Science.gov

Sample records for eukaryotic 80s ribosomes

  1. Features of 80S mammalian ribosome and its subunits

    PubMed Central

    Budkevich, Tatyana V.; El'skaya, Anna V.; Nierhaus, Knud H.

    2008-01-01

    It is generally believed that basic features of ribosomal functions are universally valid, but a systematic test still stands out for higher eukaryotic 80S ribosomes. Here we report: (i) differences in tRNA and mRNA binding capabilities of eukaryotic and bacterial ribosomes and their subunits. Eukaryotic 40S subunits bind mRNA exclusively in the presence of cognate tRNA, whereas bacterial 30S do bind mRNA already in the absence of tRNA. 80S ribosomes bind mRNA efficiently in the absence of tRNA. In contrast, bacterial 70S interact with mRNA more productively in the presence rather than in the absence of tRNA. (ii) States of initiation (Pi), pre-translocation (PRE) and post-translocation (POST) of the ribosome were checked and no significant functional differences to the prokaryotic counterpart were observed including the reciprocal linkage between A and E sites. (iii) Eukaryotic ribosomes bind tetracycline with an affinity 15 times lower than that of bacterial ribosomes (Kd 30 μM and 1–2 μM, respectively). The drug does not effect enzymatic A-site occupation of 80S ribosomes in contrast to non-enzymatic tRNA binding to the A-site. Both observations explain the relative resistance of eukaryotic ribosomes to this antibiotic. PMID:18632761

  2. Purification, characterization and crystallization of the human 80S ribosome

    PubMed Central

    Khatter, Heena; Myasnikov, Alexander G.; Mastio, Leslie; Billas, Isabelle M. L.; Birck, Catherine; Stella, Stefano; Klaholz, Bruno P.

    2014-01-01

    Ribosomes are key macromolecular protein synthesis machineries in the cell. Human ribosomes have so far not been studied to atomic resolution because of their particularly complex structure as compared with other eukaryotic or prokaryotic ribosomes, and they are difficult to prepare to high homogeneity, which is a key requisite for high-resolution structural work. We established a purification protocol for human 80S ribosomes isolated from HeLa cells that allows obtaining large quantities of homogenous samples as characterized by biophysical methods using analytical ultracentrifugation and multiangle laser light scattering. Samples prepared under different conditions were characterized by direct single particle imaging using cryo electron microscopy, which helped optimizing the preparation protocol. From a small data set, a 3D reconstruction at subnanometric resolution was obtained showing all prominent structural features of the human ribosome, and revealing a salt concentration dependence of the presence of the exit site tRNA, which we show is critical for obtaining crystals. With these well-characterized samples first human 80S ribosome crystals were obtained from several crystallization conditions in capillaries and sitting drops, which diffract to 26 Å resolution at cryo temperatures and for which the crystallographic parameters were determined, paving the way for future high-resolution work. PMID:24452798

  3. Comprehensive Molecular Structure of the Eukaryotic Ribosome

    PubMed Central

    Taylor, Derek J.; Devkota, Batsal; Huang, Andrew D.; Topf, Maya; Narayanan, Eswar; Sali, Andrej; Harvey, Stephen C.; Frank, Joachim

    2009-01-01

    Despite the emergence of a large number of X-ray crystallographic models of the bacterial 70S ribosome over the past decade, an accurate atomic model of the eukaryotic 80S ribosome is still not available. Eukaryotic ribosomes possess more ribosomal proteins and ribosomal RNA than bacterial ribosomes, which are implicated in extra-ribosomal functions in the eukaryotic cells. By combining cryo-EM with RNA and protein homology modeling, we obtained an atomic model of the yeast 80S ribosome complete with all ribosomal RNA expansion segments and all ribosomal proteins for which a structural homolog can be identified. Mutation or deletion of 80S ribosomal proteins can abrogate maturation of the ribosome, leading to several human diseases. We have localized one such protein unique to eukaryotes, rpS19e, whose mutations are associated with Diamond-Blackfan anemia in humans. Additionally, we characterize crucial and novel interactions between the dynamic stalk base of the ribosome with eukaryotic elongation factor 2. PMID:20004163

  4. Structures of the human and Drosophila 80S ribosome.

    PubMed

    Anger, Andreas M; Armache, Jean-Paul; Berninghausen, Otto; Habeck, Michael; Subklewe, Marion; Wilson, Daniel N; Beckmann, Roland

    2013-05-01

    Protein synthesis in all cells is carried out by macromolecular machines called ribosomes. Although the structures of prokaryotic, yeast and protist ribosomes have been determined, the more complex molecular architecture of metazoan 80S ribosomes has so far remained elusive. Here we present structures of Drosophila melanogaster and Homo sapiens 80S ribosomes in complex with the translation factor eEF2, E-site transfer RNA and Stm1-like proteins, based on high-resolution cryo-electron-microscopy density maps. These structures not only illustrate the co-evolution of metazoan-specific ribosomal RNA with ribosomal proteins but also reveal the presence of two additional structural layers in metazoan ribosomes, a well-ordered inner layer covered by a flexible RNA outer layer. The human and Drosophila ribosome structures will provide the basis for more detailed structural, biochemical and genetic experiments. PMID:23636399

  5. Disassembly of yeast 80S ribosomes into subunits is a concerted action of ribosome-assisted folding of denatured protein.

    PubMed

    Chakraborty, Biprashekhar; Bhakta, Sayan; Sengupta, Jayati

    2016-01-22

    It has been shown by several groups that ribosome can assist folding of denatured protein in vitro and the process is conserved across the species. Domain V of large ribosomal rRNA which occupies the intersubunit side of the large subunit was identified as the key player responsible for chaperoning the folding process. Thus, it is conceivable that denatured protein needs to access the intersubunit space of the ribosome in order to get folded. In this study, we have investigated the mechanism of release of the protein from the eukaryotic ribosome following reactivation. We have observed significant splitting of yeast 80S ribosome when incubated with the denatured BCAII protein. Energy-free disassembly mechanism functions in low Mg(+2) ion concentration for prokaryotic ribosomes. Eukaryotic ribosomes do not show significant splitting even at low Mg(+2) ion concentration. In this respect, denatured protein-induced disassembly of eukaryotic ribosome without the involvement of any external energy source is intriguing. For prokaryotic ribosomes, it was reported that the denatured protein induces ribosome splitting into subunits in order to access domain V-rRNA. In contrast, our results suggest an alternative mechanism for eukaryotic ribosomal rRNA-mediated protein folding and subsequent separation of the subunits by which release of the activated-protein occurs. PMID:26723252

  6. Visualization of the joining of ribosomal subunits reveals the presence of 80S ribosomes in the nucleus

    PubMed Central

    Al-Jubran, Khalid; Wen, Jikai; Abdullahi, Akilu; Roy Chaudhury, Subhendu; Li, Min; Ramanathan, Preethi; Matina, Annunziata; De, Sandip; Piechocki, Kim; Rugjee, Kushal Nivriti; Brogna, Saverio

    2013-01-01

    In eukaryotes the 40S and 60S ribosomal subunits are assembled in the nucleolus, but there appear to be mechanisms preventing mRNA binding, 80S formation, and initiation of translation in the nucleus. To visualize association between ribosomal subunits, we tagged pairs of Drosophila ribosomal proteins (RPs) located in different subunits with mutually complementing halves of fluorescent proteins. Pairs of tagged RPs expected to interact, or be adjacent in the 80S structure, showed strong fluorescence, while pairs that were not in close proximity did not. Moreover, the complementation signal is found in ribosomal fractions and it was enhanced by translation elongation inhibitors and reduced by initiation inhibitors. Our technique achieved 80S visualization both in cultured cells and in fly tissues in vivo. Notably, while the main 80S signal was in the cytoplasm, clear signals were also seen in the nucleolus and at other nuclear sites. Furthermore, we detected rapid puromycin incorporation in the nucleolus and at transcription sites, providing an independent indication of functional 80S in the nucleolus and 80S association with nascent transcripts. PMID:24129492

  7. Ribosomal Protein Rps26 Influences 80S Ribosome Assembly in Saccharomyces cerevisiae

    PubMed Central

    Belyy, Alexander; Levanova, Nadezhda; Tabakova, Irina; Rospert, Sabine

    2016-01-01

    ABSTRACT The eukaryotic ribosome consists of a small (40S) and a large (60S) subunit. Rps26 is one of the essential ribosomal proteins of the 40S subunit and is encoded by two almost identical genes, RPS26a and RPS26b. Previous studies demonstrated that Rps26 interacts with the 5′ untranslated region of mRNA via the eukaryote-specific 62-YXXPKXYXK-70 (Y62–K70) motif. Those observations suggested that this peptide within Rps26 might play an important and specific role during translation initiation. By using alanine-scanning mutagenesis and engineered strains of the yeast Saccharomyces cerevisiae, we found that single amino acid substitutions within the Y62–K70 motif of Rps26 did not affect the in vivo function of the protein. In contrast, complete deletion of the Y62–K70 segment was lethal. The simultaneous replacement of five conserved residues within the Y62–K70 segment by alanines resulted in growth defects under stress conditions and produced distinct changes in polysome profiles that were indicative of the accumulation of free 60S subunits. Human Rps26 (Rps26-Hs), which displays significant homology with yeast Rps26, supported the growth of an S. cerevisiae Δrps26a Δrps26b strain. However, the Δrps26a Δrps26b double deletion strain expressing Rps26-Hs displayed substantial growth defects and an altered ratio of 40S/60S ribosomal subunits. The combined data strongly suggest that the eukaryote-specific motif within Rps26 does not play a specific role in translation initiation. Rather, the data indicate that Rps26 as a whole is necessary for proper assembly of the 40S subunit and the 80S ribosome in yeast. IMPORTANCE Rps26 is an essential protein of the eukaryotic small ribosomal subunit. Previous experiments demonstrated an interaction between the eukaryote-specific Y62–K70 segment of Rps26 and the 5′ untranslated region of mRNA. The data suggested a specific role of the Y62–K70 motif during translation initiation. Here, we report that single

  8. The activity of the acidic phosphoproteins from the 80 S rat liver ribosome.

    PubMed

    MacConnell, W P; Kaplan, N O

    1982-05-25

    The selective removal of acidic phosphoproteins from the 80 S rat liver ribosome was accomplished by successive alcohol extractions at low salt concentration. The resulting core ribosomes lost over 90% of their translation activity and were unable to support the elongation factor 2 GTPase reaction. Both activities were partially restored when the dialyzed extracts were added back to the core ribosome. The binding of labeled adenosine diphosphoribosyl-elongation factor 2 to ribosomes was also affected by extraction and could be reconstituted, although not to the same extent as the GTPase activity associated with elongation factor 2 in the presence of the ribosome. The alcohol extracts of the 80 S ribosome contained mostly phosphoproteins P1 and P2 which could be dephosphorylated and rephosphorylated in solution by alkaline phosphatase and protein kinase, respectively. Dephosphorylation of the P1/P2 mixture in the extracts caused a decrease in the ability of these proteins to reactivate the polyphenylalanine synthesis activity of the core ribosome. However, treatment of the dephosphorylated proteins with the catalytic subunit of 3':5'-cAMP-dependent protein kinase in the presence of ATP reactivated the proteins when compared to the activity of the native extracts. Rabbit antisera raised against the alcohol-extracted proteins were capable of impairing both the polyphenylalanine synthesis reaction and the elongation factor 2-dependent GTPase reaction in the intact ribosomes. PMID:6121796

  9. Regulation of the mammalian elongation cycle by subunit rolling: a eukaryotic-specific ribosome rearrangement.

    PubMed

    Budkevich, Tatyana V; Giesebrecht, Jan; Behrmann, Elmar; Loerke, Justus; Ramrath, David J F; Mielke, Thorsten; Ismer, Jochen; Hildebrand, Peter W; Tung, Chang-Shung; Nierhaus, Knud H; Sanbonmatsu, Karissa Y; Spahn, Christian M T

    2014-07-01

    The extent to which bacterial ribosomes and the significantly larger eukaryotic ribosomes share the same mechanisms of ribosomal elongation is unknown. Here, we present subnanometer resolution cryoelectron microscopy maps of the mammalian 80S ribosome in the posttranslocational state and in complex with the eukaryotic eEF1A⋅Val-tRNA⋅GMPPNP ternary complex, revealing significant differences in the elongation mechanism between bacteria and mammals. Surprisingly, and in contrast to bacterial ribosomes, a rotation of the small subunit around its long axis and orthogonal to the well-known intersubunit rotation distinguishes the posttranslocational state from the classical pretranslocational state ribosome. We term this motion "subunit rolling." Correspondingly, a mammalian decoding complex visualized in substates before and after codon recognition reveals structural distinctions from the bacterial system. These findings suggest how codon recognition leads to GTPase activation in the mammalian system and demonstrate that in mammalia subunit rolling occurs during tRNA selection. PMID:24995983

  10. Ribosomal RNA sequence suggest microsporidia are extremely ancient eukaryotes

    NASA Technical Reports Server (NTRS)

    Vossbrinck, C. R.; Maddox, J. V.; Friedman, S.; Debrunner-Vossbrinck, B. A.; Woese, C. R.

    1987-01-01

    A comparative sequence analysis of the 18S small subunit ribosomal RNA (rRNA) of the microsporidium Vairimorpha necatrix is presented. The results show that this rRNA sequence is more unlike those of other eukaryotes than any known eukaryote rRNA sequence. It is concluded that the lineage leading to microsporidia branched very early from that leading to other eukaryotes.

  11. An overview of pre-ribosomal RNA processing in eukaryotes

    PubMed Central

    Henras, Anthony K; Plisson-Chastang, Célia; O'Donohue, Marie-Françoise; Chakraborty, Anirban; Gleizes, Pierre-Emmanuel

    2015-01-01

    Ribosomal RNAs are the most abundant and universal noncoding RNAs in living organisms. In eukaryotes, three of the four ribosomal RNAs forming the 40S and 60S subunits are borne by a long polycistronic pre-ribosomal RNA. A complex sequence of processing steps is required to gradually release the mature RNAs from this precursor, concomitant with the assembly of the 79 ribosomal proteins. A large set of trans-acting factors chaperone this process, including small nucleolar ribonucleoparticles. While yeast has been the gold standard for studying the molecular basis of this process, recent technical advances have allowed to further define the mechanisms of ribosome biogenesis in animals and plants. This renewed interest for a long-lasting question has been fueled by the association of several genetic diseases with mutations in genes encoding both ribosomal proteins and ribosome biogenesis factors, and by the perspective of new anticancer treatments targeting the mechanisms of ribosome synthesis. A consensus scheme of pre-ribosomal RNA maturation is emerging from studies in various kinds of eukaryotic organisms. However, major differences between mammalian and yeast pre-ribosomal RNA processing have recently come to light. WIREs RNA 2015, 6:225–242. doi: 10.1002/wrna.1269 PMID:25346433

  12. Structure of the hypusinylated eukaryotic translation factor eIF-5A bound to the ribosome.

    PubMed

    Schmidt, Christian; Becker, Thomas; Heuer, André; Braunger, Katharina; Shanmuganathan, Vivekanandan; Pech, Markus; Berninghausen, Otto; Wilson, Daniel N; Beckmann, Roland

    2016-02-29

    During protein synthesis, ribosomes become stalled on polyproline-containing sequences, unless they are rescued in archaea and eukaryotes by the initiation factor 5A (a/eIF-5A) and in bacteria by the homologous protein EF-P. While a structure of EF-P bound to the 70S ribosome exists, structural insight into eIF-5A on the 80S ribosome has been lacking. Here we present a cryo-electron microscopy reconstruction of eIF-5A bound to the yeast 80S ribosome at 3.9 Å resolution. The structure reveals that the unique and functionally essential post-translational hypusine modification reaches toward the peptidyltransferase center of the ribosome, where the hypusine moiety contacts A76 of the CCA-end of the P-site tRNA. These findings would support a model whereby eIF-5A stimulates peptide bond formation on polyproline-stalled ribosomes by stabilizing and orienting the CCA-end of the P-tRNA, rather than by directly contributing to the catalysis. PMID:26715760

  13. Structure of the hypusinylated eukaryotic translation factor eIF-5A bound to the ribosome

    PubMed Central

    Schmidt, Christian; Becker, Thomas; Heuer, André; Braunger, Katharina; Shanmuganathan, Vivekanandan; Pech, Markus; Berninghausen, Otto; Wilson, Daniel N.; Beckmann, Roland

    2016-01-01

    During protein synthesis, ribosomes become stalled on polyproline-containing sequences, unless they are rescued in archaea and eukaryotes by the initiation factor 5A (a/eIF-5A) and in bacteria by the homologous protein EF-P. While a structure of EF-P bound to the 70S ribosome exists, structural insight into eIF-5A on the 80S ribosome has been lacking. Here we present a cryo-electron microscopy reconstruction of eIF-5A bound to the yeast 80S ribosome at 3.9 Å resolution. The structure reveals that the unique and functionally essential post-translational hypusine modification reaches toward the peptidyltransferase center of the ribosome, where the hypusine moiety contacts A76 of the CCA-end of the P-site tRNA. These findings would support a model whereby eIF-5A stimulates peptide bond formation on polyproline-stalled ribosomes by stabilizing and orienting the CCA-end of the P-tRNA, rather than by directly contributing to the catalysis. PMID:26715760

  14. On the expansion of ribosomal proteins and RNAs in eukaryotes.

    PubMed

    Parker, Michael S; Sah, Renu; Balasubramaniam, Ambikaipakan; Sallee, Floyd R; Park, Edwards A; Parker, Steven L

    2014-07-01

    While the ribosome constitution is similar in all biota, there is a considerable increase in size of both ribosomal proteins (RPs) and RNAs in eukaryotes as compared to archaea and bacteria. This is pronounced in the large (60S) ribosomal subunit (LSU). In addition to enlargement (apparently maximized already in lower eukarya), the RP changes include increases in fraction, segregation and clustering of basic residues, and decrease in hydrophobicity. The acidic fraction is lower in eukaryote as compared to prokaryote RPs. In all eukaryote groups tested, the LSU RPs have significantly higher content of basic residues and homobasic segments than the SSU RPs. The vertebrate LSU RPs have much higher sequestration of basic residues than those of bacteria, archaea and even of the lower eukarya. The basic clusters are highly aligned in the vertebrate, but less in the lower eukarya, and only within families in archaea and bacteria. Increase in the basicity of RPs, besides helping transport to the nucleus, should promote stability of the assembled ribosome as well as the association with translocons and other intracellular matrix proteins. The size and GC nucleotide bias of the expansion segments of large LSU rRNAs also culminate in the vertebrate, and should support ribosome association with the endoplasmic reticulum and other intracellular networks. However, the expansion and nucleotide bias of eukaryote LSU rRNAs do not clearly correlate with changes in ionic parameters of LSU ribosomal proteins. PMID:24633358

  15. Regulation of the mammalian elongation cycle by subunit rolling: a eukaryotic-specific ribosome rearrangement

    PubMed Central

    Budkevich, Tatyana V.; Giesebrecht, Jan; Behrmann, Elmar; Loerke, Justus; Ramrath, David J.F.; Mielke, Thorsten; Ismer, Jochen; Hildebrand, Peter W.; Tung, Chang-Shung; Nierhaus, Knud H.; Sanbonmatsu, Karissa Y.; Spahn, Christian M.T.

    2014-01-01

    SUMMARY The extent to which bacterial ribosomes and the significantly larger eukaryotic ribosomes share the same mechanisms of ribosomal elongation is unknown. Here, we present sub-nanometer resolution cryo-electron microscopy maps of the mammalian 80S ribosome in the post-translocational state and in complex with the eukaryotic eEF1A•Val-tRNA•GMPPNP ternary complex, revealing significant differences in the elongation mechanism between bacteria and mammals. Surprisingly, and in contrast to bacterial ribosomes, a rotation of the small subunit around its long axis and orthogonal to the well-known intersubunit rotation distinguishes the post-translocational state from the classical pre-translocational state ribosome. We term this motion “subunit rolling”. Correspondingly, a mammalian decoding complex visualized in sub-states before and after codon recognition reveals structural distinctions from the bacterial system. These findings suggest how codon recognition leads to GTPase activation in the mammalian system and demonstrate that in mammalia subunit rolling occurs during tRNA selection. PMID:24995983

  16. Eukaryotic ribosomes that lack a 5.8S RNA

    NASA Technical Reports Server (NTRS)

    Vossbrinck, C. R.; Woese, C. R.

    1986-01-01

    The 5.8S ribosomal RNA is believed to be a universal eukaryotic characteristic. It has no (size) counterpart among the prokaryotes, although its sequence is homologous with the first 150 or so nucleotides of the prokaryotic large subunit (23S) ribosomal RNA. An exception to this rule is reported here. The microsporidian Vairimorpha necatrix is a eukaryote that has no 5.8S rRNA. As in the prokaryotes, it has a single large subunit rRNA, whose 5-prime region corresponds to the 5.8S rRNA.

  17. Recycling of eukaryotic post-termination ribosomal complexes

    PubMed Central

    Pisarev, Andrey V.; Hellen, Christopher U. T.; Pestova, Tatyana V.

    2007-01-01

    SUMMARY After translational termination, mRNA and P site deacylated tRNA remain associated with ribosomes in post-termination complexes (post-TCs), which must therefore be recycled by releasing mRNA and deacylated tRNA and by dissociating ribosomes into subunits. Recycling of bacterial post-TCs requires elongation factor EF-G and a ribosome recycling factor RRF. Eukaryotes do not encode a RRF homologue and their mechanism of ribosomal recycling is unknown. We investigated eukaryotic recycling using post-TCs assembled on a model mRNA encoding a tetrapeptide followed by a UAA stop codon and report that initiation factors eIF3, eIF1, eIF1A and eIF3j, a loosely associated subunit of eIF3, can promote recycling of eukaryotic post-TCs. eIF3 is the principal factor that promotes splitting of post-termination ribosomes into 60S subunits and tRNA- and mRNA-bound 40S subunits. Its activity is enhanced by eIF3j, eIF1 and eIF1A. eIF1 also mediates release of P-site tRNA, whereas eIF3j ensures subsequent dissociation of mRNA. PMID:17956730

  18. Functions of ribosomal proteins in assembly of eukaryotic ribosomes in vivo.

    PubMed

    de la Cruz, Jesús; Karbstein, Katrin; Woolford, John L

    2015-01-01

    The proteome of cells is synthesized by ribosomes, complex ribonucleoproteins that in eukaryotes contain 79-80 proteins and four ribosomal RNAs (rRNAs) more than 5,400 nucleotides long. How these molecules assemble together and how their assembly is regulated in concert with the growth and proliferation of cells remain important unanswered questions. Here, we review recently emerging principles to understand how eukaryotic ribosomal proteins drive ribosome assembly in vivo. Most ribosomal proteins assemble with rRNA cotranscriptionally; their association with nascent particles is strengthened as assembly proceeds. Each subunit is assembled hierarchically by sequential stabilization of their subdomains. The active sites of both subunits are constructed last, perhaps to prevent premature engagement of immature ribosomes with active subunits. Late-assembly intermediates undergo quality-control checks for proper function. Mutations in ribosomal proteins that affect mostly late steps lead to ribosomopathies, diseases that include a spectrum of cell type-specific disorders that often transition from hypoproliferative to hyperproliferative growth. PMID:25706898

  19. Functions of Ribosomal Proteins in Assembly of Eukaryotic Ribosomes In Vivo

    PubMed Central

    2016-01-01

    The proteome of cells is synthesized by ribosomes, complex ribonucleoproteins that in eukaryotes contain 79–80 proteins and four ribosomal RNAs (rRNAs) more than 5,400 nucleotides long. How these molecules assemble together and how their assembly is regulated in concert with the growth and proliferation of cells remain important unanswered questions. Here, we review recently emerging principles to understand how eukaryotic ribosomal proteins drive ribosome assembly in vivo. Most ribosomal proteins assemble with rRNA cotranscriptionally; their association with nascent particles is strengthened as assembly proceeds. Each subunit is assembled hierarchically by sequential stabilization of their subdomains. The active sites of both subunits are constructed last, perhaps to prevent premature engagement of immature ribosomes with active subunits. Late-assembly intermediates undergo quality-control checks for proper function. Mutations in ribosomal proteins that affect mostly late steps lead to ribosomopathies, diseases that include a spectrum of cell type–specific disorders that often transition from hypoproliferative to hyperproliferative growth. PMID:25706898

  20. Cryo-EM of ribosomal 80S complexes with termination factors reveal the translocated cricket paralysis virus IRES

    PubMed Central

    Muhs, Margarita; Hilal, Tarek; Mielke, Thorsten; Skabkin, Maxim A.; Sanbonmatsu, Karissa Y.; Pestova, Tatyana V.; Spahn, Christian M.T.

    2015-01-01

    Summary The Cricket paralysis virus (CrPV) uses an internal ribosomal entry site (IRES) to hijack the ribosome. In a remarkable RNA-based mechanism involving neither initiation factor nor initiator tRNA, the CrPV IRES jump starts translation in the elongation phase from the ribosomal A-site. Here we present cryo-EM maps of 80S•CrPV-STOP•eRF1•eRF3•GMPPNP and 80S•CrPV-STOP•eRF1 complexes revealing a previously unseen binding state of the IRES and directly rationalizing that an eEF2-dependent translocation of the IRES is required to allow the first A-site occupation. During this unusual translocation event the IRES undergoes a pronounced conformational change to a more stretched conformation. At the same time our structural analysis provides information about the binding modes of eRF1•eRF3•GMPPNP and eRF1 in a minimal system. It shows that neither eRF3 nor ABCE1 are required for the active conformation of eRF1 at the intersection between eukaryotic termination and recycling. PMID:25601755

  1. Cryo-EM of ribosomal 80S complexes with termination factors reveals the translocated cricket paralysis virus IRES.

    PubMed

    Muhs, Margarita; Hilal, Tarek; Mielke, Thorsten; Skabkin, Maxim A; Sanbonmatsu, Karissa Y; Pestova, Tatyana V; Spahn, Christian M T

    2015-02-01

    The cricket paralysis virus (CrPV) uses an internal ribosomal entry site (IRES) to hijack the ribosome. In a remarkable RNA-based mechanism involving neither initiation factor nor initiator tRNA, the CrPV IRES jumpstarts translation in the elongation phase from the ribosomal A site. Here, we present cryoelectron microscopy (cryo-EM) maps of 80S⋅CrPV-STOP ⋅ eRF1 ⋅ eRF3 ⋅ GMPPNP and 80S⋅CrPV-STOP ⋅ eRF1 complexes, revealing a previously unseen binding state of the IRES and directly rationalizing that an eEF2-dependent translocation of the IRES is required to allow the first A-site occupation. During this unusual translocation event, the IRES undergoes a pronounced conformational change to a more stretched conformation. At the same time, our structural analysis provides information about the binding modes of eRF1 ⋅ eRF3 ⋅ GMPPNP and eRF1 in a minimal system. It shows that neither eRF3 nor ABCE1 are required for the active conformation of eRF1 at the intersection between eukaryotic termination and recycling. PMID:25601755

  2. Quantitative studies of mRNA recruitment to the eukaryotic ribosome.

    PubMed

    Fraser, Christopher S

    2015-07-01

    The process of peptide bond synthesis by ribosomes is conserved between species, but the initiation step differs greatly between the three kingdoms of life. This is illustrated by the evolution of roughly an order of magnitude more initiation factor mass found in humans compared with bacteria. Eukaryotic initiation of translation is comprised of a number of sub-steps: (i) recruitment of an mRNA and initiator methionyl-tRNA to the 40S ribosomal subunit; (ii) migration of the 40S subunit along the 5' UTR to locate the initiation codon; and (iii) recruitment of the 60S subunit to form the 80S initiation complex. Although the mechanism and regulation of initiation has been studied for decades, many aspects of the pathway remain unclear. In this review, I will focus discussion on what is known about the mechanism of mRNA selection and its recruitment to the 40S subunit. I will summarize how the 43S preinitiation complex (PIC) is formed and stabilized by interactions between its components. I will discuss what is known about the mechanism of mRNA selection by the eukaryotic initiation factor 4F (eIF4F) complex and how the selected mRNA is recruited to the 43S PIC. The regulation of this process by secondary structure located in the 5' UTR of an mRNA will also be discussed. Finally, I present a possible kinetic model with which to explain the process of mRNA selection and recruitment to the eukaryotic ribosome. PMID:25742741

  3. Eukaryote-specific extensions in ribosomal proteins of the small subunit: Structure and function.

    PubMed

    Ghosh, Arnab; Komar, Anton A

    2015-01-01

    High-resolution structures of yeast ribosomes have improved our understanding of the architecture and organization of eukaryotic rRNA and proteins, as well as eukaryote-specific extensions present in some conserved ribosomal proteins. Despite this progress, assignment of specific functions to individual proteins and/or eukaryote-specific protein extensions remains challenging. It has been suggested that eukaryote-specific extensions of conserved proteins from the small ribosomal subunit may facilitate eukaryote-specific reactions in the initiation phase of protein synthesis. This review summarizes emerging data describing the structural and functional significance of eukaryote-specific extensions of conserved small ribosomal subunit proteins, particularly their possible roles in recruitment and spatial organization of eukaryote-specific initiation factors. PMID:26779416

  4. The Functional Role of eL19 and eB12 Intersubunit Bridge in the Eukaryotic Ribosome.

    PubMed

    Kisly, Ivan; Gulay, Suna P; Mäeorg, Uno; Dinman, Jonathan D; Remme, Jaanus; Tamm, Tiina

    2016-05-22

    During translation, the two eukaryotic ribosomal subunits remain associated through 17 intersubunit bridges, five of which are eukaryote specific. These are mainly localized to the peripheral regions and are believed to stabilize the structure of the ribosome. The functional importance of these bridges remains largely unknown. Here, the essentiality of the eukaryote-specific bridge eB12 has been investigated. The main component of this bridge is ribosomal protein eL19 that is composed of an N-terminal globular domain, a middle region, and a long C-terminal α-helix. The analysis of deletion mutants demonstrated that the globular domain and middle region of eL19 are essential for cell viability, most likely functioning in ribosome assembly. The eB12 bridge, formed by contacts between the C-terminal α-helix of eL19 and 18S rRNA in concert with additional stabilizing interactions involving either eS7 or uS17, is dispensable for viability. Nevertheless, eL19 mutants impaired in eB12 bridge formation displayed slow growth phenotypes, altered sensitivity/resistance to translational inhibitors, and enhanced hyperosmotic stress tolerance. Biochemical analyses determined that the eB12 bridge contributes to the stability of ribosome subunit interactions in vitro. 60S subunits containing eL19 variants defective in eB12 bridge formation failed to form 80S ribosomes regardless of Mg(2+) concentration. The reassociation of 40S and mutant 60S subunits was markedly improved in the presence of deacetylated tRNA, emphasizing the importance of tRNAs during the subunit association. We propose that the eB12 bridge plays an important role in subunit joining and in optimizing ribosome functionality. PMID:27038511

  5. Hydroxylation of the eukaryotic ribosomal decoding center affects translational accuracy

    PubMed Central

    Loenarz, Christoph; Sekirnik, Rok; Thalhammer, Armin; Ge, Wei; Spivakovsky, Ekaterina; Mackeen, Mukram M.; McDonough, Michael A.; Cockman, Matthew E.; Kessler, Benedikt M.; Ratcliffe, Peter J.; Wolf, Alexander; Schofield, Christopher J.

    2014-01-01

    The mechanisms by which gene expression is regulated by oxygen are of considerable interest from basic science and therapeutic perspectives. Using mass spectrometric analyses of Saccharomyces cerevisiae ribosomes, we found that the amino acid residue in closest proximity to the decoding center, Pro-64 of the 40S subunit ribosomal protein Rps23p (RPS23 Pro-62 in humans) undergoes posttranslational hydroxylation. We identify RPS23 hydroxylases as a highly conserved eukaryotic subfamily of Fe(II) and 2-oxoglutarate dependent oxygenases; their catalytic domain is closely related to transcription factor prolyl trans-4-hydroxylases that act as oxygen sensors in the hypoxic response in animals. The RPS23 hydroxylases in S. cerevisiae (Tpa1p), Schizosaccharomyces pombe and green algae catalyze an unprecedented dihydroxylation modification. This observation contrasts with higher eukaryotes, where RPS23 is monohydroxylated; the human Tpa1p homolog OGFOD1 catalyzes prolyl trans-3-hydroxylation. TPA1 deletion modulates termination efficiency up to ∼10-fold, including of pathophysiologically relevant sequences; we reveal Rps23p hydroxylation as its molecular basis. In contrast to most previously characterized accuracy modulators, including antibiotics and the prion state of the S. cerevisiae translation termination factor eRF3, Rps23p hydroxylation can either increase or decrease translational accuracy in a stop codon context-dependent manner. We identify conditions where Rps23p hydroxylation status determines viability as a consequence of nonsense codon suppression. The results reveal a direct link between oxygenase catalysis and the regulation of gene expression at the translational level. They will also aid in the development of small molecules altering translational accuracy for the treatment of genetic diseases linked to nonsense mutations. PMID:24550462

  6. Structures of Eukaryotic Ribosomal Stalk Proteins and Its Complex with Trichosanthin, and Their Implications in Recruiting Ribosome-Inactivating Proteins to the Ribosomes

    PubMed Central

    Choi, Andrew K. H.; Wong, Eddie C. K.; Lee, Ka-Ming; Wong, Kam-Bo

    2015-01-01

    Ribosome-inactivating proteins (RIP) are RNA N-glycosidases that inactivate ribosomes by specifically depurinating a conserved adenine residue at the α-sarcin/ricin loop of 28S rRNA. Recent studies have pointed to the involvement of the C-terminal domain of the eukaryotic stalk proteins in facilitating the toxic action of RIPs. This review highlights how structural studies of eukaryotic stalk proteins provide insights into the recruitment of RIPs to the ribosomes. Since the C-terminal domain of eukaryotic stalk proteins is involved in specific recognition of elongation factors and some eukaryote-specific RIPs (e.g., trichosanthin and ricin), we postulate that these RIPs may have evolved to hijack the translation-factor-recruiting function of ribosomal stalk in reaching their target site of rRNA. PMID:25723321

  7. Position of the CrPV IRES on the 40S subunit and factor dependence of IRES/80S ribosome assembly.

    PubMed

    Pestova, Tatyana V; Lomakin, Ivan B; Hellen, Christopher U T

    2004-09-01

    The cricket paralysis virus intergenic region internal ribosomal entry site (CrPV IGR IRES) can assemble translation initiation complexes by binding to 40S subunits without Met-tRNA(Met)(i) and initiation factors (eIFs) and then by joining directly with 60S subunits, yielding elongation-competent 80S ribosomes. Here, we report that eIF1, eIF1A and eIF3 do not significantly influence IRES/40S subunit binding but strongly inhibit subunit joining and the first elongation cycle. The IRES can avoid their inhibitory effect by its ability to bind directly to 80S ribosomes. The IRES's ability to bind to 40S subunits simultaneously with eIF1 allowed us to use directed hydroxyl radical cleavage to map its position relative to the known position of eIF1. A connecting loop in the IRES's pseudoknot (PK) III domain, part of PK II and the entire domain containing PK I are solvent-exposed and occupy the E site and regions of the P site that are usually occupied by Met-tRNA(Met)(i). PMID:15332113

  8. Eukaryote-specific rRNA expansion segments function in ribosome biogenesis.

    PubMed

    Ramesh, Madhumitha; Woolford, John L

    2016-08-01

    The secondary structure of ribosomal RNA (rRNA) is largely conserved across all kingdoms of life. However, eukaryotes have evolved extra blocks of rRNA sequences, relative to those of prokaryotes, called expansion segments (ES). A thorough characterization of the potential roles of ES remains to be done, possibly because of limitations in the availability of robust systems to study rRNA mutants. We sought to systematically investigate the potential functions, if any, of the ES in 25S rRNA of Saccharomyces cerevisiae by deletion mutagenesis. We deleted 14 of the 16 different eukaryote-specific ES in yeast 25S rRNA individually and assayed their phenotypes. Our results show that all but two of the ES tested are necessary for optimal growth and are required for production of 25S rRNA, suggesting that ES play roles in ribosome biogenesis. Further, we classified expansion segments into groups that participate in early nucleolar, middle, and late nucleoplasmic steps of ribosome biogenesis, by assaying their pre-rRNA processing phenotypes. This study is the first of its kind to systematically identify the functions of eukaryote-specific expansion segments by showing that they play roles in specific steps of ribosome biogenesis. The catalog of phenotypes we identified, combined with previous investigations of the roles ribosomal proteins in large subunit biogenesis, leads us to infer that assembling ribosomes are composed of distinct RNA and protein structural neighborhood clusters that participate in specific steps of ribosome biogenesis. PMID:27317789

  9. Nucleocytoplasmic transport of ribosomes in a eukaryotic system: Is there a facilitated transport process

    SciTech Connect

    Khanna-Gupta, A.; Ware, V.C. )

    1989-03-01

    The authors have examined the kinetics of the process by which ribosomes are exported from the nucleus to the cytoplasm using Xenopus laevis oocytes microinjected into the germinal vesicle with radiolabeled ribosomes or ribosomal subunits from X. laevis, Tetrahymena thermophila, or Escherichia coli. Microinjected eukaryotic mature ribosomes are redistributed into the oocyte cytoplasm by an apparent carrier-mediated transport process that exhibits saturation kinetics as increasing amounts of ribosomes are injected. T. thermophila ribosomes are competent to traverse the Xenopus nuclear envelope, suggesting that the basic mechanism underlying ribosome transport is evolutionarily conserved. Microinjected E. coli ribosomes are not transported in this system, indicating that prokaryotic ribosomes lack the signals required for transport. Surprisingly, coinjected small (40S) and large (60S) subunits from T. thermophila are transported significantly faster than individual subunits. These observations support a facilitated transport model for the translocation of ribosomal subunits as separate units across the nuclear envelope whereby the transport rate of 60S or 40S subunits is enhanced by the presence of the partner subunit. Although the basic features of the transport mechanism have been preserved through evolution, other aspects of the process may be mediated through species-specific interactions. They hypothesize that a species-specific nuclear 40S-60S subunit association may expedite the transport of individual subunits across the nuclear envelope.

  10. Eukaryotic rpL10 drives ribosomal rotation

    PubMed Central

    Sulima, Sergey O.; Gülay, Suna P.; Anjos, Margarida; Patchett, Stephanie; Meskauskas, Arturas; Johnson, Arlen W.; Dinman, Jonathan D.

    2014-01-01

    Ribosomes transit between two conformational states, non-rotated and rotated, through the elongation cycle. Here, we present evidence that an internal loop in the essential yeast ribosomal protein rpL10 is a central controller of this process. Mutations in this loop promote opposing effects on the natural equilibrium between these two extreme conformational states. rRNA chemical modification analyses reveals allosteric interactions involved in coordinating intersubunit rotation originating from rpL10 in the core of the large subunit (LSU) through both subunits, linking all the functional centers of the ribosome. Mutations promoting rotational disequilibria showed catalytic, biochemical and translational fidelity defects. An rpL3 mutation promoting opposing structural and biochemical effects, suppressed an rpL10 mutant, re-establishing rotational equilibrium. The rpL10 loop is also involved in Sdo1p recruitment, suggesting that rotational status is important for ensuring late-stage maturation of the LSU, supporting a model in which pre-60S subunits undergo a ‘test drive’ before final maturation. PMID:24214990

  11. Eukaryotic rpL10 drives ribosomal rotation.

    PubMed

    Sulima, Sergey O; Gülay, Suna P; Anjos, Margarida; Patchett, Stephanie; Meskauskas, Arturas; Johnson, Arlen W; Dinman, Jonathan D

    2014-02-01

    Ribosomes transit between two conformational states, non-rotated and rotated, through the elongation cycle. Here, we present evidence that an internal loop in the essential yeast ribosomal protein rpL10 is a central controller of this process. Mutations in this loop promote opposing effects on the natural equilibrium between these two extreme conformational states. rRNA chemical modification analyses reveals allosteric interactions involved in coordinating intersubunit rotation originating from rpL10 in the core of the large subunit (LSU) through both subunits, linking all the functional centers of the ribosome. Mutations promoting rotational disequilibria showed catalytic, biochemical and translational fidelity defects. An rpL3 mutation promoting opposing structural and biochemical effects, suppressed an rpL10 mutant, re-establishing rotational equilibrium. The rpL10 loop is also involved in Sdo1p recruitment, suggesting that rotational status is important for ensuring late-stage maturation of the LSU, supporting a model in which pre-60S subunits undergo a 'test drive' before final maturation. PMID:24214990

  12. Ribosomal 18S rRNA base pairs with mRNA during eukaryotic translation initiation

    PubMed Central

    Martin, Franck; Ménétret, Jean-François; Simonetti, Angelita; Myasnikov, Alexander G.; Vicens, Quentin; Prongidi-Fix, Lydia; Natchiar, S. Kundhavai; Klaholz, Bruno P.; Eriani, Gilbert

    2016-01-01

    Eukaryotic mRNAs often contain a Kozak sequence that helps tether the ribosome to the AUG start codon. The mRNA of histone H4 (h4) does not undergo classical ribosome scanning but has evolved a specific tethering mechanism. The cryo-EM structure of the rabbit ribosome complex with mouse h4 shows that the mRNA forms a folded, repressive structure at the mRNA entry site on the 40S subunit next to the tip of helix 16 of 18S ribosomal RNA (rRNA). Toe-printing and mutational assays reveal that an interaction exists between a purine-rich sequence in h4 mRNA and a complementary UUUC sequence of helix h16. Together the present data establish that the h4 mRNA harbours a sequence complementary to an 18S rRNA sequence which tethers the mRNA to the ribosome to promote proper start codon positioning, complementing the interactions of the 40S subunit with the Kozak sequence that flanks the AUG start codon. PMID:27554013

  13. Ribosomal 18S rRNA base pairs with mRNA during eukaryotic translation initiation.

    PubMed

    Martin, Franck; Ménétret, Jean-François; Simonetti, Angelita; Myasnikov, Alexander G; Vicens, Quentin; Prongidi-Fix, Lydia; Natchiar, S Kundhavai; Klaholz, Bruno P; Eriani, Gilbert

    2016-01-01

    Eukaryotic mRNAs often contain a Kozak sequence that helps tether the ribosome to the AUG start codon. The mRNA of histone H4 (h4) does not undergo classical ribosome scanning but has evolved a specific tethering mechanism. The cryo-EM structure of the rabbit ribosome complex with mouse h4 shows that the mRNA forms a folded, repressive structure at the mRNA entry site on the 40S subunit next to the tip of helix 16 of 18S ribosomal RNA (rRNA). Toe-printing and mutational assays reveal that an interaction exists between a purine-rich sequence in h4 mRNA and a complementary UUUC sequence of helix h16. Together the present data establish that the h4 mRNA harbours a sequence complementary to an 18S rRNA sequence which tethers the mRNA to the ribosome to promote proper start codon positioning, complementing the interactions of the 40S subunit with the Kozak sequence that flanks the AUG start codon. PMID:27554013

  14. Stage-specific assembly events of the 6-MDa small-subunit processome initiate eukaryotic ribosome biogenesis.

    PubMed

    Chaker-Margot, Malik; Hunziker, Mirjam; Barandun, Jonas; Dill, Brian D; Klinge, Sebastian

    2015-11-01

    Eukaryotic ribosome biogenesis involves a plethora of ribosome-assembly factors, and their temporal order of association with preribosomal RNA is largely unknown. By using Saccharomyces cerevisiae as a model organism, we developed a system that recapitulates and arrests ribosome assembly at early stages, thus providing in vivo snapshots of nascent preribosomal particles. Here we report the stage-specific order in which 70 ribosome-assembly factors associate with preribosomal RNA domains, thereby forming the 6-MDa small-subunit processome. PMID:26479197

  15. Eukaryotic Initiation Factor 6, an evolutionarily conserved regulator of ribosome biogenesis and protein translation

    SciTech Connect

    Guo, Jianjun; Jin, Zhaoqing; Yang, Xiaohan; Li, Jian-Feng; Chen, Jay

    2011-01-01

    We recently identified Receptor for Activated C Kinase 1 (RACK1) as one of the molecular links between abscisic acid (ABA) signaling and its regulation on protein translation. Moreover, we identified Eukaryotic Initiation Factor 6 (eIF6) as an interacting partner of RACK1. Because the interaction between RACK1 and eIF6 in mammalian cells is known to regulate the ribosome assembly step of protein translation initiation, it was hypothesized that the same process of protein translation in Arabidopsis is also regulated by RACK1 and eIF6. In this article, we analyzed the amino acid sequences of eIF6 in different species from different lineages and discovered some intriguing differences in protein phosphorylation sites that may contribute to its action in ribosome assembly and biogenesis. In addition, we discovered that, distinct from non-plant organisms in which eIF6 is encoded by a single gene, all sequenced plant genomes contain two or more copies of eIF6 genes. While one copy of plant eIF6 is expressed ubiquitously and might possess the conserved function in ribosome biogenesis and protein translation, the other copy seems to be only expressed in specific organs and therefore may have gained some new functions. We proposed some important studies that may help us better understand the function of eIF6 in plants.

  16. 2.8-Å Cryo-EM Structure of the Large Ribosomal Subunit from the Eukaryotic Parasite Leishmania.

    PubMed

    Shalev-Benami, Moran; Zhang, Yan; Matzov, Donna; Halfon, Yehuda; Zackay, Arie; Rozenberg, Haim; Zimmerman, Ella; Bashan, Anat; Jaffe, Charles L; Yonath, Ada; Skiniotis, Georgios

    2016-07-12

    Leishmania is a single-cell eukaryotic parasite of the Trypanosomatidae family, whose members cause an array of tropical diseases. The often fatal outcome of infections, lack of effective vaccines, limited selection of therapeutic drugs, and emerging resistant strains, underline the need to develop strategies to combat these pathogens. The Trypanosomatid ribosome has recently been highlighted as a promising therapeutic target due to structural features that are distinct from other eukaryotes. Here, we present the 2.8-Å resolution structure of the Leishmania donovani large ribosomal subunit (LSU) derived from a cryo-EM map, further enabling the structural observation of eukaryotic rRNA modifications that play a significant role in ribosome assembly and function. The structure illustrates the unique fragmented nature of leishmanial LSU rRNA and highlights the irregular distribution of rRNA modifications in Leishmania, a characteristic with implications for anti-parasitic drug development. PMID:27373148

  17. UtpA and UtpB chaperone nascent pre-ribosomal RNA and U3 snoRNA to initiate eukaryotic ribosome assembly

    PubMed Central

    Hunziker, Mirjam; Barandun, Jonas; Petfalski, Elisabeth; Tan, Dongyan; Delan-Forino, Clémentine; Molloy, Kelly R.; Kim, Kelly H.; Dunn-Davies, Hywel; Shi, Yi; Chaker-Margot, Malik; Chait, Brian T.; Walz, Thomas; Tollervey, David; Klinge, Sebastian

    2016-01-01

    Early eukaryotic ribosome biogenesis involves large multi-protein complexes, which co-transcriptionally associate with pre-ribosomal RNA to form the small subunit processome. The precise mechanisms by which two of the largest multi-protein complexes—UtpA and UtpB—interact with nascent pre-ribosomal RNA are poorly understood. Here, we combined biochemical and structural biology approaches with ensembles of RNA–protein cross-linking data to elucidate the essential functions of both complexes. We show that UtpA contains a large composite RNA-binding site and captures the 5′ end of pre-ribosomal RNA. UtpB forms an extended structure that binds early pre-ribosomal intermediates in close proximity to architectural sites such as an RNA duplex formed by the 5′ ETS and U3 snoRNA as well as the 3′ boundary of the 18S rRNA. Both complexes therefore act as vital RNA chaperones to initiate eukaryotic ribosome assembly. PMID:27354316

  18. UtpA and UtpB chaperone nascent pre-ribosomal RNA and U3 snoRNA to initiate eukaryotic ribosome assembly

    NASA Astrophysics Data System (ADS)

    Hunziker, Mirjam; Barandun, Jonas; Petfalski, Elisabeth; Tan, Dongyan; Delan-Forino, Clémentine; Molloy, Kelly R.; Kim, Kelly H.; Dunn-Davies, Hywel; Shi, Yi; Chaker-Margot, Malik; Chait, Brian T.; Walz, Thomas; Tollervey, David; Klinge, Sebastian

    2016-06-01

    Early eukaryotic ribosome biogenesis involves large multi-protein complexes, which co-transcriptionally associate with pre-ribosomal RNA to form the small subunit processome. The precise mechanisms by which two of the largest multi-protein complexes--UtpA and UtpB--interact with nascent pre-ribosomal RNA are poorly understood. Here, we combined biochemical and structural biology approaches with ensembles of RNA-protein cross-linking data to elucidate the essential functions of both complexes. We show that UtpA contains a large composite RNA-binding site and captures the 5' end of pre-ribosomal RNA. UtpB forms an extended structure that binds early pre-ribosomal intermediates in close proximity to architectural sites such as an RNA duplex formed by the 5' ETS and U3 snoRNA as well as the 3' boundary of the 18S rRNA. Both complexes therefore act as vital RNA chaperones to initiate eukaryotic ribosome assembly.

  19. Integrative structural analysis of the UTPB complex, an early assembly factor for eukaryotic small ribosomal subunits

    PubMed Central

    Zhang, Cheng; Sun, Qi; Chen, Rongchang; Chen, Xining; Lin, Jinzhong; Ye, Keqiong

    2016-01-01

    Ribosome assembly is an essential and conserved cellular process in eukaryotes that requires numerous assembly factors. The six-subunit UTPB complex is an essential component of the 90S precursor of the small ribosomal subunit. Here, we analyzed the molecular architecture of UTPB using an integrative structural biology approach. We mapped the major interactions that associate each of six UTPB proteins. Crystallographic studies showed that Utp1, Utp21, Utp12 and Utp13 are evolutionarily related and form a dimer of dimers (Utp1–Utp21, Utp12–Utp13) through their homologous helical C-terminal domains. Molecular docking with crosslinking restraints showed that the WD domains of Utp12 and Utp13 are associated, as are the WD domains of Utp1, Utp21 and Utp18. Electron microscopy images of the entire UTPB complex revealed that it predominantly adopts elongated conformations and possesses internal flexibility. We also determined crystal structures of the WD domain of Utp18 and the HAT and deviant HAT domains of Utp6. A structural model of UTPB was derived based on these data. PMID:27330138

  20. Biogenesis and nuclear export of ribosomal subunits in higher eukaryotes depend on the CRM1 export pathway.

    PubMed

    Thomas, Franziska; Kutay, Ulrike

    2003-06-15

    The production of ribosomes constitutes a major biosynthetic task for cells. Eukaryotic small and large ribosomal subunits are assembled in the nucleolus and independently exported to the cytoplasm. Most nuclear export pathways require RanGTP-binding export receptors. We analyzed the role of CRM1, the export receptor for leucine-rich nuclear export signals (NES), in the biogenesis of ribosomal subunits in vertebrate cells. Inhibition of the CRM1 export pathway led to a defect in nuclear export of both 40S and 60S subunits in HeLa cells. Moreover, the export of newly made ribosomal subunits in Xenopus oocytes was efficiently and specifically competed by BSA-NES conjugates. The CRM1 dependence of 60S subunit export suggested a conserved function for NMD3, a factor proposed to be a 60S subunit export adaptor in yeast. Indeed, we observed that nuclear export of human NMD3 (hNMD3) is sensitive to leptomycin B (LMB), which inactivates CRM1. It had, however, not yet been demonstrated that Nmd3 can interact with CRM1. Using purified recombinant proteins we have shown here that hNMD3 binds to CRM1 directly, in a RanGTP-dependent manner, by way of a C-terminal NES sequence. Our results suggest that the functions of CRM1 and NMD3 in ribosomal subunit export are conserved from yeast to higher eukaryotes. PMID:12724356

  1. Architecture of the 90S Pre-ribosome: A Structural View on the Birth of the Eukaryotic Ribosome.

    PubMed

    Kornprobst, Markus; Turk, Martin; Kellner, Nikola; Cheng, Jingdong; Flemming, Dirk; Koš-Braun, Isabelle; Koš, Martin; Thoms, Matthias; Berninghausen, Otto; Beckmann, Roland; Hurt, Ed

    2016-07-14

    The 90S pre-ribosome is an early biogenesis intermediate formed during co-transcriptional ribosome formation, composed of ∼70 assembly factors and several small nucleolar RNAs (snoRNAs) that associate with nascent pre-rRNA. We report the cryo-EM structure of the Chaetomium thermophilum 90S pre-ribosome, revealing how a network of biogenesis factors including 19 β-propellers and large α-solenoid proteins engulfs the pre-rRNA. Within the 90S pre-ribosome, we identify the UTP-A, UTP-B, Mpp10-Imp3-Imp4, Bms1-Rcl1, and U3 snoRNP modules, which are organized around 5'-ETS and partially folded 18S rRNA. The U3 snoRNP is strategically positioned at the center of the 90S particle to perform its multiple tasks during pre-rRNA folding and processing. The architecture of the elusive 90S pre-ribosome gives unprecedented structural insight into the early steps of pre-rRNA maturation. Nascent rRNA that is co-transcriptionally folded and given a particular shape by encapsulation within a dedicated mold-like structure is reminiscent of how polypeptides use chaperone chambers for their protein folding. PMID:27419870

  2. Identification by affinity chromatography of the eukaryotic ribosomal proteins that bind to 5.8 S ribosomal ribonucleic acid.

    PubMed

    Ulbrich, N; Lin, A; Wool, I G

    1979-09-10

    The proteins that bind to rat liver 5.8 S ribosomal ribonucleic acid were identified by affinity chromatography. The nucleic acid was oxidized with periodate and coupled by its 3'-terminus to Sepharose 4B through and adipic acid dihydrazide spacer. The ribosomal proteins that associate with the immobilized 5.8 S rRNA were identified by polyacrylamide gel electrophoresiss: they were L19, L8, and L6 from the 60 S subunit; and S13 and S9 from the small subparticle. Small amounts of L14, L17', L18, L27/L27', and L35', and of S11, S15, S23/S24, and S26 also were bound to the affinity column, but whether they associate directly and specifically with 5.8 S rRNA is not known. Escherichia coli ribosomal proteins did not bind to the rat liver 5.8 S rRNA affinity column. PMID:468846

  3. Mechanistic Insight into the Reactivation of BCAII Enzyme from Denatured and Molten Globule States by Eukaryotic Ribosomes and Domain V rRNAs.

    PubMed

    Chakraborty, Biprashekhar; Bhakta, Sayan; Sengupta, Jayati

    2016-01-01

    In all life forms, decoding of messenger-RNA into polypeptide chain is accomplished by the ribosome. Several protein chaperones are known to bind at the exit of ribosomal tunnel to ensure proper folding of the nascent chain by inhibiting their premature folding in the densely crowded environment of the cell. However, accumulating evidence suggests that ribosome may play a chaperone role in protein folding events in vitro. Ribosome-mediated folding of denatured proteins by prokaryotic ribosomes has been studied extensively. The RNA-assisted chaperone activity of the prokaryotic ribosome has been attributed to the domain V, a span of 23S rRNA at the intersubunit side of the large subunit encompassing the Peptidyl Transferase Centre. Evidently, this functional property of ribosome is unrelated to the nascent chain protein folding at the exit of the ribosomal tunnel. Here, we seek to scrutinize whether this unique function is conserved in a primitive kinetoplastid group of eukaryotic species Leishmania donovani where the ribosome structure possesses distinct additional features and appears markedly different compared to other higher eukaryotic ribosomes. Bovine Carbonic Anhydrase II (BCAII) enzyme was considered as the model protein. Our results manifest that domain V of the large subunit rRNA of Leishmania ribosomes preserves chaperone activity suggesting that ribosome-mediated protein folding is, indeed, a conserved phenomenon. Further, we aimed to investigate the mechanism underpinning the ribosome-assisted protein reactivation process. Interestingly, the surface plasmon resonance binding analyses exhibit that rRNA guides productive folding by directly interacting with molten globule-like states of the protein. In contrast, native protein shows no notable affinity to the rRNA. Thus, our study not only confirms conserved, RNA-mediated chaperoning role of ribosome but also provides crucial insight into the mechanism of the process. PMID:27099964

  4. Mechanistic Insight into the Reactivation of BCAII Enzyme from Denatured and Molten Globule States by Eukaryotic Ribosomes and Domain V rRNAs

    PubMed Central

    Chakraborty, Biprashekhar; Bhakta, Sayan; Sengupta, Jayati

    2016-01-01

    In all life forms, decoding of messenger-RNA into polypeptide chain is accomplished by the ribosome. Several protein chaperones are known to bind at the exit of ribosomal tunnel to ensure proper folding of the nascent chain by inhibiting their premature folding in the densely crowded environment of the cell. However, accumulating evidence suggests that ribosome may play a chaperone role in protein folding events in vitro. Ribosome-mediated folding of denatured proteins by prokaryotic ribosomes has been studied extensively. The RNA-assisted chaperone activity of the prokaryotic ribosome has been attributed to the domain V, a span of 23S rRNA at the intersubunit side of the large subunit encompassing the Peptidyl Transferase Centre. Evidently, this functional property of ribosome is unrelated to the nascent chain protein folding at the exit of the ribosomal tunnel. Here, we seek to scrutinize whether this unique function is conserved in a primitive kinetoplastid group of eukaryotic species Leishmania donovani where the ribosome structure possesses distinct additional features and appears markedly different compared to other higher eukaryotic ribosomes. Bovine Carbonic Anhydrase II (BCAII) enzyme was considered as the model protein. Our results manifest that domain V of the large subunit rRNA of Leishmania ribosomes preserves chaperone activity suggesting that ribosome-mediated protein folding is, indeed, a conserved phenomenon. Further, we aimed to investigate the mechanism underpinning the ribosome-assisted protein reactivation process. Interestingly, the surface plasmon resonance binding analyses exhibit that rRNA guides productive folding by directly interacting with molten globule-like states of the protein. In contrast, native protein shows no notable affinity to the rRNA. Thus, our study not only confirms conserved, RNA-mediated chaperoning role of ribosome but also provides crucial insight into the mechanism of the process. PMID:27099964

  5. Amicoumacin A induces cancer cell death by targeting the eukaryotic ribosome

    PubMed Central

    Prokhorova, Irina V.; Akulich, Kseniya A.; Makeeva, Desislava S.; Osterman, Ilya A.; Skvortsov, Dmitry A.; Sergiev, Petr V.; Dontsova, Olga A.; Yusupova, Gulnara; Yusupov, Marat M.; Dmitriev, Sergey E.

    2016-01-01

    Amicoumacin A is an antibiotic that was recently shown to target bacterial ribosomes. It affects translocation and provides an additional contact interface between the ribosomal RNA and mRNA. The binding site of amicoumacin A is formed by universally conserved nucleotides of rRNA. In this work, we showed that amicoumacin A inhibits translation in yeast and mammalian systems by affecting translation elongation. We determined the structure of the amicoumacin A complex with yeast ribosomes at a resolution of 3.1  Å. Toxicity measurement demonstrated that human cancer cell lines are more susceptible to the inhibition by this compound as compared to non-cancerous ones. This might be used as a starting point to develop amicoumacin A derivatives with clinical value. PMID:27296282

  6. Amicoumacin A induces cancer cell death by targeting the eukaryotic ribosome.

    PubMed

    Prokhorova, Irina V; Akulich, Kseniya A; Makeeva, Desislava S; Osterman, Ilya A; Skvortsov, Dmitry A; Sergiev, Petr V; Dontsova, Olga A; Yusupova, Gulnara; Yusupov, Marat M; Dmitriev, Sergey E

    2016-01-01

    Amicoumacin A is an antibiotic that was recently shown to target bacterial ribosomes. It affects translocation and provides an additional contact interface between the ribosomal RNA and mRNA. The binding site of amicoumacin A is formed by universally conserved nucleotides of rRNA. In this work, we showed that amicoumacin A inhibits translation in yeast and mammalian systems by affecting translation elongation. We determined the structure of the amicoumacin A complex with yeast ribosomes at a resolution of 3.1  Å. Toxicity measurement demonstrated that human cancer cell lines are more susceptible to the inhibition by this compound as compared to non-cancerous ones. This might be used as a starting point to develop amicoumacin A derivatives with clinical value. PMID:27296282

  7. Cladistic analysis of ribosomal RNAs--the phylogeny of eukaryotes with respect to the endosymbiotic theory.

    PubMed

    Wolters, J; Erdmann, V A

    1988-01-01

    A strict cladistic analysis of 5S and 16S rRNA secondary and primary structure confirms particular hypotheses concerning the phylogeny of eukaryotes: plastids of Euglena, green algae and land plants, and the cyanelle of Cyanophora share a specific character and are closely related to cyanobacteria of the Synechococcus-type. Angiosperm mitochondria share specific signatures with the alpha subdivision of rhodobacteria. Cyanophora is a member of the Euglenozoa, the Oomycetes are derived from a group of heterokont algae. PMID:3395680

  8. ‘Ribozoomin’ – Translation Initiation from the Perspective of the Ribosome-bound Eukaryotic Initiation Factors (eIFs)

    PubMed Central

    Valášek, Leoš Shivaya

    2012-01-01

    Protein synthesis is a fundamental biological mechanism bringing the DNA-encoded genetic information into life by its translation into molecular effectors - proteins. The initiation phase of translation is one of the key points of gene regulation in eukaryotes, playing a role in processes from neuronal function to development. Indeed, the importance of the study of protein synthesis is increasing with the growing list of genetic diseases caused by mutations that affect mRNA translation. To grasp how this regulation is achieved or altered in the latter case, we must first understand the molecular details of all underlying processes of the translational cycle with the main focus put on its initiation. In this review I discuss recent advances in our comprehension of the molecular basis of particular initiation reactions set into the context of how and where individual eIFs bind to the small ribosomal subunit in the pre-initiation complex. I also summarize our current knowledge on how eukaryotic initiation factor eIF3 controls gene expression in the gene-specific manner via reinitiation. PMID:22708493

  9. Complete Sequence Construction of the Highly Repetitive Ribosomal RNA Gene Repeats in Eukaryotes Using Whole Genome Sequence Data.

    PubMed

    Agrawal, Saumya; Ganley, Austen R D

    2016-01-01

    The ribosomal RNA genes (rDNA) encode the major rRNA species of the ribosome, and thus are essential across life. These genes are highly repetitive in most eukaryotes, forming blocks of tandem repeats that form the core of nucleoli. The primary role of the rDNA in encoding rRNA has been long understood, but more recently the rDNA has been implicated in a number of other important biological phenomena, including genome stability, cell cycle, and epigenetic silencing. Noncoding elements, primarily located in the intergenic spacer region, appear to mediate many of these phenomena. Although sequence information is available for the genomes of many organisms, in almost all cases rDNA repeat sequences are lacking, primarily due to problems in assembling these intriguing regions during whole genome assemblies. Here, we present a method to obtain complete rDNA repeat unit sequences from whole genome assemblies. Limitations of next generation sequencing (NGS) data make them unsuitable for assembling complete rDNA unit sequences; therefore, the method we present relies on the use of Sanger whole genome sequence data. Our method makes use of the Arachne assembler, which can assemble highly repetitive regions such as the rDNA in a memory-efficient way. We provide a detailed step-by-step protocol for generating rDNA sequences from whole genome Sanger sequence data using Arachne, for refining complete rDNA unit sequences, and for validating the sequences obtained. In principle, our method will work for any species where the rDNA is organized into tandem repeats. This will help researchers working on species without a complete rDNA sequence, those working on evolutionary aspects of the rDNA, and those interested in conducting phylogenetic footprinting studies with the rDNA. PMID:27576718

  10. Unveiling the Organisms behind Novel Eukaryotic Ribosomal DNA Sequences from the Ocean

    PubMed Central

    Massana, Ramon; Guillou, Laure; Díez, Beatriz; Pedrós-Alió, Carlos

    2002-01-01

    Despite the fact that the smallest eukaryotes (cells less than 5 μm in diameter) play key roles in marine food webs, particularly in open oligotrophic areas, the study of their in situ diversity started just one year ago. Perhaps the most remarkable finding of the most recent studies has been the discovery of completely new phylogenetic lineages, such as novel clades belonging to the stramenopile and alveolate phyla. The two new groups account for a significant fraction of clones in genetic libraries from North Atlantic, equatorial Pacific, Antarctic, and Mediterranean Sea waters. However, the identities and ecological relevance of these organisms remain unknown. Here we investigate the phylogenetic relationships, morphology, in situ abundance, and ecological role of novel stramenopiles. They form at least eight independent clades within the stramenopile basal branches, indicating a large phylogenetic diversity within the group. Two lineages were visualized and enumerated in field samples and enrichments by fluorescent in situ hybridization using specific rRNA-targeted oligonucleotide probes. The targeted organisms were 2- to 3-μm-diameter, round-shaped, nonpigmented flagellates. Further, they were found to be bacterivorous. One lineage accounted for up to 46% (average during an annual cycle, 19%) of heterotrophic flagellates in a coastal environment, providing evidence that novel stramenopiles are important and unrecognized components of the total stock of bacterial grazers. PMID:12200313

  11. An overview of the secondary structure of the V4 region of eukaryotic small-subunit ribosomal RNA.

    PubMed Central

    Nickrent, D L; Sargent, M L

    1991-01-01

    The V4 region of the small subunit (18S) ribosomal RNA was examined in 72 different sequences representing a broad sample eukaryotic diversity. This domain is the most variable region of the 18S rRNA molecule and ranges in length from ca. 230 to over 500 bases. Based upon comparative analysis, secondary structural models were constructed for all sequences and the resulting generalized model shows that most organisms possess seven helices for this region. The protists and two insects show from one to as many as four helices in addition to the above seven. In this report, we summarize secondary structure information presented elsewhere for the V4 region, describe the general features for helical and apical regions, and identify signature sequences useful in helix identification. Our model generally agrees with other current concepts; however, we propose modifications or alternative structures for the start of the V4 region, the large protist inserts, and the sector that may possibly contain a pseudoknot. PMID:2014163

  12. Optimal Eukaryotic 18S and Universal 16S/18S Ribosomal RNA Primers and Their Application in a Study of Symbiosis

    PubMed Central

    Wang, Yong; Tian, Ren Mao; Gao, Zhao Ming; Bougouffa, Salim; Qian, Pei-Yuan

    2014-01-01

    Eukaryotic 18S ribosomal RNA (rRNA) gene primers that feature a wide coverage are critical in detecting the composition of eukaryotic microscopic organisms in ecosystems. Here, we predicted 18S rRNA primers based on consecutive conserved sites and evaluated their coverage efficiency and scope of application to different eukaryotic groups. After evaluation, eight of them were considered as qualified 18S primers based on coverage rate. Next, we examined common conserved regions in prokaryotic 16S and eukaryotic 18S rRNA sequences to design 16S/18S universal primers. Three 16S/18S candidate primers, U515, U1390 and U1492, were then considered to be suitable for simultaneous amplification of the rRNA sequences in three domains. Eukaryotic 18S and prokaryotic 16S rRNA genes in a sponge were amplified simultaneously using universal primers U515 and U1390, and the subsequent sorting of pyrosequenced reads revealed some distinctive communities in different parts of the sample. The real difference in biodiversity between prokaryotic and eukaryotic symbionts could be discerned as the dissimilarity between OTUs was increased from 0.005 to 0.1. A network of the communities in external and internal parts of the sponge illustrated the co-variation of some unique microbes in certain parts of the sponge, suggesting that the universal primers are useful in simultaneous detection of prokaryotic and eukaryotic microbial communities. PMID:24594623

  13. Internal translation initiation and eIF4F/ATP-independent scanning of mRNA by eukaryotic ribosomal particles

    PubMed Central

    Agalarov, Sultan Ch.; Sakharov, Pavel A.; Fattakhova, Dina Kh.; Sogorin, Evgeny A.; Spirin, Alexander S.

    2014-01-01

    The recombinant mRNAs with 5′-untranslated region, called omega leader, of tobacco mosaic virus RNA are known to be well translated in eukaryotic cell-free systems, even if deprived of cap structure. Using the method of primer extension inhibition (toe-printing), the ribosomal particles were shown to initiate translation at uncapped omega leader when its 5′-end was blocked by a stable RNA-DNA double helix, thus providing evidence for internal initiation. The scanning of the leader sequence and the formation of ribosomal 48S initiation complexes at the initiation AUG codon occurred in the absence of ATP-dependent initiation factor eIF4F, as well as without ATP. The latter results implied the ability of ribosomal initiation complexes for ATP-independent, diffusional wandering (also called bi-directional movement) along the leader sequence during scanning. PMID:24657959

  14. Microsporidian Encephalitozoon cuniculi, a unicellular eukaryote with an unusual chromosomal dispersion of ribosomal genes and a LSU rRNA reduced to the universal core.

    PubMed Central

    Peyretaillade, E; Biderre, C; Peyret, P; Duffieux, F; Méténier, G; Gouy, M; Michot, B; Vivarès, C P

    1998-01-01

    Microsporidia are eukaryotic parasites lacking mitochondria, the ribosomes of which present prokaryote-like features. In order to better understand the structural evolution of rRNA molecules in microsporidia, the 5S and rDNA genes were investigated in Encephalitozoon cuniculi . The genes are not in close proximity. Non-tandemly arranged rDNA units are on every one of the 11 chromosomes. Such a dispersion is also shown in two other Encephalitozoon species. Sequencing of the 5S rRNA coding region reveals a 120 nt long RNA which folds according to the eukaryotic consensus structural shape. In contrast, the LSU rRNA molecule is greatly reduced in length (2487 nt). This dramatic shortening is essentially due to truncation of divergent domains, most of them being removed. Most variable stems of the conserved core are also deleted, reducing the LSU rRNA to only those structural features preserved in all living cells. This suggests that the E.cuniculi LSU rRNA performs only the basic mechanisms of translation. LSU rRNA phylogenetic analysis with the BASEML program favours a relatively recent origin of the fast evolving microsporidian lineage. Therefore, the prokaryote-like ribosomal features, such as the absence of ITS2, may be derived rather than primitive characters. PMID:9671812

  15. Eukaryotic Initiation Factors 4G and 4A Mediate Conformational Changes Downstream of the Initiation Codon of the Encephalomyocarditis Virus Internal Ribosomal Entry Site

    PubMed Central

    Kolupaeva, Victoria G.; Lomakin, Ivan B.; Pestova, Tatyana V.; Hellen, Christopher U. T.

    2003-01-01

    Initiation of translation of encephalomyocarditis virus mRNA is mediated by an internal ribosome entry site (IRES) comprising structural domains H, I, J-K, and L immediately upstream of the initiation codon AUG at nucleotide 834 (AUG834). Assembly of 48S ribosomal complexes on the IRES requires eukaryotic initiation factor 2 (eIF2), eIF3, eIF4A, and the central domain of eIF4G to which eIF4A binds. Footprinting experiments confirmed that eIF4G binds a three-way helical junction in the J-K domain and showed that it interacts extensively with RNA duplexes in the J-K and L domains. Deletion of apical hairpins in the J and K domains synergistically impaired the binding of eIF4G and IRES function. Directed hydroxyl radical probing, done by using Fe(II) tethered to surface residues in eIF4G's central domain, indicated that it is oriented with its N terminus towards the base of domain J and its C terminus towards the apex. eIF4G recruits eIF4A to a defined location on the IRES, and the eIF4G/eIF4A complex caused localized ATP-independent conformational changes in the eIF4G-binding region of the IRES. This complex also induced more extensive conformational rearrangements at the 3′ border of the ribosome binding site that required ATP and active eIF4A. We propose that these conformational changes prepare the region flanking AUG834 for productive binding of the ribosome. PMID:12509466

  16. RNA chaperones stimulate formation and yield of the U3 snoRNA-pre-rRNA duplexes needed for eukaryotic ribosome biogenesis

    PubMed Central

    Gérczei, Tímea; Shah, Binal N.; Manzo, Anthony J.; Walter, Nils G.; Correll, Carl C.

    2010-01-01

    To satisfy the high demand for ribosome synthesis in rapidly growing eukaryotic cells, short duplexes between the U3 small nucleolar RNA (snoRNA) and the precursor ribosomal RNA (pre-rRNA) must form quickly and with high yield. These interactions, designated the U3-ETS and U3-18S duplexes, are essential to initiate the processing of small subunit rRNA. Previously, we showed in vitro that duplexes corresponding to those in Saccharomyces cerevisiae are only observed after addition of one of two proteins: Imp3p or Imp4p. Here, we used fluorescence-based and other in vitro assays to determine whether these proteins possess RNA chaperone activities and to assess whether these activities are sufficient to satisfy the duplex yield and rate requirements expected in vivo. Assembly of both proteins with the U3 snoRNA into a chaperone complex destabilizes a U3-stem structure, apparently to expose its 18S base-pairing site. As a result, the chaperone complex accelerates formation of the U3-18S duplex from an undetectable rate to one comparable to the intrinsic rate observed for hybridizing short duplexes. The chaperone complex also stabilizes the U3-ETS duplex by 2.7 kcal/mol. These chaperone activities provide high U3-ETS duplex yield and rapid U3-18S duplex formation over a broad concentration range to help ensure that the U3-pre-rRNA interactions limit neither ribosome biogenesis nor rapid cell growth. The thermodynamic and kinetic framework used is general and thus suitable to investigate the mechanism of action of other RNA chaperones. PMID:19482034

  17. Nucleotide sequence neighbouring a late modified guanylic residue within the 28S ribosomal RNA of several eukaryotic cells.

    PubMed Central

    Eladari, M E; Hampe, A; Galibert, F

    1977-01-01

    The nucleotide sequence of a particular T1 oligonucleotide found in 41S and 28S RNAs of several cellular cell lines (human, mouse, rat and chicken fibroblast) but absent in 45S ribosomal RNA has been deduced. Its primary structure : A-U-U*-G*-psi-U-C-A-C-C-C-A-C-U-A-A-U-A-Gp shows the presence of a modified G residue which explains the existence of this oligonucleotide in the T1 fingerprint of 41S RNA and 28S. Its absence on the 45S RNA T1 fingerprint is accounted for by a late modification. Images PMID:561392

  18. The structure of Erb1-Ytm1 complex reveals the functional importance of a high-affinity binding between two β-propellers during the assembly of large ribosomal subunits in eukaryotes

    PubMed Central

    Wegrecki, Marcin; Rodríguez-Galán, Olga; de la Cruz, Jesús; Bravo, Jeronimo

    2015-01-01

    Ribosome biogenesis is one of the most essential pathways in eukaryotes although it is still not fully characterized. Given the importance of this process in proliferating cells, it is obvious that understanding the macromolecular details of the interactions that take place between the assembly factors, ribosomal proteins and nascent pre-rRNAs is essentially required for the development of new non-genotoxic treatments for cancer. Herein, we have studied the association between the WD40-repeat domains of Erb1 and Ytm1 proteins. These are essential factors for the biogenesis of 60S ribosomal subunits in eukaryotes that form a heterotrimeric complex together with the also essential Nop7 protein. We provide the crystal structure of a dimer formed by the C-terminal part of Erb1 and Ytm1 from Chaetomium thermophilum at 2.1 Å resolution. Using a multidisciplinary approach we show that the β-propeller domains of these proteins interact in a novel manner that leads to a high-affinity binding. We prove that a point mutation within the interface of the complex impairs the interaction between the two proteins and negatively affects growth and ribosome production in yeast. Our study suggests insights into the association of the Erb1-Ytm1 dimer with pre-ribosomal particles. PMID:26476442

  19. The structure of Erb1-Ytm1 complex reveals the functional importance of a high-affinity binding between two β-propellers during the assembly of large ribosomal subunits in eukaryotes.

    PubMed

    Wegrecki, Marcin; Rodríguez-Galán, Olga; de la Cruz, Jesús; Bravo, Jeronimo

    2015-12-15

    Ribosome biogenesis is one of the most essential pathways in eukaryotes although it is still not fully characterized. Given the importance of this process in proliferating cells, it is obvious that understanding the macromolecular details of the interactions that take place between the assembly factors, ribosomal proteins and nascent pre-rRNAs is essentially required for the development of new non-genotoxic treatments for cancer. Herein, we have studied the association between the WD40-repeat domains of Erb1 and Ytm1 proteins. These are essential factors for the biogenesis of 60S ribosomal subunits in eukaryotes that form a heterotrimeric complex together with the also essential Nop7 protein. We provide the crystal structure of a dimer formed by the C-terminal part of Erb1 and Ytm1 from Chaetomium thermophilum at 2.1 Å resolution. Using a multidisciplinary approach we show that the β-propeller domains of these proteins interact in a novel manner that leads to a high-affinity binding. We prove that a point mutation within the interface of the complex impairs the interaction between the two proteins and negatively affects growth and ribosome production in yeast. Our study suggests insights into the association of the Erb1-Ytm1 dimer with pre-ribosomal particles. PMID:26476442

  20. Nutritional stimulation of milk protein yield of cows is associated with changes in phosphorylation of mammary eukaryotic initiation factor 2 and ribosomal s6 kinase 1.

    PubMed

    Toerien, Chanelle A; Trout, Donald R; Cant, John P

    2010-02-01

    Production of protein by the lactating mammary gland is stimulated by intake of dietary energy and protein. Mass-action effects of essential amino acids (EAA) cannot explain all of the nutritional response. Protein synthesis in tissues of growing animals is regulated by nutrients through the mammalian target of rapamycin (mTOR) and integrated stress response (ISR) networks. To explore if nutrients signal through the mTOR and ISR networks in the mammary gland in vivo, lactating cows were feed-deprived for 22 h and then infused i.v. for 9 h with EAA+ glucose (Glc), Glc only, l-Met+l-Lys, l-His, or l-Leu. Milk protein yield was increased 33 and 27% by EAA+Glc and Glc infusions, respectively. Infusions of Met+Lys and His generated 35 and 41%, respectively, of the EAA+Glc response. Infusion of EAA+Glc reduced phosphorylation of the ISR target, eukaryotic initiation factor(eIF) 2, in mammary tissue and increased phosphorylation of the mTOR targets, ribosomal S6 kinase 1 (S6K1) and S6. Both responses are stimulatory to protein synthesis. Glucose did not significantly increase mammary S6K1 phosphorylation but reduced eIF2 phosphorylation by 62%, which implicates the ISR network in the stimulation of milk protein yield. In contrast, the EAA infusions increased (P < 0.05) or tended to increase (P < 0.1) mammary mTOR activity and only His, like Glc, decreased eIF2 phosphorylation by 62%. Despite activation of these protein synthesis signals to between 83 and 127% of the EAA+Glc response, EAA infusions produced less than one-half of the milk protein yield response generated by EAA+Glc, indicating that ISR and mTOR networks exert only a portion of the control over protein yield. PMID:20032484

  1. rRNA Suppressor of a Eukaryotic Translation Initiation Factor 5B/Initiation Factor 2 Mutant Reveals a Binding Site for Translational GTPases on the Small Ribosomal Subunit▿

    PubMed Central

    Shin, Byung-Sik; Kim, Joo-Ran; Acker, Michael G.; Maher, Kathryn N.; Lorsch, Jon R.; Dever, Thomas E.

    2009-01-01

    The translational GTPases promote initiation, elongation, and termination of protein synthesis by interacting with the ribosome. Mutations that impair GTP hydrolysis by eukaryotic translation initiation factor 5B/initiation factor 2 (eIF5B/IF2) impair yeast cell growth due to failure to dissociate from the ribosome following subunit joining. A mutation in helix h5 of the 18S rRNA in the 40S ribosomal subunit and intragenic mutations in domain II of eIF5B suppress the toxic effects associated with expression of the eIF5B-H480I GTPase-deficient mutant in yeast by lowering the ribosome binding affinity of eIF5B. Hydroxyl radical mapping experiments reveal that the domain II suppressors interface with the body of the 40S subunit in the vicinity of helix h5. As the helix h5 mutation also impairs elongation factor function, the rRNA and eIF5B suppressor mutations provide in vivo evidence supporting a functionally important docking of domain II of the translational GTPases on the body of the small ribosomal subunit. PMID:19029250

  2. Molecular mechanisms of translation initiation in eukaryotes

    PubMed Central

    Pestova, Tatyana V.; Kolupaeva, Victoria G.; Lomakin, Ivan B.; Pilipenko, Evgeny V.; Shatsky, Ivan N.; Agol, Vadim I.; Hellen, Christopher U. T.

    2001-01-01

    Translation initiation is a complex process in which initiator tRNA, 40S, and 60S ribosomal subunits are assembled by eukaryotic initiation factors (eIFs) into an 80S ribosome at the initiation codon of mRNA. The cap-binding complex eIF4F and the factors eIF4A and eIF4B are required for binding of 43S complexes (comprising a 40S subunit, eIF2/GTP/Met-tRNAi and eIF3) to the 5′ end of capped mRNA but are not sufficient to promote ribosomal scanning to the initiation codon. eIF1A enhances the ability of eIF1 to dissociate aberrantly assembled complexes from mRNA, and these factors synergistically mediate 48S complex assembly at the initiation codon. Joining of 48S complexes to 60S subunits to form 80S ribosomes requires eIF5B, which has an essential ribosome-dependent GTPase activity and hydrolysis of eIF2-bound GTP induced by eIF5. Initiation on a few mRNAs is cap-independent and occurs instead by internal ribosomal entry. Encephalomyocarditis virus (EMCV) and hepatitis C virus epitomize distinct mechanisms of internal ribosomal entry site (IRES)-mediated initiation. The eIF4A and eIF4G subunits of eIF4F bind immediately upstream of the EMCV initiation codon and promote binding of 43S complexes. EMCV initiation does not involve scanning and does not require eIF1, eIF1A, and the eIF4E subunit of eIF4F. Initiation on some EMCV-like IRESs requires additional noncanonical initiation factors, which alter IRES conformation and promote binding of eIF4A/4G. Initiation on the hepatitis C virus IRES is even simpler: 43S complexes containing only eIF2 and eIF3 bind directly to the initiation codon as a result of specific interaction of the IRES and the 40S subunit. PMID:11416183

  3. Life in the '80s and Beyond.

    ERIC Educational Resources Information Center

    Morris, Joan, Ed.

    1982-01-01

    Contains nine articles discussing how lives of students will be affected by future changes. Discusses the work ethic and work values in a time of change, entering the 80s job market, women and employment. Describes students' changing sexual values, and the impact of computers and declining enrollment on education. (RC)

  4. Eukaryotic class 1 translation termination factor eRF1--the NMR structure and dynamics of the middle domain involved in triggering ribosome-dependent peptidyl-tRNA hydrolysis.

    PubMed

    Ivanova, Elena V; Kolosov, Peter M; Birdsall, Berry; Kelly, Geoff; Pastore, Annalisa; Kisselev, Lev L; Polshakov, Vladimir I

    2007-08-01

    The eukaryotic class 1 polypeptide chain release factor is a three-domain protein involved in the termination of translation, the final stage of polypeptide biosynthesis. In attempts to understand the roles of the middle domain of the eukaryotic class 1 polypeptide chain release factor in the transduction of the termination signal from the small to the large ribosomal subunit and in peptidyl-tRNA hydrolysis, its high-resolution NMR structure has been obtained. The overall fold and the structure of the beta-strand core of the protein in solution are similar to those found in the crystal. However, the orientation of the functionally critical GGQ loop and neighboring alpha-helices has genuine and noticeable differences in solution and in the crystal. Backbone amide protons of most of the residues in the GGQ loop undergo fast exchange with water. However, in the AGQ mutant, where functional activity is abolished, a significant reduction in the exchange rate of the amide protons has been observed without a noticeable change in the loop conformation, providing evidence for the GGQ loop interaction with water molecule(s) that may serve as a substrate for the hydrolytic cleavage of the peptidyl-tRNA in the ribosome. The protein backbone dynamics, studied using 15N relaxation experiments, showed that the GGQ loop is the most flexible part of the middle domain. The conformational flexibility of the GGQ and 215-223 loops, which are situated at opposite ends of the longest alpha-helix, could be a determinant of the functional activity of the eukaryotic class 1 polypeptide chain release factor, with that helix acting as the trigger to transmit the signals from one loop to the other. PMID:17651434

  5. Molecular architecture of the ribosome-bound Hepatitis C Virus internal ribosomal entry site RNA.

    PubMed

    Yamamoto, Hiroshi; Collier, Marianne; Loerke, Justus; Ismer, Jochen; Schmidt, Andrea; Hilal, Tarek; Sprink, Thiemo; Yamamoto, Kaori; Mielke, Thorsten; Bürger, Jörg; Shaikh, Tanvir R; Dabrowski, Marylena; Hildebrand, Peter W; Scheerer, Patrick; Spahn, Christian M T

    2015-12-14

    Internal ribosomal entry sites (IRESs) are structured cis-acting RNAs that drive an alternative, cap-independent translation initiation pathway. They are used by many viruses to hijack the translational machinery of the host cell. IRESs facilitate translation initiation by recruiting and actively manipulating the eukaryotic ribosome using only a subset of canonical initiation factor and IRES transacting factors. Here we present cryo-EM reconstructions of the ribosome 80S- and 40S-bound Hepatitis C Virus (HCV) IRES. The presence of four subpopulations for the 80S•HCV IRES complex reveals dynamic conformational modes of the complex. At a global resolution of 3.9 Å for the most stable complex, a derived atomic model reveals a complex fold of the IRES RNA and molecular details of its interaction with the ribosome. The comparison of obtained structures explains how a modular architecture facilitates mRNA loading and tRNA binding to the P-site. This information provides the structural foundation for understanding the mechanism of HCV IRES RNA-driven translation initiation. PMID:26604301

  6. Paradigms of ribosome synthesis: Lessons learned from ribosomal proteins

    PubMed Central

    Gamalinda, Michael; Woolford, John L

    2015-01-01

    The proteome in all cells is manufactured via the intricate process of translation by multimolecular factories called ribosomes. Nevertheless, these ribonucleoprotein particles, the largest of their kind, also have an elaborate assembly line of their own. Groundbreaking discoveries that bacterial ribosomal subunits can be self-assembled in vitro jumpstarted studies on how ribosomes are constructed. Until recently, ribosome assembly has been investigated almost entirely in vitro with bacterial small subunits under equilibrium conditions. In light of high-resolution ribosome structures and a more sophisticated toolkit, the past decade has been defined by a burst of kinetic studies in vitro and, importantly, also a shift to examining ribosome maturation in living cells, especially in eukaryotes. In this review, we summarize the principles governing ribosome assembly that emerged from studies focusing on ribosomal proteins and their interactions with rRNA. Understanding these paradigms has taken center stage, given the linkage between anomalous ribosome biogenesis and proliferative disorders. PMID:26779413

  7. Detecting ricin: sensitive luminescent assay for ricin A-chain ribosome depurination kinetics.

    PubMed

    Sturm, Matthew B; Schramm, Vern L

    2009-04-15

    Ricin is a family member of the lethal ribosome-inactivating proteins (RIP) found in plants. Ricin toxin A-chain (RTA) from castor beans catalyzes the hydrolytic depurination of a single base from a GAGA tetraloop of eukaryotic rRNA to release a single adenine from the sarcin-ricin loop (SRL). Protein synthesis is inhibited by loss of the elongation factor binding site resulting in cell death. We report a sensitive coupled assay for the measurement of adenine released from ribosomes or small stem-loop RNAs by RTA catalysis. Adenine phosphoribosyl transferase (APRTase) and pyruvate orthophosphate dikinase (PPDK) convert adenine to ATP for quantitation by firefly luciferase. The resulting AMP is cycled to ATP to give sustained luminescence proportional to adenine concentration. Subpicomole adenine quantitation permits the action of RTA on eukaryotic ribosomes to be followed in continuous, high-throughput assays. Facile analysis of RIP catalytic activity will have applications in plant toxin detection, inhibitor screens, mechanistic analysis of depurinating agents on oligonucleotides and intact ribosomes, and in cancer immunochemotherapy. Kinetic analysis of the catalytic action of RTA on rabbit reticulocyte 80S ribosomes establishes a catalytic efficiency of 2.6 x 10(8) M(-1) s(-1), a diffusion limited reaction indicating catalytic perfection even with large reactants. PMID:19364139

  8. Human Eukaryotic Initiation Factor 4G (eIF4G) Protein Binds to eIF3c, -d, and -e to Promote mRNA Recruitment to the Ribosome*

    PubMed Central

    Villa, Nancy; Do, Angelie; Hershey, John W. B.; Fraser, Christopher S.

    2013-01-01

    Recruitment of mRNA to the 40S ribosomal subunit requires the coordinated interaction of a large number of translation initiation factors. In mammals, the direct interaction between eukaryotic initiation factor 4G (eIF4G) and eIF3 is thought to act as the molecular bridge between the mRNA cap-binding complex and the 40S subunit. A discrete ∼90 amino acid domain in eIF4G is responsible for binding to eIF3, but the identity of the eIF3 subunit(s) involved is less clear. The eIF3e subunit has been shown to directly bind eIF4G, but the potential role of other eIF3 subunits in stabilizing this interaction has not been investigated. It is also not clear if the eIF4A helicase plays a role in stabilizing the interaction between eIF4G and eIF3. Here, we have used a fluorescence anisotropy assay to demonstrate that eIF4G binds to eIF3 independently of eIF4A binding to the middle region of eIF4G. By using a site-specific cross-linking approach, we unexpectedly show that the eIF4G-binding surface in eIF3 is comprised of the -c, -d and -e subunits. Screening multiple cross-linker positions reveals that eIF4G contains two distinct eIF3-binding subdomains within the previously identified eIF3-binding domain. Finally, by employing an eIF4G-dependent translation assay, we establish that both of these subdomains are required for efficient mRNA recruitment to the ribosome and stimulate translation. Our study reveals unexpected complexity to the eIF3-eIF4G interaction that provides new insight into the regulation of mRNA recruitment to the human ribosome. PMID:24092755

  9. Chromatographic Purification of Highly Active Yeast Ribosomes

    PubMed Central

    Meskauskas, Arturas; Leshin, Jonathan A.; Dinman, Jonathan D.

    2011-01-01

    Eukaryotic ribosomes are much more labile as compared to their eubacterial and archael counterparts, thus posing a significant challenge to researchers. Particularly troublesome is the fact that lysis of cells releases a large number of proteases and nucleases which can degrade ribosomes. Thus, it is important to separate ribosomes from these enzymes as quickly as possible. Unfortunately, conventional differential ultracentrifugation methods leaves ribosomes exposed to these enzymes for unacceptably long periods of time, impacting their structural integrity and functionality. To address this problem, we utilize a chromatographic method using a cysteine charged Sulfolink resin. This simple and rapid application significantly reduces co-purifying proteolytic and nucleolytic activities, producing high yields of intact, highly biochemically active yeast ribosomes. We suggest that this method should also be applicable to mammalian ribosomes. The simplicity of the method, and the enhanced purity and activity of chromatographically purified ribosome represents a significant technical advancement for the study of eukaryotic ribosomes. PMID:22042245

  10. Structural characterization of ribosome recruitment and translocation by type IV IRES.

    PubMed

    Murray, Jason; Savva, Christos G; Shin, Byung-Sik; Dever, Thomas E; Ramakrishnan, V; Fernández, Israel S

    2016-01-01

    Viral mRNA sequences with a type IV IRES are able to initiate translation without any host initiation factors. Initial recruitment of the small ribosomal subunit as well as two translocation steps before the first peptidyl transfer are essential for the initiation of translation by these mRNAs. Using electron cryomicroscopy (cryo-EM) we have structurally characterized at high resolution how the Cricket Paralysis Virus Internal Ribosomal Entry Site (CrPV-IRES) binds the small ribosomal subunit (40S) and the translocation intermediate stabilized by elongation factor 2 (eEF2). The CrPV-IRES restricts tvhe otherwise flexible 40S head to a conformation compatible with binding the large ribosomal subunit (60S). Once the 60S is recruited, the binary CrPV-IRES/80S complex oscillates between canonical and rotated states (Fernández et al., 2014; Koh et al., 2014), as seen for pre-translocation complexes with tRNAs. Elongation factor eEF2 with a GTP analog stabilizes the ribosome-IRES complex in a rotated state with an extra ~3 degrees of rotation. Key residues in domain IV of eEF2 interact with pseudoknot I (PKI) of the CrPV-IRES stabilizing it in a conformation reminiscent of a hybrid tRNA state. The structure explains how diphthamide, a eukaryotic and archaeal specific post-translational modification of a histidine residue of eEF2, is involved in translocation. PMID:27159451

  11. Structural insights into ribosome translocation.

    PubMed

    Ling, Clarence; Ermolenko, Dmitri N

    2016-09-01

    During protein synthesis, tRNA and mRNA are translocated from the A to P to E sites of the ribosome thus enabling the ribosome to translate one codon of mRNA after the other. Ribosome translocation along mRNA is induced by the universally conserved ribosome GTPase, elongation factor G (EF-G) in bacteria and elongation factor 2 (EF-2) in eukaryotes. Recent structural and single-molecule studies revealed that tRNA and mRNA translocation within the ribosome is accompanied by cyclic forward and reverse rotations between the large and small ribosomal subunits parallel to the plane of the intersubunit interface. In addition, during ribosome translocation, the 'head' domain of small ribosomal subunit undergoes forward- and back-swiveling motions relative to the rest of the small ribosomal subunit around the axis that is orthogonal to the axis of intersubunit rotation. tRNA/mRNA translocation is also coupled to the docking of domain IV of EF-G into the A site of the small ribosomal subunit that converts the thermally driven motions of the ribosome and tRNA into the forward translocation of tRNA/mRNA inside the ribosome. Despite recent and enormous progress made in the understanding of the molecular mechanism of ribosome translocation, the sequence of structural rearrangements of the ribosome, EF-G and tRNA during translocation is still not fully established and awaits further investigation. WIREs RNA 2016, 7:620-636. doi: 10.1002/wrna.1354 For further resources related to this article, please visit the WIREs website. PMID:27117863

  12. Ribosome recycling induces optimal translation rate at low ribosomal availability.

    PubMed

    Marshall, E; Stansfield, I; Romano, M C

    2014-09-01

    During eukaryotic cellular protein synthesis, ribosomal translation is made more efficient through interaction between the two ends of the messenger RNA (mRNA). Ribosomes reaching the 3' end of the mRNA can thus recycle and begin translation again on the same mRNA, the so-called 'closed-loop' model. Using a driven diffusion lattice model of translation, we study the effects of ribosome recycling on the dynamics of ribosome flow and density on the mRNA. We show that ribosome recycling induces a substantial increase in ribosome current. Furthermore, for sufficiently large values of the recycling rate, the lattice does not transition directly from low to high ribosome density, as seen in lattice models without recycling. Instead, a maximal current phase becomes accessible for much lower values of the initiation rate, and multiple phase transitions occur over a wide region of the phase plane. Crucially, we show that in the presence of ribosome recycling, mRNAs can exhibit a peak in protein production at low values of the initiation rate, beyond which translation rate decreases. This has important implications for translation of certain mRNAs, suggesting that there is an optimal concentration of ribosomes at which protein synthesis is maximal, and beyond which translational efficiency is impaired. PMID:25008084

  13. Ribosome recycling induces optimal translation rate at low ribosomal availability

    PubMed Central

    Marshall, E.; Stansfield, I.; Romano, M. C.

    2014-01-01

    During eukaryotic cellular protein synthesis, ribosomal translation is made more efficient through interaction between the two ends of the messenger RNA (mRNA). Ribosomes reaching the 3′ end of the mRNA can thus recycle and begin translation again on the same mRNA, the so-called ‘closed-loop’ model. Using a driven diffusion lattice model of translation, we study the effects of ribosome recycling on the dynamics of ribosome flow and density on the mRNA. We show that ribosome recycling induces a substantial increase in ribosome current. Furthermore, for sufficiently large values of the recycling rate, the lattice does not transition directly from low to high ribosome density, as seen in lattice models without recycling. Instead, a maximal current phase becomes accessible for much lower values of the initiation rate, and multiple phase transitions occur over a wide region of the phase plane. Crucially, we show that in the presence of ribosome recycling, mRNAs can exhibit a peak in protein production at low values of the initiation rate, beyond which translation rate decreases. This has important implications for translation of certain mRNAs, suggesting that there is an optimal concentration of ribosomes at which protein synthesis is maximal, and beyond which translational efficiency is impaired. PMID:25008084

  14. Seeing is Believing in Ribosome Assembly.

    PubMed

    Warner, Jonathan R

    2016-07-14

    Many proteins have been implicated genetically and biochemically in the assembly of eukaryotic ribosomes. Now, Kornprobst et al. show us how they are put together with a cryoEM structure of the 90S processome that initiates ribosome assembly, revealing the arrangement of U3 RNA and the several UTP complexes that form a chaperone-like structure around and within the developing 40S ribosomal subunit. PMID:27419867

  15. Modular domains of the Dicistroviridae intergenic internal ribosome entry site

    PubMed Central

    Jang, Christopher J.; Jan, Eric

    2010-01-01

    The intergenic region internal ribosome entry site (IGR IRES) of the Dicistroviridae viral family can directly assemble 80S ribosomes and initiate translation at a non-AUG codon from the ribosomal A-site. These functions are directed by two independently folded domains of the IGR IRES. One domain, composed of overlapping pseudoknots II and III (PKII/III), mediates ribosome recruitment. The second domain, composed of PKI, mimics a tRNA anticodon–codon interaction to position the ribosome at the ribosomal A-site. Although adopting a common secondary structure, the dicistrovirus IGR IRESs can be grouped into two classes based on distinct features within each domain. In this study, we report on the modularity of the IGR IRESs and show that the ribosome-binding domain and the tRNA anticodon mimicry domain are functionally interchangeable between the Type I and the Type II IGR IRESs. Using structural probing, ribosome-binding assays, and ribosome positioning analysis by toeprinting assays, we show that the chimeric IRESs fold properly, assemble 80S ribosomes, and can mediate IRES translation in rabbit reticulocyte lysates. We also demonstrate that the chimeric IRESs can stimulate the ribosome-dependent GTPase activity of eEF2, which suggests that the ribosome is primed for a step downstream from IRES binding. Overall, the results demonstrate that the dicistrovirus IGR IRESs are composed of two modular domains that work in concert to manipulate the ribosome and direct translation initiation. PMID:20423979

  16. Eukaryotic origins

    PubMed Central

    Lake, James A.

    2015-01-01

    The origin of the eukaryotes is a fundamental scientific question that for over 30 years has generated a spirited debate between the competing Archaea (or three domains) tree and the eocyte tree. As eukaryotes ourselves, humans have a personal interest in our origins. Eukaryotes contain their defining organelle, the nucleus, after which they are named. They have a complex evolutionary history, over time acquiring multiple organelles, including mitochondria, chloroplasts, smooth and rough endoplasmic reticula, and other organelles all of which may hint at their origins. It is the evolutionary history of the nucleus and their other organelles that have intrigued molecular evolutionists, myself included, for the past 30 years and which continues to hold our interest as increasingly compelling evidence favours the eocyte tree. As with any orthodoxy, it takes time to embrace new concepts and techniques. PMID:26323753

  17. Ribosome-inactivating proteins

    PubMed Central

    Walsh, Matthew J; Dodd, Jennifer E; Hautbergue, Guillaume M

    2013-01-01

    Ribosome-inactivating proteins (RIPs) were first isolated over a century ago and have been shown to be catalytic toxins that irreversibly inactivate protein synthesis. Elucidation of atomic structures and molecular mechanism has revealed these proteins to be a diverse group subdivided into two classes. RIPs have been shown to exhibit RNA N-glycosidase activity and depurinate the 28S rRNA of the eukaryotic 60S ribosomal subunit. In this review, we compare archetypal RIP family members with other potent toxins that abolish protein synthesis: the fungal ribotoxins which directly cleave the 28S rRNA and the newly discovered Burkholderia lethal factor 1 (BLF1). BLF1 presents additional challenges to the current classification system since, like the ribotoxins, it does not possess RNA N-glycosidase activity but does irreversibly inactivate ribosomes. We further discuss whether the RIP classification should be broadened to include toxins achieving irreversible ribosome inactivation with similar turnovers to RIPs, but through different enzymatic mechanisms. PMID:24071927

  18. The mechanics of ribosomal translocation.

    PubMed

    Achenbach, John; Nierhaus, Knud H

    2015-07-01

    The ribosome translates the sequence of codons of an mRNA into the corresponding sequence of amino acids as it moves along the mRNA with a codon-step width of about 10 Å. The movement of the million-dalton complex ribosome is triggered by the universal elongation factor G (EF2 in archaea and eukaryotes) and is termed translocation. Unraveling the molecular details of translocation is one of the most challenging tasks of current ribosome research. In the last two years, enormous progress has been obtained by highly-resolved X-ray and cryo-electron microscopic structures as well as by sophisticated biochemical approaches concerning the trigger and control of the movement of the tRNA2·mRNA complex inside the ribosome during translocation. This review inspects and surveys these achievements. PMID:25514765

  19. Tricks an IRES uses to enslave ribosomes

    PubMed Central

    2012-01-01

    In eukaryotes, mRNAs are primarily translated through a cap-dependent mechanism whereby initiation factors recruit the 40S ribosomal subunit to a cap structure at the 5’ end of the mRNA. However, some viral and cellular messages initiate protein synthesis without a cap. They use a structured RNA element termed an internal ribosome entry site (IRES) to recruit the 40S ribosomal subunit. IRESs were discovered over 20 years ago but only recently have studies using a model IRES from dicistroviruses expanded our understanding of how a three dimensional RNA structure can capture and manipulate the ribosome to initiate translation. PMID:22944245

  20. Evolution of prokaryote and eukaryote lines inferred from sequence evidence

    NASA Technical Reports Server (NTRS)

    Hunt, L. T.; George, D. G.; Yeh, L.-S.; Dayhoff, M. O.

    1984-01-01

    This paper describes the evolution of prokaryotes and early eukaryotes, including their symbiotic relationships, as inferred from phylogenetic trees of bacterial ferredoxin, 5S ribosomal RNA, ribulose-1,5-biphosphate carboxylase large chain, and mitochondrial cytochrome oxidase polypeptide II.

  1. Cryo-EM structure of Hepatitis C virus IRES bound to the human ribosome at 3.9-Å resolution

    NASA Astrophysics Data System (ADS)

    Quade, Nick; Boehringer, Daniel; Leibundgut, Marc; van den Heuvel, Joop; Ban, Nenad

    2015-07-01

    Hepatitis C virus (HCV), a widespread human pathogen, is dependent on a highly structured 5'-untranslated region of its mRNA, referred to as internal ribosome entry site (IRES), for the translation of all of its proteins. The HCV IRES initiates translation by directly binding to the small ribosomal subunit (40S), circumventing the need for many eukaryotic translation initiation factors required for mRNA scanning. Here we present the cryo-EM structure of the human 40S ribosomal subunit in complex with the HCV IRES at 3.9 Å resolution, determined by focused refinement of an 80S ribosome-HCV IRES complex. The structure reveals the molecular details of the interactions between the IRES and the 40S, showing that expansion segment 7 (ES7) of the 18S rRNA acts as a central anchor point for the HCV IRES. The structural data rationalizes previous biochemical and genetic evidence regarding the initiation mechanism of the HCV and other related IRESs.

  2. Cryo-EM structure of Hepatitis C virus IRES bound to the human ribosome at 3.9-Å resolution.

    PubMed

    Quade, Nick; Boehringer, Daniel; Leibundgut, Marc; van den Heuvel, Joop; Ban, Nenad

    2015-01-01

    Hepatitis C virus (HCV), a widespread human pathogen, is dependent on a highly structured 5'-untranslated region of its mRNA, referred to as internal ribosome entry site (IRES), for the translation of all of its proteins. The HCV IRES initiates translation by directly binding to the small ribosomal subunit (40S), circumventing the need for many eukaryotic translation initiation factors required for mRNA scanning. Here we present the cryo-EM structure of the human 40S ribosomal subunit in complex with the HCV IRES at 3.9 Å resolution, determined by focused refinement of an 80S ribosome-HCV IRES complex. The structure reveals the molecular details of the interactions between the IRES and the 40S, showing that expansion segment 7 (ES7) of the 18S rRNA acts as a central anchor point for the HCV IRES. The structural data rationalizes previous biochemical and genetic evidence regarding the initiation mechanism of the HCV and other related IRESs. PMID:26155016

  3. Structural characterization of ribosome recruitment and translocation by type IV IRES

    PubMed Central

    Murray, Jason; Savva, Christos G; Shin, Byung-Sik; Dever, Thomas E; Ramakrishnan, V; Fernández, Israel S

    2016-01-01

    Viral mRNA sequences with a type IV IRES are able to initiate translation without any host initiation factors. Initial recruitment of the small ribosomal subunit as well as two translocation steps before the first peptidyl transfer are essential for the initiation of translation by these mRNAs. Using electron cryomicroscopy (cryo-EM) we have structurally characterized at high resolution how the Cricket Paralysis Virus Internal Ribosomal Entry Site (CrPV-IRES) binds the small ribosomal subunit (40S) and the translocation intermediate stabilized by elongation factor 2 (eEF2). The CrPV-IRES restricts the otherwise flexible 40S head to a conformation compatible with binding the large ribosomal subunit (60S). Once the 60S is recruited, the binary CrPV-IRES/80S complex oscillates between canonical and rotated states (Fernández et al., 2014; Koh et al., 2014), as seen for pre-translocation complexes with tRNAs. Elongation factor eEF2 with a GTP analog stabilizes the ribosome-IRES complex in a rotated state with an extra ~3 degrees of rotation. Key residues in domain IV of eEF2 interact with pseudoknot I (PKI) of the CrPV-IRES stabilizing it in a conformation reminiscent of a hybrid tRNA state. The structure explains how diphthamide, a eukaryotic and archaeal specific post-translational modification of a histidine residue of eEF2, is involved in translocation. DOI: http://dx.doi.org/10.7554/eLife.13567.001 PMID:27159451

  4. Ribosomal protein methyltransferases in the yeast Saccharomyces cerevisiae: Roles in ribosome biogenesis and translation.

    PubMed

    Al-Hadid, Qais; White, Jonelle; Clarke, Steven

    2016-02-12

    A significant percentage of the methyltransferasome in Saccharomyces cerevisiae and higher eukaryotes is devoted to methylation of the translational machinery. Methylation of the RNA components of the translational machinery has been studied extensively and is important for structure stability, ribosome biogenesis, and translational fidelity. However, the functional effects of ribosomal protein methylation by their cognate methyltransferases are still largely unknown. Previous work has shown that the ribosomal protein Rpl3 methyltransferase, histidine protein methyltransferase 1 (Hpm1), is important for ribosome biogenesis and translation elongation fidelity. In this study, yeast strains deficient in each of the ten ribosomal protein methyltransferases in S. cerevisiae were examined for potential defects in ribosome biogenesis and translation. Like Hpm1-deficient cells, loss of four of the nine other ribosomal protein methyltransferases resulted in defects in ribosomal subunit synthesis. All of the mutant strains exhibited resistance to the ribosome inhibitors anisomycin and/or cycloheximide in plate assays, but not in liquid culture. Translational fidelity assays measuring stop codon readthrough, amino acid misincorporation, and programmed -1 ribosomal frameshifting, revealed that eight of the ten enzymes are important for translation elongation fidelity and the remaining two are necessary for translation termination efficiency. Altogether, these results demonstrate that ribosomal protein methyltransferases in S. cerevisiae play important roles in ribosome biogenesis and translation. PMID:26801560

  5. Ancestral relationships of the major eukaryotic lineages.

    PubMed

    Sogin, M L; Morrison, H G; Hinkle, G; Silberman, J D

    1996-03-01

    Molecular systematics has revolutionized our understanding of microbial evolution. Phylogenetic frameworks relating all organisms in this biosphere can be inferred from comparisons of slowly evolving molecules such as the small and large subunit ribosomal RNAs. Unlike today's text book standard, the "Five Kingdoms" (plants, animals, fungi, protists and bacteria), molecular studies define three primary lines of descent (Eukaryotes, Eubacteria, and Archaebacteria). Within the Eukaryotes, the "higher" kingdoms (Fungi, Plantae, and Animalia) are joined by at least two novel complex evolutionary assemblages, the "Alveolates" (ciliates, dinoflagellates and apicomplexans) and the "Stramenopiles" (diatoms, oomycetes, labyrinthulids, brown algae and chrysophytes). The separation of these eukaryotic groups (described as the eukaryotic "crown") occurred approximately 10(9) years ago and was preceded by a succession of earlier diverging protist lineages, some as ancient as the separation of the prokaryotic domains. The molecular phylogenies suggest that multiple endosymbiotic events introduced plastids into discrete eukaryotic lineages. PMID:9019131

  6. Energy in the '80s: a call for leadership

    SciTech Connect

    Not Available

    1981-07-01

    The theme of this conference - Energy in the '80s: A Call for Leadership - was selected to focus attention on what was believed to be what America needs now - to get on with the tasks at hand. This proceedings of the Public Awareness Symposium, held on February 19, featured six speakers; the address of Senator Jackson at the banquet on February 20, which concluded the conference is also included; a separate abstract was prepared for each of these seven presentations. Also, the society-sponsored technical session papers are listed in Appendix A, and the Engineering/Communication scholarships are noted in Appendix B.

  7. Ribosomal proteins: functions beyond the ribosome

    PubMed Central

    Zhou, Xiang; Liao, Wen-Juan; Liao, Jun-Ming; Liao, Peng; Lu, Hua

    2015-01-01

    Although ribosomal proteins are known for playing an essential role in ribosome assembly and protein translation, their ribosome-independent functions have also been greatly appreciated. Over the past decade, more than a dozen of ribosomal proteins have been found to activate the tumor suppressor p53 pathway in response to ribosomal stress. In addition, these ribosomal proteins are involved in various physiological and pathological processes. This review is composed to overview the current understanding of how ribosomal stress provokes the accumulation of ribosome-free ribosomal proteins, as well as the ribosome-independent functions of ribosomal proteins in tumorigenesis, immune signaling, and development. We also propose the potential of applying these pieces of knowledge to the development of ribosomal stress-based cancer therapeutics. PMID:25735597

  8. Dissociability of free and peptidyl-tRNA bound ribosomes.

    PubMed

    Surguchov, A P; Fominykch, E S; Lyzlova, L V

    1978-06-16

    The influence of peptidyl-tRNA on the dissociation of yeast 80 S ribosomes into subunits was studied. For this purpose temperature-sensitive (ts) suppressor strain of yeast Saccharomyces cervisiae carrying a defect in peptide chain termination was used. It was found that peptidyl-tRNA did not influence the dissociation of ribosomes either at high salt concentration or in the presence of dissociation factor (DF) from yeast. After dissociation of yeast ribosomes in 0.5 M KCl, peptidyl-tRNA remains bound to the 60 S subunit. Some characteristics of the termination process and release of nascent polypeptides from yeast ribosomes are discussed. PMID:355860

  9. Viral IRES RNA structures and ribosome interactions.

    PubMed

    Kieft, Jeffrey S

    2008-06-01

    In eukaryotes, protein synthesis initiates primarily by a mechanism that requires a modified nucleotide 'cap' on the mRNA and also proteins that recruit and position the ribosome. Many pathogenic viruses use an alternative, cap-independent mechanism that substitutes RNA structure for the cap and many proteins. The RNAs driving this process are called internal ribosome-entry sites (IRESs) and some are able to bind the ribosome directly using a specific 3D RNA structure. Recent structures of IRES RNAs and IRES-ribosome complexes are revealing the structural basis of viral IRES' 'hijacking' of the protein-making machinery. It now seems that there are fundamental differences in the 3D structures used by different IRESs, although there are some common features in how they interact with ribosomes. PMID:18468443

  10. Viral IRES RNA structures and ribosome interactions

    PubMed Central

    Kieft, Jeffrey S.

    2009-01-01

    In eukaryotes, protein synthesis initiates primarily by a mechanism that requires a modified nucleotide ‘cap’ on the mRNA and also proteins that recruit and position the ribosome. Many pathogenic viruses use an alternative, cap-independent mechanism that substitutes RNA structure for the cap and many proteins. The RNAs driving this process are called internal ribosome-entry sites (IRESs) and some are able to bind the ribosome directly using a specific 3D RNA structure. Recent structures of IRES RNAs and IRES–ribosome complexes are revealing the structural basis of viral IRES’ ‘hijacking’ of the protein-making machinery. It now seems that there are fundamental differences in the 3D structures used by different IRESs, although there are some common features in how they interact with ribosomes. PMID:18468443

  11. Isolation and mapping of the human eukaryotic translation initiation factor 5 to chromosome 14

    SciTech Connect

    Romano, D.M.; Wasco, W.; Murell, J.

    1994-09-01

    Eukaryotic translation initiation factor 5 (eIF-5) is essential for the initiation of protein synthesis. eIF-5 catalyzes the hydrolysis of GTP on the 40S ribosomal initiation complex. Subsequent to GTP hydrolysis and the release of eIF-2-GDP, the 60S ribosomal subunit is joined to the 40S subunit to form an 80S initiation complex which can engage in peptide transfer. In an effort to isolate the major early-onset familial Alzheimer`s disease (FAD) gene on chromosome 14, we have isolated expressed sequences from this autosome in the form of exons `trapped` from chromosome 14-specific cosmids (library provided by L. Deaven, Los Alamos, NM). One cosmid yielded multiple exons displaying strong DNA and amino acid homology (>90%) with the rat eIF-5 gene. These exons were used to isolate full-length cDNAs from a human brain library. The eIF-5 message is approximately 3.6 kB in size and is ubiquitously expressed. The predicted amino acid sequence reveals multiple phosphorylation sites which may be involved in regulation of activity of eIF-5 and regions with homology to the GTPase superfamily, consistent with eIF-5`s role in GTP hydrolysis. Further studies are underway to determine whether the eIF-5 gene resides within the FAD minimal candidate region on chromosome 14q24.3.

  12. HCV IRES manipulates the ribosome to promote the switch from translation initiation to elongation.

    PubMed

    Filbin, Megan E; Vollmar, Breanna S; Shi, Dan; Gonen, Tamir; Kieft, Jeffrey S

    2013-02-01

    The internal ribosome entry site (IRES) of the hepatitis C virus (HCV) drives noncanonical initiation of protein synthesis necessary for viral replication. Functional studies of the HCV IRES have focused on 80S ribosome formation but have not explored its role after the 80S ribosome is poised at the start codon. Here, we report that mutations of an IRES domain that docks in the 40S subunit's decoding groove cause only a local perturbation in IRES structure and result in conformational changes in the IRES-rabbit 40S subunit complex. Functionally, the mutations decrease IRES activity by inhibiting the first ribosomal translocation event, and modeling results suggest that this effect occurs through an interaction with a single ribosomal protein. The ability of the HCV IRES to manipulate the ribosome provides insight into how the ribosome's structure and function can be altered by bound RNAs, including those derived from cellular invaders. PMID:23262488

  13. Cryo-EM structure of Hepatitis C virus IRES bound to the human ribosome at 3.9-Å resolution

    PubMed Central

    Quade, Nick; Boehringer, Daniel; Leibundgut, Marc; van den Heuvel, Joop; Ban, Nenad

    2015-01-01

    Hepatitis C virus (HCV), a widespread human pathogen, is dependent on a highly structured 5′-untranslated region of its mRNA, referred to as internal ribosome entry site (IRES), for the translation of all of its proteins. The HCV IRES initiates translation by directly binding to the small ribosomal subunit (40S), circumventing the need for many eukaryotic translation initiation factors required for mRNA scanning. Here we present the cryo-EM structure of the human 40S ribosomal subunit in complex with the HCV IRES at 3.9 Å resolution, determined by focused refinement of an 80S ribosome–HCV IRES complex. The structure reveals the molecular details of the interactions between the IRES and the 40S, showing that expansion segment 7 (ES7) of the 18S rRNA acts as a central anchor point for the HCV IRES. The structural data rationalizes previous biochemical and genetic evidence regarding the initiation mechanism of the HCV and other related IRESs. PMID:26155016

  14. Dynamics of ribosome scanning and recycling revealed by translation complex profiling.

    PubMed

    Archer, Stuart K; Shirokikh, Nikolay E; Beilharz, Traude H; Preiss, Thomas

    2016-07-28

    Regulation of messenger RNA translation is central to eukaryotic gene expression control. Regulatory inputs are specified by them RNA untranslated regions (UTRs) and often target translation initiation. Initiation involves binding of the 40S ribosomal small subunit (SSU) and associated eukaryotic initiation factors (eIFs)near the mRNA 5′ cap; the SSU then scans in the 3′ direction until it detects the start codon and is joined by the 60S ribosomal large subunit (LSU) to form the 80S ribosome. Scanning and other dynamic aspects of the initiation model have remained as conjectures because methods to trap early intermediates were lacking. Here we uncover the dynamics of the complete translation cycle in live yeast cells using translation complex profile sequencing (TCP-seq), a method developed from the ribosome profiling approach. We document scanning by observing SSU footprints along 5′ UTRs. Scanning SSU have 5′-extended footprints (up to~75 nucleotides), indicative of additional interactions with mRNA emerging from the exit channel, promoting forward movement. We visualized changes in initiation complex conformation as SSU footprints coalesced into three major sizes at start codons (19, 29 and 37 nucleotides). These share the same 5′ start site but differ at the 3′ end, reflecting successive changes at the entry channel from an open to a closed state following start codon recognition. We also observe SSU 'lingering' at stop codons after LSU departure. Our results underpin mechanistic models of translation initiation and termination, built on decades of biochemical and structural investigation, with direct genome-wide in vivo evidence. Our approach captures ribosomal complexes at all phases of translation and will aid in studying translation dynamics in diverse cellular contexts. Dysregulation of translation is common in disease and, for example, SSU scanning is a target of anti-cancer drug development. TCP-seq will prove useful in discerning differences

  15. Ribosome flow model with positive feedback

    PubMed Central

    Margaliot, Michael; Tuller, Tamir

    2013-01-01

    Eukaryotic mRNAs usually form a circular structure; thus, ribosomes that terminatae translation at the 3′ end can diffuse with increased probability to the 5′ end of the transcript, initiating another cycle of translation. This phenomenon describes ribosomal flow with positive feedback—an increase in the flow of ribosomes terminating translating the open reading frame increases the ribosomal initiation rate. The aim of this paper is to model and rigorously analyse translation with feedback. We suggest a modified version of the ribosome flow model, called the ribosome flow model with input and output. In this model, the input is the initiation rate and the output is the translation rate. We analyse this model after closing the loop with a positive linear feedback. We show that the closed-loop system admits a unique globally asymptotically stable equilibrium point. From a biophysical point of view, this means that there exists a unique steady state of ribosome distributions along the mRNA, and thus a unique steady-state translation rate. The solution from any initial distribution will converge to this steady state. The steady-state distribution demonstrates a decrease in ribosome density along the coding sequence. For the case of constant elongation rates, we obtain expressions relating the model parameters to the equilibrium point. These results may perhaps be used to re-engineer the biological system in order to obtain a desired translation rate. PMID:23720534

  16. Voices of Chinese Post-­80s Students in English Academic Writing

    ERIC Educational Resources Information Center

    Que, Hua; Li, Xuemei

    2015-01-01

    This study looks into the changing voice of Chinese Post-80s' students in English academic writing. Data were collected qualitatively through interviews with four Chinese Post-80s overseas graduate students and through an examination of their English essays with a focus on discursive features. Findings indicate that Chinese Post-80s' voice is…

  17. HCV IRES manipulates the ribosome to promote the switch from translation initiation to elongation

    PubMed Central

    Filbin, Megan E.; Vollmar, Breanna S.; Shi, Dan; Gonen, Tamir; Kieft, Jeffrey S.

    2012-01-01

    The hepatitis C virus (HCV) internal ribosome entry site (IRES) drives non-canonical initiation of protein synthesis necessary for viral replication. HCV IRES functional studies have focused on 80S ribosome formation, but have not explored roles after the 80S ribosome is poised at the start codon. Here, we report that mutations of an IRES domain that docks in the 40S subunit’s decoding groove and cause only a local perturbation in IRES structure result in conformational changes in the IRES-rabbit 40S subunit complex. Functionally, we find the mutation decreases IRES activity by inhibiting the first ribosome translocation event, and modeling suggests that this effect is through an interaction with a single ribosomal protein. The HCV IRES’ ability to manipulate the ribosome provides insight into how the ribosome’s structure and function can be altered by bound RNAs, including those derived from cellular invaders. PMID:23262488

  18. History of the ribosome and the origin of translation

    PubMed Central

    Petrov, Anton S.; Gulen, Burak; Norris, Ashlyn M.; Kovacs, Nicholas A.; Lanier, Kathryn A.; Fox, George E.; Harvey, Stephen C.; Wartell, Roger M.; Hud, Nicholas V.; Williams, Loren Dean

    2015-01-01

    We present a molecular-level model for the origin and evolution of the translation system, using a 3D comparative method. In this model, the ribosome evolved by accretion, recursively adding expansion segments, iteratively growing, subsuming, and freezing the rRNA. Functions of expansion segments in the ancestral ribosome are assigned by correspondence with their functions in the extant ribosome. The model explains the evolution of the large ribosomal subunit, the small ribosomal subunit, tRNA, and mRNA. Prokaryotic ribosomes evolved in six phases, sequentially acquiring capabilities for RNA folding, catalysis, subunit association, correlated evolution, decoding, energy-driven translocation, and surface proteinization. Two additional phases exclusive to eukaryotes led to tentacle-like rRNA expansions. In this model, ribosomal proteinization was a driving force for the broad adoption of proteins in other biological processes. The exit tunnel was clearly a central theme of all phases of ribosomal evolution and was continuously extended and rigidified. In the primitive noncoding ribosome, proto-mRNA and the small ribosomal subunit acted as cofactors, positioning the activated ends of tRNAs within the peptidyl transferase center. This association linked the evolution of the large and small ribosomal subunits, proto-mRNA, and tRNA. PMID:26621738

  19. History of the ribosome and the origin of translation.

    PubMed

    Petrov, Anton S; Gulen, Burak; Norris, Ashlyn M; Kovacs, Nicholas A; Bernier, Chad R; Lanier, Kathryn A; Fox, George E; Harvey, Stephen C; Wartell, Roger M; Hud, Nicholas V; Williams, Loren Dean

    2015-12-15

    We present a molecular-level model for the origin and evolution of the translation system, using a 3D comparative method. In this model, the ribosome evolved by accretion, recursively adding expansion segments, iteratively growing, subsuming, and freezing the rRNA. Functions of expansion segments in the ancestral ribosome are assigned by correspondence with their functions in the extant ribosome. The model explains the evolution of the large ribosomal subunit, the small ribosomal subunit, tRNA, and mRNA. Prokaryotic ribosomes evolved in six phases, sequentially acquiring capabilities for RNA folding, catalysis, subunit association, correlated evolution, decoding, energy-driven translocation, and surface proteinization. Two additional phases exclusive to eukaryotes led to tentacle-like rRNA expansions. In this model, ribosomal proteinization was a driving force for the broad adoption of proteins in other biological processes. The exit tunnel was clearly a central theme of all phases of ribosomal evolution and was continuously extended and rigidified. In the primitive noncoding ribosome, proto-mRNA and the small ribosomal subunit acted as cofactors, positioning the activated ends of tRNAs within the peptidyl transferase center. This association linked the evolution of the large and small ribosomal subunits, proto-mRNA, and tRNA. PMID:26621738

  20. Role of Pre-rRNA Base Pairing and 80S Complex Formation in Subnucleolar Localization of the U3 snoRNP

    PubMed Central

    Granneman, Sander; Vogelzangs, Judith; Lührmann, Reinhard; van Venrooij, Walther J.; Pruijn, Ger J. M.; Watkins, Nicholas J.

    2004-01-01

    In the nucleolus the U3 snoRNA is recruited to the 80S pre-rRNA processing complex in the dense fibrillar component (DFC). The U3 snoRNA is found throughout the nucleolus and has been proposed to move with the preribosomes to the granular component (GC). In contrast, the localization of other RNAs, such as the U8 snoRNA, is restricted to the DFC. Here we show that the incorporation of the U3 snoRNA into the 80S processing complex is not dependent on pre-rRNA base pairing sequences but requires the B/C motif, a U3-specific protein-binding element. We also show that the binding of Mpp10 to the 80S U3 complex is dependent on sequences within the U3 snoRNA that base pair with the pre-rRNA adjacent to the initial cleavage site. Furthermore, mutations that inhibit 80S complex formation and/or the association of Mpp10 result in retention of the U3 snoRNA in the DFC. From this we propose that the GC localization of the U3 snoRNA is a direct result of its active involvement in the initial steps of ribosome biogenesis. PMID:15367679

  1. Communities of microbial eukaryotes in the mammalian gut within the context of environmental eukaryotic diversity

    PubMed Central

    Parfrey, Laura Wegener; Walters, William A.; Lauber, Christian L.; Clemente, Jose C.; Berg-Lyons, Donna; Teiling, Clotilde; Kodira, Chinnappa; Mohiuddin, Mohammed; Brunelle, Julie; Driscoll, Mark; Fierer, Noah; Gilbert, Jack A.; Knight, Rob

    2014-01-01

    Eukaryotic microbes (protists) residing in the vertebrate gut influence host health and disease, but their diversity and distribution in healthy hosts is poorly understood. Protists found in the gut are typically considered parasites, but many are commensal and some are beneficial. Further, the hygiene hypothesis predicts that association with our co-evolved microbial symbionts may be important to overall health. It is therefore imperative that we understand the normal diversity of our eukaryotic gut microbiota to test for such effects and avoid eliminating commensal organisms. We assembled a dataset of healthy individuals from two populations, one with traditional, agrarian lifestyles and a second with modern, westernized lifestyles, and characterized the human eukaryotic microbiota via high-throughput sequencing. To place the human gut microbiota within a broader context our dataset also includes gut samples from diverse mammals and samples from other aquatic and terrestrial environments. We curated the SILVA ribosomal database to reflect current knowledge of eukaryotic taxonomy and employ it as a phylogenetic framework to compare eukaryotic diversity across environment. We show that adults from the non-western population harbor a diverse community of protists, and diversity in the human gut is comparable to that in other mammals. However, the eukaryotic microbiota of the western population appears depauperate. The distribution of symbionts found in mammals reflects both host phylogeny and diet. Eukaryotic microbiota in the gut are less diverse and more patchily distributed than bacteria. More broadly, we show that eukaryotic communities in the gut are less diverse than in aquatic and terrestrial habitats, and few taxa are shared across habitat types, and diversity patterns of eukaryotes are correlated with those observed for bacteria. These results outline the distribution and diversity of microbial eukaryotic communities in the mammalian gut and across

  2. Structure and Function of the Mitochondrial Ribosome.

    PubMed

    Greber, Basil J; Ban, Nenad

    2016-06-01

    Mitochondrial ribosomes (mitoribosomes) perform protein synthesis inside mitochondria, the organelles responsible for energy conversion and adenosine triphosphate production in eukaryotic cells. Throughout evolution, mitoribosomes have become functionally specialized for synthesizing mitochondrial membrane proteins, and this has been accompanied by large changes to their structure and composition. We review recent high-resolution structural data that have provided unprecedented insight into the structure and function of mitoribosomes in mammals and fungi. PMID:27023846

  3. Structure of a mitochondrial ribosome with minimal RNA.

    PubMed

    Sharma, Manjuli R; Booth, Timothy M; Simpson, Larry; Maslov, Dmitri A; Agrawal, Rajendra K

    2009-06-16

    The Leishmania tarentolae mitochondrial ribosome (Lmr) is a minimal ribosomal RNA (rRNA)-containing ribosome. We have obtained a cryo-EM map of the Lmr. The map reveals several features that have not been seen in previously-determined structures of eubacterial or eukaryotic (cytoplasmic or organellar) ribosomes to our knowledge. Comparisons of the Lmr map with X-ray crystallographic and cryo-EM maps of the eubacterial ribosomes and a cryo-EM map of the mammalian mitochondrial ribosome show that (i) the overall structure of the Lmr is considerably more porous, (ii) the topology of the intersubunit space is significantly different, with fewer intersubunit bridges, but more tunnels, and (iii) several of the functionally-important rRNA regions, including the alpha-sarcin-ricin loop, have different relative positions within the structure. Furthermore, the major portions of the mRNA channel, the tRNA passage, and the nascent polypeptide exit tunnel contain Lmr-specific proteins, suggesting that the mechanisms for mRNA recruitment, tRNA interaction, and exiting of the nascent polypeptide in Lmr must differ markedly from the mechanisms deduced for ribosomes in other organisms. Our study identifies certain structural features that are characteristic solely of mitochondrial ribosomes and other features that are characteristic of both mitochondrial and chloroplast ribosomes (i.e., organellar ribosomes). PMID:19497863

  4. The ribosome filter redux.

    PubMed

    Mauro, Vincent P; Edelman, Gerald M

    2007-09-15

    The ribosome filter hypothesis postulates that ribosomes are not simply translation machines but also function as regulatory elements that differentially affect or filter the translation of particular mRNAs. On the basis of new information, we take the opportunity here to review the ribosome filter hypothesis, suggest specific mechanisms of action, and discuss recent examples from the literature that support it. PMID:17890902

  5. DExD/H-box RNA helicases in ribosome biogenesis

    PubMed Central

    Martin, Roman; Straub, Annika U.; Doebele, Carmen; Bohnsack, Markus T.

    2013-01-01

    Ribosome synthesis requires a multitude of cofactors, among them DExD/H-box RNA helicases. Bacterial RNA helicases involved in ribosome assembly are not essential, while eukaryotes strictly require multiple DExD/H-box proteins that are involved in the much more complex ribosome biogenesis pathway. Here, RNA helicases are thought to act in structural remodeling of the RNPs including the modulation of protein binding, and they are required for allowing access or the release of specific snoRNPs from pre-ribosomes. Interestingly, helicase action is modulated by specific cofactors that can regulate recruitment and enzymatic activity. This review summarizes the current knowledge and focuses on recent findings and open questions on RNA helicase function and regulation in ribosome synthesis. PMID:22922795

  6. The Ribosomal RNA is a Useful Marker to Visualize Rhizobia Interacting with Legume Plants

    ERIC Educational Resources Information Center

    Rinaudi, Luciana; Isola, Maria C.; Giordano, Walter

    2004-01-01

    Symbiosis between rhizobia and leguminous plants leads to the formation of nitrogen-fixing root nodules. In the present article, we recommend the use of the ribosomal RNA (rRNA) isolated from legume nodules in an experimental class with the purpose of introducing students to the structure of eukaryotic and prokaryotic ribosomes and of…

  7. Ocean plankton. Eukaryotic plankton diversity in the sunlit ocean.

    PubMed

    de Vargas, Colomban; Audic, Stéphane; Henry, Nicolas; Decelle, Johan; Mahé, Frédéric; Logares, Ramiro; Lara, Enrique; Berney, Cédric; Le Bescot, Noan; Probert, Ian; Carmichael, Margaux; Poulain, Julie; Romac, Sarah; Colin, Sébastien; Aury, Jean-Marc; Bittner, Lucie; Chaffron, Samuel; Dunthorn, Micah; Engelen, Stefan; Flegontova, Olga; Guidi, Lionel; Horák, Aleš; Jaillon, Olivier; Lima-Mendez, Gipsi; Lukeš, Julius; Malviya, Shruti; Morard, Raphael; Mulot, Matthieu; Scalco, Eleonora; Siano, Raffaele; Vincent, Flora; Zingone, Adriana; Dimier, Céline; Picheral, Marc; Searson, Sarah; Kandels-Lewis, Stefanie; Acinas, Silvia G; Bork, Peer; Bowler, Chris; Gorsky, Gabriel; Grimsley, Nigel; Hingamp, Pascal; Iudicone, Daniele; Not, Fabrice; Ogata, Hiroyuki; Pesant, Stephane; Raes, Jeroen; Sieracki, Michael E; Speich, Sabrina; Stemmann, Lars; Sunagawa, Shinichi; Weissenbach, Jean; Wincker, Patrick; Karsenti, Eric

    2015-05-22

    Marine plankton support global biological and geochemical processes. Surveys of their biodiversity have hitherto been geographically restricted and have not accounted for the full range of plankton size. We assessed eukaryotic diversity from 334 size-fractionated photic-zone plankton communities collected across tropical and temperate oceans during the circumglobal Tara Oceans expedition. We analyzed 18S ribosomal DNA sequences across the intermediate plankton-size spectrum from the smallest unicellular eukaryotes (protists, >0.8 micrometers) to small animals of a few millimeters. Eukaryotic ribosomal diversity saturated at ~150,000 operational taxonomic units, about one-third of which could not be assigned to known eukaryotic groups. Diversity emerged at all taxonomic levels, both within the groups comprising the ~11,200 cataloged morphospecies of eukaryotic plankton and among twice as many other deep-branching lineages of unappreciated importance in plankton ecology studies. Most eukaryotic plankton biodiversity belonged to heterotrophic protistan groups, particularly those known to be parasites or symbiotic hosts. PMID:25999516

  8. Deconstructing ribosome construction

    PubMed Central

    Connolly, Keith; Culver, Gloria

    2013-01-01

    The ribosome is an essential ribonucleoprotein enzyme, and its biogenesis is a fundamental process in all living cells. Recent X-ray crystal structures of the bacterial ribosome and new technologies have allowed a greater interrogation of in vitro ribosome assembly; however, substantially less is known about ribosome biogenesis in vivo. Ongoing investigations are focused on elucidating the cellular processes that facilitate biogenesis of the ribosomal subunits, and many extraribosomal factors, including modification enzymes, remodeling enzymes and GTPases, are being uncovered. Moreover, specific roles for ribosome biogenesis factors in subunit maturation are now being elaborated. Ultimately, such studies will reveal a more complete understanding of processes at work in in vivo ribosome biogenesis. PMID:19376708

  9. Overexpression of Eukaryotic Translation Elongation Factor 3 Impairs Gcn2 Protein Activation*

    PubMed Central

    Visweswaraiah, Jyothsna; Lee, Su Jung; Hinnebusch, Alan G.; Sattlegger, Evelyn

    2012-01-01

    In eukaryotes, phosphorylation of translation initiation factor 2α (eIF2α) by the kinase Gcn2 (general control nonderepressible 2) is a key response to amino acid starvation. Sensing starvation requires that Gcn2 directly contacts its effector protein Gcn1, and both must contact the ribosome. We have proposed that Gcn2 is activated by uncharged tRNA bound to the ribosomal decoding (A) site, in a manner facilitated by ribosome-bound Gcn1. Protein synthesis requires cyclical association of eukaryotic elongation factors (eEFs) with the ribosome. Gcn1 and Gcn2 are large proteins, raising the question of whether translation and monitoring amino acid availability can occur on the same ribosome. Part of the ribosome-binding domain in Gcn1 has homology to one of the ribosome-binding domains in eEF3, suggesting that these proteins utilize overlapping binding sites on the ribosome and consequently cannot function simultaneously on the same ribosome. Supporting this idea, we found that eEF3 overexpression in Saccharomyces cerevisiae diminished growth on amino acid starvation medium (Gcn− phenotype) and decreased eIF2α phosphorylation, and that the growth defect associated with constitutively active Gcn2 was diminished by eEF3 overexpression. Overexpression of the eEF3 HEAT domain, or C terminus, was sufficient to confer a Gcn− phenotype, and both fragments have ribosome affinity. eEF3 overexpression did not significantly affect Gcn1-ribosome association, but it exacerbated the Gcn− phenotype of Gcn1-M7A that has reduced ribosome affinity. Together, this suggests that eEF3 blocks Gcn1 regulatory function on the ribosome. We propose that the Gcn1-Gcn2 complex only functions on ribosomes with A-site-bound uncharged tRNA, because eEF3 does not occupy these stalled complexes. PMID:22888004

  10. Overexpression of eukaryotic translation elongation factor 3 impairs Gcn2 protein activation.

    PubMed

    Visweswaraiah, Jyothsna; Lee, Su Jung; Hinnebusch, Alan G; Sattlegger, Evelyn

    2012-11-01

    In eukaryotes, phosphorylation of translation initiation factor 2α (eIF2α) by the kinase Gcn2 (general control nonderepressible 2) is a key response to amino acid starvation. Sensing starvation requires that Gcn2 directly contacts its effector protein Gcn1, and both must contact the ribosome. We have proposed that Gcn2 is activated by uncharged tRNA bound to the ribosomal decoding (A) site, in a manner facilitated by ribosome-bound Gcn1. Protein synthesis requires cyclical association of eukaryotic elongation factors (eEFs) with the ribosome. Gcn1 and Gcn2 are large proteins, raising the question of whether translation and monitoring amino acid availability can occur on the same ribosome. Part of the ribosome-binding domain in Gcn1 has homology to one of the ribosome-binding domains in eEF3, suggesting that these proteins utilize overlapping binding sites on the ribosome and consequently cannot function simultaneously on the same ribosome. Supporting this idea, we found that eEF3 overexpression in Saccharomyces cerevisiae diminished growth on amino acid starvation medium (Gcn(-) phenotype) and decreased eIF2α phosphorylation, and that the growth defect associated with constitutively active Gcn2 was diminished by eEF3 overexpression. Overexpression of the eEF3 HEAT domain, or C terminus, was sufficient to confer a Gcn(-) phenotype, and both fragments have ribosome affinity. eEF3 overexpression did not significantly affect Gcn1-ribosome association, but it exacerbated the Gcn(-) phenotype of Gcn1-M7A that has reduced ribosome affinity. Together, this suggests that eEF3 blocks Gcn1 regulatory function on the ribosome. We propose that the Gcn1-Gcn2 complex only functions on ribosomes with A-site-bound uncharged tRNA, because eEF3 does not occupy these stalled complexes. PMID:22888004

  11. A Ribosome-Binding, 3′ Translational Enhancer Has a T-Shaped Structure and Engages in a Long-Distance RNA-RNA Interaction

    PubMed Central

    Gao, Feng; Kasprzak, Wojciech; Stupina, Vera A.

    2012-01-01

    Many plant RNA viruses contain elements in their 3′ untranslated regions (3′ UTRs) that enhance translation. The PTE (Panicum mosaic virus-like translational enhancer) of Pea enation mosaic virus (PEMV) binds to eukaryotic initiation factor 4E (eIF4E), but how this affects translation from the 5′ end is unknown. We have discovered a three-way branched element just upstream of the PEMV PTE that engages in a long-distance kissing-loop interaction with a coding sequence hairpin that is critical for the translation of a reporter construct and the accumulation of the viral genome in vivo. Loss of the long-distance interaction was more detrimental than elimination of the adjacent PTE, indicating that the RNA-RNA interaction supports additional translation functions besides relocating the PTE to the 5′ end. The branched element is predicted by molecular modeling and molecular dynamics to form a T-shaped structure (TSS) similar to the ribosome-binding TSS of Turnip crinkle virus (TCV). The PEMV element binds to plant 80S ribosomes with a Kd (dissociation constant) of 0.52 μM and to 60S subunits with a Kd of 0.30 μM. Unlike the TCV TSS, the PEMV element also binds 40S subunits (Kd, 0.36 μM). Mutations in the element that suppressed translation reduced either ribosome binding or the RNA-RNA interaction, suggesting that ribosome binding is important for function. This novel, multifunctional element is designated a kl-TSS (kissing-loop T-shaped structure) to distinguish it from the TCV TSS. The kl-TSS has sequence and structural features conserved with the upper portion of most PTE-type elements, which, with the exception of the PEMV PTE, can engage in similar long-distance RNA-RNA interactions. PMID:22761367

  12. Evidence that Yih1 resides in a complex with ribosomes.

    PubMed

    Waller, Tracey; Lee, Su Jung; Sattlegger, Evelyn

    2012-05-01

    Adjusting protein synthesis by phosphorylating eukaryotic translation initiation factor 2 (eIF2α) is a major mechanism by which eukaryotes adapt to and overcome stress. The eIF2α kinase Gcn2 is essential for overcoming amino acid starvation in all eukaryotes. We have shown that to sense starvation, the Gcn2 RWD domain must directly contact its effector protein, Gcn1, and both must bind to the ribosome, suggesting that starvation is sensed within a Gcn1-Gcn2-ribosome complex. The mammalian protein IMPACT, highly expressed in neurons, and its yeast orthologue yeast IMPACT homologue (Yih1) harbour an RWD domain with Gcn1-binding activity. We have shown that Yih1 downregulates Gcn2 by competing with Gcn2 for Gcn1-binding. Here, we provide evidence that Yih1 forms a complex with ribosomes. In velocity sedimentation assays, overexpressed glutathione S-transferase (GST)-tagged Yih1 cosedimented with polyribosomes independently of Gcn1. Reduction of polyribosomes to monosomes concomitantly decreased GST-Yih1 sedimentation in the heavy fractions where polyribosomes are normally found. Furthermore, GST-Yih1 coprecipitated large ribosomal protein Rpl39 independently of Gcn1. GST-Yih1 overexpression did not significantly affect Gcn1-ribosome or Gcn2-ribosome cosedimentation. myc-tagged Yih1 expressed from its own promoter cosedimented with polyribosomes independently of Gcn1, indicating that Yih1-ribosome interaction occurs under physiological conditions. GST-IMPACT cosedimented with yeast ribosomes and coprecipitated Rpl39 in a Gcn1-independent fashion, suggesting that Yih1/IMPACT-ribosome association is evolutionarily conserved. Moreover, GST-IMPACT coprecipitated actin as found for GST-Yih1. Taken together, our findings strongly suggest that IMPACT/Yih1 associates with ribosomes and that these ribosomes may simultaneously carry Gcn1 and Gcn2. Close physical proximity of Yih1 to the Gcn1-Gcn2-ribosome complex would allow cells to quickly inhibit Gcn2 whenever or wherever

  13. The ribosomal database project.

    PubMed Central

    Larsen, N; Olsen, G J; Maidak, B L; McCaughey, M J; Overbeek, R; Macke, T J; Marsh, T L; Woese, C R

    1993-01-01

    The Ribosomal Database Project (RDP) is a curated database that offers ribosome data along with related programs and services. The offerings include phylogenetically ordered alignments of ribosomal RNA (rRNA) sequences, derived phylogenetic trees, rRNA secondary structure diagrams and various software packages for handling, analyzing and displaying alignments and trees. The data are available via ftp and electronic mail. Certain analytic services are also provided by the electronic mail server. PMID:8332524

  14. RNA Export through the NPC in Eukaryotes.

    PubMed

    Okamura, Masumi; Inose, Haruko; Masuda, Seiji

    2015-01-01

    In eukaryotic cells, RNAs are transcribed in the nucleus and exported to the cytoplasm through the nuclear pore complex. The RNA molecules that are exported from the nucleus into the cytoplasm include messenger RNAs (mRNAs), ribosomal RNAs (rRNAs), transfer RNAs (tRNAs), small nuclear RNAs (snRNAs), micro RNAs (miRNAs), and viral mRNAs. Each RNA is transported by a specific nuclear export receptor. It is believed that most of the mRNAs are exported by Nxf1 (Mex67 in yeast), whereas rRNAs, snRNAs, and a certain subset of mRNAs are exported in a Crm1/Xpo1-dependent manner. tRNAs and miRNAs are exported by Xpot and Xpo5. However, multiple export receptors are involved in the export of some RNAs, such as 60S ribosomal subunit. In addition to these export receptors, some adapter proteins are required to export RNAs. The RNA export system of eukaryotic cells is also used by several types of RNA virus that depend on the machineries of the host cell in the nucleus for replication of their genome, therefore this review describes the RNA export system of two representative viruses. We also discuss the NPC anchoring-dependent mRNA export factors that directly recruit specific genes to the NPC. PMID:25802992

  15. RNA Export through the NPC in Eukaryotes

    PubMed Central

    Okamura, Masumi; Inose, Haruko; Masuda, Seiji

    2015-01-01

    In eukaryotic cells, RNAs are transcribed in the nucleus and exported to the cytoplasm through the nuclear pore complex. The RNA molecules that are exported from the nucleus into the cytoplasm include messenger RNAs (mRNAs), ribosomal RNAs (rRNAs), transfer RNAs (tRNAs), small nuclear RNAs (snRNAs), micro RNAs (miRNAs), and viral mRNAs. Each RNA is transported by a specific nuclear export receptor. It is believed that most of the mRNAs are exported by Nxf1 (Mex67 in yeast), whereas rRNAs, snRNAs, and a certain subset of mRNAs are exported in a Crm1/Xpo1-dependent manner. tRNAs and miRNAs are exported by Xpot and Xpo5. However, multiple export receptors are involved in the export of some RNAs, such as 60S ribosomal subunit. In addition to these export receptors, some adapter proteins are required to export RNAs. The RNA export system of eukaryotic cells is also used by several types of RNA virus that depend on the machineries of the host cell in the nucleus for replication of their genome, therefore this review describes the RNA export system of two representative viruses. We also discuss the NPC anchoring-dependent mRNA export factors that directly recruit specific genes to the NPC. PMID:25802992

  16. The Ribosomal Database Project.

    PubMed Central

    Maidak, B L; Larsen, N; McCaughey, M J; Overbeek, R; Olsen, G J; Fogel, K; Blandy, J; Woese, C R

    1994-01-01

    The Ribosomal Database Project (RDP) is a curated database that offers ribosome-related data, analysis services, and associated computer programs. The offerings include phylogenetically ordered alignments of ribosomal RNA (rRNA) sequences, derived phylogenetic trees, rRNA secondary structure diagrams, and various software for handling, analyzing and displaying alignments and trees. The data are available via anonymous ftp (rdp.life.uiuc.edu), electronic mail (server/rdp.life.uiuc.edu) and gopher (rdpgopher.life.uiuc.edu). The electronic mail server also provides ribosomal probe checking, approximate phylogenetic placement of user-submitted sequences, screening for chimeric nature of newly sequenced rRNAs, and automated alignment. PMID:7524021

  17. Eukaryotic diversity at pH extremes

    PubMed Central

    Amaral-Zettler, Linda A.

    2013-01-01

    Extremely acidic (pH < 3) and extremely alkaline (pH > 9) environments support a diversity of single-cell and to a lesser extent, multicellular eukaryotic life. This study compared alpha and beta diversity in eukaryotic communities from seven diverse aquatic environments with pH values ranging from 2 to 11 using massively-parallel pyrotag sequencing targeting the V9 hypervariable region of the 18S ribosomal RNA (rRNA) gene. A total of 946 operational taxonomic units (OTUs) were recovered at a 6% cut-off level (94% similarity) across the sampled environments. Hierarchical clustering of the samples segregated the communities into acidic and alkaline groups. Similarity percentage (SIMPER) analysis followed by indicator OTU analysis (IOA) and non-metric multidimensional scaling (NMDS) were used to determine which characteristic groups of eukaryotic taxa typify acidic or alkaline extremes and the extent to which pH explains eukaryotic community structure in these environments. Spain's Rio Tinto yielded the fewest observed OTUs while Nebraska Sandhills alkaline lakes yielded the most. Distinct OTUs, including metazoan OTUs, numerically dominated pH extreme sites. Indicator OTUs included the diatom Pinnularia and unidentified opisthokonts (Fungi and Filasterea) in the extremely acidic environments, and the ciliate Frontonia across the extremely alkaline sites. Inferred from NMDS, pH explained only a modest fraction of the variation across the datasets, indicating that other factors influence the underlying community structure in these environments. The findings from this study suggest that the ability for eukaryotes to adapt to pH extremes over a broad range of values may be rare, but further study of taxa that can broadly adapt across diverse acidic and alkaline environments, respectively present good models for understanding adaptation and should be targeted for future investigations. PMID:23335919

  18. The Saccharomyces cerevisiae protein Stm1p facilitates ribosome preservation during quiescence

    SciTech Connect

    Van Dyke, Natalya; Chanchorn, Ekkawit; Van Dyke, Michael W.

    2013-01-11

    Highlights: Black-Right-Pointing-Pointer Stm1p confers increased resistance to the macrolide starvation-mimic rapamycin. Black-Right-Pointing-Pointer Stm1p maintains 80S ribosome integrity during stationary phase-induced quiescence. Black-Right-Pointing-Pointer Stm1p facilitates polysome formation following quiescence exit. Black-Right-Pointing-Pointer Stm1p facilitates protein synthesis following quiescence exit. Black-Right-Pointing-Pointer Stm1p is a ribosome preservation factor under conditions of nutrient deprivation. -- Abstract: Once cells exhaust nutrients from their environment, they enter an alternative resting state known as quiescence, whereby proliferation ceases and essential nutrients are obtained through internal stores and through the catabolism of existing macromolecules and organelles. One example of this is ribophagy, the degradation of ribosomes through the process of autophagy. However, some ribosomes need to be preserved for an anticipated recovery from nutrient deprivation. We found that the ribosome-associated protein Stm1p greatly increases the quantity of 80S ribosomes present in quiescent yeast cells and that these ribosomes facilitate increased protein synthesis rates once nutrients are restored. These findings suggest that Stm1p can act as a ribosome preservation factor under conditions of nutrient deprivation and restoration.

  19. A late-acting quality control process for mature eukaryotic rRNAs.

    PubMed

    LaRiviere, Frederick J; Cole, Sarah E; Ferullo, Daniel J; Moore, Melissa J

    2006-11-17

    Ribosome biogenesis is a multifaceted process involving a host of trans-acting factors mediating numerous chemical reactions, RNA conformational changes, and RNA-protein associations. Given this high degree of complexity, tight quality control is likely crucial to ensure structural and functional integrity of the end products. We demonstrate that ribosomal RNAs (rRNAs) containing individual point mutations, in either the 25S peptidyl transferase center or 18S decoding site, that adversely affect ribosome function are strongly downregulated in Saccharomyces cerevisiae. This downregulation occurs via decreased stability of the mature rRNA contained in fully assembled ribosomes and ribosomal subunits. Thus, eukaryotes possess a quality-control mechanism, nonfunctional rRNA decay (NRD), capable of detecting and eliminating the rRNA component of mature ribosomes. PMID:17188037

  20. Homoiterons and expansion in ribosomal RNAs.

    PubMed

    Parker, Michael S; Sallee, Floyd R; Park, Edwards A; Parker, Steven L

    2015-01-01

    Ribosomal RNAs in both prokaryotes and eukaryotes feature numerous repeats of three or more nucleotides with the same nucleobase (homoiterons). In prokaryotes these repeats are much more frequent in thermophile compared to mesophile or psychrophile species, and have similar frequency in both large RNAs. These features point to use of prokaryotic homoiterons in stabilization of both ribosomal subunits. The two large RNAs of eukaryotic cytoplasmic ribosomes have expanded to a different degree across the evolutionary ladder. The big RNA of the larger subunit (60S LSU) evolved expansion segments of up to 2400 nucleotides, and the smaller subunit (40S SSU) RNA acquired expansion segments of not more than 700 nucleotides. In the examined eukaryotes abundance of rRNA homoiterons generally follows size and nucleotide bias of the expansion segments, and increases with GC content and especially with phylogenetic rank. Both the nucleotide bias and frequency of homoiterons are much larger in metazoan and angiosperm LSU compared to the respective SSU RNAs. This is especially pronounced in the tetrapod vertebrates and seems to culminate in the hominid mammals. The stability of secondary structure in polyribonucleotides would significantly connect to GC content, and should also relate to G and C homoiteron content. RNA modeling points to considerable presence of homoiteron-rich double-stranded segments especially in vertebrate LSU RNAs, and homoiterons with four or more nucleotides in the vertebrate and angiosperm LSU RNAs are largely confined to the expansion segments. These features could mainly relate to protein export function and attachment of LSU to endoplasmic reticulum and other subcellular networks. PMID:26636029

  1. Homoiterons and expansion in ribosomal RNAs

    PubMed Central

    Parker, Michael S.; Sallee, Floyd R.; Park, Edwards A.; Parker, Steven L.

    2015-01-01

    Ribosomal RNAs in both prokaryotes and eukaryotes feature numerous repeats of three or more nucleotides with the same nucleobase (homoiterons). In prokaryotes these repeats are much more frequent in thermophile compared to mesophile or psychrophile species, and have similar frequency in both large RNAs. These features point to use of prokaryotic homoiterons in stabilization of both ribosomal subunits. The two large RNAs of eukaryotic cytoplasmic ribosomes have expanded to a different degree across the evolutionary ladder. The big RNA of the larger subunit (60S LSU) evolved expansion segments of up to 2400 nucleotides, and the smaller subunit (40S SSU) RNA acquired expansion segments of not more than 700 nucleotides. In the examined eukaryotes abundance of rRNA homoiterons generally follows size and nucleotide bias of the expansion segments, and increases with GC content and especially with phylogenetic rank. Both the nucleotide bias and frequency of homoiterons are much larger in metazoan and angiosperm LSU compared to the respective SSU RNAs. This is especially pronounced in the tetrapod vertebrates and seems to culminate in the hominid mammals. The stability of secondary structure in polyribonucleotides would significantly connect to GC content, and should also relate to G and C homoiteron content. RNA modeling points to considerable presence of homoiteron-rich double-stranded segments especially in vertebrate LSU RNAs, and homoiterons with four or more nucleotides in the vertebrate and angiosperm LSU RNAs are largely confined to the expansion segments. These features could mainly relate to protein export function and attachment of LSU to endoplasmic reticulum and other subcellular networks. PMID:26636029

  2. The Ribosomal Database Project

    PubMed Central

    Olsen, Gary J.; Overbeek, Ross; Larsen, Niels; Marsh, Terry L.; McCaughey, Michael J.; Maciukenas, Michael A.; Kuan, Wen-Min; Macke, Thomas J.; Xing, Yuqing; Woese, Carl R.

    1992-01-01

    The Ribosomal Database Project (RDP) compiles ribosomal sequences and related data, and redistributes them in aligned and phylogenetically ordered form to its user community. It also offers various software packages for handling, analyzing and displaying sequences. In addition, the RDP offers (or will offer) certain analytic services. At present the project is in an intermediate stage of development. PMID:1598241

  3. The Eukaryotic Replication Machine.

    PubMed

    Zhang, D; O'Donnell, M

    2016-01-01

    The cellular replicating machine, or "replisome," is composed of numerous different proteins. The core replication proteins in all cell types include a helicase, primase, DNA polymerases, sliding clamp, clamp loader, and single-strand binding (SSB) protein. The core eukaryotic replisome proteins evolved independently from those of bacteria and thus have distinct architectures and mechanisms of action. The core replisome proteins of the eukaryote include: an 11-subunit CMG helicase, DNA polymerase alpha-primase, leading strand DNA polymerase epsilon, lagging strand DNA polymerase delta, PCNA clamp, RFC clamp loader, and the RPA SSB protein. There are numerous other proteins that travel with eukaryotic replication forks, some of which are known to be involved in checkpoint regulation or nucleosome handling, but most have unknown functions and no bacterial analogue. Recent studies have revealed many structural and functional insights into replisome action. Also, the first structure of a replisome from any cell type has been elucidated for a eukaryote, consisting of 20 distinct proteins, with quite unexpected results. This review summarizes the current state of knowledge of the eukaryotic core replisome proteins, their structure, individual functions, and how they are organized at the replication fork as a machine. PMID:27241931

  4. The 3′ Untranslated Region of Pea Enation Mosaic Virus Contains Two T-Shaped, Ribosome-Binding, Cap-Independent Translation Enhancers

    PubMed Central

    Gao, Feng; Kasprzak, Wojciech K.; Szarko, Christine; Shapiro, Bruce A.

    2014-01-01

    ABSTRACT Many plant viruses without 5′caps or 3′ poly(A) tails contain 3′ proximal, cap-independent translation enhancers (3′CITEs) that bind to ribosomal subunits or translation factors thought to assist in ribosome recruitment. Most 3′CITEs participate in a long-distance kissing-loop interaction with a 5′ proximal hairpin to deliver ribosomal subunits to the 5′ end for translation initiation. Pea Enation Mosaic Virus (PEMV) contains two adjacent 3′CITEs in the center of its 703-nucleotide 3′ untranslated region (3′UTR), the ribosome-binding, kissing-loop T-shaped structure (kl-TSS) and eukaryotic translation initiation factor 4E-binding Panicum mosaic virus-like translation enhance (PTE). We now report that PEMV contains a third, independent 3′CITE located near the 3′ terminus. This 3′CITE is composed of three hairpins and two pseudoknots, similar to the TSS 3′CITE of the carmovirus Turnip crinkle virus (TCV). As with the TCV TSS, the PEMV 3′TSS is predicted to fold into a T-shaped structure that binds to 80S ribosomes and 60S ribosomal subunits. A small hairpin (kl-H) upstream of the 3′TSS contains an apical loop capable of forming a kissing-loop interaction with a 5′ proximal hairpin and is critical for the accumulation of full-length PEMV in protoplasts. Although the kl-H and 3′TSS are dispensable for the translation of a reporter construct containing the complete PEMV 3′UTR in vitro, deleting the normally required kl-TSS and PTE 3′CITEs and placing the kl-H and 3′TSS proximal to the reporter termination codon restores translation to near wild-type levels. This suggests that PEMV requires three 3′CITEs for proper translation and that additional translation enhancers may have been missed if reporter constructs were used in 3′CITE identification. IMPORTANCE The rapid life cycle of viruses requires efficient translation of viral-encoded proteins. Many plant RNA viruses contain 3′ cap-independent translation

  5. Eukaryotic selenoproteins and selenoproteomes.

    PubMed

    Lobanov, Alexey V; Hatfield, Dolph L; Gladyshev, Vadim N

    2009-11-01

    Selenium is an essential trace element for which both beneficial and toxic effects in human health have been described. It is now clear that the importance of having adequate amounts of this micronutrient in the diet is primarily due to the fact that selenium is required for biosynthesis of selenocysteine, the twenty first naturally occurring amino acid in protein. In this review, we provide an overview of eukaryotic selenoproteins and selenoproteomes, which are sets of selenoproteins in these organisms. In eukaryotes, selenoproteins show a mosaic occurrence, with some organisms, such as vertebrates and algae, having dozens of these proteins, while other organisms, such as higher plants and fungi, having lost all selenoproteins during evolution. We also discuss selenoprotein functions and evolutionary trends in the use of these proteins in eukaryotes. Functional analysis of selenoproteins is critical for better understanding of the role of selenium in human health and disease. PMID:19477234

  6. [Mechanism of tRNA translocation on the ribosome].

    PubMed

    Rodnina, M V; Semenkov, Iu P; Savelsbergh, A; Katunin, V I; Peske, F; Wilden, B; Wintermeyer, W

    2001-01-01

    During the translocation step of the elongation cycle of peptide synthesis two tRNAs together with the mRNA move synchronously and rapidly on the ribosome. Translocation is catalyzed by the elongation factor G (EF-G) and requires GTP hydrolysis. The fundamental biochemical features of the process were worked out in the 1970-80s, to a large part by A.S. Spirin and his colleagues. Recent results from pre-steady-state kinetic analysis and cryoelectron microscopy suggest that translocation is a multistep dynamic process that entails large-scale structural rearrangements of both ribosome and EF-G. Kinetic and thermodynamic data, together with the structural information on the conformational changes of the ribosome and of EF-G, provide a detailed mechanistic model of translocation and suggest a mechanism of translocation catalysis by EF-G. PMID:11524952

  7. Regulation of ribosomal DNA amplification by the TOR pathway

    PubMed Central

    Jack, Carmen V.; Cruz, Cristina; Hull, Ryan M.; Keller, Markus A.; Ralser, Markus; Houseley, Jonathan

    2015-01-01

    Repeated regions are widespread in eukaryotic genomes, and key functional elements such as the ribosomal DNA tend to be formed of high copy repeated sequences organized in tandem arrays. In general, high copy repeats are remarkably stable, but a number of organisms display rapid ribosomal DNA amplification at specific times or under specific conditions. Here we demonstrate that target of rapamycin (TOR) signaling stimulates ribosomal DNA amplification in budding yeast, linking external nutrient availability to ribosomal DNA copy number. We show that ribosomal DNA amplification is regulated by three histone deacetylases: Sir2, Hst3, and Hst4. These enzymes control homologous recombination-dependent and nonhomologous recombination-dependent amplification pathways that act in concert to mediate rapid, directional ribosomal DNA copy number change. Amplification is completely repressed by rapamycin, an inhibitor of the nutrient-responsive TOR pathway; this effect is separable from growth rate and is mediated directly through Sir2, Hst3, and Hst4. Caloric restriction is known to up-regulate expression of nicotinamidase Pnc1, an enzyme that enhances Sir2, Hst3, and Hst4 activity. In contrast, normal glucose concentrations stretch the ribosome synthesis capacity of cells with low ribosomal DNA copy number, and we find that these cells show a previously unrecognized transcriptional response to caloric excess by reducing PNC1 expression. PNC1 down-regulation forms a key element in the control of ribosomal DNA amplification as overexpression of PNC1 substantially reduces ribosomal DNA amplification rate. Our results reveal how a signaling pathway can orchestrate specific genome changes and demonstrate that the copy number of repetitive DNA can be altered to suit environmental conditions. PMID:26195783

  8. Advertising for the 80's. Marketing and Distributive Education. Advertising. Instructor's Guide.

    ERIC Educational Resources Information Center

    Ault, Craig; Elias, John

    This module contains a teacher's guide, student materials for a seminar on "advertising for the 80's" conducted for small business representatives, a 35mm slide presentation, and an audiocassette. The instructor guide contains an outline of the course, time plan, end-of-course critique, a script for the slide-tape presentation (with content on the…

  9. Futurism in the Education of the Deaf: Directions and Alternatives for the 80's.

    ERIC Educational Resources Information Center

    Marshall, William J. A.

    The author presents a rationale for the study of futurism in education and analyzes the effects of significant future changes upon deaf education in the 80s. The roles that change agents play in influencing the permanence of innovations within the school are examined: advocacy, information sharing, and organizational development training.…

  10. Therapeutic Discourse and ACOA Films of the '80s and '90s.

    ERIC Educational Resources Information Center

    Lynch, Joan Driscoll

    2000-01-01

    Argues that many family melodramas in films of the '80s and '90s focus their narrative on the negative dynamics of the parental relationship. Identifies underlying generic patterns and ideas found in these films. Explores representations of mothers, fathers, and children; gender representation and codependency; and familial dysfunction. Broadens…

  11. Sharing of mitotic pre-ribosomal particles between daughter cells.

    PubMed

    Sirri, Valentina; Jourdan, Nathalie; Hernandez-Verdun, Danièle; Roussel, Pascal

    2016-04-15

    Ribosome biogenesis is a fundamental multistep process initiated by the synthesis of 90S pre-ribosomal particles in the nucleoli of higher eukaryotes. Even though synthesis of ribosomes stops during mitosis while nucleoli disappear, mitotic pre-ribosomal particles persist as observed in pre-nucleolar bodies (PNBs) during telophase. To further understand the relationship between the nucleolus and the PNBs, the presence and the fate of the mitotic pre-ribosomal particles during cell division were investigated. We demonstrate that the recently synthesized 45S precursor ribosomal RNAs (pre-rRNAs) as well as the 32S and 30S pre-rRNAs are maintained during mitosis and associated with the chromosome periphery together with pre-rRNA processing factors. Maturation of the mitotic pre-ribosomal particles, as assessed by the stability of the mitotic pre-rRNAs, is transiently arrested during mitosis by a cyclin-dependent kinase (CDK)1-cyclin-B-dependent mechanism and can be restored by CDK inhibitor treatments. At the M-G1 transition, the resumption of mitotic pre-rRNA processing in PNBs does not induce the disappearance of PNBs; this only occurs when functional nucleoli reform. Strikingly, during their maturation process, mitotic pre-rRNAs localize in reforming nucleoli. PMID:26929073

  12. Studies on the Coordination of Ribosomal Protein Assembly Events Involved in Processing and Stabilization of Yeast Early Large Ribosomal Subunit Precursors.

    PubMed

    Ohmayer, Uli; Gil-Hernández, Álvaro; Sauert, Martina; Martín-Marcos, Pilar; Tamame, Mercedes; Tschochner, Herbert; Griesenbeck, Joachim; Milkereit, Philipp

    2015-01-01

    Cellular production of ribosomes involves the formation of highly defined interactions between ribosomal proteins (r-proteins) and ribosomal RNAs (rRNAs). Moreover in eukaryotic cells, efficient ribosome maturation requires the transient association of a large number of ribosome biogenesis factors (RBFs) with newly forming ribosomal subunits. Here, we investigated how r-protein assembly events in the large ribosomal subunit (LSU) rRNA domain II are coordinated with each other and with the association of RBFs in early LSU precursors of the yeast Saccharomyces cerevisiae. Specific effects on the pre-ribosomal association of RBFs could be observed in yeast mutants blocked in LSU rRNA domain II assembly. Moreover, formation of a cluster of r-proteins was identified as a downstream event in LSU rRNA domain II assembly. We analyzed in more detail the functional relevance of eukaryote specific bridges established by this r-protein cluster between LSU rRNA domain II and VI and discuss how they can support the stabilization and efficient processing of yeast early LSU precursor RNAs. PMID:26642313

  13. Studies on the Coordination of Ribosomal Protein Assembly Events Involved in Processing and Stabilization of Yeast Early Large Ribosomal Subunit Precursors

    PubMed Central

    Sauert, Martina; Martín-Marcos, Pilar; Tamame, Mercedes; Tschochner, Herbert; Griesenbeck, Joachim; Milkereit, Philipp

    2015-01-01

    Cellular production of ribosomes involves the formation of highly defined interactions between ribosomal proteins (r-proteins) and ribosomal RNAs (rRNAs). Moreover in eukaryotic cells, efficient ribosome maturation requires the transient association of a large number of ribosome biogenesis factors (RBFs) with newly forming ribosomal subunits. Here, we investigated how r-protein assembly events in the large ribosomal subunit (LSU) rRNA domain II are coordinated with each other and with the association of RBFs in early LSU precursors of the yeast Saccharomyces cerevisiae. Specific effects on the pre-ribosomal association of RBFs could be observed in yeast mutants blocked in LSU rRNA domain II assembly. Moreover, formation of a cluster of r-proteins was identified as a downstream event in LSU rRNA domain II assembly. We analyzed in more detail the functional relevance of eukaryote specific bridges established by this r-protein cluster between LSU rRNA domain II and VI and discuss how they can support the stabilization and efficient processing of yeast early LSU precursor RNAs. PMID:26642313

  14. Initiation of Translation in Bacteria by a Structured Eukaryotic IRES RNA

    PubMed Central

    Colussi, Timothy M.; Costantino, David A.; Zhu, Jianyu; Donohue, John Paul; Korostelev, Andrei A.; Jaafar, Zane A.; Plank, Terra-Dawn M.; Noller, Harry F.; Kieft, Jeffrey S.

    2015-01-01

    The central dogma of gene expression (DNA→RNA→protein) is universal, but in different domains of life there are fundamental mechanistic differences within this pathway. For example, the canonical molecular signals used to initiate protein synthesis in bacteria and eukaryotes are mutually exclusive1,2. However, the core structures and conformational dynamics of ribosomes that are responsible for the steps of translation following initiation are ancient and conserved across the domains of life3,4. We asked whether an undiscovered RNA-based signal might be able to use these conserved features, bypassing mechanisms specific to each domain of life, and initiate protein synthesis in both bacteria and eukaryotes. Although structured internal ribosome entry site (IRES) RNAs can manipulate ribosomes to initiate translation in eukaryotic cells, an analogous RNA structure-based mechanism has not been observed in bacteria. Here, we report our discovery that a eukaryotic viral IRES can initiate translation in live bacteria. We solved the crystal structure of this IRES bound to a bacterial ribosome to 3.8 Å resolution, revealing that despite differences between bacterial and eukaryotic ribosomes this IRES binds directly to both and occupies the space normally used by tRNAs. Initiation in both bacteria and eukaryotes depends on the structure of the IRES RNA but in bacteria this RNA uses a different mechanism that includes a form of ribosome repositioning after initial recruitment. This IRES RNA bridges billions of years of evolutionary divergence as an example of an RNA structure-based translation initiation signal capable of operating in two domains of life. PMID:25652826

  15. Initiation of translation in bacteria by a structured eukaryotic IRES RNA.

    PubMed

    Colussi, Timothy M; Costantino, David A; Zhu, Jianyu; Donohue, John Paul; Korostelev, Andrei A; Jaafar, Zane A; Plank, Terra-Dawn M; Noller, Harry F; Kieft, Jeffrey S

    2015-03-01

    The central dogma of gene expression (DNA to RNA to protein) is universal, but in different domains of life there are fundamental mechanistic differences within this pathway. For example, the canonical molecular signals used to initiate protein synthesis in bacteria and eukaryotes are mutually exclusive. However, the core structures and conformational dynamics of ribosomes that are responsible for the translation steps that take place after initiation are ancient and conserved across the domains of life. We wanted to explore whether an undiscovered RNA-based signal might be able to use these conserved features, bypassing mechanisms specific to each domain of life, and initiate protein synthesis in both bacteria and eukaryotes. Although structured internal ribosome entry site (IRES) RNAs can manipulate ribosomes to initiate translation in eukaryotic cells, an analogous RNA structure-based mechanism has not been observed in bacteria. Here we report our discovery that a eukaryotic viral IRES can initiate translation in live bacteria. We solved the crystal structure of this IRES bound to a bacterial ribosome to 3.8 Å resolution, revealing that despite differences between bacterial and eukaryotic ribosomes this IRES binds directly to both and occupies the space normally used by transfer RNAs. Initiation in both bacteria and eukaryotes depends on the structure of the IRES RNA, but in bacteria this RNA uses a different mechanism that includes a form of ribosome repositioning after initial recruitment. This IRES RNA bridges billions of years of evolutionary divergence and provides an example of an RNA structure-based translation initiation signal capable of operating in two domains of life. PMID:25652826

  16. When ribosomes go bad: diseases of ribosome biogenesis

    PubMed Central

    Freed, Emily F.; Bleichert, Franziska; Dutca, Laura M.; Baserga, Susan J.

    2010-01-01

    Ribosomes are vital for cell growth and survival. Until recently, it was believed that mutations in ribosomes or ribosome biogenesis factors would be lethal, due to the essential nature of these complexes. However, in the last few decades, a number of diseases of ribosome biogenesis have been discovered. It remains a challenge in the field to elucidate the molecular mechanisms underlying them. PMID:20174677

  17. Yeast Ribosomal Protein L40 Assembles Late into Precursor 60 S Ribosomes and Is Required for Their Cytoplasmic Maturation*

    PubMed Central

    Fernández-Pevida, Antonio; Rodríguez-Galán, Olga; Díaz-Quintana, Antonio; Kressler, Dieter; de la Cruz, Jesús

    2012-01-01

    Most ribosomal proteins play important roles in ribosome biogenesis and function. Here, we have examined the contribution of the essential ribosomal protein L40 in these processes in the yeast Saccharomyces cerevisiae. Deletion of either the RPL40A or RPL40B gene and in vivo depletion of L40 impair 60 S ribosomal subunit biogenesis. Polysome profile analyses reveal the accumulation of half-mers and a moderate reduction in free 60 S ribosomal subunits. Pulse-chase, Northern blotting, and primer extension analyses in the L40-depleted strain clearly indicate that L40 is not strictly required for the precursor rRNA (pre-rRNA) processing reactions but contributes to optimal 27 SB pre-rRNA maturation. Moreover, depletion of L40 hinders the nucleo-cytoplasmic export of pre-60 S ribosomal particles. Importantly, all these defects most likely appear as the direct consequence of impaired Nmd3 and Rlp24 release from cytoplasmic pre-60 S ribosomal subunits and their inefficient recycling back into the nucle(ol)us. In agreement, we show that hemagglutinin epitope-tagged L40A assembles in the cytoplasm into almost mature pre-60 S ribosomal particles. Finally, we have identified that the hemagglutinin epitope-tagged L40A confers resistance to sordarin, a translation inhibitor that impairs the function of eukaryotic elongation factor 2, whereas the rpl40a and rpl40b null mutants are hypersensitive to this antibiotic. We conclude that L40 is assembled at a very late stage into pre-60 S ribosomal subunits and that its incorporation into 60 S ribosomal subunits is a prerequisite for subunit joining and may ensure proper functioning of the translocation process. PMID:22995916

  18. Eukaryotic Cell Panorama

    ERIC Educational Resources Information Center

    Goodsell, David S.

    2011-01-01

    Diverse biological data may be used to create illustrations of molecules in their cellular context. This report describes the scientific results that support an illustration of a eukaryotic cell, enlarged by one million times to show the distribution and arrangement of macromolecules. The panoramic cross section includes eight panels that extend…

  19. Prokaryote and eukaryote evolvability.

    PubMed

    Poole, Anthony M; Phillips, Matthew J; Penny, David

    2003-05-01

    The concept of evolvability covers a broad spectrum of, often contradictory, ideas. At one end of the spectrum it is equivalent to the statement that evolution is possible, at the other end are untestable post hoc explanations, such as the suggestion that current evolutionary theory cannot explain the evolution of evolvability. We examine similarities and differences in eukaryote and prokaryote evolvability, and look for explanations that are compatible with a wide range of observations. Differences in genome organisation between eukaryotes and prokaryotes meets this criterion. The single origin of replication in prokaryote chromosomes (versus multiple origins in eukaryotes) accounts for many differences because the time to replicate a prokaryote genome limits its size (and the accumulation of junk DNA). Both prokaryotes and eukaryotes appear to switch from genetic stability to genetic change in response to stress. We examine a range of stress responses, and discuss how these impact on evolvability, particularly in unicellular organisms versus complex multicellular ones. Evolvability is also limited by environmental interactions (including competition) and we describe a model that places limits on potential evolvability. Examples are given of its application to predator competition and limits to lateral gene transfer. We suggest that unicellular organisms evolve largely through a process of metabolic change, resulting in biochemical diversity. Multicellular organisms evolve largely through morphological changes, not through extensive changes to cellular biochemistry. PMID:12689728

  20. The ribosomal subunit assembly line

    PubMed Central

    Dlakić, Mensur

    2005-01-01

    Recent proteomic studies in Saccharomyces cerevisiae have identified nearly 200 proteins, other than the structural ribosomal proteins, that participate in the assembly of ribosomal subunits and their transport from the nucleus. In a separate line of research, proteomic studies of mature plant ribosomes have revealed considerable variability in the protein composition of individual ribosomes. PMID:16207363

  1. Alternative Mechanisms to Initiate Translation in Eukaryotic mRNAs

    PubMed Central

    Martínez-Salas, Encarnación; Piñeiro, David; Fernández, Noemí

    2012-01-01

    The composition of the cellular proteome is under the control of multiple processes, one of the most important being translation initiation. The majority of eukaryotic cellular mRNAs initiates translation by the cap-dependent or scanning mode of translation initiation, a mechanism that depends on the recognition of the m7G(5′)ppp(5′)N, known as the cap. However, mRNAs encoding proteins required for cell survival under stress bypass conditions inhibitory to cap-dependent translation; these mRNAs often harbor internal ribosome entry site (IRES) elements in their 5′UTRs that mediate internal initiation of translation. This mechanism is also exploited by mRNAs expressed from the genome of viruses infecting eukaryotic cells. In this paper we discuss recent advances in understanding alternative ways to initiate translation across eukaryotic organisms. PMID:22536116

  2. The ribosome returned

    PubMed Central

    Moore, Peter B

    2009-01-01

    Since the mid-1990s, insights obtained from electron microscopy and X-ray crystallography have transformed our understanding of how the most important ribozyme in the cell, the ribosome, catalyzes protein synthesis. This review provides a brief account of how this structural revolution came to pass, and the impact it has had on our understanding of how the ribosome decodes messenger RNAs. PMID:19222865

  3. Ribosome-omics of the human ribosome

    PubMed Central

    Gupta, Varun; Warner, Jonathan R.

    2014-01-01

    The torrent of RNA-seq data becoming available not only furnishes an overview of the entire transcriptome but also provides tools to focus on specific areas of interest. Our focus on the synthesis of ribosomes asked whether the abundance of mRNAs encoding ribosomal proteins (RPs) matched the equimolar need for the RPs in the assembly of ribosomes. We were at first surprised to find, in the mapping data of ENCODE and other sources, that there were nearly 100-fold differences in the level of the mRNAs encoding the different RPs. However, after correcting for the mapping ambiguities introduced by the presence of more than 2000 pseudogenes derived from RP mRNAs, we show that for 80%–90% of the RP genes, the molar ratio of mRNAs varies less than threefold, with little tissue specificity. Nevertheless, since the RPs are needed in equimolar amounts, there must be sluggish or regulated translation of the more abundant RP mRNAs and/or substantial turnover of unused RPs. In addition, seven of the RPs have subsidiary genes, three of which are pseudogenes that have been “rescued” by the introduction of promoters and/or upstream introns. Several of these are transcribed in a tissue-specific manner, e.g., RPL10L in testis and RPL3L in muscle, leading to potential variation in ribosome structure from one tissue to another. Of the 376 introns in the RP genes, a single one is alternatively spliced in a tissue-specific manner. PMID:24860015

  4. Lateral gene transfer in eukaryotes.

    PubMed

    Andersson, J O

    2005-06-01

    Lateral gene transfer -- the transfer of genetic material between species -- has been acknowledged as a major mechanism in prokaryotic genome evolution for some time. Recently accumulating data indicate that the process also occurs in the evolution of eukaryotic genomes. However, there are large rate variations between groups of eukaryotes; animals and fungi seem to be largely unaffected, with a few exceptions, while lateral gene transfer frequently occurs in protists with phagotrophic lifestyles, possibly with rates comparable to prokaryotic organisms. Gene transfers often facilitate the acquisition of functions encoded in prokaryotic genomes by eukaryotic organisms, which may enable them to colonize new environments. Transfers between eukaryotes also occur, mainly into larger phagotrophic eukaryotes that ingest eukaryotic cells, but also between plant lineages. These findings have implications for eukaryotic genomic research in general, and studies of the origin and phylogeny of eukaryotes in particular. PMID:15761667

  5. Mitochondrial ribosome assembly in health and disease

    PubMed Central

    De Silva, Dasmanthie; Tu, Ya-Ting; Amunts, Alexey; Fontanesi, Flavia; Barrientos, Antoni

    2015-01-01

    The ribosome is a structurally and functionally conserved macromolecular machine universally responsible for catalyzing protein synthesis. Within eukaryotic cells, mitochondria contain their own ribosomes (mitoribosomes), which synthesize a handful of proteins, all essential for the biogenesis of the oxidative phosphorylation system. High-resolution cryo-EM structures of the yeast, porcine and human mitoribosomal subunits and of the entire human mitoribosome have uncovered a wealth of new information to illustrate their evolutionary divergence from their bacterial ancestors and their adaptation to synthesis of highly hydrophobic membrane proteins. With such structural data becoming available, one of the most important remaining questions is that of the mitoribosome assembly pathway and factors involved. The regulation of mitoribosome biogenesis is paramount to mitochondrial respiration, and thus to cell viability, growth and differentiation. Moreover, mutations affecting the rRNA and protein components produce severe human mitochondrial disorders. Despite its biological and biomedical significance, knowledge on mitoribosome biogenesis and its deviations from the much-studied bacterial ribosome assembly processes is scarce, especially the order of rRNA processing and assembly events and the regulatory factors required to achieve fully functional particles. This article focuses on summarizing the current available information on mitoribosome assembly pathway, factors that form the mitoribosome assembly machinery, and the effect of defective mitoribosome assembly on human health. PMID:26030272

  6. Ribosomal protein uS19 mutants reveal its role in coordinating ribosome structure and function

    PubMed Central

    Bowen, Alicia M; Musalgaonkar, Sharmishtha; Moomau, Christine A; Gulay, Suna P; Mirvis, Mary; Dinman, Jonathan D

    2015-01-01

    Prior studies identified allosteric information pathways connecting functional centers in the large ribosomal subunit to the decoding center in the small subunit through the B1a and B1b/c intersubunit bridges in yeast. In prokaryotes a single SSU protein, uS13, partners with H38 (the A-site finger) and uL5 to form the B1a and B1b/c bridges respectively. In eukaryotes, the SSU component was split into 2 separate proteins during the course of evolution. One, also known as uS13, participates in B1b/c bridge with uL5 in eukaryotes. The other, called uS19 is the SSU partner in the B1a bridge with H38. Here, polyalanine mutants of uS19 involved in the uS19/uS13 and the uS19/H38 interfaces were used to elucidate the important amino acid residues involved in these intersubunit communication pathways. Two key clusters of amino acids were identified: one located at the junction between uS19 and uS13, and a second that appears to interact with the distal tip of H38. Biochemical analyses reveal that these mutations shift the ribosomal rotational equilibrium toward the unrotated state, increasing ribosomal affinity for tRNAs in the P-site and for ternary complex in the A-site, and inhibit binding of the translocase, eEF2. These defects in turn affect specific aspects of translational fidelity. These findings suggest that uS19 plays a critical role as a conduit of information exchange between the large and small ribosomal subunits directly through the B1a, and indirectly through the B1b/c bridges. PMID:26824029

  7. Ribosomal protein uS19 mutants reveal its role in coordinating ribosome structure and function.

    PubMed

    Bowen, Alicia M; Musalgaonkar, Sharmishtha; Moomau, Christine A; Gulay, Suna P; Mirvis, Mary; Dinman, Jonathan D

    2015-01-01

    Prior studies identified allosteric information pathways connecting functional centers in the large ribosomal subunit to the decoding center in the small subunit through the B1a and B1b/c intersubunit bridges in yeast. In prokaryotes a single SSU protein, uS13, partners with H38 (the A-site finger) and uL5 to form the B1a and B1b/c bridges respectively. In eukaryotes, the SSU component was split into 2 separate proteins during the course of evolution. One, also known as uS13, participates in B1b/c bridge with uL5 in eukaryotes. The other, called uS19 is the SSU partner in the B1a bridge with H38. Here, polyalanine mutants of uS19 involved in the uS19/uS13 and the uS19/H38 interfaces were used to elucidate the important amino acid residues involved in these intersubunit communication pathways. Two key clusters of amino acids were identified: one located at the junction between uS19 and uS13, and a second that appears to interact with the distal tip of H38. Biochemical analyses reveal that these mutations shift the ribosomal rotational equilibrium toward the unrotated state, increasing ribosomal affinity for tRNAs in the P-site and for ternary complex in the A-site, and inhibit binding of the translocase, eEF2. These defects in turn affect specific aspects of translational fidelity. These findings suggest that uS19 plays a critical role as a conduit of information exchange between the large and small ribosomal subunits directly through the B1a, and indirectly through the B1b/c bridges. PMID:26824029

  8. Role of ribosomes in Semliki Forest virus nucleocapsid uncoating.

    PubMed Central

    Singh, I; Helenius, A

    1992-01-01

    The mechanism by which Semliki Forest virus nucleocapsids are uncoated was analyzed in living cells and in vitro. In BHK-21 cells, uncoating occurred with virtually complete efficiency within 1 to 2 min after the nucleocapsids entered the cytoplasm. It was inhibited by monensin, which blocks nucleocapsid penetration from endosomes. As previously shown for Sindbis virus (G. Wengler and G. Wengler, Virology 134:435-442, 1984), the capsid proteins from incoming nucleocapsids became associated with ribosomes. The ribosome-bound capsid proteins were distributed throughout the cytoplasm, while the viral RNA remained associated with vacuolar membranes. Using purified nucleocapsids and ribosomes in vitro, we established that ribosomes alone were sufficient for uncoating. Their role was to release the capsid proteins from nucleocapsids and irreversibly sequester them, in a process independent of energy and translation. The process was stoichiometric rather than catalytic, with a maximum of three to six capsid proteins bound to each ribosome. More than 80% of the capsid proteins could thus be removed from the viral RNA, resulting in the formation of nucleocapsid remnants whose sedimentation coefficients progressively decreased from 140S to 80S as uncoating proceeded. Images PMID:1433506

  9. Assembly and nuclear export of pre-ribosomal particles in budding yeast.

    PubMed

    Gerhardy, Stefan; Menet, Anna Maria; Peña, Cohue; Petkowski, Janusz Jurand; Panse, Vikram Govind

    2014-08-01

    The ribosome is responsible for the final step of decoding genetic information into proteins. Therefore, correct assembly of ribosomes is a fundamental task for all living cells. In eukaryotes, the construction of the ribosome which begins in the nucleolus requires coordinated efforts of >350 specialized factors that associate with pre-ribosomal particles at distinct stages to perform specific assembly steps. On their way through the nucleus, diverse energy-consuming enzymes are thought to release assembly factors from maturing pre-ribosomal particles after accomplishing their task(s). Subsequently, recruitment of export factors prepares pre-ribosomal particles for transport through nuclear pore complexes. Pre-ribosomes are exported into the cytoplasm in a functionally inactive state, where they undergo final maturation before initiating translation. Accumulating evidence indicates a tight coupling between nuclear export, cytoplasmic maturation, and final proofreading of the ribosome. In this review, we summarize our current understanding of nuclear export of pre-ribosomal subunits and cytoplasmic maturation steps that render pre-ribosomal subunits translation-competent. PMID:24817020

  10. RNase MRP and the RNA processing cascade in the eukaryotic ancestor

    PubMed Central

    Woodhams, Michael D; Stadler, Peter F; Penny, David; Collins, Lesley J

    2007-01-01

    Background Within eukaryotes there is a complex cascade of RNA-based macromolecules that process other RNA molecules, especially mRNA, tRNA and rRNA. An example is RNase MRP processing ribosomal RNA (rRNA) in ribosome biogenesis. One hypothesis is that this complexity was present early in eukaryotic evolution; an alternative is that an initial simpler network later gained complexity by gene duplication in lineages that led to animals, fungi and plants. Recently there has been a rapid increase in support for the complexity-early theory because the vast majority of these RNA-processing reactions are found throughout eukaryotes, and thus were likely to be present in the last common ancestor of living eukaryotes, herein called the Eukaryotic Ancestor. Results We present an overview of the RNA processing cascade in the Eukaryotic Ancestor and investigate in particular, RNase MRP which was previously thought to have evolved later in eukaryotes due to its apparent limited distribution in fungi and animals and plants. Recent publications, as well as our own genomic searches, find previously unknown RNase MRP RNAs, indicating that RNase MRP has a wide distribution in eukaryotes. Combining secondary structure and promoter region analysis of RNAs for RNase MRP, along with analysis of the target substrate (rRNA), allows us to discuss this distribution in the light of eukaryotic evolution. Conclusion We conclude that RNase MRP can now be placed in the RNA-processing cascade of the Eukaryotic Ancestor, highlighting the complexity of RNA-processing in early eukaryotes. Promoter analyses of MRP-RNA suggest that regulation of the critical processes of rRNA cleavage can vary, showing that even these key cellular processes (for which we expect high conservation) show some species-specific variability. We present our consensus MRP-RNA secondary structure as a useful model for further searches. PMID:17288571

  11. Crystallography of ribosomal particles

    NASA Astrophysics Data System (ADS)

    Yonath, A.; Frolow, F.; Shoham, M.; Müssig, J.; Makowski, I.; Glotz, C.; Jahn, W.; Weinstein, S.; Wittmann, H. G.

    1988-07-01

    Several forms of three-dimensional crystals and two-dimensional sheets of intact ribosomes and their subunits have been obtained as a result of: (a) an extensive systematic investigation of the parameters involved in crystallization, (b) a development of an experimental procedure for controlling the volumes of the crystallization droplets, (c) a study of the nucleation process, and (d) introducing a delicate seeding procedure coupled with variations in the ratios of mono- and divalent ions in the crystallization medium. In all cases only biologically active particles could be crystallized, and the crystalline material retains its integrity and activity. Crystallographic data have been collected from crystals of 50S ribosomal subunits, using synchrotron radiation at temperatures between + 19 and - 180°C. Although at 4°C the higher resolution reflections decay within minutes in the synchrotron beam, at cryo-temperature there was hardly any radiation damage, and a complete set of data to about 6Åresolution could be collected from a single crystal. Heavy-atom clusters were used for soaking as well as for specific binding to the surface of the ribosomal subunits prior to crystallization. The 50S ribosomal subunits from a mutant of B. stearothermophilus which lacks the ribosomal protein BL11 crystallize isomorphously with in the native ones. Models, aimed to be used for low resolution phasing, have been reconstructed from two-dimensional sheets of 70S ribosomes and 50S subunits at 47 and 30Å, respectively. These models show the overall structure of these particles, the contact areas between the large and small subunits, the space where protein synthesis might take place and a tunnel which may provide the path for the nascent protein chain.

  12. Exploring Internal Ribosome Entry Sites as Therapeutic Targets

    PubMed Central

    Komar, Anton A.; Hatzoglou, Maria

    2015-01-01

    Initiation of eukaryotic mRNA translation may proceed via several different routes, each requiring a different subset of factors and relying on different and specific interactions between the mRNA and the ribosome. Two modes predominate: (i) so-called cap-dependent initiation, which requires all canonical initiation factors and is responsible for about 95–97% of all initiation events in eukaryotic cells; and (ii) cap-independent internal initiation, which requires a reduced subset of initiation factors and accounts for up to 5% of the remaining initiation events. Internal initiation relies on the presence of so-called internal ribosome entry site (IRES) elements in the 5′ UTRs of some viral and cellular mRNAs. These elements (often possessing complex secondary and tertiary structures) promote efficient interaction of the mRNA with the 40S ribosome and allow for internal ribosome entry. Internal initiation of translation of specific mRNAs may contribute to development of severe disease and pathological states, such as hepatitis C and cancer. Therefore, this cellular mechanism represents an attractive target for pharmacological modulation. The purpose of this review is to provide insight into current strategies used to target viral and cellular IRESs and discuss the physiological consequences (and potential therapeutic implications) of abrogation/modulation of IRES-mediated translation. PMID:26539410

  13. The Ribosome Comes Alive

    PubMed Central

    2010-01-01

    This essay is a reflection on the ways the X-ray structures of the ribosome are helping in the interpretation of cryogenic electron microscopy (cryo-EM) density maps showing the translating ribosome in motion. Through advances in classification methods, cryo-EM and single-particle reconstruction methods have recently evolved to the point where they can yield an array of structures from a single sample (“story in a sample”), providing snapshots of an entire subprocess of translation, such as translocation or decoding. PMID:21072331

  14. The Ribosome Comes Alive.

    PubMed

    Frank, Joachim

    2010-06-18

    This essay is a reflection on the ways the X-ray structures of the ribosome are helping in the interpretation of cryogenic electron microscopy (cryo-EM) density maps showing the translating ribosome in motion. Through advances in classification methods, cryo-EM and single-particle reconstruction methods have recently evolved to the point where they can yield an array of structures from a single sample ("story in a sample"), providing snapshots of an entire subprocess of translation, such as translocation or decoding. PMID:21072331

  15. Endosymbiotic theories for eukaryote origin

    PubMed Central

    Martin, William F.; Garg, Sriram; Zimorski, Verena

    2015-01-01

    For over 100 years, endosymbiotic theories have figured in thoughts about the differences between prokaryotic and eukaryotic cells. More than 20 different versions of endosymbiotic theory have been presented in the literature to explain the origin of eukaryotes and their mitochondria. Very few of those models account for eukaryotic anaerobes. The role of energy and the energetic constraints that prokaryotic cell organization placed on evolutionary innovation in cell history has recently come to bear on endosymbiotic theory. Only cells that possessed mitochondria had the bioenergetic means to attain eukaryotic cell complexity, which is why there are no true intermediates in the prokaryote-to-eukaryote transition. Current versions of endosymbiotic theory have it that the host was an archaeon (an archaebacterium), not a eukaryote. Hence the evolutionary history and biology of archaea increasingly comes to bear on eukaryotic origins, more than ever before. Here, we have compiled a survey of endosymbiotic theories for the origin of eukaryotes and mitochondria, and for the origin of the eukaryotic nucleus, summarizing the essentials of each and contrasting some of their predictions to the observations. A new aspect of endosymbiosis in eukaryote evolution comes into focus from these considerations: the host for the origin of plastids was a facultative anaerobe. PMID:26323761

  16. Endosymbiotic theories for eukaryote origin.

    PubMed

    Martin, William F; Garg, Sriram; Zimorski, Verena

    2015-09-26

    For over 100 years, endosymbiotic theories have figured in thoughts about the differences between prokaryotic and eukaryotic cells. More than 20 different versions of endosymbiotic theory have been presented in the literature to explain the origin of eukaryotes and their mitochondria. Very few of those models account for eukaryotic anaerobes. The role of energy and the energetic constraints that prokaryotic cell organization placed on evolutionary innovation in cell history has recently come to bear on endosymbiotic theory. Only cells that possessed mitochondria had the bioenergetic means to attain eukaryotic cell complexity, which is why there are no true intermediates in the prokaryote-to-eukaryote transition. Current versions of endosymbiotic theory have it that the host was an archaeon (an archaebacterium), not a eukaryote. Hence the evolutionary history and biology of archaea increasingly comes to bear on eukaryotic origins, more than ever before. Here, we have compiled a survey of endosymbiotic theories for the origin of eukaryotes and mitochondria, and for the origin of the eukaryotic nucleus, summarizing the essentials of each and contrasting some of their predictions to the observations. A new aspect of endosymbiosis in eukaryote evolution comes into focus from these considerations: the host for the origin of plastids was a facultative anaerobe. PMID:26323761

  17. A molecular time-scale for eukaryote evolution recalibrated with the continuous microfossil record

    PubMed Central

    Berney, Cédric; Pawlowski, Jan

    2006-01-01

    Recent attempts to establish a molecular time-scale of eukaryote evolution failed to provide a congruent view on the timing of the origin and early diversification of eukaryotes. The major discrepancies in molecular time estimates are related to questions concerning the calibration of the tree. To limit these uncertainties, we used here as a source of calibration points the rich and continuous microfossil record of dinoflagellates, diatoms and coccolithophorids. We calibrated a small-subunit ribosomal RNA tree of eukaryotes with four maximum and 22 minimum time constraints. Using these multiple calibration points in a Bayesian relaxed molecular clock framework, we inferred that the early radiation of eukaryotes occurred near the Mesoproterozoic–Neoproterozoic boundary, about 1100 million years ago. Our results indicate that most Proterozoic fossils of possible eukaryotic origin cannot be confidently assigned to extant lineages and should therefore not be used as calibration points in molecular dating. PMID:16822745

  18. Translational control by 5'-untranslated regions of eukaryotic mRNAs.

    PubMed

    Hinnebusch, Alan G; Ivanov, Ivaylo P; Sonenberg, Nahum

    2016-06-17

    The eukaryotic 5' untranslated region (UTR) is critical for ribosome recruitment to the messenger RNA (mRNA) and start codon choice and plays a major role in the control of translation efficiency and shaping the cellular proteome. The ribosomal initiation complex is assembled on the mRNA via a cap-dependent or cap-independent mechanism. We describe various mechanisms controlling ribosome scanning and initiation codon selection by 5' upstream open reading frames, translation initiation factors, and primary and secondary structures of the 5'UTR, including particular sequence motifs. We also discuss translational control via phosphorylation of eukaryotic initiation factor 2, which is implicated in learning and memory, neurodegenerative diseases, and cancer. PMID:27313038

  19. Rational Extension of the Ribosome Biogenesis Pathway Using Network-Guided Genetics

    PubMed Central

    Li, Zhihua; Lee, Insuk; Moradi, Emily; Hung, Nai-Jung; Johnson, Arlen W.; Marcotte, Edward M.

    2009-01-01

    Biogenesis of ribosomes is an essential cellular process conserved across all eukaryotes and is known to require >170 genes for the assembly, modification, and trafficking of ribosome components through multiple cellular compartments. Despite intensive study, this pathway likely involves many additional genes. Here, we employ network-guided genetics—an approach for associating candidate genes with biological processes that capitalizes on recent advances in functional genomic and proteomic studies—to computationally identify additional ribosomal biogenesis genes. We experimentally evaluated >100 candidate yeast genes in a battery of assays, confirming involvement of at least 15 new genes, including previously uncharacterized genes (YDL063C, YIL091C, YOR287C, YOR006C/TSR3, YOL022C/TSR4). We associate the new genes with specific aspects of ribosomal subunit maturation, ribosomal particle association, and ribosomal subunit nuclear export, and we identify genes specifically required for the processing of 5S, 7S, 20S, 27S, and 35S rRNAs. These results reveal new connections between ribosome biogenesis and mRNA splicing and add >10% new genes—most with human orthologs—to the biogenesis pathway, significantly extending our understanding of a universally conserved eukaryotic process. PMID:19806183

  20. PTRF/Cavin-1 promotes efficient ribosomal RNA transcription in response to metabolic challenges.

    PubMed

    Liu, Libin; Pilch, Paul F

    2016-01-01

    Ribosomal RNA transcription mediated by RNA polymerase I represents the rate-limiting step in ribosome biogenesis. In eukaryotic cells, nutrients and growth factors regulate ribosomal RNA transcription through various key factors coupled to cell growth. We show here in mature adipocytes, ribosomal transcription can be acutely regulated in response to metabolic challenges. This acute response is mediated by PTRF (polymerase I transcription and release factor, also known as cavin-1), which has previously been shown to play a critical role in caveolae formation. The caveolae-independent rDNA transcriptional role of PTRF not only explains the lipodystrophy phenotype observed in PTRF deficient mice and humans, but also highlights its crucial physiological role in maintaining adipocyte allostasis. Multiple post-translational modifications of PTRF provide mechanistic bases for its regulation. The role of PTRF in ribosomal transcriptional efficiency is likely relevant to many additional physiological situations of cell growth and organismal metabolism. PMID:27528195

  1. Ribosome biogenesis: emerging evidence for a central role in the regulation of skeletal muscle mass†

    PubMed Central

    Chaillou, Thomas; Kirby, Tyler J.; McCarthy, John J.

    2016-01-01

    The ribosome is a supramolecular ribonucleoprotein complex that functions at the heart of the translation machinery to convert mRNA into protein. Ribosome biogenesis is the primary determinant of translational capacity of the cell and accordingly has an essential role in the control of cell growth in eukaryotes. Cumulative evidence supports the hypothesis that ribosome biogenesis has an important role in the regulation of skeletal muscle mass. The purpose of this review is to, first, summarize the main mechanisms known to regulate ribosome biogenesis and, second, put forth the hypothesis that ribosome biogenesis is a central mechanism used by skeletal muscle to regulate protein synthesis and control skeletal muscle mass in response to anabolic and catabolic stimuli. The mTORC1 and Wnt/β-catenin/c-myc signaling pathways are discussed as the major pathways that work in concert with each of the three RNA polymerases (RNA Pol I, II and III) in regulating ribosome biogenesis. Consistent with our hypothesis, activation of these two pathways has been shown to be associated with ribosome biogenesis during skeletal muscle hypertrophy. Although further study is required, the finding that ribosome biogenesis is altered under catabolic states, in particular during disuse atrophy, suggests that its activation represents a novel therapeutic target to reduce or prevent muscle atrophy. Lastly, the emerging field of ribosome specialization is discussed and its potential role in the regulation of gene expression during periods of skeletal muscle plasticity. PMID:24604615

  2. Ribosomal Slowdown Mediates Translational Arrest during Cellular Division▿

    PubMed Central

    Sivan, Gilad; Kedersha, Nancy; Elroy-Stein, Orna

    2007-01-01

    Global mRNA translation is transiently inhibited during cellular division. We demonstrate that mitotic cells contain heavy polysomes, but these are significantly less translationally active than polysomes in cycling cells. Several observations indicate that mitotic translational attenuation occurs during the elongation stage: (i) in cycling nonsynchronized cultures, only mitotic cells fail to assemble stress granules when treated with agents that inhibit translational initiation; (ii) mitotic cells contain fewer free 80S complexes, which are less sensitive to high salt disassembly; (iii) mitotic polysomes are more resistant to enforced disassembly using puromycin; and (iv) ribosome transit time increases during mitosis. Elongation slowdown guarantees that polysomes are retained even if initiation is inhibited at the same time. Stalling translating ribosomes during mitosis may protect mRNAs and allow rapid resumption of translation immediately upon entry into the G1 phase. PMID:17664278

  3. Subseabed Radioactive Waste Disposal Feasibility Program: ocean engineering challenges for the 80's

    SciTech Connect

    Talbert, D. M.

    1980-01-01

    The objective of the Subseabed Disposal Program is to assess the feasibility of disposing of high-level radioactive wastes or spent fuel in suitable geologic formations beneath the deep ocean floor. The program is entering a phase which will address engineering feasibility. While the current phase of the program to determine the scientific and environmental feasibility of the concept is not yet complete, activities to assess the engineering aspects are being initiated in parallel to facilitate the development of the concept on a time scale commensurate with other related programs both in the United States and abroad. It is anticipated that engineering aspects will become the central focus of the program during the early 80's and will continue so through the establishment of a pilot-plant level activity which could occur by the mid-90's.

  4. Ribosome Assembly as Antimicrobial Target

    PubMed Central

    Nikolay, Rainer; Schmidt, Sabine; Schlömer, Renate; Deuerling, Elke; Nierhaus, Knud H.

    2016-01-01

    Many antibiotics target the ribosome and interfere with its translation cycle. Since translation is the source of all cellular proteins including ribosomal proteins, protein synthesis and ribosome assembly are interdependent. As a consequence, the activity of translation inhibitors might indirectly cause defective ribosome assembly. Due to the difficulty in distinguishing between direct and indirect effects, and because assembly is probably a target in its own right, concepts are needed to identify small molecules that directly inhibit ribosome assembly. Here, we summarize the basic facts of ribosome targeting antibiotics. Furthermore, we present an in vivo screening strategy that focuses on ribosome assembly by a direct fluorescence based read-out that aims to identify and characterize small molecules acting as primary assembly inhibitors. PMID:27240412

  5. Ribosome Assembly as Antimicrobial Target.

    PubMed

    Nikolay, Rainer; Schmidt, Sabine; Schlömer, Renate; Deuerling, Elke; Nierhaus, Knud H

    2016-01-01

    Many antibiotics target the ribosome and interfere with its translation cycle. Since translation is the source of all cellular proteins including ribosomal proteins, protein synthesis and ribosome assembly are interdependent. As a consequence, the activity of translation inhibitors might indirectly cause defective ribosome assembly. Due to the difficulty in distinguishing between direct and indirect effects, and because assembly is probably a target in its own right, concepts are needed to identify small molecules that directly inhibit ribosome assembly. Here, we summarize the basic facts of ribosome targeting antibiotics. Furthermore, we present an in vivo screening strategy that focuses on ribosome assembly by a direct fluorescence based read-out that aims to identify and characterize small molecules acting as primary assembly inhibitors. PMID:27240412

  6. Modifying the maker: Oxygenases target ribosome biology.

    PubMed

    Zhuang, Qinqin; Feng, Tianshu; Coleman, Mathew L

    2015-01-01

    The complexity of the eukaryotic protein synthesis machinery is partly driven by extensive and diverse modifications to associated proteins and RNAs. These modifications can have important roles in regulating translation factor activity and ribosome biogenesis and function. Further investigation of 'translational modifications' is warranted considering the growing evidence implicating protein synthesis as a critical point of gene expression control that is commonly deregulated in disease. New evidence suggests that translation is a major new target for oxidative modifications, specifically hydroxylations and demethylations, which generally are catalyzed by a family of emerging oxygenase enzymes that act at the interface of nutrient availability and metabolism. This review summarizes what is currently known about the role or these enzymes in targeting rRNA synthesis, protein translation and associated cellular processes. PMID:26779412

  7. Compilation of small ribosomal subunit RNA structures.

    PubMed Central

    Neefs, J M; Van de Peer, Y; De Rijk, P; Chapelle, S; De Wachter, R

    1993-01-01

    The database on small ribosomal subunit RNA structure contained 1804 nucleotide sequences on April 23, 1993. This number comprises 365 eukaryotic, 65 archaeal, 1260 bacterial, 30 plastidial, and 84 mitochondrial sequences. These are stored in the form of an alignment in order to facilitate the use of the database as input for comparative studies on higher-order structure and for reconstruction of phylogenetic trees. The elements of the postulated secondary structure for each molecule are indicated by special symbols. The database is available on-line directly from the authors by ftp and can also be obtained from the EMBL nucleotide sequence library by electronic mail, ftp, and on CD ROM disk. PMID:8332525

  8. Modifying the maker: Oxygenases target ribosome biology

    PubMed Central

    Zhuang, Qinqin; Feng, Tianshu; Coleman, Mathew L

    2015-01-01

    The complexity of the eukaryotic protein synthesis machinery is partly driven by extensive and diverse modifications to associated proteins and RNAs. These modifications can have important roles in regulating translation factor activity and ribosome biogenesis and function. Further investigation of ‘translational modifications’ is warranted considering the growing evidence implicating protein synthesis as a critical point of gene expression control that is commonly deregulated in disease. New evidence suggests that translation is a major new target for oxidative modifications, specifically hydroxylations and demethylations, which generally are catalyzed by a family of emerging oxygenase enzymes that act at the interface of nutrient availability and metabolism. This review summarizes what is currently known about the role or these enzymes in targeting rRNA synthesis, protein translation and associated cellular processes. PMID:26779412

  9. Structural basis for stop codon recognition in eukaryotes

    PubMed Central

    Murray, Jason; Hegde, Ramanujan S.; Ramakrishnan, V.

    2015-01-01

    Termination of protein synthesis occurs when a translating ribosome encounters one of three universally conserved stop codons: UGA, UAA, or UAG. Release factors recognise stop codons in the ribosomal A site to mediate release of the nascent chain and recycling of the ribosome. Bacteria decode stop codons using two separate release factors with differing specificities for the second and third bases1. By contrast, eukaryotes rely on an evolutionarily unrelated omnipotent release factor (eRF1) to recognise all three stop codons2. The molecular basis of eRF1 discrimination for stop codons over sense codons is not known. Here, we present electron cryo-microscopy (cryo-EM) structures at 3.5 – 3.8 Å resolution of mammalian ribosomal complexes containing eRF1 interacting with each of the three stop codons in the A site. Binding of eRF1 flips nucleotide A1825 of 18S rRNA so that it stacks on the second and third stop codon bases. This configuration pulls the fourth position base into the A site, where it is stabilised by stacking against G626 of 18S rRNA. Thus, eRF1 exploits two rRNA nucleotides also used during tRNA selection to drive mRNA compaction. Stop codons are favoured in this compacted mRNA conformation by a hydrogen-bonding network with essential eRF1 residues that constrains the identity of the bases. These results provide a molecular framework for eukaryotic stop codon recognition and have implications for future studies on the mechanisms of canonical and premature translation termination3,4. PMID:26245381

  10. Ribosomal Database Project II

    DOE Data Explorer

    The Ribosomal Database Project (RDP) provides ribosome related data and services to the scientific community, including online data analysis and aligned and annotated Bacterial small-subunit 16S rRNA sequences. As of March 2008, RDP Release 10 is available and currently (August 2009) contains 1,074,075 aligned 16S rRNA sequences. Data that can be downloaded include zipped GenBank and FASTA alignment files, a histogram (in Excel) of the number of RDP sequences spanning each base position, data in the Functional Gene Pipeline Repository, and various user submitted data. The RDP-II website also provides numerous analysis tools.[From the RDP-II home page at http://rdp.cme.msu.edu/index.jsp

  11. Expanding the eukaryotic genetic code

    SciTech Connect

    Chin, Jason W.; Cropp, T. Ashton; Anderson, J. Christopher; Schultz, Peter G.

    2013-01-22

    This invention provides compositions and methods for producing translational components that expand the number of genetically encoded amino acids in eukaryotic cells. The components include orthogonal tRNAs, orthogonal aminoacyl-tRNA synthetases, orthogonal pairs of tRNAs/synthetases and unnatural amino acids. Proteins and methods of producing proteins with unnatural amino acids in eukaryotic cells are also provided.

  12. Expanding the eukaryotic genetic code

    SciTech Connect

    Chin, Jason W.; Cropp, T. Ashton; Anderson, J. Christopher; Schultz, Peter G.

    2012-02-14

    This invention provides compositions and methods for producing translational components that expand the number of genetically encoded amino acids in eukaryotic cells. The components include orthogonal tRNAs, orthogonal aminoacyl-tRNA synthetases, orthogonal pairs of tRNAs/synthetases and unnatural amino acids. Proteins and methods of producing proteins with unnatural amino acids in eukaryotic cells are also provided.

  13. Expanding the eukaryotic genetic code

    SciTech Connect

    Chin, Jason W; Cropp, T. Ashton; Anderson, J. Christopher; Schultz, Peter G

    2015-02-03

    This invention provides compositions and methods for producing translational components that expand the number of genetically encoded amino acids in eukaryotic cells. The components include orthogonal tRNAs, orthogonal aminoacyl-tRNA synthetases, orthogonal pairs of tRNAs/synthetases and unnatural amino acids. Proteins and methods of producing proteins with unnatural amino acids in eukaryotic cells are also provided.

  14. Expanding the eukaryotic genetic code

    SciTech Connect

    Chin, Jason W.; Cropp, T. Ashton; Anderson, J. Christopher; Schultz, Peter G.

    2012-05-08

    This invention provides compositions and methods for producing translational components that expand the number of genetically encoded amino acids in eukaryotic cells. The components include orthogonal tRNAs, orthogonal aminoacyl-tRNA synthetases, orthogonal pairs of tRNAs/synthetases and unnatural amino acids. Proteins and methods of producing proteins with unnatural amino acids in eukaryotic cells are also provided.

  15. Expanding the eukaryotic genetic code

    DOEpatents

    Chin, Jason W.; Cropp, T. Ashton; Anderson, J. Christopher; Schultz, Peter G.

    2009-11-17

    This invention provides compositions and methods for producing translational components that expand the number of genetically encoded amino acids in eukaryotic cells. The components include orthogonal tRNAs, orthogonal aminoacyl-tRNA synthetases, orthogonal pairs of tRNAs/synthetases and unnatural amino acids. Proteins and methods of producing proteins with unnatural amino acids in eukaryotic cells are also provided.

  16. Expanding the eukaryotic genetic code

    DOEpatents

    Chin, Jason W.; Cropp, T. Ashton; Anderson, J. Christopher; Schultz, Peter G.

    2009-12-01

    This invention provides compositions and methods for producing translational components that expand the number of genetically encoded amino acids in eukaryotic cells. The components include orthogonal tRNAs, orthogonal aminoacyl-tRNA synthetases, orthogonal pairs of tRNAs/synthetases and unnatural amino acids. Proteins and methods of producing proteins with unnatural amino acids in eukaryotic cells are also provided.

  17. Expanding the eukaryotic genetic code

    DOEpatents

    Chin, Jason W.; Cropp, T. Ashton; Anderson, J. Christopher; Schultz, Peter G.

    2009-10-27

    This invention provides compositions and methods for producing translational components that expand the number of genetically encoded amino acids in eukaryotic cells. The components include orthogonal tRNAs, orthogonal aminoacyl-tRNA synthetases, orthogonal pairs of tRNAs/synthetases and unnatural amino acids. Proteins and methods of producing proteins with unnatural amino acids in eukaryotic cells are also provided.

  18. Expanding the eukaryotic genetic code

    DOEpatents

    Chin, Jason W.; Cropp, T. Ashton; Anderson, J. Christopher; Schultz, Peter G.

    2010-09-14

    This invention provides compositions and methods for producing translational components that expand the number of genetically encoded amino acids in eukaryotic cells. The components include orthogonal tRNAs, orthogonal aminoacyl-tRNA synthetases, orthogonal pairs of tRNAs/synthetases and unnatural amino acids. Proteins and methods of producing proteins with unnatural amino acids in eukaryotic cells are also provided.

  19. Endosymbiosis and Eukaryotic Cell Evolution.

    PubMed

    Archibald, John M

    2015-10-01

    Understanding the evolution of eukaryotic cellular complexity is one of the grand challenges of modern biology. It has now been firmly established that mitochondria and plastids, the classical membrane-bound organelles of eukaryotic cells, evolved from bacteria by endosymbiosis. In the case of mitochondria, evidence points very clearly to an endosymbiont of α-proteobacterial ancestry. The precise nature of the host cell that partnered with this endosymbiont is, however, very much an open question. And while the host for the cyanobacterial progenitor of the plastid was undoubtedly a fully-fledged eukaryote, how - and how often - plastids moved from one eukaryote to another during algal diversification is vigorously debated. In this article I frame modern views on endosymbiotic theory in a historical context, highlighting the transformative role DNA sequencing played in solving early problems in eukaryotic cell evolution, and posing key unanswered questions emerging from the age of comparative genomics. PMID:26439354

  20. Synchronization of Eukaryotic Flagella

    NASA Astrophysics Data System (ADS)

    Goldstein, Raymond E.

    2012-11-01

    From unicellular organisms as small as a few microns to the largest vertebrates on earth we find groups of beating flagella or cilia that exhibit striking spatio-temporal organization. This may take the form of precise frequency and phase locking as frequently found in the swimming of green algae, or beating with long-wavelength phase modulations known as metachronal waves, seen in ciliates and in our respiratory systems. The remarkable similarity in the underlying molecular structure of flagella across the whole eukaryotic world leads naturally to the hypothesis that a similarly universal mechanism might be responsible for synchronization. Although this mechanism is poorly understood, one appealing hypothesis is that it results from hydrodynamic interactions between flagella. In this talk I will describe a synthesis of recent experimental and theoretical studies of this issue that have provided the strongest evidence to date for the hydrodynamic origin of flagellar synchronization. At the unicellular level this includes studies of the beating of the two flagella of the wild type unicellular alga Chlamydomonas reinhardtii in their native state and under conditions of regrowth following autotomy, and of the flagellar dominance mutant ptx1, which displays unusual anti-phase synchronization. Analysis of the related multicellular organism Volvox carteri shows it to be an ideal model organism for the study of metachronal waves. Supported by BBSRC, EPSRC, ERC, and The Wellcome Trust.

  1. Disruption of ribosome assembly in yeast blocks cotranscriptional pre-rRNA processing and affects the global hierarchy of ribosome biogenesis.

    PubMed

    Talkish, Jason; Biedka, Stephanie; Jakovljevic, Jelena; Zhang, Jingyu; Tang, Lan; Strahler, John R; Andrews, Philip C; Maddock, Janine R; Woolford, John L

    2016-06-01

    In higher eukaryotes, pre-rRNA processing occurs almost exclusively post-transcriptionally. This is not the case in rapidly dividing yeast, as the majority of nascent pre-rRNAs are processed cotranscriptionally, with cleavage at the A2 site first releasing a pre-40S ribosomal subunit followed by release of a pre-60S ribosomal subunit upon transcription termination. Ribosome assembly is driven in part by hierarchical association of assembly factors and r-proteins. Groups of proteins are thought to associate with pre-ribosomes cotranscriptionally during early assembly steps, whereas others associate later, after transcription is completed. Here we describe a previously uncharacterized phenotype observed upon disruption of ribosome assembly, in which normally late-binding proteins associate earlier, with pre-ribosomes containing 35S pre-rRNA. As previously observed by many other groups, we show that disruption of 60S subunit biogenesis results in increased amounts of 35S pre-rRNA, suggesting that a greater fraction of pre-rRNAs are processed post-transcriptionally. Surprisingly, we found that early pre-ribosomes containing 35S pre-rRNA also contain proteins previously thought to only associate with pre-ribosomes after early pre-rRNA processing steps have separated maturation of the two subunits. We believe the shift to post-transcriptional processing is ultimately due to decreased cellular division upon disruption of ribosome assembly. When cells are grown under stress or to high density, a greater fraction of pre-rRNAs are processed post-transcriptionally and follow an alternative processing pathway. Together, these results affirm the principle that ribosome assembly occurs through different, parallel assembly pathways and suggest that there is a kinetic foot-race between the formation of protein binding sites and pre-rRNA processing events. PMID:27036125

  2. Maize reas1 Mutant Stimulates Ribosome Use Efficiency and Triggers Distinct Transcriptional and Translational Responses.

    PubMed

    Qi, Weiwei; Zhu, Jie; Wu, Qiao; Wang, Qun; Li, Xia; Yao, Dongsheng; Jin, Ying; Wang, Gang; Wang, Guifeng; Song, Rentao

    2016-02-01

    Ribosome biogenesis is a fundamental cellular process in all cells. Impaired ribosome biogenesis causes developmental defects; however, its molecular and cellular bases are not fully understood. We cloned a gene responsible for a maize (Zea mays) small seed mutant, dek* (for defective kernel), and found that it encodes Ribosome export associated1 (ZmReas1). Reas1 is an AAA-ATPase that controls 60S ribosome export from the nucleus to the cytoplasm after ribosome maturation. dek* is a weak mutant allele with decreased Reas1 function. In dek* cells, mature 60S ribosome subunits are reduced in the nucleus and cytoplasm, but the proportion of actively translating polyribosomes in cytosol is significantly increased. Reduced phosphorylation of eukaryotic initiation factor 2α and the increased elongation factor 1α level indicate an enhancement of general translational efficiency in dek* cells. The mutation also triggers dramatic changes in differentially transcribed genes and differentially translated RNAs. Discrepancy was observed between differentially transcribed genes and differentially translated RNAs, indicating distinct cellular responses at transcription and translation levels to the stress of defective ribosome processing. DNA replication and nucleosome assembly-related gene expression are selectively suppressed at the translational level, resulting in inhibited cell growth and proliferation in dek* cells. This study provides insight into cellular responses due to impaired ribosome biogenesis. PMID:26645456

  3. Diverse roles of assembly factors revealed by structures of late nuclear pre-60S ribosomes.

    PubMed

    Wu, Shan; Tutuncuoglu, Beril; Yan, Kaige; Brown, Hailey; Zhang, Yixiao; Tan, Dan; Gamalinda, Michael; Yuan, Yi; Li, Zhifei; Jakovljevic, Jelena; Ma, Chengying; Lei, Jianlin; Dong, Meng-Qiu; Woolford, John L; Gao, Ning

    2016-06-01

    Ribosome biogenesis is a highly complex process in eukaryotes, involving temporally and spatially regulated ribosomal protein (r-protein) binding and ribosomal RNA remodelling events in the nucleolus, nucleoplasm and cytoplasm. Hundreds of assembly factors, organized into sequential functional groups, facilitate and guide the maturation process into productive assembly branches in and across different cellular compartments. However, the precise mechanisms by which these assembly factors function are largely unknown. Here we use cryo-electron microscopy to characterize the structures of yeast nucleoplasmic pre-60S particles affinity-purified using the epitope-tagged assembly factor Nog2. Our data pinpoint the locations and determine the structures of over 20 assembly factors, which are enriched in two areas: an arc region extending from the central protuberance to the polypeptide tunnel exit, and the domain including the internal transcribed spacer 2 (ITS2) that separates 5.8S and 25S ribosomal RNAs. In particular, two regulatory GTPases, Nog2 and Nog1, act as hub proteins to interact with multiple, distant assembly factors and functional ribosomal RNA elements, manifesting their critical roles in structural remodelling checkpoints and nuclear export. Moreover, our snapshots of compositionally and structurally different pre-60S intermediates provide essential mechanistic details for three major remodelling events before nuclear export: rotation of the 5S ribonucleoprotein, construction of the active centre and ITS2 removal. The rich structural information in our structures provides a framework to dissect molecular roles of diverse assembly factors in eukaryotic ribosome assembly. PMID:27251291

  4. Origins of Eukaryotic Sexual Reproduction

    PubMed Central

    2014-01-01

    Sexual reproduction is a nearly universal feature of eukaryotic organisms. Given its ubiquity and shared core features, sex is thought to have arisen once in the last common ancestor to all eukaryotes. Using the perspectives of molecular genetics and cell biology, we consider documented and hypothetical scenarios for the instantiation and evolution of meiosis, fertilization, sex determination, uniparental inheritance of organelle genomes, and speciation. PMID:24591519

  5. Ribosomes in a Stacked Array

    PubMed Central

    Yamashita, Yui; Kadokura, Yoshitomo; Sotta, Naoyuki; Fujiwara, Toru; Takigawa, Ichigaku; Satake, Akiko; Onouchi, Hitoshi; Naito, Satoshi

    2014-01-01

    Expression of CGS1, which codes for an enzyme of methionine biosynthesis, is feedback-regulated by mRNA degradation in response to S-adenosyl-l-methionine (AdoMet). In vitro studies revealed that AdoMet induces translation arrest at Ser-94, upon which several ribosomes stack behind the arrested one, and mRNA degradation occurs at multiple sites that presumably correspond to individual ribosomes in a stacked array. Despite the significant contribution of stacked ribosomes to inducing mRNA degradation, little is known about the ribosomes in the stacked array. Here, we assigned the peptidyl-tRNA species of the stacked second and third ribosomes to their respective codons and showed that they are arranged at nine-codon intervals behind the Ser-94 codon, indicating tight stacking. Puromycin reacts with peptidyl-tRNA in the P-site, releasing the nascent peptide as peptidyl-puromycin. This reaction is used to monitor the activity of the peptidyltransferase center (PTC) in arrested ribosomes. Puromycin reaction of peptidyl-tRNA on the AdoMet-arrested ribosome, which is stalled at the pre-translocation step, was slow. This limited reactivity can be attributed to the peptidyl-tRNA occupying the A-site at this step rather than to suppression of PTC activity. In contrast, puromycin reactions of peptidyl-tRNA with the stacked second and third ribosomes were slow but were not as slow as pre-translocation step ribosomes. We propose that the anticodon end of peptidyl-tRNA resides in the A-site of the stacked ribosomes and that the stacked ribosomes are stalled at an early step of translocation, possibly at the P/E hybrid state. PMID:24652291

  6. Exploring Ribosome Positioning on Translating Transcripts with Ribosome Profiling.

    PubMed

    Spealman, Pieter; Wang, Hao; May, Gemma; Kingsford, Carl; McManus, C Joel

    2016-01-01

    Recent technological advances (e.g., microarrays and massively parallel sequencing) have facilitated genome-wide measurement of many aspects of gene regulation. Ribosome profiling is a high-throughput sequencing method used to measure gene expression at the level of translation. This is accomplished by quantifying both the number of translating ribosomes and their locations on mRNA transcripts. The inventors of this approach have published several methods papers detailing its implementation and addressing the basics of ribosome profiling data analysis. Here we describe our lab's procedure, which differs in some respects from those published previously. In addition, we describe a data analysis pipeline, Ribomap, for ribosome profiling data. Ribomap allocates sequence reads to alternative mRNA isoforms, normalizes sequencing bias along transcripts using RNA-seq data, and outputs count vectors of per-codon ribosome occupancy for each transcript. PMID:26463378

  7. Archaeology of Eukaryotic DNA Replication

    PubMed Central

    Makarova, Kira S.; Koonin, Eugene V.

    2013-01-01

    Recent advances in the characterization of the archaeal DNA replication system together with comparative genomic analysis have led to the identification of several previously uncharacterized archaeal proteins involved in replication and currently reveal a nearly complete correspondence between the components of the archaeal and eukaryotic replication machineries. It can be inferred that the archaeal ancestor of eukaryotes and even the last common ancestor of all extant archaea possessed replication machineries that were comparable in complexity to the eukaryotic replication system. The eukaryotic replication system encompasses multiple paralogs of ancestral components such that heteromeric complexes in eukaryotes replace archaeal homomeric complexes, apparently along with subfunctionalization of the eukaryotic complex subunits. In the archaea, parallel, lineage-specific duplications of many genes encoding replication machinery components are detectable as well; most of these archaeal paralogs remain to be functionally characterized. The archaeal replication system shows remarkable plasticity whereby even some essential components such as DNA polymerase and single-stranded DNA-binding protein are displaced by unrelated proteins with analogous activities in some lineages. PMID:23881942

  8. Phylogenomics Reshuffles the Eukaryotic Supergroups

    PubMed Central

    Burki, Fabien; Shalchian-Tabrizi, Kamran; Minge, Marianne; Skjæveland, Åsmund; Nikolaev, Sergey I.; Jakobsen, Kjetill S.; Pawlowski, Jan

    2007-01-01

    Background Resolving the phylogenetic relationships between eukaryotes is an ongoing challenge of evolutionary biology. In recent years, the accumulation of molecular data led to a new evolutionary understanding, in which all eukaryotic diversity has been classified into five or six supergroups. Yet, the composition of these large assemblages and their relationships remain controversial. Methodology/Principle Findings Here, we report the sequencing of expressed sequence tags (ESTs) for two species belonging to the supergroup Rhizaria and present the analysis of a unique dataset combining 29908 amino acid positions and an extensive taxa sampling made of 49 mainly unicellular species representative of all supergroups. Our results show a very robust relationship between Rhizaria and two main clades of the supergroup chromalveolates: stramenopiles and alveolates. We confirm the existence of consistent affinities between assemblages that were thought to belong to different supergroups of eukaryotes, thus not sharing a close evolutionary history. Conclusions This well supported phylogeny has important consequences for our understanding of the evolutionary history of eukaryotes. In particular, it questions a single red algal origin of the chlorophyll-c containing plastids among the chromalveolates. We propose the abbreviated name ‘SAR’ (Stramenopiles+Alveolates+Rhizaria) to accommodate this new super assemblage of eukaryotes, which comprises the largest diversity of unicellular eukaryotes. PMID:17726520

  9. Size matters: a view of selenocysteine incorporation from the ribosome.

    PubMed

    Caban, K; Copeland, P R

    2006-01-01

    This review focuses on the known factors required for selenocysteine (Sec) incorporation in eukaryotes and highlights recent findings that have compelled us to propose a new model for the mechanism of Sec incorporation. In light of this data we also review the controversial aspects of the previous model specifically regarding the proposed interaction between SBP2 and eEFSec. In addition, the relevance of two recently discovered factors in the recoding of Sec are reviewed. The role of the ribosome in this process is emphasized along with a detailed analysis of kinkturn structures present in the ribosome and the L7Ae RNA-binding motif present in SBP2 and other proteins. PMID:16416259

  10. Three distinct ribosome assemblies modulated by translation are the building blocks of polysomes.

    PubMed

    Viero, Gabriella; Lunelli, Lorenzo; Passerini, Andrea; Bianchini, Paolo; Gilbert, Robert J; Bernabò, Paola; Tebaldi, Toma; Diaspro, Alberto; Pederzolli, Cecilia; Quattrone, Alessandro

    2015-03-01

    Translation is increasingly recognized as a central control layer of gene expression in eukaryotic cells. The overall organization of mRNA and ribosomes within polysomes, as well as the possible role of this organization in translation are poorly understood. Here we show that polysomes are primarily formed by three distinct classes of ribosome assemblies. We observe that these assemblies can be connected by naked RNA regions of the transcript. We show that the relative proportions of the three classes of ribosome assemblies reflect, and probably dictate, the level of translational activity. These results reveal the existence of recurrent supra-ribosomal building blocks forming polysomes and suggest the presence of unexplored translational controls embedded in the polysome structure. PMID:25713412

  11. Three distinct ribosome assemblies modulated by translation are the building blocks of polysomes

    PubMed Central

    Lunelli, Lorenzo; Passerini, Andrea; Bianchini, Paolo; Gilbert, Robert J.; Bernabò, Paola; Tebaldi, Toma; Diaspro, Alberto; Pederzolli, Cecilia

    2015-01-01

    Translation is increasingly recognized as a central control layer of gene expression in eukaryotic cells. The overall organization of mRNA and ribosomes within polysomes, as well as the possible role of this organization in translation are poorly understood. Here we show that polysomes are primarily formed by three distinct classes of ribosome assemblies. We observe that these assemblies can be connected by naked RNA regions of the transcript. We show that the relative proportions of the three classes of ribosome assemblies reflect, and probably dictate, the level of translational activity. These results reveal the existence of recurrent supra-ribosomal building blocks forming polysomes and suggest the presence of unexplored translational controls embedded in the polysome structure. PMID:25713412

  12. The unfolded protein response triggers site-specific regulatory ubiquitylation of 40S ribosomal proteins

    PubMed Central

    Rising, Lisa; Mak, Raymond; Webb, Kristofor; Kaiser, Stephen E.; Zuzow, Nathan; Riviere, Paul; Yang, Bing; Fenech, Emma; Tang, Xin; Lindsay, Scott A.; Christianson, John C.; Hampton, Randolph Y.; Wasserman, Steven A.; Bennett, Eric J.

    2015-01-01

    Summary Insults to endoplasmic reticulum (ER) homeostasis activate the unfolded protein response (UPR), which elevates protein folding and degradation capacity and attenuates protein synthesis. While a role for ubiquitin in regulating the degradation of misfolded ER-resident proteins is well described, ubiquitin-dependent regulation of translational reprogramming during the UPR remains uncharacterized. Using global quantitative ubiquitin proteomics, we identify evolutionarily conserved, site-specific regulatory ubiquitylation of 40S ribosomal proteins. We demonstrate that these events occur on assembled cytoplasmic ribosomes and are stimulated by both UPR activation and translation inhibition. We further show that ER stress-stimulated regulatory 40S ribosomal ubiquitylation occurs on a timescale similar to eIF2α phosphorylation, is dependent upon PERK signaling, and is required for optimal cell survival during chronic UPR activation. In total, these results reveal regulatory 40S ribosomal ubiquitylation as a previously uncharacterized and important facet of eukaryotic translational control. PMID:26051182

  13. Eukaryotic Richness in the Abyss: Insights from Pyrotag Sequencing

    PubMed Central

    Pawlowski, Jan; Christen, Richard; Lecroq, Béatrice; Bachar, Dipankar; Shahbazkia, Hamid Reza; Amaral-Zettler, Linda; Guillou, Laure

    2011-01-01

    Background The deep sea floor is considered one of the most diverse ecosystems on Earth. Recent environmental DNA surveys based on clone libraries of rRNA genes confirm this observation and reveal a high diversity of eukaryotes present in deep-sea sediment samples. However, environmental clone-library surveys yield only a modest number of sequences with which to evaluate the diversity of abyssal eukaryotes. Methodology/Principal Findings Here, we examined the richness of eukaryotic DNA in deep Arctic and Southern Ocean samples using massively parallel sequencing of the 18S ribosomal RNA (rRNA) V9 hypervariable region. In very small volumes of sediments, ranging from 0.35 to 0.7 g, we recovered up to 7,499 unique sequences per sample. By clustering sequences having up to 3 differences, we observed from 942 to 1756 Operational Taxonomic Units (OTUs) per sample. Taxonomic analyses of these OTUs showed that DNA of all major groups of eukaryotes is represented at the deep-sea floor. The dinoflagellates, cercozoans, ciliates, and euglenozoans predominate, contributing to 17%, 16%, 10%, and 8% of all assigned OTUs, respectively. Interestingly, many sequences represent photosynthetic taxa or are similar to those reported from the environmental surveys of surface waters. Moreover, each sample contained from 31 to 71 different metazoan OTUs despite the small sample volume collected. This indicates that a significant faction of the eukaryotic DNA sequences likely do not belong to living organisms, but represent either free, extracellular DNA or remains and resting stages of planktonic species. Conclusions/Significance In view of our study, the deep-sea floor appears as a global DNA repository, which preserves genetic information about organisms living in the sediment, as well as in the water column above it. This information can be used for future monitoring of past and present environmental changes. PMID:21483744

  14. Parallel Structural Evolution of Mitochondrial Ribosomes and OXPHOS Complexes.

    PubMed

    van der Sluis, Eli O; Bauerschmitt, Heike; Becker, Thomas; Mielke, Thorsten; Frauenfeld, Jens; Berninghausen, Otto; Neupert, Walter; Herrmann, Johannes M; Beckmann, Roland

    2015-05-01

    The five macromolecular complexes that jointly mediate oxidative phosphorylation (OXPHOS) in mitochondria consist of many more subunits than those of bacteria, yet, it remains unclear by which evolutionary mechanism(s) these novel subunits were recruited. Even less well understood is the structural evolution of mitochondrial ribosomes (mitoribosomes): while it was long thought that their exceptionally high protein content would physically compensate for their uniquely low amount of ribosomal RNA (rRNA), this hypothesis has been refuted by structural studies. Here, we present a cryo-electron microscopy structure of the 73S mitoribosome from Neurospora crassa, together with genomic and proteomic analyses of mitoribosome composition across the eukaryotic domain. Surprisingly, our findings reveal that both structurally and compositionally, mitoribosomes have evolved very similarly to mitochondrial OXPHOS complexes via two distinct phases: A constructive phase that mainly acted early in eukaryote evolution, resulting in the recruitment of altogether approximately 75 novel subunits, and a reductive phase that acted during metazoan evolution, resulting in gradual length-reduction of mitochondrially encoded rRNAs and OXPHOS proteins. Both phases can be well explained by the accumulation of (slightly) deleterious mutations and deletions, respectively, in mitochondrially encoded rRNAs and OXPHOS proteins. We argue that the main role of the newly recruited (nuclear encoded) ribosomal- and OXPHOS proteins is to provide structural compensation to the mutationally destabilized mitochondrially encoded components. While the newly recruited proteins probably provide a selective advantage owing to their compensatory nature, and while their presence may have opened evolutionary pathways toward novel mitochondrion-specific functions, we emphasize that the initial events that resulted in their recruitment was nonadaptive in nature. Our framework is supported by population genetic

  15. Parallel Structural Evolution of Mitochondrial Ribosomes and OXPHOS Complexes

    PubMed Central

    van der Sluis, Eli O.; Bauerschmitt, Heike; Becker, Thomas; Mielke, Thorsten; Frauenfeld, Jens; Berninghausen, Otto; Neupert, Walter; Herrmann, Johannes M.; Beckmann, Roland

    2015-01-01

    The five macromolecular complexes that jointly mediate oxidative phosphorylation (OXPHOS) in mitochondria consist of many more subunits than those of bacteria, yet, it remains unclear by which evolutionary mechanism(s) these novel subunits were recruited. Even less well understood is the structural evolution of mitochondrial ribosomes (mitoribosomes): while it was long thought that their exceptionally high protein content would physically compensate for their uniquely low amount of ribosomal RNA (rRNA), this hypothesis has been refuted by structural studies. Here, we present a cryo-electron microscopy structure of the 73S mitoribosome from Neurospora crassa, together with genomic and proteomic analyses of mitoribosome composition across the eukaryotic domain. Surprisingly, our findings reveal that both structurally and compositionally, mitoribosomes have evolved very similarly to mitochondrial OXPHOS complexes via two distinct phases: A constructive phase that mainly acted early in eukaryote evolution, resulting in the recruitment of altogether approximately 75 novel subunits, and a reductive phase that acted during metazoan evolution, resulting in gradual length-reduction of mitochondrially encoded rRNAs and OXPHOS proteins. Both phases can be well explained by the accumulation of (slightly) deleterious mutations and deletions, respectively, in mitochondrially encoded rRNAs and OXPHOS proteins. We argue that the main role of the newly recruited (nuclear encoded) ribosomal- and OXPHOS proteins is to provide structural compensation to the mutationally destabilized mitochondrially encoded components. While the newly recruited proteins probably provide a selective advantage owing to their compensatory nature, and while their presence may have opened evolutionary pathways toward novel mitochondrion-specific functions, we emphasize that the initial events that resulted in their recruitment was nonadaptive in nature. Our framework is supported by population genetic

  16. Phylogenetic relationships of Cryptosporidium determined by ribosomal RNA sequence comparison.

    PubMed

    Johnson, A M; Fielke, R; Lumb, R; Baverstock, P R

    1990-04-01

    Reverse transcription of total cellular RNA was used to obtain a partial sequence of the small subunit ribosomal RNA of Cryptosporidium, a protist currently placed in the phylum Apicomplexa. The semi-conserved regions were aligned with homologous sequences in a range of other eukaryotes, and the evolutionary relationships of Cryptosporidium were determined by two different methods of phylogenetic analysis. The prokaryotes Escherichia coli and Halobacterium cuti were included as outgroups. The results do not show an especially close relationship of Cryptosporidium to other members of the phylum Apicomplexa. PMID:2332273

  17. Length-dependent translation of messenger RNA by ribosomes

    NASA Astrophysics Data System (ADS)

    Valleriani, Angelo; Zhang, Gong; Nagar, Apoorva; Ignatova, Zoya; Lipowsky, Reinhard

    2011-04-01

    A simple measure for the efficiency of protein synthesis by ribosomes is provided by the steady state amount of protein per messenger RNA (mRNA), the so-called translational ratio, which is proportional to the translation rate. Taking the degradation of mRNA into account, we show theoretically that both the translation rate and the translational ratio decrease with increasing mRNA length, in agreement with available experimental data for the prokaryote Escherichia coli. We also show that, compared to prokaryotes, mRNA degradation in eukaryotes leads to a less rapid decrease of the translational ratio. This finding is consistent with the fact that, compared to prokaryotes, eukaryotes tend to have longer proteins.

  18. Structural basis for translational surveillance by the large ribosomal subunit-associated protein quality control complex

    PubMed Central

    Lyumkis, Dmitry; Oliveira dos Passos, Dario; Tahara, Erich B.; Webb, Kristofor; Bennett, Eric J.; Vinterbo, Staal; Potter, Clinton S.; Carragher, Bridget; Joazeiro, Claudio A. P.

    2014-01-01

    All organisms have evolved mechanisms to manage the stalling of ribosomes upon translation of aberrant mRNA. In eukaryotes, the large ribosomal subunit-associated quality control complex (RQC), composed of the listerin/Ltn1 E3 ubiquitin ligase and cofactors, mediates the ubiquitylation and extraction of ribosome-stalled nascent polypeptide chains for proteasomal degradation. How RQC recognizes stalled ribosomes and performs its functions has not been understood. Using single-particle cryoelectron microscopy, we have determined the structure of the RQC complex bound to stalled 60S ribosomal subunits. The structure establishes how Ltn1 associates with the large ribosomal subunit and properly positions its E3-catalytic RING domain to mediate nascent chain ubiquitylation. The structure also reveals that a distinguishing feature of stalled 60S particles is an exposed, nascent chain-conjugated tRNA, and that the Tae2 subunit of RQC, which facilitates Ltn1 binding, is responsible for selective recognition of stalled 60S subunits. RQC components are engaged in interactions across a large span of the 60S subunit surface, connecting the tRNA in the peptidyl transferase center to the distally located nascent chain tunnel exit. This work provides insights into a mechanism linking translation and protein degradation that targets defective proteins immediately after synthesis, while ignoring nascent chains in normally translating ribosomes. PMID:25349383

  19. A liaison between mTOR signaling, ribosome biogenesis and cancer☆

    PubMed Central

    Gentilella, Antonio; Kozma, Sara C.; Thomas, George

    2016-01-01

    The ability to translate genetic information into functional proteins is considered a landmark in evolution. Ribosomes have evolved to take on this responsibility and, although there are some differences in their molecular make-up, both prokaryotes and eukaryotes share a common structural architecture and similar underlying mechanisms of protein synthesis. Understanding ribosome function and biogenesis has been the focus of extensive research since the early days of their discovery. In the last decade however, new and unexpected roles have emerged that place deregulated ribosome biogenesis and protein synthesis at the crossroads of pathological settings, particularly cancer, revealing a set of novel cellular checkpoints. Moreover, it is also becoming evident that mTOR signaling, which regulates an array of anabolic processes, including ribosome biogenesis, is often exploited by cancer cells to sustain proliferation through the upregulation of global protein synthesis. The use of pharmacological agents that interfere with ribosome biogenesis and mTOR signaling has proven to be an effective strategy to control cancer development clinically. Here we discuss the most recent findings concerning the underlying mechanisms by which mTOR signaling controls ribosome production and the potential impact of ribosome bio-genesis in tumor development. This article is part of a Special Issue entitled: Translation and Cancer. PMID:25735853

  20. Sequential domain assembly of ribosomal protein S3 drives 40S subunit maturation

    PubMed Central

    Mitterer, Valentin; Murat, Guillaume; Réty, Stéphane; Blaud, Magali; Delbos, Lila; Stanborough, Tamsyn; Bergler, Helmut; Leulliot, Nicolas; Kressler, Dieter; Pertschy, Brigitte

    2016-01-01

    Eukaryotic ribosomes assemble by association of ribosomal RNA with ribosomal proteins into nuclear precursor particles, which undergo a complex maturation pathway coordinated by non-ribosomal assembly factors. Here, we provide functional insights into how successive structural re-arrangements in ribosomal protein S3 promote maturation of the 40S ribosomal subunit. We show that S3 dimerizes and is imported into the nucleus with its N-domain in a rotated conformation and associated with the chaperone Yar1. Initial assembly of S3 with 40S precursors occurs via its C-domain, while the N-domain protrudes from the 40S surface. Yar1 is replaced by the assembly factor Ltv1, thereby fixing the S3 N-domain in the rotated orientation and preventing its 40S association. Finally, Ltv1 release, triggered by phosphorylation, and flipping of the S3 N-domain into its final position results in the stable integration of S3. Such a stepwise assembly may represent a new paradigm for the incorporation of ribosomal proteins. PMID:26831757

  1. Human Cells Require Non-stop Ribosome Rescue Activity in Mitochondria

    PubMed Central

    Feaga, Heather A.; Quickel, Michael D.; Hankey-Giblin, Pamela A.; Keiler, Kenneth C.

    2016-01-01

    Bacteria use trans-translation and the alternative rescue factors ArfA (P36675) and ArfB (Q9A8Y3) to hydrolyze peptidyl-tRNA on ribosomes that stall near the 3' end of an mRNA during protein synthesis. The eukaryotic protein ICT1 (Q14197) is homologous to ArfB. In vitro ribosome rescue assays of human ICT1 and Caulobacter crescentus ArfB showed that these proteins have the same activity and substrate specificity. Both ArfB and ICT1 hydrolyze peptidyl-tRNA on nonstop ribosomes or ribosomes stalled with ≤6 nucleotides extending past the A site, but are unable to hydrolyze peptidyl-tRNA when the mRNA extends ≥14 nucleotides past the A site. ICT1 provided sufficient ribosome rescue activity to support viability in C. crescentus cells that lacked both trans-translation and ArfB. Likewise, expression of ArfB protected human cells from death when ICT1 was silenced with siRNA. These data indicate that ArfB and ICT1 are functionally interchangeable, and demonstrate that ICT1 is a ribosome rescue factor. Because ICT1 is essential in human cells, these results suggest that ribosome rescue activity in mitochondria is required in humans. PMID:27029019

  2. Cap-dependent translation is mediated by 'RNA looping' rather than 'ribosome scanning'.

    PubMed

    Jang, Sung Key; Paek, Ki Young

    2016-01-01

    The 40S ribosomal subunit cannot directly recognize the start codon of eukaryotic mRNAs. Instead, it recognizes the start codon after its association with the 5'-cap structure via translation initiation factors. Base-by-base inspection of the 5'UTR by a scanning ribosome is the generally accepted hypothesis of start codon selection. As part of an effort to confirm the underlying mechanism of start codon selection by the 40S ribosome, we investigated the role of eIF4G, which participates in the recruitment of 40S ribosomes to various translation enhancers, such as 5'-cap structure, poly(A) tail, and several internal ribosome entry sites. We found that an artificial translation factor composed of recombinant eIF4G fused with MS2 greatly enhanced translation of an upstream reporter gene when it was tethered to the 3'UTR. These data suggest that the 40S ribosome recruited to a translation enhancer can find the start codon by looping of the intervening RNA segment. The 'RNA-looping' hypothesis of translation start codon recognition was further supported by an analysis of the effect of 5'UTR length on translation efficiency and the mathematically predicted probability of RNA-loop-mediated interactions between the start codon and the 40S ribosome associated at the 5'-end. PMID:26515582

  3. Proteome distribution between nucleoplasm and nucleolus and its relation to ribosome biogenesis in Arabidopsis thaliana.

    PubMed

    Palm, Denise; Simm, Stefan; Darm, Katrin; Weis, Benjamin L; Ruprecht, Maike; Schleiff, Enrico; Scharf, Christian

    2016-01-01

    Ribosome biogenesis is an essential process initiated in the nucleolus. In eukaryotes, multiple ribosome biogenesis factors (RBFs) can be found in the nucleolus, the nucleus and in the cytoplasm. They act in processing, folding and modification of the pre-ribosomal (r)RNAs, incorporation of ribosomal proteins (RPs), export of pre-ribosomal particles to the cytoplasm, and quality control mechanisms. Ribosome biogenesis is best established for Saccharomyces cerevisiae. Plant ortholog assignment to yeast RBFs revealed the absence of about 30% of the yeast RBFs in plants. In turn, few plant specific proteins have been identified by biochemical experiments to act in plant ribosome biogenesis. Nevertheless, a complete inventory of plant RBFs has not been established yet. We analyzed the proteome of the nucleus and nucleolus of Arabidopsis thaliana and the post-translational modifications of these proteins. We identified 1602 proteins in the nucleolar and 2544 proteins in the nuclear fraction with an overlap of 1429 proteins. For a randomly selected set of proteins identified by the proteomic approach we confirmed the localization inferred from the proteomics data by the localization of GFP fusion proteins. We assigned the identified proteins to various complexes and functions and found about 519 plant proteins that have a potential to act as a RBFs, but which have not been experimentally characterized yet. Last, we compared the distribution of RBFs and RPs in the various fractions with the distribution established for yeast. PMID:26980300

  4. Drug resistance in eukaryotic microorganisms.

    PubMed

    Fairlamb, Alan H; Gow, Neil A R; Matthews, Keith R; Waters, Andrew P

    2016-01-01

    Eukaryotic microbial pathogens are major contributors to illness and death globally. Although much of their impact can be controlled by drug therapy as with prokaryotic microorganisms, the emergence of drug resistance has threatened these treatment efforts. Here, we discuss the challenges posed by eukaryotic microbial pathogens and how these are similar to, or differ from, the challenges of prokaryotic antibiotic resistance. The therapies used for several major eukaryotic microorganisms are then detailed, and the mechanisms that they have evolved to overcome these therapies are described. The rapid emergence of resistance and the restricted pipeline of new drug therapies pose considerable risks to global health and are particularly acute in the developing world. Nonetheless, we detail how the integration of new technology, biological understanding, epidemiology and evolutionary analysis can help sustain existing therapies, anticipate the emergence of resistance or optimize the deployment of new therapies. PMID:27572976

  5. Synaptic view of eukaryotic cell

    NASA Astrophysics Data System (ADS)

    Baluška, František; Mancuso, Stefano

    2014-10-01

    Synapses are stable adhesive domains between two neighbouring cells of the multicellular organisms which serve for cell-cell communication as well as for information processing and storing. The synaptic concept was developed over more than 100 years specifically for neuronal cell-cell communication. In the last ten years, this concept was adapted to embrace other cell-cell communication phenomena. Here, we focus on the recently emerged phagocytic synapse and propose new endosymbiotic synapses and "intracellular organellar synapses". All these synapses of eukaryotic cells are in a good position to explain the high capacity of eukaryotic cells for integration of diverse signalling inputs into coherent cellular behaviour.

  6. Eukaryotic vs. prokaryotic chemosensory systems.

    PubMed

    Sbarbati, Andrea; Merigo, Flavia; Osculati, Francesco

    2010-04-01

    In the last decades, microbiologists demonstrated that microorganisms possess chemosensory capabilities and communicate with each other via chemical signals. In parallel, it was demonstrated that solitary eukaryotic chemosensory cells are diffusely located on the mucosae of digestive and respiratory apparatuses. It is now evident that on the mucosal surfaces of vertebrates, two chemoreceptorial systems (i.e. eukaryotic and prokaryotic) coexist in a common microenvironment. To date, it is not known if the two chemosensory systems reciprocally interact and compete for detection of chemical cues. This appears to be a fruitful field of study and future researches must consider that the mucosal epithelia possess more chemosensory capabilities than previously supposed. PMID:20347567

  7. Death of a dogma: eukaryotic mRNAs can code for more than one protein.

    PubMed

    Mouilleron, Hélène; Delcourt, Vivian; Roucou, Xavier

    2016-01-01

    mRNAs carry the genetic information that is translated by ribosomes. The traditional view of a mature eukaryotic mRNA is a molecule with three main regions, the 5' UTR, the protein coding open reading frame (ORF) or coding sequence (CDS), and the 3' UTR. This concept assumes that ribosomes translate one ORF only, generally the longest one, and produce one protein. As a result, in the early days of genomics and bioinformatics, one CDS was associated with each protein-coding gene. This fundamental concept of a single CDS is being challenged by increasing experimental evidence indicating that annotated proteins are not the only proteins translated from mRNAs. In particular, mass spectrometry (MS)-based proteomics and ribosome profiling have detected productive translation of alternative open reading frames. In several cases, the alternative and annotated proteins interact. Thus, the expression of two or more proteins translated from the same mRNA may offer a mechanism to ensure the co-expression of proteins which have functional interactions. Translational mechanisms already described in eukaryotic cells indicate that the cellular machinery is able to translate different CDSs from a single viral or cellular mRNA. In addition to summarizing data showing that the protein coding potential of eukaryotic mRNAs has been underestimated, this review aims to challenge the single translated CDS dogma. PMID:26578573

  8. Death of a dogma: eukaryotic mRNAs can code for more than one protein

    PubMed Central

    Mouilleron, Hélène; Delcourt, Vivian; Roucou, Xavier

    2016-01-01

    mRNAs carry the genetic information that is translated by ribosomes. The traditional view of a mature eukaryotic mRNA is a molecule with three main regions, the 5′ UTR, the protein coding open reading frame (ORF) or coding sequence (CDS), and the 3′ UTR. This concept assumes that ribosomes translate one ORF only, generally the longest one, and produce one protein. As a result, in the early days of genomics and bioinformatics, one CDS was associated with each protein-coding gene. This fundamental concept of a single CDS is being challenged by increasing experimental evidence indicating that annotated proteins are not the only proteins translated from mRNAs. In particular, mass spectrometry (MS)-based proteomics and ribosome profiling have detected productive translation of alternative open reading frames. In several cases, the alternative and annotated proteins interact. Thus, the expression of two or more proteins translated from the same mRNA may offer a mechanism to ensure the co-expression of proteins which have functional interactions. Translational mechanisms already described in eukaryotic cells indicate that the cellular machinery is able to translate different CDSs from a single viral or cellular mRNA. In addition to summarizing data showing that the protein coding potential of eukaryotic mRNAs has been underestimated, this review aims to challenge the single translated CDS dogma. PMID:26578573

  9. Crystal structures of complexes containing domains from two viral internal ribosome entry site (IRES) RNAs bound to the 70S ribosome

    SciTech Connect

    Zhu, Jianyu; Korostelev, Andrei; Costantino, David A.; Donohue, John P.; Noller, Harry F.; Kieft, Jeffrey S.

    2011-08-24

    Internal ribosome entry site (IRES) RNAs are elements of viral or cellular mRNAs that bypass steps of canonical eukaryotic cap-dependent translation initiation. Understanding of the structural basis of IRES mechanisms is limited, partially due to a lack of high-resolution structures of IRES RNAs bound to their cellular targets. Prompted by the universal phylogenetic conservation of the ribosomal P site, we solved the crystal structures of proposed P site binding domains from two intergenic region IRES RNAs bound to bacterial 70S ribosomes. The structures show that these IRES domains nearly perfectly mimic a tRNA-mRNA interaction. However, there are clear differences in the global shape and position of this IRES domain in the intersubunit space compared to those of tRNA, supporting a mechanism for IRES action that invokes hybrid state mimicry to drive a noncanonical mode of translocation. These structures suggest how relatively small structured RNAs can manipulate complex biological machines.

  10. The Ribosomal Database Project (RDP).

    PubMed Central

    Maidak, B L; Olsen, G J; Larsen, N; Overbeek, R; McCaughey, M J; Woese, C R

    1996-01-01

    The Ribosomal Database Project (RDP) is a curated database that offers ribosome-related data, analysis services and associated computer programs. The offerings include phylogenetically ordered alignments of ribosomal RNA (rRNA) sequences, derived phylogenetic trees, rRNA secondary structure diagrams and various software for handling, analyzing and displaying alignments and trees. The data are available via anonymous ftp (rdp.life.uiuc.edu), electronic mail (server@rdp.life.uiuc.edu), gopher (rdpgopher.life.uiuc.edu) and World Wide Web (WWW)(http://rdpwww.life.uiuc.edu/). The electronic mail and WWW servers provide ribosomal probe checking, screening for possible chimeric rRNA sequences, automated alignment and approximate phylogenetic placement of user-submitted sequences on an existing phylogenetic tree. PMID:8594608

  11. Evolutionary analyses of the 12-kDa acidic ribosomal P-proteins reveal a distinct protein of higher plant ribosomes

    PubMed Central

    Szick, Kathleen; Springer, Mark; Bailey-Serres, Julia

    1998-01-01

    The P-protein complex of eukaryotic ribosomes forms a lateral stalk structure in the active site of the large ribosomal subunit and is thought to assist in the elongation phase of translation by stimulating GTPase activity of elongation factor-2 and removal of deacylated tRNA. The complex in animals, fungi, and protozoans is composed of the acidic phosphoproteins P0 (35 kDa), P1 (11–12 kDa), and P2 (11–12 kDa). Previously we demonstrated by protein purification and microsequencing that ribosomes of maize (Zea mays L.) contain P0, one type of P1, two types of P2, and a distinct P1/P2 type protein designated P3. Here we implemented distance matrices, maximum parsimony, and neighbor-joining analyses to assess the evolutionary relationships between the 12 kDa P-proteins of maize and representative eukaryotic species. The analyses identify P3, found to date only in mono- and dicotyledonous plants, as an evolutionarily distinct P-protein. Plants possess three distinct groups of 12 kDa P-proteins (P1, P2, and P3), whereas animals, fungi, and protozoans possess only two distinct groups (P1 and P2). These findings demonstrate that the P-protein complex has evolved into a highly divergent complex with respect to protein composition despite its critical position within the active site of the ribosome. PMID:9482893

  12. Eukaryotic organisms in Proterozoic oceans

    PubMed Central

    Knoll, A.H; Javaux, E.J; Hewitt, D; Cohen, P

    2006-01-01

    The geological record of protists begins well before the Ediacaran and Cambrian diversification of animals, but the antiquity of that history, its reliability as a chronicle of evolution and the causal inferences that can be drawn from it remain subjects of debate. Well-preserved protists are known from a relatively small number of Proterozoic formations, but taphonomic considerations suggest that they capture at least broad aspects of early eukaryotic evolution. A modest diversity of problematic, possibly stem group protists occurs in ca 1800–1300 Myr old rocks. 1300–720 Myr fossils document the divergence of major eukaryotic clades, but only with the Ediacaran–Cambrian radiation of animals did diversity increase within most clades with fossilizable members. While taxonomic placement of many Proterozoic eukaryotes may be arguable, the presence of characters used for that placement is not. Focus on character evolution permits inferences about the innovations in cell biology and development that underpin the taxonomic and morphological diversification of eukaryotic organisms. PMID:16754612

  13. Changing ideas about eukaryotic origins

    PubMed Central

    Williams, Tom A.; Embley, T. Martin

    2015-01-01

    The origin of eukaryotic cells is one of the most fascinating challenges in biology, and has inspired decades of controversy and debate. Recent work has led to major upheavals in our understanding of eukaryotic origins and has catalysed new debates about the roles of endosymbiosis and gene flow across the tree of life. Improved methods of phylogenetic analysis support scenarios in which the host cell for the mitochondrial endosymbiont was a member of the Archaea, and new technologies for sampling the genomes of environmental prokaryotes have allowed investigators to home in on closer relatives of founding symbiotic partners. The inference and interpretation of phylogenetic trees from genomic data remains at the centre of many of these debates, and there is increasing recognition that trees built using inadequate methods can prove misleading, whether describing the relationship of eukaryotes to other cells or the root of the universal tree. New statistical approaches show promise for addressing these questions but they come with their own computational challenges. The papers in this theme issue discuss recent progress on the origin of eukaryotic cells and genomes, highlight some of the ongoing debates, and suggest possible routes to future progress. PMID:26323752

  14. Ribosome dynamics and the evolutionary history of ribosomes

    NASA Astrophysics Data System (ADS)

    Fox, George E.; Paci, Maxim; Tran, Quyen; Petrov, Anton S.; Williams, Loren D.

    2015-09-01

    The ribosome is a dynamic nanomachine responsible for coded protein synthesis. Its major subsystems were essentially in place at the time of the last universal common ancestor (LUCA). Ribosome evolutionary history thus potentially provides a window into the pre- LUCA world. This history begins with the origins of the peptidyl transferase center where the actual peptide is synthesized and then continues over an extended timeframe as additional functional centers including the GTPase center are added. The large ribosomal RNAs (rRNAs) have grown over time by an accretion process and a model exists that proposes a relative age of each accreted element. We have compared atomic resolution ribosome structures before and after EF-G bound GTP hydrolysis and thereby identified the location of 23 pivot points in the large rRNAs that facilitate ribosome dynamics. Pivots in small subunit helices h28 and h44 appear to be especially central to the process and according to the accretion model significantly older than the other helices containing pivots. Overall, the results suggest that ribosomal dynamics occurred in two phases. In the first phase, an inherently mobile h28/h44 combination provided the flexibility needed to create a dynamic ribosome that was essentially a Brownian machine. This addition likely made coded peptide synthesis possible by facilitating movement of a primitive mRNA. During the second phase, addition of pivoting elements and the creation of a factor binding site allowed the regulation of the inherent motion created by h28/h44. All of these events likely occurred before LUCA.

  15. Active eukaryotes in microbialites from Highborne Cay, Bahamas, and Hamelin Pool (Shark Bay), Australia

    PubMed Central

    Edgcomb, Virginia P; Bernhard, Joan M; Summons, Roger E; Orsi, William; Beaudoin, David; Visscher, Pieter T

    2014-01-01

    Microbialites are organosedimentary structures that are formed through the interaction of benthic microbial communities and sediments and include mineral precipitation. These lithifying microbial mat structures include stromatolites and thrombolites. Exuma Sound in the Bahamas, and Hamelin Pool in Shark Bay, Western Australia, are two locations where significant stands of modern microbialites exist. Although prokaryotic diversity in these structures is reasonably well documented, little is known about the eukaryotic component of these communities and their potential to influence sedimentary fabrics through grazing, binding and burrowing activities. Accordingly, comparisons of eukaryotic communities in modern stromatolitic and thrombolitic mats can potentially provide insight into the coexistence of both laminated and clotted mat structures in close proximity to one another. Here we examine this possibility by comparing eukaryotic diversity based on Sanger and high-throughput pyrosequencing of small subunit ribosomal RNA (18S rRNA) genes. Analyses were based on total RNA extracts as template to minimize input from inactive or deceased organisms. Results identified diverse eukaryotic communities particularly stramenopiles, Alveolata, Metazoa, Amoebozoa and Rhizaria within different mat types at both locations, as well as abundant and diverse signatures of eukaryotes with <80% sequence similarity to sequences in GenBank. This suggests the presence of significant novel eukaryotic diversity, particularly in hypersaline Hamelin Pool. There was evidence of vertical structuring of protist populations and foraminiferal diversity was highest in bioturbated/clotted thrombolite mats of Highborne Cay. PMID:23924782

  16. Construction of sized eukaryotic cDNA libraries using low input of total environmental metatranscriptomic RNA

    PubMed Central

    2014-01-01

    Background Construction of high quality cDNA libraries from the usually low amounts of eukaryotic mRNA extracted from environmental samples is essential in functional metatranscriptomics for the selection of functional, full-length genes encoding proteins of interest. Many of the inserts in libraries constructed by standard methods are represented by truncated cDNAs due to premature stoppage of reverse transcriptase activity and preferential cloning of short cDNAs. Results We report here a simple and cost effective technique for preparation of sized eukaryotic cDNA libraries from as low as three microgram of total soil RNA dominated by ribosomal and bacterial RNA. cDNAs synthesized by a template switching approach were size-fractionated by two dimensional agarose gel electrophoresis prior to PCR amplification and cloning. Effective size selection was demonstrated by PCR amplification of conserved gene families specific of each size class. Libraries of more than one million independent inserts whose sizes ranged between one and four kb were thus produced. Up to 80% of the insert sequences were homologous to eukaryotic gene sequences present in public databases. Conclusions A simple and cost effective technique has been developed to construct sized eukaryotic cDNA libraries from environmental samples. This technique will facilitate expression cloning of environmental eukaryotic genes and contribute to a better understanding of basic biological and/or ecological processes carried out by eukaryotic microbial communities. PMID:25183040

  17. The kissing-loop T-shaped structure translational enhancer of Pea enation mosaic virus can bind simultaneously to ribosomes and a 5' proximal hairpin.

    PubMed

    Gao, Feng; Gulay, Suna P; Kasprzak, Wojciech; Dinman, Jonathan D; Shapiro, Bruce A; Simon, Anne E

    2013-11-01

    The Pea enation mosaic virus (PEMV) 3' translational enhancer, known as the kissing-loop T-shaped structure (kl-TSS), binds to 40S subunits, 60S subunits, and 80S ribosomes, whereas the Turnip crinkle virus (TCV) TSS binds only to 60S subunits and 80S ribosomes. Using electrophoretic mobility gel shift assay (EMSA)-based competition assays, the kl-TSS was found to occupy a different site in the ribosome than the P-site-binding TCV TSS, suggesting that these two TSS employ different mechanisms for enhancing translation. The kl-TSS also engages in a stable, long-distance RNA-RNA kissing-loop interaction with a 12-bp 5'-coding-region hairpin that does not alter the structure of the kl-TSS as revealed by molecular dynamics simulations. Addition of the kl-TSS in trans to a luciferase reporter construct containing either wild-type or mutant 5' and 3' PEMV sequences suppressed translation, suggesting that the kl-TSS is required in cis to function, and both ribosome-binding and RNA interaction activities of the kl-TSS contributed to translational inhibition. Addition of the kl-TSS was more detrimental for translation than an adjacent eIF4E-binding 3' translational enhancer known as the PTE, suggesting that the PTE may support the ribosome-binding function of the kl-TSS. Results of in-line RNA structure probing, ribosome filter binding, and high-throughput selective 2'-hydroxyl acylation analyzed by primer extension (hSHAPE) of rRNAs within bound ribosomes suggest that kl-TSS binding to ribosomes and binding to the 5' hairpin are compatible activities. These results suggest a model whereby posttermination ribosomes/ribosomal subunits bind to the kl-TSS and are delivered to the 5' end of the genome via the associated RNA-RNA interaction, which enhances the rate of translation reinitiation. PMID:23986599

  18. Characterization of silk gland ribosomes from a bivoltine caddisfly, Stenopsyche marmorata: translational suppression of a silk protein in cold conditions.

    PubMed

    Nomura, Takaomi; Ito, Miho; Kanamori, Mai; Shigeno, Yuta; Uchiumi, Toshio; Arai, Ryoichi; Tsukada, Masuhiro; Hirabayashi, Kimio; Ohkawa, Kousaku

    2016-01-01

    Larval Stenopsyche marmorata constructs food capture nets and fixed retreats underwater using self-produced proteinaceous silk fibers. In the Chikuma River (Nagano Prefecture, Japan) S. marmorata has a bivoltine life cycle; overwintering larvae grow slowly with reduced net spinning activity in winter. We recently reported constant transcript abundance of S. marmorata silk protein 1 (Smsp-1), a core S. marmorata silk fiber component, in all seasons, implying translational suppression in the silk gland during winter. Herein, we prepared and characterized silk gland ribosomes from seasonally collected S. marmorata larvae. Ribosomes from silk glands immediately frozen in liquid nitrogen (LN2) after dissection exhibited comparable translation elongation activity in spring, summer, and autumn. Conversely, silk glands obtained in winter did not contain active ribosomes and Smsp-1. Ribosomes from silk glands immersed in ice-cold physiological saline solution for approximately 4 h were translationally inactive, despite summer collection and Smsp-1 expression. The ribosomal inactivation occurs because of defects in the formation of 80S ribosomes, presumably due to splitting of 60S subunits containing 28S rRNA with central hidden break, in response to cold stress. These results suggest a novel-type ribosome-regulated translation control mechanism. PMID:26646291

  19. [Ribosomal RNA Evolution

    NASA Technical Reports Server (NTRS)

    1997-01-01

    It is generally believed that an RNA World existed at an early stage in the history of life. During this early period, RNA molecules are seen to be potentially involved in both catalysis and the storage of genetic information. Translation presents several interrelated themes of inquiry for exobiology. First, it is essential, for understanding the very origin of life, how peptides and eventually proteins might have come to be made on the early Earth in a template directed manner. Second, it is necessary to understand how a machinery of similar complexity to that found in the ribosomes of modern organisms came to exist by the time of the last common ancestor (as detected by 16S rRNA sequence studies). Third, the ribosomal RNAs themselves likely had a very early origin and studies of their history may be very informative about the nature of the RNA World. Moreover, studies of these RNAs will contribute to a better understanding of the potential roles of RNA in early evolution.During the past year we have ave conducted a comparative study of four completely sequenced bacterial genoames. We have focused initially on conservation of gene order. The second component of the project continues to build on the model system for studying the validity of variant 5S rRNA sequences in the vicinity of the modern Vibrio proteolyticus 5S rRNA that we established earlier. This system has made it possible to conduct a detailed and extensive analysis of a local portion of the sequence space. These core methods have been used to construct numerous mutants during the last several years. Although it has been a secondary focus, this work has continued over the last year such that we now have in excess of 125 V. proteolyticus derived constructs which have been made and characterized. We have also continued high resolution NMR work on RNA oligomers originally initiated by G. Kenneth Smith who was funded by a NASA Graduate Student Researcher's Fellowship Award until May of 1996. Mr. Smith

  20. Neuron-Like Networks Between Ribosomal Proteins Within the Ribosome.

    PubMed

    Poirot, Olivier; Timsit, Youri

    2016-01-01

    From brain to the World Wide Web, information-processing networks share common scale invariant properties. Here, we reveal the existence of neural-like networks at a molecular scale within the ribosome. We show that with their extensions, ribosomal proteins form complex assortative interaction networks through which they communicate through tiny interfaces. The analysis of the crystal structures of 50S eubacterial particles reveals that most of these interfaces involve key phylogenetically conserved residues. The systematic observation of interactions between basic and aromatic amino acids at the interfaces and along the extension provides new structural insights that may contribute to decipher the molecular mechanisms of signal transmission within or between the ribosomal proteins. Similar to neurons interacting through "molecular synapses", ribosomal proteins form a network that suggest an analogy with a simple molecular brain in which the "sensory-proteins" innervate the functional ribosomal sites, while the "inter-proteins" interconnect them into circuits suitable to process the information flow that circulates during protein synthesis. It is likely that these circuits have evolved to coordinate both the complex macromolecular motions and the binding of the multiple factors during translation. This opens new perspectives on nanoscale information transfer and processing. PMID:27225526

  1. Neuron-Like Networks Between Ribosomal Proteins Within the Ribosome

    PubMed Central

    Poirot, Olivier; Timsit, Youri

    2016-01-01

    From brain to the World Wide Web, information-processing networks share common scale invariant properties. Here, we reveal the existence of neural-like networks at a molecular scale within the ribosome. We show that with their extensions, ribosomal proteins form complex assortative interaction networks through which they communicate through tiny interfaces. The analysis of the crystal structures of 50S eubacterial particles reveals that most of these interfaces involve key phylogenetically conserved residues. The systematic observation of interactions between basic and aromatic amino acids at the interfaces and along the extension provides new structural insights that may contribute to decipher the molecular mechanisms of signal transmission within or between the ribosomal proteins. Similar to neurons interacting through “molecular synapses”, ribosomal proteins form a network that suggest an analogy with a simple molecular brain in which the “sensory-proteins” innervate the functional ribosomal sites, while the “inter-proteins” interconnect them into circuits suitable to process the information flow that circulates during protein synthesis. It is likely that these circuits have evolved to coordinate both the complex macromolecular motions and the binding of the multiple factors during translation. This opens new perspectives on nanoscale information transfer and processing. PMID:27225526

  2. Dynamic evolution of mitochondrial ribosomal proteins in Holozoa.

    PubMed

    Scheel, Bettina M; Hausdorf, Bernhard

    2014-07-01

    We studied the highly dynamic evolution of mitochondrial ribosomal proteins (MRPs) in Holozoa. Most major clades within Holozoa are characterized by gains and/or losses of MRPs. The usefulness of gains of MRPs as rare genomic changes in phylogenetics is undermined by the high frequency of secondary losses. However, phylogenetic analyses of the MRP sequences provide evidence for the Acrosomata hypothesis, a sister group relationship between Ctenophora and Bilateria. An extensive restructuring of the mitochondrial genome and, as a consequence, of the mitochondrial ribosomes occurred in the ancestor of metazoans. The last MRP genes encoded in the mitochondrial genome were either moved to the nuclear genome or were lost. The strong decrease in size of the mitochondrial genome was probably caused by selection for rapid replication of mitochondrial DNA during oogenesis in the metazoan ancestor. A phylogenetic analysis of MRPL56 sequences provided evidence for a horizontal gene transfer of the corresponding MRP gene between metazoans and Dictyostelidae (Amoebozoa). The hypothesis that the requisition of additional MRPs compensated for a loss of rRNA segments in the mitochondrial ribosomes is corroborated by a significant negative correlation between the number of MRPs and length of the rRNA. Newly acquired MRPs evolved faster than bacterial MRPs and positions in eukaryote-specific MRPs were more strongly affected by coevolution than positions in prokaryotic MRPs in accordance with the necessity to fit these proteins into the pre-existing structure of the mitoribosome. PMID:24631858

  3. Maize reas1 Mutant Stimulates Ribosome Use Efficiency and Triggers Distinct Transcriptional and Translational Responses1[OPEN

    PubMed Central

    Qi, Weiwei; Zhu, Jie; Wu, Qiao; Wang, Qun; Li, Xia; Yao, Dongsheng; Jin, Ying; Wang, Gang; Wang, Guifeng

    2016-01-01

    Ribosome biogenesis is a fundamental cellular process in all cells. Impaired ribosome biogenesis causes developmental defects; however, its molecular and cellular bases are not fully understood. We cloned a gene responsible for a maize (Zea mays) small seed mutant, dek* (for defective kernel), and found that it encodes Ribosome export associated1 (ZmReas1). Reas1 is an AAA-ATPase that controls 60S ribosome export from the nucleus to the cytoplasm after ribosome maturation. dek* is a weak mutant allele with decreased Reas1 function. In dek* cells, mature 60S ribosome subunits are reduced in the nucleus and cytoplasm, but the proportion of actively translating polyribosomes in cytosol is significantly increased. Reduced phosphorylation of eukaryotic initiation factor 2α and the increased elongation factor 1α level indicate an enhancement of general translational efficiency in dek* cells. The mutation also triggers dramatic changes in differentially transcribed genes and differentially translated RNAs. Discrepancy was observed between differentially transcribed genes and differentially translated RNAs, indicating distinct cellular responses at transcription and translation levels to the stress of defective ribosome processing. DNA replication and nucleosome assembly-related gene expression are selectively suppressed at the translational level, resulting in inhibited cell growth and proliferation in dek* cells. This study provides insight into cellular responses due to impaired ribosome biogenesis. PMID:26645456

  4. A tRNA methyltransferase paralog is important for ribosome stability and cell division in Trypanosoma brucei.

    PubMed

    Fleming, Ian M C; Paris, Zdeněk; Gaston, Kirk W; Balakrishnan, R; Fredrick, Kurt; Rubio, Mary Anne T; Alfonzo, Juan D

    2016-01-01

    Most eukaryotic ribosomes contain 26/28S, 5S, and 5.8S large subunit ribosomal RNAs (LSU rRNAs) in addition to the 18S rRNA of the small subunit (SSU rRNA). However, in kinetoplastids, a group of organisms that include medically important members of the genus Trypanosoma and Leishmania, the 26/28S large subunit ribosomal RNA is uniquely composed of 6 rRNA fragments. In addition, recent studies have shown the presence of expansion segments in the large ribosomal subunit (60S) of Trypanosoma brucei. Given these differences in structure, processing and assembly, T. brucei ribosomes may require biogenesis factors not found in other organisms. Here, we show that one of two putative 3-methylcytidine methyltransferases, TbMTase37 (a homolog of human methyltransferase-like 6, METTL6), is important for ribosome stability in T. brucei. TbMTase37 localizes to the nucleolus and depletion of the protein results in accumulation of ribosomal particles lacking srRNA 4 and reduced levels of polysome associated ribosomes. We also find that TbMTase37 plays a role in cytokinesis, as loss of the protein leads to multi-flagellated and multi-nucleated cells. PMID:26888608

  5. A tRNA methyltransferase paralog is important for ribosome stability and cell division in Trypanosoma brucei

    PubMed Central

    Fleming, Ian M. C.; Paris, Zdeněk; Gaston, Kirk W.; Balakrishnan, R.; Fredrick, Kurt; Rubio, Mary Anne T.; Alfonzo, Juan D.

    2016-01-01

    Most eukaryotic ribosomes contain 26/28S, 5S, and 5.8S large subunit ribosomal RNAs (LSU rRNAs) in addition to the 18S rRNA of the small subunit (SSU rRNA). However, in kinetoplastids, a group of organisms that include medically important members of the genus Trypanosoma and Leishmania, the 26/28S large subunit ribosomal RNA is uniquely composed of 6 rRNA fragments. In addition, recent studies have shown the presence of expansion segments in the large ribosomal subunit (60S) of Trypanosoma brucei. Given these differences in structure, processing and assembly, T. brucei ribosomes may require biogenesis factors not found in other organisms. Here, we show that one of two putative 3-methylcytidine methyltransferases, TbMTase37 (a homolog of human methyltransferase-like 6, METTL6), is important for ribosome stability in T. brucei. TbMTase37 localizes to the nucleolus and depletion of the protein results in accumulation of ribosomal particles lacking srRNA 4 and reduced levels of polysome associated ribosomes. We also find that TbMTase37 plays a role in cytokinesis, as loss of the protein leads to multi-flagellated and multi-nucleated cells. PMID:26888608

  6. Evolution: Steps on the road to eukaryotes

    NASA Astrophysics Data System (ADS)

    Embley, T. Martin; Williams, Tom A.

    2015-05-01

    A new archaeal phylum represents the closest known relatives of eukaryotes, the group encompassing all organisms that have nucleated cells. The discovery holds promise for a better understanding of eukaryotic origins. See Article p.173

  7. Comparative genomics of eukaryotic small nucleolar RNAs reveals deep evolutionary ancestry amidst ongoing intragenomic mobility

    PubMed Central

    2012-01-01

    Background Small nucleolar (sno)RNAs are required for posttranscriptional processing and modification of ribosomal, spliceosomal and messenger RNAs. Their presence in both eukaryotes and archaea indicates that snoRNAs are evolutionarily ancient. The location of some snoRNAs within the introns of ribosomal protein genes has been suggested to belie an RNA world origin, with the exons of the earliest protein-coding genes having evolved around snoRNAs after the advent of templated protein synthesis. Alternatively, this intronic location may reflect more recent selection for coexpression of snoRNAs and ribosomal components, ensuring rRNA modification by snoRNAs during ribosome synthesis. To gain insight into the evolutionary origins of this genetic organization, we examined the antiquity of snoRNA families and the stability of their genomic location across 44 eukaryote genomes. Results We report that dozens of snoRNA families are traceable to the Last Eukaryotic Common Ancestor (LECA), but find only weak similarities between the oldest eukaryotic snoRNAs and archaeal snoRNA-like genes. Moreover, many of these LECA snoRNAs are located within the introns of host genes independently traceable to the LECA. Comparative genomic analyses reveal the intronic location of LECA snoRNAs is not ancestral however, suggesting the pattern we observe is the result of ongoing intragenomic mobility. Analysis of human transcriptome data indicates that the primary requirement for hosting intronic snoRNAs is a broad expression profile. Consistent with ongoing mobility across broadly-expressed genes, we report a case of recent migration of a non-LECA snoRNA from the intron of a ubiquitously expressed non-LECA host gene into the introns of two LECA genes during the evolution of primates. Conclusions Our analyses show that snoRNAs were a well-established family of RNAs at the time when eukaryotes began to diversify. While many are intronic, this association is not evolutionarily stable across

  8. The complete structure of the large subunit of the mammalian mitochondrial ribosome.

    PubMed

    Greber, Basil J; Boehringer, Daniel; Leibundgut, Marc; Bieri, Philipp; Leitner, Alexander; Schmitz, Nikolaus; Aebersold, Ruedi; Ban, Nenad

    2014-11-13

    Mitochondrial ribosomes (mitoribosomes) are extensively modified ribosomes of bacterial descent specialized for the synthesis and insertion of membrane proteins that are critical for energy conversion and ATP production inside mitochondria. Mammalian mitoribosomes, which comprise 39S and 28S subunits, have diverged markedly from the bacterial ribosomes from which they are derived, rendering them unique compared to bacterial, eukaryotic cytosolic and fungal mitochondrial ribosomes. We have previously determined at 4.9 Å resolution the architecture of the porcine (Sus scrofa) 39S subunit, which is highly homologous to the human mitoribosomal large subunit. Here we present the complete atomic structure of the porcine 39S large mitoribosomal subunit determined in the context of a stalled translating mitoribosome at 3.4 Å resolution by cryo-electron microscopy and chemical crosslinking/mass spectrometry. The structure reveals the locations and the detailed folds of 50 mitoribosomal proteins, shows the highly conserved mitoribosomal peptidyl transferase active site in complex with its substrate transfer RNAs, and defines the path of the nascent chain in mammalian mitoribosomes along their idiosyncratic exit tunnel. Furthermore, we present evidence that a mitochondrial tRNA has become an integral component of the central protuberance of the 39S subunit where it architecturally substitutes for the absence of the 5S ribosomal RNA, a ubiquitous component of all cytoplasmic ribosomes. PMID:25271403

  9. Influence of 4'-O-Glycoside Constitution and Configuration on Ribosomal Selectivity of Paromomycin.

    PubMed

    Matsushita, Takahiko; Chen, Weiwei; Juskeviciene, Reda; Teo, Youjin; Shcherbakov, Dimitri; Vasella, Andrea; Böttger, Erik C; Crich, David

    2015-06-24

    A series of 20 4'-O-glycosides of the aminoglycoside antibiotic paromomycin were synthesized and evaluated for their ability to inhibit protein synthesis by bacterial, mitochondrial and cytosolic ribosomes. Target selectivity, i.e., inhibition of the bacterial ribosome over eukaryotic mitochondrial and cytosolic ribosomes, which is predictive of antibacterial activity with reduced ototoxicity and systemic toxicity, was greater for the equatorial than for the axial pyranosides, and greater for the d-pentopyranosides than for the l-pentopyranosides and d-hexopyranosides. In particular, 4'-O-β-d-xylopyranosyl paromomycin shows antibacterioribosomal activity comparable to that of paromomycin, but is significantly more selective showing considerably reduced affinity for the cytosolic ribosome and for the A1555G mutant mitochondrial ribosome associated with hypersusceptibility to drug-induced ototoxicity. Compound antibacterioribosomal activity correlates with antibacterial activity, and the ribosomally more active compounds show activity against Escherichia coli, Klebsiella pneumonia, Enterobacter cloacae, Acinetobacter baumannii, and methicillin-resistant Staphylococcus aureus (MRSA). The paromomycin glycosides retain activity against clinical strains of MRSA that are resistant to paromomycin, which is demonstrated to be a consequence of 4'-O-glycosylation blocking the action of 4'-aminoglycoside nucleotidyl transferases by the use of recombinant E. coli carrying the specific resistance determinant. PMID:26024064

  10. The revised classification of eukaryotes

    PubMed Central

    Adl, Sina M.; Simpson, Alastair. G.; Lane, Christopher E.; Lukeš, Julius; Bass, David; Bowser, Samuel S.; Brown, Matt; Burki, Fabien; Dunthorn, Micah; Hampl, Vladimir; Heiss, Aaron; Hoppenrath, Mona; Lara, Enrique; leGall, Line; Lynn, Denis H.; McManus, Hilary; Mitchell, Edward A. D.; Mozley-Stanridge, Sharon E.; Parfrey, Laura Wegener; Pawlowski, Jan; Rueckert, Sonja; Shadwick, Lora; Schoch, Conrad; Smirnov, Alexey; Spiegel, Frederick W.

    2012-01-01

    This revision of the classification of eukaryotes, which updates that of Adl et al. (2005), retains an emphasis on the protists and incorporates changes since 2005 that have resolved nodes and branches in phylogenetic trees. Whereas the previous revision was successful in re-introducing name stability to the classification, this revision provides a classification for lineages that were then still unresolved. The supergroups have withstood phylogenetic hypothesis testing with some modifications, but despite some progress, problematic nodes at the base of the eukaryotic tree still remain to be statistically resolved. Looking forward, subsequent transformations to our understanding of the diversity of life will be from the discovery of novel lineages in previously under-sampled areas and from environmental genomic information. PMID:23020233

  11. Replicating Damaged DNA in Eukaryotes

    PubMed Central

    Chatterjee, Nimrat; Siede, Wolfram

    2013-01-01

    DNA damage is one of many possible perturbations that challenge the mechanisms that preserve genetic stability during the copying of the eukaryotic genome in S phase. This short review provides, in the first part, a general introduction to the topic and an overview of checkpoint responses. In the second part, the mechanisms of error-free tolerance in response to fork-arresting DNA damage will be discussed in some detail. PMID:24296172

  12. Molecular Mechanism of Scanning and Start Codon Selection in Eukaryotes

    PubMed Central

    Hinnebusch, Alan G.

    2011-01-01

    Summary: The correct translation of mRNA depends critically on the ability to initiate at the right AUG codon. For most mRNAs in eukaryotic cells, this is accomplished by the scanning mechanism, wherein the small (40S) ribosomal subunit attaches to the 5′ end of the mRNA and then inspects the leader base by base for an AUG in a suitable context, using complementarity with the anticodon of methionyl initiator tRNA (Met-tRNAiMet) as the key means of identifying AUG. Over the past decade, a combination of yeast genetics, biochemical analysis in reconstituted systems, and structural biology has enabled great progress in deciphering the mechanism of ribosomal scanning. A robust molecular model now exists, describing the roles of initiation factors, notably eukaryotic initiation factor 1 (eIF1) and eIF1A, in stabilizing an “open” conformation of the 40S subunit with Met-tRNAiMet bound in a low-affinity state conducive to scanning and in triggering rearrangement into a “closed” conformation incompatible with scanning, which features Met-tRNAiMet more tightly bound to the “P” site and base paired with AUG. It has also emerged that multiple DEAD-box RNA helicases participate in producing a single-stranded “landing pad” for the 40S subunit and in removing the secondary structure to enable the mRNA to traverse the 40S mRNA-binding channel in the single-stranded form for base-by-base inspection in the P site. PMID:21885680

  13. Functional Role of Ribosomal Signatures

    PubMed Central

    Chen, Ke; Eargle, John; Sarkar, Krishnarjun; Gruebele, Martin; Luthey-Schulten, Zaida

    2010-01-01

    Although structure and sequence signatures in ribosomal RNA and proteins are defining characteristics of the three domains of life and instrumental in constructing the modern phylogeny, little is known about their functional roles in the ribosome. In this work, the largest coevolving RNA/protein signatures in the bacterial 30S ribosome are investigated both experimentally and computationally through all-atom molecular-dynamics simulations. The complex includes the N-terminal fragment of the ribosomal protein S4, which is a primary binding protein that initiates 30S small subunit assembly from the 5′ domain, and helix 16 (h16), which is part of the five-way junction in 16S rRNA. Our results show that the S4 N-terminus signature is intrinsically disordered in solution, whereas h16 is relatively stable by itself. The dynamic disordered property of the protein is exploited to couple the folding and binding process to the five-way junction, and the results provide insight into the mechanism for the early and fast binding of S4 in the assembly of the ribosomal small subunit. PMID:21156135

  14. Chloroplast ribosomes and protein synthesis.

    PubMed Central

    Harris, E H; Boynton, J E; Gillham, N W

    1994-01-01

    Consistent with their postulated origin from endosymbiotic cyanobacteria, chloroplasts of plants and algae have ribosomes whose component RNAs and proteins are strikingly similar to those of eubacteria. Comparison of the secondary structures of 16S rRNAs of chloroplasts and bacteria has been particularly useful in identifying highly conserved regions likely to have essential functions. Comparative analysis of ribosomal protein sequences may likewise prove valuable in determining their roles in protein synthesis. This review is concerned primarily with the RNAs and proteins that constitute the chloroplast ribosome, the genes that encode these components, and their expression. It begins with an overview of chloroplast genome structure in land plants and algae and then presents a brief comparison of chloroplast and prokaryotic protein-synthesizing systems and a more detailed analysis of chloroplast rRNAs and ribosomal proteins. A description of the synthesis and assembly of chloroplast ribosomes follows. The review concludes with discussion of whether chloroplast protein synthesis is essential for cell survival. PMID:7854253

  15. The molecular structure of the left-handed supra-molecular helix of eukaryotic polyribosomes

    NASA Astrophysics Data System (ADS)

    Myasnikov, Alexander G.; Afonina, Zhanna A.; Ménétret, Jean-François; Shirokov, Vladimir A.; Spirin, Alexander S.; Klaholz, Bruno P.

    2014-11-01

    During protein synthesis, several ribosomes bind to a single messenger RNA (mRNA) forming large macromolecular assemblies called polyribosomes. Here we report the detailed molecular structure of a 100 MDa eukaryotic poly-ribosome complex derived from cryo electron tomography, sub-tomogram averaging and pseudo-atomic modelling by crystal structure fitting. The structure allowed the visualization of the three functional parts of the polysome assembly, the central core region that forms a rather compact left-handed supra-molecular helix, and the more open regions that harbour the initiation and termination sites at either ends. The helical region forms a continuous mRNA channel where the mRNA strand bridges neighbouring exit and entry sites of the ribosomes and prevents mRNA looping between ribosomes. This structure provides unprecedented insights into protein- and RNA-mediated inter-ribosome contacts that involve conserved sites through 40S subunits and long protruding RNA expansion segments, suggesting a role in stabilizing the overall polyribosomal assembly.

  16. Defensins: antifungal lessons from eukaryotes

    PubMed Central

    Silva, Patrícia M.; Gonçalves, Sónia; Santos, Nuno C.

    2014-01-01

    Over the last years, antimicrobial peptides (AMPs) have been the focus of intense research toward the finding of a viable alternative to current antifungal drugs. Defensins are one of the major families of AMPs and the most represented among all eukaryotic groups, providing an important first line of host defense against pathogenic microorganisms. Several of these cysteine-stabilized peptides present a relevant effect against fungi. Defensins are the AMPs with the broader distribution across all eukaryotic kingdoms, namely, Fungi, Plantae, and Animalia, and were recently shown to have an ancestor in a bacterial organism. As a part of the host defense, defensins act as an important vehicle of information between innate and adaptive immune system and have a role in immunomodulation. This multidimensionality represents a powerful host shield, hard for microorganisms to overcome using single approach resistance strategies. Pathogenic fungi resistance to conventional antimycotic drugs is becoming a major problem. Defensins, as other AMPs, have shown to be an effective alternative to the current antimycotic therapies, demonstrating potential as novel therapeutic agents or drug leads. In this review, we summarize the current knowledge on some eukaryotic defensins with antifungal action. An overview of the main targets in the fungal cell and the mechanism of action of these AMPs (namely, the selectivity for some fungal membrane components) are presented. Additionally, recent works on antifungal defensins structure, activity, and cytotoxicity are also reviewed. PMID:24688483

  17. Selective ribosome profiling as a tool to study the interaction of chaperones and targeting factors with nascent polypeptide chains and ribosomes

    PubMed Central

    Becker, Annemarie H.; Oh, Eugene; Weissman, Jonathan S.; Kramer, Günter; Bukau, Bernd

    2014-01-01

    A plethora of factors is involved in the maturation of newly synthesized proteins, including chaperones, membrane targeting factors, and enzymes. Many factors act cotranslationally through association with ribosome-nascent chain complexes (RNCs), but their target specificities and modes of action remain poorly understood. We developed selective ribosome profiling (SeRP) to identify substrate pools and points of RNC engagement of these factors. SeRP is based on sequencing mRNA fragments covered by translating ribosomes (general ribosome profiling, RP), combined with a procedure to selectively isolate RNCs whose nascent polypeptides are associated with the factor of interest. Factor–RNC interactions are stabilized by crosslinking, the resulting factor–RNC adducts are then nuclease-treated to generate monosomes, and affinity-purified. The ribosome-extracted mRNA footprints are converted to DNA libraries for deep sequencing. The protocol is specified for general RP and SeRP in bacteria. It was first applied to the chaperone trigger factor and is readily adaptable to other cotranslationally acting factors, including eukaryotic factors. Factor–RNC purification and sequencing library preparation takes 7–8 days, sequencing and data analysis can be completed in 5–6 days. PMID:24136347

  18. Apramycin Recognition by the Human Ribosomal Decoding Site

    SciTech Connect

    Hermann,T.; Tereshko, V.; Skripkin, E.; Patel, D.

    2007-01-01

    Aminoglycoside antibiotics bind specifically to the bacterial ribosomal decoding-site RNA and thereby interfere with fidelity but not efficiency of translation. Apramycin stands out among aminoglycosides for its mechanism of action which is based on blocking translocation and its ability to bind also to the eukaryotic decoding site despite differences in key residues required for apramycin recognition by the bacterial target. To elucidate molecular recognition of the eukaryotic decoding site by apramycin we have determined the crystal structure of an oligoribonucleotide containing the human sequence free and in complex with the antibiotic at 1.5 {angstrom} resolution. The drug binds in the deep groove of the RNA which forms a continuously stacked helix comprising non-canonical C{center_dot}A and G{center_dot}A base pairs and a bulged-out adenine. The binding mode of apramycin at the human decoding-site RNA is distinct from aminoglycoside recognition of the bacterial target, suggesting a molecular basis for the actions of apramycin in eukaryotes and bacteria.

  19. Changed in translation: mRNA recoding by -1 programmed ribosomal frameshifting.

    PubMed

    Caliskan, Neva; Peske, Frank; Rodnina, Marina V

    2015-05-01

    Programmed -1 ribosomal frameshifting (-1PRF) is an mRNA recoding event commonly utilized by viruses and bacteria to increase the information content of their genomes. Recent results have implicated -1PRF in quality control of mRNA and DNA stability in eukaryotes. Biophysical experiments demonstrated that the ribosome changes the reading frame while attempting to move over a slippery sequence of the mRNA--when a roadblock formed by a folded downstream segment in the mRNA stalls the ribosome in a metastable conformational state. The efficiency of -1PRF is modulated not only by cis-regulatory elements in the mRNA but also by trans-acting factors such as proteins, miRNAs, and antibiotics. These recent results suggest a molecular mechanism and new important cellular roles for -1PRF. PMID:25850333

  20. Profiling of Mycoplasma gallisepticum Ribosomes.

    PubMed

    Fisunov, G Y; Evsyutina, D V; Arzamasov, A A; Butenko, I O; Govorun, V M

    2015-01-01

    The development of high-throughput technologies is increasingly resulting in identification of numerous cases of low correlation between mRNA and the protein level in cells. These controversial observations were made on various bacteria, such as E. coli, Desulfovibrio vulgaris, and Lactococcus lactis. Thus, it is important to develop technologies, including high-throughput techniques, aimed at studying gene expression regulation at the level of translation. In the current study, we performed proteomic profiling of M. gallisepticum ribosomes and identified high abundant noncanonical proteins. We found that binding of mRNAs to ribosomes is mainly determined by two parameters: (1) abundance of mRNA itself and (2) complimentary interactions between the 3' end of 16S rRNA and the ribosome binding site in the 5'-untranslated region of mRNA. PMID:26798497

  1. Profiling of Mycoplasma gallisepticum Ribosomes

    PubMed Central

    Fisunov, G. Y.; Evsyutina, D. V.; Arzamasov, A. A.; Butenko, I. O.; Govorun, V. M.

    2015-01-01

    The development of high-throughput technologies is increasingly resulting in identification of numerous cases of low correlation between mRNA and the protein level in cells. These controversial observations were made on various bacteria, such as E. coli, Desulfovibrio vulgaris, and Lactococcus lactis. Thus, it is important to develop technologies, including high-throughput techniques, aimed at studying gene expression regulation at the level of translation. In the current study, we performed proteomic profiling of M. gallisepticum ribosomes and identified high abundant noncanonical proteins. We found that binding of mRNAs to ribosomes is mainly determined by two parameters: (1) abundance of mRNA itself and (2) complimentary interactions between the 3’ end of 16S rRNA and the ribosome binding site in the 5’-untranslated region of mRNA. PMID:26798497

  2. The N-terminal extension of yeast ribosomal protein L8 is involved in two major remodeling events during late nuclear stages of 60S ribosomal subunit assembly.

    PubMed

    Tutuncuoglu, Beril; Jakovljevic, Jelena; Wu, Shan; Gao, Ning; Woolford, John L

    2016-09-01

    Assaying effects on pre-rRNA processing and ribosome assembly upon depleting individual ribosomal proteins (r-proteins) provided an initial paradigm for assembly of eukaryotic ribosomes in vivo-that each structural domain of ribosomal subunits assembles in a hierarchical fashion. However, two features suggest that a more complex pathway may exist: (i) Some r-proteins contain extensions that reach long distances across ribosomes to interact with multiple rRNA domains as well as with other r-proteins. (ii) Individual r-proteins may assemble in a stepwise fashion. For example, the globular domain of an r-protein might assemble separately from its extensions. Thus, these extensions might play roles in assembly that could not be revealed by depleting the entire protein. Here, we show that deleting or mutating extensions of r-proteins L7 (uL30) and L35 (uL29) from yeast reveal important roles in early and middle steps during 60S ribosomal subunit biogenesis. Detailed analysis of the N-terminal terminal extension of L8 (eL8) showed that it is necessary for late nuclear stages of 60S subunit assembly involving two major remodeling events: removal of the ITS2 spacer; and reorganization of the central protuberance (CP) containing 5S rRNA and r-proteins L5 (uL18) and L11 (uL5). Mutations in the L8 extension block processing of 7S pre-rRNA, prevent release of assembly factors Rpf2 and Rrs1 from pre-ribosomes, which is required for rotation of the CP, and block association of Sda1, the Rix1 complex, and the Rea1 ATPase involved in late steps of remodeling. PMID:27390266

  3. Distinct types of translation termination generate substrates for ribosome-associated quality control.

    PubMed

    Shcherbik, Natalia; Chernova, Tatiana A; Chernoff, Yury O; Pestov, Dimitri G

    2016-08-19

    Cotranslational degradation of polypeptide nascent chains plays a critical role in quality control of protein synthesis and the rescue of stalled ribosomes. In eukaryotes, ribosome stalling triggers release of 60S subunits with attached nascent polypeptides, which undergo ubiquitination by the E3 ligase Ltn1 and proteasomal degradation facilitated by the ATPase Cdc48. However, the identity of factors acting upstream in this process is less clear. Here, we examined how the canonical release factors Sup45-Sup35 (eRF1-eRF3) and their paralogs Dom34-Hbs1 affect the total population of ubiquitinated nascent chains associated with yeast ribosomes. We found that the availability of the functional release factor complex Sup45-Sup35 strongly influences the amount of ubiquitinated polypeptides associated with 60S ribosomal subunits, while Dom34-Hbs1 generate 60S-associated peptidyl-tRNAs that constitute a relatively minor fraction of Ltn1 substrates. These results uncover two separate pathways that target nascent polypeptides for Ltn1-Cdc48-mediated degradation and suggest that in addition to canonical termination on stop codons, eukaryotic release factors contribute to cotranslational protein quality control. PMID:27325745

  4. New ribosomes for new memories?

    PubMed Central

    Hernández, A Iván; Alarcon, Juan M; Allen, Kim D

    2015-01-01

    Widely thought to be a housekeeping process, the regulation and synthesis of rRNA emerges as a potentially central mechanism for the maintenance of synaptic plasticity and memory. We have recently shown that an essential component of late-phase synaptic plasticity is rRNA biosynthesis — the rate-limiting step in the production of new ribosomes. We hypothesize that a particular population of ribosomes is generated upon learning-associated neural activity to alter the rate of synthesis of plasticity factors at tagged synapses that will support the maintenance of synaptic plasticity and memory. PMID:26479998

  5. Satratoxin G interaction with 40S and 60S ribosomal subunits precedes apoptosis in the macrophage

    SciTech Connect

    Bae, Hee Kyong; Shinozuka, Junko; Islam, Zahidul; Pestka, James J.

    2009-06-01

    Satratoxin G (SG) and other macrocyclic trichothecene mycotoxins are potent inhibitors of eukaryotic translation that are potentially immunosuppressive. The purpose of this research was to test the hypothesis that SG-induced apoptosis in the macrophage correlates with binding of this toxin to the ribosome. Exposure of RAW 264.7 murine macrophages to SG at concentrations of 10 to 80 ng/ml induced DNA fragmentation within 4 h that was indicative of apoptosis. To relate these findings to ribosome binding of SG, RAW cells were exposed to different toxin concentrations for various time intervals, ribosomal fractions isolated by sucrose density gradient ultracentrifugation and resultant fractions analyzed for SG by competitive ELISA. SG was found to specifically interact with 40S and 60S ribosomal subunits as early as 5 min and that, at high concentrations or extended incubation times, the toxin induced polysome disaggregation. While co-incubation with the simple Type B trichothecene DON had no effect on SG uptake into cell cytoplasm, it inhibited SG binding to the ribosome, suggesting that the two toxins bound to identical sites and that SG binding was reversible. Although both SG and DON induced mobilization of p38 and JNK 1/2 to the ribosome, phosphorylation of ribosomal bound MAPKs occurred only after DON treatment. SG association with the 40S and 60S subunits was also observed in the PC-12 neuronal cell model which is similarly susceptible to apoptosis. To summarize, SG rapidly binds small and large ribosomal subunits in a concentration- and time-dependent manner that was consistent with induction of apoptosis.

  6. Inhibitors of Ribosome Rescue Arrest Growth of Francisella tularensis at All Stages of Intracellular Replication.

    PubMed

    Goralski, Tyler D P; Dewan, Kalyan K; Alumasa, John N; Avanzato, Victoria; Place, David E; Markley, Rachel L; Katkere, Bhuvana; Rabadi, Seham M; Bakshi, Chandra Shekhar; Keiler, Kenneth C; Kirimanjeswara, Girish S

    2016-06-01

    Bacteria require at least one pathway to rescue ribosomes stalled at the ends of mRNAs. The primary pathway for ribosome rescue is trans-translation, which is conserved in >99% of sequenced bacterial genomes. Some species also have backup systems, such as ArfA or ArfB, which can rescue ribosomes in the absence of sufficient trans-translation activity. Small-molecule inhibitors of ribosome rescue have broad-spectrum antimicrobial activity against bacteria grown in liquid culture. These compounds were tested against the tier 1 select agent Francisella tularensis to determine if they can limit bacterial proliferation during infection of eukaryotic cells. The inhibitors KKL-10 and KKL-40 exhibited exceptional antimicrobial activity against both attenuated and fully virulent strains of F. tularensis in vitro and during ex vivo infection. Addition of KKL-10 or KKL-40 to macrophages or liver cells at any time after infection by F. tularensis prevented further bacterial proliferation. When macrophages were stimulated with the proinflammatory cytokine gamma interferon before being infected by F. tularensis, addition of KKL-10 or KKL-40 reduced intracellular bacteria by >99%, indicating that the combination of cytokine-induced stress and a nonfunctional ribosome rescue pathway is fatal to F. tularensis Neither KKL-10 nor KKL-40 was cytotoxic to eukaryotic cells in culture. These results demonstrate that ribosome rescue is required for F. tularensis growth at all stages of its infection cycle and suggest that KKL-10 and KKL-40 are good lead compounds for antibiotic development. PMID:26953190

  7. Reprogramming eukaryotic translation with ligand-responsive synthetic RNA switches.

    PubMed

    Anzalone, Andrew V; Lin, Annie J; Zairis, Sakellarios; Rabadan, Raul; Cornish, Virginia W

    2016-05-01

    Protein synthesis in eukaryotes is regulated by diverse reprogramming mechanisms that expand the coding capacity of individual genes. Here, we exploit one such mechanism, termed -1 programmed ribosomal frameshifting (-1 PRF), to engineer ligand-responsive RNA switches that regulate protein expression. First, efficient -1 PRF stimulatory RNA elements were discovered by in vitro selection; then, ligand-responsive switches were constructed by coupling -1 PRF stimulatory elements to RNA aptamers using rational design and directed evolution in Saccharomyces cerevisiae. We demonstrate that -1 PRF switches tightly control the relative stoichiometry of two distinct protein outputs from a single mRNA, exhibiting consistent ligand response across whole populations of cells. Furthermore, -1 PRF switches were applied to build single-mRNA logic gates and an apoptosis module in yeast. Together, these results showcase the potential for harnessing translation-reprogramming mechanisms for synthetic biology, and they establish -1 PRF switches as powerful RNA tools for controlling protein synthesis in eukaryotes. PMID:26999002

  8. Ribosomal Oxygenases are Structurally Conserved from Prokaryotes to Humans

    PubMed Central

    Chowdhury, Rasheduzzaman; Krojer, Tobias; Ho, Chia-hua; Ng, Stanley S.; Clifton, Ian J.; Ge, Wei; Kershaw, Nadia J.; Fox, Gavin C.; Muniz, Joao R. C.; Vollmar, Melanie; Phillips, Claire; Pilka, Ewa S.; Kavanagh, Kathryn L.; von Delft, Frank; Oppermann, Udo; McDonough, Michael A.; Doherty, Aiden J.; Schofield, Christopher J.

    2014-01-01

    2-Oxoglutarate (2OG)-dependent oxygenases play important roles in the regulation of gene expression via demethylation of N-methylated chromatin components1,2, hydroxylation of transcription factors3, and of splicing factor proteins4. Recently, 2OG-oxygenases that catalyze hydroxylation of tRNA5-7 and ribosomal proteins8, have been shown to play roles in translation relating to cellular growth, TH17-cell differentiation and translational accuracy9-12. The finding that the ribosomal oxygenases (ROX) occur in organisms ranging from prokaryotes to humans8 raises questions as to their structural and evolutionary relationships. In Escherichia coli, ycfD catalyzes arginine-hydroxylation in the ribosomal protein L16; in humans, Mina53 (MYC-induced nuclear antigen) and NO66 (Nucleolar protein 66) catalyze histidine-hydroxylation in ribosomal proteins rpL27a and rpL8, respectively. The functional assignments of the ROX open therapeutic possibilities via either ROX inhibition or targeting of differentially modified ribosomes. Despite differences in residue- and protein-selectivities of prokaryotic and eukaryotic ROX, crystal structures of ycfD and ycfDRM from E. coli and Rhodothermus marinus with those of human Mina53 and NO66 (hROX) reveal highly conserved folds and novel dimerization modes defining a new structural subfamily of 2OG-oxygenases. ROX structures in complex with/without their substrates, support their functional assignments as hydroxylases, but not demethylases and reveal how the subfamily has evolved to catalyze the hydroxylation of different residue sidechains of ribosomal proteins. Comparison of ROX crystal structures with those of other JmjC-hydroxylases including the hypoxia-inducible factor asparaginyl-hydroxylase (FIH) and histone Nε-methyl lysine demethylases (KDMs) identifies branchpoints in 2OG-oxygenase evolution and distinguishes between JmjC-hydroxylases and -demethylases catalyzing modifications of translational and transcriptional machinery. The

  9. Analysis of two domains with novel RNA-processing activities throws light on the complex evolution of ribosomal RNA biogenesis

    PubMed Central

    Burroughs, A. Maxwell; Aravind, L.

    2014-01-01

    Ribosomal biogenesis has been extensively investigated, especially to identify the elusive nucleases and cofactors involved in the complex rRNA processing events in eukaryotes. Large-scale screens in yeast identified two biochemically uncharacterized proteins, TSR3 and TSR4, as being key players required for rRNA maturation. Using multiple computational approaches we identify the conserved domains comprising these proteins and establish sequence and structural features providing novel insights regarding their roles. TSR3 is unified with the DTW domain into a novel superfamily of predicted enzymatic domains, with the balance of the available evidence pointing toward an RNase role with the archaeo-eukaryotic TSR3 proteins processing rRNA and the bacterial versions potentially processing tRNA. TSR4, its other eukaryotic homologs PDCD2/rp-8, PDCD2L, Zfrp8, and trus, the predominantly bacterial DUF1963 proteins, and other uncharacterized proteins are unified into a new domain superfamily, which arose from an ancient duplication event of a strand-swapped, dimer-forming all-beta unit. We identify conserved features mediating protein-protein interactions (PPIs) and propose a potential chaperone-like function. While contextual evidence supports a conserved role in ribosome biogenesis for the eukaryotic TSR4-related proteins, there is no evidence for such a role for the bacterial versions. Whereas TSR3-related proteins can be traced to the last universal common ancestor (LUCA) with a well-supported archaeo-eukaryotic branch, TSR4-related proteins of eukaryotes are derived from within the bacterial radiation of this superfamily, with archaea entirely lacking them. This provides evidence for “systems admixture,” which followed the early endosymbiotic event, playing a key role in the emergence of the uniquely eukaryotic ribosome biogenesis process. PMID:25566315

  10. Mutations in the leader region of ribosomal RNA operons cause structurally defective 30 S ribosomes as revealed by in vivo structural probing.

    PubMed

    Balzer, M; Wagner, R

    1998-02-27

    The biogenesis of functional ribosomes is regulated in a very complex manner, involving different proteins and RNA molecules. RNAs are not only essential components of both ribosomal subunits but also transiently interacting factors during particle formation. In eukaryotes snoRNAs act as molecular chaperones to assist maturation, modification and assembly. In a very similar way highly conserved leader sequences of bacterial rRNA operons are involved in the correct formation of 30 S ribosomal subunits. Certain mutations in the rRNA leader region cause severe growth defects due to malfunction of ribosomes which are assembled from such transcription units. To understand how the leader sequences act to facilitate the formation of the correct 30 S subunits we performed in vivo chemical probing to assess structural differences between ribosomes assembled either from rRNA transcribed from wild-type operons or from operons which contain mutations in the rRNA leader region. Cells transformed with plasmids containing the respective rRNA operons were reacted with dimethylsulphate (DMS). Ribosomes were isolated by sucrose gradient centrifugation and modified nucleotides within the 16 S rRNA were identified by primer extension reaction. Structural differences between ribosomes from wild-type and mutant rRNA operons occur in several clusters within the 16 S rRNA secondary structure. The most prominent differences are located in the central domain including the universally conserved pseudoknot structure which connects the 5', the central and the 3' domain of 16 S rRNA. Two other clusters with structural differences fall in the 5' domain where the leader had been shown to interact with mature 16 S rRNA and within the ribosomal protein S4 binding site. The other differences in structure are located in sites which are also known as sites for the action of several antibiotics. The data explain the functional defects of ribosomes from rRNA operons with leader mutations and help to

  11. Early-branching or fast-evolving eukaryotes? An answer based on slowly evolving positions.

    PubMed

    Philippe, H; Lopez, P; Brinkmann, H; Budin, K; Germot, A; Laurent, J; Moreira, D; Müller, M; Le Guyader, H

    2000-06-22

    The current paradigm of eukaryotic evolution is based primarily on comparative analysis of ribosomal RNA sequences. It shows several early-emerging lineages, mostly amitochondriate, which might be living relics of a progressive assembly of the eukaryotic cell. However, the analysis of slow-evolving positions, carried out with the newly developed slow-fast method, reveals that these lineages are, in terms of nucleotide substitution, fast-evolving ones, misplaced at the base of the tree by a long branch attraction artefact. Since the fast-evolving groups are not always the same, depending on which macromolecule is used as a marker, this explains most of the observed incongruent phylogenies. The current paradigm of eukaryotic evolution thus has to be seriously re-examined as the eukaryotic phylogeny is presently best summarized by a multifurcation. This is consistent with the Big Bang hypothesis that all extant eukaryotic lineages are the result of multiple cladogeneses within a relatively brief period, although insufficiency of data is also a possible explanation for the lack of resolution. For further resolution, rare evolutionary events such as shared insertions and/or deletions or gene fusions might be helpful. PMID:10902687

  12. The twilight of Heliozoa and rise of Rhizaria, an emerging supergroup of amoeboid eukaryotes

    PubMed Central

    Nikolaev, Sergey I.; Berney, Cédric; Fahrni, José F.; Bolivar, Ignacio; Polet, Stephane; Mylnikov, Alexander P.; Aleshin, Vladimir V.; Petrov, Nikolai B.; Pawlowski, Jan

    2004-01-01

    Recent molecular phylogenetic studies revealed the extraordinary diversity of single-celled eukaryotes. However, the proper assessment of this diversity and accurate reconstruction of the eukaryote phylogeny are still impeded by the lack of molecular data for some major groups of easily identifiable and cultivable protists. Among them, amoeboid eukaryotes have been notably absent from molecular phylogenies, despite their diversity, complexity, and abundance. To partly fill this phylogenetic gap, we present here combined small-subunit ribosomal RNA and actin sequence data for the three main groups of “Heliozoa” (Actinophryida, Centrohelida, and Desmothoracida), the heliozoan-like Sticholonche, and the radiolarian group Polycystinea. Phylogenetic analyses of our sequences demonstrate the polyphyly of heliozoans, which branch either as an independent eukaryotic lineage (Centrohelida), within stramenopiles (Actinophryida), or among cercozoans (Desmothoracida), in broad agreement with previous ultrastructure-based studies. Our data also provide solid evidence for the existence of the Rhizaria, an emerging supergroup of mainly amoeboid eukaryotes that includes desmothoracid heliozoans, all radiolarians, Sticholonche, and foraminiferans, as well as various filose and reticulose amoebae and some flagellates. PMID:15148395

  13. Sequence of the 16S ribosomal RNA from Halobacterium volcanii, an archaebacterium

    NASA Technical Reports Server (NTRS)

    Gupta, R.; Lanter, J. M.; Woese, C. R.

    1983-01-01

    The sequence of the 16S ribosomal RNA (rRNA) from the archaebacterium Halobacterium volcanii has been determined by DNA sequencing methods. The archaebacterial rRNA is similar to its eubacterial counterpart in secondary structure. Although it is closer in sequence to the eubacterial 16S rRNA than to the eukaryotic 16S-like rRNA, the H. volcanii sequence also shows certain points of specific similarity to its eukaryotic counterpart. Since the H. volcanii sequence is closer to both the eubacterial and the eukaryotic sequences than these two are to one another, it follows that the archaebacterial sequence resembles their common ancestral sequence more closely than does either of the other two versions.

  14. AMPLIFICATION OF RIBOSOMAL RNA SEQUENCES

    EPA Science Inventory

    This book chapter offers an overview of the use of ribosomal RNA sequences. A history of the technology traces the evolution of techniques to measure bacterial phylogenetic relationships and recent advances in obtaining rRNA sequence information. The manual also describes procedu...

  15. Studies on Pea Ribosomal Proteins

    PubMed Central

    Lin, Chu-Yung; Chia, Subrina Li-Li; Travis, Robert L.; Key, Joe L.

    1975-01-01

    Ribosomal subunits prepared by NH4Cl dissociation (0.5 m) of the monomeric ribosomes were much less active in in vitro protein synthesis than those prepared by KCl dissociation. The decrease in activity correlated with a detachment of some proteins (L2 and L9 as shown by gel electrophoresis) within the 60S ribosomal subunits. Subunits prepared with 0.3 m NH4Cl retained L2 and L9, but the activity remained low. Incubation of these 60S subunits in TKM buffer (50 mm tris [pH 7.5], 20 mm KCl, and 5 mm MgCl2) for 20 min at 37 C restored the activity almost to the level of those obtained by KCl dissociation. Treatment of the 0.3 m NH4Cl-derived 60S subunits with a protein reagent, Procion brilliant blue, prior to extraction of the ribosomal proteins resulted in the loss of L2 and L9, showing that these proteins were made accessible for dye binding. These observations suggest that a considerable degree of unfolding of the 60S subunit occurs at 0.3 m NH4Cl (this apparently leads to a preferential detachment of L2 and L9 at 0.5 m NH4Cl) and that the activity of the purified subunits depends not only on the presence of L2 and L9 but also on the organization of these proteins within the 60S subunits. Images PMID:16659254

  16. The ribosomal protein Asc1/RACK1 is required for efficient translation of short mRNAs

    PubMed Central

    Thompson, Mary K; Rojas-Duran, Maria F; Gangaramani, Paritosh; Gilbert, Wendy V

    2016-01-01

    Translation is a core cellular process carried out by a highly conserved macromolecular machine, the ribosome. There has been remarkable evolutionary adaptation of this machine through the addition of eukaryote-specific ribosomal proteins whose individual effects on ribosome function are largely unknown. Here we show that eukaryote-specific Asc1/RACK1 is required for efficient translation of mRNAs with short open reading frames that show greater than average translational efficiency in diverse eukaryotes. ASC1 mutants in S. cerevisiae display compromised translation of specific functional groups, including cytoplasmic and mitochondrial ribosomal proteins, and display cellular phenotypes consistent with their gene-specific translation defects. Asc1-sensitive mRNAs are preferentially associated with the translational ‘closed loop’ complex comprised of eIF4E, eIF4G, and Pab1, and depletion of eIF4G mimics the translational defects of ASC1 mutants. Together our results reveal a role for Asc1/RACK1 in a length-dependent initiation mechanism optimized for efficient translation of genes with important housekeeping functions. DOI: http://dx.doi.org/10.7554/eLife.11154.001 PMID:27117520

  17. Cap-dependent translation is mediated by ‘RNA looping’ rather than ‘ribosome scanning’

    PubMed Central

    Jang, Sung Key; Paek, Ki Young

    2016-01-01

    Abstract The 40S ribosomal subunit cannot directly recognize the start codon of eukaryotic mRNAs. Instead, it recognizes the start codon after its association with the 5′-cap structure via translation initiation factors. Base-by-base inspection of the 5′UTR by a scanning ribosome is the generally accepted hypothesis of start codon selection. As part of an effort to confirm the underlying mechanism of start codon selection by the 40S ribosome, we investigated the role of eIF4G, which participates in the recruitment of 40S ribosomes to various translation enhancers, such as 5′-cap structure, poly(A) tail, and several internal ribosome entry sites. We found that an artificial translation factor composed of recombinant eIF4G fused with MS2 greatly enhanced translation of an upstream reporter gene when it was tethered to the 3′UTR. These data suggest that the 40S ribosome recruited to a translation enhancer can find the start codon by looping of the intervening RNA segment. The ‘RNA-looping’ hypothesis of translation start codon recognition was further supported by an analysis of the effect of 5′UTR length on translation efficiency and the mathematically predicted probability of RNA-loop–mediated interactions between the start codon and the 40S ribosome associated at the 5′-end. PMID:26515582

  18. Open questions on the origin of eukaryotes

    PubMed Central

    López-García, Purificación; Moreira, David

    2015-01-01

    Despite recent progress, the origin of the eukaryotic cell remains enigmatic. It is now known that the last eukaryotic common ancestor was complex and that endosymbiosis played a crucial role in eukaryogenesis at least via the acquisition of the alphaproteobacterial ancestor of mitochondria. However, the nature of the mitochondrial host is controversial, although the recent discovery of an archaeal lineage phylogenetically close to eukaryotes reinforces models proposing archaea-derived hosts. We argue that, in addition to improved phylogenomic analyses with more comprehensive taxon sampling to pinpoint the closest prokaryotic relatives of eukaryotes, determining plausible mechanisms and selective forces at the origin of key eukaryotic features, such as the nucleus or the bacterial-like eukaryotic membrane system, is essential to constrain existing models. PMID:26455774

  19. A Eukaryote without a Mitochondrial Organelle.

    PubMed

    Karnkowska, Anna; Vacek, Vojtěch; Zubáčová, Zuzana; Treitli, Sebastian C; Petrželková, Romana; Eme, Laura; Novák, Lukáš; Žárský, Vojtěch; Barlow, Lael D; Herman, Emily K; Soukal, Petr; Hroudová, Miluše; Doležal, Pavel; Stairs, Courtney W; Roger, Andrew J; Eliáš, Marek; Dacks, Joel B; Vlček, Čestmír; Hampl, Vladimír

    2016-05-23

    The presence of mitochondria and related organelles in every studied eukaryote supports the view that mitochondria are essential cellular components. Here, we report the genome sequence of a microbial eukaryote, the oxymonad Monocercomonoides sp., which revealed that this organism lacks all hallmark mitochondrial proteins. Crucially, the mitochondrial iron-sulfur cluster assembly pathway, thought to be conserved in virtually all eukaryotic cells, has been replaced by a cytosolic sulfur mobilization system (SUF) acquired by lateral gene transfer from bacteria. In the context of eukaryotic phylogeny, our data suggest that Monocercomonoides is not primitively amitochondrial but has lost the mitochondrion secondarily. This is the first example of a eukaryote lacking any form of a mitochondrion, demonstrating that this organelle is not absolutely essential for the viability of a eukaryotic cell. PMID:27185558

  20. The size and conformation of Artemia (brine-shrimp) ribosomal RNA free in solution.

    PubMed

    Donceel, K; Nieuwenhuysen, P; Clauwaert, J

    1982-09-01

    The RNA was isolated from the large ribosomal subunits of the brine shrimp Artemia, and its conformation free in solution was studied by determining its sedimentation and diffusion coefficients. A comparison was made of the hydrodynamic radius of the ribosomal subunit and its isolated RNA in various buffers. The conformation of the rRNA free in solution is more extended than when it is incorporated in the ribosome. This is not only the case when the rRNA solution lacks bivalent and polyvalent cations, but even in the presence of Mg2+ and spermidine, which cause a tightening of RNA. Thus the ribosomal proteins should induce a further tightening of the rRNA during the assembly of the ribosome. In the discussion, the reported data on Escherichia coli rRNA species are presented in such a way that large discrepancies between various studied are revealed, and that they can be compared with the data reported here on the larger rRNA of an eukaryote. PMID:7150228

  1. Insertion of the Biogenesis Factor Rei1 Probes the Ribosomal Tunnel during 60S Maturation.

    PubMed

    Greber, Basil Johannes; Gerhardy, Stefan; Leitner, Alexander; Leibundgut, Marc; Salem, Michèle; Boehringer, Daniel; Leulliot, Nicolas; Aebersold, Ruedi; Panse, Vikram Govind; Ban, Nenad

    2016-01-14

    Eukaryotic ribosome biogenesis depends on several hundred assembly factors to produce functional 40S and 60S ribosomal subunits. The final phase of 60S subunit biogenesis is cytoplasmic maturation, which includes the proofreading of functional centers of the 60S subunit and the release of several ribosome biogenesis factors. We report the cryo-electron microscopy (cryo-EM) structure of the yeast 60S subunit in complex with the biogenesis factors Rei1, Arx1, and Alb1 at 3.4 Å resolution. In addition to the network of interactions formed by Alb1, the structure reveals a mechanism for ensuring the integrity of the ribosomal polypeptide exit tunnel. Arx1 probes the entire set of inner-ring proteins surrounding the tunnel exit, and the C terminus of Rei1 is deeply inserted into the ribosomal tunnel, where it forms specific contacts along almost its entire length. We provide genetic and biochemical evidence that failure to insert the C terminus of Rei1 precludes subsequent steps of 60S maturation. PMID:26709046

  2. PTRF/Cavin-1 promotes efficient ribosomal RNA transcription in response to metabolic challenges

    PubMed Central

    Liu, Libin; Pilch, Paul F

    2016-01-01

    Ribosomal RNA transcription mediated by RNA polymerase I represents the rate-limiting step in ribosome biogenesis. In eukaryotic cells, nutrients and growth factors regulate ribosomal RNA transcription through various key factors coupled to cell growth. We show here in mature adipocytes, ribosomal transcription can be acutely regulated in response to metabolic challenges. This acute response is mediated by PTRF (polymerase I transcription and release factor, also known as cavin-1), which has previously been shown to play a critical role in caveolae formation. The caveolae–independent rDNA transcriptional role of PTRF not only explains the lipodystrophy phenotype observed in PTRF deficient mice and humans, but also highlights its crucial physiological role in maintaining adipocyte allostasis. Multiple post-translational modifications of PTRF provide mechanistic bases for its regulation. The role of PTRF in ribosomal transcriptional efficiency is likely relevant to many additional physiological situations of cell growth and organismal metabolism. DOI: http://dx.doi.org/10.7554/eLife.17508.001 PMID:27528195

  3. Characterizing inactive ribosomes in translational profiling.

    PubMed

    Liu, Botao; Qian, Shu-Bing

    2016-01-01

    The broad impact of translational regulation has emerged explosively in the last few years in part due to the technological advance in genome-wide interrogation of gene expression. During mRNA translation, the majority of actively translating ribosomes exist as polysomes in cells with multiple ribosomes loaded on a single transcript. The importance of the monosome, however, has been less appreciated in translational profiling analysis. Here we report that the monosome fraction isolated by sucrose sedimentation contains a large quantity of inactive ribosomes that do not engage on mRNAs to direct translation. We found that the elongation factor eEF2, but not eEF1A, stably resides in these non-translating ribosomes. This unique feature permits direct evaluation of ribosome status under various stress conditions and in the presence of translation inhibitors. Ribosome profiling reveals that the monosome has a similar but not identical pattern of ribosome footprints compared to the polysome. We show that the association of free ribosomal subunits minimally contributes to ribosome occupancy outside of the coding region. Our results not only offer a quantitative method to monitor ribosome availability, but also uncover additional layers of ribosome status needed to be considered in translational profiling analysis. PMID:27335722

  4. Alcoholic Liver Disease and the Mitochondrial Ribosome

    PubMed Central

    Cahill, Alan; Sykora, Peter

    2009-01-01

    Summary Chronic alcohol consumption has been shown to severely compromise mitochondrial protein synthesis. Hepatic mitochondria isolated from alcoholic animals contain decreased levels of respiratory complexes and display depressed respiration rates when compared to pair-fed controls. One underlying mechanism for this involves ethanol-elicited alterations in the structural and functional integrity of the mitochondrial ribosome. Ethanol feeding results in ribosomal changes that include decreased sedimentation rates, larger hydrodynamic volumes, increased levels of unassociated subunits and changes in the levels of specific ribosomal proteins. The methods presented in this chapter detail how to isolate mitochondrial ribosomes, determine ribosomal activity, separate ribosomes into nucleic acid and protein, and perform two-dimensional nonequilibrium pH gradient electrophoretic polyacrylamide gel electrophoresis to separate and subsequently identify mitochondrial ribosomal proteins. PMID:18369931

  5. [About the ribosomal biogenesis in human].

    PubMed

    Tafforeau, Lionel

    2015-01-01

    Ribosomes are cellular ribonucleoprotein particles required for a fundamental mechanism, translation of the genetic information into proteins. Ribosome biogenesis is a highly complex pathway involving many maturation steps: ribosomal RNA (rRNA) synthesis, rRNA processing, pre-rRNA modifications, its assembly with ribosomal proteins in the nuceolus, export of the subunit precursors to the nucleoplasm and the cytoplasm. Ribosome biogenesis has mainly being investigated in yeast during these last 25 years. However, recent works have shown that, despite many similarities between yeast and human ribosome structure and biogenesis, human pre-rRNA processing is far more complex than in yeast. In order to better understand diseases related to a malfunction in ribosome synthesis, the ribosomopathies, research should be conducted directly in human cells and animal models. PMID:26152166

  6. Intersubunit movement is required for ribosomal translocation

    PubMed Central

    Horan, Lucas H.; Noller, Harry F.

    2007-01-01

    Translocation of tRNA and mRNA during protein synthesis is believed to be coupled to structural changes in the ribosome. The “ratchet model,” based on cryo-EM reconstructions of ribosome complexes, invokes relative movement of the 30S and 50S ribosomal subunits in this process; however, evidence that directly demonstrates a requirement for intersubunit movement during translocation is lacking. To address this problem, we created an intersubunit disulfide cross-link to restrict potential movement. The cross-linked ribosomes were unable to carry out polypeptide synthesis; this inhibition was completely reversed upon reduction of the disulfide bridge. In vitro assays showed that the cross-linked ribosomes were specifically blocked in elongation factor G-dependent translocation. These findings show that intersubunit movement is required for ribosomal translocation, accounting for the universal two-subunit architecture of ribosomes. PMID:17360328

  7. The ribosome quality control pathway can access nascent polypeptides stalled at the Sec61 translocon.

    PubMed

    von der Malsburg, Karina; Shao, Sichen; Hegde, Ramanujan S

    2015-06-15

    Cytosolic ribosomes that stall during translation are split into subunits, and nascent polypeptides trapped in the 60S subunit are ubiquitinated by the ribosome quality control (RQC) pathway. Whether the RQC pathway can also target stalls during cotranslational translocation into the ER is not known. Here we report that listerin and NEMF, core RQC components, are bound to translocon-engaged 60S subunits on native ER membranes. RQC recruitment to the ER in cultured cells is stimulated by translation stalling. Biochemical analyses demonstrated that translocon-targeted nascent polypeptides that subsequently stall are polyubiquitinated in 60S complexes. Ubiquitination at the translocon requires cytosolic exposure of the polypeptide at the ribosome-Sec61 junction. This exposure can result from either failed insertion into the Sec61 channel or partial backsliding of translocating nascent chains. Only Sec61-engaged nascent chains early in their biogenesis were relatively refractory to ubiquitination. Modeling based on recent 60S-RQC and 80S-Sec61 structures suggests that the E3 ligase listerin accesses nascent polypeptides via a gap in the ribosome-translocon junction near the Sec61 lateral gate. Thus the RQC pathway can target stalled translocation intermediates for degradation from the Sec61 channel. PMID:25877867

  8. How eukaryotic genes are transcribed

    PubMed Central

    Venters, Bryan J.; Pugh, B. Franklin

    2009-01-01

    Summary Regulation of eukaryotic gene expression is far more complex than one might have imagined thirty years ago. However, progress towards understanding gene regulatory mechanisms has been rapid and comprehensive, which has made the integration of detailed observations into broadly connected concepts a challenge. This review attempts to integrate the following concepts: 1) a well-defined organization of nucleosomes and modification states at most genes, 2) regulatory networks of sequence-specific transcription factors, 3) chromatin remodeling coupled to promoter assembly of the general transcription factors and RNA polymerase II, and 4) phosphorylation states of RNA polymerase II coupled to chromatin modification states during transcription. The wealth of new insights arising from the tools of biochemistry, genomics, cell biology, and genetics is providing a remarkable view into the mechanics of gene regulation. PMID:19514890

  9. Dosage Sensitivity of RPL9 and Concerted Evolution of Ribosomal Protein Genes in Plants

    PubMed Central

    Devis, Deborah; Firth, Sue M.; Liang, Zhe; Byrne, Mary E.

    2015-01-01

    The ribosome in higher eukaryotes is a large macromolecular complex composed of four rRNAs and eighty different ribosomal proteins. In plants, each ribosomal protein is encoded by multiple genes. Duplicate genes within a family are often necessary to provide a threshold dose of a ribosomal protein but in some instances appear to have non-redundant functions. Here, we addressed whether divergent members of the RPL9 gene family are dosage sensitive or whether these genes have non-overlapping functions. The RPL9 family in Arabidopsis thaliana comprises two nearly identical members, RPL9B and RPL9C, and a more divergent member, RPL9D. Mutations in RPL9C and RPL9D genes lead to delayed growth early in development, and loss of both genes is embryo lethal, indicating that these are dosage-sensitive and redundant genes. Phylogenetic analysis of RPL9 as well as RPL4, RPL5, RPL27a, RPL36a, and RPS6 family genes in the Brassicaceae indicated that multicopy ribosomal protein genes have been largely retained following whole genome duplication. However, these gene families also show instances of tandem duplication, small scale deletion, and evidence of gene conversion. Furthermore, phylogenetic analysis of RPL9 genes in angiosperm species showed that genes within a species are more closely related to each other than to RPL9 genes in other species, suggesting ribosomal protein genes undergo convergent evolution. Our analysis indicates that ribosomal protein gene retention following whole genome duplication contributes to the number of genes in a family. However, small scale rearrangements influence copy number and likely drive concerted evolution of these dosage-sensitive genes. PMID:26734020

  10. The origin and diversification of eukaryotes: problems with molecular phylogenetics and molecular clock estimation

    PubMed Central

    Roger, Andrew J; Hug, Laura A

    2006-01-01

    Determining the relationships among and divergence times for the major eukaryotic lineages remains one of the most important and controversial outstanding problems in evolutionary biology. The sequencing and phylogenetic analyses of ribosomal RNA (rRNA) genes led to the first nearly comprehensive phylogenies of eukaryotes in the late 1980s, and supported a view where cellular complexity was acquired during the divergence of extant unicellular eukaryote lineages. More recently, however, refinements in analytical methods coupled with the availability of many additional genes for phylogenetic analysis showed that much of the deep structure of early rRNA trees was artefactual. Recent phylogenetic analyses of a multiple genes and the discovery of important molecular and ultrastructural phylogenetic characters have resolved eukaryotic diversity into six major hypothetical groups. Yet relationships among these groups remain poorly understood because of saturation of sequence changes on the billion-year time-scale, possible rapid radiations of major lineages, phylogenetic artefacts and endosymbiotic or lateral gene transfer among eukaryotes. Estimating the divergence dates between the major eukaryote lineages using molecular analyses is even more difficult than phylogenetic estimation. Error in such analyses comes from a myriad of sources including: (i) calibration fossil dates, (ii) the assumed phylogenetic tree, (iii) the nucleotide or amino acid substitution model, (iv) substitution number (branch length) estimates, (v) the model of how rates of evolution change over the tree, (vi) error inherent in the time estimates for a given model and (vii) how multiple gene data are treated. By reanalysing datasets from recently published molecular clock studies, we show that when errors from these various sources are properly accounted for, the confidence intervals on inferred dates can be very large. Furthermore, estimated dates of divergence vary hugely depending on the methods

  11. Crystallization of the two-domain N-terminal fragment of the archaeal ribosomal protein L10(P0) in complex with a specific fragment of 23S rRNA

    SciTech Connect

    Kravchenko, O. V.; Mitroshin, I. V.; Gabdulkhakov, A. G.; Nikonov, S. V.; Garber, M. B.

    2011-07-15

    Lateral L12-stalk (P1-stalk in Archaea, P1/P2-stalk in eukaryotes) is an obligatory morphological element of large ribosomal subunits in all organisms studied. This stalk is composed of the complex of ribosomal proteins L10(P0) and L12(P1) and interacts with 23S rRNA through the protein L10(P0). L12(P1)-stalk is involved in the formation of GTPase center of the ribosome and plays an important role in the ribosome interaction with translation factors. High mobility of this stalk puts obstacles in determination of its structure within the intact ribosome. Crystals of a two-domain N-terminal fragment of ribosomal protein L10(P0) from the archaeon Methanococcus jannaschii in complex with a specific fragment of rRNA from the same organism have been obtained. The crystals diffract X-rays at 3.2 Angstrom-Sign resolution.

  12. Crystallization of the two-domain N-terminal fragment of the archaeal ribosomal protein L10(P0) in complex with a specific fragment of 23S rRNA

    NASA Astrophysics Data System (ADS)

    Kravchenko, O. V.; Mitroshin, I. V.; Gabdulkhakov, A. G.; Nikonov, S. V.; Garber, M. B.

    2011-07-01

    Lateral L12-stalk (P1-stalk in Archaea, P1/P2-stalk in eukaryotes) is an obligatory morphological element of large ribosomal subunits in all organisms studied. This stalk is composed of the complex of ribosomal proteins L10(P0) and L12(P1) and interacts with 23S rRNA through the protein L10(P0). L12(P1)-stalk is involved in the formation of GTPase center of the ribosome and plays an important role in the ribosome interaction with translation factors. High mobility of this stalk puts obstacles in determination of its structure within the intact ribosome. Crystals of a two-domain N-terminal fragment of ribosomal protein L10(P0) from the archaeon Methanococcus jannaschii in complex with a specific fragment of rRNA from the same organism have been obtained. The crystals diffract X-rays at 3.2 Å resolution.

  13. Re-analysis of cryoEM data on HCV IRES bound to 40S subunit of human ribosome integrated with recent structural information suggests new contact regions between ribosomal proteins and HCV RNA

    PubMed Central

    Joseph, Agnel Praveen; Bhat, Prasanna; Das, Saumitra; Srinivasan, Narayanaswamy

    2014-01-01

    In this study, we combine available high resolution structural information on eukaryotic ribosomes with low resolution cryo-EM data on the Hepatitis C Viral RNA (IRES) human ribosome complex. Aided further by the prediction of RNA-protein interactions and restrained docking studies, we gain insights on their interaction at the residue level. We identified the components involved at the major and minor contact regions, and propose that there are energetically favorable local interactions between 40S ribosomal proteins and IRES domains. Domain II of the IRES interacts with ribosomal proteins S5 and S25 while the pseudoknot and the downstream domain IV region bind to ribosomal proteins S26, S28 and S5. We also provide support using UV cross-linking studies to validate our proposition of interaction between the S5 and IRES domains II and IV. We found that domain IIIe makes contact with the ribosomal protein S3a (S1e). Our model also suggests that the ribosomal protein S27 interacts with domain IIIc while S7 has a weak contact with a single base RNA bulge between junction IIIabc and IIId. The interacting residues are highly conserved among mammalian homologs while IRES RNA bases involved in contact do not show strict conservation. IRES RNA binding sites for S25 and S3a show the best conservation among related viral IRESs. The new contacts identified between ribosomal proteins and RNA are consistent with previous independent studies on RNA-binding properties of ribosomal proteins reported in literature, though information at the residue level is not available in previous studies. PMID:25268799

  14. Ribosome engineering to promote new crystal forms

    SciTech Connect

    Selmer, Maria; Gao, Yong-Gui; Weixlbaumer, Albert; Ramakrishnan, V.

    2012-05-01

    Truncation of ribosomal protein L9 in T. thermophilus allows the generation of new crystal forms and the crystallization of ribosome–GTPase complexes. Crystallographic studies of the ribosome have provided molecular details of protein synthesis. However, the crystallization of functional complexes of ribosomes with GTPase translation factors proved to be elusive for a decade after the first ribosome structures were determined. Analysis of the packing in different 70S ribosome crystal forms revealed that regardless of the species or space group, a contact between ribosomal protein L9 from the large subunit and 16S rRNA in the shoulder of a neighbouring small subunit in the crystal lattice competes with the binding of GTPase elongation factors to this region of 16S rRNA. To prevent the formation of this preferred crystal contact, a mutant strain of Thermus thermophilus, HB8-MRCMSAW1, in which the ribosomal protein L9 gene has been truncated was constructed by homologous recombination. Mutant 70S ribosomes were used to crystallize and solve the structure of the ribosome with EF-G, GDP and fusidic acid in a previously unobserved crystal form. Subsequent work has shown the usefulness of this strain for crystallization of the ribosome with other GTPase factors.

  15. Neutron scattering in the ribosome structure

    NASA Astrophysics Data System (ADS)

    Serdyuk, Igor N.

    1997-02-01

    Thermal neutron scattering has become a powerful instrument for studying the ribosome and its components. The application of neutron scattering allowed to establish some principal features of the ribosome structure: non-homogeneous distribution of the RNA and protein within ribosomal particles, the RNA role as a framework in the arrangement and maintenance of the structure of ribosomal particles, and the globular character of ribosomal proteins. The use of selective deuteration of separate ribosomal proteins in combination with the triangulation method revealed mutual spatial arrangement (the 3D-map) of all the ribosomal proteins within the small particle and in the most part of the large ribosomal particle. An essential impact has been made in the structural studies of ribosomes with the development of novel experimental approaches: triple isotopic substitution and spin contrast variation. These approaches with direct interpretation of spherical harmonics provide new possibilities for constructing models of ribosomal particles, opening principally new perspectives for joint use of X-ray synchrotron diffraction in crystals and small-angle neutron scattering in solution.

  16. Unlocking the eukaryotic membrane protein structural proteome

    PubMed Central

    Lee, John Kyongwon; Stroud, Robert Michael

    2012-01-01

    Summary Most of the 231 unique membrane protein structures (as of 3/2010) are of bacterial membrane proteins (MPs) expressed in bacteria, or eukaryotic MPs from natural sources. However eukaryotic membrane proteins, especially those with more than three membrane crossings rarely succumb to any suitable expression in bacterial cells. They typically require expression in eukaryotic cells that can provide appropriate endoplasmic reticulum, chaperones, targeting and post-translational processing. In evidence, only ~20 eukaryotic MP structures have resulted from heterologous expression. This is required for a general approach to target particular human or pathogen membrane proteins of importance to human health. The first of these appeared in 2005. Our review addresses the special issues that pertain to the expression of eukaryotic and human membrane proteins, and recent advances in the tool kit for crystallization and structure determination. PMID:20739007

  17. Eukaryote kingdoms: seven or nine?

    PubMed

    Cavalier-Smith, T

    1981-01-01

    The primary taxa of eukaryote classification should be monophyletic and based on fundamental cell structure rather than nutritional adaptive zones. The classical two kingdom classification into "plants" and "animals" and the newer four kingdom classifications into "protis", "fungi" "animals" and "plants" are therefore both unsatisfactory. Eukaryotes can be classified into nine kingdoms each defined in terms of a unique constellation of cell structures. Five kingdoms have plate-like mitochondrial cristae: (1) Eufungi (the non-ciliated fungi, which unlike the other eight kingdoms have unstacked Golgi cisternae), (2) Ciliofungi (the posteriorly ciliated fungi), (3) Animalia (Animals, sponges, mesozoa, and choanociliates; phagotrophs with basically posterior ciliation), (4) Biliphyta (Non-phagotrophic, phycobilisome-containing, algae; i.e. theGlaucophyceae and Rhodophyceae), (5) Viridiplantae (Non-phagotrophic green plants, with starch-containing plastids). Kingdom (6), the Euglenozoa, has disc-shaped cristae and an intraciliary dense rod and may be phagotrophic and/or phototrophic with plastids with three-membraned envelopes. Kingdom (7), the cryptophyta, has flattened tubular cristae, tubular mastigonemes on both cilia,m and starch in thecompartment between the plastid endoplasmic reticulum and the plastid envelope; their plastids, if present, have phycobilins inside the paired thylakoids and chlorophyll c2. Kingdom (8), the Chromophyta, has tubular cristae, together with tubular mastigonemes on one anterior cilum and/or a plastid endoplasmic reticulum and chlorophyll c1 + c2. Members of the ninth kingdom, the Protozoa, are mainly phagotrophic, and have tubular or vesicular cristae (or lack mitochondria altogether), and lack tubular mastigonemes on their (primitively anterior) cilia; plastids if present have three-envelop membranes, chlorophyll c2, and no internal starch, and a plastid endoplasmic reticulum is absent. Kingdoms 4-9 are primitively anteriorly biciliate

  18. Structural Insights Into Ribosome Recycling Factor Interactions with the 70S Ribosome

    PubMed Central

    Pai, Raj D.; Zhang, Wen; Schuwirth, Barbara S.; Hirokawa, Go; Kaji, Hideko; Kaji, Akira; Cate, Jamie H.D.

    2009-01-01

    SUMMARY At the end of translation in bacteria, ribosome recycling factor (RRF) is used together with Elongation Factor G (EF-G) to recycle the 30S and 50S ribosomal subunits for the next round of translation. In x-ray crystal structures of RRF with the Escherichia coli 70S ribosome, RRF binds to the large ribosomal subunit in the cleft that contains the peptidyl transferase center (PTC). Upon binding of either E. coli or T. thermophilus RRF to the E. coli ribosome, the tip of ribosomal RNA helix H69 in the large subunit moves away from the small subunit toward RRF by 8 Å, thereby disrupting a key contact between the small and large ribosomal subunits, termed bridge B2a. In the ribosome crystals, the ability of RRF to destabilize bridge B2a is influenced by crystal packing forces. Movement of H69 involves an ordered to disordered transition upon binding of RRF to the ribosome. The disruption of bridge B2a upon RRF binding to the ribosome seen in the present structures reveals one of the key roles that RRF plays in ribosome recycling, the dissociation of 70S ribosomes into subunits. The structures also reveal contacts between Domain II of RRF and protein S12 in the 30S subunit that may also play a role in ribosome recycling. PMID:18234219

  19. Synthesis of ribosomes in Saccharomyces cerevisiae.

    PubMed Central

    Warner, J R

    1989-01-01

    The assembly of a eucaryotic ribosome requires the synthesis of four ribosomal ribonucleic acid (RNA) molecules and more than 75 ribosomal proteins. It utilizes all three RNA polymerases; it requires the cooperation of the nucleus and the cytoplasm, the processing of RNA, and the specific interaction of RNA and protein molecules. It is carried out efficiently and is exquisitely sensitive to the needs of the cell. Our current understanding of this process in the genetically tractable yeast Saccharomyces cerevisiae is reviewed. The ribosomal RNA genes are arranged in a tandem array of 100 to 200 copies. This tandem array has led to unique ways of carrying out a number of functions. Replication is asymmetric and does not initiate from every autonomously replicating sequence. Recombination is suppressed. Transcription of the major ribosomal RNA appears to involve coupling between adjacent transcription units, which are separated by the 5S RNA transcription unit. Genes for many ribosomal proteins have been cloned and sequenced. Few are linked; most are duplicated; most have an intron. There is extensive homology between yeast ribosomal proteins and those of other species. Most, but not all, of the ribosomal protein genes have one or two sites that are essential for their transcription and that bind a common transcription factor. This factor binds also to many other places in the genome, including the telomeres. There is coordinated transcription of the ribosomal protein genes under a variety of conditions. However, the cell seems to possess no mechanism for regulating the transcription of individual ribosomal protein genes in response either to a deficiency or an excess of a particular ribosomal protein. A deficiency causes slow growth. Any excess ribosomal protein is degraded very rapidly, with a half-life of 1 to 5 min. Unlike most types of cells, yeast cells appear not to regulate the translation of ribosomal proteins. However, in the case of ribosomal protein L32

  20. Chromatin and histones from Giardia lamblia: a new puzzle in primitive eukaryotes.

    PubMed

    Triana, O; Galanti, N; Olea, N; Hellman, U; Wernstedt, C; Lujan, H; Medina, C; Toro, G C

    2001-01-01

    The three deepest eukaryote lineages in small subunit ribosomal RNA phylogenies are the amitochondriate Microsporidia, Metamonada, and Parabasalia. They are followed by either the Euglenozoa (e.g., Euglena and Trypanosoma) or the Percolozoa as the first mitochondria-containing eukaryotes. Considering the great divergence of histone proteins in protozoa we have extended our studies of histones from Trypanosomes (Trypanosoma cruzi, Crithidia fasciculata and Leishmania mexicana) to the Metamonada Giardia lamblia, since Giardia is thought to be one of the most primitive eukaryotes. In the present work, the structure of G. lamblia chromatin and the histone content of the soluble chromatin were investigated and compared with that of higher eukaryotes, represented by calf thymus. The chromatin is present as nucleosome filaments which resemble the calf thymus array in that they show a more regular arrangement than those described for Trypanosoma. SDS-polyacrylamide gel electrophoresis and protein characterization revealed that the four core histones described in Giardia are in the same range of divergence with the histones from other lower eukaryotes. In addition, G. lamblia presented an H1 histone with electrophoretic mobility resembling the H1 of higher eukaryotes, in spite of the fact that H1 has a different molecular mass in calf thymus. Giardia also presents a basic protein which was identified as an HU-like DNA-binding protein usually present in eubacteria, indicating a chimaeric composition for the DNA-binding protein set in this species. Finally, the phylogenetic analysis of selected core histone protein sequences place Giardia divergence before Trypanosoma, despite the fact that Trypanosoma branch shows an acceleration in the evolutionary rate pointing to an unusual evolutionary behavior in this lineage. PMID:11500935

  1. Control of ribosome formation in rat heart

    SciTech Connect

    Russo, L.A.

    1987-01-01

    Diabetes of 9 days duration produced a 17% diminution in the rate of total protein synthesis in rat hearts perfused as Langendorff preparations supplied with glucose, plasma levels of amino acids, and 400 ..mu..U/ml insulin. This reduction was attributable to a decrease in efficiency of protein synthesis and total RNA content. Total messenger RNA content decreased in diabetic hearts in proportion to the reduction in total RNA. Diabetes also resulted in diminished ribosome content as reflected by the induction in total RNA. Ribosome production was investigated by monitoring incorporation of (/sup 3/H)phenylalanine into the proteins of cytoplasmic ribosomes. Rates of ribosome formation in diabetic hearts were as fast as control rates in the presence of insulin, and were faster than control rates in the absence of the hormone. These results indicated that ribosome content fell in diabetic hearts despite unchanged or faster rates of ribosome formation.

  2. In Silico Resurrection of the Major Vault Protein Suggests It Is Ancestral in Modern Eukaryotes

    PubMed Central

    Daly, Toni K.; Sutherland-Smith, Andrew J.; Penny, David

    2013-01-01

    Vaults are very large oligomeric ribonucleoproteins conserved among a variety of species. The rat vault 3D structure shows an ovoid oligomeric particle, consisting of 78 major vault protein monomers, each of approximately 861 amino acids. Vaults are probably the largest ribonucleoprotein structures in eukaryote cells, being approximately 70 nm in length with a diameter of 40 nm—the size of three ribosomes and with a lumen capacity of 50 million Å3. We use both protein sequences and inferred ancestral sequences for in silico virtual resurrection of tertiary and quaternary structures to search for vaults in a wide variety of eukaryotes. We find that the vault’s phylogenetic distribution is widespread in eukaryotes, but is apparently absent in some notable model organisms. Our conclusion from the distribution of vaults is that they were present in the last eukaryote common ancestor but they have apparently been lost from a number of groups including fungi, insects, and probably plants. Our approach of inferring ancestral 3D and quaternary structures is expected to be useful generally. PMID:23887922

  3. In silico resurrection of the major vault protein suggests it is ancestral in modern eukaryotes.

    PubMed

    Daly, Toni K; Sutherland-Smith, Andrew J; Penny, David

    2013-01-01

    Vaults are very large oligomeric ribonucleoproteins conserved among a variety of species. The rat vault 3D structure shows an ovoid oligomeric particle, consisting of 78 major vault protein monomers, each of approximately 861 amino acids. Vaults are probably the largest ribonucleoprotein structures in eukaryote cells, being approximately 70 nm in length with a diameter of 40 nm--the size of three ribosomes and with a lumen capacity of 50 million Å(3). We use both protein sequences and inferred ancestral sequences for in silico virtual resurrection of tertiary and quaternary structures to search for vaults in a wide variety of eukaryotes. We find that the vault's phylogenetic distribution is widespread in eukaryotes, but is apparently absent in some notable model organisms. Our conclusion from the distribution of vaults is that they were present in the last eukaryote common ancestor but they have apparently been lost from a number of groups including fungi, insects, and probably plants. Our approach of inferring ancestral 3D and quaternary structures is expected to be useful generally. PMID:23887922

  4. Circular RNAs in Eukaryotic Cells

    PubMed Central

    Chen, Liang; Huang, Chuan; Wang, Xiaolin; Shan, Ge

    2015-01-01

    Circular RNAs (circRNAs) are now recognized as large species of transcripts in eukaryotic cells. From model organisms such as C. elegans, Drosophila, mice to human beings, thousands of circRNAs formed from back-splicing of exons have been identified. The known complexity of transcriptome has been greatly expanded upon the discovery of these RNAs. Studies about the biogenesis and physiological functions have yielded substantial knowledge for the circRNAs, and they are now more likely to be viewed as regulatory elements coded by the genome rather than unavoidable noise of gene expression. Certain human diseases may also relate to circRNAs. These circRNAs show diversifications in features such as sequence composition and cellular localization, and thus we propose that they may be divided into subtypes such as cytoplasmic circRNAs, nuclear circRNAs, and exon-intron circRNAs (EIciRNAs). Here we summarize and discuss knowns and unknowns for these RNAs, and we need to keep in mind that the whole field is still at the beginning of exciting explorations. PMID:27047251

  5. Ribosomal stress activates eEF2K–eEF2 pathway causing translation elongation inhibition and recruitment of Terminal Oligopyrimidine (TOP) mRNAs on polysomes

    PubMed Central

    Gismondi, Angelo; Caldarola, Sara; Lisi, Gaia; Juli, Giada; Chellini, Lidia; Iadevaia, Valentina; Proud, Christopher G.; Loreni, Fabrizio

    2014-01-01

    The synthesis of adequate amounts of ribosomes is an essential task for the cell. It is therefore not surprising that regulatory circuits exist to organize the synthesis of ribosomal components. It has been shown that defect in ribosome biogenesis (ribosomal stress) induces apoptosis or cell cycle arrest through activation of the tumor suppressor p53. This mechanism is thought to be implicated in the pathophysiology of a group of genetic diseases such as Diamond Blackfan Anemia which are called ribosomopathies. We have identified an additional response to ribosomal stress that includes the activation of eukaryotic translation elongation factor 2 kinase with a consequent inhibition of translation elongation. This leads to a translational reprogramming in the cell that involves the structurally defined group of messengers called terminal oligopyrimidine (TOP) mRNAs which encode ribosomal proteins and translation factors. In fact, while general protein synthesis is decreased by the impairment of elongation, TOP mRNAs are recruited on polysomes causing a relative increase in the synthesis of TOP mRNA-encoded proteins compared to other proteins. Therefore, in response to ribosomal stress, there is a change in the translation pattern of the cell which may help restore a sufficient level of ribosomes. PMID:25332393

  6. Ribosomal stress activates eEF2K-eEF2 pathway causing translation elongation inhibition and recruitment of terminal oligopyrimidine (TOP) mRNAs on polysomes.

    PubMed

    Gismondi, Angelo; Caldarola, Sara; Lisi, Gaia; Juli, Giada; Chellini, Lidia; Iadevaia, Valentina; Proud, Christopher G; Loreni, Fabrizio

    2014-11-10

    The synthesis of adequate amounts of ribosomes is an essential task for the cell. It is therefore not surprising that regulatory circuits exist to organize the synthesis of ribosomal components. It has been shown that defect in ribosome biogenesis (ribosomal stress) induces apoptosis or cell cycle arrest through activation of the tumor suppressor p53. This mechanism is thought to be implicated in the pathophysiology of a group of genetic diseases such as Diamond Blackfan Anemia which are called ribosomopathies. We have identified an additional response to ribosomal stress that includes the activation of eukaryotic translation elongation factor 2 kinase with a consequent inhibition of translation elongation. This leads to a translational reprogramming in the cell that involves the structurally defined group of messengers called terminal oligopyrimidine (TOP) mRNAs which encode ribosomal proteins and translation factors. In fact, while general protein synthesis is decreased by the impairment of elongation, TOP mRNAs are recruited on polysomes causing a relative increase in the synthesis of TOP mRNA-encoded proteins compared to other proteins. Therefore, in response to ribosomal stress, there is a change in the translation pattern of the cell which may help restore a sufficient level of ribosomes. PMID:25332393

  7. The Structures of Antibiotics Bound to the E Site Region of the 50 S Ribosomal Subunit of Haloarcula marismortui: 13-Deoxytedanolide and Girodazole

    SciTech Connect

    Schroeder,S.; Blaha, G.; Tirado-Rives, J.; Steitz, T.; Moore, P.

    2007-01-01

    Crystal structures of the 50 S ribosomal subunit from Haloarcula marismortui complexed with two antibiotics have identified new sites at which antibiotics interact with the ribosome and inhibit protein synthesis. 13-Deoxytedanolide binds to the E site of the 50 S subunit at the same location as the CCA of tRNA, and thus appears to inhibit protein synthesis by competing with deacylated tRNAs for E site binding. Girodazole binds near the E site region, but is somewhat buried and may inhibit tRNA binding by interfering with conformational changes that occur at the E site. The specificity of 13-deoxytedanolide for eukaryotic ribosomes is explained by its extensive interactions with protein L44e, which is an E site component of archaeal and eukaryotic ribosomes, but not of eubacterial ribosomes. In addition, protein L28, which is unique to the eubacterial E site, overlaps the site occupied by 13-deoxytedanolide, precluding its binding to eubacterial ribosomes. Girodazole is specific for eukarytes and archaea because it makes interactions with L15 that are not possible in eubacteria.

  8. Function and ribosomal localization of aIF6, a translational regulator shared by archaea and eukarya

    PubMed Central

    Benelli, Dario; Marzi, Stefano; Mancone, Carmine; Alonzi, Tonino; la Teana, Anna; Londei, Paola

    2009-01-01

    The translation factor IF6 is shared by the Archaea and the Eukarya, but is not found in Bacteria. The properties of eukaryal IF6 (eIF6) have been extensively studied, but remain somewhat elusive. eIF6 behaves as a ribosome-anti-association factor and is involved in miRNA-mediated gene silencing; however, it also seems to participate in ribosome synthesis and export. Here we have determined the function and ribosomal localization of the archaeal (Sulfolobus solfataricus) IF6 homologue (aIF6). We find that aIF6 binds specifically to the 50S ribosomal subunits, hindering the formation of 70S ribosomes and strongly inhibiting translation. aIF6 is uniformly expressed along the cell cycle, but it is upregulated following both cold- and heat shock. The aIF6 ribosomal binding site lies in the middle of the 30-S interacting surface of the 50S subunit, including a number of critical RNA and protein determinants involved in subunit association. The data suggest that the IF6 protein evolved in the archaeal–eukaryal lineage to modulate translational efficiency under unfavourable environmental conditions, perhaps acquiring additional functions during eukaryotic evolution. PMID:19036786

  9. Las1 interacts with Grc3 polynucleotide kinase and is required for ribosome synthesis in Saccharomyces cerevisiae

    PubMed Central

    Castle, Christopher D.; Sardana, Richa; Dandekar, Varada; Borgianini, Victoria; Johnson, Arlen W.; Denicourt, Catherine

    2013-01-01

    Ribosome biogenesis is a multi-step process that couples cell growth with cell proliferation. Although several large-scale analysis of pre-ribosomal particles have identified numerous trans-acting factors involved in this process, many proteins involved in pre-rRNA processing and ribosomal subunit maturation have yet to be identified. Las1 was originally identified in Saccharomyces cerevisiae as a protein involved in cell morphogenesis. We previously demonstrated that the human homolog, Las1L, is required for efficient ITS2 rRNA processing and synthesis of the 60S ribosomal subunit. Here, we report that the functions of Las1 in ribosome biogenesis are also conserved in S. cerevisiae. Depletion of Las1 led to the accumulation of both the 27S and 7S rRNA intermediates and impaired the synthesis of the 60S subunit. We show that Las1 co-precipitates mainly with the 27S rRNA and associates with an Nsa1 and Rix1-containing pre-60S particle. We further identify Grc3 as a major Las1-interacting protein. We demonstrate that the kinase activity of Grc3 is required for efficient pre-rRNA processing and that depletion of Grc3 leads to rRNA processing defects similar to the ones observed in Las1-depleted cells. We propose that Las1 and Grc3 function together in a conserved mechanism to modulate rRNA processing and eukaryotic ribosome biogenesis. PMID:23175604

  10. Ribosome biogenesis in the yeast Saccharomyces cerevisiae.

    PubMed

    Woolford, John L; Baserga, Susan J

    2013-11-01

    Ribosomes are highly conserved ribonucleoprotein nanomachines that translate information in the genome to create the proteome in all cells. In yeast these complex particles contain four RNAs (>5400 nucleotides) and 79 different proteins. During the past 25 years, studies in yeast have led the way to understanding how these molecules are assembled into ribosomes in vivo. Assembly begins with transcription of ribosomal RNA in the nucleolus, where the RNA then undergoes complex pathways of folding, coupled with nucleotide modification, removal of spacer sequences, and binding to ribosomal proteins. More than 200 assembly factors and 76 small nucleolar RNAs transiently associate with assembling ribosomes, to enable their accurate and efficient construction. Following export of preribosomes from the nucleus to the cytoplasm, they undergo final stages of maturation before entering the pool of functioning ribosomes. Elaborate mechanisms exist to monitor the formation of correct structural and functional neighborhoods within ribosomes and to destroy preribosomes that fail to assemble properly. Studies of yeast ribosome biogenesis provide useful models for ribosomopathies, diseases in humans that result from failure to properly assemble ribosomes. PMID:24190922

  11. Scattering studies on ribosomes in solution

    NASA Astrophysics Data System (ADS)

    Ramakrishnan, V.

    1986-02-01

    Ribosomes are organelles that play a central role in protein synthesis. They are complexes of protein and nucleic acid, and can be analysed as two-component systems by neutron scattering. Moreover, ribosomes can be biochemically prepared that have specific proteins deuterated. Both these properties have been exploited to study the structure of the ribosome by neutron scattering. This article reviews the studies carried out on the small ribosomal subunit, and describes a recent study that has resolved a conflict between the results of two classes of experiments.

  12. Through the '80s: thinking globally, acting locally. [Combined Canadian Futures Society and Third General Assembly of World Future Society

    SciTech Connect

    Feather, F.

    1980-01-01

    This volume was prepared in conjunction with the First Global Conference on the Future, held in Toronto, Canada, July 20-24, 1980. The conference combined the Third General Assembly of the World Future Society and the fifth annual conference of the Canadian Futures Society. The 59 papers presented here were selected from the very large number submitted to the conference committee; space limitations permitted only a small number of papers to be published in this volume. Included also are: the foreword, Mystery of the Future, by Edward R. Schreyer, Governor General of Canada; preface, A Time for Action, by Maurice F. Strong; introduction, Transition to Harmonic Globalism, by Frank Feather; conclusion, What We Must Do: An Agenda for Futurists; and postscript, The Challenge of the '80s, by Aurelio Peccei. The papers were presented under the following topics: The Trauma of Change (4); A Global Perspective (7); Inventorying Our Resources (7); The International Context (8); Economics: Getting Down to Business (9); Human Values: Personal, Social, Religious (6); Communications: Connecting Ourselves Together (4); Education: Learning to Meet Tomorrow (4); Health: New Approaches to Staying Fit (3); Futurism as a Way of Life (5); and Dreams into Action: Methods and Real-Life Experience (2).

  13. The global translation profile in a ribosomal protein mutant resembles that of an eIF3 mutant

    PubMed Central

    2013-01-01

    represent the first genome-wide analysis of translation in a eukaryote defective in the large ribosomal subunit. RPL24 and eIF3h play similar but non-identical roles in eukaryotic translation. The data also shed light on the fine structure of the regulon of ribosomal protein mRNAs. PMID:24377433

  14. The eukaryotic fossil record in deep time

    NASA Astrophysics Data System (ADS)

    Butterfield, N.

    2011-12-01

    Eukaryotic organisms are defining constituents of the Phanerozoic biosphere, but they also extend well back into the Proterozoic record, primarily in the form of microscopic body fossils. Criteria for identifying pre-Ediacaran eukaryotes include large cell size, morphologically complex cell walls and/or the recognition of diagnostically eukaryotic cell division patterns. The oldest unambiguous eukaryote currently on record is an acanthomorphic acritarch (Tappania) from the Palaeoproterozoic Semri Group of central India. Older candidate eukaryotes are difficult to distinguish from giant bacteria, prokaryotic colonies or diagenetic artefacts. In younger Meso- and Neoproterozoic strata, the challenge is to recognize particular grades and clades of eukaryotes, and to document their macro-evolutionary expression. Distinctive unicellular forms include mid-Neoproterozoic testate amoebae and phosphate biomineralizing 'scale-microfossils' comparable to an extant green alga. There is also a significant record of seaweeds, possible fungi and problematica from this interval, documenting multiple independent experiments in eukaryotic multicellularity. Taxonomically resolved forms include a bangiacean red alga and probable vaucheriacean chromalveolate algae from the late Mesoproterozoic, and populations of hydrodictyacean and siphonocladalean green algae of mid Neoproterozoic age. Despite this phylogenetic breadth, however, or arguments from molecular clocks, there is no convincing evidence for pre-Ediacaran metazoans or metaphytes. The conspicuously incomplete nature of the Proterozoic record makes it difficult to resolve larger-scale ecological and evolutionary patterns. Even so, both body fossils and biomarker data point to a pre-Ediacaran biosphere dominated overwhelming by prokaryotes. Contemporaneous eukaryotes appear to be limited to conspicuously shallow water environments, and exhibit fundamentally lower levels of morphological diversity and evolutionary turnover than

  15. Prokaryotic and eukaryotic unicellular chronomics

    PubMed Central

    Halberg, F.; Cornélissen, G.; Faraone, P.; Poeggeler, B.; Hardeland, R.; Katinas, G.; Schwartzkopff, O.; Otsuka, K.; Bakken, E. E.

    2008-01-01

    An impeccable time series, published in 1930, consisting of hourly observations on colony advance in a fluid culture of E. coli, was analyzed by a periodogram and power spectrum in 1961. While the original senior author had emphasized specifically periodicity with no estimate of period length, he welcomed further analyses. After consulting his technician, he knew of no environmental periodicity related to human schedules other than an hourly photography. A periodogram analysis in 1961 showed a 20.75-h period. It was emphasized that “… the circadian period disclosed is not of exactly 24-h length.” Confirmations notwithstanding, a committee ruled out microbial circadian rhythms based on grounds that could have led to a different conclusion, namely first, the inability of some committee members to see (presumably by eyeballing) the rhythms in their own data, and second, what hardly follows, that there were “too many analyses” in the published papers. Our point in dealing with microbes and humans is that analyses are indispensable for quantification and for discovering a biologically novel spectrum of cyclicities, matching physical ones. The scope of circadian organization estimated in 1961 has become broader, including about 7-day, about half-yearly, about-yearly and ex-yearly and decadal periodisms, among others. Microbial circadians have become a field of their own with eyeballing, yet time-microscopy can quantify characteristics with their uncertainties and can assess broad chronomes (time structures) with features beyond circadians. As yet only suggestive differences between eukaryotes and prokaryotes further broaden the perspective and may lead to life’s sites of origin and to new temporal aspects of life’ s development as a chronomic tree by eventual rhythm dating in ontogeny and phylogeny. PMID:16275493

  16. Complementing the Eukaryotic Protein Interactome

    PubMed Central

    Pesch, Robert; Zimmer, Ralf

    2013-01-01

    Protein interaction networks are important for the understanding of regulatory mechanisms, for the explanation of experimental data and for the prediction of protein functions. Unfortunately, most interaction data is available only for model organisms. As a possible remedy, the transfer of interactions to organisms of interest is common practice, but it is not clear when interactions can be transferred from one organism to another and, thus, the confidence in the derived interactions is low. Here, we propose to use a rich set of features to train Random Forests in order to score transferred interactions. We evaluated the transfer from a range of eukaryotic organisms to S. cerevisiae using orthologs. Directly transferred interactions to S. cerevisiae are on average only 24% consistent with the current S. cerevisiae interaction network. By using commonly applied filter approaches the transfer precision can be improved, but at the cost of a large decrease in the number of transferred interactions. Our Random Forest approach uses various features derived from both the target and the source network as well as the ortholog annotations to assign confidence values to transferred interactions. Thereby, we could increase the average transfer consistency to 85%, while still transferring almost 70% of all correctly transferable interactions. We tested our approach for the transfer of interactions to other species and showed that our approach outperforms competing methods for the transfer of interactions to species where no experimental knowledge is available. Finally, we applied our predictor to score transferred interactions to 83 targets species and we were able to extend the available interactome of B. taurus, M. musculus and G. gallus with over 40,000 interactions each. Our transferred interaction networks are publicly available via our web interface, which allows to inspect and download transferred interaction sets of different sizes, for various species, and at specified

  17. Evolutionary mechanisms for establishing eukaryotic cellular complexity.

    PubMed

    Mast, Fred D; Barlow, Lael D; Rachubinski, Richard A; Dacks, Joel B

    2014-07-01

    Through a comparative approach, evolutionary cell biology makes use of genomics, bioinformatics, and cell biology of non-model eukaryotes to provide new avenues for understanding basic cellular processes. This approach has led to proposed mechanisms underpinning the evolution of eukaryotic cellular organization including endosymbiotic and autogenous processes and neutral and adaptive processes. Together these mechanisms have contributed to the genesis and complexity of organelles, molecular machines, and genome architecture. We review these mechanisms and suggest that a greater appreciation of the diversity in eukaryotic form has led to a more complete understanding of the evolutionary connections between organelles and the unexpected routes by which this diversity has been reached. PMID:24656655

  18. Ribosome Mechanics Informs about Mechanism.

    PubMed

    Zimmermann, Michael T; Jia, Kejue; Jernigan, Robert L

    2016-02-27

    The essential aspects of the ribosome's mechanism can be extracted from coarse-grained simulations, including the ratchet motion, the movement together of critical bases at the decoding center, and movements of the peptide tunnel lining that assist in the expulsion of the synthesized peptide. Because of its large size, coarse graining helps to simplify and to aid in the understanding of its mechanism. Results presented here utilize coarse-grained elastic network modeling to extract the dynamics, and both RNAs and proteins are coarse grained. We review our previous results, showing the well-known ratchet motions and the motions in the peptide tunnel and in the mRNA tunnel. The motions of the lining of the peptide tunnel appear to assist in the expulsion of the growing peptide chain, and clamps at the ends of the mRNA tunnel with three proteins ensure that the mRNA is held tightly during decoding and essential for the helicase activity at the entrance. The entry clamp may also assist in base recognition to ensure proper selection of the incoming tRNA. The overall precision of the ribosome machine-like motions is remarkable. PMID:26687034

  19. Mitomycin C Inhibits Ribosomal RNA

    PubMed Central

    Snodgrass, Ryan G.; Collier, Abby C.; Coon, Amy E.; Pritsos, Chris A.

    2010-01-01

    Mitomycin C (MMC) is a commonly used and extensively studied chemotherapeutic agent requiring biological reduction for activity. Damage to nuclear DNA is thought to be its primary mechanism of cell death. Due to a lack of evidence for significant MMC activation in the nucleus and for in vivo studies demonstrating the formation of MMC-DNA adducts, we chose to investigate alternative nucleic acid targets. Real-time reverse transcription-PCR was used to determine changes in mitochondrial gene expression induced by MMC treatment. Although no consistent effects on mitochondrial mRNA expression were observed, complementary results from reverse transcription-PCR experiments and gel-shift and binding assays demonstrated that MMC rapidly decreased the transcript levels of 18S ribosomal RNA in a concentration-dependent manner. Under hypoxic conditions, transcript levels of 18S rRNA decreased by 1.5-fold compared with untreated controls within 30 min. Recovery to base line required several hours, indicating that de novo synthesis of 18S was necessary. Addition of MMC to an in vitro translation reaction significantly decreased protein production in the cell-free system. Functional assays performed using a luciferase reporter construct in vivo determined that protein translation was inhibited, further confirming this mechanism of toxicity. The interaction of MMC with ribosomal RNA and subsequent inhibition of protein translation is consistent with mechanisms proposed for other natural compounds. PMID:20418373

  20. The Caulobacter crescentus CgtAC Protein Cosediments with the Free 50S Ribosomal Subunit

    PubMed Central

    Lin, Bin; Thayer, Desiree A.; Maddock, Janine R.

    2004-01-01

    The Obg family of GTPases is widely conserved and predicted to play an as-yet-unknown role in translation. Recent reports provide circumstantial evidence that both eukaryotic and prokaryotic Obg proteins are associated with the large ribosomal subunit. Here we provide direct evidence that the Caulobacter crescentus CgtAC protein is associated with the free large (50S) ribosomal subunit but not with 70S monosomes or with translating ribosomes. In contrast to the Bacillus subtilis and Escherichia coli proteins, CgtAC does not fractionate in a large complex by gel filtration, indicating a moderately weak association with the 50S subunit. Moreover, binding of CgtAC to the 50S particle is sensitive to salt concentration and buffer composition but not guanine nucleotide occupancy of CgtAC. Assays of epitope-tagged wild-type and mutant variants of CgtAC indicate that the C terminus of CgtAC is critical for 50S association. Interestingly, the addition of a C-terminal epitope tag also affected the ability of various cgtAC alleles to function in vivo. Depletion of CgtAC led to perturbations in the polysome profile, raising the possibility that CgtAC is involved in ribosome assembly or stability. PMID:14702318

  1. X-ray Analyses of the Ribosomal A-Site Molecular Switches

    NASA Astrophysics Data System (ADS)

    Kondo, Jiro

    The aminoacyl-tRNA decoding site (A-site) on the small ribosomal subunit is an RNA molecular switch guaranteeing high translation fidelity. Due to the similarity of the secondary structure of the A-site, it has long been believed that the functional characteristics and tertiary structure of the A-site molecular switch are basically conserved in three main cell types, bacteria, mitochondria and eukaryotic cytoplasm. However, these three cell types are noticeably different in their biological properties such as life cycle, genome size, structural component of ribosome and number of tRNA species. In our structural studies, we have shown how a small difference of nucleotide sequences affects the dynamics of the A-site molecular switches underlying the decoding mechanism adapted to their biological properties and environments. The observed structural insights into the decoding process allowed us to understand molecular mechanisms of non-syndromic hearing loss and toxicity mechanism of aminoglycoside antibiotics.

  2. Origin of the nucleus and Ran-dependent transport to safeguard ribosome biogenesis in a chimeric cell

    PubMed Central

    Jékely, Gáspár

    2008-01-01

    Background The origin of the nucleus is a central problem about the origin of eukaryotes. The common ancestry of nuclear pore complexes (NPC) and vesicle coating complexes indicates that the nucleus evolved via the modification of a pre-existing endomembrane system. Such an autogenous scenario is cell biologically feasible, but it is not clear what were the selective or neutral mechanisms that had led to the origin of the nuclear compartment. Results A key selective force during the autogenous origin of the nucleus could have been the need to segregate ribosome factories from the cytoplasm where ribosomal proteins (RPs) of the protomitochondrium were synthesized. After its uptake by an anuclear cell the protomitochondrium transferred several of its RP genes to the host genome. Alphaproteobacterial RPs and archaebacterial-type host ribosomes were consequently synthesized in the same cytoplasm. This could have led to the formation of chimeric ribosomes. I propose that the nucleus evolved when the host cell compartmentalised its ribosome factories and the tightly linked genome to reduce ribosome chimerism. This was achieved in successive stages by first evolving karyopherin and RanGTP dependent chaperoning of RPs, followed by the evolution of a membrane network to serve as a diffusion barrier, and finally a hydrogel sieve to ensure selective permeability at nuclear pores. Computer simulations show that a gradual segregation of cytoplasm and nucleoplasm via these steps can progressively reduce ribosome chimerism. Conclusion Ribosome chimerism can provide a direct link between the selective forces for and the mechanisms of evolving nuclear transport and compartmentalisation. The detailed molecular scenario presented here provides a solution to the gradual evolution of nuclear compartmentalization from an anuclear stage. Reviewers This article was reviewed by Eugene V Koonin, Martijn Huynen, Anthony M. Poole and Patrick Forterre. PMID:18652645

  3. Paleobiological Perspectives on Early Eukaryotic Evolution

    PubMed Central

    Knoll, Andrew H.

    2014-01-01

    Eukaryotic organisms radiated in Proterozoic oceans with oxygenated surface waters, but, commonly, anoxia at depth. Exceptionally preserved fossils of red algae favor crown group emergence more than 1200 million years ago, but older (up to 1600–1800 million years) microfossils could record stem group eukaryotes. Major eukaryotic diversification ∼800 million years ago is documented by the increase in the taxonomic richness of complex, organic-walled microfossils, including simple coenocytic and multicellular forms, as well as widespread tests comparable to those of extant testate amoebae and simple foraminiferans and diverse scales comparable to organic and siliceous scales formed today by protists in several clades. Mid-Neoproterozoic establishment or expansion of eukaryophagy provides a possible mechanism for accelerating eukaryotic diversification long after the origin of the domain. Protists continued to diversify along with animals in the more pervasively oxygenated oceans of the Phanerozoic Eon. PMID:24384569

  4. The Eukaryotic Replisome Goes Under the Microscope

    PubMed Central

    O’Donnell, Mike; Li, Huilin

    2016-01-01

    The machinery at the eukaryotic replication fork has seen many new structural advances using electron microscopy and crystallography. Recent structures of eukaryotic replisome components include the Mcm2-7 complex, the CMG helicase, DNA polymerases, a Ctf4 trimer hub and the first look at a core replisome of 20 different proteins containing the helicase, primase, leading polymerase and a lagging strand polymerase. The eukaryotic core replisome shows an unanticipated architecture, with one polymerase sitting above the helicase and the other below. Additionally, structures of Mcm2 bound to an H3/H4 tetramer suggest a direct role of the replisome in handling nucleosomes, which are important to DNA organization and gene regulation. This review provides a summary of some of the many recent advances in the structure of the eukaryotic replisome. PMID:27003891

  5. Biochemical characterization of three mycobacterial ribosomal fractions.

    PubMed

    Portelance, V; Beaudet, R

    1983-02-01

    The induction of antituberculous immunity by crude ribosomal fractions isolated from Mycobacterium tuberculosis strain H37Ra, M. bovis strain BCG, and M. smegmatis was studied in CF-1 mice. Levels of antituberculous immunity similar to that induced by live BCG were induced by the BCG and H37Ra ribosomal fractions whereas that isolated from M. smegmatis was found to be inactive. Electrophoresis of the three ribosomal fractions in sodium dodecyl sulfate - polyacylamide gels followed by differential staining showed the two active ribosomal fractions to be similar in their proteins, carbohydrate-containing substances, and lipid profiles. The inactive smegmatis ribosomal fraction differed mainly from the active ones on the basis of its carbohydrate-containing substances profile and by the absence of lipids. The polysaccharides and the ribosomes present in the H37Ra ribosomal fractions were purified by affinity chromatography on concanavalin A - Sepharose 4B. Each purified preparation showed no or only low antituberculous activity when injected separately, but when mixed together a high protection was observed. The formation of complexes between the ribosomes and the polysaccharide fraction was suggested and appears to be necessary for the induction of antituberculous immunity. PMID:6189570

  6. Evolution of the ribosome at atomic resolution

    PubMed Central

    Petrov, Anton S.; Bernier, Chad R.; Hsiao, Chiaolong; Norris, Ashlyn M.; Kovacs, Nicholas A.; Waterbury, Chris C.; Stepanov, Victor G.; Harvey, Stephen C.; Fox, George E.; Wartell, Roger M.; Hud, Nicholas V.; Williams, Loren Dean

    2014-01-01

    The origins and evolution of the ribosome, 3–4 billion years ago, remain imprinted in the biochemistry of extant life and in the structure of the ribosome. Processes of ribosomal RNA (rRNA) expansion can be “observed” by comparing 3D rRNA structures of bacteria (small), yeast (medium), and metazoans (large). rRNA size correlates well with species complexity. Differences in ribosomes across species reveal that rRNA expansion segments have been added to rRNAs without perturbing the preexisting core. Here we show that rRNA growth occurs by a limited number of processes that include inserting a branch helix onto a preexisting trunk helix and elongation of a helix. rRNA expansions can leave distinctive atomic resolution fingerprints, which we call “insertion fingerprints.” Observation of insertion fingerprints in the ribosomal common core allows identification of probable ancestral expansion segments. Conceptually reversing these expansions allows extrapolation backward in time to generate models of primordial ribosomes. The approach presented here provides insight to the structure of pre-last universal common ancestor rRNAs and the subsequent expansions that shaped the peptidyl transferase center and the conserved core. We infer distinct phases of ribosomal evolution through which ribosomal particles evolve, acquiring coding and translocation, and extending and elaborating the exit tunnel. PMID:24982194

  7. rRNA genes from the lower chordate Herdmania momus: structural similarity with higher eukaryotes.

    PubMed Central

    Degnan, B M; Yan, J; Hawkins, C J; Lavin, M F

    1990-01-01

    Ascidians, primitive chordates that have retained features of the likely progenitors to all vertebrates, are a useful model to study the evolutionary relationship of chordates to other animals. We have selected the well characterized ribosomal RNA (rRNA) genes to investigate this relationship, and we describe here the cloning and characterization of an entire ribosomal DNA (rDNA) tandem repeat unit from a lower chordate, the ascidian Herdmania momus. rDNA copy number and considerable sequence differences were observed between two H. momus populations. Comparison of rDNA primary sequence and rRNA secondary structures from H. momus with those from other well characterized organisms, demonstrated that the ascidians are more closely related to other chordates than invertebrates. The rDNA tandem repeat makes up a larger percentage (7%) of the genome of this animal than in other higher eukaryotes. The total length of the spacer and transcribed region in H. momus rDNA is small compared to most higher eukaryotes, being less than 8 kb, and the intergenic spacer region consists of smaller internal repeats. Comparative analysis of rDNA sequences has allowed the construction of secondary structures for the 18S, 5.8S and 26S rRNAs. Images PMID:2263465

  8. Repetitive DNA in eukaryotic genomes.

    PubMed

    Biscotti, Maria Assunta; Olmo, Ettore; Heslop-Harrison, J S Pat

    2015-09-01

    Repetitive DNA--sequence motifs repeated hundreds or thousands of times in the genome--makes up the major proportion of all the nuclear DNA in most eukaryotic genomes. However, the significance of repetitive DNA in the genome is not completely understood, and it has been considered to have both structural and functional roles, or perhaps even no essential role. High-throughput DNA sequencing reveals huge numbers of repetitive sequences. Most bioinformatic studies focus on low-copy DNA including genes, and hence, the analyses collapse repeats in assemblies presenting only one or a few copies, often masking out and ignoring them in both DNA and RNA read data. Chromosomal studies are proving vital to examine the distribution and evolution of sequences because of the challenges of analysis of sequence data. Many questions are open about the origin, evolutionary mode and functions that repetitive sequences might have in the genome. Some, the satellite DNAs, are present in long arrays of similar motifs at a small number of sites, while others, particularly the transposable elements (DNA transposons and retrotranposons), are dispersed over regions of the genome; in both cases, sequence motifs may be located at relatively specific chromosome domains such as centromeres or subtelomeric regions. Here, we overview a range of works involving detailed characterization of the nature of all types of repetitive sequences, in particular their organization, abundance, chromosome localization, variation in sequence within and between chromosomes, and, importantly, the investigation of their transcription or expression activity. Comparison of the nature and locations of sequences between more, and less, related species is providing extensive information about their evolution and amplification. Some repetitive sequences are extremely well conserved between species, while others are among the most variable, defining differences between even closely relative species. These data suggest

  9. Metabolic Constraints on the Eukaryotic Transition

    NASA Astrophysics Data System (ADS)

    Wallace, Rodrick

    2009-04-01

    Mutualism, obligate mutualism, symbiosis, and the eukaryotic ‘fusion’ of Serial Endosymbiosis Theory represent progressively more rapid and less distorted real-time communication between biological structures instantiating information sources. Such progression in accurate information transmission requires, in turn, progressively greater channel capacity that, through the homology between information source uncertainty and free energy density, requires ever more energetic metabolism. The eukaryotic transition, according to this model, may have been entrained by an ecosystem resilience shift from anaerobic to aerobic metabolism.

  10. Complementary roles of initiation factor 1 and ribosome recycling factor in 70S ribosome splitting

    PubMed Central

    Pavlov, Michael Y; Antoun, Ayman; Lovmar, Martin; Ehrenberg, Måns

    2008-01-01

    We demonstrate that ribosomes containing a messenger RNA (mRNA) with a strong Shine–Dalgarno sequence are rapidly split into subunits by initiation factors 1 (IF1) and 3 (IF3), but slowly split by ribosome recycling factor (RRF) and elongation factor G (EF-G). Post-termination-like (PTL) ribosomes containing mRNA and a P-site-bound deacylated transfer RNA (tRNA) are split very rapidly by RRF and EF-G, but extremely slowly by IF1 and IF3. Vacant ribosomes are split by RRF/EF-G much more slowly than PTL ribosomes and by IF1/IF3 much more slowly than mRNA-containing ribosomes. These observations reveal complementary splitting of different ribosomal complexes by IF1/IF3 and RRF/EF-G, and suggest the existence of two major pathways for ribosome splitting into subunits in the living cell. We show that the identity of the deacylated tRNA in the PTL ribosome strongly affects the rate by which it is split by RRF/EF-G and that IF3 is involved in the mechanism of ribosome splitting by IF1/IF3 but not by RRF/EF-G. With support from our experimental data, we discuss the principally different mechanisms of ribosome splitting by IF1/IF3 and by RRF/EF-G. PMID:18497739

  11. Differential Stoichiometry among Core Ribosomal Proteins

    PubMed Central

    Slavov, Nikolai; Semrau, Stefan; Airoldi, Edoardo; Budnik, Bogdan; van Oudenaarden, Alexander

    2015-01-01

    Summary Understanding the regulation and structure of ribosomes is essential to understanding protein synthesis and its dysregulation in disease. While ribosomes are believed to have a fixed stoichiometry among their core ribosomal proteins (RPs), some experiments suggest a more variable composition. Testing such variability requires direct and precise quantification of RPs. We used mass spectrometry to directly quantify RPs across monosomes and polysomes of mouse embryonic stem cells (ESC) and budding yeast. Our data show that the stoichiometry among core RPs in wild-type yeast cells and ESC depends both on the growth conditions and on the number of ribosomes bound per mRNA. Furthermore, we find that the fitness of cells with a deleted RP-gene is inversely proportional to the enrichment of the corresponding RP in polysomes. Together, our findings support the existence of ribosomes with distinct protein composition and physiological function. PMID:26565899

  12. Ribosome defects in disorders of erythropoiesis.

    PubMed

    Narla, Anupama; Hurst, Slater N; Ebert, Benjamin L

    2011-02-01

    Over the past decade, genetic lesions that cause ribosome dysfunction have been identified in both congenital and acquired human disorders. These discoveries have established a new category of disorders, known as ribosomopathies, in which the primary pathophysiology is related to impaired ribosome function. The protoptypical disorders are Diamond-Blackfan anemia, a congenital bone marrow failure syndrome, and the 5q- syndrome, a subtype of myelodysplastic syndrome. In both of these disorders, impaired ribosome function causes a severe macrocytic anemia. In this review, we will discuss the evidence that defects in ribosomal biogenesis cause the hematologic phenotype of Diamond-Blackfan anemia and the 5q- syndrome. We will also explore the potential mechanisms by which a ribosomal defect, which would be expected to have widespread consequences, may lead to specific defects in erythropoiesis. PMID:21279816

  13. Interaction of Chloramphenicol Tripeptide Analogs with Ribosomes.

    PubMed

    Tereshchenkov, A G; Shishkina, A V; Tashlitsky, V N; Korshunova, G A; Bogdanov, A A; Sumbatyan, N V

    2016-04-01

    Chloramphenicol amine peptide derivatives containing tripeptide fragments of regulatory "stop peptides" - MRL, IRA, IWP - were synthesized. The ability of the compounds to form ribosomal complexes was studied by displacement of the fluorescent erythromycin analog from its complex with E. coli ribosomes. It was found that peptide chloramphenicol analogs are able to bind to bacterial ribosomes. The dissociation constants were 4.3-10 µM, which is 100-fold lower than the corresponding values for chloramphenicol amine-ribosome complex. Interaction of the chloramphenicol peptide analogs with ribosomes was simulated by molecular docking, and the most probable contacts of "stop peptide" motifs with the elements of nascent peptide exit tunnel were identified. PMID:27293096

  14. Differential Stoichiometry among Core Ribosomal Proteins.

    PubMed

    Slavov, Nikolai; Semrau, Stefan; Airoldi, Edoardo; Budnik, Bogdan; van Oudenaarden, Alexander

    2015-11-01

    Understanding the regulation and structure of ribosomes is essential to understanding protein synthesis and its dysregulation in disease. While ribosomes are believed to have a fixed stoichiometry among their core ribosomal proteins (RPs), some experiments suggest a more variable composition. Testing such variability requires direct and precise quantification of RPs. We used mass spectrometry to directly quantify RPs across monosomes and polysomes of mouse embryonic stem cells (ESC) and budding yeast. Our data show that the stoichiometry among core RPs in wild-type yeast cells and ESC depends both on the growth conditions and on the number of ribosomes bound per mRNA. Furthermore, we find that the fitness of cells with a deleted RP-gene is inversely proportional to the enrichment of the corresponding RP in polysomes. Together, our findings support the existence of ribosomes with distinct protein composition and physiological function. PMID:26565899

  15. Transfer of DNA from Bacteria to Eukaryotes.

    PubMed

    Lacroix, Benoît; Citovsky, Vitaly

    2016-01-01

    Historically, the members of the Agrobacterium genus have been considered the only bacterial species naturally able to transfer and integrate DNA into the genomes of their eukaryotic hosts. Yet, increasing evidence suggests that this ability to genetically transform eukaryotic host cells might be more widespread in the bacterial world. Indeed, analyses of accumulating genomic data reveal cases of horizontal gene transfer from bacteria to eukaryotes and suggest that it represents a significant force in adaptive evolution of eukaryotic species. Specifically, recent reports indicate that bacteria other than Agrobacterium, such as Bartonella henselae (a zoonotic pathogen), Rhizobium etli (a plant-symbiotic bacterium related to Agrobacterium), or even Escherichia coli, have the ability to genetically transform their host cells under laboratory conditions. This DNA transfer relies on type IV secretion systems (T4SSs), the molecular machines that transport macromolecules during conjugative plasmid transfer and also during transport of proteins and/or DNA to the eukaryotic recipient cells. In this review article, we explore the extent of possible transfer of genetic information from bacteria to eukaryotic cells as well as the evolutionary implications and potential applications of this transfer. PMID:27406565

  16. Transfer of DNA from Bacteria to Eukaryotes

    PubMed Central

    2016-01-01

    ABSTRACT Historically, the members of the Agrobacterium genus have been considered the only bacterial species naturally able to transfer and integrate DNA into the genomes of their eukaryotic hosts. Yet, increasing evidence suggests that this ability to genetically transform eukaryotic host cells might be more widespread in the bacterial world. Indeed, analyses of accumulating genomic data reveal cases of horizontal gene transfer from bacteria to eukaryotes and suggest that it represents a significant force in adaptive evolution of eukaryotic species. Specifically, recent reports indicate that bacteria other than Agrobacterium, such as Bartonella henselae (a zoonotic pathogen), Rhizobium etli (a plant-symbiotic bacterium related to Agrobacterium), or even Escherichia coli, have the ability to genetically transform their host cells under laboratory conditions. This DNA transfer relies on type IV secretion systems (T4SSs), the molecular machines that transport macromolecules during conjugative plasmid transfer and also during transport of proteins and/or DNA to the eukaryotic recipient cells. In this review article, we explore the extent of possible transfer of genetic information from bacteria to eukaryotic cells as well as the evolutionary implications and potential applications of this transfer. PMID:27406565

  17. The problem of the eukaryotic genome size.

    PubMed

    Patrushev, L I; Minkevich, I G

    2008-12-01

    The current state of knowledge concerning the unsolved problem of the huge interspecific eukaryotic genome size variations not correlating with the species phenotypic complexity (C-value enigma also known as C-value paradox) is reviewed. Characteristic features of eukaryotic genome structure and molecular mechanisms that are the basis of genome size changes are examined in connection with the C-value enigma. It is emphasized that endogenous mutagens, including reactive oxygen species, create a constant nuclear environment where any genome evolves. An original quantitative model and general conception are proposed to explain the C-value enigma. In accordance with the theory, the noncoding sequences of the eukaryotic genome provide genes with global and differential protection against chemical mutagens and (in addition to the anti-mutagenesis and DNA repair systems) form a new, third system that protects eukaryotic genetic information. The joint action of these systems controls the spontaneous mutation rate in coding sequences of the eukaryotic genome. It is hypothesized that the genome size is inversely proportional to functional efficiency of the anti-mutagenesis and/or DNA repair systems in a particular biological species. In this connection, a model of eukaryotic genome evolution is proposed. PMID:19216716

  18. Phylogenetic relationships of the green alga Volvox carteri deduced from small-subunit ribosomal RNA comparisons.

    PubMed

    Rausch, H; Larsen, N; Schmitt, R

    1989-09-01

    The 1788-nucleotide sequence of the small-subunit ribosomal RNA (srRNA) coding region from the chlorophyte Volvox carteri was determined. The secondary structure bears features typical of the universal model of srRNA, including about 40 helices and a division into four domains. Phylogenetic relationships to 17 other eukaryotes, including two other chlorophytes, were explored by comparing srRNA sequences. Similarity values and the inspection of phylogenetic trees derived by distance matrix methods revealed a close relationship between V. carteri and Chlamydomonas reinhardtii. The results are consistent with the view that these Volvocales, and the third green alga, Nanochlorum eucaryotum, are more closely related to higher plants than to any other major eukaryotic group, but constitute a distinct lineage that has long been separated from the line leading to the higher plants. PMID:2506359

  19. The Dedicated Chaperone Acl4 Escorts Ribosomal Protein Rpl4 to Its Nuclear Pre-60S Assembly Site

    PubMed Central

    Pillet, Benjamin; García-Gómez, Juan J.; Pausch, Patrick; Falquet, Laurent; Bange, Gert; de la Cruz, Jesús; Kressler, Dieter

    2015-01-01

    Ribosomes are the highly complex macromolecular assemblies dedicated to the synthesis of all cellular proteins from mRNA templates. The main principles underlying the making of ribosomes are conserved across eukaryotic organisms and this process has been studied in most detail in the yeast Saccharomyces cerevisiae. Yeast ribosomes are composed of four ribosomal RNAs (rRNAs) and 79 ribosomal proteins (r-proteins). Most r-proteins need to be transported from the cytoplasm to the nucleus where they get incorporated into the evolving pre-ribosomal particles. Due to the high abundance and difficult physicochemical properties of r-proteins, their correct folding and fail-safe targeting to the assembly site depends largely on general, as well as highly specialized, chaperone and transport systems. Many r-proteins contain universally conserved or eukaryote-specific internal loops and/or terminal extensions, which were shown to mediate their nuclear targeting and association with dedicated chaperones in a growing number of cases. The 60S r-protein Rpl4 is particularly interesting since it harbours a conserved long internal loop and a prominent C-terminal eukaryote-specific extension. Here we show that both the long internal loop and the C-terminal eukaryote-specific extension are strictly required for the functionality of Rpl4. While Rpl4 contains at least five distinct nuclear localization signals (NLS), the C-terminal part of the long internal loop associates with a specific binding partner, termed Acl4. Absence of Acl4 confers a severe slow-growth phenotype and a deficiency in the production of 60S subunits. Genetic and biochemical evidence indicates that Acl4 can be considered as a dedicated chaperone of Rpl4. Notably, Acl4 localizes to both the cytoplasm and nucleus and it has the capacity to capture nascent Rpl4 in a co-translational manner. Taken together, our findings indicate that the dedicated chaperone Acl4 accompanies Rpl4 from the cytoplasm to its pre-60S

  20. The Dedicated Chaperone Acl4 Escorts Ribosomal Protein Rpl4 to Its Nuclear Pre-60S Assembly Site.

    PubMed

    Pillet, Benjamin; García-Gómez, Juan J; Pausch, Patrick; Falquet, Laurent; Bange, Gert; de la Cruz, Jesús; Kressler, Dieter

    2015-10-01

    Ribosomes are the highly complex macromolecular assemblies dedicated to the synthesis of all cellular proteins from mRNA templates. The main principles underlying the making of ribosomes are conserved across eukaryotic organisms and this process has been studied in most detail in the yeast Saccharomyces cerevisiae. Yeast ribosomes are composed of four ribosomal RNAs (rRNAs) and 79 ribosomal proteins (r-proteins). Most r-proteins need to be transported from the cytoplasm to the nucleus where they get incorporated into the evolving pre-ribosomal particles. Due to the high abundance and difficult physicochemical properties of r-proteins, their correct folding and fail-safe targeting to the assembly site depends largely on general, as well as highly specialized, chaperone and transport systems. Many r-proteins contain universally conserved or eukaryote-specific internal loops and/or terminal extensions, which were shown to mediate their nuclear targeting and association with dedicated chaperones in a growing number of cases. The 60S r-protein Rpl4 is particularly interesting since it harbours a conserved long internal loop and a prominent C-terminal eukaryote-specific extension. Here we show that both the long internal loop and the C-terminal eukaryote-specific extension are strictly required for the functionality of Rpl4. While Rpl4 contains at least five distinct nuclear localization signals (NLS), the C-terminal part of the long internal loop associates with a specific binding partner, termed Acl4. Absence of Acl4 confers a severe slow-growth phenotype and a deficiency in the production of 60S subunits. Genetic and biochemical evidence indicates that Acl4 can be considered as a dedicated chaperone of Rpl4. Notably, Acl4 localizes to both the cytoplasm and nucleus and it has the capacity to capture nascent Rpl4 in a co-translational manner. Taken together, our findings indicate that the dedicated chaperone Acl4 accompanies Rpl4 from the cytoplasm to its pre-60S

  1. The Kissing-Loop T-Shaped Structure Translational Enhancer of Pea Enation Mosaic Virus Can Bind Simultaneously to Ribosomes and a 5′ Proximal Hairpin

    PubMed Central

    Gao, Feng; Gulay, Suna P.; Kasprzak, Wojciech; Dinman, Jonathan D.

    2013-01-01

    The Pea Enation Mosaic Virus (PEMV) 3′ translational enhancer, known as the kissing-loop T-shaped structure (kl-TSS), binds to 40S subunits, 60S subunits, and 80S ribosomes, whereas the Turnip crinkle virus (TCV) TSS binds only to 60S subunits and 80S ribosomes. Using electrophoretic mobility gel shift assay (EMSA)-based competition assays, the kl-TSS was found to occupy a different site in the ribosome than the P-site-binding TCV TSS, suggesting that these two TSS employ different mechanisms for enhancing translation. The kl-TSS also engages in a stable, long-distance RNA-RNA kissing-loop interaction with a 12-bp 5′-coding-region hairpin that does not alter the structure of the kl-TSS as revealed by molecular dynamics simulations. Addition of the kl-TSS in trans to a luciferase reporter construct containing either wild-type or mutant 5′ and 3′ PEMV sequences suppressed translation, suggesting that the kl-TSS is required in cis to function, and both ribosome-binding and RNA interaction activities of the kl-TSS contributed to translational inhibition. Addition of the kl-TSS was more detrimental for translation than an adjacent eIF4E-binding 3′ translational enhancer known as the PTE, suggesting that the PTE may support the ribosome-binding function of the kl-TSS. Results of in-line RNA structure probing, ribosome filter binding, and high-throughput selective 2′-hydroxyl acylation analyzed by primer extension (hSHAPE) of rRNAs within bound ribosomes suggest that kl-TSS binding to ribosomes and binding to the 5′ hairpin are compatible activities. These results suggest a model whereby posttermination ribosomes/ribosomal subunits bind to the kl-TSS and are delivered to the 5′ end of the genome via the associated RNA-RNA interaction, which enhances the rate of translation reinitiation. PMID:23986599

  2. Crystal structures of complexes containing domains from two viral internal ribosome entry site (IRES) RNAs bound to the 70S ribosome.

    PubMed

    Zhu, Jianyu; Korostelev, Andrei; Costantino, David A; Donohue, John P; Noller, Harry F; Kieft, Jeffrey S

    2011-02-01

    Internal ribosome entry site (IRES) RNAs are elements of viral or cellular mRNAs that bypass steps of canonical eukaryotic cap-dependent translation initiation. Understanding of the structural basis of IRES mechanisms is limited, partially due to a lack of high-resolution structures of IRES RNAs bound to their cellular targets. Prompted by the universal phylogenetic conservation of the ribosomal P site, we solved the crystal structures of proposed P site binding domains from two intergenic region IRES RNAs bound to bacterial 70S ribosomes. The structures show that these IRES domains nearly perfectly mimic a tRNA • mRNA interaction. However, there are clear differences in the global shape and position of this IRES domain in the intersubunit space compared to those of tRNA, supporting a mechanism for IRES action that invokes hybrid state mimicry to drive a noncanonical mode of translocation. These structures suggest how relatively small structured RNAs can manipulate complex biological machines. PMID:21245352

  3. Stimulation of -1 programmed ribosomal frameshifting by a metabolite-responsive RNA pseudoknot.

    PubMed

    Chou, Ming-Yuan; Lin, Szu-Chieh; Chang, Kung-Yao

    2010-06-01

    Specific recognition of metabolites by functional RNA motifs within mRNAs has emerged as a crucial regulatory strategy for feedback control of biochemical reactions. Such riboswitches have been demonstrated to regulate different gene expression processes, including transcriptional termination and translational initiation in prokaryotic cells, as well as splicing in eukaryotic cells. The regulatory process is usually mediated by modulating the accessibility of specific sequence information of the expression platforms via metabolite-induced RNA conformational rearrangement. In eukaryotic systems, viral and the more limited number of cellular decoding -1 programmed ribosomal frameshifting (PRF) are commonly promoted by a 3' mRNA pseudoknot. In addition, such -1 PRF is generally constitutive rather than being regulatory, and usually results in a fixed ratio of products. We report here an RNA pseudoknot capable of stimulating -1 PRF whose efficiency can be tuned in response to the concentration of S-adenosylhomocysteine (SAH), and the improvement of its frameshifting efficiency by RNA engineering. In addition to providing an alternative approach for small-molecule regulation of gene expression in eukaryotic cells, such a metabolite-responsive pseudoknot suggests a plausible mechanism for metabolite-driven translational regulation of gene expression in eukaryotic systems. PMID:20435898

  4. Metal-regulated transcription in eukaryotes.

    PubMed Central

    Thiele, D J

    1992-01-01

    This review has summarized many of the major aspects of metal-regulated gene transcription in eukaryotic organisms as they are currently understood at the mechanistic level. Clearly, metals represent a class of important transcriptional effector molecules which regulate gene expression in different ways and both by activation or repression of gene transcription. To date, studies of metal-regulated transcription in fungi have resulted in the most detailed description of the structure, function and mechanisms of action of eukaryotic metal-responsive transcription factors. Recently, significant progress has been made in higher eukaryotic systems through the biochemical detection and purification of MRE binding proteins which may represent MRTFs. Additionally, perhaps fungi will be exploited for their genetics and ease of manipulation to clone and functionally analyze cDNAs for MRTFs from higher eukaryotes. The isolation of cDNAs for higher eukaryotic MRTFs will provide important tools for answering a number of interesting questions in metal-regulated gene transcription. How do higher eukaryotes activate MT gene transcription in response to a broad range of environmental metals? What are the tissue distributions of MRTFs and how does their activity correlate with the exposure of different tissues to varying concentrations of metals? What are the identities of other genes regulated by MRTFs and why are such genes metal-responsive? A comprehensive understanding of the detailed mechanisms for metal-regulated transcription will ultimately require an understanding of how eukaryotic cells sense, transport, distribute and remove metals from their environment. These questions provide an interesting and exciting area of investigation for geneticists, physiologists, molecular biologists, biophysicists and biochemists now and in the future. PMID:1561077

  5. Decreased activity of Blastocladiella emersonii zoospore ribosomes: correlation with developmental changes in ribosome-associated proteins.

    PubMed

    Jaworski, A J; Wilson, J B

    1989-10-01

    Ribosomal proteins isolated from dormant zoospores were compared to the ribosomal proteins found in the active growth phase by two-dimensional polyacrylamide gel electrophoresis. Zoospore ribosomes were found to contain a set of five proteins, designated Z1 to Z5, which were not present in growth phase ribosomes. The Z1-Z5 proteins were not removed by high-salt washes using either 1 M KCl or 1 M NH4 Cl. The Z1 protein is found associated with zoospore 60 S subunits while Z2-Z5 are bound to 40 S subunits. Zoospore monoribosomes and polyribosomes contain comparable levels of each of the five proteins. Approximately 60 min. after sporulation is induced, the Z1-Z5 proteins begin to accumulate on the ribosomes with the highest levels of these proteins found associated with ribosomes at the zoospore stage. During germination, the proteins gradually disappear and are not detectable on the ribosomes after 4 hr of germination. The presence of the Z1-Z5 proteins correlates with a decrease in in vitro protein synthetic activity of the fungal ribosomes. The data are consistent with the hypothesis that the proteins regulate translation by completely blocking protein synthesis on a subset of ribosomes while the remainder of the ribosomes function at normal rates. PMID:2776972

  6. Yeast polypeptide exit tunnel ribosomal proteins L17, L35 and L37 are necessary to recruit late-assembling factors required for 27SB pre-rRNA processing

    PubMed Central

    Gamalinda, Michael; Jakovljevic, Jelena; Babiano, Reyes; Talkish, Jason; de la Cruz, Jesús; Woolford, John L.

    2013-01-01

    Ribosome synthesis involves the coordinated folding and processing of pre-rRNAs with assembly of ribosomal proteins. In eukaryotes, these events are facilitated by trans-acting factors that propel ribosome maturation from the nucleolus to the cytoplasm. However, there is a gap in understanding how ribosomal proteins configure pre-ribosomes in vivo to enable processing to occur. Here, we have examined the role of adjacent yeast r-proteins L17, L35 and L37 in folding and processing of pre-rRNAs, and binding of other proteins within assembling ribosomes. These three essential ribosomal proteins, which surround the polypeptide exit tunnel, are required for 60S subunit formation as a consequence of their role in removal of the ITS2 spacer from 27SB pre-rRNA. L17-, L35- and L37-depleted cells exhibit turnover of aberrant pre-60S assembly intermediates. Although the structure of ITS2 does not appear to be grossly affected in their absence, these three ribosomal proteins are necessary for efficient recruitment of factors required for 27SB pre-rRNA processing, namely, Nsa2 and Nog2, which associate with pre-60S ribosomal particles containing 27SB pre-rRNAs. Altogether, these data support that L17, L35 and L37 are specifically required for a recruiting step immediately preceding removal of ITS2. PMID:23268442

  7. Ribosomopathies: human disorders of ribosome dysfunction.

    PubMed

    Narla, Anupama; Ebert, Benjamin L

    2010-04-22

    Ribosomopathies compose a collection of disorders in which genetic abnormalities cause impaired ribosome biogenesis and function, resulting in specific clinical phenotypes. Congenital mutations in RPS19 and other genes encoding ribosomal proteins cause Diamond-Blackfan anemia, a disorder characterized by hypoplastic, macrocytic anemia. Mutations in other genes required for normal ribosome biogenesis have been implicated in other rare congenital syndromes, Schwachman-Diamond syndrome, dyskeratosis congenita, cartilage hair hypoplasia, and Treacher Collins syndrome. In addition, the 5q- syndrome, a subtype of myelodysplastic syndrome, is caused by a somatically acquired deletion of chromosome 5q, which leads to haploinsufficiency of the ribosomal protein RPS14 and an erythroid phenotype highly similar to Diamond-Blackfan anemia. Acquired abnormalities in ribosome function have been implicated more broadly in human malignancies. The p53 pathway provides a surveillance mechanism for protein translation as well as genome integrity and is activated by defects in ribosome biogenesis; this pathway appears to be a critical mediator of many of the clinical features of ribosomopathies. Elucidation of the mechanisms whereby selective abnormalities in ribosome biogenesis cause specific clinical syndromes will hopefully lead to novel therapeutic strategies for these diseases. PMID:20194897

  8. Ribonucleic acid and ribosomes of Bacillus stearothermophilus.

    PubMed

    Saunders, G F; Campbell, L L

    1966-01-01

    Saunders, Grady F. (University of Illinois, Urbana), and L. Leon Campbell. Ribonucleic acid and ribosomes of Bacillus stearothermophilus. J. Bacteriol. 91:332-339. 1966.-The ability of some thermophilic bacteria to grow at temperatures as high as 76 C emphasizes the remarkable thermal stability of their crucial macromolecules. An investigation of the ribonucleic acid (RNA) and ribosomes of Bacillus stearothermophilus was conducted. Washed log-phase cells were disrupted either by sonic treatment or by alumina grinding in 10(-2)m MgCl(2)-10(-2)m tris-(hydroxymethyl)aminomethane buffer, pH 7.4 (TM buffer). Ultracentrifugal analysis revealed peaks at 72.5S, 101S, and 135S, with the 101S peak being the most prominent. By lowering the Mg(++) concentration to 10(-3)m, the ribosome preparation was dissociated to give 40S, 31S, and 54S peaks. These in turn were reassociated in the presence of 10(-2)m Mg(++) to give the larger 73S and 135S particles. When heated in TM buffer, Escherichia coli ribosomes began a gradual dissociation at 58 C, and at 70 C underwent a large hyperchromic shift with a T(m) at 72.8 C. In contrast, B. stearothermophilus ribosomes did not show a hyperchromic shift below 70 C; they had a T(m) of 77.9 C. The thermal denaturation curves of the 4S, 16S, and 23S RNA from both organisms were virtually identical. The gross amino acid composition of B. stearothermophilus ribosomes showed no marked differences from that reported for E. coli ribosomes. These data suggest that the unusual thermal stability of B. stearothermophilus ribosomes may reflect either an unusual packing arrangement of the protein to the RNA or differences in the primary structure of the ribosomal proteins. PMID:5903099

  9. An inhibitor of eIF2 activity in the sRNA pool of eukaryotic cells

    PubMed Central

    Centrella, Michael; Porter, David L.; McCarthy, Thomas L.

    2012-01-01

    Eukaryotic protein synthesis is a multi-step and highly controlled process that includes an early initiation complex containing eukaryotic initiation factor 2 (eIF2), GTP, and methionine-charged initiator methionyl-tRNA (met-tRNAi). During studies to reconstruct formation of the ternary complex containing these molecules, we detected a potent inhibitor in low molecular mass RNA (sRNA) preparations of eukaryotic tRNA. The ternary complex inhibitor (TCI) was retained in the total sRNA pool after met-tRNAi was charged by aminoacyl tRNA synthetase, co-eluted with sRNA by size exclusion chromatography, but resolved from met-tRNAi by ion exchange chromatography. The adverse effect of TCI was not overcome by high GTP or magnesium omission and was independent of GTP regeneration. Rather, TCI suppressed the rate of ternary complex formation, and disrupted protein synthesis and the accumulation of heavy polymeric ribosomes in reticulocyte lysates in vitro. Lastly, a component or components in ribosome depleted cell lysate significantly reversed TCI activity. Since assembly of the met-tRNAi/eIF2/GTP ternary complex is integral to protein synthesis, awareness of TCI is important to avoid confusion in studies of translation initiation. A clear definition of TCI may also allow a better appreciation of physiologic or pathologic situations factors and events that control protein synthesis in vivo. PMID:21640800

  10. An inhibitor of eIF2 activity in the sRNA pool of eukaryotic cells.

    PubMed

    Centrella, Michael; Porter, David L; McCarthy, Thomas L

    2011-08-15

    Eukaryotic protein synthesis is a multi-step and highly controlled process that includes an early initiation complex containing eukaryotic initiation factor 2 (eIF2), GTP, and methionine-charged initiator methionyl-tRNA (met-tRNAi). During studies to reconstruct formation of the ternary complex containing these molecules, we detected a potent inhibitor in low molecular mass RNA (sRNA) preparations of eukaryotic tRNA. The ternary complex inhibitor (TCI) was retained in the total sRNA pool after met-tRNAi was charged by aminoacyl tRNA synthetase, co-eluted with sRNA by size exclusion chromatography, but resolved from met-tRNAi by ion exchange chromatography. The adverse effect of TCI was not overcome by high GTP or magnesium omission and was independent of GTP regeneration. Rather, TCI suppressed the rate of ternary complex formation, and disrupted protein synthesis and the accumulation of heavy polymeric ribosomes in reticulocyte lysates in vitro. Lastly, a component or components in ribosome depleted cell lysate significantly reversed TCI activity. Since assembly of the met-tRNAi/eIF2/GTP ternary complex is integral to protein synthesis, awareness of TCI is important to avoid confusion in studies of translation initiation. A clear definition of TCI may also allow a better appreciation of physiologic or pathologic situations, factors, and events that control protein synthesis in vivo. PMID:21640800

  11. Gcn1 contacts the small ribosomal protein Rps10, which is required for full activation of the protein kinase Gcn2.

    PubMed

    Lee, Su Jung; Swanson, Mark J; Sattlegger, Evelyn

    2015-03-15

    In eukaryotes, amino acid deprivation leads to the accumulation of uncharged tRNAs that are detected by Gcn2 (general control non-derepressible 2), which in turn phosphorylates eIF2α (α-subunit of eukaryotic translation initiation factor 2), an essential process for overcoming starvation. In Saccharomyces cerevisiae, sensing amino acid shortages requires that Gcn2 binds directly to its effector protein Gcn1 and both must associate with the ribosome. Our hypothesis is that uncharged tRNAs occur in the ribosomal A-site and that Gcn1 is directly involved in transfer of this starvation signal to Gcn2. In the present paper, we provide evidence that Gcn1 directly contacts the small ribosomal protein S10 (Rps10). Gcn1 residues 1060-1777 showed a yeast two-hybrid (Y2H) interaction with Rps10A. In vitro, Rps10A or Rps10B co-precipitated Gcn1[1060-1777] in an RNA-independent manner. rps10AΔ or rps10BΔ strains showed reduced eIF2α phosphorylation under replete conditions and shortly after onset of starvation, suggesting that Gcn1-mediated Gcn2 activation was impaired. Overexpression of GST-tagged Rps10 reduced growth under amino acid starvation and this was exacerbated by the Gcn1-M7A mutation known to impair Gcn1-ribosome interaction and Gcn2 activity. Under amino acid starvation, eEF3 (eukaryotic translation elongation factor 3) overexpression, known to weaken Gcn1 function on the ribosome, exacerbated the growth defect of rps10AΔ or rps10BΔ strains. Taken together, these data support the idea that Gcn1 contacts ribosome-bound Rps10 to efficiently mediate Gcn2 activation. PMID:25437641

  12. Origins and activities of the eukaryotic exosome.

    PubMed

    Lykke-Andersen, Søren; Brodersen, Ditlev E; Jensen, Torben Heick

    2009-05-15

    The exosome is a multi-subunit 3'-5' exonucleolytic complex that is conserved in structure and function in all eukaryotes studied to date. The complex is present in both the nucleus and cytoplasm, where it continuously works to ensure adequate quantities and quality of RNAs by facilitating normal RNA processing and turnover, as well as by participating in more complex RNA quality-control mechanisms. Recent progress in the field has convincingly shown that the nucleolytic activity of the exosome is maintained by only two exonuclease co-factors, one of which is also an endonuclease. The additional association of the exosome with RNA-helicase and poly(A) polymerase activities results in a flexible molecular machine that is capable of dealing with the multitude of cellular RNA substrates that are found in eukaryotic cells. Interestingly, the same basic set of enzymatic activities is found in prokaryotic cells, which might therefore illustrate the evolutionary origin of the eukaryotic system. In this Commentary, we compare the structural and functional characteristics of the eukaryotic and prokaryotic RNA-degradation systems, with an emphasis on some of the functional networks in which the RNA exosome participates in eukaryotes. PMID:19420235

  13. Atypical mitochondrial inheritance patterns in eukaryotes.

    PubMed

    Breton, Sophie; Stewart, Donald T

    2015-10-01

    Mitochondrial DNA (mtDNA) is predominantly maternally inherited in eukaryotes. Diverse molecular mechanisms underlying the phenomenon of strict maternal inheritance (SMI) of mtDNA have been described, but the evolutionary forces responsible for its predominance in eukaryotes remain to be elucidated. Exceptions to SMI have been reported in diverse eukaryotic taxa, leading to the prediction that several distinct molecular mechanisms controlling mtDNA transmission are present among the eukaryotes. We propose that these mechanisms will be better understood by studying the deviations from the predominating pattern of SMI. This minireview summarizes studies on eukaryote species with unusual or rare mitochondrial inheritance patterns, i.e., other than the predominant SMI pattern, such as maternal inheritance of stable heteroplasmy, paternal leakage of mtDNA, biparental and strictly paternal inheritance, and doubly uniparental inheritance of mtDNA. The potential genes and mechanisms involved in controlling mitochondrial inheritance in these organisms are discussed. The linkage between mitochondrial inheritance and sex determination is also discussed, given that the atypical systems of mtDNA inheritance examined in this minireview are frequently found in organisms with uncommon sexual systems such as gynodioecy, monoecy, or andromonoecy. The potential of deviations from SMI for facilitating a better understanding of a number of fundamental questions in biology, such as the evolution of mtDNA inheritance, the coevolution of nuclear and mitochondrial genomes, and, perhaps, the role of mitochondria in sex determination, is considerable. PMID:26501689

  14. Comparative genomics and evolution of eukaryotic phospholipidbiosynthesis

    SciTech Connect

    Lykidis, Athanasios

    2006-12-01

    Phospholipid biosynthetic enzymes produce diverse molecular structures and are often present in multiple forms encoded by different genes. This work utilizes comparative genomics and phylogenetics for exploring the distribution, structure and evolution of phospholipid biosynthetic genes and pathways in 26 eukaryotic genomes. Although the basic structure of the pathways was formed early in eukaryotic evolution, the emerging picture indicates that individual enzyme families followed unique evolutionary courses. For example, choline and ethanolamine kinases and cytidylyltransferases emerged in ancestral eukaryotes, whereas, multiple forms of the corresponding phosphatidyltransferases evolved mainly in a lineage specific manner. Furthermore, several unicellular eukaryotes maintain bacterial-type enzymes and reactions for the synthesis of phosphatidylglycerol and cardiolipin. Also, base-exchange phosphatidylserine synthases are widespread and ancestral enzymes. The multiplicity of phospholipid biosynthetic enzymes has been largely generated by gene expansion in a lineage specific manner. Thus, these observations suggest that phospholipid biosynthesis has been an actively evolving system. Finally, comparative genomic analysis indicates the existence of novel phosphatidyltransferases and provides a candidate for the uncharacterized eukaryotic phosphatidylglycerol phosphate phosphatase.

  15. Evolution of Proteasome Regulators in Eukaryotes

    PubMed Central

    Fort, Philippe; Kajava, Andrey V.; Delsuc, Fredéric; Coux, Olivier

    2015-01-01

    All living organisms require protein degradation to terminate biological processes and remove damaged proteins. One such machine is the 20S proteasome, a specialized barrel-shaped and compartmentalized multicatalytic protease. The activity of the 20S proteasome generally requires the binding of regulators/proteasome activators (PAs), which control the entrance of substrates. These include the PA700 (19S complex), which assembles with the 20S and forms the 26S proteasome and allows the efficient degradation of proteins usually labeled by ubiquitin tags, PA200 and PA28, which are involved in proteolysis through ubiquitin-independent mechanisms and PI31, which was initially identified as a 20S inhibitor in vitro. Unlike 20S proteasome, shown to be present in all Eukaryotes and Archaea, the evolutionary history of PAs remained fragmentary. Here, we made a comprehensive survey and phylogenetic analyses of the four types of regulators in 17 clades covering most of the eukaryotic supergroups. We found remarkable conservation of each PA700 subunit in all eukaryotes, indicating that the current complex PA700 structure was already set up in the last eukaryotic common ancestor (LECA). Also present in LECA, PA200, PA28, and PI31 showed a more contrasted evolutionary picture, because many lineages have subsequently lost one or two of them. The paramount conservation of PA700 composition in all eukaryotes and the dynamic evolution of PA200, PA28, and PI31 are discussed in the light of current knowledge on their physiological roles. PMID:25943340

  16. A new system for naming ribosomal proteins

    PubMed Central

    Ban, Nenad; Beckmann, Roland; Cate, Jamie HD; Dinman, Jonathan D; Dragon, François; Ellis, Steven R; Lafontaine, Denis LJ; Lindahl, Lasse; Liljas, Anders; Lipton, Jeffrey M; McAlear, Michael A; Moore, Peter B; Noller, Harry F; Ortega, Joaquin; Panse, Vikram Govind; Ramakrishnan, V; Spahn, Christian MT; Steitz, Thomas A; Tchorzewski, Marek; Tollervey, David; Warren, Alan J; Williamson, James R; Wilson, Daniel; Yonath, Ada; Yusupov, Marat

    2015-01-01

    A system for naming ribosomal proteins is described that the authors intend to use in the future. They urge others to adopt it. The objective is to eliminate the confusion caused by the assignment of identical names to ribosomal proteins from different species that are unrelated in structure and function. In the system proposed here, homologous ribosomal proteins are assigned the same name, regardless of species. It is designed so that new names are similar enough to old names to be easily recognized, but are written in a format that unambiguously identifies them as ‘new system’ names. PMID:24524803

  17. The economics of ribosome biosynthesis in yeast.

    PubMed

    Warner, J R

    1999-11-01

    In a rapidly growing yeast cell, 60% of total transcription is devoted to ribosomal RNA, and 50% of RNA polymerase II transcription and 90% of mRNA splicing are devoted to ribosomal proteins (RPs). Coordinate regulation of the approximately 150 rRNA genes and 137 RP genes that make such prodigious use of resources is essential for the economy of the cell. This is entrusted to a number of signal transduction pathways that can abruptly induce or silence the ribosomal genes, leading to major implications for the expression of other genes as well. PMID:10542411

  18. Computational studies of molecular machines: the ribosome.

    PubMed

    Sanbonmatsu, Karissa Y

    2012-04-01

    The past decade has produced an avalanche of experimental data on the structure and dynamics of the ribosome. Groundbreaking studies in structural biology and kinetics have placed important constraints on ribosome structural dynamics. However, a gulf remains between static structures and time dependent data. In particular, X-ray crystallography and cryo-EM studies produce static models of the ribosome in various states, but lack dynamic information. Single molecule studies produce information on the rates of transitions between these states but do not have high-resolution spatial information. Computational studies have aided in bridging this gap by providing atomic resolution simulations of structural fluctuations and transitions between configurations. PMID:22336622

  19. Computational studies of molecular machines: the ribosome

    PubMed Central

    Sanbonmatsu, Karissa Y.

    2013-01-01

    The past decade has produced an avalanche of experimental data on the structure and dynamics of the ribosome. Groundbreaking studies in structural biology and kinetics have placed important constraints on ribosome structural dynamics. However, a gulf remains between static structures and time dependent data. In particular, x-ray crystallography and cryo-EM studies produce static models of the ribosome in various states, but lack dynamic information. Single molecule studies produce information on the rates of transitions between these states but do not have high-resolution spatial information. Computational studies have aided in bridging this gap by providing atomic resolution simulations of structural fluctuations and transitions between configurations. PMID:22336622

  20. The extent of protist diversity: insights from molecular ecology of freshwater eukaryotes.

    PubMed

    Slapeta, Jan; Moreira, David; López-García, Purificación

    2005-10-01

    Classical studies on protist diversity of freshwater environments worldwide have led to the idea that most species of microbial eukaryotes are known. One exemplary case would be constituted by the ciliates, which have been claimed to encompass a few thousands of ubiquitous species, most of them already described. Recently, molecular methods have revealed an unsuspected protist diversity, especially in oceanic as well as some extreme environments, suggesting the occurrence of a hidden diversity of eukaryotic lineages. In order to test if this holds also for freshwater environments, we have carried out a molecular survey of small subunit ribosomal RNA genes in water and sediment samples of two ponds, one oxic and another suboxic, from the same geographic area. Our results show that protist diversity is very high. The majority of phylotypes affiliated within a few well established eukaryotic kingdoms or phyla, including alveolates, cryptophytes, heterokonts, Cercozoa, Centroheliozoa and haptophytes, although a few sequences did not display a clear taxonomic affiliation. The diversity of sequences within groups was very large, particularly that of ciliates, and a number of them were very divergent from known species, which could define new intra-phylum groups. This suggests that, contrary to current ideas, the diversity of freshwater protists is far from being completely described. PMID:16191619

  1. Large variability of bathypelagic microbial eukaryotic communities across the world's oceans.

    PubMed

    Pernice, Massimo C; Giner, Caterina R; Logares, Ramiro; Perera-Bel, Júlia; Acinas, Silvia G; Duarte, Carlos M; Gasol, Josep M; Massana, Ramon

    2016-04-01

    In this work, we study the diversity of bathypelagic microbial eukaryotes (0.8-20 μm) in the global ocean. Seawater samples from 3000 to 4000 m depth from 27 stations in the Atlantic, Pacific and Indian Oceans were analyzed by pyrosequencing the V4 region of the 18S ribosomal DNA. The relative abundance of the most abundant operational taxonomic units agreed with the results of a parallel metagenomic analysis, suggesting limited PCR biases in the tag approach. Although rarefaction curves for single stations were seldom saturated, the global analysis of all sequences together suggested an adequate recovery of bathypelagic diversity. Community composition presented a large variability among samples, which was poorly explained by linear geographic distance. In fact, the similarity between communities was better explained by water mass composition (26% of the variability) and the ratio in cell abundance between prokaryotes and microbial eukaryotes (21%). Deep diversity appeared dominated by four taxonomic groups (Collodaria, Chrysophytes, Basidiomycota and MALV-II) appearing in different proportions in each sample. Novel diversity amounted to 1% of the pyrotags and was lower than expected. Our study represents an essential step in the investigation of bathypelagic microbial eukaryotes, indicating dominating taxonomic groups and suggesting idiosyncratic assemblages in distinct oceanic regions. PMID:26451501

  2. The ribosome as a missing link in prebiotic evolution II: Ribosomes encode ribosomal proteins that bind to common regions of their own mRNAs and rRNAs.

    PubMed

    Root-Bernstein, Robert; Root-Bernstein, Meredith

    2016-05-21

    We have proposed that the ribosome may represent a missing link between prebiotic chemistries and the first cells. One of the predictions that follows from this hypothesis, which we test here, is that ribosomal RNA (rRNA) must have encoded the proteins necessary for ribosomal function. In other words, the rRNA also functioned pre-biotically as mRNA. Since these ribosome-binding proteins (rb-proteins) must bind to the rRNA, but the rRNA also functioned as mRNA, it follows that rb-proteins should bind to their own mRNA as well. This hypothesis can be contrasted to a "null" hypothesis in which rb-proteins evolved independently of the rRNA sequences and therefore there should be no necessary similarity between the rRNA to which rb-proteins bind and the mRNA that encodes the rb-protein. Five types of evidence reported here support the plausibility of the hypothesis that the mRNA encoding rb-proteins evolved from rRNA: (1) the ubiquity of rb-protein binding to their own mRNAs and autogenous control of their own translation; (2) the higher-than-expected incidence of Arginine-rich modules associated with RNA binding that occurs in rRNA-encoded proteins; (3) the fact that rRNA-binding regions of rb-proteins are homologous to their mRNA binding regions; (4) the higher than expected incidence of rb-protein sequences encoded in rRNA that are of a high degree of homology to their mRNA as compared with a random selection of other proteins; and (5) rRNA in modern prokaryotes and eukaryotes encodes functional proteins. None of these results can be explained by the null hypothesis that assumes independent evolution of rRNA and the mRNAs encoding ribosomal proteins. Also noteworthy is that very few proteins bind their own mRNAs that are not associated with ribosome function. Further tests of the hypothesis are suggested: (1) experimental testing of whether rRNA-encoded proteins bind to rRNA at their coding sites; (2) whether tRNA synthetases, which are also known to bind to their

  3. Introns regulate the production of ribosomal proteins by modulating splicing of duplicated ribosomal protein genes.

    PubMed

    Petibon, Cyrielle; Parenteau, Julie; Catala, Mathieu; Elela, Sherif Abou

    2016-05-01

    Most budding yeast introns exist in the many duplicated ribosomal protein genes (RPGs) and it has been posited that they remain there to modulate the expression of RPGs and cell growth in response to stress. However, the mechanism by which introns regulate the expression of RPGs and their impact on the synthesis of ribosomal proteins remain unclear. In this study, we show that introns determine the ratio of ribosomal protein isoforms through asymmetric paralog-specific regulation of splicing. Exchanging the introns and 3' untranslated regions of the duplicated RPS9 genes altered the splicing efficiency and changed the ratio of the ribosomal protein isoforms. Mutational analysis of the RPS9 genes indicated that splicing is regulated by variations in the intron structure and the 3' untranslated region. Together these data suggest that preferential splicing of duplicated RPGs provides a means for adjusting the ratio of different ribosomal protein isoforms, while maintaining the overall expression level of each ribosomal protein. PMID:26945043

  4. Nuclear ribosomal internal transcribed spacer (ITS) region as a universal DNA barcode marker for Fungi.

    PubMed

    Schoch, Conrad L; Seifert, Keith A; Huhndorf, Sabine; Robert, Vincent; Spouge, John L; Levesque, C André; Chen, Wen

    2012-04-17

    Six DNA regions were evaluated as potential DNA barcodes for Fungi, the second largest kingdom of eukaryotic life, by a multinational, multilaboratory consortium. The region of the mitochondrial cytochrome c oxidase subunit 1 used as the animal barcode was excluded as a potential marker, because it is difficult to amplify in fungi, often includes large introns, and can be insufficiently variable. Three subunits from the nuclear ribosomal RNA cistron were compared together with regions of three representative protein-coding genes (largest subunit of RNA polymerase II, second largest subunit of RNA polymerase II, and minichromosome maintenance protein). Although the protein-coding gene regions often had a higher percent of correct identification compared with ribosomal markers, low PCR amplification and sequencing success eliminated them as candidates for a universal fungal barcode. Among the regions of the ribosomal cistron, the internal transcribed spacer (ITS) region has the highest probability of successful identification for the broadest range of fungi, with the most clearly defined barcode gap between inter- and intraspecific variation. The nuclear ribosomal large subunit, a popular phylogenetic marker in certain groups, had superior species resolution in some taxonomic groups, such as the early diverging lineages and the ascomycete yeasts, but was otherwise slightly inferior to the ITS. The nuclear ribosomal small subunit has poor species-level resolution in fungi. ITS will be formally proposed for adoption as the primary fungal barcode marker to the Consortium for the Barcode of Life, with the possibility that supplementary barcodes may be developed for particular narrowly circumscribed taxonomic groups. PMID:22454494

  5. Nuclear ribosomal internal transcribed spacer (ITS) region as a universal DNA barcode marker for Fungi

    PubMed Central

    Schoch, Conrad L.; Seifert, Keith A.; Huhndorf, Sabine; Robert, Vincent; Spouge, John L.; Levesque, C. André; Chen, Wen; Bolchacova, Elena; Voigt, Kerstin; Crous, Pedro W.; Miller, Andrew N.; Wingfield, Michael J.; Aime, M. Catherine; An, Kwang-Deuk; Bai, Feng-Yan; Barreto, Robert W.; Begerow, Dominik; Bergeron, Marie-Josée; Blackwell, Meredith; Boekhout, Teun; Bogale, Mesfin; Boonyuen, Nattawut; Burgaz, Ana R.; Buyck, Bart; Cai, Lei; Cai, Qing; Cardinali, G.; Chaverri, Priscila; Coppins, Brian J.; Crespo, Ana; Cubas, Paloma; Cummings, Craig; Damm, Ulrike; de Beer, Z. Wilhelm; de Hoog, G. Sybren; Del-Prado, Ruth; Dentinger, Bryn; Diéguez-Uribeondo, Javier; Divakar, Pradeep K.; Douglas, Brian; Dueñas, Margarita; Duong, Tuan A.; Eberhardt, Ursula; Edwards, Joan E.; Elshahed, Mostafa S.; Fliegerova, Katerina; Furtado, Manohar; García, Miguel A.; Ge, Zai-Wei; Griffith, Gareth W.; Griffiths, K.; Groenewald, Johannes Z.; Groenewald, Marizeth; Grube, Martin; Gryzenhout, Marieka; Guo, Liang-Dong; Hagen, Ferry; Hambleton, Sarah; Hamelin, Richard C.; Hansen, Karen; Harrold, Paul; Heller, Gregory; Herrera, Cesar; Hirayama, Kazuyuki; Hirooka, Yuuri; Ho, Hsiao-Man; Hoffmann, Kerstin; Hofstetter, Valérie; Högnabba, Filip; Hollingsworth, Peter M.; Hong, Seung-Beom; Hosaka, Kentaro; Houbraken, Jos; Hughes, Karen; Huhtinen, Seppo; Hyde, Kevin D.; James, Timothy; Johnson, Eric M.; Johnson, Joan E.; Johnston, Peter R.; Jones, E.B. Gareth; Kelly, Laura J.; Kirk, Paul M.; Knapp, Dániel G.; Kõljalg, Urmas; Kovács, Gábor M.; Kurtzman, Cletus P.; Landvik, Sara; Leavitt, Steven D.; Liggenstoffer, Audra S.; Liimatainen, Kare; Lombard, Lorenzo; Luangsa-ard, J. Jennifer; Lumbsch, H. Thorsten; Maganti, Harinad; Maharachchikumbura, Sajeewa S. N.; Martin, María P.; May, Tom W.; McTaggart, Alistair R.; Methven, Andrew S.; Meyer, Wieland; Moncalvo, Jean-Marc; Mongkolsamrit, Suchada; Nagy, László G.; Nilsson, R. Henrik; Niskanen, Tuula; Nyilasi, Ildikó; Okada, Gen; Okane, Izumi; Olariaga, Ibai; Otte, Jürgen; Papp, Tamás; Park, Duckchul; Petkovits, Tamás; Pino-Bodas, Raquel; Quaedvlieg, William; Raja, Huzefa A.; Redecker, Dirk; Rintoul, Tara L.; Ruibal, Constantino; Sarmiento-Ramírez, Jullie M.; Schmitt, Imke; Schüßler, Arthur; Shearer, Carol; Sotome, Kozue; Stefani, Franck O.P.; Stenroos, Soili; Stielow, Benjamin; Stockinger, Herbert; Suetrong, Satinee; Suh, Sung-Oui; Sung, Gi-Ho; Suzuki, Motofumi; Tanaka, Kazuaki; Tedersoo, Leho; Telleria, M. Teresa; Tretter, Eric; Untereiner, Wendy A.; Urbina, Hector; Vágvölgyi, Csaba; Vialle, Agathe; Vu, Thuy Duong; Walther, Grit; Wang, Qi-Ming; Wang, Yan; Weir, Bevan S.; Weiß, Michael; White, Merlin M.; Xu, Jianping; Yahr, Rebecca; Yang, Zhu L.; Yurkov, Andrey; Zamora, Juan-Carlos; Zhang, Ning; Zhuang, Wen-Ying; Schindel, David

    2012-01-01

    Six DNA regions were evaluated as potential DNA barcodes for Fungi, the second largest kingdom of eukaryotic life, by a multinational, multilaboratory consortium. The region of the mitochondrial cytochrome c oxidase subunit 1 used as the animal barcode was excluded as a potential marker, because it is difficult to amplify in fungi, often includes large introns, and can be insufficiently variable. Three subunits from the nuclear ribosomal RNA cistron were compared together with regions of three representative protein-coding genes (largest subunit of RNA polymerase II, second largest subunit of RNA polymerase II, and minichromosome maintenance protein). Although the protein-coding gene regions often had a higher percent of correct identification compared with ribosomal markers, low PCR amplification and sequencing success eliminated them as candidates for a universal fungal barcode. Among the regions of the ribosomal cistron, the internal transcribed spacer (ITS) region has the highest probability of successful identification for the broadest range of fungi, with the most clearly defined barcode gap between inter- and intraspecific variation. The nuclear ribosomal large subunit, a popular phylogenetic marker in certain groups, had superior species resolution in some taxonomic groups, such as the early diverging lineages and the ascomycete yeasts, but was otherwise slightly inferior to the ITS. The nuclear ribosomal small subunit has poor species-level resolution in fungi. ITS will be formally proposed for adoption as the primary fungal barcode marker to the Consortium for the Barcode of Life, with the possibility that supplementary barcodes may be developed for particular narrowly circumscribed taxonomic groups. PMID:22454494

  6. Canonical Initiation Factor Requirements of the Myc Family of Internal Ribosome Entry Segments▿ †

    PubMed Central

    Spriggs, Keith A.; Cobbold, Laura C.; Jopling, Catherine L.; Cooper, Rebecca E.; Wilson, Lindsay A.; Stoneley, Mark; Coldwell, Mark J.; Poncet, Didier; Shen, Ya-Ching; Morley, Simon J.; Bushell, Martin; Willis, Anne E.

    2009-01-01

    Initiation of protein synthesis in eukaryotes requires recruitment of the ribosome to the mRNA and its translocation to the start codon. There are at least two distinct mechanisms by which this process can be achieved; the ribosome can be recruited either to the cap structure at the 5′ end of the message or to an internal ribosome entry segment (IRES), a complex RNA structural element located in the 5′ untranslated region (5′-UTR) of the mRNA. However, it is not well understood how cellular IRESs function to recruit the ribosome or how the 40S ribosomal subunits translocate from the initial recruitment site on the mRNA to the AUG initiation codon. We have investigated the canonical factors that are required by the IRESs found in the 5′-UTRs of c-, L-, and N-myc, using specific inhibitors and a tissue culture-based assay system, and have shown that they differ considerably in their requirements. The L-myc IRES requires the eIF4F complex and the association of PABP and eIF3 with eIF4G for activity. The minimum requirements of the N- and c-myc IRESs are the C-terminal domain of eIF4G to which eIF4A is bound and eIF3, although interestingly this protein does not appear to be recruited to the IRES RNA via eIF4G. Finally, our data show that all three IRESs require a ternary complex, although in contrast to c- and L-myc IRESs, the N-myc IRES has a lesser requirement for a ternary complex. PMID:19124605

  7. Structure and function of eukaryotic chromosomes

    SciTech Connect

    Hennig, W.

    1987-01-01

    Contents: Introduction; Polytene Chromosomel Giant Chromosomes in Ciliates; The sp-I Genes in the Balbiani Rings of Chironomus Salivary Glands; The White Locus of Drosophila Melanogaster; The Genetic and Molecular Organization of the Dense Cluster of Functionally Related Vital Genes in the DOPA Decarboxylase Region of the Drosophila melanogaster Genome; Heat Shock Puffs and Response to Environmental Stress; The Y Chromosomal Lampbrush Loops of Drosophila; Contributions of Electron Microscopic Spreading Preparations (''Miller Spreads'') to the Analysis of Chromosome Structure; Replication of DNA in Eukaryotic Chromosomes; Gene Amplification in Dipteran Chromosomes; The Significance of Plant Transposable Elements in Biologically Relevant Processes; Arrangement of Chromosomes in Interphase Cell Nuclei; Heterochromatin and the Phenomenon of Chromosome Banding; Multiple Nonhistone Protein-DNA Complexes in Chromatin Regulate the Cell- and Stage-Specific Activity of an Eukaryotic Gene; Genetics of Sex Determination in Eukaryotes; Application of Basic Chromosome Research in Biotechnology and Medicine. This book presents an overview of various aspects of chromosome research.

  8. Force generation in a regrowing eukaryotic flagellum

    NASA Astrophysics Data System (ADS)

    Polin, Marco; Bruneau, Bastien; Johnson, Thomas; Goldstein, Raymond

    2012-02-01

    Flagella are whip-like organelles with a complex internal structure, the axoneme, highly conserved across eukaryotic species. The highly regulated activity of motor proteins arranged along the axoneme moves the flagellum in the surrounding fluid, generating forces that can be used for swimming or fluid propulsion. Although our understanding of the general mechanism behind flagellar motion is well established, the details of its implementation in a real axoneme is still poorly understood. Here we explore the inner working of the eukaryotic flagellum using a uniflagellated mutant of the unicellular green alga Chlamydomonas reinhardtii to investigate in detail the force and power generated by a moving flagellum during axonemal regrowth after deflagellation. These experiments will contribute to our understanding of the inner working of the eukaryotic flagellum.

  9. The tails of ubiquitin precursors are ribosomal proteins whose fusion to ubiquitin facilitates ribosome biogenesis

    NASA Astrophysics Data System (ADS)

    Finley, Daniel; Bartel, Bonnie; Varshavsky, Alexander

    1989-03-01

    Three of the four yeast ubiquitin genes encode hybrid proteins which are cleaved to yield ubiquitin and previously unidentified ribosomal proteins. The transient association between ubiquitin and these proteins promotes their incorporation into nascent ribosomes and is required for efficient ribosome biogenesis. These results suggest a novel 'chaperone' function for ubiquitin, in which its covalent association with other proteins promotes the formation of specific cellular structures.

  10. Marrow failure: a window into ribosome biology.

    PubMed

    Ruggero, Davide; Shimamura, Akiko

    2014-10-30

    Diamond-Blackfan anemia, Shwachman-Diamond syndrome, and dyskeratosis congenita are inherited syndromes characterized by marrow failure, congenital anomalies, and cancer predisposition. Genetic and molecular studies have uncovered distinct abnormalities in ribosome biogenesis underlying each of these 3 disorders. How defects in ribosomes, the essential organelles required for protein biosynthesis in all cells, cause tissue-specific abnormalities in human disease remains a question of fundamental scientific and medical importance. Here we review the overlapping and distinct clinical features of these 3 syndromes and discuss current knowledge regarding the ribosomal pathways disrupted in each of these disorders. We also explore the increasing complexity of ribosome biology and how this informs our understanding of developmental biology and human disease. PMID:25237201

  11. Marrow failure: a window into ribosome biology

    PubMed Central

    Ruggero, Davide

    2014-01-01

    Diamond-Blackfan anemia, Shwachman-Diamond syndrome, and dyskeratosis congenita are inherited syndromes characterized by marrow failure, congenital anomalies, and cancer predisposition. Genetic and molecular studies have uncovered distinct abnormalities in ribosome biogenesis underlying each of these 3 disorders. How defects in ribosomes, the essential organelles required for protein biosynthesis in all cells, cause tissue-specific abnormalities in human disease remains a question of fundamental scientific and medical importance. Here we review the overlapping and distinct clinical features of these 3 syndromes and discuss current knowledge regarding the ribosomal pathways disrupted in each of these disorders. We also explore the increasing complexity of ribosome biology and how this informs our understanding of developmental biology and human disease. PMID:25237201

  12. The immunological properties of Brucella ribosomal preparations.

    PubMed

    Corbel, M J

    1976-01-01

    Ribosomes were isolated from Brucella abortus strains 19 and 45/20 by disruption of the cells followed by differential ultracentrifugation. The ribosome preparations contained 2-3 components reacting in immunodiffusion tests but were free of detectable lipopolysaccharide-protein agglutinogen. They crossreacted with antisera to Br. abortus, Br. melitensis, Br. suis and Br. ovis and elicited intradermal delayed hypersensitivity reactions in animals infected with Br. abortus, Br. melitensis or Br. suis. The ribosomes were antigenic in rabbits, guinea pigs and mice. Those from Br. abortus S19 induced agglutinins reaction with smooth brucella strains whereas those from Br. abortus 45/20 induced agglutinins reacting with rough brucella strains. Cattle vaccinated with S19 or 45/20 vaccines or infected with Br. abortus developed pricipitins to ribosomal components at an early stage in the immune response. PMID:816681

  13. Illuminating Parasite Protein Production by Ribosome Profiling.

    PubMed

    Parsons, Marilyn; Myler, Peter J

    2016-06-01

    While technologies for global enumeration of transcript abundance are well-developed, those that assess protein abundance require tailoring to penetrate to low-abundance proteins. Ribosome profiling circumvents this challenge by measuring global protein production via sequencing small mRNA fragments protected by the assembled ribosome. This powerful approach is now being applied to protozoan parasites including trypanosomes and Plasmodium. It has been used to identify new protein-coding sequences (CDSs) and clarify the boundaries of previously annotated CDSs in Trypanosoma brucei. Ribosome profiling has demonstrated that translation efficiencies vary widely between genes and, for trypanosomes at least, for the same gene across stages. The ribosomal proteins are themselves subjected to translational control, suggesting a means of reinforcing global translational regulation. PMID:27061497

  14. Reproduction, symbiosis, and the eukaryotic cell.

    PubMed

    Godfrey-Smith, Peter

    2015-08-18

    This paper develops a conceptual framework for addressing questions about reproduction, individuality, and the units of selection in symbiotic associations, with special attention to the origin of the eukaryotic cell. Three kinds of reproduction are distinguished, and a possible evolutionary sequence giving rise to a mitochondrion-containing eukaryotic cell from an endosymbiotic partnership is analyzed as a series of transitions between each of the three forms of reproduction. The sequence of changes seen in this "egalitarian" evolutionary transition is compared with those that apply in "fraternal" transitions, such as the evolution of multicellularity in animals. PMID:26286983

  15. Uniquely designed nuclear structures of lower eukaryotes.

    PubMed

    Iwamoto, Masaaki; Hiraoka, Yasushi; Haraguchi, Tokuko

    2016-06-01

    The nuclear structures of lower eukaryotes, specifically protists, often vary from those of yeasts and metazoans. Several studies have demonstrated the unique and fascinating features of these nuclear structures, such as a histone-independent condensed chromatin in dinoflagellates and two structurally distinct nuclear pore complexes in ciliates. Despite their unique molecular/structural features, functions required for formation of their cognate molecules/structures are highly conserved. This provides important information about the structure-function relationship of the nuclear structures. In this review, we highlight characteristic nuclear structures found in lower eukaryotes, and discuss their attractiveness as potential biological systems for studying nuclear structures. PMID:26963276

  16. Recombinant vector and eukaryotic host transformed thereby

    SciTech Connect

    Sugden, W.M.

    1987-08-11

    A recombinant plasmid is described comprising: a segment from a first plasmid which is not a lymphotrophic herpes virus segment and which facilitates the replication of the recombinant plasmid in a prokaryotic host; a segment from a lymphotrophic herpes virus which is linked to the first plasmid segment such that is a capable of assisting in maintaining the recombinant plasmid as a plasmid if the recombinant plasmid is inserted into a eukaryotic host that has been transformed by the lymphotrophic herpes virus; and a foreign eukaryotic gene component linked as part of the recombinant plasmid.

  17. Ribosome Inactivating Proteins from Rosaceae.

    PubMed

    Shang, Chenjing; Rougé, Pierre; Van Damme, Els J M

    2016-01-01

    Ribosome-inactivating proteins (RIPs) are widespread among higher plants of different taxonomic orders. In this study, we report on the RIP sequences found in the genome/transcriptome of several important Rosaceae species, including many economically important edible fruits such as apple, pear, peach, apricot, and strawberry. All RIP domains from Rosaceae share high sequence similarity with conserved residues in the catalytic site and the carbohydrate binding sites. The genomes of Malus domestica and Pyrus communis contain both type 1 and type 2 RIP sequences, whereas for Prunus mume, Prunus persica, Pyrus bretschneideri, and Pyrus communis a complex set of type 1 RIP sequences was retrieved. Heterologous expression and purification of the type 1 as well as the type 2 RIP from apple allowed to characterize the biological activity of the proteins. Both RIPs from Malus domestica can inhibit protein synthesis. Furthermore, molecular modelling suggests that RIPs from Rosaceae possess three-dimensional structures that are highly similar to the model proteins and can bind to RIP substrates. Screening of the recombinant type 2 RIP from apple on a glycan array revealed that this type 2 RIP interacts with terminal sialic acid residues. Our data suggest that the RIPs from Rosaceae are biologically active proteins. PMID:27556443

  18. Frozen spin targets in ribosomal structure research.

    PubMed

    Stuhrmann, H B

    1991-01-01

    Polarized neutron scattering strongly depends on nuclear spin polarisation, particularly on proton spin polarisation. A single proton in a deuterated environment then is as efficient as 10 electrons in X-ray anomalous diffraction. Neutron scattering from the nuclear spin label is controlled by the polarisation of neutron spins and nuclear spins. Pure deuteron spin labels and proton spin labels are created by NMR saturation. We report on results obtained from the large subunit of E. coli ribosomes which have been obtained at the research reactor of GKSS using the polarized target facility developed by CERN. The nuclear spins were oriented with respect to an external field by dynamic nuclear polarisation. Proton spin polarisations of more than 80% were obtained in ribosomes at temperatures below 0.5 K. At T = 130 mK the relaxation time of the polarized target is one month (frozen spin target). Polarized small-angle neutron scattering of the in situ structure of rRNA and the total ribosomal protein (TP) has been determined from the frozen spin targets of the large ribosomal subunit, which has been deuterated in the TP and rRNA respectively. The results agree with those from neutron scattering in H2O/D2O mixtures obtained at room temperature. This is a necessary prerequisite for the planned determination of the in situ structure of individual ribosomal proteins and especially of that of ribosome bound mRNA and tRNAs. PMID:1720669

  19. Initiation factor 2 crystal structure reveals a different domain organization from eukaryotic initiation factor 5B and mechanism among translational GTPases.

    PubMed

    Eiler, Daniel; Lin, Jinzhong; Simonetti, Angelita; Klaholz, Bruno P; Steitz, Thomas A

    2013-09-24

    The initiation of protein synthesis uses initiation factor 2 (IF2) in prokaryotes and a related protein named eukaryotic initiation factor 5B (eIF5B) in eukaryotes. IF2 is a GTPase that positions the initiator tRNA on the 30S ribosomal initiation complex and stimulates its assembly to the 50S ribosomal subunit to make the 70S ribosome. The 3.1-Å resolution X-ray crystal structures of the full-length Thermus thermophilus apo IF2 and its complex with GDP presented here exhibit two different conformations (all of its domains except C2 domain are visible). Unlike all other translational GTPases, IF2 does not have an effecter domain that stably contacts the switch II region of the GTPase domain. The domain organization of IF2 is inconsistent with the "articulated lever" mechanism of communication between the GTPase and initiator tRNA binding domains that has been proposed for eIF5B. Previous cryo-electron microscopy reconstructions, NMR experiments, and this structure show that IF2 transitions from being flexible in solution to an extended conformation when interacting with ribosomal complexes. PMID:24029018

  20. RING FISSION OF ANTHRACENE BY A EUKARYOTE

    EPA Science Inventory

    Ligninolytic fungi are unique among eukaryotes in their ability to degrade polycyclic aromatic hydrocarbons (PAHs), but the mechanism for this process is unknown. lthough certain PAHs are oxidized in vitro by the fungal lignin peroxidases (LiPs) that catalyze ligninolysis, it has...

  1. Endonucleolytic RNA cleavage by a eukaryotic exosome.

    PubMed

    Lebreton, Alice; Tomecki, Rafal; Dziembowski, Andrzej; Séraphin, Bertrand

    2008-12-18

    The exosome is a major eukaryotic nuclease located in both the nucleus and the cytoplasm that contributes to the processing, quality control and/or turnover of a large number of cellular RNAs. This large macromolecular assembly has been described as a 3'-->5' exonuclease and shown to contain a nine-subunit ring structure evolutionarily related to archaeal exosome-like complexes and bacterial polynucleotide phosphorylases. Recent results have shown that, unlike its prokaryotic counterparts, the yeast and human ring structures are catalytically inactive. In contrast, the exonucleolytic activity of the yeast exosome core was shown to be mediated by the RNB domain of the eukaryote-specific Dis3 subunit. Here we show, using in vitro assays, that yeast Dis3 has an additional endoribonuclease activity mediated by the PIN domain located at the amino terminus of this multidomain protein. Simultaneous inactivation of the endonucleolytic and exonucleolytic activities of the exosome core generates a synthetic growth phenotype in vivo, supporting a physiological function for the PIN domain. This activity is responsible for the cleavage of some natural exosome substrates, independently of exonucleolytic degradation. In contrast with current models, our results show that eukaryotic exosome cores have both endonucleolytic and exonucleolytic activities, mediated by two distinct domains of the Dis3 subunit. The mode of action of eukaryotic exosome cores in RNA processing and degradation should be reconsidered, taking into account the cooperation between its multiple ribonucleolytic activities. PMID:19060886

  2. The origin of the eukaryotic cell

    NASA Technical Reports Server (NTRS)

    Hartman, H.

    1984-01-01

    The endosymbiotic hypothesis for the origin of the eukaryotic cell has been applied to the origin of the mitochondria and chloroplasts. However as has been pointed out by Mereschowsky in 1905, it should also be applied to the nucleus as well. If the nucleus, mitochondria and chloroplasts are endosymbionts, then it is likely that the organism that did the engulfing was not a DNA-based organism. In fact, it is useful to postulate that this organism was a primitive RNA-based organism. This hypothesis would explain the preponderance of RNA viruses found in eukaryotic cells. The centriole and basal body do not have a double membrane or DNA. Like all MTOCs (microtubule organising centres), they have a structural or morphic RNA implicated in their formation. This would argue for their origin in the early RNA-based organism rather than in an endosymbiotic event involving bacteria. Finally, the eukaryotic cell uses RNA in ways quite unlike bacteria, thus pointing to a greater emphasis of RNA in both control and structure in the cell. The origin of the eukaryotic cell may tell us why it rather than its prokaryotic relative evolved into the metazoans who are reading this paper.

  3. Eukaryotic transposable elements as mutagenic agents

    SciTech Connect

    Lambert, M.E. . Banbury Center); McDonald, J.F. ); Weinstein, I.B. )

    1988-01-01

    This book contains the proceedings on eukaryotic transposable elements as mutagenic agents. Topics covered include: overview of prokaryotic transposable elements, mutational effects of transposable element insertions, inducers/regulators of transposable element expression and transposition, genomic stress and environmental effects, and inducers/regulators of retroviral element expression.

  4. Eukaryote DIRS1-like retrotransposons: an overview

    PubMed Central

    2011-01-01

    Background DIRS1-like elements compose one superfamily of tyrosine recombinase-encoding retrotransposons. They have been previously reported in only a few diverse eukaryote species, describing a patchy distribution, and little is known about their origin and dynamics. Recently, we have shown that these retrotransposons are common among decapods, which calls into question the distribution of DIRS1-like retrotransposons among eukaryotes. Results To determine the distribution of DIRS1-like retrotransposons, we developed a new computational tool, ReDoSt, which allows us to identify well-conserved DIRS1-like elements. By screening 274 completely sequenced genomes, we identified more than 4000 DIRS1-like copies distributed among 30 diverse species which can be clustered into roughly 300 families. While the diversity in most species appears restricted to a low copy number, a few bursts of transposition are strongly suggested in certain species, such as Danio rerio and Saccoglossus kowalevskii. Conclusion In this study, we report 14 new species and 8 new higher taxa that were not previously known to harbor DIRS1-like retrotransposons. Now reported in 61 species, these elements appear widely distributed among eukaryotes, even if they remain undetected in streptophytes and mammals. Especially in unikonts, a broad range of taxa from Cnidaria to Sauropsida harbors such elements. Both the distribution and the similarities between the DIRS1-like element phylogeny and conventional phylogenies of the host species suggest that DIRS1-like retrotransposons emerged early during the radiation of eukaryotes. PMID:22185659

  5. Eukaryotes in Arctic and Antarctic cyanobacterial mats.

    PubMed

    Jungblut, Anne D; Vincent, Warwick F; Lovejoy, Connie

    2012-11-01

    Cyanobacterial mats are commonly found in freshwater ecosystems throughout the polar regions. Most mats are multilayered three-dimensional structures with the filamentous cyanobacteria embedded in a gel-like matrix. Although early descriptions mentioned the presence of larger organisms including metazoans living in the mats, there have been few studies specifically focused on the microbial eukaryotes, which are often small cells with few morphological features suitable for identification by microscopy. Here, we applied 18S rRNA gene clone library analysis to identify eukaryotes in cyanobacterial mat communities from both the Antarctic and the extreme High Arctic. We identified 39 ribotypes at the level of 99% sequence similarity. These consisted of taxa within algal and other protist groups including Chlorophyceae, Prasinophyceae, Ulvophyceae, Trebouxiophyceae, Bacillariophyceae, Chrysophyceae, Ciliophora, and Cercozoa. Fungi were also recovered, as were 21 metazoan ribotypes. The eukaryotic taxa appeared habitat-specific with little overlap between lake, pond, and ice shelf communities. Some ribotypes were common to both Arctic and Antarctic mats, suggesting global dispersal of these taxa and similarity in the environmental filters acting on protist communities. Many of these eukaryotic taxa likely benefit from protected, nutrient-rich microhabitats within the cyanobacterial mat environment. PMID:22630054

  6. Rapid quantification and taxonomic classification of environmentalDNA from both prokaryotic and eukaryotic origins using a microarray

    SciTech Connect

    DeSantis, Todd Z.; Stone, Carol E.; Murray, Sonya R.; Moberg,Jordan P.; Andersen, Gary L.

    2005-02-22

    A microarray has been designed using 62,358 probes matched to both prokaryotic and eukaryotic small-subunit ribosomal RNA genes. The array categorized environmental DNA to specific phylogenetic clusters in under 9 h. To a background of DNA generated from natural outdoor aerosols, known quantities of rRNA gene copies from distinct organisms were added producing corresponding hybridization intensity scores that correlated well with their concentrations (r=0.917). Reproducible differences in microbial community composition were observed by altering the genomic DNA extraction method. Notably, gentle extractions produced peak intensities for Mycoplasmatales and Burkholderiales, whereas a vigorous disruption produced peak intensities for Vibrionales,Clostridiales, and Bacillales.

  7. IRES-mediated translation of membrane proteins and glycoproteins in eukaryotic cell-free systems.

    PubMed

    Brödel, Andreas K; Sonnabend, Andrei; Roberts, Lisa O; Stech, Marlitt; Wüstenhagen, Doreen A; Kubick, Stefan

    2013-01-01

    Internal ribosome entry site (IRES) elements found in the 5' untranslated region of mRNAs enable translation initiation in a cap-independent manner, thereby representing an alternative to cap-dependent translation in cell-free protein expression systems. However, IRES function is largely species-dependent so their utility in cell-free systems from different species is rather limited. A promising approach to overcome these limitations would be the use of IRESs that are able to recruit components of the translation initiation apparatus from diverse origins. Here, we present a solution to this technical problem and describe the ability of a number of viral IRESs to direct efficient protein expression in different eukaryotic cell-free expression systems. The IRES from the intergenic region (IGR) of the Cricket paralysis virus (CrPV) genome was shown to function efficiently in four different cell-free systems based on lysates derived from cultured Sf21, CHO and K562 cells as well as wheat germ. Our results suggest that the CrPV IGR IRES-based expression vector is universally applicable for a broad range of eukaryotic cell lysates. Sf21, CHO and K562 cell-free expression systems are particularly promising platforms for the production of glycoproteins and membrane proteins since they contain endogenous microsomes that facilitate the incorporation of membrane-spanning proteins and the formation of post-translational modifications. We demonstrate the use of the CrPV IGR IRES-based expression vector for the enhanced synthesis of various target proteins including the glycoprotein erythropoietin and the membrane proteins heparin-binding EGF-like growth factor receptor as well as epidermal growth factor receptor in the above mentioned eukaryotic cell-free systems. CrPV IGR IRES-mediated translation will facilitate the development of novel eukaryotic cell-free expression platforms as well as the high-yield synthesis of desired proteins in already established systems. PMID

  8. Solution Structure of Ribosomal Protein L40E, a Unique C4 Zinc Finger Protein Encoded by Archaeon Sulfolobus Solfataricus

    SciTech Connect

    Wu, Bin; Lukin, Jonathan A.; Yee, Adelinda; Lemak, Alexander; Semesi, Anthony; Ramelot, Theresa A.; Kennedy, Michael A.; Arrowsmith, Cheryl H.

    2008-01-31

    The ribosomal protein L40E from archaeon Sulfolobus solfataricus is a component of the 50S ribosomal subunit. L40E is a 56-residue, highly basic protein that contains a C4 zinc finger motif, CRKC_X10_CRRC. Homologs are found in both archaea and eukaryotes but are not present in bacteria. Eukaryotic genomes encode L40E as a ubiquitin-fusion protein. L40E was absent from the crystal structure of euryarchaeota 50S ribosomal subunit. Here we report the three-dimensional solution structure of L40E by NMR spectroscopy. The structure of L40E is a three-stranded b-sheet with a simple b2b1b3 topology. There are two unique characteristics revealed by the structure. First, a large and ordered b2–b3 loop twists to pack across the one side of the protein. L40E contains a buried polar cluster comprising Lys19, Lys20, Cys22, Asn29, and Cys36. Second, the surface of L40E is almost entirely positively charged. Ten conserved basic residues are positioned on the two sides of the surface. It is likely that binding of zinc is essential in stabilizing the tertiary structure of L40E to act as a scaffold to create a broad positively charged surface for RNA and/or protein recognition. A portion of this work was performed in the Environmental Molecular Sciences Facility, a DOE national scientific user facility.

  9. DNA homologies of ribosomal RNA genes of Neurospora species

    SciTech Connect

    Mukhopadhyay, D.K.; Mimiko, R.; Dutta, S.K.

    1980-01-01

    Ribosomal RNA genes (rDNAs) of Neurospora crassa contain DNA sequences which code for 17S, 5.8S, and 26S rRNAs, in addition to internal and external spacers. As has been reported for many eukaryotes, the DNA sequences which code for 17S, 5.8S, and 26S rRNAs in Neurospora species are probably conserved while the internal and external spacer regions are probably variable sequences. Extensive electron microscopic studies of 45S precursor rRNA of several cold and warm blooded animals confirm that spacer regions vary extensively from species to species. It was desirable to know whether such differences in rDNA sequences exist between Neurospora species. Any such difference should be detectable using standard procedures for DNA homology studies rDNA sequences were isolated from N. crassa mycelial cells using the procedure described previously. The purified rDNA was /sup 3/H-labeled (by nick translation) and reassociated with total DNA isolated from the heterothallic species N. crassa and from three homothalliospecies: N. dodgei, N. lineolata, and N. africana. In addition, /sup 32/P-labeled total DNA of N. crassa was reannealed with unlabeled bulk DNA from N. crassa, N. dodgei, and N. lineolata.

  10. RNA structure-based ribosome recruitment: lessons from the Dicistroviridae intergenic region IRESes.

    PubMed

    Pfingsten, Jennifer S; Kieft, Jeffrey S

    2008-07-01

    In eukaryotes, the canonical process of initiating protein synthesis on an mRNA depends on many large protein factors and the modified nucleotide cap on the 5' end of the mRNA. However, certain RNA sequences can bypass the need for these proteins and cap, using an RNA structure-based mechanism called internal initiation of translation. These RNAs are called internal ribosome entry sites (IRESes), and the cap-independent initiation pathway they support is critical for successful infection by many viruses of medical and economic importance. In this review, we briefly describe and compare mechanistic and structural groups of viral IRES RNAs, focusing on those IRESes that are capable of direct ribosome recruitment using specific RNA structures. We then discuss in greater detail some recent advances in our understanding of the intergenic region IRESes of the Dicistroviridae, which use the most streamlined ribosome-recruitment mechanism yet discovered. By combining these findings with knowledge of canonical translation and the behavior of other IRESes, mechanistic models of this RNA structure-based process are emerging. PMID:18515544

  11. Crystal structure of prokaryotic ribosomal protein L9: a bi-lobed RNA-binding protein.

    PubMed Central

    Hoffman, D W; Davies, C; Gerchman, S E; Kycia, J H; Porter, S J; White, S W; Ramakrishnan, V

    1994-01-01

    The crystal structure of protein L9 from the Bacillus stearothermophilus ribosome has been determined at 2.8 A resolution using X-ray diffraction methods. This primary RNA-binding protein has a highly elongated and unusual structure consisting of two separated domains joined by a long exposed alpha-helix. Conserved, positively charged and aromatic amino acids on the surfaces of both domains probably represent the sites of specific interactions with 23S rRNA. Comparisons with other prokaryotic L9 sequences show that while the length of the connecting alpha-helix is invariant, the sequence within the exposed central region is not conserved. This suggests that the alpha-helix has an architectural role and serves to fix the relative separation and orientation of the N- and C-terminal domains within the ribosome. The N-terminal domain has structural homology to the smaller ribosomal proteins L7/L12 and L30, and the eukaryotic RNA recognition motif (RRM). Images PMID:8306963

  12. Ribosome profiling reveals pervasive and regulated stop codon readthrough in Drosophila melanogaster

    PubMed Central

    Dunn, Joshua G; Foo, Catherine K; Belletier, Nicolette G; Gavis, Elizabeth R; Weissman, Jonathan S

    2013-01-01

    Ribosomes can read through stop codons in a regulated manner, elongating rather than terminating the nascent peptide. Stop codon readthrough is essential to diverse viruses, and phylogenetically predicted to occur in a few hundred genes in Drosophila melanogaster, but the importance of regulated readthrough in eukaryotes remains largely unexplored. Here, we present a ribosome profiling assay (deep sequencing of ribosome-protected mRNA fragments) for Drosophila melanogaster, and provide the first genome-wide experimental analysis of readthrough. Readthrough is far more pervasive than expected: the vast majority of readthrough events evolved within D. melanogaster and were not predicted phylogenetically. The resulting C-terminal protein extensions show evidence of selection, contain functional subcellular localization signals, and their readthrough is regulated, arguing for their importance. We further demonstrate that readthrough occurs in yeast and humans. Readthrough thus provides general mechanisms both to regulate gene expression and function, and to add plasticity to the proteome during evolution. DOI: http://dx.doi.org/10.7554/eLife.01179.001 PMID:24302569

  13. Ribosome binding induces repositioning of the signal recognition particle receptor on the translocon

    PubMed Central

    Kuhn, Patrick; Draycheva, Albena; Vogt, Andreas; Petriman, Narcis-Adrian; Sturm, Lukas; Drepper, Friedel; Warscheid, Bettina; Wintermeyer, Wolfgang

    2015-01-01

    Cotranslational protein targeting delivers proteins to the bacterial cytoplasmic membrane or to the eukaryotic endoplasmic reticulum membrane. The signal recognition particle (SRP) binds to signal sequences emerging from the ribosomal tunnel and targets the ribosome-nascent-chain complex (RNC) to the SRP receptor, termed FtsY in bacteria. FtsY interacts with the fifth cytosolic loop of SecY in the SecYEG translocon, but the functional role of the interaction is unclear. By using photo-cross-linking and fluorescence resonance energy transfer measurements, we show that FtsY–SecY complex formation is guanosine triphosphate independent but requires a phospholipid environment. Binding of an SRP–RNC complex exposing a hydrophobic transmembrane segment induces a rearrangement of the SecY–FtsY complex, which allows the subsequent contact between SecY and ribosomal protein uL23. These results suggest that direct RNC transfer to the translocon is guided by the interaction between SRP and translocon-bound FtsY in a quaternary targeting complex. PMID:26459600

  14. Crystal structure of bacillus subtilis YdaF protein : a putative ribosomal N-acetyltransferase.

    SciTech Connect

    Brunzelle, J. S.; Wu, R.; Korolev, S. V.; Collart, F. R.; Joachimiak, A.; Anderson, W. F.; Biosciences Division; Northwestern Univ.; Saint Louis Univ. School of Medicine

    2004-12-01

    Comparative sequence analysis suggests that the ydaF gene encodes a protein (YdaF) that functions as an N-acetyltransferase, more specifically, a ribosomal N-acetyltransferase. Sequence analysis using basic local alignment search tool (BLAST) suggests that YdaF belongs to a large family of proteins (199 proteins found in 88 unique species of bacteria, archaea, and eukaryotes). YdaF also belongs to the COG1670, which includes the Escherichia coli RimL protein that is known to acetylate ribosomal protein L12. N-acetylation (NAT) has been found in all kingdoms. NAT enzymes catalyze the transfer of an acetyl group from acetyl-CoA (AcCoA) to a primary amino group. For example, NATs can acetylate the N-terminal {alpha}-amino group, the {epsilon}-amino group of lysine residues, aminoglycoside antibiotics, spermine/speridine, or arylalkylamines such as serotonin. The crystal structure of the alleged ribosomal NAT protein, YdaF, from Bacillus subtilis presented here was determined as a part of the Midwest Center for Structural Genomics. The structure maintains the conserved tertiary structure of other known NATs and a high sequence similarity in the presumed AcCoA binding pocket in spite of a very low overall level of sequence identity to other NATs of known structure.

  15. Circular non-coding RNA ANRIL modulates ribosomal RNA maturation and atherosclerosis in humans.

    PubMed

    Holdt, Lesca M; Stahringer, Anika; Sass, Kristina; Pichler, Garwin; Kulak, Nils A; Wilfert, Wolfgang; Kohlmaier, Alexander; Herbst, Andreas; Northoff, Bernd H; Nicolaou, Alexandros; Gäbel, Gabor; Beutner, Frank; Scholz, Markus; Thiery, Joachim; Musunuru, Kiran; Krohn, Knut; Mann, Matthias; Teupser, Daniel

    2016-01-01

    Circular RNAs (circRNAs) are broadly expressed in eukaryotic cells, but their molecular mechanism in human disease remains obscure. Here we show that circular antisense non-coding RNA in the INK4 locus (circANRIL), which is transcribed at a locus of atherosclerotic cardiovascular disease on chromosome 9p21, confers atheroprotection by controlling ribosomal RNA (rRNA) maturation and modulating pathways of atherogenesis. CircANRIL binds to pescadillo homologue 1 (PES1), an essential 60S-preribosomal assembly factor, thereby impairing exonuclease-mediated pre-rRNA processing and ribosome biogenesis in vascular smooth muscle cells and macrophages. As a consequence, circANRIL induces nucleolar stress and p53 activation, resulting in the induction of apoptosis and inhibition of proliferation, which are key cell functions in atherosclerosis. Collectively, these findings identify circANRIL as a prototype of a circRNA regulating ribosome biogenesis and conferring atheroprotection, thereby showing that circularization of long non-coding RNAs may alter RNA function and protect from human disease. PMID:27539542

  16. Substitution rate calibration of small subunit ribosomal RNA identifies chlorarachniophyte endosymbionts as remnants of green algae.

    PubMed Central

    Van de Peer, Y; Rensing, S A; Maier, U G; De Wachter, R

    1996-01-01

    Chlorarachniophytes are amoeboid algae with chlorophyll a and b containing plastids that are surrounded by four membranes instead of two as in plants and green algae. These extra membranes form important support for the hypothesis that chlorarachniophytes have acquired their plastids by the ingestion of another eukaryotic plastid-containing alga. Chlorarachniophytes also contain a small nucleus-like structure called the nucleomorph situated between the two inner and the two outer membranes surrounding the plastid. This nucleomorph is a remnant of the endosymbiont's nucleus and encodes, among other molecules, small subunit ribosomal RNA. Previous phylogenetic analyses on the basis of this molecule provided unexpected and contradictory evidence for the origin of the chlorarachniophyte endosymbiont. We developed a new method for measuring the substitution rates of the individual nucleotides of small subunit ribosomal RNA. From the resulting substitution rate distribution, we derived an equation that gives a more realistic relationship between sequence dissimilarity and evolutionary distance than equations previously available. Phylogenetic trees constructed on the basis of evolutionary distances computed by this new method clearly situate the chlorarachniophyte nucleomorphs among the green algae. Moreover, this relationship is confirmed by transversion analysis of the Chlorarachnion plastid small subunit ribosomal RNA. PMID:8755544

  17. Circular non-coding RNA ANRIL modulates ribosomal RNA maturation and atherosclerosis in humans

    PubMed Central

    Holdt, Lesca M.; Stahringer, Anika; Sass, Kristina; Pichler, Garwin; Kulak, Nils A.; Wilfert, Wolfgang; Kohlmaier, Alexander; Herbst, Andreas; Northoff, Bernd H.; Nicolaou, Alexandros; Gäbel, Gabor; Beutner, Frank; Scholz, Markus; Thiery, Joachim; Musunuru, Kiran; Krohn, Knut; Mann, Matthias; Teupser, Daniel

    2016-01-01

    Circular RNAs (circRNAs) are broadly expressed in eukaryotic cells, but their molecular mechanism in human disease remains obscure. Here we show that circular antisense non-coding RNA in the INK4 locus (circANRIL), which is transcribed at a locus of atherosclerotic cardiovascular disease on chromosome 9p21, confers atheroprotection by controlling ribosomal RNA (rRNA) maturation and modulating pathways of atherogenesis. CircANRIL binds to pescadillo homologue 1 (PES1), an essential 60S-preribosomal assembly factor, thereby impairing exonuclease-mediated pre-rRNA processing and ribosome biogenesis in vascular smooth muscle cells and macrophages. As a consequence, circANRIL induces nucleolar stress and p53 activation, resulting in the induction of apoptosis and inhibition of proliferation, which are key cell functions in atherosclerosis. Collectively, these findings identify circANRIL as a prototype of a circRNA regulating ribosome biogenesis and conferring atheroprotection, thereby showing that circularization of long non-coding RNAs may alter RNA function and protect from human disease. PMID:27539542

  18. The structure of ribosome-lankacidin complex reveals ribosomal sites for synergistic antibiotics

    SciTech Connect

    Auerbach, Tamar; Mermershtain, Inbal; Davidovich, Chen; Bashan, Anat; Belousoff, Matthew; Wekselman, Itai; Zimmerman, Ella; Xiong, Liqun; Klepacki, Dorota; Arakawa, Kenji; Kinashi, Haruyasu; Mankin, Alexander S.; Yonath, Ada

    2010-04-26

    Crystallographic analysis revealed that the 17-member polyketide antibiotic lankacidin produced by Streptomyces rochei binds at the peptidyl transferase center of the eubacterial large ribosomal subunit. Biochemical and functional studies verified this finding and showed interference with peptide bond formation. Chemical probing indicated that the macrolide lankamycin, a second antibiotic produced by the same species, binds at a neighboring site, at the ribosome exit tunnel. These two antibiotics can bind to the ribosome simultaneously and display synergy in inhibiting bacterial growth. The binding site of lankacidin and lankamycin partially overlap with the binding site of another pair of synergistic antibiotics, the streptogramins. Thus, at least two pairs of structurally dissimilar compounds have been selected in the course of evolution to act synergistically by targeting neighboring sites in the ribosome. These results underscore the importance of the corresponding ribosomal sites for development of clinically relevant synergistic antibiotics and demonstrate the utility of structural analysis for providing new directions for drug discovery.

  19. The SBP2 protein central to selenoprotein synthesis contacts the human ribosome at expansion segment 7L of the 28S rRNA.

    PubMed

    Kossinova, Olga; Malygin, Alexey; Krol, Alain; Karpova, Galina

    2014-07-01

    SBP2 is a pivotal protein component in selenoprotein synthesis. It binds the SECIS stem-loop in the 3' UTR of selenoprotein mRNA and interacts with both the specialized translation elongation factor and the ribosome at the 60S subunit. In this work, our goal was to identify the binding partners of SBP2 on the ribosome. Cross-linking experiments with bifunctional reagents demonstrated that the SBP2-binding site on the human ribosome is mainly formed by the 28S rRNA. Direct hydroxyl radical probing of the entire 28S rRNA revealed that SBP2 bound to 80S ribosomes or 60S subunits protects helix ES7L-E in expansion segment 7 of the 28S rRNA. Diepoxybutane cross-linking confirmed the interaction of SBP2 with helix ES7L-E. Additionally, binding of SBP2 to the ribosome led to increased reactivity toward chemical probes of a few bases in ES7L-E and in the universally conserved helix H89, indicative of conformational changes in the 28S rRNA in response to SBP2 binding. This study revealed for the first time that SBP2 makes direct contacts with a discrete region of the human 28S rRNA. PMID:24850884

  20. High-resolution structure of the Escherichia coli ribosome

    PubMed Central

    Noeske, Jonas; Wasserman, Michael R.; Terry, Daniel S.; Altman, Roger B.; Blanchard, Scott C.; Cate, Jamie H. D.

    2015-01-01

    Protein synthesis by the ribosome is highly dependent on the ionic conditions in the cellular environment, but the roles of ribosome solvation remain poorly understood. Moreover, the function of modifications to ribosomal RNA and ribosomal proteins are unclear. Here we present the structure of the Escherichia coli 70S ribosome to 2.4 Å resolution. The structure reveals details of the ribosomal subunit interface that are conserved in all domains of life, and suggest how solvation contributes to ribosome integrity and function. The structure also suggests how the conformation of ribosomal protein uS12 likely impacts its contribution to messenger RNA decoding. This structure helps to explain the phylogenetic conservation of key elements of the ribosome, including posttranscriptional and posttranslational modifications and should serve as a basis for future antibiotic development. PMID:25775265

  1. Mitochondrial ribosomal proteins (MRPs) of yeast.

    PubMed Central

    Graack, H R; Wittmann-Liebold, B

    1998-01-01

    Mitochondrial ribosomal proteins (MRPs) are the counterparts in that organelle of the cytoplasmic ribosomal proteins in the host. Although the MRPs fulfil similar functions in protein biosynthesis, they are distinct in number, features and primary structures from the latter. Most progress in the eludication of the properties of individual MRPs, and in the characterization of the corresponding genes, has been made in baker's yeast (Saccharomyces cerevisiae). To date, 50 different MRPs have been determined, although biochemical data and mutational analysis propose a total number which is substantially higher. Surprisingly, only a minority of the MRPs that have been characterized show significant sequence similarities to known ribosomal proteins from other sources, thus limiting the deduction of their functions by simple comparison of amino acid sequences. Further, individual MRPs have been characterized functionally by mutational studies, and the regulation of expression of MRP genes has been described. The interaction of the mitochondrial ribosomes with transcription factors specific for individual mitochondrial mRNAs, and the communication between mitochondria and the nucleus for the co-ordinated expression of ribosomal constituents, are other aspects of current MRP research. Although the mitochondrial translational system is still far from being described completely, the yeast MRP system serves as a model for other organisms, including that of humans. PMID:9445368

  2. Large-scale isolation of mitochondrial ribosomes from mammalian tissues.

    PubMed

    Spremulli, Linda L

    2007-01-01

    The preparation of mammalian mitochondrial ribosomes in sufficient quantities for biochemical studies is best done beginning with whole tissue rather than from cells in culture. This issue arises because of the low abundance of these ribosomes in cells, making their isolation a challenge. Crude mitochondrial preparations are made by differential centrifugation and are treated with digitonin to remove the outer membrane. This treatment also effectively removes most contamination by cytoplasmic ribosomes. Purification of mammalian mitochondrial ribosomes requires treatment with detergents to release the ribosomes from their association with the membrane. Sucrose density gradient centrifugation is used to separate the ribosomes from other large oligomeric complexes from this organelle. PMID:18314732

  3. Origin and evolution of organisms as deduced from 5S ribosomal RNA sequences.

    PubMed

    Hori, H; Osawa, S

    1987-09-01

    A phylogenetic tree of most of the major groups of organisms has been constructed from the 352 5S ribosomal RNA sequences now available. The tree suggests that there are several major groups of eubacteria that diverged during the early stages of their evolution. Metabacteria (= archaebacteria) and eukaryotes separated after the emergence of eubacteria. Among eukaryotes, red algae emerged first; and, later, thraustochytrids (a Proctista group), ascomycetes (yeast), green plants (green algae and land plants), "yellow algae" (brown algae, diatoms, and chrysophyte algae), basidiomycetes (mushrooms and rusts), slime- and water molds, various protozoans, and animals emerged, approximately in that order. Three major types of photosynthetic eukaryotes--i.e., red algae (= Chlorophyll a group), green plants (Chl. a + b group) and yellow algae (Chl. a + c)--are remotely related to one another. Other photosynthetic unicellular protozoans--such as Cyanophora (Chl. a), Euglenophyta (Chl. a + b), Cryptophyta (Chl. a + c), and Dinophyta (Chl. a + c)--seem to have separated shortly after the emergence of the yellow algae. PMID:2452957

  4. Metabarcoding improves detection of eukaryotes from early biofouling communities: implications for pest monitoring and pathway management.

    PubMed

    Zaiko, Anastasija; Schimanski, Kate; Pochon, Xavier; Hopkins, Grant A; Goldstien, Sharyn; Floerl, Oliver; Wood, Susanna A

    2016-07-01

    In this experimental study the patterns in early marine biofouling communities and possible implications for surveillance and environmental management were explored using metabarcoding, viz. 18S ribosomal RNA gene barcoding in combination with high-throughput sequencing. The community structure of eukaryotic assemblages and the patterns of initial succession were assessed from settlement plates deployed in a busy port for one, five and 15 days. The metabarcoding results were verified with traditional morphological identification of taxa from selected experimental plates. Metabarcoding analysis identified > 400 taxa at a comparatively low taxonomic level and morphological analysis resulted in the detection of 25 taxa at varying levels of resolution. Despite the differences in resolution, data from both methods were consistent at high taxonomic levels and similar patterns in community shifts were observed. A high percentage of sequences belonging to genera known to contain non-indigenous species (NIS) were detected after exposure for only one day. PMID:27212415

  5. Hippuristanol - A potent steroid inhibitor of eukaryotic initiation factor 4A.

    PubMed

    Cencic, Regina; Pelletier, Jerry

    2016-01-01

    Protein synthesis and its regulatory signaling pathways play essential roles in the initiation and maintenance of the cancer phenotype. Insight obtained over the last 3 decades on the mechanisms regulating translation in normal and transformed cells have revealed that perturbed control in cancer cells may offer an Achilles' heel for the development of novel anti-neoplastic agents. Several small molecule inhibitors have been identified and characterized that target translation initiation - more specifically, the rate-limiting step where ribosomes are recruited to mRNA templates. Among these, hippuristanol, a polyhydroxysteroid from the gorgonian Isis hippuris has been found to inhibit translation initiation by blocking the activity of eukaryotic initiation factor (eIF) 4A, an essential RNA helicase involved in this process. Herein, we highlight the biological properties of this compound, its potential development as an anti-cancer agent, and its use to validate eIF4A as an anti-neoplastic target. PMID:27335721

  6. eSLDB: eukaryotic subcellular localization database.

    PubMed

    Pierleoni, Andea; Martelli, Pier Luigi; Fariselli, Piero; Casadio, Rita

    2007-01-01

    Eukaryotic Subcellular Localization DataBase collects the annotations of subcellular localization of eukaryotic proteomes. So far five proteomes have been processed and stored: Homo sapiens, Mus musculus, Caenorhabditis elegans, Saccharomyces cerevisiae and Arabidopsis thaliana. For each sequence, the database lists localization obtained adopting three different approaches: (i) experimentally determined (when available); (ii) homology-based (when possible); and (iii) predicted. The latter is computed with a suite of machine learning based methods, developed in house. All the data are available at our website and can be searched by sequence, by protein code and/or by protein description. Furthermore, a more complex search can be performed combining different search fields and keys. All the data contained in the database can be freely downloaded in flat file format. The database is available at http://gpcr.biocomp.unibo.it/esldb/. PMID:17108361

  7. The evolution of modern eukaryotic phytoplankton.

    PubMed

    Falkowski, Paul G; Katz, Miriam E; Knoll, Andrew H; Quigg, Antonietta; Raven, John A; Schofield, Oscar; Taylor, F J R

    2004-07-16

    The community structure and ecological function of contemporary marine ecosystems are critically dependent on eukaryotic phytoplankton. Although numerically inferior to cyanobacteria, these organisms are responsible for the majority of the flux of organic matter to higher trophic levels and the ocean interior. Photosynthetic eukaryotes evolved more than 1.5 billion years ago in the Proterozoic oceans. However, it was not until the Mesozoic Era (251 to 65 million years ago) that the three principal phytoplankton clades that would come to dominate the modern seas rose to ecological prominence. In contrast to their pioneering predecessors, the dinoflagellates, coccolithophores, and diatoms all contain plastids derived from an ancestral red alga by secondary symbiosis. Here we examine the geological, geochemical, and biological processes that contributed to the rise of these three, distantly related, phytoplankton groups. PMID:15256663

  8. Structural insights into eukaryotic aquaporin regulation.

    PubMed

    Törnroth-Horsefield, Susanna; Hedfalk, Kristina; Fischer, Gerhard; Lindkvist-Petersson, Karin; Neutze, Richard

    2010-06-18

    Aquaporin-mediated water transport across cellular membranes is an ancient, ubiquitous mechanism within cell biology. This family of integral membrane proteins includes both water selective pores (aquaporins) and transport facilitators of other small molecules such as glycerol and urea (aquaglyceroporins). Eukaryotic aquaporins are frequently regulated post-translationally by gating, whereby the rate of flux through the channel is controlled, or by trafficking, whereby aquaporins are shuttled from intracellular storage sites to the plasma membrane. A number of high-resolution X-ray structures of eukaryotic aquaporins have recently been reported and the new structural insights into gating and trafficking that emerged from these studies are described. Basic structural themes reoccur, illustrating how the problem of regulation in diverse biological contexts builds upon a limited set of possible solutions. PMID:20416297

  9. Towards New Antifolates Targeting Eukaryotic Opportunistic Infections

    SciTech Connect

    Liu, J.; Bolstad, D; Bolstad, E; Wright, D; Anderson, A

    2009-01-01

    Trimethoprim, an antifolate commonly prescribed in combination with sulfamethoxazole, potently inhibits several prokaryotic species of dihydrofolate reductase (DHFR). However, several eukaryotic pathogenic organisms are resistant to trimethoprim, preventing its effective use as a therapeutic for those infections. We have been building a program to reengineer trimethoprim to more potently and selectively inhibit eukaryotic species of DHFR as a viable strategy for new drug discovery targeting several opportunistic pathogens. We have developed a series of compounds that exhibit potent and selective inhibition of DHFR from the parasitic protozoa Cryptosporidium and Toxoplasma as well as the fungus Candida glabrata. A comparison of the structures of DHFR from the fungal species Candida glabrata and Pneumocystis suggests that the compounds may also potently inhibit Pneumocystis DHFR.

  10. The Iron Metallome in Eukaryotic Organisms

    PubMed Central

    Dlouhy, Adrienne C.; Outten, Caryn E.

    2013-01-01

    This chapter is focused on the iron metallome in eukaryotes at the cellular and subcellular level, including properties, utilization in metalloproteins, trafficking, storage, and regulation of these processes. Studies in the model eukaryote Saccharomyces cerevisiae and mammalian cells will be highlighted. The discussion of iron properties will center on the speciation and localization of intracellular iron as well as the cellular and molecular mechanisms for coping with both low iron bioavailability and iron toxicity. The section on iron metalloproteins will emphasize heme, iron-sulfur cluster, and non-heme iron centers, particularly their cellular roles and mechanisms of assembly. The section on iron uptake, trafficking, and storage will compare methods used by yeast and mammalian cells to import iron, how this iron is brought into various organelles, and types of iron storage proteins. Regulation of these processes will be compared between yeast and mammalian cells at the transcriptional, post-transcriptional, and post-translational levels. PMID:23595675

  11. Eukaryotic expression: developments for structural proteomics.

    PubMed

    Aricescu, A R; Assenberg, R; Bill, R M; Busso, D; Chang, V T; Davis, S J; Dubrovsky, A; Gustafsson, L; Hedfalk, K; Heinemann, U; Jones, I M; Ksiazek, D; Lang, C; Maskos, K; Messerschmidt, A; Macieira, S; Peleg, Y; Perrakis, A; Poterszman, A; Schneider, G; Sixma, T K; Sussman, J L; Sutton, G; Tarboureich, N; Zeev-Ben-Mordehai, T; Jones, E Yvonne

    2006-10-01

    The production of sufficient quantities of protein is an essential prelude to a structure determination, but for many viral and human proteins this cannot be achieved using prokaryotic expression systems. Groups in the Structural Proteomics In Europe (SPINE) consortium have developed and implemented high-throughput (HTP) methodologies for cloning, expression screening and protein production in eukaryotic systems. Studies focused on three systems: yeast (Pichia pastoris and Saccharomyces cerevisiae), baculovirus-infected insect cells and transient expression in mammalian cells. Suitable vectors for HTP cloning are described and results from their use in expression screening and protein-production pipelines are reported. Strategies for co-expression, selenomethionine labelling (in all three eukaryotic systems) and control of glycosylation (for secreted proteins in mammalian cells) are assessed. PMID:17001089

  12. Symbiosis and the origin of eukaryotic motility

    NASA Technical Reports Server (NTRS)

    Margulis, L.; Hinkle, G.

    1991-01-01

    Ongoing work to test the hypothesis of the origin of eukaryotic cell organelles by microbial symbioses is discussed. Because of the widespread acceptance of the serial endosymbiotic theory (SET) of the origin of plastids and mitochondria, the idea of the symbiotic origin of the centrioles and axonemes for spirochete bacteria motility symbiosis was tested. Intracellular microtubular systems are purported to derive from symbiotic associations between ancestral eukaryotic cells and motile bacteria. Four lines of approach to this problem are being pursued: (1) cloning the gene of a tubulin-like protein discovered in Spirocheata bajacaliforniesis; (2) seeking axoneme proteins in spirochets by antibody cross-reaction; (3) attempting to cultivate larger, free-living spirochetes; and (4) studying in detail spirochetes (e.g., Cristispira) symbiotic with marine animals. Other aspects of the investigation are presented.

  13. Eukaryotic algal phytochromes span the visible spectrum.

    PubMed

    Rockwell, Nathan C; Duanmu, Deqiang; Martin, Shelley S; Bachy, Charles; Price, Dana C; Bhattacharya, Debashish; Worden, Alexandra Z; Lagarias, J Clark

    2014-03-11

    Plant phytochromes are photoswitchable red/far-red photoreceptors that allow competition with neighboring plants for photosynthetically active red light. In aquatic environments, red and far-red light are rapidly attenuated with depth; therefore, photosynthetic species must use shorter wavelengths of light. Nevertheless, phytochrome-related proteins are found in recently sequenced genomes of many eukaryotic algae from aquatic environments. We examined the photosensory properties of seven phytochromes from diverse algae: four prasinophyte (green algal) species, the heterokont (brown algal) Ectocarpus siliculosus, and two glaucophyte species. We demonstrate that algal phytochromes are not limited to red and far-red responses. Instead, different algal phytochromes can sense orange, green, and even blue light. Characterization of these previously undescribed photosensors using CD spectroscopy supports a structurally heterogeneous chromophore in the far-red-absorbing photostate. Our study thus demonstrates that extensive spectral tuning of phytochromes has evolved in phylogenetically distinct lineages of aquatic photosynthetic eukaryotes. PMID:24567382

  14. The architecture of a eukaryotic replisome

    SciTech Connect

    Sun, Jingchuan; Yuan, Zuanning; Shi, Yi; Georgescu, Roxana E.; Chait, Brian T.; Li, Huilin; O'Donnell, Michael E.

    2015-11-02

    At the eukaryotic DNA replication fork, it is widely believed that the Cdc45–Mcm2–7–GINS (CMG) helicase is positioned in front to unwind DNA and that DNA polymerases trail behind the helicase. Here we used single-particle EM to directly image a Saccharomyces cerevisiae replisome. Contrary to expectations, the leading strand Pol ε is positioned ahead of CMG helicase, whereas Ctf4 and the lagging-strand polymerase (Pol) α–primase are behind the helicase. This unexpected architecture indicates that the leading-strand DNA travels a long distance before reaching Pol ε, first threading through the Mcm2–7 ring and then making a U-turn at the bottom and reaching Pol ε at the top of CMG. Lastly, our work reveals an unexpected configuration of the eukaryotic replisome, suggests possible reasons for this architecture and provides a basis for further structural and biochemical replisome studies.

  15. Single-Molecule Observations of Ribosome Function

    PubMed Central

    Blanchard, Scott C.

    2009-01-01

    Summary of Recent Advances Single-molecule investigations promise to greatly advance our understanding of basic and regulated ribosome functions during the process of translation. Here, recent progress towards directly imaging the elemental translation elongation steps using fluorescence resonance energy transfer (FRET)-based imaging methods is discussed, which provide striking evidence of the highly dynamic nature of the ribosome. In this view, global rates and fidelities of protein synthesis reactions may be regulated by interactions of the ribosome with mRNA, tRNA, translation factors, and potentially many other cellular ligands, that modify intrinsic conformational equilibria in the translating particle. Future investigations probing this model must aim to visualize translation processes from multiple structural and kinetic perspectives simultaneously, to provide direct correlations between factor binding and conformational events. PMID:19223173

  16. Genome Mining for Ribosomally Synthesized Natural Products

    PubMed Central

    Velásquez, Juan E.; van der Donk, Wilfred

    2011-01-01

    In recent years, the number of known peptide natural products that are synthesized via the ribosomal pathway has rapidly grown. Taking advantage of sequence homology among genes encoding precursor peptides or biosynthetic proteins, in silico mining of genomes combined with molecular biology approaches has guided the discovery of a large number of new ribosomal natural products, including lantipeptides, cyanobactins, linear thiazole/oxazole-containing peptides, microviridins, lasso peptides, amatoxins, cyclotides, and conopeptides. In this review, we describe the strategies used for the identification of these ribosomally-synthesized and posttranslationally modified peptides (RiPPs) and the structures of newly identified compounds. The increasing number of chemical entities and their remarkable structural and functional diversity may lead to novel pharmaceutical applications. PMID:21095156

  17. Extracellular enzymes produced by marine eukaryotes, thraustochytrids.

    PubMed

    Taoka, Yousuke; Nagano, Naoki; Okita, Yuji; Izumida, Hitoshi; Sugimoto, Shinichi; Hayashi, Masahiro

    2009-01-01

    Extracellular enzymes produced by six strains of thraustochytrids, Thraustochytrium, Schizochytrium, and Aurantiochytrium, were investigated. These strains produced 5 to 8 kinds of the extracellular enzymes, depending on the species. Only the genus Thraustochytrium produced amylase. When insoluble cellulose was used as substrate, cellulase was not detected in the six strains of thraustochytrids. This study indicates that marine eukaryotes, thraustochytrids, produced a wide variety of extracellular enzymes. PMID:19129663

  18. Endosymbiotic origin and differential loss of eukaryotic genes.

    PubMed

    Ku, Chuan; Nelson-Sathi, Shijulal; Roettger, Mayo; Sousa, Filipa L; Lockhart, Peter J; Bryant, David; Hazkani-Covo, Einat; McInerney, James O; Landan, Giddy; Martin, William F

    2015-08-27

    Chloroplasts arose from cyanobacteria, mitochondria arose from proteobacteria. Both organelles have conserved their prokaryotic biochemistry, but their genomes are reduced, and most organelle proteins are encoded in the nucleus. Endosymbiotic theory posits that bacterial genes in eukaryotic genomes entered the eukaryotic lineage via organelle ancestors. It predicts episodic influx of prokaryotic genes into the eukaryotic lineage, with acquisition corresponding to endosymbiotic events. Eukaryotic genome sequences, however, increasingly implicate lateral gene transfer, both from prokaryotes to eukaryotes and among eukaryotes, as a source of gene content variation in eukaryotic genomes, which predicts continuous, lineage-specific acquisition of prokaryotic genes in divergent eukaryotic groups. Here we discriminate between these two alternatives by clustering and phylogenetic analysis of eukaryotic gene families having prokaryotic homologues. Our results indicate (1) that gene transfer from bacteria to eukaryotes is episodic, as revealed by gene distributions, and coincides with major evolutionary transitions at the origin of chloroplasts and mitochondria; (2) that gene inheritance in eukaryotes is vertical, as revealed by extensive topological comparison, sparse gene distributions stemming from differential loss; and (3) that continuous, lineage-specific lateral gene transfer, although it sometimes occurs, does not contribute to long-term gene content evolution in eukaryotic genomes. PMID:26287458

  19. Ribosome-dependent activation of stringent control.

    PubMed

    Brown, Alan; Fernández, Israel S; Gordiyenko, Yuliya; Ramakrishnan, V

    2016-06-01

    In order to survive, bacteria continually sense, and respond to, environmental fluctuations. Stringent control represents a key bacterial stress response to nutrient starvation that leads to rapid and comprehensive reprogramming of metabolic and transcriptional patterns. In general, transcription of genes for growth and proliferation is downregulated, while those important for survival and virulence are upregulated. Amino acid starvation is sensed by depletion of the aminoacylated tRNA pools, and this results in accumulation of ribosomes stalled with non-aminoacylated (uncharged) tRNA in the ribosomal A site. RelA is recruited to stalled ribosomes and activated to synthesize a hyperphosphorylated guanosine analogue, (p)ppGpp, which acts as a pleiotropic secondary messenger. However, structural information about how RelA recognizes stalled ribosomes and discriminates against aminoacylated tRNAs is missing. Here we present the cryo-electron microscopy structure of RelA bound to the bacterial ribosome stalled with uncharged tRNA. The structure reveals that RelA utilizes a distinct binding site compared to the translational factors, with a multi-domain architecture that wraps around a highly distorted A-site tRNA. The TGS (ThrRS, GTPase and SpoT) domain of RelA binds the CCA tail to orient the free 3' hydroxyl group of the terminal adenosine towards a β-strand, such that an aminoacylated tRNA at this position would be sterically precluded. The structure supports a model in which association of RelA with the ribosome suppresses auto-inhibition to activate synthesis of (p)ppGpp and initiate the stringent response. Since stringent control is responsible for the survival of pathogenic bacteria under stress conditions, and contributes to chronic infections and antibiotic tolerance, RelA represents a good target for the development of novel antibacterial therapeutics. PMID:27279228

  20. Genetic analysis of L123 of the tRNA-mimicking eukaryote release factor eRF1, an amino acid residue critical for discrimination of stop codons

    PubMed Central

    Saito, Kazuki; Ito, Koichi

    2015-01-01

    In eukaryotes, the tRNA-mimicking polypeptide-chain release factor, eRF1, decodes stop codons on the ribosome in a complex with eRF3; this complex exhibits striking structural similarity to the tRNA–eEF1A–GTP complex. Although amino acid residues or motifs of eRF1 that are critical for stop codon discrimination have been identified, the details of the molecular mechanisms involved in the function of the ribosomal decoding site remain obscure. Here, we report analyses of the position-123 amino acid of eRF1 (L123 in Saccharomyces cerevisiae eRF1), a residue that is phylogenetically conserved among species with canonical and variant genetic codes. In vivo readthrough efficiency analysis and genetic growth complementation analysis of the residue-123 systematic mutants suggested that this amino acid functions in stop codon discrimination in a manner coupled with eRF3 binding, and distinctive from previously reported adjacent residues. Furthermore, aminoglycoside antibiotic sensitivity analysis and ribosomal docking modeling of eRF1 in a quasi-A/T state suggested a functional interaction between the side chain of L123 and ribosomal residues critical for codon recognition in the decoding site, as a molecular explanation for coupling with eRF3. Our results provide insights into the molecular mechanisms underlying stop codon discrimination by a tRNA-mimicking protein on the ribosome. PMID:25897120

  1. Structure of a eukaryotic thiaminase I

    PubMed Central

    Kreinbring, Cheryl A.; Remillard, Stephen P.; Hubbard, Paul; Brodkin, Heather R.; Leeper, Finian J.; Hawksley, Dan; Lai, Elaine Y.; Fulton, Chandler; Petsko, Gregory A.; Ringe, Dagmar

    2014-01-01

    Thiaminases, enzymes that cleave vitamin B1, are sporadically distributed among prokaryotes and eukaryotes. Thiaminase I enzymes catalyze the elimination of the thiazole ring moiety from thiamin through substitution of the methylene group with a nitrogenous base or sulfhydryl compound. In eukaryotic organisms, these enzymes are reported to have much higher molecular weights than their bacterial counterparts. A thiaminase I of the single-celled amoeboflagellate Naegleria gruberi is the only eukaryotic thiaminase I to have been cloned, sequenced, and expressed. Here, we present the crystal structure of N. gruberi thiaminase I to a resolution of 2.8 Å, solved by isomorphous replacement and pseudo–two-wavelength multiwavelength anomalous diffraction and refined to an R factor of 0.231 (Rfree, 0.265). This structure was used to solve the structure of the enzyme in complex with 3-deazathiamin, a noncleavable thiamin analog and enzyme inhibitor (2.7 Å; R, 0.233; Rfree, 0.267). These structures define the mode of thiamin binding to this class of thiaminases and indicate the involvement of Asp272 as the catalytic base. This enzyme is able to use thiamin as a substrate and is active with amines such as aniline and veratrylamine as well as sulfhydryl compounds such as l-cysteine and β-mercaptoethanol as cosubstrates. Despite significant differences in polypeptide sequence and length, we have shown that the N. gruberi thiaminase I is homologous in structure and activity to a previously characterized bacterial thiaminase I. PMID:24351929

  2. Single-cell transcriptomics for microbial eukaryotes.

    PubMed

    Kolisko, Martin; Boscaro, Vittorio; Burki, Fabien; Lynn, Denis H; Keeling, Patrick J

    2014-11-17

    One of the greatest hindrances to a comprehensive understanding of microbial genomics, cell biology, ecology, and evolution is that most microbial life is not in culture. Solutions to this problem have mainly focused on whole-community surveys like metagenomics, but these analyses inevitably loose information and present particular challenges for eukaryotes, which are relatively rare and possess large, gene-sparse genomes. Single-cell analyses present an alternative solution that allows for specific species to be targeted, while retaining information on cellular identity, morphology, and partitioning of activities within microbial communities. Single-cell transcriptomics, pioneered in medical research, offers particular potential advantages for uncultivated eukaryotes, but the efficiency and biases have not been tested. Here we describe a simple and reproducible method for single-cell transcriptomics using manually isolated cells from five model ciliate species; we examine impacts of amplification bias and contamination, and compare the efficacy of gene discovery to traditional culture-based transcriptomics. Gene discovery using single-cell transcriptomes was found to be comparable to mass-culture methods, suggesting single-cell transcriptomics is an efficient entry point into genomic data from the vast majority of eukaryotic biodiversity. PMID:25458215

  3. Arsenic and Antimony Transporters in Eukaryotes

    PubMed Central

    Maciaszczyk-Dziubinska, Ewa; Wawrzycka, Donata; Wysocki, Robert

    2012-01-01

    Arsenic and antimony are toxic metalloids, naturally present in the environment and all organisms have developed pathways for their detoxification. The most effective metalloid tolerance systems in eukaryotes include downregulation of metalloid uptake, efflux out of the cell, and complexation with phytochelatin or glutathione followed by sequestration into the vacuole. Understanding of arsenic and antimony transport system is of high importance due to the increasing usage of arsenic-based drugs in the treatment of certain types of cancer and diseases caused by protozoan parasites as well as for the development of bio- and phytoremediation strategies for metalloid polluted areas. However, in contrast to prokaryotes, the knowledge about specific transporters of arsenic and antimony and the mechanisms of metalloid transport in eukaryotes has been very limited for a long time. Here, we review the recent advances in understanding of arsenic and antimony transport pathways in eukaryotes, including a dual role of aquaglyceroporins in uptake and efflux of metalloids, elucidation of arsenic transport mechanism by the yeast Acr3 transporter and its role in arsenic hyperaccumulation in ferns, identification of vacuolar transporters of arsenic-phytochelatin complexes in plants and forms of arsenic substrates recognized by mammalian ABC transporters. PMID:22489166

  4. Cloning, sequencing, and characterization of ribosomal protein and RNA polymerase genes from the region analogous to the alpha-operon of escherichia coli in halophilic archaea, halobacterium halobium.

    PubMed

    Sano, K; Taguchi, A; Furumoto, H; Uda, T; Itoh, T

    1999-10-14

    A determination was made of the nucleotide sequence of the 3215-bp region of a ribosomal protein gene cluster (HS13, HS4, HS11, and HeL18), RNA polymerase (RNA poly D), and tRNA genes (tRNAser and tRNAarg) of halophilic Archaea Halobacterium halobium, which is analogous to the alpha-operon of Escherichia coli (tRNAser-HS13-HS4-HS11-RNA poly D-tRNAarg-HeL18). The seven-gene string was preceded by a pseudoknot-like structure similar to the proposed S4 ribosomal protein binding site of the alpha-operon mRNA leader in E. coli. Using an inducible expression system H. halobium HS4 was produced in large amounts in E. coli, and immunoblot analysis showed the S4 to constitute a 21-kDa polypeptide component of the ribosome. Analysis of the deduced amino acids sequence revealed that the HS13, HS4, and HS11 sequences including the RNA polymerase subunit are more similar to their eukaryotic than to their bacterial counterparts. HeL18, located downstream of the gene cluster analogous to the E. coli alpha-operon (S13-S11-S4-RNA poly D-L17), was similar to both the eukaryotic (eL18) and eubacterial ribosomal protein L15 located in the spc-operon, but not to L17 positioned as the terminal gene of the bacterial alpha-operon. PMID:10527834

  5. The NF45/NF90 Heterodimer Contributes to the Biogenesis of 60S Ribosomal Subunits and Influences Nucleolar Morphology

    PubMed Central

    Wandrey, Franziska; Montellese, Christian; Koos, Krisztian; Badertscher, Lukas; Bammert, Lukas; Cook, Atlanta G.; Zemp, Ivo; Horvath, Peter

    2015-01-01

    The interleukin enhancer binding factors ILF2 (NF45) and ILF3 (NF90/NF110) have been implicated in various cellular pathways, such as transcription, microRNA (miRNA) processing, DNA repair, and translation, in mammalian cells. Using tandem affinity purification, we identified human NF45 and NF90 as components of precursors to 60S (pre-60S) ribosomal subunits. NF45 and NF90 are enriched in nucleoli and cosediment with pre-60S ribosomal particles in density gradient analysis. We show that association of the NF45/NF90 heterodimer with pre-60S ribosomal particles requires the double-stranded RNA binding domains of NF90, while depletion of NF45 and NF90 by RNA interference leads to a defect in 60S biogenesis. Nucleoli of cells depleted of NF45 and NF90 have altered morphology and display a characteristic spherical shape. These effects are not due to impaired rRNA transcription or processing of the precursors to 28S rRNA. Consistent with a role of the NF45/NF90 heterodimer in nucleolar steps of 60S subunit biogenesis, downregulation of NF45 and NF90 leads to a p53 response, accompanied by induction of the cyclin-dependent kinase inhibitor p21/CIP1, which can be counteracted by depletion of RPL11. Together, these data indicate that NF45 and NF90 are novel higher-eukaryote-specific factors required for the maturation of 60S ribosomal subunits. PMID:26240280

  6. Concerted removal of the Erb1-Ytm1 complex in ribosome biogenesis relies on an elaborate interface.

    PubMed

    Thoms, Matthias; Ahmed, Yasar Luqman; Maddi, Karthik; Hurt, Ed; Sinning, Irmgard

    2016-01-29

    The complicated process of eukaryotic ribosome biogenesis involves about 200 assembly factors that transiently associate with the nascent pre-ribosome in a spatiotemporally ordered way. During the early steps of 60S subunit formation, several proteins, collectively called A3 cluster factors, participate in the removal of the internal transcribed spacer 1 (ITS1) from 27SA3 pre-rRNA. Among these factors is the conserved hetero-trimeric Nop7-Erb1-Ytm1 complex (or human Pes1-Bop1-Wdr12), which is removed from the evolving pre-60S particle by the AAA ATPase Rea1 to allow progression in the pathway. Here, we clarify how Ytm1 and Erb1 interact, which has implications for the release mechanism of both factors from the pre-ribosome. Biochemical studies show that Ytm1 and Erb1 bind each other via their ß-propeller domains. The crystal structure of the Erb1-Ytm1 heterodimer determined at 2.67Å resolution reveals an extended interaction surface between the propellers in a rarely observed binding mode. Structure-based mutations in the interface that impair the Erb1-Ytm1 interaction do not support growth, with specific defects in 60S subunit synthesis. Under these mutant conditions, it becomes clear that an intact Erb1-Ytm1 complex is required for 60S maturation and that loss of this stable interaction prevents ribosome production. PMID:26657628

  7. Peter Pan functions independently of its role in ribosome biogenesis during early eye and craniofacial cartilage development in Xenopus laevis.

    PubMed

    Bugner, Verena; Tecza, Aleksandra; Gessert, Susanne; Kühl, Michael

    2011-06-01

    The Xenopus oocyte possesses a large maternal store of ribosomes, thereby uncoupling early development from the de novo ribosome biosynthesis required for cell growth. Brix domain-containing proteins, such as Peter Pan (PPan), are essential for eukaryotic ribosome biogenesis. In this study, we demonstrate that PPan is expressed maternally as well as in the eye and cranial neural crest cells (NCCs) during early Xenopus laevis development. Depletion of PPan and interference with rRNA processing using antisense morpholino oligonucleotides resulted in eye and cranial cartilage malformations. Loss of PPan, but not interference with rRNA processing, led to an early downregulation of specific marker genes of the eye, including Rx1 and Pax6, and of NCCs, such as Twist, Slug and FoxD3. We found that PPan protein is localized in the nucleoli and mitochondria and that loss of PPan results in increased apoptosis. These findings indicate a novel function of PPan that is independent of its role in ribosome biogenesis. PMID:21558383

  8. Suppression of a temperature-sensitive cdc33 mutation of yeast by a multicopy plasmid expressing a Drosophila ribosomal protein.

    PubMed

    Lavoie, C; Tam, R; Clark, M; Lee, H; Sonenberg, N; Lasko, P

    1994-05-20

    The Saccharomyces cerevisiae cdc33ts4-2 mutant produces a temperature-sensitive allele of the cap-binding subunit of eukaryotic initiation factor-4F (also termed eIF-4E). From a Drosophila cDNA library constructed in a multicopy yeast shuttle vector, a clone was isolated which restored the ability to grow at elevated temperature to cdc33ts4-2 cells. The rescuing Drosophila clone encodes a small ribosomal subunit protein, which we name S15a based on its molecular weight and similarity with the Brassica napus S15a ribosomal protein. Transcription of the Drosophila gene, RpS15a, occurs at all developmental stages and is enhanced during oogenesis. The ribosomal protein gene is capable of suppressing other alleles of cdc33 but not an inactivation mutation, suggesting that suppression is dependent upon the presence of the temperature-sensitive eIF-4E protein. Supporting this, Western blot analysis shows that far more eIF-4E protein is present in cdc33 yeast cells expressing the RpS15a gene than lacking it. Levels of other unrelated proteins are unaffected. We propose therefore that the expression of high levels of the Drosophila S15a ribosomal protein in the cdc33 yeast cells leads to a selective stabilization of the temperature-sensitive eIF-4E protein, which accounts for the suppression phenomenon. PMID:8182070

  9. The catalytic subunit of shiga-like toxin 1 interacts with ribosomal stalk proteins and is inhibited by their conserved C-terminal domain.

    PubMed

    McCluskey, Andrew J; Poon, Gregory M K; Bolewska-Pedyczak, Eleonora; Srikumar, Tharan; Jeram, Stanley M; Raught, Brian; Gariépy, Jean

    2008-04-25

    Shiga-like toxin 1 (SLT-1) is a type II ribosome-inactivating protein; its A(1) domain blocks protein synthesis in eukaryotic cells by catalyzing the depurination of a single adenine base in 28 S rRNA. The molecular mechanism leading to this site-specific depurination event is thought to involve interactions with eukaryotic ribosomal proteins. Here, we present evidence that the A(1) chain of SLT-1 binds to the ribosomal proteins P0, P1, and P2. These proteins were identified from a HeLa cell lysate by tandem mass spectrometry, and subsequently confirmed to bind to SLT-1 A(1) chain by yeast-two-hybrid and pull-down experiments using candidate full-length proteins. Moreover, the removal of the last 17 amino acids of either protein P1 or P2 abolishes the interaction with the A(1) chain, whereas P0, lacking this common C terminus, still binds to the A(1) domain. In vitro pull-down experiments using fusion protein-tagged C-terminal peptides corresponding to the common 7, 11, and 17 terminal residues of P1 and P2 confirmed that the A(1) chain of SLT-1 as well as the A chain of ricin bind to this shared C-terminal peptide motif. More importantly, a synthetic peptide corresponding to the 17 amino acid C terminus of P1 and P2 was shown to inhibit the ribosome-inactivating function of the A(1) chain of SLT-1 in an in vitro transcription and translation-coupled assay. These results suggest a role for the ribosomal stalk in aiding the A(1) chain of SLT-1 and other type II ribosome-inactivating proteins in localizing its catalytic domain near the site of depurination in the 28 S rRNA. PMID:18358491

  10. Structural Changes Enable Start Codon Recognition by the Eukaryotic Translation Initiation Complex

    PubMed Central

    Hussain, Tanweer; Llácer, Jose L.; Fernández, Israel S.; Munoz, Antonio; Martin-Marcos, Pilar; Savva, Christos G.; Lorsch, Jon R.; Hinnebusch, Alan G.; Ramakrishnan, V.

    2014-01-01

    Summary During eukaryotic translation initiation, initiator tRNA does not insert fully into the P decoding site on the 40S ribosomal subunit. This conformation (POUT) is compatible with scanning mRNA for the AUG start codon. Base pairing with AUG is thought to promote isomerization to a more stable conformation (PIN) that arrests scanning and promotes dissociation of eIF1 from the 40S subunit. Here, we present a cryoEM reconstruction of a yeast preinitiation complex at 4.0 Å resolution with initiator tRNA in the PIN state, prior to eIF1 release. The structure reveals stabilization of the codon-anticodon duplex by the N-terminal tail of eIF1A, changes in the structure of eIF1 likely instrumental in its subsequent release, and changes in the conformation of eIF2. The mRNA traverses the entire mRNA cleft and makes connections to the regulatory domain of eIF2α, eIF1A, and ribosomal elements that allow recognition of context nucleotides surrounding the AUG codon. PMID:25417110

  11. Host RNAs, including transposons, are encapsidated by a eukaryotic single-stranded RNA virus

    PubMed Central

    Routh, Andrew; Domitrovic, Tatiana; Johnson, John E.

    2012-01-01

    Next-generation sequencing is a valuable tool in our growing understanding of the genetic diversity of viral populations. Using this technology, we have investigated the RNA content of a purified nonenveloped single-stranded RNA virus, flock house virus (FHV). We have also investigated the RNA content of virus-like particles (VLPs) of FHV and the related Nudaurelia capensis omega virus. VLPs predominantly package ribosomal RNA and transcripts of their baculoviral expression vectors. In addition, we find that 5.3% of the packaged RNAs are transposable elements derived from the Sf21 genome. This observation may be important when considering the therapeutic use of VLPs. We find that authentic FHV virions also package a variety of host RNAs, accounting for 1% of the packaged nucleic acid. Significant quantities of host messenger RNAs, ribosomal RNA, noncoding RNAs, and transposable elements are readily detected. The packaging of these host RNAs elicits the possibility of horizontal gene transfer between eukaryotic hosts that share a viral pathogen. We conclude that the genetic content of nonenveloped RNA viruses is variable, not just by genome mutation, but also in the diversity of RNA transcripts that are packaged. PMID:22308402

  12. RNA-dependent conversion of phosphoserine forms selenocysteine in eukaryotes and archaea

    PubMed Central

    Yuan, Jing; Palioura, Sotiria; Salazar, Juan Carlos; Su, Dan; O'Donoghue, Patrick; Hohn, Michael J.; Cardoso, Alexander Machado; Whitman, William B.; Söll, Dieter

    2006-01-01

    The trace element selenium is found in proteins as selenocysteine (Sec), the 21st amino acid to participate in ribosome-mediated translation. The substrate for ribosomal protein synthesis is selenocysteinyl-tRNASec. Its biosynthesis from seryl-tRNASec has been established for bacteria, but the mechanism of conversion from Ser-tRNASec remained unresolved for archaea and eukarya. Here, we provide evidence for a different route present in these domains of life that requires the tRNASec-dependent conversion of O-phosphoserine (Sep) to Sec. In this two-step pathway, O-phosphoseryl-tRNASec kinase (PSTK) converts Ser-tRNASec to Sep-tRNASec. This misacylated tRNA is the obligatory precursor for a Sep-tRNA:Sec-tRNA synthase (SepSecS); this protein was previously annotated as SLA/LP. The human and archaeal SepSecS genes complement in vivo an Escherichia coli Sec synthase (SelA) deletion strain. Furthermore, purified recombinant SepSecS converts Sep-tRNASec into Sec-tRNASec in vitro in the presence of sodium selenite and purified recombinant E. coli selenophosphate synthetase (SelD). Phylogenetic arguments suggest that Sec decoding was present in the last universal common ancestor. SepSecS and PSTK coevolved with the archaeal and eukaryotic lineages, but the history of PSTK is marked by several horizontal gene transfer events, including transfer to non-Sec-decoding Cyanobacteria and fungi. PMID:17142313

  13. Chlorolissoclimides: New inhibitors of eukaryotic protein synthesis

    PubMed Central

    Robert, Francis; Gao, Hong Qing; Donia, Marwa; Merrick, William C.; Hamann, Mark T.; Pelletier, Jerry

    2006-01-01

    Lissoclimides are cytotoxic compounds produced by shell-less molluscs through chemical secretions to deter predators. Chlorinated lissoclimides were identified as the active component of a marine extract from Pleurobranchus forskalii found during a high-throughput screening campaign to characterize new protein synthesis inhibitors. It was demonstrated that these compounds inhibit protein synthesis in vitro, in extracts prepared from mammalian and plant cells, as well as in vivo against mammalian cells. Our results suggest that they block translation elongation by inhibiting translocation, leading to an accumulation of ribosomes on mRNA. These data provide a rationale for the cytotoxic nature of this class of small molecule natural products. PMID:16540697

  14. What Was the Real Contribution of Endosymbionts to the Eukaryotic Nucleus? Insights from Photosynthetic Eukaryotes

    PubMed Central

    Moreira, David; Deschamps, Philippe

    2014-01-01

    Eukaryotic genomes are composed of genes of different evolutionary origins. This is especially true in the case of photosynthetic eukaryotes, which, in addition to typical eukaryotic genes and genes of mitochondrial origin, also contain genes coming from the primary plastids and, in the case of secondary photosynthetic eukaryotes, many genes provided by the nuclei of red or green algal endosymbionts. Phylogenomic analyses have been applied to detect those genes and, in some cases, have led to proposing the existence of cryptic, no longer visible endosymbionts. However, detecting them is a very difficult task because, most often, those genes were acquired a long time ago and their phylogenetic signal has been heavily erased. We revisit here two examples, the putative cryptic endosymbiosis of green algae in diatoms and chromerids and of Chlamydiae in the first photosynthetic eukaryotes. We show that the evidence sustaining them has been largely overestimated, and we insist on the necessity of careful, accurate phylogenetic analyses to obtain reliable results. PMID:24984774

  15. Late-assembly of human ribosomal protein S20 in the cytoplasm is essential for the functioning of the small subunit ribosome

    SciTech Connect

    Tai, Lin-Ru; Chou, Chang-Wei; Wu, Jing-Ying; Kirby, Ralph; Lin, Alan

    2013-11-15

    Using immuno-fluorescent probing and Western blotting analysis, we reveal the exclusive cytoplasm nature of the small subunit ribosomal protein S20. To illustrate the importance of the cellular compartmentation of S20 to the function of small subunit 40S, we created a nuclear resident S20{sub NLS} mutant gene and examined polysome profile of cells that had been transfected with the S20{sub NLS} gene. As a result, we observed the formation of recombinant 40S carried S20{sub NLS} but this recombinant 40S was never found in the polysome, suggesting such a recombinant 40S was translation incompetent. Moreover, by the tactic of the energy depletion and restoration, we were able to restrain the nuclear-resided S20{sub NLS} in the cytoplasm. Yet, along a progressive energy restoration, we observed the presence of recombinant 40S subunits carrying the S20{sub NLS} in the polysome. This proves that S20 needs to be cytoplasmic in order to make a functional 40S subunit. Furthermore, it also implies that the assembly order of ribosomal protein in eukaryote is orderly regulated. - Highlights: • The step of S20 assembled on 40S is happened in the cytoplasm. • A small subunit assembled with a nuclear S20{sub NLS} is translational incompetence. • Using energy depletion and recovery to manipulate the cellular compartment of S20{sub NLS}. • Cytoplasm-retained S20{sub NLS} is crucial for creating a functional small subunit.

  16. The importance of inter- and intramolecular base pairing for translation reinitiation on a eukaryotic bicistronic mRNA.

    PubMed

    Luttermann, Christine; Meyers, Gregor

    2009-02-01

    Calicivirus structure proteins are expressed from a subgenomic mRNA with two overlapping cistrons. The first ORF of this RNA codes for the viral major capsid protein VP1, and the second for the minor capsid protein VP2. Translation of VP2 is mediated by a termination/reinitiation mechanism, which depends on an upstream sequence element of approximately 70 nucleotides denoted "termination upstream ribosomal binding site" (TURBS). Two short sequence motifs within the TURBS were found to be essential for reinitiation. By a whole set of single site mutations and reciprocal base exchanges we demonstrate here for the first time conclusive evidence for the necessity of mRNA/18S rRNA hybridization for translation reinitiation in an eukaryotic system. Moreover, we show that motif 2 exhibits intramolecular hybridization with a complementary region upstream of motif 1, thus forming a secondary structure that positions post-termination ribosomes in an optimal distance to the VP2 start codon. Analysis of the essential elements of the TURBS led to a better understanding of the requirements for translation termination/reinitiation in eukaryotes. PMID:19204118

  17. RNS2, a conserved member of the RNase T2 family, is necessary for ribosomal RNA decay in plants.

    PubMed

    Hillwig, Melissa S; Contento, Anthony L; Meyer, Alexander; Ebany, Danielle; Bassham, Diane C; Macintosh, Gustavo C

    2011-01-18

    RNase T2 enzymes are conserved in most eukaryotic genomes, and expression patterns and phylogenetic analyses suggest that they may carry out an important housekeeping role. However, the nature of this role has been elusive. Here we show that RNS2, an intracellular RNase T2 from Arabidopsis thaliana, is essential for normal ribosomal RNA recycling. This enzyme is the main endoribonuclease activity in plant cells and localizes to the endoplasmic reticulum (ER), ER-derived structures, and vacuoles. Mutants lacking RNS2 activity accumulate RNA intracellularly, and rRNA in these mutants has a longer half-life. Normal rRNA turnover seems essential to maintain cell homeostasis because rns2 mutants display constitutive autophagy. We propose that RNS2 is part of a process that degrades rRNA to recycle its components. This process appears to be conserved in all eukaryotes. PMID:21199950

  18. RNS2, a conserved member of the RNase T2 family, is necessary for ribosomal RNA decay in plants

    PubMed Central

    Hillwig, Melissa S.; Contento, Anthony L.; Meyer, Alexander; Ebany, Danielle; Bassham, Diane C.; MacIntosh, Gustavo C.

    2011-01-01

    RNase T2 enzymes are conserved in most eukaryotic genomes, and expression patterns and phylogenetic analyses suggest that they may carry out an important housekeeping role. However, the nature of this role has been elusive. Here we show that RNS2, an intracellular RNase T2 from Arabidopsis thaliana, is essential for normal ribosomal RNA recycling. This enzyme is the main endoribonuclease activity in plant cells and localizes to the endoplasmic reticulum (ER), ER-derived structures, and vacuoles. Mutants lacking RNS2 activity accumulate RNA intracellularly, and rRNA in these mutants has a longer half-life. Normal rRNA turnover seems essential to maintain cell homeostasis because rns2 mutants display constitutive autophagy. We propose that RNS2 is part of a process that degrades rRNA to recycle its components. This process appears to be conserved in all eukaryotes. PMID:21199950

  19. Primary structure of dihydrofolate reductase and mitochondrial ribosomal protein L36 genes from the basidiomycete Coprinus cinereus.

    PubMed

    Aimi, Tadanori; Fukuhara, Shoji; Ishiguro, Maki; Kitamoto, Yutaka; Morinaga, Tsutomu

    2004-08-01

    We amplified and sequenced the dihydrofolate reductase (DHFR) gene of the basidiomycete Coprinus cinereus. Downstream of the DHFR coding region, a mitochondrial (mt) ribosomal protein L36 (RPL36) gene was discovered in the opposite orientation to DHFR gene. Putative polyadenylation signals of the two genes overlapped, both containing the 8-bp palindrome 5'-aatatatt-3'. The finding that C. cinereus DHFR gene is closely clustered with a mt protein gene strongly suggests that C. cinereus DHFR is closely related to mt function and evolution. The amino acid sequence of C. cinereus DHFR is most homologous to eukaryotic proteins such as Cryptococcus neoformans and Pneumocystis carinii DHFRs. However, the sequence of C. cinereus mt RPL36 closely resembles RPL36 of bacteria and cyanobacteria such as Synechocystis sp. and Escherichia coli. This result strongly supports the serial endosymbiotic theory of the development of ancestral eukaryotes, and suggests that C. cinereus mt RPL36 gene originated from the ancestral eubacterial genome. PMID:15620217

  20. Polyribosome binding by GCN1 is required for full activation of eukaryotic translation initiation factor 2{alpha} kinase GCN2 during amino acid starvation.

    PubMed

    Sattlegger, Evelyn; Hinnebusch, Alan G

    2005-04-22

    The protein kinase GCN2 mediates translational control of gene expression in amino acid-starved cells by phosphorylating eukaryotic translation initiation factor 2alpha. In Saccharomyces cerevisiae, activation of GCN2 by uncharged tRNAs in starved cells requires its direct interaction with both the GCN1.GCN20 regulatory complex and ribosomes. GCN1 also interacts with ribosomes in cell extracts, but it was unknown whether this activity is crucial for its ability to stimulate GCN2 function in starved cells. We describe point mutations in two conserved, noncontiguous segments of GCN1 that lead to reduced polyribosome association by GCN1.GCN20 in living cells without reducing GCN1 expression or its interaction with GCN20. Mutating both segments simultaneously produced a greater reduction in polyribosome binding by GCN1.GCN20 and a stronger decrease in eukaryotic translation initiation factor 2alpha phosphorylation than did mutating in one segment alone. These findings provide strong evidence that ribosome binding by GCN1 is required for its role as a positive regulator of GCN2. A particular mutation in the GCN1 domain, related in sequence to translation elongation factor 3 (eEF3), decreased GCN2 activation much more than it reduced ribosome binding by GCN1. Hence, the eEF3-like domain appears to have an effector function in GCN2 activation. This conclusion supports the model that an eEF3-related activity of GCN1 influences occupancy of the ribosomal decoding site by uncharged tRNA in starved cells. PMID:15722345

  1. Intra-Genomic Variation in the Ribosomal Repeats of Nematodes

    PubMed Central

    Bik, Holly M.; Fournier, David; Sung, Way; Bergeron, R. Daniel; Thomas, W. Kelley

    2013-01-01

    Ribosomal loci represent a major tool for investigating environmental diversity and community structure via high-throughput marker gene studies of eukaryotes (e.g. 18S rRNA). Since the estimation of species’ abundance is a major goal of environmental studies (by counting numbers of sequences), understanding the patterns of rRNA copy number across species will be critical for informing such high-throughput approaches. Such knowledge is critical, given that ribosomal RNA genes exist within multi-copy repeated arrays in a genome. Here we measured the repeat copy number for six nematode species by mapping the sequences from whole genome shotgun libraries against reference sequences for their rRNA repeat. This revealed a 6-fold variation in repeat copy number amongst taxa investigated, with levels of intragenomic variation ranging from 56 to 323 copies of the rRNA array. By applying the same approach to four C. elegans mutation accumulation lines propagated by repeated bottlenecking for an average of ~400 generations, we find on average a 2-fold increase in repeat copy number (rate of increase in rRNA estimated at 0.0285-0.3414 copies per generation), suggesting that rRNA repeat copy number is subject to selection. Within each Caenorhabditis species, the majority of intragenomic variation found across the rRNA repeat was observed within gene regions (18S, 28S, 5.8S), suggesting that such intragenomic variation is not a product of selection for rRNA coding function. We find that the dramatic variation in repeat copy number among these six nematode genomes would limit the use of rRNA in estimates of organismal abundance. In addition, the unique pattern of variation within a single genome was uncorrelated with patterns of divergence between species, reflecting a strong signature of natural selection for rRNA function. A better understanding of the factors that control or affect copy number in these arrays, as well as their rates and patterns of evolution, will be

  2. Complex archaea that bridge the gap between prokaryotes and eukaryotes.

    PubMed

    Spang, Anja; Saw, Jimmy H; Jørgensen, Steffen L; Zaremba-Niedzwiedzka, Katarzyna; Martijn, Joran; Lind, Anders E; van Eijk, Roel; Schleper, Christa; Guy, Lionel; Ettema, Thijs J G

    2015-05-14

    The origin of the eukaryotic cell remains one of the most contentious puzzles in modern biology. Recent studies have provided support for the emergence of the eukaryotic host cell from within the archaeal domain of life, but the identity and nature of the putative archaeal ancestor remain a subject of debate. Here we describe the discovery of 'Lokiarchaeota', a novel candidate archaeal phylum, which forms a monophyletic group with eukaryotes in phylogenomic analyses, and whose genomes encode an expanded repertoire of eukaryotic signature proteins that are suggestive of sophisticated membrane remodelling capabilities. Our results provide strong support for hypotheses in which the eukaryotic host evolved from a bona fide archaeon, and demonstrate that many components that underpin eukaryote-specific features were already present in that ancestor. This provided the host with a rich genomic 'starter-kit' to support the increase in the cellular and genomic complexity that is characteristic of eukaryotes. PMID:25945739

  3. Complex archaea that bridge the gap between prokaryotes and eukaryotes

    PubMed Central

    Martijn, Joran; Lind, Anders E.; van Eijk, Roel; Schleper, Christa; Guy, Lionel; Ettema, Thijs J. G.

    2015-01-01

    The origin of the eukaryotic cell remains one of the most contentious puzzles in modern biology. Recent studies have provided support for the emergence of the eukaryotic host cell from within the archaeal domain of life, but the identity and nature of the putative archaeal ancestor remain a subject of debate. Here we describe the discovery of ‘Lokiarchaeota’, a novel candidate archaeal phylum, which forms a monophyletic group with eukaryotes in phylogenomic analyses, and whose genomes encode an expanded repertoire of eukaryotic signature proteins that are suggestive of sophisticated membrane remodelling capabilities. Our results provide strong support for hypotheses in which the eukaryotic host evolved from a bona fide archaeon, and demonstrate that many components that underpin eukaryote-specific features were already present in that ancestor. This provided the host with a rich genomic ‘starter-kit’ to support the increase in the cellular and genomic complexity that is characteristic of eukaryotes. PMID:25945739

  4. Horizontal gene transfer in eukaryotes: The weak-link model

    PubMed Central

    Huang, Jinling

    2013-01-01

    The significance of horizontal gene transfer (HGT) in eukaryotic evolution remains controversial. Although many eukaryotic genes are of bacterial origin, they are often interpreted as being derived from mitochondria or plastids. Because of their fixed gene pool and gene loss, however, mitochondria and plastids alone cannot adequately explain the presence of all, or even the majority, of bacterial genes in eukaryotes. Available data indicate that no insurmountable barrier to HGT exists, even in complex multicellular eukaryotes. In addition, the discovery of both recent and ancient HGT events in all major eukaryotic groups suggests that HGT has been a regular occurrence throughout the history of eukaryotic evolution. A model of HGT is proposed that suggests both unicellular and early developmental stages as likely entry points for foreign genes into multicellular eukaryotes. PMID:24037739

  5. Two thraustochytrid 5S ribosomal RNAs.

    PubMed Central

    MacKay, R M; Doolittle, W F

    1982-01-01

    The complete nucleotide sequences of the 5S ribosomal RNAs (rRNAs) of two thraustochytrids, Thraustochytrium visurgense and Schizochytrium, aggregatum, are AUGAGCCCUCAUAUCAUGUGGAGUGCACCGGAUCUCAUCCGAACUCCGUAGUUAAGCCACAUAGAGCGCGUC UAGUACUGCCGUAGGGGACUAGGUGGGAAGCACGCGUGGGGCUCAUU and ACAGCCGUUCAUACCACACGGAGA AUACCGGAUCUCGUUCGAACUCCGCAGUCAAGCCGUGUCGGGCGUGCUCAGUACUACCAUAGGGGACUGGGUGGGA AGCGUGCGUGACGGCUGUU, respectively. These sequences are discussed in terms of the apparent unity in secondary structure and strong divergence in primary structure exhibited by protist 5S rRNAs. PMID:7162992

  6. Two thraustochytrid 5S ribosomal RNAs.

    PubMed

    MacKay, R M; Doolittle, W F

    1982-12-20

    The complete nucleotide sequences of the 5S ribosomal RNAs (rRNAs) of two thraustochytrids, Thraustochytrium visurgense and Schizochytrium, aggregatum, are AUGAGCCCUCAUAUCAUGUGGAGUGCACCGGAUCUCAUCCGAACUCCGUAGUUAAGCCACAUAGAGCGCGUC UAGUACUGCCGUAGGGGACUAGGUGGGAAGCACGCGUGGGGCUCAUU and ACAGCCGUUCAUACCACACGGAGA AUACCGGAUCUCGUUCGAACUCCGCAGUCAAGCCGUGUCGGGCGUGCUCAGUACUACCAUAGGGGACUGGGUGGGA AGCGUGCGUGACGGCUGUU, respectively. These sequences are discussed in terms of the apparent unity in secondary structure and strong divergence in primary structure exhibited by protist 5S rRNAs. PMID:7162992

  7. Release of Nonstop Ribosomes Is Essential

    PubMed Central

    Feaga, Heather A.; Viollier, Patrick H.

    2014-01-01

    ABSTRACT Bacterial ribosomes frequently translate to the 3′ end of an mRNA without terminating at a stop codon. Almost all bacteria use the transfer-messenger RNA (tmRNA)-based trans-translation pathway to release these “nonstop” ribosomes and maintain protein synthesis capacity. trans-translation is essential in some species, but in others, such as Caulobacter crescentus, trans-translation can be inactivated. To determine why trans-translation is dispensable in C. crescentus, a Tn-seq screen was used to identify genes that specifically alter growth in cells lacking ssrA, the gene encoding tmRNA. One of these genes, CC1214, was essential in ΔssrA cells. Purified CC1214 protein could release nonstop ribosomes in vitro. CC1214 is a homolog of the Escherichia coli ArfB protein, and using the CC1214 sequence, ArfB homologs were identified in the majority of bacterial phyla. Most species in which ssrA has been deleted contain an ArfB homolog, suggesting that release of nonstop ribosomes may be essential in most or all bacteria. PMID:25389176

  8. Modeling Interactions of Erythromycin Derivatives with Ribosomes.

    PubMed

    Shishkina, A V; Makarova, T M; Tereshchenkov, A G; Makarov, G I; Korshunova, G A; Bogdanov, A A

    2015-11-01

    Using a method of static simulation, a series of erythromycin A analogs was designed with aldehyde functions introduced instead of one of the methyl substituents in the 3'-N-position of the antibiotic that was potentially capable of forming a covalent bond with an amino group of one of the nucleotide residues of the 23S rRNA in the ribosomal exit tunnel. Similar interaction is observed for antibiotics of the tylosin series, which bind tightly to the large ribosomal subunit and demonstrate high antibacterial activity. Binding of novel erythromycin derivatives with the bacterial ribosome was investigated with the method of fluorescence polarization. It was found that the erythromycin analog containing a 1-methyl-3-oxopropyl group in the 3'-N-position demonstrates the best binding. Based on the ability to inhibit protein biosynthesis, it is on the same level as erythromycin, and it is significantly better than desmethyl-erythromycin. Molecular dynamic modeling of complexes of the derivatives with ribosomes was conducted to explain the observed effects. PMID:26615442

  9. Depth shapes α- and β-diversities of microbial eukaryotes in surficial sediments of coastal ecosystems.

    PubMed

    Gong, Jun; Shi, Fei; Ma, Bin; Dong, Jun; Pachiadaki, Maria; Zhang, Xiaoli; Edgcomb, Virginia P

    2015-10-01

    Little is known about the relative influence of historic processes and environmental gradients on shaping the diversity of single-celled eukaryotes in marine benthos. By combining pyrosequencing of 18S ribosomal RNA genes with data on multiple environmental factors, we investigated the diversity of microeukaryotes in surficial sediments of three basins of the Yellow Sea Large Marine Ecosystem. A considerable proportion (about 20%) of reads was affiliated with known parasitoid protists. Dinophyta and Ciliophora appeared dominant in terms of relative proportion of reads and operational taxonomic unit (OTU) richness. Overall, OTU richness of benthic microeukaryotes decreased with increasing water depth and decreasing pH. While community composition was significantly different among basins, partial Mantel tests indicated a depth-decay pattern of community similarity, whereby water depth, rather than geographic distance or environment, shaped β-diversity of benthic microeukaryotes (including both the abundant and the rare biosphere) on a regional scale. Similar hydrographic and mineralogical factors contributed to the biogeography of both the abundant and the rare OTUs. The trace metal vanadium had a significant effect on the biogeography of the rare biosphere. Our study sheds new light on the composition, diversity patterns and underlying mechanisms of single-celled eukaryote distribution in surficial sediments of coastal oceans. PMID:25581721

  10. Pyrosequencing assessment of prokaryotic and eukaryotic diversity in biofilm communities from a French river

    PubMed Central

    Bricheux, Geneviève; Morin, Loïc; Le Moal, Gwenaël; Coffe, Gérard; Balestrino, Damien; Charbonnel, Nicolas; Bohatier, Jacques; Forestier, Christiane

    2013-01-01

    Despite the recent and significant increase in the study of aquatic microbial communities, little is known about the microbial diversity of complex ecosystems such as running waters. This study investigated the biodiversity of biofilm communities formed in a river with 454 Sequencing™. This river has the particularity of integrating both organic and microbiological pollution, as receiver of agricultural pollution in its upstream catchment area and urban pollution through discharges of the wastewater treatment plant of the town of Billom. Different regions of the small subunit (SSU) ribosomal RNA gene were targeted using nine pairs of primers, either universal or specific for bacteria, eukarya, or archaea. Our aim was to characterize the widest range of rDNA sequences using different sets of polymerase chain reaction (PCR) primers. A first look at reads abundance revealed that a large majority (47–48%) were rare sequences (<5 copies). Prokaryotic phyla represented the species richness, and eukaryotic phyla accounted for a small part. Among the prokaryotic phyla, Proteobacteria (beta and alpha) predominated, followed by Bacteroidetes together with a large number of nonaffiliated bacterial sequences. Bacillariophyta plastids were abundant. The remaining bacterial phyla, Verrucomicrobia and Cyanobacteria, made up the rest of the bulk biodiversity. The most abundant eukaryotic phyla were annelid worms, followed by Diatoms, and Chlorophytes. These latter phyla attest to the abundance of plastids and the importance of photosynthetic activity for the biofilm. These findings highlight the existence and plasticity of multiple trophic levels within these complex biological systems. PMID:23520129

  11. Pyrosequencing assessment of prokaryotic and eukaryotic diversity in biofilm communities from a French river.

    PubMed

    Bricheux, Geneviève; Morin, Loïc; Le Moal, Gwenaël; Coffe, Gérard; Balestrino, Damien; Charbonnel, Nicolas; Bohatier, Jacques; Forestier, Christiane

    2013-06-01

    Despite the recent and significant increase in the study of aquatic microbial communities, little is known about the microbial diversity of complex ecosystems such as running waters. This study investigated the biodiversity of biofilm communities formed in a river with 454 Sequencing™. This river has the particularity of integrating both organic and microbiological pollution, as receiver of agricultural pollution in its upstream catchment area and urban pollution through discharges of the wastewater treatment plant of the town of Billom. Different regions of the small subunit (SSU) ribosomal RNA gene were targeted using nine pairs of primers, either universal or specific for bacteria, eukarya, or archaea. Our aim was to characterize the widest range of rDNA sequences using different sets of polymerase chain reaction (PCR) primers. A first look at reads abundance revealed that a large majority (47-48%) were rare sequences (<5 copies). Prokaryotic phyla represented the species richness, and eukaryotic phyla accounted for a small part. Among the prokaryotic phyla, Proteobacteria (beta and alpha) predominated, followed by Bacteroidetes together with a large number of nonaffiliated bacterial sequences. Bacillariophyta plastids were abundant. The remaining bacterial phyla, Verrucomicrobia and Cyanobacteria, made up the rest of the bulk biodiversity. The most abundant eukaryotic phyla were annelid worms, followed by Diatoms, and Chlorophytes. These latter phyla attest to the abundance of plastids and the importance of photosynthetic activity for the biofilm. These findings highlight the existence and plasticity of multiple trophic levels within these complex biological systems. PMID:23520129

  12. A universal strategy for regulating mRNA translation in prokaryotic and eukaryotic cells

    PubMed Central

    Cao, Jicong; Arha, Manish; Sudrik, Chaitanya; Mukherjee, Abhirup; Wu, Xia; Kane, Ravi S.

    2015-01-01

    We describe a simple strategy to control mRNA translation in both prokaryotic and eukaryotic cells which relies on a unique protein–RNA interaction. Specifically, we used the Pumilio/FBF (PUF) protein to repress translation by binding in between the ribosome binding site (RBS) and the start codon (in Escherichia coli), or by binding to the 5′ untranslated region of target mRNAs (in mammalian cells). The design principle is straightforward, the extent of translational repression can be tuned and the regulator is genetically encoded, enabling the construction of artificial signal cascades. We demonstrate that this approach can also be used to regulate polycistronic mRNAs; such regulation has rarely been achieved in previous reports. Since the regulator used in this study is a modular RNA-binding protein, which can be engineered to target different 8-nucleotide RNA sequences, our strategy could be used in the future to target endogenous mRNAs for regulating metabolic flows and signaling pathways in both prokaryotic and eukaryotic cells. PMID:25845589

  13. Deep Sequencing of Subseafloor Eukaryotic rRNA Reveals Active Fungi across Marine Subsurface Provinces

    PubMed Central

    Orsi, William; Biddle, Jennifer F.; Edgcomb, Virginia

    2013-01-01

    The deep marine subsurface is a vast habitat for microbial life where cells may live on geologic timescales. Because DNA in sediments may be preserved on long timescales, ribosomal RNA (rRNA) is suggested to be a proxy for the active fraction of a microbial community in the subsurface. During an investigation of eukaryotic 18S rRNA by amplicon pyrosequencing, unique profiles of Fungi were found across a range of marine subsurface provinces including ridge flanks, continental margins, and abyssal plains. Subseafloor fungal populations exhibit statistically significant correlations with total organic carbon (TOC), nitrate, sulfide, and dissolved inorganic carbon (DIC). These correlations are supported by terminal restriction length polymorphism (TRFLP) analyses of fungal rRNA. Geochemical correlations with fungal pyrosequencing and TRFLP data from this geographically broad sample set suggests environmental selection of active Fungi in the marine subsurface. Within the same dataset, ancient rRNA signatures were recovered from plants and diatoms in marine sediments ranging from 0.03 to 2.7 million years old, suggesting that rRNA from some eukaryotic taxa may be much more stable than previously considered in the marine subsurface. PMID:23418556

  14. CASSIS and SMIPS: promoter-based prediction of secondary metabolite gene clusters in eukaryotic genomes

    PubMed Central

    Wolf, Thomas; Shelest, Vladimir; Nath, Neetika; Shelest, Ekaterina

    2016-01-01

    Motivation: Secondary metabolites (SM) are structurally diverse natural products of high pharmaceutical importance. Genes involved in their biosynthesis are often organized in clusters, i.e., are co-localized and co-expressed. In silico cluster prediction in eukaryotic genomes remains problematic mainly due to the high variability of the clusters’ content and lack of other distinguishing sequence features. Results: We present Cluster Assignment by Islands of Sites (CASSIS), a method for SM cluster prediction in eukaryotic genomes, and Secondary Metabolites by InterProScan (SMIPS), a tool for genome-wide detection of SM key enzymes (‘anchor’ genes): polyketide synthases, non-ribosomal peptide synthetases and dimethylallyl tryptophan synthases. Unlike other tools based on protein similarity, CASSIS exploits the idea of co-regulation of the cluster genes, which assumes the existence of common regulatory patterns in the cluster promoters. The method searches for ‘islands’ of enriched cluster-specific motifs in the vicinity of anchor genes. It was validated in a series of cross-validation experiments and showed high sensitivity and specificity. Availability and implementation: CASSIS and SMIPS are freely available at https://sbi.hki-jena.de/cassis. Contact: thomas.wolf@leibniz-hki.de or ekaterina.shelest@leibniz-hki.de Supplementary information: Supplementary data are available at Bioinformatics online. PMID:26656005

  15. Eukaryotic TPP riboswitch regulation of alternative splicing involving long-distance base pairing

    PubMed Central

    Li, Sanshu; Breaker, Ronald R.

    2013-01-01

    Thiamin pyrophosphate (TPP) riboswitches are found in organisms from all three domains of life. Examples in bacteria commonly repress gene expression by terminating transcription or by blocking ribosome binding, whereas most eukaryotic TPP riboswitches are predicted to regulate gene expression by modulating RNA splicing. Given the widespread distribution of eukaryotic TPP riboswitches and the diversity of their locations in precursor messenger RNAs (pre-mRNAs), we sought to examine the mechanism of alternative splicing regulation by a fungal TPP riboswitch from Neurospora crassa, which is mostly located in a large intron separating protein-coding exons. Our data reveal that this riboswitch uses a long-distance (∼530-nt separation) base-pairing interaction to regulate alternative splicing. Specifically, a portion of the TPP-binding aptamer can form a base-paired structure with a conserved sequence element (α) located near a 5′ splice site, which greatly increases use of this 5′ splice site and promotes gene expression. Comparative sequence analyses indicate that many fungal species carry a TPP riboswitch with similar intron architecture, and therefore the homologous genes in these fungi are likely to use the same mechanism. Our findings expand the scope of genetic control mechanisms relying on long-range RNA interactions to include riboswitches. PMID:23376932

  16. Promoter architectures in the yeast ribosomal expression program

    PubMed Central

    Bosio, Maria Cristina; Negri, Rodolfo

    2011-01-01

    Ribosome biogenesis begins with the orchestrated expression of hundreds of genes, including the three large classes of ribosomal protein, ribosome biogenesis and snoRNA genes. Current knowledge about the corresponding promoters suggests the existence of novel class-specific transcriptional strategies and crosstalk between telomere length and cell growth control. PMID:21468232

  17. Ribosomal DNA organization patterns within the dinoflagellate genus Alexandrium as revealed by FISH: life cycle and evolutionary implications.

    PubMed

    Figueroa, Rosa Isabel; Cuadrado, Angeles; Stüken, Anke; Rodríguez, Francisco; Fraga, Santiago

    2014-05-01

    Dinoflagellates are a group of protists whose genome differs from that of other eukaryotes in terms of size (contains up to 250pg per haploid cell), base composition, chromosomal organization, and gene expression. But rDNA gene mapping of the active nucleolus in this unusual eukaryotic genome has not been carried out thus far. Here we used FISH in dinoflagellate species belonging to the genus Alexandrium (genome sizes ranging from 21 to 170 pg of DNA per haploid genome) to localize the sequences encoding the 18S, 5.8S, and 28S rRNA genes. The results can be summarized as follows: 1) Each dinoflagellate cell contains only one active nucleolus, with no hybridization signals outside it. However, the rDNA organization varies among species, from repetitive clusters forming discrete nuclear organizer regions (NORs) in some to specialized "ribosomal chromosomes" in other species. The latter chromosomes, never reported before in other eukaryotes, are mainly formed by rDNA genes and appeared in the species with the highest DNA content. 2) Dinoflagellate chromosomes are first characterized by several eukaryotic features, such as structural differentiation (centromere-like constrictions), size differences (dot chromosomes), and SAT (satellite) chromosomes. 3) NOR patterns prove to be useful in discriminating between cryptic species and life cycle stages in protists. PMID:24846057

  18. Prokaryotes Versus Eukaryotes: Who is Hosting Whom?

    PubMed

    Tellez, Guillermo

    2014-01-01

    Microorganisms represent the largest component of biodiversity in our world. For millions of years, prokaryotic microorganisms have functioned as a major selective force shaping eukaryotic evolution. Microbes that live inside and on animals outnumber the animals' actual somatic and germ cells by an estimated 10-fold. Collectively, the intestinal microbiome represents a "forgotten organ," functioning as an organ inside another that can execute many physiological responsibilities. The nature of primitive eukaryotes was drastically changed due to the association with symbiotic prokaryotes facilitating mutual coevolution of host and microbe. Phytophagous insects have long been used to test theories of evolutionary diversification; moreover, the diversification of a number of phytophagous insect lineages has been linked to mutualisms with microbes. From termites and honey bees to ruminants and mammals, depending on novel biochemistries provided by the prokaryotic microbiome, the association helps to metabolize several nutrients that the host cannot digest and converting these into useful end products (such as short-chain fatty acids), a process, which has huge impact on the biology and homeostasis of metazoans. More importantly, in a direct and/or indirect way, the intestinal microbiota influences the assembly of gut-associated lymphoid tissue, helps to educate immune system, affects the integrity of the intestinal mucosal barrier, modulates proliferation and differentiation of its epithelial lineages, regulates angiogenesis, and modifies the activity of enteric as well as the central nervous system. Despite these important effects, the mechanisms by which the gut microbial community influences the host's biology remain almost entirely unknown. Our aim here is to encourage empirical inquiry into the relationship between mutualism and evolutionary diversification between prokaryotes and eukaryotes, which encourage us to postulate: who is hosting whom? PMID:26664911

  19. Earth's earliest non-marine eukaryotes.

    PubMed

    Strother, Paul K; Battison, Leila; Brasier, Martin D; Wellman, Charles H

    2011-05-26

    The existence of a terrestrial Precambrian (more than 542 Myr ago) biota has been largely inferred from indirect chemical and geological evidence associated with palaeosols, the weathering of clay minerals and microbially induced sedimentary structures in siliciclastic sediments. Direct evidence of fossils within rocks of non-marine origin in the Precambrian is exceedingly rare. The most widely cited example comprises a single report of morphologically simple mineralized tubes and spheres interpreted as cyanobacteria, obtained from 1,200-Myr-old palaeokarst in Arizona. Organic-walled microfossils were first described from the non-marine Torridonian (1.2-1.0 Gyr ago) sequence of northwest Scotland in 1907. Subsequent studies found few distinctive taxa-a century later, the Torridonian microflora is still being characterized as primarily nondescript "leiospheres". We have comprehensively sampled grey shales and phosphatic nodules throughout the Torridonian sequence. Here we report the recovery of large populations of diverse organic-walled microfossils extracted by acid maceration, complemented by studies using thin sections of phosphatic nodules that yield exceptionally detailed three-dimensional preservation. These assemblages contain multicellular structures, complex-walled cysts, asymmetric organic structures, and dorsiventral, compressed organic thalli, some approaching one millimetre in diameter. They offer direct evidence of eukaryotes living in freshwater aquatic and subaerially exposed habitats during the Proterozoic era. The apparent dominance of eukaryotes in non-marine settings by 1 Gyr ago indicates that eukaryotic evolution on land may have commenced far earlier than previously thought. PMID:21490597

  20. Prokaryotes Versus Eukaryotes: Who is Hosting Whom?

    PubMed Central

    Tellez, Guillermo

    2014-01-01

    Microorganisms represent the largest component of biodiversity in our world. For millions of years, prokaryotic microorganisms have functioned as a major selective force shaping eukaryotic evolution. Microbes that live inside and on animals outnumber the animals’ actual somatic and germ cells by an estimated 10-fold. Collectively, the intestinal microbiome represents a “forgotten organ,” functioning as an organ inside another that can execute many physiological responsibilities. The nature of primitive eukaryotes was drastically changed due to the association with symbiotic prokaryotes facilitating mutual coevolution of host and microbe. Phytophagous insects have long been used to test theories of evolutionary diversification; moreover, the diversification of a number of phytophagous insect lineages has been linked to mutualisms with microbes. From termites and honey bees to ruminants and mammals, depending on novel biochemistries provided by the prokaryotic microbiome, the association helps to metabolize several nutrients that the host cannot digest and converting these into useful end products (such as short-chain fatty acids), a process, which has huge impact on the biology and homeostasis of metazoans. More importantly, in a direct and/or indirect way, the intestinal microbiota influences the assembly of gut-associated lymphoid tissue, helps to educate immune system, affects the integrity of the intestinal mucosal barrier, modulates proliferation and differentiation of its epithelial lineages, regulates angiogenesis, and modifies the activity of enteric as well as the central nervous system. Despite these important effects, the mechanisms by which the gut microbial community influences the host’s biology remain almost entirely unknown. Our aim here is to encourage empirical inquiry into the relationship between mutualism and evolutionary diversification between prokaryotes and eukaryotes, which encourage us to postulate: who is hosting whom? PMID

  1. Introns regulate the production of ribosomal proteins by modulating splicing of duplicated ribosomal protein genes

    PubMed Central

    Petibon, Cyrielle; Parenteau, Julie; Catala, Mathieu; Elela, Sherif Abou

    2016-01-01

    Most budding yeast introns exist in the many duplicated ribosomal protein genes (RPGs) and it has been posited that they remain there to modulate the expression of RPGs and cell growth in response to stress. However, the mechanism by which introns regulate the expression of RPGs and their impact on the synthesis of ribosomal proteins remain unclear. In this study, we show that introns determine the ratio of ribosomal protein isoforms through asymmetric paralog-specific regulation of splicing. Exchanging the introns and 3′ untranslated regions of the duplicated RPS9 genes altered the splicing efficiency and changed the ratio of the ribosomal protein isoforms. Mutational analysis of the RPS9 genes indicated that splicing is regulated by variations in the intron structure and the 3′ untranslated region. Together these data suggest that preferential splicing of duplicated RPGs provides a means for adjusting the ratio of different ribosomal protein isoforms, while maintaining the overall expression level of each ribosomal protein. PMID:26945043

  2. A RanGTP-independent mechanism allows ribosomal protein nuclear import for ribosome assembly.

    PubMed

    Schütz, Sabina; Fischer, Ute; Altvater, Martin; Nerurkar, Purnima; Peña, Cohue; Gerber, Michaela; Chang, Yiming; Caesar, Stefanie; Schubert, Olga T; Schlenstedt, Gabriel; Panse, Vikram G

    2014-01-01

    Within a single generation time a growing yeast cell imports ∼14 million ribosomal proteins (r-proteins) into the nucleus for ribosome production. After import, it is unclear how these intrinsically unstable and aggregation-prone proteins are targeted to the ribosome assembly site in the nucleolus. Here, we report the discovery of a conserved nuclear carrier Tsr2 that coordinates transfer of the r-protein eS26 to the earliest assembling pre-ribosome, the 90S. In vitro studies revealed that Tsr2 efficiently dissociates importin:eS26 complexes via an atypical RanGTP-independent mechanism that terminates the import process. Subsequently, Tsr2 binds the released eS26, shields it from proteolysis, and ensures its safe delivery to the 90S pre-ribosome. We anticipate similar carriers-termed here escortins-to securely connect the nuclear import machinery with pathways that deposit r-proteins onto developing pre-ribosomal particles. PMID:25144938

  3. A RanGTP-independent mechanism allows ribosomal protein nuclear import for ribosome assembly

    PubMed Central

    Schütz, Sabina; Fischer, Ute; Altvater, Martin; Nerurkar, Purnima; Peña, Cohue; Gerber, Michaela; Chang, Yiming; Caesar, Stefanie; Schubert, Olga T; Schlenstedt, Gabriel; Panse, Vikram G

    2014-01-01

    Within a single generation time a growing yeast cell imports ∼14 million ribosomal proteins (r-proteins) into the nucleus for ribosome production. After import, it is unclear how these intrinsically unstable and aggregation-prone proteins are targeted to the ribosome assembly site in the nucleolus. Here, we report the discovery of a conserved nuclear carrier Tsr2 that coordinates transfer of the r-protein eS26 to the earliest assembling pre-ribosome, the 90S. In vitro studies revealed that Tsr2 efficiently dissociates importin:eS26 complexes via an atypical RanGTP-independent mechanism that terminates the import process. Subsequently, Tsr2 binds the released eS26, shields it from proteolysis, and ensures its safe delivery to the 90S pre-ribosome. We anticipate similar carriers—termed here escortins—to securely connect the nuclear import machinery with pathways that deposit r-proteins onto developing pre-ribosomal particles. DOI: http://dx.doi.org/10.7554/eLife.03473.001 PMID:25144938

  4. Arabidopsis protein arginine methyltransferase 3 is required for ribosome biogenesis by affecting precursor ribosomal RNA processing

    PubMed Central

    Hang, Runlai; Liu, Chunyan; Ahmad, Ayaz; Zhang, Yong; Lu, Falong; Cao, Xiaofeng

    2014-01-01

    Ribosome biogenesis is a fundamental and tightly regulated cellular process, including synthesis, processing, and assembly of rRNAs with ribosomal proteins. Protein arginine methyltransferases (PRMTs) have been implicated in many important biological processes, such as ribosome biogenesis. Two alternative precursor rRNA (pre-rRNA) processing pathways coexist in yeast and mammals; however, how PRMT affects ribosome biogenesis remains largely unknown. Here we show that Arabidopsis PRMT3 (AtPRMT3) is required for ribosome biogenesis by affecting pre-rRNA processing. Disruption of AtPRMT3 results in pleiotropic developmental defects, imbalanced polyribosome profiles, and aberrant pre-rRNA processing. We further identify an alternative pre-rRNA processing pathway in Arabidopsis and demonstrate that AtPRMT3 is required for the balance of these two pathways to promote normal growth and development. Our work uncovers a previously unidentified function of PRMT in posttranscriptional regulation of rRNA, revealing an extra layer of complexity in the regulation of ribosome biogenesis. PMID:25352672

  5. Synchronization of eukaryotic cells by periodic forcing.

    PubMed

    Battogtokh, Dorjsuren; Aihara, Kazuyuki; Tyson, John J

    2006-04-14

    We study a cell population described by a minimal mathematical model of the eukaryotic cell cycle subject to periodic forcing that simultaneously perturbs the dynamics of the cell cycle engine and cell growth, and we show that the population can be synchronized in a mode-locked regime. By simplifying the model to two variables, for the phase of cell cycle progression and the mass of the cell, we calculate the Lyapunov exponents to obtain the parameter window for synchronization. We also discuss the effects of intrinsic mitotic fluctuations, asymmetric division, and weak mutual coupling on the pace of synchronization. PMID:16712125

  6. Expression of eukaryotic polypeptides in chloroplasts

    DOEpatents

    Mayfield, Stephen P

    2013-06-04

    The present invention relates to a gene expression system in eukaryotic and prokaryotic cells, preferably plant cells and intact plants. In particular, the invention relates to an expression system having a RB47 binding site upstream of a translation initiation site for regulation of translation mediated by binding of RB47 protein, a member of the poly(A) binding protein family. Regulation is further effected by RB60, a protein disulfide isomerase. The expression system is capable of functioning in the nuclear/cytoplasm of cells and in the chloroplast of plants. Translation regulation of a desired molecule is enhanced approximately 100 fold over that obtained without RB47 binding site activation.

  7. Polyamines in Eukaryotes, Bacteria, and Archaea.

    PubMed

    Michael, Anthony J

    2016-07-15

    Polyamines are primordial polycations found in most cells and perform different functions in different organisms. Although polyamines are mainly known for their essential roles in cell growth and proliferation, their functions range from a critical role in cellular translation in eukaryotes and archaea, to bacterial biofilm formation and specialized roles in natural product biosynthesis. At first glance, the diversity of polyamine structures in different organisms appears chaotic; however, biosynthetic flexibility and evolutionary and ecological processes largely explain this heterogeneity. In this review, I discuss the biosynthetic, evolutionary, and physiological processes that constrain or expand polyamine structural and functional diversity. PMID:27268252

  8. Activation of cap-independent translation by variant eukaryotic initiation factor 4G in vivo

    PubMed Central

    Kaiser, Constanze; Dobrikova, Elena Y.; Bradrick, Shelton S.; Shveygert, Mayya; Herbert, James T.; Gromeier, Matthias

    2008-01-01

    Protein synthesis is tightly controlled by assembly of an intricate ribonucleoprotein complex at the m7GTP-cap on eukaryotic mRNAs. Ensuing linear scanning of the 5′ untranslated region (UTR) is believed to transfer the preinitiation complex to the initiation codon. Eukaryotic mRNAs are characterized by significant 5′ UTR heterogeneity, raising the possibility of differential control of translation initiation rate at individual mRNAs. Curiously, many mRNAs with unconventional, highly structured 5′ UTRs encode proteins with central biological roles in growth control, metabolism, or stress response. The 5′ UTRs of such mRNAs may influence protein synthesis rate in multiple ways, but most significantly they have been implicated in mediating alternative means of translation initiation. Cap-independent initiation bypasses strict control over the formation of initiation intermediates at the m7GTP cap. However, the molecular mechanisms that favor alternative means of ribosome recruitment are not understood. Here we provide evidence that eukaryotic initiation factor (eIF) 4G controls cap-independent translation initiation at the c-myc and vascular endothelial growth factor (VEGF) 5′ UTRs in vivo. Cap-independent translation was investigated in tetracycline-inducible cell lines expressing either full-length eIF4G or a C-terminal fragment (Ct) lacking interaction with eIF4E and poly(A) binding protein. Expression of Ct, but not intact eIF4G, potently stimulated cap-independent initiation at the c-myc/VEGF 5′ UTRs. In vitro RNA-binding assays suggest that stimulation of cap-independent translation initiation by Ct is due to direct association with the c-myc/VEGF 5′ UTR, enabling 43S preinitiation complex recruitment. Our work demonstrates that variant translation initiation factors enable unconventional translation initiation at mRNA subsets with distinct structural features. PMID:18755839

  9. Contribution of the 80s loop of HIV-1 protease to the multidrug-resistance mechanism: crystallographic study of MDR769 HIV-1 protease variants

    SciTech Connect

    Yedidi, Ravikiran S.; Proteasa, Georghe; Martinez, Jorge L.; Vickrey, John F.; Martin, Philip D.; Wawrzak, Zdzislaw; Liu, Zhigang; Kovari, Iulia A.; Kovari, Ladislau C.

    2011-09-06

    The flexible flaps and the 80s loops (Pro79-Ile84) of HIV-1 protease are crucial in inhibitor binding. Previously, it was reported that the crystal structure of multidrug-resistant 769 (MDR769) HIV-1 protease shows a wide-open conformation of the flaps owing to conformational rigidity acquired by the accumulation of mutations. In the current study, the effect of mutations on the conformation of the 80s loop of MDR769 HIV-1 protease variants is reported. Alternate conformations of Pro81 (proline switch) with a root-mean-square deviation of 3-4.8 {angstrom} in the C{alpha} atoms of the I10V mutant and a side chain with a 'flipped-out' conformation in the A82F mutant cause distortion in the S1/S1' binding pockets that affects inhibitor binding. The A82S and A82T mutants show local changes in the electrostatics of inhibitor binding owing to the mutation from nonpolar to polar residues. In summary, the crystallographic studies of four variants of MDR769 HIV-1 protease presented in this article provide new insights towards understanding the drug-resistance mechanism as well as a basis for design of future protease inhibitors with enhanced potency.

  10. Reconstructing the mosaic glycolytic pathway of the anaerobic eukaryote Monocercomonoides.

    PubMed

    Liapounova, Natalia A; Hampl, Vladimir; Gordon, Paul M K; Sensen, Christoph W; Gedamu, Lashitew; Dacks, Joel B

    2006-12-01

    All eukaryotes carry out glycolysis, interestingly, not all using the same enzymes. Anaerobic eukaryotes face the challenge of fewer molecules of ATP extracted per molecule of glucose due to their lack of a complete tricarboxylic acid cycle. This may have pressured anaerobic eukaryotes to acquire the more ATP-efficient alternative glycolytic enzymes, such as pyrophosphate-fructose 6-phosphate phosphotransferase and pyruvate orthophosphate dikinase, through lateral gene transfers from bacteria and other eukaryotes. Most studies of these enzymes in eukaryotes involve pathogenic anaerobes; Monocercomonoides, an oxymonad belonging to the eukaryotic supergroup Excavata, is a nonpathogenic anaerobe representing an evolutionarily and ecologically distinct sampling of an anaerobic glycolytic pathway. We sequenced cDNA encoding glycolytic enzymes from a previously established cDNA library of Monocercomonoides and analyzed the relationships of these enzymes to those from other organisms spanning the major groups of Eukaryota, Bacteria, and Archaea. We established that, firstly, Monocercomonoides possesses alternative versions of glycolytic enzymes: fructose-6-phosphate phosphotransferase, both pyruvate kinase and pyruvate orthophosphate dikinase, cofactor-independent phosphoglycerate mutase, and fructose-bisphosphate aldolase (class II, type B). Secondly, we found evidence for the monophyly of oxymonads, kinetoplastids, diplomonads, and parabasalids, the major representatives of the Excavata. We also found several prokaryote-to-eukaryote as well as eukaryote-to-eukaryote lateral gene transfers involving glycolytic enzymes from anaerobic eukaryotes, further suggesting that lateral gene transfer was an important factor in the evolution of this pathway for denizens of this environment. PMID:17071828

  11. Prototypes for the 80s.

    ERIC Educational Resources Information Center

    Instructor, 1980

    1980-01-01

    Presented are brief descriptions of the winning entries in this magazine's contest for existing programs to serve as prototypes for wide-scale use in elementary schools of the 1980s. Top prizes went to computer literacy, energy education, and nutrition projects. Twenty runners-up are also described. Project addresses are included. (SJL)

  12. Challenges for the 80's

    SciTech Connect

    Lesch, J.R.

    1980-09-01

    Finding and developing the necessary petroleum reserves in the 1980's will require drilling deeper wells in more hostile environments, drilling in increasing water depths, drilling in hostile Arctic areas and in waters where icebergs must be dealt with, and exploring deeper onshore horizons in more difficult topographical areas. These conditions impose severe demands on drilling and production equipment. The deeper wells will challenge drilling and production capabilities because of higher down-hole temperatures, greater capacity requirements on surface equipment, and more critical demands on the associated down-hole equipment. Drilling fluids, tools, and elastomers will need to withstand higher temperatures and greater stresses. Drilling in deeper waters will require the development and refinement of better and more economical drilling and production platforms. Increased drilling from platforms will necessitate improved drilling fluids to minimize torque, drill string, and casing wear in highly deviated holes. Another technological challenge is rig automation to minimize the physical work and injury factors associated with tripping and to reduce personnel requirements on the drilling rig.

  13. Horizontal Transfer and Evolution of Prokaryote Transposable Elements in Eukaryotes

    PubMed Central

    Gilbert, Clément; Cordaux, Richard

    2013-01-01

    Horizontal transfer (HT) of transposable elements (TEs) plays a key role in prokaryotic evolution, and mounting evidence suggests that it has also had an important impact on eukaryotic evolution. Although many prokaryote-to-prokaryote and eukaryote-to-eukaryote HTs of TEs have been characterized, only few cases have been reported between prokaryotes and eukaryotes. Here, we carried out a comprehensive search for all major groups of prokaryotic insertion sequences (ISs) in 430 eukaryote genomes. We uncovered a total of 80 sequences, all deriving from the IS607 family, integrated in the genomes of 14 eukaryote species belonging to four distinct phyla (Amoebozoa, Ascomycetes, Basidiomycetes, and Stramenopiles). Given that eukaryote IS607-like sequences are most closely related to cyanobacterial IS607 and that their phylogeny is incongruent with that of their hosts, we conclude that the presence of IS607-like sequences in eukaryotic genomes is the result of several HT events. Selection analyses further suggest that our ability to detect these prokaryote TEs today in eukaryotes is because HT of these sequences occurred recently and/or some IS607 elements were domesticated after HT, giving rise to new eukaryote genes. Supporting the recent age of some of these HTs, we uncovered intact full-length, potentially active IS607 copies in the amoeba Acanthamoeba castellani. Overall, our study shows that prokaryote-to-eukaryote HT of TEs occurred at relatively low frequency during recent eukaryote evolution and it sets IS607 as the most widespread TE (being present in prokaryotes, eukaryotes, and viruses). PMID:23563966

  14. Recent structural studies on Dom34/aPelota and Hbs1/aEF1α: important factors for solving general problems of ribosomal stall in translation

    PubMed Central

    Kobayashi, Kan; Ishitani, Ryuichiro; Nureki, Osamu

    2013-01-01

    In the translation process, translating ribosomes usually move on an mRNA until they reach the stop codon. However, when ribosomes translate an aberrant mRNA, they stall. Then, ribosomes are rescued from the aberrant mRNA, and the aberrant mRNA is subsequently degraded. In eukaryotes, Pelota (Dom34 in yeast) and Hbs1 are responsible for solving general problems of ribosomal stall in translation. In archaea, aPelota and aEF1α, homologous to Pelota and Hbs1, respectively, are considered to be involved in that process. In recent years, great progress has been made in determining structures of Dom34/aPelota and Hbs1/aEF1α. In this review, we focus on the functional roles of Dom34/aPelota and Hbs1/aEF1α in ribosome rescue, based on recent structural studies of them. We will also present questions to be answered by future work. PMID:27493551

  15. A stable hairpin preceded by a short open reading frame promotes nonlinear ribosome migration on a synthetic mRNA leader.

    PubMed Central

    Hemmings-Mieszczak, M; Hohn, T

    1999-01-01

    The regulation of cauliflower mosaic virus (CaMV) pregenomic 35S RNA translation occurs via nonlinear ribosome migration (ribosome shunt) and is mediated by an elongated hairpin structure in the leader. The replacement of the viral leader by a series of short, low-energy stems in either orientation supports efficient ribosomal shunting, showing that the stem per se, and not its sequence, is recognized by the translation machinery. The requirement for cis-acting sequences from the unstructured terminal regions of the viral leader was analyzed: the 5'-terminal polypyrimidine stretch and the short upstream open reading frame (uORF) A stimulate translation, whereas the 3'-flanking region seems not to be essential. Based on these results, an artificial leader was designed with a stable stem flanked by unstructured sequences derived from parts of the 5'- and 3'-proximal regions of the CaMV 35S RNA leader. This artificial leader is shunt-competent in translation assays in vivo and in vitro, indicating that a low-energy stem, broadly used as a device to successfully interfere with ribosome scanning, can efficiently support translation, if preceded by a short uORF. The synthetic 140-nt leader can functionally replace the CaMV 35S RNA 600-nt leader, thus implicating the universal role that nonlinear ribosome scanning could play in translation initiation in eukaryotes. PMID:10496216

  16. Eukaryotic and Prokaryotic Cytoskeletons: Structure and Mechanics

    NASA Astrophysics Data System (ADS)

    Gopinathan, Ajay

    2013-03-01

    The eukaryotic cytoskeleton is an assembly of filamentous proteins and a host of associated proteins that collectively serve functional needs ranging from spatial organization and transport to the production and transmission of forces. These systems can exhibit a wide variety of non-equilibrium, self-assembled phases depending on context and function. While much recent progress has been made in understanding the self-organization, rheology and nonlinear mechanical properties of such active systems, in this talk, we will concentrate on some emerging aspects of cytoskeletal physics that are promising. One such aspect is the influence of cytoskeletal network topology and its dynamics on both active and passive intracellular transport. Another aspect we will highlight is the interplay between chirality of filaments, their elasticity and their interactions with the membrane that can lead to novel conformational states with functional implications. Finally we will consider homologs of cytoskeletal proteins in bacteria, which are involved in templating cell growth, segregating genetic material and force production, which we will discuss with particular reference to contractile forces during cell division. These prokaryotic structures function in remarkably similar yet fascinatingly different ways from their eukaryotic counterparts and can enrich our understanding of cytoskeletal functioning as a whole.

  17. Phosphorylation Stoichiometries of Human Eukaryotic Initiation Factors

    PubMed Central

    Andaya, Armann; Villa, Nancy; Jia, Weitao; Fraser, Christopher S.; Leary, Julie A.

    2014-01-01

    Eukaryotic translation initiation factors are the principal molecular effectors regulating the process converting nucleic acid to functional protein. Commonly referred to as eIFs (eukaryotic initiation factors), this suite of proteins is comprised of at least 25 individual subunits that function in a coordinated, regulated, manner during mRNA translation. Multiple facets of eIF regulation have yet to be elucidated; however, many of the necessary protein factors are phosphorylated. Herein, we have isolated, identified and quantified phosphosites from eIF2, eIF3, and eIF4G generated from log phase grown HeLa cell lysates. Our investigation is the first study to globally quantify eIF phosphosites and illustrates differences in abundance of phosphorylation between the residues of each factor. Thus, identification of those phosphosites that exhibit either high or low levels of phosphorylation under log phase growing conditions may aid researchers to concentrate their investigative efforts to specific phosphosites that potentially harbor important regulatory mechanisms germane to mRNA translation. PMID:24979134

  18. Viruses and viruslike particles of eukaryotic algae.

    PubMed Central

    Van Etten, J L; Lane, L C; Meints, R H

    1991-01-01

    Until recently there was little interest or information on viruses and viruslike particles of eukaryotic algae. However, this situation is changing. In the past decade many large double-stranded DNA-containing viruses that infect two culturable, unicellular, eukaryotic green algae have been discovered. These viruses can be produced in large quantities, assayed by plaque formation, and analyzed by standard bacteriophage techniques. The viruses are structurally similar to animal iridoviruses, their genomes are similar to but larger (greater than 300 kbp) than that of poxviruses, and their infection process resembles that of bacteriophages. Some of the viruses have DNAs with low levels of methylated bases, whereas others have DNAs with high concentrations of 5-methylcytosine and N6-methyladenine. Virus-encoded DNA methyltransferases are associated with the methylation and are accompanied by virus-encoded DNA site-specific (restriction) endonucleases. Some of these enzymes have sequence specificities identical to those of known bacterial enzymes, and others have previously unrecognized specificities. A separate rod-shaped RNA-containing algal virus has structural and nucleotide sequence affinities to higher plant viruses. Quite recently, viruses have been associated with rapid changes in marine algal populations. In the next decade we envision the discovery of new algal viruses, clarification of their role in various ecosystems, discovery of commercially useful genes in these viruses, and exploitation of algal virus genetic elements in plant and algal biotechnology. Images PMID:1779928

  19. Extremophilic Eukaryote Life in Hawaiian Fumaroles

    NASA Astrophysics Data System (ADS)

    Ackerman, C.; Anderson, S.; Anderson, C.

    2008-12-01

    Extremophilic microorganisms exist in all three domains of life (Eukarya, Archaea, Bacteria), but are less known in eukaryotes. Fumaroles provide heat and moisture characteristic of an environment suitable for these organisms. On the Island of Hawaii, fumaroles are scattered across the southeastern portion of the island as a result of the volcanic activity from Kilauea Crater and Pu'u' O'o vent with all forming within geochemically similar basalt substrates. We used metagenomics to detect 18S rDNA from eukaryotic extremophilic microorganisms indicating their presence in Hawaiian fumaroles. To determine the effects of environmental gradients (temperature and pH) on microbial diversity within and among fumaroles, 11 samples from 3 fumaroles were collected over a three-day period in February of 2007. Temperatures of the different fumaroles range from 31.0oC to 62.7oC, with pH values that vary from 2.55 to 6.93 allowing for 8 different microenvironments. Fifty sequences per sample were analyzed with eighteen different organisms identified, the majority belonging to the family Cercozoa. The most diverse fumarole consisted of 8 different genera residing in a temperature of 34.1oC and a pH of 3.0. Unclassified mosses were identified in the fumarole with the highest temperature and Phaeoceros (hornworts) were identified at the most acidic fumarole. Both of these groups have been previously identified in geothermal areas.

  20. Eukaryotic replication origins: Strength in flexibility

    PubMed Central

    Kumar, Charanya; Remus, Dirk

    2016-01-01

    ABSTRACT The eukaryotic replicative DNA helicase, Mcm2-7, is loaded in inactive form as a double hexameric complex around double-stranded DNA. To ensure that replication origins fire no more than once per S phase, activation of the Mcm2-7 helicase is temporally separated from Mcm2-7 loading in the cell cycle. This 2-step mechanism requires that inactive Mcm2-7 complexes be maintained for variable periods of time in a topologically bound state on chromatin, which may create a steric obstacle to other DNA transactions. We have recently found in the budding yeast, Saccharomyces cerevisiae, that Mcm2-7 double hexamers can respond to collisions with transcription complexes by sliding along the DNA template. Importantly, Mcm2-7 double hexamers remain functional after displacement along DNA and support replication initiation from sites distal to the origin. These results reveal a novel mechanism to specify eukaryotic replication origin sites and to maintain replication origin competence without the need for Mcm2-7 reloading. PMID:27416360

  1. The architecture of a eukaryotic replisome

    DOE PAGESBeta

    Sun, Jingchuan; Yuan, Zuanning; Shi, Yi; Georgescu, Roxana E.; Chait, Brian T.; Li, Huilin; O'Donnell, Michael E.

    2015-11-02

    At the eukaryotic DNA replication fork, it is widely believed that the Cdc45–Mcm2–7–GINS (CMG) helicase is positioned in front to unwind DNA and that DNA polymerases trail behind the helicase. Here we used single-particle EM to directly image a Saccharomyces cerevisiae replisome. Contrary to expectations, the leading strand Pol ε is positioned ahead of CMG helicase, whereas Ctf4 and the lagging-strand polymerase (Pol) α–primase are behind the helicase. This unexpected architecture indicates that the leading-strand DNA travels a long distance before reaching Pol ε, first threading through the Mcm2–7 ring and then making a U-turn at the bottom and reachingmore » Pol ε at the top of CMG. Lastly, our work reveals an unexpected configuration of the eukaryotic replisome, suggests possible reasons for this architecture and provides a basis for further structural and biochemical replisome studies.« less

  2. The Genes for Cytoplasmic Ribosomal Ribonucleic Acid in Higher Plants

    PubMed Central

    Scott, N. Steele; Ingle, J.

    1973-01-01

    The genes for cytoplasmic ribosomal RNA are partially resolved from the bulk of the DNA by CsCl equilibrium centrifugation. Although in some plants the buoyant density of the ribosomal RNA genes is as expected from the base composition of ribosomal RNA, others show a large discrepancy which cannot be due to the presence of low G-C spacer-DNA. The cross-hybridization observed with 1.3 and 0.7 × 106 molecular weight ribosomal RNAs and DNA, which varies greatly with different plant species, is not due to contamination of the ribosomal RNAs, and is specific for the ribosomal DNA of each species, probably largely restricted to those sequences coding for the two stable ribosomal RNAs. The double reciprocal plot may be used for the extrapolation of saturation values only with caution, because in these cases such plots are not linear over the whole of the hybridization reaction. PMID:16658392

  3. Origins of prokaryotes, eukaryotes, mitochondria, and chloroplasts

    NASA Technical Reports Server (NTRS)

    Schwartz, R. M.; Dayhoff, M. O.

    1978-01-01

    A computer branching model is used to analyze cellular evolution. Attention is given to certain key amino acids and nucleotide residues (ferredoxin, 5s ribosomal RNA, and c-type cytochromes) because of their commonality over a wide variety of cell types. Each amino acid or nucleotide residue is a sequence in an inherited biological trait; and the branching method is employed to align sequences so that changes reflect substitution of one residue for another. Based on the computer analysis, the symbiotic theory of cellular evolution is considered the most probable. This theory holds that organelles, e.g., mitochondria and chloroplasts invaded larger bodies, e.g., bacteria, and combined functions to form eucaryotic cells.

  4. Immature large ribosomal subunits containing the 7S pre-rRNA can engage in translation in Saccharomyces cerevisiae.

    PubMed

    Rodríguez-Galán, Olga; García-Gómez, Juan J; Kressler, Dieter; de la Cruz, Jesús

    2015-01-01

    Evolution has provided eukaryotes with mechanisms that impede immature and/or aberrant ribosomes to engage in translation. These mechanisms basically either prevent the nucleo-cytoplasmic export of these particles or, once in the cytoplasm, the release of associated assembly factors, which interfere with the binding of translation initiation factors and/or the ribosomal subunit joining. We have previously shown that aberrant yeast 40S ribosomal subunits containing the 20S pre-rRNA can engage in translation. In this study, we describe that cells harbouring the dob1-1 allele, encoding a mutated version of the exosome-assisting RNA helicase Mtr4, accumulate otherwise nuclear pre-60S ribosomal particles containing the 7S pre-rRNA in the cytoplasm. Polysome fractionation analyses revealed that these particles are competent for translation and do not induce elongation stalls. This phenomenon is rather specific since most mutations in other exosome components or co-factors, impairing the 3' end processing of the mature 5.8S rRNA, accumulate 7S pre-rRNAs in the nucleus. In addition, we confirm that pre-60S ribosomal particles containing either 5.8S + 30 or 5.8S + 5 pre-rRNAs also engage in translation elongation. We propose that 7S pre-rRNA processing is not strictly required for pre-60S r-particle export and that, upon arrival in the cytoplasm, there is no specific mechanism to prevent translation by premature pre-60S r-particles containing 3' extended forms of mature 5.8S rRNA. PMID:26151772

  5. Direct Activation of Ribosome-Associated Double-Stranded RNA-Dependent Protein Kinase (PKR) by Deoxynivalenol, Anisomycin and Ricin: A New Model for Ribotoxic Stress Response Induction

    PubMed Central

    Zhou, Hui-Ren; He, Kaiyu; Landgraf, Jeff; Pan, Xiao; Pestka, James J.

    2014-01-01

    Double-stranded RNA (dsRNA)-activated protein kinase (PKR) is a critical upstream mediator of the ribotoxic stress response (RSR) to the trichothecene deoxynivalenol (DON) and other translational inhibitors. Here, we employed HeLa cell lysates to: (1) characterize PKR’s interactions with the ribosome and ribosomal RNA (rRNA); (2) demonstrate cell-free activation of ribosomal-associated PKR and (3) integrate these findings in a unified model for RSR. Robust PKR-dependent RSR was initially confirmed in intact cells. PKR basally associated with 40S, 60S, 80S and polysome fractions at molar ratios of 7, 2, 23 and 3, respectively. Treatment of ATP-containing HeLa lysates with DON or the ribotoxins anisomycin and ricin concentration-dependently elicited phosphorylation of PKR and its substrate eIF2α. These phosphorylations could be blocked by PKR inhibitors. rRNA immunoprecipitation (RNA-IP) of HeLa lysates with PKR-specific antibody and sequencing revealed that in the presence of DON or not, the kinase associated with numerous discrete sites on both the 18S and 28S rRNA molecules, a number of which contained double-stranded hairpins. These findings are consistent with a sentinel model whereby multiple PKR molecules basally associate with the ribosome positioning them to respond to ribotoxin-induced alterations in rRNA structure by dimerizing, autoactivating and, ultimately, evoking RSR. PMID:25521494

  6. Identification of eukaryotic and prokaryotic methylthiotransferase for biosynthesis of 2-methylthio-N6-threonylcarbamoyladenosine in tRNA.

    PubMed

    Arragain, Simon; Handelman, Samuel K; Forouhar, Farhad; Wei, Fan-Yan; Tomizawa, Kazuhito; Hunt, John F; Douki, Thierry; Fontecave, Marc; Mulliez, Etienne; Atta, Mohamed

    2010-09-10

    Bacterial and eukaryotic transfer RNAs have been shown to contain hypermodified adenosine, 2-methylthio-N(6)-threonylcarbamoyladenosine, at position 37 (A(37)) adjacent to the 3'-end of the anticodon, which is essential for efficient and highly accurate protein translation by the ribosome. Using a combination of bioinformatic sequence analysis and in vivo assay coupled to HPLC/MS technique, we have identified, from distinct sequence signatures, two methylthiotransferase (MTTase) subfamilies, designated as MtaB in bacterial cells and e-MtaB in eukaryotic and archaeal cells. Both subfamilies are responsible for the transformation of N(6)-threonylcarbamoyladenosine into 2-methylthio-N(6)-threonylcarbamoyladenosine. Recently, a variant within the human CDKAL1 gene belonging to the e-MtaB subfamily was shown to predispose for type 2 diabetes. CDKAL1 is thus the first eukaryotic MTTase identified so far. Using purified preparations of Bacillus subtilis MtaB (YqeV), a CDKAL1 bacterial homolog, we demonstrate that YqeV/CDKAL1 enzymes, as the previously studied MTTases MiaB and RimO, contain two [4Fe-4S] clusters. This work lays the foundation for elucidating the function of CDKAL1. PMID:20584901

  7. The Genome of Naegleria gruberi Illuminates Early Eukaryotic Versatility

    SciTech Connect

    Fritz-Laylin, Lillian K.; Prochnik, Simon E.; Ginger, Michael L.; Dacks, Joel; Carpenter, Meredith L.; Field, Mark C.; Kuo, Alan; Paredez, Alex; Chapman, Jarrod; Pham, Jonathan; Shu, Shengqiang; Neupane, Rochak; Cipriano, Michael; Mancuso, Joel; Tu, Hank; Salamov, Asaf; Lindquist, Erika; Shapiro, Harris; Lucas, Susan; Grigoriev, Igor V.; Cande, W. Zacheus; Fulton, Chandler; Rokhsar, Daniel S.; Dawson, Scott C.

    2010-03-01

    Genome sequences of diverse free-living protists are essential for understanding eukaryotic evolution and molecular and cell biology. The free-living amoeboflagellate Naegleria gruberi belongs to a varied and ubiquitous protist clade (Heterolobosea) that diverged from other eukaryotic lineages over a billion years ago. Analysis of the 15,727 protein-coding genes encoded by Naegleria's 41 Mb nuclear genome indicates a capacity for both aerobic respiration and anaerobic metabolism with concomitant hydrogen production, with fundamental implications for the evolution of organelle metabolism. The Naegleria genome facilitates substantially broader phylogenomic comparisons of free-living eukaryotes than previously possible, allowing us to identify thousands of genes likely present in the pan-eukaryotic ancestor, with 40% likely eukaryotic inventions. Moreover, we construct a comprehensive catalog of amoeboid-motility genes. The Naegleria genome, analyzed in the context of other protists, reveals a remarkably complex ancestral eukaryote with a rich repertoire of cytoskeletal, sexual, signaling, and metabolic modules.

  8. Ribosomal Mutations in Streptococcus pneumoniae Clinical Isolates

    PubMed Central

    Pihlajamäki, Marja; Kataja, Janne; Seppälä, Helena; Elliot, John; Leinonen, Maija; Huovinen, Pentti; Jalava, Jari

    2002-01-01

    Eleven clinical isolates of Streptococcus pneumoniae, isolated in Finland during 1996 to 2000, had an unusual macrolide resistance phenotype. They were resistant to macrolides and streptogramin B but susceptible, intermediate, or low-level resistant to lincosamides. No acquired macrolide resistance genes were detected from the strains. The isolates were found to have mutations in domain V of the 23S rRNA or ribosomal protein L4. Seven isolates had an A2059C mutation in two to four out of the four alleles encoding the 23S rRNA, two isolates had an A2059G mutation in two alleles, one isolate had a C2611G mutation in all four alleles, and one isolate had a 69GTG71-to-69TPS71 substitution in ribosomal protein L4. PMID:11850244

  9. Navigating the ribosome's metastable energy landscape.

    PubMed

    Munro, James B; Sanbonmatsu, Kevin Y; Spahn, Christian M T; Blanchard, Scott C

    2009-08-01

    The molecular mechanisms by which tRNA molecules enter and transit the ribosome during mRNA translation remains elusive. However, recent genetic, biochemical and structural studies offer important new findings into the ordered sequence of events underpinning the translocation process that help place the molecular mechanism within reach. In particular, new structural and kinetic insights have been obtained regarding tRNA movements through 'hybrid state' configurations. These dynamic views reveal that the macromolecular ribosome particle, like many smaller proteins, has an intrinsic capacity to reversibly sample an ensemble of similarly stable native states. Such perspectives suggest that substrates, factors and environmental cues contribute to translation regulation by helping the dynamic system navigate through a highly complex and metastable energy landscape. PMID:19647434

  10. Energy landscape of the ribosomal decoding center.

    PubMed

    Sanbonmatsu, K Y

    2006-08-01

    The ribosome decodes the genetic information that resides in nucleic acids. A key component of the decoding mechanism is a conformational switch in the decoding center of the small ribosomal subunit discovered in high-resolution X-ray crystallography studies. It is known that small subunit nucleotides A1492 and A1493 flip out of helix 44 upon transfer RNA (tRNA) binding; however, the operation principles of this switch remain unknown. Replica molecular dynamics simulations reveal a low free energy barrier between flipped-out and flipped-in states, consistent with a switch that can be controlled by shifting the equilibrium between states. The barrier determined by the simulations is sufficiently small for the binding of ligands, such as tRNAs or aminoglycoside antibiotics, to shift the equilibrium. PMID:16905237

  11. Evidence for a Negative Cooperativity between eIF5A and eEF2 on Binding to the Ribosome

    PubMed Central

    Galvão, Fabio C.; Boldrin, Paulo E. G.; Hershey, John W. B.; Zanelli, Cleslei F.; Fraser, Christopher S.; Valentini, Sandro R.

    2016-01-01

    eIF5A is the only protein known to contain the essential and unique amino acid residue hypusine. eIF5A functions in both translation initiation due to its stimulation of methionyl-puromycin synthesis and translation elongation, being highly required for peptide-bound formation of specific ribosome stalling sequences such as poly-proline. The functional interaction between eIF5A, tRNA, and eEF2 on the surface of the ribosome is further clarified herein. Fluorescence anisotropy assays were performed to determine the affinity of eIF5A to different ribosomal complexes and reveal its interaction exclusively and directly with the 60S ribosomal subunit in a hypusine-dependent manner (Ki60S-eIF5A-Hyp = 16 nM, Ki60S-eIF5A-Lys = 385 nM). A 3-fold increase in eIF5A affinity to the 80S is observed upon charged-tRNAiMet binding, indicating positive cooperativity between P-site tRNA binding and eIF5A binding to the ribosome. Previously identified conditional mutants of yeast eIF5A, eIF5AQ22H/L93F and eIF5AK56A, display a significant decrease in ribosome binding affinity. Binding affinity between ribosome and eIF5A-wild type or mutants eIF5AK56A, but not eIF5AQ22H/L93F, is impaired in the presence of eEF2 by 4-fold, consistent with negative cooperativity between eEF2 and eIF5A binding to the ribosome. Interestingly, high-copy eEF2 is toxic only to eIF5AQ22H/L93F and causes translation elongation defects in this mutant. These results suggest that binding of eEF2 to the ribosome alters its conformation, resulting in a weakened affinity of eIF5A and impairment of this interplay compromises cell growth due to translation elongation defects. PMID:27115996

  12. Structural snapshots of actively translating human ribosomes.

    PubMed

    Behrmann, Elmar; Loerke, Justus; Budkevich, Tatyana V; Yamamoto, Kaori; Schmidt, Andrea; Penczek, Pawel A; Vos, Matthijn R; Bürger, Jörg; Mielke, Thorsten; Scheerer, Patrick; Spahn, Christian M T

    2015-05-01

    Macromolecular machines, such as the ribosome, undergo large-scale conformational changes during their functional cycles. Although their mode of action is often compared to that of mechanical machines, a crucial difference is that, at the molecular dimension, thermodynamic effects dominate functional cycles, with proteins fluctuating stochastically between functional states defined by energetic minima on an energy landscape. Here, we have used cryo-electron microscopy to image ex-vivo-derived human polysomes as a source of actively translating ribosomes. Multiparticle refinement and 3D variability analysis allowed us to visualize a variety of native translation intermediates. Significantly populated states include not only elongation cycle intermediates in pre- and post-translocational states, but also eEF1A-containing decoding and termination/recycling complexes. Focusing on the post-translocational state, we extended this assessment to the single-residue level, uncovering striking details of ribosome-ligand interactions and identifying both static and functionally important dynamic elements. PMID:25957688

  13. Structural snapshots of actively translating human ribosomes

    PubMed Central

    Behrmann, Elmar; Loerke, Justus; Budkevich, Tatyana V.; Yamamoto, Kaori; Schmidt, Andrea; Penczek, Pawel A.; Vos, Matthijn R.; Bürger, Jörg; Mielke, Thorsten; Scheerer, Patrick; Spahn, Christian M.T.

    2015-01-01

    Summary Macromolecular machines, such as the ribosome, undergo large-scale conformational changes during their functional cycles. While their mode of action is often compared to that of mechanical machines, a crucial difference is that at the molecular dimension, thermodynamic effects dominate functional cycles, with proteins fluctuating stochastically between functional states defined by energetic minima on an energy landscape. Here, we have used cryo-electron microscopy to image ex vivo-derived human polysomes as a source of actively translating ribosomes. Multiparticle refinement and three-dimensional variability analysis allowed us to visualize a variety of native translation intermediates. Significantly populated states include not only elongation cycle intermediates in pre- and post-translocational states, but also eEF1A-containing decoding and termination/recycling complexes. Focusing on the post-translocational state, we extended this assessment to the single-residue level, uncovering striking details of ribosome-ligand interactions and identifying both static and functionally important dynamic elements. PMID:25957688

  14. Stochastic gating and drug-ribosome interactions.

    PubMed

    Vaiana, Andrea C; Sanbonmatsu, Kevin Y

    2009-02-27

    Gentamicin is a potent antibiotic that is used in combination therapy for inhalation anthrax disease. The drug is also often used in therapy for methicillin-resistant Staphylococcusaureus. Gentamicin works by flipping a conformational switch on the ribosome, disrupting the reading head (i.e., 16S ribosomal decoding bases 1492-1493) used for decoding messenger RNA. We use explicit solvent all-atom molecular simulation to study the thermodynamics of the ribosomal decoding site and its interaction with gentamicin. The replica exchange molecular dynamics simulations used an aggregate sampling of 15 mus when summed over all replicas, allowing us to explicitly calculate the free-energy landscape, including a rigorous treatment of enthalpic and entropic effects. Here, we show that the decoding bases flip on a timescale faster than that of gentamicin binding, supporting a stochastic gating mechanism for antibiotic binding, rather than an induced-fit model where the bases only flip in the presence of a ligand. The study also allows us to explore the nonspecific binding landscape near the binding site and reveals that, rather than a two-state bound/unbound scenario, drug dissociation entails shuttling between many metastable local minima in the free-energy landscape. Special care is dedicated to validation of the obtained results, both by direct comparison to experiment and by estimation of simulation convergence. PMID:19146858

  15. Eukaryotic gene prediction using GeneMark.hmm.

    PubMed

    Borodovsky, Mark; Lomsadze, Alex; Ivanov, Nikolai; Mills, Ryan

    2003-05-01

    In this unit, eukaryotic GeneMark.hmm is presented as a method for detecting genes in eukaryotic DNA sequences. The eukaryotic GeneMark.hmm uses Markov models of protein coding and noncoding sequences, as well as positional nucleotide frequency matrices for prediction of the translational start, translational termination and splice sites. All these models along with length distributions of exons, introns and intergenic regions are integrated into one Hidden Markov model. The unit describes running the program over the Internet and locally on a Unix machine. It also discusses GeneMarkS EV, which can be used to detect genes in eukaryotic viruses. PMID:18428701

  16. Catalytic properties of the eukaryotic exosome.

    PubMed

    Chlebowski, Aleksander; Tomecki, Rafał; López, María Eugenia Gas; Séraphin, Bertrand; Dziembowski, Andrzej

    2010-01-01

    The eukaryotic exosome complex is built around the backbone of a 9-subunit ring similar to phosporolytic ribonucleases such as RNase PH and polynucleotide phosphorylase (PNPase). Unlike those enzymes, the ring is devoid of any detectable catalytic activities, with the possible exception of the plant version of the complex. Instead, the essential RNA decay capability is supplied by associated hydrolytic ribonucleases belonging to the Dis3 and Rrp6 families. Dis3 proteins are endowed with two different activities: the long known processive 3'-5' exonucleolytic one and the recently discovered endonucleolytic one. Rrp6 proteins are distributive exonucleases. This chapter will review the current knowledge about the catalytic properties of theses nucleases and their interplay within the exosome holocomplex. PMID:21618875

  17. Catalytic properties of the eukaryotic exosome.

    PubMed

    Chlebowski, Aleksander; Tomecki, Rafał; Gas López, María Eugenia; Séraphin, Bertrand; Dziembowski, Andrzej

    2011-01-01

    The eukaryotic exosome complex is built around the backbone of a 9-subunit ring similar to phosporolytic ribonucleases such as RNase PH and polynucleotide phosphorylase (PNPase). Unlike those enzymes, the ring is devoid of any detectable catalytic activities, with the possible exception of the plant version of the complex. Instead, the essential RNA decay capability is supplied by associated hydrolytic ribonucleases belonging to the Dis3 and Rrp6 families. Dis3 proteins are endowed with two different activities: the long known processive 3'-5' exonucleolytic one and the recently discovered endonucleolytic one. Rrp6 proteins are distributive exonucleases. This chapter will review the current knowledge about the catalytic properties of theses nucleases and their interplay within the exosome holocomplex. PMID:21713678

  18. Metabolic and Nontranscriptional Circadian Clocks: Eukaryotes

    PubMed Central

    Reddy, Akhilesh B.; Rey, Guillaume

    2016-01-01

    Circadian clocks are cellular timekeeping mechanisms that coordinate behavior and physiology around the 24-h day in most living organisms. Misalignment of an organism’s clock with its environment is associated with long-term adverse fitness consequences, as exemplified by the link between circadian disruption and various age-related diseases in humans. Current eukaryotic models of the circadian oscillator rely on transcription/translation feedback loop mechanisms, supplemented with accessory cytosolic loops that connect them to cellular physiology. However, there is mounting evidence questioning the absolute necessity of transcription-based oscillators for circadian rhythmicity, supported by the recent discovery of oxidation-reduction cycles of peroxiredoxin proteins, which persist even in the absence of transcription. A more fundamental mechanism based on metabolic cycles could thus underlie circadian transcriptional and cytosolic rhythms, thereby promoting circadian oscillations to integral properties of cellular metabolism. PMID:24606143

  19. (Viruses of eukaryotic green algae): Performance report

    SciTech Connect

    Not Available

    1987-01-01

    The primary objective of this research was to develop the Chlorella-PBCV-1 virus system so that it can be used as a model system for studying gene expression in a photosynthetic eukaryote. Discoveries include the finding that morphologically similar, plaque forming, dsDNA containing viruses are common in nature and can be isolated readily from fresh water; the finding that all of these Chlorella viruses contain methylated bases which range in concentration from 0.1% to 47.5% mVdC and 0 to 37% mWdA and the discovery that infection with at least some of these viruses induces the appearance of DNA modification/restriction systems. 18 refs.

  20. Processing ribonucleotides incorporated during eukaryotic DNA replication.

    PubMed

    Williams, Jessica S; Lujan, Scott A; Kunkel, Thomas A

    2016-06-01

    The information encoded in DNA is influenced by the presence of non-canonical nucleotides, the most frequent of which are ribonucleotides. In this Review, we discuss recent discoveries about ribonucleotide incorporation into DNA during replication by the three major eukaryotic replicases, DNA polymerases α, δ and ε. The presence of ribonucleotides in DNA causes short deletion mutations and may result in the generation of single- and double-strand DNA breaks, leading to genome instability. We describe how these ribonucleotides are removed from DNA through ribonucleotide excision repair and by topoisomerase I. We discuss the biological consequences and the physiological roles of ribonucleotides in DNA, and consider how deficiencies in their removal from DNA may be important in the aetiology of disease. PMID:27093943

  1. Cell cycle control (and more) by programmed −1 ribosomal frameshifting: implications for disease and therapeutics

    PubMed Central

    Belew, Ashton T; Dinman, Jonathan D

    2015-01-01

    Abstract Like most basic molecular mechanisms, programmed –1 ribosomal frameshifting (−1 PRF) was first identified in viruses. Early observations that global dysregulation of −1 PRF had deleterious effects on yeast cell growth suggested that −1 PRF may be used to control cellular gene expression, and the cell cycle in particular. Collection of sufficient numbers of viral −1 PRF signals coupled with advances in computer sciences enabled 2 complementary computational approaches to identify −1 PRF signals in free living organisms. The unexpected observation that almost all −1 PRF events on eukaryotic mRNAs direct ribosomes to premature termination codons engendered the hypothesis that −1 PRF signals post-transcriptionally regulate gene expression by functioning as mRNA destabilizing elements. Emerging research suggests that some human diseases are associated with global defects in −1 PRF. The recent discovery of −1 PRF signal-specific trans-acting regulators may provide insight into novel therapeutic strategies aimed at treating diseases caused by changes in gene expression patterns. PMID:25584829

  2. Analysis of tetra- and hepta-nucleotides motifs promoting -1 ribosomal frameshifting in Escherichia coli

    PubMed Central

    Sharma, Virag; Prère, Marie-Françoise; Canal, Isabelle; Firth, Andrew E.; Atkins, John F.; Baranov, Pavel V.; Fayet, Olivier

    2014-01-01

    Programmed ribosomal -1 frameshifting is a non-standard decoding process occurring when ribosomes encounter a signal embedded in the mRNA of certain eukaryotic and prokaryotic genes. This signal has a mandatory component, the frameshift motif: it is either a Z_ZZN tetramer or a X_XXZ_ZZN heptamer (where ZZZ and XXX are three identical nucleotides) allowing cognate or near-cognate repairing to the -1 frame of the A site or A and P sites tRNAs. Depending on the signal, the frameshifting frequency can vary over a wide range, from less than 1% to more than 50%. The present study combines experimental and bioinformatics approaches to carry out (i) a systematic analysis of the frameshift propensity of all possible motifs (16 Z_ZZN tetramers and 64 X_XXZ_ZZN heptamers) in Escherichia coli and (ii) the identification of genes potentially using this mode of expression amongst 36 Enterobacteriaceae genomes. While motif efficiency varies widely, a major distinctive rule of bacterial -1 frameshifting is that the most efficient motifs are those allowing cognate re-pairing of the A site tRNA from ZZN to ZZZ. The outcome of the genomic search is a set of 69 gene clusters, 59 of which constitute new candidates for functional utilization of -1 frameshifting. PMID:24875478

  3. Analysis of tetra- and hepta-nucleotides motifs promoting -1 ribosomal frameshifting in Escherichia coli.

    PubMed

    Sharma, Virag; Prère, Marie-Françoise; Canal, Isabelle; Firth, Andrew E; Atkins, John F; Baranov, Pavel V; Fayet, Olivier

    2014-06-01

    Programmed ribosomal -1 frameshifting is a non-standard decoding process occurring when ribosomes encounter a signal embedded in the mRNA of certain eukaryotic and prokaryotic genes. This signal has a mandatory component, the frameshift motif: it is either a Z_ZZN tetramer or a X_XXZ_ZZN heptamer (where ZZZ and XXX are three identical nucleotides) allowing cognate or near-cognate repairing to the -1 frame of the A site or A and P sites tRNAs. Depending on the signal, the frameshifting frequency can vary over a wide range, from less than 1% to more than 50%. The present study combines experimental and bioinformatics approaches to carry out (i) a systematic analysis of the frameshift propensity of all possible motifs (16 Z_ZZN tetramers and 64 X_XXZ_ZZN heptamers) in Escherichia coli and (ii) the identification of genes potentially using this mode of expression amongst 36 Enterobacteriaceae genomes. While motif efficiency varies widely, a major distinctive rule of bacterial -1 frameshifting is that the most efficient motifs are those allowing cognate re-pairing of the A site tRNA from ZZN to ZZZ. The outcome of the genomic search is a set of 69 gene clusters, 59 of which constitute new candidates for functional utilization of -1 frameshifting. PMID:24875478

  4. Concerted copy number variation balances ribosomal DNA dosage in human and mouse genomes.

    PubMed

    Gibbons, John G; Branco, Alan T; Godinho, Susana A; Yu, Shoukai; Lemos, Bernardo

    2015-02-24

    Tandemly repeated ribosomal DNA (rDNA) arrays are among the most evolutionary dynamic loci of eukaryotic genomes. The loci code for essential cellular components, yet exhibit extensive copy number (CN) variation within and between species. CN might be partly determined by the requirement of dosage balance between the 5S and 45S rDNA arrays. The arrays are nonhomologous, physically unlinked in mammals, and encode functionally interdependent RNA components of the ribosome. Here we show that the 5S and 45S rDNA arrays exhibit concerted CN variation (cCNV). Despite 5S and 45S rDNA elements residing on different chromosomes and lacking sequence similarity, cCNV between these loci is strong, evolutionarily conserved in humans and mice, and manifested across individual genotypes in natural populations and pedigrees. Finally, we observe that bisphenol A induces rapid and parallel modulation of 5S and 45S rDNA CN. Our observations reveal a novel mode of genome variation, indicate that natural selection contributed to the evolution and conservation of cCNV, and support the hypothesis that 5S CN is partly determined by the requirement of dosage balance with the 45S rDNA array. We suggest that human disease variation might be traced to disrupted rDNA dosage balance in the genome. PMID:25583482

  5. The effect of ribosomal protein S15a in lung adenocarcinoma

    PubMed Central

    Zhang, Yifan; Zhang, Guangxin; Li, Xin

    2016-01-01

    Background: RPS15A (Ribosomal Protein S15A) promotes mRNA/ribosome interactions in translation. It is critical for the process of eukaryotic protein biosynthesis. Recently, aberrantly expressed RPS15A was found in the hepatitis virus and in malignant tumors. However, the role of RPS15A has not been fully revealed on the development of lung cancer. Method: In this study, a Tissue Microarray (TMA) of primary lung adenocarcinoma tissue specimens was carried out. Furthermore, to further investigate the function of RPS15A in lung cancer, RPS15A-specific short hairpin RNA (shRNA) expressing lentivirus (Lv-shRPS15A) was constructed and used to infect H1299 and A549 cells. Result: Our data showed that RPS15A expression was increased in tumor tissues. Furthermore, the knockdown of RSP15A inhibited cancer cell growth and induced apoptosis in the cancer cells. Gene expression profile microarray also revealed that the P53 signaling pathway was activated in Lv-shRPS15A-infected cancer cells. Conclusion: Taken together, our results demonstrate that RPS15A is a novel oncogene in non-small cell lung cancer and may be a potential therapeutic target in lung cancer. PMID:26989627

  6. The structure of Rpf2-Rrs1 explains its role in ribosome biogenesis.

    PubMed

    Kharde, Satyavati; Calviño, Fabiola R; Gumiero, Andrea; Wild, Klemens; Sinning, Irmgard

    2015-08-18

    The assembly of eukaryotic ribosomes is a hierarchical process involving about 200 biogenesis factors and a series of remodeling steps. The 5S RNP consisting of the 5S rRNA, RpL5 and RpL11 is recruited at an early stage, but has to rearrange during maturation of the pre-60S ribosomal subunit. Rpf2 and Rrs1 have been implicated in 5S RNP biogenesis, but their precise role was unclear. Here, we present the crystal structure of the Rpf2-Rrs1 complex from Aspergillus nidulans at 1.5 Å resolution and describe it as Brix domain of Rpf2 completed by Rrs1 to form two anticodon-binding domains with functionally important tails. Fitting the X-ray structure into the cryo-EM density of a previously described pre-60S particle correlates with biochemical data. The heterodimer forms specific contacts with the 5S rRNA, RpL5 and the biogenesis factor Rsa4. The flexible protein tails of Rpf2-Rrs1 localize to the central protuberance. Two helices in the Rrs1 C-terminal tail occupy a strategic position to block the rotation of 25S rRNA and the 5S RNP. Our data provide a structural model for 5S RNP recruitment to the pre-60S particle and explain why removal of Rpf2-Rrs1 is necessary for rearrangements to drive 60S maturation. PMID:26117542

  7. Stepwise and dynamic assembly of the earliest precursors of small ribosomal subunits in yeast.

    PubMed

    Zhang, Liman; Wu, Chen; Cai, Gaihong; Chen, She; Ye, Keqiong

    2016-03-15

    The eukaryotic ribosomal RNA (rRNA) is associated cotranscriptionally with numerous factors into an enormous 90S preribosomal particle that conducts early processing of small ribosomal subunits. The assembly pathway and structure of the 90S particle is poorly understood. Here, we affinity-purified and analyzed the constituents of yeast 90S particles that were assembled on a series of plasmid-encoded 3'-truncated pre-18S RNAs. We determined the assembly point of 65 proteins and the U3, U14, and snR30 small nucleolar RNAs (snoRNAs), revealing a stepwise and dynamic assembly map. The 5' external transcribed spacer (ETS) alone can nucleate a large complex. When the 18S rRNA is nearly complete, the 90S structure undergoes a dramatic reorganization, releasing U14, snR30, and 14 protein factors that bind earlier. We also identified a reference state of 90S that is fully assembled yet has not undergone 5'ETS processing. The assembly map present here provides a new framework to understand small subunit biogenesis. PMID:26980190

  8. Relationship between organization and function of ribosomal genes in Drosophila melanogaster

    SciTech Connect

    Karpen, G.H.

    1987-01-01

    In most eukaryotic organisms, the genes that encode the 18S and 28S ribosomal RNAs (rDNA genes) are tandemly repeated, and are located in constitutive heterochromatin and/or centromeric or telomeric regions. P-element mediated transformation was used to investigate the relationship between rDNA organization and function in Drosophila melanogaster. Tritiated-uridine incorporation under heat shock conditions and in situ hybridization to rRNA were used to demonstrate that a single rDNA gene inserted into euchromatin can be transcribed at a high rate, in polytene nuclei. P-element-mediated transformation of a single Drosophila rDNA gene was also utilized to investigate the ability of ribosomal DNA to organize a nucleolus. Cytological approaches demonstrated that structures resembling the endogenous nucleoli were preferentially associated with four different sites of rDNA insertion, in polytene nuclei. These mini-nucleoli also contained components specific to the nucleolus, as shown by in situ hybridization to rRNA and indirect immunofluorescence with an antibody that binds to Drosophila nucleoli. The transformed genes were able to partially rescue mutant phenotypes due to a deficiency of rDNA, indicating that the mini-nucleoli were functional.

  9. Bactobolin Resistance Is Conferred by Mutations in the L2 Ribosomal Protein

    PubMed Central

    Chandler, Josephine R.; Truong, Thao T.; Silva, Patricia M.; Seyedsayamdost, Mohammad R.; Carr, Gavin; Radey, Matthew; Jacobs, Michael A.; Sims, Elizabeth H.; Clardy, Jon; Greenberg, E. Peter

    2012-01-01

    ABSTRACT Burkholderia thailandensis produces a family of polyketide-peptide molecules called bactobolins, some of which are potent antibiotics. We found that growth of B. thailandensis at 30°C versus that at 37°C resulted in increased production of bactobolins. We purified the three most abundant bactobolins and determined their activities against a battery of bacteria and mouse fibroblasts. Two of the three compounds showed strong activities against both bacteria and fibroblasts. The third analog was much less potent in both assays. These results suggested that the target of bactobolins might be conserved across bacteria and mammalian cells. To learn about the mechanism of bactobolin activity, we isolated four spontaneous bactobolin-resistant Bacillus subtilis mutants. We used genomic sequencing technology to show that each of the four resistant variants had mutations in rplB, which codes for the 50S ribosome-associated L2 protein. Ectopic expression of a mutant rplB gene in wild-type B. subtilis conferred bactobolin resistance. Finally, the L2 mutations did not confer resistance to other antibiotics known to interfere with ribosome function. Our data indicate that bactobolins target the L2 protein or a nearby site and that this is not the target of other antibiotics. We presume that the mammalian target of bactobolins involves the eukaryotic homolog of L2 (L8e). PMID:23249812

  10. Polar bears, antibiotics, and the evolving ribosome (Nobel Lecture).

    PubMed

    Yonath, Ada

    2010-06-14

    High-resolution structures of ribosomes, the cellular machines that translate the genetic code into proteins, revealed the decoding mechanism, detected the mRNA path, identified the sites of the tRNA molecules in the ribosome, elucidated the position and the nature of the nascent proteins exit tunnel, illuminated the interactions of the ribosome with non-ribosomal factors, such as the initiation, release and recycling factors, and provided valuable information on ribosomal antibiotics, their binding sites, modes of action, principles of selectivity and the mechanisms leading to their resistance. Notably, these structures proved that the ribosome is a ribozyme whose active site, namely where the peptide bonds are being formed, is situated within a universal symmetrical region that is embedded in the otherwise asymmetric ribosome structure. As this symmetrical region is highly conserved and provides the machinery required for peptide bond formation and for ribosome polymerase activity, it may be the remnant of the proto-ribosome, a dimeric prebiotic machine that formed peptide bonds and non-coded polypeptide chains. Structures of complexes of ribosomes with antibiotics targeting them revealed the principles allowing for their clinical use, identified resistance mechanisms and showed the structural bases for discriminating pathogenic bacteria from hosts, hence providing valuable structural information for antibiotics improvement and for the design of novel compounds that can serve as antibiotics. PMID:20535730

  11. Ribosomal History Reveals Origins of Modern Protein Synthesis

    PubMed Central

    Harish, Ajith; Caetano-Anollés, Gustavo

    2012-01-01

    The origin and evolution of the ribosome is central to our understanding of the cellular world. Most hypotheses posit that the ribosome originated in the peptidyl transferase center of the large ribosomal subunit. However, these proposals do not link protein synthesis to RNA recognition and do not use a phylogenetic comparative framework to study ribosomal evolution. Here we infer evolution of the structural components of the ribosome. Phylogenetic methods widely used in morphometrics are applied directly to RNA structures of thousands of molecules and to a census of protein structures in hundreds of genomes. We find that components of the small subunit involved in ribosomal processivity evolved earlier than the catalytic peptidyl transferase center responsible for protein synthesis. Remarkably, subunit RNA and proteins coevolved, starting with interactions between the oldest proteins (S12 and S17) and the oldest substructure (the ribosomal ratchet) in the small subunit and ending with the rise of a modern multi-subunit ribosome. Ancestral ribonucleoprotein components show similarities to in vitro evolved RNA replicase ribozymes and protein structures in extant replication machinery. Our study therefore provides important clues about the chicken-or-egg dilemma associated with the central dogma of molecular biology by showing that ribosomal history is driven by the gradual structural accretion of protein and RNA structures. Most importantly, results suggest that functionally important and conserved regions of the ribosome were recruited and could be relics of an ancient ribonucleoprotein world. PMID:22427882

  12. O6-Methylguanosine leads to position-dependent effects on ribosome speed and fidelity

    PubMed Central

    Hudson, Benjamin H.; Zaher, Hani S.

    2015-01-01

    Nucleic acids are under constant assault from endogenous and environmental agents that alter their physical and chemical properties. O6-methylation of guanosine (m6G) is particularly notable for its high mutagenicity, pairing with T, during DNA replication. Yet, while m6G accumulates in both DNA and RNA, little is known about its effects on RNA. Here, we investigate the effects of m6G on the decoding process, using a reconstituted bacterial translation system. m6G at the first and third position of the codon decreases the accuracy of tRNA selection. The ribosome readily incorporates near-cognate aminoacyl-tRNAs (aa-tRNAs) by forming m6G-uridine codon–anticodon pairs. Surprisingly, the introduction of m6G to the second position of the codon does not promote miscoding, but instead slows the observed rates of peptide-bond formation by >1000-fold for cognate aa-tRNAs without altering the rates for near-cognate aa-tRNAs. These in vitro observations were recapitulated in eukaryotic extracts and HEK293 cells. Interestingly, the analogous modification N6-methyladenosine (m6A) at the second position has only a minimal effect on tRNA selection, suggesting that the effects on tRNA selection seen with m6G are due to altered geometry of the base pair. Given that the m6G:U base pair is predicted to be nearly indistinguishable from a Watson-Crick base pair, our data suggest that the decoding center of the ribosome is extremely sensitive to changes at the second position. Our data, apart from highlighting the deleterious effects that these adducts pose to cellular fitness, shed new insight into decoding and the process by which the ribosome recognizes codon–anticodon pairs. PMID:26199454

  13. Cryo-EM structure of the small subunit of the mammalian mitochondrial ribosome.

    PubMed

    Kaushal, Prem S; Sharma, Manjuli R; Booth, Timothy M; Haque, Emdadul M; Tung, Chang-Shung; Sanbonmatsu, Karissa Y; Spremulli, Linda L; Agrawal, Rajendra K

    2014-05-20

    The mammalian mitochondrial ribosomes (mitoribosomes) are responsible for synthesizing 13 membrane proteins that form essential components of the complexes involved in oxidative phosphorylation or ATP generation for the eukaryotic cell. The mammalian 55S mitoribosome contains significantly smaller rRNAs and a large mass of mitochondrial ribosomal proteins (MRPs), including large mito-specific amino acid extensions and insertions in MRPs that are homologous to bacterial ribosomal proteins and an additional 35 mito-specific MRPs. Here we present the cryo-EM structure analysis of the small (28S) subunit (SSU) of the 55S mitoribosome. We find that the mito-specific extensions in homologous MRPs generally are involved in inter-MRP contacts and in contacts with mito-specific MRPs, suggesting a stepwise evolution of the current architecture of the mitoribosome. Although most of the mito-specific MRPs and extensions of homologous MRPs are situated on the peripheral regions, they also contribute significantly to the formation of linings of the mRNA and tRNA paths, suggesting a tailor-made structural organization of the mito-SSU for the recruitment of mito-specific mRNAs, most of which do not possess a 5' leader sequence. In addition, docking of previously published coordinates of the large (39S) subunit (LSU) into the cryo-EM map of the 55S mitoribosome reveals that mito-specific MRPs of both the SSU and LSU are involved directly in the formation of six of the 15 intersubunit bridges. PMID:24799711

  14. Cryo-EM structure of the small subunit of the mammalian mitochondrial ribosome

    PubMed Central

    Kaushal, Prem S.; Sharma, Manjuli R.; Booth, Timothy M.; Haque, Emdadul M.; Tung, Chang-Shung; Sanbonmatsu, Karissa Y.; Spremulli, Linda L.; Agrawal, Rajendra K.

    2014-01-01

    The mammalian mitochondrial ribosomes (mitoribosomes) are responsible for synthesizing 13 membrane proteins that form essential components of the complexes involved in oxidative phosphorylation or ATP generation for the eukaryotic cell. The mammalian 55S mitoribosome contains significantly smaller rRNAs and a large mass of mitochondrial ribosomal proteins (MRPs), including large mito-specific amino acid extensions and insertions in MRPs that are homologous to bacterial ribosomal proteins and an additional 35 mito-specific MRPs. Here we present the cryo-EM structure analysis of the small (28S) subunit (SSU) of the 55S mitoribosome. We find that the mito-specific extensions in homologous MRPs generally are involved in inter-MRP contacts and in contacts with mito-specific MRPs, suggesting a stepwise evolution of the current architecture of the mitoribosome. Although most of the mito-specific MRPs and extensions of homologous MRPs are situated on the peripheral regions, they also contribute significantly to the formation of linings of the mRNA and tRNA paths, suggesting a tailor-made structural organization of the mito-SSU for the recruitment of mito-specific mRNAs, most of which do not possess a 5′ leader sequence. In addition, docking of previously published coordinates of the large (39S) subunit (LSU) into the cryo-EM map of the 55S mitoribosome reveals that mito-specific MRPs of both the SSU and LSU are involved directly in the formation of six of the 15 intersubunit bridges. PMID:24799711

  15. Modification of ribosomal RNA by ribosome-inactivating proteins from plants.

    PubMed Central

    Stirpe, F; Bailey, S; Miller, S P; Bodley, J W

    1988-01-01

    We have surveyed 14 different toxic and nontoxic ribosome-inactivating proteins from plants for the ability to act on the RNA of the eucaryotic 60 S ribosomal subunit. All of these proteins act to introduce a specific modification into 26-28 S RNA which renders the RNA sensitive to cleavage by aniline. Sequence analysis of the 5'-termini of the fragments produced by ricin and saporin following aniline cleavage indicate that both proteins possess identical specificity. Our observations support the conclusion of Endo and Tsurugi (J. Biol. Chem. 262, 8128-8130, 1987) that ricin is a specific N-glycosidase and we have located the site of this cleavage by direct sequence analysis. Our results further suggest that all plant ribosome-inactivating proteins function as specific N-glycosidases with the same specificity. Images PMID:3347493

  16. Identification of a Recently Active Mammalian SINE Derived from Ribosomal RNA

    PubMed Central

    Longo, Mark S.; Brown, Judy D.; Zhang, Chu; O’Neill, Michael J.; O’Neill, Rachel J.

    2015-01-01

    Complex eukaryotic genomes are riddled with repeated sequences whose derivation does not coincide with phylogenetic history and thus is often unknown. Among such sequences, the capacity for transcriptional activity coupled with the adaptive use of reverse transcription can lead to a diverse group of genomic elements across taxa, otherwise known as selfish elements or mobile elements. Short interspersed nuclear elements (SINEs) are nonautonomous mobile elements found in eukaryotic genomes, typically derived from cellular RNAs such as tRNAs, 7SL or 5S rRNA. Here, we identify and characterize a previously unknown SINE derived from the 3′-end of the large ribosomal subunit (LSU or 28S rDNA) and transcribed via RNA polymerase III. This new element, SINE28, is represented in low-copy numbers in the human reference genome assembly, wherein we have identified 27 discrete loci. Phylogenetic analysis indicates these elements have been transpositionally active within primate lineages as recently as 6 MYA while modern humans still carry transcriptionally active copies. Moreover, we have identified SINE28s in all currently available assembled mammalian genome sequences. Phylogenetic comparisons indicate that these elements are frequently rederived from the highly conserved LSU rRNA sequences in a lineage-specific manner. We propose that this element has not been previously recognized as a SINE given its high identity to the canonical LSU, and that SINE28 likely represents one of possibly many unidentified, active transposable elements within mammalian genomes. PMID:25637222

  17. The sequence of 28S ribosomal RNA varies within and between human cell lines.

    PubMed Central

    Leffers, H; Andersen, A H

    1993-01-01

    The primary structure of 28S ribosomal RNA constitutes a conserved core which is similar among most 23S-like rRNAs and expansion segments which occur at specific positions in the sequence. The expansion segments account for most of the size difference between prokaryotic (archaeal and eubacterial) and eukaryotic rRNAs and they exhibit a sequence variation which is unique among rRNAs. We have investigated the sequence variation of one of the expansion segments, V8, by sequencing a total of 111 V8 segments from 9 different human cell lines and tissues and have found 35 different variants. The variation occur mainly at two 'hot spots' which are separated by 170 nucleotides in the primary sequence but are neighbours in the secondary structure. The sequence of V8 segments varies both within and between human cell lines and tissues. The implications for the evolution of the eukaryotic 28S rRNA are discussed together with possible functions of the expansion segments. We also present a secondary structure model for the V8 segment based on comparative sequence analysis and chemical and enzymatic foot printing. Images PMID:8464736

  18. The human insulin receptor mRNA contains a functional internal ribosome entry segment

    PubMed Central

    Spriggs, Keith A.; Cobbold, Laura C.; Ridley, Simon H.; Coldwell, Mark; Bottley, Andrew; Bushell, Martin; Willis, Anne E.; Siddle, Kenneth

    2009-01-01

    Regulation of mRNA translation is an important mechanism determining the level of expression of proteins in eukaryotic cells. Translation is most commonly initiated by cap-dependent scanning, but many eukaryotic mRNAs contain internal ribosome entry segments (IRESs), providing an alternative means of initiation capable of independent regulation. Here, we show by using dicistronic luciferase reporter vectors that the 5′-UTR of the mRNA encoding human insulin receptor (hIR) contains a functional IRES. RNAi-mediated knockdown showed that the protein PTB was required for maximum IRES activity. Electrophoretic mobility shift assays confirmed that PTB1, PTB2 and nPTB, but not unr or PTB4, bound to hIR mRNA, and deletion mapping implicated a CCU motif 448 nt upstream of the initiator AUG in PTB binding. The IR-IRES was functional in a number of cell lines, and most active in cells of neuronal origin, as assessed by luciferase reporter assays. The IRES was more active in confluent than sub-confluent cells, but activity did not change during differentiation of 3T3-L1 fibroblasts to adipocytes. IRES activity was stimulated by insulin in sub-confluent cells. The IRES may function to maintain expression of IR protein in tissues such as the brain where mRNA translation by cap-dependent scanning is less effective. PMID:19654240

  19. Crystallization and preliminary crystallographic studies of L30e, a ribosomal protein from Methanocaldococcus jannaschii (MJ1044)

    SciTech Connect

    Rangarajan, Sarani; Jeyakanthan, Jeyaraman; Mridula, Palappetty; Sakamoto, Keiko; Kitamura, Yoshiaki; Agari, Yoshihiro; Shinkai, Akeo; Ebihara, Akio; Kuramitsu, Seiki; Yokoyama, Shigeyuki; Sekar, Kanagaraj E-mail: sekar@physics.iisc.ernet.in

    2008-02-01

    The ribosomal protein (L30e) from M. jannaschii was cloned from the gene MJ1044, expressed, purified and crystallized. The crystal belongs to the primitive tetragonal space group P4{sub 3} and diffracted to 1.9 Å resolution. In view of the biological significance of understanding the ribosomal machinery of both prokaryotes and eukaryotes, the L30e ribosomal protein from Methanocaldococcus jannaschii was cloned, overexpressed, purified and crystallized using the microbatch-under-oil method with the crystallization conditions 40% PEG 400, 0.1 M MES pH 6.0 and 5% PEG 3000 at 291 K. A diffraction-quality crystal (0.20 × 0.20 × 0.35 mm) was obtained that belonged to the primitive tetragonal space group P4{sub 3}, with unit-cell parameters a = 46.1, b = 46.1, c = 98.5 Å, and diffracted to a resolution of 1.9 Å. Preliminary calculations reveal that the asymmetric unit contains two monomers with a Matthews coefficient (V{sub M}) of 2.16 Å{sup 3} Da{sup −1}.

  20. Conservation and divergence of transcriptional coregulations between box C/D snoRNA and ribosomal protein genes in Ascomycota

    PubMed Central

    Diao, Li-Ting; Xiao, Zhen-Dong; Leng, Xiao-Min; Li, Bin; Li, Jun-Hao; Luo, Yu-Ping; Li, Si-Guang; Yu, Chuan-He; Zhou, Hui

    2014-01-01

    Coordinated assembly of the ribosome is essential for proper translational activity in eukaryotic cells. It is therefore critical to coordinate the expression of components of ribosomal programs with the cell's nutritional status. However, coordinating expression of these components is poorly understood. Here, by combining experimental and computational approaches, we systematically identified box C/D snoRNAs in four fission yeasts and found that the expression of box C/D snoRNA and ribosomal protein (RP) genes were orchestrated by a common Homol-D box, thereby ensuring a constant balance of these two genetic components. Interestingly, such transcriptional coregulations could be observed in most Ascomycota species and were mediated by different cis-regulatory elements. Via the reservation of cis elements, changes in spatial configuration, the substitution of cis elements, and gain or loss of cis elements, the regulatory networks of box C/D snoRNAs evolved to correspond with those of the RP genes, maintaining transcriptional coregulation between box C/D snoRNAs and RP genes. Our results indicate that coregulation via common cis elements is an important mechanism to coordinate expression of the RP and snoRNA genes, which ensures a constant balance of these two components. PMID:25002674