseen properties. To this end, enzymes have been chemically or physically anchored to a surface, which is often disadvantageous because it may lead to denaturation. In a natural environment, enzymes are present in a confined reaction space, which inspired us to develop a generic method to carry out single-enzyme experiments in the restricted spatial environment of a virus capsid. We report here the incorporation of individual horseradish peroxidase enzymes in the inner cavity of a virus, and describe single-molecule studies on their enzymatic behaviour. These show that the virus capsid is permeable for substrate and product and that this permeability can be altered by changing pH.
Enhanced enzyme stability through site-directed covalent immobilization.
Wu, Jeffrey Chun Yu; Hutchings, Christopher Hayden; Lindsay, Mark Jeffrey; Werner, Christopher James; Bundy, Bradley Charles
2015-01-10
Breakthroughs in enzyme immobilization have enabled increased enzyme recovery and reusability, leading to significant decreases in the cost of enzyme use and fueling biocatalysis growth. However, current enzyme immobilization techniques suffer from leaching, enzyme stability, and recoverability and reusability issues. Moreover, these techniques lack the ability to control the orientation of the immobilized enzymes. To determine the impact of orientation on covalently immobilized enzyme activity and stability, we apply our PRECISE (Protein Residue-Explicit Covalent Immobilization for Stability Enhancement) system to a model enzyme, T4 lysozyme. The PRECISE system uses non-canonical amino acid incorporation and the Huisgen 1,3-dipolar cycloaddition "click" reaction to enable directed enzyme immobilization at rationally chosen residues throughout an enzyme. Unlike previous site-specific systems, the PRECISE system is a truly covalent immobilization method. Utilizing this system, enzymes immobilized at proximate and distant locations from the active site were tested for activity and stability under denaturing conditions. Our results demonstrate that orientation control of covalently immobilized enzymes can provide activity and stability benefits exceeding that of traditional random covalent immobilization techniques. PRECISE immobilized enzymes were 50 and 73% more active than randomly immobilized enzymes after harsh freeze-thaw and chemical denaturant treatments. Copyright © 2014 Elsevier B.V. All rights reserved.
Lu, Xiao-Ming; Chen, Chang; Zheng, Tian-Ling
2017-05-01
Pyrosequencing and metagenomic profiling were used to assess the phylogenetic and functional characteristics of microbial communities residing in sediments collected from the estuaries of Rivers Oujiang (OS) and Jiaojiang (JS) in the western region of the East China Sea. Another sediment sample was obtained from near the shore far from estuaries, used for contrast (CS). Characterization of estuary sediment bacterial communities showed that toxic chemicals potentially reduced the natural variability in microbial communities, while they increased the microbial metabolic enzymes and pathways. Polycyclic aromatic hydrocarbons (PAHs) and nitrobenzene were negatively correlated with the bacterial community variation. The dominant class in the sediments was Gammaproteobacteria. According to Kyoto Encyclopedia of Genes and Genomes (KEGG) enzyme profiles, dominant enzymes were found in estuarine sediments, which increased greatly, such as 2-oxoglutarate synthase, acetolactate synthase, inorganic diphosphatase, and aconitate hydratase. In KEGG pathway profiles, most of the pathways were also dominated by specific metabolism in these sediments and showed a marked increase, for instance alanine, aspartate, and glutamate metabolism, carbon fixation pathways in prokaryotes, and aminoacyl-tRNA biosynthesis. The estuarine sediment bacterial diversity varied with the polluted river water inputs. In the estuary receiving river water from the more seriously polluted River Oujiang, the sediment bacterial community function was more severely affected.
Dinkova-Kostova, Albena T; Talalay, Paul; Sharkey, John; Zhang, Ying; Holtzclaw, W David; Wang, Xiu Jun; David, Emilie; Schiavoni, Katherine H; Finlayson, Stewart; Mierke, Dale F; Honda, Tadashi
2010-10-29
The Keap1/Nrf2/ARE pathway controls a network of cytoprotective genes that defend against the damaging effects of oxidative and electrophilic stress, and inflammation. Induction of this pathway is a highly effective strategy in combating the risk of cancer and chronic degenerative diseases, including atherosclerosis and neurodegeneration. An acetylenic tricyclic bis(cyano enone) bearing two highly electrophilic Michael acceptors is an extremely potent inducer in cells and in vivo. We demonstrate spectroscopically that both cyano enone functions of the tricyclic molecule react with cysteine residues of Keap1 and activate transcription of cytoprotective genes. Novel monocyclic cyano enones, representing fragments of rings A and C of the tricyclic compound, reveal that the contribution to inducer potency of the ring C Michael acceptor is much greater than that of ring A, and that potency is further enhanced by spatial proximity of an acetylenic function. Critically, the simultaneous presence of two cyano enone functions in rings A and C within a rigid three-ring system results in exceptionally high inducer potency. Detailed understanding of the structural elements that contribute to the reactivity with the protein sensor Keap1 and to high potency of induction is essential for the development of specific and selective lead compounds as clinically relevant chemoprotective agents.
Conformational diversity and computational enzyme design
Lassila, Jonathan K.
2010-01-01
The application of computational protein design methods to the design of enzyme active sites offers potential routes to new catalysts and new reaction specificities. Computational design methods have typically treated the protein backbone as a rigid structure for the sake of computational tractability. However, this fixed-backbone approximation introduces its own special challenges for enzyme design and it contrasts with an emerging picture of natural enzymes as dynamic ensembles with multiple conformations and motions throughout a reaction cycle. This review considers the impact of conformational variation and dynamics on computational enzyme design and it highlights new approaches to addressing protein conformational diversity in enzyme design including recent advances in multistate design, backbone flexibility, and computational library design. PMID:20829099
Monovalent Cation Activation of the Radical SAM Enzyme Pyruvate Formate-Lyase Activating Enzyme.
Shisler, Krista A; Hutcheson, Rachel U; Horitani, Masaki; Duschene, Kaitlin S; Crain, Adam V; Byer, Amanda S; Shepard, Eric M; Rasmussen, Ashley; Yang, Jian; Broderick, William E; Vey, Jessica L; Drennan, Catherine L; Hoffman, Brian M; Broderick, Joan B
2017-08-30
Pyruvate formate-lyase activating enzyme (PFL-AE) is a radical S-adenosyl-l-methionine (SAM) enzyme that installs a catalytically essential glycyl radical on pyruvate formate-lyase. We show that PFL-AE binds a catalytically essential monovalent cation at its active site, yet another parallel with B 12 enzymes, and we characterize this cation site by a combination of structural, biochemical, and spectroscopic approaches. Refinement of the PFL-AE crystal structure reveals Na + as the most likely ion present in the solved structures, and pulsed electron nuclear double resonance (ENDOR) demonstrates that the same cation site is occupied by 23 Na in the solution state of the as-isolated enzyme. A SAM carboxylate-oxygen is an M + ligand, and EPR and circular dichroism spectroscopies reveal that both the site occupancy and the identity of the cation perturb the electronic properties of the SAM-chelated iron-sulfur cluster. ENDOR studies of the PFL-AE/[ 13 C-methyl]-SAM complex show that the target sulfonium positioning varies with the cation, while the observation of an isotropic hyperfine coupling to the cation by ENDOR measurements establishes its intimate, SAM-mediated interaction with the cluster. This monovalent cation site controls enzyme activity: (i) PFL-AE in the absence of any simple monovalent cations has little-no activity; and (ii) among monocations, going down Group 1 of the periodic table from Li + to Cs + , PFL-AE activity sharply maximizes at K + , with NH 4 + closely matching the efficacy of K + . PFL-AE is thus a type I M + -activated enzyme whose M + controls reactivity by interactions with the cosubstrate, SAM, which is bound to the catalytic iron-sulfur cluster.
21 CFR 864.4400 - Enzyme preparations.
Code of Federal Regulations, 2013 CFR
2013-04-01
... 21 Food and Drugs 8 2013-04-01 2013-04-01 false Enzyme preparations. 864.4400 Section 864.4400...) MEDICAL DEVICES HEMATOLOGY AND PATHOLOGY DEVICES Specimen Preparation Reagents § 864.4400 Enzyme preparations. (a) Identification. Enzyme preparations are products that are used in the histopathology...
21 CFR 864.4400 - Enzyme preparations.
Code of Federal Regulations, 2014 CFR
2014-04-01
... 21 Food and Drugs 8 2014-04-01 2014-04-01 false Enzyme preparations. 864.4400 Section 864.4400...) MEDICAL DEVICES HEMATOLOGY AND PATHOLOGY DEVICES Specimen Preparation Reagents § 864.4400 Enzyme preparations. (a) Identification. Enzyme preparations are products that are used in the histopathology...
21 CFR 864.4400 - Enzyme preparations.
Code of Federal Regulations, 2012 CFR
2012-04-01
... 21 Food and Drugs 8 2012-04-01 2012-04-01 false Enzyme preparations. 864.4400 Section 864.4400...) MEDICAL DEVICES HEMATOLOGY AND PATHOLOGY DEVICES Specimen Preparation Reagents § 864.4400 Enzyme preparations. (a) Identification. Enzyme preparations are products that are used in the histopathology...
21 CFR 864.4400 - Enzyme preparations.
Code of Federal Regulations, 2011 CFR
2011-04-01
... 21 Food and Drugs 8 2011-04-01 2011-04-01 false Enzyme preparations. 864.4400 Section 864.4400...) MEDICAL DEVICES HEMATOLOGY AND PATHOLOGY DEVICES Specimen Preparation Reagents § 864.4400 Enzyme preparations. (a) Identification. Enzyme preparations are products that are used in the histopathology...
21 CFR 864.4400 - Enzyme preparations.
Code of Federal Regulations, 2010 CFR
2010-04-01
... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Enzyme preparations. 864.4400 Section 864.4400...) MEDICAL DEVICES HEMATOLOGY AND PATHOLOGY DEVICES Specimen Preparation Reagents § 864.4400 Enzyme preparations. (a) Identification. Enzyme preparations are products that are used in the histopathology...
Bhattacharya, Abhishek; Pletschke, Brett I
2014-01-01
The enzymatic conversion of lignocellulosic biomass into biofuels has been identified as an excellent strategy to generate clean energy. However, the current process is cost-intensive as an effective immobilization approach to reuse the enzyme(s) has been a major challenge. The present study introduces the concept and application of novel magnetic cross-linked enzyme aggregates (mag-CLEAs). Both mag-CLEAs and calcium-mag-CLEAs (Ca-mag-CLEAs) exhibited a 1.35 fold higher xylanase activity compared to the free enzyme and retained more than 80.0% and 90.0% activity, respectively, after 136h of incubation at 50°C, compared to 50% activity retained by CLEAs. A 7.4 and 9.0 fold higher sugar release from lime-pretreated and NH4OH pre-treated sugar bagasse, respectively, was achieved with Ca-mag-CLEAs compared to the free enzymes. The present study promotes the successful application of mag-CLEAs and Ca-mag-CLEAs as carrier free immobilized enzymes for the effective hydrolysis of lignocellulolytic biomass and associated biofuel feedstocks. Copyright © 2014 Elsevier Inc. All rights reserved.
Artificial enzyme mimics for catalysis and double natural enzyme co-immobilization.
Li, Xiaohua; Zhang, Zhujun; Li, Yongbo
2014-02-01
This work presents a new chemiluminescent (CL) probe array assay. The new type CL probe array is based on enzyme mimics of Co3O4-SiO2 mesoporous nanocomposite material, which not only have an excellent catalytic effect on the luminol-H2O2 CL reaction in an alkaline medium but also can be used for the immobilization of enzymes. The linear range of the lactose concentration is 3.0 × 10(-7) to 1.0 × 10(-5) g mL(-1) and the detection limit is 6.9 × 10(-8) g mL(-1). β-Galactosidase and glucose oxidase were selected as a model for enzyme assays to demonstrate the applicability of Co3O4-SiO2 mesoporous nanocomposite material in multienzyme immobilization. The novel bifunctional CL probe array has been successfully applied to the determination of lactose in milk.
21 CFR 864.9400 - Stabilized enzyme solution.
Code of Federal Regulations, 2010 CFR
2010-04-01
... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Stabilized enzyme solution. 864.9400 Section 864... and Blood Products § 864.9400 Stabilized enzyme solution. (a) Identification. A stabilized enzyme... enzyme solutions include papain, bromelin, ficin, and trypsin. (b) Classification. Class II (performance...
21 CFR 864.9400 - Stabilized enzyme solution.
Code of Federal Regulations, 2011 CFR
2011-04-01
... 21 Food and Drugs 8 2011-04-01 2011-04-01 false Stabilized enzyme solution. 864.9400 Section 864... and Blood Products § 864.9400 Stabilized enzyme solution. (a) Identification. A stabilized enzyme... enzyme solutions include papain, bromelin, ficin, and trypsin. (b) Classification. Class II (performance...
Bacterial enzymes involved in lignin degradation.
de Gonzalo, Gonzalo; Colpa, Dana I; Habib, Mohamed H M; Fraaije, Marco W
2016-10-20
Lignin forms a large part of plant biomass. It is a highly heterogeneous polymer of 4-hydroxyphenylpropanoid units and is embedded within polysaccharide polymers forming lignocellulose. Lignin provides strength and rigidity to plants and is rather resilient towards degradation. To improve the (bio)processing of lignocellulosic feedstocks, more effective degradation methods of lignin are in demand. Nature has found ways to fully degrade lignin through the production of dedicated ligninolytic enzyme systems. While such enzymes have been well thoroughly studied for ligninolytic fungi, only in recent years biochemical studies on bacterial enzymes capable of lignin modification have intensified. This has revealed several types of enzymes available to bacteria that enable them to act on lignin. Two major classes of bacterial lignin-modifying enzymes are DyP-type peroxidases and laccases. Yet, recently also several other bacterial enzymes have been discovered that seem to play a role in lignin modifications. In the present review, we provide an overview of recent advances in the identification and use of bacterial enzymes acting on lignin or lignin-derived products. Copyright © 2016 The Author(s). Published by Elsevier B.V. All rights reserved.
NASA Astrophysics Data System (ADS)
Liang, Hao; Jiang, Shuhui; Yuan, Qipeng; Li, Guofeng; Wang, Feng; Zhang, Zijie; Liu, Juewen
2016-03-01
Preserving enzyme activity and promoting synergistic activity via co-localization of multiple enzymes are key topics in bionanotechnology, materials science, and analytical chemistry. This study reports a facile method for co-immobilizing multiple enzymes in metal coordinated hydrogel nanofibers. Specifically, four types of protein enzymes, including glucose oxidase, Candida rugosa lipase, α-amylase, and horseradish peroxidase, were respectively encapsulated in a gel nanofiber made of Zn2+ and adenosine monophosphate (AMP) with a simple mixing step. Most enzymes achieved quantitative loading and retained full activity. At the same time, the entrapped enzymes were more stable against temperature variation (by 7.5 °C), protease attack, extreme pH (by 2-fold), and organic solvents. After storing for 15 days, the entrapped enzyme still retained 70% activity while the free enzyme nearly completely lost its activity. Compared to nanoparticles formed with AMP and lanthanide ions, the nanofiber gels allowed much higher enzyme activity. Finally, a highly sensitive and selective biosensor for glucose was prepared using the gel nanofiber to co-immobilize glucose oxidase and horseradish peroxidase for an enzyme cascade system. A detection limit of 0.3 μM glucose with excellent selectivity was achieved. This work indicates that metal coordinated materials using nucleotides are highly useful for interfacing with biomolecules.Preserving enzyme activity and promoting synergistic activity via co-localization of multiple enzymes are key topics in bionanotechnology, materials science, and analytical chemistry. This study reports a facile method for co-immobilizing multiple enzymes in metal coordinated hydrogel nanofibers. Specifically, four types of protein enzymes, including glucose oxidase, Candida rugosa lipase, α-amylase, and horseradish peroxidase, were respectively encapsulated in a gel nanofiber made of Zn2+ and adenosine monophosphate (AMP) with a simple mixing step. Most
Applications of Microbial Enzymes in Food Industry.
Raveendran, Sindhu; Parameswaran, Binod; Ummalyma, Sabeela Beevi; Abraham, Amith; Mathew, Anil Kuruvilla; Madhavan, Aravind; Rebello, Sharrel; Pandey, Ashok
2018-03-01
The use of enzymes or microorganisms in food preparations is an age-old process. With the advancement of technology, novel enzymes with wide range of applications and specificity have been developed and new application areas are still being explored. Microorganisms such as bacteria, yeast and fungi and their enzymes are widely used in several food preparations for improving the taste and texture and they offer huge economic benefits to industries. Microbial enzymes are the preferred source to plants or animals due to several advantages such as easy, cost-effective and consistent production. The present review discusses the recent advancement in enzyme technology for food industries. A comprehensive list of enzymes used in food processing, the microbial source of these enzymes and the wide range of their application are discussed.
Applications of Microbial Enzymes in Food Industry
2018-01-01
Summary The use of enzymes or microorganisms in food preparations is an age-old process. With the advancement of technology, novel enzymes with wide range of applications and specificity have been developed and new application areas are still being explored. Microorganisms such as bacteria, yeast and fungi and their enzymes are widely used in several food preparations for improving the taste and texture and they offer huge economic benefits to industries. Microbial enzymes are the preferred source to plants or animals due to several advantages such as easy, cost-effective and consistent production. The present review discusses the recent advancement in enzyme technology for food industries. A comprehensive list of enzymes used in food processing, the microbial source of these enzymes and the wide range of their application are discussed. PMID:29795993
[Hepatic allopurinol oxidizing enzyme in mice].
Huh, K; Iwata, H; Yamamoto, I
1975-03-01
The relationship between allopurinol oxidizing enzyme and aldehyde oxidase was investaged in mice. The oxidation of both N-methylnicotinamide and allopurinol appears to be catalized by a single enzyme, aldehyde oxidase (aldehyde-oxygen oxidoreductase EC, 1.2.3.1.). This conclusion is based on the following evidence; The postnatal changes of allopurinol and N-methylnicotinamide oxidizing activities were similar during growth and the levels of both activities increased in a parallel fashion upon the attainment of sexual maturity. The rates of loss of the activities of both enzymes by heat denaturation as well as dexamethasone administration were similar. The inhibitors of allopurinol oxidizing enzyme also suppressed N-methylnicotinamide oxidation. Competition of N-methylnicotineamide and allopurinol for oxidation was demonstrated. The rate of increase of the activities in both enzymes was almost parallel during each step of the purification from mouse liver supernatant. It was ascertained that xanthine oxidase in the enzyme preparation does not influence allopurinol oxidation.
Wang, Juan; Zhang, Huizhan; Bao, Jie
2015-11-01
Oleaginous yeast Trichosporon cutaneum CGMCC 2.1374 was found to utilize inulin directly for microbial lipid fermentation without a hydrolysis step. The potential inulinase-like enzyme(s) in T. cutaneum CGMCC 2.1374 were characterized and compared with other inulinase enzymes produced by varied yeast strains. The consolidated bioprocessing (CBP) for lipid accumulated using inulin was optimized with 4.79 g/L of lipid produced from 50 g/L inulin with the lipid content of 33.6% in dry cells. The molecular weight of the enzyme was measured which was close to invertase in Saccharomyces cerevisiae. The study provided information for inulin hydrolyzing enzyme(s) in oleaginous yeasts, as well as a preliminary CBP process for lipid production from inulin feedstock.
Heavy enzymes--experimental and computational insights in enzyme dynamics.
Swiderek, Katarzyna; Ruiz-Pernía, J Javier; Moliner, Vicent; Tuñón, Iñaki
2014-08-01
The role of protein motions in the chemical step of enzyme-catalyzed reactions is the subject of an open debate in the scientific literature. The systematic use of isotopically substituted enzymes has been revealed as a useful tool to quantify the role of these motions. According to the Born-Oppenheimer approximation, changing the mass of the protein does not change the forces acting on the system but alters the frequencies of the protein motions, which in turn can affect the rate constant. Experimental and theoretical studies carried out in this field are presented in this article and discussed in the framework of Transition State Theory. Copyright © 2014 Elsevier Ltd. All rights reserved.
Determining Enzyme Activity by Radial Diffusion
ERIC Educational Resources Information Center
Davis, Bill D.
1977-01-01
Discusses advantages of radial diffusion assay in determining presence of enzyme and/or rough approximation of amount of enzyme activities. Procedures are included for the preparation of starch-agar plates, and the application and determination of enzyme. Techniques using plant materials (homogenates, tissues, ungerminated embryos, and seedlings)…