Science.gov

Sample records for factor sp1 leads

  1. Co-operation of the transcription factor hepatocyte nuclear factor-4 with Sp1 or Sp3 leads to transcriptional activation of the human haem oxygenase-1 gene promoter in a hepatoma cell line.

    PubMed Central

    Takahashi, Shigeru; Matsuura, Naomi; Kurokawa, Takako; Takahashi, Yuji; Miura, Takashi

    2002-01-01

    We reported previously that the 5'-flanking region (nucleotides -1976 to -1655) of the human haem oxygenase-1 ( hHO-1 ) gene enhances hHO-1 promoter activity in human hepatoma HepG2 cells, but not in HeLa cells [Takahashi, Takahashi, Ito, Nagano, Shibahara and Miura (1999) Biochim. Biophys. Acta 1447, 231-235]. To define more precisely the regulatory elements involved, in the present study we have functionally dissected this region and localized the enhancer to a 50 bp fragment (-1793 to -1744). Site-direct mutagenesis analysis revealed that two regions were responsible for this enhancer activity, i.e. a hepatocyte nuclear factor-4 (HNF-4) homologous region and a GC box motif homologous region. Mutation in either region alone moderately decreased enhancer activity. However, mutations in both regions reduced promoter activity to the basal level. Electrophoretic mobility-shift assays demonstrated that the P5-2 fragment (-1793 to -1744) interacted with at least two nuclear factors, i.e. HNF-4 and Sp1/Sp3. Co-transfection experiments using Drosophila SL2 cells revealed that HNF-4 and Sp1/Sp3 synergistically stimulated the enhancer activity of the P5-2 fragment. These results indicate that co-operation of HNF-4 with Sp1 or Sp3 leads to the activation of hHO-1 gene expression in hepatoma cells. PMID:12133007

  2. Co-operation of the transcription factor hepatocyte nuclear factor-4 with Sp1 or Sp3 leads to transcriptional activation of the human haem oxygenase-1 gene promoter in a hepatoma cell line.

    PubMed

    Takahashi, Shigeru; Matsuura, Naomi; Kurokawa, Takako; Takahashi, Yuji; Miura, Takashi

    2002-11-01

    We reported previously that the 5'-flanking region (nucleotides -1976 to -1655) of the human haem oxygenase-1 ( hHO-1 ) gene enhances hHO-1 promoter activity in human hepatoma HepG2 cells, but not in HeLa cells [Takahashi, Takahashi, Ito, Nagano, Shibahara and Miura (1999) Biochim. Biophys. Acta 1447, 231-235]. To define more precisely the regulatory elements involved, in the present study we have functionally dissected this region and localized the enhancer to a 50 bp fragment (-1793 to -1744). Site-direct mutagenesis analysis revealed that two regions were responsible for this enhancer activity, i.e. a hepatocyte nuclear factor-4 (HNF-4) homologous region and a GC box motif homologous region. Mutation in either region alone moderately decreased enhancer activity. However, mutations in both regions reduced promoter activity to the basal level. Electrophoretic mobility-shift assays demonstrated that the P5-2 fragment (-1793 to -1744) interacted with at least two nuclear factors, i.e. HNF-4 and Sp1/Sp3. Co-transfection experiments using Drosophila SL2 cells revealed that HNF-4 and Sp1/Sp3 synergistically stimulated the enhancer activity of the P5-2 fragment. These results indicate that co-operation of HNF-4 with Sp1 or Sp3 leads to the activation of hHO-1 gene expression in hepatoma cells. PMID:12133007

  3. Interaction of Sp1 zinc finger with transport factor in the nuclear localization of transcription factor Sp1

    SciTech Connect

    Ito, Tatsuo; Kitamura, Haruka; Uwatoko, Chisana; Azumano, Makiko; Itoh, Kohji; Kuwahara, Jun

    2010-12-10

    Research highlights: {yields} Sp1 zinc fingers themselves interact with importin {alpha}. {yields} Sp1 zinc finger domains play an essential role as a nuclear localization signal. {yields} Sp1 can be transported into the nucleus in an importin-dependent manner. -- Abstract: Transcription factor Sp1 is localized in the nucleus and regulates the expression of many cellular genes, but the nuclear transport mechanism of Sp1 is not well understood. In this study, we revealed that GST-fused Sp1 protein bound to endogenous importin {alpha} in HeLa cells via the Sp1 zinc finger domains, which comprise the DNA binding domain of Sp1. It was found that the Sp1 zinc finger domains directly interacted with a wide range of importin {alpha} including the armadillo (arm) repeat domain and the C-terminal acidic domain. Furthermore, it turned out that all three zinc fingers of Sp1 are essential for binding to importin {alpha}. Taken together, these results suggest that the Sp1 zinc finger domains play an essential role as a NLS and Sp1 can be transported into the nucleus in an importin-dependent manner even though it possesses no classical NLSs.

  4. Role of zinc finger structure in nuclear localization of transcription factor Sp1

    SciTech Connect

    Ito, Tatsuo; Azumano, Makiko; Uwatoko, Chisana; Itoh, Kohji Kuwahara, Jun

    2009-02-27

    Transcription factor Sp1 is localized in the nucleus and regulates gene expression. Our previous study demonstrated that the carboxyl terminal region of Sp1 containing 3-zinc finger region as DNA binding domain can also serve as nuclear localization signal (NLS). However, the nuclear transport mechanism of Sp1 has not been well understood. In this study, we performed a gene expression study on mutant Sp1 genes causing a set of amino acid substitutions in zinc finger domains to elucidate nuclear import activity. Nuclear localization of the GFP-fused mutant Sp1 proteins bearing concomitant substitutions in the first and third zinc fingers was highly inhibited. These mutant Sp1 proteins had also lost the binding ability as to the GC box sequence. The results suggest that the overall tertiary structure formed by the three zinc fingers is essential for nuclear localization of Sp1 as well as dispersed basic amino acids within the zinc fingers region.

  5. Overexpression of the Transcription Factor Sp1 Activates the OAS-RNAse L-RIG-I Pathway

    PubMed Central

    Dupuis-Maurin, Valéryane; Brinza, Lilia; Baguet, Joël; Plantamura, Emilie; Schicklin, Stéphane; Chambion, Solène; Macari, Claire; Tomkowiak, Martine; Deniaud, Emmanuelle; Leverrier, Yann

    2015-01-01

    Deregulated expression of oncogenes or transcription factors such as specificity protein 1 (Sp1) is observed in many human cancers and plays a role in tumor maintenance. Paradoxically in untransformed cells, Sp1 overexpression induces late apoptosis but the early intrinsic response is poorly characterized. In the present work, we studied increased Sp1 level consequences in untransformed cells and showed that it turns on an early innate immune transcriptome. Sp1 overexpression does not activate known cellular stress pathways such as DNA damage response or endoplasmic reticulum stress, but induces the activation of the OAS-RNase L pathway and the generation of small self-RNAs, leading to the upregulation of genes of the antiviral RIG-I pathway at the transcriptional and translational levels. Finally, Sp1-induced intrinsic innate immune response leads to the production of the chemokine CXCL4 and to the recruitment of inflammatory cells in vitro and in vivo. Altogether our results showed that increased Sp1 level in untransformed cells constitutes a novel danger signal sensed by the OAS-RNase L axis leading to the activation of the RIG-I pathway. These results suggested that the OAS-RNase L-RIG-I pathway may be activated in sterile condition in absence of pathogen. PMID:25738304

  6. O-GlcNAc inhibits interaction between Sp1 and Elf-1 transcription factors

    SciTech Connect

    Lim, Kihong; Chang, Hyo-Ihl

    2009-03-13

    The novel protein modification, O-linked N-acetylglucosamine (O-GlcNAc), plays an important role in various aspects of cell regulation. Although most of nuclear transcription regulatory factors are modified by O-GlcNAc, O-GlcNAc effects on transcription remain largely undefined yet. In this study, we show that O-GlcNAc inhibits a physical interaction between Sp1 and Elf-1 transcription factors, and negatively regulates transcription of placenta and embryonic expression oncofetal protein gene (Pem). These findings suggest that O-GlcNAc inhibits Sp1-mediated gene transcription possibly by interrupting Sp1 interaction with its cooperative factor.

  7. Elevated SP-1 transcription factor expression and activity drives basal and hypoxia-induced vascular endothelial growth factor (VEGF) expression in non-small cell lung cancer.

    PubMed

    Deacon, Karl; Onion, David; Kumari, Rajendra; Watson, Susan A; Knox, Alan J

    2012-11-16

    VEGF plays a central role in angiogenesis in cancer. Non-small cell lung cancer (NSCLC) tumors have increased microvascular density, localized hypoxia, and high VEGF expression levels; however, there is a lack of understanding of how oncogenic and tumor microenvironment changes such as hypoxia lead to greater VEGF expression in lung and other cancers. We show that NSCLC cells secreted higher levels of VEGF than normal airway epithelial cells. Actinomycin D inhibited all NSCLC VEGF secretion, and VEGF minimal promoter-luciferase reporter constructs were constitutively active until the last 85 base pairs before the transcription start site containing three SP-1 transcription factor-binding sites; mutation of these VEGF promoter SP-1-binding sites eliminated VEGF promoter activity. Furthermore, dominant negative SP-1, mithramycin A, and SP-1 shRNA decreased VEGF promoter activity, whereas overexpression of SP-1 increased VEGF promoter activity. Chromatin immunoprecipitation assays demonstrated SP-1, p300, and PCA/F histone acetyltransferase binding and histone H4 hyperacetylation at the VEGF promoter in NSCLC cells. Cultured NSCLC cells expressed higher levels of SP-1 protein than normal airway epithelial cells, and double-fluorescence immunohistochemistry showed a strong correlation between SP-1 and VEGF in human NSCLC tumors. In addition, hypoxia-driven VEGF expression in NSCLC cells was SP-1-dependent, with hypoxia increasing SP-1 activity and binding to the VEGF promoter. These studies are the first to demonstrate that overexpression of SP-1 plays a central role in hypoxia-induced VEGF secretion. PMID:22992725

  8. Transcription factor Sp1 inhibition, memory, and cytokines in a mouse model of Alzheimer’s disease

    PubMed Central

    Citron, Bruce A; Saykally, Jessica N; Cao, Chuanhai; Dennis, John S; Runfeldt, Melissa; Arendash, Gary W

    2015-01-01

    Transcription factors are involved to varying extents in the health and survival of neurons in the brain and a better understanding of their roles with respect to the pathogenesis of Alzheimer’s disease (AD) could lead to the development of additional treatment strategies. Sp1 is a transcription factor that responds to inflammatory signals occurring in the AD brain. It is known to regulate genes with demonstrated importance in AD, and we have previously found it upregulated in the AD brain and in brains of transgenic AD model mice. To better understand the role of Sp1 in AD, we tested whether we could affect memory function (measured with a battery of behavioral tests discriminating different aspects of cognitive function) in a transgenic model of AD by pharmaceutical modulation of Sp1. We found that inhibition of Sp1 function in transgenic AD model mice increased memory deficits, while there were no changes in sensorimotor or anxiety tests. Aβ42 and Aβ40 peptide levels were significantly higher in the treated mice, indicating that Sp1 elevation in AD could be a functionally protective response. Circulating levels of CXCL1 (KC) decreased following treatment with mithramycin, while a battery of other cytokines, including IL-1α, IL-6, INF-γ and MCP-1, were unchanged. Gene expression levels for several genes important to neuronal health were determined by qRT-PCR, and none of these appeared to change at the transcriptional level. PMID:26807343

  9. Negative Regulation of DsbA-L Gene Expression by the Transcription Factor Sp1

    PubMed Central

    Fang, Qichen; Yang, Wenjing; Li, Huating; Hu, Wenxiu; Chen, Lihui; Jiang, Shan; Dong, Kun; Song, Qianqian; Wang, Chen; Chen, Shuo; Liu, Feng

    2014-01-01

    Disulfide-bond A oxidoreductase-like protein (DsbA-L) possesses beneficial effects such as promoting adiponectin multimerization and stability, increasing insulin sensitivity, and enhancing energy metabolism. The expression level of DsbA-L is negatively correlated with obesity in mice and humans, but the underlying mechanisms remain unknown. To address this question, we generated reporter gene constructs containing the promoter sequence of the mouse DsbA-L gene. Deletion analysis showed that the proximal promoter of mouse DsbA-L is located between −186 and −34 bp relative to the transcription start site. In silico analysis identified a putative Sp1 transcription factor binding site in the first intron of the DsbA-L gene. Electrophoretic mobility shift assay and chromatin immunoprecipitation analysis indicated that Sp1 bound to this intron region in vitro and in intact cells. Overexpression of Sp1 or suppressing Sp1 expression by siRNA reduced or increased DsbA-L promoter activity, respectively. The binding activity of Sp1 was gradually decreased during 3T3-L1 cell differentiation and was significantly increased in adipose tissues of obese mice. Our results identify Sp1 as an inhibitor of DsbA-L gene transcription, and the Sp1-mediated inhibition of DsbA-L gene expression may provide a mechanism underlying obesity-induced adiponectin downregulation and insulin resistance. PMID:25024375

  10. Sequence-independent induction of Sp1 transcription factor activity by phosphorothioate oligodeoxynucleotides.

    PubMed Central

    Perez, J R; Li, Y; Stein, C A; Majumder, S; van Oorschot, A; Narayanan, R

    1994-01-01

    Modified analogues of antisense oligodeoxynucleotides (ODNs), particularly phosphorothioates ([S]ODNs), have been extensively used to inhibit gene expression. The potential sequence specificity of antisense oligomers makes them attractive as molecular drugs for human diseases. The use of antisense [S]ODNs to inhibit gene expression has been complicated by frequent nonspecific effects. In this study we show in diverse cell types that [S]ODNs, independent of their base sequence, mediated the induction of an Sp1 nuclear transcription factor. The [S]ODN-mediated Sp1 induction was rapid and was associated with elevated levels of Sp1 protein. This induction was dependent on NF-kappa B activity, since inhibition of NF-kappa B activity abolished the [S]ODN-induced Sp1 activity. [S]ODN-induced Sp1 activity was seen in mouse spleen cells following in vivo administration. Sp1 activity induced by [S]ODNs required the tyrosine kinase pathway and did not have transactivating potential. These results may help to explain some of the non-specific effects often seen with [S]ODNs. Images PMID:8016096

  11. A non-canonical DNA structure is a binding motif for the transcription factor SP1 in vitro

    PubMed Central

    Raiber, Eun-Ang; Kranaster, Ramon; Lam, Enid; Nikan, Mehran; Balasubramanian, Shankar

    2012-01-01

    SP1 is a ubiquitous transcription factor that is involved in the regulation of various house-keeping genes. It is known that it acts by binding to a double-stranded consensus motif. Here, we have discovered that SP1 binds also to a non-canonical DNA structure, a G-quadruplex, with high affinity. In particular, we have studied the SP1 binding site within the promoter region of the c-KIT oncogene and found that this site can fold into an anti-parallel two-tetrad G-quadruplex. SP1 pull-down experiments from cellular extracts, together with biophysical binding assays revealed that SP1 has a comparable binding affinity for this G-quadruplex structure and the canonical SP1 duplex sequence. Using SP1 ChIP-on-chip data sets, we have also found that 87% of SP1 binding sites overlap with G-quadruplex forming sequences. Furthermore, while many of these immuoprecipitated sequences (36%) even lack the minimal SP1 consensus motif, 5′-GGGCGG-3′, we have shown that 77% of them are putative G-quadruplexes. Collectively, these data suggest that SP1 is able to bind both, canonical SP1 duplex DNA as well as G-quadruplex structures in vitro and we hypothesize that both types of interactions may occur in cells. PMID:22021377

  12. Transcription factors nuclear factor I and Sp1 interact with the murine collagen alpha 1 (I) promoter.

    PubMed Central

    Nehls, M C; Rippe, R A; Veloz, L; Brenner, D A

    1991-01-01

    The collagen alpha 1(I) promoter, which is efficiently transcribed in NIH 3T3 fibroblasts, contains four binding sites for trans-acting factors, as demonstrated by DNase I protection assays (D. A. Brenner, R. A. Rippe, and L. Veloz, Nucleic Acids Res. 17:6055-6064, 1989). This study characterizes the DNA-binding proteins that interact with the two proximal footprinted regions, both of which contain a reverse CCAAT box and a G + C-rich 12-bp direct repeat. Analysis by DNase I protection assays, mobility shift assays, competition with specific oligonucleotides, binding with recombinant proteins, and reactions with specific antisera showed that the transcriptional factors nuclear factor I (NF-I) and Sp1 bind to these two footprinted regions. Because of overlapping binding sites, NF-I binding and Sp1 binding appear to be mutually exclusive. Overexpression of NF-I in cotransfection experiments with the alpha 1(I) promoter in NIH 3T3 fibroblasts increased alpha 1(I) expression, while Sp1 overexpression reduced this effect, as well as basal promoter activity. The herpes simplex virus thymidine kinase promoter, which contains independent NF-I- and Sp1-binding sites, was stimulated by both factors. Therefore, expression of the collagen alpha 1(I) gene may depend on the relative activities of NF-I and Sp1. Images PMID:2072909

  13. Androgen up-regulates vascular endothelial growth factor expression in prostate cancer cells via an Sp1 binding site

    PubMed Central

    2013-01-01

    Background Vascular Endothelial Growth Factor (VEGF) is regulated by a number of different factors, but the mechanism(s) behind androgen-mediated regulation of VEGF in prostate cancer are poorly understood. Results Three novel androgen receptor (AR) binding sites were discovered in the VEGF promoter and in vivo binding of AR to these sites was demonstrated by chromatin immunoprecipitation. Mutation of these sites attenuated activation of the VEGF promoter by the androgen analog, R1881 in prostate cancer cells. The transcription factors AR and Sp1 were shown to form a nuclear complex and both bound the VEGF core promoter in chromatin of hormone treated CWR22Rv1 prostate cancer cells. The importance of the Sp1 binding site in hormone mediated activation of VEGF expression was demonstrated by site directed mutagenesis. Mutation of a critical Sp1 binding site (Sp1.4) in the VEGF core promoter region prevented activation by androgen. Similarly, suppression of Sp1 binding by Mithramycin A treatment significantly reduced VEGF expression. Conclusions Our mechanistic study of androgen mediated induction of VEGF expression in prostate cancer cells revealed for the first time that this induction is mediated through the core promoter region and is dependent upon a critical Sp1 binding site. The importance of Sp1 binding suggests that therapy targeting the AR-Sp1 complex may dampen VEGF induced angiogenesis and, thereby, block prostate cancer progression, helping to maintain the indolent form of prostate cancer. PMID:23369005

  14. MPTP’s Pathway of Toxicity Indicates Central Role of Transcription Factor SP1

    PubMed Central

    Maertens, Alexandra; Luechtefeld, Thomas; Kleensang, Andre

    2015-01-01

    Deriving a Pathway of Toxicity from transcriptomic data remains a challenging task. We explore the use of weighted gene correlation network analysis (WGCNA) to extract an initial network from a small microarray study of MPTP toxicity in mice. Five modules were statistically significant; each module was analyzed for gene signatures in the Chemical and Genetic Perturbation subset of the Molecular Signatures Database as well as for over-represented transcription factor binding sites and WGCNA clustered probes by function and captured pathways relevant to neurodegenerative disorders. The resulting network was analyzed for transcription factor candidates, which were narrowed down via text-mining for relevance to the disease model, and then combined with the large-scale interaction FANTOM4 database to generate a genetic regulatory network. Modules were enriched for transcription factors relevant to Parkinson’s disease. Transcription factors significantly improved the number of genes that could be connected in a given component. For each module, the transcription factor that had, by far, the highest number of interactions was SP1, and it also had substantial experimental evidence of interactions. This analysis both captures much of the known biology of MPTP toxicity and suggests several candidates for further study. Furthermore, the analysis strongly suggests that SP1 plays a central role in coordinating the cellular response to MPTP toxicity. PMID:25851821

  15. MPTP's pathway of toxicity indicates central role of transcription factor SP1.

    PubMed

    Maertens, Alexandra; Luechtefeld, Thomas; Kleensang, Andre; Hartung, Thomas

    2015-05-01

    Deriving a Pathway of Toxicity from transcriptomic data remains a challenging task. We explore the use of weighted gene correlation network analysis (WGCNA) to extract an initial network from a small microarray study of MPTP toxicity in mice. Five modules were statistically significant; each module was analyzed for gene signatures in the Chemical and Genetic Perturbation subset of the Molecular Signatures Database as well as for over-represented transcription factor binding sites and WGCNA clustered probes by function and captured pathways relevant to neurodegenerative disorders. The resulting network was analyzed for transcription factor candidates, which were narrowed down via text-mining for relevance to the disease model, and then combined with the large-scale interaction FANTOM4 database to generate a genetic regulatory network. Modules were enriched for transcription factors relevant to Parkinson's disease. Transcription factors significantly improved the number of genes that could be connected in a given component. For each module, the transcription factor that had, by far, the highest number of interactions was SP1, and it also had substantial experimental evidence of interactions. This analysis both captures much of the known biology of MPTP toxicity and suggests several candidates for further study. Furthermore, the analysis strongly suggests that SP1 plays a central role in coordinating the cellular response to MPTP toxicity. PMID:25851821

  16. Molecular Characterisation, Evolution and Expression of Hypoxia-Inducible Factor in Aurelia sp.1

    PubMed Central

    Wang, Guoshan; Yu, Zhigang; Zhen, Yu; Mi, Tiezhu; Shi, Yan; Wang, Jianyan; Wang, Minxiao; Sun, Song

    2014-01-01

    The maintenance of physiological oxygen homeostasis is mediated by hypoxia-inducible factor (HIF), a key transcriptional factor of the PHD-HIF system in all metazoans. However, the molecular evolutionary origin of this central physiological regulatory system is not well characterized. As the earliest eumetazoans, Cnidarians can be served as an interesting model for exploring the HIF system from an evolutionary perspective. We identified the complete cDNA sequence of HIF-1α (ASHIF) from the Aurelia sp.1, and the predicted HIF-1α protein (pASHIF) was comprised of 674 amino acids originating from 2,025 bp nucleotides. A Pairwise comparison revealed that pASHIF not only possessed conserved basic helix-loop-helix (bHLH) and Per-Arnt-Sim (PAS) domains but also contained the oxygen dependent degradation (ODD) and the C-terminal transactivation domains (C-TAD), the key domains for hypoxia regulation. As indicated by sequence analysis, the ASHIF gene contains 8 exons interrupted by 7 introns. Western blot analysis indicated that pASHIF that existed in the polyps and medusa of Aurelia. sp.1 was more stable for a hypoxic response than normoxia. PMID:24926666

  17. Role of Transglutaminase 2 in Liver Injury via Cross-linking and Silencing of Transcription Factor Sp1

    PubMed Central

    TATSUKAWA, HIDEKI; FUKAYA, YAYOI; FRAMPTON, GORDON; MARTINEZ–FUENTES, ANTONIO; SUZUKI, KENJI; KUO, TING–FANG; NAGATSUMA, KEISUKE; SHIMOKADO, KENTARO; OKUNO, MASATAKA; WU, JIAN; IISMAA, SIIRI; MATSUURA, TOMOKAZU; TSUKAMOTO, HIDEKAZU; ZERN, MARK A.; GRAHAM, ROBERT M.; KOJIMA, SOICHI

    2016-01-01

    Background & Aims Despite high morbidity and mortality of alcoholic liver disease worldwide, the molecular mechanisms underlying alcohol-induced liver cell death are not fully understood. Transglutaminase 2 (TG2) is a cross-linking enzyme implicated in apoptosis. TG2 levels and activity are increased in association with various types of liver injury. However, how TG2 induces hepatic apoptosis is not known. Methods Human hepatic cells or primary hepatocytes from rats or TG2+/+ and TG2−/− mice were treated with ethanol. Mice were administered anti-Fas antibody or alcohol. Liver sections were prepared from patients with alcoholic steatohepatitis. Changes in TG2 levels, Sp1 cross-linking and its activities, expression of hepatocyte growth factor receptor, c-Met, and hepatic apoptosis were measured. Results Ethanol induced apoptosis in hepatic cells, enhanced activity and nuclear accumulation of TG2 as well as accumulation of cross-linked and inactivated Sp1, and reduced expression of the Sp1-responsive gene, c-Met. These effects were rescued by TG2 knockdown, restoration of functional Sp1, or addition of hepatocyte growth factor, whereas apoptosis was reproduced by Sp1 knockdown or TG2 overexpression. Compared with TG2+/+ mice, TG2−/− mice showed markedly reduced hepatocyte apoptosis and Sp1 cross-linking following ethanol or anti-Fas treatment. Treatment of TG2+/+ mice with the TG2 inhibitors putrescine or cystamine blocked anti-Fas–induced hepatic apoptosis and Sp1 silencing. Moreover, enhanced expression of cross-linked Sp1 and TG2 was evident in hepatocyte nuclei of patients with alcoholic steatohepatitis. Conclusions TG2 induces hepatocyte apoptosis via Sp1 cross-linking and inactivation, with resultant inhibition of the expression of c-Met required for hepatic cell viability. PMID:19208340

  18. 5-Azacytidine treatment of HA-A melanoma cells induces Sp1 activity and concomitant transforming growth factor alpha expression.

    PubMed Central

    Shin, T H; Paterson, A J; Grant, J H; Meluch, A A; Kudlow, J E

    1992-01-01

    Evidence indicates DNA methylation as a part of the regulatory machinery controlling mammalian gene expression. The human melanoma cell line HA-A expresses low levels of transforming growth factor alpha (TGF-alpha). TGF-alpha mRNA accumulated, however, in response to DNA demethylation induced by a nucleoside analog, 5-azacytidine (5-azaC). The importance of DNA methylation in the TGF-alpha promoter region was examined by a transient transfection assay with luciferase reporter plasmids containing a portion of the TGF-alpha promoter. 5-azaC treatment of HA-A cells before the transfection caused a significant increase in the luciferase activity. Since input plasmids were confirmed to remain unmethylated, DNA demethylation of the TGF-alpha promoter itself does not account for the observed increase in TGF-alpha mRNA. Using an electrophoretic mobility shift assay, enhanced formation of protein-TGF-alpha promoter complex was detected in response to 5-azaC treatment. This 5-azaC-induced complex was shown to contain the transcription factor Sp1 by the following criteria: the protein-DNA complex formed on the TGF-alpha promoter contained immunoreactive Sp1; the mobility of the complex in an electrophoretic mobility shift assay was similar to that formed by recombinant Sp1; and DNase I footprinting analysis demonstrated that the 5-azaC-induced complex produced a footprint on the TGF-alpha promoter identical to that of authentic Sp1. These observations suggest that 5-azaC induces TGF-alpha expression by augmenting the Sp1 activity. However, neither the Sp1 mRNA nor its protein was induced by 5-azaC. These results suggest that in HA-A cells, TGF-alpha expression is down-modulated by DNA methylation. In addition, this process may involve the specific regulation of Sp1 activity without altering the amount of the transcription factor. Images PMID:1380648

  19. The oncoprotein HBXIP upregulates PDGFB via activating transcription factor Sp1 to promote the proliferation of breast cancer cells

    SciTech Connect

    Zhang, Yingyi; Zhao, Yu; Li, Leilei; Shen, Yu; Cai, Xiaoli; Zhang, Xiaodong; Ye, Lihong

    2013-05-03

    Highlights: •HBXIP is able to upregulate the expression of PDGFB in breast cancer cells. •HBXIP serves as a coactivator of activating transcription factor Sp1. •HBXIP stimulates the PDGFB promoter via activating transcription factor Sp1. •HBXIP promotes the proliferation of breast cancer cell via upregulating PDGFB. -- Abstract: We have reported that the oncoprotein hepatitis B virus X-interacting protein (HBXIP) acts as a novel transcriptional coactivator to promote proliferation and migration of breast cancer cells. Previously, we showed that HBXIP was able to activate nuclear factor-κB (NF-κB) in breast cancer cells. As an oncogene, the platelet-derived growth factor beta polypeptide (PDGFB) plays crucial roles in carcinogenesis. In the present study, we found that both HBXIP and PDGFB were highly expressed in breast cancer cell lines. Interestingly, HBXIP was able to increase transcriptional activity of NF-κB through PDGFB, suggesting that HBXIP is associated with PDGFB in the cells. Moreover, HBXIP was able to upregulate PDGFB at the levels of mRNA, protein and promoter in the cells. Then, we identified that HBXIP stimulated the promoter of PDGFB through activating transcription factor Sp1. In function, HBXIP enhanced the proliferation of breast cancer cells through PDGFB in vitro. Thus, we conclude that HBXIP upregulates PDGFB via activating transcription factor Sp1 to promote proliferation of breast cancer cells.

  20. Stimulation of ribosomal RNA gene promoter by transcription factor Sp1 involves active DNA demethylation by Gadd45-NER pathway.

    PubMed

    Rajput, Pallavi; Pandey, Vijaya; Kumar, Vijay

    2016-08-01

    The well-studied Pol II transcription factor Sp1 has not been investigated for its regulatory role in rDNA transcription. Here, we show that Sp1 bound to specific sites on rDNA and localized into the nucleoli during the G1 phase of cell cycle to activate rDNA transcription. It facilitated the recruitment of Pol I pre-initiation complex and impeded the binding of nucleolar remodeling complex (NoRC) to rDNA resulting in the formation of euchromatin active state. More importantly, Sp1 also orchestrated the site-specific binding of Gadd45a-nucleotide excision repair (NER) complex resulting in active demethylation and transcriptional activation of rDNA. Interestingly, knockdown of Sp1 impaired rDNA transcription due to reduced engagement of the Gadd45a-NER complex and hypermethylation of rDNA. Thus, the present study unveils a novel role of Sp1 in rDNA transcription involving promoter demethylation. PMID:27156884

  1. Triptolide-induced Cell Death in Pancreatic Cancer Is Mediated by O-GlcNAc Modification of Transcription Factor Sp1*

    PubMed Central

    Banerjee, Sulagna; Sangwan, Veena; McGinn, Olivia; Chugh, Rohit; Dudeja, Vikas; Vickers, Selwyn M.; Saluja, Ashok K.

    2013-01-01

    Pancreatic cancer, the fourth most prevalent cancer-related cause of death in the United States, is a disease with a dismal survival rate of 5% 5 years after diagnosis. One of the survival proteins responsible for its extraordinary ability to evade cell death is HSP70. A naturally derived compound, triptolide, and its water-soluble prodrug, Minnelide, down-regulate the expression of this protein in pancreatic cancer cells, thereby causing cell death. However, the mechanism of action of triptolide has not been elucidated. Our study shows that triptolide-induced down-regulation of HSP70 expression is associated with a decrease in glycosylation of the transcription factor Sp1. We further show that triptolide inhibits glycosylation of Sp1, inhibiting the hexosamine biosynthesis pathway, particularly the enzyme O-GlcNAc transferase. Inhibition of O-GlcNAc transferase prevents nuclear localization of Sp1 and affects its DNA binding activity. This in turn down-regulates prosurvival pathways like NF-κB, leading to inhibition of HSF1 and HSP70 and eventually to cell death. In this study, we evaluated the mechanism by which triptolide affects glycosylation of Sp1, which in turn affects downstream pathways controlling survival of pancreatic cancer cells. PMID:24129563

  2. Triptolide-induced cell death in pancreatic cancer is mediated by O-GlcNAc modification of transcription factor Sp1.

    PubMed

    Banerjee, Sulagna; Sangwan, Veena; McGinn, Olivia; Chugh, Rohit; Dudeja, Vikas; Vickers, Selwyn M; Saluja, Ashok K

    2013-11-22

    Pancreatic cancer, the fourth most prevalent cancer-related cause of death in the United States, is a disease with a dismal survival rate of 5% 5 years after diagnosis. One of the survival proteins responsible for its extraordinary ability to evade cell death is HSP70. A naturally derived compound, triptolide, and its water-soluble prodrug, Minnelide, down-regulate the expression of this protein in pancreatic cancer cells, thereby causing cell death. However, the mechanism of action of triptolide has not been elucidated. Our study shows that triptolide-induced down-regulation of HSP70 expression is associated with a decrease in glycosylation of the transcription factor Sp1. We further show that triptolide inhibits glycosylation of Sp1, inhibiting the hexosamine biosynthesis pathway, particularly the enzyme O-GlcNAc transferase. Inhibition of O-GlcNAc transferase prevents nuclear localization of Sp1 and affects its DNA binding activity. This in turn down-regulates prosurvival pathways like NF-κB, leading to inhibition of HSF1 and HSP70 and eventually to cell death. In this study, we evaluated the mechanism by which triptolide affects glycosylation of Sp1, which in turn affects downstream pathways controlling survival of pancreatic cancer cells. PMID:24129563

  3. Starvation after Cobalt-60 γ-Ray Radiation Enhances Metastasis in U251 Glioma Cells by Regulating the Transcription Factor SP1

    PubMed Central

    Zhao, Tuo; Wang, Hailong; Ma, Hong; Wang, Hao; Chen, Bo; Deng, Yulin

    2016-01-01

    Radiation is of clinical importance during glioma therapy; however, vasculature damage is observed over the treatment course. This type of tissue damage might lead to starvation conditions, affecting tumor metastasis. To test this possibility, we compared starvation conditions in conjunction with radiation treatment to monitor metastatic ability in the U251 glioma cell line. Transcriptome, western blot, and immunofluorescence analyses were used to measure the RNA and protein expression changes of the U251 cells after various treatments. We found that starvation combined with radiation treatment yielded the most significant expression changes in metastasis-related factors compared to that in the control groups. In addition, a metastasis assay was used to directly measure the metastatic ability of the treated cells, which confirmed that the U251 cells treated with starvation combined with radiation possessed the highest metastatic ability. Furthermore, bioinformatics analysis demonstrated that SP1 represented a common transcription factor associated with changes in metastasis-related factors. Blocking SP1 activity by an inhibitor suppressed the starvation-plus-radiation treatment-mediated enhancement of U251 cell metastasis. Our study provides the first evidence that starvation caused by radiation might play a significant role in enhancing the ability of the glioma cell line U251 to metastasize via regulation of the transcription factor SP1. PMID:27058528

  4. Differences in the expression of cathepsin B in B16 melanoma metastatic variants depend on transcription factor Sp1.

    PubMed

    Sitabkhan, Yasmin; Frankfater, Allen

    2007-09-01

    Cathepsin B contributes to the invasiveness of B16 melanoma cells in mice, with the highly metastatic B16a melanoma producing six- to eightfold more cathepsin B mRNA and protein than the less metastatic B16F1 variant. The proximal promoter region of the cathepsin B (Ctsb) gene (-149 to +94) was previously found to be capable of reproducing this pattern of differential gene activation in B16 melanoma variants. The binding of B16 melanoma nuclear proteins to this promoter region has now been mapped to three GC-boxes (Sp1 transcription factor binding sites) and a potential X-box [tax response element (TRE)/c-AMP responsive element (CRE) site]. Mutation of the GC-boxes at -55 and -37 independently decreased the expression of a luciferase reporter gene in B16a cells to the level observed in B16F1 cells. Promoter activity was also attenuated by mutations within the GC-rich segment between +6 and +16, but not by mutation of the putative X-box. Both Sp1 and Sp3 bound the GC-boxes in the Ctsb promoter, and western blotting showed the level of Sp1 to be greater in B16a compared to B16F1 cells. B16F1 cells that were made to express Sp1 at levels observed in B16a cells produced corresponding increased amounts of endogenous cathepsin B mRNA and enzyme activity. Thus, the difference in cathepsin B expression between high and low metastatic B16 melanoma variants is largely due to different levels of Sp1. PMID:17691867

  5. Transcription factors YY1, Sp1 and Sp3 modulate dystrophin Dp71 gene expression in hepatic cells.

    PubMed

    Peñuelas-Urquides, Katia; Becerril-Esquivel, Carolina; Mendoza-de-León, Laura C; Silva-Ramírez, Beatriz; Dávila-Velderrain, José; Cisneros, Bulmaro; de León, Mario Bermúdez

    2016-07-01

    Dystrophin Dp71, the smallest product encoded by the Duchenne muscular dystrophy gene, is ubiquitously expressed in all non-muscle cells. Although Dp71 is involved in various cellular processes, the mechanisms underlying its expression have been little studied. In hepatic cells, Dp71 expression is down-regulated by the xenobiotic β-naphthoflavone. However, the effectors of this regulation remain unknown. In the present study we aimed at identifying DNA elements and transcription factors involved in Dp71 expression in hepatic cells. Relevant DNA elements on the Dp71 promoter were identified by comparing Dp71 5'-end flanking regions between species. The functionality of these elements was demonstrated by site-directed mutagenesis. Using EMSAs and ChIP, we showed that the Sp1 (specificity protein 1), Sp3 (specificity protein 3) and YY1 (Yin and Yang 1) transcription factors bind to the Dp71 promoter region. Knockdown of Sp1, Sp3 and YY1 in hepatic cells increased endogenous Dp71 expression, but reduced Dp71 promoter activity. In summary, Dp71 expression in hepatic cells is carried out, in part, by YY1-, Sp1- and Sp3-mediated transcription from the Dp71 promoter. PMID:27143785

  6. Transcription factor Sp1 regulates T-type Ca(2+) channel CaV 3.1 gene expression.

    PubMed

    González-Ramírez, Ricardo; Martínez-Hernández, Elizabeth; Sandoval, Alejandro; Felix, Ricardo

    2014-05-01

    Voltage-gated T-type Ca(2+) (CaV 3) channels mediate a number of physiological events in developing and mature cells, and are implicated in neurological and cardiovascular diseases. In mammals, there are three distinct T-channel genes (CACNA1G, CACNA1H, and CACNA1I) encoding proteins (CaV 3.1-CaV 3.3) that differ in their localization as well as in molecular, biophysical, and pharmacological properties. The CACNA1G is a large gene that contains 38 exons and is localized in chromosome 17q22. Only basic characteristics of the CACNA1G gene promoter region have been investigated classifying it as a TATA-less sequence containing several potential transcription factor-binding motifs. Here, we cloned and characterized a proximal promoter region and initiated the analysis of transcription factors that control CaV 3.1 channel expression using the murine Cacna1g gene as a model. We isolated a ∼1.5 kb 5'-upstream region of Cacna1g and verified its transcriptional activity in the mouse neuroblastoma N1E-115 cell line. In silico analysis revealed that this region possesses a TATA-less minimal promoter that includes two potential transcription start sites and four binding sites for the transcription factor Sp1. The ability of one of these sites to interact with the transcription factor was confirmed by electrophoretic mobility shift assays. Consistent with this, Sp1 over-expression enhanced promoter activity while siRNA-mediated Sp1 silencing significantly decreased the level of CaV 3.1 protein and reduced the amplitude of whole-cell T-type Ca(2+) currents expressed in the N1E-115 cells. These results provide new insights into the molecular mechanisms that control CaV 3.1 channel expression. PMID:23868804

  7. DNA binding and regulatory effects of transcription factors SP1 and USF at the rat amyloid precursor protein gene promoter.

    PubMed Central

    Hoffman, P W; Chernak, J M

    1995-01-01

    Two DNA elements which we have termed SAA and GAG have been shown to control expression of the rat amyloid precursor protein (APP) gene, and the region containing the SAA element has been shown to interact with nuclear proteins [Hoffman and Chernak (1994) Biochem. Biophys. Res. Commun. 201, 610-617]. In this report we study DNA sequences and proteins which influence the activity of the SAA element. An oligonucleotide containing the SAA element is specifically bound by nuclear proteins derived from rat PC12 cells, consistently forming four complexes designated C25, C30, C35 and C40 in electrophoretic mobility shift assays (EMSAs). We demonstrate that the C25, C30 and C40 complexes involve the binding of nuclear proteins to an SP1 consensus sequence located within the SAA element and that the C25 complex contains a protein antigenically related to the human SP1 protein. We establish further that the C35 complex requires a USF recognition site located within the SAA element and contains a protein antigenically related to the human upstream stimulatory factor (USF) protein. Using APP promoter/luciferase reporter gene constructs, we demonstrate that both the SP1 and the USF sites can play a role in the transcriptional activity of the SAA element. Finally, we show that complexes similar to the C25, C30 and C35 complexes are formed by rat cortex nuclear extracts and the SAA element in EMSA experiments, suggesting the relevance of our in vitro observations to the in vivo functioning of the rat APP promoter. Images PMID:7610052

  8. Specificity protein (Sp) transcription factors Sp1, Sp3 and Sp4 are non-oncogene addiction genes in cancer cells

    PubMed Central

    Hedrick, Erik; Cheng, Yating; Jin, Un-Ho; Kim, Kyounghyun; Safe, Stephen

    2016-01-01

    Specificity protein (Sp) transcription factor (TF) Sp1 is overexpressed in multiple tumors and is a negative prognostic factor for patient survival. Sp1 and also Sp3 and Sp4 are highly expressed in cancer cells and in this study, we have used results of RNA interference (RNAi) to show that the three TFs individually play a role in the growth, survival and migration/invasion of breast, kidney, pancreatic, lung and colon cancer cell lines. Moreover, tumor growth in athymic nude mice bearing L3.6pL pancreatic cancer cells as xenografts were significantly decreased in cells depleted for Sp1, Sp3 and Sp4 (combined) or Sp1 alone. Ingenuity Pathway Analysis (IPA) of changes in gene expression in Panc1 pancreatic cancer cells after individual knockdown of Sp1, Sp3 and Sp4 demonstrates that these TFs regulate genes and pathways that correlated with the functional responses observed after knockdown but also some genes and pathways that inversely correlated with the functional responses. However, causal IPA analysis which integrates all pathway-dependent changes in all genes strongly predicted that Sp1-, Sp3- and Sp4-regulated genes were associated with the pro-oncogenic activity. These functional and genomic results coupled with overexpression of Sp transcription factors in tumor vs. non-tumor tissues and decreased Sp1 expression with age indicate that Sp1, Sp3 and Sp4 are non-oncogene addiction (NOA) genes and are attractive drug targets for individual and combined cancer chemotherapies. PMID:26967243

  9. O-GlcNAc Modification of Transcription Factor Sp1 Mediates Hyperglycemia-Induced VEGF-A Upregulation in Retinal Cells

    PubMed Central

    Donovan, Kelly; Alekseev, Oleg; Qi, Xin; Cho, William; Azizkhan-Clifford, Jane

    2014-01-01

    Purpose. Proangiogenic protein VEGF-A contributes significantly to retinal lesions and neovascularization in diabetic retinopathy (DR). In preclinical DR, hyperglycemia can upregulate VEGF-A in retinal cells. The VEGF-A promoter is responsive to the transcription factor specificity protein 1 (Sp1). The O-GlcNAc modification is driven by glucose concentration and has a profound effect on Sp1 activity. This study investigated the effects of hyperglycemia on Sp1-mediated expression of VEGF-A in the retinal endothelium and pigment epithelium. Methods. Hyperglycemia-exposed ARPE-19 (human retinal pigment epithelial cells) and TR-iBRB (rat retinal microendothelial cells) were assayed for levels of VEGF-A by qRT-PCR, Western blot, and ELISA. Small molecule inhibitors of O-GlcNAc transferase (OGT) or O-GlcNAcase (OGA) were used to manipulate O-GlcNAc levels. Vascular endothelial growth factor–A protein and transcript were measured in cells depleted of OGT or Sp1 by shRNA. The proximal VEGF-A promoter was analyzed for glucose sensitivity by luciferase assay. Chromatin immunoprecipitation (ChIP) was used to assess Sp1 occupancy on the VEGF-A promoter. Results. Hyperglycemia increased VEGF-A promoter activity and upregulated VEGF-A transcript and protein. Elevation of O-GlcNAc by OGA inhibitors was sufficient to increase VEGF-A. O-GlcNAc transferase inhibition abrogated glucose-driven VEGF-A. Cellular depletion of OGT or Sp1 by shRNA significantly abrogated glucose-induced changes in VEGF-A. ChIP analysis showed that hyperglycemia significantly increased binding of Sp1 to the VEGF-A promoter. Conclusions. Hyperglycemia-driven VEGF-A production is mediated by elevated O-GlcNAc modification of the Sp1 transcription factor. This mechanism may be significant in the pathogenesis of preclinical DR through VEGF-A upregulation. PMID:25352121

  10. Involvement of PKC{alpha} in insulin-induced PKC{delta} expression: Importance of SP-1 and NF{kappa}B transcription factors

    SciTech Connect

    Horovitz-Fried, Miriam; Sampson, Sanford R. . E-mail: sampsos@mail.biu.ac.il

    2007-01-05

    Protein kinase C delta (PKC{delta}) is a key molecule in insulin signaling essential for insulin-induced glucose transport in skeletal muscle. Recent studies in our laboratory have shown that insulin rapidly stimulates PKC{delta} activity and increases PKC{delta} protein and RNA levels, and that the SP-1 transcription factor is involved in insulin-induced transcription of the PKC{delta} gene. Activation of SP-1 involves serine phosphorylation and translocation to the nucleus. In this study we examined the possibility that PKC{alpha} might be involved in serine phosphorylation and activation of SP-1. We found that insulin rapidly phosphorylates and translocates SP-1. In the cytoplasm, SP-1 was constitutively associated with PKC{alpha}, and insulin stimulation caused these proteins to dissociate. In contrast, in the nucleus insulin induced an increase in association between PKC{alpha} and SP-1. PKC{alpha} inhibition blocked insulin-induced serine phosphorylation of SP-1 and its association with PKC{alpha} in the nucleus. Inhibition of PKC{alpha} also reduced the insulin-induced increase in PKC{delta} RNA and protein in the cytoplasmic and nuclear fractions. We also attempted to determine if another transcription factor might be involved in regulation of PKC{delta} expression. We earlier showed that insulin did not affect nuclear NF{kappa}B levels. Inhibition of NF{kappa}B, however, increased insulin-induced increase in PKC{delta} RNA and protein in the cytoplasmic and nuclear fractions. Surprisingly, this inhibition reduced the insulin-induced increase in cytoplasmic and nuclear PKC{alpha} RNA and protein. Inhibition of PKC{delta} reduced I{kappa}B{alpha} phosphorylation as well as NF{kappa}B activation. Thus, PKC{alpha} regulates insulin-induced PKC{delta} expression levels and this regulation involves activation of SP-1 and NF{kappa}B.

  11. NF-κB Activation Limits Airway Branching through Inhibition of Sp1-Mediated Fibroblast Growth Factor-10 Expression

    PubMed Central

    Benjamin, John T.; Carver, Billy J.; Plosa, Erin J.; Yamamoto, Yasutoshi; Miller, J. Davin; Liu, Jin-Hua; van der Meer, Riet; Blackwell, Timothy S.; Prince, Lawrence S.

    2015-01-01

    Bronchopulmonary dysplasia (BPD) is a frequent complication of preterm birth. This chronic lung disease results from arrested saccular airway development and is most common in infants exposed to inflammatory stimuli. In experimental models, inflammation inhibits expression of fibroblast growth factor-10 (FGF-10) and impairs epithelial–mesenchymal interactions during lung development; however, the mechanisms connecting inflammatory signaling with reduced growth factor expression are not yet understood. In this study we found that soluble inflammatory mediators present in tracheal fluid from preterm infants can prevent saccular airway branching. In addition, LPS treatment led to local production of mediators that inhibited airway branching and FGF-10 expression in LPS-resistant C.C3-Tlr4Lpsd/J fetal mouse lung explants. Both direct NF-κB activation and inflammatory cytokines (IL-1β and TNF-α) that activate NF-κB reduced FGF-10 expression, whereas chemokines that signal via other inflammatory pathways had no effect. Mutational analysis of the FGF-10 promoter failed to identify genetic elements required for direct NF-κB–mediated FGF-10 inhibition. Instead, NF-κB activation appeared to interfere with the normal stimulation of FGF-10 expression by Sp1. Chromatin immunoprecipitation and nuclear coimmunoprecipitation studies demonstrated that the RelA subunit of NF-κB and Sp1 physically interact at the FGF-10 promoter. These findings indicate that inflammatory signaling through NF-κB disrupts the normal expression of FGF-10 in fetal lung mesenchyme by interfering with the transcriptional machinery critical for lung morphogenesis. PMID:20861353

  12. Hepatitis C virus nonstructural protein-5A activates sterol regulatory element-binding protein-1c through transcription factor Sp1

    SciTech Connect

    Xiang, Zhonghua; Qiao, Ling; Zhou, Yan; Babiuk, Lorne A.; Liu, Qiang

    2010-11-19

    Research highlights: {yields} A chimeric subgenomic HCV replicon expresses HCV-3a NS5A in an HCV-1b backbone. {yields} HCV-3a NS5A increases mature SREBP-1c protein level. {yields} HCV-3a NS5A activates SREBP-1c transcription. {yields} Domain II of HCV-3a NS5A is more effective in SREBP-1c promoter activation. {yields} Transcription factor Sp1 is required for SREBP-1c activation by HCV-3a NS5A. -- Abstract: Steatosis is an important clinical manifestation of hepatitis C virus (HCV) infection. The molecular mechanisms of HCV-associated steatosis are not well understood. Sterol regulatory element-binding protein-1c (SREBP-1c) is a key transcription factor which activates the transcription of lipogenic genes. Here we showed that the nuclear, mature SREBP-1c level increases in the nucleus of replicon cells expressing HCV-3a nonstructural protein-5A (NS5A). We further showed that HCV-3a NS5A up-regulates SREBP-1c transcription. Additional analysis showed that transcriptional factor Sp1 is involved in SREBP-1c activation by HCV-3a NS5A because inhibition of Sp1 activity by mithramycin A or a dominant-negative Sp1 construct abrogated SREBP-1c promoter activation by HCV-3a NS5A. In addition, chromatin immunoprecipitation (ChIP) assay demonstrated enhanced binding of Sp1 on the SREBP-1c promoter in HCV-3a NS5A replicon cells. These results showed that HCV-3a NS5A activates SREBP-1c transcription through Sp1. Taken together, our results suggest that HCV-3a NS5A is a contributing factor for steatosis caused by HCV-3a infection.

  13. Sp1 Transcription Factor Interaction with Accumulated Prelamin A Impairs Adipose Lineage Differentiation in Human Mesenchymal Stem Cells: Essential Role of Sp1 in the Integrity of Lipid Vesicles

    PubMed Central

    Ruiz de Eguino, Garbiñe; Infante, Arantza; Schlangen, Karin; Aransay, Ana M.; Fullaondo, Ane; Soriano, Mario; García-Verdugo, José Manuel; Martín, Ángel G.

    2012-01-01

    Lamin A (LMNA)-linked lipodystrophies may be either genetic (associated with LMNA mutations) or acquired (associated with the use of human immunodeficiency virus protease inhibitors [PIs]), and in both cases they share clinical features such as anomalous distribution of body fat or generalized loss of adipose tissue, metabolic alterations, and early cardiovascular complications. Both LMNA-linked lipodystrophies are characterized by the accumulation of the lamin A precursor prelamin A. The pathological mechanism by which prelamin A accumulation induces the lipodystrophy associated phenotypes remains unclear. Since the affected tissues in these disorders are of mesenchymal origin, we have generated an LMNA-linked experimental model using human mesenchymal stem cells treated with a PI, which recapitulates the phenotypes observed in patient biopsies. This model has been demonstrated to be a useful tool to unravel the pathological mechanism of the LMNA-linked lipodystrophies, providing an ideal system to identify potential targets to generate new therapies for drug discovery screening. We report for the first time that impaired adipogenesis is a consequence of the interaction between accumulated prelamin A and Sp1 transcription factor, sequestration of which results in altered extracellular matrix gene expression. In fact, our study shows a novel, essential, and finely tuned role for Sp1 in adipose lineage differentiation in human mesenchymal stem cells. These findings define a new physiological experimental model to elucidate the pathological mechanisms LMNA-linked lipodystrophies, creating new opportunities for research and treatment not only of LMNA-linked lipodystrophies but also of other adipogenesis-associated metabolic diseases. PMID:23197810

  14. Sp1 and the ets-related transcription factor complex GABP alpha/beta functionally cooperate to activate the utrophin promoter.

    PubMed

    Gyrd-Hansen, Mads; Krag, Thomas O B; Rosmarin, Alan G; Khurana, Tejvir S

    2002-05-15

    Duchenne muscular dystrophy (DMD) is a fatal neuromuscular disease caused by the absence of dystrophin. Utrophin is the autosomal homolog of dystrophin and capable of compensating for the absence of dystrophin, when overexpressed. In skeletal muscle, utrophin plays an important role in the formation of neuromuscular junctions. This selective enrichment occurs, in part by transcriptional regulation of the utrophin gene at the sub-synaptic nuclei in muscle. Utrophin's complex transcriptional regulation is not yet fully understood, however, GABP alpha / beta has recently been shown to bind the N box and activate the utrophin promoter in response to heregulin. In this study, we show that the transcription factor Sp1 binds and activates the utrophin promoter in Drosophila S2 cells as well as define a Sp1 response element. We demonstrate that heregulin treatment of cultured muscle cells activates the ERK pathway and phosphorylates serine residue(s) in the consensus ERK recognition site of Sp1. Finally, Sp1 is shown to functionally cooperate with GABP alpha / beta and cause a 58-fold increase of de novo utrophin promoter transcription. Taken together, these findings help define mechanisms used for transcriptional regulation of utrophin expression as well as identify new targets for achieving potentially therapeutic upregulation of utrophin in DMD. PMID:11997063

  15. Transcription factor-pathway co-expression analysis reveals cooperation between SP1 and ESR1 on dysregulating cell cycle arrest in non-hyperdiploid multiple myeloma

    PubMed Central

    Wang, Xujun; Yan, Zhenyu; Fulciniti, Mariateresa; Li, Yingxiang; Gkotzamanidou, Maria; Amin, Samir B; Shah, Parantu K; Zhang, Yong

    2014-01-01

    Multiple myeloma is a hematological cancer of plasma B-cells and remains incurable. Two major subtypes of myeloma, hyperdiploid (HMM) and non-hyperdiploid myeloma (NHMM), have distinct chromosomal alterations and different survival outcomes. Transcription factors (TrFs) have been implicated in myeloma oncogenesis but their dysregulation in myeloma subtypes are less studied. Here we develop a TrF-pathway co-expression analysis to identify altered co-expression between two sample types. We apply the method to the two myeloma subtypes and the cell cycle arrest pathway, which is significantly differentially expressed between the two subtypes. We find that TrFs MYC, NF-κB and HOXA9 have significantly lower co-expression with cell cycle arrest in HMM, co-occurring with their over-activation in HMM. In contrast, TrFs ESR1, SP1 and E2F1 have significantly lower co-expression with cell cycle arrest in NHMM. SP1 ChIP targets are enriched by cell cycle arrest genes. These results motivate a cooperation model of ESR1 and SP1 in regulating cell cycle arrest, and a hypothesis that their over-activation in NHMM disrupts proper regulation of cell cycle arrest. Co-targeting ESR1 and SP1 shows a synergistic effect on inhibiting myeloma proliferation in NHMM cell lines. Therefore, studying TrF-pathway co-expression dysregulation in human cancers facilitates forming novel hypotheses towards clinical utility. PMID:23925045

  16. Transcriptional regulation of the human cystathionine beta-synthase -1b basal promoter: synergistic transactivation by transcription factors NF-Y and Sp1/Sp3.

    PubMed Central

    Ge, Y; Konrad, M A; Matherly, L H; Taub, J W

    2001-01-01

    Cystathionine beta-synthase (CBS) catalyses the condensation of serine and homocysteine to form cystathionine, an intermediate step in the synthesis of cysteine. Human CBS encodes five distinct 5' non-coding exons, the most frequent termed CBS -1a and CBS -1b, each transcribed from its own unique GC-rich TATA-less promoter. The minimal transcriptional region (-3792 to -3667) of the CBS -1b promoter was defined by 5'- and 3'-deletions, and transient transfections of reporter gene constructs in HepG2 cells, characterized by CBS transcription exclusively from the -1b promoter. Included in this 125 bp region are 3 GC-boxes (termed GC-a, GC-b and GC-c), an inverted CAAT-box and an E-box. By gel-shift and supershift assays, binding of specificity protein (Sp)1 and Sp3 to the GC-box elements, upstream stimulatory factor 1 (USF-1) to the E-box, and both nuclear factor (NF)-Y and an NF-1-like factor to the CAAT box could be demonstrated. By transient trans fections and reporter gene assays in HepG2 and Drosophila SL2 cells, a functional interplay was indicated between NF-Y binding to the CAAT-box, or between USF-1 binding to the E-box, and Sp1/Sp3 binding to the GC-box elements. In SL2 cells, NF-Y and Sp1/Sp3 were synergistic. Furthermore, both Sp1 and the long Sp3 isoform transactivated the CBS -1b minimal promoter; however, the short Sp3 isoforms were potent repressors. These results may explain the cell- or tissue-specific regulation of CBS transcription, and clarify the bases for alterations in CBS gene expression in human disease and Down's syndrome. PMID:11415440

  17. Arsenic trioxide-mediated growth inhibition in gallbladder carcinoma cells via down-regulation of Cyclin D1 transcription mediated by Sp1 transcription factor

    SciTech Connect

    Ai, Zhilong; Lu, Weiqi; Ton, Saixiong; Liu, Houbao; Sou, Tao; Shen, Zhenbin; Qin, Xinyu . E-mail: smc_jjh@yahoo.com.cn

    2007-08-31

    Gallbladder carcinoma (GBC), an aggressive and mostly lethal malignancy, is known to be resistant to a number of drug stimuli. Here, we demonstrated that arsenic trioxide inhibited the proliferation of gallbladder carcinoma in vivo and in vitro as well as the transcription of cell cycle-related protein Cyclin D1. And, Cyclin D1 overexpression inhibited the negative role of arsenic trioxide in cell cycle progression. We further explored the mechanisms by which arsenic trioxide affected Cyclin D1 transcription and found that the Sp1 transcription factor was down-regulated by arsenic trioxide, with a corresponding decrease in Cyclin D1 promoter activity. Taken together, these results suggested that arsenic trioxide inhibited gallbladder carcinoma cell proliferation via down-regulation of Cyclin D1 transcription in a Sp1-dependent manner, which provided a new mechanism of arsenic trioxide-involved cell proliferation and may have important therapeutic implications in gallbladder carcinoma patients.

  18. Brg-1 mediates the constitutive and fenretinide-induced expression of SPARC in mammary carcinoma cells via its interaction with transcription factor Sp1

    PubMed Central

    2010-01-01

    Background Secreted protein, acidic and rich in cysteine (SPARC) is a matricellular protein that mediates cell-matrix interactions. It has been shown, depending on the type of cancer, to possess either pro- or anti-tumorigenic properties. The transcriptional regulation of the SPARC gene expression has not been fully elucidated and the effects of anti-cancer drugs on this process have not been explored. Results In the present study, we demonstrated that chromatin remodeling factor Brg-1 is recruited to the proximal SPARC promoter region (-130/-56) through an interaction with transcription factor Sp1. We identified Brg-1 as a critical regulator for the constitutive expression levels of SPARC mRNA and protein in mammary carcinoma cell lines and for SPARC secretion into culture media. Furthermore, we found that Brg-1 cooperates with Sp1 to enhance SPARC promoter activity. Interestingly, fenretinide [N-4(hydroxyphenyl) retinamide, 4-HPR], a synthetic retinoid with anti-cancer properties, was found to up-regulate the transcription, expression and secretion of SPARC via induction of the Brg-1 in a dose-dependent manner. Finally, our results demonstrated that fenretinide-induced expression of SPARC contributes significantly to a decreased invasion of mammary carcinoma cells. Conclusions Overall, our results reveal a novel cooperative role of Brg-1 and Sp1 in mediating the constitutive and fenretinide-induced expression of SPARC, and provide new insights for the understanding of the anti-cancer effects of fenretinide. PMID:20687958

  19. Transcription Factors Sp1 and p73 Control the Expression of the Proapoptotic Protein NOXA in the Response of Testicular Embryonal Carcinoma Cells to Cisplatin*

    PubMed Central

    Grande, Lara; Bretones, Gabriel; Rosa-Garrido, Manuel; Garrido-Martin, Eva M.; Hernandez, Teresa; Fraile, Susana; Botella, Luisa; de Alava, Enrique; Vidal, August; Garcia del Muro, Xavier; Villanueva, Alberto; Delgado, M. Dolores; Fernandez-Luna, Jose L.

    2012-01-01

    Testicular germ cell tumors (TGCTs) are highly responsive to and curable by cisplatin-based chemotherapy even in advanced stages. We have studied the molecular mechanisms involved in the induction of apoptosis in response to cisplatin, and found that proapoptotic Noxa is transcriptionally up-regulated following cisplatin exposure, even in the absence of p53, in NTERA2 cisplatin-sensitive cells but not in 1411HP-resistant cells. Blockade of Noxa reduced the apoptotic response of embryonal carcinoma (EC) NTERA2 cells to cisplatin. A detailed analysis of the Noxa promoter revealed that p73 and Sp1-like factors, Sp1 and KLF6, played key roles in the transcriptional control of this gene. Overexpression of TAp73 induced Noxa whereas the dominant negative isoform ΔNp73, reduced the levels of Noxa after cisplatin exposure in NTERA2 and 2102EP. Interestingly, down-regulation of Sp1 increased Noxa expression in response to cisplatin. However, blockade of KLF6 decreased cisplatin-induced up-regulation of Noxa in EC cell lines. In addition, tissue microarray analyses of TGCTs revealed that expression of Noxa correlates with good clinical prognosis in patients with embryonal carcinoma. Thus, our data show the transcriptional network that regulates Noxa in EC cells, which is key for their apoptotic response to cisplatin-based chemotherapy, and propose Noxa as a predictive factor of therapeutic response. PMID:22718761

  20. Transcription factors Sp1 and p73 control the expression of the proapoptotic protein NOXA in the response of testicular embryonal carcinoma cells to cisplatin.

    PubMed

    Grande, Lara; Bretones, Gabriel; Rosa-Garrido, Manuel; Garrido-Martin, Eva M; Hernandez, Teresa; Fraile, Susana; Botella, Luisa; de Alava, Enrique; Vidal, August; Garcia del Muro, Xavier; Villanueva, Alberto; Delgado, M Dolores; Fernandez-Luna, Jose L

    2012-08-01

    Testicular germ cell tumors (TGCTs) are highly responsive to and curable by cisplatin-based chemotherapy even in advanced stages. We have studied the molecular mechanisms involved in the induction of apoptosis in response to cisplatin, and found that proapoptotic Noxa is transcriptionally up-regulated following cisplatin exposure, even in the absence of p53, in NTERA2 cisplatin-sensitive cells but not in 1411HP-resistant cells. Blockade of Noxa reduced the apoptotic response of embryonal carcinoma (EC) NTERA2 cells to cisplatin. A detailed analysis of the Noxa promoter revealed that p73 and Sp1-like factors, Sp1 and KLF6, played key roles in the transcriptional control of this gene. Overexpression of TAp73 induced Noxa whereas the dominant negative isoform ΔNp73, reduced the levels of Noxa after cisplatin exposure in NTERA2 and 2102EP. Interestingly, down-regulation of Sp1 increased Noxa expression in response to cisplatin. However, blockade of KLF6 decreased cisplatin-induced up-regulation of Noxa in EC cell lines. In addition, tissue microarray analyses of TGCTs revealed that expression of Noxa correlates with good clinical prognosis in patients with embryonal carcinoma. Thus, our data show the transcriptional network that regulates Noxa in EC cells, which is key for their apoptotic response to cisplatin-based chemotherapy, and propose Noxa as a predictive factor of therapeutic response. PMID:22718761

  1. miR-29b sensitizes multiple myeloma cells to bortezomib-induced apoptosis through the activation of a feedback loop with the transcription factor Sp1

    PubMed Central

    Amodio, N; Di Martino, M T; Foresta, U; Leone, E; Lionetti, M; Leotta, M; Gullà, A M; Pitari, M R; Conforti, F; Rossi, M; Agosti, V; Fulciniti, M; Misso, G; Morabito, F; Ferrarini, M; Neri, A; Caraglia, M; Munshi, N C; Anderson, K C; Tagliaferri, P; Tassone, P

    2012-01-01

    MicroRNAs (miRNAs) with tumor-suppressor potential might have therapeutic applications in multiple myeloma (MM) through the modulation of still undiscovered molecular pathways. Here, we investigated the effects of enforced expression of miR-29b on the apoptotic occurrence in MM and highlighted its role in the context of a new transcriptional loop that is finely tuned by the proteasome inhibitor bortezomib. In details, in vitro growth inhibition and apoptosis of MM cells was induced by either transient expression of synthetic miR-29b or its stable lentivirus-enforced expression. We identified Sp1, a transcription factor endowed with oncogenic activity, as a negative regulator of miR-29b expression in MM cells. Since Sp1 expression and functions are regulated via the 26S proteasome, we investigated the effects of bortezomib on miR-29b-Sp1 loop, showing that miR-29b levels were indeed upregulated by the drug. At the same time, the bortezomib/miR-29b combination produced significant pro-apoptotic effects. We also demonstrated that the PI3K/AKT pathway plays a major role in the regulation of miR-29b-Sp1 loop and induction of apoptosis in MM cells. Finally, MM xenografts constitutively expressing miR-29b showed significant reduction of their tumorigenic potential. Our findings indicate that miR-29b is involved in a regulatory loop amenable of pharmacologic intervention and modulates the anti-MM activity of bortezomib in MM cells. PMID:23190608

  2. miR-29b sensitizes multiple myeloma cells to bortezomib-induced apoptosis through the activation of a feedback loop with the transcription factor Sp1.

    PubMed

    Amodio, N; Di Martino, M T; Foresta, U; Leone, E; Lionetti, M; Leotta, M; Gullà, A M; Pitari, M R; Conforti, F; Rossi, M; Agosti, V; Fulciniti, M; Misso, G; Morabito, F; Ferrarini, M; Neri, A; Caraglia, M; Munshi, N C; Anderson, K C; Tagliaferri, P; Tassone, P

    2012-01-01

    MicroRNAs (miRNAs) with tumor-suppressor potential might have therapeutic applications in multiple myeloma (MM) through the modulation of still undiscovered molecular pathways. Here, we investigated the effects of enforced expression of miR-29b on the apoptotic occurrence in MM and highlighted its role in the context of a new transcriptional loop that is finely tuned by the proteasome inhibitor bortezomib. In details, in vitro growth inhibition and apoptosis of MM cells was induced by either transient expression of synthetic miR-29b or its stable lentivirus-enforced expression. We identified Sp1, a transcription factor endowed with oncogenic activity, as a negative regulator of miR-29b expression in MM cells. Since Sp1 expression and functions are regulated via the 26S proteasome, we investigated the effects of bortezomib on miR-29b-Sp1 loop, showing that miR-29b levels were indeed upregulated by the drug. At the same time, the bortezomib/miR-29b combination produced significant pro-apoptotic effects. We also demonstrated that the PI3K/AKT pathway plays a major role in the regulation of miR-29b-Sp1 loop and induction of apoptosis in MM cells. Finally, MM xenografts constitutively expressing miR-29b showed significant reduction of their tumorigenic potential. Our findings indicate that miR-29b is involved in a regulatory loop amenable of pharmacologic intervention and modulates the anti-MM activity of bortezomib in MM cells. PMID:23190608

  3. Altered Expression of NF- κ B and SP1 after Exposure to Advanced Glycation End-Products and Effects of Neurotrophic Factors in AGEs Exposed Rat Retinas.

    PubMed

    Bikbova, Guzel; Oshitari, Toshiyuki; Baba, Takayuki; Yamamoto, Shuichi

    2015-01-01

    To determine the effect of advanced glycation end-products (AGEs) on neurite regeneration, and also to determine the regenerative effects of different neurotrophic factors (NTFs) on rat retinal explants, the retinas of SD rats were cultured in three-dimensional collagen gels and incubated in 6 types of media: (1) serum-free control culture media; (2) 100 μg/mL AGEs-BSA media; (3) AGEs-BSA + 100 ng/mL neurotrophin-4 (NT-4) media; (4) AGEs-BSA + 100 ng/mL hepatocyte growth factor media; (5) AGEs-BSA + 100 ng/mL glial cell line-derived neurotrophic factor media; or (6) AGEs-BSA + 100 µM tauroursodeoxycholic acid media. After 7 days, the number of regenerating neurites was counted. The explants were immunostained for nuclear factor-κB (NF-κB) and specificity protein 1 (SP1). Statistical analyses were performed by one-way ANOVA. In retinas incubated with AGEs, the numbers of neurites were fewer than in control. All of the NTFs increased the number of neurites, and the increase was more significant in the NT-4 group. The number of NF-κB and SP1 immunopositive cells was higher in retinas exposed to AGEs than in control. All of the NTFs decreased the number of NF-κB immunopositive cells but did not significantly affect SP1 expression. These results demonstrate the potential of the NTFs as axoprotectants in AGEs exposed retinal neurons. PMID:26078979

  4. Contribution of transcription factor, SP1, to the promotion of HB-EGF expression in defense mechanism against the treatment of irinotecan in ovarian clear cell carcinoma

    PubMed Central

    Miyata, Kohei; Yotsumoto, Fusanori; Nam, Sung Ouk; Odawara, Takashi; Manabe, Sadao; Ishikawa, Toyokazu; Itamochi, Hiroaki; Kigawa, Junzo; Takada, Shuji; Asahara, Hiroshi; Kuroki, Masahide; Miyamoto, Shingo

    2014-01-01

    Ovarian clear cell carcinoma (OCCC) is a worst histological subtype than other ovarian malignant tumor. Heparin-binding epidermal growth factor-like growth factor (HB-EGF) is a promising target for ovarian cancer therapy. The aims of this study were to validate the efficacy of HB-EGF–targeted therapy for OCCC and to identify the transcription factor that contributed to the induction of HB-EGF by SN38 treatment in OCCC cells. HB-EGF was highly expressed in OCCC cells, and an increase of HB-EGF was induced by SN38 which had only antitumor effect among conventional anticancer agents on OCCC. A specific inhibitor of HB-EGF, a cross-reacting material 197 (CRM197), led to a synergistic increase in the number of apoptotic OCCC cells with the treatment of SN38. The luciferase assay with 5′-deletion promoter constructs identified a GC-rich element between −125 and −178 (the distal transcription start site was denoted +1) as a cis-regulatory region, and the treatment of SN38 induced luciferase activity in this region. An in silico and chromatin immunoprecipitation analysis estimated that SP1 bound to the cis-regulatory region of HB-EGF in OCCC cells. Real-time PCR and cell viability assays showed that the transfection of a small interfering RNA targeting SP1 suppressed the expression of HB-EGF induced by SN38, resulting in the enhanced sensitivity of SN38. Taken together, these results indicate that induction of HB-EGF expression contributed to defense mechanism against treatment of SN38 through the transcriptional activity of SP1 in OCCC cells. PMID:25060396

  5. Expression of the rat liver carnitine palmitoyltransferase I (CPT-Ialpha) gene is regulated by Sp1 and nuclear factor Y: chromosomal localization and promoter characterization.

    PubMed Central

    Steffen, M L; Harrison, W R; Elder, F F; Cook, G A; Park, E A

    1999-01-01

    Carnitine palmitoyltransferase (CPT)-I catalyses the transfer of long-chain fatty acids from CoA to carnitine for translocation across the mitochondrial inner membrane. Expression of the 'liver' isoform of the CPT-I gene (CPT-Ialpha) is subject to developmental, hormonal and tissue-specific regulation. To understand the basis for control of CPT-Ialpha gene expression, we have characterized the proximal promoter of the CPT-Ialpha gene. Here, we report the sequence of 6839 base pairs of the promoter and the localization of the rat CPT-Ialpha gene to region q43 on chromosome 1. Our studies show that the first 200 base pairs of the promoter are sufficient to drive transcription of the CPT-Ialpha gene. Within this region are two sites that bind both Sp1 and Sp3 transcription factors. In addition, nuclear factor Y (NF-Y) binds the proximal promoter. Mutation at the Sp1 or NF-Y sites severely decreases transcription from the CPT-Ialpha promoter. Other protein binding sites were identified within the first 200 base pairs of the promoter by DNase I footprinting, and these elements contribute to CPT-Ialpha gene expression. Our studies demonstrate that CPT-Ialpha is a TATA-less gene which utilizes NF-Y and Sp proteins to drive basal expression. PMID:10333485

  6. Regulation of Sp1 by cell cycle related proteins

    PubMed Central

    Tapias, Alicia; Ciudad, Carlos J.; Roninson, Igor B.; Noé, Véronique

    2009-01-01

    Sp1 transcription factor regulates the expression of multiple genes, including the Sp1 gene itself. We analyzed the ability of different cell cycle regulatory proteins to interact with Sp1 and to affect Sp1 promoter activity. Using an antibody array, we observed that CDK4, SKP2, Rad51, BRCA2 and p21 could interact with Sp1 and we confirmed these interactions by co-immunoprecipitation. CDK4, SKP2, Rad51, BRCA2 and p21 also activated the Sp1 promoter. Among the known Sp1-interacting proteins, E2F-DP1, Cyclin D1, Stat3 and Rb activated the Sp1 promoter, whereas p53 and NFκB inhibited it. The proteins that regulated Sp1 gene expression were shown by positive chromatin immunoprecipitation to be bound to the Sp1 promoter. Moreover, SKP2, BRCA2, p21, E2F-DP1, Stat3, Rb, p53 and NFκB had similar effects on an artificial promoter containing only Sp1 binding sites. Transient transfections of CDK4, Rad51, E2F-DP1, p21 and Stat3 increased mRNA expression from the endogenous Sp1 gene in HeLa cells whereas overexpression of NFκB, and p53 decreased Sp1 mRNA levels. p21 expression from a stably integrated inducible promoter in HT1080 cells activated Sp1 expression at the promoter and mRNA levels, but at the same time it decreased Sp1 protein levels due to the activation of Sp1 degradation. The observed multiple effects of cell cycle regulators on Sp1 suggest that Sp1 may be a key mediator of cell cycle associated changes in gene expression. PMID:18769160

  7. Fibroblast growth factor-2 up-regulates the expression of nestin through the Ras–Raf–ERK–Sp1 signaling axis in C6 glioma cells

    SciTech Connect

    Chang, Kai-Wei; Huang, Yuan-Li; Wong, Zong-Ruei; Su, Peng-Han; Huang, Bu-Miin; Ju, Tsai-Kai; Yang, Hsi-Yuan

    2013-05-17

    Highlights: •Nestin expression in C6 glioma cells is induced by FGF-2. •Nestin expression is induced by FGF-2 via de novo RNA and protein synthesis. •The FGFR inhibitor SU5402 blocks the FGF-2-induced nestin expression. •The mRNA of FGFR1 and 3 are detected in C6 glioma cells. •Ras–Raf–ERK–Sp1 signaling pathway is responsibe for FGF-2-induced nestin expression. -- Abstract: Nestin is a 240-kDa intermediate filament protein expressed mainly in neural and myogenic stem cells. Although a substantial number of studies have focused on the expression of nestin during development of the central nervous system, little is known about the factors that induce and regulate its expression. Fibroblast growth factor-2 (FGF-2) is an effective mitogen and stimulates the proliferation and differentiation of a subset of nestin-expressing cells, including neural progenitor cells, glial precursor cells, and smooth muscle cells. To assess whether FGF-2 is a potent factor that induces the expression of nestin, C6 glioma cells were used. The results showed that nestin expression was up-regulated by FGF-2 via de novo RNA and protein synthesis. Our RT-PCR results showed that C6 glioma cells express FGFR1/3, and FGFRs is required for FGF-2-induced nestin expression. Further signaling analysis also revealed that FGF-2-induced nestin expression is mediated through FGFR–MAPK–ERK signaling axis and the transcriptional factor Sp1. These findings provide new insight into the regulation of nestin in glial system and enable the further studies on the function of nestin in glial cells.

  8. The human papillomavirus type 16 E2 transcription factor binds with low cooperativity to two flanking sites and represses the E6 promoter through displacement of Sp1 and TFIID.

    PubMed Central

    Tan, S H; Leong, L E; Walker, P A; Bernard, H U

    1994-01-01

    The E6 promoters of all genital human papillomaviruses have a characteristic alignment of transcription factor binding sites. Activation of the basic transcription complex at the TATA box depends upon a sequence-aberrant Sp1 site. Repression of E6 promoters is achieved by two binding sites for the viral E2 protein positioned between the Sp1 site and the TATA box. We have purified the human papillomavirus type 16 E2 protein after expression in Escherichia coli and studied its binding and repression properties with oligonucleotides representing the homologous promoter sequences. A Kd value of 3 x 10(-10) M indicated binding properties expected for a native protein. We found low cooperativity in the binding of two E2 dimers to flanking sites, both when these sites were separated by 3 nucleotides, as in the natural promoter, and when they were further apart. E2 protein, bound close to the distal Sp1 site, displaced the Sp1 factor even when the aberrant sequence was replaced by a typical Sp1 core recognition site. The high affinity of E2 protein for its binding site even led to Sp1 displacement at concentrations of E2 protein nearly 2 orders of magnitude lower than those of Sp1. Functional analyses of mutated E6 promoter sequences showed repression by this distal E2 binding site in the complete absence of binding to the proximal E2 binding site. From our findings and observations published by others, we conclude that each of the E2 binding sites in the E6 promoter of genital human papillomaviruses plays a separate role by displacing the transcription factors Sp1 and TFIID. Images PMID:8083979

  9. Functional activity of the porcine Gnrhr2 gene promoter in testis-derived cells is partially conferred by nuclear factor-κB, specificity protein 1 and 3 (SP1/3) and overlapping early growth response 1/SP1/3 binding sites.

    PubMed

    Brauer, Vanessa M; Wiarda-Bell, Jocelyn R; Desaulniers, Amy T; Cederberg, Rebecca A; White, Brett R

    2016-08-10

    Unlike the classical gonadotropin-releasing hormone (GnRH1), the second mammalian isoform (GnRH2) is ubiquitously expressed, suggesting a divergent function. Indeed, we demonstrated that GnRH2 governs LH-independent testosterone secretion in porcine testes via interaction with its receptor (GnRHR2) on Leydig cells. Transient transfections with luciferase reporter vectors containing 3009bp of 5' flanking sequence for the porcine Gnrhr2 gene (-3009pGL3) revealed promoter activity in all 15 cell lines examined, including swine testis-derived (ST) cells. Therefore, ST cells were utilized to explore the molecular mechanisms underlying transcriptional regulation of the porcine Gnrhr2 gene in the testis. Reporter plasmids containing progressive 5' deletions of the Gnrhr2 promoter indicated that the -708/-490 region contained elements critical to promoter activity. Electrophoretic mobility shift assays (EMSAs) with radiolabeled oligonucleotides spanning the -708/-490bp region and ST nuclear extracts, identified specific binding complexes for the -513/-490, -591/-571 and -606/-581bp segments of promoter. Antibody addition to EMSAs indicated that the p65 and p52 subunits of nuclear factor-κB (NF-κB) comprised the specific complex bound to the oligonucleotide probe for the -513/-490bp promoter region, specificity protein (SP) 1 and 3 bound the -591/-571bp probe and early growth response 1 (EGR1), SP1 and SP3 bound the -606/-581 radiolabeled oligonucleotide. Transient transfections with vectors containing mutations of the NF-κB (-499/-493), SP1/3 (-582/-575) or overlapping EGR1/SP1/3 (-597/-587) binding sites reduced luciferase activity by 26%, 61% and 56%, respectively (P<0.05). Thus, NF-κB, SP1/3 and overlapping EGR1/SP1/3 binding sites are critical to expression of the porcine Gnrhr2 gene in ST cells. PMID:27134031

  10. The retinoblastoma gene product RB stimulates Sp1-mediated transcription by liberating Sp1 from a negative regulator.

    PubMed Central

    Chen, L I; Nishinaka, T; Kwan, K; Kitabayashi, I; Yokoyama, K; Fu, Y H; Grünwald, S; Chiu, R

    1994-01-01

    Studies have demonstrated that the retinoblastoma susceptibility gene product, RB, can either positively or negatively regulate expression of several genes through cis-acting elements in a cell-type-dependent manner. The nucleotide sequence of the retinoblastoma control element (RCE) motif, GCCACC or CCACCC, and the Sp1 consensus binding sequence, CCGCCC, can confer equal responsiveness to RB. Here, we report that RB activates transcription of the c-jun gene through the Sp1-binding site within the c-jun promoter. Preincubation of crude nuclear extracts with monoclonal antibodies to RB results in reduction of Sp1 complexes in a mobility shift assay, while addition of recombinant RB in mobility shift assay mixtures with CCL64 cell extracts leads to an enhancement of DNA-binding activity of SP1. These results suggest that RB is directly or indirectly involved in Sp1-DNA binding activity. A mechanism by which RB regulates transactivation is indicated by our detection of a heat-labile and protease-sensitive Sp1 negative regulator(s) (Sp1-I) that specifically inhibits Sp1 binding to a c-jun Sp1 site. This inhibition is reversed by addition of recombinant RB proteins, suggesting that RB stimulates Sp1-mediated transactivation by liberating Sp1 from Sp1-I. Additional evidence for Sp1-I involvement in Sp1-mediated transactivation was demonstrated by cotransfection of RB, GAL4-Sp1, and a GAL4-responsive template into CV-1 cells. Finally, we have identified Sp1-I, a approximately 20-kDa protein(s) that inhibits the Sp1 complexes from binding to DNA and that is also an RB-associated protein. These findings provide evidence for a functional link between two distinct classes of oncoproteins, RB and c-Jun, that are involved in the control of cell growth, and also define a novel mechanism for the regulation of c-jun expression. Images PMID:8007947

  11. A functional polymorphism in the Eta-1 promoter is associated with allele specific binding to the transcription factor Sp1 and elevated gene expression.

    PubMed

    Hummelshoj, Tina; Ryder, Lars P; Madsen, Hans O; Odum, Niels; Svejgaard, Arne

    2006-03-01

    Early T lymphocyte activator 1 (Eta-1), also known as Osteopontin, is a cytokine produced by macrophages and T lymphocytes. It is involved in the regulation of IL-12 and IL-10 expression in macrophages and stimulates the polarization of T cells to the Th1 subset. Three promoter polymorphisms of the human Eta-1 gene, -443T/C, -156delG/G, -66T/G, were investigated for possible influence on gene expression. Electrophoretic mobility shift assays (EMSA) with nuclear extract from the human myeloid leukaemia premonocyte cell line, THP-1, revealed sequence specific binding of the transcription factor Sp1 to the -66T allele but not the -66G allele, and haplotype -443C/-156G/-66T showed a marked increase in promoter activity of a luciferase reporter gene. Thus, a substitution of the T-base with G at position -66 in the Eta-1 promoter modulates the promoter activity of the Eta-1 gene, which might influence the Th1 versus Th2 balance. These observations are discussed in relation to a recently reported related observation on the same gene, and it is argued that discrepancies between reporter gene assays in the two studies may be due to the use of different cell lines and may reflect requirements for different transcription factors in cells involved in immune responses compared with other cells. PMID:16009426

  12. Characterization of the human granulocyte-macrophage colony-stimulating factor gene promoter: an AP1 complex and an Sp1-related complex transactivate the promoter activity that is suppressed by a YY1 complex.

    PubMed Central

    Ye, J; Zhang, X; Dong, Z

    1996-01-01

    It is well documented that a repeated CATT element in the human granulocyte-macrophage colony-stimulating factor (GM-CSF) gene promoter is required for promoter activity. However, the transcription factors that are able to transactivate this enhancer element remain unidentified. Recently, we have found that nuclear factor YY1 can interact with the enhancer element. Here, we report that in addition to YY1, two other nuclear factors have been identified in the DNA-protein complexes formed by the CATT oligonucleotide and the Jurkat T-cell nuclear protein. One of these factors is AP1, and the other one is an Sp1-related protein. Results from transient transfection of Jurkat T cells have revealed that formation of both AP1 and the Sp1-related complex is required for the full enhancer activity of the CATT element. This result is supported by cotransfection of a c-jun expression vector and mutational analysis of the AP1 site or the Sp1-related protein binding site. In contrast, formation of the YY1 complex suppresses enhancer activity, since deletion of the YY1 complex induces an augmentation of the enhancer activity and overexpression of YY1 results in an attenuation of the enhancer activity. Results from the mechanism study have revealed that YY1 is able to inhibit transactivation mediated by either AP1 or the Sp1-related protein, and YY1 suppressive activity is DNA binding dependent. Taken together, these data support the ideas that AP1 and the Sp1-related nuclear protein are required for transactivation of the human GM-CSF gene promoter and that YY1 can suppress transactivation of the promoter even under inducible conditions. PMID:8524292

  13. O-Linked N-acetylglucosaminylation of Sp1 interferes with Sp1 activation of glycolytic genes.

    PubMed

    Lim, Kihong; Yoon, Bo Hyun; Ha, Chang Hoon

    Glycolysis, the primary pathway metabolizing glucose for energy production, is connected to the hexosamine biosynthetic pathway (HBP) which produces UDP-N-acetylglucosamine (UDP-GlcNAc), a GlcNAc donor for O-linked GlcNAc modification (O-GlcNAc), as well as for traditional elongated glycosylation. Thus, glycolysis and O-GlcNAc are intimately associated. The present study reports the transcriptional activation of glycolytic genes by the transcription factor Sp1 and the O-GlcNAc-mediated suppression of Sp1-dependent activation of glycolytic genes. O-GlcNAc-deficient mutant Sp1 stimulated the transcription of nine glycolytic genes and cellular production of pyruvate, the final product of glycolysis, to a greater extent than wild-type Sp1. Consistently, this mutant Sp1 increased the protein levels of the two key glycolytic enzymes, phosphofructokinase (PFK) and glyceraldehyde 3-phosphate dehydrogenase (GAPDH), to a greater extent than wild-type Sp1. Finally, the mutant Sp1 occupied GC-rich elements on PFK and GAPDH promoters more efficiently than wild-type Sp1. These results suggest that O-GlcNAcylation of Sp1 suppresses Sp1-mediated activation of glycolytic gene transcription. PMID:26499076

  14. Fetal lead exposure: antenatal factors

    SciTech Connect

    Ernhart, C.B.; Wolf, A.W.; Sokol, R.J.; Brittenham, G.M.; Erhard, P.

    1985-10-01

    It was hypothesized that maternal blood lead level at delivery and cord blood lead level of the neonate would be affected by maternal use of alcohol, history of alcohol abuse, and smoking. The possibility that iron status, as reflected in maternal serum ferritin, would be related to lead level was also explored. The maternal history of alcohol abuse was unrelated to lead level in 208 samples of maternal blood and 178 samples of cord blood. However, alcohol use during pregnancy was related in a dose-response fashion to maternal and to cord blood lead level. This effect was significant with and without control of maternal smoking. The effect of maternal smoking and serum thiocyanate on maternal and cord blood lead level were also highly significant with and without control of the maternal drinking variable. Serum ferritin was marginally related to lead level for white women and for black infants, but tests of the dichotomized maternal ferritin variable did not yield a significant linkage with maternal or cord blood lead level. The results further support recommendations that women abstain from alcohol consumption and cigarette smoking in pregnancy.

  15. E6 and E7 oncoproteins from human papillomavirus type 16 induce activation of human transforming growth factor beta1 promoter throughout Sp1 recognition sequence.

    PubMed

    Peralta-Zaragoza, Oscar; Bermúdez-Morales, Víctor; Gutiérrez-Xicotencatl, Lourdes; Alcocer-González, Juan; Recillas-Targa, Félix; Madrid-Marina, Vicente

    2006-01-01

    Human Papillomavirus (HPV) infection is the main etiologic agent of cervical cancer and HPV E6 and E7 oncogenes trans-regulate many cellular genes. An association between TGF-beta1 gene expression and cervical cancer development has been suggested; however, the mechanisms by which HPV influences TGF-beta1 expression remain unclear. In the present study we analyzed the mechanism through which HPV-16 E6 and E7 oncoproteins regulate the TGF-beta1 promoter in cervical tumor cells. Our results showed that E6 and E7 increased TGF-beta1 promoter activity. Furthermore, we identified a specific DNA sequence motif in the TGF-beta1 core promoter that is responsible for trans-activation and that corresponds to the Sp1e-binding site associated with HPV-16 E6 and E7 oncoproteins. Mutational analysis showed that the Sp1e recognition site abolished the trans-activation caused by E6 and E7. These results suggest a physical interaction and functional cooperation between viral oncoproteins and cellular regulatory elements of the TGF-beta1 promoter, and may explain the contribution of HPV-16 to TGF-beta1 gene expression in cervical cancer. PMID:16987065

  16. The Sp(1)-Kepler problems

    SciTech Connect

    Meng Guowu

    2009-07-15

    Let n{>=}2 be a positive integer. To each irreducible representation {sigma} of Sp(1), an Sp(1)-Kepler problem in dimension (4n-3) is constructed and analyzed. This system is superintegrable, and when n=2 it is equivalent to a generalized MICZ-Kepler problem in dimension of 5. The dynamical symmetry group of this system is O-tilde*(4n) with the Hilbert space of bound states H({sigma}) being the unitary highest weight representation of O*-tilde(4n) with highest weight, (-1,{center_dot}{center_dot}{center_dot},-1,-(1+{sigma})), which occurs at the rightmost nontrivial reduction point in the Enright-Howe-Wallach classification diagram for the unitary highest weight modules. Here {sigma} is the highest weight of {sigma}. Furthermore, it is shown that the correspondence {sigma}{r_reversible}H({sigma}) is the theta-correspondence for dual pair (Sp(1),O*(4n))subset Sp(8n,R)

  17. Essential role of an activator protein-2 (AP-2)/specificity protein 1 (Sp1) cluster in the UVB-mediated induction of the human vascular endothelial growth factor in HaCaT keratinocytes.

    PubMed Central

    Brenneisen, Peter; Blaudschun, Ralf; Gille, Jens; Schneider, Lars; Hinrichs, Ralf; Wlaschek, Meinhard; Eming, Sabine; Scharffetter-Kochanek, Karin

    2003-01-01

    Chronic sun exposure of the skin has long been postulated to enhance cutaneous angiogenesis, resulting in highly vascularized skin cancers. As the UVB component of sunlight is a major contributor to photocarcinogenesis, we aimed to explore the effects of UVB radiation on vascular endothelial growth factor (VEGF) gene expression, using the immortalized keratinocyte cell line HaCaT as a model for transformed premalignant epithelial cells. In the present paper, we studied the molecular mechanism of UVB-induced VEGF providing a major angiogenic activity in tumour progression and invasion. After 12-24 h of UVB irradiation, a 2.4- to 2.7-fold increase in endogenous VEGF protein level was measured, correlating with an up to 2.5-fold induction of promoter-based reporter gene constructs of VEGF. Furthermore, we identified a GC-rich UVB-responsive region between -87 and -65 bp of the VEGF promoter. In electrophoretic mobility-shift assays, this region binds Sp1-dependent protein complexes constitutively and an additional UVB-inducible protein complex distinct from Sp1 protein. The transcription factor AP-2 (activator protein-2) was detected as a component of the UVB-inducible protein complex. The critical role of the AP-2/Sp1 (specificity protein 1) cluster was supported by demonstration of a significant reduction of UVB-mediated promoter activity upon deletion of this recognition site. The specificity of this region for UVB irradiation was demonstrated using PMA, which increased VEGF activity in HaCaT cells after transient transfection of the deleted promoter construct. In conclusion, our data clarified regulatory mechanisms of UVB-dependent VEGF stimulation which may be critical for angiogenic processes in the skin. PMID:12358602

  18. Low-density lipoprotein upregulate SR-BI through Sp1 Ser702 phosphorylation in hepatic cells.

    PubMed

    Yang, Fan; Du, Yu; Zhang, Jin; Jiang, Zhibo; Wang, Li; Hong, Bin

    2016-09-01

    Scavenger receptor class B type I (SR-BI) is one of the key proteins in the process of reverse cholesterol transport (RCT), and its major function is to uptake high density lipoprotein (HDL) cholesterol from plasma into liver cells. The regulation of SR-BI expression is important for controlling serum lipid content and reducing the risks of cardiovascular diseases. Here we found that SR-BI expression was significantly increased by LDL in vivo and in vitro, and the transcription factor specific protein 1 (Sp1) plays a critical role in this process. Results from co-immunoprecipitation experiments indicate that the activation of SR-BI was associated with Sp1-recruited protein complexes in the promoter region of SR-BI, where histone acetyltransferase p300 was recruited and histone deacetylase HDAC1 was dismissed. As a result, histone acetylation increased, leading to activation of SR-BI transcription. With further investigation, we found that LDL phosphorylated Sp1 through ERK1/2 pathway, which affected Sp1 protein complexes formation in SR-BI promoter. Using mass spectrometry and site directed mutagenesis, a new Sp1 phosphorylation site Ser702 was defined to be associated with Sp1-HDAC1 interaction and may be important in SR-BI activation, shedding light on the knowledge of delicate mechanism of hepatic HDL receptor SR-BI gene modulation by LDL. PMID:27320013

  19. Regulation of the Cyclin-dependent Kinase Inhibitor 1A Gene (CDKN1A) by the Repressor BOZF1 through Inhibition of p53 Acetylation and Transcription Factor Sp1 Binding*

    PubMed Central

    Kim, Min-Kyeong; Jeon, Bu-Nam; Koh, Dong-In; Kim, Kyung-Sup; Park, So-Yoon; Yun, Chae-Ok; Hur, Man-Wook

    2013-01-01

    The human POZ domain and Krüppel-like zinc finger (POK) family proteins play important roles in the regulation of apoptosis, cell proliferation, differentiation, development, oncogenesis, and tumor suppression. A novel POK family transcription factor, BTB/POZ and zinc finger domains factor on chromosome 1 (BOZF-1; also called ZBTB8A), contains a POZ domain and two C2H2-type Krüppel-like zinc fingers and is localized at nuclear speckles. Compared with paired normal tissues, BOZF1 expression is increased in cancer tissues of the prostate, breast, and cervix. BOZF1 repressed the transcription of p21WAF/CDKN1A by acting on the proximal promoter concentrated with Sp1-binding GC boxes. BOZF1 competed with Sp1 in binding to GC boxes 1–5/6 of the CDKN1A proximal promoter. In addition, BOZF1 interacted with p53 and decreased the acetylation of p53 by p300, which reduced the DNA binding activity of p53 at the far distal p53-binding element. BOZF1 blocked the two major molecular events that are important in both constitutive and inducible transcription activation of CDKN1A. BOZF1 is unique in that it bound to all the proximal GC boxes to repress transcription, and it inhibited p53 acetylation without affecting p53 stability. BOZF1 might be a novel proto-oncoprotein that stimulates cell proliferation. PMID:23329847

  20. Interplay of posttranslational modifications in Sp1 mediates Sp1 stability during cell cycle progression.

    PubMed

    Wang, Yi-Ting; Yang, Wen-Bin; Chang, Wen-Chang; Hung, Jan-Jong

    2011-11-18

    Although Sp1 is known to undergo posttranslational modifications such as phosphorylation, glycosylation, acetylation, sumoylation, and ubiquitination, little is known about the possible interplay between the different forms of Sp1 that may affect its overall levels. It is also unknown whether changes in the levels of Sp1 influence any biological cell processes. Here, we identified RNF4 as the ubiquitin E3 ligase of Sp1. From in vitro and in vivo experiments, we found that sumoylated Sp1 can recruit RNF4 as a ubiquitin E3 ligase that subjects sumoylated Sp1 to proteasomal degradation. Sp1 mapping revealed two ubiquitination-related domains: a small ubiquitin-like modifier in the N-terminus of Sp1(Lys16) and the C-terminus of Sp1 that directly interacts with RNF4. Interestingly, when Sp1 was phosphorylated at Thr739 by c-Jun NH(2)-terminal kinase 1 during mitosis, this phosphorylated form of Sp1 abolished the Sp1-RNF4 interaction. Our results show that, while sumoylated Sp1 subjects to proteasomal degradation, the phosphorylation that occurs during the cell cycle can protect Sp1 from degradation by repressing the Sp1-RNF4 interaction. Thus, we propose that the interplay between posttranslational modifications of Sp1 plays an important role in cell cycle progression and keeps Sp1 at a critical level for mitosis. PMID:21983342

  1. Nucleolin enhances internal ribosomal entry site (IRES)-mediated translation of Sp1 in tumorigenesis.

    PubMed

    Hung, Chia-Yang; Yang, Wen-Bin; Wang, Shao-An; Hsu, Tsung-I; Chang, Wen-Chang; Hung, Jan-Jong

    2014-12-01

    Our previous study indicated that specificity protein-1 (Sp1) is accumulated during hypoxia in an internal ribosomal entry site (IRES)-dependent manner. Herein, we found that the Sp1 was induced strongly at the protein level, but not in the mRNA level, in lung tumor tissue, indicating that translational regulation might contribute to the Sp1 accumulation during tumorigenesis. A further study showed that the translation of Sp1 was dramatically induced through an IRES-dependent pathway. RNA immunoprecipitation analysis of proteins bound to the 5'-untranslated region (5'-UTR) of Sp1 identified interacting protein - nucleolin. Knockdown of nucleolin significantly inhibited IRES-mediated translation of Sp1, suggesting that nucleolin positively facilitates Sp1 IRES activation. Further analysis of the interaction between nucleolin and the 5'-UTR of Sp1 mRNA revealed that the GAR domain was important for IRES-mediated translation of Sp1. Moreover, gefitinib, and LY294002 and MK2206 compounds inhibited IRES-mediated Sp1 translation, implying that activation of the epithelial growth factor receptor (EGFR) pathway via Akt activation triggers the IRES pathway. In conclusion, EGFR activation-mediated nucleolin phosphorylated at Thr641 and Thr707 was recruited to the 5'-UTR of Sp1 as an IRES trans-acting factor to modulate Sp1 translation during lung cancer formation. PMID:25173817

  2. Transcription of the catalytic 180-kDa subunit gene of mouse DNA polymerase alpha is controlled by E2F, an Ets-related transcription factor, and Sp1.

    PubMed

    Izumi, M; Yokoi, M; Nishikawa, N S; Miyazawa, H; Sugino, A; Yamagishi, M; Yamaguchi, M; Matsukage, A; Yatagai, F; Hanaoka, F

    2000-07-24

    We have isolated a genomic DNA fragment spanning the 5'-end of the gene encoding the catalytic subunit of mouse DNA polymerase alpha. The nucleotide sequence of the upstream region was G/C-rich and lacked a TATA box. Transient expression assays in cycling NIH 3T3 cells demonstrated that the GC box of 20 bp (at nucleotides -112/-93 with respect to the transcription initiation site) and the palindromic sequence of 14 bp (at nucleotides -71/-58) were essential for basal promoter activity. Electrophoretic mobility shift assays showed that Sp1 binds to the GC box. We also purified a protein capable of binding to the palindrome and identified it as GA-binding protein (GABP), an Ets- and Notch-related transcription factor. Transient expression assays in synchronized NIH 3T3 cells revealed that three variant E2F sites near the transcription initiation site (at nucleotides -23/-16, -1/+7 and +17/+29) had no basal promoter activity by themselves, but were essential for growth-dependent stimulation of the gene expression. These data indicate that E2F, GABP and Sp1 regulate the gene expression of this principal replication enzyme. PMID:11004506

  3. Treatment with Combination of Mithramycin A and Tolfenamic Acid Promotes Degradation of Sp1 Protein and Synergistic Antitumor Activity in Pancreatic Cancer

    PubMed Central

    Jia, Zhiliang; Gao, Yong; Wang, Liwei; Li, Qiang; Zhang, Jun; Le, Xiangdong; Wei, Daoyan; Yao, James C.; Chang, David Z.; Huang, Suyun; Xie, Keping

    2010-01-01

    Previous studies showed that both mithramycin (MIT) and tolfenamic acid (TA) inhibits the activity of the transcription factor Sp1. In the present study, we sought to determine whether treatment with a combination of these two compounds has a synergistic effect on Sp1 activity and pancreatic cancer growth and their underlying mechanisms. In xenograft mouse models of human pancreatic cancer, treatment with MIT and TA produced dose-dependent antitumor activity, and significant antitumor activity of either compound alone was directly associated with systemic side effects as determined according to overall weight loss. However, combination treatment with nontoxic doses of TA and MIT produced synergistic antitumor activity, whereas treatment with a nontoxic dose of either compound alone did not have a discernible antitumor effect. The synergistic therapeutic effects of MIT and TA correlated directly with synergistic antiproliferation and antiangiogenesis in vitro. Moreover, treatment with the combination of TA and MIT resulted in Sp1 protein degradation, leading to drastic downregulation of Sp1 and vascular endothelial growth factor protein expression. Our data demonstrated that Sp1 is a critical target of TA and MIT in human pancreatic cancer therapy. Further studies should be performed to determine the impact of existing pancreatic cancer therapy regimens on Sp1 signaling in tumors and normal pancreatic tissue and the ability of Sp1-targeting strategies to modify these responses and improve upon these regimens. PMID:20086170

  4. Social factors leading to juvenile delinquency.

    PubMed

    Sakuta, T

    1996-12-01

    According to the White Paper on Crime 1994 published by the Ministry of Justice in Japan, the delinquent rate in Japan was highest when juveniles were approximately 14 to 16 years old, and declined as they grew older. The analysis of juvenile offenders in Japan showed that 70% of them had two living parents, 90% of them from families which were financially stable or affluent. The breakdown of their parents attitudes showed, however, that 48.2% were classified as neglectful, followed by harshness at 30.3% and spoiling or overprotection at 17.3% in 1993 in Japan. In the following, social factors leading to juvenile delinquency were reviewed. Factors leading to juvenile delinquency were classified into social factors, school factors and home factors, and recent findings concerning those three factors were explained. A fairly clear outlook on the efforts required by society, schools and families to reduce juvenile delinquency was shown by revealing important factors leading juveniles to delinquency. PMID:9023445

  5. SP1 protein-based nanostructures and arrays.

    PubMed

    Medalsy, Izhar; Dgany, Or; Sowwan, Mukhles; Cohen, Hezy; Yukashevska, Alevtyna; Wolf, Sharon G; Wolf, Amnon; Koster, Abraham; Almog, Orna; Marton, Ira; Pouny, Yehonathan; Altman, Arie; Shoseyov, Oded; Porath, Danny

    2008-02-01

    Controlled formation of complex nanostructures is one of the main goals of nanoscience and nanotechnology. Stable Protein 1 (SP1) is a boiling-stable ring protein complex, 11 nm in diameter, which self-assembles from 12 identical monomers. SP1 can be utilized to form large ordered arrays; it can be easily modified by genetic engineering to produce various mutants; it is also capable of binding gold nanoparticles (GNPs) and thus forming protein-GNP chains made of alternating SP1s and GNPs. We report the formation and the protocols leading to the formation of those nanostructures and their characterization by transmission electron microscopy, atomic force microscopy, and electrostatic force microscopy. Further control over the GNP interdistances within the protein-GNP chains may lead to the formation of nanowires and structures that may be useful for nanoelectronics. PMID:18193911

  6. Sp1/NFκB/HDAC/miR-29b Regulatory Network in KIT-driven Myeloid Leukemia

    PubMed Central

    Liu, Shujun; Wu, Lai-Chu; Pang, Jiuxia; Santhanam, Ramasamy; Schwind, Sebastian; Wu, Yue-Zhong; Hickey, Christopher; Yu, Jianhua; Becker, Heiko; Maharry, Kati; Radmacher, Michael D; Li, Chenglong; Whitman, Susan P.; Mishra, Anjali; Stauffer, Nicole; Eiring, Anna M.; Briesewitz, Roger; Baiocchi, Robert A.; Chan, Kenneth K.; Paschka, Peter; Caligiuri, Michael A.; Byrd, John C.; Croce, Carlo M; Bloomfield, Clara D.; Perrotti, Danilo; Garzon, Ramiro; Marcucci, Guido

    2010-01-01

    SUMMARY The biologic and clinical significance of KIT overexpression that associates with KIT gain-of- function mutations occurring in subsets of acute myeloid leukemia (AML) (i.e., core binding factor AML) is unknown. Here, we show that KIT mutations lead to MYC-dependent miR-29b repression and increased levels of the miR-29b target Sp1 in KIT-driven leukemia. Sp1 enhances its own expression by participating in a NFκB/HDAC complex that further represses miR-29b transcription. Upregulated Sp1 then binds NFκB and transactivates KIT. Therefore, activated KIT ultimately induces its own transcription. Our results provide evidence that the mechanisms of Sp1/NFκB/HDAC/miR-29b-dependent KIT overexpression contribute to leukemia growth and can be successfully targeted by pharmacological disruption of the Sp1/NFκB/HDAC complex or synthetic miR-29b treatment in KIT-driven AML. PMID:20385359

  7. Sumoylation differentially regulates Sp1 to control cell differentiation

    PubMed Central

    Gong, Lili; Ji, Wei-Ke; Hu, Xiao-Hui; Hu, Wen-Feng; Tang, Xiang-Cheng; Huang, Zhao-Xia; Li, Ling; Liu, Mugen; Xiang, Shi-Hua; Wu, Erxi; Woodward, Zachary; Liu, Yi-Zhi; Nguyen, Quan Dong; Li, David Wan-Cheng

    2014-01-01

    The mammalian small ubiquitin-like modifiers (SUMOs) are actively involved in regulating differentiation of different cell types. However, the functional differences between SUMO isoforms and their mechanisms of action remain largely unknown. Using the ocular lens as a model system, we demonstrate that different SUMOs display distinct functions in regulating differentiation of epithelial cells into fiber cells. During lens differentiation, SUMO1 and SUMO2/3 displayed different expression, localization, and targets, suggesting differential functions. Indeed, overexpression of SUMO2/3, but not SUMO1, inhibited basic (b) FGF-induced cell differentiation. In contrast, knockdown of SUMO1, but not SUMO2/3, also inhibited bFGF action. Mechanistically, specificity protein 1 (Sp1), a major transcription factor that controls expression of lens-specific genes such as β-crystallins, was positively regulated by SUMO1 but negatively regulated by SUMO2. SUMO2 was found to inhibit Sp1 functions through several mechanisms: sumoylating it at K683 to attenuate DNA binding, and at K16 to increase its turnover. SUMO2 also interfered with the interaction between Sp1 and the coactivator, p300, and recruited a repressor, Sp3 to β-crystallin gene promoters, to negatively regulate their expression. Thus, stable SUMO1, but diminishing SUMO2/3, during lens development is necessary for normal lens differentiation. In support of this conclusion, SUMO1 and Sp1 formed complexes during early and later stages of lens development. In contrast, an interaction between SUMO2/3 and Sp1 was detected only during the initial lens vesicle stage. Together, our results establish distinct roles of different SUMO isoforms and demonstrate for the first time, to our knowledge, that Sp1 acts as a major transcription factor target for SUMO control of cell differentiation. PMID:24706897

  8. Indole-3-carbinol downregulation of telomerase gene expression requires the inhibition of estrogen receptor-alpha and Sp1 transcription factor interactions within the hTERT promoter and mediates the G1 cell cycle arrest of human breast cancer cells

    PubMed Central

    Marconett, Crystal N.; Sundar, Shyam N.; Tseng, Min; Tin, Antony S.; Tran, Kalvin Q.; Mahuron, Kelly M.; Bjeldanes, Leonard F.; Firestone, Gary L.

    2011-01-01

    Indole-3-carbinol (I3C), a naturally occurring hydrolysis product of glucobrassicin from cruciferous vegetables such as broccoli, cabbage and Brussels sprouts, is an anticancer phytochemical that triggers complementary sets of antiproliferative pathways to induce a cell cycle arrest of estrogen-responsive MCF7 breast cancer cells. I3C strongly downregulated transcript expression of the catalytic subunit of the human telomerase (hTERT) gene, which correlated with the dose-dependent indole-mediated G1 cell cycle arrest without altering the transcript levels of the RNA template (hTR) for telomerase elongation. Exogenous expression of hTERT driven by a constitutive promoter prevented the I3C-induced cell cycle arrest and rescued the I3C inhibition of telomerase enzymatic activity and activation of cellular senescence. Time course studies showed that I3C downregulated expression of estrogen receptor-alpha (ERα) and cyclin-dependent kinase-6 transcripts levels (which is regulated through the Sp1 transcription factor) prior to the downregulation of hTERT suggesting a mechanistic link. Chromatin immunoprecipitation assays demonstrated that I3C disrupted endogenous interactions of both ERα and Sp1 with an estrogen response element–Sp1 composite element within the hTERT promoter. I3C inhibited 17β-estradiol stimulated hTERT expression and stimulated the production of threonine-phosphorylated Sp1, which inhibits Sp1–DNA interactions. Exogenous expression of both ERα and Sp1, but not either alone, in MCF7 cells blocked the I3C-mediated downregulation of hTERT expression. These results demonstrate that I3C disrupts the combined ERα- and Sp1-driven transcription of hTERT gene expression, which plays a significant role in the I3C-induced cell cycle arrest of human breast cancer cells. PMID:21693539

  9. Co-operative interactions between NFAT (nuclear factor of activated T cells) c1 and the zinc finger transcription factors Sp1/Sp3 and Egr-1 regulate MT1-MMP (membrane type 1 matrix metalloproteinase) transcription by glomerular mesangial cells.

    PubMed Central

    Alfonso-Jaume, Maria Alejandra; Mahimkar, Rajeev; Lovett, David H

    2004-01-01

    The transition of normally quiescent glomerular MCs (mesangial cells) to a highly proliferative phenotype with characteristics of myofibroblasts is a process commonly observed in inflammatory diseases affecting the renal glomerulus, the ultimate result of which is glomerulosclerosis. Generation of proteolytically active MMP (matrix metalloproteinase)-2 by the membrane-associated membrane type 1 (MT1)-MMP is responsible for the transition of mesangial cells to the myofibroblast phenotype [Turck, Pollock, Lee, Marti and Lovett (1996) J. Biol. Chem. 271, 15074-15083]. In the present study, we show that the expression of MT1-MMP within the context of MCs is mediated by three discrete cis -acting elements: a proximal non-canonical Sp1 site that preferentially binds Sp1; an overlapping Sp1/Egr-1-binding site that preferentially binds Egr-1; and a more distal binding site for the NFAT (nuclear factor of activated T cells) that binds the NFAT c1 isoform present in MC nuclear extracts. Transfection with an NFAT c1 expression plasmid, or activation of calcineurin with a calcium ionophore, yielded major increases in NFAT c1 nuclear DNA-binding activity, MT1-MMP transcription and protein synthesis, which were additive with the lower levels of transactivation provided by the proximal Sp1 and the overlapping Sp1/Egr-1 sites. Specific binding of NFAT c1 to the MT1-MMP promoter was confirmed by chromatin immunoprecipitation studies, while MT1-MMP expression was suppressed by treatment with the calcineurin inhibitor, cyclosporin A. These studies are the first demonstration that a specific NFAT isoform enhances transcription of an MMP (MT1-MMP) that plays a major role in the proteolytic events that are a dominant feature of acute glomerular inflammation. Suppression of MT1-MMP by commonly used calcineurin inhibitors may play a role in the development of renal fibrosis following renal transplantation. PMID:14979875

  10. Translational and transcriptional control of Sp1 against ischaemia through a hydrogen peroxide-activated internal ribosomal entry site pathway

    PubMed Central

    Yeh, Shiu Hwa; Yang, Wen Bin; Gean, Po Wu; Hsu, Chung Yi; Tseng, Joseph T.; Su, Tsung Ping; Chang, Wen Chang; Hung, Jan Jong

    2011-01-01

    The exact mechanism underlying increases in Sp1 and the physiological consequences thereafter remains unknown. In rat primary cortical neurons, oxygen-glucose deprivation (OGD) causes an increase in H2O2 as well as Sp1 in early ischaemia but apparently does not change mRNA level or Sp1 stability. We hereby identified a longer 5′-UTR in Sp1 mRNA that contains an internal ribosome entry site (IRES) that regulates rapid and efficient translation of existing mRNAs. By using polysomal fragmentation and bicistronic luciferase assays, we found that H2O2 activates IRES-dependent translation. Thus, H2O2 or tempol, a superoxide dismutase-mimetic, increases Sp1 levels in OGD-treated neurons. Further, early-expressed Sp1 binds to Sp1 promoter to cause a late rise in Sp1 in a feed-forward manner. Short hairpin RNA against Sp1 exacerbates OGD-induced apoptosis in primary neurons. While Sp1 levels increase in the cortex in a rat model of stroke, inhibition of Sp1 binding leads to enhanced apoptosis and cortical injury. These results demonstrate that neurons can use H2O2 as a signalling molecule to quickly induce Sp1 translation through an IRES-dependent translation pathway that, in cooperation with a late rise in Sp1 via feed-forward transcriptional activation, protects neurons against ischaemic damage. PMID:21441538

  11. Early experiences with the IBM SP-1

    SciTech Connect

    Gropp, W.

    1993-06-01

    The IBM SP-1 is IBM`s newest parallel distributed-memory computer. As part of a joint project with IBM, Argonne took delivery of an early system in order to evaluate the software environment and to begin porting programming packages and applications to this machine. This report discusses the results of those early efforts. Despite the newness of the machine and the lack of a fast interprocessor switch (part of the SP-1 but not yet available for the machine), every code that they attempted to port ran on the SP-1 with little or no modification. The report concludes with a discussion of expectations for the fast interconnect.

  12. The Influence of Declining Air Lead Levels on Blood Lead-Air Lead Slope Factors in Children

    EPA Science Inventory

    This presentation describes calculation of blood lead-air lead slope factor within an analysis of the relationship between blood lead levels and air lead levels among participants in the National Health and Nutrition Examination Survey (NHANES). The slope factors are compared wi...

  13. Reduced O glycosylation of Sp1 is associated with increased proteasome susceptibility.

    PubMed Central

    Han, I; Kudlow, J E

    1997-01-01

    Sp1 is a ubiquitously expressed transcription factor that is particularly important for the regulation of TATA-less genes that encode housekeeping proteins. Most growth factors and receptors are also encoded by such genes. Sp1 is multiply O glycosylated by covalent linkage of the monosaccharide N-acetylglucosamine (O-GlcNAc) to serine and threonine residues. Based on an earlier observation that growth factor gene transcription can be regulated by glucose and glucosamine in vascular smooth muscle cells, we determined whether Sp1 glycosylation could be regulated and if this modification altered Sp1 function. We found that Sp1 becomes hyperglycosylated when cells are exposed to 5 mM glucosamine, whereas under glucose starvation, stimulation with cyclic AMP (cAMP) results in nearly complete deglycosylation of this protein. Correlating with this hypoglycosylated state, Sp1 is rapidly proteolytically degraded by an enzyme(s) that can be inhibited by specific proteasome inhibitors, lactacystin and LLnL. Treatment of cells with glucose or glucosamine protects Sp1 from cAMP-mediated degradation, whereas blockade of glucosamine synthesis abrogates glucose but not glucosamine protection. This effect on Sp1 is specific, in that the Stat-3 and E2F transcription factors did not undergo degradation under these conditions. The O-GlcNAc modification of Sp1 may play a role as a nutritional checkpoint. In the absence of adequate nutrition, Sp1 becomes hypoglycosylated and thereby subject to proteasome degradation. This process could potentially result in reduced general transcription, thereby conserving nutrients. PMID:9111324

  14. Sp1 Facilitates DNA Double-Strand Break Repair through a Nontranscriptional Mechanism

    PubMed Central

    Beishline, Kate; Kelly, Crystal M.; Olofsson, Beatrix A.; Koduri, Sravanthi; Emrich, Jacqueline; Greenberg, Roger A.

    2012-01-01

    Sp1 is a ubiquitously expressed transcription factor that is phosphorylated by ataxia telangiectasia mutated kinase (ATM) in response to ionizing radiation and H2O2. Here, we show by indirect immunofluorescence that Sp1 phosphorylated on serine 101 (pSp1) localizes to ionizing radiation-induced foci with phosphorylated histone variant γH2Ax and members of the MRN (Mre11, Rad50, and Nbs1) complex. More precise analysis of occupancy of DNA double-strand breaks (DSBs) by chromatin immunoprecipitation (ChIP) shows that Sp1, like Nbs1, resides within 200 bp of DSBs. Using laser microirradiation of cells, we demonstrate that pSp1 is present at DNA DSBs by 7.5 min after induction of damage and remains at the break site for at least 8 h. Depletion of Sp1 inhibits repair of site-specific DNA breaks, and the N-terminal 182-amino-acid peptide, which contains targets of ATM kinase but lacks the zinc finger DNA binding domain, is phosphorylated, localizes to DSBs, and rescues the repair defect resulting from Sp1 depletion. Together, these data demonstrate that Sp1 is rapidly recruited to the region immediately adjacent to sites of DNA DSBs and is required for DSB repair, through a mechanism independent of its sequence-directed transcriptional effects. PMID:22826432

  15. MiR-22/Sp-1 Links Estrogens With the Up-Regulation of Cystathionine γ-Lyase in Myocardium, Which Contributes to Estrogenic Cardioprotection Against Oxidative Stress.

    PubMed

    Wang, Long; Tang, Zhi-Ping; Zhao, Wei; Cong, Bing-Hai; Lu, Jian-Qiang; Tang, Xiao-Lu; Li, Xiao-Han; Zhu, Xiao-Yan; Ni, Xin

    2015-06-01

    Hydrogen sulfide, generated in the myocardium predominantly via cystathionine-γ-lyase (CSE), is cardioprotective. Our previous study has shown that estrogens enhance CSE expression in myocardium of female rats. The present study aims to explore the mechanisms by which estrogens regulate CSE expression, in particular to clarify the role of estrogen receptor subtypes and the transcriptional factor responsible for the estrogenic effects. We found that either the CSE inhibitor or the CSE small interfering RNA attenuated the protective effect of 17β-estradiol (E2) against H2O2- and hypoxia/reoxygenation-induced injury in primary cultured neonatal cardiomyocytes. E2 stimulates CSE expression via estrogen receptor (ER)-α both in cultured cardiomyocytes in vitro and in the myocardium of female mice in vivo. A specificity protein-1 (Sp-1) consensus site was identified in the rat CSE promoter and was found to mediate the E2-induced CSE expression. E2 increases ERα and Sp-1 and inhibits microRNA (miR)-22 expression in myocardium of ovariectomized rats. In primary cardiomyocytes, E2 stimulates Sp-1 expression through the ERα-mediated down-regulation of miR-22. It was confirmed that both ERα and Sp-1 were targeted by miR-22. In the myocardium of ovariectomized rats, the level of miR-22 inversely correlated to CSE, ERα, Sp-1, and antioxidant biomarkers and positively correlated to oxidative biomarkers. In summary, this study demonstrates that estrogens stimulate Sp-1 through the ERα-mediated down-regulation of miR-22 in cardiomyocytes, leading to the up-regulation of CSE, which in turn results in an increase of antioxidative defense. Interaction of ERα, miR-22, and Sp-1 may play a critical role in the control of oxidative stress status in the myocardium of female rats. PMID:25825815

  16. Comparative integromics on FZD7 orthologs: conserved binding sites for PU.1, SP1, CCAAT-box and TCF/LEF/SOX transcription factors within 5'-promoter region of mammalian FZD7 orthologs.

    PubMed

    Katoh, Masuko; Katoh, Masaru

    2007-03-01

    that the binding sites for PU.1, SP1/Krüppel-like, CCAAT-box, and TCF/LEF/SOX transcription factors were conserved among 5'-promoter regions of mammalian FZD7 orthologs. PMID:17273804

  17. Mineralocorticoid receptor interaction with SP1 generates a new response element for pathophysiologically relevant gene expression

    PubMed Central

    Meinel, Sandra; Ruhs, Stefanie; Schumann, Katja; Strätz, Nicole; Trenkmann, Kay; Schreier, Barbara; Grosse, Ivo; Keilwagen, Jens; Gekle, Michael; Grossmann, Claudia

    2013-01-01

    The mineralocorticoid receptor (MR) is a ligand-induced transcription factor belonging to the steroid receptor family and involved in water-electrolyte homeostasis, blood pressure regulation, inflammation and fibrosis in the renocardiovascular system. The MR shares a common hormone-response-element with the glucocorticoid receptor but nevertheless elicits MR-specific effects including enhanced epidermal growth factor receptor (EGFR) expression via unknown mechanisms. The EGFR is a receptor tyrosine kinase that leads to activation of MAP kinases, but that can also function as a signal transducer for other signaling pathways. In the present study, we mechanistically investigate the interaction between a newly discovered MR- but not glucocorticoid receptor- responsive-element (=MRE1) of the EGFR promoter, specificity protein 1 (SP1) and MR to gain general insights into MR-specificity. Biological relevance of the interaction for EGFR expression and consequently for different signaling pathways in general is demonstrated in human, rat and murine vascular smooth muscle cells and cells of EGFR knockout mice. A genome-wide promoter search for identical binding regions followed by quantitative PCR validation suggests that the identified MR-SP1–MRE1 interaction might be applicable to other genes. Overall, a novel principle of MR-specific gene expression is explored that applies to the pathophysiologically relevant expression of the EGFR and potentially also to other genes. PMID:23821666

  18. EFFECT MEASURE MODIFICATION OF BLOOD LEAD-AIR LEAD SLOPE FACTORS

    EPA Science Inventory

    Background: There is abundant literature finding that blood lead (PbB) levels are directly influenced by susceptibility factors including race and ethnicity, age, and housing. However, no study has explored how susceptibility factors influence the PbB-air lead (PbA) relationship...

  19. Nuclear receptors modulate the interaction of Sp1 and GC-rich DNA via ternary complex formation.

    PubMed Central

    Husmann, M; Dragneva, Y; Romahn, E; Jehnichen, P

    2000-01-01

    Binding sites for transcription factor Sp1 have been implicated in the transcriptional regulation of several genes by hormones or vitamins, and here we show that a GC-rich element contributes to the retinoic acid response of the interleukin 1beta promoter. To explain such observations, it has been proposed that nuclear receptors can interact with Sp1 bound to GC-rich DNA. However, evidence supporting this model has remained indirect. So far, nuclear receptors have not been detected in a complex with Sp1 and GC-rich DNA, and the expected ternary complexes in non-denaturing gels were not seen. In search for these missing links we found that nuclear receptors [retinoic acid receptor (RAR), thyroid hormone receptor (TR), vitamin D(3) receptor, peroxisome-proliferator-activated receptor and retinoic X receptor] induce an electrophoretic mobility increase of Sp1-GC-rich DNA complexes. Concomitantly, binding of Sp1 to the GC-box is enhanced. It is proposed that nuclear receptors may partially replace Sp1 in homo-oligomers at the GC-box. RARs and Sp1 can also combine into a complex with a retinoic acid-response element. The presence of RAR and Sp1 in complexes with either cognate site was revealed in supershift experiments. The C-terminus of Sp1 interacts with nuclear receptors. Both the ligand- and DNA-binding domains of the receptor are important for complex formation with Sp1 and GC-rich DNA. In spite of similar capacity to form ternary complexes, RAR but not TR up-regulated an Sp1-driven reporter in a ligand-dependent way. Thus additional factors limit the transcriptional response mediated by nuclear receptors and Sp1. PMID:11104684

  20. Physiological TLR5 expression in the intestine is regulated by differential DNA binding of Sp1/Sp3 through simultaneous Sp1 dephosphorylation and Sp3 phosphorylation by two different PKC isoforms.

    PubMed

    Thakur, Bhupesh Kumar; Dasgupta, Nirmalya; Ta, Atri; Das, Santasabuj

    2016-07-01

    Toll-like receptor 5 (TLR5) expression in the intestinal epithelial cells (IECs) is critical to maintain health, as underscored by multiple intestinal and extra-intestinal diseases in mice genetically engineered for IEC-specific TLR5 knockout. A gradient of expression exists in the colonic epithelial cells from the cecum to the distal colon. Intriguingly, an identical gradient for the dietary metabolite, butyrate also exists in the luminal contents. However, both being critical for intestinal homeostasis and immune response, no studies examined the role of butyrate in the regulation of TLR5 expression. We showed that butyrate transcriptionally upregulates TLR5 in the IECs and augments flagellin-induced immune responses. Both basal and butyrate-induced transcription is regulated by differential binding of Sp-family transcription factors to the GC-box sequences over the TLR5 promoter. Butyrate activates two different protein kinase C isoforms to dephosphorylate/acetylate Sp1 by serine/threonine phosphatases and phosphorylate Sp3 by ERK-MAPK, respectively. This resulted in Sp1 displacement from the promoter and binding of Sp3 to it, leading to p300 recruitment and histone acetylation, activating transcription. This is the first study addressing the mechanisms of physiological TLR5 expression in the intestine. Additionally, a novel insight is gained into Sp1/Sp3-mediated gene regulation that may apply to other genes. PMID:27060138

  1. Physiological TLR5 expression in the intestine is regulated by differential DNA binding of Sp1/Sp3 through simultaneous Sp1 dephosphorylation and Sp3 phosphorylation by two different PKC isoforms

    PubMed Central

    Thakur, Bhupesh Kumar; Dasgupta, Nirmalya; Ta, Atri; Das, Santasabuj

    2016-01-01

    Toll-like receptor 5 (TLR5) expression in the intestinal epithelial cells (IECs) is critical to maintain health, as underscored by multiple intestinal and extra-intestinal diseases in mice genetically engineered for IEC-specific TLR5 knockout. A gradient of expression exists in the colonic epithelial cells from the cecum to the distal colon. Intriguingly, an identical gradient for the dietary metabolite, butyrate also exists in the luminal contents. However, both being critical for intestinal homeostasis and immune response, no studies examined the role of butyrate in the regulation of TLR5 expression. We showed that butyrate transcriptionally upregulates TLR5 in the IECs and augments flagellin-induced immune responses. Both basal and butyrate-induced transcription is regulated by differential binding of Sp-family transcription factors to the GC-box sequences over the TLR5 promoter. Butyrate activates two different protein kinase C isoforms to dephosphorylate/acetylate Sp1 by serine/threonine phosphatases and phosphorylate Sp3 by ERK-MAPK, respectively. This resulted in Sp1 displacement from the promoter and binding of Sp3 to it, leading to p300 recruitment and histone acetylation, activating transcription. This is the first study addressing the mechanisms of physiological TLR5 expression in the intestine. Additionally, a novel insight is gained into Sp1/Sp3-mediated gene regulation that may apply to other genes. PMID:27060138

  2. Retinoid-induced apoptosis and Sp1 cleavage occur independently of transcription and require caspase activation.

    PubMed Central

    Piedrafita, F J; Pfahl, M

    1997-01-01

    Vitamin A and its derivatives, the retinoids, are essential regulators of many important biological functions, including cell growth and differentiation, development, homeostasis, and carcinogenesis. Natural retinoids such as all-trans retinoic acid can induce cell differentiation and inhibit growth of certain cancer cells. We recently identified a novel class of synthetic retinoids with strong anti-cancer cell activities in vitro and in vivo which can induce apoptosis in several cancer cell lines. Using an electrophoretic mobility shift assay, we analyzed the DNA binding activity of several transcription factors in T cells treated with apoptotic retinoids. We found that the DNA binding activity of the general transcription factor Sp1 is lost in retinoid-treated T cells undergoing apoptosis. A truncated Sp1 protein is detected by immunoblot analysis, and cytosolic protein extracts prepared from apoptotic cells contain a protease activity which specifically cleaves purified Sp1 in vitro. This proteolysis of Sp1 can be inhibited by N-ethylmaleimide and iodoacetamide, indicating that a cysteine protease mediates cleavage of Sp1. Furthermore, inhibition of Sp1 cleavage by ZVAD-fmk and ZDEVD-fmk suggests that caspases are directly involved in this event. In fact, caspases 2 and 3 are activated in T cells after treatment with apoptotic retinoids. The peptide inhibitors also blocked retinoid-induced apoptosis, as well as processing of caspases and proteolysis of Sp1 and poly(ADP-ribose) polymerase in intact cells. Degradation of Sp1 occurs early during apoptosis and is therefore likely to have profound effects on the basal transcription status of the cell. Interestingly, retinoid-induced apoptosis does not require de novo mRNA and protein synthesis, suggesting that a novel mechanism of retinoid signaling is involved, triggering cell death in a transcriptional activation-independent, caspase-dependent manner. PMID:9343396

  3. Age-specific risk factors for lead absorption in children

    SciTech Connect

    Walter, S.D.; Yankel, A.J.; von Lindern, I.H.

    1980-01-01

    The relationship of blood lead levels to environmental and individual characteristics is analyzed in a large sample of children residing near a lead smelting complex, with particular emphasis on the identification of age-related risk factors. Exceptional variation in both blood leads and its determinants within the study region facilitated the simultaneous detection of several significant risk factors for each year of age from 1 to 9 y. The strongest predictor of blood lead at all ages was air lead, but the secondary risk factors were age dependent. Household dustiness was significantly related to blood lead in young children, especially those under 2 y of age; soil lead may be an important source of ingested lead for children between 2 and 7 y. Other significant effects included that of pica at about 2 y of age, a slight effect of the occupational category of the fathers of 5- to 8-y-old children, and a tendency for 8- and 9-y-old boys to have higher blood leads than girls of the same age. Lead concentration in household paint was not a significant risk factor. These results suggest that a multifactorial approach to the prevention of excessive lead absorption by children is required.

  4. A novel functional interaction between the Sp1-like protein KLF13 and SREBP-Sp1 activation complex underlies regulation of low density lipoprotein receptor promoter function.

    PubMed

    Natesampillai, Sekar; Fernandez-Zapico, Martin E; Urrutia, Raul; Veldhuis, Johannes D

    2006-02-10

    Cholesterol homeostasis is regulated by a family of transcription factors designated sterol regulatory element-binding proteins (SREBPs). Precise control of SREBP-targeted genes requires additional interactions with co-regulatory transcription factors. In the case of the low density lipoprotein receptor (LDLR), SREBP cooperates with the specificity protein Sp1 to activate the promoter. In this report, we describe a novel pathway in LDLR transcriptional regulation distinct from the SREBP-Sp1 activation complex involving the Sp1-like protein Krueppel-like factor 13 (KLF13). Using a combination of RNA interference, electrophoretic mobility shift, chromatin immunoprecipitation, and reporter assays, deletion, and site-directed mutagenesis, we demonstrated that KLF13 mediates repression in a DNA context-selective manner. KLF13 repression of LDLR promoter activity appears to be needed to keep the receptor silent, a state that can be antagonized by Sp1, SREBP, and inhibitors of histone deacetylase activity. Chromatin immunoprecipitation assay confirmed that KLF13 binds proximal LDLR DNA sequences in vivo and that exogenous oxysterol up-regulates such binding. Together these studies identify a novel regulatory pathway in which gene repression by KLF13 must be overcome by the Sp1-SREBP complex to activate the LDLR promoter. Therefore, these data should replace a pre-existent and more simple paradigm that takes into consideration only the induction of the activator proteins Sp1-SREBP as necessary for LDLR promoter drive without including default repression, such as that by KLF13, of the LDLR gene. PMID:16303770

  5. Crosstalk of Sp1 and Stat3 signaling in pancreatic cancer pathogenesis

    PubMed Central

    Huang, Chen; Xie, Keping

    2012-01-01

    Pancreatic cancer progression is attributed to genetic and epigenetic alterations and a chaotic tumor microenvironment. Those diverse “upstream signal” factors appear to converge on specific sets of central nuclear regulators, namely, transcription factors. Specificity Protein 1 (Sp1) and signal transducer and activator of transcription 3 (Stat3) are central transcription factors that regulate a number of pathways important to tumorigenesis, including tumor cell-cycle progression, apoptosis, angiogenesis, metastasis, and evasion of the immune system. Recently, researchers demonstrated many types of crosstalk of Sp1 and Stat3 in tumor signal transduction and that these factors function cooperatively to activate targeted genes and promote tumorigenesis in pancreatic cancer. Therefore, targeting both Sp1 and Stat3 is a potential preventive and therapeutic strategy for pancreatic cancer. PMID:22342309

  6. Effect measure modification of blood lead-air lead slope factors.

    PubMed

    Richmond-Bryant, Jennifer; Meng, Qingyu; Cohen, Jonathan; Davis, J Allen; Svendsgaard, David; Brown, James S; Tuttle, Lauren; Hubbard, Heidi; Rice, Joann; Kirrane, Ellen; Vinikoor-Imler, Lisa; Kotchmar, Dennis; Hines, Erin; Ross, Mary

    2015-01-01

    There is abundant literature finding that susceptibility factors, including race and ethnicity, age, and housing, directly influence blood lead levels. No study has explored how susceptibility factors influence the blood lead-air lead relationship nationally. The objective is to evaluate whether susceptibility factors act as effect measure modifiers on the blood lead-air lead relationship. Participant level blood lead data from the 1999 to 2008 National Health and Nutrition Examination Survey were merged with air lead data from the US Environmental Protection Agency. Linear mixed effects models were run with and without an air lead interaction term for age group, sex, housing age, or race/ethnicity to determine whether these factors are effect measure modifiers for all ages combined and for five age brackets. Age group and race/ethnicity were determined to be effect measure modifiers in the all-age model and for some age groups. Being a child (1-5, 6-11, and 12-19 years) or of Mexican-American ethnicity increased the effect estimate. Living in older housing (built before 1950) decreased the effect estimate for all models except for the 1-5-year group, where older housing was an effect measure modifier. These results are consistent with the peer-reviewed literature of time-activity patterns, ventilation, and toxicokinetics. PMID:24961837

  7. EPAS-1 Mediates SP-1-Dependent FBI-1 Expression and Regulates Tumor Cell Survival and Proliferation

    PubMed Central

    Wang, Xiaogang; Cao, Peng; Li, Zhiqing; Wu, Dongyang; Wang, Xi; Liang, Guobiao

    2014-01-01

    Factor binding IST-1 (FBI-1) plays an important role in oncogenic transformation and tumorigenesis. As FBI-1 is over-expressed in multiple human cancers, the regulation of itself would provide new effective options for cancer intervention. In this work, we aimed to study the role that EPAS-1 plays in regulating FBI-1. We use the fact that specificity protein-1 (SP-1) is one of the crucial transcription factors of FBI-1, and that SP-1 can interact with the endothelial pas domain protein-1 (EPAS-1) for the induction of hypoxia related genes. The study showed that EPAS-1 plays an indispensible role in SP-1 transcription factor-mediated FBI-1 induction, and participated in tumor cell survival and proliferation. Thus, EPAS-1 could be a novel target for cancer therapeutics. PMID:25192290

  8. EPAS-1 mediates SP-1-dependent FBI-1 expression and regulates tumor cell survival and proliferation.

    PubMed

    Wang, Xiaogang; Cao, Peng; Li, Zhiqing; Wu, Dongyang; Wang, Xi; Liang, Guobiao

    2014-01-01

    Factor binding IST-1 (FBI-1) plays an important role in oncogenic transformation and tumorigenesis. As FBI-1 is over-expressed in multiple human cancers, the regulation of itself would provide new effective options for cancer intervention. In this work, we aimed to study the role that EPAS-1 plays in regulating FBI-1. We use the fact that specificity protein-1 (SP-1) is one of the crucial transcription factors of FBI-1, and that SP-1 can interact with the endothelial pas domain protein-1 (EPAS-1) for the induction of hypoxia related genes. The study showed that EPAS-1 plays an indispensible role in SP-1 transcription factor-mediated FBI-1 induction, and participated in tumor cell survival and proliferation. Thus, EPAS-1 could be a novel target for cancer therapeutics. PMID:25192290

  9. A Study of the Factors Leading English Teachers to Burnout

    ERIC Educational Resources Information Center

    Cephe, Pasa Tevfik

    2010-01-01

    This paper reports a research study carried out on teacher burnout with a group of English instructors (N=44) in order to identify the major factor(s) leading instructors to burnout at various levels. A survey research model was first applied to find out the instructors (N=37) with a burnout problem and categorize them at different levels of…

  10. Influence of social and environmental factors on dust, lead, hand lead, and blood lead levels in young children

    SciTech Connect

    Bornschein, R.L.; Succop, P.; Dietrich, K.N.; Clark, C.S.; Que Hee, S.; Hammond, P.B.

    1985-10-01

    The roles of environmental and behavioral factors in determining blood lead levels were studied in a cohort of young children living in an urban environment. The subjects were observed at 3-month intervals from birth to 24 months of age. Repeated measurements were made of the children's blood lead levels, environmental levels of lead in house dust, and in the dust found on the children's hands. A qualitative rating of the residence and of the socioeconomic status of the family was obtained. Interviews and direct observation of parent and child at home were used to evaluate various aspects of caretaker-child interactions. Data analysis consisted of a comparison of results obtained by (a) simple correlational analysis, (b) multiple regression analysis, and (c) structural equations analysis. The results demonstrated that structural equation modeling offers a useful approach to unraveling the complex interactions present in the data set. In this preliminary analysis, the suspected relationship between the levels of lead in house dust and on hands and the blood lead level was clearly demonstrated. Furthermore, the analyses indicated an important interplay between environmental sources and social factors in the determination of hand lead and blood lead levels in very young children.

  11. Risk factors for lead poisoning among Cuban refugee children.

    PubMed Central

    Trepka, Mary Jo; Pekovic, Vukosava; Santana, Juan Carlos; Zhang, Guoyan

    2005-01-01

    OBJECTIVES: This study was designed to explore whether parental activities such as repairing cars, welding, and rebuilding car batteries are risk factors for lead poisoning among Cuban refugee children in Miami-Dade County. METHODS: The authors performed a cross-sectional study of 479 children aged 12-83 months who had lived in Cuba during the six months prior to immigrating to the U.S. Lead levels were obtained, and parents provided information on demographics, home/neighborhood environment in Cuba prior to immigration, family/occupational factors prior to immigration, and child behavior factors. RESULTS: Of 479 children, 30 (6.3%) had elevated blood lead levels (EBLLs), defined as > or = 10 microg/dL, based on the Centers for Disease Control and Prevention action level. In multivariate analysis, racial/ethnic identification other than white, living in a home built after 1979, car repair in the home or yard, eating paint chips, and male sex were independently associated with EBLL. CONCLUSIONS: Risk factors for lead poisoning among immigrant children may differ from those among U.S.-born children. Screening of immigrant children who may have been exposed in their country of origin and education of immigrant parents about lead exposure hazards associated with activities such as car repair should be considered in the design of lead poisoning prevention and control programs. PMID:15842120

  12. LPS induces IL-10 production by human alveolar macrophages via MAPKinases- and Sp1-dependent mechanisms

    PubMed Central

    Chanteux, Hugues; Guisset, Amélie C; Pilette, Charles; Sibille, Yves

    2007-01-01

    Background IL-10 is a cytokine mainly produced by macrophages that plays key roles in tolerance to inhaled antigens and in lung homeostasis. Its regulation in alveolar macrophages (HAM), the resident lung phagocytes, remains however unknown. Methods The present study investigated the role of intracellular signalling and transcription factors controlling the production of IL-10 in LPS-activated HAM from normal nonsmoking volunteers. Results LPS (1–1000 pg/ml) induced in vitro IL-10 production by HAM, both at mRNA and protein levels. LPS also activated the phosphorylation of ERK, p38 and JNK MAPkinases (immunoblots) and Sp-1 nuclear activity (EMSA). Selective inhibitors of MAPKinases (respectively PD98059, SB203580 and SP600125) and of Sp-1 signaling (mithramycin) decreased IL-10 expression in HAM. In addition, whilst not affecting IL-10 mRNA degradation, the three MAPKinase inhibitors completely abolished Sp-1 activation by LPS in HAM. Conclusion These results demonstrate for the first time that expression of IL-10 in lung macrophages stimulated by LPS depends on the concomitant activation of ERK, p38 and JNK MAPKinases, which control downstream signalling to Sp-1 transcription factor. This study further points to Sp-1 as a key signalling pathway for IL-10 expression in the lung. PMID:17916230

  13. Zac1, an Sp1-like protein, regulates human p21{sup WAF1/Cip1} gene expression in HeLa cells

    SciTech Connect

    Liu, Pei-Yao; Hsieh, Tsai-Yuan; Liu, Shu-Ting; Chang, Yung-Lung; Lin, Wei-Shiang; Wang, Wei-Ming; Huang, Shih-Ming

    2011-12-10

    Zac1 functions as both a transcription factor and a transcriptional cofactor for p53, nuclear receptors (NRs) and NR coactivators. Zac1 might also act as a transcriptional repressor via the recruitment of histone deacetylase 1 (HDAC1). The ability of Zac1 to interact directly with GC-specific elements indicates that Zac1 possibly binds to Sp1-responsive elements. In the present study, our data show that Zac1 is able to interact directly with the Sp1-responsive element in the p21{sup WAF1/Cip1} gene promoter and enhance the transactivation activity of Sp1 through direct physical interaction. Our data further demonstrate that Zac1 might enhance Sp1-specific promoter activity by interacting with the Sp1-responsive element, affecting the transactivation activity of Sp1 via a protein-protein interaction, or competing the HDAC1 protein away from the pre-existing Sp1/HDAC1 complex. Finally, the synergistic regulation of p21{sup WAF1/Cip1} gene expression by Zac1 and Sp1 is mediated by endogenous p53 protein and p53-responsive elements in HeLa cells. Our work suggests that Zac1 might serve as an Sp1-like protein that directly interacts with the Sp1-responsive element to oligomerize with and/or to coactivate Sp1.

  14. Environmental Lead Exposure among Preschool Children in Shanghai, China: Blood Lead Levels and Risk Factors

    PubMed Central

    Wang, Yu; Yu, Guangjun; Yan, Chonghuai

    2014-01-01

    Objective To determine blood lead levels and to identify related risk factors among children in Shanghai; to explore the lead change trend of children after industrial transformation and to provide data for policy development to control environmental lead pollution in Shanghai. Methods A stratified-clustered-random sampling method was used. A tungsten atomizer absorption spectrophotometer was employed to determine blood lead levels. Results The arithmetic mean, geometric mean and median of blood lead levels of 0- to 6-year-old children from Shanghai were 22.49 µg/L, 19.65 µg/L and 19.5 µg/L, including 0.26% (6/2291) with concentrations ≥100 µg/L and 2.7% (61/2291) with concentrations ≥50 µg/L. Boys' levels (23.57 µg/L) were greater than those of girls (21.2 µg/L). The blood lead levels increased with age. This survey showed that the Chongming district was the highest and Yangpu district was the lowest, this result is completely opposite with the earlier survey in Shanghai. Risk factors for lead contamination included housing environment, parents' education levels, social status, hobbies, and children's nutritional status. Conclusions The blood lead levels of children in Shanghai were lower than the earlier data of Shanghai and those of published studies in China, but higher than the blood lead levels of developed countries. The blood lead levels of urban districts are higher than the central districts with the industrial transformation. Society and the government should take an active interest in childhood lead poisoning of urban areas. PMID:25436459

  15. Factors associated with blood lead concentrations of children in Jamaica

    PubMed Central

    RAHBAR, MOHAMMAD H.; SAMMS-VAUGHAN, MAUREEN; DICKERSON, AISHA S.; LOVELAND, KATHERINE A.; ARDJOMAND-HESSABI, MANOUCHEHR; BRESSLER, JAN; SHAKESPEARE-PELLINGTON, SYDONNIE; GROVE, MEGAN L.; BOERWINKLE, ERIC

    2015-01-01

    Lead is a heavy metal known to be detrimental to neurologic, physiologic, and behavioral health of children. Previous studies from Jamaica reported that mean lead levels in soil are four times that of lead levels in some other parts of the world. Other studies detected lead levels in fruits and root vegetables, which were grown in areas with lead contaminated soil. In this study, we investigate environmental factors associated with blood lead concentrations in Jamaican children. The participants in this study comprised 125 typically developing (TD) children (ages 2–8 years) who served as controls in an age- and sex-matched case-control study that enrolled children from 2009 – 2012 in Jamaica. We administered a questionnaire to assess demographic and socioeconomic information as well as potential exposures to lead through food. Using General Linear Models (GLMs), we identified factors associated with blood lead concentrations in Jamaican children. The geometric mean blood lead concentration (GMBLC) in the sample of children in this study was 2.80 μg/dL. In univariable GLM analyses, GMBLC was higher for children whose parents did not have education beyond high school compared to those whose parents had attained this level (3.00 μg/dL vs. 2.31 μg/dL; P = 0.05), children living near a high traffic road compared to those who did not (3.43 μg/dL vs. 2.52 μg/dL; P < 0.01), and children who reported eating ackee compared to those who did not eat this fruit (2.89 μg/dL vs. 1.65 μg/dL; P < 0.05). In multivariable analysis, living near a high traffic road was identified as an independent risk factor for higher adjusted GMBLC (3.05 μg/dL vs. 2.19 μg/dL; P = 0.01). While our findings indicate that GMBLC in Jamaican children has dropped by at least 62% during the past two decades, children living in Jamaica still have GMBLC that is twice that of children in more developed countries. In addition, we have identified significant risk factors for higher blood lead

  16. Investigation and Evaluation of Children's Blood Lead Levels around a Lead Battery Factory and Influencing Factors.

    PubMed

    Zhang, Feng; Liu, Yang; Zhang, Hengdong; Ban, Yonghong; Wang, Jianfeng; Liu, Jian; Zhong, Lixing; Chen, Xianwen; Zhu, Baoli

    2016-01-01

    Lead pollution incidents have occurred frequently in mainland China, which has caused many lead poisoning incidents. This paper took a battery recycling factory as the subject, and focused on measuring the blood lead levels of environmental samples and all the children living around the factory, and analyzed the relationship between them. We collected blood samples from the surrounding residential area, as well as soil, water, vegetables. The atomic absorption method was applied to measure the lead content in these samples. The basic information of the generation procedure, operation type, habit and personal protect equipment was collected by an occupational hygiene investigation. Blood lead levels in 43.12% of the subjects exceeded 100 μg/L. The 50th and the 95th percentiles were 89 μg/L and 232 μg/L for blood lead levels in children, respectively, and the geometric mean was 94 μg/L. Children were stratified into groups by age, gender, parents' occupation, distance and direction from the recycling plant. The difference of blood lead levels between groups was significant (p < 0.05). Four risk factors for elevated blood lead levels were found by logistic regression analysis, including younger age, male, shorter distance from the recycling plant, and parents with at least one working in the recycling plant. The rate of excess lead concentration in water was 6.25%, 6.06% in soil and 44.44% in leaf vegetables, which were all higher than the Chinese environment standards. The shorter the distance to the factory, the higher the value of BLL and lead levels in vegetable and environment samples. The lead level in the environmental samples was higher downwind of the recycling plant. PMID:27240393

  17. Teaching the Factors Affecting Resistance Using Pencil Leads

    ERIC Educational Resources Information Center

    Küçüközer, Asuman

    2015-01-01

    The aim of this paper is to provide a way of teaching the factors that affect resistance using mechanical pencil leads and the brightness of the light given out by a light bulb connected to an electrical circuit. The resistance of a conductor is directly proportional to its length (L) and inversely proportional to its cross-sectional area (A).…

  18. SEPARATING THE EFFECTS OF LEAD AND SOCIAL FACTORS ON IQ

    EPA Science Inventory

    Initial evaluations of 104 low-socioeconomic status black children screened by the local community health departments in North Carolina showed significant effects of lead in the range 6-59 micrograms/dl on IQ after controlling for concomitant social factors, such as socioeconomic...

  19. Overexpression of HDAC1 induces cellular senescence by Sp1/PP2A/pRb pathway

    SciTech Connect

    Chuang, Jian-Ying; Hung, Jan-Jong

    2011-04-15

    Highlights: {yields} Overexpression of HDAC1 induces Sp1 deacetylation and raises Sp1/p300 complex formation to bind to PP2Ac promoter. {yields} Overexpression of HDAC1 strongly inhibits the phosphorylation of pRb through up-regulation of PP2A. {yields} Overexpressed HDAC1 restrains cell proliferaction and induces cell senescence though a novel Sp1/PP2A/pRb pathway. -- Abstract: Senescence is associated with decreased activities of DNA replication, protein synthesis, and cellular division, which can result in deterioration of cellular functions. Herein, we report that the growth and division of tumor cells were significantly repressed by overexpression of histone deacetylase (HDAC) 1 with the Tet-off induced system or transient transfection. In addition, HDAC1 overexpression led to senescence through both an accumulation of hypophosphorylated active retinoblastoma protein (pRb) and an increase in the protein level of protein phosphatase 2A catalytic subunit (PP2Ac). HDAC1 overexpression also increased the level of Sp1 deacetylation and elevated the interaction between Sp1 and p300, and subsequently that Sp1/p300 complex bound to the promoter of PP2Ac, thus leading to induction of PP2Ac expression. Similar results were obtained in the HDAC1-Tet-off stable clone. Taken together, these results indicate that HDAC1 overexpression restrained cell proliferation and induced premature senescence in cervical cancer cells through a novel Sp1/PP2A/pRb pathway.

  20. Integrated high-throughput analysis identifies Sp1 as a crucial determinant of p53-mediated apoptosis

    PubMed Central

    Li, H; Zhang, Y; Ströse, A; Tedesco, D; Gurova, K; Selivanova, G

    2014-01-01

    The restoration of p53 tumor suppressor function is a promising therapeutic strategy to combat cancer. However, the biological outcomes of p53 activation, ranging from the promotion of growth arrest to the induction of cell death, are hard to predict, which limits the clinical application of p53-based therapies. In the present study, we performed an integrated analysis of genome-wide short hairpin RNA screen and gene expression data and uncovered a previously unrecognized role of Sp1 as a central modulator of the transcriptional response induced by p53 that leads to robust induction of apoptosis. Sp1 is indispensable for the pro-apoptotic transcriptional repression by p53, but not for the induction of pro-apoptotic genes. Furthermore, the p53-dependent pro-apoptotic transcriptional repression required the co-binding of Sp1 to p53 target genes. Our results also highlight that Sp1 shares with p53 a common regulator, MDM2, which targets Sp1 for proteasomal degradation. This uncovers a new mechanism of the tight control of apoptosis in cells. Our study advances the understanding of the molecular basis of p53-mediated apoptosis and implicates Sp1 as one of its key modulators. We found that small molecules reactivating p53 can differentially modulate Sp1, thus providing insights into how to manipulate p53 response in a controlled way. PMID:24971482

  1. Sp1 trans-activates the murine H(+)-K(+)-ATPase alpha(2)-subunit gene.

    PubMed

    Yu, Zhiyuan; Li, Mei; Zhang, Dongyu; Xu, William; Kone, Bruce C

    2009-07-01

    The H(+)-K(+)-ATPase alpha(2) (HKalpha2) gene of the renal collecting duct and distal colon plays a central role in potassium and acid-base homeostasis, yet its transcriptional control remains poorly characterized. We previously demonstrated that the proximal 177 bp of its 5'-flanking region confers basal transcriptional activity in murine inner medullary collecting duct (mIMCD3) cells and that NF-kappaB and CREB-1 bind this region to alter transcription. In the present study, we sought to determine whether the -144/-135 Sp element influences basal HKalpha2 gene transcription in these cells. Electrophoretic mobility shift and supershift assays using probes for -154/-127 revealed Sp1-containing DNA-protein complexes in nuclear extracts of mIMCD3 cells. Chromatin immunoprecipitation (ChIP) assays demonstrated that Sp1, but not Sp3, binds to this promoter region of the HKalpha2 gene in mIMCD3 cells in vivo. HKalpha2 minimal promoter-luciferase constructs with point mutations in the -144/-135 Sp element exhibited much lower activity than the wild-type promoter in transient transfection assays. Overexpression of Sp1, but not Sp3, trans-activated an HKalpha2 proximal promoter-luciferase construct in mIMCD3 cells as well as in SL2 insect cells, which lack Sp factors. Conversely, small interfering RNA knockdown of Sp1 inhibited endogenous HKalpha2 mRNA expression, and binding of Sp1 to chromatin associated with the proximal HKalpha2 promoter without altering the binding or regulatory influence of NF-kappaB p65 or CREB-1 on the proximal HKalpha2 promoter. We conclude that Sp1 plays an important and positive role in controlling basal HKalpha2 gene expression in mIMCD3 cells in vivo and in vitro. PMID:19420113

  2. Childhood lead poisoning in Brussels. Prevalence study and etiological factors

    NASA Astrophysics Data System (ADS)

    Claeys, F.; Sykes, C.; Limbos, C.; Ducoffre, G.

    2003-05-01

    The objectives of this study were twofold: firstly, to assess the frequency (prevalence) of childhood lead poisoning in some districts of Brussels and second, to identify within the dwellings the major source of lead as well as the risk factors connected with this intoxication. The study population (533 participants) was selected among children who visited childhood health centres in downtown Brussels. The reference group was chosen among children living outside Brussels city center. A casecontrol study was undertaken to meet the second objective of the investigation. The average blood lead level (PbB) was 104 μg/1 in the study population compared with 36 μg/l in the reference group. The 100 μg/l “non effect level" put forward by the Centres for Disease Control (CDC) and by the French legislation, is exceeded by 50% of the children living in this rundown environment. The major cause of intoxication is the presence of old lead-based paints in dwellings (Odd Ratio (OR): 4.4) constructed before 1940. Hand-to-mouth activity, pica activity (OR: 17.1) and a lack of hygiene are factors, which combined, promote intoxication. When the dwellings are undergoing renovation, this risk increases (OR: 7.2).

  3. Users guide for the ANL IBM SP1

    SciTech Connect

    Gropp, W.; Lusk, E.; Pieper, S.C.

    1994-10-01

    This guide presents the features of the IBM SP1 installed in the Mathematics and Computer Science Division at Argonne National Laboratory. The guide describes the available hardware and software, access policies, and hints for using the system productively.

  4. Transcriptional activation of human 12-lipoxygenase gene promoter is mediated through Sp1 consensus sites in A431 cells.

    PubMed Central

    Liu, Y W; Arakawa, T; Yamamoto, S; Chang, W C

    1997-01-01

    The functional 5' flanking region of the human 12-lipoxygenase in epidermoid carcinoma A431 cells was characterized. By a primer extension method, the transcription initiation sites were mapped at -47 adenosine, -48 guanosine and -55 guanosine upstream of the ATG translation start codon. Transient transfection with a series of 5' and 3' deletion constructs showed that the 5' flanking region spanning from -224 to -100 bp was important for the basal expression of 12-lipoxygenase gene. Gel mobility shift assays with antibodies of transcription factors showed that both Sp1 and Sp3 required highly GC-rich Sp1 sites within this region for binding. Disruption of two Sp1 recognition motifs residing at -158 to -150 bp and -123 to -114 bp by site-directed mutagenesis markedly reduced the basal 12-lipoxygenase promoter activity and abolished the retarded bands in a gel-shift assay, indicating that these two Sp1-binding sites were essential for gene expression. The same two Sp1-binding sites in this promoter region were also responsible for epidermal growth factor (EGF)-induced expression of 12-lipoxygenase gene. Moreover, EGF also induced the transcriptional activation of luciferase driven by SV40 early promoter, which contained rich Sp1-binding sites. Taken together, the results suggest that two specific Sp1 consensus sites are involved in the mediation of the basal promoter activity as well as EGF induction of the 12-lipoxygenase gene and that Sp1 and Sp3 transcription factors might have a role in their regulation. PMID:9164849

  5. Monoamine oxidase B levels are highly expressed in human gliomas and are correlated with the expression of HiF-1α and with transcription factors Sp1 and Sp3

    PubMed Central

    Sharpe, Martyn A.; Baskin, David S.

    2016-01-01

    Monoamine oxidases A and B (MAOA and MAOB) are highly expressed in many cancers. Here we investigated the level of MAOB in gliomas and confirmed its high expression. We found that MAOB levels correlated with tumor grade and hypoxia-inducible factor 1-alpha (HiF-1α) expression. HiF-1α was localized to the nuclei in high-grade gliomas, but it was primarily cytosolic in low-grade gliomas and normal human astrocytes. Expression of both glial fibrillary acidic protein (GFAP) and MAOB are correlated to HiF-1α expression levels. Levels of MAOB are correlated by the levels of transcription factor Sp3 in the majority of GBM examined, but this control of MAOB expression by Sp3 in low grade astrocytic gliomas is significantly different from control in the in the majority of glioblastomas. The current findings support previous suggestions that MAOB can be exploited for the killing of cancer cells. Selective cell toxicity can be achieved by designing non-toxic prodrugs that require MAOB for their catalytic conversion into mature cytotoxic chemotherapeutics. PMID:26689994

  6. Propensity for HBZ-SP1 isoform of HTLV-I to inhibit c-Jun activity correlates with sequestration of c-Jun into nuclear bodies rather than inhibition of its DNA-binding activity

    SciTech Connect

    Clerc, Isabelle; Hivin, Patrick; Rubbo, Pierre-Alain; Lemasson, Isabelle; Barbeau, Benoit; Mesnard, Jean-Michel

    2009-09-01

    HTLV-I bZIP factor (HBZ) contains a C-terminal zipper domain involved in its interaction with c-Jun. This interaction leads to a reduction of c-Jun DNA-binding activity and prevents the protein from activating transcription of AP-1-dependent promoters. However, it remained unclear whether the negative effect of HBZ-SP1 was due to its weak DNA-binding activity or to its capacity to target cellular factors to transcriptionally-inactive nuclear bodies. To answer this question, we produced a mutant in which specific residues present in the modulatory and DNA-binding domain of HBZ-SP1 were substituted for the corresponding c-Fos amino acids to improve the DNA-binding activity of the c-Jun/HBZ-SP1 heterodimer. The stability of the mutant, its interaction with c-Jun, DNA-binding activity of the resulting heterodimer, and its effect on the c-Jun activity were tested. In conclusion, we demonstrate that the repression of c-Jun activity in vivo is mainly due to the HBZ-SP1-mediated sequestration of c-Jun to the HBZ-NBs.

  7. Capsaicin sensitizes TRAIL-induced apoptosis through Sp1-mediated DR5 up-regulation: Involvement of Ca{sup 2+} influx

    SciTech Connect

    Moon, Dong-Oh; Kang, Chang-Hee; Kang, Sang-Hyuck; Choi, Yung-Hyun; Hyun, Jin-Won; Chang, Weon-Young; Kang, Hee-Kyoung; Koh, Young-Sang; Maeng, Young-Hee; Kim, Young-Ree; Kim, Gi-Young

    2012-02-15

    Although tumor necrosis factor-related apoptosis-inducing ligand (TRAIL) induces apoptosis in various malignant cells, several cancers including human hepatocellular carcinoma (HCC) exhibit potent resistance to TRAIL-induced cell death. The aim of this study is to evaluate the anti-cancer potential of capsaicin in TRAIL-induced cancer cell death. As indicated by assays that measure phosphatidylserine exposure, mitochondrial activity and activation of caspases, capsaicin potentiated TRAIL-resistant cells to lead to cell death. In addition, we found that capsaicin induces the cell surface expression of TRAIL receptor DR5, but not DR4 through the activation Sp1 on its promoter region. Furthermore, we investigated that capsaicin-induced DR5 expression and apoptosis are inhibited by calcium chelator or inhibitors for calmodulin-dependent protein kinase. Taken together, our data suggest that capsaicin sensitizes TRAIL-mediated HCC cell apoptosis by DR5 up-regulation via calcium influx-dependent Sp1 activation. Highlights: ► Capsaicin sensitizes TRAIL-induced apoptosis through activation of caspases. ► Capsaicin induces expression of DR5 through Sp1 activation. ► Capsaicin activates calcium signaling pathway.

  8. Teaching the Factors Affecting Resistance Using Pencil Leads

    NASA Astrophysics Data System (ADS)

    Küçüközer, Asuman

    2015-01-01

    The aim of this paper is to provide a way of teaching the factors that affect resistance using mechanical pencil leads and the brightness of the light given out by a light bulb connected to an electrical circuit. The resistance of a conductor is directly proportional to its length (L) and inversely proportional to its cross-sectional area (A). Additionally, the resistance depends on the type of conductor. Resistance R can be thus be expressed as R = ρL/A, where ρ is the resistivity of the conductor.

  9. Sp1 is essential and its position is important for p120 gene transcription: a 35 bp juxtaposed positive regulatory element enhances transcription 2.5 fold.

    PubMed Central

    Haidar, M A; Henning, D; Busch, H

    1991-01-01

    Human proliferating cell nucleolar antigen p120 is expressed in tumor cells in the early G1 phase of the cell cycle. Deletion analyses of the essential cis-acting region -537/-278 showed that a 58 bp sequence from -457 to -400 is an important cis-acting element. An Sp1 transcription factor binds to the sequence AGAGGCGGGG (-425 to -416) within the -458/-400 cis-acting region. Deletion of the Sp1 binding sequence eliminated transcription. Substitution of the Sp1 box(-437/-406), containing the Sp1 recognition site, for the entire cis-acting region (-537/-278) restored transcription only at a very low level (18%). Deletion of the -537/-278 cis-acting region followed by substitutions showed that the Sp1 box (-437/-406) stimulated transcription 2.4 fold, when juxtaposed and downstream of a 35 bp (-472 GGGCGAGCGTAAGTTCCGGGTGCGGCGGCCGACTA -438) positive regulatory cis-element (PRE) over that by substitution of the Sp1 box alone. When the -406/-278 sequence was downstream of the PRE-Sp1 box, transcription was stimulated 4.4 fold over that produced by substitution of the Sp1 box alone. These results suggest that Sp1 is essential and its proper position in the 5' flanking sequence, juxtaposed and down stream of a 35 bp positive regulatory sequence, is required for efficient transcription. Images PMID:1754393

  10. E-Ras improves the efficiency of reprogramming by facilitating cell cycle progression through JNK-Sp1 pathway.

    PubMed

    Kwon, Yoo-Wook; Jang, Seulgi; Paek, Jae-Seung; Lee, Jae-Woong; Cho, Hyun-Jai; Yang, Han-Mo; Kim, Hyo-Soo

    2015-11-01

    We have previously shown that pluripotent stem cells can be induced from adult somatic cells which were exposed to protein extracts isolated from mouse embryonic stem cells (mESC). Interestingly, generation of induced pluripotent stem (iPS) cells depended on the background of ES cell lines; possible by extracts from C57, but not from E14. Proteomic analysis of two different mES cell lines (C57 and E14) shows that embryonic Ras (E-Ras) is expressed differently in two mES cell lines; high level of E-Ras only in C57 mESC whose extracts allows iPS cells production from somatic cells. Here, we show that E-Ras augments the efficiency in reprogramming of fibroblast by promoting cell proliferation. We found that over-expression of E-Ras in fibroblast increased cell proliferation which was caused by specific up-regulation of cyclins D and E, not A or B, leading to the accelerated G1 to S phase transition. To figure out the common transcription factor of cyclins D and E, we used TRANSFAC database and selected SP1 as a candidate which was confirmed as enhancer of cyclins D and E by luciferase promoter assay using mutants. As downstream signaling pathways, E-Ras activated only c-Jun N-terminal kinases (JNK) but not ERK or p38. Inhibition of JNK prevented E-Ras-mediated induction of pSP1, cyclins D, E, and cell proliferation. Finally, E-Ras transduction to fibroblast enhanced the efficiency of iPS cell generation by 4 factors (Oct4/Klf4/Sox2/C-myc), which was prevented by JNK inhibitor. In conclusion, E-Ras stimulates JNK, enhances binding of Sp1 on the promoter of cyclins D and E, leading to cell proliferation. E-Ras/JNK axis is a critical mechanism to generate iPS cells by transduction of 4 factors or by treatment of mESC protein extracts. PMID:26413787

  11. Photon impact factor and k{sub T} factorization in the next-to-leading order

    SciTech Connect

    Ian Balitsky

    2012-12-01

    The photon impact factor for the BFKL pomeron is calculated in the next-to-leading order (NLO) approximation using the operator expansion in Wilson lines. The result is represented as a NLO k{sub T}-factorization formula for the structure functions of small-x deep inelastic scattering.

  12. Lead Concentrations in Inner-City Soils as a Factor in the Child Lead Problem.

    ERIC Educational Resources Information Center

    Mielke, Howard W.; And Others

    1983-01-01

    Excess lead concentration (resulting primarily from vehicular emissions) in Baltimore's inner city soils probably has a bearing on that city's child lead poisoning problem. Soil lead concentrations were lower outside the inner city. (GC)

  13. Leading concentration correction to polymer dynamic self-structure factor

    NASA Astrophysics Data System (ADS)

    Perico, Angelo; La Ferla, Roberto; Freed, Karl F.

    1989-10-01

    The discrete chain representation of multiple scattering theory of the concentration dependence of the hydrodynamics of polymer solutions is applied to the calculation of the leading concentration correction to the dynamic structure factor S(k,t) and its first and second cumulants of individual labeled Gaussian chains in theta solutions at nonzero concentrations. Contributions are separated into those from overall translational and internal chain motions as well as couplings between different internal modes and between translation and internal modes, coupling that are introduced by interchain hydrodynamic interactions. The separate contributions are analyzed as a function of k and of t in order to isolate regions where certain contributions are dominant. As expected, short times and larger k tend to favor contributions from internal chain dynamics, while longer times and smaller k make concentration dependent translational effects predominate. Computations for shorter chains are extrapolated to provide the asymptotic long chain behavior.

  14. Women and Alcohol Use Disorders: Factors That Lead to Harm.

    PubMed

    Brighton, Renee; Moxham, Lorna; Traynor, Victoria

    2016-01-01

    Women, alcohol, and alcohol use disorders are underresearched topics when compared with the plethora of literature exploring male alcohol consumption and its related harms. It is time to change the fact that women are underrepresented in research and programs targeting alcohol use disorders. Given the changing patterns of alcohol consumption by women, coupled with the fact that women experience a telescoping effect in alcohol-related harms, it is time that increasing attention be paid to the way gender influences the experience of alcohol-related harms, including the development of alcohol use disorders. Recovery-orientated systems are not possible without the voices of the consumers being heard. With this in mind, the purposes of this article are to explore factors that lead to alcohol-related harm in women and to highlight the gender-specific barriers to service engagement. PMID:27580194

  15. Pin1-mediated Sp1 phosphorylation by CDK1 increases Sp1 stability and decreases its DNA-binding activity during mitosis.

    PubMed

    Yang, Hang-Che; Chuang, Jian-Ying; Jeng, Wen-Yih; Liu, Chia-I; Wang, Andrew H-J; Lu, Pei-Jung; Chang, Wen-Chang; Hung, Jan-Jong

    2014-12-16

    We have shown that Sp1 phosphorylation at Thr739 decreases its DNA-binding activity. In this study, we found that phosphorylation of Sp1 at Thr739 alone is necessary, but not sufficient for the inhibition of its DNA-binding activity during mitosis. We demonstrated that Pin1 could be recruited to the Thr739(p)-Pro motif of Sp1 to modulate the interaction between phospho-Sp1 and CDK1, thereby facilitating CDK1-mediated phosphorylation of Sp1 at Ser720, Thr723 and Thr737 during mitosis. Loss of the C-terminal end of Sp1 (amino acids 741-785) significantly increased Sp1 phosphorylation, implying that the C-terminus inhibits CDK1-mediated Sp1 phosphorylation. Binding analysis of Sp1 peptides to Pin1 by isothermal titration calorimetry indicated that Pin1 interacts with Thr739(p)-Sp1 peptide but not with Thr739-Sp1 peptide. X-ray crystallography data showed that the Thr739(p)-Sp1 peptide occupies the active site of Pin1. Increased Sp1 phosphorylation by CDK1 during mitosis not only stabilized Sp1 levels by decreasing interaction with ubiquitin E3-ligase RNF4 but also caused Sp1 to move out of the chromosomes completely by decreasing its DNA-binding activity, thereby facilitating cell cycle progression. Thus, Pin1-mediated conformational changes in the C-terminal region of Sp1 are critical for increased CDK1-mediated Sp1 phosphorylation to facilitate cell cycle progression during mitosis. PMID:25398907

  16. Next-to-leading-order correction to pion form factor in k{sub T} factorization

    SciTech Connect

    Li Hsiangnan; Shen Yuelong; Wang Yuming; Zou Hao

    2011-03-01

    We calculate the next-to-leading-order (NLO) correction to the pion electromagnetic form factor at leading twist in the k{sub T} factorization theorem. Partons off-shell by k{sub T}{sup 2} are considered in both quark diagrams and effective diagrams for the transverse-momentum-dependent pion wave function. The light-cone singularities in the transverse-momentum-dependent pion wave function are regularized by rotating the Wilson lines away from the light cone. The soft divergences from gluon exchanges among initial- and fal-state partons cancel exactly. We derive the infrared-finite k{sub T}-dependent NLO hard kernel for the pion electromagnetic form factor by taking the difference of the above two sets of diagrams. Varying the renormalization and factorization scales, we find that the NLO correction is smaller, when both the scales are set to the invariant masses of internal particles: it becomes lower than 40% of the leading-order contribution for momentum transfer squared Q{sup 2}>7 GeV{sup 2}. It is observed that the NLO leading-twist correction does not play an essential role in explaining the experimental data, but the leading-order higher-twist contribution does.

  17. Lead

    MedlinePlus

    ... Lead Share Facebook Twitter Google+ Pinterest Contact Us Lead Poisoning is Preventable If your home was built before ... of the RRP rule. Read more . Learn about Lead Poisoning Prevention Week . Report Uncertified Contractors and Environmental Violations ...

  18. A cooperative interaction between NF-kappa B and Sp1 is required for HIV-1 enhancer activation.

    PubMed Central

    Perkins, N D; Edwards, N L; Duckett, C S; Agranoff, A B; Schmid, R M; Nabel, G J

    1993-01-01

    The human immunodeficiency virus (HIV-1) long terminal repeat (LTR) contains two binding sites for NF-kappa B in close proximity to three binding sites for the constitutive transcription factor, Sp1. Previously, stimulation of the HIV enhancer in response to mitogens has been attributed to the binding of NF-kappa B to the viral enhancer. In this report, we show that the binding of NF-kappa B is not by itself sufficient to induce HIV gene expression. Instead, a protein-protein interaction must occur between NF-kappa B and Sp1 bound to an adjacent site. Cooperativity both in DNA binding and in transcriptional activation of NF-kappa B and Sp1 was confirmed by electrophoretic mobility shift gel analysis, DNase footprinting, chemical cross-linking and transfection studies in vivo. With a heterologous promoter, we find that the interaction of NF-kappa B with Sp1 is dependent on orientation and position, and is not observed with other elements, including GATA, CCAAT or octamer. An increase in the spacing between the kappa B and Sp1 elements virtually abolishes this functional interaction, which is not restored when these sites are brought back into the same helical position. Several other promoters regulated by NF-kappa B also contain kappa B in proximity to Sp1 binding sites. These findings suggest that an interaction between NF-kappa B and Sp1 is required for inducible HIV-1 gene expression and may serve as a regulatory mechanism to activate specific viral and cellular genes. Images PMID:8253080

  19. Lead

    MedlinePlus

    ... obvious symptoms, it frequently goes unrecognized. CDC’s Childhood Lead Poisoning Prevention Program is committed to the Healthy People ... Lead Levels Information for Parents Tips for preventing lead poisoning About Us Overview of CDC’s Childhood Lead Poisoning ...

  20. Bortezomib induces DNA hypomethylation and silenced gene transcription by interfering with Sp1/NF-κB–dependent DNA methyltransferase activity in acute myeloid leukemia

    PubMed Central

    Liu, Shujun; Liu, Zhongfa; Xie, Zhiliang; Pang, Jiuxia; Yu, Jianhua; Lehmann, Esther; Huynh, Lenguyen; Vukosavljevic, Tamara; Takeki, Mitsui; Klisovic, Rebecca B.; Baiocchi, Robert A.; Blum, William; Porcu, Pierluigi; Garzon, Ramiro; Byrd, John C.; Perrotti, Danilo; Caligiuri, Michael A.; Chan, Kenneth K.; Wu, Lai-Chu

    2008-01-01

    Bortezomib reversibly inhibits 26S proteasomal degradation, interferes with NF-κB, and exhibits antitumor activity in human malignancies. Zinc finger protein Sp1 transactivates DNMT1 gene in mice and is functionally regulated through protein abundance, posttranslational modifications (ie, ubiquitination), or interaction with other transcription factors (ie, NF-κB). We hypothesize that inhibition of proteasomal degradation and Sp1/NF-κB–mediated transactivation may impair aberrant DNA methyltransferase activity. We show here that, in addition to inducing accumulation of polyubiquitinated proteins and abolishment of NF-κB activities, bortezomib decreases Sp1 protein levels, disrupts the physical interaction of Sp1/NF-κB, and prevents binding of the Sp1/NF-κB complex to the DNMT1 gene promoter. Abrogation of Sp1/NF-κB complex by bortezomib causes transcriptional repression of DNMT1 gene and down-regulation of DNMT1 protein, which in turn induces global DNA hypomethylation in vitro and in vivo and re-expression of epigenetically silenced genes in human cancer cells. The involvement of Sp1/NF-κB in DNMT1 regulation is further demonstrated by the observation that Sp1 knockdown using mithramycin A or shRNA decreases DNMT1 protein levels, which instead are increased by Sp1 or NF-κB overexpression. Our results unveil the Sp1/NF-κB pathway as a modulator of DNA methyltransferase activity in human cancer and identify bortezomib as a novel epigenetic-targeting drug. PMID:18083845

  1. Kaempferol stimulates gene expression of low-density lipoprotein receptor through activation of Sp1 in cultured hepatocytes

    PubMed Central

    Ochiai, Ayasa; Miyata, Shingo; Iwase, Masamori; Shimizu, Makoto; Inoue, Jun; Sato, Ryuichiro

    2016-01-01

    A high level of plasma low-density lipoprotein (LDL) cholesterol is considered a risk factor for atherosclerosis. Because the hepatic LDL receptor (LDLR) is essential for clearing plasma LDL cholesterol, activation of LDLR is a promising therapeutic target for patients with atherosclerotic disease. Here we demonstrated how the flavonoid kaempferol stimulated the gene expression and activity of LDLR in HepG2 cells. The kaempferol-mediated stimulation of LDLR gene expression was completely inhibited by knockdown of Sp1 gene expression. Treatment of HepG2 cells with kaempferol stimulated the recruitment of Sp1 to the promoter region of the LDLR gene, as well as the phosphorylation of Sp1 on Thr-453 and Thr-739. Moreover, these kaempferol-mediated processes were inhibited in the presence of U0126, an ERK pathway inhibitor. These results suggest that kaempferol may increase the activity of Sp1 through stimulation of Sp1 phosphorylation by ERK1/2 and subsequent induction of LDLR expression and activity. PMID:27109240

  2. PTEN downregulates p75NTR expression by decreasing DNA-binding activity of Sp1

    SciTech Connect

    Rankin, Sherri L.; Guy, Clifford S.; Mearow, Karen M.

    2009-02-13

    p75NTR is expressed throughout the nervous system and its dysregulation is associated with pathological conditions. We have recently demonstrated a signalling cascade initiated by laminin (LN), which upregulates PTEN and downregulates p75NTR. Here we investigate the mechanism by which PTEN modulates p75NTR. Studies using PTEN mutants show that its protein phosphatase activity directly modulates p75NTR protein expression. Nuclear relocalization of PTEN subsequent to LN stimulation suggests transcriptional control of p75NTR expression, which was confirmed following EMSA and ChIP analysis of Sp1 transcription factor binding activity. LN and PTEN independently decrease the DNA-binding ability of PTEN to the p75NTR promoter. Sp1 regulation of p75NTR occurs via dephosphorylation of Sp1, thus reducing p75NTR transcription and protein expression. This mechanism represents a novel regulatory pathway which controls the expression level of a receptor with broad implications not only for the development of the nervous system but also for progression of pathological conditions.

  3. Curcumin Suppresses Metastasis via Sp-1, FAK Inhibition, and E-Cadherin Upregulation in Colorectal Cancer

    PubMed Central

    Chen, Chun-Chieh; Sureshbabul, Munisamy; Chen, Huei-Wen; Lin, Yu-Shuang; Lee, Jen-Yi; Hong, Qi-Sheng; Yang, Ya-Chien

    2013-01-01

    Colorectal cancer (CRC) is a serious public health problem that results due to changes of diet and various environmental stress factors in the world. Curcumin is a traditional medicine used for treatment of a wide variety of tumors. However, antimetastasis mechanism of curcumin on CRC has not yet been completely investigated. Here, we explored the underlying molecular mechanisms of curcumin on metastasis of CRC cells in vitro and in vivo. Curcumin significantly inhibits cell migration, invasion, and colony formation in vitro and reduces tumor growth and liver metastasis in vivo. We found that curcumin suppresses Sp-1 transcriptional activity and Sp-1 regulated genes including ADEM10, calmodulin, EPHB2, HDAC4, and SEPP1 in CRC cells. Curcumin inhibits focal adhesion kinase (FAK) phosphorylation and enhances the expressions of several extracellular matrix components which play a critical role in invasion and metastasis. Curcumin reduces CD24 expression in a dose-dependent manner in CRC cells. Moreover, E-cadherin expression is upregulated by curcumin and serves as an inhibitor of EMT. These results suggest that curcumin executes its antimetastasis function through downregulation of Sp-1, FAK, and CD24 and by promoting E-cadherin expression in CRC cells. PMID:23970932

  4. Curcumin Suppresses Metastasis via Sp-1, FAK Inhibition, and E-Cadherin Upregulation in Colorectal Cancer.

    PubMed

    Chen, Chun-Chieh; Sureshbabul, Munisamy; Chen, Huei-Wen; Lin, Yu-Shuang; Lee, Jen-Yi; Hong, Qi-Sheng; Yang, Ya-Chien; Yu, Sung-Liang

    2013-01-01

    Colorectal cancer (CRC) is a serious public health problem that results due to changes of diet and various environmental stress factors in the world. Curcumin is a traditional medicine used for treatment of a wide variety of tumors. However, antimetastasis mechanism of curcumin on CRC has not yet been completely investigated. Here, we explored the underlying molecular mechanisms of curcumin on metastasis of CRC cells in vitro and in vivo. Curcumin significantly inhibits cell migration, invasion, and colony formation in vitro and reduces tumor growth and liver metastasis in vivo. We found that curcumin suppresses Sp-1 transcriptional activity and Sp-1 regulated genes including ADEM10, calmodulin, EPHB2, HDAC4, and SEPP1 in CRC cells. Curcumin inhibits focal adhesion kinase (FAK) phosphorylation and enhances the expressions of several extracellular matrix components which play a critical role in invasion and metastasis. Curcumin reduces CD24 expression in a dose-dependent manner in CRC cells. Moreover, E-cadherin expression is upregulated by curcumin and serves as an inhibitor of EMT. These results suggest that curcumin executes its antimetastasis function through downregulation of Sp-1, FAK, and CD24 and by promoting E-cadherin expression in CRC cells. PMID:23970932

  5. Functional Interactions between C/EBP, Sp1, and COUP-TF Regulate Human Immunodeficiency Virus Type 1 Gene Transcription in Human Brain Cells

    PubMed Central

    Schwartz, Christian; Catez, Philippe; Rohr, Olivier; Lecestre, Dominique; Aunis, Dominique; Schaeffer, Evelyne

    2000-01-01

    Human immunodeficiency virus type 1 (HIV-1) infects the central nervous system (CNS) and plays a direct role in the pathogenesis of AIDS dementia. However, mechanisms underlying HIV-1 gene expression in the CNS are poorly understood. The importance of CCAAT/enhancer binding proteins (C/EBP) for HIV-1 expression in cells of the immune system has been recently reported. In this study, we have examined the role and the molecular mechanisms by which proteins of the C/EBP family regulate HIV-1 gene transcription in human brain cells. We found that NF-IL6 acts as a potent activator of the long terminal repeat (LTR)-driven transcription in microglial and oligodendroglioma cells. In contrast, C/EBPγ inhibits NF-IL6-induced activation. Consistent with previous data, our transient expression results show cell-type-specific NF-IL6-mediated transactivation. In glial cells, full activation needs the presence of the C/EBP binding sites; however, NF-IL6 is still able to function via the minimal −40/+80 region. In microglial cells, C/EBP sites are not essential, since NF-IL6 acts through the −68/+80 LTR region, containing two binding sites for the transcription factor Sp1. Moreover, we show that functional interactions between NF-IL6 and Sp1 lead to synergistic transcriptional activation of the LTR in oligodendroglioma and to mutual repression in microglial cells. We further demonstrate that NF-IL6 physically interacts with the nuclear receptor chicken ovalbumin upstream promoter transcription factor (COUP-TF), via its DNA binding domain, in vitro and in cells, which results in mutual transcriptional repression. These findings reveal how the interplay of NF-IL6 and C/EBPγ, together with Sp1 and COUP-TF, regulates HIV-1 gene transcription in brain cells. PMID:10590092

  6. Proto-oncogene FBI-1 represses transcription of p21CIP1 by inhibition of transcription activation by p53 and Sp1.

    PubMed

    Choi, Won-Il; Jeon, Bu-Nam; Yun, Chae-Ok; Kim, Pyung-Hwan; Kim, Sung-Eun; Choi, Kang-Yell; Kim, Se Hoon; Hur, Man-Wook

    2009-05-01

    Aberrant transcriptional repression through chromatin remodeling and histone deacetylation has been postulated as the driving force for tumorigenesis. FBI-1 (formerly called Pokemon) is a member of the POK family of transcriptional repressors. Recently, FBI-1 was characterized as a critical oncogenic factor that specifically represses transcription of the tumor suppressor gene ARF, potentially leading indirectly to p53 inactivation. Our investigations on transcriptional repression of the p53 pathway revealed that FBI-1 represses transcription of ARF, Hdm2 (human analogue of mouse double minute oncogene), and p21CIP1 (hereafter indicated as p21) but not of p53. FBI-1 showed a more potent repressive effect on p21 than on p53. Our data suggested that FBI-1 is a master controller of the ARF-Hdm2-p53-p21 pathway, ultimately impinging on cell cycle arrest factor p21, by inhibiting upstream regulators at the transcriptional and protein levels. FBI-1 acted as a competitive transcriptional repressor of p53 and Sp1 and was shown to bind the proximal Sp1-3 GC-box and the distal p53-responsive elements of p21. Repression involved direct binding competition of FBI-1 with Sp1 and p53. FBI-1 also interacted with corepressors, such as mSin3A, NCoR, and SMRT, thereby deacetylating Ac-H3 and Ac-H4 histones at the promoter. FBI-1 caused cellular transformation, promoted cell cycle proliferation, and significantly increased the number of cells in S phase. FBI-1 is aberrantly overexpressed in many human solid tumors, particularly in adenocarcinomas and squamous carcinomas. The role of FBI-1 as a master controller of the p53 pathway therefore makes it an attractive therapeutic target. PMID:19244234

  7. Proto-oncogene FBI-1 Represses Transcription of p21CIP1 by Inhibition of Transcription Activation by p53 and Sp1*S⃞

    PubMed Central

    Choi, Won-Il; Jeon, Bu-Nam; Yun, Chae-Ok; Kim, Pyung-Hwan; Kim, Sung-Eun; Choi, Kang-Yell; Kim, Se Hoon; Hur, Man-Wook

    2009-01-01

    Aberrant transcriptional repression through chromatin remodeling and histone deacetylation has been postulated as the driving force for tumorigenesis. FBI-1 (formerly called Pokemon) is a member of the POK family of transcriptional repressors. Recently, FBI-1 was characterized as a critical oncogenic factor that specifically represses transcription of the tumor suppressor gene ARF, potentially leading indirectly to p53 inactivation. Our investigations on transcriptional repression of the p53 pathway revealed that FBI-1 represses transcription of ARF, Hdm2 (human analogue of mouse double minute oncogene), and p21CIP1 (hereafter indicated as p21) but not of p53. FBI-1 showed a more potent repressive effect on p21 than on p53. Our data suggested that FBI-1 is a master controller of the ARF-Hdm2-p53-p21 pathway, ultimately impinging on cell cycle arrest factor p21, by inhibiting upstream regulators at the transcriptional and protein levels. FBI-1 acted as a competitive transcriptional repressor of p53 and Sp1 and was shown to bind the proximal Sp1–3 GC-box and the distal p53-responsive elements of p21. Repression involved direct binding competition of FBI-1 with Sp1 and p53. FBI-1 also interacted with corepressors, such as mSin3A, NCoR, and SMRT, thereby deacetylating Ac-H3 and Ac-H4 histones at the promoter. FBI-1 caused cellular transformation, promoted cell cycle proliferation, and significantly increased the number of cells in S phase. FBI-1 is aberrantly overexpressed in many human solid tumors, particularly in adenocarcinomas and squamous carcinomas. The role of FBI-1 as a master controller of the p53 pathway therefore makes it an attractive therapeutic target. PMID:19244234

  8. On the trajectories of Sp(1) -Kepler problems

    NASA Astrophysics Data System (ADS)

    Meng, Guowu

    2015-10-01

    The classical Sp(1) -Kepler problems are formulated with the help of an idea from S. Sternberg. The trajectories of these models are determined via an idea originated from Levi-Civita. It is found that, for a non-colliding trajectory, its shadow-its projection to the external configuration space-is an ellipse, a parabola or a branch of hyperbola according as the total energy is negative, zero or positive. Moreover, it is shown that, for the Sp(1) -Kepler problems at level n ≥ 2, the group SL(n, H) ×R+ acts transitively on both the set of elliptic shadow trajectories and the set of parabolic shadow trajectories.

  9. Lead poisoning and other mortality factors in trumpeter swans

    USGS Publications Warehouse

    Blus, L.J.; Stroud, R.K.; Reiswig, B.; McEneaney, T.

    1989-01-01

    Lead poisoning and other causes of mortality of trumpeter swans were investigated. Necropsies or Pb concentrations in livers were available for 72 trumpeter swans found dead in seven western states from 1976 to 1987; data from other published and unpublished sources also are summarized. Ingestion of lead artifacts accounted for about 20% of the known mortality of trumpeter swans in the tri-state area of Idaho, Montana and Wyoming, where the population has been declining for several decades.

  10. Factors affecting lead release in sodium silicate-treated partial lead service line replacements.

    PubMed

    Zhou, Emily; Payne, Sarah Jane O; Hofmann, Ron; Andrews, Robert C

    2015-01-01

    Water quality parameters affecting sodium silicate performance in partial lead service line replacements were examined using a fractional factorial experimental design and static pipe systems. An external copper wire was used to create a galvanic connection between a former lead service line and a new copper pipe. The pipe systems were filled with lab prepared water made to mimic real water quality. Water was changed on a three times per week basis. A 2(4-1) fractional factorial design was used to evaluate the impact of alkalinity (15 mg L(-1) or 250 mg L(-1) as CaCO3), nitrate (1 mg L(-1) or 7 mg L(-1) as N), natural organic matter (1 mg L(-1) or 7 mg L(-1) as dissolved organic carbon), and disinfectant type (1 mg L(-1) chlorine or 3 mg L(-1) monochloramine), resulting in eight treatment conditions. Fractional factorial analysis revealed that alkalinity, natural organic matter and monochloramine had a significant positive effect on galvanic current. Natural organic matter and monochloramine also had a significant positive effect with respect to both total and dissolved lead release. For the treatment conditions examined, 67-98% of the lead released through galvanic currents was stored as corrosion scales and predominantly comprised of particulate lead (96.1-99.9%) for all eight treatments. The use of monochloramine and the presence of natural organic matter (7 mg L(-1)) were not favourable for corrosion control in sodium silicate-treated partial lead service line replacements, although further studies would be required to characterize optimal water quality parameters for specific water quality types. For utilities operating with sodium silicate as a corrosion inhibitor, this work offers further evidence regarding the consideration of chlorine as a secondary disinfectant instead of monochloramine, as well as the value of controlling natural organic matter in distributed water. PMID:26061205

  11. Synthetic retinoid Am80 up-regulates apelin expression by promoting interaction of RARα with KLF5 and Sp1 in vascular smooth muscle cells.

    PubMed

    Lv, Xin-Rui; Zheng, Bin; Li, Shu-Ya; Han, Ai-Li; Wang, Chang; Shi, Jian-Hong; Zhang, Xin-Hua; Liu, Yan; Li, Yong-Hui; Wen, Jin-Kun

    2013-11-15

    Previous studies have demonstrated that both retinoids and apelin possess potent cardiovascular properties and that retinoids can mediate the expression of many genes in the cardiovascular system. However, it is not clear whether and how retinoids regulate apelin expression in rat VSMCs (vascular smooth muscle cells). In the present study, we investigated the molecular mechanism of apelin expression regulation by the synthetic retinoid Am80 in VSMCs. The results showed that Am80 markedly up-regulated apelin mRNA and protein levels in VSMCs. Furthermore, KLF5 (Krüppel-like factor 5) and Sp1 (stimulating protein-1) co-operatively mediated Am80-induced apelin expression through their direct binding to the TCE (transforming growth factor-β control element) on the apelin promoter. Interestingly, upon Am80 stimulation, the RARα (retinoic acid receptor α) was recruited to the apelin promoter by interacting with KLF5 and Sp1 prebound to the TCE site of the apelin promoter to form a transcriptional activation complex, subsequently leading to the up-regulation of apelin expression in VSMCs. An in vivo study indicated that Am80 increased apelin expression in balloon-injured arteries of rats, consistent with the results from the cultured VSMCs. Thus the results of the present study describe a novel mechanism of apelin regulation by Am80 and further expand the network of RARα in the retinoid pathway. PMID:23992409

  12. Factors Leading to Students' Satisfaction in the Higher Learning Institutions

    ERIC Educational Resources Information Center

    Siming, Luo; Niamatullah; Gao, Jianying; Xu, Dan; Shaf, Khurrum

    2015-01-01

    There is an increasing need to understand factors that affect satisfaction of students with learning. This study will explore the relationship between student satisfaction and teacher-student relationship, teacher preparedness, campus support facilities and experiences provided by the institute to the students. Study is a necessary activity that…

  13. Blood lead levels and risk factors for lead toxicity in children from schools and an urban slum in Delhi.

    PubMed

    Kalra, Veena; Chitralekha, K T; Dua, Tarun; Pandey, R M; Gupta, Yogesh

    2003-04-01

    This cross-sectional study was conducted to estimate the mean blood lead levels (BLL) and prevalence of lead toxicity in a representative sample of schoolchildren and children residing in an urban slum. In addition, the association of potential environmental risk factors with elevated BLL was studied. Children aged 4-6 years were selected from schools of the South zone of Delhi (n = 125) and from an urban slum (n = 65). Risk factors were recorded using a pre-tested questionnaire and blood lead and zinc protoporphyrin (ZPP) levels were estimated. The mean BLL was 7.8 microg/dl (SD 3.9) and the proportion of children with blood lead > or = 10 microg/dl was 18.4 per cent. Distance of the residence or school from a main road appeared to be associated with higher blood lead concentrations, but these differences were not statistically significant. In our setting, vehicular pollution may be a major contributing factor in lead contamination of the environment. PMID:12729296

  14. Impact of developmental lead exposure on splenic factors

    SciTech Connect

    Kasten-Jolly, Jane; Heo, Yong; Lawrence, David A.

    2010-09-01

    Lead (Pb) is known to alter the functions of numerous organ systems, including the hematopoietic and immune systems. Pb can induce anemia and can lower host resistance to bacterial and viral infections. The anemia is due to Pb's inhibition of hemoglobin synthesis and Pb's induction of membrane changes, leading to early erythrocyte senescence. Pb also increases B-cell activation/proliferation and skews T-cell help (Th) toward Th2 subset generation. The specific mechanisms for many of the Pb effects are, as yet, not completely understood. Therefore, we performed gene expression analysis, via microarray, on RNA from the spleens of developmentally Pb-exposed mice, in order to gain further insight into these Pb effects. Splenic RNA microarray analysis indicated strong up-regulation of genes coding for proteolytic enzymes, lipases, amylase, and RNaseA. The data also showed that Pb affected the expression of many genes associated with innate immunity. Analysis of the microarray results via GeneSifter software indicated that Pb increased apoptosis, B-cell differentiation, and Th2 development. Direct up-regulation by Pb of expression of the gene encoding the heme-regulated inhibitor (HRI) suggested that Pb can decrease erythropoiesis by blocking globin mRNA translation. Pb's high elevation of digestive/catabolizing enzymes could generate immunogenic self peptides. With Pb's potential to induce new self-peptides and to enhance the expression of caspases, cytokines, and other immunomodulators, further evaluation of Pb's involvement in autoimmune phenomena, especially Th2-mediated autoantibody production, and alteration of organ system activities is warranted.

  15. Investigation and Evaluation of Children’s Blood Lead Levels around a Lead Battery Factory and Influencing Factors

    PubMed Central

    Zhang, Feng; Liu, Yang; Zhang, Hengdong; Ban, Yonghong; Wang, Jianfeng; Liu, Jian; Zhong, Lixing; Chen, Xianwen; Zhu, Baoli

    2016-01-01

    Lead pollution incidents have occurred frequently in mainland China, which has caused many lead poisoning incidents. This paper took a battery recycling factory as the subject, and focused on measuring the blood lead levels of environmental samples and all the children living around the factory, and analyzed the relationship between them. We collected blood samples from the surrounding residential area, as well as soil, water, vegetables. The atomic absorption method was applied to measure the lead content in these samples. The basic information of the generation procedure, operation type, habit and personal protect equipment was collected by an occupational hygiene investigation. Blood lead levels in 43.12% of the subjects exceeded 100 μg/L. The 50th and the 95th percentiles were 89 μg/L and 232 μg/L for blood lead levels in children, respectively, and the geometric mean was 94 μg/L. Children were stratified into groups by age, gender, parents’ occupation, distance and direction from the recycling plant. The difference of blood lead levels between groups was significant (p < 0.05). Four risk factors for elevated blood lead levels were found by logistic regression analysis, including younger age, male, shorter distance from the recycling plant, and parents with at least one working in the recycling plant. The rate of excess lead concentration in water was 6.25%, 6.06% in soil and 44.44% in leaf vegetables, which were all higher than the Chinese environment standards. The shorter the distance to the factory, the higher the value of BLL and lead levels in vegetable and environment samples. The lead level in the environmental samples was higher downwind of the recycling plant. PMID:27240393

  16. Mortality factors and lead contamination of wild birds from Korea.

    PubMed

    Nam, Dong-Ha; Lee, Doo-Pyo

    2011-07-01

    Wild birds have frequently been found dead in their natural habitats, but little is known about what ecological stressors may impact health of wild populations. Here, we report the potentially harmful lead (Pb) levels in tissues along with necropsies on 69 individuals of cranes, raptors, and waterfowl found dead between 2000 and 2003 in Korea. In all samples diagnosed, trauma (n = 22), severe emaciation (n = 15), and infectious diseases (n = 11) were identified. In the survey, injury with Pb shot or bullet fragments was associated with three of the deaths; one of three showed lesions suggestive of Pb poisoning in the tissues. Of 69 birds, 12 had >25 ppm dry wt. (equivalent to 8 ppm wet wt.) in liver or kidney, which is known to be a potentially lethal level of Pb in wild birds. Three individuals had hepatic Pb levels of 101.3 ppm (Whooper swan), 120.4 ppm (Great white-fronted goose), and 1,059 ppm (Mandarin duck), with evidence of Pb pellets in their gizzard. This study suggests that many birds examined may be suffering from excessive Pb exposure that may be of health concern with respect to a potential cause of their mortality. The need for additional research is heightened when considering that some migrants are classified as a globally protected species by the International Union for the Conservation of Nature. PMID:20824331

  17. Methylation Status of SP1 Sites within miR-23a-27a-24-2 Promoter Region Influences Laryngeal Cancer Cell Proliferation and Apoptosis

    PubMed Central

    Wang, Ye; Zhang, Zhao-Xiong; Chen, Sheng; Qiu, Guang-Bin; Xu, Zhen-Ming

    2016-01-01

    DNA methylation plays critical roles in regulation of microRNA expression and function. miR-23a-27a-24-2 cluster has various functions and aberrant expression of the cluster is a common event in many cancers. However, whether DNA methylation influences the cluster expression and function is not reported. Here we found a CG-rich region spanning two SP1 sites in the cluster promoter region. The SP1 sites in the cluster were demethylated and methylated in Hep2 cells and HEK293 cells, respectively. Meanwhile, the cluster was significantly upregulated and downregulated in Hep2 cells and HEK293 cells, respectively. The SP1 sites were remethylated and the cluster was significantly downregulated in Hep2 cells into which methyl donor, S-adenosyl-L-methionine, was introduced. Moreover, S-adenosyl-L-methionine significantly increased Hep2 cell viability and repressed Hep2 cell early apoptosis. We also found that construct with two SP1 sites had highest luciferase activity and SP1 specifically bound the gene cluster promoter in vitro. We conclude that demethylated SP1 sites in miR-23a-27a-24-2 cluster upregulate the cluster expression, leading to proliferation promotion and early apoptosis inhibition in laryngeal cancer cells. PMID:27099864

  18. Life Cycle Reversal in Aurelia sp.1 (Cnidaria, Scyphozoa)

    PubMed Central

    He, Jinru; Zheng, Lianming; Zhang, Wenjing; Lin, Yuanshao

    2015-01-01

    The genus Aurelia is one of the major contributors to jellyfish blooms in coastal waters, possibly due in part to hydroclimatic and anthropogenic causes, as well as their highly adaptive reproductive traits. Despite the wide plasticity of cnidarian life cycles, especially those recognized in certain Hydroza species, the known modifications of Aurelia life history were mostly restricted to its polyp stage. In this study, we document the formation of polyps directly from the ectoderm of degenerating juvenile medusae, cell masses from medusa tissue fragments, and subumbrella of living medusae. This is the first evidence for back-transformation of sexually mature medusae into polyps in Aurelia sp.1. The resulting reconstruction of the schematic life cycle of Aurelia reveals the underestimated potential of life cycle reversal in scyphozoan medusae, with possible implications for biological and ecological studies. PMID:26690755

  19. SENP3 regulates the global protein turnover and the Sp1 level via antagonizing SUMO2/3-targeted ubiquitination and degradation.

    PubMed

    Wang, Ming; Sang, Jing; Ren, Yanhua; Liu, Kejia; Liu, Xinyi; Zhang, Jian; Wang, Haolu; Wang, Jian; Orian, Amir; Yang, Jie; Yi, Jing

    2016-01-01

    SUMOylation is recently found to function as a targeting signal for the degradation of substrates through the ubiquitin-proteasome system. RNF4 is the most studied human SUMO-targeted ubiquitin E3 ligase. However, the relationship between SUMO proteases, SENPs, and RNF4 remains obscure. There are limited examples of the SENP regulation of SUMO2/3-targeted proteolysis mediated by RNF4. The present study investigated the role of SENP3 in the global protein turnover related to SUMO2/3-targeted ubiquitination and focused in particular on the SENP3 regulation of the stability of Sp1. Our data demonstrated that SENP3 impaired the global ubiquitination profile and promoted the accumulation of many proteins. Sp1, a cancer-associated transcription factor, was among these proteins. SENP3 increased the level of Sp1 protein via antagonizing the SUMO2/3-targeted ubiquitination and the consequent proteasome-dependent degradation that was mediated by RNF4. De-conjugation of SUMO2/3 by SENP3 attenuated the interaction of Sp1 with RNF4. In gastric cancer cell lines and specimens derived from patients and nude mice, the level of Sp1 was generally increased in parallel to the level of SENP3. These results provided a new explanation for the enrichment of the Sp1 protein in various cancers, and revealed a regulation of SUMO2/3 conjugated proteins whose levels may be tightly controlled by SENP3 and RNF4. PMID:26511642

  20. Sp1/3 and NF-1 mediate basal transcription of the human P2X1 gene in megakaryoblastic MEG-01 cells

    PubMed Central

    Zhao, Jiangqin; Ennion, Steven J

    2006-01-01

    Background P2X1 receptors play an important role in platelet function as they can induce shape change, granule centralization and are also involved in thrombus formation. As platelets have no nuclei, the level of P2X1 expression depends on transcriptional regulation in megakaryocytes, the platelet precursor cell. Since nothing is known about the molecular mechanisms regulating megakaryocytic P2X1 expression, this study aimed to identify and functionally characterize the P2X1 core promoter utilized in the human megakaryoblastic cell line MEG-01. Results In order to identify cis-acting elements involved in the transcriptional regulation of P2X1 expression, the ability of 4.7 kb P2X1 upstream sequence to drive luciferase reporter gene expression was tested. Low promoter activity was detected in proliferating MEG-01 cells. This activity increased 20-fold after phorbol-12-myristate-13-acetate (PMA) induced differentiation. A transcription start site was detected 365 bp upstream of the start codon by primer extension. Deletion analysis of reporter constructs indicated a core promoter located within the region -68 to +149 bp that contained two Sp1 sites (named Sp1a and Sp1b) and an NF-1 site. Individual mutations of Sp1b or NF-1 binding sites severely reduced promoter activity whereas triple mutation of Sp1a, Sp1b and NF-1 sites completely abolished promoter activity in both untreated and PMA treated cells. Sp1/3 and NF-1 proteins were shown to bind their respective sites by EMSA and interaction of Sp1/3, NF-1 and TFIIB with the endogenous P2X1 core promoter in MEG-01 cells was demonstrated by chromatin immunoprecipitation. Alignment of P2X1 genes from human, chimp, rat, mouse and dog revealed consensus Sp1a, Sp1b and NF-1 binding sites in equivalent positions thereby demonstrating evolutionary conservation of these functionally important sites. Conclusion This study has identified and characterized the P2X1 promoter utilized in MEG-01 cells and shown that binding of Sp1

  1. Betulinic acid decreases specificity protein 1 (Sp1) level via increasing the sumoylation of sp1 to inhibit lung cancer growth.

    PubMed

    Hsu, Tsung-I; Wang, Mei-Chun; Chen, Szu-Yu; Huang, Shih-Ting; Yeh, Yu-Min; Su, Wu-Chou; Chang, Wen-Chang; Hung, Jan-Jong

    2012-12-01

    Previous studies have shown that the inhibitory effect of betulinic acid (BA) on specificity protein 1 (Sp1) expression is involved in the prevention of cancer progression, but the mechanism of this effect remains to be delineated. In this study, we determined that BA treatment in HeLa cells increased the sumoylation of Sp1 by inhibiting sentrin-specific protease 1 expression. The subsequent recruitment of E3 ubiquitin-protein ligase RING finger protein 4 resulted in ubiquitin-mediated degradation in a 26S-proteosome-dependent pathway. In addition, both BA treatment and mithramycin A (MMA) treatment inhibited lung tumor growth and down-regulated Sp1 protein expression in Kras(G12D)-induced lung cancers of bitransgenic mice. In gene expression profiles of Kras(G12D)-induced lung cancers in bitransgenic mice with and without Sp1 inhibition, 542 genes were affected by MMA treatment. One of the gene products, cyclin A2, which was involved in the S and G(2)/M phase transition during cell cycle progression, was investigated in detail because its expression was regulated by Sp1. The down-regulation of cyclin A2 by BA treatment resulted in decreased retinoblastoma protein phosphorylation and cell cycle G(2)/M arrest. The BA-mediated cellular Sp1 degradation and antitumor effect were also confirmed in a xenograft mouse model by using H1299 cells. The knockdown of Sp1 in lung cancer cells attenuated the tumor-suppressive effect of BA. Taken together, the results of this study clarify the mechanism of BA-mediated Sp1 degradation and identify a pivotal role for Sp1 in the BA-induced repression of lung cancer growth. PMID:22956772

  2. The Influence of Declining Air Lead Levels on Blood Lead–Air Lead Slope Factors in Children

    PubMed Central

    Richmond-Bryant, Jennifer; Davis, Allen; Cohen, Jonathan; Lu, Shou-En; Svendsgaard, David; Brown, James S.; Tuttle, Lauren; Hubbard, Heidi; Rice, Joann; Kirrane, Ellen; Vinikoor-Imler, Lisa C.; Kotchmar, Dennis; Hines, Erin P.; Ross, Mary

    2014-01-01

    Background: It is difficult to discern the proportion of blood lead (PbB) attributable to ambient air lead (PbA), given the multitude of lead (Pb) sources and pathways of exposure. The PbB–PbA relationship has previously been evaluated across populations. This relationship was a central consideration in the 2008 review of the Pb national ambient air quality standards. Objectives: The objectives of this study were to evaluate the relationship between PbB and PbA concentrations among children nationwide for recent years and to compare the relationship with those obtained from other studies in the literature. Methods: We merged participant-level data for PbB from the National Health and Nutrition Examination Survey (NHANES) III (1988–1994) and NHANES 9908 (1999–2008) with PbA data from the U.S. Environmental Protection Agency. We applied mixed-effects models, and we computed slope factor, d[PbB]/d[PbA] or the change in PbB per unit change in PbA, from the model results to assess the relationship between PbB and PbA. Results: Comparing the NHANES regression results with those from the literature shows that slope factor increased with decreasing PbA among children 0–11 years of age. Conclusion: These findings suggest that a larger relative public health benefit may be derived among children from decreases in PbA at low PbA exposures. Simultaneous declines in Pb from other sources, changes in PbA sampling uncertainties over time largely related to changes in the size distribution of Pb-bearing particulate matter, and limitations regarding sampling size and exposure error may contribute to the variability in slope factor observed across peer-reviewed studies. Citation: Richmond-Bryant J, Meng Q, Davis A, Cohen J, Lu SE, Svendsgaard D, Brown JS, Tuttle L, Hubbard H, Rice J, Kirrane E, Vinikoor-Imler LC, Kotchmar D, Hines EP, Ross M. 2014. The Influence of declining air lead levels on blood lead–air lead slope factors in children. Environ Health Perspect 122:754

  3. SP1 and USF differentially regulate ADAMTS1 gene expression under normoxic and hypoxic conditions in hepatoma cells.

    PubMed

    Turkoglu, Sumeyye Aydogan; Kockar, Feray

    2016-01-01

    ADAM metallopeptidase with thrombospondin type I motif, 1 (ADAMTS1) that has both antiangiogenic and aggrecanase activity was dysregulated in many pathophysiologic circumstances. However, there is limited information available on the transcriptional regulation of ADAMTS1 gene. Therefore, this study mainly aimed to identify regulatory regions important for the regulation of ADAMTS1 gene under normoxic and hypoxic conditions in human hepatoma cells (HEP3B). Cultured HEP3B cells were exposed to normal oxygen condition, and Cobalt chloride (CoCl2) induced the hypoxic condition, which is an HIF-1 inducer. The cocl2-induced hypoxic condition led to the induced ADAMTS1 mRNA and protein expression in Hepatoma cells. Differential regulation of SP1 and USF transcription factors on ADAMTS1 gene expression was determined by transcriptional activity, mRNA and protein level of ADAMTS1 gene. Ectopic expression of SP1 and USF transcription factors resulted in the decrease in ADAMTS1 transcriptional activity of all promoter constructs consistent with mRNA and protein level in normoxic condition. However, overexpression of SP1 and USF led to the increase of ADAMTS1 gene expressions at mRNA and protein level in hypoxic condition. On the other hand, C/EBPα transcription factor didn't show any statistically significant effect on ADAMTS1 gene expression at mRNA, protein and transcriptional level under normoxic and hypoxic condition. PMID:26299656

  4. miRNA-223 inhibits epithelial-mesenchymal transition in gastric carcinoma cells via Sp1.

    PubMed

    Hu, Jing; Shan, Zhiyan; Hu, Kewei; Ren, Fengyun; Zhang, Wei; Han, Meiling; Li, Yuezhen; Feng, Kejian; Lei, Lei; Feng, Yukuan

    2016-07-01

    Sp1 plays critical roles in epithelial-mesenchymal transition (EMT) of certain cancer. However, few studies have indicated whether Sp1 is involved in the EMT of gastric cancer, and whether abnormal expression of Sp1 in gastric cancer EMT is regulated in a post-transcriptional manner, and the involvement of miRNAs in this regulation. In this study, we selected 20 cases of gastric cancers, their liver metastases and para-carcinoma tissues to examine the levels of Sp1 protein and mRNA by immunohistochemistry and fluorescent PCR, which showed that Sp1 was increased in gastric cancers and their metastases compared with adjacent tissues, but there was no difference in Sp1 mRNA between these three groups, suggesting changes in Sp1 may be attributed to inactivation of post-transcriptional regulation. We verified by a luciferase reporter system that miRNA-223 binds to 3'-UTR of Sp1 gene and inhibits its translation, in agreement with negative correlation between miRNA-223 and Sp1 protein levels in gastric cancer cells. By employing TGF-β1 to induce MGC-803, BGC-823 and SGC-7901, we successfully built cellular EMT model. Then, we overexpressed miRNA-223 in the model by using a lentiviral system, which diminished EMT indicators and suppressed proliferation and invasion ability, and induced apoptosis. Finally, we verified the specificity of the regulation pathway miRNA-223/Sp1/EMT. These findings suggest that low expression of miRNA-223 in gastric cancer cells is an important cause for EMT. miRNA-223 specifically regulates the EMT process of gastric cancer cells through its target gene Sp1. Overexpression of miRNA-223 in these cells inhibits EMT via the miRNA-223/Sp1/EMT pathway. PMID:27212195

  5. First functional polymorphism in CFTR promoter that results in decreased transcriptional activity and Sp1/USF binding

    SciTech Connect

    Taulan, M. Lopez, E.; Guittard, C.; Rene, C.; Baux, D.; Altieri, J.P.; DesGeorges, M.; Claustres, M.; Romey, M.C.

    2007-09-28

    Growing evidences show that functionally relevant polymorphisms in various promoters alter both transcriptional activity and affinities of existing protein-DNA interactions, and thus influence disease progression in humans. We previously reported the -94G>T CFTR promoter variant in a female CF patient in whom any known disease-causing mutation has been detected. To investigate whether the -94G>T could be a regulatory variant, we have proceeded to in silico analyses and functional studies including EMSA and reporter gene assays. Our data indicate that the promoter variant decreases basal CFTR transcriptional activity in different epithelial cells and alters binding affinities of both Sp1 and USF nuclear proteins to the CFTR promoter. The present report provides evidence for the first functional polymorphism that negatively affects the CFTR transcriptional activity and demonstrates a cooperative role of Sp1 and USF transcription factors in transactivation of the CFTR gene promoter.

  6. Photon impact factor and k{sub T}-factorization for DIS in the next-to-leading order

    SciTech Connect

    Ian Balitsky, Giovanni Chirilli

    2013-01-01

    The photon impact factor for the BFKL pomeron is calculated in the next-to-leading order (NLO) approximation using the operator expansion in Wilson lines. The result is represented as an NLO k{sub T}-factorization formula for structure functions of small-x deep inelastic scattering.

  7. Chromatin, TAFs, and a novel multiprotein coactivator are required for synergistic activation by Sp1 and SREBP-1a in vitro.

    PubMed

    Näär, A M; Beaurang, P A; Robinson, K M; Oliner, J D; Avizonis, D; Scheek, S; Zwicker, J; Kadonaga, J T; Tjian, R

    1998-10-01

    The promoter selectivity factor Sp1 often cooperates with other enhancer-binding proteins to activate transcription. To study the molecular underpinnings of these regulatory events, we have reconstituted in vitro the synergy observed in vivo between Sp1 and the sterol-regulated factor SREBP-1a at the low density lipoprotein receptor (LDLR) promoter. Using a highly purified human transcription system, we found that chromatin, TAFs, and a novel SREBP-binding coactivator activity, which includes CBP, are all required to mediate full synergistic activation by Sp1 and SREBP-1a. The SREBP-binding domain of CBP inhibits activation by SREBP-1a and Sp1 in a dominant-negative fashion that is both chromatin- and activator-specific. Whereas recombinant CBP alone is not sufficient to mediate activation, a human cellular fraction containing CBP can support high levels of chromatin-dependent synergistic activation. Purification of this activity to near homogeneity resulted in the identification of a multiprotein coactivator, including CBP, that selectively binds to the SREBP-1a activation domain and is capable of mediating high levels of synergistic activation by SREBP/Sp1 on chromatin templates. The development of a reconstituted chromatin transcription system has allowed us to isolate a novel coactivator that is recruited by the SREBP-1a activation domain and that functions in concert with TFIID to coordinate the action of multiple activators at complex promoters in the context of chromatin. PMID:9765204

  8. Increased Expression of Colonic Wnt9A through Sp1-mediated Transcriptional Effects involving Arylsulfatase B, Chondroitin 4-Sulfate, and Galectin-3

    PubMed Central

    Bhattacharyya, Sumit; Feferman, Leo; Tobacman, Joanne K.

    2014-01-01

    In cultured human colonic epithelial cells and mouse colonic tissue, exposure to the common food additive carrageenan leads to inflammation, activation of Wnt signaling, increased Wnt9A expression, and decline in the activity of the enzyme arylsulfatase B (ARSB; N-acetylgalactosamine-4-sulfatase). In this study, the novel transcriptional mechanism by which carrageenan and decline in ARSB increase Wnt9A expression in NCM460 and HT-29 human colonic epithelial cells and in mouse colon is presented. Increased expression of Wnt9A has been associated with multiple malignancies, including colon carcinoma, and with ectodermal and mesoendodermal morphogenesis. When ARSB activity was reduced by siRNA or by exposure to carrageenan (1 μg/ml for 24 h), degradation of chondroitin 4-sulfate (C4S) was inhibited, leading to accumulation of more highly sulfated C4S, which binds less galectin-3, a β-galactoside-binding protein. Nuclear galectin-3 increased and mediated increased binding of Sp1 to the Sp1 consensus sequence in the Wnt9A promoter, shown by oligonucleotide-binding assay and by chromatin immunoprecipitation assay. When galectin-3 was silenced, the increases in Sp1 binding to the Wnt9A promoter and in Wnt9A expression, which followed carrageenan or ARSB silencing, were inhibited. Mithramycin A, a specific inhibitor of Sp1 oligonucleotide binding, and Sp1 siRNA blocked the carrageenan- and ARSB siRNA-induced increases in Wnt9A expression. These studies reveal how carrageenan exposure can lead to transcriptional events in colonic epithelial cells through decline in arylsulfatase B activity, with subsequent impact on C4S, galectin-3, Sp1, and Wnt9A and can exert significant effects on Wnt-initiated signaling and related vital cell processes. PMID:24778176

  9. SP1-binding elements, within the common metaxin-thrombospondin 3 intergenic region, participate in the regulation of the metaxin gene.

    PubMed Central

    Collins, M; Bornstein, P

    1996-01-01

    Metaxin (Mtx) is an essential nuclear gene which is expressed ubiquitously in mice and encodes a mitochondrial protein. The gene is located upstream and is transcribed divergently from the thrombospondin 3 (Thbs3) gene; 1352 nucleotides separate the putative translation start sites. Although the Mtx and Thbs3 genes share a common intergenic region, transient transfection experiments in rat chondro-sarcoma cells and in NIH-3T3 fibroblasts demonstrated that the elements required for expression of the Mtx gene are situated within a short proximal promoter and have no major effect on the transcription of Thbs3. The metaxin --377 bp promoter contains four clustered GC boxes between nucleotides --146 and --58 and an inverted GT box between nucleotides --152 and --161, but does not contain TATA or CCAAT boxes. Like many genes regulated by a TATA-less promoter, the transcription start site of metaxin is heterogeneous. The major start site is only 13 bp upstream from the putative translation start site. Electrophoretic mobility shift, competition and supershift assays showed that the ubiquitous transcription factor, Sp1, and, to a lesser extent, the Sp1-related protein, Sp3, bind to four of these Sp1-binding motifs. Co-transfection of metaxin promoter-luciferase constructs and an Sp1 expression vector into Schneider Drosophila cells, which do not synthesize Sp1, demonstrated that the metaxin gene is activated by Sp1. Deletion of the four upstream Sp1-binding elements, on the other hand, demonstrated that these motifs are superfluous in context of the larger Mtx promoter. Thus, despite the potential for common regulatory mechanisms, the available evidence indicates that the Mtx minimal promoter does not significantly affect Thbs3 gene expression. PMID:8871542

  10. Progesterone induces expression of the prolactin receptor gene through cooperative action of Sp1 and C/EBP

    PubMed Central

    Goldhar, Anita S.; Duan, Renqin; Ginsburg, Erika; Vonderhaar, Barbara K.

    2011-01-01

    Prolactin (Prl) and progesterone (P) cooperate synergistically during mammary gland development and tumorigenesis. We hypothesized that one mechanism for these effects may be through mutual induction of receptors (R). EpH4 mouse mammary epithelial cells stably transfected with PR-A express elevated levels of PrlR mRNA and protein compared to control EpH4 cells that lack the PR. Likewise, T47D human breast cancer cells treated with P overexpress the PrlR and activate PrlR promoter III. PrlR promoter III does not contain a classical P response element but contains several binding sites for transcription proteins, including C/EBP, Sp1 and AP1, which may also interact with the PR. Using promoter deletion and site directed mutagenesis analyses as well as gel shift assays, cooperative activation of the C/EBP and adjacent Sp1A, but not the Sp1B or AP1, sites by P is shown to confer P responsiveness leading to increased PrlR transcription. PMID:21238538

  11. Down-regulation of EPHX2 gene transcription by Sp1 under high-glucose conditions.

    PubMed

    Oguro, Ami; Oida, Shoko; Imaoka, Susumu

    2015-09-15

    sEH (soluble epoxide hydrolase), which is encoded by the EPHX2 gene, regulates the actions of bioactive lipids, EETs (epoxyeicosatrienoic acids). Previously, we found that high-glucose-induced oxidative stress suppressed sEH levels in a hepatocarcinoma cell line (Hep3B) and sEH was decreased in streptozotocin-induced diabetic mice in vivo. In the present study, we investigated the regulatory mechanisms underlying EPHX2 transcriptional suppression under high-glucose conditions. The decrease in sEH was prevented by an Sp1 (specificity protein 1) inhibitor, mithramycin A, and overexpression or knockdown of Sp1 revealed that Sp1 suppressively regulated sEH expression, in contrast with the general role of Sp1 on transcriptional activation. In addition, we found that AP2α (activating protein 2α) promoted EPHX2 transcription. The nuclear transport of Sp1, but not that of AP2α, was increased under high glucose concomitantly with the decrease in sEH. Within the EPHX2 promoter -56/+32, five Sp1-binding sites were identified, and the mutation of each of these sites showed that the first one (SP1_1) was important in both suppression by Sp1 and activation by AP2α. Furthermore, overexpression of Sp1 diminished the binding of AP2α by DNA-affinity precipitation assay and ChIP, suggesting competition between Sp1 and AP2α on the EPHX2 promoter. These findings provide novel insights into the role of Sp1 in transcriptional suppression, which may be applicable to the transcriptional regulation of other genes. PMID:26341485

  12. PERSONAL AND ENVIRONMENTAL RISK FACTORS SIGNIFICANTLY ASSOCIATED WITH ELEVATED BLOOD LEAD LEVELS IN RURAL THAI CHILDREN.

    PubMed

    Swaddiwudhipong, Witaya; Kavinum, Suporn; Papwijitsil, Ratchadaporn; Tontiwattanasap, Worawit; Khunyotying, Wanlee; Umpan, Jiraporn; BoonthuM, Ratchaneekorn; Kaewnate, Yingyot; Boonmee, Sasis; Thongchub, Winai; Rodsung, Thassanee

    2014-11-01

    A community-based study was conducted to determine personal risk factors and environmental sources of lead exposure for elevated blood lead levels (≥ 10 µg/dl, EBLLs) among rural children living at the Thailand-Myanmar border in Tak Province, northwestern Thailand. Six hundred ninety-five children aged 1-14 years old were screened for BLLs. Environmental specimens for lead measurements included samples of water from the streams, taps, and household containers, house floor dust, and foods. Possible lead release from the cooking ware was determined using the leaching method with acetic acid. The overall prevalence of EBLLs was 47.1% and the geometric mean level of blood lead was 9.16 µg/dl. Personal risk factors significantly associated with EBLLs included being male, younger age, anemia, and low weight-for-age. Significant environmental risk factors were exposure to a lead-acid battery of solar energy system and use of a non-certified metal cooking pot. Some families whose children had high BLLs reported production of lead bullets from the used batteries at home. About one-third of the house dust samples taken near batteries contained lead content above the recommended value, compared with none of those taken from other areas and from the houses with no batteries. The metal pots were safe for cooking rice but might be unsafe for acidic food preparation. Both nutritional intervention and lead exposure prevention programs are essential to reduce EBLLs in this population. PMID:26466436

  13. Lead in New York City Community Garden Chicken Eggs: Influential Factors and Health Implications

    PubMed Central

    Spliethoff, Henry M.; Mitchell, Rebecca G.; Ribaudo, Lisa N.; Taylor, Owen; Shayler, Hannah A.; Greene, Virginia; Oglesby, Debra

    2014-01-01

    Raising chickens for eggs in urban areas is becoming increasingly common. Urban chickens may be exposed to lead, a common urban soil contaminant. We measured lead concentrations in chicken eggs from New York City (NYC) community gardens and collected information on factors that might affect those concentrations. Lead was detected between 10 and 167 μg/kg in 48% of NYC eggs. Measures of lead in eggs from a henhouse were significantly associated (p<0.005) with lead concentrations in soil. The association between soil and egg lead has been evaluated only once before, by a study of a rural region in Belgium. In our study, the apparent lead soil-to-egg transfer efficiency was considerably lower than that found in Belgium, suggesting that there may be important geographic differences in this transfer. We developed models that suggested that, for sites like ours, lead concentrations in >50% of eggs from a henhouse would exceed store-bought egg concentrations (<7–13 μg/kg; 3% above detection limit) at soil lead concentrations >120 mg/kg, and that the concentration in one of six eggs from a henhouse would exceed a 100 μg/kg guidance value at soil lead concentrations >410 mg/kg. Our models also suggested that the availability of dietary calcium supplements was another influential factor that reduced egg lead concentrations. Estimates of health risk from consuming eggs with the lead concentrations we measured generally were not significant. However, soil lead concentrations in this study were <600 mg/kg, and considerably higher concentrations are not uncommon. Efforts to reduce lead transfer to chicken eggs and associated exposure are recommended for urban chicken keepers. PMID:24287691

  14. Factors Leading to Success in Diversified Occupation: A Livelihood Analysis in India

    ERIC Educational Resources Information Center

    Saha, Biswarup; Bahal, Ram

    2015-01-01

    Purpose: Livelihood diversification is a sound alternative for higher economic growth and its success or failure is conditioned by the interplay of a multitude of factors. The study of the profile of the farmers in which they operate is important to highlight the factors leading to success in diversified livelihoods. Design/Methodology/Approach: A…

  15. Benchmarking Potential Factors Leading to Education Quality: A Study of Cambodian Higher Education

    ERIC Educational Resources Information Center

    Chen, Ching-Yaw; Sok, Phyra; Sok, Keomony

    2007-01-01

    Purpose: To study the quality in higher education in Cambodia and explore the potential factors leading to quality in Cambodian higher education. Design/methodology/approach: Five main factors that were deemed relevant in providing quality in Cambodian higher education were proposed: academic curriculum and extra-curricular activities, teachers'…

  16. Genome Sequence of the Microsporidian Species Nematocida sp1 Strain ERTm6 (ATCC PRA-372)

    PubMed Central

    Bakowski, Malina A.; Priest, Margaret; Young, Sarah

    2014-01-01

    Microsporidia comprise a phylum of obligate intracellular pathogens related to fungi. Microsporidia Nematocida sp1 strain ERTm6 was isolated from wild-caught Caenorhabditis briggsae and causes a lethal intestinal infection in Caenorhabditis nematodes. We report the genome sequence of N. sp1 ERTm6, which will facilitate study of the Nematocida genus and other Microsporidia. PMID:25237020

  17. Risk factors for high levels of lead in blood of schoolchildren in Mexico City.

    PubMed

    Olaiz, G; Fortoul, T I; Rojas, R; Doyer, M; Palazuelos, E; Tapia, C R

    1996-01-01

    Risk factors associated with blood lead levels exceeding 15 microg/dl were analyzed in this report. This relatively high lead level was selected because, at the time the study commenced, it was considered to be a "safe" level. A total of 1583 schoolchildren were studied. The students were from (a) two areas in Mexico City (Tlalnepantla and Xalostoc) that have had historically high concentrations of lead in air, and (b) three areas (Pedregal, Iztalpalapa, and Centro) with less impressive air lead levels. Parents were presented with a questionnaire that solicited information about lead risk factors. A bivariate analysis and a multilogistic analysis were conducted to identify associations and to identify the model that most accurately explains the variability of the sample. High blood lead concentrations were found in children who lived in Xalostoc and Tlalnepantla (16.1 and 17.0 microg/dl, respectively), and the lowest concentration (i.e., 10 microg/dl) was found in children from Iztapalapa. The strongest association was with area of residence, followed by education level of parents, cooking of meals in glazed pottery, and chewing or sucking of yellow or other colored pencils. A child's area of residence is the most significant risk factor that must be accounted for when any study of lead and blood lead concentrations is undertaken. Follow-up in similar populations should assist greatly in the evaluation of the impact of governmental actions on public health. PMID:8638962

  18. YY1 and Sp1 activate transcription of the human NDUFS8 gene encoding the mitochondrial complex I TYKY subunit.

    PubMed

    Lescuyer, Pierre; Martinez, Pascal; Lunardi, Joël

    2002-03-19

    Complex I is the most complicated of the multimeric enzymes that constitute the mitochondrial respiratory chain. It is encoded by both mitochondrial and nuclear genomes. We have previously characterized the human NDUFS8 gene that encodes the TYKY subunit. This essential subunit is thought to participate in the electron transfer and proton pumping activities of complex I. Here, we have analyzed the transcriptional regulation of the NDUFS8 gene. Using primer extension assays, we have identified two transcription start sites. The basal promoter was mapped to a 247 bp sequence upstream from the main transcription start site by reporter gene analysis in HeLa cells and in differentiated or non-differentiated C2C12 cells. Three Sp1 sites and one YY1 site were identified in this minimal promoter. Through gel shift analysis, all sites were shown to bind to their cognate transcription factors. Site-directed mutagenesis revealed that the YY1 site and two upstream adjacent Sp1 sites drive most of the promoter activity. This work represents the first promoter analysis for a complex I gene. Together with previous studies, our results indicate that YY1 and Sp1 control the expression of genes encoding proteins that are involved in almost all steps of the oxidative phosphorylation metabolism. PMID:11955626

  19. Small constrained SP1-7 analogs bind to a unique site and promote anti-allodynic effects following systemic injection in mice.

    PubMed

    Jonsson, A; Fransson, R; Haramaki, Y; Skogh, A; Brolin, E; Watanabe, H; Nordvall, G; Hallberg, M; Sandström, A; Nyberg, F

    2015-07-01

    Previous results have shown that the substance P (SP) N-terminal fragment SP1-7 may attenuate hyperalgesia and produce anti-allodynia in animals using various experimental models for neuropathic pain. The heptapeptide was found to induce its effects through binding to and activating specific sites apart from any known neurokinin or opioid receptor. Furthermore, we have applied a medicinal chemistry program to develop lead compounds mimicking the effect of SP1-7. The present study was designed to evaluate the pharmacological effect of these compounds using the mouse spared nerve injury (SNI) model of chronic neuropathic pain. Also, as no comprehensive screen with the aim to identify the SP1-7 target has yet been performed we screened our lead compound H-Phe-Phe-NH2 toward a panel of drug targets. The extensive target screen, including 111 targets, did not reveal any hit for the binding site among a number of known receptors or enzymes involved in pain modulation. Our animal studies confirmed that SP1-7, but also synthetic analogs thereof, possesses anti-allodynic effects in the mouse SNI model of neuropathic pain. One of the lead compounds, a constrained H-Phe-Phe-NH2 analog, was shown to exhibit a significant anti-allodynic effect. PMID:25862586

  20. Curcumin decreases the expression of Pokemon by suppressing the binding activity of the Sp1 protein in human lung cancer cells.

    PubMed

    Cui, Jiajun; Meng, Xianfeng; Gao, Xudong; Tan, Guangxuan

    2010-03-01

    Pokemon, which stands for POK erythroid myeloid ontogenic factor, can regulate expression of many genes and plays an important role in tumorigenesis. Curcumin, a natural and non-toxic yellow compound, has capacity for antioxidant, free radical scavenger, anti-inflammatory properties. Recent studies shows it is a potential inhibitor of cell proliferation in a variety of tumour cells. To investigate whether curcumin can regulate the expression of Pokemon, a series of experiments were carried out. Transient transfection experiments demonstrated that curcumin could decrease the activity of the Pokemon promoter. Western blot analysis suggested that curcumin could significantly decrease the expression of the Pokemon. Overexpression of Sp1 could enhance the activity of the Pokemon promoter, whereas knockdown of Sp1 could decrease its activity. More important, we also found that curcumin could decrease the expression of the Pokemon by suppressing the stimulation of the Sp1 protein. Therefore, curcumin is a potential reagent for tumour therapy which may target Pokemon. PMID:19444642

  1. The Risk Factors of Child Lead Poisoning in China: A Meta-Analysis

    PubMed Central

    Li, You; Qin, Jian; Wei, Xiao; Li, Chunhong; Wang, Jian; Jiang, Meiyu; Liang, Xue; Xia, Tianlong; Zhang, Zhiyong

    2016-01-01

    Background: To investigate the risk factors of child lead poisoning in China. Methods: A document retrieval was performed using MeSH (Medical subject heading terms) and key words. The Newcastle-Ottawa Scale (NOS) was used to assess the quality of the studies, and the pooled odd ratios with a 95% confidence interval were used to identify the risk factors. We employed Review Manager 5.2 and Stata 10.0 to analyze the data. Heterogeneity was assessed by both the Chi-square and I2 tests, and publication bias was evaluated using a funnel plot and Egger’s test. Results: Thirty-four articles reporting 13,587 lead-poisoned children met the inclusion criteria. Unhealthy lifestyle and behaviors, environmental pollution around the home and potential for parents’ occupational exposure to lead were risk factors of child lead poisoning in the pooled analyses. Our assessments yielded no severe publication biases. Conclusions: Seventeen risk factors are associated with child lead poisoning, which can be used to identify high-risk children. Health education and promotion campaigns should be designed in order to minimize or prevent child lead poisoning in China. PMID:27005641

  2. Effect of lead factors on the embrittlement of RPV SA-508 cl 3 steel

    NASA Astrophysics Data System (ADS)

    Kempf, Rodolfo; Troiani, Horacio; Fortis, Ana Maria

    2013-03-01

    This paper presents a project to study the effect of lead factors on the mechanical behaviour of the SA-508 type 3 Reactor Pressure Vessel (RPV) steel used in the reactor under construction Atucha II in Argentina. Charpy-V notch specimens of this steel were irradiated at the RA1 experimental reactor at a temperature of 275 °C with two lead factors (186 and 93). The neutron flux was 3.71 × 1015 n m-2 s-1 and 1.85 × 1015 n m-2 s-1 (E > 1 MeV) respectively. In both cases, the fluence was 6.6 × 1021 n m-2, which is equivalent to that received by the PHWR Atucha II RPV in 10 years of full power irradiation. The results of Charpy tests revealed significant embrittlement both in the ΔT = 14 °C and ΔT = 21 °C shifts of the ductile-brittle transition temperatures (DBTT) and in the reduction of the maximum energy absorbed. This result shows that the shift of the DBTT with a lead factor of 93 is larger than that obtained with a lead factor of 186. Then, the results of irradiation in experimental reactors (MTR) with high lead factors may not be conservative with respect to the actual RPV embrittlement.

  3. In vitro chromatin assembly of the HIV-1 promoter. ATP-dependent polar repositioning of nucleosomes by Sp1 and NFkappaB.

    PubMed

    Widlak, P; Gaynor, R B; Garrard, W T

    1997-07-11

    Nuclease hypersensitive sites exist in vivo in the chromatin of the integrated human immunodeficiency virus (HIV)-1 proviral genome, in the 5'-long terminal repeat (LTR) within the promoter/enhancer region near Sp1 and NFkappaB binding sites. Previous studies from the Kadonaga and Jones laboratories have shown that Sp1 and NFkappaB can establish hypersensitive sites in a truncated form of this LTR when added before in vitro chromatin assembly with Drosophila extracts, thus facilitating subsequent transcriptional activation of a linked reporter gene upon the association of additional factors (Pazin, M. J., Sheridan, P. L., Cannon, K., Cao, Z., Keck, J. G., Kadanaga, J. T., and Jones, K. A. (1996) Genes & Dev. 10, 37-49). Here we assess the role of a full-length LTR and 1 kilobase pair of downstream flanking HIV sequences in chromatin remodeling when these transcription factors are added after chromatin assembly. Using Xenopus laevis oocyte extracts to assemble chromatin in vitro, we have confirmed that Sp1 and NFkappaB can indeed induce sites hypersensitive to DNase I, micrococcal nuclease, or restriction enzymes on either side of factor binding sites in chromatin but not naked DNA. We extend these earlier studies by demonstrating that the process is ATP-dependent when the factors are added after chromatin assembly and that histone H1, AP1, TBP, or Tat had no effect on hypersensitive site formation. Furthermore, we have found that nucleosomes upstream of NFkappaB sites are rotationally positioned prior to factor binding and that their translational frame is registered after binding NFkappaB. On the other hand, binding of Sp1 positions adjacent downstream nucleosome(s). We term this polar repositioning because each factor aligns nucleosomes only on one side of its binding sites. Mutational analysis and oligonucleotide competition each demonstrated that this remodeling required Sp1 and NFkappaB binding sites. PMID:9211915

  4. Lifestyle and environmental factors as determinants of blood lead levels in a Swiss population

    SciTech Connect

    Berode, M.; Wietlisbach, V.; Rickenbach, M.; Guillemin, M.P. )

    1991-06-01

    The determination of blood lead levels was included in a Swiss population survey on cardiovascular risk factors in 1984-1985; 931 men and 843 women aged 25 to 75 years participated in the study. Mean blood lead levels ({plus minus}SD) were 0.63 {plus minus} 0.27 {mu}mole/liter for men and 0.44 {plus minus} 0.19 {mu}mole/liter for women, respectively, with a slight increase with age for both sexes. These values are below the maximum level recommended by the Commission of the European Community in 1977; 18 cases were found with blood lead higher than 1.5 {mu}mole/liter and in six of these, a professional exposure was suspected. Smoking habits, drinking habits, and consumption of diary products were selected as lifestyle descriptors and educational level, occupational category, and size of the community as sociodemographic indicators. Smoking and alcohol consumption show a direct association with blood lead, consuming dairy products an inverse one. Occupation and level of education are significantly related to blood lead only for men, blue-collar workers and less-educated men being more exposed. A higher blood lead level in cities was only found for women. The lifestyle indicators showed a consistently stronger effect on blood lead than sociodemographic indicators. For mean, smoking has an effect on blood lead for blue-collar workers much stronger than that for nonindustrial employees and may compound in some way the professional exposure to lead.

  5. Nucleon form factors to next-to-leading order with light-cone sum rules

    SciTech Connect

    Passek-Kumericki, K.; Peters, G.

    2008-08-01

    We have calculated the leading-twist next-to-leading order (NLO), i.e., O({alpha}{sub s}), correction to the light-cone sum rules prediction for the electromagnetic form factors of the nucleon. We have used the Ioffe nucleon interpolation current and worked in M{sub N}=0 approximation, with M{sub N} being the mass of the nucleon. In this approximation, only the Pauli form factor F{sub 2} receives a correction and the calculated correction is quite sizable (ca. 60%). The numerical results for the proton form factors show the improved agreement with the experimental data. We also discuss the problems encountered when going away from M{sub N}=0 approximation at NLO, as well as gauge invariance of the perturbative results. This work presents the first step towards the NLO accuracy in the light-cone sum rules for baryon form factors.

  6. Transcriptional interference perturbs the binding of Sp1 to the HIV-1 promoter.

    PubMed Central

    Greger, I H; Demarchi, F; Giacca, M; Proudfoot, N J

    1998-01-01

    Transcriptional interference between adjacent genes has been demonstrated in a variety of biological systems. To study this process in RNA polymerase II (pol II) transcribed genes we have analysed the effect of transcription on tandem HIV-1 promoters integrated into the genome of HeLa cells. We show that transcriptional activation at the upstream promoter reduces transcription from the downstream promoter, as compared with basal transcription conditions (in the absence of an activator). Furthermore, insertion of a strong transcriptional termination element between the two promoters alleviates this transcriptional interference, resulting in elevated levels of transcription from the downstream promoter. Actual protein interactions with the downstream (occluded) promoter were analysed by in vivo footprinting. Binding of Sp1 transcription factors to the occluded promoter was reduced, when compared with the footprint pattern of the promoter protected by the terminator. This suggests that promoter occlusion is due to disruption of certain transcription factors and that it can be blocked by an intervening transcriptional terminator. Chromatin mapping with DNase I indicates that a factor binds to the termination element under both basal and induced conditions. PMID:9469840

  7. Inhibition of Phosphatase Activity Follows Decline in Sulfatase Activity and Leads to Transcriptional Effects through Sustained Phosphorylation of Transcription Factor MITF

    PubMed Central

    Bhattacharyya, Sumit; Feferman, Leo; Tobacman, Joanne K.

    2016-01-01

    Arylsulfatase B (B-acetylgalactosamine 4-sulfatase; ARSB) is the enzyme that removes 4-sulfate groups from the non-reducing end of the glycosaminoglycans chondroitin 4-sulfate and dermatan sulfate. Decline in ARSB has been shown in malignant prostate, colonic, and mammary cells and tissues, and decline in ARSB leads to transcriptional events mediated by galectin-3 with AP-1 and Sp1. Increased mRNA expression of GPNMB (transmembrane glycoprotein NMB) in HepG2 cells and in hepatic tissue from ARSB-deficient mice followed decline in expression of ARSB and was mediated by the microphthalmia-associated transcription factor (MITF), but was unaffected by silencing galectin-3. Since GPNMB is increased in multiple malignancies, studies were performed to determine how decline in ARSB increased GPNMB expression. The mechanism by which decline in ARSB increased nuclear phospho-MITF was due to reduced activity of SHP2, a protein tyrosine phosphatase with Src homology (SH2) domains that regulates multiple cellular processes. SHP2 activity declined due to increased binding with chondroitin 4-sulfate when ARSB was reduced. When SHP2 activity was inhibited, phosphorylations of p38 mitogen-associated phosphokinase (MAPK) and of MITF increased, leading to GPNMB promoter activation. A dominant negative SHP2 construct, the SHP2 inhibitor PHSP1, and silencing of ARSB increased phospho-p38, nuclear MITF, and GPNMB. In contrast, constitutively active SHP2 and overexpression of ARSB inhibited GPNMB expression. The interaction between chondroitin 4-sulfate and SHP2 is a novel intersection between sulfation and phosphorylation, by which decline in ARSB and increased chondroitin 4-sulfation can inhibit SHP2, thereby regulating downstream tyrosine phosphorylations by sustained phosphorylations with associated activation of signaling and transcriptional events. PMID:27078017

  8. Diverse Mechanisms of Sp1-Dependent Transcriptional Regulation Potentially Involved in the Adaptive Response of Cancer Cells to Oxygen-Deficient Conditions

    PubMed Central

    Koizume, Shiro; Miyagi, Yohei

    2015-01-01

    The inside of a tumor often contains a hypoxic area caused by a limited supply of molecular oxygen due to aberrant vasculature. Hypoxia-inducible factors (HIFs) are major transcription factors that are required for cancer cells to adapt to such stress conditions. HIFs, complexed with the aryl hydrocarbon receptor nuclear translocator, bind to and activate target genes as enhancers of transcription. In addition to this common mechanism, the induction of the unfolded protein response and mTOR signaling in response to endoplasmic reticulum stress is also known to be involved in the adaptation to hypoxia conditions. Sp1 is a ubiquitously-expressed transcription factor that plays a vital role in the regulation of numerous genes required for normal cell function. In addition to the well-characterized stress response mechanisms described above, increasing experimental evidence suggests that Sp1 and HIFs collaborate to drive gene expression in cancer cells in response to hypoxia, thereby regulating additional adaptive responses to cellular oxygen deficiency. However, these characteristics of Sp1 and their biological merits have not been summarized. In this review, we will discuss the diverse mechanisms of transcriptional regulation by Sp1 and their potential involvement in the adaptive response of cancer cells to hypoxic tumor microenvironments. PMID:26703734

  9. miR-23b/SP1/c-myc forms a feed-forward loop supporting multiple myeloma cell growth

    PubMed Central

    Fulciniti, M; Amodio, N; Bandi, R L; Cagnetta, A; Samur, M K; Acharya, C; Prabhala, R; D'Aquila, P; Bellizzi, D; Passarino, G; Adamia, S; Neri, A; Hunter, Z R; Treon, S P; Anderson, K C; Tassone, P; Munshi, N C

    2016-01-01

    Deregulated microRNA (miR)/transcription factor (TF)-based networks represent a hallmark of cancer. We report here a novel c-Myc/miR-23b/Sp1 feed-forward loop with a critical role in multiple myeloma (MM) and Waldenstrom's macroglobulinemia (WM) cell growth and survival. We have found miR-23b to be downregulated in MM and WM cells especially in the presence of components of the tumor bone marrow milieu. Promoter methylation is one mechanism of miR-23b suppression in myeloma. In gain-of-function studies using miR-23b mimics-transfected or in miR-23b-stably expressing MM and WM cell lines, we observed a significant decrease in cell proliferation and survival, along with induction of caspase-3/7 activity over time, thus supporting a tumor suppressor role for miR-23b. At the molecular level, miR-23b targeted Sp1 3′UTR and significantly reduced Sp1-driven nuclear factor-κB activity. Finally, c-Myc, an important oncogenic transcription factor known to stimulate MM cell proliferation, transcriptionally repressed miR-23b. Thus MYC-dependent miR-23b repression in myeloma cells may promote activation of oncogenic Sp1-mediated signaling, representing the first feed-forward loop with critical growth and survival role in myeloma. PMID:26771806

  10. Factors associated with elevated blood lead concentrations in children in Karachi, Pakistan.

    PubMed Central

    Rahbar, Mohammad Hossein; White, Franklin; Agboatwalla, Mubina; Hozhabri, Siroos; Luby, Stephen

    2002-01-01

    OBJECTIVES: To confirm whether blood lead concentrations in Karachi were as high as reported in 1989 and to identify which types of exposure to lead contribute most to elevated blood lead concentrations in children in Karachi. METHODS: A total of 430 children aged 36-60 months were selected through a geographically stratified design from the city centre, two suburbs, a rural community and an island situated within the harbour at Karachi. Blood samples were collected from children and a pretested questionnaire was administered to assess the effect of various types of exposure. Cooked food, drinking-water and house dust samples were collected from households. FINDINGS: About 80% of children had blood lead concentrations 10 g/dl, with an overall mean of 15.6 g/dl. At the 5% level of significance, houses nearer to the main intersection in the city centre, application of surma to children's eyes, father's exposure to lead at workplace, parents' illiteracy and child's habit of hand- to-mouth activity were among variables associated with elevated lead concentrations in blood. CONCLUSION: These findings are of public health concern, as most children in Karachi are likely to suffer some degree of intellectual impairment as a result of environmental lead exposure. We believe that there is enough evidence of the continuing problem of lead in petrol to prompt the petroleum industry to take action. The evidence also shows the need for appropriate interventions in reducing the burden due to other factors associated with this toxic element. PMID:12471396

  11. Understanding Factors Leading to Participation in Supplemental Instruction Programs in Introductory Accounting Courses

    ERIC Educational Resources Information Center

    Goldstein, James; Sauer, Paul; O'Donnell, Joseph

    2014-01-01

    Although studies have shown that supplemental instruction (SI) programs can have positive effects in introductory accounting courses, these programs experience low participation rates. Thus, our study is the first to examine the factors leading to student participation in SI programs. We do this through a survey instrument based on the Theory of…

  12. RELATION OF LEAD AND SOCIAL FACTORS TO IQ OF LOW-SES CHILDREN: A PARTIAL REPLICATION

    EPA Science Inventory

    An independent replication of a previous study (Schroeder et al., 1985) of the effects of interactive social environmental factors on the relationship of lead and Stanford-Binet IQ was performed on 75 of 80 low-Socioeconomic status black children screened by county health departm...

  13. Blood lead levels and risk factors in pregnant women from Durango, Mexico.

    PubMed

    La-Llave-León, Osmel; Estrada-Martínez, Sergio; Manuel Salas-Pacheco, José; Peña-Elósegui, Rocío; Duarte-Sustaita, Jaime; Candelas Rangel, Jorge-Luís; García Vargas, Gonzalo

    2011-01-01

    In this cross-sectional study the authors determined blood lead levels (BLLs) and some risk factors for lead exposure in pregnant women. Two hundred ninety-nine pregnant women receiving medical attention by the Secretary of Health, State of Durango, Mexico, participated in this study between 2007 and 2008. BLLs were evaluated with graphite furnace atomic absorption spectrometry. The authors used Student t test, 1-way analysis of variance (ANOVA), and linear regression as statistical treatments. BLLs ranged from 0.36 to 23.6 μg/dL (mean = 2.79 μg/dL, standard deviation = 2.14). Multivariate analysis showed that the main predictors of BLLs were working in a place where lead is used, using lead glazed pottery, and eating soil. PMID:24484368

  14. The conjugate gradient NAS parallel benchmark on the IBM SP1

    SciTech Connect

    Trefethen, A.E.; Zhang, T.

    1994-12-31

    The NAS Parallel Benchmarks are a suite of eight benchmark problems developed at the NASA Ames Research Center. They are specified in such a way that the benchmarkers are free to choose the language and method of implementation to suit the system in which they are interested. In this presentation the authors will discuss the Conjugate Gradient benchmark and its implementation on the IBM SP1. The SP1 is a parallel system which is comprised of RS/6000 nodes connected by a high performance switch. They will compare the results of the SP1 implementation with those reported for other machines. At this time, such a comparison shows the SP1 to be very competitive.

  15. An atomic model of HIV-1 capsid-SP1 reveals structures regulating assembly and maturation.

    PubMed

    Schur, Florian K M; Obr, Martin; Hagen, Wim J H; Wan, William; Jakobi, Arjen J; Kirkpatrick, Joanna M; Sachse, Carsten; Kräusslich, Hans-Georg; Briggs, John A G

    2016-07-29

    Immature HIV-1 assembles at and buds from the plasma membrane before proteolytic cleavage of the viral Gag polyprotein induces structural maturation. Maturation can be blocked by maturation inhibitors (MIs), thereby abolishing infectivity. The CA (capsid) and SP1 (spacer peptide 1) region of Gag is the key regulator of assembly and maturation and is the target of MIs. We applied optimized cryo-electron tomography and subtomogram averaging to resolve this region within assembled immature HIV-1 particles at 3.9 angstrom resolution and built an atomic model. The structure reveals a network of intra- and intermolecular interactions mediating immature HIV-1 assembly. The proteolytic cleavage site between CA and SP1 is inaccessible to protease. We suggest that MIs prevent CA-SP1 cleavage by stabilizing the structure, and MI resistance develops by destabilizing CA-SP1. PMID:27417497

  16. Epigenetic modification of TLR4 promotes activation of NF-κB by regulating methyl-CpG-binding domain protein 2 and Sp1 in gastric cancer.

    PubMed

    Kim, Tae Woo; Lee, Seon-Jin; Oh, Byung Moo; Lee, Heesoo; Uhm, Tae Gi; Min, Jeong-Ki; Park, Young-Jun; Yoon, Suk Ran; Kim, Bo-Yeon; Kim, Jong Wan; Choe, Yong-Kyung; Lee, Hee Gu

    2016-01-26

    Toll-like receptor 4 (TLR4) is important in promoting the immune response in various cancers. Recently, TLR4 is highly expressed in a stage-dependent manner in gastric cancer, but the regulatory mechanism of TLR4 expression has been not elucidated it. Here, we investigated the mechanism underlying regulation of TLR4 expression through promoter methylation and histone modification between transcriptional regulation and silencing of the TLR4 gene in gastric cancer cells. Chromatin immunoprecipitation was carried out to screen for factors related to TLR4 methylation such as MeCP2, HDAC1, and Sp1 on the TLR4 promoter. Moreover, DNA methyltransferase inhibitor 5-aza-deoxycytidine (5-aza-dC) induced demethylation of the TLR4 promoter and increased H3K4 trimethylation and Sp1 binding to reactivate silenced TLR4. In contrast, although the silence of TLR4 activated H3K9 trimethylation and MeCP2 complex, combined treatment with TLR4 agonist and 5-aza-dC upregulated H3K4 trimethylation and activated with transcription factors as Sp1 and NF-κB. This study demonstrates that recruitment of the MeCP2/HDAC1 repressor complex increases the low levels of TLR4 expression through epigenetic modification of DNA and histones on the TLR4 promoter, but Sp1 activates TLR4 high expression by hypomethylation and NF-κB signaling in gastric cancer cells. PMID:26675260

  17. Epigenetic modification of TLR4 promotes activation of NF-κB by regulating methyl-CpG-binding domain protein 2 and Sp1 in gastric cancer

    PubMed Central

    Oh, Byung Moo; Lee, Heesoo; Uhm, Tae Gi; Min, Jeong-Ki; Park, Young-Jun; Yoon, Suk Ran; Kim, Bo-Yeon; Kim, Jong Wan; Choe, Yong-Kyung; Lee, Hee Gu

    2016-01-01

    Toll-like receptor 4 (TLR4) is important in promoting the immune response in various cancers. Recently, TLR4 is highly expressed in a stage-dependent manner in gastric cancer, but the regulatory mechanism of TLR4 expression has been not elucidated it. Here, we investigated the mechanism underlying regulation of TLR4 expression through promoter methylation and histone modification between transcriptional regulation and silencing of the TLR4 gene in gastric cancer cells. Chromatin immunoprecipitation was carried out to screen for factors related to TLR4 methylation such as MeCP2, HDAC1, and Sp1 on the TLR4 promoter. Moreover, DNA methyltransferase inhibitor 5-aza-deoxycytidine (5-aza-dC) induced demethylation of the TLR4 promoter and increased H3K4 trimethylation and Sp1 binding to reactivate silenced TLR4. In contrast, although the silence of TLR4 activated H3K9 trimethylation and MeCP2 complex, combined treatment with TLR4 agonist and 5-aza-dC upregulated H3K4 trimethylation and activated with transcription factors as Sp1 and NF-κB. This study demonstrates that recruitment of the MeCP2/HDAC1 repressor complex increases the low levels of TLR4 expression through epigenetic modification of DNA and histones on the TLR4 promoter, but Sp1 activates TLR4 high expression by hypomethylation and NF-κB signaling in gastric cancer cells. PMID:26675260

  18. Draft Genome Sequences of Two Magnetotactic Bacteria, Magnetospirillum moscoviense BB-1 and Magnetospirillum marisnigri SP-1.

    PubMed

    Koziaeva, Veronika V; Dziuba, Marina V; Ivanov, Timophey M; Kuznetsov, Boris B; Skryabin, Konstantin G; Grouzdev, Denis S

    2016-01-01

    We report here the draft genome sequences of two recently isolated magnetotactic species, Magnetospirillum moscoviense BB-1 and Magnetospirillum marisnigri SP-1. The genome of M. moscoviense BB-1 has 4,164,497 bp, 65.2% G+C content, and comprises 207 contigs. The genome of M. marisnigri SP-1 consists of 131 contigs and has a length of 4,619,819 bp and 64.7% G+C content. PMID:27516508

  19. Draft Genome Sequences of Two Magnetotactic Bacteria, Magnetospirillum moscoviense BB-1 and Magnetospirillum marisnigri SP-1

    PubMed Central

    Koziaeva, Veronika V.; Dziuba, Marina V.; Ivanov, Timophey M.; Kuznetsov, Boris B.; Skryabin, Konstantin G.

    2016-01-01

    We report here the draft genome sequences of two recently isolated magnetotactic species, Magnetospirillum moscoviense BB-1 and Magnetospirillum marisnigri SP-1. The genome of M. moscoviense BB-1 has 4,164,497 bp, 65.2% G+C content, and comprises 207 contigs. The genome of M. marisnigri SP-1 consists of 131 contigs and has a length of 4,619,819 bp and 64.7% G+C content. PMID:27516508

  20. Single-molecule DNA detection using a novel SP1 protein nanopore.

    PubMed

    Wang, Hai-Yan; Li, Yang; Qin, Li-Xia; Heyman, Arnon; Shoseyov, Oded; Willner, Itamar; Long, Yi-Tao; Tian, He

    2013-02-28

    SP1 protein as a new type of biological nanopore is described and is utilized to distinguish single-stranded DNA at the single-molecule level. Using the SP1 nanopore to investigate single molecule detection broadens the existing research areas of pore-forming biomaterials from unsymmetrical biological nanopores to symmetrical biological nanopores. This novel nanopore could provide a good candidate for single-molecule detection and characterization of biomaterial applications. PMID:23340583

  1. Arf Induction by Tgfβ Is Influenced by Sp1 and C/ebpβ in Opposing Directions

    PubMed Central

    Zheng, Yanbin; Devitt, Caitlin; Liu, Jing; Iqbal, Nida; Skapek, Stephen X.

    2013-01-01

    Recent studies show that Arf, a bona fide tumor suppressor, also plays an essential role during mouse eye development. Tgfβ is required for Arf promoter activation in developing mouse eyes, and its capacity to induce Arf depends on Smads 2/3 as well as p38 Mapk. Substantial delay between activation of these pathways and increased Arf transcription imply that changes in the binding of additional transcription factors help orchestrate changes in Arf expression. Focusing on proteins with putative DNA binding elements near the mouse Arf transcription start, we now show that Tgfβ induction of this gene correlated with decreased expression and DNA binding of C/ebpβ to the proximal Arf promoter. Ectopic expression of C/ebpβ in mouse embryo fibroblasts (MEFs) blocked Arf induction by Tgfβ. Although basal levels of Arf mRNA were increased by C/ebpβ loss in MEFs and in the developing eye, Tgfβ was still able to increase Arf, indicating that derepression was not the sole factor. Chromatin immunoprecipitation (ChIP) assay showed increased Sp1 binding to the Arf promotor at 24 and 48 hours after Tgfβ treatment, at which time points Arf expression was significantly induced by Tgfβ. Chemical inhibition of Sp1 and its knockdown by RNA interference blocked Arf induction by Tgfβ in MEFs. In summary, our results indicate that C/ebpβ and Sp1 are negative and positive Arf regulators that are influenced by Tgfβ. PMID:23940569

  2. Sp1 transcriptionally regulates BRK1 expression in non-small cell lung cancer cells.

    PubMed

    Li, Meng; Ling, Bing; Xiao, Ting; Tan, Jinjing; An, Ning; Han, Naijun; Guo, Suping; Cheng, Shujun; Zhang, Kaitai

    2014-06-01

    Following a previous study reporting that BRK1 is upregulated in non-small cell lung cancer (NSCLC), the present study sought to clarify the role of specificity protein 1 (Sp1) in the transcriptional regulation of the BRK1 gene. Therefore, a construct, named F8, consisting of the -1341 to -1 nt sequence upstream of the start codon of the BRK1 gene inserted into pGL4.26 was made. A series of truncated fragments was then constructed based on F8. Segment S831, which contained the -84 to -1 nt region, displayed the highest transcriptional activity in the A549, H1299 and H520 NSCLC cell lines. Bioinformatic analysis showed a potential Sp1-binding element at -73 to -64 nt, and a mutation in this region suppressed the transcriptional activity of S831. Then the RNAi assays of Sp1 and its coworkers Sp3 and Sp4 were performed, and suppression of Sp1 by siRNA inhibited the mRNA expression of BRK1. Both an electrophoretic mobility shift assay (EMSA) and a chromatin immunoprecipitation (ChIP) assay demonstrated that Sp1 bound to the promoter area of the BRK1 gene. Our data identified a functional and positive Sp1 regulatory element from -73 to -64 nt in the BRK1 promoter, which may likely explain the overexpression of BRK1 in NSCLC. PMID:24680773

  3. An interaction between the DNA-binding domains of RelA(p65) and Sp1 mediates human immunodeficiency virus gene activation.

    PubMed Central

    Perkins, N D; Agranoff, A B; Pascal, E; Nabel, G J

    1994-01-01

    Induction of human immunodeficiency virus type 1 (HIV-1) gene expression in stimulated T cells has been attributed to the activation of the transcription factor NF-kappa B. The twice-repeated kappa B sites within the HIV-1 long terminal repeat are in close proximity to three binding sites for Sp1. We have previously shown that a cooperative interaction of NF-kappa B with Sp1 is required for the efficient stimulation of HIV-1 transcription. In this report, we define the domains of each protein responsible for this effect. Although the transactivation domains seemed likely to mediate this interaction, we find, surprisingly, that this interaction occurs through the putative DNA-binding domains of both proteins. Sp1 specifically interacted with the amino-terminal region of RelA(p65). Similarly, RelA bound directly to the zinc finger region of Sp1. This interaction was specific and resulted in cooperative DNA binding to the kappa B and Sp1 sites in the HIV-1 long terminal repeat. Furthermore, the amino-terminal region of RelA did not associate with several other transcription factors, including MyoD, E12, or Kox15, another zinc finger protein. These findings suggest that the juxtaposition of DNA-binding sites promotes a specific protein interaction between the DNA-binding regions of these transcription factors. This interaction is required for HIV transcriptional activation and may provide a mechanism to allow for selective activation of kappa B-regulated genes. Images PMID:7935378

  4. All-trans retinoic acid increases expression of aquaporin-5 and plasma membrane water permeability via transactivation of Sp1 in mouse lung epithelial cells.

    PubMed

    Nomura, Johji; Horie, Ichiro; Seto, Mayumi; Nagai, Kazufumi; Hisatsune, Akinori; Miyata, Takeshi; Isohama, Yoichiro

    2006-12-29

    Aquaporin-5 (AQP5) is a water-selective channel protein that is expressed in lacrimal glands, salivary glands, and distal lung. Several studies using AQP5 knockout mice have revealed that AQP5 plays an important role in maintaining water homeostasis in the lung. We report here that all-trans retinoic acid (atRA) increases plasma membrane water permeability, AQP5 mRNA and protein expression, and AQP5 promoter activity in MLE-12 cells. The promoter activation induced by atRA was diminished by mutation at the Sp1/Sp3 binding element (SBE), suggesting that the SBE mediates the effects of atRA. In addition, atRA increased the binding of Sp1 to the SBE without changing the levels of Sp1 in the nucleus. Taken together, our data indicate that atRA increases AQP5 expression through transactivation of Sp1, leading to an increase in plasma membrane water permeability. PMID:17097063

  5. Benjamin Franklin's risk factors for gout and stones: from genes and diet to possible lead poisoning.

    PubMed

    Finger, Stanley; Hagemann, Ian S

    2008-06-01

    Benjamin Franklin's medical history shows that he suffered from repeated attacks of gout and a large bladder stone. These conditions caused him considerable pain, markedly decreased his mobility, and likely contributed in indirect ways to his decline and eventual death from a pulmonary disorder. This article examines Franklin's risk factors for gout and stones, both as Franklin understood them and as we know them today. Significantly, both of these disorders are associated with high blood levels of uric acid, a metabolic by-product. Franklin's risk factors included his gender, genetics, diet, drinking, advanced age, psoriasis, and exposure to lead. Although it is impossible to assign a weight to each of these factors, it can be shown that a number of factors, each capable of raising uric acid levels, converged and conspired against him. PMID:19244863

  6. Relationship between orientation factor of lead zirconate titanate nanowires and dielectric permittivity of nanocomposites

    SciTech Connect

    Tang, Haixiong E-mail: hsodano@ufl.edu; Malakooti, Mohammad H.; Sodano, Henry A. E-mail: hsodano@ufl.edu

    2013-11-25

    The relationship between the orientation of lead zirconate titanate (PZT) nanowires dispersed in nanocomposites and the resulting dielectric constants are quantified. The orientation of the PZT nanowires embedded in a polymer matrix is controlled by varying the draw ratio and subsequently quantified using Herman's Orientation Factor. Consequently, it is demonstrated that the dielectric constants of nanocomposites are improved by increasing the orientation factor of the PZT nanowires. This technique is proposed to improve the dielectric constant of the nanocomposites without the need for additional filler volume fraction since the nanocomposites are utilized in a wide range of high dielectric permittivity electronic components.

  7. Maximal Expression of the Evolutionarily Conserved Slit2 Gene Promoter Requires Sp1.

    PubMed

    Saunders, Jacquelyn; Wisidagama, D Roonalika; Morford, Travis; Malone, Cindy S

    2016-08-01

    Slit2 is a neural axon guidance and chemorepellent protein that stimulates motility in a variety of cell types. The role of Slit2 in neural development and neoplastic growth and migration has been well established, while the genetic mechanisms underlying regulation of the Slit2 gene have not. We identified the core and proximal promoter of Slit2 by mapping multiple transcriptional start sites, analyzing transcriptional activity, and confirming sequence homology for the Slit2 proximal promoter among a number of species. Deletion series and transient transfection identified the Slit2 proximal promoter as within 399 base pairs upstream of the start of transcription. A crucial region for full expression of the Slit2 proximal promoter lies between 399 base pairs and 296 base pairs upstream of the start of transcription. Computer modeling identified three transcription factor-binding consensus sites within this region, of which only site-directed mutagenesis of one of the two identified Sp1 consensus sites inhibited transcriptional activity of the Slit2 proximal promoter (-399 to +253). Bioinformatics analysis of the Slit2 proximal promoter -399 base pair to -296 base pair region shows high sequence conservation over twenty-two species, and that this region follows an expected pattern of sequence divergence through evolution. PMID:26456684

  8. Cloning of the human activated leukocyte cell adhesion molecule promoter and identification of its tissue-independent transcriptional activation by Sp1.

    PubMed

    Tan, Fang; Mbunkui, Flaubert; Ofori-Acquah, Solomon F

    2012-12-01

    Activated leukocyte cell adhesion molecule (ALCAM) belongs to the immunoglobulin cell adhesion molecule super family. ALCAM is implicated in tumor progression, inflammation, and the differentiation of hematopoietic stem cells. Hitherto, the identity of regulatory DNA elements and cognate transcription factors responsible for ALCAM gene expression remained unknown. In this report, the human ALCAM promoter was cloned and its transcriptional mechanisms elucidated. The promoter is TATA-less and contains multiple GC-boxes. A proximal 650-bp promoter fragment conferred tissue-independent activation, whereas two contiguous regions upstream of this region negatively influenced promoter activity in a tissue-specific manner. The positive regulatory promoter region was mapped to a core 50 base pair sequence containing a conical Sp1 element. Mutation analysis revealed that this element alone or in tandem with elements immediately upstream was required for maximal promoter activity. Chromatin analysis revealed that Sp1 binds exclusively to the canonical binding sequence in vivo, but not to DNA sequence immediately upstream. Finally, we showed that over-expression of Sp1 significantly increased the basal promoter activity. Thus, Sp1 activated the ALCAM promoter in most cells. These findings have important ramifications for unraveling the roles of ALCAM in inflammation and tumorigenesis. PMID:22941204

  9. The impact of high co-expression of Sp1 and HIF1α on prognosis of patients with hepatocellular cancer

    PubMed Central

    LIU, LIANG; JI, PING; QU, NING; PU, WEI-LIN; JIANG, DAO-WEN; LIU, WEI-YAN; LI, YA-QI; SHI, RONG-LIANG

    2016-01-01

    Transcription factor specificity protein 1 (Sp1) and hypoxia-inducible factor 1α (HIF1α) serve vital roles in tumor growth and metastasis. The present study aimed to evaluate the impact of co-expression of Sp1 and HIF1α on the prognosis of patients with hepatocellular cancer (HCC) using The Cancer Genome Atlas (TCGA) database and to validate the association between the expression levels of Sp1/HIF1α in HCC specimens and patient survival using immunohistochemical analysis. A total of 214 eligible patients with HCC from TCGA database were collected for the study. The expression profile of Sp1 and HIF1α were obtained from the TCGA RNAseq database. Clinicopathological characteristics, including age, height, weight, gender, race, ethnicity, family cancer history, serum α-fetoprotein (AFP), surgical procedures and TNM stage were collected. The Cox proportional hazards regression model and Kaplan-Meier curves were used to assess the relative factors. Receiver operating characteristic (ROC) curves for cancer-specific survival (CSS) prediction were plotted to compare the prediction ability of expression of Sp1 and HIF1α and their co-expression. The location and expression of Sp1 and HIF1α in the HCC tissues were detected by immunohistochemistry (IHC) to verify the association between these two genes and CSS. The results demonstrated that the expressions of Sp1 and HIF1α were significantly increased in the succumbed group (P=0.001), compared with the surviving group. The CSS rates were 60.1% at 3 years (1,067 days), 35.8% at 5 years (1,823 days) and 9.5% at 10 years (3,528 days). Multivariate Cox regression analysis demonstrated that only the high expression levels of Sp1 and HIF1α (≥2×103) were independent predictors for cancer mortality, with P=0.001 and P=0.029, respectively. The area under the curve for the ROC was found to be higher using the combination testing for two genes (0.751) in predicting cancer mortality, compared to a single gene (0.632 for Sp1

  10. A Systematic Assessment of Blood Lead Level in Children and Associated Risk Factors in China.

    PubMed

    Wang, Lu; Li, Zhen; Huang, Shao Xin; DU, Chuang; Wang, Hong; He, Li Ping; Bi, Yong Yi; Shi, Yong; Wang, Chun Hong

    2015-08-01

    In this study, we searched multiple databases for all relevant original articles (1996-2013). To investigate blood lead levels (BLL) and possible risk factors for lead exposure among children in China A total of 388 articles met our inclusion criteria. The overall geometric mean (GM) BLL was 71 µg/L, and the prevalence of elevated BLL (EBLL, defined as BLL ⋝ 100 µg/L) was 18.48% among children. The prevalence of EBLL remained significantly higher among boys. In children less than 6 years of age, there were significantly increasing trends in both BLL and prevalence of EBLL in an age-dependent manner. The ban on leaded gasoline significantly reduced the BLL as well as EBLL prevalence; however, children whose parents had lower educational levels or were exposed to lead in the workplace had a higher EBLL prevalence. Despite its decline over time, the average BLL among children in China remains higher than the average level most recently reported in the United States. Childhood lead poisoning remains a public health problem in China. PMID:26383600

  11. Artemisinin blocks prostate cancer growth and cell cycle progression by disrupting Sp1 interactions with the cyclin-dependent kinase-4 (CDK4) promoter and inhibiting CDK4 gene expression.

    PubMed

    Willoughby, Jamin A; Sundar, Shyam N; Cheung, Mark; Tin, Antony S; Modiano, Jaime; Firestone, Gary L

    2009-01-23

    Artemisinin, a naturally occurring component of Artemisia annua, or sweet wormwood, is a potent anti-malaria compound that has recently been shown to have anti-proliferative effects on a number of human cancer cell types, although little is know about the molecular mechanisms of this response. We have observed that artemisinin treatment triggers a stringent G1 cell cycle arrest of LNCaP (lymph node carcinoma of the prostate) human prostate cancer cells that is accompanied by a rapid down-regulation of CDK2 and CDK4 protein and transcript levels. Transient transfection with promoter-linked luciferase reporter plasmids revealed that artemisinin strongly inhibits CDK2 and CDK4 promoter activity. Deletion analysis of the CDK4 promoter revealed a 231-bp artemisinin-responsive region between -1737 and -1506. Site-specific mutations revealed that the Sp1 site at -1531 was necessary for artemisinin responsiveness in the context of the CDK4 promoter. DNA binding assays as well as chromatin immunoprecipitation assays demonstrated that this Sp1-binding site in the CDK4 promoter forms a specific artemisinin-responsive DNA-protein complex that contains the Sp1 transcription factor. Artemisinin reduced phosphorylation of Sp1, and when dephosphorylation of Sp1 was inhibited by treatment of cells with the phosphatase inhibitor okadaic acid, the ability of artemisinin to down-regulate Sp1 interactions with the CDK4 promoter was ablated, rendering the CDK4 promoter unresponsive to artemisinin. Finally, overexpression of Sp1 mostly reversed the artemisinin down-regulation of CDK4 promoter activity and partially reversed the cell cycle arrest. Taken together, our results demonstrate that a key event in the artemisinin anti-proliferative effects in prostate cancer cells is the transcriptional down-regulation of CDK4 expression by disruption of Sp1 interactions with the CDK4 promoter. PMID:19017637

  12. Nucleolin regulates c-Jun/Sp1-dependent transcriptional activation of cPLA2alpha in phorbol ester-treated non-small cell lung cancer A549 cells.

    PubMed

    Tsou, Jen-Hui; Chang, Kwang-Yu; Wang, Wei-Chiao; Tseng, Joseph T; Su, Wu-Chou; Hung, Liang-Yi; Chang, Wen-Chang; Chen, Ben-Kuen

    2008-01-01

    The expression of cPLA2 is critical for transformed growth of non-small cell lung cancer (NSCLC). It is known that phorbol 12-myristate 13-acetate (PMA)-activated signal transduction pathway is thought to be involved in the oncogene action in NSCLC and enzymatic activation of cPLA2. However, the transcriptional regulation of cPLA2alpha in PMA-activated NSCLC is not clear. In this study, we found that PMA induced the mRNA level and protein expression of cPLA2alpha. In addition, two Sp1-binding sites of cPLA2alpha promoter were required for response to PMA and c-Jun overexpression. Small interfering RNA (siRNA) of c-Jun and nucleolin inhibited PMA induced the promoter activity and protein expression of cPLA2alpha. Furthermore, PMA stimulated the formation of c-Jun/Sp1 and c-Jun/nucleolin complexes as well as the binding of these transcription factor complexes to the cPLA2alpha promoter. Although Sp1-binding sites were required for the bindings of Sp1 and nucleolin to the promoter, the binding of nucleolin or Sp1 to the promoter was independent of each other. Our results revealed that c-Jun/nucleolin and c-Jun/Sp1 complexes play an important role in PMA-regulated cPLA2alpha gene expression. It is likely that nucleolin binding at place of Sp1 on gene promoter could also mediate the regulation of c-Jun/Sp1-activated genes. PMID:18025046

  13. A factorization approach to next-to-leading-power threshold logarithms

    NASA Astrophysics Data System (ADS)

    Bonocore, D.; Laenen, E.; Magnea, L.; Melville, S.; Vernazza, L.; White, C. D.

    2015-06-01

    Threshold logarithms become dominant in partonic cross sections when the selected final state forces gluon radiation to be soft or collinear. Such radiation factorizes at the level of scattering amplitudes, and this leads to the resummation of threshold logarithms which appear at leading power in the threshold variable. In this paper, we consider the extension of this factorization to include effects suppressed by a single power of the threshold variable. Building upon the Low-Burnett-Kroll-Del Duca (LBKD) theorem, we propose a decomposition of radiative amplitudes into universal building blocks, which contain all effects ultimately responsible for next-to-leading-power (NLP) threshold logarithms in hadronic cross sections for electroweak annihilation processes. In particular, we provide a NLO evaluation of the radiative jet function, responsible for the interference of next-to-soft and collinear effects in these cross sections. As a test, using our expression for the amplitude, we reproduce all abelian-like NLP threshold logarithms in the NNLO Drell-Yan cross section, including the interplay of real and virtual emissions. Our results are a significant step towards developing a generally applicable resummation formalism for NLP threshold effects, and illustrate the breakdown of next-to-soft theorems for gauge theory amplitudes at loop level.

  14. Lead exposure in children: levels in blood, prevalence of intoxication and related factors.

    PubMed

    Solé, E; Ballabriga, A; Domínguez, C

    1998-09-01

    Lead is a highly toxic metal, the main source of which is contamination from combustion of unleaded petrol. The aims of this work were to detect the degree of lead exposure in a large sample of children; determine the relationship between blood lead levels (BPb) and age, sex, habitat and season of the year; and correlate BPb with zinc protoporphyrin (ZPP) values. A cross-sectional study was carried out. Blood from routine extractions drawn at our centre was used. BPb and ZPP were measured by atomic absorption spectrophotometry and haematofluorimetry, respectively. We analysed 1158 blood samples from children. BPb (mean +/- SEM): 0.22 +/- 0.04 mumol l-1. Correlation BPb-age: BPb = 0.19 + 0.086 x age (months), r = 0.129, P < 0.0001. BPb was greater in boys (0.23 +/- 0.007 versus 0.20 +/- 0.006 mumol l-1, P < 0.0002). No differences were observed between habitats (urban versus rural). BPb were higher in the warm months (0.24 +/- 0.013 versus 0.21 +/- 0.007 mumol l-1, P < 0.0001). Prevalence of lead intoxication (BPb > 0.48 mumol l-1) was 4.2%. No differences in prevalence were found among the different groups. The correlation between BPb and ZPP showed r = 0.0969, P = 0.0024. Utility for screening: sensitivity of 53.7% and specificity of 59.3% (cut-off point of 60 mumol ZPP mol-1 haem). We can conclude that lead exposure in children in our sample was in the range reported in similar studies in other areas and countries, and below the toxic limit. None of the factors analysed significantly influenced lead intoxication prevalence. There was no good correlation between ZPP and BPb in our samples and the ZPP cut-off point used did not present good specificity and sensitivity values. PMID:9850561

  15. Analysis of lead/acid battery life cycle factors: their impact on society and the lead industry

    NASA Astrophysics Data System (ADS)

    Robertson, J. G. S.; Wood, J. R.; Ralph, B.; Fenn, R.

    The underlying theme of this paper is that society, globally, is undergoing a fundamental conceptual shift in the way it views the environment and the role of industry within it. There are views in certain quarters that this could result in the virtual elimination of the lead industry's entire product range. Despite these threats, it is argued that the prospects for the lead industry appear to be relatively favourable in a number of respects. The industry's future depends to a significant degree, however, upon its ability to argue its case in a number of key areas. It is contended, therefore, that if appropriate strategies and means are promulgated, the prospects of the industry would appear to be relatively healthy. But, for this to happen with optimal effectiveness, a conceptual change will be necessary within the industry. New strategies and tools will have to be developed. These will require a significantly more integrated, holistically based and 'reflexive' approach than previously. The main elements of such an approach are outlined. With reference to the authors' ongoing research into automotive lead/acid starting lighting ignition (SLI) batteries, the paper shows how the technique of in-depth life cycle assessment (LCA), appropriately adapted to the needs of the industry, will provide a crucial role in this new approach. It also shows how it may be used as an internal design and assessment tool to identify those stages in the battery life cycle that give rise to the greatest environmental burdens, and to assess the effects of changes in the cycle to those burdens. It is argued that the development of this approach requires the serious and urgent attention of the whole of the lead industry. Also to make the LCA tool fully effective, it must be based on a 'live' database that is produced, maintained and continually updated by the industry.

  16. Bovine lactoferricin induces TIMP-3 via the ERK1/2-Sp1 axis in human articular chondrocytes

    PubMed Central

    Yan, Dongyao; Chen, Di; Hawse, John R; van Wijnen, Andre J; Im, Hee-Jeong

    2013-01-01

    Bovine lactoferricin (LfcinB) is a heparan sulfate-binding peptide with multiple bioactivities. In human articular cartilage, LfcinB antagonizes interleukin-1 β (IL-1β) and fibroblast growth factor 2 (FGF-2) in proteoglycan metabolism, catabolic protease expression, and induction of pro-inflammatory mediators. LfcinB specifically activates ERK1/2, p38 and Akt, but whether these signaling pathways control the expression of LfcinB target genes remained unknown. In this report, we characterized a novel aspect of LfcinB-mediated genetic response in human articular chondrocytes, tissue inhibitor of metalloproteinase 3 (TIMP-3) induction. Inhibition of individual signaling pathways revealed that ERK1/2 functions as the major pathway in TIMP-3 expression, whereas Akt plays a minor role. Further investigation identified Sp1 as a critical transcriptional activator in TIMP-3 regulation, and Sp1 activity is modulated by ERK1/2, not Akt. Comparative quantification indicates significant downregulation of TIMP-3 occurs in OA chondrocytes, suggesting a beneficial role of LfcinB in OA pathogenesis. Our results collectively provide new insights into the mechanism of action of LfcinB, and support the candidacy of LfcinB as a chondroprotective agent. PMID:23313877

  17. Loss of proteolytically processed filaggrin caused by epidermal deletion of Matriptase/MT-SP1

    PubMed Central

    List, Karin; Szabo, Roman; Wertz, Philip W.; Segre, Julie; Haudenschild, Christian C.; Kim, Soo-Youl; Bugge, Thomas H.

    2003-01-01

    Profilaggrin is a large epidermal polyprotein that is proteolytically processed during keratinocyte differentiation to release multiple filaggrin monomer units as well as a calcium-binding regulatory NH2-terminal filaggrin S-100 protein. We show that epidermal deficiency of the transmembrane serine protease Matriptase/MT-SP1 perturbs lipid matrix formation, cornified envelope morphogenesis, and stratum corneum desquamation. Surprisingly, proteomic analysis of Matriptase/MT-SP1–deficient epidermis revealed the selective loss of both proteolytically processed filaggrin monomer units and the NH2-terminal filaggrin S-100 regulatory protein. This was associated with a profound accumulation of profilaggrin and aberrant profilaggrin-processing products in the stratum corneum. The data identify keratinocyte Matriptase/MT-SP1 as an essential component of the profilaggrin-processing pathway and a key regulator of terminal epidermal differentiation. PMID:14638864

  18. An Sp1 binding site and the minimal promoter contribute to overexpression of the cytokeratin 18 gene in tumorigenic clones relative to that in nontumorigenic clones of a human carcinoma cell line.

    PubMed Central

    Gunther, M; Frebourg, T; Laithier, M; Fossar, N; Bouziane-Ouartini, M; Lavialle, C; Brison, O

    1995-01-01

    Clones of cells tumorigenic or nontumorigenic in nude mice have been previously isolated from the SW613-S human colon carcinoma cell line. We have already reported that tumorigenic cells overexpress the cytokeratin 18 (K18) gene in comparison with nontumorigenic cells and that this difference is mainly due to a transcriptional regulation. We now report that a 2,532-bp cloned human K18 gene promoter drives the differential expression of a reporter gene in a transient assay. A 62-bp minimal K18 promoter (TATA box and initiation site) has a low but differential activity. Analysis of deletion and substitution mutants as well as hybrid SV40-K18 promoters and reconstructed K18 promoters indicated that an important element for the activity of the K18 promoter is a high-affinity binding site for transcription factor Sp1 located just upstream of the TATA box. This Sp1 binding element, as well as the intron 1 enhancer element, stimulates the basal activity of the minimal promoter through mechanisms that maintain the differential activity. Gel shift assays and the use of an anti-Sp1 antibody have shown that both tumorigenic and nontumorigenic SW613-S cells contain three factors able to bind to the Sp1 binding element site and that one of them is Sp1. A hybrid GAL4-Sp1 protein transactivated to comparable extents in tumorigenic and nontumorigenic cells a reconstructed K18 promoter containing GAL4 binding sites and therefore without altering its differential behavior. These results indicate that the Sp1 transcription factor is involved in the overexpression of the K18 gene in tumorigenic SW613-S cells through its interaction with a component of the basal transcription machinery. PMID:7537848

  19. Crucial Dimensions of Human Altruism. Affective vs. Conceptual Factors Leading to Helping or Reinforcing Others

    PubMed Central

    Szuster, Anna

    2016-01-01

    The aim of this article is to identify factors leading to favorable attitudes toward other people from different social categories. The parts of article reflect diverse levels of altruism regulation from primary affective responses to the environment, through social norms, to abstract moral concepts related to good and evil. The latter allow understanding of the perspective of other people (including those belonging to out-groups), acceptance of their values and engagement not only in helping behavior but also in supporting the development of others. PMID:27148127

  20. Crucial Dimensions of Human Altruism. Affective vs. Conceptual Factors Leading to Helping or Reinforcing Others.

    PubMed

    Szuster, Anna

    2016-01-01

    The aim of this article is to identify factors leading to favorable attitudes toward other people from different social categories. The parts of article reflect diverse levels of altruism regulation from primary affective responses to the environment, through social norms, to abstract moral concepts related to good and evil. The latter allow understanding of the perspective of other people (including those belonging to out-groups), acceptance of their values and engagement not only in helping behavior but also in supporting the development of others. PMID:27148127

  1. Imported Flood-Related Leptospirosis From Palau: Awareness of Risk Factors Leads to Early Treatment.

    PubMed

    Matono, Takashi; Kutsuna, Satoshi; Koizumi, Nobuo; Fujiya, Yoshihiro; Takeshita, Nozomi; Hayakawa, Kayoko; Kanagawa, Shuzo; Kato, Yasuyuki; Ohmagari, Norio

    2015-01-01

    We describe two Japanese travelers with leptospirosis who visited Palau. Both travelers swam in Ngardmau Falls, which was flooded for two days after typhoon Phanfone. The diagnoses were confirmed by microscopic agglutination test or polymerase chain reaction. This is the first report of leptospirosis in travelers who returned from Palau. It should be noted that choosing the appropriate test to biologically confirm leptospirosis was highly time-dependent. Awareness of the risk factors for leptospirosis, mainly that of the exposure to contaminated fresh water after a flooding, would lead to an early and appropriate treatment before the confirmed diagnosis. PMID:26503094

  2. Early experiences with the IBM SP1 and the high-performance switch

    SciTech Connect

    Gropp, W.

    1993-11-01

    The IBM SP1 is IBM`s newest parallel distributed-memory computer. As part of a joint project with IBM, Argonne took delivery of an early system in order to evaluate the software environment and to begin porting programming packages and applications to this machine. This report discusses the results of those efforts once the high-performance switch was installed. An earlier report (ANL/MCS-TM-177) emphasized software usability and the initial ports to the SP1. This report contains performance results and discusses some applications and tools not covered in TM 177.

  3. Zinc Finger Independent Genome-Wide Binding of Sp2 Potentiates Recruitment of Histone-Fold Protein Nf-y Distinguishing It from Sp1 and Sp3

    PubMed Central

    Finkernagel, Florian; Stiewe, Thorsten; Nist, Andrea; Suske, Guntram

    2015-01-01

    Transcription factors are grouped into families based on sequence similarity within functional domains, particularly DNA-binding domains. The Specificity proteins Sp1, Sp2 and Sp3 are paradigmatic of closely related transcription factors. They share amino-terminal glutamine-rich regions and a conserved carboxy-terminal zinc finger domain that can bind to GC rich motifs in vitro. All three Sp proteins are ubiquitously expressed; yet they carry out unique functions in vivo raising the question of how specificity is achieved. Crucially, it is unknown whether they bind to distinct genomic sites and, if so, how binding site selection is accomplished. In this study, we have examined the genomic binding patterns of Sp1, Sp2 and Sp3 in mouse embryonic fibroblasts by ChIP-seq. Sp1 and Sp3 essentially occupy the same promoters and localize to GC boxes. The genomic binding pattern of Sp2 is different; Sp2 primarily localizes at CCAAT motifs. Consistently, re-expression of Sp2 and Sp3 mutants in corresponding knockout MEFs revealed strikingly different modes of genomic binding site selection. Most significantly, while the zinc fingers dictate genomic binding of Sp3, they are completely dispensable for binding of Sp2. Instead, the glutamine-rich amino-terminal region is sufficient for recruitment of Sp2 to its target promoters in vivo. We have identified the trimeric histone-fold CCAAT box binding transcription factor Nf-y as the major partner for Sp2-chromatin interaction. Nf-y is critical for recruitment of Sp2 to co-occupied regulatory elements. Equally, Sp2 potentiates binding of Nf-y to shared sites indicating the existence of an extensive Sp2-Nf-y interaction network. Our results unveil strikingly different recruitment mechanisms of Sp1/Sp2/Sp3 transcription factor members uncovering an unexpected layer of complexity in their binding to chromatin in vivo. PMID:25793500

  4. Factors Leading to Variability of Emission Factors, Single Scattering Albedo, and Elemental Carbon Fraction from Biofuel Emissions

    NASA Astrophysics Data System (ADS)

    Roden, C. A.; Bond, T. C.; Conway, S.; Osorto Pinel, B.; Maccarty, N.

    2006-12-01

    In a three-year study of field and laboratory emissions of traditional and improved biofuel cookstoves, we found that field measured particulate emissions of actual cooking events average 2.5 times those of reproduced lab emissions. Emission factors are highly dependent on the care and skill of the operator, and the resulting combustion; these do not appear to be accurately reproduced in the lab. The single scatter albedo (SSA) of the emissions is very low in both lab and field measurements, averaging about 0.3 for lab tests and around 0.5 for field tests, indicating that the primary particles are climate warming. In Honduras, improved stoves generally had lower emission factors than traditional stoves. Over the course of 3 summers we have measured field emissions from traditional cookstoves, relatively-new improved cookstoves, and "broken-in" improved cookstoves. For improved stoves, the presence of a chimney generally resulted in lower emission factors but left the SSA unaffected. Traditional cookstoves had an average PM emission factor of 8.5 g/kg significantly larger than previous studies. Particulate emission factors for improved cookstoves without and with chimneys averaged about 5.7 g/kg and 3.5 g/kg respectively. The elemental carbon (EC) fraction of PM varied significantly between individual tests, but averaged about 25% for each of the categories. Wood type affects on the PM emission factor, the SSA of the emissions and EC fraction. During our 2006 field measurements, we performed multiple emission measurements on the same stove while varying the fuel. Pine wood generally produced more PM than oak per kilogram of fuel. Additionally, Ocote, a resinous pitch pine often used in Central America for lighting fires, produces emissions which have a very low SSA and high EC fraction. We present the elemental carbon fraction and mass emission factors for different type of stoves and testing conditions. We summarize the characteristics of the particles emitted

  5. Factorization for groomed jet substructure beyond the next-to-leading logarithm

    NASA Astrophysics Data System (ADS)

    Frye, Christopher; Larkoski, Andrew J.; Schwartz, Matthew D.; Yan, Kai

    2016-07-01

    Jet grooming algorithms are widely used in experimental analyses at hadron colliders to remove contaminating radiation from within jets. While the algorithms perform a great service to the experiments, their intricate algorithmic structure and multiple parameters has frustrated precision theoretic understanding. In this paper, we demonstrate that one particular groomer called soft drop actually makes precision jet substructure easier. In particular, we derive a factorization formula for a large class of soft drop jet substructure observables, including jet mass. The essential observation that allows for this factorization is that, without the soft wide-angle radiation groomed by soft drop, all singular contributions are collinear. The simplicity and universality of the collinear limit in QCD allows us to show that to all orders, the normalized differential cross section has no contributions from non-global logarithms. It is also independent of process, up to the relative fraction of quark and gluon jets. In fact, soft drop allows us to define this fraction precisely. The factorization theorem also explains why soft drop observables are less sensitive to hadronization than their ungroomed counterparts. Using the factorization theorem, we resum the soft drop jet mass to next-to-next-to-leading logarithmic accuracy. This requires calculating some clustering effects that are closely related to corresponding effects found in jet veto calculations. We match our resummed calculation to fixed order results for both e + e - → dijets and pp → Z + j events, producing the first jet substructure predictions (groomed or ungroomed) to this accuracy for the LHC.

  6. Can mammographic assessments lead to consider density as a risk factor for breast cancer?

    PubMed

    Colin, C; Prince, V; Valette, P J

    2013-03-01

    Admitting that mammographic breast density is an important independent risk factor for breast cancer in the general population, has a crucial economical health care impact, since it might lead to increasing screening frequency or reinforcing additional modalities. Thus, the impact of density as a risk factor has to be carefully investigated and might be debated. Some authors suggested that high density would be either a weak factor or confused with a masking effect. Others concluded that most of the studies have methodological biases in basic physics to quantify percentage of breast density, as well as in mammographic acquisition parameters. The purpose of this review is to evaluate mammographic procedures and density assessments in published studies regarding density as a breast cancer risk. No standardization was found in breast density assessments and compared density categories. High density definitions varied widely from 25 to 75% of dense tissues on mammograms. Some studies showed an insufficient follow-up to reveal masking effect related to mammographic false negatives. Evaluating breast density impact needs thorough studies with consensual mammographic procedures, methods of density measurement, breast density classification as well as a standardized definition of high breast density. Digital mammography, more effective in dense breasts, should help to re-evaluate the issue of density as a risk factor for breast cancer. PMID:20133095

  7. Lead halide perovskite nanowire lasers with low lasing thresholds and high quality factors.

    PubMed

    Zhu, Haiming; Fu, Yongping; Meng, Fei; Wu, Xiaoxi; Gong, Zizhou; Ding, Qi; Gustafsson, Martin V; Trinh, M Tuan; Jin, Song; Zhu, X-Y

    2015-06-01

    The remarkable performance of lead halide perovskites in solar cells can be attributed to the long carrier lifetimes and low non-radiative recombination rates, the same physical properties that are ideal for semiconductor lasers. Here, we show room-temperature and wavelength-tunable lasing from single-crystal lead halide perovskite nanowires with very low lasing thresholds (220 nJ cm(-2)) and high quality factors (Q ∼ 3,600). The lasing threshold corresponds to a charge carrier density as low as 1.5 × 10(16) cm(-3). Kinetic analysis based on time-resolved fluorescence reveals little charge carrier trapping in these single-crystal nanowires and gives estimated lasing quantum yields approaching 100%. Such lasing performance, coupled with the facile solution growth of single-crystal nanowires and the broad stoichiometry-dependent tunability of emission colour, makes lead halide perovskites ideal materials for the development of nanophotonics, in parallel with the rapid development in photovoltaics from the same materials. PMID:25849532

  8. Environmental Factors Predicting Blood Lead Levels in Pregnant Women in the UK: The ALSPAC Study

    PubMed Central

    Taylor, Caroline M.; Golding, Jean; Hibbeln, Joseph; Emond, Alan M.

    2013-01-01

    Background Lead is a widespread environmental toxin. The behaviour and academic performance of children can be adversely affected even at low blood lead levels (BLL) of 5–10 µg/dl. An important contribution to the infant's lead load is provided by maternal transfer during pregnancy. Objectives Our aim was to determine BLL in a large cohort of pregnant women in the UK and to identify the factors that contribute to BLL in pregnant women. Methods Pregnant women resident in the Avon area of the UK were enrolled in the Avon Longitudinal Study of Parents and Children (ALSPAC) in 1991–1992. Whole blood samples were collected at median gestational age of 11 weeks and analysed by inductively coupled plasma dynamic reaction cell mass spectrometry (n = 4285). Self-completion postal questionnaires were used to collect data during pregnancy on lifestyle, diet and other environmental exposures. Statistical analysis was carried out with SPSS v19. Results The mean±SD BLL was 3.67±1.47 (median 3.41, range 0.41–19.14) µg/dl. Higher educational qualification was found to be one of the strongest independent predictor of BLL in an adjusted backwards stepwise logistic regression to predict maternal BLL <5 or ≥5 µg/dl (odds ratio 1.26, 95% confidence interval 1.12–1.42; p<0.001). Other predictive factors included cigarette smoking, alcohol and coffee drinking, and heating the home with a coal fire, with some evidence for iron and calcium intake having protective effects. Conclusion The mean BLL in this group of pregnant women is higher than has been found in similar populations in developed countries. The finding that high education attainment was independently associated with higher BLL was unexpected and currently unexplained. Reduction in maternal lead levels can best be undertaken by reducing intake of the social drugs cigarettes, alcohol and caffeine, although further investigation of the effect of calcium on lead levels is needed. PMID:24039753

  9. Blood Lead Levels and Serum Insulin-Like Growth Factor 1 Concentrations in Peripubertal Boys

    PubMed Central

    Fleisch, Abby F.; Burns, Jane S.; Williams, Paige L.; Lee, Mary M.; Sergeyev, Oleg; Korrick, Susan A.

    2013-01-01

    Background: Childhood lead exposure has been associated with growth delay. However, the association between blood lead levels (BLLs) and insulin-like growth factor 1 (IGF-1) has not been characterized in a large cohort with low-level lead exposure. Methods: We recruited 394 boys 8–9 years of age from an industrial Russian town in 2003–2005 and followed them annually thereafter. We used linear regression models to estimate the association of baseline BLLs with serum IGF-1 concentration at two follow-up visits (ages 10–11 and 12–13 years), adjusting for demographic and socioeconomic covariates. Results: At study entry, median BLL was 3 μg/dL (range, < 0.5–31 μg/dL), most boys (86%) were prepubertal, and mean ± SD height and BMI z-scores were 0.14 ± 1.0 and –0.2 ± 1.3, respectively. After adjustment for covariates, the mean follow-up IGF-1 concentration was 29.2 ng/mL lower (95% CI: –43.8, –14.5) for boys with high versus low BLL (≥ 5 μg/dL or < 5 μg/dL); this difference persisted after further adjustment for pubertal status. The association of BLL with IGF-1 was stronger for mid-pubertal than prepubertal boys (p = 0.04). Relative to boys with BLLs < 2 μg/dL, adjusted mean IGF-1 concentrations decreased by 12.8 ng/mL (95% CI: –29.9, 4.4) for boys with BLLs of 3–4 μg/dL; 34.5 ng/mL (95% CI: –53.1, –16.0) for BLLs 5–9 μg/dL; and 60.4 ng/mL (95% CI: –90.9, –29.9) for BLLs ≥ 10 μg/dL. Conclusions: In peripubertal boys with low-level lead exposure, higher BLLs were associated with lower serum IGF-1. Inhibition of the hypothalamic–pituitary–growth axis may be one possible pathway by which lead exposure leads to growth delay. PMID:23632160

  10. AmeriFlux US-SP1 Slashpine-Austin Cary- 65yrs nat regen

    SciTech Connect

    Martin, Tim

    2016-01-01

    This is the AmeriFlux version of the carbon flux data for the site US-SP1 Slashpine-Austin Cary- 65yrs nat regen. Site Description - The ACMF site is a 67 hectare naturally regenerated Pinus palustris and Pinus elliottii mixed stand.

  11. Scalability study of parallel spatial direct numerical simulation code on IBM SP1 parallel supercomputer

    NASA Technical Reports Server (NTRS)

    Hanebutte, Ulf R.; Joslin, Ronald D.; Zubair, Mohammad

    1994-01-01

    The implementation and the performance of a parallel spatial direct numerical simulation (PSDNS) code are reported for the IBM SP1 supercomputer. The spatially evolving disturbances that are associated with laminar-to-turbulent in three-dimensional boundary-layer flows are computed with the PS-DNS code. By remapping the distributed data structure during the course of the calculation, optimized serial library routines can be utilized that substantially increase the computational performance. Although the remapping incurs a high communication penalty, the parallel efficiency of the code remains above 40% for all performed calculations. By using appropriate compile options and optimized library routines, the serial code achieves 52-56 Mflops on a single node of the SP1 (45% of theoretical peak performance). The actual performance of the PSDNS code on the SP1 is evaluated with a 'real world' simulation that consists of 1.7 million grid points. One time step of this simulation is calculated on eight nodes of the SP1 in the same time as required by a Cray Y/MP for the same simulation. The scalability information provides estimated computational costs that match the actual costs relative to changes in the number of grid points.

  12. Cardiovascular Risk Factors Promote Brain Hypoperfusion Leading to Cognitive Decline and Dementia

    PubMed Central

    de la Torre, Jack C.

    2012-01-01

    Heart disease is the major leading cause of death and disability in the world. Mainly affecting the elderly population, heart disease and its main outcome, cardiovascular disease, have become an important risk factor in the development of cognitive decline and Alzheimer's disease (AD). This paper examines the evidence linking chronic brain hypoperfusion induced by a variety of cardiovascular deficits in the development of cognitive impairment preceding AD. The evidence indicates a strong association between AD and cardiovascular risk factors, including ApoE4, atrial fibrillation, thrombotic events, hypertension, hypotension, heart failure, high serum markers of inflammation, coronary artery disease, low cardiac index, and valvular pathology. In elderly people whose cerebral perfusion is already diminished by their advanced age, additional reduction of cerebral blood flow stemming from abnormalities in the heart-brain vascular loop ostensibly increases the probability of developing AD. Evidence also suggests that a neuronal energy crisis brought on by relentless brain hypoperfusion may be responsible for protein synthesis abnormalities that later result in the classic neurodegenerative lesions involving the formation of amyloid-beta plaques and neurofibrillary tangles. Insight into how cardiovascular risk factors can induce progressive cognitive impairment offers an enhanced understanding of the multifactorial pathophysiology characterizing AD and ways at preventing or managing the cardiovascular precursors of this dementia. PMID:23243502

  13. SP1 as a novel scaffold building block for self-assembly nanofabrication of submicron enzymatic structures.

    PubMed

    Heyman, Arnon; Levy, Ilan; Altman, Arie; Shoseyov, Oded

    2007-06-01

    In this study, SP1, a ring-shaped highly stable homododecamer protein complex was utilized for the self-assembly of multiple domains in a predefined manner. Glucose oxidase (GOx) was fused in-frame to SP1 and expressed in Escherichia coli. Complexes where GOx encircled SP1 dodecamer were observed, and moreover, the enzymatic monomers self-assembled into active multienzyme nanotube particles containing hundreds of GOx molecules per tube. This work demonstrates the value of SP1 as a self-assembly scaffold. PMID:17530810

  14. Early factors leading to later obesity: interactions of the microbiome, epigenome, and nutrition.

    PubMed

    Chang, Lilly; Neu, Josef

    2015-05-01

    Obesity is a major public health problem in the United States and many other countries. Childhood obesity rates have risen extensively over the last several decades with the numbers continuing to rise. Obese and overweight children are at high risk of becoming overweight adolescents and adults. The causes are multifactorial and are affected by various genetic, behavioral, and environmental factors. This review aims to discuss a previously under-recognized antecedent of obesity and related chronic metabolic diseases such as heart disease and diabetes. Specifically, we highlight the relationship of the microbial ecology of the gastrointestinal tract during early development and the consequent effects on metabolism, epigenetics, and inflammatory responses that can subsequently result in metabolic syndrome. Although studies in this area are just beginning, this area of research is rapidly expanding and may lead to early life interventions that may have significant impacts in the prevention of obesity. PMID:26043042

  15. p53 inhibits the expression of p125 and the methylation of POLD1 gene promoter by downregulating the Sp1-induced DNMT1 activities in breast cancer

    PubMed Central

    Zhang, Liang; Yang, Weiping; Zhu, Xiao; Wei, Changyuan

    2016-01-01

    p125 is one of four subunits of human DNA polymerases – DNA Pol δ as well as one of p53 target protein encoded by POLD1. However, the function and significance of p125 and the role that p53 plays in regulating p125 expression are not fully understood in breast cancer. Tissue sections of human breast cancer obtained from 70 patients whose median age was 47.6 years (range: 38–69 years) with stage II–III breast cancer were studied with normal breast tissue from the same patients and two human breast cell lines (MCF-7 and MCF-10A). p53 expression levels were reduced, while p125 protein expression was increased in human breast cancer tissues and cell line detected by Western blot and quantitative reverse transcriptase-polymerase chain reaction. The methylation level of the POLD1 gene promoter was greater in breast cancer tissues and cells when compared with normal tissues and cells. In MCF-7 cell model, p53 overexpression caused a decrease in the level of p125 protein, while the methylation level of the p125 gene promoter was also inhibited by p53 overexpression. To further investigate the regulating mechanism of p53 on p125 expression, our study focused on DNA methyltransferase 1 (DNMT1) and transcription factor Sp1. Both DNMT1 and Sp1 protein expression were reduced when p53 was overexpressed in MCF-7 cells. The Sp1 binding site appears to be important for DNMT1 gene transcription; Sp1 and p53 can bind together, which means that DNMT1 gene expression may be downregulated by p53 through binding to Sp1. Because DNMT1 methylation level of the p125 gene promoter can affect p125 gene transcription, we propose that p53 may indirectly regulate p125 gene promoter expression through the control of DNMT1 gene transcription. In conclusion, the data from this preliminary study have shown that p53 inhibits the methylation of p125 gene promoter by downregulating the activities of Sp1 and DNMT1 in breast cancer. PMID:27022290

  16. Investigating factors leading to fogging of glass vials in lyophilized drug products.

    PubMed

    Abdul-Fattah, Ahmad M; Oeschger, Richard; Roehl, Holger; Bauer Dauphin, Isabelle; Worgull, Martin; Kallmeyer, Georg; Mahler, Hanns-Christian

    2013-10-01

    Vial "Fogging" is a phenomenon observed after lyophilization due to drug product creeping upwards along the inner vial surface. After the freeze-drying process, a haze of dried powder is visible inside the drug product vial, making it barely acceptable for commercial distribution from a cosmetic point of view. Development studies were performed to identify the root cause for fogging during manufacturing of a lyophilized monoclonal antibody drug product. The results of the studies indicate that drug product creeping occurs during the filling process, leading to vial fogging after lyophilization. Glass quality/inner surface, glass conversion/vial processing (vial "history") and formulation excipients, e.g., surfactants (three different surfactants were tested), all affect glass fogging to a certain degree. Results showed that the main factor to control fogging is primarily the inner vial surface hydrophilicity/hydrophobicity. While Duran vials were not capable of reliably improving the level of fogging, hydrophobic containers provided reliable means to improve the cosmetic appearance due to reduction in fogging. Varying vial depyrogenation treatment conditions did not lead to satisfying results in removal of the fogging effect. Processing conditions of the vial after filling with drug product had a strong impact on reducing but not eliminating fogging. PMID:23791681

  17. Levels of Aggression among Turkish Adolescents and Factors Leading to Aggression.

    PubMed

    Avci, Dilek; Kilic, Mahmut; Tari Selcuk, Kevser; Uzuncakmak, Tugba

    2016-07-01

    Aggression, an increasing problem among adolescents, is a potential threat to public health as it can lead to violence. Determining the factors causing aggression plays an important role in taking measures to reduce violence. This study aimed at determining the level of aggression among adolescents and at identifying the factors associated with high levels of aggression. This cross-sectional study was conducted with 2,409 Turkish adolescents. Data were collected with the Socio-demographic Questionnaire, Aggression Scale, Perceived Social Support Scale, and Communication Skills Attitude Scale. Data were analyzed using descriptive statistics, the chi-square test, t-test, and logistic regression. The participants' mean aggression score was 91.83 ± 24.05, and 24.0% of the adolescents' aggression levels rated high. According to the logistic regression model, aggression was 1.26 times higher among males, 1.92 times higher among those who perceived their mental health as poor, 1.58 times higher among those with suicidal ideation, 1.29 times higher among those who did not get prepared for university entrance exams, and 1.62 times higher among those who perceived their school performance as poor. Perceived family social support was a protective factor against high aggression. Approximately one out of every four adolescents in the two Turkish high schools where the study was conducted was determined to display high levels of aggression. Therefore, in order to reduce aggression among adolescents, programs such as coping management and coping with anger should be applied by nurses. Programs should include not only students but also families. PMID:27111434

  18. Numerical and experimental analysis of factors leading to suture dehiscence after Billroth II gastric resection.

    PubMed

    Cvetkovic, Aleksandar M; Milasinovic, Danko Z; Peulic, Aleksandar S; Mijailovic, Nikola V; Filipovic, Nenad D; Zdravkovic, Nebojsa D

    2014-11-01

    The main goal of this study was to numerically quantify risk of duodenal stump blowout after Billroth II (BII) gastric resection. Our hypothesis was that the geometry of the reconstructed tract after BII resection is one of the key factors that can lead to duodenal dehiscence. We used computational fluid dynamics (CFD) with finite element (FE) simulations of various models of BII reconstructed gastrointestinal (GI) tract, as well as non-perfused, ex vivo, porcine experimental models. As main geometrical parameters for FE postoperative models we have used duodenal stump length and inclination between gastric remnant and duodenal stump. Virtual gastric resection was performed on each of 3D FE models based on multislice Computer Tomography (CT) DICOM. According to our computer simulation the difference between maximal duodenal stump pressures for models with most and least preferable geometry of reconstructed GI tract is about 30%. We compared the resulting postoperative duodenal pressure from computer simulations with duodenal stump dehiscence pressure from the experiment. Pressure at duodenal stump after BII resection obtained by computer simulation is 4-5 times lower than the dehiscence pressure according to our experiment on isolated bowel segment. Our conclusion is that if the surgery is performed technically correct, geometry variations of the reconstructed GI tract by themselves are not sufficient to cause duodenal stump blowout. Pressure that develops in the duodenal stump after BII resection using omega loop, only in the conjunction with other risk factors can cause duodenal dehiscence. Increased duodenal pressure after BII resection is risk factor. Hence we recommend the routine use of Roux en Y anastomosis as a safer solution in terms of resulting intraluminal pressure. However, if the surgeon decides to perform BII reconstruction, results obtained with this methodology can be valuable. PMID:25201585

  19. Lead exposure in Laysan albatross adults and chicks in Hawaii: prevalence, risk factors, and biochemical effects.

    USGS Publications Warehouse

    Work, T.M.; Smith, M.R.

    1996-01-01

    Prevalence of lead exposure and elevated tissue lead was determined in Laysan albatross (Diomedea immutabilis) in Hawaii. The relationship between lead exposure and proximity to buildings, between elevated blood lead and droopwing status, and elevated liver lead and presence of lead-containing paint chips in the proventriculus in albatross chicks was also examined. Finally, the effects of lead on the enzyme δ-amino-levulinic acid dehydratase (ALAD) was determined. There was a significant association between lead exposure or elevated tissue lead and proximity to buildings in albatross chicks and presence of lead paint chips in the proventriculus and elevated liver lead in carcasses. Although there was a significant association between elevated blood lead and droopwing chicks, there were notable exceptions. Prevalence of elevated tissue lead in albatross chicks was highest on Sand Island Midway and much less so on Kauai and virtually nonexistent in other areas. Prevalence of lead exposure decreased as numbers of buildings to which chicks were exposed on a given island decreased. Laysan albatross adults had minimal to no lead exposure. There was a significant negative correlation between blood lead concentration and ALAD activity in chicks. Based on ALAD activity, 0.03-0.05 μg/ml was the no effect range for blood lead in albatross chicks.

  20. Venous Stenosis After Transvenous Lead Placement: A Study of Outcomes and Risk Factors in 212 Consecutive Patients

    PubMed Central

    Abu-El-Haija, Basil; Bhave, Prashant D; Campbell, Dwayne N; Mazur, Alexander; Hodgson-Zingman, Denice M; Cotarlan, Vlad; Giudici, Michael C

    2015-01-01

    Background Venous stenosis is a common complication of transvenous lead implantation, but the risk factors for venous stenosis have not been well defined to date. This study was designed to evaluate the incidence of and risk factors for venous stenosis in a large consecutive cohort. Methods and Results A total of 212 consecutive patients (136 male, 76 female; mean age 69 years) with existing pacing or implantable cardioverter-defibrillator systems presented for generator replacement, lead revision, or device upgrade with a mean time since implantation of 6.2 years. Venograms were performed and percentage of stenosis was determined. Variables studied included age, sex, number of leads, lead diameter, implant duration, insulation material, side of implant, and anticoagulant use. Overall, 56 of 212 patients had total occlusion of the subclavian or innominate vein (26%). There was a significant association between the number of leads implanted and percentage of venous stenosis (P =0.012). Lead diameter, as an independent variable, was not a risk factor; however, greater sum of the lead diameters implanted was a predictor of subsequent venous stenosis (P =0.009). Multiple lead implant procedures may be associated with venous stenosis (P =0.057). No other variables approached statistical significance. Conclusions A significant association exists between venous stenosis and the number of implanted leads and also the sum of the lead diameters. When combined with multiple implant procedures, the incidence of venous stenosis is increased. PMID:26231843

  1. Cadmium down-regulation of kidney Sp1 binding to mouse SGLT1 and SGLT2 gene promoters: Possible reaction of cadmium with the zinc finger domain of Sp1

    SciTech Connect

    Kothinti, Rajendra K.; Blodgett, Amy B.; Petering, David H.; Tabatabai, Niloofar M.

    2010-05-01

    Cadmium (Cd) exposure causes glucosuria (glucose in the urine). Previously, it was shown that Cd exposure of primary cultures of mouse kidney cells (PMKC) decreased mRNA levels of the glucose transporters, SGLT1 and SGLT2 and that Sp1 from Cd-exposed cells displayed reduced binding to the GC boxes of the mouse SGLT1 promoter in vitro. Here, we identified a GC box upstream of mouse SGLT2 gene. ChIP assays on PMKC revealed that exposure to 5 muM Cd abolished Sp1 binding to SGLT1 GC box while it decreased Sp1 binding to SGLT2 GC sequence by 30% in vivo. The in vitro DNA binding assay, EMSA, demonstrated that binding of Sp1 from Cd (7.5 muM)-treated PMKC to the SGLT2 GC probe was 86% lower than in untreated cells. Sp1 is a zinc finger protein. Compared to PMKC exposed to 5 muM Cd alone, inclusion of 5 muM Zn restored SGLT1 and 2 mRNA levels by 15% and 30%, respectively. Cd (10 muM) decreased the binding of recombinant Sp1 (rhSp1) to SGLT1 and SGLT2 GC probes to 12% and 8% of untreated controls. Cd exerted no effect on GC-bound rhSp1. Co-treatment with Cd and Zn showed that added Zn significantly restored rhSp1 binding to the SGLT1 and SGLT2. Addition of Zn post Cd treatment was not stimulatory. We conclude that Cd can replace Zn in Sp1 DNA binding domain to reduce its binding to GC sites in mouse SGLT1 and SGLT2 promoters.

  2. Aspen SP1, an exceptional thermal, protease and detergent-resistant self-assembled nano-particle.

    PubMed

    Wang, Wang-Xia; Dgany, Or; Wolf, Sharon Grayer; Levy, Ilan; Algom, Rachel; Pouny, Yehonathan; Wolf, Amnon; Marton, Ira; Altman, Arie; Shoseyov, Oded

    2006-09-01

    Stable protein 1 (SP1) is a homo-oligomeric protein isolated from aspen (Populus tremula aspen) plants which forms a ring-shape dodecameric particle with a central cavity. The oligomeric form of SP1 is an exceptionally stable structure that is resistant to proteases (e.g., trypsin, V8, and proteinase K), high temperatures, organic solvents, and high levels of ionic detergent. Analytical ultra-centrifugation, chemical cross-linking, matrix-assisted laser-desorption time-of-flight mass spectrometry (MALDI-TOF-MS), and transmission electron microscopy were used to further characterize the SP1 dodecamer. Introduction of a single cysteine at the N-terminus of SP1 enabled the formation of disulfide bridges within the SP1 dodecamer, concurrent with increased melting point. A six-histidine tag was introduced at the N-terminus of SP1 to generate 6HSP1, and the DeltaNSP1 mutant was generated by a deletion of amino acids 2-6 at the N-terminus. Both 6HSP1 and DeltaNSP1 maintained their ability to assemble a stable dodecamer. Remarkably, these SP1 homo-dodecamers were able to re-assemble into stable hetero-dodecamers following co-electro-elution from SDS-PAGE. The exceptional stability of the SP1-nano ring and its ability to self-assemble hetero-complexes paves the way to further research in utilizing this unique protein in nano-biotechnology. PMID:16732592

  3. Species-specific interaction of the glutamine-rich activation domains of Sp1 with the TATA box-binding protein.

    PubMed Central

    Emili, A; Greenblatt, J; Ingles, C J

    1994-01-01

    We have used protein-blotting and protein affinity chromatography to demonstrate that each of the two glutamine-rich activation domains of the human transcription factor Sp1 can bind specifically and directly to the C-terminal evolutionarily conserved domain of the human TATA box-binding protein (TBP). These activation domains of Sp1 also bind directly to Drosophila TBP but bind much less strongly to TBP from the yeast Saccharomyces cerevisiae. The abilities of the Sp1 activation domains to interact directly with the TBPs of various species correlate well with their abilities to activate transcription in extracts derived from the same species. We also show that a glutamine-rich transcriptional activating region of the Drosophila protein Antennapedia binds directly to TBP in a species-specific manner that reflects its ability to activate transcription in vivo. These results support the notion that TBP is a direct and important target of glutamine-rich transcriptional activators. Images PMID:8114696

  4. Up-regulation of Hsp27 by ERα/Sp1 facilitates proliferation and confers resistance to apoptosis in human papillary thyroid cancer cells.

    PubMed

    Mo, Xiao-Mei; Li, Li; Zhu, Ping; Dai, Yu-Jie; Zhao, Ting-Ting; Liao, Ling-Yao; Chen, George G; Liu, Zhi-Min

    2016-08-15

    17β-estradiol (E2) has been suggested to play a role in the development and progression of papillary thyroid cancer. Heat shock protein 27 (Hsp27) is a member of the Hsp family that is responsible for cell survival under stressful conditions. Previous studies have shown that the 5'-promoter region of Hsp27 gene contains a specificity protein-1 (Spl) and estrogen response element half-site (ERE-half), which contributes to Hsp27 induction by E2 in breast cancer cells. However, it is unclear whether Hsp27 can be up-regulated by E2 and which estrogen receptor (ER) isoform and tethered transcription factor are involved in this regulation in papillary thyroid cancer cells. In the present study, we demonstrated that Hsp27 can be effectively up-regulated by E2 at mRNA and protein levels in human K1 and BCPAP papillary thyroid cancer cells which have more than two times higher level of ERα than that of ERβ. The up-regulation of Hsp27 by E2 is mediated by ERα/Sp1 and ERβ has repressive effect on this ERα/Sp1-mediated up-regulation of Hsp27. Moreover, we showed that the up-regulation of Hsp27 by ERα/Sp1 facilitates proliferation and confers resistance to apoptosis through interaction with procaspase-3. Targeting this pathway may be a potential strategy for therapy of papillary thyroid cancer. PMID:27179757

  5. Involvement of the GC-rich sequence and specific proteins (Sp1/Sp3) in the basal transcription activity of neurogranin gene

    SciTech Connect

    Gui Jingang; Song Yan; Han, N.-L.R.; Zhou Shufeng; Sheu, F.-S. . E-mail: dbssfs@nus.edu.sg

    2006-06-23

    Neurogranin (Ng), a neuronal protein implicated in learning and memory, contains a TATA-less promoter. Analysis of 5'-deletion mutations and site-directed mutations of the mouse Ng promoter revealed that a 258 bp 5'-flanking sequence (+3 to +260) conferred the basal transcription activity, and that the GC-rich sequence (+22 to +33) served as an important determinant of the promoter activity. Transient transfection of the Sp1 expression plasmid transactivated the reporter activity in neuroblastoma N2A cells while knocking down of endogenous Sp1 expression resulted in a 2.5-fold reduction of the reporter activity in HEK 293 cells. Exogenous expression of Sp3 in HEK 293 cells, however, repressed the reporter activity by 50%. Nevertheless, by gel shift assays, Sp1 and Sp3 were not found to be responsible for the protein-DNA complexes formed by the GC-rich sequence. Moreover, a nuclear factor from the mouse brain tissues was discovered to bind to multiple AT-rich regions in Ng promoter.

  6. Creating Novel Activated Factor XI Inhibitors through Fragment Based Lead Generation and Structure Aided Drug Design

    PubMed Central

    Fjellström, Ola; Akkaya, Sibel; Beisel, Hans-Georg; Eriksson, Per-Olof; Erixon, Karl; Gustafsson, David; Jurva, Ulrik; Kang, Daiwu; Karis, David; Knecht, Wolfgang; Nerme, Viveca; Nilsson, Ingemar; Olsson, Thomas; Redzic, Alma; Roth, Robert; Sandmark, Jenny; Tigerström, Anna; Öster, Linda

    2015-01-01

    Activated factor XI (FXIa) inhibitors are anticipated to combine anticoagulant and profibrinolytic effects with a low bleeding risk. This motivated a structure aided fragment based lead generation campaign to create novel FXIa inhibitor leads. A virtual screen, based on docking experiments, was performed to generate a FXIa targeted fragment library for an NMR screen that resulted in the identification of fragments binding in the FXIa S1 binding pocket. The neutral 6-chloro-3,4-dihydro-1H-quinolin-2-one and the weakly basic quinolin-2-amine structures are novel FXIa P1 fragments. The expansion of these fragments towards the FXIa prime side binding sites was aided by solving the X-ray structures of reported FXIa inhibitors that we found to bind in the S1-S1’-S2’ FXIa binding pockets. Combining the X-ray structure information from the identified S1 binding 6-chloro-3,4-dihydro-1H-quinolin-2-one fragment and the S1-S1’-S2’ binding reference compounds enabled structure guided linking and expansion work to achieve one of the most potent and selective FXIa inhibitors reported to date, compound 13, with a FXIa IC50 of 1.0 nM. The hydrophilicity and large polar surface area of the potent S1-S1’-S2’ binding FXIa inhibitors compromised permeability. Initial work to expand the 6-chloro-3,4-dihydro-1H-quinolin-2-one fragment towards the prime side to yield molecules with less hydrophilicity shows promise to afford potent, selective and orally bioavailable compounds. PMID:25629509

  7. CYP1B1 Enhances Cell Proliferation and Metastasis through Induction of EMT and Activation of Wnt/β-Catenin Signaling via Sp1 Upregulation.

    PubMed

    Kwon, Yeo-Jung; Baek, Hyoung-Seok; Ye, Dong-Jin; Shin, Sangyun; Kim, Donghak; Chun, Young-Jin

    2016-01-01

    Cytochrome P450 1B1 (CYP1B1) is a major E2 hydroxylase involved in the metabolism of potential carcinogens. CYP1B1 expression has been reported to be higher in tumors compared to normal tissues, especially in hormone-related cancers including breast, ovary, and prostate tumors. To explore the role of CYP1B1 in cancer progression, we investigated the action of CYP1B1 in cells with increased CYP1B1 via the inducer 7,12-dimethylbenz[α]anthracene (DMBA) or an overexpression vector, in addition to decreased CYP1B1 via the inhibitor tetramethoxystilbene (TMS) or siRNA knockdown. We observed that CYP1B1 promoted cell proliferation, migration, and invasion in MCF-7 and MCF-10A cells. To understand its molecular mechanism, we measured key oncogenic proteins including β-catenin, c-Myc, ZEB2, and matrix metalloproteinases following CYP1B1 modulation. CYP1B1 induced epithelial-mesenchymal transition (EMT) and activated Wnt/β-catenin signaling via upregulation of CTNNB1, ZEB2, SNAI1, and TWIST1. Sp1, a transcription factor involved in cell growth and metastasis, was positively regulated by CYP1B1, and suppression of Sp1 expression by siRNA or DNA binding activity using mithramycin A blocked oncogenic transformation by CYP1B1. Therefore, we suggest that Sp1 acts as a key mediator for CYP1B1 action. Treatment with 4-hydroxyestradiol (4-OHE2), a major metabolite generated by CYP1B1, showed similar effects as CYP1B1 overexpression, indicating that CYP1B1 activity mediated various oncogenic events in cells. In conclusion, our data suggests that CYP1B1 promotes cell proliferation and metastasis by inducing EMT and Wnt/β-catenin signaling via Sp1 induction. PMID:26981862

  8. CYP1B1 Enhances Cell Proliferation and Metastasis through Induction of EMT and Activation of Wnt/β-Catenin Signaling via Sp1 Upregulation

    PubMed Central

    Kwon, Yeo-Jung; Baek, Hyoung-Seok; Ye, Dong-Jin; Shin, Sangyun; Kim, Donghak; Chun, Young-Jin

    2016-01-01

    Cytochrome P450 1B1 (CYP1B1) is a major E2 hydroxylase involved in the metabolism of potential carcinogens. CYP1B1 expression has been reported to be higher in tumors compared to normal tissues, especially in hormone-related cancers including breast, ovary, and prostate tumors. To explore the role of CYP1B1 in cancer progression, we investigated the action of CYP1B1 in cells with increased CYP1B1 via the inducer 7,12-dimethylbenz[α]anthracene (DMBA) or an overexpression vector, in addition to decreased CYP1B1 via the inhibitor tetramethoxystilbene (TMS) or siRNA knockdown. We observed that CYP1B1 promoted cell proliferation, migration, and invasion in MCF-7 and MCF-10A cells. To understand its molecular mechanism, we measured key oncogenic proteins including β-catenin, c-Myc, ZEB2, and matrix metalloproteinases following CYP1B1 modulation. CYP1B1 induced epithelial-mesenchymal transition (EMT) and activated Wnt/β-catenin signaling via upregulation of CTNNB1, ZEB2, SNAI1, and TWIST1. Sp1, a transcription factor involved in cell growth and metastasis, was positively regulated by CYP1B1, and suppression of Sp1 expression by siRNA or DNA binding activity using mithramycin A blocked oncogenic transformation by CYP1B1. Therefore, we suggest that Sp1 acts as a key mediator for CYP1B1 action. Treatment with 4-hydroxyestradiol (4-OHE2), a major metabolite generated by CYP1B1, showed similar effects as CYP1B1 overexpression, indicating that CYP1B1 activity mediated various oncogenic events in cells. In conclusion, our data suggests that CYP1B1 promotes cell proliferation and metastasis by inducing EMT and Wnt/β-catenin signaling via Sp1 induction. PMID:26981862

  9. Employing Lead Thiocyanate Additive to Reduce the Hysteresis and Boost the Fill Factor of Planar Perovskite Solar Cells.

    PubMed

    Ke, Weijun; Xiao, Chuanxiao; Wang, Changlei; Saparov, Bayrammurad; Duan, Hsin-Sheng; Zhao, Dewei; Xiao, Zewen; Schulz, Philip; Harvey, Steven P; Liao, Weiqiang; Meng, Weiwei; Yu, Yue; Cimaroli, Alexander J; Jiang, Chun-Sheng; Zhu, Kai; Al-Jassim, Mowafak; Fang, Guojia; Mitzi, David B; Yan, Yanfa

    2016-07-01

    Lead thiocyanate in the perovskite precursor can increase the grain size of a perovskite thin film and reduce the conductivity of the grain boundaries, leading to perovskite solar cells with reduced hysteresis and enhanced fill factor. A planar perovskite solar cell with grain boundary and interface passivation achieves a steady-state efficiency of 18.42%. PMID:27145346

  10. Sp1 mediates repression of the resistin gene by PPAR{gamma} agonists in 3T3-L1 adipocytes

    SciTech Connect

    Chung, S.S.; Choi, H.H.; Cho, Y.M.; Lee, H.K.; Park, K.S. . E-mail: kspark@snu.ac.kr

    2006-09-15

    Resistin is an adipokine related to obesity and insulin resistance. Expression of the resistin gene is repressed by the treatment of peroxisome proliferator-activated receptor {gamma} (PPAR{gamma}) agonists, thiazolidinediones (TZDs). In this study, we investigated the mechanism by which TZDs inhibit the resistin gene expression. Resistin gene expression was decreased by TZD in fully differentiated 3T3-L1 adipocytes, which was abolished after treatment of cycloheximide (a protein synthesis inhibitor). TZD could not repress the expression of the resistin gene in the presence of mithramycin A (an Sp1 binding inhibitor). Sp1 binding site of the resistin promoter (-122/-114 bp) was necessary for the repression. Further investigation of the effect of TZDs on the modification of Sp1 showed that the level of O-glycosylation of Sp1 was decreased in this process. These results suggest that PPAR{gamma} activation represses the expression of the resistin gene by modulating Sp1 activity.

  11. Complete genome sequence of Kosakonia sacchari type strain SP1T

    PubMed Central

    Chen, Mingyue; Zhu, Bo; Lin, Li; Yang, Litao; Li, Yangrui; An, Qianli

    2014-01-01

    Kosakonia sacchari sp. nov. is a new species within the new genus Kosakonia, which was included in the genus Enterobacter. K sacchari is a nitrogen-fixing bacterium named for its association with sugarcane (Saccharum officinarum L.). K sacchari bacteria are Gram-negative, aerobic, non-spore-forming, motile rods. Strain SP1T (=CGMCC1.12102T=LMG 26783T) is the type strain of the K sacchari sp. nov and is able to colonize and fix N2 in association with sugarcane plants, thus promoting plant growth. Here we summarize the features of strain SP1T and describe its complete genome sequence. The genome contains a single chromosome and no plasmids, 4,902,024 nucleotides with 53.7% GC content, 4,460 protein-coding genes and 105 RNA genes including 22 rRNA genes, 82 tRNA genes, and 1 ncRNA gene. PMID:25197499

  12. Lead contamination in tea leaves and non-edaphic factors affecting it.

    PubMed

    Jin, Chong Wei; He, Yun Feng; Zhang, Kai; Zhou, Gen Di; Shi, Jian Liang; Zheng, Shao Jian

    2005-11-01

    Recent tests have detected high lead (Pb) concentrations in some commercial brands of tea leaves and this finding has raised concerns due to the possible health-related problems associated with Pb poisoning. In present research, we investigated the Pb contamination in tea leaves produced in Zhejiang province in China. Pb concentrations in all tea leaves sampled were below 5 mg/kg, the permissible levels given by Chinese Ministry of Agriculture, indicating that Pb contamination in this province is not excessive. We then investigated the non-edaphic factors that may potentially contribute to Pb accumulation in tea leaves. Pb concentration in tea leaves was found to be positively correlated with the industrialization level of a district (R = 0.83, the significant level at P < 0.05), and greater amounts of Pb were washed from the leaves of plants in districts with more industrial activity. This suggests that Pb accumulation in tea leaves could, in part, be attributed to industrial activity through the precipitation of atmospheric Pb. Furthermore greater amounts of Pb were washed from the leaves of plants growing near road than those growing farther away from road. This trend indicates that automobile activity was another likely contributor to Pb accumulation in tea. Pb content of green tea was also affected by the processing of the leaves in the factory. In particular the twisting and water-removal stages caused increases in Pb content in the tea product. This study suggests that non-edaphic factors also contribute to the Pb accumulation in tea. PMID:16219507

  13. Characterization of SP1, a Stress-Responsive, Boiling-Soluble, Homo-Oligomeric Protein from Aspen1

    PubMed Central

    Wang, Wang-Xia; Pelah, Dan; Alergand, Tal; Shoseyov, Oded; Altman, Arie

    2002-01-01

    sp1 cDNA was isolated from aspen (Populus tremula) plants by immunoscreening an expression library using polyclonal antibodies against BspA protein. BspA, which is a boiling-stable protein, accumulates in aspen plants in response to water stress and abscisic acid application (Pelah et al., 1995). The sp1 cDNA was found to encode a 12.4-kD generally hydrophilic protein with a hydrophobic C terminus, which is different from the BspA protein and was termed SP1 (stable protein 1). Northern-blot analysis revealed that sp1 encodes a small mRNA (about 0.6 kb) that is expressed in aspen plants under non-stress conditions and is accumulated after salt, cold, heat, and desiccation stress, and during the recovery from stress. The SP1 detected in plants remained soluble upon boiling, migrated both as a 12.4-kD band and a much higher mass of 116 kD on a 17% (w/v) Tricine-sodium dodecyl sulfate-polyacrylamide gel. Comparative protease digestion patterns, amino acid analyses, and the N-terminal sequences of the 12.4- and 116-kD proteins revealed that SP1 is homo-oligomeric. Furthermore, gel filtration chromatography analysis indicated that SP1 exists in aspen plants as a complex, composed of 12 subunits of 12.4 kD. A large number of sequences deduced from expressed sequence tags and genomic sequences of other organisms with unknown function show high homology to SP1. Thus, SP1 may represent a new protein family. Here, we present the first report on this putative protein family: the cloning, isolation, and characterization of SP1, a stress-responsive, boiling-soluble, oligomeric protein. PMID:12376651

  14. Loss of runt-related transcription factor 3 expression leads hepatocellular carcinoma cells to escape apoptosis

    PubMed Central

    2011-01-01

    Background Runt-related transcription factor 3 (RUNX3) is known as a tumor suppressor gene for gastric cancer and other cancers, this gene may be involved in the development of hepatocellular carcinoma (HCC). Methods RUNX3 expression was analyzed by immunoblot and immunohistochemistry in HCC cells and tissues, respectively. Hep3B cells, lacking endogenous RUNX3, were introduced with RUNX3 constructs. Cell proliferation was measured using the MTT assay and apoptosis was evaluated using DAPI staining. Apoptosis signaling was assessed by immunoblot analysis. Results RUNX3 protein expression was frequently inactivated in the HCC cell lines (91%) and tissues (90%). RUNX3 expression inhibited 90 ± 8% of cell growth at 72 h in serum starved Hep3B cells. Forty-eight hour serum starvation-induced apoptosis and the percentage of apoptotic cells reached 31 ± 4% and 4 ± 1% in RUNX3-expressing Hep3B and control cells, respectively. Apoptotic activity was increased by Bim expression and caspase-3 and caspase-9 activation. Conclusion RUNX3 expression enhanced serum starvation-induced apoptosis in HCC cell lines. RUNX3 is deleted or weakly expressed in HCC, which leads to tumorigenesis by escaping apoptosis. PMID:21205319

  15. Noncovalent Mutant Selective Epidermal Growth Factor Receptor Inhibitors: A Lead Optimization Case Study.

    PubMed

    Heald, Robert; Bowman, Krista K; Bryan, Marian C; Burdick, Daniel; Chan, Bryan; Chan, Emily; Chen, Yuan; Clausen, Saundra; Dominguez-Fernandez, Belen; Eigenbrot, Charles; Elliott, Richard; Hanan, Emily J; Jackson, Philip; Knight, Jamie; La, Hank; Lainchbury, Michael; Malek, Shiva; Mann, Sam; Merchant, Mark; Mortara, Kyle; Purkey, Hans; Schaefer, Gabriele; Schmidt, Stephen; Seward, Eileen; Sideris, Steve; Shao, Lily; Wang, Shumei; Yeap, Kuen; Yen, Ivana; Yu, Christine; Heffron, Timothy P

    2015-11-25

    Because of their increased activity against activating mutants, first-generation epidermal growth factor receptor (EGFR) kinase inhibitors have had remarkable success in treating non-small-cell lung cancer (NSCLC) patients, but acquired resistance, through a secondary mutation of the gatekeeper residue, means that clinical responses only last for 8-14 months. Addressing this unmet medical need requires agents that can target both of the most common double mutants: T790M/L858R (TMLR) and T790M/del(746-750) (TMdel). Herein we describe how a noncovalent double mutant selective lead compound was optimized using a strategy focused on the structure-guided increase in potency without added lipophilicity or reduction of three-dimensional character. Following successive rounds of design and synthesis it was discovered that cis-fluoro substitution on 4-hydroxy- and 4-methoxypiperidinyl groups provided synergistic, substantial, and specific potency gain through direct interaction with the enzyme and/or effects on the proximal ligand oxygen atom. Further development of the fluorohydroxypiperidine series resulted in the identification of a pair of diastereomers that showed 50-fold enzyme and cell based selectivity for T790M mutants over wild-type EGFR (wtEGFR) in vitro and pathway knock-down in an in vivo xenograft model. PMID:26455919

  16. Transcriptional Regulation of Oncogenic Protein Kinase Cϵ (PKCϵ) by STAT1 and Sp1 Proteins*

    PubMed Central

    Wang, HongBin; Gutierrez-Uzquiza, Alvaro; Garg, Rachana; Barrio-Real, Laura; Abera, Mahlet B.; Lopez-Haber, Cynthia; Rosemblit, Cinthia; Lu, Huaisheng; Abba, Martin; Kazanietz, Marcelo G.

    2014-01-01

    Overexpression of PKCϵ, a kinase associated with tumor aggressiveness and widely implicated in malignant transformation and metastasis, is a hallmark of multiple cancers, including mammary, prostate, and lung cancer. To characterize the mechanisms that control PKCϵ expression and its up-regulation in cancer, we cloned an ∼1.6-kb promoter segment of the human PKCϵ gene (PRKCE) that displays elevated transcriptional activity in cancer cells. A comprehensive deletional analysis established two regions rich in Sp1 and STAT1 sites located between −777 and −105 bp (region A) and −921 and −796 bp (region B), respectively, as responsible for the high transcriptional activity observed in cancer cells. A more detailed mutagenesis analysis followed by EMSA and ChIP identified Sp1 sites in positions −668/−659 and −269/−247 as well as STAT1 sites in positions −880/−869 and −793/−782 as the elements responsible for elevated promoter activity in breast cancer cells relative to normal mammary epithelial cells. RNAi silencing of Sp1 and STAT1 in breast cancer cells reduced PKCϵ mRNA and protein expression, as well as PRKCE promoter activity. Moreover, a strong correlation was found between PKCϵ and phospho-Ser-727 (active) STAT1 levels in breast cancer cells. Our results may have significant implications for the development of approaches to target PKCϵ and its effectors in cancer therapeutics. PMID:24825907

  17. Molecular characterization of alkaline protease of Bacillus amyloliquefaciens SP1 involved in biocontrol of Fusarium oxysporum.

    PubMed

    Guleria, Shiwani; Walia, Abhishek; Chauhan, Anjali; Shirkot, C K

    2016-09-01

    An alkaline protease gene was amplified from genomic DNA of Bacillus amyloliquefaciens SP1 which was involved in effective biocontrol of Fusarium oxysporum. We investigated the antagonistic capacity of protease of B. amyloliquifaciens SP1, under in vitro conditions. The 5.62 fold purified enzyme with specific activity of 607.69U/mg reported 24.14% growth inhibition of F. oxysporum. However, no antagonistic activity was found after addition of protease inhibitor i.e. PMSF (15mM) to purified enzyme. An 1149bp nucleotide sequence of protease gene encoded 382 amino acids of 43kDa and calculated isoelectric point of 9.29. Analysis of deduced amino acid sequence revealed high homology (86%) with subtilisin E of Bacillus subtilis. The B. amyloliquefaciens SP1 protease gene was expressed in Escherichiax coli BL21. The expressed protease was secreted into culture medium by E. coli and exhibited optimum activity at pH8.0 and 60°C. The most reliable three dimensional structure of alkaline protease was determined using Phyre 2 server which was validated on the basis of Ramachandran plot and ERRAT value. The expression and structure prediction of the enzyme offers potential value for commercial application in agriculture and industry. PMID:27294522

  18. Quantitative and qualitative beta diversity measures lead to different insights into factors that structure microbial communities.

    PubMed

    Lozupone, Catherine A; Hamady, Micah; Kelley, Scott T; Knight, Rob

    2007-03-01

    The assessment of microbial diversity and distribution is a major concern in environmental microbiology. There are two general approaches for measuring community diversity: quantitative measures, which use the abundance of each taxon, and qualitative measures, which use only the presence/absence of data. Quantitative measures are ideally suited to revealing community differences that are due to changes in relative taxon abundance (e.g., when a particular set of taxa flourish because a limiting nutrient source becomes abundant). Qualitative measures are most informative when communities differ primarily by what can live in them (e.g., at high temperatures), in part because abundance information can obscure significant patterns of variation in which taxa are present. We illustrate these principles using two 16S rRNA-based surveys of microbial populations and two phylogenetic measures of community beta diversity: unweighted UniFrac, a qualitative measure, and weighted UniFrac, a new quantitative measure, which we have added to the UniFrac website (http://bmf.colorado.edu/unifrac). These studies considered the relative influences of mineral chemistry, temperature, and geography on microbial community composition in acidic thermal springs in Yellowstone National Park and the influences of obesity and kinship on microbial community composition in the mouse gut. We show that applying qualitative and quantitative measures to the same data set can lead to dramatically different conclusions about the main factors that structure microbial diversity and can provide insight into the nature of community differences. We also demonstrate that both weighted and unweighted UniFrac measurements are robust to the methods used to build the underlying phylogeny. PMID:17220268

  19. Blood Lead and Other Metal Biomarkers as Risk Factors for Cardiovascular Disease Mortality

    PubMed Central

    Aoki, Yutaka; Brody, Debra J.; Flegal, Katherine M.; Fakhouri, Tala H.I.; Parker, Jennifer D.; Axelrad, Daniel A.

    2016-01-01

    Abstract Analyses of the Third National Health and Nutrition Examination Survey (NHANES III) in 1988 to 1994 found an association of increasing blood lead levels <10 μg/dL with a higher risk of cardiovascular disease (CVD) mortality. The potential need to correct blood lead for hematocrit/hemoglobin and adjust for biomarkers for other metals, for example, cadmium and iron, had not been addressed in the previous NHANES III-based studies on blood lead-CVD mortality association. We analyzed 1999 to 2010 NHANES data for 18,602 participants who had a blood lead measurement, were ≥40 years of age at the baseline examination and were followed for mortality through 2011. We calculated the relative risk for CVD mortality as a function of hemoglobin- or hematocrit-corrected log-transformed blood lead through Cox proportional hazard regression analysis with adjustment for serum iron, blood cadmium, serum C-reactive protein, serum calcium, smoking, alcohol intake, race/Hispanic origin, and sex. The adjusted relative risk for CVD mortality was 1.44 (95% confidence interval = 1.05, 1.98) per 10-fold increase in hematocrit-corrected blood lead with little evidence of nonlinearity. Similar results were obtained with hemoglobin-corrected blood lead. Not correcting blood lead for hematocrit/hemoglobin resulted in underestimation of the lead-CVD mortality association while not adjusting for iron status and blood cadmium resulted in overestimation of the lead-CVD mortality association. In a nationally representative sample of U.S. adults, log-transformed blood lead was linearly associated with increased CVD mortality. Correcting blood lead for hematocrit/hemoglobin and adjustments for some biomarkers affected the association. PMID:26735529

  20. Draft genome sequence of Sphingomonas paucimobilis strain LCT-SP1 isolated from the Shenzhou X spacecraft of China.

    PubMed

    Pan, Lei; Zhou, Hong; Li, Jia; Huang, Bing; Guo, Jun; Zhang, Xue-Lin; Gao, Long-Cheng; Xu, Chou; Liu, Chang-Ting

    2016-01-01

    Sphingomonas paucimobilis strain LCT-SP1 is a glucose-nonfermenting Gram-negative, chemoheterotrophic, strictly aerobic bacterium. The major feature of strain LCT-SP1, isolated from the Chinese spacecraft Shenzhou X, together with the genome draft and annotation are described in this paper. The total size of strain LCT-SP1 is 4,302,226 bp with 3,864 protein-coding and 50 RNA genes. The information gained from its sequence is potentially relevant to the elucidation of microbially mediated corrosion of various materials. PMID:26918090

  1. THE SIGNIFICANCE OF "STAGNATION CURVES" FOR LEAD AND COPPER, AND WATER QUALITY FACTORS AFFECTING THEM

    EPA Science Inventory

    "Stagnation curves" are the response of metal levels, particularly lead and copper, to time under conditions of no water flow. Research on lead pipe in the early 1980's in the United States, Germany, and in the United Kingdom suggested that they were characterized by rapid incre...

  2. Influenza A induces the major secreted airway mucin MUC5AC in a protease-EGFR-extracellular regulated kinase-Sp1-dependent pathway.

    PubMed

    Barbier, Diane; Garcia-Verdugo, Ignacio; Pothlichet, Julien; Khazen, Roxana; Descamps, Delphyne; Rousseau, Karine; Thornton, David; Si-Tahar, Mustapha; Touqui, Lhousseine; Chignard, Michel; Sallenave, Jean-Michel

    2012-08-01

    Mucins, the main glycoproteins present within mucus, modulate the rheologic properties of airways and participate in lung defense. They are thought to be able to trap and eliminate microorganisms from the lung. Among the mucins secreted in the lung, MUC5AC is the most prominent factor secreted by surface epithelial cells. Although much is known about the signaling pathways involved in the regulation of MUC5AC by host factors such as cytokines or proteases, less is known about the pathways triggered by microorganisms and, specifically, by influenza A virus (IAV). We therefore set up experiments to dissect the molecular mechanisms responsible for the potential modulation of MUC5AC by IAV. Using epithelial cells, C57/Bl6 mice, and IAV strains, we measured MUC5AC expression at the RNA and protein levels, specificity protein 1 (Sp1) activation, and protease activity. Intermediate molecular partners were confirmed using pharmacological inhibitors, blocking antibodies, and small interfering (si)RNAs. We showed in vitro and in vivo that IAV up-regulates epithelial cell-derived MUC5AC and Muc5ac expression in mice, both at transcriptional (through the induction of Sp1) and translational levels. In addition, we determined that this induction was dependent on a protease-epithelial growth factor receptor-extracellular regulated kinase-Sp1 signaling cascade, involving in particular the human airway trypsin. Our data point to MUC5AC as a potential modulatory mechanism by which the lung epithelia respond to IAV infection, and we dissect, for the first time to the best of our knowledge, the molecular partners involved. Future experiments using MUC5AC-targeted strategies should help further unravel the pathophysiological consequences of IAV-induced MUC5AC expression for lung homeostasis. PMID:22383584

  3. Next-to-leading-order forward hadron production in the small-x regime: the role of rapidity factorization.

    PubMed

    Kang, Zhong-Bo; Vitev, Ivan; Xing, Hongxi

    2014-08-01

    Single inclusive hadron production at forward rapidity in high energy p+A collisions is an important probe of the high gluon density regime of QCD and the associated small-x formalism. We revisit an earlier one-loop calculation to illustrate the significance of the "rapidity factorization" approach in this regime. Such factorization separates the very small-x unintegrated gluon density evolution and leads to a new correction term to the physical cross section at one-loop level. Importantly, this rapidity factorization formalism remedies the previous unphysical negative next-to-leading-order contribution to the cross section. It is much more stable with respect to "rapidity" variation when compared to the leading-order calculation and provides improved agreement between theory and experiment in the forward rapidity region. PMID:25148318

  4. Characterization of a family of cysteine rich proteins and development of a MaSp1 derived miniature fibroin

    NASA Astrophysics Data System (ADS)

    Chuang, Tyler Casey

    Spider silk displays a unique balance of high tensile strength and extensibility, making it one of the toughest materials on the planet. Dragline silk, also known as the lifeline of the spider, represents one of the best studied fiber types and many labs are attempting to produce synthetic dragline silk fibers for commercial applications. In these studies, we develop a minifibroin for expression studies in bacteria. Using recombinant DNA methodology and protein expression studies, we develop a natural minifibroin that contains the highly conserved N- and C-terminal domains, along with several internal block repeats of MaSp1. We also characterize a family of small cysteine-rich proteins (CRPs) and demonstrate that these factors are present within the spinning dope of the major ampullate gland using MS analysis. Biochemical studies and characterization of one of the family members, CRP1, demonstrate that this factor can self-polymerize into higher molecular weight complexes under oxidizing conditions, but can be converted into a monomeric species under reducing conditions. Self-polymerization of CRP1 is also shown to be independent of pH and salt concentration, two important chemical cues that help fibroin aggregation. Overall, our data demonstrate that the polymerization state of CRP1 is dependent upon redox state, suggesting that the redox environment during fiber extrusion may help regulate the oligomerization of CRP molecules during dragline silk production.

  5. [Probiotic features of carotene producing strains Bacillus sp. 1.1 and B. amyloliquefaciens UCM B-5113].

    PubMed

    Avdeeva, L V; Nechypurenko, O O; Kharhota, M A

    2015-01-01

    Researched probiotic properties of carotinproducing strains Bacillus sp. 1.1 and B. amyloliquefaciens UCM B-5113. It was established that Bacillus sp. 1.1 characterized by high and middle antagonistic activity against museums and actual test cultures and B. amyloliquefaciens UCM B-5113 shown middle and low activity. They grew up and formed a pigment at pH 6.0 in the presence of 0.4% bile. Bacillus sp. 1.1 and B. amyloliquefaciens UCM B-5113 were avirulent, had low antagonistic activity and characterized by susceptibility to antimicrobial agents, excluding colistin. The results suggested the possibility to create based on Bacillus sp. 1.1 and B. amyloliquefaciens UCM B-5113 probiotic preparation. PMID:26036029

  6. Lead and PCBs as Risk Factors for Attention Deficit/Hyperactivity Disorder

    PubMed Central

    Eubig, Paul A.; Aguiar, Andréa; Schantz, Susan L.

    2010-01-01

    Objectives Attention deficit/hyperactivity disorder (ADHD) is the most frequently diagnosed neurobehavioral disorder of childhood, yet its etiology is not well understood. In this review we present evidence that environmental chemicals, particularly polychlorinated biphenyls (PCBs) and lead, are associated with deficits in many neurobehavioral functions that are also impaired in ADHD. Data sources Human and animal studies of developmental PCB or lead exposures that assessed specific functional domains shown to be impaired in ADHD children were identified via searches of PubMed using “lead” or “PCB exposure” in combination with key words, including “attention,” “working memory,” “response inhibition,” “executive function,” “cognitive function,” “behavior,” and “ADHD.” Data synthesis Children and laboratory animals exposed to lead or PCBs show deficits in many aspects of attention and executive function that have been shown to be impaired in children diagnosed with ADHD, including tests of working memory, response inhibition, vigilance, and alertness. Studies conducted to date suggest that lead may reduce both attention and response inhibition, whereas PCBs may impair response inhibition to a greater degree than attention. Low-level lead exposure has been associated with a clinical diagnosis of ADHD in several recent studies. Similar studies of PCBs have not been conducted. Conclusions We speculate that exposures to environmental contaminants, including lead and PCBs, may increase the prevalence of ADHD. PMID:20829149

  7. Sp1 Sites in the Noncoding Control Region of BK Polyomavirus Are Key Regulators of Bidirectional Viral Early and Late Gene Expression

    PubMed Central

    Bethge, Tobias; Hachemi, Helen A.; Manzetti, Julia; Gosert, Rainer; Schaffner, Walter

    2015-01-01

    ABSTRACT In kidney transplant patients with BK polyomavirus (BKPyV) nephropathy, viral variants arise bearing rearranged noncoding control regions (rr-NCCRs) that increase viral early gene expression, replicative fitness, and cytopathology. rr-NCCRs result from various deletions and duplications of archetype NCCR (ww-NCCR) sequences, which alter transcription factor binding sites (TFBS). However, the role of specific TFBS is unclear. We inactivated 28 TFBS in the archetype NCCR by selective point mutations and examined viral gene expression in bidirectional reporter constructs. Compared to the archetype, group 1 mutations increased viral early gene expression similar to rr-NCCR and resulted from inactivating one Sp1 or one Ets1 TFBS near the late transcription start site (TSS). Group 2 mutations conferred intermediate early gene activation and affected NF1, YY1, and p53 sites between early and late TSS. Group 3 mutations decreased early and late gene expression and included two other Sp1 sites near the early TSS. Recombinant viruses bearing group 1 NCCRs showed increased replication in human renal epithelial cells similar to clinical rr-NCCR variants. Group 2 and 3 viruses showed intermediate or no replication, respectively. A literature search revealed unnoticed group 1 mutations in BKPyV nephropathy, hemorrhagic cystitis, and disseminated disease. IMPORTANCE The NCCRs of polyomaviruses mediate silent persistence of the viral genome as well as the appropriately timed (re)activation of the viral life cycle. This study indicates that the basal BKPyV NCCR is critically controlled by a hierarchy of single TFBS in the archetype NCCR that direct, modulate, and execute the bidirectional early and late viral gene expression. The results provide new insights into how BKPyV NCCR functions as a viral sensor of host cell signals and shed new light on how transcription factors like Sp1 control bidirectional viral gene expression and contribute to replication and pathology

  8. Factors That Lead to Environmentally Sustainable Practices in the Restaurant Industry: A Qualitative Analysis of Two Green Restaurant Innovators

    ERIC Educational Resources Information Center

    Nyheim, Peter

    2012-01-01

    In recent years, more organizations, including restaurants, have concerned themselves with sustainability. As with any new endeavor, guidance is needed. The purpose of this study was to investigate factors that lead to environmentally sustainable practices in the restaurant industry. Using Rogers' Diffusion of Innovation Theory as a…

  9. The Effects of Occupational Work Adjustment on Factors Leading to High School Drop Out in Rural Northwest Ohio.

    ERIC Educational Resources Information Center

    Dietrich, Angela

    The effect of four Occupational Work Adjustment (OWA) programs on risk factors leading to students dropping out of high school was assessed. Data were gathered from four OWA teachers in high schools in Northwest Ohio; information was provided for 27 individual students and 2 groups of 28 students each for the 1992-93 school year. The following…

  10. Achromobacter denitrificans strain SP1 efficiently remediates di(2-ethylhexyl)phthalate.

    PubMed

    Pradeep, S; Josh, M K Sarath; Binod, P; Devi, R Sudha; Balachandran, S; Anderson, Robin C; Benjamin, Sailas

    2015-02-01

    This study describes how Achromobacter denitrificans strain SP1, a novel isolate from heavily plastics-contaminated sewage sludge efficiently consumed the hazardous plasticizer, di(2-ethylhexyl)phthalate (DEHP) as carbon source supplemented in a simple basal salt medium (BSM). Response surface methodology was employed for the statistical optimization of the process parameters such as temperature (32°C), agitation (200 rpm), DEHP concentration (10 mM), time (72 h) and pH (8.0). At these optimized conditions, experimentally observed DEHP degradation was 63%, while the predicted value was 59.2%; and the correlation coefficient between them was 0.998, i.e., highly significant and fit to the predicted model. Employing GC-MS analysis, the degradation pathway was partially deduced with intermediates such as mono(2-ethylhexyl)phthalate and 2-ethyl hexanol. Briefly, this first report describes A. denitrificans strain SP1 as a highly efficient bacterium for completely remediating the hazardous DEHP (10 mM) in 96 h in BSM (50% consumed in 60 h), which offers great potentials for efficiently cleaning the DEHP-contaminated environments such as soil, sediments and water upon its deployment. PMID:25463861

  11. Sp1 and CREB regulate basal transcription of the human SNF2L gene

    SciTech Connect

    Xia Yu; Jiang Baichun; Zou Yongxin; Gao Guimin; Shang Linshan; Chen Bingxi; Liu Qiji; Gong Yaoqin

    2008-04-04

    Imitation Switch (ISWI) is a member of the SWI2/SNF2 superfamily of ATP-dependent chromatin remodelers, which are involved in multiple nuclear functions, including transcriptional regulation, replication, and chromatin assembly. Mammalian genomes encode two ISWI orthologs, SNF2H and SNF2L. In order to clarify the molecular mechanisms governing the expression of human SNF2L gene, we functionally examined the transcriptional regulation of human SNF2L promoter. Reporter gene assays demonstrated that the minimal SNF2L promoter was located between positions -152 to -86 relative to the transcription start site. In this region we have identified a cAMP-response element (CRE) located at -99 to -92 and a Sp1-binding site at -145 to -135 that play a critical role in regulating basal activity of human SNF2L gene, which were proven by deletion and mutation of specific binding sites, EMSA, and down-regulating Sp1 and CREB via RNAi. This study provides the first insight into the mechanisms that control basal expression of human SNF2L gene.

  12. Experimental neurotrophic factor therapy leads to cortical synaptic remodeling and compensates for behavioral deficits.

    PubMed Central

    Cuello, A C

    1997-01-01

    This brief review discusses experimental therapy with neurotrophic factors in a model of central nervous system (CNS) neural atrophy and synaptic loss resulting from unilateral cortical infarctions. It discusses the trophic factor protection of the cholinergic phenotype of neurons belonging to the forebrain-to-neocortex projection, as well as the capacity of trophic therapy to elicit synaptogenesis in the cerebral cortex of adult animals. Finally, it addresses the behavioral consequences of trophic factor-induced synaptic remodeling of the neocortex in this model. Images Figure 3 PMID:9002392

  13. Blood lead slope factor models for adults: comparisons of observations and predictions.

    PubMed Central

    Bowers, T S; Cohen, J T

    1998-01-01

    Here we explore the appropriateness of various parameter values for the Bowers et al. model [Risk Anal 14:183-189, 1994] in the context of predicting the influence of site-related exposure to lead in soil on the blood lead (PbB) levels of women of childbearing age. We outline the parameters prescribed by Bowers et al. as well as those prescribed by the U.S. Environmental Protection Agency (U.S. EPA). Comparison of the PbB levels predicted by the Bowers et al. model to those predicted by the validated O'Flaherty pharmacokinetic model indicates that the Bowers et al. model performs favorably when parameter values prescribed here are used. Use of the U.S. EPA-prescribed parameters yields predicted PbB levels that substantially exceed the validated O'Flaherty model predictions. Finally, both the U.S. EPA-prescribed parameter values and the parameter values recommended herein are used to predict PbB levels among adults living in four Superfund communities. Comparison of predicted PbB levels for these communities indicates that the U.S. EPA parameters overstate the incremental influence of lead in soil on PbB levels. Differences between the parameter values prescribed here and the U.S. EPA-prescribed parameters yield substantially different cleanup criteria for lead in soil, although conservative parameter values may still be appropriate for screening purposes. PMID:9860916

  14. Deficiency in the nuclear-related factor erythroid 2 transcription factor (Nrf1) leads to genetic instability.

    PubMed

    Oh, Diane H; Rigas, Diamanda; Cho, Ara; Chan, Jefferson Y

    2012-11-01

    Nuclear factor erythroid-derived 2-related factor 1 (Nrf1) regulates cellular stress response genes, and has also been suggested to play a role in other cellular processes. We previously demonstrated that hepatocyte-specific deletion of Nrf1 in mice resulted in spontaneous apoptosis, inflammation, and development of liver tumors. Here, we showed that both fibroblasts derived from Nrf1 null mouse embryos and fibroblasts expressing a conditional Nrf1 allele showed increased micronuclei and formation of abnormal nuclei. Lentiviral shRNA-mediated knockdown of Nrf1 in SAOS-2 cells also resulted in increased micronuclei, abnormal mitosis and multi-nucleated cells. Metaphase analyses showed increased aneuploidy in Nrf1(-/-) embryonic fibroblasts. Nuclear defects in Nrf1-deficient cells were associated with decreased expression of various genes encoding kinetochore and mitotic checkpoint proteins. Our findings suggest that Nrf1 may play a role in maintaining genomic integrity, and that Nrf1 dysregulation may induce tumorigenesis. PMID:22971132

  15. ERK-dependent activation of Sp1 is required for low-power laser irradiation-induced vascular endothelial cell proliferation

    NASA Astrophysics Data System (ADS)

    Feng, Jie; Xing, Da

    2012-12-01

    Here, we report that low-power laser irradiation (LPLI) activates ERK/Sp1 pathway to upregulate VEGF expression and promote vascular endothelial cell proliferation. We demonstrate for the first time that LPLI enhances DNA-binding activity and transactivation activity of Sp1 on VEGF promoter. Additionally, ERK translocates from cytoplasm to nucleus following LPLI. Moreover, activated ERK phosphorylates Sp1 and results in increased EKR-Sp1 interaction. Selective inhibition of Sp1 or ERK suppresses the effect of LPLI on the promotion of cell cycle progression and proliferation. These findings provide a novel link between LPLI and angiogenesis, supplying potential therapy strategies for angiogenesis with LPLI.

  16. Investigations of the factors causing performance losses of lead/acid traction batteries

    NASA Astrophysics Data System (ADS)

    Kronberger, H.; Fabjan, Ch.; Gofas, N.

    A failure analysis is carried out with a lead/acid traction battery after a two-years' test run in an electric passenger car. A survey of the operational data, in combination with laboratory tests and chemical and physical analyses, reveals the main causes of battery damage and performance loss: insufficiencies of the charging procedure, inadequate maintainance (water-refilling system), antimony-contamination and loss of the active material due to grid corrosion and shedding of PbO 2.

  17. Positive matrix factorization as source apportionment of soil lead and cadmium around a battery plant (Changxing County, China).

    PubMed

    Xue, Jian-long; Zhi, Yu-you; Yang, Li-ping; Shi, Jia-chun; Zeng, Ling-zao; Wu, Lao-sheng

    2014-06-01

    Chemical compositions of soil samples are multivariate in nature and provide datasets suitable for the application of multivariate factor analytical techniques. One of the analytical techniques, the positive matrix factorization (PMF), uses a weighted least square by fitting the data matrix to determine the weights of the sources based on the error estimates of each data point. In this research, PMF was employed to apportion the sources of heavy metals in 104 soil samples taken within a 1-km radius of a lead battery plant contaminated site in Changxing County, Zhejiang Province, China. The site is heavily contaminated with high concentrations of lead (Pb) and cadmium (Cd). PMF successfully partitioned the variances into sources related to soil background, agronomic practices, and the lead battery plants combined with a geostatistical approach. It was estimated that the lead battery plants and the agronomic practices contributed 55.37 and 29.28%, respectively, for soil Pb of the total source. Soil Cd mainly came from the lead battery plants (65.92%), followed by the agronomic practices (21.65%), and soil parent materials (12.43%). This research indicates that PMF combined with geostatistics is a useful tool for source identification and apportionment. PMID:24622990

  18. Quenching of leading jets and particles: The p⊥ dependent Landau-Pomeranchuk-Migdal effect from nonlinear k⊥ factorization

    NASA Astrophysics Data System (ADS)

    Nikolaev, N. N.; Schäfer, W.

    2006-07-01

    We report the first derivation of radiative nuclear stopping (the Landau-Pomeranchuk-Migdal effect) for leading jets at fixed values of the transverse momentum p in the beam fragmentation region of hadron-nucleus collisions from Relativistic Heavy Ion Collider (RHIC) to Large Hadron Collider (LHC). The major novelty of this work is a derivation of the missing virtual radiative pQCD correction to these processes—the real-emission radiative corrections are already available in the literature. We manifestly implement the unitarity relation, which in the simplest form requires that upon summing over the virtual and real-emission corrections the total number of scattered quarks must exactly equal unity. For the free-nucleon target, the leading jet spectrum is shown to satisfy the familiar linear Balitsky-Fadin-Kuraev-Lipatov leading log⁡-(1)/(x) (LL(1)/(x)) evolution. For nuclear targets, the nonlinear k⊥-factorization for the LL-(1)/(x) evolution of the leading jet spectrum is shown to exactly match the equally nonlinear LL(1)/(x) evolution of the collective nuclear glue—there emerges a unique linear k⊥-factorization relation between the two nonlinear evolving nuclear observables. We argue that within the standard dilute uncorrelated nucleonic gas treatment of heavy nuclei, in the finite energy range from RHIC to LHC, the leading jet spectrum can be evolved in the LL(1)/(x) Balitsky-Kovchegov approximation. We comment on the extension of these results to, and their possible Reggeon field theory interpretation for, midrapidity jets.

  19. Kr-pok increases FASN expression by modulating the DNA binding of SREBP-1c and Sp1 at the proximal promoter[S

    PubMed Central

    Jeon, Bu-Nam; Kim, Yeon-Sook; Choi, Won-Il; Koh, Dong-In; Kim, Min-Kyeong; Yoon, Jae-Hyeon; Kim, Min-Young; Hur, Benjamin; Paik, Philip Dong-Hyun; Hur, Man-Wook

    2012-01-01

    Kr-pok (kidney cancer-related POZ domain and Krüppel-like protein) is a new proto-oncogenic POZ-domain transcription factor. Fatty acid synthase gene (FASN) encodes one of the key enzymes in fatty acids synthesis and is the only enzyme that synthesizes fatty acids in cancer cells. Sp1 and SREBP-1c are the two major transcription activators of FASN. We investigated whether Kr-pok modulates transcription of the FASN. FASN expression is significantly decreased in Kr-pok knockout murine embryonic fibroblasts. Coimmunoprecipitation, GST fusion protein pull-down, and immunocytochemistry assays show that the zinc-finger domain of Kr-pok interacts directly with the bZIP DNA binding domain of SREBP-1. Electrophoretic mobility shift assay, oligonucleotide pull-down, and chromatin immunoprecipitation assays showed that Kr-pok changes the transcription factor binding dynamics of Sp1 and SREBP-1c to the SRE/E-box elements of the proximal promoter. We found that Kr-pok expression increased during 3T3-L1 preadipocyte differentiation and that FASN expression is decreased by the knockdown of Kr-pok. Kr-pok facilitates the SREBP-1c-mediated preadipocyte differentiation and/or fatty acid synthesis. Kr-pok may act as an important regulator of fatty acid synthesis and may induce rapid cancer cell proliferation by increasing palmitate synthesis. PMID:22331133

  20. Scalability of Parallel Spatial Direct Numerical Simulations on Intel Hypercube and IBM SP1 and SP2

    NASA Technical Reports Server (NTRS)

    Joslin, Ronald D.; Hanebutte, Ulf R.; Zubair, Mohammad

    1995-01-01

    The implementation and performance of a parallel spatial direct numerical simulation (PSDNS) approach on the Intel iPSC/860 hypercube and IBM SP1 and SP2 parallel computers is documented. Spatially evolving disturbances associated with the laminar-to-turbulent transition in boundary-layer flows are computed with the PSDNS code. The feasibility of using the PSDNS to perform transition studies on these computers is examined. The results indicate that PSDNS approach can effectively be parallelized on a distributed-memory parallel machine by remapping the distributed data structure during the course of the calculation. Scalability information is provided to estimate computational costs to match the actual costs relative to changes in the number of grid points. By increasing the number of processors, slower than linear speedups are achieved with optimized (machine-dependent library) routines. This slower than linear speedup results because the computational cost is dominated by FFT routine, which yields less than ideal speedups. By using appropriate compile options and optimized library routines on the SP1, the serial code achieves 52-56 M ops on a single node of the SP1 (45 percent of theoretical peak performance). The actual performance of the PSDNS code on the SP1 is evaluated with a "real world" simulation that consists of 1.7 million grid points. One time step of this simulation is calculated on eight nodes of the SP1 in the same time as required by a Cray Y/MP supercomputer. For the same simulation, 32-nodes of the SP1 and SP2 are required to reach the performance of a Cray C-90. A 32 node SP1 (SP2) configuration is 2.9 (4.6) times faster than a Cray Y/MP for this simulation, while the hypercube is roughly 2 times slower than the Y/MP for this application. KEY WORDS: Spatial direct numerical simulations; incompressible viscous flows; spectral methods; finite differences; parallel computing.

  1. Factors Leading to Retention of School Librarian Positions: A School District Case Study

    ERIC Educational Resources Information Center

    Ewbank, Ann Dutton

    2010-01-01

    In the past five years, the number of school librarians has greatly diminished despite valiant advocacy efforts by librarians, parents, and state and national library associations. This descriptive case study investigated the factors that led governing board members in a mid-sized urban high school district to retain certified school librarian…

  2. Values-Oriented Factors Leading to Retention of School Librarian Positions: A School District Case Study

    ERIC Educational Resources Information Center

    Ewbank, Ann Dutton

    2011-01-01

    The number of U.S. school librarians has greatly diminished despite advocacy efforts on the local and national level. This case study investigated the factors that led governing board members in a mid-size urban high school district to retain certified school librarian positions despite a major economic crisis. Data were collected through school…

  3. Factors That Lead to Positive or Negative Stress in Secondary School Teachers of Mathematics and Science

    ERIC Educational Resources Information Center

    Mujtaba, Tamjid; Reiss, Michael

    2013-01-01

    This paper explores the factors that contribute to the development of positive stress and distress in teachers within secondary schools in England. It draws on narrative interviews undertaken with 12 mathematics and science teachers in six schools and focuses on three of these teachers to explore issues in more depth. The findings demonstrate that…

  4. Inflammation and the coagulation system in tuberculosis: Tissue Factor leads the dance.

    PubMed

    Caccamo, Nadia; Dieli, Francesco

    2016-02-01

    Mycobacterium tuberculosis, the causative agent of tuberculosis, drives the formation of granulomas, structures in which both immune cells and the bacterial pathogen cohabit. The most abundant cells in granulomas are macrophages, which contribute as both cells with bactericidal activity and as targets for M. tuberculosis infection and proliferation during the entire course of infection. The mechanisms and factors involved in the regulation and control of macrophage microenvironment-specific polarization and plasticity are not well understood, as some granulomas are able to control bacteria growth and others fail to do so, permitting bacterial spread. In this issue of the European Journal of Immunology, Venkatasubramanian et al. [Eur. J. Immunol. 2016. 46: 464-479] show that mice lacking the tissue factor gene in myeloid cells have augmented M. tuberculosis growth and increased inflammation in the lungs. This suggests that tissue factor, an initiator of coagulation, is important for the generation of fibrin, which supports granuloma formation. This article demonstrates for the first time the involvement of tissue factor in inducing effective immunity against M. tuberculosis, and sheds new lights on the complex interplay between host inflammatory response, the coagulation system, and the control of M. tuberculosis infection. PMID:26763085

  5. Factors and Events Leading to the Passage of the Indian Child Welfare Act.

    ERIC Educational Resources Information Center

    Mannes, Marc

    1995-01-01

    Presents the historical background, contemporary factors, issues, and activities that led to the enactment of the Indian Child Welfare Act. Discusses actions of the Devils Lake Sioux of North Dakota in 1968 and involvement of the Association on American Indian Affairs, which led to Senate hearings in 1974 and passage of the act in 1978. (TM)

  6. Top jets in the peak region: Factorization analysis with next-to-leading-log resummation

    SciTech Connect

    Fleming, Sean; Hoang, Andre H.; Mantry, Sonny; Stewart, Iain W.

    2008-06-01

    We consider top quarks produced at large energy in e{sup +}e{sup -} collisions, and address the question of what top mass can be measured from reconstruction. The production process is characterized by well-separated scales: the center-of-mass energy Q, the top mass m, the top decay width {gamma}{sub t}, and also {lambda}{sub QCD}; scales which can be disentangled with effective theory methods. In particular we show how the mass measurement depends on the way in which soft radiation is treated, and that this can shift the mass peak by an amount of order Q{lambda}{sub QCD}/m. We sum large logs for Q>>m>>{gamma}{sub t}>{lambda}{sub QCD} and demonstrate that the renormalization group ties together the jet and soft interactions below the scale m. Necessary conditions for the invariant mass spectrum to be protected from large logs are formulated. Results for the cross section are presented at next-to-leading order with next-to-leading-log (NLL) resummation, for invariant masses in the peak region and the tail region. Using our results we also predict the thrust distribution for massive quark jets at NLL order for large thrust. We demonstrate that soft radiation can be precisely controlled using data on massless jet production, and that in principle, a short-distance mass parameter can be measured using jets with precision better than {lambda}{sub QCD}.

  7. Development of the rhopalial nervous system in Aurelia sp.1 (Cnidaria, Scyphozoa).

    PubMed

    Nakanishi, Nagayasu; Hartenstein, Volker; Jacobs, David K

    2009-06-01

    We examined the development of the nervous system in the rhopalium, a medusa-specific sensory structure, in Aurelia sp.1 (Cnidaria, Scyphozoa) using confocal microscopy. The rhopalial nervous system appears primarily ectodermal and contains neurons immunoreactive to antibodies against tyrosinated tubulin, taurine, GLWamide, and FMRFamide. The rhopalial nervous system develops in an ordered manner: the presumptive gravity-sensing organ, consisting of the lithocyst and the touch plate, differentiates first; the "marginal center," which controls swimming activity, second; and finally, the ocelli, the presumptive photoreceptors. At least seven bilaterally arranged neuronal clusters consisting of sensory and ganglion cells and their neuronal processes became evident in the rhopalium during metamorphosis to the medusa stage. Our analysis provides an anatomical framework for future gene expression and experimental studies of development and functions of scyphozoan rhopalia. PMID:19543911

  8. Further investigation of g factors for the lead monofluoride ground state

    DOE PAGESBeta

    Skripnikov, L. V.; Petrov, A. N.; Titov, A. V.; Mawhorter, R. J.; Baum, A. L.; Sears, T. J.; Grabow, J. -U.

    2015-09-15

    We report the results of our theoretical study and analysis of earlier experimental data for the g-factor tensor components of the ground 2II1/2 state of the free PbF radical. These values obtained both within the relativistic coupled-cluster method combined with the generalized relativistic effective core potential approach and with our fit of the experimental data from [R. J. Mawhorter, B. S. Murphy, A. L. Baum, T. J. Sears, T. Yang, P. M. Rupasinghe, C. P. McRaven, N. E. Shafer-Ray, L. D. Alphei, and J.-U. Grabow, Phys. Rev. A 84, 022508 (2011); A. L. Baum, B.A. thesis, Pomona College, 2011]. Themore » obtained results agree very well with each other but contradict the previous fit performed in the cited works. Our final prediction for g factors is G∥=0.081(5),G⊥=–0.27(1).« less

  9. Further investigation of g factors for the lead monofluoride ground state

    NASA Astrophysics Data System (ADS)

    Skripnikov, L. V.; Petrov, A. N.; Titov, A. V.; Mawhorter, R. J.; Baum, A. L.; Sears, T. J.; Grabow, J.-U.

    2015-09-01

    We report the results of our theoretical study and analysis of earlier experimental data for the g -factor tensor components of the ground 2Π1 /2 state of the free PbF radical. The values were obtained both within the relativistic coupled-cluster method combined with the generalized relativistic effective core potential approach and with our fit of the experimental data from [R. J. Mawhorter, B. S. Murphy, A. L. Baum, T. J. Sears, T. Yang, P. M. Rupasinghe, C. P. McRaven, N. E. Shafer-Ray, L. D. Alphei, and J.-U. Grabow, Phys. Rev. A 84, 022508 (2011), 10.1103/PhysRevA.84.022508; A. L. Baum, B.A. thesis, Pomona College, 2011]. The obtained results agree very well with each other but contradict the previous fit performed in the cited works. Our final prediction for g factors is G∥=0.081 (5 ) ,G⊥=-0.27 (1 ) .

  10. Socioeconomic and behavioral factors leading to acquired bacterial resistance to antibiotics in developing countries.

    PubMed Central

    Okeke, I. N.; Lamikanra, A.; Edelman, R.

    1999-01-01

    In developing countries, acquired bacterial resistance to antimicrobial agents is common in isolates from healthy persons and from persons with community-acquired infections. Complex socioeconomic and behavioral factors associated with antibiotic resistance, particularly regarding diarrheal and respiratory pathogens, in developing tropical countries, include misuse of antibiotics by health professionals, unskilled practitioners, and laypersons; poor drug quality; unhygienic conditions accounting for spread of resistant bacteria; and inadequate surveillance. PMID:10081668

  11. Understanding Turning Points in Intimate Partner Violence: Factors and Circumstances Leading Women Victims Toward Change

    PubMed Central

    Dado, Diane; Hawker, Lynn; Cluss, Patricia A.; Buranosky, Raquel; Slagel, Leslie; McNeil, Melissa; Scholle, Sarah Hudson

    2010-01-01

    Abstract Objective When counseling women experiencing intimate partner violence (IPV), healthcare providers can benefit from understanding the factors contributing to a women's motivation to change her situation. We wished to examine the various factors and situations associated with turning points and change seeking in the IPV situation. Methods We performed qualitative analysis on data from 7 focus groups and 20 individual interviews with women (61 participants) with past and/or current histories of IPV. Results The turning points women identified fell into 5 major themes: (1) protecting others from the abuse/abuser; (2) increased severity/humiliation with abuse; (3) increased awareness of options/access to support and resources; (4) fatigue/recognition that the abuser was not going to change; and (5) partner betrayal/infidelity. Conclusions Women experiencing IPV can identify specific factors and events constituting turning points or catalyst to change in their IPV situation. These turning points are dramatic shifts in beliefs and perceptions of themselves, their partners, and/or their situation that alter the women's willingness to tolerate the situation and motivate them to consider change. When counseling women experiencing IPV, health providers can incorporate understanding of turning points to motivate women to move forward in their process of changing their IPV situation. PMID:20113147

  12. Mithramycin inhibits SP1 binding and selectively inhibits transcriptional activity of the dihydrofolate reductase gene in vitro and in vivo.

    PubMed Central

    Blume, S W; Snyder, R C; Ray, R; Thomas, S; Koller, C A; Miller, D M

    1991-01-01

    The promoter of the human dihydrofolate reductase (DHFR) gene contains two consensus binding sites for the DNA binding protein Sp1. DNAse protection and gel mobility shift assays demonstrate binding of recombinant Sp1 to both decanucleotide Sp1 binding sequences which are located 49 and 14 base pairs upstream of the transcription start site. The more distal of the two binding sites exhibits a somewhat higher affinity for Sp1. The G-C specific DNA binding drug, mithramycin, binds to both consensus sequences and prevents subsequent Sp1 binding. Promoter-dependent in vitro transcription of a DHFR template is selectively inhibited by mithramycin when compared to the human H2b histone gene. A similar effect is also noted in vivo. Mithramycin treatment of MCF-7 human breast carcinoma cells containing an amplified DHFR gene induces selective inhibition of DHFR transcription initiation, resulting in a decline in DHFR mRNA level and enzyme activity. This selective inhibition of DHFR expression suggests that it is possible to modulate the overexpression of the DHFR gene in methotrexate resistant cells. Images PMID:1834700

  13. Preservation of wing leading edge suction at the plane of symmetry as a factor in wing-fuselage design

    NASA Technical Reports Server (NTRS)

    Larrabee, E. E.

    1975-01-01

    Most fuselage geometries cover a portion of the wing leading edge near the plane of symmetry, and it seems reasonable to expect that a large fraction of the leading edge suction which would be developed by the covered wing at high angles of attack is not developed on the fuselage. This is one of the reasons that the Oswald span efficiency factor for the wing body combination fails to approach the value predicted by lifting line theory for the isolated wing. Some traditional and recent literature on wing-body interference is discussed and high Reynolds number data on wing-body-nacelle drag are reviewed. An exposed central leading edge geometry has been developed for a sailplane configuration. Low Reynolds number tests have not validated the design concept.

  14. Combined impact of lead, cadmium, polychlorinated biphenyls and non-chemical risk factors on blood pressure in NHANES

    SciTech Connect

    Peters, Junenette L. Patricia Fabian, M. Levy, Jonathan I.

    2014-07-15

    High blood pressure is associated with exposure to multiple chemical and non-chemical risk factors, but epidemiological analyses to date have not assessed the combined effects of both chemical and non-chemical stressors on human populations in the context of cumulative risk assessment. We developed a novel modeling approach to evaluate the combined impact of lead, cadmium, polychlorinated biphenyls (PCBs), and multiple non-chemical risk factors on four blood pressure measures using data for adults aged ≥20 years from the National Health and Nutrition Examination Survey (1999–2008). We developed predictive models for chemical and other stressors. Structural equation models were applied to account for complex associations among predictors of stressors as well as blood pressure. Models showed that blood lead, serum PCBs, and established non-chemical stressors were significantly associated with blood pressure. Lead was the chemical stressor most predictive of diastolic blood pressure and mean arterial pressure, while PCBs had a greater influence on systolic blood pressure and pulse pressure, and blood cadmium was not a significant predictor of blood pressure. The simultaneously fit exposure models explained 34%, 43% and 52% of the variance for lead, cadmium and PCBs, respectively. The structural equation models were developed using predictors available from public data streams (e.g., U.S. Census), which would allow the models to be applied to any U.S. population exposed to these multiple stressors in order to identify high risk subpopulations, direct intervention strategies, and inform public policy. - Highlights: • We evaluated joint impact of chemical and non-chemical stressors on blood pressure. • We built predictive models for lead, cadmium and polychlorinated biphenyls (PCBs). • Our approach allows joint evaluation of predictors from population-specific data. • Lead, PCBs and established non-chemical stressors were related to blood pressure.

  15. Lead (Pb) and other metals in New York City community garden soils: factors influencing contaminant distributions.

    PubMed

    Mitchell, Rebecca G; Spliethoff, Henry M; Ribaudo, Lisa N; Lopp, Donna M; Shayler, Hannah A; Marquez-Bravo, Lydia G; Lambert, Veronique T; Ferenz, Gretchen S; Russell-Anelli, Jonathan M; Stone, Edie B; McBride, Murray B

    2014-04-01

    Urban gardens provide affordable fresh produce to communities with limited access to healthy food but may also increase exposure to lead (Pb) and other soil contaminants. Metals analysis of 564 soil samples from 54 New York City (NYC) community gardens found at least one sample exceeding health-based guidance values in 70% of gardens. However, most samples (78%) did not exceed guidance values, and medians were generally below those reported in NYC soil and other urban gardening studies. Barium (Ba) and Pb most frequently exceeded guidance values and along with cadmium (Cd) were strongly correlated with zinc (Zn), a commonly measured nutrient. Principal component analysis suggested that contaminants varied independently from organic matter and geogenic metals. Contaminants were associated with visible debris and a lack of raised beds; management practices (e.g., importing uncontaminated soil) have likely reduced metals concentrations. Continued exposure reduction efforts would benefit communities already burdened by environmental exposures. PMID:24502997

  16. Lead (Pb) and other metals in New York City community garden soils: factors influencing contaminant distributions

    PubMed Central

    Mitchell, Rebecca G.; Spliethoff, Henry M.; Ribaudo, Lisa N.; Lopp, Donna M.; Shayler, Hannah A.; Marquez-Bravo, Lydia G.; Lambert, Veronique T.; Ferenz, Gretchen S.; Russell-Anelli, Jonathan M.; Stone, Edie B.; McBride, Murray B.

    2014-01-01

    Urban gardens provide affordable fresh produce to communities with limited access to healthy food but may also increase exposure to lead (Pb) and other soil contaminants. Metals analysis of 564 soil samples from 54 New York City (NYC) community gardens found at least one sample exceeding health-based guidance values in 70% of gardens. However, most samples (78%) did not exceed guidance values, and medians were generally below those reported in NYC soil and other urban gardening studies. Barium (Ba) and Pb most frequently exceeded guidance values and along with cadmium (Cd) were strongly correlated with zinc (Zn), a commonly measured nutrient. Principal component analysis suggested that contaminants varied independently from organic matter and geogenic metals. Contaminants were associated with visible debris and a lack of raised beds; management practices (e.g., importing uncontaminated soil) have likely reduced metals concentrations. Continued exposure reduction efforts would benefit communities already burdened by environmental exposures. PMID:24502997

  17. Concomitant Factors Leading to an Atypical Osteonecrosis of the Jaw in a Patient with Multiple Myeloma

    PubMed Central

    Miranda-Rius, Jaume; Brunet-Llobet, Lluís; Lahor-Soler, Eduard; Giménez-Rubio, Josep Anton

    2014-01-01

    Osteonecrosis of the jaw (ONJ) is a site specific osseous pathology, characterized by chronic exposed bone in the mouth, which needs to be reinforced periodically within the medical literature. ONJ is a clinical entity with many possible aetiologies and its pathogenesis is not well understood. The risk factors for ONJ include bisphosphonates treatments, head and neck radiotherapy, dental procedures involving bone surgery, and trauma. Management of ONJ has centred on efforts to eliminate or reduce severity of symptoms, to slow or prevent the progression of disease, and to eradicate diseased bone. This case describes a rare case of ONJ in a 64-year-old Caucasian male diagnosed with multiple myeloma stage III. The lesion was related to a traumatic injury during mastication. Eighteen months ago in the same area the molar 37 was extracted, achieving a complete satisfactory healing, when only 2 doses of zoledronic acid had been administered. Actinomyces bacterial aggregates were also identified in the microscopic analysis. The management of this osteonecrotic lesion included antibiotic treatment and chlorhexidine topical gel administration. The evolution was monitored every two weeks until patient's death. The authors provide a discussion of the etiology, pathogenesis, diagnosis, and management. This case report may shed light on the controversies about concomitant factors and mechanisms inducing ONJ. PMID:25140178

  18. Further investigation of g factors for the lead monofluoride ground state

    SciTech Connect

    Skripnikov, L. V.; Petrov, A. N.; Titov, A. V.; Mawhorter, R. J.; Baum, A. L.; Sears, T. J.; Grabow, J. -U.

    2015-09-15

    We report the results of our theoretical study and analysis of earlier experimental data for the g-factor tensor components of the ground 2II1/2 state of the free PbF radical. These values obtained both within the relativistic coupled-cluster method combined with the generalized relativistic effective core potential approach and with our fit of the experimental data from [R. J. Mawhorter, B. S. Murphy, A. L. Baum, T. J. Sears, T. Yang, P. M. Rupasinghe, C. P. McRaven, N. E. Shafer-Ray, L. D. Alphei, and J.-U. Grabow, Phys. Rev. A 84, 022508 (2011); A. L. Baum, B.A. thesis, Pomona College, 2011]. The obtained results agree very well with each other but contradict the previous fit performed in the cited works. Our final prediction for g factors is G=0.081(5),G=–0.27(1).

  19. Genome-Wide Occupancy of SREBP1 and Its Partners NFY and SP1 Reveals Novel Functional Roles and Combinatorial Regulation of Distinct Classes of Genes

    PubMed Central

    Reed, Brian D.; Charos, Alexandra E.; Szekely, Anna M.; Weissman, Sherman M.; Snyder, Michael

    2008-01-01

    The sterol regulatory element-binding protein (SREBP) family member SREBP1 is a critical transcriptional regulator of cholesterol and fatty acid metabolism and has been implicated in insulin resistance, diabetes, and other diet-related diseases. We globally identified the promoters occupied by SREBP1 and its binding partners NFY and SP1 in a human hepatocyte cell line using chromatin immunoprecipitation combined with genome tiling arrays (ChIP-chip). We find that SREBP1 occupies the promoters of 1,141 target genes involved in diverse biological pathways, including novel targets with roles in lipid metabolism and insulin signaling. We also identify a conserved SREBP1 DNA-binding motif in SREBP1 target promoters, and we demonstrate that many SREBP1 target genes are transcriptionally activated by treatment with insulin and glucose using gene expression microarrays. Finally, we show that SREBP1 cooperates extensively with NFY and SP1 throughout the genome and that unique combinations of these factors target distinct functional pathways. Our results provide insight into the regulatory circuitry in which SREBP1 and its network partners coordinate a complex transcriptional response in the liver with cues from the diet. PMID:18654640

  20. The tumor suppressor gene KCTD11REN is regulated by Sp1 and methylation and its expression is reduced in tumors.

    PubMed

    Mancarelli, M Michela; Zazzeroni, Francesca; Ciccocioppo, Lucia; Capece, Daria; Po, Agnese; Murgo, Simona; Di Camillo, Raffaello; Rinaldi, Christian; Ferretti, Elisabetta; Gulino, Alberto; Alesse, Edoardo

    2010-01-01

    A hallmark of several human cancers is loss of heterozygosity (LOH) of chromosome 17p13. The same chromosomal region is also frequently hypermethylated in cancer. Although loss of 17p13 has been often associated with p53 genetic alteration or Hypermethylated in Cancer 1 (HIC1) gene hypermethylation, other tumor suppressor genes (TSGs) located in this region have critical roles in tumorigenesis. A novel TSG mapping on human chromosome 17p13.2 is KCTD11REN (KCTD11). We have recently demonstrated that KCTD11 expression is frequently lost in human medulloblastoma (MB), in part by LOH and in part by uncharacterized epigenetic events. Using a panel of human 177 tumor samples and their normal matching samples representing 18 different types of cancer, we show here that the down-regulation of KCTD11 protein level is a specific and a diffusely common event in tumorigenesis. Additionally, in order to characterize the regulatory regions in KCTD11 promoter, we identified a CpG island and several Sp1 binding sites on this promoter, and demonstrated that Sp1 transcription factor and DNA methylation contribute, at least in part, to regulate KCTD11 expression. Our findings identify KCTD11 as a widely down-regulated gene in human cancers, and provide a basis to understand how its expression might be deregulated in tumor cells. PMID:20591193

  1. The tumor suppressor gene KCTD11REN is regulated by Sp1 and methylation and its expression is reduced in tumors

    PubMed Central

    2010-01-01

    A hallmark of several human cancers is loss of heterozygosity (LOH) of chromosome 17p13. The same chromosomal region is also frequently hypermethylated in cancer. Although loss of 17p13 has been often associated with p53 genetic alteration or Hypermethylated in Cancer 1 (HIC1) gene hypermethylation, other tumor suppressor genes (TSGs) located in this region have critical roles in tumorigenesis. A novel TSG mapping on human chromosome 17p13.2 is KCTD11REN (KCTD11). We have recently demonstrated that KCTD11 expression is frequently lost in human medulloblastoma (MB), in part by LOH and in part by uncharacterized epigenetic events. Using a panel of human 177 tumor samples and their normal matching samples representing 18 different types of cancer, we show here that the down-regulation of KCTD11 protein level is a specific and a diffusely common event in tumorigenesis. Additionally, in order to characterize the regulatory regions in KCTD11 promoter, we identified a CpG island and several Sp1 binding sites on this promoter, and demonstrated that Sp1 transcription factor and DNA methylation contribute, at least in part, to regulate KCTD11 expression. Our findings identify KCTD11 as a widely down-regulated gene in human cancers, and provide a basis to understand how its expression might be deregulated in tumor cells. PMID:20591193

  2. Basal expression of the human MAPEG members microsomal glutathione transferase 1 and prostaglandin E synthase genes is mediated by Sp1 and Sp3.

    PubMed

    Ekström, Lena; Lyrenäs, Louise; Jakobsson, Per-Johan; Morgenstern, Ralf; Kelner, Michael J

    2003-06-19

    Microsomal glutathione transferase (MGST1) and prostaglandin E synthase (PGES) are both members of the MAPEG (Membrane Associated Proteins involved in Eicosanoid and Glutathione metabolism) superfamily. In humans, their organ distribution is quite distinct with the former being widely and constitutively expressed whereas PGES is largely inducible. In order to study the basal expression of these genes, we characterized the promoter regions and identified the elements and the transcription factors required using in vitro assays, including reporter analysis of deletion and mutant clones and EMSA. The results indicate that Sp1 is the protein mediating the basal transcription of MGST1. It appears that both the Sp1 and Sp3 proteins are important for the basal expression of PGES. In addition, mutational analysis of two Barbie-box elements in the PGES promoter showed that these were not involved in the down-regulation of PGES by phenobarbital (PB). These results provide the first description of the basal regulation of these genes in humans. PMID:12818425

  3. Factors affecting lead, cadmium, and arsenic levels in house dust in a smelter town in eastern Germany

    SciTech Connect

    Meyer, I.; Heinrich, J. . Inst. fuer Epidemiologie); Lippold, U. )

    1999-07-01

    Hettstedt, a city in eastern Germany with a long history of mining and smelting of nonferrous ores, has several industrial sources of heavy metals. The indoor exposure to metals of children (5 to 14 years old) in the Hettstedt area was assessed by measuring the levels of lead, cadmium, and arsenic contamination in sedimented house dust. Factors which influence the dust loading rate and the surface loading rates of these contaminants in house dust were investigated. The geometric mean of the dust loading rate was 8.9 mg/m[sup 2] day. The geometric means of surface loading rates were 1.14, 0.024, and 0.023 [micro]g/m[sup 2] day for lead, cadmium, and arsenic, respectively. Factors that were significantly associated with surface loading rates included the city area of residence, automobile traffic near home, parent with occupational exposure to heavy metals, type of heating, housing characteristics, whether child's home is damp, number of persons living in the child's home,and parents' education. The most significant of these factors was the city area of residence, which reflects the distance from the metal sources; this factor accounted for about half of the variances explained by the regression models.

  4. Impact factor for gluon production in multi-Regge kinematics in the next-to-leading order

    SciTech Connect

    Kozlov, M. G. Reznichenko, A. V. Fadin, V. S.

    2012-07-15

    The one-loop correction to the impact factor for gluon production upon the transition of a one-Reggeon state in the t channel to a two-Reggeon state is found. This impact factor is an element of multiparticle amplitudes in multi-Regge kinematics. The correction in question is necessary for developing the theory of Regge and multi-Regge processes. In particular, it is necessary for proving the multi-Regge form of the amplitude in the next-to-leading-logarithm approximation. This correction also makes it possible to complete the verification of the last of the unproven bootstrap conditions for gluon Reggeization and to prove, in this approximation, the validity of the multi-Regge form of the amplitude. All necessary calculations are presented, and an explicit expression for the impact factor in front of all possible color states in the t channel is given.

  5. Sp1 binds two sites in the CD11c promoter in vivo specifically in myeloid cells and cooperates with AP1 to activate transcription.

    PubMed Central

    Noti, J D; Reinemann, B C; Petrus, M N

    1996-01-01

    The leukocyte integrin gene, CD11c, is transcriptionally regulated and is expressed predominantly on differentiated cells of the myelomonocytic lineage. In this study we have demonstrated that the regions -72 to -63 and -132 to -104 of the CD11c promoter contain elements responsible for phorbol ester-induced differentiation of the myeloid cell line HL60. DNase I footprinting analysis revealed that these regions can bind purified Sp1, and supershift analysis with Sp1 antibody confirmed that Sp1 in HL60 nuclear extracts could bind these regions. Transfection analysis of CD11c promoter-chloramphenicol acetyltransferase constructs containing deletions of these Sp1-binding sites revealed that these sites are essential for expression of the CD11c gene in HL60 cells but not in the T-cell line Molt4 or the cervical carcinoma cell line HeLa. Moreover, cotransfection of pPacSp1 along with these CD11c promoter-chloramphenicol acetyltransferase constructs into Sp1-deficient Drosophila Schneider 2 cells verified that these sites are essential for Sp1-dependent expression of the CD11c promoter. In vivo genomic footprinting revealed that Sp1 contacts the CD11c promoter within the regions -69 to -63 and -116 to -105 in phorbol 12-myristate 13-acetate-differentiated HL60 cells but not in undifferentiated HL60 cells or in Molt4 or HeLa cells. Cotransfection assays in HL60 cells revealed that Sp1 acts synergistically with Ap1 to activate CD11c. Further, both Sp1 sites are capable of cooperating with AP1. In vitro DNase I footprinting analysis with purified Sp1 and c-jun proteins showed that Sp1 binding could facilitate binding of c-jun. We propose that myeloid-specific expression of the CD11c promoter and is facilitated by cooperative interaction between the Sp1- and Ap1-binding sites. PMID:8649405

  6. Blood Lead Levels and Associated Factors among Children in Guiyu of China: A Population-Based Study

    PubMed Central

    Guo, Pi; Xu, Xijin; Huang, Binliang; Sun, Di; Zhang, Jian; Chen, Xiaojuan; Zhang, Qin

    2014-01-01

    Objectives Children's health problems caused by the electronic waste (e-waste) lead exposure in China remains. To assess children's blood lead levels (BLLs) in Guiyu of China and investigate risk factors of children's elevated BLLs in Guiyu. Material and Methods 842 children under 11 years of age from Guiyu and Haojiang were enrolled in this population-based study during 2011–2013. Participants completed a lifestyle and residential environment questionnaire and their physical growth indices were measured, and blood samples taken. Blood samples were tested to assess BLLs. Children's BLLs between the two groups were compared and factors associated with elevated BLLs among Guiyu children were analyzed by group Lasso logistic regression model. Results Children living in Guiyu had significant higher BLLs (7.06 µg/dL) than the quantity (5.89 µg/dL) of Haojiang children (P<0.05). Subgroup analyses of BLLs exceeding 10 µg/dL showed the proportion (24.80%) of high-level BLLs for Guiyu children was greater than that (12.84%) in Haojiang (P<0.05). Boys had greater BLLs than girls, irrespectively of areas (P<0.05). The number of e-waste piles or recycling workshops around the house (odds ratio, 2.28; 95% confidence interval [CI], 1.37 to 3.87) significantly contributed to the elevated BLLs of children in Guiyu, and girls had less risk (odds ratio, 0.51; 95% CI, 0.31 to 0.83) of e-waste lead exposure than boys. Conclusions This analysis reinforces the importance of shifting e-waste recycling piles or workshops to non-populated areas as part of a comprehensive response to e-waste lead exposure control in Guiyu. To correct the problem of lead poisoning in children in Guiyu should be a long-term mission. PMID:25136795

  7. Formation of hydrophilic nanochannels in the membrane of living cells by the ringlike stable protein-SP1.

    PubMed

    Khoutorsky, Arkady; Heyman, Arnon; Shoseyov, Oded; Spira, Micha E

    2011-07-13

    The assembly of functional junction between nerve cells and electronic sensing pads is a critical problem in the construction of effective neuroelectronic hybrid systems. Here, we demonstrate for the first time that the ringlike Stable Protein 1 (Sp1) and its derivatives can be used to generate hydrophilic nanochannels in the plasma membrane of living cells. Since SP1-derivatives can be linked to both the plasma membrane, gold or silicon surfaces, they may serve to ohmically link between cells interior and electronic sensing devices. PMID:21651305

  8. Loss of transforming growth factor-beta 2 leads to impairment of central synapse function

    PubMed Central

    Heupel, Katharina; Sargsyan, Vardanush; Plomp, Jaap J; Rickmann, Michael; Varoqueaux, Frédérique; Zhang, Weiqi; Krieglstein, Kerstin

    2008-01-01

    Background The formation of functional synapses is a crucial event in neuronal network formation, and with regard to regulation of breathing it is essential for life. Members of the transforming growth factor-beta (TGF-β) superfamily act as intercellular signaling molecules during synaptogenesis of the neuromuscular junction of Drosophila and are involved in synaptic function of sensory neurons of Aplysia. Results Here we show that while TGF-β2 is not crucial for the morphology and function of the neuromuscular junction of the diaphragm muscle of mice, it is essential for proper synaptic function in the pre-Bötzinger complex, a central rhythm organizer located in the brainstem. Genetic deletion of TGF-β2 in mice strongly impaired both GABA/glycinergic and glutamatergic synaptic transmission in the pre-Bötzinger complex area, while numbers and morphology of central synapses of knock-out animals were indistinguishable from their wild-type littermates at embryonic day 18.5. Conclusion The results demonstrate that TGF-β2 influences synaptic function, rather than synaptogenesis, specifically at central synapses. The functional alterations in the respiratory center of the brain are probably the underlying cause of the perinatal death of the TGF-β2 knock-out mice. PMID:18854036

  9. Identifying the Factors Leading to Success: How an Innovative Science Curriculum Cultivates Student Motivation

    NASA Astrophysics Data System (ADS)

    Scogin, Stephen C.

    2016-06-01

    PlantingScience is an award-winning program recognized for its innovation and use of computer-supported scientist mentoring. Science learners work on inquiry-based experiments in their classrooms and communicate asynchronously with practicing plant scientist-mentors about the projects. The purpose of this study was to identify specific factors contributing to the program's effectiveness in engaging students. Using multiple data sources, grounded theory (Strauss and Corbin in Basics of qualitative research. Sage, Newbury Park, 1990) was used to develop a conceptual model identifying the central phenomenon, causal conditions, intervening conditions, strategies, contexts, and student outcomes of the project. Student motivation was determined to be the central phenomenon explaining the success of the program, with student empowerment, online mentor interaction, and authenticity of the scientific experiences serving as causal conditions. Teachers contributed to student motivation by giving students more freedom, challenging students to take projects deeper, encouraging, and scaffolding. Scientists contributed to student motivation by providing explanations, asking questions, encouraging, and offering themselves as partners in the inquiry process. Several positive student outcomes of the program were uncovered and included increased positivity, greater willingness to take projects deeper, better understanding of scientific concepts, and greater commitments to collaboration. The findings of this study provide relevant information on how to develop curriculum, use technology, and train practitioners and mentors to utilize strategies and actions that improve learners' motivation to engage in authentic science in the classroom.

  10. Identifying the Factors Leading to Success: How an Innovative Science Curriculum Cultivates Student Motivation

    NASA Astrophysics Data System (ADS)

    Scogin, Stephen C.

    2016-01-01

    PlantingScience is an award-winning program recognized for its innovation and use of computer-supported scientist mentoring. Science learners work on inquiry-based experiments in their classrooms and communicate asynchronously with practicing plant scientist-mentors about the projects. The purpose of this study was to identify specific factors contributing to the program's effectiveness in engaging students. Using multiple data sources, grounded theory (Strauss and Corbin in Basics of qualitative research. Sage, Newbury Park, 1990) was used to develop a conceptual model identifying the central phenomenon, causal conditions, intervening conditions, strategies, contexts, and student outcomes of the project. Student motivation was determined to be the central phenomenon explaining the success of the program, with student empowerment, online mentor interaction, and authenticity of the scientific experiences serving as causal conditions. Teachers contributed to student motivation by giving students more freedom, challenging students to take projects deeper, encouraging, and scaffolding. Scientists contributed to student motivation by providing explanations, asking questions, encouraging, and offering themselves as partners in the inquiry process. Several positive student outcomes of the program were uncovered and included increased positivity, greater willingness to take projects deeper, better understanding of scientific concepts, and greater commitments to collaboration. The findings of this study provide relevant information on how to develop curriculum, use technology, and train practitioners and mentors to utilize strategies and actions that improve learners' motivation to engage in authentic science in the classroom.

  11. Lutein Leads to a Decrease of Factor D Secretion by Cultured Mature Human Adipocytes

    PubMed Central

    Tian, Yuan; Kijlstra, Aize; Renes, Johan; Wabitsch, Martin; Webers, Carroll A. B.; Berendschot, Tos T. J. M.

    2015-01-01

    Purpose. Complement plays an important role in the pathogenesis of age related macular degeneration (AMD) and trials are currently being conducted to investigate the effect of complement inhibition on AMD progression. We previously found that the plasma level of factor D (FD), which is the rate limiting enzyme of the complement alternative pathway, was significantly decreased following lutein supplementation. FD is synthesized by adipose tissue, which is also the main storage site of lutein. In view of these findings we tested the hypothesis whether lutein could affect FD synthesis by adipocytes. Methods. A cell line of mature human adipocytes was incubated with 50 μg/mL lutein for 24 and 48 h, whereafter FD mRNA and protein expression were measured. Results. Lutein significantly inhibited adipocyte FD mRNA expression and FD protein release into adipocyte culture supernatants. Conclusions. Our earlier observations showing that a daily lutein supplement in individuals with early signs of AMD lowered the level of circulating FD might be caused by blocking adipocyte FD production. PMID:26504594

  12. Application of Canonical Correlation Analysis for Detecting Risk Factors Leading to Recurrence of Breast Cancer

    PubMed Central

    Sadoughi, Farahnaz; Lotfnezhad Afshar, Hadi; Olfatbakhsh, Asiie; Mehrdad, Neda

    2016-01-01

    Background: Advances in treatment options of breast cancer and development of cancer research centers have necessitated the collection of many variables about breast cancer patients. Detection of important variables as predictors and outcomes among them, without applying an appropriate statistical method is a very challenging task. Because of recurrent nature of breast cancer occurring in different time intervals, there are usually more than one variable in the outcome set. For the prevention of this problem that causes multicollinearity, a statistical method named canonical correlation analysis (CCA) is a good solution. Objectives: The purpose of this study was to analyze the data related to breast cancer recurrence of Iranian females using the CCA method to determine important risk factors. Patients and Methods: In this cross-sectional study, data of 584 female patients (mean age of 45.9 years) referred to Breast Cancer Research Center (Tehran, Iran) were analyzed anonymously. SPSS and NORM softwares (2.03) were used for data transformation, running and interpretation of CCA and replacing missing values, respectively. Data were obtained from Breast Cancer Research Center, Tehran, Iran. Results: Analysis showed seven important predictors resulting in breast cancer recurrence in different time periods. Family history and loco-regional recurrence more than 5 years after diagnosis were the most important variables among predictors and outcomes sets, respectively. Conclusions: Canonical correlation analysis can be used as a useful tool for management and preparing of medical data for discovering of knowledge hidden in them. PMID:27231580

  13. Factors controlling elevated lead concentrations in water samples from aquifer systems in Florida

    USGS Publications Warehouse

    Katz, B.G.; Bullen, M.P.; Bullen, T.D.; Hansard, Paul

    1999-01-01

    Concentrations of total lead (Pb) and dissolved Pb exceeded the U.S. Environmental Protection Agency action level of 15 micrograms per liter (mg/L) in approximately 19 percent and 1.3 percent, respectively, of ground-water samples collected during 1991-96 from a statewide network of monitoring wells designed to delineate background water quality of Florida's major aquifer systems. Differences in total Pb concentrations among aquifer systems reflect the combined influence of anthropogenic sources and chemical conditions in each system. A highly significant (p<0.001) difference in median total Pb concentrations was found for water samples from wells with water-level recording devices that contain Pb-counterweights (14 mg/L) compared to non-recorder wells (2 mg/L). Differences between total Pb concentrations for recorder and non-recorder wells are even more pronounced when compared for each aquifer system. The largest differences for recorder status are found for the surficial aquifer system, where median total Pb concentrations are 44 and 2.4 mg/L for recorder wells and non-recorder wells, respectively. Leaching of Pb from metal casing materials is another potential source of Pb in ground water samples. Median total Pb concentrations in water samples from the surficial, intermediate, and Floridan aquifer systems are higher from recorder wells cased with black iron than for recorder wells with steel and PVC casing material. Stable isotopes of Pb were used in this study to distinguish between anthropogenic and natural sources of Pb in ground water, as Pb retains the isotopic signature of the source from which it is derived. Based on similarities between slopes and intercepts of trend lines for various sample types (plots of 206Pb/204Pb versus 208Pb/204Pb and 207Pb/204Pb versus 208Pb/204Pb) the predominant source of total Pb in water samples from the surficial aquifer system is corrosion of Pb counterweights. It is likely that only ground-water samples, not the aquifer

  14. Lead sources, behaviors, and socioeconomic factors in relation to blood lead of native american and white children: a community-based assessment of a former mining area.

    PubMed

    Malcoe, Lorraine Halinka; Lynch, Robert A; Keger, Michelle Crozier; Skaggs, Valerie J

    2002-04-01

    Lead poisoning prevention requires knowledge of lead sources and of appropriate residential lead standards. Data are severely lacking on lead sources for Native American children, many of whom live in rural areas. Further, the relation of mining waste to blood lead concentrations (BPbs) of rural children is controversial. In collaboration with the eight tribes of northeastern Oklahoma, we assessed lead sources and their effects on BPbs for rural Native American and White children living in a former mining region. Venous blood lead, residential environmental (soil, dust, paint, water), and caregiver interview (e.g., hand-to-mouth behaviors, socioeconomic conditions) data were obtained from a representative sample of 245 children 1-6 years of age. BPbs ranged from 1 to 24 microg/dL. There were no ethnic differences in BPbs (p= 0.48) nor any patterns of excess lead sources for Native American or White children. Multiple linear regression analyses indicated that mean soil lead, mean floor lead loading, mouthing behaviors, caregivers' education, and residence in former mining towns were all strongly associated with BPbs. Logistic regression results showed mean floor dust lead loading greater than or equal to 10.1 microg/ft(2) (odds ratio [OR], 11.4; 95% confidence interval [CI], 3.5-37.3), and yard soil lead >165.3 mg/kg (OR, 4.1; CI, 1.3-12.4) were independently associated with BPbs greater than or equal to 10 microg/dL. We also found strong interactions between soil lead and poverty (p= 0.005), and dust and soil sources (p= 0.02). Our findings indicate that soil and dust lead derived largely from mining waste pose a health hazard to Native American and White children, and that current residential dust lead standards are insufficient to adequately protect children. Moreover, our finding that poor children are especially vulnerable to lead exposures suggests that residential standards should consider interactions among socioeconomic conditions and lead sources if

  15. Lead sources, behaviors, and socioeconomic factors in relation to blood lead of native american and white children: a community-based assessment of a former mining area.

    PubMed Central

    Malcoe, Lorraine Halinka; Lynch, Robert A; Keger, Michelle Crozier; Skaggs, Valerie J

    2002-01-01

    Lead poisoning prevention requires knowledge of lead sources and of appropriate residential lead standards. Data are severely lacking on lead sources for Native American children, many of whom live in rural areas. Further, the relation of mining waste to blood lead concentrations (BPbs) of rural children is controversial. In collaboration with the eight tribes of northeastern Oklahoma, we assessed lead sources and their effects on BPbs for rural Native American and White children living in a former mining region. Venous blood lead, residential environmental (soil, dust, paint, water), and caregiver interview (e.g., hand-to-mouth behaviors, socioeconomic conditions) data were obtained from a representative sample of 245 children 1-6 years of age. BPbs ranged from 1 to 24 microg/dL. There were no ethnic differences in BPbs (p= 0.48) nor any patterns of excess lead sources for Native American or White children. Multiple linear regression analyses indicated that mean soil lead, mean floor lead loading, mouthing behaviors, caregivers' education, and residence in former mining towns were all strongly associated with BPbs. Logistic regression results showed mean floor dust lead loading greater than or equal to 10.1 microg/ft(2) (odds ratio [OR], 11.4; 95% confidence interval [CI], 3.5-37.3), and yard soil lead >165.3 mg/kg (OR, 4.1; CI, 1.3-12.4) were independently associated with BPbs greater than or equal to 10 microg/dL. We also found strong interactions between soil lead and poverty (p= 0.005), and dust and soil sources (p= 0.02). Our findings indicate that soil and dust lead derived largely from mining waste pose a health hazard to Native American and White children, and that current residential dust lead standards are insufficient to adequately protect children. Moreover, our finding that poor children are especially vulnerable to lead exposures suggests that residential standards should consider interactions among socioeconomic conditions and lead sources if

  16. Measles Virus Infection Inactivates Cellular Protein Phosphatase 5 with Consequent Suppression of Sp1 and c-Myc Activities

    PubMed Central

    Sato, Hiroki; Yoneda, Misako; Honma, Reiko; Ikeda, Fusako; Watanabe, Shinya

    2015-01-01

    ABSTRACT Measles virus (MeV) causes several unique syndromes, including transient immunosuppression. To clarify the cellular responses to MeV infection, we previously analyzed a MeV-infected epithelial cell line and a lymphoid cell line by microarray and showed that the expression of numerous genes was up- or downregulated in the epithelial cells. In particular, there was a characteristic comprehensive downregulation of housekeeping genes during late stage infection. To identify the mechanism underlying this phenomenon, we examined the phosphorylation status of transcription factors and kinase/phosphatase activities in epithelial cells after infection. MeV infection inactivated cellular protein phosphatase 5 (PP5) that consequently inactivated DNA-dependent protein kinase, which reduced Sp1 phosphorylation levels, and c-Myc degradation, both of which downregulated the expression of many housekeeping genes. In addition, intracellular accumulation of viral nucleocapsid inactivated PP5 and subsequent downstream responses. These findings demonstrate a novel strategy of MeV during infection, which causes the collapse of host cellular functions. IMPORTANCE Measles virus (MeV) is one of the most important pathogens in humans. We previously showed that MeV infection induces the comprehensive downregulation of housekeeping genes in epithelial cells. By examining this phenomenon, we clarified the molecular mechanism underlying the constitutive expression of housekeeping genes in cells, which is maintained by cellular protein phosphatase 5 (PP5) and DNA-dependent protein kinase. We also demonstrated that MeV targets PP5 for downregulation in epithelial cells. This is the first report to show how MeV infection triggers a reduction in overall cellular functions of infected host cells. Our findings will help uncover unique pathogenicities caused by MeV. PMID:26157124

  17. Identification by In Vivo Genomic Footprinting of a Transcriptional Switch Containing NF-κB and Sp1 That Regulates the IκBα Promoter

    PubMed Central

    Algarté, Michèle; Kwon, Hakju; Génin, Pierre; Hiscott, John

    1999-01-01

    In unstimulated cells, NF-κB transcription factors are retained in the cytoplasm by inhibitory IκB proteins. Upon stimulation by multiple inducers including cytokines or viruses, IκBα is rapidly phosphorylated and degraded, resulting in the release of NF-κB and the subsequent increase in NF-κB-regulated gene expression. IκBα gene expression is also regulated by an NF-κB autoregulatory mechanism, via NF-κB binding sites in the IκBα promoter. In previous studies, tetracycline-inducible expression of transdominant repressors of IκBα (TD-IκBα) progressively decreased endogenous IκBα protein levels. In the present study, we demonstrate that expression of TD-IκBα blocked phorbol myristate acetate-phytohemagglutinin or tumor necrosis factor alpha-induced IκBα gene transcription and abolished NF-κB DNA binding activity, due to the continued cytoplasmic sequestration of RelA(p65) by TD-IκBα. In vivo genomic footprinting revealed stimulus-responsive protein-DNA binding not only to the −63 to −53 κB1 site but also to the adjacent −44 to −36 Sp1 site of the IκBα promoter. In vivo protection of both sites was inhibited by tetracycline-inducible TD-IκBα expression. Prolonged NF-κB binding and a temporal switch in the composition of NF-κB complexes bound to the −63 to −53 κB1 site of the IκBα promoter were also observed; with time after induction, decreased levels of transcriptionally active p50-p65 and increased p50–c-Rel heterodimers were detected at the κB1 site. Mutation of either the κB1 site or the Sp1 site abolished transcription factor binding to the respective sites and the inducibility of the IκBα promoter in transient transfection studies. These observations provide the first in vivo characterization of a promoter proximal transcriptional switch involving NF-κB and Sp1 that is essential for autoregulation of the IκBα promoter. PMID:10454561

  18. A Survey of Factors Affecting Blunt Leading-Edge Separation for Swept and Semi-Slender Wings

    NASA Technical Reports Server (NTRS)

    Luckring, James M.

    2010-01-01

    A survey is presented of factors affecting blunt leading-edge separation for swept and semi-slender wings. This class of separation often results in the onset and progression of separation-induced vortical flow over a slender or semi-slender wing. The term semi-slender is used to distinguish wings with moderate sweeps and aspect ratios from the more traditional highly-swept, low-aspect-ratio slender wing. Emphasis is divided between a selection of results obtained through literature survey a section of results from some recent research projects primarily being coordinated through NATO s Research and Technology Organization (RTO). An aircraft context to these studies is included.

  19. Role of SP1-binding domains in in vivo transcriptional regulation of the human immunodeficiency virus type 1 long terminal repeat.

    PubMed

    Harrich, D; Garcia, J; Wu, F; Mitsuyasu, R; Gonazalez, J; Gaynor, R

    1989-06-01

    Five regions of the human immunodeficiency virus type 1 (HIV-1) long terminal repeat (LTR) have been shown to be important in the transcriptional regulation of HIV in HeLa cells. These include the negative regulatory, enhancer, SP1, TATA, and TAR regions. Previous studies in which purified SP1 was used showed that the three SP1-binding sites in the HIV LTR were important in the in vitro transcription of this promoter. However, no studies to ascertain the role of each of these SP1-binding sites in basal and tat-induced transcriptional activation in vivo have been reported. To determine the role of SP1 sites in transcriptional regulation of the HIV LTR in vivo, these sites were subjected to oligonucleotide mutagenesis both individually and in groups. The constructs were tested by DNase I footprinting with both oligonucleotide affinity column-purified SP1 and partially purified HeLa extract and by chloramphenicol acetyltransferase assays in both the presence and absence of the tat gene. Mutagenesis of each SP1-binding site resulted in minimal changes in basal and tat-induced transcriptional activation. Mutations involving alterations of SP1 sites I and II, I and III, or II and III also resulted in minimal decreases in basal and tat-induced transcriptional activation. However, mutagenesis of all three SP1-binding sites resulted in a marked decrease in tat induction. The latter mutation also greatly decreased DNase I protection over the enhancer, TATA, and TAR regions when partially purified HeLa nuclear extract was used. Mutagenesis of the HIV LTR SP1 sites which converted them to consensus high-affinity SP1-binding sites with the sequence GGGGCGGGGC resulted in increased tat-induced gene expression compared with the wild-type HIV LTR template. These results suggest that SP1, through its interaction with other DNA-binding proteins, is critical for in vivo transcriptional regulation of HIV. PMID:2657100

  20. Significance of different microalgal species for growth of moon jellyfish ephyrae, Aurelia sp.1

    NASA Astrophysics Data System (ADS)

    Zheng, Shan; Sun, Xiaoxia; Wang, Yantao; Sun, Song

    2015-10-01

    The scyphozoan Aurelia aurita (Linnaeus) sp. l., is a cosmopolitan species-complex which blooms seasonally in a variety of coastal and shelf sea environments around the world. The effects of different microalgal species on the growth of newly-released Aurelia sp.1 ephyrae were studied under laboratory conditions. We fed ephyrae with four different microalgal species (diatom, autotrophic dinoflagellate, heterotrophic dinoflagellate, and chlorophyta) plus Artemia nauplii for 12-24 d at 18°C. Results showed that the growth rate diverged significantly for Artemia nauplii compared to other food types. In addition, there was no significant variation between the growth rates for Skeletonema costatum and Prorocentrum donghaiense, and no significant variation was found in the growth rates for N. scintillans and P. subcordiformis. Artemia nauplii could support the energy requirement for the newly-released ephyrae to develop to meduase, and the ephyrae with Artemia nauplii showed a significant average growth rate of 25.85% d-1. Newly-released ephyrae could grow slightly with some species of microalgae in the earliest development stage. Chain diatom Skeletonema costatum and autotrophic dinoflagellate Prorocentrum donghaiense, could not support the growth of the ephyrae, while heterotrophic dinoflagellate Noctiluca scintillans and chlorophyta Platymonas subcordiformis could support the growth of the ephyrae. However, none of the ephyrae fed with the tested phytoplankton could mature to medusae.

  1. Achromobactor denitrificans SP1 produces pharmaceutically active 25C prodigiosin upon utilizing hazardous di(2-ethylhexyl)phthalate

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Achromobacter denitrificans SP1 isolated from soil sludge heavily contaminated with plastic waste produced a novel pharmaceutically-active 25C prodigiosin analog during growth in a simple mineral salt medium supplemented with hazardous di(2-ethylhexyl)phthalate (DEHP) blended PVC plastics (in situ) ...

  2. Quantitative Analysis of Estrogen Receptor Expression Shows SP1 antibody is more sensitive than 1D5

    PubMed Central

    Welsh, Allison W.; Harigopal, Malini; Wimberly, Hallie; Prasad, Manju; Rimm, David L.

    2012-01-01

    Studies comparing rabbit monoclonal SP1 antibody to 1D5 for ER immunohistochemical (IHC) testing show conflicting results. Here we use a standardized quantitative immunofluorescent (QIF) ER assay to determine the level and significance of discordance between antibodies. Both antibodies are assessed by QIF on our Index TMA of cell lines and case controls, followed by QIF and IHC on two retrospective cohorts from Yale. On the Index TMA, SP1 displayed stronger signal-to-noise than 1D5. On the patient cohorts, the range of discrepancy between the two antibodies is 8% to 16.9%, with the majority of discrepant cases being SP1-positive/1D5-negative. Kaplan Meier analysis of the discrepant cases shows outcome comparable to double positive cases, suggesting that SP1 is more sensitive than 1D5. A series of cases with high levels of ER-beta shows that neither antibody cross-reacts, suggesting equivalent specificity. Future efforts are needed to determine if response to endocrine therapies show superiority of either antibody as a companion diagnostic test. PMID:22820659

  3. The anti-proliferative effects of type I IFN involve STAT6-mediated regulation of SP1 and BCL6.

    PubMed

    Hsu, Yu-An; Huang, Chi-Chun; Kung, Yung-Jen; Lin, Hui-Ju; Chang, Ching-Yao; Lee, Kuan-Rong; Wan, Lei

    2016-06-01

    Type I IFN-induced STAT6 has been shown to have anti-proliferative effects in Daudi and B cells. IFN-sensitive (DS) and IFN-resistant (DR) subclones of Daudi cells were used to study the role of STAT6 in the anti-proliferative activities. Type I IFN significantly increased STAT6 mRNA and protein expression in DS but not DR cells. STAT6 knockdown significantly reduced the sensitivity to IFN in both cell lines. The molecular targets and functional importance of IFN-activated STAT6 were performed by chromatin immunoprecipitation-on-chip (ChIP-on-chip) experiments in type I IFN-treated Daudi cells. Two target genes (Sp1 and BCL6) were selected from the ChIP-on-chip data. IFN-induced STAT6 activation led to Sp1 upregulation and BCL6 downregulation in DS cells, with only minimal effects in DR cells. siRNA inhibition of STAT6 expression resulted in decreased Sp1 and BCL6 mRNA and protein levels in both DS and DR cells. IFN treatment did not increase Sp1 and BCL6 expression in a STAT2-deficient RST2 cell line, and this effect was mitigated by plasmid overexpression of STAT2, indicating that STAT2 is important for STAT6 activation. These results suggest that STAT6 plays an important role in regulating Sp1 and BCL6 through STAT2 to exert the anti-proliferative effects of type I IFN. PMID:26945968

  4. Accentuating and Opposing Factors Leading to Development of Thoracic Aortic Aneurysms Not Due to Genetic or Inherited Conditions.

    PubMed

    Rabkin, Simon W

    2015-01-01

    Understanding and unraveling the pathophysiology of thoracic aortic aneurysm (TAA), a vascular disease with a potentially high-mortality rate, is one of the next frontiers in vascular biology. The processes leading to the formation of TAA, of unknown cause, so-called degenerative TAA, are complex. This review advances the concept of promoters and inhibitors of the development of degenerative TAA. Promoters of TAA development include age, blood pressure elevation, increased pulse pressure, neurohumeral factors increasing blood pressure, inflammation specifically IFN-γ, IL-1 β, IL-6, TNF-α, and S100 A12; the coagulation system specifically plasmin, platelets, and thrombin as well as matrix metalloproteinases (MMPs). SMAD-2 signaling and specific microRNAs modulate TAA development. The major inhibitors or factors opposing TAA development are the constituents of the aortic wall (elastic lamellae, collagen, fibulins, fibronectin, proteoglycans, and vascular smooth muscle cells), which maintain normal aortic dimensions in the face of aortic wall stress, specific tissue MMP inhibitors, plasminogen activator inhibitor-1, protease nexin-1, and Syndecans. Increases in promoters and reductions in inhibitors expand the thoracic aorta leading to TAA formation. PMID:26664893

  5. A Study on Voltage Rise Control Effect by Leading Power Factor Operation of PVs Considering Tap Change of Distribution Transformer

    NASA Astrophysics Data System (ADS)

    Ishimaru, Masa-Aki; Tamachi, Hideki; Komami, Shintaroh

    Voltage rise problem in distribution networks has been discussed as the foremost concern against the penetration of large amount of photovoltaics (PVs). As a solution of such problem, using voltage regulation facility such as SVC (Static Var Compensator) or Loop power flow controller are proposed. However, it might require major investments in the distribution network and that means the cost would be imposed on the nation. In this paper, the authors focus on latent ability of the present distribution network and PVs to find solution against the problem and propose a low cost solution to mitigate the voltage rise by using constant leading power factor operation of PVs. The distribution voltages are calculated in case of increasing highly penetrated PVs, where it is very important to make an aggregated model of the distribution networks including loads and PVs. The authors aggregate a lot of loads and PVs by using an aggregation method called “Y-connection”. As a result of having simulated with the aggregated realistic model of distribution networks, the authors confirmed that using a combination of leading power factor operation by Q = -0.2P and LDC of distribution transformer make it possible to maintain adequate voltage without voltage regulation facility such as SVC.

  6. Cross-sectional study on the effects of socioeconomic factors on lead exposure in children by gender in Serpong, Indonesia.

    PubMed

    Iriani, Dewi U; Matsukawa, Takehisa; Tadjudin, Muhammad K; Itoh, Hiroaki; Yokoyama, Kazuhito

    2012-11-01

    To elucidate the socioeconomic factors influencing lead exposure in elementary school children by gender, 108 children (56 male, 52 female), aged 6-7 years, were randomly selected from 39 elementary state schools in Serpong, Banten, Indonesia. Their parents were interviewed to obtain information on sociodemographic characteristics. Their blood lead (BPb) levels were measured by atomic absorption spectrophotometry. BPb concentrations were significantly higher in males than in females, i.e., 6.8 ± 2.0 (2.9-12.5) µg/dL and 5.9 ± 1.9 (3.1-11.7) µg/dL, respectively (p < 0.05). Lower socioeconomic status and well water use were associated with increased BPb concentrations, especially in females. The proportion of well water use was related to lower socioeconomic status. Lower socioeconomic status linked with well water drinking seemed to be associated with increased lead exposure in children in Serpong. Their exposure levels possibly varied according to gender differences in behavior. An intervention should be instituted among children in Serpong with BPb concentrations of 10 µg/dL or above. PMID:23202836

  7. EMMPRIN, SP1 and microRNA-27a mediate physcion 8-O-β-glucopyranoside-induced apoptosis in osteosarcoma cells.

    PubMed

    Wang, Zhaohong; Yang, Huilin

    2016-01-01

    Physcion 8-O-β-glucopyranoside (PG), the main active ingredient of Rumex japonicus, induces apoptosis and causes cell cycle arrest in human lung cancer cells. However, its anti-tumor effects are not fully understood. In this study, we explored the mechanisms underlying PG induced apoptosis in the osteosarcoma cell line MG-63. Our results showed that PG exerted anti-proliferative effects and induced apoptosis in MG-63 cells via the intrinsic mitochondrial pathway, accompanied by loss of mitochondrial membrane potential (MMP) and cytochrome C release from the mitochondria. In addition, physcion treatment significantly inhibited extracellular matrix metalloproteinase inducer (EMMPRIN) expression in MG-63 cells, in a dose-dependent manner; meanwhile, EMMPRIN protein overexpression markedly reduced PG-induced apoptosis. Moreover, our findings suggested that the modulatory effects of PG on EMMPRIN were due, at least in part, to regulation of an ROS-miR-27a/ZBTB10-Sp1 transcription factor pathway. PMID:27429847

  8. EMMPRIN, SP1 and microRNA-27a mediate physcion 8-O-β-glucopyranoside-induced apoptosis in osteosarcoma cells

    PubMed Central

    Wang, Zhaohong; Yang, Huilin

    2016-01-01

    Physcion 8-O-β-glucopyranoside (PG), the main active ingredient of Rumex japonicus, induces apoptosis and causes cell cycle arrest in human lung cancer cells. However, its anti-tumor effects are not fully understood. In this study, we explored the mechanisms underlying PG induced apoptosis in the osteosarcoma cell line MG-63. Our results showed that PG exerted anti-proliferative effects and induced apoptosis in MG-63 cells via the intrinsic mitochondrial pathway, accompanied by loss of mitochondrial membrane potential (MMP) and cytochrome C release from the mitochondria. In addition, physcion treatment significantly inhibited extracellular matrix metalloproteinase inducer (EMMPRIN) expression in MG-63 cells, in a dose-dependent manner; meanwhile, EMMPRIN protein overexpression markedly reduced PG-induced apoptosis. Moreover, our findings suggested that the modulatory effects of PG on EMMPRIN were due, at least in part, to regulation of an ROS-miR-27a/ZBTB10-Sp1 transcription factor pathway. PMID:27429847

  9. Blood lead and cadmium levels and relevant factors among children from an e-waste recycling town in China

    SciTech Connect

    Zheng Liangkai; Wu Kusheng; Li Yan; Qi Zongli; Han Dai; Zhang Bao; Gu Chengwu; Chen Gangjian; Liu Junxiao; Chen Songjian; Xu Xijin; Huo Xia

    2008-09-15

    Background: Primitive electronic waste (e-waste) recycling is ongoing in Guiyu, and thus toxic heavy metals may keep on threatening to the health of local children. Some related factors may contribute to the elevation of blood lead levels (BLLs) or blood cadmium levels (BCLs). Objective: To investigate the children's BLLs and BCLs in Guiyu and Chendian as compare to discuss the effects of primitive e-waste recycling activities on children's health. Methods: Two hundred and seventy-eight children less than 8 years who lived in Guiyu and Chendian were observed, and their BLLs and BCLs were determined by graphite atomizer absorption spectrophotometer. Questionnaire survey for risk factors was also performed and data were analyzed using spearman correlation analyses and logistic regression analyses. Results: Children living in Guiyu had significantly higher BLLs and BCLs as compared with those living in Chendian (p<0.01). In Guiyu, 70.8% of children (109/154) had BLLs>10 {mu}g/dL, and 20.1% of children (31/154) had BCLs>2 {mu}g/L, compared with 38.7% of children (48/124) had BLLs>10 {mu}g/dL and 7.3% of children (9/124) had BCLs>2 {mu}g/L in Chendian (p<0.01, respectively). We also observed a significant increasing trend in BLLs with increasing age in Guiyu (p<0.01). Mean height of children in Guiyu was significantly lower than that in Chendian (p<0.01). The risk factors related to children's BLLs and BCLs mainly included father's engagement in the work related to e-waste, children's residence in Guiyu and the amount of time that children played outside near the road everyday. Conclusions: There are close relationships between the BLLs, BCLs in children and the primitive e-waste recycling activities in Guiyu. Environmental pollution, especially lead pollution, has threatened the health of children living around e-waste recycling site.

  10. Next-to-leading order QCD factorization for semi-inclusive deep inelastic scattering at twist 4.

    PubMed

    Kang, Zhong-Bo; Wang, Enke; Wang, Xin-Nian; Xing, Hongxi

    2014-03-14

    Within the framework of a high-twist approach, we calculate the next-to-leading order (NLO) perturbative QCD corrections to the transverse momentum broadening in semi-inclusive hadron production in deeply inelastic e+A collisions, as well as lepton pair production in p+A collisions. With explicit calculations of both real and virtual contributions, we verify, for the first time, the factorization theorem at twist 4 in NLO for the nuclear-enhanced transverse momentum weighted differential cross section and demonstrate the universality of the associated twist-4 quark-gluon correlation function. We also identify the QCD evolution equation for the twist-4 quark-gluon correlation function in a large nucleus, which can be solved to determine the scale dependence of the jet transport parameter in the study of jet quenching. PMID:24679281

  11. Next-to-Leading Order QCD Factorization for Semi-Inclusive Deep Inelastic Scattering at Twist 4

    NASA Astrophysics Data System (ADS)

    Kang, Zhong-Bo; Wang, Enke; Wang, Xin-Nian; Xing, Hongxi

    2014-03-01

    Within the framework of a high-twist approach, we calculate the next-to-leading order (NLO) perturbative QCD corrections to the transverse momentum broadening in semi-inclusive hadron production in deeply inelastic e +A collisions, as well as lepton pair production in p +A collisions. With explicit calculations of both real and virtual contributions, we verify, for the first time, the factorization theorem at twist 4 in NLO for the nuclear-enhanced transverse momentum weighted differential cross section and demonstrate the universality of the associated twist-4 quark-gluon correlation function. We also identify the QCD evolution equation for the twist-4 quark-gluon correlation function in a large nucleus, which can be solved to determine the scale dependence of the jet transport parameter in the study of jet quenching.

  12. CD1d induction in solid tumor cells by histone deacetylase inhibitors through inhibition of HDAC1/2 and activation of Sp1.

    PubMed

    Yang, Pei-Ming; Lin, Pei-Jie; Chen, Ching-Chow

    2012-04-01

    CD1d is a MHC class-like molecule that presents glycolipids to natural killer T (NKT) cells, then regulates innate and adaptive immunity. The regulation of CD1d gene expression in solid tumors is still largely unknown. Gene expression can be epigenetically regulated by DNA methylation and histone acetylation. We found that histone deacetylase inhibitors, trichostatin A (TSA) and suberoylanilide hydroxamic acid (SAHA), induced CD1d gene expression in human (A549 and NCI-H292) and mouse (TC-1 and B16/F0) cancer cells. Simultaneous knockdown of HDAC1 and 2 induced CD1d gene expression. Sp1 inhibitor mitramycin A (MTM) blocked TSA- and SAHA-induced CD1d mRNA expression and Sp1 luciferase activity. Co-transfection of GAL4-Sp1 and Fc-luciferase reporters demonstrated that TSA and SAHA induced Sp1 luciferase reporter activity by enhancing Sp1 transactivation activity. The binding of Sp1 to CD1d promoter and histone H3 acetylation on Sp1 sites were increased by TSA and SAHA. These results indicate that TSA and SAHA could up-regulate CD1d expression in tumor cells through inhibition of HDAC1/2 and activation of Sp1. PMID:22419072

  13. Factors Leading to the Formation of a Resistive Thin Film at the Bottom of Aluminum Electrolysis Cells

    NASA Astrophysics Data System (ADS)

    Coulombe, Marc-André; Soucy, Gervais; Rivoaland, Loig; Davies, Lynne

    2016-04-01

    Studies on sludge formation in aluminum electrolysis cells are rare and typically do not distinguish the deposits at the center of the cell from those composing the ledge toe because low voltage lost is expected at the center of the cell. However, high amount of sludge in the center leads to the formation of a thin film in an intermediate zone between the ledge toe and this center thick sludge accumulation. Looking at sludge deposits through composition mapping and microstructure analysis coming from four aluminum cells of two different aluminum reduction technologies, major factors leading to a thin resistive film were identified. This includes the formation of a suspension on the top of the thick deposit at the center of the cell, its displacement through magnetohydrodynamic induced movement by the metal pad, and the growth and thickening of a carbide sublayer making the thin film even more resistive. Correlation between thickening of the thin film and cathode voltage drop increase was observed. The postmortem analysis performed on six laboratory experiments was found useful to support different observations made on the industrial cells at lower cost.

  14. Proto-oncogene FBI-1 (Pokemon/ZBTB7A) represses transcription of the tumor suppressor Rb gene via binding competition with Sp1 and recruitment of co-repressors.

    PubMed

    Jeon, Bu-Nam; Yoo, Jung-Yoon; Choi, Won-Il; Lee, Choong-Eun; Yoon, Ho-Geun; Hur, Man-Wook

    2008-11-28

    FBI-1 (also called Pokemon/ZBTB7A) is a BTB/POZ-domain Krüppel-like zinc-finger transcription factor. Recently, FBI-1 was characterized as a proto-oncogenic protein, which represses tumor suppressor ARF gene transcription. The expression of FBI-1 is increased in many cancer tissues. We found that FBI-1 potently represses transcription of the Rb gene, a tumor suppressor gene important in cell cycle arrest. FBI-1 binds to four GC-rich promoter elements (FREs) located at bp -308 to -188 of the Rb promoter region. The Rb promoter also contains two Sp1 binding sites: GC-box 1 (bp -65 to -56) and GC-box 2 (bp -18 to -9), the latter of which is also bound by FBI-1. We found that FRE3 (bp -244 to -236) is also a Sp1 binding element. FBI-1 represses transcription of the Rb gene not only by binding to the FREs, but also by competing with Sp1 at the GC-box 2 and the FRE3. By binding to the FREs and/or the GC-box, FBI-1 represses transcription of the Rb gene through its POZ-domain, which recruits a co-repressor-histone deacetylase complex and deacetylates histones H3 and H4 at the Rb gene promoter. FBI-1 inhibits C2C12 myoblast cell differentiation by repressing Rb gene expression. PMID:18801742

  15. Proto-oncogene FBI-1 (Pokemon/ZBTB7A) Represses Transcription of the Tumor Suppressor Rb Gene via Binding Competition with Sp1 and Recruitment of Co-repressors*S⃞

    PubMed Central

    Jeon, Bu-Nam; Yoo, Jung-Yoon; Choi, Won-Il; Lee, Choong-Eun; Yoon, Ho-Geun; Hur, Man-Wook

    2008-01-01

    FBI-1 (also called Pokemon/ZBTB7A) is a BTB/POZ-domain Krüppel-like zinc-finger transcription factor. Recently, FBI-1 was characterized as a proto-oncogenic protein, which represses tumor suppressor ARF gene transcription. The expression of FBI-1 is increased in many cancer tissues. We found that FBI-1 potently represses transcription of the Rb gene, a tumor suppressor gene important in cell cycle arrest. FBI-1 binds to four GC-rich promoter elements (FREs) located at bp –308 to –188 of the Rb promoter region. The Rb promoter also contains two Sp1 binding sites: GC-box 1 (bp –65 to –56) and GC-box 2 (bp –18 to –9), the latter of which is also bound by FBI-1. We found that FRE3 (bp –244 to –236) is also a Sp1 binding element. FBI-1 represses transcription of the Rb gene not only by binding to the FREs, but also by competing with Sp1 at the GC-box 2 and the FRE3. By binding to the FREs and/or the GC-box, FBI-1 represses transcription of the Rb gene through its POZ-domain, which recruits a co-repressor-histone deacetylase complex and deacetylates histones H3 and H4 at the Rb gene promoter. FBI-1 inhibits C2C12 myoblast cell differentiation by repressing Rb gene expression. PMID:18801742

  16. Low levels of tissue factor lead to alveolar hemorrhage, potentiating murine acute lung injury and oxidative stress

    PubMed Central

    Bastarache, J.A.; Sebag, S. C.; Clune, J.K.; Grove, B.S.; Lawson, W.E.; Janz, D. R.; Roberts, L. J.; Dworski, R; Mackman, N.; Ware, L. B.

    2013-01-01

    Background Systemic blockade of Tissue Factor (TF) attenuates acute lung injury (ALI) in animal models of sepsis but the effects of global TF deficiency are unknown. Hypothesis We used mice with complete knockout of mouse TF and low levels (~1%) of human TF (LTF mice) to test the hypothesis that global TF deficiency attenuates lung inflammation in direct lung injury. Methods LTF mice were treated with 10 μg of lipopolysaccharide (LPS) or vehicle administered by direct intratracheal (IT) injection and studied at 24 hours. Results Contrary to our hypothesis, LTF mice had increased lung inflammation and injury as measured by bronchoalveolar lavage cell count (3.4 × 105 WT LPS versus 3.3 × 105 LTF LPS, p=0.947) and protein (493 μg/ml WT LPS versus 1014 μg/ml LTF LPS, p=0.006), proinflammatory cytokines (TNF-α, IL-10, IL-12, p<0.035 WT LPS versus LTF LPS) and histology compared to wild type mice. LTF mice also had increased hemorrhage and free hemoglobin in the airspace accompanied by increased oxidant stress as measured by lipid peroxidation products (F2-Isoprostanes and Isofurans). Conclusions These findings indicate that global TF deficiency does not confer protection in a direct lung injury model. Rather, TF deficiency causes increased intra-alveolar hemorrhage following LPS leading to increased lipid peroxidation. Strategies to globally inhibit tissue factor may be deleterious in patients with ALI. PMID:23033361

  17. Peritoneal Dissemination Requires an Sp1-Dependent CXCR4/CXCL12 Signaling Axis and Extracellular Matrix-Directed Spheroid Formation.

    PubMed

    Kasagi, Yuta; Harada, Yui; Morodomi, Yosuke; Iwai, Toshiki; Saito, Satoru; Yoshida, Kumi; Oki, Eiji; Saeki, Hiroshi; Ohgaki, Kippei; Sugiyama, Masahiko; Onimaru, Mitsuho; Maehara, Yoshihiko; Yonemitsu, Yoshikazu

    2016-01-15

    Peritonitis carcinomatosa is an advanced and intractable state of gastrointestinal and ovarian cancer, where mechanistic elucidation might enable the development of more effective therapies. Peritoneal dissemination of this type of malignancy has been generally thought to initiate from "milky spots" of primitive lymphoid tissues in the peritoneal cavity. In this study, we offer evidence challenging this idea, based on the finding that tumor implantation and directional dissemination was not required for the presence of milky spots, but rather SCF/CXCL12-expressing niche-like cells located at the border regions of perivascular adipose tissue. Interestingly, we found that peritoneal cavity lavage fluid, which specifically contains peritoneal collagen type IV and plasma fibronectin, dramatically facilitated spheroid formation of murine and human colon cancer cells. Spheroid formation strongly induced the expression of CXCR4 in an Sp1-dependent manner to promote niche-directed metastasis. Notably, disrupting sphere formation or inhibiting Sp1 activity was sufficient to suppress tumor dissemination and potentiated chemosensitivity to 5-fluorouracil. Our findings illuminate mechanisms of peritoneal cancer dissemination and highlight the Sp1/CXCR4/CXCL12 signaling axis as a rational target for the development of therapeutics to manage this intractable form of malignancy. PMID:26744523

  18. Purification and characterization of detergent stable alkaline protease from Bacillus amyloliquefaciens SP1 isolated from apple rhizosphere.

    PubMed

    Guleria, Shiwani; Walia, Abhishek; Chauhan, Anjali; Shirkot, Chand Karan

    2016-02-01

    A thermostable extracellular alkaline protease producing Bacillus amyloliquefaciens SP1 was isolated from apple rhizosphere having multifarious plant growth promoting activities. Strain SP1 was purified to 6.48-fold using four-step purification protocol and characterized in detail for its robustness and ecofriendly application in leather and detergent industries. Structural analysis revealed that the protease was monomeric and had a molecular weight of 43 kDa. It exhibited optimum activity at 60°C in alkaline environment (pH 8.0) and stable in the presence of surfactants and oxidizing agents. Enzyme was thermostable at 50°C and retained more than 70% activity after 30 min incubation. It has shown stain removal property and dehairing of goat skin without chemical assistance and hydrolyzing fibrous proteins. This protease showed Km of 0.125 mg ml(-1) and V(max) of 12820 μg ml(-1) indicating its excellent affinity and catalytic role. Thermal inactivation of the pure enzyme followed first-order kinetics. The half life of the pure enzyme at 50, 60, and 65°C was 77, 19.80, and 13.33 min, respectively. The activation energy was 37.19 KJ mol(-1). The results suggest that the B. amyloliquefaciens SP1 has a potential application in different industries. PMID:26375163

  19. Reference values of lead in blood and related factors among blood donors in the Western Amazon, Brazil.

    PubMed

    Freire, Carmen; Koifman, Rosalina Jorge; Fujimoto, Denys; de Oliveira Souza, Vanessa Cristina; Barbosa, Fernando; Koifman, Sergio

    2014-01-01

    The aim of this study was to (1) determine the reference value of blood lead levels (BLL) in a sample of blood donors of Rio Branco, the capital city of Acre, in the Western Brazilian Amazon, and (2) explore factors influencing lead (Pb) exposure levels. Between 2010 and 2011, blood samples were collected from universal blood donors attending the Central Hemotherapic Unit in Rio Branco with a total number of 1196. Information on characteristics of 1183 donors was obtained through questionnaires. Blood Pb concentrations were determined by inductively coupled plasma-mass spectrometry with detection limit of 0.003 μg/L. Association between BLL and participant characteristics was examined by linear regression analysis. Reference values of BLL were calculated as the upper limit of the 95% confidence interval of the 95th percentile. Reference values of BLL were 109.5 μg/L for men, 70.7 μg/L for women, 88.9 μg/L for younger individuals (18-29 yr), 115.3 μg/L for older ones (≥30 yr), 94.2 μg/L for nonsmokers, and 164.5 μg/L for smokers. Levels of BLL were significantly higher in males, subjects older than 29 yr, non-whites, smokers, regular consumers of manioc flour, and donors practicing any activity related to paints, ceramics, pottery, fishing, or firearms. Subjects with higher education, higher income, vitamin intake use, and drinkers of bottled water displayed lower BLL. In general, BLL in men and women from Rio Branco were higher than those described in other adult populations. Prevention of exposure of this population to local sources of Pb needs to be addressed. PMID:24627997

  20. An experimental analysis of critical factors involved in the breakdown process of leading edge vortex flows. Ph.D. Thesis

    NASA Technical Reports Server (NTRS)

    Visser, Kenneth D.

    1991-01-01

    factors leading to the onset of breakdown are felt to be the local circulation of the vortex and the accompanying pressure field.

  1. Cyclin A regulates a cell-cycle-dependent expression of CKAP2 through phosphorylation of Sp1

    SciTech Connect

    Kang, Du-Seock; Hong, Kyeong-Man; Park, Joobae; Bae, Chang-Dae

    2012-04-20

    Highlights: Black-Right-Pointing-Pointer We identified a GC box and a CHR element in human CKAP2 minimal promoter. Black-Right-Pointing-Pointer The CHR element repressed the CKAP2 minimal promoter activity at the G1/S phase. Black-Right-Pointing-Pointer The GC box was essential for the basic promoter activity of human CKAP2. Black-Right-Pointing-Pointer The GC box was also essential for the cyclic expression of human CKAP2. Black-Right-Pointing-Pointer The phosphorylation of Sp1, mediated by Cyclin A, underlies the cyclic expression. -- Abstract: CKAP2 plays crucial roles in proper chromosome segregation and maintaining genomic stability. CKAP2 protein showed cell-cycle-dependent expression, which reached a maximum level at the G2/M phase and disappeared at the onset of G1 phase. To elucidate the mechanisms underlying cell cycle-dependent expression of CKAP2, we cloned and analyzed the human CKAP2 promoter. The upstream 115-bp region from the transcription start site was sufficient for minimal CKAP2 promoter activity. We identified 2 regulatory sequences; a CHR (-110 to -104 bp) and a GC box (-41 to -32 bp). We confirmed Sp1 bound to the GC box using a supershift assay and a ChIP assay. Mutation in the GC box resulted in a near complete loss of CKAP2 promoter activity while mutation in the CHR decreased the promoter activity by 50%. The CHR mutation showed enhanced activity at the G1/S phase, but still retained cyclic activity. The Chromatin IP revealed that the amount of Sp1 bound to the GC box gradually increased and reached a maximum level at the G2/M phase. The amount of Sp1 bound to the GC box was greatly reduced when Cyclin A was depleted, which was restored by adding Cyclin A/Cdk2 complex back into the nuclear extracts. Together, we concluded that the GC box was responsible for the cyclic activity of human CKAP2 promoter through the phosphorylation of Sp1, possibly by Cyclin A/Cdk complex.

  2. Dipeptidyl peptidase-4 inhibition in diabetic rats leads to activation of the transcription factor CREB in β-cells.

    PubMed

    Pugazhenthi, Subbiah; Qin, LiMei; Bouchard, Ron

    2015-05-15

    Incretin therapies are effective in controlling blood glucose levels in type 2 diabetic patients by improving the survival and function of β-cells. They include dipeptidyl peptidase-4 (DPP-4) inhibitors and long-acting glucagon-like peptide-1 (GLP-1) analogs. We have previously reported that GLP-1 enhances the survival of cultured human islets by activation of the transcription factor CREB. To test the in vivo relevance of these findings, we examined the effects of alogliptin, a DPP-4 inhibitor, in Zucker Diabetic rats, a model for type 2 diabetes. The plasma levels of GLP-1 increased in alogliptin-treated diabetic rats leading to normoglycemia. Pancreatic islets of untreated diabetic rats were characterized by decreased immunostaining for insulin and PDX-1. Elevation of GLP-1 in treated diabetic rats resulted in the improved survival of β-cells. Dual immunofluorescent staining showed phosphorylation/activation of CREB in insulin-positive β-cells of islets. This led to increases in the levels of CREB targets including Bcl-2, an antiapoptotic mitochondrial protein, BIRC3, a caspase inhibitor and IRS-2, an adapter protein needed for insulin signaling. Findings from this study suggest potential activation of cytoprotective CREB by GLP-1 in pancreatic β-cells of diabetic patients undergoing incretin-based therapies. PMID:25720341

  3. Development of an electrode for lead-acid batteries possessing a high electrochemical utilization factor and invariable cycling characteristics

    NASA Astrophysics Data System (ADS)

    Yolshina, L. A.; Kudyakov, V. Ya.; Zyryanov, V. G.

    Investigations have been carried out on the deposition of compact lead layers on the surfaces of various metallic substrates. It is shown that the lead coatings so obtained are non-uniform in thickness and feature high porosities. The lead-film electrode thus produced on the surface of a fine copper grid can be used as a positive electrode in the lead-acid battery.

  4. Interleukin-18 induces EMMPRIN expression in primary cardiomyocytes via JNK/Sp1 signaling and MMP-9 in part via EMMPRIN and through AP-1 and NF-κB activation

    PubMed Central

    Reddy, Venkatapuram Seenu; Prabhu, Sumanth D.; Mummidi, Srinivas; Valente, Anthony J.; Venkatesan, Balachandar; Shanmugam, Prakashsrinivasan; Delafontaine, Patrice

    2010-01-01

    IL-18 and the extracellular matrix metalloproteinase (MMP) inducer (EMMPRIN) stimulate the expression of proinflammatory cytokines and MMPs and are elevated in myocardial hypertrophy, remodeling, and failure. Here, we report several novel findings in primary cardiomyocytes treated with IL-18. First, IL-18 activated multiple transcription factors, including NF-κB (p50 and p65), activator protein (AP)-1 (cFos, cJun, and JunD), GATA, CCAAT/enhancer-binding protein, myocyte-specific enhancer-binding factor, interferon regulatory factor-1, p53, and specific protein (Sp)-1. Second, IL-18 induced EMMPRIN expression via myeloid differentiation primary response gene 88/IL-1 receptor-associated kinase/TNF receptor-associated factor-6/JNK-dependent Sp1 activation. Third, IL-18 induced a number of MMP genes, particularly MMP-9, at a rapid rate as well as tissue inhibitor of metalloproteinase (TIMP)-1 and TIMP-3 at a slower rate. Finally, the IL-18 induction of MMP-9 was mediated in part via EMMPRIN and through JNK- and ERK-dependent AP-1 activation and p38 MAPK-dependent NF-κB activation. These results suggest that the elevated expression of IL-18 during myocardial injury and inflammation may favor EMMPRIN and MMP induction and extracellular matrix degradation. Therefore, targeting IL-18 or its signaling pathways may be of potential therapeutic benefit in adverse remodeling. PMID:20693392

  5. Impacts of MicroRNA Gene Polymorphisms on the Susceptibility of Environmental Factors Leading to Carcinogenesis in Oral Cancer

    PubMed Central

    Chu, Yin-Hung; Tzeng, Shu-Ling; Lin, Chiao-Wen; Chien, Ming-Hsien; Chen, Mu-Kuan; Yang, Shun-Fa

    2012-01-01

    Background MicroRNAs (miRNAs) have been regarded as a critical factor in targeting oncogenes or tumor suppressor genes in tumorigenesis. The genetic predisposition of miRNAs-signaling pathways related to the development of oral squamous cell carcinoma (OSCC) remains unresolved. This study examined the associations of polymorphisms with four miRNAs with the susceptibility and clinicopathological characteristics of OSCC. Methodology/Principal Findings A total of 895 male subjects, including 425 controls and 470 male oral cancer patients, were selected. Polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) and real-time PCR were used to analyze miRNA146a, miRNA196, miRNA499 and miRNA149 genetic polymorphisms between the control group and the case group. This study determined that a significant association of miRNA499 with CC genotype, as compared to the subjects with TT genotype, had a higher risk (AOR = 4.52, 95% CI = 1.24–16.48) of OSCC. Moreover, an impact of those four miRNAs gene polymorphism on the susceptibility of betel nut and tobacco consumption leading to oral cancer was also revealed. We found a protective effect between clinical stage development (AOR = 0.58, 95% CI = 0.36–0.94) and the tumor size growth (AOR = 0.47, 95% CI = 0.28–0.79) in younger patients (age<60). Conclusions Our results suggest that genetic polymorphism of miRNA499 is associated with oral carcinogenesis, and the interaction of the miRNAs genetic polymorphism and environmental carcinogens is also related to an increased risk of oral cancer in Taiwanese. PMID:22761899

  6. Aurintricarboxylic acid structure modifications lead to reduction of inhibitory properties against virulence factor YopH and higher cytotoxicity.

    PubMed

    Kuban-Jankowska, Alicja; Sahu, Kamlesh K; Gorska, Magdalena; Niedzialkowski, Pawel; Tuszynski, Jack A; Ossowski, Tadeusz; Wozniak, Michal

    2016-10-01

    Yersinia sp. bacteria owe their viability and pathogenic virulence to the YopH factor, which is a highly active bacterial protein tyrosine phosphatase. Inhibition of YopH phosphatase results in the lack of Yersinia sp. pathogenicity. We have previously described that aurintricarboxylic acid inhibits the activity of YopH at nanomolar concentrations and represents a unique mechanism of YopH inactivation due to a redox process. This work is a continuation of our previous studies. Here we show that modifications of the structure of aurintricarboxylic acid reduce the ability to inactivate YopH and lead to higher cytotoxicity. In the present paper we examine the inhibitory properties of aurintricarboxylic acid analogues, such as eriochrome cyanine R (ECR) and pararosaniline. Computational docking studies we report here indicate that ATA analogues are not precluded to bind in the YopH active site and in all obtained binding conformations ECR and pararosaniline bind to YopH active site. The free binding energy calculations show that ECR has a stronger binding affinity to YopH than pararosaniline, which was confirmed by experimental YopH enzymatic activity studies. We found that ATA analogues can reversibly reduce the enzymatic activity of YopH, but possess weaker inhibitory properties than ATA. The ATA analogues induced inactivation of YopH is probably due to oxidative mechanism, as pretreatment with catalase prevents from inhibition. We also found that ATA analogues significantly decrease the viability of macrophage cells, especially pararosaniline, while ATA reveals only slight effect on cell viability. PMID:27562597

  7. The genomic context and co-recruitment of SP1 affect ERRα co-activation by PGC-1α in muscle cells

    PubMed Central

    Baresic, Mario; van Nimwegen, Erik; Handschin, Christoph

    2016-01-01

    The peroxisome proliferator-activated receptor γ co-activator 1α (PGC-1α) coordinates the transcriptional network response to promote an improved endurance capacity in skeletal muscle, e.g. by co-activating the estrogen-related receptor α (ERRα) in the regulation of oxidative substrate metabolism. Despite a close functional relationship, the interaction between these two proteins has not been studied on a genomic level. We now mapped the genome-wide binding of ERRα to DNA in a skeletal muscle cell line with elevated PGC-1α and linked the DNA recruitment to global PGC-1α target gene regulation. We found that, surprisingly, ERRα co-activation by PGC-1α is only observed in the minority of all PGC-1α recruitment sites. Nevertheless, a majority of PGC-1α target gene expression is dependent on ERRα. Intriguingly, the interaction between these two proteins is controlled by the genomic context of response elements, in particular the relative GC and CpG content, monomeric and dimeric repeat binding site configuration for ERRα, and adjacent recruitment of the transcription factor SP1. These findings thus not only reveal a novel insight into the regulatory network underlying muscle cell plasticity, but also strongly link the genomic context of DNA response elements to control transcription factor – co-regulator interactions. PMID:27182621

  8. Reference values of lead in blood and related factors among Korean adolescents: the Korean National Health and Nutrition Examination Survey 2010-2013

    PubMed Central

    Choi, Min-Gyu; Park, Mi-Jung

    2016-01-01

    Purpose This study aimed to assess the reference values and factors influencing blood lead levels among Korean adolescents. Methods The study population consisted of 1,585 adolescents (801 males, 784 females; aged 10-19 years) who participated in the Korea National Health and Nutrition Examination Survey 2010-2013. We analyzed blood lead concentrations in relation to demographic/lifestyle characteristics for all participants. "Reference values" of blood lead levels were calculated as the upper limit of the 95% confidence interval of the 95th percentile. Results The average "reference value" for blood lead concentrations among Korean adolescents was 2.25 µg/dL (2.49 µg/dL for males, 2.07 µg/dL for females), and the geometric mean of the blood lead concentrations was 1.34 µg/dL. Males had higher blood lead concentrations than females (male, 1.48 µg/dL; female, 1.19 µg/dL; P<0.001). Elementary school students had higher blood lead concentrations than junior and senior high school students (1.44 µg/dL vs. 1.31 µg/dL, P<0.001). Participants living in detached houses had higher blood lead concentrations than those living in apartments (P<0.001) and current smokers had higher concentrations than nonsmokers or participants with secondhand smoke exposure (P<0.05). Additionally, participants with excessive alcohol consumption had higher levels than non-drinkers (P<0.001). Conclusion This study provides national reference data on blood lead concentrations stratified by demographic and lifestyle factors among Korean adolescents. Further studies are needed to elucidate the relationship between increased lead exposure and demographic factors including type of housing. PMID:27186217

  9. Lead exposure in the general population of the Metropolitan Area of Barcelona: blood levels and related factors.

    PubMed

    Solé, E; Ballabriga, A; Dominguez, C

    1998-12-11

    A cross-sectional study was conducted on 254 individuals not occupationally exposed to lead to determine the degree of lead exposure in the general population of the Metropolitan Area of Barcelona. Blood lead levels (BPb) were analysed by atomic absorption spectrophotometry and zinc protoporphyrin (ZPP) by haemofluorimetry. Blood lead levels were analysed with respect to individuals' age, sex, area of residence, the season of the year the blood was drawn and ZPP. Mean blood lead in our series was 0.22 +/- 0.011 mumol/l (mean +/- S.E.); no significant differences were found with respect to area of residence, sex or season. A linear relationship was observed between BPb and individuals' age (BPb = 0.08 + 0.05 x age; r = 0.37). The prevalence of lead intoxication (BPb > 0.48 mumol/l) was 7.1%. No linear relationship was observed between BPb and ZPP. ZPP determination does not appear to be a good screening method for lead intoxication since it presents low specificity and sensitivity values with an area below the ROC curve similar to the null value line (area below the curve = 0.5052, IC 95% = 0.443-0.568). We conclude that lead exposure does not constitute a serious health problem in the area studied, since BPb levels found are far below the toxic limit and the prevalence of intoxication is similar to that reported in other studies conducted in other developed countries. PMID:9926425

  10. Induction of truncated form of tenascin-X (XB-S) through dissociation of HDAC1 from SP-1/HDAC1 complex in response to hypoxic conditions

    SciTech Connect

    Kato, Akari; Endo, Toshiya; Abiko, Shun; Ariga, Hiroyoshi; Matsumoto, Ken-ichi

    2008-08-15

    ABSTRACT: XB-S is an amino-terminal truncated protein of tenascin-X (TNX) in humans. The levels of the XB-S transcript, but not those of TNX transcripts, were increased upon hypoxia. We identified a critical hypoxia-responsive element (HRE) localized to a GT-rich element positioned from - 1410 to - 1368 in the XB-S promoter. Using an electrophoretic mobility shift assay (EMSA), we found that the HRE forms a DNA-protein complex with Sp1 and that GG positioned in - 1379 and - 1378 is essential for the binding of the nuclear complex. Transfection experiments in SL2 cells, an Sp1-deficient model system, with an Sp1 expression vector demonstrated that the region from - 1380 to - 1371, an HRE, is sufficient for efficient activation of the XB-S promoter upon hypoxia. The EMSA and a chromatin immunoprecipitation (ChIP) assay showed that Sp1 together with the transcriptional repressor histone deacetylase 1 (HDAC1) binds to the HRE of the XB-S promoter under normoxia and that hypoxia causes dissociation of HDAC1 from the Sp1/HDAC1 complex. The HRE promoter activity was induced in the presence of a histone deacetylase inhibitor, trichostatin A, even under normoxia. Our results indicate that the hypoxia-induced activation of the XB-S promoter is regulated through dissociation of HDAC1 from an Sp1-binding HRE site.

  11. Chronic alterations in growth hormone/insulin-like growth factor-I signaling lead to changes in mouse tendon structure.

    PubMed

    Nielsen, R H; Clausen, N M; Schjerling, P; Larsen, J O; Martinussen, T; List, E O; Kopchick, J J; Kjaer, M; Heinemeier, K M

    2014-02-01

    The growth hormone/insulin-like growth factor-I (GH/IGF-I) axis is an important stimulator of collagen synthesis in connective tissue, but the effect of chronically altered GH/IGF-I levels on connective tissue of the muscle-tendon unit is not known. We studied three groups of mice; 1) giant transgenic mice that expressed bovine GH (bGH) and had high circulating levels of GH and IGF-I, 2) dwarf mice with a disrupted GH receptor gene (GHR-/-) leading to GH resistance and low circulating IGF-I, and 3) a wild-type control group (CTRL). We measured the ultra-structure, collagen content and mRNA expression (targets: GAPDH, RPLP0, IGF-IEa, IGF-IR, COL1A1, COL3A1, TGF-β1, TGF-β2, TGF-β3, versican, scleraxis, tenascin C, fibronectin, fibromodulin, decorin) in the Achilles tendon, and the mRNA expression was also measured in calf muscle (same targets as tendon plus IGF-IEb, IGF-IEc). We found that GHR-/- mice had significantly lower collagen fibril volume fraction in Achilles tendon, as well as decreased mRNA expression of IGF-I isoforms and collagen types I and III in muscle compared to CTRL. In contrast, the mRNA expression of IGF-I isoforms and collagens in bGH mice was generally high in both tendon and muscle compared to CTRL. Mean collagen fibril diameter was significantly decreased with both high and low GH/IGF-I signaling, but the GHR-/- mouse tendons were most severely affected with a total loss of the normal bimodal diameter distribution. In conclusion, chronic manipulation of the GH/IGF-I axis influenced both morphology and mRNA levels of selected genes in the muscle-tendon unit of mice. Whereas only moderate structural changes were observed with up-regulation of GH/IGF-I axis, disruption of the GH receptor had pronounced effects upon tendon ultra-structure. PMID:24080228

  12. Interleukin-6-Specific Activation of the C/EBPδ Gene in Hepatocytes Is Mediated by Stat3 and Sp1

    PubMed Central

    Cantwell, Carrie A.; Sterneck, Esta; Johnson, Peter F.

    1998-01-01

    C/EBPδ (CCAAT/enhancer binding protein δ) has been implicated as a regulator of acute-phase response (APR) genes in hepatocytes. Its expression increases dramatically in liver during the APR and can be induced in hepatic cell lines by interleukin-6 (IL-6), an acute-phase mediator that activates transcription of many APR genes. Here we have investigated the mechanism by which C/EBPδ expression is regulated by IL-6 in hepatoma cells. C/EBPδ promoter sequences to −125 bp are sufficient for IL-6 inducibility of a reporter gene and include an APR element (APRE) that is essential for IL-6 responsiveness. DNA binding experiments and transactivation assays demonstrate that Stat3, but not Stat1, interacts with this APRE. Two Sp1 sites, one of which is adjacent to the APRE, are required for IL-6 induction and transactivation by Stat3. Thus, Stat3 and Sp1 function cooperatively to activate the C/EBPδ promoter. Replacement of the APRE with Stat binding elements (SBEs) from the ICAM-1 or C/EBPβ promoter, both of which recognize both Stat1 and Stat3, confers responsiveness to gamma interferon, a cytokine that selectively activates Stat1. Sequence comparisons suggest that the distinct Stat binding specificities of the C/EBPδ and C/EBPβ SBEs are determined primarily by a single base pair difference. Our findings indicate that the cytokine specificity of C/EBPδ gene expression is governed by the APRE sequence. PMID:9528783

  13. Complete genome sequence of Terriglobus saanensis type strain SP1PR4T, an Acidobacteria from tundra soil

    SciTech Connect

    Rawat, Suman R.; Mannisto, Minna; Starovoytov, Valentin; Goodwin, Lynne A.; Nolan, Matt; Hauser, Loren John; Land, Miriam L; Davenport, Karen W.; Woyke, Tanja; Haggblom, Max

    2012-01-01

    Terriglobus saanensis SP1PR4T is a novel species of the genus Terriglobus. T. saanensis is of ecological interest because it is a representative of the phylum Acidobacteria, which are dominant members of bacterial soil microbiota in Arctic ecosystems. T. saanensis is a cold-adapted acidophile and a versatile heterotroph utilizing a suite of simple sugars and complex polysaccharides. The genome contained an abundance of genes assigned to metabolism and transport of carbohydrates including gene modules encoding for carbohydrate-active enzyme (CAZyme) family involved in breakdown, utilization and biosynthesis of diverse structural and storage polysaccharides. T. saanensis SP1PR4T represents the first member of genus Terriglobus with a completed genome sequence, consisting of a single replicon of 5,095,226 base pairs (bp), 54 RNA genes and 4,279 protein-coding genes. We infer that the physiology and metabolic potential of T. saanensis is adapted to allow for resilience to the nutrient-deficient conditions and fluctuating temperatures of Arctic tundra soils.

  14. Bioactive metabolites produced by Penicillium sp. 1 and sp. 2, two endophytes associated with Alibertia macrophylla (Rubiaceae).

    PubMed

    Oliveira, Camila M; Silva, Geraldo H; Regasini, Luis O; Zanardi, Lisinéia M; Evangelista, Alana H; Young, Maria C M; Bolzani, Vanderlan S; Araujo, Angela R

    2009-01-01

    In the course of our continuous search for bioactive metabolites from endophytic fungi living in plants from the Brazilian flora, leaves of Alibertia macrophylla (Rubiaceae) were submitted to isolation of endophytes, and two species of Penicillium were isolated. The acetonitrile fraction obtained in corn from a culture of Penicillium sp. 1 afforded orcinol (1). On the other hand, Penicillium sp. 1 cultivated in potato-dextrose-broth furnished two different compounds, cyclo-(L-Pro-L-Val) (2) and uracil (3). The chromatographic fractionation of the acetonitrile fraction obtained from Penicillium sp. 2 led to three dihydroisocoumarins, 4-hydroxymellein (4), 8-methoxymellein (5) and 5-hydroxymellein (6). Compounds 5 and 6 were obtained from the Penicillium genus for the first time. Additionally, metabolites 1-6 were evaluated for their antifungal and acetylcholinesterase (AChE) inhibitory activities. The most active compounds 1 and 4 exhibited detection limits of 5.00 and 10.0 microg against Cladosporium cladosporioides and C. sphaerospermum, respectively. Compound 2 showed a detection limit of 10.0 microg, displaying potent AChE inhibitory activity. PMID:20158153

  15. Sum Rules for Leading and Subleading Form Factors in Heavy Quark Effective Theory using the Non-forward Amplitude

    NASA Astrophysics Data System (ADS)

    Jugeau, F.; Le Yaouanc, A.; Oliver, L.; Raynal, J.-C.

    2006-01-01

    Within the OPE, we formulate new sum rules in Heavy Quark Effective Theory in the heavy quark limit and at order 1/mQ, using the non-forward amplitude. In the heavy quark limit, these sum rules imply that the elastic Isgur-Wise function ξ(w) is an alternate series in powers of (w - 1). Moreover, one gets that the n-th derivative of ξ(w) at w = 1 can be bounded by the (n - 1)-th one, and the absolute lower bound for the n-th derivative (-1)nξ(n)(1) ⩾ (2n+1)!!/22n. Moreover, for the curvature we find ξ″(1) ⩾ 1/5[4ρ2 + 3(ρ2)2] where ρ2 = -ξ'(1). These results are consistent with the dispersive bounds, and they strongly reduce the allowed region of the latter for ξ(w). The method is extended to the subleading quantities in 1/mQ. Concerning the perturbations of the Current, we derive new simple relations between the functions ξ3(w) and Λ¯ξ(w) and the sums ∑ n ΔEj(n)τj(n)(1)τj(n)(w) (j = 1/2, 3/2), that involve leading quantities, Isgur-Wise functions τj(n)(w) and level spacings ΔEj(n). Our results follow because the non-forward amplitude depends on three variables (wi, wf, wif) = (vi ṡ v', vf ṡ v', vi ṡ vf), and we consider the zero recoil frontier (w, 1, w) where only a finite number of jP states contribute (1/2+, 3/2+). We also obtain new sum rules involving the elastic subleading form factors χi(w) (i = 1, 2, 3) at order 1/mQ that originate from the Lkin and Lmag perturbations of the Lagrangian. To the sum rules contribute only the same intermediate states (jP, JP) = (1/2-, 1-),(3/2-, 1-) that enter in the 1/mQ2 corrections of the axial form factor hA1(w) at zero recoil. This allows to obtain a lower bound on -δ1/m2(A1) in terms of the χi(w) and the shape of the elastic IW function ξ(w). An important theoretical implication is that χ1'(1), χ2(1) and χ3'(1)(χ1(1) = χ3(1) = 0 from Luke theorem) must vanish when the slope and the curvature attain their lowest values ρ2 → 3/4, σ2 → 15/16. These constraints should be taken

  16. Environmental factors contributing to the body burden of lead as determined by in vivo x-ray fluorescence

    SciTech Connect

    Ryde, S.J.S.; Jones, S.J.; Evans, C.J.; Lewis, D.G.; Morgan, W.D.

    1995-12-31

    Human exposure to lead may induce a variety of adverse effects on health including heamatological, neurobehavioural, cardiovascular and renal changes and therefore continues to be a public health concern. Lead is dispersed in the environment from where it may be inhaled or ingested by man. Environmental exposure may arise from a number of potential sources: typically industrial emissions, exhaust from petrol engines, drinking water, foodstuffs, paint, soldered cans, lead glazed earthenware, dust and soil. A further source is tobacco smoke. Measurement of the concentration of lead in blood has been widely used to evaluate exposure, although a biological half-life of only a few weeks suggests that the measurement is indicative of recent exposure and is unlikely to provide insight into cumulative exposure over many years. The skeleton, however, is the principal organ of accumulation and contains more than 90% of the adult body burden. The biological half-life of lead in bone is of the order of one to several decades. Thus bone lead concentration may provide an index of cumulative exposure. The preferred method of estimating bone lead in vivo is x-ray fluorescence (XRF), a non-invasive measurement normally undertaken at the mid-shaft of the tibia.

  17. Blood lead concentration and related factors in Korea from the 2008 National Survey for Environmental Pollutants in the Human Body.

    PubMed

    Jeong, Seong Wook; Lee, Chae Kwan; Suh, Chun Hui; Kim, Kun Hyung; Son, Byung Chul; Kim, Jeong Ho; Lee, Jong Tae; Lee, Soo Woong; Park, Yeong Beom; Lee, Jong Wha; Yu, Seung-Do; Moon, Chan Seok; Kim, Dae Hwan; Lee, Sang Yoon

    2014-11-01

    This study evaluated blood lead concentrations in the Korean general population and the correlation between various exposure sources using data from the 2008 Korea National Survey for Environmental Pollutants in the Human Body (National Institute of Environmental Research, Korea). The general and occupational characteristics were gathered from 5136 participants who were 20 years of age and older using a structured questionnaire. Blood lead concentrations were analyzed using an atomic absorption spectrophotometer. Statistical analysis was performed using multiple linear regressions of the log lead concentrations to the independent variables such as age, gender, smoke, herbal medication and drug consumption, drinking water, and living area. Geometric mean (GM) blood lead concentrations in Korean adults were 19.7 μg/l. The blood lead concentrations increased with age; the highest concentrations were found in the 50-69-year age group (p<0.001). Males were higher than in females (p<0.001). Current smokers and drinkers had higher concentrations than nonsmokers (p<0.001) and nondrinkers (p<0.001), respectively. People who took herbal medication and drug consumption were higher than those who did not (p<0.001). Education level was negatively associated with blood lead concentration (p<0.001). People living in or around industrial areas had elevated blood lead concentration (p<0.001). Family income was also negatively associated with lead concentration, but not significantly. For drinking water, the underground water (spring or well water) drinking group had higher concentrations than other types of water drinking groups, but not significantly (p=0.063). The blood lead concentrations by occupation were significant (p<0.034): the highest was in laborer and Agricultural-Fishery-Forestry and the lowest in office workers. In women, blood lead concentrations tended to decrease with increasing delivery times, but not significantly. The blood lead concentration (GM) of the

  18. A systematic review of qualitative research on the contributory factors leading to medicine-related problems from the perspectives of adult patients with cardiovascular diseases and diabetes mellitus

    PubMed Central

    Al Hamid, A; Ghaleb, M; Aljadhey, H; Aslanpour, Z

    2014-01-01

    Objectives To synthesise contributing factors leading to medicine-related problems (MRPs) in adult patients with cardiovascular diseases and/or diabetes mellitus from their perspectives. Design A systematic literature review of qualitative studies regarding the contributory factors leading to MRPs, medication errors and non-adherence, followed by a thematic synthesis of the studies. Data sources We screened Pubmed, EMBASE, ISI Web of Knowledge, PsycInfo, International Pharmaceutical Abstract and PsycExtra for qualitative studies (interviews, focus groups and questionnaires of a qualitative nature). Review methods Thematic synthesis was achieved by coding and developing themes from the findings of qualitative studies. Results The synthesis yielded 21 studies that satisfied the inclusion and exclusion criteria. Three themes emerged that involved contributing factors to MRPs: patient-related factors including socioeconomic factors (beliefs, feeling victimised, history of the condition, lack of finance, lack of motivation and low self-esteem) and lifestyle factors (diet, lack of exercise/time to see the doctor, obesity, smoking and stress), medicine-related factors (belief in natural remedies, fear of medicine, lack of belief in medicines, lack of knowledge, non-adherence and polypharmacy) and condition-related factors (lack of knowledge/understanding, fear of condition and its complications, and lack of control). Conclusions MRPs represent a major health threat, especially among adult patients with cardiovascular diseases and/or diabetes mellitus. The patients’ perspectives uncovered hidden factors that could cause and/or contribute to MRPs in these groups of patients. PMID:25239295

  19. Serum starvation-induced voltage-gated potassium channel Kv7.5 expression and its regulation by Sp1 in canine osteosarcoma cells.

    PubMed

    Lee, Bo Hyung; Ryu, Pan Dong; Lee, So Yeong

    2014-01-01

    The KCNQ gene family, whose members encode Kv7 channels, belongs to the voltage-gated potassium (Kv) channel group. The roles of this gene family have been widely investigated in nerve and muscle cells. In the present study, we investigated several characteristics of Kv7.5, which is strongly expressed in the canine osteosarcoma cell line, CCL-183. Serum starvation upregulated Kv7.5 expression, and the Kv7 channel opener, flupirtine, attenuated cell proliferation by arresting cells in the G0/G1 phase. We also showed that Kv7.5 knockdown helps CCL-183 cells to proliferate. In an effort to find an endogenous regulator of Kv7.5, we used mithramycin A to reduce the level of the transcription factor Sp1, and it strongly inhibited the induction of Kv7.5 in CCL-183 cells. These results suggest that the activation of Kv7.5 by flupirtine may exert an anti-proliferative effect in canine osteosarcoma. Therefore, Kv7.5 is a possible molecular target for canine osteosarcoma therapy. PMID:24434641

  20. Serum Starvation-Induced Voltage-Gated Potassium Channel Kv7.5 Expression and Its Regulation by Sp1 in Canine Osteosarcoma Cells

    PubMed Central

    Lee, Bo Hyung; Ryu, Pan Dong; Lee, So Yeong

    2014-01-01

    The KCNQ gene family, whose members encode Kv7 channels, belongs to the voltage-gated potassium (Kv) channel group. The roles of this gene family have been widely investigated in nerve and muscle cells. In the present study, we investigated several characteristics of Kv7.5, which is strongly expressed in the canine osteosarcoma cell line, CCL-183. Serum starvation upregulated Kv7.5 expression, and the Kv7 channel opener, flupirtine, attenuated cell proliferation by arresting cells in the G0/G1 phase. We also showed that Kv7.5 knockdown helps CCL-183 cells to proliferate. In an effort to find an endogenous regulator of Kv7.5, we used mithramycin A to reduce the level of the transcription factor Sp1, and it strongly inhibited the induction of Kv7.5 in CCL-183 cells. These results suggest that the activation of Kv7.5 by flupirtine may exert an anti-proliferative effect in canine osteosarcoma. Therefore, Kv7.5 is a possible molecular target for canine osteosarcoma therapy. PMID:24434641

  1. Functional analysis of basic transcription element (BTE)-binding protein (BTEB) 3 and BTEB4, a novel Sp1-like protein, reveals a subfamily of transcriptional repressors for the BTE site of the cytochrome P4501A1 gene promoter.

    PubMed Central

    Kaczynski, Joanna A; Conley, Abigail A; Fernandez Zapico, Martin; Delgado, Sharon M; Zhang, Jin-San; Urrutia, Raul

    2002-01-01

    The Sp1-like family of transcription factors is emerging as an integral part of the cellular machinery involved in the control of gene expression. Members of this family of proteins contain three highly homologous C-terminal zinc-finger motifs that bind GC-rich sequences found in the promoters of a diverse number of genes, such as the basic transcription element (BTE) in the promoter of the carcinogen-metabolizing cytochrome P4501A1 (CYP1A1) gene. In the present study, we report the molecular and functional characterization of BTE-binding protein (BTEB) 4, a novel ubiquitously expressed member of the Sp1-like proteins family. This protein represents a new homologue of BTEB1, originally described as a regulator of the BTE site in the CYP1A1 gene promoter. Similarly to the recently described BTEB3, we demonstrate that the N-terminal region of BTEB4 directly represses transcription and binds the co-repressor mSin3A. In addition, we show that the C-terminal zinc-finger domain of BTEB4 binds specifically the BTE site of the CYP1A1 promoter, similar to BTEB1 and BTEB3. Also, we show that both BTEB3 and BTEB4 repress the CYP1A1 gene promoter via the BTE site in HepG2 and BxPC3 cells. Thus the identification of this protein expands the repertoire of BTEB-like members of the Sp1-like protein family involved in transcriptional repression. Furthermore, our results demonstrate that the BTEB subfamily can repress the CYP1A1 gene promoter via the BTE site. PMID:12036432

  2. β-elemene inhibited expression of DNA methyltransferase 1 through activation of ERK1/2 and AMPKα signalling pathways in human lung cancer cells: the role of Sp1

    PubMed Central

    Zhao, ShunYu; Wu, Jingjing; Zheng, Fang; Tang, Qing; Yang, LiJun; Li, Liuning; Wu, WanYin; Hann, Swei Sunny

    2015-01-01

    β-elemene, a compound derived from Rhizoma zedoariae, is a promising new plant-derived drug with broad-spectrum anticancer activity. However, the underlying mechanism by which this agent inhibits human lung cancer cell growth has not been well elucidated. In this study, we showed that β-elemene inhibits human non-small cell lung carcinoma (NSCLC) cell growth, and increased phosphorylation of ERK1/2, Akt and AMPKα. Moreover, β-elemene inhibited expression of DNA methyltransferase 1 (DNMT1), which was not observed in the presence of the specific inhibitors of ERK (PD98059) or AMPK (compound C). Overexpression of DNMT1 reversed the effect of β-elemene on cell growth. Interestingly, metformin not only reversed the effect of β-elemene on phosphorylation of Akt but also strengthened the β-elemene-reduced DNMT1. In addition, β-elemene suppressed Sp1 protein expression, which was eliminated by either ERK1/2 or AMPK inhibitor. Conversely, overexpression of Sp1 antagonized the effect of β-elemene on DNMT1 protein expression and cell growth. Taken together, our results show that β-elemene inhibits NSCLC cell growth viaERK1/2- and AMPKα-mediated inhibition of transcription factor Sp1, followed by reduction in DNMT1 protein expression. Metformin augments the effect of β-elemene by blockade of Akt signalling and additively inhibition of DNMT1 protein expression. The reciprocal ERK1/2 and AMPKα signalling pathways contribute to the overall responses of β-elemene. This study reveals a potential novel mechanism by which β-elemene inhibits growth of NSCLC cells. PMID:25598321

  3. PP2A inhibitors arrest G2/M transition through JNK/Sp1-dependent down-regulation of CDK1 and autophagy-dependent up-regulation of p21

    PubMed Central

    Zhi, Qiaoming; Xu, Ze-Kuan; Wang, Rong; Wang, Wen-Jie; Zong, Yang; Li, Zeng-Liang; Wu, Yadi; Zhou, Binhua P.; Chen, Kai; Tao, Min; Li, Wei

    2015-01-01

    Protein phosphatase 2A (PP2A) plays an important role in the control of the cell cycle. We previously reported that the PP2A inhibitors, cantharidin and okadaic acid (OA), efficiently repressed the growth of cancer cells. In the present study, we found that PP2A inhibitors arrested the cell cycle at the G2 phase through a mechanism that was dependent on the JNK pathway. Microarrays further showed that PP2A inhibitors induced expression changes in multiple genes that participate in cell cycle transition. To verify whether these expression changes were executed in a PP2A-dependent manner, we targeted the PP2A catalytic subunit (PP2Ac) using siRNA and evaluated gene expression with a microarray. After the cross comparison of these microarray data, we identified that CDK1 was potentially the same target when treated with either PP2A inhibitors or PP2Ac siRNA. In addition, we found that the down-regulation of CDK1 occurred in a JNK-dependent manner. Luciferase reporter gene assays demonstrated that repression of the transcription of CDK1 was executed through the JNK-dependent activation of the Sp1 transcription factor. By constructing deletion mutants of the CDK1 promoter and by using ChIP assays, we identified an element in the CDK1 promoter that responded to the JNK/Sp1 pathway after stimulation with PP2A inhibitors. Cantharidin and OA also up-regulated the expression of p21, an inhibitor of CDK1, via autophagy rather than PP2A/JNK pathway. Thus, this present study found that the PP2A/JNK/Sp1/CDK1 pathway and the autophagy/p21 pathway participated in G2/M cell cycle arrest triggered by PP2A inhibitors. PMID:26053095

  4. VIGILANCE POISON: Illegal poisoning and lead intoxication are the main factors affecting avian scavenger survival in the Pyrenees (France).

    PubMed

    Berny, Philippe; Vilagines, Lydia; Cugnasse, Jean-Marc; Mastain, Olivier; Chollet, Jean-Yves; Joncour, Guy; Razin, Martine

    2015-08-01

    A specific surveillance program has been set up to monitor avian scavenger populations in the French Pyrenean Mountains, hosting a high proportion of the French populations. The two main purposes of the study were to identify all causes of death and to investigate poisoning cases. All 170 birds found dead during the 7-year program were submitted to full necropsy, X-Ray, parasitological investigations and consistent analytical toxicology screenings (Cholinesterase inhibitors, anticoagulant rodenticides, organochlorine insecticides, Pb, Cd). Over the study period, 8 Bearded Vultures, 120 Griffon Vultures, 8 Egyptian Vultures and 34 Red kites were eventually collected. Mortality events were often multifactorial, but poisoning was by far the most common cause of death (24.1%), followed by trauma/fall (12%), bacterial diseases and starvation (8%) and electrocution (6%). Illicit use of banned pesticides was identified as a common cause of poisoning (53% of all poisoning cases) and lead poisoning was also identified as a significant toxicant issue (17% of all poisoning cases). Lead isotopic signature could be associated primarily with ammunition. Last, a positive association between trauma and lead contamination was detected, indicating that lead could be a significant contributor to different causes of death. These results urge for severe restrictions on the use of lead ammunition to prevent scavengers from detrimental exposure. PMID:25913360

  5. A Case Study of Factors Leading to Student Success in an Accelerated Licensed Practical Nurse to Associate Degree Nursing Program

    ERIC Educational Resources Information Center

    Taylor, Sherry T.

    2012-01-01

    This case study attempted to discover and comprehend the relationship of students and contributing factors of success, of one Licensed Practical Nurse (LPN) to Associate Degree in Nursing (ADN) program, to formulate an understanding of which contributing factors are most beneficial to enable students to persist to graduation and/or successfully…

  6. Effects of prostaglandin E2 and vascular endothelial growth factor on sperm might lead to endometriosis-associated infertility.

    PubMed

    Lee, Te-Ching; Ho, Han-Chen

    2011-01-01

    Significantly higher levels of prostaglandin E2 and vascular endothelial growth factor were associated with the severity of endometriosis. In this study, pathologic concentrations of prostaglandin E2 and vascular endothelial growth factor found in endometriotic women significantly inhibited sperm motility, acrosome reaction, and sperm-oocyte interaction, which might result in endometriosis-associated subfertility/infertility. PMID:20864099

  7. Assessment of Hair Aluminum, Lead, and Mercury in a Sample of Autistic Egyptian Children: Environmental Risk Factors of Heavy Metals in Autism

    PubMed Central

    Mohamed, Farida El Baz; Zaky, Eman Ahmed; El-Sayed, Adel Bassuoni; Elhossieny, Reham Mohammed; Zahra, Sally Soliman; Salah Eldin, Waleed; Youssef, Walaa Yousef; Khaled, Rania Abdelmgeed; Youssef, Azza Mohamed

    2015-01-01

    Background and Aims. The etiological factors involved in the etiology of autism remain elusive and controversial, but both genetic and environmental factors have been implicated. The aim of this study was to assess the levels and possible environmental risk factors and sources of exposure to mercury, lead, and aluminum in children with autism spectrum disorder (ASD) as compared to their matched controls. Methods. One hundred ASD children were studied in comparison to 100 controls. All participants were subjected to clinical evaluation and measurement of mercury, lead, and aluminum through hair analysis which reflects past exposure. Results. The mean Levels of mercury, lead, and aluminum in hair of the autistic patients were significantly higher than controls. Mercury, lead, and aluminum levels were positively correlated with maternal fish consumptions, living nearby gasoline stations, and the usage of aluminum pans, respectively. Conclusion. Levels of mercury, lead, and aluminum in the hair of autistic children are higher than controls. Environmental exposure to these toxic heavy metals, at key times in development, may play a causal role in autism. PMID:26508811

  8. Sp1-mediated nonmuscle myosin light chain kinase expression and enhanced activity in vascular endothelial growth factor–induced vascular permeability

    PubMed Central

    2015-01-01

    Abstract Despite the important role played by the nonmuscle isoform of myosin light chain kinase (nmMLCK) in vascular barrier regulation and the implication of both nmMLCK and vascular endothelial growth factor (VEGF) in the pathogenesis of acute respiratory distress syndrome (ARDS), the role played by nmMLCK in VEGF-induced vascular permeability is poorly understood. In this study, the role played by nmMLCK in VEGF-induced vascular hyperpermeability was investigated. Human lung endothelial cell barrier integrity in response to VEGF is examined in both the absence and the presence of nmMLCK small interfering RNAs. Levels of nmMLCK messenger RNA (mRNA), protein, and promoter activity expression were monitored after VEGF stimulation in lung endothelial cells. nmMYLK promoter activity was assessed using nmMYLK promoter luciferase reporter constructs with a series of nested deletions. nmMYLK transcriptional regulation was further characterized by examination of a key transcriptional factor. nmMLCK plays an important role in VEGF-induced permeability. We found that activation of the VEGF signaling pathway in lung endothelial cells increases MYLK gene product at both mRNA and protein levels. Increased nmMLCK mRNA and protein expression is a result of increased nmMYLK promoter activity, regulated in part by binding of the Sp1 transcription factor on triggering by the VEGF signaling pathway. Taken together, these findings suggest that MYLK is an important ARDS candidate gene and a therapeutic target that is highly influenced by excessive VEGF concentrations in the inflamed lung. PMID:26697178

  9. High concentration of blood lead levels among young children in Bagega community, Zamfara – Nigeria and the potential risk factor

    PubMed Central

    Ajumobi, Olufemi Olamide; Tsofo, Ahmed; Yango, Matthias; Aworh, Mabel Kamweli; Anagbogu, Ifeoma Nkiruka; Mohammed, Abdulazeez; Umar-Tsafe, Nasir; Mohammed, Suleiman; Abdullahi, Muhammad; Davis, Lora; Idris, Suleiman; Poggensee, Gabriele; Nguku, Patrick; Gitta, Sheba; Nsubuga, Peter

    2014-01-01

    Introduction In May 2010, lead poisoning (LP) was confirmed among children <5years (U5) in two communities in Zamfara state, northwest Nigeria. Following reports of increased childhood deaths in Bagega, another community in Zamfara, we conducted a survey to investigate the outbreak and recommend appropriate control measures. Methods We conducted a cross-sectional survey in Bagega community from 23rd August to 6th September, 2010. We administered structured questionnaires to parents of U5 to collect information on household participation in ore processing activities. We collected and analysed venous blood samples from 185 U5 with LeadCare II machine. Soil samples were analysed with X-ray fluorescence spectrometer for lead contamination. We defined blood lead levels (BLL) of >10ug/dL as elevated BLL, and BLL ≥45ug/dL as the criterion for chelation therapy. We defined soil lead levels (SLL) of ≥400 parts per million (ppm) as elevated SLL. Results The median age of U5 was 36 months (Inter-quartile range: 17-48 months). The median BLL was 71µg/dL (range: 8-332µg/dL). Of the 185 U5, 184 (99.5%) had elevated BLL, 169 (91.4%) met criterion for CT. The median SLL in tested households (n = 37) of U5 was 1,237ppm (range: 53-45,270ppm). Households breaking ore rocks within the compound were associated with convulsion related-children's death (OR: 5.80, 95% CI: 1.08 - 27.85). Conclusion There was an LP outbreak in U5 in Bagega community possibly due to heavy contamination of the environment as a result of increased ore processing activities. Community-driven remediation activities are ongoing. We recommended support for sustained environmental remediation, health education, intensified surveillance, and case management. PMID:25328633

  10. Is home renovation or repair a risk factor for exposure to lead among children residing in New York City?

    PubMed

    Reissman, Dori B; Matte, Thomas D; Gurnitz, Karen L; Kaufmann, Rachel B; Leighton, Jessica

    2002-12-01

    Children can be lead poisoned when leaded paint is disturbed during home renovation or repair. We conducted a case-control study to assess the association between elevated blood lead levels (BLLs) in children younger than 5 years of age and renovation or repair of homes built before 1950 in New York City. In 1998, we interviewed parents of 106 case children (BLLs >/= 10 micro g/dL) and 159 control children (BLLs lead test, and we adjusted for age and test month. Case children were only slightly more likely than control children to live in a house that had undergone any renovation (OR = 1.2, 95% confidence interval [95% CI] = 0.7, 2.1). Case children were more likely to (1) live in housing that had interior surfaces prepared for painting, especially by hand sanding (OR = 3.5, 95% CI = 1.1, 10.9; population attributable risk [PAR%] = 10.4%, 95% CI = 0.5%, 19.3%); and (2) have work-created dust throughout their housing unit (OR = 6.3, 95% CI = 1.2, 32.3; PAR% = 6.8%, 95% CI = 0.0%, 13.1%). The risk for excess lead exposure is increased by home renovation or repair work involving interior paint preparation or reported dispersal of dust beyond the work area. The proportion of cases related to this exposure is high enough to merit preventive measures. PMID:12468670

  11. Continuum limit of the leading-order HQET form factor in Bs → Kℓν decays

    NASA Astrophysics Data System (ADS)

    Bahr, Felix; Banerjee, Debasish; Bernardoni, Fabio; Joseph, Anosh; Koren, Mateusz; Simma, Hubert; Sommer, Rainer

    2016-06-01

    We discuss the computation of form factors for semi-leptonic decays of B-, Bs-mesons in lattice QCD. Considering in particular the example of the static Bs form factors we demonstrate that after non-perturbative renormalization the continuum limit can be taken with confidence. The resulting precision is of interest for extractions of Vub. The size of the corrections of order 1 /mb is just estimated at present but it is expected that their inclusion does not pose significant difficulties.

  12. G244E in the canine factor IX gene leads to severe haemophilia B in Rhodesian Ridgebacks.

    PubMed

    Mischke, R; Kühnlein, P; Kehl, A; Langbein-Detsch, I; Steudle, F; Schmid, A; Dandekar, T; Czwalinna, A; Müller, E

    2011-01-01

    Haemophilia B in Rhodesian Ridgebacks is currently the most important canine haemophilia in Germany. The aim of this study was to define the underlying genetic defect. Genetic studies were performed including six phenotypically affected male dogs (factor IX activity: approximately 1%), four suspected carriers (factor IX activity 48-69%, one confirmed by affected offspring), and 12 healthy dogs. Comparison of the entire coding region of the canine factor IX DNA sequences and exon-intron junctions from affected dogs with the wild type canine factor IX DNA revealed a G-A missense mutation in exon 7. This mutation results in a glycine (GGA) to glutamic acid (GAA) exchange in the catalytic domain of the haemophilic factor IX. All affected dogs were hemizygous for the detected mutation and carriers were heterozygous, whereas none of the Rhodesian Ridgebacks with normal factor IX activity showed the mutation. No further alterations in the sequences between affected dogs and the healthy control group could be observed. None of the Rhodesian Ridgebacks with undefined haemophilia B status (n=30) and no individual of three other dog breeds (Doberman Pinscher: n=20; German Wire haired Pointer: n=20; Labrador: n=25) showed the presence of the mutation. Amino acid sequence alignment and protein structural modelling analysis indicate that the detected mutation causes a relevant functional defect. The results of this study suggest that the detected mutation is responsible for a severe form of haemophilia B in Rhodesian Ridgebacks. PMID:20303304

  13. 12-O-tetradecanoyl-phorbol-13-acetate down-regulates the Huntingtin promoter at Sp1 sites.

    PubMed

    Coles, R; Birdsall, M; Wyttenbach, A; Rubinsztein, D C

    2000-09-28

    We have studied the effects of the phorbol ester, 12-O-tetradecanoyl-phorbol-13-acetate (TPA) on Huntington's disease (HD) gene transcription in neuronal and non-neuronal cell lines, to investigate pathways regulating HD gene expression. TPA reduced transcription from the HD gene promoter in SK-N-SH (neuroblastoma) and HeLa cells but not in JEG3 (choriocarcinoma) cells. In SK-N-SH cells, the responsible cis-acting promoter sequences comprise the tandemly duplicated Sp1 sites in the region from -213 to -174, relative to the translation start site. The TPA-down-regulating region in HeLa cells was mapped to the sequence from -141 to -126. In conclusion, this demonstrates that HD gene transcription can be down-regulated in vitro in a cell-specific manner. PMID:11043541

  14. Ubiquitin (UbC) expression in muscle cells is increased by glucocorticoids through a mechanism involving Sp1 and MEK1.

    PubMed

    Marinovic, Anne C; Zheng, Bin; Mitch, William E; Price, S Russ

    2002-05-10

    The muscle protein catabolism present in rats with insulin-dependent diabetes and other catabolic conditions is generally associated with increased glucocorticoid production and mRNAs encoding components of the ubiquitin-proteasome system. The mechanisms that increase ubiquitin (UbC) expression have not been identified. We studied the regulation of UbC expression in L6 muscle cells because dexamethasone stimulates the transcription of this gene and others encoding components of the ubiquitin-proteasome pathway. Results of in vivo genomic DNA footprinting experiments indicate that a protein(s) binds to Sp1 sites approximately 50 bp upstream from the UbC transcription start site; dexamethasone changes the methylation pattern at these sites. Sp1 binds to DNA probes corresponding to the rat or human UbC promoter, and treating cells with dexamethasone increases this binding. Deletion and mutation analyses of the rat and human UbC promoters are consistent with an important role of Sp1 in UbC induction by glucocorticoids. Dexamethasone-induced ubiquitin expression is blocked by mithramycin, an inhibitor of Sp1 binding. UO126, a pharmacologic inhibitor of MEK1, also blocks UbC transcriptional activation by dexamethasone; L6 cells transfected to express constitutively active MEK1 exhibit increased UbC promoter activity. Thus, glucocorticoids increase UbC expression in muscle cells by a novel transcriptional mechanism involving Sp1 and MEK1. PMID:11872750

  15. Where Will LEAD Lead?

    ERIC Educational Resources Information Center

    Wildman, Louis

    After setting forth eight assumptions concerning the education of educational administrators, findings about the Leadership in Educational Administration Development (LEAD) program are discussed. The analysis is based on the first-year applications, telephone conversations with staff at a majority of the project sites, and additional material…

  16. The loss of local HGF, an endogenous gastrotrophic factor, leads to mucosal injuries in the stomach of mice

    SciTech Connect

    Nakahira, Rie; Mizuno, Shinya; Yoshimine, Toshiki; Nakamura, Toshikazu . E-mail: nakamura@onbich.med.osaka-u.ac.jp

    2006-03-24

    The stomach is constantly exposed to mechanical and chemical stresses. Under persistent damages, epithelial cell proliferation is required to maintain mucosal integrity. Nevertheless, which ligand system(s) is physiologically involved in gastric defense remains unclear. Herein, we provide evidence that HGF is a key 'natural ligand' to reverse gastric injury. The injection of cisplatin in mice led to the loss of HGF in the gastric interstitium, associated with the decrease in proliferating epithelium and the progression of mucotitis. When c-Met tyrosine phosphorylation was abolished by anti-HGF IgG, mucosal cell proliferation became faint, leading to delayed recovery from mucotitis, and vice versa in cases of HGF supplementation. Our findings indicate that: (1) HGF/c-Met signal on mucosa is needed to restore gastric injuries; and (2) the loss of local HGF leads to manifestation of gastric lesions. This study provides a rationale that explains why HGF supplement is useful for reversing gastric diseases.

  17. Characterization of the human activator protein-2gamma (AP-2gamma) gene: control of expression by Sp1/Sp3 in breast tumour cells.

    PubMed Central

    Hasleton, Mark D; Ibbitt, J Claire; Hurst, Helen C

    2003-01-01

    The activator protein-2 (AP-2) family of DNA-binding transcription factors are developmentally regulated and also play a role in human neoplasia. In particular, the AP-2gamma protein has been shown to be overexpressed in a high percentage of breast tumours. In the present study, we report the complete sequence determination of the human TFAP2C gene encoding the AP-2gamma transcription factor plus the mapping of the transcription start site used in breast tumour-derived cells. The 5'-end of the gene lies within a CpG island and transcription is initiated at a single site within a classical initiator motif. We have gone on to investigate why some breast tumour-derived cell lines readily express AP-2gamma, whereas others do not, and show that the proximal promoter (+191 to -312) is differentially active in the two cell phenotypes. DNase footprinting led to the identification of three Sp1/Sp3-binding sites within this region, two of which are absolutely required both for promoter function and cell-type-specific activity. By Western blotting a panel of expressing and non-expressing breast tumour lines we show that the latter have higher levels of Sp3. Furthermore, increasing Sp3 levels in AP-2gamma-expressing cells led to the repression of AP-2gamma promoter activity, particularly when Sp3 inhibitory function was maximized through sumoylation. We propose that differences in the level and activity of Sp3 between breast tumour lines can determine the expression level of their AP-2gamma gene. PMID:12733991

  18. LEADING WITH LEADING INDICATORS

    SciTech Connect

    PREVETTE, S.S.

    2005-01-27

    This paper documents Fluor Hanford's use of Leading Indicators, management leadership, and statistical methodology in order to improve safe performance of work. By applying these methods, Fluor Hanford achieved a significant reduction in injury rates in 2003 and 2004, and the improvement continues today. The integration of data, leadership, and teamwork pays off with improved safety performance and credibility with the customer. The use of Statistical Process Control, Pareto Charts, and Systems Thinking and their effect on management decisions and employee involvement are discussed. Included are practical examples of choosing leading indicators. A statistically based color coded dashboard presentation system methodology is provided. These tools, management theories and methods, coupled with involved leadership and employee efforts, directly led to significant improvements in worker safety and health, and environmental protection and restoration at one of the nation's largest nuclear cleanup sites.

  19. Factors Associated With Successful Completion of a College Compensatory Program or Program Evaluation May Lead to "Bad" News. Draft.

    ERIC Educational Resources Information Center

    Hawkins, Joseph A., Jr.

    This paper examines Howard University's Center for Academic Reinforcement (CAR), which provides college compensatory education to underprepared students. Research findings from CAR and the academic and non-academic factors related to students' successful completion of the program are discussed. The research findings reported include: (1) the…

  20. Breaking the Boundaries: Decision Factors That Lead Male Students to Enroll in Associate Degree Nursing Programs in Illinois Community Colleges

    ERIC Educational Resources Information Center

    Resurreccion, Leandro Alcovendaz

    2013-01-01

    Male nurses are but a small percentage of the total nurse population in the United States, and most certainly have potential to increase in numbers if the profession appeared more attractive as a career option for men. The purpose of this research was to discover the decision factors used by males that led them to enroll in Associate Degree…

  1. Factors Leading African Americans and Black Caribbeans to Use Social Work Services for Treating Mental and Substance Use Disorders

    ERIC Educational Resources Information Center

    Cheng, Tyrone C.; Robinson, Michael A.

    2013-01-01

    This secondary analysis of 5,000 African Americans and black Caribbeans explored how their use of social work services to address mental and substance use disorders was associated with the disorder involved as well as their perceived need for services, belief system, family resources, proximity to services, social-structural factors, and…

  2. An Examination into the Factors Leading to Superintendent Longevity in Urban, Southern California School Districts: A Comparative Case Study

    ERIC Educational Resources Information Center

    Remland, Michael D.

    2012-01-01

    Within a modern context, superintendents walk a fine line in today's reform minded, accountability centered, sociopolitical setting. To many, the position of public school superintendent is perceived as a job where failure is inevitable. The purpose of this comparative case study was to understand the factors that contribute to superintendent…

  3. Expression of microRNA-195 is transactivated by Sp1 but inhibited by histone deacetylase 3 in hepatocellular carcinoma cells.

    PubMed

    Zhao, Na; Li, Siwen; Wang, Ruizhi; Xiao, Manhuan; Meng, Yu; Zeng, Chunxian; Fang, Jian-Hong; Yang, Jine; Zhuang, Shi-Mei

    2016-07-01

    MiR-195 expression is frequently reduced in various cancers, but its underlying mechanisms remain unknown. To explore whether abnormal transcription contributed to miR-195 downregulation in hepatocellular carcinoma (HCC), we characterized the -2165-bp site upstream of mature miR-195 as transcription start site and the -2.4 to -2.0-kb fragment as the promoter of miR-195 gene. Subsequent investigation showed that deletion of the predicted Sp1 binding site decreased the miR-195 promoter activity; Sp1 silencing significantly reduced the miR-195 promoter activity and the endogenous miR-195 level; Sp1 directly interacted with the miR-195 promoter in vitro and in vivo. These data suggest Sp1 as a transactivator for miR-195 transcription. Interestingly, miR-195 expression was also subjected to epigenetic regulation. Histone deacetylase 3 (HDAC3) could anchor to the miR-195 promoter via interacting with Sp1 and consequently repress the Sp1-mediated miR-195 transactivation by deacetylating histone in HCC cells. Consistently, substantial increase of HDAC3 protein was detected in human HCC tissues and HDAC3 upregulation was significantly correlated with miR-195 downregulation, suggesting that HDAC3 elevation may represent an important cause for miR-195 reduction in HCC. Our findings uncover the mechanisms underlying the transcriptional regulation and expression deregulation of miR-195 in HCC cells and provide new insight into microRNA biogenesis in cancer cells. PMID:27179445

  4. Ancient Properties of Spider Silks Revealed by the Complete Gene Sequence of the Prey-Wrapping Silk Protein (AcSp1)

    PubMed Central

    Ayoub, Nadia A.; Garb, Jessica E.; Kuelbs, Amanda; Hayashi, Cheryl Y.

    2013-01-01

    Spider silk fibers have impressive mechanical properties and are primarily composed of highly repetitive structural proteins (termed spidroins) encoded by a single gene family. Most characterized spidroin genes are incompletely known because of their extreme size (typically >9 kb) and repetitiveness, limiting understanding of the evolutionary processes that gave rise to their unusual gene architectures. The only complete spidroin genes characterized thus far form the dragline in the Western black widow, Latrodectus hesperus. Here, we describe the first complete gene sequence encoding the aciniform spidroin AcSp1, the primary component of spider prey-wrapping fibers. L. hesperus AcSp1 contains a single enormous (∼19 kb) exon. The AcSp1 repeat sequence is exceptionally conserved between two widow species (∼94% identity) and between widows and distantly related orb-weavers (∼30% identity), consistent with a history of strong purifying selection on its amino acid sequence. Furthermore, the 16 repeats (each 371–375 amino acids long) found in black widow AcSp1 are, on average, >99% identical at the nucleotide level. A combination of stabilizing selection on amino acid sequence, selection on silent sites, and intragenic recombination likely explains the extreme homogenization of AcSp1 repeats. In addition, phylogenetic analyses of spidroin paralogs support a gene duplication event occurring concomitantly with specialization of the aciniform glands and the tubuliform glands, which synthesize egg-case silk. With repeats that are dramatically different in length and amino acid composition from dragline spidroins, our L. hesperus AcSp1 expands the knowledge base for developing silk-based biomimetic technologies. PMID:23155003

  5. Changes in spawning time led to the speciation of the broadcast spawning corals Acropora digitifera and the cryptic species Acropora sp. 1 with similar gamete recognition systems

    NASA Astrophysics Data System (ADS)

    Ohki, Shun; Kowalski, Radoslaw K.; Kitanobo, Seiya; Morita, Masaya

    2015-12-01

    Multi-species spawning is reported in the coral genus Acropora, but hybridization in nature rarely occurs because of the incompatibility of gametes and the timing of spawning. However, the evolutionary relationships between gamete compatibility and spawning time are obscure. Investigations of gamete compatibility in sister species that spawn at different times may provide clues to answering this question. Acropora sp. 1 has been defined as a cryptic species of Acropora digitifera, and they are morphologically similar, but spawn in different months, suggesting that they are either a cryptic species or a different species. We examined the morphology and conducted crossing experiments using cryopreserved sperm. The morphologies (branch length, branch width, and outer diameter of axial corallites) of A. digitifera and Acropora sp. 1 differed significantly. A phylogenetic tree of partial Pax- C nuclear sequences from A. digitifera and Acropora sp. 1 shows that they are monophyletic and closely related genetically, based on F ST values and P-distance. These results imply that these two species originated recently from a common ancestor. In addition, cryopreserved sperm from both A. digitifera and Acropora sp. 1 showed bidirectional inter-crossing (cryopreserved sperm of A. digitifera and eggs of Acropora sp. 1 from Sesoko: 32.1 ± 6.7 %, control-conspecific cryopreserved sperm and eggs: 46.1 ± 10.6 %; cryopreserved sperm of Acropora sp. 1 and eggs of A. digitifera from Oku: 63.3 ± 16.6 %, control: 83.6 ± 6.0 %). The results suggest that the gametes of these two species are compatible and that the pre-zygotic isolation mechanism is relaxed because their gametes do not interact. Overall, these two species should be classified as distinct species, and changes in spawning time are related to speciation in a similar gamete recognition system.

  6. Evaluation of Factors Contributing to Excessive Nitrate Accumulation in Fodder Crops Leading to Ill-Health in Dairy Animals

    PubMed Central

    Sidhu, P. K.; Bedi, G. K.; Meenakshi; Mahajan, V.; Sharma, S.; Sandhu, K. S.; Gupta, M. P.

    2011-01-01

    A study was conducted to estimate nitrate content in commonly used fodder crops, viz., berseem (Trifolium alexandrinum), bajra (Pennisetum glaucum), maize (Zea mays), oats (Avena sativa), sorghum (Sorghum vulgare) and toriya (Brassica napus), collected from the fields of different villages of Punjab and farms of the university, and to evaluate the factors associated with nitrate accumulation in these crops. The nitrate level was highest in sorghum on dry matter basis, followed by oats and toriya, berseem, maize and bajra. The nitrate content was also determined in fodder samples harvested from young and mature stages and in different parts of plants. The stem part of forages had higher content than leaves; however, concentrations were low in mature crops as compared to immature ones. The environmental and soil factors associated with it are discussed and correlated with the experimental findings. PMID:21430916

  7. Somatic Embryogenesis: Identified Factors that Lead to Embryogenic Repression. A Case of Species of the Same Genus

    PubMed Central

    Nic-Can, Geovanny I.; Galaz-Ávalos, Rosa M.; De-la-Peña, Clelia; Alcazar-Magaña, Armando; Wrobel, Kazimierz; Loyola-Vargas, Víctor M.

    2015-01-01

    Somatic embryogenesis is a powerful biotechnological tool for the mass production of economically important cultivars. Due to the cellular totipotency of plants, somatic cells under appropriate conditions are able to develop a complete functional embryo. During the induction of somatic embryogenesis, there are different factors involved in the success or failure of the somatic embryogenesis response. Among these factors, the origin of the explant, the culture medium and the in vitro environmental conditions have been the most studied. However, the secretion of molecules into the media has not been fully addressed. We found that the somatic embryogenesis of Coffea canephora, a highly direct embryogenic species, is disrupted by the metabolites secreted from C. arabica, a poorly direct embryogenic species. These metabolites also affect DNA methylation. Our results show that the abundance of two major phenolic compounds, caffeine and chlorogenic acid, are responsible for inhibiting somatic embryogenesis in C. canephora. PMID:26038822

  8. Measurements of heat transfer coefficients and friction factors in rib-roughened channels simulating leading-edge cavities of a modern turbine blade

    SciTech Connect

    Taslim, M.E.; Li, T.; Spring, S.D.

    1997-07-01

    Leading edge cooling cavities in modern gas turbine blades play an important role in maintaining the leading edge temperature at levels consistent with air foil design life. These cavities often have a complex cross-sectional shape to be compatible with the external contour of the blade at the leading edge. A survey of many existing geometries shows that, for analytical as well as experimental analyses, such cavities can be simplified in shape by a four-sided polygon with one curved side similar to the leading edge curvature, a rectangle with one semicircular side (often the smaller side) or a trapezoid, the smaller base of which is replaced by a semicircle. Furthermore, to enhance the heat transfer coefficient in these cavities, they are mostly roughened on three sides with ribs of different geometries. Experimental data on friction factors and heat transfer coefficients in such cavities are rare if not nonexistent. A liquid crystal technique was used in this experimental investigation to measure heat transfer coefficients in six test sections representing the leading-edge cooling cavities. Both straight and tapered ribs were configured on the two opposite sidewalls in a staggered arrangement with angles of attack to the mainstream flow, {alpha}, of 60 and 90 deg. The ribs on the curved surface were of constant cross section with an angle of attack 90 deg to the flow. Heat transfer measurements were performed on the straight sidewalls, as well as on the round surface adjacent to the blade leading edge. Effects such as rib angle of attack to the mainstream flow and constant versus tapered rib cross-sectional areas were also investigated. Nusselt numbers, friction factors, and thermal performances are reported for nine rib geometries in six test sections.

  9. Analysis of risk factors leading to postoperative urethral stricture and bladder neck contracture following transurethral resection of prostate

    PubMed Central

    Tao, Huang; Jiang, Yu Yong; Jun, Qi; Ding, Xu; Jian, Duan Liu; Jie, Ding; Ping, Zhu Yu

    2016-01-01

    ABSTRACT Purpose: To determine risk factors of postoperative urethral stricture (US) and vesical neck contracture (BNC) after transurethral resection of prostate (TURP) from perioperative parameters. Materials and Methods: 373 patients underwent TURP in a Chinese center for lower urinary tract symptoms suggestive of benign prostatic obstruction (LUTS/BPO), with their perioperative and follow-up clinical data being collected. Univariate analyses were used to determine variables which had correlation with the incidence of US and BNC before logistic regression being applied to find out independent risk factors. Results: The median follow-up was 29.3 months with the incidence of US and BNC being 7.8% and 5.4% respectively. Resection speed, reduction in hemoglobin (ΔHb) and hematocrit (ΔHCT) levels, incidence of urethral mucosa rupture, re-catheterization and continuous infection had significant correlation with US, while PSA level, storage score, total prostate volume (TPV), transitional zone volume (TZV), transitional zone index (TZI), resection time and resected gland weight had significant correlation with BNC. Lower resection speed (OR=0.48), urethral mucosa rupture (OR=2.44) and continuous infection (OR=1.49) as well as higher storage score (OR=2.51) and lower TPV (OR=0.15) were found to be the independent risk factors of US and BNC respectively. Conclusions: Lower resection speed, intraoperative urethral mucosa rupture and postoperative continuous infection were associated with a higher risk of US while severer storage phase symptom and smaller prostate size were associated with a higher risk of BNC after TURP. PMID:27256185

  10. Camel-back band-induced power factor enhancement of thermoelectric lead-tellurium from Boltzmann transport calculations

    SciTech Connect

    Wang, X. G. Wang, L. Liu, J. Peng, L. M.

    2014-03-31

    Band structures of PbTe can be abnormally bended via dual-doping on both the cationic and anionic sites to form camel-back multivalley energy band structures near the band edge. As a result, additional carrier pockets and strong intervalley scattering of carriers are introduced. Boltzmann transport calculations indicate that their contradictory effects yield remarkably enhanced power factor due to the improved thermopower and almost unchanged electrical conductivity in low temperature and high carrier concentration ranges. These findings prove dual-doping-induced band bending as an effective approach to improve the thermoelectric properties of PbTe and other similar materials.

  11. Gefitinib and Erlotinib Lead to Phosphorylation of Eukaryotic Initiation Factor 2 Alpha Independent of Epidermal Growth Factor Receptor in A549 Cells

    PubMed Central

    Koyama, Satoshi; Omura, Tomohiro; Yonezawa, Atsushi; Imai, Satoshi; Nakagawa, Shunsaku; Nakagawa, Takayuki; Yano, Ikuko; Matsubara, Kazuo

    2015-01-01

    Gefitinib and erlotinib are anticancer agents, which inhibit epidermal growth factor receptor (EGFR) tyrosine kinase. Interstitial lung disease (ILD) occurs in patients with non-small cell lung cancer receiving EGFR inhibitors. In the present study, we examined whether gefitinib- and erlotinib-induced lung injury related to ILD through endoplasmic reticulum (ER) stress, which is a causative intracellular mechanism in cytotoxicity caused by various chemicals in adenocarcinomic human alveolar basal epithelial cells. These two EGFR inhibitors increased Parkinson juvenile disease protein 2 and C/EBP homologous protein mRNA expressions, and activated the eukaryotic initiation factor (eIF) 2α/activating transcription factor 4 pathway without protein kinase R-like ER kinase activation in A549 cells. Gefitinib and erlotinib caused neither ER stress nor cell death; however, these agents inhibited cell growth via the reduction of cyclin-D1 expression. Tauroursodeoxycholic acid, which is known to suppress eIF2α phosphorylation, cancelled the effects of EGFR inhibitors on cyclin-D1 expression and cell proliferation in a concentration-dependent manner. The results of an EGFR-silencing study using siRNA showed that gefitinib and erlotinib affected eIF2α phosphorylation and cyclin-D1 expression independent of EGFR inhibition. Therefore, the inhibition of cell growth by these EGFR inhibitors might equate to impairment of the alveolar epithelial cell repair system via eIF2α phosphorylation and reduced cyclin-D1 expression. PMID:26288223

  12. Gefitinib and Erlotinib Lead to Phosphorylation of Eukaryotic Initiation Factor 2 Alpha Independent of Epidermal Growth Factor Receptor in A549 Cells.

    PubMed

    Koyama, Satoshi; Omura, Tomohiro; Yonezawa, Atsushi; Imai, Satoshi; Nakagawa, Shunsaku; Nakagawa, Takayuki; Yano, Ikuko; Matsubara, Kazuo

    2015-01-01

    Gefitinib and erlotinib are anticancer agents, which inhibit epidermal growth factor receptor (EGFR) tyrosine kinase. Interstitial lung disease (ILD) occurs in patients with non-small cell lung cancer receiving EGFR inhibitors. In the present study, we examined whether gefitinib- and erlotinib-induced lung injury related to ILD through endoplasmic reticulum (ER) stress, which is a causative intracellular mechanism in cytotoxicity caused by various chemicals in adenocarcinomic human alveolar basal epithelial cells. These two EGFR inhibitors increased Parkinson juvenile disease protein 2 and C/EBP homologous protein mRNA expressions, and activated the eukaryotic initiation factor (eIF) 2α/activating transcription factor 4 pathway without protein kinase R-like ER kinase activation in A549 cells. Gefitinib and erlotinib caused neither ER stress nor cell death; however, these agents inhibited cell growth via the reduction of cyclin-D1 expression. Tauroursodeoxycholic acid, which is known to suppress eIF2α phosphorylation, cancelled the effects of EGFR inhibitors on cyclin-D1 expression and cell proliferation in a concentration-dependent manner. The results of an EGFR-silencing study using siRNA showed that gefitinib and erlotinib affected eIF2α phosphorylation and cyclin-D1 expression independent of EGFR inhibition. Therefore, the inhibition of cell growth by these EGFR inhibitors might equate to impairment of the alveolar epithelial cell repair system via eIF2α phosphorylation and reduced cyclin-D1 expression. PMID:26288223

  13. Glycerol-3-phosphate acyltransferase-1 upregulation by O-GlcNAcylation of Sp1 protects against hypoxia-induced mouse embryonic stem cell apoptosis via mTOR activation.

    PubMed

    Lee, H J; Ryu, J M; Jung, Y H; Lee, K H; Kim, D I; Han, H J

    2016-01-01

    Oxygen signaling is critical for stem cell regulation, and oxidative stress-induced stem cell apoptosis decreases the efficiency of stem cell therapy. Hypoxia activates O-linked β-N-acetyl glucosaminylation (O-GlcNAcylation) of stem cells, which contributes to regulation of cellular metabolism, as well as cell fate. Our study investigated the role of O-GlcNAcylation via glucosamine in the protection of hypoxia-induced apoptosis of mouse embryonic stem cells (mESCs). Hypoxia increased mESCs apoptosis in a time-dependent manner. Moreover, hypoxia also slightly increased the O-GlcNAc level. Glucosamine treatment further enhanced the O-GlcNAc level and prevented hypoxia-induced mESC apoptosis, which was suppressed by O-GlcNAc transferase inhibitors. In addition, hypoxia regulated several lipid metabolic enzymes, whereas glucosamine increased expression of glycerol-3-phosphate acyltransferase-1 (GPAT1), a lipid metabolic enzyme producing lysophosphatidic acid (LPA). In addition, glucosamine-increased O-GlcNAcylation of Sp1, which subsequently leads to Sp1 nuclear translocation and GPAT1 expression. Silencing of GPAT1 by gpat1 siRNA transfection reduced glucosamine-mediated anti-apoptosis in mESCs and reduced mammalian target of rapamycin (mTOR) phosphorylation. Indeed, LPA prevented mESCs from undergoing hypoxia-induced apoptosis and increased phosphorylation of mTOR and its substrates (S6K1 and 4EBP1). Moreover, mTOR inactivation by rapamycin (mTOR inhibitor) increased pro-apoptotic proteins expressions and mESC apoptosis. Furthermore, transplantation of non-targeting siRNA and glucosamine-treated mESCs increased cell survival and inhibited flap necrosis in mouse skin flap model. Conversely, silencing of GPAT1 expression reversed those glucosamine effects. In conclusion, enhancing O-GlcNAcylation of Sp1 by glucosamine stimulates GPAT1 expression, which leads to inhibition of hypoxia-induced mESC apoptosis via mTOR activation. PMID:27010859

  14. Glycerol-3-phosphate acyltransferase-1 upregulation by O-GlcNAcylation of Sp1 protects against hypoxia-induced mouse embryonic stem cell apoptosis via mTOR activation

    PubMed Central

    Lee, H J; Ryu, J M; Jung, Y H; Lee, K H; Kim, D I; Han, H J

    2016-01-01

    Oxygen signaling is critical for stem cell regulation, and oxidative stress-induced stem cell apoptosis decreases the efficiency of stem cell therapy. Hypoxia activates O-linked β-N-acetyl glucosaminylation (O-GlcNAcylation) of stem cells, which contributes to regulation of cellular metabolism, as well as cell fate. Our study investigated the role of O-GlcNAcylation via glucosamine in the protection of hypoxia-induced apoptosis of mouse embryonic stem cells (mESCs). Hypoxia increased mESCs apoptosis in a time-dependent manner. Moreover, hypoxia also slightly increased the O-GlcNAc level. Glucosamine treatment further enhanced the O-GlcNAc level and prevented hypoxia-induced mESC apoptosis, which was suppressed by O-GlcNAc transferase inhibitors. In addition, hypoxia regulated several lipid metabolic enzymes, whereas glucosamine increased expression of glycerol-3-phosphate acyltransferase-1 (GPAT1), a lipid metabolic enzyme producing lysophosphatidic acid (LPA). In addition, glucosamine-increased O-GlcNAcylation of Sp1, which subsequently leads to Sp1 nuclear translocation and GPAT1 expression. Silencing of GPAT1 by gpat1 siRNA transfection reduced glucosamine-mediated anti-apoptosis in mESCs and reduced mammalian target of rapamycin (mTOR) phosphorylation. Indeed, LPA prevented mESCs from undergoing hypoxia-induced apoptosis and increased phosphorylation of mTOR and its substrates (S6K1 and 4EBP1). Moreover, mTOR inactivation by rapamycin (mTOR inhibitor) increased pro-apoptotic proteins expressions and mESC apoptosis. Furthermore, transplantation of non-targeting siRNA and glucosamine-treated mESCs increased cell survival and inhibited flap necrosis in mouse skin flap model. Conversely, silencing of GPAT1 expression reversed those glucosamine effects. In conclusion, enhancing O-GlcNAcylation of Sp1 by glucosamine stimulates GPAT1 expression, which leads to inhibition of hypoxia-induced mESC apoptosis via mTOR activation. PMID:27010859

  15. Groundwater Dynamics as an Essential Factor in the Precipitation of the Pine Point MVT Lead-Zinc Deposits

    NASA Astrophysics Data System (ADS)

    Weyer, K. U.

    2014-12-01

    Hypotheses on the genesis of MVT lead zinc deposits place that genesis generally well into the geological past with elevated temperatures in the 100 °C range. In the case of the Pine Point lead zinc deposits, the time of genesis has been assumed to have happened from the Middle Devonian age to the Tertiary age. It is generally said that, based on isotope data, the ore forming fluid there must have been hydrothermal in a temperature range of 100 °C or more. The average homogenized temperature in fluid inclusions in dolomite in the Pine Point area has been reported to be 116 °C and the burial temperature at about 70 °C. In the course of a former joint industry/governmental research project on regional and local groundwater flow, water chemistry, and water isotopes, all available regional and local geological and mineral data for exploration bore holes were collected. The massive body of these data indicated that in the Pine Point region, the present groundwater flow systems and their respective chemistry would support the continuous formation of ore bodies from glacial times to the present day. This body of data provides strong indications that the interplay of today's groundwater flow systems, their chemistry, and the associated microbiological activity may currently be forming MVT ore bodies and mineral showings even at low non-hydrothermal temperatures in the range of 3 °C. Upon abandonment of Pine Point Mines this suspicion was supported by the occurrence of a 'black smoker' discharging from a flowing hole near one of the formerly mined ore bodies (Figure 1). At Pine Point, MVT ore bodies are positioned within karstic rocks at the intersection of two active and very substantial groundwater flow systems. In one of these systems, groundwater carries sulphate, while the other, upwelling one, also carries NaCl and metals. At the ore bodies, microbiological populations of sulfur-reducing bacteria are present and participate in forming conditions for ore

  16. Interaction of Operational and Physicochemical Factors Leading to Gordonia amarae-Like Foaming in an Incompletely Nitrifying Activated Sludge Plant

    PubMed Central

    Asvapathanagul, Pitiporn; Huang, Zhonghua; Gedalanga, Phillip B.; Baylor, Amber

    2012-01-01

    The overgrowth of Gordonia amarae-like bacteria in the mixed liquor of an incompletely nitrifying water reclamation plant was inversely correlated with temperature (r = −0.78; P < 0.005) and positively correlated with the solids retention time (SRT) obtained a week prior to sampling (r = 0.67; P < 0.005). Drops followed by spikes in the food-to-mass ratio (0.18 to 0.52) and biochemical oxygen demand concentrations in primary effluent (94 to 298 mg liter−1) occurred at the initiation of G. amarae-like bacterial growth. The total bacterial concentration did not increase as concentrations of G. amarae-like cells increased, but total bacterial cell concentrations fluctuated in a manner similar to that of G. amarae-like bacteria in the pseudo-steady state. The ammonium ion removal rate (percent) was inversely related to G. amarae-like cell concentrations during accelerated growth and washout phases. The dissolved oxygen concentration decreased as the G. amarae-like cell concentration decreased. The concentrations of G. amarae-like cells peaked (2.47 × 109 cells liter−1) approximately 1.5 months prior to foaming. Foaming occurred during the late pseudo-steady-state phase, when temperature declines reversed. These findings suggested that temperature changes triggered operational and physicochemical changes favorable to the growth of G. amarae-like bacteria. Fine-scale quantitative PCR (qPCR) monitoring at weekly intervals allowed a better understanding of the factors affecting this organism and indicated that frequent sampling was required to obtain statistical significance with factors changing as the concentrations of this organism increased. Furthermore, the early identification of G. amarae-like cells when they are confined to mixed liquor (107 cells liter−1) allows management strategies to prevent foaming. PMID:22983974

  17. Involvement of DkTGA1 Transcription Factor in Anaerobic Response Leading to Persimmon Fruit Postharvest De-Astringency.

    PubMed

    Zhu, Qing-Gang; Wang, Miao-Miao; Gong, Zi-Yuan; Fang, Fang; Sun, Ning-Jing; Li, Xian; Grierson, Donald; Yin, Xue-Ren; Chen, Kun-Song

    2016-01-01

    Persimmon fruit are unique in accumulating proanthocyanidins (tannins) during development, which cause astringency in mature fruit. In 'Mopanshi' persimmon, astringency can be removed by treatment with 95% CO2, which increases the concentrations of ethanol and acetaldehyde by glycolysis, and precipitates the soluble tannin. A TGA transcription factor, DkTGA1, belonging to the bZIP super family, was isolated from an RNA-seq database and real-time quantitative PCR indicated that DkTGA1 was up-regulated by CO2 treatment, in concert with the removal of astringency from persimmon fruit. Dual-luciferase assay revealed that DkTGA1 had a small (less than 2-fold), but significant effect on the promoters of de-astringency-related genes DkADH1, DkPDC2 and DkPDC3, which encode enzymes catalyzing formation of acetaldehyde and ethanol. A combination of DkTGA1 and a second transcription factor, DkERF9, shown previously to be related to de-astringency, showed additive effects on the activation of the DkPDC2 promoter. Yeast one-hybrid assay showed that DkERF9, but not DkTGA1, could bind to the DkPDC2 promoter. Thus, although DkTGA1 expression is positively associated with persimmon fruit de-astringency, trans-activation analyses with DkPDC2 indicates it is likely to act by binding indirectly DkPDC2 promoter, might with helps of DkERF9. PMID:27196670

  18. Involvement of DkTGA1 Transcription Factor in Anaerobic Response Leading to Persimmon Fruit Postharvest De-Astringency

    PubMed Central

    Zhu, Qing-gang; Wang, Miao-miao; Gong, Zi-yuan; Fang, Fang; Sun, Ning-jing; Li, Xian; Grierson, Donald; Yin, Xue-ren; Chen, Kun-song

    2016-01-01

    Persimmon fruit are unique in accumulating proanthocyanidins (tannins) during development, which cause astringency in mature fruit. In ‘Mopanshi’ persimmon, astringency can be removed by treatment with 95% CO2, which increases the concentrations of ethanol and acetaldehyde by glycolysis, and precipitates the soluble tannin. A TGA transcription factor, DkTGA1, belonging to the bZIP super family, was isolated from an RNA-seq database and real-time quantitative PCR indicated that DkTGA1 was up-regulated by CO2 treatment, in concert with the removal of astringency from persimmon fruit. Dual-luciferase assay revealed that DkTGA1 had a small (less than 2-fold), but significant effect on the promoters of de-astringency-related genes DkADH1, DkPDC2 and DkPDC3, which encode enzymes catalyzing formation of acetaldehyde and ethanol. A combination of DkTGA1 and a second transcription factor, DkERF9, shown previously to be related to de-astringency, showed additive effects on the activation of the DkPDC2 promoter. Yeast one-hybrid assay showed that DkERF9, but not DkTGA1, could bind to the DkPDC2 promoter. Thus, although DkTGA1 expression is positively associated with persimmon fruit de-astringency, trans-activation analyses with DkPDC2 indicates it is likely to act by binding indirectly DkPDC2 promoter, might with helps of DkERF9. PMID:27196670

  19. An analysis of factors that lead to better learning in an integrated and interdisciplinary course on climate change

    NASA Astrophysics Data System (ADS)

    Reed, D. E.; Lyford, M.; Schmidt, L. O.; Bowles-Terry, M.

    2012-12-01

    Climate change education presents many challenges to college educators due to the interdisciplinary nature of the issue as well as the social and political context and implications. This presents multiple barriers to learning for the student, both because it is difficult to address all scientific components in one course, and because many students have strong preconceived feelings or beliefs about climate change. A further barrier to learning for non-science majors is that very often the number of required science courses is low and a highly complex issue such as climate change is difficult to address in introductory science courses. To attempt to address these issues a course for non-science majors, Life Science 1002, Discovering Science, at the University of Wyoming was created as an interdisciplinary and integrated science course that includes a lecture component as well as weekly lab and discussion sections. Our previous work has shown a clear change in the reference sources used by non-science majors when referring to complex topics; namely, students increase their use of scientific journals when they are shown how to use scientific journals and students also report a correlated decrease in non-peer reviewed sources (ie, radio, newspapers, TV). We seek to expand on this work by using pre- and post-topic student surveys in the course at the University of Wyoming to directly measure student performance in different components of the course. The course has enrollment between 120 and 130 students, with nearly equal distribution between grade levels and a wide sampling of non-science majors or undeclared majors. For this work we will use a non-quantitative survey of students to find out which part of the course (lecture, lab or discussion) is most effective for student learning. Further, quantitative analysis of which factors of the student body (class standing, major, gender, background and personal beliefs) will be correlated to help predict who achieved the best

  20. Identification of factors involved in medication compliance: incorrect inhaler technique of asthma treatment leads to poor compliance

    PubMed Central

    Darbà, Josep; Ramírez, Gabriela; Sicras, Antoni; García-Bujalance, Laura; Torvinen, Saku; Sánchez-de la Rosa, Rainel

    2016-01-01

    Objective To identify the impact of delivery device of inhaled corticosteroids and long-acting β2-agonist (ICS/LABA) on asthma medication compliance, and investigate other factors associated with compliance. Materials and methods We conducted a retrospective and multicenter study based on a review of medical registries of asthmatic patients treated with ICS/LABA combinations (n=2,213) whose medical devices were either dry powder inhalers (DPIs, such as Accuhaler®, Turbuhaler®, and NEXThaler®) or pressurized metered-dose inhalers (pMDI). Medication compliance included persistence outcomes through 18 months and medication possession ratios. Data on potential confounders of treatment compliance such as asthma exacerbations, comorbidities, demographic characteristics, and health care resource utilization were also explored. Results The probability of asthma medication compliance in case of DPIs was lower compared to pMDIs, which suggests that inhaler devices influence inhalation therapies. There were additional confounding factors that were considered as explanatory variables of compliance. A worse measure of airflow obstruction (forced expiration volume in 1 second), comorbidities and general practitioner (GP) consultations more than once per month decreased the probability of compliance. Within comorbidities, alcoholism was positively associated with compliance. Patients of 29–39, 40–50, and 51–61 age groups or suffering from more than two exacerbations during the study period were more likely to comply with their medication regime. The effects of DPIs toward compliance varied with the different DPIs. For instance, Accuhaler® had a greater negative effect on compliance compared to Turbuhaler® and Nexthaler® in cases of patients who suffered exacerbations. We found that GP consultations reduced the probability of medication compliance for patients treated with formoterol/budesonide combination. For retired patients, visiting the GP increased the

  1. Interactive factors leading to dying-off Carex tato in Momoge wetland polluted by crude oil, Western Jilin, China.

    PubMed

    Pan, Xiangliang; Zhang, Daoyong; Quan, Liu

    2006-12-01

    Momoge wetland is an internationally important wetland not only because it is a habitat for many rare bird species but also because it is an internationally important stopover for some rare global migratory bird species. However the petroleum exploitation in wetland has brought about many environmental problems. One of the most severe problems is crude oil pollution, which has caused the dying-off Carex tato and imposes great threat on survival of rare birds. This work studied the factors that caused the dying off of Carex tato. The results showed that death of Carex tato was the result narcosis toxicity of alcohols, intermediate biodegradation products of crude oil, on the root tissue, and the fragmentization of cuticle of leaves by light components of crude oil volatized from soil surface. However, the mechanism involved was much more complex and three interactive factors including crude oil pollution of soil, long-term drought and poor permeability of soil were responsible for the dying-off of Carex tato grassland. The distribution of crude oil in soil profile was characterized with high concentrations at top silty layer and the layer below root zone and low or no crude oil at root zone layer. This distribution was relative to root system characteristics and rhizospheric biodegradation. In root zone, substantive oxygen could be transported to root zone through dense root system and well developed aerenchyma. The crude oil in root zone was easily biodegraded by aerobic rhizosphere microbes. However, some toxic intermediate products, such as some alcohols, was sealed in root zone due to poor permeability of the top soil layer and the deeper soil layer and they had lethal effects on root tissue. Above ground, low molecular components of crude oil in top soil layer was easily volatized into atmosphere during long-term drought. Some of the volatized components were adsorbed onto leaves. SEM analysis showed that these components destroyed the leaves by fragmentization

  2. The conjunction of factors that lead to formation of giant gold provinces and deposits in non-arc settings

    USGS Publications Warehouse

    Groves, David I.; Goldfarb, Richard J.; Santosh, M.

    2016-01-01

    In contrast to their province scale similarities, the different giant gold deposit styles show contrasting critical controls at the district to deposit scale. For orogenic gold deposits, the giants appear to have formed by conjunction of a greater number of parameters to those that control smaller deposits, with resultant geometrical and lithostratigraphic complexity as a guide to their location. There are few giant IRGS due to their inferior fluid-flux systems relative to orogenic gold deposits, and those few giants are essentially preservational exceptions. Many Carlin-type deposits are giants due to the exceptional conjunction of both structural and lithological parameters that caused reactive and permeable rocks, enriched in syngenetic gold, to be located below an impermeable cap along antiformal “trends”. Hydrocarbons probably played an important role in concentrating metal. The supergiant Post-Betze deposit has additional ore zones in strain heterogeneities surrounding the pre-gold Goldstrike stock. All unequivocal IOCG deposits are giant or near-giant deposits in terms of gold-equivalent resources, partly due to economic factors for this relatively poorly understood, low Cu-Au grade deposit type. The supergiant Olympic Dam deposit, the most shallowly formed deposit among the larger IOCGs, probably owes its origin to eruption of volatile-rich hybrid magma at surface, with formation of a large maar and intense and widespread brecciation, alteration and Cu-Au-U deposition in a huge rock volume.

  3. Some factors that can lead to poor peak shape in hydrophilic interaction chromatography, and possibilities for their remediation.

    PubMed

    Heaton, James C; McCalley, David V

    2016-01-01

    Some factors which present difficulties for obtaining good peak shape in hydrophilic interaction chromatography (HILIC) were studied. The effect of injection solvent composition and volume was systematically investigated using a selection of weak and stronger basic compounds on a hybrid bare silica phase. Increasing the mismatch between the injection solvent (range 95-0% ACNv/v) and the mobile phase (maintained at 95% ACNv/v) gave increasing deterioration in peak shape. With the 2.1mm ID columns used, injections in the mobile phase of increasing volume (1-20 μL) gave poorer peak shape, but the magnitude of the effect was considerably smaller than that of solvent mismatch over this range. Some solute structural features such as galloyl (trihydroxy benzene), catechol (benzene diol) and phosphate (in nucleotides) gave serious peak tailing, attributed to interactions with metals in the stationary phase or the chromatographic hardware. These undesirable effects can be moderated by including complexing agents in the mobile phase, by changing the stationary phase chemistry, or by altering the mobile phase pH. PMID:26689823

  4. Blocking Endogenous Leukemia Inhibitory Factor During Placental Development in Mice Leads to Abnormal Placentation and Pregnancy Loss

    PubMed Central

    Winship, Amy; Correia, Jeanne; Krishnan, Tara; Menkhorst, Ellen; Cuman, Carly; Zhang, Jian-Guo; Nicola, Nicos A.; Dimitriadis, Evdokia

    2015-01-01

    The placenta forms the interface between the maternal and fetal circulation and is critical for the establishment of a healthy pregnancy. Specialized trophoblast cells derived from the embryonic trophectoderm play a pivotal role in the establishment of the placenta. Leukemia inhibitory factor (LIF) is one of the predominant cytokines present in the placenta during early pregnancy. LIF has been shown to regulate trophoblast adhesion and invasion in vitro, however its precise role in vivo is unknown. We hypothesized that LIF would be required for normal placental development in mice. LIF and LIFRα were immunolocalized to placental trophoblasts and fetal vessels in mouse implantation sites during mid-gestation. Temporally blocking LIF action during specific periods of placental development via intraperitoneal administration of our specific LIFRα antagonist, PEGLA, resulted in abnormal placental trophoblast and vascular morphology and reduced activated STAT3 but not ERK. Numerous genes regulating angiogenesis and oxidative stress were altered in the placenta in response to LIF inhibition. Pregnancy viability was also significantly compromised in PEGLA treated mice. Our data suggest that LIF plays an important role in placentation in vivo and the maintenance of healthy pregnancy. PMID:26272398

  5. Signals leading to the activation of NF-kappa B transcription factor are stronger in neonatal than adult T lymphocytes.

    PubMed

    Kilpinen, S; Henttinen, T; Lahdenpohja, N; Hulkkonen, J; Hurme, M

    1996-07-01

    The molecular background of the defects in the immune reactivity of human neonates has not been fully elucidated. As the NF-kappa B transcription factor has a central role in the control of transcription of several genes involved in immune and inflammatory responses, the authors have analysed the activation of NF-kappa B in human umbilical cord T lymphocytes. The activity was tested by quantitating the nuclear proteins binding to an oligonucleotide containing the consensus kappa B binding sequence (electrophoretic mobility shift assay). The data obtained demonstrate that phorbol dibutyrate/calcium ionophore A23187 (PDBu/iono) combination induced a clearly higher nuclear translocation of NF-kappa B in neonatal than adult T cells. This higher NF-kappa B activity was restricted to the CD4+ T-cell subset. Analysis of the nuclear extracts with antibodies directed against the major components of NF-kappa B the p50 and RelA (p65) proteins, indicated that the composition of NF-kappa B was similar in neonatal and adult cells. These results suggest that neonatal T cells are exposed to oxidative stress-inducing signals during delivery and/or are inherently more sensitive to NF-kappa B activating signals than adult T cells. PMID:8693296

  6. [EFFICIENCY OF INTRODUCING CAROTENE PRODUCING STRAINS BACILLUS SP. 1.1 AND B. AMYLOLIQUEFACIENS UCM B-5113 INTO THE CHIKENS DIET].

    PubMed

    Nechypurenko, O O; Kharhota M A; Avdeeva, L V

    2015-01-01

    It was shown the efficiency of carotene producing strains Bacillus sp. 1.1 and B. amyloliquefaciens UCM B-5113 in the diet of chickens. Also it was detected the lowering of the quantitative content of bacterial genera Enterococcus, Staphylococcus, family Enterobacteriaceae in the gut after eating by chickens cross "H&N Brown Nick" fodder with strains Bacillus sp. 1.1 and B. amyloliquefaciens UCM B-5113 alone and in composition in quantities 1 x 10(10) CFU per 1 g of feed. On the 18th day after introduction of cultures Bacillus sp. 1.1, B. amyloliquefaciens UCM B-5113 and their composition in the diet of poultry we revealed the increasing of body weight by 21.6, 7.6 and 22.0%, respectively, comparesing to controls. Also due to Bacillus sp. 1.1 it was detected the restore of intestinal villous structures, tissues of spleen, liver and heart. We found the additive effect of the composition of the investigated strains of bacteria genus Bacillus to the chickens. PMID:26214892

  7. Draft Genome Sequence of “Candidatus Methanomethylophilus” sp. 1R26, Enriched from Bovine Rumen, a Methanogenic Archaeon Belonging to the Methanomassiliicoccales Order

    PubMed Central

    Højberg, Ole; Urich, Tim

    2016-01-01

    Here, we present the draft genome of “Candidatus Methanomethylophilus” sp. 1R26, a member of the newly described Methanomassiliicoccales order of Euryarcheaota. The enrichment culture was established from bovine rumen contents and produced methane from trimethylamine and methanol. The draft genome contains genes for methanogenesis from methylated compounds. PMID:26893425

  8. Gap junctional communication modulates gene transcription by altering the recruitment of Sp1 and Sp3 to connexin-response elements in osteoblast promoters

    NASA Technical Reports Server (NTRS)

    Stains, Joseph P.; Lecanda, Fernando; Screen, Joanne; Towler, Dwight A.; Civitelli, Roberto

    2003-01-01

    Loss-of-function mutations of gap junction proteins, connexins, represent a mechanism of disease in a variety of tissues. We have shown that recessive (gene deletion) or dominant (connexin45 overexpression) disruption of connexin43 function results in osteoblast dysfunction and abnormal expression of osteoblast genes, including down-regulation of osteocalcin transcription. To elucidate the molecular mechanisms of gap junction-sensitive transcriptional regulation, we systematically analyzed the rat osteocalcin promoter for sensitivity to gap junctional intercellular communication. We identified an Sp1/Sp3 containing complex that assembles on a minimal element in the -70 to -57 region of the osteocalcin promoter in a gap junction-dependent manner. This CT-rich connexin-response element is necessary and sufficient to confer gap junction sensitivity to the osteocalcin proximal promoter. Repression of osteocalcin transcription occurs as a result of displacement of the stimulatory Sp1 by the inhibitory Sp3 on the promoter when gap junctional communication is perturbed. Modulation of Sp1/Sp3 recruitment also occurs on the collagen Ialpha1 promoter and translates into gap junction-sensitive transcriptional control of collagen Ialpha1 gene expression. Thus, regulation of Sp1/Sp3 recruitment to the promoter may represent a potential general mechanism for transcriptional control of target genes by signals passing through gap junctions.

  9. Draft Genome Sequence of "Candidatus Methanomethylophilus" sp. 1R26, Enriched from Bovine Rumen, a Methanogenic Archaeon Belonging to the Methanomassiliicoccales Order.

    PubMed

    Noel, Samantha Joan; Højberg, Ole; Urich, Tim; Poulsen, Morten

    2016-01-01

    Here, we present the draft genome of "Candidatus Methanomethylophilus" sp. 1R26, a member of the newly described Methanomassiliicoccales order of Euryarcheaota. The enrichment culture was established from bovine rumen contents and produced methane from trimethylamine and methanol. The draft genome contains genes for methanogenesis from methylated compounds. PMID:26893425

  10. Lead Poisoning

    MedlinePlus

    ... Experiments Stories Lessons Topics Games Activities Lessons MENU Lead Poisoning Kids Homepage Topics Pollution Lead Poisoning What is ... you can avoid contact with it! Sources of Lead Poisoning HOUSE PAINTS: Before1950, lead-based paint was used ...

  11. Lead Test

    MedlinePlus

    ... to determine lead sources, educating family members about lead poisoning , and instituting follow-up testing to monitor the ... high levels of lead, see the article on Lead Poisoning . The Occupational Safety and Health Administration (OSHA) has ...

  12. Lead Poisoning

    MedlinePlus

    Lead Poisoning What is it and who is affected? Lead is a highly toxic substance, exposure to which ... and children can suffer from the effects of lead poisoning, but childhood lead poisoning is much more frequent. ...

  13. Factors Leading to the Spatial Heterogeneity of Sediment-Transport Processes on the Fly River Clinoform, Gulf of Papua

    NASA Astrophysics Data System (ADS)

    Ogston, A. S.; Sternberg, R. W.; Crockett, J. S.; Nittrouer, C. A.; Goni, M. A.

    2004-12-01

    As part of the NSF Source-to-Sink program in the Gulf of Papua, the relationships between sediment transport processes, development of short-term sedimentary deposition, subsequent burial and long-term accumulation are being investigated. Sediment-transport processes were evaluated using both time-series observations from bottom-mounted tripods and repeated water-column profiling throughout the study area during three seasonal cruises. These observations are being evaluated in relation to the morphology of the clinoform that is offshore and to the northeast of the Fly River mouth. Channels across the clinoform feature off the river distributary mouths have been identified as active transport pathways delivering sediment to the deeper portions of the shelf. Tidal currents are focussed in the channels and there is potentially a direct supply of sediment from the river mouth. During the trade wind season, gravity-driven (fluid mud) flows were observed in this environment when waves added a critical component to the shear stress. Processes on the open clinoform differ from those in the channels. The open clinoform to the northeast appears to be a relatively smooth feature, yet measurements show that dramatically different sediment flux rates exist along the feature. On the open clinoform in the central part of the gulf, gravity flows were observed during trade-wind conditions, but were not seen closer to the Fly River mouth under similar energetic forcing. Factors that influence this heterogeneity include convergence of flow due to regional circulation and fresh water input, and variable sediment supply from a number of rivers entering the broad, shallow tidal region.

  14. Transcription Factor Pip Can Enhance DNA Binding by E47, Leading to Transcriptional Synergy Involving Multiple Protein Domains

    PubMed Central

    Nagulapalli, Sujatha; Atchison, Michael L.

    1998-01-01

    The transcription factors E2A (E12/E47) and Pip are both required for normal B-cell development. Each protein binds to regulatory sequences within various immunoglobulin enhancer elements. Activity of E2A proteins can be regulated by interactions with other proteins which influence their DNA binding or activation potential. Similarly, Pip function can be influenced by interaction with the protein PU.1, which can recruit Pip to bind to DNA. We show here that a previously unidentified Pip binding site resides adjacent to the E2A binding site within the immunoglobulin κ 3′ enhancer. Both of these binding sites are crucial for high-level enhancer activity. We found that E47 and Pip can functionally interact to generate a very potent 100-fold transcriptional synergy. Through a series of mutagenesis experiments, we identified the Pip sequences necessary for transcriptional activation and for synergy with E47. Two synergy domains (residues 140 to 207 and 300 to 420) in addition to the Pip DNA binding domain (residues 1 to 134) are required for maximal synergy with E47. We also identified a Pip domain (residues 207 to 300) that appears to mask Pip transactivation potential. Part of the synergy mechanism between E47 and Pip appears to involve the ability of Pip to increase DNA binding by E47, perhaps by inducing a conformational change in the E47 protein. E47 may also induce a conformational change in Pip which unmasks sequences important for transcriptional activity. Based upon our results, we propose a model for E47-Pip transcriptional synergy. PMID:9671474

  15. Involvement of Sp1 and SREBP-1a in transcriptional activation of the LDL receptor gene by insulin and LH in cultured porcine granulosa-luteal cells.

    PubMed

    Sekar, Natesampillai; Veldhuis, Johannes D

    2004-07-01

    Luteinizing hormone (LH) and insulin stimulate transcriptional activity of the porcine low-density lipoprotein (LDL) receptor (LDLR) promoter supra-additively in primary cultures of granulosa-luteal cells. The mechanistic basis of this bihormonal interaction is unknown. The pig LDLR gene promoter includes three putative Sp1/Sp3-binding sites and one sterol response element (SRE) site 5' upstream to the transcriptional start site. To assess the role of SRE-binding protein (SREBP) in LDLR gene regulation, swine granulosa-luteal cells were cotransfected with CMV/SREBP-1a or SREBP-2 and the pLDLR1076/luc promoter. SREBP-1a and SREBP-2 stimulated LDLR gene transcription eight- and fourfold, respectively. LH alone augmented stimulation by SREBP-1 twofold. Conversely, cotransfection of a dominant-negative mutant form of SREBP-1a repressed basal and hormonally stimulated LDLR promoter activity by >80% (P < 0.01). Mutation of the SRE -167 ATCACCCCATG -157 to -167 ATCACCgCATG -157 bp decreased basal expression by 50% and LH + insulin- and LH + IGF-I-stimulated transcriptional activity by 80% and >90%, respectively (both P < 0.01). Mutations within each of the three flanking putative Sp1/Sp3 sites at -216/-211, -201/-196, and -151/-146 bp in the LDLR gene promoter also reduced basal activity (by >85%) and hormonal responsiveness (>95%, P < 0.05). EMSA confirmed that presumptive SRE-1 and Sp1/Sp3 elements bind respective peptides. Mithramycin, an inhibitor of Sp1/Sp3 protein(s) binding, blocked hormonally induced LDLR promoter expression by 80%. Basal transcription and supra-additive stimulation of porcine LDLR gene transcription by LH and insulin in granulosa-luteal cells require SREBP-1a and Sp1/Sp3-binding elements. PMID:14998783

  16. The Antagonistic Effect of Selenium on Lead-Induced Inflammatory Factors and Heat Shock Protein mRNA Level in Chicken Cartilage Tissue.

    PubMed

    Zheng, Shufang; Song, Huanyu; Gao, Han; Liu, Chunpeng; Zhang, Ziwei; Fu, Jing

    2016-09-01

    Selenium (Se) is recognized as a necessary trace mineral in animal diets, including those of birds. Lead (Pb) is a toxic heavy metal and can damage organs in humans and animals. Complex antagonistic interactions between Se and heavy metals have been reported in previous studies. However, little is known regarding the effects of Se on Pb-induced toxicity and the expression of inflammatory factors and heat shock proteins (HSPs) in the cartilage of chickens. In this present study, we fed chickens either with Se or Pb or both Se and Pb supplement and later analyzed the mRNA expressions of inflammatory factors (inducible nitric oxide synthase (iNOS), nuclear factor-kappa B (NF-κB), tumor necrosis factor-α (TNF-α), and cyclooxygenase-2 (COX-2)) and HSPs (Hsp27, Hsp40, Hsp60, Hsp70, and Hsp90). The results showed that Se and Pb influenced the expression of inflammatory factors and HSP genes in the chicken cartilage tissues. Additionally, we also found that antagonistic interaction existed between Se and Pb supplementation. Our findings suggested that Se could exert a antagonistic effect on Pb in chicken cartilage tissues. PMID:26831653

  17. Activation of TGF-β1 promoter by hepatitis C virus-induced AP-1 and Sp1: role of TGF-β1 in hepatic stellate cell activation and invasion.

    PubMed

    Presser, Lance D; McRae, Steven; Waris, Gulam

    2013-01-01

    Our previous studies have shown the induction and maturation of transforming growth factor-beta 1 (TGF-β1) in HCV-infected human hepatoma cells. In this study, we have investigated the molecular mechanism of TGF-β1 gene expression in response to HCV infection. We demonstrate that HCV-induced transcription factors AP-1, Sp1, NF-κB and STAT-3 are involved in TGF-β1 gene expression. Using chromatin immunoprecipitation (ChIP) assay, we further show that AP-1 and Sp1 interact with TGF-b1 promoter in vivo in HCV-infected cells. In addition, we demonstrate that HCV-induced TGF-β1 gene expression is mediated by the activation of cellular kinases such as p38 MAPK, Src, JNK, and MEK1/2. Next, we determined the role of secreted bioactive TGF-β1 in human hepatic stellate cells (HSCs) activation and invasion. Using siRNA approach, we show that HCV-induced bioactive TGF-β1 is critical for the induction of alpha smooth muscle actin (α-SMA) and type 1 collagen, the markers of HSCs activation and proliferation. We further demonstrate the potential role of HCV-induced bioactive TGF-β1 in HSCs invasion/cell migration using a transwell Boyden chamber. Our results also suggest the role of HCV-induced TGF-β1 in HCV replication and release. Collectively, these observations provide insight into the mechanism of TGF-β1 promoter activation, as well as HSCs activation and invasion, which likely manifests in liver fibrosis associated with HCV infection. PMID:23437118

  18. The Sp1-mediaded allelic regulation of MMP13 expression by an ESCC susceptibility SNP rs2252070

    PubMed Central

    Shi, Meng; Xia, Jianhong; Xing, Huaixin; Yang, Wenjun; Xiong, Xiangyu; Pan, Wenting; Han, Sichong; Shang, Jinhua; Zhou, Changchun; Zhou, Liqing; Yang, Ming

    2016-01-01

    Metallopeptidase 13 (MMP13), a well-known and highly regulated zinc-dependent MMP collagenase, plays a crucial part in development and progression of esophageal squamous cell carcinoma (ESCC). Therefore, we examined associations between ESCC susceptibility and four haplotype-tagging single nucleotide polymorphisms (htSNPs) using a two stage case-control strategy. Odds ratios (OR) and 95% confidence intervals (95% CI) were computed by logistic regression model. After analyzing 1588 ESCC patients and frequency-matched 1600 unaffected controls, we found that MMP13 rs2252070 G > A genetic polymorphism is significantly associated with ESCC risk in Chinese Han populations (GA: OR = 0.63, 95% CI = 0.54–0.74, P = 1.7 × 10−6, AA: OR = 0.73, 95% CI = 0.66–0.81, P = 1.8 × 10−6). Interestingly, the rs2252070 G-to-A change was shown to diminish a Sp1-binding site in ESCC cells. Reporter gene assays indicated that the rs2252070 A allele locating in a potential MMP13 promoter has low promoter activities. After measuring MMP13 gene expression in sixty-six pairs of esophageal cancer and normal tissues, we observed that the rs2252070 A protective allele carriers showed decreased oncogene MMP13 expression. Results of these analyses underline the support of the notion that MMP13 might function as a key oncogene in esophageal carcinogenesis. PMID:27245877

  19. Estrogen Receptor beta binds Sp1 and recruits a Corepressor Complex to the Estrogen Receptor alpha Gene Promoter

    PubMed Central

    Bartella, V; Rizza, P; Barone, I; Zito, D; Giordano, F; Giordano, C; Catalano, S; Mauro, L; Sisci, D; Panno, ML; Fuqua, SA; Andò, Sebastiano

    2015-01-01

    Human estrogen receptors (ERs) alpha and beta are crucially involved in the regulation of mammary growth and development. Normal breast tissues display a prevalently expression of ER beta than ER alpha, which drastically increases during breast tumorogenesis. So, it is reasonable to assume how a dysregulation of the two estrogen receptor subtypes may induce breast cancer development. However, the molecular mechanism underlying the opposite role played by the two estrogen receptors on tumor cell growth remains to be elucidated. In the present study, we have demonstrated that ER beta overexpression in breast cancer cells decreases cell proliferation and down-regulates ER alpha mRNA and protein content along with a concomitant repression of estrogen-regulated genes. Transient transfection experiments, using a vector containing the human ER alpha promoter region, showed that elevated levels of the ER beta down-regulated basal ER alpha promoter activity. Furthermore, side-directed mutagenesis and deletion analysis have revealed that the proximal GC-rich motifs at −223 and −214 is crucial for the ER beta-induced ER alpha down-regulation in breast cancer cells. This occurred through ER beta-Sp1 protein-protein interaction within the ER alpha promoter region and the recruitment of a corepressor complex containing NCoR/SMRT (nuclear receptor corepressor/silencing mediator of retinoic acid and thyroid hormone receptor), accompanied by hypoacetylation of histone H4 and displacement of RNA polymerase II. Silencing of NCoR gene expression by RNA interference reversed the down-regulatory effect of ER beta on ER alpha gene expression and cell proliferation. Our results provide evidence for a novel mechanism by which overexpression of ER beta through NCoR is able to down regulate ER alpha gene expression, thus inhibiting ER alpha’s driving role on breast cancer cell growth. PMID:22622808

  20. Down-regulation of PROS1 Gene Expression by 17β-Estradiol via Estrogen Receptor α (ERα)-Sp1 Interaction Recruiting Receptor-interacting Protein 140 and the Corepressor-HDAC3 Complex*

    PubMed Central

    Suzuki, Atsuo; Sanda, Naomi; Miyawaki, Yuhri; Fujimori, Yuta; Yamada, Takayuki; Takagi, Akira; Murate, Takashi; Saito, Hidehiko; Kojima, Tetsuhito

    2010-01-01

    Pregnant women show a low level of protein S (PS) in plasma, which is known to be a risk for deep venous thrombosis. 17β-Estradiol (E2), an estrogen that increases in concentration in the late stages of pregnancy, regulates the expression of various genes via the estrogen receptor (ER). Here, we investigated the molecular mechanisms behind the reduction in PS levels caused by E2 in HepG2-ERα cells, which stably express ERα, and also the genomic ER signaling pathway, which modulates the ligand-dependent repression of the PSα gene (PROS1). We observed that E2 repressed the production of mRNA and antigen of PS. A luciferase reporter assay revealed that E2 down-regulated PROS1 promoter activity and that this E2-dependent repression disappeared upon the deletion or mutation of two adjacent GC-rich motifs in the promoter. An electrophoretic mobility shift assay and DNA pulldown assay revealed that the GC-rich motifs were associated with Sp1, Sp3, and ERα. In a chromatin immunoprecipitation assay, we found ERα-Sp protein-promoter interaction involved in the E2-dependent repression of PROS1 transcription. Furthermore, we demonstrated that E2 treatment recruited RIP140 and the NCoR-SMRT-HDAC3 complex to the PROS1 promoter, which hypoacetylated chromatin. Taken together, this suggested that E2 might repress PROS1 transcription depending upon ERα-Sp1 recruiting transcriptional repressors in HepG2-ERα cells and, consequently, that high levels of E2 leading to reduced levels of plasma PS would be a risk for deep venous thrombosis in pregnant women. PMID:20200160

  1. Lead Poisoning

    MedlinePlus

    Lead is a metal that occurs naturally in the earth's crust. Lead can be found in all parts of our ... from human activities such as mining and manufacturing. Lead used to be in paint; older houses may ...

  2. Lead poisoning

    MedlinePlus

    ... swallows a lead object or breathes in lead dust, some of the poison can stay in the ... a health problem. Lead is everywhere, including dirt, dust, new toys, and old house paint. Unfortunately, you ...

  3. Lead Toxicity

    MedlinePlus

    ... homes. • Most people, especially children, who suffer from lead poisoning are exposed through lead-contaminated household dust or ... and six if they are at risk of lead poisoning (see: ). Who can I call to get more ...

  4. Multiple environmental chemical exposures to lead, mercury and polychlorinated biphenyls among childbearing-aged women (NHANES 1999–2004): Body burden and risk factors

    PubMed Central

    Thompson, Marcella Remer; Boekelheide, Kim

    2013-01-01

    Background Lead, mercury and polychlorinated biphenyls (PCBs) are neurotoxicants with intergenerational health consequences from maternal body burden and gestational exposures. Little is known about multiple chemical exposures among childbearing-aged women. Objectives To determine the percentage of women aged 16–49 of diverse races and ethnicities whose body burdens for all three xenobiotics were at or above the median; to identify mixed exposures; and to describe those women disproportionately burdened by two or more of these chemicals based on susceptibility- and exposure-related attributes, socioeconomic factors and race-ethnicity. Methods Secondary data analysis of National Health and Nutrition Examination Survey (1999–2004). Results The best-fit logistic regression model without interactions contained 12 variables. Four risk factors associated with body burden were notable (P ≤ 0.05). An exponential relationship was demonstrated with increasing age. Any fish consumption in past 30 days more than doubled the odds. Heavy alcohol consumption increased the relative risk. History of breastfeeding reduced this risk. These women were more likely to have two xenobiotics at or above the median than one. More than one-fifth of these childbearing-aged women had three xenobiotic levels at or above the median. Conclusions These findings are among the first description of US childbearing-aged women’s body burden and risk factors for multiple chemical exposures. This study supports increasing age, any fish consumption and heavy alcohol consumption as significant risk factors for body burden. History of breastfeeding lowered the body burden. Limited evidence was found of increased risk among minority women independent of other risk factors. PMID:23158727

  5. The mucoid switch in Pseudomonas aeruginosa represses quorum sensing systems and leads to complex changes to stationary phase virulence factor regulation.

    PubMed

    Ryall, Ben; Carrara, Marta; Zlosnik, James E A; Behrends, Volker; Lee, Xiaoyun; Wong, Zhen; Lougheed, Kathryn E; Williams, Huw D

    2014-01-01

    The opportunistic pathogen Pseudomonas aeruginosa chronically infects the airways of Cystic Fibrosis (CF) patients during which it adapts and undergoes clonal expansion within the lung. It commonly acquires inactivating mutations of the anti-sigma factor MucA leading to a mucoid phenotype, caused by excessive production of the extracellular polysaccharide alginate that is associated with a decline in lung function. Alginate production is believed to be the key benefit of mucA mutations to the bacterium in the CF lung. A phenotypic and gene expression characterisation of the stationary phase physiology of mucA22 mutants demonstrated complex and subtle changes in virulence factor production, including cyanide and pyocyanin, that results in their down-regulation upon entry into stationary phase but, (and in contrast to wildtype strains) continued production in prolonged stationary phase. These findings may have consequences for chronic infection if mucoid P. aeruginosa were to continue to make virulence factors under non-growing conditions during infection. These changes resulted in part from a severe down-regulation of both AHL-and AQ (PQS)-dependent quorum sensing systems. In trans expression of the cAMP-dependent transcription factor Vfr restored both quorum sensing defects and virulence factor production in early stationary phase. Our findings have implications for understanding the evolution of P. aeruginosa during CF lung infection and it demonstrates that mucA22 mutation provides a second mechanism, in addition to the commonly occurring lasR mutations, of down-regulating quorum sensing during chronic infection this may provide a selection pressure for the mucoid switch in the CF lung. PMID:24852379

  6. The Mucoid Switch in Pseudomonas aeruginosa Represses Quorum Sensing Systems and Leads to Complex Changes to Stationary Phase Virulence Factor Regulation

    PubMed Central

    Ryall, Ben; Carrara, Marta; Zlosnik, James E. A.; Behrends, Volker; Lee, Xiaoyun; Wong, Zhen; Lougheed, Kathryn E.; Williams, Huw D.

    2014-01-01

    The opportunistic pathogen Pseudomonas aeruginosa chronically infects the airways of Cystic Fibrosis (CF) patients during which it adapts and undergoes clonal expansion within the lung. It commonly acquires inactivating mutations of the anti-sigma factor MucA leading to a mucoid phenotype, caused by excessive production of the extracellular polysaccharide alginate that is associated with a decline in lung function. Alginate production is believed to be the key benefit of mucA mutations to the bacterium in the CF lung. A phenotypic and gene expression characterisation of the stationary phase physiology of mucA22 mutants demonstrated complex and subtle changes in virulence factor production, including cyanide and pyocyanin, that results in their down-regulation upon entry into stationary phase but, (and in contrast to wildtype strains) continued production in prolonged stationary phase. These findings may have consequences for chronic infection if mucoid P. aeruginosa were to continue to make virulence factors under non-growing conditions during infection. These changes resulted in part from a severe down-regulation of both AHL-and AQ (PQS)-dependent quorum sensing systems. In trans expression of the cAMP-dependent transcription factor Vfr restored both quorum sensing defects and virulence factor production in early stationary phase. Our findings have implications for understanding the evolution of P. aeruginosa during CF lung infection and it demonstrates that mucA22 mutation provides a second mechanism, in addition to the commonly occurring lasR mutations, of down-regulating quorum sensing during chronic infection this may provide a selection pressure for the mucoid switch in the CF lung. PMID:24852379

  7. The Antagonistic Effect of Selenium on Lead-Induced Inflammatory Factors and Heat Shock Proteins mRNA Expression in Chicken Livers.

    PubMed

    Wang, Hao; Li, Shu; Teng, Xiaohua

    2016-06-01

    The aim of this study was to investigate the effect of lead (Pb) poisoning on nitric oxide (NO) content, inducible nitric oxide synthase (iNOS) activity, the messenger RNA (mRNA) levels of inflammatory factors (nuclear factor-kappa B (NF-κB), tumor necrosis factor-α (TNF-α), cyclooxygenase-2 (COX-2), prostaglandin E synthases (PTGEs), and iNOS), heat shock proteins (HSPs) (HSP27, HSP40, HSP60, HSP70, and HSP90), and the antagonistic effect of selenium (Se) on Pb in chicken livers. One hundred eighty 7-day-old male chickens were randomly divided into four groups and were fed commercial diet and drinking water, Na2SeO3-added commercial diet and drinking water, commercial diet and (CH3OO)2Pb-added drinking water, and Na2SeO3-added commercial diet and (CH3OO)2Pb-added drinking water, respectively, for 30, 60, and 90 days. Then, NO content, iNOS activity, and the mRNA levels of NF-κB, TNF-α, COX-2, PTGEs, iNOS, HSP27, HSP40, HSP60, HSP70, and HSP90 were examined in chicken livers. The results showed that Pb poisoning induced NO content, iNOS activity, and mRNA expression of inflammation factors and HSPs in chicken livers. In addition, Se alleviated Pb-induced increase of inflammation factor and HSP expression in chicken livers. PMID:26470710

  8. Lipopolysaccharide Decreases Single Immunoglobulin Interleukin-1 Receptor-related Molecule (SIGIRR) Expression by Suppressing Specificity Protein 1 (Sp1) via the Toll-like Receptor 4 (TLR4)-p38 Pathway in Monocytes and Neutrophils*

    PubMed Central

    Ueno-Shuto, Keiko; Kato, Kosuke; Tasaki, Yukihiro; Sato, Miki; Sato, Keizo; Uchida, Yuji; Sakai, Hiromichi; Ono, Tomomi; Suico, Mary Ann; Mitsutake, Kazunori; Tokutomi, Naofumi; Kai, Hirofumi; Shuto, Tsuyoshi

    2014-01-01

    Single immunoglobulin interleukin-1 receptor-related molecule (SIGIRR) is one of the immunoglobulin-like membrane proteins that is crucial for negative regulation of toll-like receptor 4 (TLR4) and interleukin-1 receptor. Despite the importance of understanding its expression and function, knowledge is limited on the regulatory mechanism in the epithelial tissues, such as the liver, lung, and gut, where its predominant expression is originally described. Here, we found expression of SIGIRR in non-epithelial innate immune cells, including primary peripheral blood monocytes, polymorphonuclear neutrophils, monocytic RAW264 cells, and neutrophilic-differentiated HL-60 cells. Consistent with previous findings in epithelial tissues, SIGIRR gene and protein expression were also down-regulated by LPS treatment in a time-dependent manner in primary blood monocytes and polymorphonuclear neutrophils. A reduction was also observed in RAW264 and differentiated HL-60 cells. Notably, exogenous introduction of the dominant negative form of TLR4 and siRNA of p38 resulted in inhibition of LPS-induced SIGIRR down-regulation, whereas treatment with p38 activator anisomycin showed a dose-dependent decrease in SIGIRR expression, suggesting TLR4-p38 signal as a critical pathway for LPS-induced SIGIRR down-regulation. Finally, reporter gene and chromatin immunoprecipitation assays demonstrated that Sp1 is a key factor that directly binds to the proximal promoter of SIGIRR gene and consequently regulates basal SIGIRR expression, which is negatively regulated by the LPS-dependent TLR4-p38 pathway. In summary, the data precisely demonstrate how LPS down-regulates SIGIRR expression and provide a role of LPS signal that counteracts Sp1-dependent basal promoter activation of SIGIRR gene via TLR4-p38 pathway in non-epithelial innate immune cells. PMID:24821721

  9. Lead Poisoning

    MedlinePlus

    ... our environment. Much of it comes from human activities such as mining and manufacturing. Lead used to be in paint; older houses may still have lead paint. You could be exposed to lead by Eating food or drinking water that contains lead. Water pipes in older homes ...

  10. Lead poisoning

    SciTech Connect

    Rekus, J.F.

    1992-08-01

    Construction workers who weld, cut or blast structural steel coated with lead-based paint are at significant risk of lead poisoning. Although technology to control these exposures may not have existed when the lead standard was promulgated, it is available today. Employers who do not take steps to protect their employees from lead exposure may be cited and fined severely for their failure.

  11. Insulin-like Growth Factor I (IGF-I)-induced Chronic Gliosis and Retinal Stress Lead to Neurodegeneration in a Mouse Model of Retinopathy*

    PubMed Central

    Villacampa, Pilar; Ribera, Albert; Motas, Sandra; Ramírez, Laura; García, Miquel; de la Villa, Pedro; Haurigot, Virginia; Bosch, Fatima

    2013-01-01

    Insulin-like growth factor I (IGF-I) exerts multiple effects on different retinal cell types in both physiological and pathological conditions. Despite the growth factor's extensively described neuroprotective actions, transgenic mice with increased intraocular levels of IGF-I showed progressive impairment of electroretinographic amplitudes up to complete loss of response, with loss of photoreceptors and bipolar, ganglion, and amacrine neurons. Neurodegeneration was preceded by the overexpression of genes related to retinal stress, acute-phase response, and gliosis, suggesting that IGF-I altered normal retinal homeostasis. Indeed, gliosis and microgliosis were present from an early age in transgenic mice, before other alterations occurred, and were accompanied by signs of oxidative stress and impaired glutamate recycling. Older mice also showed overproduction of pro-inflammatory cytokines. Our results suggest that, when chronically increased, intraocular IGF-I is responsible for the induction of deleterious cellular processes that can lead to neurodegeneration, and they highlight the importance that this growth factor may have in the pathogenesis of conditions such as ischemic or diabetic retinopathy. PMID:23620587

  12. Manumycin A induces apoptosis in malignant pleural mesothelioma through regulation of Sp1 and activation of the mitochondria-related apoptotic pathway.

    PubMed

    Kim, Ka Hwi; Chae, Jung-Il; Oh, Hana; Cho, Jin Hyoung; Lee, Ra-Ham; Yoon, Goo; Cho, Seung-Sik; Cho, Young-Sik; Lee, Mee-Hyun; Liu, Kangdong; Lee, Hyun-Jeong; Shim, Jung-Hyun

    2016-07-01

    Manumycin A (Manu A) is a natural product isolated from Streptomyces parvulus and has been reported to have anti-carcinogenic and anti-biotic properties. However, neither its molecular mechanism nor its molecular targets are well understood. Thus, the aim of the present study was to explore the possibility that Manu A has cancer preventive and chemotherapeutic effects on malignant pleural mesothelioma (MPM) through regulation of Sp1 and induction of mitochondrial cell death pathway. Manu A inhibited the cell viability of MSTO-211H and H28 cells in a concentration‑dependent manner as determined by MTS assay. IC50 values were calculated as 8.3 and 4.3 µM in the MSTO-311H and H28 cells following 48 h incubation, respectively. Manu A induced a significant increase in apoptotic indices as shown by DAPI staining, Annexin V assay, multi-caspase activity and mitochondrial membrane potential assay. The downregulation of Sp1 mRNA and protein expression by Manu A led to apoptosis by suppressing Sp1-regulated proteins (cyclin D1, Mcl-1 and survivin). Manu A decreased the protein levels of BID, Bcl-xL and PARP while it increased Bax levels. Manu A caused depolarization of the mitochondrial membrane with induction of CHOP, DR4 and DR5. Our results demonstrated that Manu A exerted anticancer effects by inducing apoptosis via inhibition of the Sp1-related signaling pathway in human MPM. PMID:27176604

  13. Histone deacetylase 3 represses p15{sup INK4b} and p21{sup WAF1/cip1} transcription by interacting with Sp1

    SciTech Connect

    Huang Weifeng; Tan Dapeng; Wang Xiuli; Han Songyan; Tan Jiang; Zhao Yanmei; Lu Jun . E-mail: ycsuo@nenu.edu.cn; Huang Baiqu

    2006-01-06

    Histone deacetylase 3 (HDAC3) has been implicated to play roles in governing cell proliferation. Here we demonstrated that the overexpression of HDAC3 repressed transcription of p15{sup INK4b} and p21{sup WAF1/cip1} genes in 293T cells, and that the recruitment of HDAC3 to the promoter regions of these genes was critical to this repression. We also showed that HDAC3 repressed GAL4-Sp1 transcriptional activity, and that Sp1 was co-immunoprecipitated with FLAG-tagged HDAC3. We conclude that HDAC3 can repress p15{sup INK4b} and p21{sup WAF1/cip1} transcription by interacting with Sp1. Furthermore, knockdown of HDAC3 by RNAi up-regulated the transcriptional expression of p15{sup INK4b}, but not that of p21{sup WAF1/cip1}, implicating the different roles of HDAC3 in repression of p15{sup INK4b} and p21{sup WAF1/cip1} transcription. Data from this study indicate that the inhibition of p15{sup INK4b} and p21{sup WAF1/cip1} may be one of the mechanisms by which HDAC3 participates in cell cycle regulation and oncogenesis.

  14. Guanine Nucleotide Exchange Factor αPIX Leads to Activation of the Rac 1 GTPase/Glycogen Phosphorylase Pathway in Interleukin (IL)-2-stimulated T Cells

    PubMed Central

    Llavero, Francisco; Urzelai, Bakarne; Osinalde, Nerea; Gálvez, Patricia; Lacerda, Hadriano M.; Parada, Luis A.; Zugaza, José L.

    2015-01-01

    Recently, we have reported that the active form of Rac 1 GTPase binds to the glycogen phosphorylase muscle isoform (PYGM) and modulates its enzymatic activity leading to T cell proliferation. In the lymphoid system, Rac 1 and in general other small GTPases of the Rho family participate in the signaling cascades that are activated after engagement of the T cell antigen receptor. However, little is known about the IL-2-dependent Rac 1 activator molecules. For the first time, a signaling pathway leading to the activation of Rac 1/PYGM in response to IL-2-stimulated T cell proliferation is described. More specifically, αPIX, a known guanine nucleotide exchange factor for the small GTPases of the Rho family, preferentially Rac 1, mediates PYGM activation in Kit 225 T cells stimulated with IL-2. Using directed mutagenesis, phosphorylation of αPIX Rho-GEF serines 225 and 488 is required for activation of the Rac 1/PYGM pathway. IL-2-stimulated serine phosphorylation was corroborated in Kit 225 T cells cultures. A parallel pharmacological and genetic approach identified PKCθ as the serine/threonine kinase responsible for αPIX serine phosphorylation. The phosphorylated state of αPIX was required to activate first Rac 1 and subsequently PYGM. These results demonstrate that the IL-2 receptor activation, among other early events, leads to activation of PKCθ. To activate Rac 1 and consequently PYGM, PKCθ phosphorylates αPIX in T cells. The biological significance of this PKCθ/αPIX/Rac 1 GTPase/PYGM signaling pathway seems to be the control of different cellular responses such as migration and proliferation. PMID:25694429

  15. Lead poisoning

    MedlinePlus

    ... lead is still found in some modern faucets. Soil contaminated by decades of car exhaust or years ... house paint scrapings. Lead is more common in soil near highways and houses. Hobbies involving soldering, stained ...

  16. Autoantibody stabilization of the classical pathway C3 convertase leading to C3 deficiency and Neisserial sepsis: C4 nephritic factor revisited

    PubMed Central

    Miller, Elizabeth C.; Chase, Nicole M.; Densen, Peter; Hintermeyer, Mary K.; Casper, James T.; Atkinson, John P.

    2012-01-01

    C3 deficiency is a rare disorder that leads to recurrent pyogenic infections. Here we describe a previously healthy 18 y/o Caucasian male with severe meningococcal disease. Total hemolytic activity was zero secondary to an undetectable C3. The C3 gene was normal by sequencing. Mixing the patient’s serum with normal human serum led to C3 consumption. An IgG autoantibody in the patient’s serum was identified that stabilized the classical pathway C3 and C5 convertases, thus preventing decay of these enzyme complexes. This autoantibody is an example of a C4 nephritic factor, with an additional feature of stabilizing the C5 convertase. Previous patients with C4 nephritic factor had membranoproliferative glomerulonephritis. Two years after presentation, this patient’s C3 remains undetectable with no evidence of renal disease. We revisit the role of autoantibodies to classical pathway convertases in disease, reviews the literature on C4-NeF and we comment on its detection in the clinical laboratory. PMID:23117396

  17. Effects of Cu(II) and cisplatin on the stability of Specific protein 1 (Sp1)-DNA binding: Insights into the regulation of copper homeostasis and platinum drug transport.

    PubMed

    Yan, Dong; Aiba, Isamu; Chen, Helen H W; Kuo, Macus Tien

    2016-08-01

    The human high-affinity copper transporter 1 (hCtr1) transports both Cu(I) and cisplatin (cDDP). Because Cu deficiency is lethal yet Cu overload is poisonous, hCtr1 expression is transcriptionally upregulated in response to Cu deficiency but is downregulated under Cu replete conditions in controlling Cu homeostasis. The up- and down-regulation of hCtr1 is regulated by Specific protein 1 (Sp1), which itself is also correspondingly regulated under these Cu conditions. hCtr1 expression is also upregulated by cDDP via upregulation of Sp1. The underlying mechanisms of these regulations are unknown. Using gel-electrophoretic mobility shift assays, we demonstrated here that Sp1-DNA binding affinity is reduced under Cu replete conditions but increased under reduced Cu conditions. Similarly, Sp1-DNA binding affinity is increased by cDDP treatment. This in vitro system demonstrated, for the first time, that regulation of Sp1/hCtr1 expression by these agents is modulated by the stability of Sp1-DNA binding, the first step in the Sp1-mediated transcriptional regulation process. PMID:27172866

  18. Lead Pencils

    NASA Technical Reports Server (NTRS)

    Gray, L. B.

    1971-01-01

    A study, undertaken to determine the lead content of paint on various pencils in the Goddard supply system, is reported. The survey found that lead content varied from .04 mg per pencil for carmine colored pencils to approximately 43 mg per pencil for yellow colored pencils. Results also show that yellow pencils had higher lead content than other colors analyzed. More detailed results are given in tabular form.

  19. Chronic Lead Exposure and Mixed Factors of Gender×Age×Brain Regions Interactions on Dendrite Growth, Spine Maturity and NDR Kinase

    PubMed Central

    Xue, Weizhen; Yang, Qian-Qian; Wang, Shuang; Xu, Yi; Wang, Hui-Li

    2015-01-01

    NDR1/2 kinase is essential in dendrite morphology and spine formation, which is regulated by cellular Ca2+. Lead (Pb) is a potent blocker of L-type calcium channel and our recent work showed Pb exposure impairs dendritic spine outgrowth in hippocampal neurons in rats. But the sensitivity of Pb-induced spine maturity with mixed factors (gender×age×brain regions) remains unknown. This study aimed to systematically investigate the effect of Pb exposure on spine maturity in rat brain with three factors (gender×age×brain regions), as well as the NDR1/2 kinase expression. Sprague–Dawley rats were exposed to Pb from parturition to postnatal day 30, 60, 90, respectively. Golgi-Cox staining was used to examine spine maturity. Western blot assay was applied to measure protein expression and real-time fluorescence quantitative PCR assay was used to examine mRNA levels. The results showed chronic Pb exposure significantly decreased dendritic length and impaired spine maturity in both rat hippocampus and medial prefrontal cortex. The impairment of dendritic length induced by Pb exposure tended to adolescence > adulthood, hippocampus > medial prefrontal cortex and female > male. Pb exposure induced significant damage in spine maturity during adolescence and early adult while little damage during adult in male rat brain and female medial prefrontal cortex. Besides, there was sustained impairment from adolescence to adulthood in female hippocampus. Interestingly, impairment of spine maturity followed by Pb exposure was correlated with NDR1/2 kinase. The reduction of NDR1/2 kinase protein expression after Pb exposure was similar to the result of spine maturity. In addition, NDR2 and their substrate Rabin3 mRNA levels were significantly decreased by Pb exposure in developmental rat brain. Taken together, Pb exposure impaired dendrite growth and maturity which was subject to gender×age×brain regions effects and related to NDR1/2 signal expression. PMID:26368815

  20. Microcystin-LR induces endoplasmatic reticulum stress and leads to induction of NFκB, interferon-alpha, and tumor necrosis factor-alpha.

    PubMed

    Christen, Verena; Meili, Nicole; Fent, Karl

    2013-04-01

    Microcystins (MCs) are hepatotoxins produced by cyanobacteria responsible for toxicity in humans and animals. Here, we investigate unexplored molecular pathways by which microcystin-LR (MC-LR) acts on hepatocytes to elucidate unknown modes of action. We focus on the endoplasmatic reticulum (ER) stress response or unfolded protein response (UPR), and on mechanisms that may contribute to the tumor-promoting effect of MCs in animals, including the activation of NFκB, the expression of interferon alpha (IFN-α) and the induction of interferon stimulated genes (ISGs), as well as the expression of tumor necrosis factor alpha (TNF-α). To this end, we exposed human hepatoma cells (Huh7) to 0.5 μM (nontoxic concentration), 5 μM (EC50 concentration), 25 μM and 50 μM (cytotoxic concentrations) MC-LR for 6, 24, 48, and 72 h. The expression of phosphatase 2A (PP2A) mRNA and protein was induced at 5 μM MC-LR. Phosphorylated P-CREB, a transcription factor for PP2A, leads to elevated expression of PP2A. Furthermore, all of the three ER stress pathways, the UPR and the endoplasmic reticulum-associated degradation were activated after exposure to 5, 25, and 50 μM MC-LR. Additionally, the expression of NFκB, IFN-α, and several INF-α-stimulated genes was strongly activated. The proinflammatory cytokine TNF-α was also induced. Our data demonstrate that MC-LR induces all ER stress response pathways. Consequently NFκB is activated, which in turn induces the expression of IFN-α and TNF-α. All of these activated pathways, which are analyzed here for the first time in detail, may contribute to the hepatotoxic, inflammatory, and tumorigenic action of MC-LR. PMID:23431999

  1. Development of a real-time PCR assay (SYBR Green I) for rapid identification and quantification of scyphomedusae Aurelia sp.1 planulae

    NASA Astrophysics Data System (ADS)

    Wang, Jianyan; Zhen, Yu; Mi, Tiezhu; Yu, Zhigang; Wang, Guoshan

    2015-07-01

    The complicated life cycle of Aurelia spp., comprising benthic asexually-reproducing polyps and sexually-reproducing medusae, makes it hard for researchers to identify and track them, especially for early stage individuals, such as planulae. To solve this problem, we developed a real-time PCR assay (SYBR Green I) to identify planulae in both cultured and natural seawater samples. Species-specific primers targeting Aurelia sp.1 mitochondrial 16S rDNA (mt 16S rDNA) regions were designed. Using a calibration curve constructed with plasmids containing the Aurelia sp.1 mt 16S rDNA fragment and a standard curve for planulae, the absolute number of mt 16S rDNA copies per planula was determined and from that the total number of planulae per sample was estimated. For the field samples, a 100-fold dilution of the sample DNA combined with a final concentration of 0.2 μg/μL BSA in the PCR reaction mixture was used to remove real-time PCR inhibitors. Samples collected in Jiaozhou Bay from July to September 2012 were subsequently analyzed using this assay. Peak Aurelia sp.1 planula abundance occurred in July 2012 at stations near Hongdao Island and Qingdao offshore; abundances were very low in August and September. The real-time PCR assay (SYBR Green I) developed here negates the need for traditional microscopic identification, which is laborious and time-consuming, and can detect and quantify jellyfish planulae in field plankton samples rapidly and specifically.

  2. Induction of p53-independent apoptosis by a novel synthetic hexahydrocannabinol analog is mediated via Sp1-dependent NSAID-activated gene-1 in colon cancer cells.

    PubMed

    Thapa, Dinesh; Babu, Dinesh; Park, Min-A; Kwak, Mi-Kyoung; Lee, Yong-Rok; Kim, Jeong Min; Kwon, Taeg Kyu; Kim, Jung-Ae

    2010-07-01

    Nonsteroidal anti-inflammatory drug (NSAID)-activated gene-1 (NAG-1) has received greater attention as a novel molecular target for anti-cancer therapeutics in recent years. We identified a novel synthetic hexahydrocannabinol analog, LYR-8 [(1-((9S)-1-hydroxy-6,6,9-trimethyl-6a,7,8,9,10,10a-hexahydro-6H-benzo[c]chromen-2-yl)ethanone)], as a potent NAG-1 and apoptosis inducer in a panel of human cancer cells. LYR-8 did not possess any affinity for cannabinoid receptor CB(1) or CB(2), which eliminates the concern about potential psychoactive side effects. LYR-8 dramatically induced NAG-1 expression and apoptosis in HCT116 (wild-type p53) and HT29 (mutant p53) colon cancer cells. The NAG-1 expression by LYR-8 was not blocked by pifithrin-alpha, a specific p53 inhibitor, which was different from doxorubicin that induced p53-dependent NAG-1 transcriptional activity. The induction of NAG-1 promoter activity by LYR-8 was strongly correlated with increased Sp1 activation as noted in various luc-promoter activities. Furthermore, pretreatment with the specific Sp1 inhibitor mithramycin A completely reversed the LYR-8-induced NAG-1 expression in both HCT116 and HT29 cells. Knockdown of NAG-1 using siRNA significantly reversed LYR-8-induced cell death in both wild-type and mutant p53-expressing colon cancer cells. Furthermore, sensitization with NAG-1 inducer sulindac sulfide synergized LYR-8-induced cell death in both colon cancer cells. These results suggest that induction of NAG-1 via Sp1 activation is a promising therapeutic approach in cancer treatment, and that a novel compound like LYR-8 could be a potent chemotherapeutic agent for colon cancers including p53-mutated cancer. PMID:20230799

  3. Leading Democratically

    ERIC Educational Resources Information Center

    Brookfield, Stephen

    2010-01-01

    Democracy is the most venerated of American ideas, the one for which wars are fought and people die. So most people would probably agree that leaders should be able to lead well in a democratic society. Yet, genuinely democratic leadership is a relative rarity. Leading democratically means viewing leadership as a function or process, rather than…

  4. LASIK surgery of granular corneal dystrophy type 2 patients leads to accumulation and differential proteolytic processing of transforming growth factor beta-induced protein (TGFBIp).

    PubMed

    Poulsen, Ebbe Toftgaard; Nielsen, Nadia Sukusu; Jensen, Morten M; Nielsen, Esben; Hjortdal, Jesper; Kim, Eung Kweon; Enghild, Jan J

    2016-02-01

    More than 60 mutations in transforming growth factor beta-induced protein (TGFBIp) have been reported in humans causing a variety of phenotypic protein aggregates in the cornea, commonly termed corneal dystrophies. One mutation, generating an arginine to histidine amino acid substitution at position 124 in mature TGFBIp leads to granular corneal dystrophy type 2 (GCD2). Homozygous GCD2 cases develop massive protein accumulation early in life whereas heterozygous GCD2 cases become affected much later and generally with a much less severe outcome. However, if heterozygous GCD2 patients undergo laser-assisted in situ keratomileusis (LASIK) surgery protein accumulation is accelerated and they develop massive protein accumulations a few years after surgery. Here, we present the protein profile of aggregate-containing corneal tissue from GCD2 patients with a history of LASIK surgery using LC-MS/MS. Label-free quantification of corneal extracellular matrix proteins showed accumulation of TGFBIp. This was supported by 2DE and immunoblotting against TGFBIp that revealed the accumulation of full-length TGFBIp. In addition, a high molecular weight TGFBIp complex was more apparent in GCD2 patients after LASIK surgery, which may be important for the disease progression. Lastly, 2DE also revealed differential processing between GCD2 patients with a history of LASIK surgery when compared to healthy individuals. PMID:26864644

  5. Glucosamine-induced Sp1 O-GlcNAcylation ameliorates hypoxia-induced SGLT dysfunction in primary cultured renal proximal tubule cells.

    PubMed

    Suh, Han Na; Lee, Yu Jin; Kim, Mi Ok; Ryu, Jung Min; Han, Ho Jae

    2014-10-01

    The aim of this study is to determine whether GlcN could recover the endoplasmic reticulum (ER) stress-induced dysfunction of Na(+) /glucose cotransporter (SGLT) in renal proximal tubule cells (PTCs) under hypoxia. With the rabbit model, the renal ischemia induced tubulointerstitial abnormalities and decreased SGLTs expression in tubular brush-border, which were recovered by GlcN. Thus, the protective mechanism of GlcN against renal ischemia was being examined by using PTCs. Hypoxia decreased the level of protein O-GlcNAc and the expression of O-GlcNAc transferase (OGT) while increased O-GlcNAcase (OGA) and these were reversed by GlcN. Hypoxia also decreased the expression of SGLTs (SGLT1 and 2) and [(14) C]-α-methyl-D-glucopyranoside (α-MG) uptake which were recovered by GlcN and PUGNAc (OGA inhibitor). Hypoxia enhanced reactive oxygen species (ROS) and then ER stress proteins, glucose-regulated protein 78 (GRP78), and C/EBP-homologous protein (CHOP). However, the expression of GRP78 increased till 6 h and then decreased whereas CHOP increased gradually. Moreover, decreased GRP78 and increased CHOP were reversed by NAC (antioxidant) and GlcN. GlcN ameliorated hypoxia-induced decrease of O-GlcNAc modification of Sp1 but OGT or Sp1 siRNAs blocked the recovery effect of GlcN on SGLT expression and α-MG uptake. In addition, hypoxia-decreased GRP78 and HIF-1α expression was reversed by GlcN but OGT siRNA or Sp1 siRNA ameliorated the effect of GlcN. When PTCs were transfected with GRP78 siRNA or HIF-1α siRNA, SGLT expression and α-MG uptake was decreased. Taken together, these data suggest that GlcN-induced O-GlcNAc modified Sp1 with stimulating GRP78 and HIF-1α activity ameliorate hypoxia-induced SGLT dysfunction in renal PTCs. J. Cell. Physiol. 229: 1557-1568, 2014. © 2014 Wiley Periodicals, Inc. PMID:24591095

  6. Estrogen receptor beta (ERβ) produces autophagy and necroptosis in human seminoma cell line through the binding of the Sp1 on the phosphatase and tensin homolog deleted from chromosome 10 (PTEN) promoter gene.

    PubMed

    Guido, Carmela; Panza, Salvatore; Santoro, Marta; Avena, Paola; Panno, Maria Luisa; Perrotta, Ida; Giordano, Francesca; Casaburi, Ivan; Catalano, Stefania; De Amicis, Francesca; Sotgia, Federica; Lisanti, Michael P; Andò, Sebastiano; Aquila, Saveria

    2012-08-01

    Testicular germ cell tumors are the most common tumor in male and the least studied. We focused on human seminoma using the TCAM2 cell line. Through ERβ, 10 nM estradiol (E2) was able to induce PTEN gene expression and promoter transactivation. Transient transfections, ChIP and EMSA assays evidenced the 5'-flanking region of PTEN gene promoter E2-responsive. The ERβ binding to the Sp1 on PTEN promoter decreased cell survival. The presence of ERβ or PTEN is necessary to induce the loss of cell survival upon E2, addressing their cooperation in this action. pAKT and AKT expression decreased under E2 and DPN, while known apoptotic markers appeared to be unchanged. The PI3K/AKT pathway inhibition also leads to autophagy: E2 and DPN enhanced the expression of autophagy-related markers such as PI3III, Beclin 1, AMBRA and UVRAG. MDC and TEM assays confirmed E2-induced autophagy. The absence of DNA fragmentation, caspase 9 and PARP1 cleavages suggested that necroptosis and/or parthanatos may occur. FACS analysis, LDH assay and RIP1 expression attested this hypothesis. Our study reveals a unique mechanism through which ERβ/PTEN signaling induces cell death in TCAM2 by autophagy and necroptosis. These data, supporting estrogen-dependency of human seminoma, propose ERβ ligands for therapeutic use in the treatment of this pathological condition. PMID:22810004

  7. Preferential binding of anti-cancer drug adriamycin to the Sp1 binding site in c-met promoter region: A spectroscopic and molecular modeling study

    NASA Astrophysics Data System (ADS)

    Singhal, Garima; Rajeswari, Moganty R.

    2009-02-01

    The c-met gene encodes a transmembrane glycoprotein receptor with tyrosine kinase activity and overexpression of MET receptor is found in a number of common human malignancies. Regulation of c-met oncogene expression in general can be controlled by several DNA binding anti-cancer drugs. Interaction of adriamycin with a short oligonucleotide (24RY), which is part of the positive regulatory element (-233 to -68) in c-met gene was studied using UV-Vis absorption and fluorescence spectroscopy, UV-thermal melting, and molecular modeling. Strong binding of adriamycin to 24RY (overall binding constant K, 1- 3 × 10 5 M -1) is thermodynamically favored and is accompanied by the following: a marked increase in the melting temperature of 24RY by +15 °C and ˜60% decrease in absorption at 480 nm, ˜80% quenching of fluorescence at 555 nm along with a blue shift of the λemimax to 522 nm of adriamycin. Present data reveals that adriamycin binds to ˜ 5 bp (GCGGG) of the Sp1 binding site in 24RY and thus competes with Sp1 binding to the promoter site which results in down-regulation of kinase. Therefore, targeting c-met is a promising approach as it is an attractive novel oncogene for cancer therapeutics.

  8. Molecular and functional characterization of the promoter region of the mouse LDH/C gene: enhancer-assisted, Sp1-mediated transcriptional activation.

    PubMed Central

    Yang, J; Thomas, K

    1997-01-01

    Molecular and functional studies of the LDH/C 5' upstream promoter elements were undertaken to elucidate the molecular mechanisms involved in temporal activation of LDH/C gene expression in differentiating germ cells. Ligation mediated-PCR (LM-PCR) gene walking techniques were exploited to isolate a 2.1 kb fragment of the mouse LDH/C 5' promoter region. DNA sequence analysis of this isolated genomic fragment indicated that the mouse LDH/C promoter contained TATA and CCAT boxes as well as a GC-box (Sp1-binding site) situated upstream from the transcription start site. PCR-based in vivo DNase I footprinting analysis of a 600 bp fragment of the proximal LDH/C promoter region (-524/+38) in isolated mouse pachytene spermatocytes identified a single footprint over the GC-box motif. Three DNase I hypersensitive sites were also detectable in vivo, in a region containing (CT)n(GA)n repeats upstream from the CCAT box domain. Functional characterization of the promoter region was carried out in a rat C6 glioma cell line and an SV40 transformed germ cell line (GC-1 spg) using wild-type and mutated LDH/C promoter CAT reporter constructs. These studies provide experimental evidence suggesting that transcriptional activation of the LDH/C promoter is regulated by enhancer-mediated coactivation of the Sp1 proteins bound to the GC-box motif footprinted in vivo in pachytene spermatocytes. PMID:9153323

  9. Interference with Activator Protein-2 transcription factors leads to induction of apoptosis and an increase in chemo- and radiation-sensitivity in breast cancer cells

    PubMed Central

    2010-01-01

    Background Activator Protein-2 (AP-2) transcription factors are critically involved in a variety of fundamental cellular processes such as proliferation, differentiation and apoptosis and have also been implicated in carcinogenesis. Expression of the family members AP-2α and AP-2γ is particularly well documented in malignancies of the female breast. Despite increasing evaluation of single AP-2 isoforms in mammary tumors the functional role of concerted expression of multiple AP-2 isoforms in breast cancer remains to be elucidated. AP-2 proteins can form homo- or heterodimers, and there is growing evidence that the net effect whether a cell will proliferate, undergo apoptosis or differentiate is partly dependent on the balance between different AP-2 isoforms. Methods We simultaneously interfered with all AP-2 isoforms expressed in ErbB-2-positive murine N202.1A breast cancer cells by conditionally over-expressing a dominant-negative AP-2 mutant. Results We show that interference with AP-2 protein function lead to reduced cell number, induced apoptosis and increased chemo- and radiation-sensitivity. Analysis of global gene expression changes upon interference with AP-2 proteins identified 139 modulated genes (90 up-regulated, 49 down-regulated) compared with control cells. Gene Ontology (GO) investigations for these genes revealed Cell Death and Cell Adhesion and Migration as the main functional categories including 25 and 12 genes, respectively. By using information obtained from Ingenuity Pathway Analysis Systems we were able to present proven or potential connections between AP-2 regulated genes involved in cell death and response to chemo- and radiation therapy, (i.e. Ctgf, Nrp1, Tnfaip3, Gsta3) and AP-2 and other main apoptosis players and to create a unique network. Conclusions Expression of AP-2 transcription factors in breast cancer cells supports proliferation and contributes to chemo- and radiation-resistance of tumor cells by impairing the ability to

  10. Nodularin induces tumor necrosis factor-alpha and mitogen-activated protein kinases (MAPK) and leads to induction of endoplasmic reticulum stress.

    PubMed

    Meili, Nicole; Christen, Verena; Fent, Karl

    2016-06-01

    Nodularin is produced by the cyanobacterium Nodularia spumigena. It is of concern due to hepatotoxicity in humans and animals. Here we investigated unexplored molecular mechanisms by transcription analysis in human liver cells, focusing on induction of pro-inflammatory cytokines, the tumor necrosis factor α (TNF-α), endoplasmic reticulum (ER) stress and components of the activator protein-1 complex in human hepatoma cells (Huh7) exposed to non-cytotoxic (0.1 and 1μM) and toxic concentrations (5μM) for 24, 48, and 72h. Transcripts of TNF-α and ER stress marker genes were strongly induced at 1 and 5μM at all time-points. TNF-α led to induction of mitogen-activated protein kinases (MAPK), as demonstrated by induction of CJUN and CFOS, which form the AP-1 complex. Human primary liver cells reacted more sensitive than Huh7 cells. They showed higher cytotoxicity and induction of TNF-α and ER stress at 2.5nM, while HepG2 cells were insensitive up to 10μM due to low expression of organic anion transporting polypeptides. Furthermore, nodularin led to induction of TNF-α protein, and CCAAT/enhancer-binding protein-homologous (CHOP) protein. Our data indicate that nodularin induces inflammation and ER stress and leads to activation of MAPK in liver cells. All of these activated pathways, which were analysed here for the first time in detail, may contribute to the hepatotoxic, and tumorigenic action of nodularin. PMID:27061667

  11. Loss of Hypoxia-Inducible Factor 2 Alpha in the Lung Alveolar Epithelium of Mice Leads to Enhanced Eosinophilic Inflammation in Cobalt-Induced Lung Injury

    PubMed Central

    Proper, Steven P.; Saini, Yogesh; LaPres, John J.

    2014-01-01

    Hard metal lung disease (HMLD) is an occupational lung disease specific to inhalation of cobalt-containing particles whose mechanism is largely unknown. Cobalt is a known hypoxia mimic and stabilizer of the alpha subunits of hypoxia-inducible factors (HIFs). Previous work revealed that though HIF1α contrib utes to cobalt toxicity in vitro, loss of HIF1α in the alveolar epithelial cells does not provide in vivo protection from cobalt-induced lung inflammation. HIF1α and HIF2α show unique tissue expression profiles, and HIF2α is known to be the predominant HIF mRNA isoform in the adult lung. Thus, if HIF2α activation by cobalt contributes to pathophysiology of HMLD, we hypothesized that loss of HIF2α in lung epithelium would provide protection from cobalt-induced inflammation. Mice with HIF2α-deficiency in Club and alveolar type II epithelial cells (ATIIs) (HIF2αΔ/Δ) were exposed to cobalt (60 µg/day) or saline using a subacute occupational exposure model. Bronchoalveolar lavage cellularity, cytokines, qRT-PCR, and histopathology were analyzed. Results show that loss of HIF2α leads to enhanced eosinophilic inflammation and increased goblet cell metaplasia. Additionally, control mice demonstrated a mild recovery from cobalt-induced lung injury compared with HIF2αΔ/Δ mice, suggesting a role for epithelial HIF2α in repair mechanisms. The expression of important cytokines, such as interleukin (IL)-5 and IL-10, displayed significant differences following cobalt exposure when HIF2αΔ/Δ and control mice were compared. In summary, our data suggest that although loss of HIF2α does not afford protection from cobalt-induced lung inflammation, epithelial HIF2α signaling does play an important role in modulating the inflammatory and repair response in the lung. PMID:24218148

  12. Iron deficiency leads to inhibition of oxygen transfer and enhanced formation of virulence factors in cultures of Pseudomonas aeruginosa PAO1.

    PubMed

    Kim, Eun-Jin; Sabra, Wael; Zeng, An-Ping

    2003-09-01

    Pseudomonas aeruginosa PAO1 was recently found to exhibit two remarkable physiological responses to oxidative stress: (1) a strong reduction in the efficiency of oxygen transfer from the gas phase into the liquid phase, thus causing oxygen limitation in the culture and (2) formation of a clear polysaccharide capsule on the cell surface. In this work, it has been shown that the iron concentration in the culture plays a crucial role in evoking these phenomena. The physiological responses of two P. aeruginosa PAO1 isolates (NCCB 2452 and ATCC 15692) were examined in growth media with varied iron concentrations. In a computer-controlled bioreactor cultivation system for controlled dissolved oxygen tension (pO2), a strong correlation between the exhaustion of iron and the onset of oxygen limitation was observed. The oxygen transfer rate of the culture, characterized by the volumetric oxygen transfer coefficient, kLa, significantly decreased under iron-limited conditions. The formation of alginate and capsule was more strongly affected by iron concentration than by oxygen concentration. The reduction of the oxygen transfer rate and the subsequent oxygen limitation triggered by iron deficiency may represent a new and efficient way for P. aeruginosa PAO1 to adapt to growth conditions of iron limitation. Furthermore, the secretion of proteins into the culture medium was strongly enhanced by iron limitation. The formation of the virulence factor elastase and the iron chelators pyoverdine and pyochelin also significantly increased under iron-limited conditions. These results have implications for lung infection of cystic fibrosis patients by P. aeruginosa in view of the prevalence of iron limitation at the site of infection and the respiratory failure leading to death. PMID:12949186

  13. Loss of hypoxia-inducible factor 2 alpha in the lung alveolar epithelium of mice leads to enhanced eosinophilic inflammation in cobalt-induced lung injury.

    PubMed

    Proper, Steven P; Saini, Yogesh; Greenwood, Krista K; Bramble, Lori A; Downing, Nathaniel J; Harkema, Jack R; Lapres, John J

    2014-02-01

    Hard metal lung disease (HMLD) is an occupational lung disease specific to inhalation of cobalt-containing particles whose mechanism is largely unknown. Cobalt is a known hypoxia mimic and stabilizer of the alpha subunits of hypoxia-inducible factors (HIFs). Previous work revealed that though HIF1α contrib utes to cobalt toxicity in vitro, loss of HIF1α in the alveolar epithelial cells does not provide in vivo protection from cobalt-induced lung inflammation. HIF1α and HIF2α show unique tissue expression profiles, and HIF2α is known to be the predominant HIF mRNA isoform in the adult lung. Thus, if HIF2α activation by cobalt contributes to pathophysiology of HMLD, we hypothesized that loss of HIF2α in lung epithelium would provide protection from cobalt-induced inflammation. Mice with HIF2α-deficiency in Club and alveolar type II epithelial cells (ATIIs) (HIF2α(Δ/Δ)) were exposed to cobalt (60 µg/day) or saline using a subacute occupational exposure model. Bronchoalveolar lavage cellularity, cytokines, qRT-PCR, and histopathology were analyzed. Results show that loss of HIF2α leads to enhanced eosinophilic inflammation and increased goblet cell metaplasia. Additionally, control mice demonstrated a mild recovery from cobalt-induced lung injury compared with HIF2α(Δ/Δ) mice, suggesting a role for epithelial HIF2α in repair mechanisms. The expression of important cytokines, such as interleukin (IL)-5 and IL-10, displayed significant differences following cobalt exposure when HIF2α(Δ/Δ) and control mice were compared. In summary, our data suggest that although loss of HIF2α does not afford protection from cobalt-induced lung inflammation, epithelial HIF2α signaling does play an important role in modulating the inflammatory and repair response in the lung. PMID:24218148

  14. Ecotoxicology: Lead

    USGS Publications Warehouse

    Scheuhammer, A.M.; Beyer, W.N.; Schmitt, C.J.

    2008-01-01

    Lead (Pb) is a naturally occurring metallic element; trace concentrations are found in all environmental media and in all living things. However, certain human activities, especially base metal mining and smelting; combustion of leaded gasoline; the use of Pb in hunting, target shooting, and recreational angling; the use of Pb-based paints; and the uncontrolled disposal of Pb-containing products such as old vehicle batteries and electronic devices have resulted in increased environmental levels of Pb, and have created risks for Pb exposure and toxicity in invertebrates, fish, and wildlife in some ecosystems.

  15. Tetraethyl lead

    Integrated Risk Information System (IRIS)

    Tetraethyl lead ; CASRN 78 - 00 - 2 Human health assessment information on a chemical substance is included in the IRIS database only after a comprehensive review of toxicity data , as outlined in the IRIS assessment development process . Sections I ( Health Hazard Assessments for Noncarcinogenic Ef

  16. Investigation of a novel molecular descriptor for the lead optimization of 4-aminoquinazolines as vascular endothelial growth factor receptor-2 inhibitors: application for quantitative structure-activity relationship analysis in lead optimization.

    PubMed

    Kawakami, Joel K; Martinez, Yannica; Sasaki, Brandi; Harris, Melissa; Kurata, Wendy E; Lau, Alan F

    2011-03-01

    We investigated the use of infrared vibrational frequency of ligands as a potential novel molecular descriptor in three different molecular target and chemical series. The vibrational energy of a ligand was approximated from the sum of infrared (IR) absorptions of each functional group within a molecule and normalized by its molecular weight (MDIR). Calculations were performed on a set of 4-aminoquinazolines with similar docking scores for the VEGFR2/KDR receptor. 4-Aminoquinazolines with MDIR values ranging 192-196 provided compounds with KDR inhibitory activity. The correlation of KDR inhibitory activity was similarly observed in a separate chemical series, the pyrazolo[1,5-a]pyrimidines. Initial exploration of this molecular descriptor supports a tool for rapid lead optimization in the 4-aminoquinazoline chemical series and a potential method for scaffold hopping in pursuit of new inhibitors. PMID:21306896

  17. Investigation of a novel molecular descriptor for the lead optimization of 4-aminoquinazolines as vascular endothelial growth factor receptor – 2 inhibitors: Application for quantitative structure activity relationship analysis in lead optimization

    PubMed Central

    Kawakami, Joel K.; Martinez, Yannica; Sasaki, Brandi; Harris, Melissa; Kurata, Wendy E.; Lau, Alan F.

    2013-01-01

    We investigated the use of infrared vibrational frequency of ligands as a potential novel molecular descriptor in three different molecular target and chemical series. The vibrational energy of a ligand was approximated from the sum of infrared (IR) absorptions of each functional group within a molecule and normalized by its molecular weight (MDIR). Calculations were performed on a set of 4-aminoquinazolines with similar docking scores for the VEGFR2/KDR receptor. 4-Aminoquinazolines with MDIR values ranging 192–196 provided compounds with KDR inhibitory activity. The correlation of KDR inhibitory activity was similarly observed in a separate chemical series, the pyrazolo[1,5-a]pyrimidines. Initial exploration of this molecular descriptor supports a tool for rapid lead optimization in the 4-aminoquinazoline chemical series and a potential method for scaffold hopping in pursuit of new inhibitors. PMID:21306896

  18. Human Immunodeficiency Virus Type 1 Resistance to the Small Molecule Maturation Inhibitor 3-O-(3′,3′-Dimethylsuccinyl)-Betulinic Acid Is Conferred by a Variety of Single Amino Acid Substitutions at the CA-SP1 Cleavage Site in Gag▿ †

    PubMed Central

    Zhou, Jing; Chen, Chin Ho; Aiken, Christopher

    2006-01-01

    The compound 3-O-(3′,3′-dimethylsuccinyl)-betulinic acid (DSB) potently and specifically inhibits human immunodeficiency virus type 1 (HIV-1) replication by delaying the cleavage of the CA-SP1 junction in Gag, leading to impaired maturation of the viral core. In this study, we investigated HIV-1 resistance to DSB by analyzing HIV-1 mutants encoding a variety of individual amino acid substitutions in the CA-SP1 cleavage site. Three of the substitutions were lethal to HIV-1 replication owing to a deleterious effect on particle assembly. The remaining mutants exhibited a range of replication efficiencies; however, each mutant was capable of replicating in the presence of concentrations of DSB that effectively inhibited wild-type HIV-1. Mutations conferring resistance to DSB also led to impaired binding of the compound to immature HIV-1 virions and loss of DSB-mediated inhibition of cleavage of Gag. Surprisingly, two of the DSB-resistant mutants retained an intermediate ability to bind the compound, suggesting that binding of DSB to immature HIV-1 particles may not be sufficient for antiviral activity. Overall, our results indicate that Gag amino acids L363 and A364 are critical for inhibition of HIV-1 replication by DSB and suggest that these residues form key contacts with the drug in the context of the assembling HIV-1 particle. These results have implications for the design of and screening for novel inhibitors of HIV-1 maturation. PMID:17035324

  19. The Genomic Context and Corecruitment of SP1 Affect ERRα Coactivation by PGC-1α in Muscle Cells.

    PubMed

    Salatino, Silvia; Kupr, Barbara; Baresic, Mario; van Nimwegen, Erik; Handschin, Christoph

    2016-07-01

    The peroxisome proliferator-activated receptor-γ coactivator 1α (PGC-1α) coordinates the transcriptional network response to promote an improved endurance capacity in skeletal muscle, eg, by coactivating the estrogen-related receptor-α (ERRα) in the regulation of oxidative substrate metabolism. Despite a close functional relationship, the interaction between these 2 proteins has not been studied on a genomic level. We now mapped the genome-wide binding of ERRα to DNA in a skeletal muscle cell line with elevated PGC-1α and linked the DNA recruitment to global PGC-1α target gene regulation. We found that, surprisingly, ERRα coactivation by PGC-1α is only observed in the minority of all PGC-1α recruitment sites. Nevertheless, a majority of PGC-1α target gene expression is dependent on ERRα. Intriguingly, the interaction between these 2 proteins is controlled by the genomic context of response elements, in particular the relative GC and CpG content, monomeric and dimeric repeat-binding site configuration for ERRα, and adjacent recruitment of the transcription factor specificity protein 1. These findings thus not only reveal a novel insight into the regulatory network underlying muscle cell plasticity but also strongly link the genomic context of DNA-response elements to control transcription factor-coregulator interactions. PMID:27182621

  20. Self-assembled semi-crystallinity at parallel β-sheet nanocrystal interfaces in clustered MaSp1 (spider silk) proteins.

    PubMed

    Sintya, Erly; Alam, Parvez

    2016-01-01

    In this communication, we use molecular dynamics methods to model the self-assembly of semi-crystalline domains at β-sheet nanocrystal interfaces in clusters of spider silk (MaSp1) proteins. Our research elucidates that the energetics at interfaces between crystalline and amorphous domains control effectively, the extent to which semi-crystalline domains can form at interfaces. Stability at nanocrystal interfaces is not linearly related to the internal (bulk) stability of the β-sheet nanocrystal. Rather, interfacial stability is found to be highly sensitive to the number of alanine repeat units that make up each sheet. Intriguingly, the most stable interface for the development of semi-crystallinity is built up of polyalanine β-sheets of a length similar to that which is spun naturally in spider dragline silk. PMID:26478322

  1. Serine proteases SP1 and SP13 mediate the melanization response of Asian corn borer, Ostrinia furnacalis, against entomopathogenic fungus Beauveria bassiana.

    PubMed

    Chu, Yuan; Liu, Yang; Shen, Dongxu; Hong, Fang; Wang, Guirong; An, Chunju

    2015-06-01

    Exposure to entomopathogenic fungi is one approach for insect pest control. Little is known about the immune interactions between fungus and its insect host. Melanization is a prominent immune response in insects in defending against pathogens such as bacteria and fungi. Clip domain serine proteases in insect plasma have been implicated in the activation of prophenoloxidase, a key enzyme in the melanization. The relationship between host melanization and the infection by a fungus needs to be established. We report here that the injection of entomopathogenic fungus Beauveria bassiana induced both melanin synthesis and phenoloxidase activity in its host insect, the Asian corn borer, Ostrinia furnacalis (Guenée). qRT-PCR analysis showed several distinct patterns of expression of 13 clip-domain serine proteases in response to the challenge of fungi, with seven increased, two decreased, and four unchanged. Of special interest among these clip-domain serine protease genes are SP1 and SP13, the orthologs of Manduca sexta HP6 and PAP1 which are involved in the prophenoloxidase activation pathway. Recombinant O. furnacalis SP1 was found to activate proSP13 and induce the phenoloxidase activity in corn borer plasma. Additionally, SP13 was determined to directly cleave prophenoloxidase and therefore act as the prophenoloxidase activating protease. Our work thus reveals a biochemical mechanism in the melanization in corn borer associated with the challenge by B. bassiana injection. These insights could provide valuable information for better understanding the immune responses of Asian corn borer against B. bassiana. PMID:25900291

  2. Sp1 and Sp3 Are the Transcription Activators of Human ek1 Promoter in TSA-Treated Human Colon Carcinoma Cells

    PubMed Central

    Kuan, Chee Sian; See Too, Wei Cun; Few, Ling Ling

    2016-01-01

    Background Ethanolamine kinase (EK) catalyzes the phosphorylation of ethanolamine, the first step in the CDP-ethanolamine pathway for the biosynthesis of phosphatidylethanolamine (PE). Human EK exists as EK1, EK2α and EK2β isoforms, encoded by two separate genes, named ek1 and ek2. EK activity is stimulated by carcinogens and oncogenes, suggesting the involvement of EK in carcinogenesis. Currently, little is known about EK transcriptional regulation by endogenous or exogenous signals, and the ek gene promoter has never been studied. Methodology/Principal Findings In this report, we mapped the important regulatory regions in the human ek1 promoter. 5’ deletion analysis and site-directed mutagenesis identified a Sp site at position (-40/-31) that was essential for the basal transcription of this gene. Treatment of HCT116 cells with trichostatin A (TSA), a histone deacetylase inhibitor, significantly upregulated the ek1 promoter activity through the Sp(-40/-31) site and increased the endogenous expression of ek1. Chromatin immunoprecipitation assay revealed that TSA increased the binding of Sp1, Sp3 and RNA polymerase II to the ek1 promoter in HCT116 cells. The effect of TSA on ek1 promoter activity was cell-line specific as TSA treatment did not affect ek1 promoter activity in HepG2 cells. Conclusion/Significance In conclusion, we showed that Sp1 and Sp3 are not only essential for the basal transcription of the ek1 gene, their accessibility to the target site on the ek1 promoter is regulated by histone protein modification in a cell line dependent manner. PMID:26807725

  3. Interactive Roles of Ets-1, Sp1, and Acetylated Histones in the Retinoic Acid-dependent Activation of Guanylyl Cyclase/Atrial Natriuretic Peptide Receptor-A Gene Transcription*

    PubMed Central

    Kumar, Prerna; Garg, Renu; Bolden, Gevoni; Pandey, Kailash N.

    2010-01-01

    Cardiac hormones atrial and brain natriuretic peptides activate guanylyl cyclase/natriuretic peptide receptor-A (GC-A/NPRA), which plays a critical role in reduction of blood pressure and blood volume. Currently, the mechanisms responsible for regulating the Npr1 gene (coding for GC-A/NPRA) transcription are not well understood. The present study was conducted to examine the interactive roles of all-trans retinoic acid (ATRA), Ets-1, Sp1, and histone acetylation on the transcriptional regulation and function of the Npr1 gene. Deletion analysis of the Npr1 promoter and luciferase assays showed that ATRA enhanced a 16-fold Npr1 promoter activity and greatly stimulated guanylyl cyclase (GC) activity of the receptor protein in both atrial natriuretic peptide (ANP)-dependent and -independent manner. As confirmed by gel shift and chromatin immunoprecipitation assays, ATRA enhanced the binding of both Ets-1 and Sp1 to the Npr1 promoter. The retinoic acid receptor α (RARα) was recruited by Ets-1 and Sp1 to form a transcriptional activator complex with their binding sites in the Npr1 promoter. Interestingly, ATRA also increased the acetylation of histones H3 and H4 and enhanced their recruitment to Ets-1 and Sp1 binding sites within the Npr1 promoter. Collectively, the present results demonstrate that ATRA regulates Npr1 gene transcription and GC activity of the receptor by involving the interactive actions of Ets-1, Sp1, and histone acetylation. PMID:20864529

  4. Protease Cleavage Leads to Formation of Mature Trimer Interface in HIV-1 Capsid

    PubMed Central

    Ke, Danxia; Ning, Jiying; DeLucia, Maria; Ahn, Jinwoo; Gronenborn, Angela M.; Aiken, Christopher; Zhang, Peijun

    2012-01-01

    During retrovirus particle maturation, the assembled Gag polyprotein is cleaved by the viral protease into matrix (MA), capsid (CA), and nucleocapsid (NC) proteins. To form the mature viral capsid, CA rearranges, resulting in a lattice composed of hexameric and pentameric CA units. Recent structural studies of assembled HIV-1 CA revealed several inter-subunit interfaces in the capsid lattice, including a three-fold interhexamer interface that is critical for proper capsid stability. Although a general architecture of immature particles has been provided by cryo-electron tomographic studies, the structural details of the immature particle and the maturation pathway remain unknown. Here, we used cryo-electron microscopy (cryoEM) to determine the structure of tubular assemblies of the HIV-1 CA-SP1-NC protein. Relative to the mature assembled CA structure, we observed a marked conformational difference in the position of the CA-CTD relative to the NTD in the CA-SP1-NC assembly, involving the flexible hinge connecting the two domains. This difference was verified via engineered disulfide crosslinking, revealing that inter-hexamer contacts, in particular those at the pseudo three-fold axis, are altered in the CA-SP1-NC assemblies compared to the CA assemblies. Results from crosslinking analyses of mature and immature HIV-1 particles containing the same Cys substitutions in the Gag protein are consistent with these findings. We further show that cleavage of preassembled CA-SP1-NC by HIV-1 protease in vitro leads to release of SP1 and NC without disassembly of the lattice. Collectively, our results indicate that the proteolytic cleavage of Gag leads to a structural reorganization of the polypeptide and creates the three-fold interhexamer interface, important for the formation of infectious HIV-1 particles. PMID:22927821

  5. Loss of BRCA1 leads to an increase in epidermal growth factor receptor expression in mammary epithelial cells, and epidermal growth factor receptor inhibition prevents estrogen receptor-negative cancers in BRCA1-mutant mice

    PubMed Central

    2011-01-01

    Introduction Women who carry a BRCA1 mutation typically develop "triple-negative" breast cancers (TNBC), defined by the absence of estrogen receptor (ER), progesterone receptor and Her2/neu. In contrast to ER-positive tumors, TNBCs frequently express high levels of epidermal growth factor receptor (EGFR). Previously, we found a disproportionate fraction of progenitor cells in BRCA1 mutation carriers with EGFR overexpression. Here we examine the role of EGFR in mammary epithelial cells (MECs) in the emergence of BRCA1-related tumors and as a potential target for the prevention of TNBC. Methods Cultures of MECs were used to examine EGFR protein levels and promoter activity in response to BRCA1 suppression with inhibitory RNA. EGFR was assessed by immunoblot and immunofluorescence analysis, real-time reverse transcriptase-polymerase chain reaction assay (RT-PCR) and flow cytometry. Binding of epidermal growth factor (EGF) to subpopulations of MECs was examined by Scatchard analysis. The responsiveness of MECs to the EGFR inhibitor erlotinib was assessed in vitro in three-dimensional cultures and in vivo. Mouse mammary tumor virus-Cre recombinase (MMTV-Cre) BRCA1flox/flox p53+/- mice were treated daily with erlotinib or vehicle control, and breast cancer-free survival was analyzed using the Kaplan-Meier method. Results Inhibition of BRCA1 in MECs led to upregulation of EGFR with an inverse correlation of BRCA1 with cellular EGFR protein levels (r2 = 0.87) and to an increase in cell surface-expressed EGFR. EGFR upregulation in response to BRCA1 suppression was mediated by transcriptional and posttranslational mechanisms. Aldehyde dehydrogenase 1 (ALDH1)-positive MECs expressed higher levels of EGFR than ALDH1-negative MECs and were expanded two- to threefold in the BRCA1-inhibited MEC population. All MECs were exquisitely sensitive to EGFR inhibition with erlotinib in vitro. EGFR inhibition in MMTV-Cre BRCA1flox/flox p53+/- female mice starting at age 3 months increased

  6. Transcription factor KLF11 integrates progesterone receptor signaling and proliferation in uterine leiomyoma cells.

    PubMed

    Yin, Ping; Lin, Zhihong; Reierstad, Scott; Wu, Ju; Ishikawa, Hiroshi; Marsh, Erica E; Innes, Joy; Cheng, Youhong; Pearson, Kerry; Coon, John Sayler; Kim, J Julie; Chakravarti, Debabrata; Bulun, Serdar E

    2010-02-15

    Uterine leiomyoma is the most common tumor of the female genital tract and the leading cause of hysterectomy. Although progesterone stimulates the proliferation of uterine leiomyoma cells, the mechanism of progesterone action is not well understood. We used chromatin immunoprecipitation (ChIP)-cloning approach to identify progesterone receptor (PR) target genes in primary uterine leiomyoma smooth muscle cells. We identified 18 novel PR-binding sites, one of which was located 20.5 kb upstream of the transcriptional start site of the Krüppel-like transcription factor 11 (KLF11) gene. KLF11 mRNA levels were minimally downregulated by progesterone but robustly upregulated by the progesterone antagonist RU486. Luciferase reporter assays showed significant baseline and RU486-inducible promoter activity in the KLF11 basal promoter or distal PR-binding region, both of which contained multiple Sp1-binding sequences but lacked classic progesterone response elements. RU486 stimulated recruitment of Sp1, RNA polymerase II, PR, and the coactivators SRC-1 and SRC-2 to the distal region and basal promoter. siRNA knockdown of PR increased KLF11 expression, whereas knockdown of KLF11 increased leiomyoma cell proliferation and abolished the antiproliferative effect of RU486. In vivo, KLF11 expression was significantly lower in leiomyoma tissues compared with adjacent myometrial tissues. Taken together, using a ChIP-cloning approach, we uncovered KLF11 as an integrator of PR signaling and proliferation in uterine leiomyoma cells. PMID:20124487

  7. Exterior surface dust lead, interior house dust lead and childhood lead exposure in an urban environment

    SciTech Connect

    Bornschein, R.L.; Succop, P.A.; Krafft, K.M.; Clark, C.S.; Peace, B.; Hammond, P.B.

    1986-01-01

    The impact of urban lead exposure is being examined in a prospective study of several hundred children followed from birth to five years of age. A wide range of social, behavioral, biological and environmental factors are being assessed at approximately one year intervals beginning at birth. Previous analyses on this cohort have indicated a strong relationship between hand lead and hand-to-mouth activity and suggests that this is an important mechanism of inadvertent ingestion of lead in infants and young children. The present analyses was undertaken to examine the joint influence of lead in exterior surface dust and interior lead-containing painted surfaces on lead levels in house dust. In addition the joint influence of exterior and interior surface dust lead on children's hand lead content and blood lead concentration was examined. At 18 months of age 38% of the observed variation in blood lead was accounted for by hand lead and dust lead. Interior paint lead and exterior surface dust lead accounted for 52% of the observed variation in interior surface dust lead concentration. Exterior surface dust lead, obtained from exterior surface scrapings, indirectly influenced blood lead through its impact on interior house dust lead and children's hand lead content, but had no observable direct impact on blood lead. 13 references, 4 figures, 3 tables.

  8. Leading for Engagement

    ERIC Educational Resources Information Center

    Yazzie-Mintz, Ethan

    2010-01-01

    As the dropout problem has grown--and as increasing numbers of students have started to see dropping out as a viable option for expressing their disaffection with school--practitioners, policymakers, and researchers have looked more closely at the factors that lead students to disengage from school and have attempted to find ways to create…

  9. CHICAGO BLOOD LEAD MAPPING PROJECT

    EPA Science Inventory

    Region 5's Office of Strategic Environmental Analysis (OSEA) undertook an effort to map blood lead data in the Chicago area and assess the associated risk factors that influence the elevated lead levels. The goal was to obtain individual blood lead results and map the data on th...

  10. Factors Leading to Membership in Professional Associations and Levels of Professional Commitment as Determined by Active and Inactive Members of Delta Pi Epsilon

    ERIC Educational Resources Information Center

    McCroskey, Stacey; O'Neil, Sharon Lund

    2010-01-01

    Purpose: This study was undertaken with grant funds provided by the Delta Pi Epsilon (DPE) Research Foundation, Inc., to assess the factors of professional commitment related to membership. Additionally, the respondents' perceptions about DPE affiliating with the National Business Education Association (NBEA) were investigated. Method: Of the…

  11. Dioscorea nipponica Attenuates Migration and Invasion by Inhibition of Urokinase-Type Plasminogen Activator through Involving PI3K/Akt and Transcriptional Inhibition of NF-[Formula: see text]B and SP-1 in Hepatocellular Carcinoma.

    PubMed

    Hsieh, Ming-Ju; Yeh, Chao-Bin; Chiou, Hui-Ling; Hsieh, Ming-Chang; Yang, Shun-Fa

    2016-01-01

    High mortality and morbidity rates for hepatocellular carcinoma (HCC) in Taiwan primarily result from uncontrolled tumor metastasis. In our previous studies, we have reported that Dioscorea nipponica Makino extract (DNE) has anti-metastasis effects on human oral cancer cells. However, the effect of DNE on hepatoma metastasis have not been thoroughly investigated and remains poorly understood. To determine the effects of DNE on the migration and invasion in HCC cells we used a wound healing model, Boyden chamber assays, gelatin/casein zymography and Western blotting. Transcriptional levels of matrix metalloproteinase-9 (MMP-9) and urokinase-type plasminogen activator (u-PA) were detected by real-time PCR and promoter assays. In this study, DNE treatment significantly inhibited the migration/invasion capacities of Huh7 cell lines. The results of gelatin/casein zymography and Western blotting revealed that the activities and protein levels of the MMP-9 and u-PA were inhibited by DNE. Tests of the mRNA levels, real-time PCR, and promoter assays evaluated the inhibitory effects of DNE on u-PA expression in human hepatoma cells. A chromatin immunoprecipitation (ChIP) assay showed not only that DNE inhibits u-PA expression, but also the inhibitory effects were associated with the down-regulation of the transcription factors of NF-[Formula: see text]B and SP-1 signaling pathways. Western blot analysis also showed that DNE inhibits PI3K and phosphorylation of Akt. In conclusion, these results show that u-PA expression may be a potent therapeutic target in the DNE-mediated suppression of HCC invasion/migration. DNE may have potential use as a chemo-preventive agent against liver cancer metastasis. PMID:26916922

  12. A study of the prevalence and risk factors leading to HIV infection among a sample of street children and youth of Kathmandu

    PubMed Central

    2012-01-01

    Background The true prevalence of HIV and other sexually transmitted diseases among street children in Nepal is virtually unknown while information on related behavioural risk factors in this population is non-existent. The risk of HIV infection among street children and adolescents may be especially high due to their marginalized social and economic conditions. This study was conducted to determine the prevalence of HIV infection among a sample of street children and youth of Kathmandu and to identify risk factors associated with HIV infection in this group. A sample of street children and youth was recruited based on the purposive sampling of ten streets in Kathmandu, Nepal, known to have a high density of street children and youth. A total of 251 street children (aged 11–16 years) and youth (aged 17–24 years) were enrolled, with informed consent, from November, 2008 through June, 2009. Most of the participants (95%) were male. Case status was determined by serological assessment of HIV status; data on risk factors were obtained using structured survey interviews. HIV prevalence and rates of a number of behavioural risk factors suspected to play a role in HIV transmission among street children and youth were determined, including unprotected sex, intravenous drug use, and other risky sex and substance use behaviours. Results Among the 251 children and youth, we found an overall HIV prevalence of 7.6%. As the sample size of females was small (n = 13) and the behavioural risk factors are likely to be quite different for boys and girls, we conducted separate analyses by gender. As our small sample of females is unlikely to be representative and lacks power for statistical testing, our report focuses on the results for the males surveyed.The strongest behavioural risk factor to emerge from this study was intravenous drug use; 30% of the male subjects were injecting drug users and 20% of those were HIV positive. Furthermore, frequency of drug injection was

  13. Lead toxicity: Current concerns

    SciTech Connect

    Goyer, R.A. )

    1993-04-01

    Over the 20-year period since the first issue of Environmental Health Perspectives was published, there has been considerable progress in the understanding of the potential toxicity of exposure to lead. Many of these advances have been reviewed in published symposia, conferences, and review papers in EHP. This brief review identifies major advances as well as a number of current concerns that present opportunities for prevention and intervention strategies. The major scientific advance has been the demonstration that blood lead (PbB) levels of 10-15 micrograms/dL in newborn and very young infants result in cognitive and behavioral deficits. Further support for this observation is being obtained by prospective or longitudinal studies presently in progress. The mechanism(s) for the central nervous system effects of lead is unclear but involve lead interactions within calcium-mediated intracellular messenger systems and neurotransmission. Effects of low-level lead exposure on blood pressure, particularly in adult men, may be related to the effect of lead on calcium-mediated control of vascular smooth muscle contraction and on the renin-angiotensin system. Reproductive effects of lead have long been suspected, but low-level effects have not been well studied. Whether lead is a carcinogen or its association with renal adenocarcinoma is a consequence of cystic nephropathy is uncertain. Major risk factors for lead toxicity in children in the United States include nutrition, particularly deficiencies of essential metals, calcium, iron, and zinc, and housing and socioeconomic status. A goal for the year 2000 is to reduce prevalence of blood lead levels exceeding 15 micrograms/dL. 97 refs.

  14. Silver Nanoparticles Induce Degradation of the Endoplasmic Reticulum Stress Sensor Activating Transcription Factor-6 Leading to Activation of the NLRP-3 Inflammasome

    PubMed Central

    Simard, Jean-Christophe; Vallieres, Francis; de Liz, Rafael; Lavastre, Valerie; Girard, Denis

    2015-01-01

    In the past decade, the increasing amount of nanoparticles (NP) and nanomaterials used in multiple applications led the scientific community to investigate the potential toxicity of NP. Many studies highlighted the cytotoxic effects of various NP, including titanium dioxide, zinc oxide, and silver nanoparticles (AgNP). In a few studies, endoplasmic reticulum (ER) stress was found to be associated with NP cytotoxicity leading to apoptosis in different cell types. In this study, we report for the first time that silver nanoparticles of 15 nm (AgNP15), depending on the concentration, induced different signature ER stress markers in human THP-1 monocytes leading to a rapid ER stress response with degradation of the ATF-6 sensor. Also, AgNP15 induced pyroptosis and activation of the NLRP-3 inflammasome as demonstrated by the processing and increased activity of caspase-1 and secretion of IL-1β and ASC (apoptosis-associated speck-like protein containing a CARD domain) pyroptosome formation. Transfection of THP-1 cells with siRNA targeting NLRP-3 decreased the AgNP15-induced IL-1β production. The absence of caspase-4 expression resulted in a significant reduction of pro-IL-1β. However, caspase-1 activity was significantly higher in caspase-4-deficient cells when compared with WT cells. Inhibition of AgNP15-induced ATF-6 degradation with Site-2 protease inhibitors completely blocked the effect of AgNP15 on pyroptosis and secretion of IL-1β, indicating that ATF-6 is crucial for the induction of this type of cell death. We conclude that AgNP15 induce degradation of the ER stress sensor ATF-6, leading to activation of the NLRP-3 inflammasome regulated by caspase-4 in human monocytes. PMID:25593314

  15. International perspectives of lead exposure and lead toxicity.

    PubMed

    Grandjean, P

    1993-01-01

    Three approaches have been used to examine how human body burdens of lead depend on different environments: (1) In paleopathologic studies, lead concentrations have been determined in well-preserved human bones or teeth, and pre-pollution samples generally show lead concentrations of about 1% of current levels in industrialized countries. (2) Geographic comparisons of blood-lead concentrations show low levels in, Nepal, Faroe Islands, and Sweden, while high levels occur in Mexico and Malta; average blood-lead levels may vary by a factor of 10 or more. (3) In analytical epidemiology, major exposure sources have been related to lead levels in blood, by either prospective or cross-sectional design. Increased blood-lead concentrations are related to smoking, drinking alcoholic beverages, eating vegetables for dinner, urban residence, and exposure from lead-using industries; average blood-lead values of subgroups within well-defined populations may vary by a factor of 3 or more. The dose-relationships for lead-induced neurotoxicity will depend on the sensitivity of the parameters chosen as indicators of lead exposure and of neurotoxicity. The temporal relationship between lead exposures and the development of deficits must be ascertained. Individual susceptibility and interacting factors must also be taken into account. Differences in addressing these issues impede the comparison between studies. Recently neonatal jaundice has been found to be a risk factor for subsequent neurobehavioral dysfunction in children with a birth weight above 2500 g, but only in children with increased lead exposure. Lead exposure may act in combination with several other factors and result in additive, or synergistic effects.(ABSTRACT TRUNCATED AT 250 WORDS) PMID:8247415

  16. EPAS1/HIF-2 alpha-mediated downregulation of tissue factor pathway inhibitor leads to a pro-thrombotic potential in endothelial cells.

    PubMed

    Stavik, Benedicte; Espada, Sandra; Cui, Xue Yan; Iversen, Nina; Holm, Sverre; Mowinkel, Marie-Christine; Halvorsen, Bente; Skretting, Grethe; Sandset, Per Morten

    2016-04-01

    Neovascularization and hemorrhaging are evident in advanced atherosclerotic plaques due to hypoxic conditions, and mediate the accumulation of metabolic substrates, inflammatory cells, lipids, and other blood born factors inside the plaque. Tissue factor (TF) pathway inhibitor (TFPI) is mainly expressed by endothelial cells and is the endogenous inhibitor of the coagulation activator TF, which together with the downstream product thrombin can drive plaque progression and atherogenesis. We aimed to investigate the effect of hypoxic conditions on endothelial cell expression and activity of TFPI and TF that are important in coagulation initiation. Hypoxia was induced in primary human umbilical vein endothelial cells using chemicals or 1% oxygen tension, and mRNA and protein expressions were measured using qRT-PCR, ELISA, and Western blot analysis. Microscopy of fluorescence-labeled cells was used to visualize cell-associated TFPI. Cell-surface factor Xa (FXa) activity was measured using a two-stage chromogenic substrate method. We found that hypoxia reduced the TFPI mRNA and protein levels and increased the TF mRNA expression in a dose-dependent manner. The effect on TFPI was apparent on all the protein pools of TFPI, i.e., secreted TFPI, cell-surface associated TFPI, and intracellular TFPI, and seemed to be dependent upon hypoxia inducible factor-2α (HIF-2α). An increase in FXa activity was also observed on the endothelial cell surface, reflecting an increase in pro-thrombotic potential of the cells. Our findings indicate that hypoxic conditions may enhance the pro-coagulant activity of endothelial cells, which may promote atherogenesis in addition to clinical events and thus the severity of atherosclerotic disorders. PMID:26826018

  17. Math achievement is important, but task values are critical, too: examining the intellectual and motivational factors leading to gender disparities in STEM careers.

    PubMed

    Wang, Ming-Te; Degol, Jessica; Ye, Feifei

    2015-01-01

    Although young women now obtain higher course grades in math than boys and are just as likely to be enrolled in advanced math courses in high school, females continue to be underrepresented in some Science, Technology, Engineering, and Mathematics (STEM) occupations. This study drew on expectancy-value theory to assess (1) which intellectual and motivational factors in high school predict gender differences in career choices and (2) whether students' motivational beliefs mediated the pathway of gender on STEM career via math achievement by using a national longitudinal sample in the United States. We found that math achievement in 12th grade mediated the association between gender and attainment of a STEM career by the early to mid-thirties. However, math achievement was not the only factor distinguishing gender differences in STEM occupations. Even though math achievement explained career differences between men and women, math task value partially explained the gender differences in STEM career attainment that were attributed to math achievement. The identification of potential factors of women's underrepresentation in STEM will enhance our ability to design intervention programs that are optimally tailored to female needs to impact STEM achievement and occupational choices. PMID:25741292

  18. Risk Factors for Fall-Related Injuries Leading to Hospitalization Among Community-Dwelling Older Persons: A Hospital-Based Case-Control Study in Thiruvananthapuram, Kerala, India.

    PubMed

    Ravindran, Rekha M; Kutty, V Raman

    2016-01-01

    This study intended to identify the risk factors for injurious falls that led to hospitalization of older persons living in the community. A hospital-based unmatched incident case-control study was done among 251 cases and 250 controls admitted at a tertiary care centre in Kerala. Mean age of cases was 71.6 ± 9.13 years and that of controls was 67.02 ± 6.17 years. Hip fractures were the predominant injury following falls. Falls were mostly a result of intrinsic causes. After adjusting for other variabes, the risk factors for all injuries were age above 70 years (odds ratio [OR] = 2.25; 95% confidence interval [CI] = 1.46-3.46), previous fall history (OR = 2.76; 95% CI = 1.08-7.08), impaired vision (OR = 4.49; 95% CI = 2.77-7.30), not living with spouse (OR = 1.97; 95% CI = 1.31-2.97), door thresholds (OR = 1.52; 95% CI = 1.01-2.29), and slippery floor (OR = 2.37; 95% CI = 1.31-4.32). The risk factors for hip fractures and other injuries were identified separately. Fall prevention strategies among older persons are warranted in Kerala. PMID:26463576

  19. Math achievement is important, but task values are critical, too: examining the intellectual and motivational factors leading to gender disparities in STEM careers

    PubMed Central

    Wang, Ming-Te; Degol, Jessica; Ye, Feifei

    2015-01-01

    Although young women now obtain higher course grades in math than boys and are just as likely to be enrolled in advanced math courses in high school, females continue to be underrepresented in some Science, Technology, Engineering, and Mathematics (STEM) occupations. This study drew on expectancy-value theory to assess (1) which intellectual and motivational factors in high school predict gender differences in career choices and (2) whether students’ motivational beliefs mediated the pathway of gender on STEM career via math achievement by using a national longitudinal sample in the United States. We found that math achievement in 12th grade mediated the association between gender and attainment of a STEM career by the early to mid-thirties. However, math achievement was not the only factor distinguishing gender differences in STEM occupations. Even though math achievement explained career differences between men and women, math task value partially explained the gender differences in STEM career attainment that were attributed to math achievement. The identification of potential factors of women’s underrepresentation in STEM will enhance our ability to design intervention programs that are optimally tailored to female needs to impact STEM achievement and occupational choices. PMID:25741292

  20. Clinical laboratory standard capillary protein electrophoresis alerted of a low C3 state and lead to the identification of a Factor I deficiency due to a novel homozygous mutation.

    PubMed

    Franco-Jarava, Clara; Colobran, Roger; Mestre-Torres, Jaume; Vargas, Victor; Pujol-Borrell, Ricardo; Hernández-González, Manuel

    2016-06-01

    Complement factor I (CFI) deficiency is typically associated to recurrent infections with encapsulated microorganisms and, less commonly, to autoimmunity. We report a 53-years old male who, in a routine control for non-alcoholic fatty liver disease, presented a flat beta-2 fraction at the capillary protein electropherogram. Patient's clinical records included multiple oropharyngeal infections since infancy and an episode of invasive meningococcal infection. Complement studies revealed reduced C3, low classical pathway activation and undetectable Factor I. CFI gene sequencing showed a novel inherited homozygous deletion of 5 nucleotides in exon 12, causing a frameshift leading to a truncated protein. This study points out that capillary protein electrophoresis can alert of possible states of low C3, which, once confirmed and common causes ruled out, can lead to CFI and other complement deficiency diagnosis. This is important since they constitute a still underestimated risk of invasive meningococcemia that can be greatly reduced by vaccination. PMID:27091480

  1. Terameprocol (tetra-O-methyl nordihydroguaiaretic acid), an inhibitor of Sp1-mediated survivin transcription, induces radiosensitization in non-small cell lung carcinoma

    PubMed Central

    Sun, Yunguang; Giacalone, Nicholas J.; Lu, Bo

    2010-01-01

    Introduction Survivin, an inhibitor of apoptosis protein (IAP) and key regulator of mitosis, is up-regulated in a variety of cancers and is often associated with a worse prognosis. Terameprocol down-regulates the Sp1-mediated transcription of survivin and Cdk1, which is important for cell cycle progression, as well as many other proteins. Survivin inhibition has previously been shown to result in the induction of apoptosis and radiosensitization. Methods This study examined the effects of terameprocol administration on survivin transcription and expression in HCC2429 and H460 lung cancer cells. We also examined the combined effects of radiation and terameprocol on apoptosis and radiosensitivity. Results Using immunoblot analysis and luciferase assays, we confirmed that terameprocol decreases survivin transcription and protein expression. Ultimately, however, decreases in survivin expression failed to correlate with an increase in apoptosis. Nonetheless, clonogenic assay revealed that terameprocol induces increased radiosensitization in HCC2429 (DER = 1.26, p = 0.019) and H460 (DER = 1.18, p = 0.001) cells. Additionally, the data show no effect of terameprocol on cell cycle in either HCC2429 or H460 cells. Conclusions Terameprocol significantly enhances the sensitivity of non-small cell lung carcinoma cell lines to radiation therapy, although the mechanism of action remains unclear. Further study is warranted to assess the potential of terameprocol as an agent that may enhance the therapeutic ratio of radiotherapy in lung cancer. PMID:21107289

  2. The New Face of the University of California: Undergraduate Admissions in the Aftermath of SP-1. [Background Information on the] Senate Select Committee on Higher Education Admissions and Outreach [and] Senate Select Committee on Higher Education (May 5, 1998).

    ERIC Educational Resources Information Center

    California State Legislature, Sacramento. Senate.

    This report provides background materials related to the California Senate Select Committee on Higher Education Admissions and Outreach and the California Senate Select Committee on Higher Education hearing on undergraduate admissions at the University of California (UC) and the Board of Regents' Special Proposal 1 (SP-1), which eliminated the use…

  3. t(15;21) translocations leading to the concurrent downregulation of RUNX1 and its transcription factor partner genes SIN3A and TCF12 in myeloid disorders.

    PubMed

    L'Abbate, Alberto; Tolomeo, Doron; De Astis, Francesca; Lonoce, Angelo; Lo Cunsolo, Crocifissa; Mühlematter, Dominique; Schoumans, Jacqueline; Vandenberghe, Peter; Van Hoof, Achilles; Palumbo, Orazio; Carella, Massimo; Mazza, Tommaso; Storlazzi, Clelia Tiziana

    2015-01-01

    Through a combined approach integrating RNA-Seq, SNP-array, FISH and PCR techniques, we identified two novel t(15;21) translocations leading to the inactivation of RUNX1 and its partners SIN3A and TCF12. One is a complex t(15;21)(q24;q22), with both breakpoints mapped at the nucleotide level, joining RUNX1 to SIN3A and UBL7-AS1 in a patient with myelodysplasia. The other is a recurrent t(15;21)(q21;q22), juxtaposing RUNX1 and TCF12, with an opposite transcriptional orientation, in three myeloid leukemia cases. Since our transcriptome analysis indicated a significant number of differentially expressed genes associated with both translocations, we speculate an important pathogenetic role for these alterations involving RUNX1. PMID:26671595

  4. miR-504 mediated down-regulation of nuclear respiratory factor 1 leads to radio-resistance in nasopharyngeal carcinoma

    PubMed Central

    Zhao, Luqing; Tang, Min; Hu, Zheyu; Yan, Bin; Pi, Weiwei; Li, Zhi; Zhang, Jing; Zhang, Liqin; Jiang, Wuzhong; Li, Guo; Qiu, Yuanzheng; Hu, Fang; Liu, Feng; Lu, Jingchen; Chen, Xue; Xiao, Lanbo; Xu, Zhijie; Tao, Yongguang; Yang, Lifang; Bode, Ann M.; Dong, Zigang; Zhou, Jian; Fan, Jia; Sun, Lunquan; Cao, Ya

    2015-01-01

    microRNAs (miRNAs) are involved in the various processes of DNA damage repair and play crucial roles in regulating response of tumors to radiation therapy. Here, we used nasopharyngeal carcinoma (NPC) radio-resistant cell lines as models and found that the expression of miR-504 was significantly up-regulated. In contrast, the expression of nuclear respiratory factor 1 (NRF1) and other mitochondrial metabolism factors, including mitochondrial transcription factor A (TFAM) and oxidative phosphorylation (OXPHOS) complex III were down-regulated in these cell lines. At the same time, the Seahorse cell mitochondrial stress test results indicated that the mitochondrial respiratory capacity was impaired in NPC radio-resistant cell lines and in a miR-504 over-expressing cell line. We also conducted dual luciferase reporter assays and verified that miR-504 could directly target NRF1. Additionally, miR-504 could down-regulate the expression of TFAM and OXPHOS complexes I, III, and IV and impaired the mitochondrial respiratory function of NPC cells. Furthermore, serum from NPC patients showed that miR-504 was up-regulated during different weeks of radiotherapy and correlated with tumor, lymph nodes and metastasis (TNM) stages and total tumor volume. The radio-therapeutic effect at three months after radiotherapy was evaluated. Results indicated that patients with high expression of miR-504 exhibited a relatively lower therapeutic effect ratio of complete response (CR), but a higher ratio of partial response (PR), compared to patients with low expression of miR-504. Taken together, these results demonstrated that miR-504 affected the radio-resistance of NPC by down-regulating the expression of NRF1 and disturbing mitochondrial respiratory function. Thus, miR-504 might become a promising biomarker of NPC radio-resistance and targeting miR-504 might improve tumor radiation response. PMID:26201446

  5. The over-expression of an Arabidopsis B3 transcription factor, ABS2/NGAL1, leads to the loss of flower petals.

    PubMed

    Shao, Jingxia; Liu, Xiayan; Wang, Rui; Zhang, Gaisheng; Yu, Fei

    2012-01-01

    Transcriptional regulations are involved in many aspects of plant development and are mainly achieved through the actions of transcription factors (TF). To investigate the mechanisms of plant development, we carried out genetic screens for mutants with abnormal shoot development. Taking an activation tagging approach, we isolated a gain-of-function mutant abs2-1D (abnormal shoot 2-1D). abs2-1D showed pleiotropic growth defects at both the vegetative and reproductive developmental stages. We cloned ABS2 and it encodes a RAV sub-family of plant B3 type of transcriptional factors. Phylogenetic analysis showed that ABS2 was closely related to NGATHA (NGA) genes that are involved in flower development and was previously named NGATHA-Like 1 (NGAL1). NGAL1 was expressed mainly in the root and the filament of the stamen in flower tissues and sub-cellular localization assay revealed that NGAL1 accumulated in the nucleus. Interestingly, over-expression of NGAL1 driven by the constitutive 35S promoter led to transgenic plants with conspicuous flower defects, particularly a loss-of-petal phenotype. A loss-of-function ngal1-1 mutant did not show obvious phenotype, suggesting the existence of redundant activities and also the utility of gain-of-function genetic screens. Our results show that the over-expression of NGAL1 is capable of altering flower petal development, as well as shoot development. PMID:23185464

  6. de novo Design and Synthesis of Candida antarctica Lipase B Gene and α-Factor Leads to High-Level Expression in Pichia pastoris

    PubMed Central

    Yang, Jiang-Ke; Liu, Li-Ying; Dai, Jiang-Hong; Li, Qin

    2013-01-01

    Candida antarctica lipase B (CALB) is one of the most widely used and studied enzymes in the world. In order to achieve the high-level expression of CALB in Pichia, we optimized the codons of CALB gene and α-factor by using a de novo design and synthesis strategy. Through comparative analysis of a series of recombinants with different expression components, we found that the methanol-inducible expression recombinant carrying the codon-optimized α-factor and mature CALB gene (pPIC9KαM-CalBM) has the highest lipase production capacity. After fermentation parameters optimization, the lipase activity and protein content of the recombinant pPIC9KαM-CalBM reached 6,100 U/mL and 3.0 g/L, respectively, in a 5-L fermentor. We believe this strategy could be of special interest due to its capacity to improve the expression level of target gene, and the Pichia transformants carrying the codon-optimized gene had great poten