Science.gov

Sample records for factor sp1 leads

  1. Co-operation of the transcription factor hepatocyte nuclear factor-4 with Sp1 or Sp3 leads to transcriptional activation of the human haem oxygenase-1 gene promoter in a hepatoma cell line.

    PubMed Central

    Takahashi, Shigeru; Matsuura, Naomi; Kurokawa, Takako; Takahashi, Yuji; Miura, Takashi

    2002-01-01

    We reported previously that the 5'-flanking region (nucleotides -1976 to -1655) of the human haem oxygenase-1 ( hHO-1 ) gene enhances hHO-1 promoter activity in human hepatoma HepG2 cells, but not in HeLa cells [Takahashi, Takahashi, Ito, Nagano, Shibahara and Miura (1999) Biochim. Biophys. Acta 1447, 231-235]. To define more precisely the regulatory elements involved, in the present study we have functionally dissected this region and localized the enhancer to a 50 bp fragment (-1793 to -1744). Site-direct mutagenesis analysis revealed that two regions were responsible for this enhancer activity, i.e. a hepatocyte nuclear factor-4 (HNF-4) homologous region and a GC box motif homologous region. Mutation in either region alone moderately decreased enhancer activity. However, mutations in both regions reduced promoter activity to the basal level. Electrophoretic mobility-shift assays demonstrated that the P5-2 fragment (-1793 to -1744) interacted with at least two nuclear factors, i.e. HNF-4 and Sp1/Sp3. Co-transfection experiments using Drosophila SL2 cells revealed that HNF-4 and Sp1/Sp3 synergistically stimulated the enhancer activity of the P5-2 fragment. These results indicate that co-operation of HNF-4 with Sp1 or Sp3 leads to the activation of hHO-1 gene expression in hepatoma cells. PMID:12133007

  2. Co-operation of the transcription factor hepatocyte nuclear factor-4 with Sp1 or Sp3 leads to transcriptional activation of the human haem oxygenase-1 gene promoter in a hepatoma cell line.

    PubMed

    Takahashi, Shigeru; Matsuura, Naomi; Kurokawa, Takako; Takahashi, Yuji; Miura, Takashi

    2002-11-01

    We reported previously that the 5'-flanking region (nucleotides -1976 to -1655) of the human haem oxygenase-1 ( hHO-1 ) gene enhances hHO-1 promoter activity in human hepatoma HepG2 cells, but not in HeLa cells [Takahashi, Takahashi, Ito, Nagano, Shibahara and Miura (1999) Biochim. Biophys. Acta 1447, 231-235]. To define more precisely the regulatory elements involved, in the present study we have functionally dissected this region and localized the enhancer to a 50 bp fragment (-1793 to -1744). Site-direct mutagenesis analysis revealed that two regions were responsible for this enhancer activity, i.e. a hepatocyte nuclear factor-4 (HNF-4) homologous region and a GC box motif homologous region. Mutation in either region alone moderately decreased enhancer activity. However, mutations in both regions reduced promoter activity to the basal level. Electrophoretic mobility-shift assays demonstrated that the P5-2 fragment (-1793 to -1744) interacted with at least two nuclear factors, i.e. HNF-4 and Sp1/Sp3. Co-transfection experiments using Drosophila SL2 cells revealed that HNF-4 and Sp1/Sp3 synergistically stimulated the enhancer activity of the P5-2 fragment. These results indicate that co-operation of HNF-4 with Sp1 or Sp3 leads to the activation of hHO-1 gene expression in hepatoma cells. PMID:12133007

  3. Interaction of Sp1 zinc finger with transport factor in the nuclear localization of transcription factor Sp1

    SciTech Connect

    Ito, Tatsuo; Kitamura, Haruka; Uwatoko, Chisana; Azumano, Makiko; Itoh, Kohji; Kuwahara, Jun

    2010-12-10

    Research highlights: {yields} Sp1 zinc fingers themselves interact with importin {alpha}. {yields} Sp1 zinc finger domains play an essential role as a nuclear localization signal. {yields} Sp1 can be transported into the nucleus in an importin-dependent manner. -- Abstract: Transcription factor Sp1 is localized in the nucleus and regulates the expression of many cellular genes, but the nuclear transport mechanism of Sp1 is not well understood. In this study, we revealed that GST-fused Sp1 protein bound to endogenous importin {alpha} in HeLa cells via the Sp1 zinc finger domains, which comprise the DNA binding domain of Sp1. It was found that the Sp1 zinc finger domains directly interacted with a wide range of importin {alpha} including the armadillo (arm) repeat domain and the C-terminal acidic domain. Furthermore, it turned out that all three zinc fingers of Sp1 are essential for binding to importin {alpha}. Taken together, these results suggest that the Sp1 zinc finger domains play an essential role as a NLS and Sp1 can be transported into the nucleus in an importin-dependent manner even though it possesses no classical NLSs.

  4. Role of zinc finger structure in nuclear localization of transcription factor Sp1

    SciTech Connect

    Ito, Tatsuo; Azumano, Makiko; Uwatoko, Chisana; Itoh, Kohji Kuwahara, Jun

    2009-02-27

    Transcription factor Sp1 is localized in the nucleus and regulates gene expression. Our previous study demonstrated that the carboxyl terminal region of Sp1 containing 3-zinc finger region as DNA binding domain can also serve as nuclear localization signal (NLS). However, the nuclear transport mechanism of Sp1 has not been well understood. In this study, we performed a gene expression study on mutant Sp1 genes causing a set of amino acid substitutions in zinc finger domains to elucidate nuclear import activity. Nuclear localization of the GFP-fused mutant Sp1 proteins bearing concomitant substitutions in the first and third zinc fingers was highly inhibited. These mutant Sp1 proteins had also lost the binding ability as to the GC box sequence. The results suggest that the overall tertiary structure formed by the three zinc fingers is essential for nuclear localization of Sp1 as well as dispersed basic amino acids within the zinc fingers region.

  5. Overexpression of the Transcription Factor Sp1 Activates the OAS-RNAse L-RIG-I Pathway

    PubMed Central

    Dupuis-Maurin, Valéryane; Brinza, Lilia; Baguet, Joël; Plantamura, Emilie; Schicklin, Stéphane; Chambion, Solène; Macari, Claire; Tomkowiak, Martine; Deniaud, Emmanuelle; Leverrier, Yann

    2015-01-01

    Deregulated expression of oncogenes or transcription factors such as specificity protein 1 (Sp1) is observed in many human cancers and plays a role in tumor maintenance. Paradoxically in untransformed cells, Sp1 overexpression induces late apoptosis but the early intrinsic response is poorly characterized. In the present work, we studied increased Sp1 level consequences in untransformed cells and showed that it turns on an early innate immune transcriptome. Sp1 overexpression does not activate known cellular stress pathways such as DNA damage response or endoplasmic reticulum stress, but induces the activation of the OAS-RNase L pathway and the generation of small self-RNAs, leading to the upregulation of genes of the antiviral RIG-I pathway at the transcriptional and translational levels. Finally, Sp1-induced intrinsic innate immune response leads to the production of the chemokine CXCL4 and to the recruitment of inflammatory cells in vitro and in vivo. Altogether our results showed that increased Sp1 level in untransformed cells constitutes a novel danger signal sensed by the OAS-RNase L axis leading to the activation of the RIG-I pathway. These results suggested that the OAS-RNase L-RIG-I pathway may be activated in sterile condition in absence of pathogen. PMID:25738304

  6. O-GlcNAc inhibits interaction between Sp1 and Elf-1 transcription factors

    SciTech Connect

    Lim, Kihong; Chang, Hyo-Ihl

    2009-03-13

    The novel protein modification, O-linked N-acetylglucosamine (O-GlcNAc), plays an important role in various aspects of cell regulation. Although most of nuclear transcription regulatory factors are modified by O-GlcNAc, O-GlcNAc effects on transcription remain largely undefined yet. In this study, we show that O-GlcNAc inhibits a physical interaction between Sp1 and Elf-1 transcription factors, and negatively regulates transcription of placenta and embryonic expression oncofetal protein gene (Pem). These findings suggest that O-GlcNAc inhibits Sp1-mediated gene transcription possibly by interrupting Sp1 interaction with its cooperative factor.

  7. Elevated SP-1 transcription factor expression and activity drives basal and hypoxia-induced vascular endothelial growth factor (VEGF) expression in non-small cell lung cancer.

    PubMed

    Deacon, Karl; Onion, David; Kumari, Rajendra; Watson, Susan A; Knox, Alan J

    2012-11-16

    VEGF plays a central role in angiogenesis in cancer. Non-small cell lung cancer (NSCLC) tumors have increased microvascular density, localized hypoxia, and high VEGF expression levels; however, there is a lack of understanding of how oncogenic and tumor microenvironment changes such as hypoxia lead to greater VEGF expression in lung and other cancers. We show that NSCLC cells secreted higher levels of VEGF than normal airway epithelial cells. Actinomycin D inhibited all NSCLC VEGF secretion, and VEGF minimal promoter-luciferase reporter constructs were constitutively active until the last 85 base pairs before the transcription start site containing three SP-1 transcription factor-binding sites; mutation of these VEGF promoter SP-1-binding sites eliminated VEGF promoter activity. Furthermore, dominant negative SP-1, mithramycin A, and SP-1 shRNA decreased VEGF promoter activity, whereas overexpression of SP-1 increased VEGF promoter activity. Chromatin immunoprecipitation assays demonstrated SP-1, p300, and PCA/F histone acetyltransferase binding and histone H4 hyperacetylation at the VEGF promoter in NSCLC cells. Cultured NSCLC cells expressed higher levels of SP-1 protein than normal airway epithelial cells, and double-fluorescence immunohistochemistry showed a strong correlation between SP-1 and VEGF in human NSCLC tumors. In addition, hypoxia-driven VEGF expression in NSCLC cells was SP-1-dependent, with hypoxia increasing SP-1 activity and binding to the VEGF promoter. These studies are the first to demonstrate that overexpression of SP-1 plays a central role in hypoxia-induced VEGF secretion. PMID:22992725

  8. Transcription factor Sp1 inhibition, memory, and cytokines in a mouse model of Alzheimer’s disease

    PubMed Central

    Citron, Bruce A; Saykally, Jessica N; Cao, Chuanhai; Dennis, John S; Runfeldt, Melissa; Arendash, Gary W

    2015-01-01

    Transcription factors are involved to varying extents in the health and survival of neurons in the brain and a better understanding of their roles with respect to the pathogenesis of Alzheimer’s disease (AD) could lead to the development of additional treatment strategies. Sp1 is a transcription factor that responds to inflammatory signals occurring in the AD brain. It is known to regulate genes with demonstrated importance in AD, and we have previously found it upregulated in the AD brain and in brains of transgenic AD model mice. To better understand the role of Sp1 in AD, we tested whether we could affect memory function (measured with a battery of behavioral tests discriminating different aspects of cognitive function) in a transgenic model of AD by pharmaceutical modulation of Sp1. We found that inhibition of Sp1 function in transgenic AD model mice increased memory deficits, while there were no changes in sensorimotor or anxiety tests. Aβ42 and Aβ40 peptide levels were significantly higher in the treated mice, indicating that Sp1 elevation in AD could be a functionally protective response. Circulating levels of CXCL1 (KC) decreased following treatment with mithramycin, while a battery of other cytokines, including IL-1α, IL-6, INF-γ and MCP-1, were unchanged. Gene expression levels for several genes important to neuronal health were determined by qRT-PCR, and none of these appeared to change at the transcriptional level. PMID:26807343

  9. Negative Regulation of DsbA-L Gene Expression by the Transcription Factor Sp1

    PubMed Central

    Fang, Qichen; Yang, Wenjing; Li, Huating; Hu, Wenxiu; Chen, Lihui; Jiang, Shan; Dong, Kun; Song, Qianqian; Wang, Chen; Chen, Shuo; Liu, Feng

    2014-01-01

    Disulfide-bond A oxidoreductase-like protein (DsbA-L) possesses beneficial effects such as promoting adiponectin multimerization and stability, increasing insulin sensitivity, and enhancing energy metabolism. The expression level of DsbA-L is negatively correlated with obesity in mice and humans, but the underlying mechanisms remain unknown. To address this question, we generated reporter gene constructs containing the promoter sequence of the mouse DsbA-L gene. Deletion analysis showed that the proximal promoter of mouse DsbA-L is located between −186 and −34 bp relative to the transcription start site. In silico analysis identified a putative Sp1 transcription factor binding site in the first intron of the DsbA-L gene. Electrophoretic mobility shift assay and chromatin immunoprecipitation analysis indicated that Sp1 bound to this intron region in vitro and in intact cells. Overexpression of Sp1 or suppressing Sp1 expression by siRNA reduced or increased DsbA-L promoter activity, respectively. The binding activity of Sp1 was gradually decreased during 3T3-L1 cell differentiation and was significantly increased in adipose tissues of obese mice. Our results identify Sp1 as an inhibitor of DsbA-L gene transcription, and the Sp1-mediated inhibition of DsbA-L gene expression may provide a mechanism underlying obesity-induced adiponectin downregulation and insulin resistance. PMID:25024375

  10. Sequence-independent induction of Sp1 transcription factor activity by phosphorothioate oligodeoxynucleotides.

    PubMed Central

    Perez, J R; Li, Y; Stein, C A; Majumder, S; van Oorschot, A; Narayanan, R

    1994-01-01

    Modified analogues of antisense oligodeoxynucleotides (ODNs), particularly phosphorothioates ([S]ODNs), have been extensively used to inhibit gene expression. The potential sequence specificity of antisense oligomers makes them attractive as molecular drugs for human diseases. The use of antisense [S]ODNs to inhibit gene expression has been complicated by frequent nonspecific effects. In this study we show in diverse cell types that [S]ODNs, independent of their base sequence, mediated the induction of an Sp1 nuclear transcription factor. The [S]ODN-mediated Sp1 induction was rapid and was associated with elevated levels of Sp1 protein. This induction was dependent on NF-kappa B activity, since inhibition of NF-kappa B activity abolished the [S]ODN-induced Sp1 activity. [S]ODN-induced Sp1 activity was seen in mouse spleen cells following in vivo administration. Sp1 activity induced by [S]ODNs required the tyrosine kinase pathway and did not have transactivating potential. These results may help to explain some of the non-specific effects often seen with [S]ODNs. Images PMID:8016096

  11. A non-canonical DNA structure is a binding motif for the transcription factor SP1 in vitro

    PubMed Central

    Raiber, Eun-Ang; Kranaster, Ramon; Lam, Enid; Nikan, Mehran; Balasubramanian, Shankar

    2012-01-01

    SP1 is a ubiquitous transcription factor that is involved in the regulation of various house-keeping genes. It is known that it acts by binding to a double-stranded consensus motif. Here, we have discovered that SP1 binds also to a non-canonical DNA structure, a G-quadruplex, with high affinity. In particular, we have studied the SP1 binding site within the promoter region of the c-KIT oncogene and found that this site can fold into an anti-parallel two-tetrad G-quadruplex. SP1 pull-down experiments from cellular extracts, together with biophysical binding assays revealed that SP1 has a comparable binding affinity for this G-quadruplex structure and the canonical SP1 duplex sequence. Using SP1 ChIP-on-chip data sets, we have also found that 87% of SP1 binding sites overlap with G-quadruplex forming sequences. Furthermore, while many of these immuoprecipitated sequences (36%) even lack the minimal SP1 consensus motif, 5′-GGGCGG-3′, we have shown that 77% of them are putative G-quadruplexes. Collectively, these data suggest that SP1 is able to bind both, canonical SP1 duplex DNA as well as G-quadruplex structures in vitro and we hypothesize that both types of interactions may occur in cells. PMID:22021377

  12. Transcription factors nuclear factor I and Sp1 interact with the murine collagen alpha 1 (I) promoter.

    PubMed Central

    Nehls, M C; Rippe, R A; Veloz, L; Brenner, D A

    1991-01-01

    The collagen alpha 1(I) promoter, which is efficiently transcribed in NIH 3T3 fibroblasts, contains four binding sites for trans-acting factors, as demonstrated by DNase I protection assays (D. A. Brenner, R. A. Rippe, and L. Veloz, Nucleic Acids Res. 17:6055-6064, 1989). This study characterizes the DNA-binding proteins that interact with the two proximal footprinted regions, both of which contain a reverse CCAAT box and a G + C-rich 12-bp direct repeat. Analysis by DNase I protection assays, mobility shift assays, competition with specific oligonucleotides, binding with recombinant proteins, and reactions with specific antisera showed that the transcriptional factors nuclear factor I (NF-I) and Sp1 bind to these two footprinted regions. Because of overlapping binding sites, NF-I binding and Sp1 binding appear to be mutually exclusive. Overexpression of NF-I in cotransfection experiments with the alpha 1(I) promoter in NIH 3T3 fibroblasts increased alpha 1(I) expression, while Sp1 overexpression reduced this effect, as well as basal promoter activity. The herpes simplex virus thymidine kinase promoter, which contains independent NF-I- and Sp1-binding sites, was stimulated by both factors. Therefore, expression of the collagen alpha 1(I) gene may depend on the relative activities of NF-I and Sp1. Images PMID:2072909

  13. Androgen up-regulates vascular endothelial growth factor expression in prostate cancer cells via an Sp1 binding site

    PubMed Central

    2013-01-01

    Background Vascular Endothelial Growth Factor (VEGF) is regulated by a number of different factors, but the mechanism(s) behind androgen-mediated regulation of VEGF in prostate cancer are poorly understood. Results Three novel androgen receptor (AR) binding sites were discovered in the VEGF promoter and in vivo binding of AR to these sites was demonstrated by chromatin immunoprecipitation. Mutation of these sites attenuated activation of the VEGF promoter by the androgen analog, R1881 in prostate cancer cells. The transcription factors AR and Sp1 were shown to form a nuclear complex and both bound the VEGF core promoter in chromatin of hormone treated CWR22Rv1 prostate cancer cells. The importance of the Sp1 binding site in hormone mediated activation of VEGF expression was demonstrated by site directed mutagenesis. Mutation of a critical Sp1 binding site (Sp1.4) in the VEGF core promoter region prevented activation by androgen. Similarly, suppression of Sp1 binding by Mithramycin A treatment significantly reduced VEGF expression. Conclusions Our mechanistic study of androgen mediated induction of VEGF expression in prostate cancer cells revealed for the first time that this induction is mediated through the core promoter region and is dependent upon a critical Sp1 binding site. The importance of Sp1 binding suggests that therapy targeting the AR-Sp1 complex may dampen VEGF induced angiogenesis and, thereby, block prostate cancer progression, helping to maintain the indolent form of prostate cancer. PMID:23369005

  14. MPTP's pathway of toxicity indicates central role of transcription factor SP1.

    PubMed

    Maertens, Alexandra; Luechtefeld, Thomas; Kleensang, Andre; Hartung, Thomas

    2015-05-01

    Deriving a Pathway of Toxicity from transcriptomic data remains a challenging task. We explore the use of weighted gene correlation network analysis (WGCNA) to extract an initial network from a small microarray study of MPTP toxicity in mice. Five modules were statistically significant; each module was analyzed for gene signatures in the Chemical and Genetic Perturbation subset of the Molecular Signatures Database as well as for over-represented transcription factor binding sites and WGCNA clustered probes by function and captured pathways relevant to neurodegenerative disorders. The resulting network was analyzed for transcription factor candidates, which were narrowed down via text-mining for relevance to the disease model, and then combined with the large-scale interaction FANTOM4 database to generate a genetic regulatory network. Modules were enriched for transcription factors relevant to Parkinson's disease. Transcription factors significantly improved the number of genes that could be connected in a given component. For each module, the transcription factor that had, by far, the highest number of interactions was SP1, and it also had substantial experimental evidence of interactions. This analysis both captures much of the known biology of MPTP toxicity and suggests several candidates for further study. Furthermore, the analysis strongly suggests that SP1 plays a central role in coordinating the cellular response to MPTP toxicity. PMID:25851821

  15. MPTP’s Pathway of Toxicity Indicates Central Role of Transcription Factor SP1

    PubMed Central

    Maertens, Alexandra; Luechtefeld, Thomas; Kleensang, Andre

    2015-01-01

    Deriving a Pathway of Toxicity from transcriptomic data remains a challenging task. We explore the use of weighted gene correlation network analysis (WGCNA) to extract an initial network from a small microarray study of MPTP toxicity in mice. Five modules were statistically significant; each module was analyzed for gene signatures in the Chemical and Genetic Perturbation subset of the Molecular Signatures Database as well as for over-represented transcription factor binding sites and WGCNA clustered probes by function and captured pathways relevant to neurodegenerative disorders. The resulting network was analyzed for transcription factor candidates, which were narrowed down via text-mining for relevance to the disease model, and then combined with the large-scale interaction FANTOM4 database to generate a genetic regulatory network. Modules were enriched for transcription factors relevant to Parkinson’s disease. Transcription factors significantly improved the number of genes that could be connected in a given component. For each module, the transcription factor that had, by far, the highest number of interactions was SP1, and it also had substantial experimental evidence of interactions. This analysis both captures much of the known biology of MPTP toxicity and suggests several candidates for further study. Furthermore, the analysis strongly suggests that SP1 plays a central role in coordinating the cellular response to MPTP toxicity. PMID:25851821

  16. Molecular Characterisation, Evolution and Expression of Hypoxia-Inducible Factor in Aurelia sp.1

    PubMed Central

    Wang, Guoshan; Yu, Zhigang; Zhen, Yu; Mi, Tiezhu; Shi, Yan; Wang, Jianyan; Wang, Minxiao; Sun, Song

    2014-01-01

    The maintenance of physiological oxygen homeostasis is mediated by hypoxia-inducible factor (HIF), a key transcriptional factor of the PHD-HIF system in all metazoans. However, the molecular evolutionary origin of this central physiological regulatory system is not well characterized. As the earliest eumetazoans, Cnidarians can be served as an interesting model for exploring the HIF system from an evolutionary perspective. We identified the complete cDNA sequence of HIF-1α (ASHIF) from the Aurelia sp.1, and the predicted HIF-1α protein (pASHIF) was comprised of 674 amino acids originating from 2,025 bp nucleotides. A Pairwise comparison revealed that pASHIF not only possessed conserved basic helix-loop-helix (bHLH) and Per-Arnt-Sim (PAS) domains but also contained the oxygen dependent degradation (ODD) and the C-terminal transactivation domains (C-TAD), the key domains for hypoxia regulation. As indicated by sequence analysis, the ASHIF gene contains 8 exons interrupted by 7 introns. Western blot analysis indicated that pASHIF that existed in the polyps and medusa of Aurelia. sp.1 was more stable for a hypoxic response than normoxia. PMID:24926666

  17. Role of Transglutaminase 2 in Liver Injury via Cross-linking and Silencing of Transcription Factor Sp1

    PubMed Central

    TATSUKAWA, HIDEKI; FUKAYA, YAYOI; FRAMPTON, GORDON; MARTINEZ–FUENTES, ANTONIO; SUZUKI, KENJI; KUO, TING–FANG; NAGATSUMA, KEISUKE; SHIMOKADO, KENTARO; OKUNO, MASATAKA; WU, JIAN; IISMAA, SIIRI; MATSUURA, TOMOKAZU; TSUKAMOTO, HIDEKAZU; ZERN, MARK A.; GRAHAM, ROBERT M.; KOJIMA, SOICHI

    2016-01-01

    Background & Aims Despite high morbidity and mortality of alcoholic liver disease worldwide, the molecular mechanisms underlying alcohol-induced liver cell death are not fully understood. Transglutaminase 2 (TG2) is a cross-linking enzyme implicated in apoptosis. TG2 levels and activity are increased in association with various types of liver injury. However, how TG2 induces hepatic apoptosis is not known. Methods Human hepatic cells or primary hepatocytes from rats or TG2+/+ and TG2−/− mice were treated with ethanol. Mice were administered anti-Fas antibody or alcohol. Liver sections were prepared from patients with alcoholic steatohepatitis. Changes in TG2 levels, Sp1 cross-linking and its activities, expression of hepatocyte growth factor receptor, c-Met, and hepatic apoptosis were measured. Results Ethanol induced apoptosis in hepatic cells, enhanced activity and nuclear accumulation of TG2 as well as accumulation of cross-linked and inactivated Sp1, and reduced expression of the Sp1-responsive gene, c-Met. These effects were rescued by TG2 knockdown, restoration of functional Sp1, or addition of hepatocyte growth factor, whereas apoptosis was reproduced by Sp1 knockdown or TG2 overexpression. Compared with TG2+/+ mice, TG2−/− mice showed markedly reduced hepatocyte apoptosis and Sp1 cross-linking following ethanol or anti-Fas treatment. Treatment of TG2+/+ mice with the TG2 inhibitors putrescine or cystamine blocked anti-Fas–induced hepatic apoptosis and Sp1 silencing. Moreover, enhanced expression of cross-linked Sp1 and TG2 was evident in hepatocyte nuclei of patients with alcoholic steatohepatitis. Conclusions TG2 induces hepatocyte apoptosis via Sp1 cross-linking and inactivation, with resultant inhibition of the expression of c-Met required for hepatic cell viability. PMID:19208340

  18. 5-Azacytidine treatment of HA-A melanoma cells induces Sp1 activity and concomitant transforming growth factor alpha expression.

    PubMed Central

    Shin, T H; Paterson, A J; Grant, J H; Meluch, A A; Kudlow, J E

    1992-01-01

    Evidence indicates DNA methylation as a part of the regulatory machinery controlling mammalian gene expression. The human melanoma cell line HA-A expresses low levels of transforming growth factor alpha (TGF-alpha). TGF-alpha mRNA accumulated, however, in response to DNA demethylation induced by a nucleoside analog, 5-azacytidine (5-azaC). The importance of DNA methylation in the TGF-alpha promoter region was examined by a transient transfection assay with luciferase reporter plasmids containing a portion of the TGF-alpha promoter. 5-azaC treatment of HA-A cells before the transfection caused a significant increase in the luciferase activity. Since input plasmids were confirmed to remain unmethylated, DNA demethylation of the TGF-alpha promoter itself does not account for the observed increase in TGF-alpha mRNA. Using an electrophoretic mobility shift assay, enhanced formation of protein-TGF-alpha promoter complex was detected in response to 5-azaC treatment. This 5-azaC-induced complex was shown to contain the transcription factor Sp1 by the following criteria: the protein-DNA complex formed on the TGF-alpha promoter contained immunoreactive Sp1; the mobility of the complex in an electrophoretic mobility shift assay was similar to that formed by recombinant Sp1; and DNase I footprinting analysis demonstrated that the 5-azaC-induced complex produced a footprint on the TGF-alpha promoter identical to that of authentic Sp1. These observations suggest that 5-azaC induces TGF-alpha expression by augmenting the Sp1 activity. However, neither the Sp1 mRNA nor its protein was induced by 5-azaC. These results suggest that in HA-A cells, TGF-alpha expression is down-modulated by DNA methylation. In addition, this process may involve the specific regulation of Sp1 activity without altering the amount of the transcription factor. Images PMID:1380648

  19. The oncoprotein HBXIP upregulates PDGFB via activating transcription factor Sp1 to promote the proliferation of breast cancer cells

    SciTech Connect

    Zhang, Yingyi; Zhao, Yu; Li, Leilei; Shen, Yu; Cai, Xiaoli; Zhang, Xiaodong; Ye, Lihong

    2013-05-03

    Highlights: •HBXIP is able to upregulate the expression of PDGFB in breast cancer cells. •HBXIP serves as a coactivator of activating transcription factor Sp1. •HBXIP stimulates the PDGFB promoter via activating transcription factor Sp1. •HBXIP promotes the proliferation of breast cancer cell via upregulating PDGFB. -- Abstract: We have reported that the oncoprotein hepatitis B virus X-interacting protein (HBXIP) acts as a novel transcriptional coactivator to promote proliferation and migration of breast cancer cells. Previously, we showed that HBXIP was able to activate nuclear factor-κB (NF-κB) in breast cancer cells. As an oncogene, the platelet-derived growth factor beta polypeptide (PDGFB) plays crucial roles in carcinogenesis. In the present study, we found that both HBXIP and PDGFB were highly expressed in breast cancer cell lines. Interestingly, HBXIP was able to increase transcriptional activity of NF-κB through PDGFB, suggesting that HBXIP is associated with PDGFB in the cells. Moreover, HBXIP was able to upregulate PDGFB at the levels of mRNA, protein and promoter in the cells. Then, we identified that HBXIP stimulated the promoter of PDGFB through activating transcription factor Sp1. In function, HBXIP enhanced the proliferation of breast cancer cells through PDGFB in vitro. Thus, we conclude that HBXIP upregulates PDGFB via activating transcription factor Sp1 to promote proliferation of breast cancer cells.

  20. Stimulation of ribosomal RNA gene promoter by transcription factor Sp1 involves active DNA demethylation by Gadd45-NER pathway.

    PubMed

    Rajput, Pallavi; Pandey, Vijaya; Kumar, Vijay

    2016-08-01

    The well-studied Pol II transcription factor Sp1 has not been investigated for its regulatory role in rDNA transcription. Here, we show that Sp1 bound to specific sites on rDNA and localized into the nucleoli during the G1 phase of cell cycle to activate rDNA transcription. It facilitated the recruitment of Pol I pre-initiation complex and impeded the binding of nucleolar remodeling complex (NoRC) to rDNA resulting in the formation of euchromatin active state. More importantly, Sp1 also orchestrated the site-specific binding of Gadd45a-nucleotide excision repair (NER) complex resulting in active demethylation and transcriptional activation of rDNA. Interestingly, knockdown of Sp1 impaired rDNA transcription due to reduced engagement of the Gadd45a-NER complex and hypermethylation of rDNA. Thus, the present study unveils a novel role of Sp1 in rDNA transcription involving promoter demethylation. PMID:27156884

  1. Triptolide-induced Cell Death in Pancreatic Cancer Is Mediated by O-GlcNAc Modification of Transcription Factor Sp1*

    PubMed Central

    Banerjee, Sulagna; Sangwan, Veena; McGinn, Olivia; Chugh, Rohit; Dudeja, Vikas; Vickers, Selwyn M.; Saluja, Ashok K.

    2013-01-01

    Pancreatic cancer, the fourth most prevalent cancer-related cause of death in the United States, is a disease with a dismal survival rate of 5% 5 years after diagnosis. One of the survival proteins responsible for its extraordinary ability to evade cell death is HSP70. A naturally derived compound, triptolide, and its water-soluble prodrug, Minnelide, down-regulate the expression of this protein in pancreatic cancer cells, thereby causing cell death. However, the mechanism of action of triptolide has not been elucidated. Our study shows that triptolide-induced down-regulation of HSP70 expression is associated with a decrease in glycosylation of the transcription factor Sp1. We further show that triptolide inhibits glycosylation of Sp1, inhibiting the hexosamine biosynthesis pathway, particularly the enzyme O-GlcNAc transferase. Inhibition of O-GlcNAc transferase prevents nuclear localization of Sp1 and affects its DNA binding activity. This in turn down-regulates prosurvival pathways like NF-κB, leading to inhibition of HSF1 and HSP70 and eventually to cell death. In this study, we evaluated the mechanism by which triptolide affects glycosylation of Sp1, which in turn affects downstream pathways controlling survival of pancreatic cancer cells. PMID:24129563

  2. Triptolide-induced cell death in pancreatic cancer is mediated by O-GlcNAc modification of transcription factor Sp1.

    PubMed

    Banerjee, Sulagna; Sangwan, Veena; McGinn, Olivia; Chugh, Rohit; Dudeja, Vikas; Vickers, Selwyn M; Saluja, Ashok K

    2013-11-22

    Pancreatic cancer, the fourth most prevalent cancer-related cause of death in the United States, is a disease with a dismal survival rate of 5% 5 years after diagnosis. One of the survival proteins responsible for its extraordinary ability to evade cell death is HSP70. A naturally derived compound, triptolide, and its water-soluble prodrug, Minnelide, down-regulate the expression of this protein in pancreatic cancer cells, thereby causing cell death. However, the mechanism of action of triptolide has not been elucidated. Our study shows that triptolide-induced down-regulation of HSP70 expression is associated with a decrease in glycosylation of the transcription factor Sp1. We further show that triptolide inhibits glycosylation of Sp1, inhibiting the hexosamine biosynthesis pathway, particularly the enzyme O-GlcNAc transferase. Inhibition of O-GlcNAc transferase prevents nuclear localization of Sp1 and affects its DNA binding activity. This in turn down-regulates prosurvival pathways like NF-κB, leading to inhibition of HSF1 and HSP70 and eventually to cell death. In this study, we evaluated the mechanism by which triptolide affects glycosylation of Sp1, which in turn affects downstream pathways controlling survival of pancreatic cancer cells. PMID:24129563

  3. Starvation after Cobalt-60 γ-Ray Radiation Enhances Metastasis in U251 Glioma Cells by Regulating the Transcription Factor SP1

    PubMed Central

    Zhao, Tuo; Wang, Hailong; Ma, Hong; Wang, Hao; Chen, Bo; Deng, Yulin

    2016-01-01

    Radiation is of clinical importance during glioma therapy; however, vasculature damage is observed over the treatment course. This type of tissue damage might lead to starvation conditions, affecting tumor metastasis. To test this possibility, we compared starvation conditions in conjunction with radiation treatment to monitor metastatic ability in the U251 glioma cell line. Transcriptome, western blot, and immunofluorescence analyses were used to measure the RNA and protein expression changes of the U251 cells after various treatments. We found that starvation combined with radiation treatment yielded the most significant expression changes in metastasis-related factors compared to that in the control groups. In addition, a metastasis assay was used to directly measure the metastatic ability of the treated cells, which confirmed that the U251 cells treated with starvation combined with radiation possessed the highest metastatic ability. Furthermore, bioinformatics analysis demonstrated that SP1 represented a common transcription factor associated with changes in metastasis-related factors. Blocking SP1 activity by an inhibitor suppressed the starvation-plus-radiation treatment-mediated enhancement of U251 cell metastasis. Our study provides the first evidence that starvation caused by radiation might play a significant role in enhancing the ability of the glioma cell line U251 to metastasize via regulation of the transcription factor SP1. PMID:27058528

  4. Differences in the expression of cathepsin B in B16 melanoma metastatic variants depend on transcription factor Sp1.

    PubMed

    Sitabkhan, Yasmin; Frankfater, Allen

    2007-09-01

    Cathepsin B contributes to the invasiveness of B16 melanoma cells in mice, with the highly metastatic B16a melanoma producing six- to eightfold more cathepsin B mRNA and protein than the less metastatic B16F1 variant. The proximal promoter region of the cathepsin B (Ctsb) gene (-149 to +94) was previously found to be capable of reproducing this pattern of differential gene activation in B16 melanoma variants. The binding of B16 melanoma nuclear proteins to this promoter region has now been mapped to three GC-boxes (Sp1 transcription factor binding sites) and a potential X-box [tax response element (TRE)/c-AMP responsive element (CRE) site]. Mutation of the GC-boxes at -55 and -37 independently decreased the expression of a luciferase reporter gene in B16a cells to the level observed in B16F1 cells. Promoter activity was also attenuated by mutations within the GC-rich segment between +6 and +16, but not by mutation of the putative X-box. Both Sp1 and Sp3 bound the GC-boxes in the Ctsb promoter, and western blotting showed the level of Sp1 to be greater in B16a compared to B16F1 cells. B16F1 cells that were made to express Sp1 at levels observed in B16a cells produced corresponding increased amounts of endogenous cathepsin B mRNA and enzyme activity. Thus, the difference in cathepsin B expression between high and low metastatic B16 melanoma variants is largely due to different levels of Sp1. PMID:17691867

  5. Transcription factors YY1, Sp1 and Sp3 modulate dystrophin Dp71 gene expression in hepatic cells.

    PubMed

    Peñuelas-Urquides, Katia; Becerril-Esquivel, Carolina; Mendoza-de-León, Laura C; Silva-Ramírez, Beatriz; Dávila-Velderrain, José; Cisneros, Bulmaro; de León, Mario Bermúdez

    2016-07-01

    Dystrophin Dp71, the smallest product encoded by the Duchenne muscular dystrophy gene, is ubiquitously expressed in all non-muscle cells. Although Dp71 is involved in various cellular processes, the mechanisms underlying its expression have been little studied. In hepatic cells, Dp71 expression is down-regulated by the xenobiotic β-naphthoflavone. However, the effectors of this regulation remain unknown. In the present study we aimed at identifying DNA elements and transcription factors involved in Dp71 expression in hepatic cells. Relevant DNA elements on the Dp71 promoter were identified by comparing Dp71 5'-end flanking regions between species. The functionality of these elements was demonstrated by site-directed mutagenesis. Using EMSAs and ChIP, we showed that the Sp1 (specificity protein 1), Sp3 (specificity protein 3) and YY1 (Yin and Yang 1) transcription factors bind to the Dp71 promoter region. Knockdown of Sp1, Sp3 and YY1 in hepatic cells increased endogenous Dp71 expression, but reduced Dp71 promoter activity. In summary, Dp71 expression in hepatic cells is carried out, in part, by YY1-, Sp1- and Sp3-mediated transcription from the Dp71 promoter. PMID:27143785

  6. Transcription factor Sp1 regulates T-type Ca(2+) channel CaV 3.1 gene expression.

    PubMed

    González-Ramírez, Ricardo; Martínez-Hernández, Elizabeth; Sandoval, Alejandro; Felix, Ricardo

    2014-05-01

    Voltage-gated T-type Ca(2+) (CaV 3) channels mediate a number of physiological events in developing and mature cells, and are implicated in neurological and cardiovascular diseases. In mammals, there are three distinct T-channel genes (CACNA1G, CACNA1H, and CACNA1I) encoding proteins (CaV 3.1-CaV 3.3) that differ in their localization as well as in molecular, biophysical, and pharmacological properties. The CACNA1G is a large gene that contains 38 exons and is localized in chromosome 17q22. Only basic characteristics of the CACNA1G gene promoter region have been investigated classifying it as a TATA-less sequence containing several potential transcription factor-binding motifs. Here, we cloned and characterized a proximal promoter region and initiated the analysis of transcription factors that control CaV 3.1 channel expression using the murine Cacna1g gene as a model. We isolated a ∼1.5 kb 5'-upstream region of Cacna1g and verified its transcriptional activity in the mouse neuroblastoma N1E-115 cell line. In silico analysis revealed that this region possesses a TATA-less minimal promoter that includes two potential transcription start sites and four binding sites for the transcription factor Sp1. The ability of one of these sites to interact with the transcription factor was confirmed by electrophoretic mobility shift assays. Consistent with this, Sp1 over-expression enhanced promoter activity while siRNA-mediated Sp1 silencing significantly decreased the level of CaV 3.1 protein and reduced the amplitude of whole-cell T-type Ca(2+) currents expressed in the N1E-115 cells. These results provide new insights into the molecular mechanisms that control CaV 3.1 channel expression. PMID:23868804

  7. DNA binding and regulatory effects of transcription factors SP1 and USF at the rat amyloid precursor protein gene promoter.

    PubMed Central

    Hoffman, P W; Chernak, J M

    1995-01-01

    Two DNA elements which we have termed SAA and GAG have been shown to control expression of the rat amyloid precursor protein (APP) gene, and the region containing the SAA element has been shown to interact with nuclear proteins [Hoffman and Chernak (1994) Biochem. Biophys. Res. Commun. 201, 610-617]. In this report we study DNA sequences and proteins which influence the activity of the SAA element. An oligonucleotide containing the SAA element is specifically bound by nuclear proteins derived from rat PC12 cells, consistently forming four complexes designated C25, C30, C35 and C40 in electrophoretic mobility shift assays (EMSAs). We demonstrate that the C25, C30 and C40 complexes involve the binding of nuclear proteins to an SP1 consensus sequence located within the SAA element and that the C25 complex contains a protein antigenically related to the human SP1 protein. We establish further that the C35 complex requires a USF recognition site located within the SAA element and contains a protein antigenically related to the human upstream stimulatory factor (USF) protein. Using APP promoter/luciferase reporter gene constructs, we demonstrate that both the SP1 and the USF sites can play a role in the transcriptional activity of the SAA element. Finally, we show that complexes similar to the C25, C30 and C35 complexes are formed by rat cortex nuclear extracts and the SAA element in EMSA experiments, suggesting the relevance of our in vitro observations to the in vivo functioning of the rat APP promoter. Images PMID:7610052

  8. Specificity protein (Sp) transcription factors Sp1, Sp3 and Sp4 are non-oncogene addiction genes in cancer cells

    PubMed Central

    Hedrick, Erik; Cheng, Yating; Jin, Un-Ho; Kim, Kyounghyun; Safe, Stephen

    2016-01-01

    Specificity protein (Sp) transcription factor (TF) Sp1 is overexpressed in multiple tumors and is a negative prognostic factor for patient survival. Sp1 and also Sp3 and Sp4 are highly expressed in cancer cells and in this study, we have used results of RNA interference (RNAi) to show that the three TFs individually play a role in the growth, survival and migration/invasion of breast, kidney, pancreatic, lung and colon cancer cell lines. Moreover, tumor growth in athymic nude mice bearing L3.6pL pancreatic cancer cells as xenografts were significantly decreased in cells depleted for Sp1, Sp3 and Sp4 (combined) or Sp1 alone. Ingenuity Pathway Analysis (IPA) of changes in gene expression in Panc1 pancreatic cancer cells after individual knockdown of Sp1, Sp3 and Sp4 demonstrates that these TFs regulate genes and pathways that correlated with the functional responses observed after knockdown but also some genes and pathways that inversely correlated with the functional responses. However, causal IPA analysis which integrates all pathway-dependent changes in all genes strongly predicted that Sp1-, Sp3- and Sp4-regulated genes were associated with the pro-oncogenic activity. These functional and genomic results coupled with overexpression of Sp transcription factors in tumor vs. non-tumor tissues and decreased Sp1 expression with age indicate that Sp1, Sp3 and Sp4 are non-oncogene addiction (NOA) genes and are attractive drug targets for individual and combined cancer chemotherapies. PMID:26967243

  9. O-GlcNAc Modification of Transcription Factor Sp1 Mediates Hyperglycemia-Induced VEGF-A Upregulation in Retinal Cells

    PubMed Central

    Donovan, Kelly; Alekseev, Oleg; Qi, Xin; Cho, William; Azizkhan-Clifford, Jane

    2014-01-01

    Purpose. Proangiogenic protein VEGF-A contributes significantly to retinal lesions and neovascularization in diabetic retinopathy (DR). In preclinical DR, hyperglycemia can upregulate VEGF-A in retinal cells. The VEGF-A promoter is responsive to the transcription factor specificity protein 1 (Sp1). The O-GlcNAc modification is driven by glucose concentration and has a profound effect on Sp1 activity. This study investigated the effects of hyperglycemia on Sp1-mediated expression of VEGF-A in the retinal endothelium and pigment epithelium. Methods. Hyperglycemia-exposed ARPE-19 (human retinal pigment epithelial cells) and TR-iBRB (rat retinal microendothelial cells) were assayed for levels of VEGF-A by qRT-PCR, Western blot, and ELISA. Small molecule inhibitors of O-GlcNAc transferase (OGT) or O-GlcNAcase (OGA) were used to manipulate O-GlcNAc levels. Vascular endothelial growth factor–A protein and transcript were measured in cells depleted of OGT or Sp1 by shRNA. The proximal VEGF-A promoter was analyzed for glucose sensitivity by luciferase assay. Chromatin immunoprecipitation (ChIP) was used to assess Sp1 occupancy on the VEGF-A promoter. Results. Hyperglycemia increased VEGF-A promoter activity and upregulated VEGF-A transcript and protein. Elevation of O-GlcNAc by OGA inhibitors was sufficient to increase VEGF-A. O-GlcNAc transferase inhibition abrogated glucose-driven VEGF-A. Cellular depletion of OGT or Sp1 by shRNA significantly abrogated glucose-induced changes in VEGF-A. ChIP analysis showed that hyperglycemia significantly increased binding of Sp1 to the VEGF-A promoter. Conclusions. Hyperglycemia-driven VEGF-A production is mediated by elevated O-GlcNAc modification of the Sp1 transcription factor. This mechanism may be significant in the pathogenesis of preclinical DR through VEGF-A upregulation. PMID:25352121

  10. Involvement of PKC{alpha} in insulin-induced PKC{delta} expression: Importance of SP-1 and NF{kappa}B transcription factors

    SciTech Connect

    Horovitz-Fried, Miriam; Sampson, Sanford R. . E-mail: sampsos@mail.biu.ac.il

    2007-01-05

    Protein kinase C delta (PKC{delta}) is a key molecule in insulin signaling essential for insulin-induced glucose transport in skeletal muscle. Recent studies in our laboratory have shown that insulin rapidly stimulates PKC{delta} activity and increases PKC{delta} protein and RNA levels, and that the SP-1 transcription factor is involved in insulin-induced transcription of the PKC{delta} gene. Activation of SP-1 involves serine phosphorylation and translocation to the nucleus. In this study we examined the possibility that PKC{alpha} might be involved in serine phosphorylation and activation of SP-1. We found that insulin rapidly phosphorylates and translocates SP-1. In the cytoplasm, SP-1 was constitutively associated with PKC{alpha}, and insulin stimulation caused these proteins to dissociate. In contrast, in the nucleus insulin induced an increase in association between PKC{alpha} and SP-1. PKC{alpha} inhibition blocked insulin-induced serine phosphorylation of SP-1 and its association with PKC{alpha} in the nucleus. Inhibition of PKC{alpha} also reduced the insulin-induced increase in PKC{delta} RNA and protein in the cytoplasmic and nuclear fractions. We also attempted to determine if another transcription factor might be involved in regulation of PKC{delta} expression. We earlier showed that insulin did not affect nuclear NF{kappa}B levels. Inhibition of NF{kappa}B, however, increased insulin-induced increase in PKC{delta} RNA and protein in the cytoplasmic and nuclear fractions. Surprisingly, this inhibition reduced the insulin-induced increase in cytoplasmic and nuclear PKC{alpha} RNA and protein. Inhibition of PKC{delta} reduced I{kappa}B{alpha} phosphorylation as well as NF{kappa}B activation. Thus, PKC{alpha} regulates insulin-induced PKC{delta} expression levels and this regulation involves activation of SP-1 and NF{kappa}B.

  11. NF-κB Activation Limits Airway Branching through Inhibition of Sp1-Mediated Fibroblast Growth Factor-10 Expression

    PubMed Central

    Benjamin, John T.; Carver, Billy J.; Plosa, Erin J.; Yamamoto, Yasutoshi; Miller, J. Davin; Liu, Jin-Hua; van der Meer, Riet; Blackwell, Timothy S.; Prince, Lawrence S.

    2015-01-01

    Bronchopulmonary dysplasia (BPD) is a frequent complication of preterm birth. This chronic lung disease results from arrested saccular airway development and is most common in infants exposed to inflammatory stimuli. In experimental models, inflammation inhibits expression of fibroblast growth factor-10 (FGF-10) and impairs epithelial–mesenchymal interactions during lung development; however, the mechanisms connecting inflammatory signaling with reduced growth factor expression are not yet understood. In this study we found that soluble inflammatory mediators present in tracheal fluid from preterm infants can prevent saccular airway branching. In addition, LPS treatment led to local production of mediators that inhibited airway branching and FGF-10 expression in LPS-resistant C.C3-Tlr4Lpsd/J fetal mouse lung explants. Both direct NF-κB activation and inflammatory cytokines (IL-1β and TNF-α) that activate NF-κB reduced FGF-10 expression, whereas chemokines that signal via other inflammatory pathways had no effect. Mutational analysis of the FGF-10 promoter failed to identify genetic elements required for direct NF-κB–mediated FGF-10 inhibition. Instead, NF-κB activation appeared to interfere with the normal stimulation of FGF-10 expression by Sp1. Chromatin immunoprecipitation and nuclear coimmunoprecipitation studies demonstrated that the RelA subunit of NF-κB and Sp1 physically interact at the FGF-10 promoter. These findings indicate that inflammatory signaling through NF-κB disrupts the normal expression of FGF-10 in fetal lung mesenchyme by interfering with the transcriptional machinery critical for lung morphogenesis. PMID:20861353

  12. Hepatitis C virus nonstructural protein-5A activates sterol regulatory element-binding protein-1c through transcription factor Sp1

    SciTech Connect

    Xiang, Zhonghua; Qiao, Ling; Zhou, Yan; Babiuk, Lorne A.; Liu, Qiang

    2010-11-19

    Research highlights: {yields} A chimeric subgenomic HCV replicon expresses HCV-3a NS5A in an HCV-1b backbone. {yields} HCV-3a NS5A increases mature SREBP-1c protein level. {yields} HCV-3a NS5A activates SREBP-1c transcription. {yields} Domain II of HCV-3a NS5A is more effective in SREBP-1c promoter activation. {yields} Transcription factor Sp1 is required for SREBP-1c activation by HCV-3a NS5A. -- Abstract: Steatosis is an important clinical manifestation of hepatitis C virus (HCV) infection. The molecular mechanisms of HCV-associated steatosis are not well understood. Sterol regulatory element-binding protein-1c (SREBP-1c) is a key transcription factor which activates the transcription of lipogenic genes. Here we showed that the nuclear, mature SREBP-1c level increases in the nucleus of replicon cells expressing HCV-3a nonstructural protein-5A (NS5A). We further showed that HCV-3a NS5A up-regulates SREBP-1c transcription. Additional analysis showed that transcriptional factor Sp1 is involved in SREBP-1c activation by HCV-3a NS5A because inhibition of Sp1 activity by mithramycin A or a dominant-negative Sp1 construct abrogated SREBP-1c promoter activation by HCV-3a NS5A. In addition, chromatin immunoprecipitation (ChIP) assay demonstrated enhanced binding of Sp1 on the SREBP-1c promoter in HCV-3a NS5A replicon cells. These results showed that HCV-3a NS5A activates SREBP-1c transcription through Sp1. Taken together, our results suggest that HCV-3a NS5A is a contributing factor for steatosis caused by HCV-3a infection.

  13. Sp1 Transcription Factor Interaction with Accumulated Prelamin A Impairs Adipose Lineage Differentiation in Human Mesenchymal Stem Cells: Essential Role of Sp1 in the Integrity of Lipid Vesicles

    PubMed Central

    Ruiz de Eguino, Garbiñe; Infante, Arantza; Schlangen, Karin; Aransay, Ana M.; Fullaondo, Ane; Soriano, Mario; García-Verdugo, José Manuel; Martín, Ángel G.

    2012-01-01

    Lamin A (LMNA)-linked lipodystrophies may be either genetic (associated with LMNA mutations) or acquired (associated with the use of human immunodeficiency virus protease inhibitors [PIs]), and in both cases they share clinical features such as anomalous distribution of body fat or generalized loss of adipose tissue, metabolic alterations, and early cardiovascular complications. Both LMNA-linked lipodystrophies are characterized by the accumulation of the lamin A precursor prelamin A. The pathological mechanism by which prelamin A accumulation induces the lipodystrophy associated phenotypes remains unclear. Since the affected tissues in these disorders are of mesenchymal origin, we have generated an LMNA-linked experimental model using human mesenchymal stem cells treated with a PI, which recapitulates the phenotypes observed in patient biopsies. This model has been demonstrated to be a useful tool to unravel the pathological mechanism of the LMNA-linked lipodystrophies, providing an ideal system to identify potential targets to generate new therapies for drug discovery screening. We report for the first time that impaired adipogenesis is a consequence of the interaction between accumulated prelamin A and Sp1 transcription factor, sequestration of which results in altered extracellular matrix gene expression. In fact, our study shows a novel, essential, and finely tuned role for Sp1 in adipose lineage differentiation in human mesenchymal stem cells. These findings define a new physiological experimental model to elucidate the pathological mechanisms LMNA-linked lipodystrophies, creating new opportunities for research and treatment not only of LMNA-linked lipodystrophies but also of other adipogenesis-associated metabolic diseases. PMID:23197810

  14. Sp1 and the ets-related transcription factor complex GABP alpha/beta functionally cooperate to activate the utrophin promoter.

    PubMed

    Gyrd-Hansen, Mads; Krag, Thomas O B; Rosmarin, Alan G; Khurana, Tejvir S

    2002-05-15

    Duchenne muscular dystrophy (DMD) is a fatal neuromuscular disease caused by the absence of dystrophin. Utrophin is the autosomal homolog of dystrophin and capable of compensating for the absence of dystrophin, when overexpressed. In skeletal muscle, utrophin plays an important role in the formation of neuromuscular junctions. This selective enrichment occurs, in part by transcriptional regulation of the utrophin gene at the sub-synaptic nuclei in muscle. Utrophin's complex transcriptional regulation is not yet fully understood, however, GABP alpha / beta has recently been shown to bind the N box and activate the utrophin promoter in response to heregulin. In this study, we show that the transcription factor Sp1 binds and activates the utrophin promoter in Drosophila S2 cells as well as define a Sp1 response element. We demonstrate that heregulin treatment of cultured muscle cells activates the ERK pathway and phosphorylates serine residue(s) in the consensus ERK recognition site of Sp1. Finally, Sp1 is shown to functionally cooperate with GABP alpha / beta and cause a 58-fold increase of de novo utrophin promoter transcription. Taken together, these findings help define mechanisms used for transcriptional regulation of utrophin expression as well as identify new targets for achieving potentially therapeutic upregulation of utrophin in DMD. PMID:11997063

  15. Transcription factor-pathway co-expression analysis reveals cooperation between SP1 and ESR1 on dysregulating cell cycle arrest in non-hyperdiploid multiple myeloma

    PubMed Central

    Wang, Xujun; Yan, Zhenyu; Fulciniti, Mariateresa; Li, Yingxiang; Gkotzamanidou, Maria; Amin, Samir B; Shah, Parantu K; Zhang, Yong

    2014-01-01

    Multiple myeloma is a hematological cancer of plasma B-cells and remains incurable. Two major subtypes of myeloma, hyperdiploid (HMM) and non-hyperdiploid myeloma (NHMM), have distinct chromosomal alterations and different survival outcomes. Transcription factors (TrFs) have been implicated in myeloma oncogenesis but their dysregulation in myeloma subtypes are less studied. Here we develop a TrF-pathway co-expression analysis to identify altered co-expression between two sample types. We apply the method to the two myeloma subtypes and the cell cycle arrest pathway, which is significantly differentially expressed between the two subtypes. We find that TrFs MYC, NF-κB and HOXA9 have significantly lower co-expression with cell cycle arrest in HMM, co-occurring with their over-activation in HMM. In contrast, TrFs ESR1, SP1 and E2F1 have significantly lower co-expression with cell cycle arrest in NHMM. SP1 ChIP targets are enriched by cell cycle arrest genes. These results motivate a cooperation model of ESR1 and SP1 in regulating cell cycle arrest, and a hypothesis that their over-activation in NHMM disrupts proper regulation of cell cycle arrest. Co-targeting ESR1 and SP1 shows a synergistic effect on inhibiting myeloma proliferation in NHMM cell lines. Therefore, studying TrF-pathway co-expression dysregulation in human cancers facilitates forming novel hypotheses towards clinical utility. PMID:23925045

  16. Transcriptional regulation of the human cystathionine beta-synthase -1b basal promoter: synergistic transactivation by transcription factors NF-Y and Sp1/Sp3.

    PubMed Central

    Ge, Y; Konrad, M A; Matherly, L H; Taub, J W

    2001-01-01

    Cystathionine beta-synthase (CBS) catalyses the condensation of serine and homocysteine to form cystathionine, an intermediate step in the synthesis of cysteine. Human CBS encodes five distinct 5' non-coding exons, the most frequent termed CBS -1a and CBS -1b, each transcribed from its own unique GC-rich TATA-less promoter. The minimal transcriptional region (-3792 to -3667) of the CBS -1b promoter was defined by 5'- and 3'-deletions, and transient transfections of reporter gene constructs in HepG2 cells, characterized by CBS transcription exclusively from the -1b promoter. Included in this 125 bp region are 3 GC-boxes (termed GC-a, GC-b and GC-c), an inverted CAAT-box and an E-box. By gel-shift and supershift assays, binding of specificity protein (Sp)1 and Sp3 to the GC-box elements, upstream stimulatory factor 1 (USF-1) to the E-box, and both nuclear factor (NF)-Y and an NF-1-like factor to the CAAT box could be demonstrated. By transient trans fections and reporter gene assays in HepG2 and Drosophila SL2 cells, a functional interplay was indicated between NF-Y binding to the CAAT-box, or between USF-1 binding to the E-box, and Sp1/Sp3 binding to the GC-box elements. In SL2 cells, NF-Y and Sp1/Sp3 were synergistic. Furthermore, both Sp1 and the long Sp3 isoform transactivated the CBS -1b minimal promoter; however, the short Sp3 isoforms were potent repressors. These results may explain the cell- or tissue-specific regulation of CBS transcription, and clarify the bases for alterations in CBS gene expression in human disease and Down's syndrome. PMID:11415440

  17. Arsenic trioxide-mediated growth inhibition in gallbladder carcinoma cells via down-regulation of Cyclin D1 transcription mediated by Sp1 transcription factor

    SciTech Connect

    Ai, Zhilong; Lu, Weiqi; Ton, Saixiong; Liu, Houbao; Sou, Tao; Shen, Zhenbin; Qin, Xinyu . E-mail: smc_jjh@yahoo.com.cn

    2007-08-31

    Gallbladder carcinoma (GBC), an aggressive and mostly lethal malignancy, is known to be resistant to a number of drug stimuli. Here, we demonstrated that arsenic trioxide inhibited the proliferation of gallbladder carcinoma in vivo and in vitro as well as the transcription of cell cycle-related protein Cyclin D1. And, Cyclin D1 overexpression inhibited the negative role of arsenic trioxide in cell cycle progression. We further explored the mechanisms by which arsenic trioxide affected Cyclin D1 transcription and found that the Sp1 transcription factor was down-regulated by arsenic trioxide, with a corresponding decrease in Cyclin D1 promoter activity. Taken together, these results suggested that arsenic trioxide inhibited gallbladder carcinoma cell proliferation via down-regulation of Cyclin D1 transcription in a Sp1-dependent manner, which provided a new mechanism of arsenic trioxide-involved cell proliferation and may have important therapeutic implications in gallbladder carcinoma patients.

  18. Brg-1 mediates the constitutive and fenretinide-induced expression of SPARC in mammary carcinoma cells via its interaction with transcription factor Sp1

    PubMed Central

    2010-01-01

    Background Secreted protein, acidic and rich in cysteine (SPARC) is a matricellular protein that mediates cell-matrix interactions. It has been shown, depending on the type of cancer, to possess either pro- or anti-tumorigenic properties. The transcriptional regulation of the SPARC gene expression has not been fully elucidated and the effects of anti-cancer drugs on this process have not been explored. Results In the present study, we demonstrated that chromatin remodeling factor Brg-1 is recruited to the proximal SPARC promoter region (-130/-56) through an interaction with transcription factor Sp1. We identified Brg-1 as a critical regulator for the constitutive expression levels of SPARC mRNA and protein in mammary carcinoma cell lines and for SPARC secretion into culture media. Furthermore, we found that Brg-1 cooperates with Sp1 to enhance SPARC promoter activity. Interestingly, fenretinide [N-4(hydroxyphenyl) retinamide, 4-HPR], a synthetic retinoid with anti-cancer properties, was found to up-regulate the transcription, expression and secretion of SPARC via induction of the Brg-1 in a dose-dependent manner. Finally, our results demonstrated that fenretinide-induced expression of SPARC contributes significantly to a decreased invasion of mammary carcinoma cells. Conclusions Overall, our results reveal a novel cooperative role of Brg-1 and Sp1 in mediating the constitutive and fenretinide-induced expression of SPARC, and provide new insights for the understanding of the anti-cancer effects of fenretinide. PMID:20687958

  19. Transcription Factors Sp1 and p73 Control the Expression of the Proapoptotic Protein NOXA in the Response of Testicular Embryonal Carcinoma Cells to Cisplatin*

    PubMed Central

    Grande, Lara; Bretones, Gabriel; Rosa-Garrido, Manuel; Garrido-Martin, Eva M.; Hernandez, Teresa; Fraile, Susana; Botella, Luisa; de Alava, Enrique; Vidal, August; Garcia del Muro, Xavier; Villanueva, Alberto; Delgado, M. Dolores; Fernandez-Luna, Jose L.

    2012-01-01

    Testicular germ cell tumors (TGCTs) are highly responsive to and curable by cisplatin-based chemotherapy even in advanced stages. We have studied the molecular mechanisms involved in the induction of apoptosis in response to cisplatin, and found that proapoptotic Noxa is transcriptionally up-regulated following cisplatin exposure, even in the absence of p53, in NTERA2 cisplatin-sensitive cells but not in 1411HP-resistant cells. Blockade of Noxa reduced the apoptotic response of embryonal carcinoma (EC) NTERA2 cells to cisplatin. A detailed analysis of the Noxa promoter revealed that p73 and Sp1-like factors, Sp1 and KLF6, played key roles in the transcriptional control of this gene. Overexpression of TAp73 induced Noxa whereas the dominant negative isoform ΔNp73, reduced the levels of Noxa after cisplatin exposure in NTERA2 and 2102EP. Interestingly, down-regulation of Sp1 increased Noxa expression in response to cisplatin. However, blockade of KLF6 decreased cisplatin-induced up-regulation of Noxa in EC cell lines. In addition, tissue microarray analyses of TGCTs revealed that expression of Noxa correlates with good clinical prognosis in patients with embryonal carcinoma. Thus, our data show the transcriptional network that regulates Noxa in EC cells, which is key for their apoptotic response to cisplatin-based chemotherapy, and propose Noxa as a predictive factor of therapeutic response. PMID:22718761

  20. Transcription factors Sp1 and p73 control the expression of the proapoptotic protein NOXA in the response of testicular embryonal carcinoma cells to cisplatin.

    PubMed

    Grande, Lara; Bretones, Gabriel; Rosa-Garrido, Manuel; Garrido-Martin, Eva M; Hernandez, Teresa; Fraile, Susana; Botella, Luisa; de Alava, Enrique; Vidal, August; Garcia del Muro, Xavier; Villanueva, Alberto; Delgado, M Dolores; Fernandez-Luna, Jose L

    2012-08-01

    Testicular germ cell tumors (TGCTs) are highly responsive to and curable by cisplatin-based chemotherapy even in advanced stages. We have studied the molecular mechanisms involved in the induction of apoptosis in response to cisplatin, and found that proapoptotic Noxa is transcriptionally up-regulated following cisplatin exposure, even in the absence of p53, in NTERA2 cisplatin-sensitive cells but not in 1411HP-resistant cells. Blockade of Noxa reduced the apoptotic response of embryonal carcinoma (EC) NTERA2 cells to cisplatin. A detailed analysis of the Noxa promoter revealed that p73 and Sp1-like factors, Sp1 and KLF6, played key roles in the transcriptional control of this gene. Overexpression of TAp73 induced Noxa whereas the dominant negative isoform ΔNp73, reduced the levels of Noxa after cisplatin exposure in NTERA2 and 2102EP. Interestingly, down-regulation of Sp1 increased Noxa expression in response to cisplatin. However, blockade of KLF6 decreased cisplatin-induced up-regulation of Noxa in EC cell lines. In addition, tissue microarray analyses of TGCTs revealed that expression of Noxa correlates with good clinical prognosis in patients with embryonal carcinoma. Thus, our data show the transcriptional network that regulates Noxa in EC cells, which is key for their apoptotic response to cisplatin-based chemotherapy, and propose Noxa as a predictive factor of therapeutic response. PMID:22718761

  1. miR-29b sensitizes multiple myeloma cells to bortezomib-induced apoptosis through the activation of a feedback loop with the transcription factor Sp1

    PubMed Central

    Amodio, N; Di Martino, M T; Foresta, U; Leone, E; Lionetti, M; Leotta, M; Gullà, A M; Pitari, M R; Conforti, F; Rossi, M; Agosti, V; Fulciniti, M; Misso, G; Morabito, F; Ferrarini, M; Neri, A; Caraglia, M; Munshi, N C; Anderson, K C; Tagliaferri, P; Tassone, P

    2012-01-01

    MicroRNAs (miRNAs) with tumor-suppressor potential might have therapeutic applications in multiple myeloma (MM) through the modulation of still undiscovered molecular pathways. Here, we investigated the effects of enforced expression of miR-29b on the apoptotic occurrence in MM and highlighted its role in the context of a new transcriptional loop that is finely tuned by the proteasome inhibitor bortezomib. In details, in vitro growth inhibition and apoptosis of MM cells was induced by either transient expression of synthetic miR-29b or its stable lentivirus-enforced expression. We identified Sp1, a transcription factor endowed with oncogenic activity, as a negative regulator of miR-29b expression in MM cells. Since Sp1 expression and functions are regulated via the 26S proteasome, we investigated the effects of bortezomib on miR-29b-Sp1 loop, showing that miR-29b levels were indeed upregulated by the drug. At the same time, the bortezomib/miR-29b combination produced significant pro-apoptotic effects. We also demonstrated that the PI3K/AKT pathway plays a major role in the regulation of miR-29b-Sp1 loop and induction of apoptosis in MM cells. Finally, MM xenografts constitutively expressing miR-29b showed significant reduction of their tumorigenic potential. Our findings indicate that miR-29b is involved in a regulatory loop amenable of pharmacologic intervention and modulates the anti-MM activity of bortezomib in MM cells. PMID:23190608

  2. miR-29b sensitizes multiple myeloma cells to bortezomib-induced apoptosis through the activation of a feedback loop with the transcription factor Sp1.

    PubMed

    Amodio, N; Di Martino, M T; Foresta, U; Leone, E; Lionetti, M; Leotta, M; Gullà, A M; Pitari, M R; Conforti, F; Rossi, M; Agosti, V; Fulciniti, M; Misso, G; Morabito, F; Ferrarini, M; Neri, A; Caraglia, M; Munshi, N C; Anderson, K C; Tagliaferri, P; Tassone, P

    2012-01-01

    MicroRNAs (miRNAs) with tumor-suppressor potential might have therapeutic applications in multiple myeloma (MM) through the modulation of still undiscovered molecular pathways. Here, we investigated the effects of enforced expression of miR-29b on the apoptotic occurrence in MM and highlighted its role in the context of a new transcriptional loop that is finely tuned by the proteasome inhibitor bortezomib. In details, in vitro growth inhibition and apoptosis of MM cells was induced by either transient expression of synthetic miR-29b or its stable lentivirus-enforced expression. We identified Sp1, a transcription factor endowed with oncogenic activity, as a negative regulator of miR-29b expression in MM cells. Since Sp1 expression and functions are regulated via the 26S proteasome, we investigated the effects of bortezomib on miR-29b-Sp1 loop, showing that miR-29b levels were indeed upregulated by the drug. At the same time, the bortezomib/miR-29b combination produced significant pro-apoptotic effects. We also demonstrated that the PI3K/AKT pathway plays a major role in the regulation of miR-29b-Sp1 loop and induction of apoptosis in MM cells. Finally, MM xenografts constitutively expressing miR-29b showed significant reduction of their tumorigenic potential. Our findings indicate that miR-29b is involved in a regulatory loop amenable of pharmacologic intervention and modulates the anti-MM activity of bortezomib in MM cells. PMID:23190608

  3. Altered Expression of NF- κ B and SP1 after Exposure to Advanced Glycation End-Products and Effects of Neurotrophic Factors in AGEs Exposed Rat Retinas.

    PubMed

    Bikbova, Guzel; Oshitari, Toshiyuki; Baba, Takayuki; Yamamoto, Shuichi

    2015-01-01

    To determine the effect of advanced glycation end-products (AGEs) on neurite regeneration, and also to determine the regenerative effects of different neurotrophic factors (NTFs) on rat retinal explants, the retinas of SD rats were cultured in three-dimensional collagen gels and incubated in 6 types of media: (1) serum-free control culture media; (2) 100 μg/mL AGEs-BSA media; (3) AGEs-BSA + 100 ng/mL neurotrophin-4 (NT-4) media; (4) AGEs-BSA + 100 ng/mL hepatocyte growth factor media; (5) AGEs-BSA + 100 ng/mL glial cell line-derived neurotrophic factor media; or (6) AGEs-BSA + 100 µM tauroursodeoxycholic acid media. After 7 days, the number of regenerating neurites was counted. The explants were immunostained for nuclear factor-κB (NF-κB) and specificity protein 1 (SP1). Statistical analyses were performed by one-way ANOVA. In retinas incubated with AGEs, the numbers of neurites were fewer than in control. All of the NTFs increased the number of neurites, and the increase was more significant in the NT-4 group. The number of NF-κB and SP1 immunopositive cells was higher in retinas exposed to AGEs than in control. All of the NTFs decreased the number of NF-κB immunopositive cells but did not significantly affect SP1 expression. These results demonstrate the potential of the NTFs as axoprotectants in AGEs exposed retinal neurons. PMID:26078979

  4. Contribution of transcription factor, SP1, to the promotion of HB-EGF expression in defense mechanism against the treatment of irinotecan in ovarian clear cell carcinoma

    PubMed Central

    Miyata, Kohei; Yotsumoto, Fusanori; Nam, Sung Ouk; Odawara, Takashi; Manabe, Sadao; Ishikawa, Toyokazu; Itamochi, Hiroaki; Kigawa, Junzo; Takada, Shuji; Asahara, Hiroshi; Kuroki, Masahide; Miyamoto, Shingo

    2014-01-01

    Ovarian clear cell carcinoma (OCCC) is a worst histological subtype than other ovarian malignant tumor. Heparin-binding epidermal growth factor-like growth factor (HB-EGF) is a promising target for ovarian cancer therapy. The aims of this study were to validate the efficacy of HB-EGF–targeted therapy for OCCC and to identify the transcription factor that contributed to the induction of HB-EGF by SN38 treatment in OCCC cells. HB-EGF was highly expressed in OCCC cells, and an increase of HB-EGF was induced by SN38 which had only antitumor effect among conventional anticancer agents on OCCC. A specific inhibitor of HB-EGF, a cross-reacting material 197 (CRM197), led to a synergistic increase in the number of apoptotic OCCC cells with the treatment of SN38. The luciferase assay with 5′-deletion promoter constructs identified a GC-rich element between −125 and −178 (the distal transcription start site was denoted +1) as a cis-regulatory region, and the treatment of SN38 induced luciferase activity in this region. An in silico and chromatin immunoprecipitation analysis estimated that SP1 bound to the cis-regulatory region of HB-EGF in OCCC cells. Real-time PCR and cell viability assays showed that the transfection of a small interfering RNA targeting SP1 suppressed the expression of HB-EGF induced by SN38, resulting in the enhanced sensitivity of SN38. Taken together, these results indicate that induction of HB-EGF expression contributed to defense mechanism against treatment of SN38 through the transcriptional activity of SP1 in OCCC cells. PMID:25060396

  5. Expression of the rat liver carnitine palmitoyltransferase I (CPT-Ialpha) gene is regulated by Sp1 and nuclear factor Y: chromosomal localization and promoter characterization.

    PubMed Central

    Steffen, M L; Harrison, W R; Elder, F F; Cook, G A; Park, E A

    1999-01-01

    Carnitine palmitoyltransferase (CPT)-I catalyses the transfer of long-chain fatty acids from CoA to carnitine for translocation across the mitochondrial inner membrane. Expression of the 'liver' isoform of the CPT-I gene (CPT-Ialpha) is subject to developmental, hormonal and tissue-specific regulation. To understand the basis for control of CPT-Ialpha gene expression, we have characterized the proximal promoter of the CPT-Ialpha gene. Here, we report the sequence of 6839 base pairs of the promoter and the localization of the rat CPT-Ialpha gene to region q43 on chromosome 1. Our studies show that the first 200 base pairs of the promoter are sufficient to drive transcription of the CPT-Ialpha gene. Within this region are two sites that bind both Sp1 and Sp3 transcription factors. In addition, nuclear factor Y (NF-Y) binds the proximal promoter. Mutation at the Sp1 or NF-Y sites severely decreases transcription from the CPT-Ialpha promoter. Other protein binding sites were identified within the first 200 base pairs of the promoter by DNase I footprinting, and these elements contribute to CPT-Ialpha gene expression. Our studies demonstrate that CPT-Ialpha is a TATA-less gene which utilizes NF-Y and Sp proteins to drive basal expression. PMID:10333485

  6. Regulation of Sp1 by cell cycle related proteins

    PubMed Central

    Tapias, Alicia; Ciudad, Carlos J.; Roninson, Igor B.; Noé, Véronique

    2009-01-01

    Sp1 transcription factor regulates the expression of multiple genes, including the Sp1 gene itself. We analyzed the ability of different cell cycle regulatory proteins to interact with Sp1 and to affect Sp1 promoter activity. Using an antibody array, we observed that CDK4, SKP2, Rad51, BRCA2 and p21 could interact with Sp1 and we confirmed these interactions by co-immunoprecipitation. CDK4, SKP2, Rad51, BRCA2 and p21 also activated the Sp1 promoter. Among the known Sp1-interacting proteins, E2F-DP1, Cyclin D1, Stat3 and Rb activated the Sp1 promoter, whereas p53 and NFκB inhibited it. The proteins that regulated Sp1 gene expression were shown by positive chromatin immunoprecipitation to be bound to the Sp1 promoter. Moreover, SKP2, BRCA2, p21, E2F-DP1, Stat3, Rb, p53 and NFκB had similar effects on an artificial promoter containing only Sp1 binding sites. Transient transfections of CDK4, Rad51, E2F-DP1, p21 and Stat3 increased mRNA expression from the endogenous Sp1 gene in HeLa cells whereas overexpression of NFκB, and p53 decreased Sp1 mRNA levels. p21 expression from a stably integrated inducible promoter in HT1080 cells activated Sp1 expression at the promoter and mRNA levels, but at the same time it decreased Sp1 protein levels due to the activation of Sp1 degradation. The observed multiple effects of cell cycle regulators on Sp1 suggest that Sp1 may be a key mediator of cell cycle associated changes in gene expression. PMID:18769160

  7. Fibroblast growth factor-2 up-regulates the expression of nestin through the Ras–Raf–ERK–Sp1 signaling axis in C6 glioma cells

    SciTech Connect

    Chang, Kai-Wei; Huang, Yuan-Li; Wong, Zong-Ruei; Su, Peng-Han; Huang, Bu-Miin; Ju, Tsai-Kai; Yang, Hsi-Yuan

    2013-05-17

    Highlights: •Nestin expression in C6 glioma cells is induced by FGF-2. •Nestin expression is induced by FGF-2 via de novo RNA and protein synthesis. •The FGFR inhibitor SU5402 blocks the FGF-2-induced nestin expression. •The mRNA of FGFR1 and 3 are detected in C6 glioma cells. •Ras–Raf–ERK–Sp1 signaling pathway is responsibe for FGF-2-induced nestin expression. -- Abstract: Nestin is a 240-kDa intermediate filament protein expressed mainly in neural and myogenic stem cells. Although a substantial number of studies have focused on the expression of nestin during development of the central nervous system, little is known about the factors that induce and regulate its expression. Fibroblast growth factor-2 (FGF-2) is an effective mitogen and stimulates the proliferation and differentiation of a subset of nestin-expressing cells, including neural progenitor cells, glial precursor cells, and smooth muscle cells. To assess whether FGF-2 is a potent factor that induces the expression of nestin, C6 glioma cells were used. The results showed that nestin expression was up-regulated by FGF-2 via de novo RNA and protein synthesis. Our RT-PCR results showed that C6 glioma cells express FGFR1/3, and FGFRs is required for FGF-2-induced nestin expression. Further signaling analysis also revealed that FGF-2-induced nestin expression is mediated through FGFR–MAPK–ERK signaling axis and the transcriptional factor Sp1. These findings provide new insight into the regulation of nestin in glial system and enable the further studies on the function of nestin in glial cells.

  8. The human papillomavirus type 16 E2 transcription factor binds with low cooperativity to two flanking sites and represses the E6 promoter through displacement of Sp1 and TFIID.

    PubMed Central

    Tan, S H; Leong, L E; Walker, P A; Bernard, H U

    1994-01-01

    The E6 promoters of all genital human papillomaviruses have a characteristic alignment of transcription factor binding sites. Activation of the basic transcription complex at the TATA box depends upon a sequence-aberrant Sp1 site. Repression of E6 promoters is achieved by two binding sites for the viral E2 protein positioned between the Sp1 site and the TATA box. We have purified the human papillomavirus type 16 E2 protein after expression in Escherichia coli and studied its binding and repression properties with oligonucleotides representing the homologous promoter sequences. A Kd value of 3 x 10(-10) M indicated binding properties expected for a native protein. We found low cooperativity in the binding of two E2 dimers to flanking sites, both when these sites were separated by 3 nucleotides, as in the natural promoter, and when they were further apart. E2 protein, bound close to the distal Sp1 site, displaced the Sp1 factor even when the aberrant sequence was replaced by a typical Sp1 core recognition site. The high affinity of E2 protein for its binding site even led to Sp1 displacement at concentrations of E2 protein nearly 2 orders of magnitude lower than those of Sp1. Functional analyses of mutated E6 promoter sequences showed repression by this distal E2 binding site in the complete absence of binding to the proximal E2 binding site. From our findings and observations published by others, we conclude that each of the E2 binding sites in the E6 promoter of genital human papillomaviruses plays a separate role by displacing the transcription factors Sp1 and TFIID. Images PMID:8083979

  9. Functional activity of the porcine Gnrhr2 gene promoter in testis-derived cells is partially conferred by nuclear factor-κB, specificity protein 1 and 3 (SP1/3) and overlapping early growth response 1/SP1/3 binding sites.

    PubMed

    Brauer, Vanessa M; Wiarda-Bell, Jocelyn R; Desaulniers, Amy T; Cederberg, Rebecca A; White, Brett R

    2016-08-10

    Unlike the classical gonadotropin-releasing hormone (GnRH1), the second mammalian isoform (GnRH2) is ubiquitously expressed, suggesting a divergent function. Indeed, we demonstrated that GnRH2 governs LH-independent testosterone secretion in porcine testes via interaction with its receptor (GnRHR2) on Leydig cells. Transient transfections with luciferase reporter vectors containing 3009bp of 5' flanking sequence for the porcine Gnrhr2 gene (-3009pGL3) revealed promoter activity in all 15 cell lines examined, including swine testis-derived (ST) cells. Therefore, ST cells were utilized to explore the molecular mechanisms underlying transcriptional regulation of the porcine Gnrhr2 gene in the testis. Reporter plasmids containing progressive 5' deletions of the Gnrhr2 promoter indicated that the -708/-490 region contained elements critical to promoter activity. Electrophoretic mobility shift assays (EMSAs) with radiolabeled oligonucleotides spanning the -708/-490bp region and ST nuclear extracts, identified specific binding complexes for the -513/-490, -591/-571 and -606/-581bp segments of promoter. Antibody addition to EMSAs indicated that the p65 and p52 subunits of nuclear factor-κB (NF-κB) comprised the specific complex bound to the oligonucleotide probe for the -513/-490bp promoter region, specificity protein (SP) 1 and 3 bound the -591/-571bp probe and early growth response 1 (EGR1), SP1 and SP3 bound the -606/-581 radiolabeled oligonucleotide. Transient transfections with vectors containing mutations of the NF-κB (-499/-493), SP1/3 (-582/-575) or overlapping EGR1/SP1/3 (-597/-587) binding sites reduced luciferase activity by 26%, 61% and 56%, respectively (P<0.05). Thus, NF-κB, SP1/3 and overlapping EGR1/SP1/3 binding sites are critical to expression of the porcine Gnrhr2 gene in ST cells. PMID:27134031

  10. The retinoblastoma gene product RB stimulates Sp1-mediated transcription by liberating Sp1 from a negative regulator.

    PubMed Central

    Chen, L I; Nishinaka, T; Kwan, K; Kitabayashi, I; Yokoyama, K; Fu, Y H; Grünwald, S; Chiu, R

    1994-01-01

    Studies have demonstrated that the retinoblastoma susceptibility gene product, RB, can either positively or negatively regulate expression of several genes through cis-acting elements in a cell-type-dependent manner. The nucleotide sequence of the retinoblastoma control element (RCE) motif, GCCACC or CCACCC, and the Sp1 consensus binding sequence, CCGCCC, can confer equal responsiveness to RB. Here, we report that RB activates transcription of the c-jun gene through the Sp1-binding site within the c-jun promoter. Preincubation of crude nuclear extracts with monoclonal antibodies to RB results in reduction of Sp1 complexes in a mobility shift assay, while addition of recombinant RB in mobility shift assay mixtures with CCL64 cell extracts leads to an enhancement of DNA-binding activity of SP1. These results suggest that RB is directly or indirectly involved in Sp1-DNA binding activity. A mechanism by which RB regulates transactivation is indicated by our detection of a heat-labile and protease-sensitive Sp1 negative regulator(s) (Sp1-I) that specifically inhibits Sp1 binding to a c-jun Sp1 site. This inhibition is reversed by addition of recombinant RB proteins, suggesting that RB stimulates Sp1-mediated transactivation by liberating Sp1 from Sp1-I. Additional evidence for Sp1-I involvement in Sp1-mediated transactivation was demonstrated by cotransfection of RB, GAL4-Sp1, and a GAL4-responsive template into CV-1 cells. Finally, we have identified Sp1-I, a approximately 20-kDa protein(s) that inhibits the Sp1 complexes from binding to DNA and that is also an RB-associated protein. These findings provide evidence for a functional link between two distinct classes of oncoproteins, RB and c-Jun, that are involved in the control of cell growth, and also define a novel mechanism for the regulation of c-jun expression. Images PMID:8007947

  11. A functional polymorphism in the Eta-1 promoter is associated with allele specific binding to the transcription factor Sp1 and elevated gene expression.

    PubMed

    Hummelshoj, Tina; Ryder, Lars P; Madsen, Hans O; Odum, Niels; Svejgaard, Arne

    2006-03-01

    Early T lymphocyte activator 1 (Eta-1), also known as Osteopontin, is a cytokine produced by macrophages and T lymphocytes. It is involved in the regulation of IL-12 and IL-10 expression in macrophages and stimulates the polarization of T cells to the Th1 subset. Three promoter polymorphisms of the human Eta-1 gene, -443T/C, -156delG/G, -66T/G, were investigated for possible influence on gene expression. Electrophoretic mobility shift assays (EMSA) with nuclear extract from the human myeloid leukaemia premonocyte cell line, THP-1, revealed sequence specific binding of the transcription factor Sp1 to the -66T allele but not the -66G allele, and haplotype -443C/-156G/-66T showed a marked increase in promoter activity of a luciferase reporter gene. Thus, a substitution of the T-base with G at position -66 in the Eta-1 promoter modulates the promoter activity of the Eta-1 gene, which might influence the Th1 versus Th2 balance. These observations are discussed in relation to a recently reported related observation on the same gene, and it is argued that discrepancies between reporter gene assays in the two studies may be due to the use of different cell lines and may reflect requirements for different transcription factors in cells involved in immune responses compared with other cells. PMID:16009426

  12. Characterization of the human granulocyte-macrophage colony-stimulating factor gene promoter: an AP1 complex and an Sp1-related complex transactivate the promoter activity that is suppressed by a YY1 complex.

    PubMed Central

    Ye, J; Zhang, X; Dong, Z

    1996-01-01

    It is well documented that a repeated CATT element in the human granulocyte-macrophage colony-stimulating factor (GM-CSF) gene promoter is required for promoter activity. However, the transcription factors that are able to transactivate this enhancer element remain unidentified. Recently, we have found that nuclear factor YY1 can interact with the enhancer element. Here, we report that in addition to YY1, two other nuclear factors have been identified in the DNA-protein complexes formed by the CATT oligonucleotide and the Jurkat T-cell nuclear protein. One of these factors is AP1, and the other one is an Sp1-related protein. Results from transient transfection of Jurkat T cells have revealed that formation of both AP1 and the Sp1-related complex is required for the full enhancer activity of the CATT element. This result is supported by cotransfection of a c-jun expression vector and mutational analysis of the AP1 site or the Sp1-related protein binding site. In contrast, formation of the YY1 complex suppresses enhancer activity, since deletion of the YY1 complex induces an augmentation of the enhancer activity and overexpression of YY1 results in an attenuation of the enhancer activity. Results from the mechanism study have revealed that YY1 is able to inhibit transactivation mediated by either AP1 or the Sp1-related protein, and YY1 suppressive activity is DNA binding dependent. Taken together, these data support the ideas that AP1 and the Sp1-related nuclear protein are required for transactivation of the human GM-CSF gene promoter and that YY1 can suppress transactivation of the promoter even under inducible conditions. PMID:8524292

  13. O-Linked N-acetylglucosaminylation of Sp1 interferes with Sp1 activation of glycolytic genes.

    PubMed

    Lim, Kihong; Yoon, Bo Hyun; Ha, Chang Hoon

    Glycolysis, the primary pathway metabolizing glucose for energy production, is connected to the hexosamine biosynthetic pathway (HBP) which produces UDP-N-acetylglucosamine (UDP-GlcNAc), a GlcNAc donor for O-linked GlcNAc modification (O-GlcNAc), as well as for traditional elongated glycosylation. Thus, glycolysis and O-GlcNAc are intimately associated. The present study reports the transcriptional activation of glycolytic genes by the transcription factor Sp1 and the O-GlcNAc-mediated suppression of Sp1-dependent activation of glycolytic genes. O-GlcNAc-deficient mutant Sp1 stimulated the transcription of nine glycolytic genes and cellular production of pyruvate, the final product of glycolysis, to a greater extent than wild-type Sp1. Consistently, this mutant Sp1 increased the protein levels of the two key glycolytic enzymes, phosphofructokinase (PFK) and glyceraldehyde 3-phosphate dehydrogenase (GAPDH), to a greater extent than wild-type Sp1. Finally, the mutant Sp1 occupied GC-rich elements on PFK and GAPDH promoters more efficiently than wild-type Sp1. These results suggest that O-GlcNAcylation of Sp1 suppresses Sp1-mediated activation of glycolytic gene transcription. PMID:26499076

  14. Fetal lead exposure: antenatal factors

    SciTech Connect

    Ernhart, C.B.; Wolf, A.W.; Sokol, R.J.; Brittenham, G.M.; Erhard, P.

    1985-10-01

    It was hypothesized that maternal blood lead level at delivery and cord blood lead level of the neonate would be affected by maternal use of alcohol, history of alcohol abuse, and smoking. The possibility that iron status, as reflected in maternal serum ferritin, would be related to lead level was also explored. The maternal history of alcohol abuse was unrelated to lead level in 208 samples of maternal blood and 178 samples of cord blood. However, alcohol use during pregnancy was related in a dose-response fashion to maternal and to cord blood lead level. This effect was significant with and without control of maternal smoking. The effect of maternal smoking and serum thiocyanate on maternal and cord blood lead level were also highly significant with and without control of the maternal drinking variable. Serum ferritin was marginally related to lead level for white women and for black infants, but tests of the dichotomized maternal ferritin variable did not yield a significant linkage with maternal or cord blood lead level. The results further support recommendations that women abstain from alcohol consumption and cigarette smoking in pregnancy.

  15. E6 and E7 oncoproteins from human papillomavirus type 16 induce activation of human transforming growth factor beta1 promoter throughout Sp1 recognition sequence.

    PubMed

    Peralta-Zaragoza, Oscar; Bermúdez-Morales, Víctor; Gutiérrez-Xicotencatl, Lourdes; Alcocer-González, Juan; Recillas-Targa, Félix; Madrid-Marina, Vicente

    2006-01-01

    Human Papillomavirus (HPV) infection is the main etiologic agent of cervical cancer and HPV E6 and E7 oncogenes trans-regulate many cellular genes. An association between TGF-beta1 gene expression and cervical cancer development has been suggested; however, the mechanisms by which HPV influences TGF-beta1 expression remain unclear. In the present study we analyzed the mechanism through which HPV-16 E6 and E7 oncoproteins regulate the TGF-beta1 promoter in cervical tumor cells. Our results showed that E6 and E7 increased TGF-beta1 promoter activity. Furthermore, we identified a specific DNA sequence motif in the TGF-beta1 core promoter that is responsible for trans-activation and that corresponds to the Sp1e-binding site associated with HPV-16 E6 and E7 oncoproteins. Mutational analysis showed that the Sp1e recognition site abolished the trans-activation caused by E6 and E7. These results suggest a physical interaction and functional cooperation between viral oncoproteins and cellular regulatory elements of the TGF-beta1 promoter, and may explain the contribution of HPV-16 to TGF-beta1 gene expression in cervical cancer. PMID:16987065

  16. The Sp(1)-Kepler problems

    SciTech Connect

    Meng Guowu

    2009-07-15

    Let n{>=}2 be a positive integer. To each irreducible representation {sigma} of Sp(1), an Sp(1)-Kepler problem in dimension (4n-3) is constructed and analyzed. This system is superintegrable, and when n=2 it is equivalent to a generalized MICZ-Kepler problem in dimension of 5. The dynamical symmetry group of this system is O-tilde*(4n) with the Hilbert space of bound states H({sigma}) being the unitary highest weight representation of O*-tilde(4n) with highest weight, (-1,{center_dot}{center_dot}{center_dot},-1,-(1+{sigma})), which occurs at the rightmost nontrivial reduction point in the Enright-Howe-Wallach classification diagram for the unitary highest weight modules. Here {sigma} is the highest weight of {sigma}. Furthermore, it is shown that the correspondence {sigma}{r_reversible}H({sigma}) is the theta-correspondence for dual pair (Sp(1),O*(4n))subset Sp(8n,R)

  17. Essential role of an activator protein-2 (AP-2)/specificity protein 1 (Sp1) cluster in the UVB-mediated induction of the human vascular endothelial growth factor in HaCaT keratinocytes.

    PubMed Central

    Brenneisen, Peter; Blaudschun, Ralf; Gille, Jens; Schneider, Lars; Hinrichs, Ralf; Wlaschek, Meinhard; Eming, Sabine; Scharffetter-Kochanek, Karin

    2003-01-01

    Chronic sun exposure of the skin has long been postulated to enhance cutaneous angiogenesis, resulting in highly vascularized skin cancers. As the UVB component of sunlight is a major contributor to photocarcinogenesis, we aimed to explore the effects of UVB radiation on vascular endothelial growth factor (VEGF) gene expression, using the immortalized keratinocyte cell line HaCaT as a model for transformed premalignant epithelial cells. In the present paper, we studied the molecular mechanism of UVB-induced VEGF providing a major angiogenic activity in tumour progression and invasion. After 12-24 h of UVB irradiation, a 2.4- to 2.7-fold increase in endogenous VEGF protein level was measured, correlating with an up to 2.5-fold induction of promoter-based reporter gene constructs of VEGF. Furthermore, we identified a GC-rich UVB-responsive region between -87 and -65 bp of the VEGF promoter. In electrophoretic mobility-shift assays, this region binds Sp1-dependent protein complexes constitutively and an additional UVB-inducible protein complex distinct from Sp1 protein. The transcription factor AP-2 (activator protein-2) was detected as a component of the UVB-inducible protein complex. The critical role of the AP-2/Sp1 (specificity protein 1) cluster was supported by demonstration of a significant reduction of UVB-mediated promoter activity upon deletion of this recognition site. The specificity of this region for UVB irradiation was demonstrated using PMA, which increased VEGF activity in HaCaT cells after transient transfection of the deleted promoter construct. In conclusion, our data clarified regulatory mechanisms of UVB-dependent VEGF stimulation which may be critical for angiogenic processes in the skin. PMID:12358602

  18. Low-density lipoprotein upregulate SR-BI through Sp1 Ser702 phosphorylation in hepatic cells.

    PubMed

    Yang, Fan; Du, Yu; Zhang, Jin; Jiang, Zhibo; Wang, Li; Hong, Bin

    2016-09-01

    Scavenger receptor class B type I (SR-BI) is one of the key proteins in the process of reverse cholesterol transport (RCT), and its major function is to uptake high density lipoprotein (HDL) cholesterol from plasma into liver cells. The regulation of SR-BI expression is important for controlling serum lipid content and reducing the risks of cardiovascular diseases. Here we found that SR-BI expression was significantly increased by LDL in vivo and in vitro, and the transcription factor specific protein 1 (Sp1) plays a critical role in this process. Results from co-immunoprecipitation experiments indicate that the activation of SR-BI was associated with Sp1-recruited protein complexes in the promoter region of SR-BI, where histone acetyltransferase p300 was recruited and histone deacetylase HDAC1 was dismissed. As a result, histone acetylation increased, leading to activation of SR-BI transcription. With further investigation, we found that LDL phosphorylated Sp1 through ERK1/2 pathway, which affected Sp1 protein complexes formation in SR-BI promoter. Using mass spectrometry and site directed mutagenesis, a new Sp1 phosphorylation site Ser702 was defined to be associated with Sp1-HDAC1 interaction and may be important in SR-BI activation, shedding light on the knowledge of delicate mechanism of hepatic HDL receptor SR-BI gene modulation by LDL. PMID:27320013

  19. Regulation of the Cyclin-dependent Kinase Inhibitor 1A Gene (CDKN1A) by the Repressor BOZF1 through Inhibition of p53 Acetylation and Transcription Factor Sp1 Binding*

    PubMed Central

    Kim, Min-Kyeong; Jeon, Bu-Nam; Koh, Dong-In; Kim, Kyung-Sup; Park, So-Yoon; Yun, Chae-Ok; Hur, Man-Wook

    2013-01-01

    The human POZ domain and Krüppel-like zinc finger (POK) family proteins play important roles in the regulation of apoptosis, cell proliferation, differentiation, development, oncogenesis, and tumor suppression. A novel POK family transcription factor, BTB/POZ and zinc finger domains factor on chromosome 1 (BOZF-1; also called ZBTB8A), contains a POZ domain and two C2H2-type Krüppel-like zinc fingers and is localized at nuclear speckles. Compared with paired normal tissues, BOZF1 expression is increased in cancer tissues of the prostate, breast, and cervix. BOZF1 repressed the transcription of p21WAF/CDKN1A by acting on the proximal promoter concentrated with Sp1-binding GC boxes. BOZF1 competed with Sp1 in binding to GC boxes 1–5/6 of the CDKN1A proximal promoter. In addition, BOZF1 interacted with p53 and decreased the acetylation of p53 by p300, which reduced the DNA binding activity of p53 at the far distal p53-binding element. BOZF1 blocked the two major molecular events that are important in both constitutive and inducible transcription activation of CDKN1A. BOZF1 is unique in that it bound to all the proximal GC boxes to repress transcription, and it inhibited p53 acetylation without affecting p53 stability. BOZF1 might be a novel proto-oncoprotein that stimulates cell proliferation. PMID:23329847

  20. Interplay of posttranslational modifications in Sp1 mediates Sp1 stability during cell cycle progression.

    PubMed

    Wang, Yi-Ting; Yang, Wen-Bin; Chang, Wen-Chang; Hung, Jan-Jong

    2011-11-18

    Although Sp1 is known to undergo posttranslational modifications such as phosphorylation, glycosylation, acetylation, sumoylation, and ubiquitination, little is known about the possible interplay between the different forms of Sp1 that may affect its overall levels. It is also unknown whether changes in the levels of Sp1 influence any biological cell processes. Here, we identified RNF4 as the ubiquitin E3 ligase of Sp1. From in vitro and in vivo experiments, we found that sumoylated Sp1 can recruit RNF4 as a ubiquitin E3 ligase that subjects sumoylated Sp1 to proteasomal degradation. Sp1 mapping revealed two ubiquitination-related domains: a small ubiquitin-like modifier in the N-terminus of Sp1(Lys16) and the C-terminus of Sp1 that directly interacts with RNF4. Interestingly, when Sp1 was phosphorylated at Thr739 by c-Jun NH(2)-terminal kinase 1 during mitosis, this phosphorylated form of Sp1 abolished the Sp1-RNF4 interaction. Our results show that, while sumoylated Sp1 subjects to proteasomal degradation, the phosphorylation that occurs during the cell cycle can protect Sp1 from degradation by repressing the Sp1-RNF4 interaction. Thus, we propose that the interplay between posttranslational modifications of Sp1 plays an important role in cell cycle progression and keeps Sp1 at a critical level for mitosis. PMID:21983342

  1. Nucleolin enhances internal ribosomal entry site (IRES)-mediated translation of Sp1 in tumorigenesis.

    PubMed

    Hung, Chia-Yang; Yang, Wen-Bin; Wang, Shao-An; Hsu, Tsung-I; Chang, Wen-Chang; Hung, Jan-Jong

    2014-12-01

    Our previous study indicated that specificity protein-1 (Sp1) is accumulated during hypoxia in an internal ribosomal entry site (IRES)-dependent manner. Herein, we found that the Sp1 was induced strongly at the protein level, but not in the mRNA level, in lung tumor tissue, indicating that translational regulation might contribute to the Sp1 accumulation during tumorigenesis. A further study showed that the translation of Sp1 was dramatically induced through an IRES-dependent pathway. RNA immunoprecipitation analysis of proteins bound to the 5'-untranslated region (5'-UTR) of Sp1 identified interacting protein - nucleolin. Knockdown of nucleolin significantly inhibited IRES-mediated translation of Sp1, suggesting that nucleolin positively facilitates Sp1 IRES activation. Further analysis of the interaction between nucleolin and the 5'-UTR of Sp1 mRNA revealed that the GAR domain was important for IRES-mediated translation of Sp1. Moreover, gefitinib, and LY294002 and MK2206 compounds inhibited IRES-mediated Sp1 translation, implying that activation of the epithelial growth factor receptor (EGFR) pathway via Akt activation triggers the IRES pathway. In conclusion, EGFR activation-mediated nucleolin phosphorylated at Thr641 and Thr707 was recruited to the 5'-UTR of Sp1 as an IRES trans-acting factor to modulate Sp1 translation during lung cancer formation. PMID:25173817

  2. Transcription of the catalytic 180-kDa subunit gene of mouse DNA polymerase alpha is controlled by E2F, an Ets-related transcription factor, and Sp1.

    PubMed

    Izumi, M; Yokoi, M; Nishikawa, N S; Miyazawa, H; Sugino, A; Yamagishi, M; Yamaguchi, M; Matsukage, A; Yatagai, F; Hanaoka, F

    2000-07-24

    We have isolated a genomic DNA fragment spanning the 5'-end of the gene encoding the catalytic subunit of mouse DNA polymerase alpha. The nucleotide sequence of the upstream region was G/C-rich and lacked a TATA box. Transient expression assays in cycling NIH 3T3 cells demonstrated that the GC box of 20 bp (at nucleotides -112/-93 with respect to the transcription initiation site) and the palindromic sequence of 14 bp (at nucleotides -71/-58) were essential for basal promoter activity. Electrophoretic mobility shift assays showed that Sp1 binds to the GC box. We also purified a protein capable of binding to the palindrome and identified it as GA-binding protein (GABP), an Ets- and Notch-related transcription factor. Transient expression assays in synchronized NIH 3T3 cells revealed that three variant E2F sites near the transcription initiation site (at nucleotides -23/-16, -1/+7 and +17/+29) had no basal promoter activity by themselves, but were essential for growth-dependent stimulation of the gene expression. These data indicate that E2F, GABP and Sp1 regulate the gene expression of this principal replication enzyme. PMID:11004506

  3. Treatment with Combination of Mithramycin A and Tolfenamic Acid Promotes Degradation of Sp1 Protein and Synergistic Antitumor Activity in Pancreatic Cancer

    PubMed Central

    Jia, Zhiliang; Gao, Yong; Wang, Liwei; Li, Qiang; Zhang, Jun; Le, Xiangdong; Wei, Daoyan; Yao, James C.; Chang, David Z.; Huang, Suyun; Xie, Keping

    2010-01-01

    Previous studies showed that both mithramycin (MIT) and tolfenamic acid (TA) inhibits the activity of the transcription factor Sp1. In the present study, we sought to determine whether treatment with a combination of these two compounds has a synergistic effect on Sp1 activity and pancreatic cancer growth and their underlying mechanisms. In xenograft mouse models of human pancreatic cancer, treatment with MIT and TA produced dose-dependent antitumor activity, and significant antitumor activity of either compound alone was directly associated with systemic side effects as determined according to overall weight loss. However, combination treatment with nontoxic doses of TA and MIT produced synergistic antitumor activity, whereas treatment with a nontoxic dose of either compound alone did not have a discernible antitumor effect. The synergistic therapeutic effects of MIT and TA correlated directly with synergistic antiproliferation and antiangiogenesis in vitro. Moreover, treatment with the combination of TA and MIT resulted in Sp1 protein degradation, leading to drastic downregulation of Sp1 and vascular endothelial growth factor protein expression. Our data demonstrated that Sp1 is a critical target of TA and MIT in human pancreatic cancer therapy. Further studies should be performed to determine the impact of existing pancreatic cancer therapy regimens on Sp1 signaling in tumors and normal pancreatic tissue and the ability of Sp1-targeting strategies to modify these responses and improve upon these regimens. PMID:20086170

  4. Social factors leading to juvenile delinquency.

    PubMed

    Sakuta, T

    1996-12-01

    According to the White Paper on Crime 1994 published by the Ministry of Justice in Japan, the delinquent rate in Japan was highest when juveniles were approximately 14 to 16 years old, and declined as they grew older. The analysis of juvenile offenders in Japan showed that 70% of them had two living parents, 90% of them from families which were financially stable or affluent. The breakdown of their parents attitudes showed, however, that 48.2% were classified as neglectful, followed by harshness at 30.3% and spoiling or overprotection at 17.3% in 1993 in Japan. In the following, social factors leading to juvenile delinquency were reviewed. Factors leading to juvenile delinquency were classified into social factors, school factors and home factors, and recent findings concerning those three factors were explained. A fairly clear outlook on the efforts required by society, schools and families to reduce juvenile delinquency was shown by revealing important factors leading juveniles to delinquency. PMID:9023445

  5. SP1 protein-based nanostructures and arrays.

    PubMed

    Medalsy, Izhar; Dgany, Or; Sowwan, Mukhles; Cohen, Hezy; Yukashevska, Alevtyna; Wolf, Sharon G; Wolf, Amnon; Koster, Abraham; Almog, Orna; Marton, Ira; Pouny, Yehonathan; Altman, Arie; Shoseyov, Oded; Porath, Danny

    2008-02-01

    Controlled formation of complex nanostructures is one of the main goals of nanoscience and nanotechnology. Stable Protein 1 (SP1) is a boiling-stable ring protein complex, 11 nm in diameter, which self-assembles from 12 identical monomers. SP1 can be utilized to form large ordered arrays; it can be easily modified by genetic engineering to produce various mutants; it is also capable of binding gold nanoparticles (GNPs) and thus forming protein-GNP chains made of alternating SP1s and GNPs. We report the formation and the protocols leading to the formation of those nanostructures and their characterization by transmission electron microscopy, atomic force microscopy, and electrostatic force microscopy. Further control over the GNP interdistances within the protein-GNP chains may lead to the formation of nanowires and structures that may be useful for nanoelectronics. PMID:18193911

  6. Sp1/NFκB/HDAC/miR-29b Regulatory Network in KIT-driven Myeloid Leukemia

    PubMed Central

    Liu, Shujun; Wu, Lai-Chu; Pang, Jiuxia; Santhanam, Ramasamy; Schwind, Sebastian; Wu, Yue-Zhong; Hickey, Christopher; Yu, Jianhua; Becker, Heiko; Maharry, Kati; Radmacher, Michael D; Li, Chenglong; Whitman, Susan P.; Mishra, Anjali; Stauffer, Nicole; Eiring, Anna M.; Briesewitz, Roger; Baiocchi, Robert A.; Chan, Kenneth K.; Paschka, Peter; Caligiuri, Michael A.; Byrd, John C.; Croce, Carlo M; Bloomfield, Clara D.; Perrotti, Danilo; Garzon, Ramiro; Marcucci, Guido

    2010-01-01

    SUMMARY The biologic and clinical significance of KIT overexpression that associates with KIT gain-of- function mutations occurring in subsets of acute myeloid leukemia (AML) (i.e., core binding factor AML) is unknown. Here, we show that KIT mutations lead to MYC-dependent miR-29b repression and increased levels of the miR-29b target Sp1 in KIT-driven leukemia. Sp1 enhances its own expression by participating in a NFκB/HDAC complex that further represses miR-29b transcription. Upregulated Sp1 then binds NFκB and transactivates KIT. Therefore, activated KIT ultimately induces its own transcription. Our results provide evidence that the mechanisms of Sp1/NFκB/HDAC/miR-29b-dependent KIT overexpression contribute to leukemia growth and can be successfully targeted by pharmacological disruption of the Sp1/NFκB/HDAC complex or synthetic miR-29b treatment in KIT-driven AML. PMID:20385359

  7. Sumoylation differentially regulates Sp1 to control cell differentiation

    PubMed Central

    Gong, Lili; Ji, Wei-Ke; Hu, Xiao-Hui; Hu, Wen-Feng; Tang, Xiang-Cheng; Huang, Zhao-Xia; Li, Ling; Liu, Mugen; Xiang, Shi-Hua; Wu, Erxi; Woodward, Zachary; Liu, Yi-Zhi; Nguyen, Quan Dong; Li, David Wan-Cheng

    2014-01-01

    The mammalian small ubiquitin-like modifiers (SUMOs) are actively involved in regulating differentiation of different cell types. However, the functional differences between SUMO isoforms and their mechanisms of action remain largely unknown. Using the ocular lens as a model system, we demonstrate that different SUMOs display distinct functions in regulating differentiation of epithelial cells into fiber cells. During lens differentiation, SUMO1 and SUMO2/3 displayed different expression, localization, and targets, suggesting differential functions. Indeed, overexpression of SUMO2/3, but not SUMO1, inhibited basic (b) FGF-induced cell differentiation. In contrast, knockdown of SUMO1, but not SUMO2/3, also inhibited bFGF action. Mechanistically, specificity protein 1 (Sp1), a major transcription factor that controls expression of lens-specific genes such as β-crystallins, was positively regulated by SUMO1 but negatively regulated by SUMO2. SUMO2 was found to inhibit Sp1 functions through several mechanisms: sumoylating it at K683 to attenuate DNA binding, and at K16 to increase its turnover. SUMO2 also interfered with the interaction between Sp1 and the coactivator, p300, and recruited a repressor, Sp3 to β-crystallin gene promoters, to negatively regulate their expression. Thus, stable SUMO1, but diminishing SUMO2/3, during lens development is necessary for normal lens differentiation. In support of this conclusion, SUMO1 and Sp1 formed complexes during early and later stages of lens development. In contrast, an interaction between SUMO2/3 and Sp1 was detected only during the initial lens vesicle stage. Together, our results establish distinct roles of different SUMO isoforms and demonstrate for the first time, to our knowledge, that Sp1 acts as a major transcription factor target for SUMO control of cell differentiation. PMID:24706897

  8. Indole-3-carbinol downregulation of telomerase gene expression requires the inhibition of estrogen receptor-alpha and Sp1 transcription factor interactions within the hTERT promoter and mediates the G1 cell cycle arrest of human breast cancer cells

    PubMed Central

    Marconett, Crystal N.; Sundar, Shyam N.; Tseng, Min; Tin, Antony S.; Tran, Kalvin Q.; Mahuron, Kelly M.; Bjeldanes, Leonard F.; Firestone, Gary L.

    2011-01-01

    Indole-3-carbinol (I3C), a naturally occurring hydrolysis product of glucobrassicin from cruciferous vegetables such as broccoli, cabbage and Brussels sprouts, is an anticancer phytochemical that triggers complementary sets of antiproliferative pathways to induce a cell cycle arrest of estrogen-responsive MCF7 breast cancer cells. I3C strongly downregulated transcript expression of the catalytic subunit of the human telomerase (hTERT) gene, which correlated with the dose-dependent indole-mediated G1 cell cycle arrest without altering the transcript levels of the RNA template (hTR) for telomerase elongation. Exogenous expression of hTERT driven by a constitutive promoter prevented the I3C-induced cell cycle arrest and rescued the I3C inhibition of telomerase enzymatic activity and activation of cellular senescence. Time course studies showed that I3C downregulated expression of estrogen receptor-alpha (ERα) and cyclin-dependent kinase-6 transcripts levels (which is regulated through the Sp1 transcription factor) prior to the downregulation of hTERT suggesting a mechanistic link. Chromatin immunoprecipitation assays demonstrated that I3C disrupted endogenous interactions of both ERα and Sp1 with an estrogen response element–Sp1 composite element within the hTERT promoter. I3C inhibited 17β-estradiol stimulated hTERT expression and stimulated the production of threonine-phosphorylated Sp1, which inhibits Sp1–DNA interactions. Exogenous expression of both ERα and Sp1, but not either alone, in MCF7 cells blocked the I3C-mediated downregulation of hTERT expression. These results demonstrate that I3C disrupts the combined ERα- and Sp1-driven transcription of hTERT gene expression, which plays a significant role in the I3C-induced cell cycle arrest of human breast cancer cells. PMID:21693539

  9. Co-operative interactions between NFAT (nuclear factor of activated T cells) c1 and the zinc finger transcription factors Sp1/Sp3 and Egr-1 regulate MT1-MMP (membrane type 1 matrix metalloproteinase) transcription by glomerular mesangial cells.

    PubMed Central

    Alfonso-Jaume, Maria Alejandra; Mahimkar, Rajeev; Lovett, David H

    2004-01-01

    The transition of normally quiescent glomerular MCs (mesangial cells) to a highly proliferative phenotype with characteristics of myofibroblasts is a process commonly observed in inflammatory diseases affecting the renal glomerulus, the ultimate result of which is glomerulosclerosis. Generation of proteolytically active MMP (matrix metalloproteinase)-2 by the membrane-associated membrane type 1 (MT1)-MMP is responsible for the transition of mesangial cells to the myofibroblast phenotype [Turck, Pollock, Lee, Marti and Lovett (1996) J. Biol. Chem. 271, 15074-15083]. In the present study, we show that the expression of MT1-MMP within the context of MCs is mediated by three discrete cis -acting elements: a proximal non-canonical Sp1 site that preferentially binds Sp1; an overlapping Sp1/Egr-1-binding site that preferentially binds Egr-1; and a more distal binding site for the NFAT (nuclear factor of activated T cells) that binds the NFAT c1 isoform present in MC nuclear extracts. Transfection with an NFAT c1 expression plasmid, or activation of calcineurin with a calcium ionophore, yielded major increases in NFAT c1 nuclear DNA-binding activity, MT1-MMP transcription and protein synthesis, which were additive with the lower levels of transactivation provided by the proximal Sp1 and the overlapping Sp1/Egr-1 sites. Specific binding of NFAT c1 to the MT1-MMP promoter was confirmed by chromatin immunoprecipitation studies, while MT1-MMP expression was suppressed by treatment with the calcineurin inhibitor, cyclosporin A. These studies are the first demonstration that a specific NFAT isoform enhances transcription of an MMP (MT1-MMP) that plays a major role in the proteolytic events that are a dominant feature of acute glomerular inflammation. Suppression of MT1-MMP by commonly used calcineurin inhibitors may play a role in the development of renal fibrosis following renal transplantation. PMID:14979875

  10. Translational and transcriptional control of Sp1 against ischaemia through a hydrogen peroxide-activated internal ribosomal entry site pathway

    PubMed Central

    Yeh, Shiu Hwa; Yang, Wen Bin; Gean, Po Wu; Hsu, Chung Yi; Tseng, Joseph T.; Su, Tsung Ping; Chang, Wen Chang; Hung, Jan Jong

    2011-01-01

    The exact mechanism underlying increases in Sp1 and the physiological consequences thereafter remains unknown. In rat primary cortical neurons, oxygen-glucose deprivation (OGD) causes an increase in H2O2 as well as Sp1 in early ischaemia but apparently does not change mRNA level or Sp1 stability. We hereby identified a longer 5′-UTR in Sp1 mRNA that contains an internal ribosome entry site (IRES) that regulates rapid and efficient translation of existing mRNAs. By using polysomal fragmentation and bicistronic luciferase assays, we found that H2O2 activates IRES-dependent translation. Thus, H2O2 or tempol, a superoxide dismutase-mimetic, increases Sp1 levels in OGD-treated neurons. Further, early-expressed Sp1 binds to Sp1 promoter to cause a late rise in Sp1 in a feed-forward manner. Short hairpin RNA against Sp1 exacerbates OGD-induced apoptosis in primary neurons. While Sp1 levels increase in the cortex in a rat model of stroke, inhibition of Sp1 binding leads to enhanced apoptosis and cortical injury. These results demonstrate that neurons can use H2O2 as a signalling molecule to quickly induce Sp1 translation through an IRES-dependent translation pathway that, in cooperation with a late rise in Sp1 via feed-forward transcriptional activation, protects neurons against ischaemic damage. PMID:21441538

  11. Early experiences with the IBM SP-1

    SciTech Connect

    Gropp, W.

    1993-06-01

    The IBM SP-1 is IBM`s newest parallel distributed-memory computer. As part of a joint project with IBM, Argonne took delivery of an early system in order to evaluate the software environment and to begin porting programming packages and applications to this machine. This report discusses the results of those early efforts. Despite the newness of the machine and the lack of a fast interprocessor switch (part of the SP-1 but not yet available for the machine), every code that they attempted to port ran on the SP-1 with little or no modification. The report concludes with a discussion of expectations for the fast interconnect.

  12. The Influence of Declining Air Lead Levels on Blood Lead-Air Lead Slope Factors in Children

    EPA Science Inventory

    This presentation describes calculation of blood lead-air lead slope factor within an analysis of the relationship between blood lead levels and air lead levels among participants in the National Health and Nutrition Examination Survey (NHANES). The slope factors are compared wi...

  13. Reduced O glycosylation of Sp1 is associated with increased proteasome susceptibility.

    PubMed Central

    Han, I; Kudlow, J E

    1997-01-01

    Sp1 is a ubiquitously expressed transcription factor that is particularly important for the regulation of TATA-less genes that encode housekeeping proteins. Most growth factors and receptors are also encoded by such genes. Sp1 is multiply O glycosylated by covalent linkage of the monosaccharide N-acetylglucosamine (O-GlcNAc) to serine and threonine residues. Based on an earlier observation that growth factor gene transcription can be regulated by glucose and glucosamine in vascular smooth muscle cells, we determined whether Sp1 glycosylation could be regulated and if this modification altered Sp1 function. We found that Sp1 becomes hyperglycosylated when cells are exposed to 5 mM glucosamine, whereas under glucose starvation, stimulation with cyclic AMP (cAMP) results in nearly complete deglycosylation of this protein. Correlating with this hypoglycosylated state, Sp1 is rapidly proteolytically degraded by an enzyme(s) that can be inhibited by specific proteasome inhibitors, lactacystin and LLnL. Treatment of cells with glucose or glucosamine protects Sp1 from cAMP-mediated degradation, whereas blockade of glucosamine synthesis abrogates glucose but not glucosamine protection. This effect on Sp1 is specific, in that the Stat-3 and E2F transcription factors did not undergo degradation under these conditions. The O-GlcNAc modification of Sp1 may play a role as a nutritional checkpoint. In the absence of adequate nutrition, Sp1 becomes hypoglycosylated and thereby subject to proteasome degradation. This process could potentially result in reduced general transcription, thereby conserving nutrients. PMID:9111324

  14. Sp1 Facilitates DNA Double-Strand Break Repair through a Nontranscriptional Mechanism

    PubMed Central

    Beishline, Kate; Kelly, Crystal M.; Olofsson, Beatrix A.; Koduri, Sravanthi; Emrich, Jacqueline; Greenberg, Roger A.

    2012-01-01

    Sp1 is a ubiquitously expressed transcription factor that is phosphorylated by ataxia telangiectasia mutated kinase (ATM) in response to ionizing radiation and H2O2. Here, we show by indirect immunofluorescence that Sp1 phosphorylated on serine 101 (pSp1) localizes to ionizing radiation-induced foci with phosphorylated histone variant γH2Ax and members of the MRN (Mre11, Rad50, and Nbs1) complex. More precise analysis of occupancy of DNA double-strand breaks (DSBs) by chromatin immunoprecipitation (ChIP) shows that Sp1, like Nbs1, resides within 200 bp of DSBs. Using laser microirradiation of cells, we demonstrate that pSp1 is present at DNA DSBs by 7.5 min after induction of damage and remains at the break site for at least 8 h. Depletion of Sp1 inhibits repair of site-specific DNA breaks, and the N-terminal 182-amino-acid peptide, which contains targets of ATM kinase but lacks the zinc finger DNA binding domain, is phosphorylated, localizes to DSBs, and rescues the repair defect resulting from Sp1 depletion. Together, these data demonstrate that Sp1 is rapidly recruited to the region immediately adjacent to sites of DNA DSBs and is required for DSB repair, through a mechanism independent of its sequence-directed transcriptional effects. PMID:22826432

  15. MiR-22/Sp-1 Links Estrogens With the Up-Regulation of Cystathionine γ-Lyase in Myocardium, Which Contributes to Estrogenic Cardioprotection Against Oxidative Stress.

    PubMed

    Wang, Long; Tang, Zhi-Ping; Zhao, Wei; Cong, Bing-Hai; Lu, Jian-Qiang; Tang, Xiao-Lu; Li, Xiao-Han; Zhu, Xiao-Yan; Ni, Xin

    2015-06-01

    Hydrogen sulfide, generated in the myocardium predominantly via cystathionine-γ-lyase (CSE), is cardioprotective. Our previous study has shown that estrogens enhance CSE expression in myocardium of female rats. The present study aims to explore the mechanisms by which estrogens regulate CSE expression, in particular to clarify the role of estrogen receptor subtypes and the transcriptional factor responsible for the estrogenic effects. We found that either the CSE inhibitor or the CSE small interfering RNA attenuated the protective effect of 17β-estradiol (E2) against H2O2- and hypoxia/reoxygenation-induced injury in primary cultured neonatal cardiomyocytes. E2 stimulates CSE expression via estrogen receptor (ER)-α both in cultured cardiomyocytes in vitro and in the myocardium of female mice in vivo. A specificity protein-1 (Sp-1) consensus site was identified in the rat CSE promoter and was found to mediate the E2-induced CSE expression. E2 increases ERα and Sp-1 and inhibits microRNA (miR)-22 expression in myocardium of ovariectomized rats. In primary cardiomyocytes, E2 stimulates Sp-1 expression through the ERα-mediated down-regulation of miR-22. It was confirmed that both ERα and Sp-1 were targeted by miR-22. In the myocardium of ovariectomized rats, the level of miR-22 inversely correlated to CSE, ERα, Sp-1, and antioxidant biomarkers and positively correlated to oxidative biomarkers. In summary, this study demonstrates that estrogens stimulate Sp-1 through the ERα-mediated down-regulation of miR-22 in cardiomyocytes, leading to the up-regulation of CSE, which in turn results in an increase of antioxidative defense. Interaction of ERα, miR-22, and Sp-1 may play a critical role in the control of oxidative stress status in the myocardium of female rats. PMID:25825815

  16. Comparative integromics on FZD7 orthologs: conserved binding sites for PU.1, SP1, CCAAT-box and TCF/LEF/SOX transcription factors within 5'-promoter region of mammalian FZD7 orthologs.

    PubMed

    Katoh, Masuko; Katoh, Masaru

    2007-03-01

    that the binding sites for PU.1, SP1/Krüppel-like, CCAAT-box, and TCF/LEF/SOX transcription factors were conserved among 5'-promoter regions of mammalian FZD7 orthologs. PMID:17273804

  17. Mineralocorticoid receptor interaction with SP1 generates a new response element for pathophysiologically relevant gene expression

    PubMed Central

    Meinel, Sandra; Ruhs, Stefanie; Schumann, Katja; Strätz, Nicole; Trenkmann, Kay; Schreier, Barbara; Grosse, Ivo; Keilwagen, Jens; Gekle, Michael; Grossmann, Claudia

    2013-01-01

    The mineralocorticoid receptor (MR) is a ligand-induced transcription factor belonging to the steroid receptor family and involved in water-electrolyte homeostasis, blood pressure regulation, inflammation and fibrosis in the renocardiovascular system. The MR shares a common hormone-response-element with the glucocorticoid receptor but nevertheless elicits MR-specific effects including enhanced epidermal growth factor receptor (EGFR) expression via unknown mechanisms. The EGFR is a receptor tyrosine kinase that leads to activation of MAP kinases, but that can also function as a signal transducer for other signaling pathways. In the present study, we mechanistically investigate the interaction between a newly discovered MR- but not glucocorticoid receptor- responsive-element (=MRE1) of the EGFR promoter, specificity protein 1 (SP1) and MR to gain general insights into MR-specificity. Biological relevance of the interaction for EGFR expression and consequently for different signaling pathways in general is demonstrated in human, rat and murine vascular smooth muscle cells and cells of EGFR knockout mice. A genome-wide promoter search for identical binding regions followed by quantitative PCR validation suggests that the identified MR-SP1–MRE1 interaction might be applicable to other genes. Overall, a novel principle of MR-specific gene expression is explored that applies to the pathophysiologically relevant expression of the EGFR and potentially also to other genes. PMID:23821666

  18. EFFECT MEASURE MODIFICATION OF BLOOD LEAD-AIR LEAD SLOPE FACTORS

    EPA Science Inventory

    Background: There is abundant literature finding that blood lead (PbB) levels are directly influenced by susceptibility factors including race and ethnicity, age, and housing. However, no study has explored how susceptibility factors influence the PbB-air lead (PbA) relationship...

  19. Nuclear receptors modulate the interaction of Sp1 and GC-rich DNA via ternary complex formation.

    PubMed Central

    Husmann, M; Dragneva, Y; Romahn, E; Jehnichen, P

    2000-01-01

    Binding sites for transcription factor Sp1 have been implicated in the transcriptional regulation of several genes by hormones or vitamins, and here we show that a GC-rich element contributes to the retinoic acid response of the interleukin 1beta promoter. To explain such observations, it has been proposed that nuclear receptors can interact with Sp1 bound to GC-rich DNA. However, evidence supporting this model has remained indirect. So far, nuclear receptors have not been detected in a complex with Sp1 and GC-rich DNA, and the expected ternary complexes in non-denaturing gels were not seen. In search for these missing links we found that nuclear receptors [retinoic acid receptor (RAR), thyroid hormone receptor (TR), vitamin D(3) receptor, peroxisome-proliferator-activated receptor and retinoic X receptor] induce an electrophoretic mobility increase of Sp1-GC-rich DNA complexes. Concomitantly, binding of Sp1 to the GC-box is enhanced. It is proposed that nuclear receptors may partially replace Sp1 in homo-oligomers at the GC-box. RARs and Sp1 can also combine into a complex with a retinoic acid-response element. The presence of RAR and Sp1 in complexes with either cognate site was revealed in supershift experiments. The C-terminus of Sp1 interacts with nuclear receptors. Both the ligand- and DNA-binding domains of the receptor are important for complex formation with Sp1 and GC-rich DNA. In spite of similar capacity to form ternary complexes, RAR but not TR up-regulated an Sp1-driven reporter in a ligand-dependent way. Thus additional factors limit the transcriptional response mediated by nuclear receptors and Sp1. PMID:11104684

  20. Physiological TLR5 expression in the intestine is regulated by differential DNA binding of Sp1/Sp3 through simultaneous Sp1 dephosphorylation and Sp3 phosphorylation by two different PKC isoforms.

    PubMed

    Thakur, Bhupesh Kumar; Dasgupta, Nirmalya; Ta, Atri; Das, Santasabuj

    2016-07-01

    Toll-like receptor 5 (TLR5) expression in the intestinal epithelial cells (IECs) is critical to maintain health, as underscored by multiple intestinal and extra-intestinal diseases in mice genetically engineered for IEC-specific TLR5 knockout. A gradient of expression exists in the colonic epithelial cells from the cecum to the distal colon. Intriguingly, an identical gradient for the dietary metabolite, butyrate also exists in the luminal contents. However, both being critical for intestinal homeostasis and immune response, no studies examined the role of butyrate in the regulation of TLR5 expression. We showed that butyrate transcriptionally upregulates TLR5 in the IECs and augments flagellin-induced immune responses. Both basal and butyrate-induced transcription is regulated by differential binding of Sp-family transcription factors to the GC-box sequences over the TLR5 promoter. Butyrate activates two different protein kinase C isoforms to dephosphorylate/acetylate Sp1 by serine/threonine phosphatases and phosphorylate Sp3 by ERK-MAPK, respectively. This resulted in Sp1 displacement from the promoter and binding of Sp3 to it, leading to p300 recruitment and histone acetylation, activating transcription. This is the first study addressing the mechanisms of physiological TLR5 expression in the intestine. Additionally, a novel insight is gained into Sp1/Sp3-mediated gene regulation that may apply to other genes. PMID:27060138

  1. Physiological TLR5 expression in the intestine is regulated by differential DNA binding of Sp1/Sp3 through simultaneous Sp1 dephosphorylation and Sp3 phosphorylation by two different PKC isoforms

    PubMed Central

    Thakur, Bhupesh Kumar; Dasgupta, Nirmalya; Ta, Atri; Das, Santasabuj

    2016-01-01

    Toll-like receptor 5 (TLR5) expression in the intestinal epithelial cells (IECs) is critical to maintain health, as underscored by multiple intestinal and extra-intestinal diseases in mice genetically engineered for IEC-specific TLR5 knockout. A gradient of expression exists in the colonic epithelial cells from the cecum to the distal colon. Intriguingly, an identical gradient for the dietary metabolite, butyrate also exists in the luminal contents. However, both being critical for intestinal homeostasis and immune response, no studies examined the role of butyrate in the regulation of TLR5 expression. We showed that butyrate transcriptionally upregulates TLR5 in the IECs and augments flagellin-induced immune responses. Both basal and butyrate-induced transcription is regulated by differential binding of Sp-family transcription factors to the GC-box sequences over the TLR5 promoter. Butyrate activates two different protein kinase C isoforms to dephosphorylate/acetylate Sp1 by serine/threonine phosphatases and phosphorylate Sp3 by ERK-MAPK, respectively. This resulted in Sp1 displacement from the promoter and binding of Sp3 to it, leading to p300 recruitment and histone acetylation, activating transcription. This is the first study addressing the mechanisms of physiological TLR5 expression in the intestine. Additionally, a novel insight is gained into Sp1/Sp3-mediated gene regulation that may apply to other genes. PMID:27060138

  2. Retinoid-induced apoptosis and Sp1 cleavage occur independently of transcription and require caspase activation.

    PubMed Central

    Piedrafita, F J; Pfahl, M

    1997-01-01

    Vitamin A and its derivatives, the retinoids, are essential regulators of many important biological functions, including cell growth and differentiation, development, homeostasis, and carcinogenesis. Natural retinoids such as all-trans retinoic acid can induce cell differentiation and inhibit growth of certain cancer cells. We recently identified a novel class of synthetic retinoids with strong anti-cancer cell activities in vitro and in vivo which can induce apoptosis in several cancer cell lines. Using an electrophoretic mobility shift assay, we analyzed the DNA binding activity of several transcription factors in T cells treated with apoptotic retinoids. We found that the DNA binding activity of the general transcription factor Sp1 is lost in retinoid-treated T cells undergoing apoptosis. A truncated Sp1 protein is detected by immunoblot analysis, and cytosolic protein extracts prepared from apoptotic cells contain a protease activity which specifically cleaves purified Sp1 in vitro. This proteolysis of Sp1 can be inhibited by N-ethylmaleimide and iodoacetamide, indicating that a cysteine protease mediates cleavage of Sp1. Furthermore, inhibition of Sp1 cleavage by ZVAD-fmk and ZDEVD-fmk suggests that caspases are directly involved in this event. In fact, caspases 2 and 3 are activated in T cells after treatment with apoptotic retinoids. The peptide inhibitors also blocked retinoid-induced apoptosis, as well as processing of caspases and proteolysis of Sp1 and poly(ADP-ribose) polymerase in intact cells. Degradation of Sp1 occurs early during apoptosis and is therefore likely to have profound effects on the basal transcription status of the cell. Interestingly, retinoid-induced apoptosis does not require de novo mRNA and protein synthesis, suggesting that a novel mechanism of retinoid signaling is involved, triggering cell death in a transcriptional activation-independent, caspase-dependent manner. PMID:9343396

  3. Age-specific risk factors for lead absorption in children

    SciTech Connect

    Walter, S.D.; Yankel, A.J.; von Lindern, I.H.

    1980-01-01

    The relationship of blood lead levels to environmental and individual characteristics is analyzed in a large sample of children residing near a lead smelting complex, with particular emphasis on the identification of age-related risk factors. Exceptional variation in both blood leads and its determinants within the study region facilitated the simultaneous detection of several significant risk factors for each year of age from 1 to 9 y. The strongest predictor of blood lead at all ages was air lead, but the secondary risk factors were age dependent. Household dustiness was significantly related to blood lead in young children, especially those under 2 y of age; soil lead may be an important source of ingested lead for children between 2 and 7 y. Other significant effects included that of pica at about 2 y of age, a slight effect of the occupational category of the fathers of 5- to 8-y-old children, and a tendency for 8- and 9-y-old boys to have higher blood leads than girls of the same age. Lead concentration in household paint was not a significant risk factor. These results suggest that a multifactorial approach to the prevention of excessive lead absorption by children is required.

  4. A novel functional interaction between the Sp1-like protein KLF13 and SREBP-Sp1 activation complex underlies regulation of low density lipoprotein receptor promoter function.

    PubMed

    Natesampillai, Sekar; Fernandez-Zapico, Martin E; Urrutia, Raul; Veldhuis, Johannes D

    2006-02-10

    Cholesterol homeostasis is regulated by a family of transcription factors designated sterol regulatory element-binding proteins (SREBPs). Precise control of SREBP-targeted genes requires additional interactions with co-regulatory transcription factors. In the case of the low density lipoprotein receptor (LDLR), SREBP cooperates with the specificity protein Sp1 to activate the promoter. In this report, we describe a novel pathway in LDLR transcriptional regulation distinct from the SREBP-Sp1 activation complex involving the Sp1-like protein Krueppel-like factor 13 (KLF13). Using a combination of RNA interference, electrophoretic mobility shift, chromatin immunoprecipitation, and reporter assays, deletion, and site-directed mutagenesis, we demonstrated that KLF13 mediates repression in a DNA context-selective manner. KLF13 repression of LDLR promoter activity appears to be needed to keep the receptor silent, a state that can be antagonized by Sp1, SREBP, and inhibitors of histone deacetylase activity. Chromatin immunoprecipitation assay confirmed that KLF13 binds proximal LDLR DNA sequences in vivo and that exogenous oxysterol up-regulates such binding. Together these studies identify a novel regulatory pathway in which gene repression by KLF13 must be overcome by the Sp1-SREBP complex to activate the LDLR promoter. Therefore, these data should replace a pre-existent and more simple paradigm that takes into consideration only the induction of the activator proteins Sp1-SREBP as necessary for LDLR promoter drive without including default repression, such as that by KLF13, of the LDLR gene. PMID:16303770

  5. Crosstalk of Sp1 and Stat3 signaling in pancreatic cancer pathogenesis

    PubMed Central

    Huang, Chen; Xie, Keping

    2012-01-01

    Pancreatic cancer progression is attributed to genetic and epigenetic alterations and a chaotic tumor microenvironment. Those diverse “upstream signal” factors appear to converge on specific sets of central nuclear regulators, namely, transcription factors. Specificity Protein 1 (Sp1) and signal transducer and activator of transcription 3 (Stat3) are central transcription factors that regulate a number of pathways important to tumorigenesis, including tumor cell-cycle progression, apoptosis, angiogenesis, metastasis, and evasion of the immune system. Recently, researchers demonstrated many types of crosstalk of Sp1 and Stat3 in tumor signal transduction and that these factors function cooperatively to activate targeted genes and promote tumorigenesis in pancreatic cancer. Therefore, targeting both Sp1 and Stat3 is a potential preventive and therapeutic strategy for pancreatic cancer. PMID:22342309

  6. Effect measure modification of blood lead-air lead slope factors.

    PubMed

    Richmond-Bryant, Jennifer; Meng, Qingyu; Cohen, Jonathan; Davis, J Allen; Svendsgaard, David; Brown, James S; Tuttle, Lauren; Hubbard, Heidi; Rice, Joann; Kirrane, Ellen; Vinikoor-Imler, Lisa; Kotchmar, Dennis; Hines, Erin; Ross, Mary

    2015-01-01

    There is abundant literature finding that susceptibility factors, including race and ethnicity, age, and housing, directly influence blood lead levels. No study has explored how susceptibility factors influence the blood lead-air lead relationship nationally. The objective is to evaluate whether susceptibility factors act as effect measure modifiers on the blood lead-air lead relationship. Participant level blood lead data from the 1999 to 2008 National Health and Nutrition Examination Survey were merged with air lead data from the US Environmental Protection Agency. Linear mixed effects models were run with and without an air lead interaction term for age group, sex, housing age, or race/ethnicity to determine whether these factors are effect measure modifiers for all ages combined and for five age brackets. Age group and race/ethnicity were determined to be effect measure modifiers in the all-age model and for some age groups. Being a child (1-5, 6-11, and 12-19 years) or of Mexican-American ethnicity increased the effect estimate. Living in older housing (built before 1950) decreased the effect estimate for all models except for the 1-5-year group, where older housing was an effect measure modifier. These results are consistent with the peer-reviewed literature of time-activity patterns, ventilation, and toxicokinetics. PMID:24961837

  7. EPAS-1 Mediates SP-1-Dependent FBI-1 Expression and Regulates Tumor Cell Survival and Proliferation

    PubMed Central

    Wang, Xiaogang; Cao, Peng; Li, Zhiqing; Wu, Dongyang; Wang, Xi; Liang, Guobiao

    2014-01-01

    Factor binding IST-1 (FBI-1) plays an important role in oncogenic transformation and tumorigenesis. As FBI-1 is over-expressed in multiple human cancers, the regulation of itself would provide new effective options for cancer intervention. In this work, we aimed to study the role that EPAS-1 plays in regulating FBI-1. We use the fact that specificity protein-1 (SP-1) is one of the crucial transcription factors of FBI-1, and that SP-1 can interact with the endothelial pas domain protein-1 (EPAS-1) for the induction of hypoxia related genes. The study showed that EPAS-1 plays an indispensible role in SP-1 transcription factor-mediated FBI-1 induction, and participated in tumor cell survival and proliferation. Thus, EPAS-1 could be a novel target for cancer therapeutics. PMID:25192290

  8. EPAS-1 mediates SP-1-dependent FBI-1 expression and regulates tumor cell survival and proliferation.

    PubMed

    Wang, Xiaogang; Cao, Peng; Li, Zhiqing; Wu, Dongyang; Wang, Xi; Liang, Guobiao

    2014-01-01

    Factor binding IST-1 (FBI-1) plays an important role in oncogenic transformation and tumorigenesis. As FBI-1 is over-expressed in multiple human cancers, the regulation of itself would provide new effective options for cancer intervention. In this work, we aimed to study the role that EPAS-1 plays in regulating FBI-1. We use the fact that specificity protein-1 (SP-1) is one of the crucial transcription factors of FBI-1, and that SP-1 can interact with the endothelial pas domain protein-1 (EPAS-1) for the induction of hypoxia related genes. The study showed that EPAS-1 plays an indispensible role in SP-1 transcription factor-mediated FBI-1 induction, and participated in tumor cell survival and proliferation. Thus, EPAS-1 could be a novel target for cancer therapeutics. PMID:25192290

  9. A Study of the Factors Leading English Teachers to Burnout

    ERIC Educational Resources Information Center

    Cephe, Pasa Tevfik

    2010-01-01

    This paper reports a research study carried out on teacher burnout with a group of English instructors (N=44) in order to identify the major factor(s) leading instructors to burnout at various levels. A survey research model was first applied to find out the instructors (N=37) with a burnout problem and categorize them at different levels of…

  10. Influence of social and environmental factors on dust, lead, hand lead, and blood lead levels in young children

    SciTech Connect

    Bornschein, R.L.; Succop, P.; Dietrich, K.N.; Clark, C.S.; Que Hee, S.; Hammond, P.B.

    1985-10-01

    The roles of environmental and behavioral factors in determining blood lead levels were studied in a cohort of young children living in an urban environment. The subjects were observed at 3-month intervals from birth to 24 months of age. Repeated measurements were made of the children's blood lead levels, environmental levels of lead in house dust, and in the dust found on the children's hands. A qualitative rating of the residence and of the socioeconomic status of the family was obtained. Interviews and direct observation of parent and child at home were used to evaluate various aspects of caretaker-child interactions. Data analysis consisted of a comparison of results obtained by (a) simple correlational analysis, (b) multiple regression analysis, and (c) structural equations analysis. The results demonstrated that structural equation modeling offers a useful approach to unraveling the complex interactions present in the data set. In this preliminary analysis, the suspected relationship between the levels of lead in house dust and on hands and the blood lead level was clearly demonstrated. Furthermore, the analyses indicated an important interplay between environmental sources and social factors in the determination of hand lead and blood lead levels in very young children.

  11. Risk factors for lead poisoning among Cuban refugee children.

    PubMed Central

    Trepka, Mary Jo; Pekovic, Vukosava; Santana, Juan Carlos; Zhang, Guoyan

    2005-01-01

    OBJECTIVES: This study was designed to explore whether parental activities such as repairing cars, welding, and rebuilding car batteries are risk factors for lead poisoning among Cuban refugee children in Miami-Dade County. METHODS: The authors performed a cross-sectional study of 479 children aged 12-83 months who had lived in Cuba during the six months prior to immigrating to the U.S. Lead levels were obtained, and parents provided information on demographics, home/neighborhood environment in Cuba prior to immigration, family/occupational factors prior to immigration, and child behavior factors. RESULTS: Of 479 children, 30 (6.3%) had elevated blood lead levels (EBLLs), defined as > or = 10 microg/dL, based on the Centers for Disease Control and Prevention action level. In multivariate analysis, racial/ethnic identification other than white, living in a home built after 1979, car repair in the home or yard, eating paint chips, and male sex were independently associated with EBLL. CONCLUSIONS: Risk factors for lead poisoning among immigrant children may differ from those among U.S.-born children. Screening of immigrant children who may have been exposed in their country of origin and education of immigrant parents about lead exposure hazards associated with activities such as car repair should be considered in the design of lead poisoning prevention and control programs. PMID:15842120

  12. Zac1, an Sp1-like protein, regulates human p21{sup WAF1/Cip1} gene expression in HeLa cells

    SciTech Connect

    Liu, Pei-Yao; Hsieh, Tsai-Yuan; Liu, Shu-Ting; Chang, Yung-Lung; Lin, Wei-Shiang; Wang, Wei-Ming; Huang, Shih-Ming

    2011-12-10

    Zac1 functions as both a transcription factor and a transcriptional cofactor for p53, nuclear receptors (NRs) and NR coactivators. Zac1 might also act as a transcriptional repressor via the recruitment of histone deacetylase 1 (HDAC1). The ability of Zac1 to interact directly with GC-specific elements indicates that Zac1 possibly binds to Sp1-responsive elements. In the present study, our data show that Zac1 is able to interact directly with the Sp1-responsive element in the p21{sup WAF1/Cip1} gene promoter and enhance the transactivation activity of Sp1 through direct physical interaction. Our data further demonstrate that Zac1 might enhance Sp1-specific promoter activity by interacting with the Sp1-responsive element, affecting the transactivation activity of Sp1 via a protein-protein interaction, or competing the HDAC1 protein away from the pre-existing Sp1/HDAC1 complex. Finally, the synergistic regulation of p21{sup WAF1/Cip1} gene expression by Zac1 and Sp1 is mediated by endogenous p53 protein and p53-responsive elements in HeLa cells. Our work suggests that Zac1 might serve as an Sp1-like protein that directly interacts with the Sp1-responsive element to oligomerize with and/or to coactivate Sp1.

  13. LPS induces IL-10 production by human alveolar macrophages via MAPKinases- and Sp1-dependent mechanisms

    PubMed Central

    Chanteux, Hugues; Guisset, Amélie C; Pilette, Charles; Sibille, Yves

    2007-01-01

    Background IL-10 is a cytokine mainly produced by macrophages that plays key roles in tolerance to inhaled antigens and in lung homeostasis. Its regulation in alveolar macrophages (HAM), the resident lung phagocytes, remains however unknown. Methods The present study investigated the role of intracellular signalling and transcription factors controlling the production of IL-10 in LPS-activated HAM from normal nonsmoking volunteers. Results LPS (1–1000 pg/ml) induced in vitro IL-10 production by HAM, both at mRNA and protein levels. LPS also activated the phosphorylation of ERK, p38 and JNK MAPkinases (immunoblots) and Sp-1 nuclear activity (EMSA). Selective inhibitors of MAPKinases (respectively PD98059, SB203580 and SP600125) and of Sp-1 signaling (mithramycin) decreased IL-10 expression in HAM. In addition, whilst not affecting IL-10 mRNA degradation, the three MAPKinase inhibitors completely abolished Sp-1 activation by LPS in HAM. Conclusion These results demonstrate for the first time that expression of IL-10 in lung macrophages stimulated by LPS depends on the concomitant activation of ERK, p38 and JNK MAPKinases, which control downstream signalling to Sp-1 transcription factor. This study further points to Sp-1 as a key signalling pathway for IL-10 expression in the lung. PMID:17916230

  14. Environmental Lead Exposure among Preschool Children in Shanghai, China: Blood Lead Levels and Risk Factors

    PubMed Central

    Wang, Yu; Yu, Guangjun; Yan, Chonghuai

    2014-01-01

    Objective To determine blood lead levels and to identify related risk factors among children in Shanghai; to explore the lead change trend of children after industrial transformation and to provide data for policy development to control environmental lead pollution in Shanghai. Methods A stratified-clustered-random sampling method was used. A tungsten atomizer absorption spectrophotometer was employed to determine blood lead levels. Results The arithmetic mean, geometric mean and median of blood lead levels of 0- to 6-year-old children from Shanghai were 22.49 µg/L, 19.65 µg/L and 19.5 µg/L, including 0.26% (6/2291) with concentrations ≥100 µg/L and 2.7% (61/2291) with concentrations ≥50 µg/L. Boys' levels (23.57 µg/L) were greater than those of girls (21.2 µg/L). The blood lead levels increased with age. This survey showed that the Chongming district was the highest and Yangpu district was the lowest, this result is completely opposite with the earlier survey in Shanghai. Risk factors for lead contamination included housing environment, parents' education levels, social status, hobbies, and children's nutritional status. Conclusions The blood lead levels of children in Shanghai were lower than the earlier data of Shanghai and those of published studies in China, but higher than the blood lead levels of developed countries. The blood lead levels of urban districts are higher than the central districts with the industrial transformation. Society and the government should take an active interest in childhood lead poisoning of urban areas. PMID:25436459

  15. Factors associated with blood lead concentrations of children in Jamaica

    PubMed Central

    RAHBAR, MOHAMMAD H.; SAMMS-VAUGHAN, MAUREEN; DICKERSON, AISHA S.; LOVELAND, KATHERINE A.; ARDJOMAND-HESSABI, MANOUCHEHR; BRESSLER, JAN; SHAKESPEARE-PELLINGTON, SYDONNIE; GROVE, MEGAN L.; BOERWINKLE, ERIC

    2015-01-01

    Lead is a heavy metal known to be detrimental to neurologic, physiologic, and behavioral health of children. Previous studies from Jamaica reported that mean lead levels in soil are four times that of lead levels in some other parts of the world. Other studies detected lead levels in fruits and root vegetables, which were grown in areas with lead contaminated soil. In this study, we investigate environmental factors associated with blood lead concentrations in Jamaican children. The participants in this study comprised 125 typically developing (TD) children (ages 2–8 years) who served as controls in an age- and sex-matched case-control study that enrolled children from 2009 – 2012 in Jamaica. We administered a questionnaire to assess demographic and socioeconomic information as well as potential exposures to lead through food. Using General Linear Models (GLMs), we identified factors associated with blood lead concentrations in Jamaican children. The geometric mean blood lead concentration (GMBLC) in the sample of children in this study was 2.80 μg/dL. In univariable GLM analyses, GMBLC was higher for children whose parents did not have education beyond high school compared to those whose parents had attained this level (3.00 μg/dL vs. 2.31 μg/dL; P = 0.05), children living near a high traffic road compared to those who did not (3.43 μg/dL vs. 2.52 μg/dL; P < 0.01), and children who reported eating ackee compared to those who did not eat this fruit (2.89 μg/dL vs. 1.65 μg/dL; P < 0.05). In multivariable analysis, living near a high traffic road was identified as an independent risk factor for higher adjusted GMBLC (3.05 μg/dL vs. 2.19 μg/dL; P = 0.01). While our findings indicate that GMBLC in Jamaican children has dropped by at least 62% during the past two decades, children living in Jamaica still have GMBLC that is twice that of children in more developed countries. In addition, we have identified significant risk factors for higher blood lead

  16. Investigation and Evaluation of Children's Blood Lead Levels around a Lead Battery Factory and Influencing Factors.

    PubMed

    Zhang, Feng; Liu, Yang; Zhang, Hengdong; Ban, Yonghong; Wang, Jianfeng; Liu, Jian; Zhong, Lixing; Chen, Xianwen; Zhu, Baoli

    2016-01-01

    Lead pollution incidents have occurred frequently in mainland China, which has caused many lead poisoning incidents. This paper took a battery recycling factory as the subject, and focused on measuring the blood lead levels of environmental samples and all the children living around the factory, and analyzed the relationship between them. We collected blood samples from the surrounding residential area, as well as soil, water, vegetables. The atomic absorption method was applied to measure the lead content in these samples. The basic information of the generation procedure, operation type, habit and personal protect equipment was collected by an occupational hygiene investigation. Blood lead levels in 43.12% of the subjects exceeded 100 μg/L. The 50th and the 95th percentiles were 89 μg/L and 232 μg/L for blood lead levels in children, respectively, and the geometric mean was 94 μg/L. Children were stratified into groups by age, gender, parents' occupation, distance and direction from the recycling plant. The difference of blood lead levels between groups was significant (p < 0.05). Four risk factors for elevated blood lead levels were found by logistic regression analysis, including younger age, male, shorter distance from the recycling plant, and parents with at least one working in the recycling plant. The rate of excess lead concentration in water was 6.25%, 6.06% in soil and 44.44% in leaf vegetables, which were all higher than the Chinese environment standards. The shorter the distance to the factory, the higher the value of BLL and lead levels in vegetable and environment samples. The lead level in the environmental samples was higher downwind of the recycling plant. PMID:27240393

  17. SEPARATING THE EFFECTS OF LEAD AND SOCIAL FACTORS ON IQ

    EPA Science Inventory

    Initial evaluations of 104 low-socioeconomic status black children screened by the local community health departments in North Carolina showed significant effects of lead in the range 6-59 micrograms/dl on IQ after controlling for concomitant social factors, such as socioeconomic...

  18. Teaching the Factors Affecting Resistance Using Pencil Leads

    ERIC Educational Resources Information Center

    Küçüközer, Asuman

    2015-01-01

    The aim of this paper is to provide a way of teaching the factors that affect resistance using mechanical pencil leads and the brightness of the light given out by a light bulb connected to an electrical circuit. The resistance of a conductor is directly proportional to its length (L) and inversely proportional to its cross-sectional area (A).…

  19. Integrated high-throughput analysis identifies Sp1 as a crucial determinant of p53-mediated apoptosis

    PubMed Central

    Li, H; Zhang, Y; Ströse, A; Tedesco, D; Gurova, K; Selivanova, G

    2014-01-01

    The restoration of p53 tumor suppressor function is a promising therapeutic strategy to combat cancer. However, the biological outcomes of p53 activation, ranging from the promotion of growth arrest to the induction of cell death, are hard to predict, which limits the clinical application of p53-based therapies. In the present study, we performed an integrated analysis of genome-wide short hairpin RNA screen and gene expression data and uncovered a previously unrecognized role of Sp1 as a central modulator of the transcriptional response induced by p53 that leads to robust induction of apoptosis. Sp1 is indispensable for the pro-apoptotic transcriptional repression by p53, but not for the induction of pro-apoptotic genes. Furthermore, the p53-dependent pro-apoptotic transcriptional repression required the co-binding of Sp1 to p53 target genes. Our results also highlight that Sp1 shares with p53 a common regulator, MDM2, which targets Sp1 for proteasomal degradation. This uncovers a new mechanism of the tight control of apoptosis in cells. Our study advances the understanding of the molecular basis of p53-mediated apoptosis and implicates Sp1 as one of its key modulators. We found that small molecules reactivating p53 can differentially modulate Sp1, thus providing insights into how to manipulate p53 response in a controlled way. PMID:24971482

  20. Overexpression of HDAC1 induces cellular senescence by Sp1/PP2A/pRb pathway

    SciTech Connect

    Chuang, Jian-Ying; Hung, Jan-Jong

    2011-04-15

    Highlights: {yields} Overexpression of HDAC1 induces Sp1 deacetylation and raises Sp1/p300 complex formation to bind to PP2Ac promoter. {yields} Overexpression of HDAC1 strongly inhibits the phosphorylation of pRb through up-regulation of PP2A. {yields} Overexpressed HDAC1 restrains cell proliferaction and induces cell senescence though a novel Sp1/PP2A/pRb pathway. -- Abstract: Senescence is associated with decreased activities of DNA replication, protein synthesis, and cellular division, which can result in deterioration of cellular functions. Herein, we report that the growth and division of tumor cells were significantly repressed by overexpression of histone deacetylase (HDAC) 1 with the Tet-off induced system or transient transfection. In addition, HDAC1 overexpression led to senescence through both an accumulation of hypophosphorylated active retinoblastoma protein (pRb) and an increase in the protein level of protein phosphatase 2A catalytic subunit (PP2Ac). HDAC1 overexpression also increased the level of Sp1 deacetylation and elevated the interaction between Sp1 and p300, and subsequently that Sp1/p300 complex bound to the promoter of PP2Ac, thus leading to induction of PP2Ac expression. Similar results were obtained in the HDAC1-Tet-off stable clone. Taken together, these results indicate that HDAC1 overexpression restrained cell proliferation and induced premature senescence in cervical cancer cells through a novel Sp1/PP2A/pRb pathway.

  1. Sp1 trans-activates the murine H(+)-K(+)-ATPase alpha(2)-subunit gene.

    PubMed

    Yu, Zhiyuan; Li, Mei; Zhang, Dongyu; Xu, William; Kone, Bruce C

    2009-07-01

    The H(+)-K(+)-ATPase alpha(2) (HKalpha2) gene of the renal collecting duct and distal colon plays a central role in potassium and acid-base homeostasis, yet its transcriptional control remains poorly characterized. We previously demonstrated that the proximal 177 bp of its 5'-flanking region confers basal transcriptional activity in murine inner medullary collecting duct (mIMCD3) cells and that NF-kappaB and CREB-1 bind this region to alter transcription. In the present study, we sought to determine whether the -144/-135 Sp element influences basal HKalpha2 gene transcription in these cells. Electrophoretic mobility shift and supershift assays using probes for -154/-127 revealed Sp1-containing DNA-protein complexes in nuclear extracts of mIMCD3 cells. Chromatin immunoprecipitation (ChIP) assays demonstrated that Sp1, but not Sp3, binds to this promoter region of the HKalpha2 gene in mIMCD3 cells in vivo. HKalpha2 minimal promoter-luciferase constructs with point mutations in the -144/-135 Sp element exhibited much lower activity than the wild-type promoter in transient transfection assays. Overexpression of Sp1, but not Sp3, trans-activated an HKalpha2 proximal promoter-luciferase construct in mIMCD3 cells as well as in SL2 insect cells, which lack Sp factors. Conversely, small interfering RNA knockdown of Sp1 inhibited endogenous HKalpha2 mRNA expression, and binding of Sp1 to chromatin associated with the proximal HKalpha2 promoter without altering the binding or regulatory influence of NF-kappaB p65 or CREB-1 on the proximal HKalpha2 promoter. We conclude that Sp1 plays an important and positive role in controlling basal HKalpha2 gene expression in mIMCD3 cells in vivo and in vitro. PMID:19420113

  2. Childhood lead poisoning in Brussels. Prevalence study and etiological factors

    NASA Astrophysics Data System (ADS)

    Claeys, F.; Sykes, C.; Limbos, C.; Ducoffre, G.

    2003-05-01

    The objectives of this study were twofold: firstly, to assess the frequency (prevalence) of childhood lead poisoning in some districts of Brussels and second, to identify within the dwellings the major source of lead as well as the risk factors connected with this intoxication. The study population (533 participants) was selected among children who visited childhood health centres in downtown Brussels. The reference group was chosen among children living outside Brussels city center. A casecontrol study was undertaken to meet the second objective of the investigation. The average blood lead level (PbB) was 104 μg/1 in the study population compared with 36 μg/l in the reference group. The 100 μg/l “non effect level" put forward by the Centres for Disease Control (CDC) and by the French legislation, is exceeded by 50% of the children living in this rundown environment. The major cause of intoxication is the presence of old lead-based paints in dwellings (Odd Ratio (OR): 4.4) constructed before 1940. Hand-to-mouth activity, pica activity (OR: 17.1) and a lack of hygiene are factors, which combined, promote intoxication. When the dwellings are undergoing renovation, this risk increases (OR: 7.2).

  3. Users guide for the ANL IBM SP1

    SciTech Connect

    Gropp, W.; Lusk, E.; Pieper, S.C.

    1994-10-01

    This guide presents the features of the IBM SP1 installed in the Mathematics and Computer Science Division at Argonne National Laboratory. The guide describes the available hardware and software, access policies, and hints for using the system productively.

  4. Transcriptional activation of human 12-lipoxygenase gene promoter is mediated through Sp1 consensus sites in A431 cells.

    PubMed Central

    Liu, Y W; Arakawa, T; Yamamoto, S; Chang, W C

    1997-01-01

    The functional 5' flanking region of the human 12-lipoxygenase in epidermoid carcinoma A431 cells was characterized. By a primer extension method, the transcription initiation sites were mapped at -47 adenosine, -48 guanosine and -55 guanosine upstream of the ATG translation start codon. Transient transfection with a series of 5' and 3' deletion constructs showed that the 5' flanking region spanning from -224 to -100 bp was important for the basal expression of 12-lipoxygenase gene. Gel mobility shift assays with antibodies of transcription factors showed that both Sp1 and Sp3 required highly GC-rich Sp1 sites within this region for binding. Disruption of two Sp1 recognition motifs residing at -158 to -150 bp and -123 to -114 bp by site-directed mutagenesis markedly reduced the basal 12-lipoxygenase promoter activity and abolished the retarded bands in a gel-shift assay, indicating that these two Sp1-binding sites were essential for gene expression. The same two Sp1-binding sites in this promoter region were also responsible for epidermal growth factor (EGF)-induced expression of 12-lipoxygenase gene. Moreover, EGF also induced the transcriptional activation of luciferase driven by SV40 early promoter, which contained rich Sp1-binding sites. Taken together, the results suggest that two specific Sp1 consensus sites are involved in the mediation of the basal promoter activity as well as EGF induction of the 12-lipoxygenase gene and that Sp1 and Sp3 transcription factors might have a role in their regulation. PMID:9164849

  5. Monoamine oxidase B levels are highly expressed in human gliomas and are correlated with the expression of HiF-1α and with transcription factors Sp1 and Sp3

    PubMed Central

    Sharpe, Martyn A.; Baskin, David S.

    2016-01-01

    Monoamine oxidases A and B (MAOA and MAOB) are highly expressed in many cancers. Here we investigated the level of MAOB in gliomas and confirmed its high expression. We found that MAOB levels correlated with tumor grade and hypoxia-inducible factor 1-alpha (HiF-1α) expression. HiF-1α was localized to the nuclei in high-grade gliomas, but it was primarily cytosolic in low-grade gliomas and normal human astrocytes. Expression of both glial fibrillary acidic protein (GFAP) and MAOB are correlated to HiF-1α expression levels. Levels of MAOB are correlated by the levels of transcription factor Sp3 in the majority of GBM examined, but this control of MAOB expression by Sp3 in low grade astrocytic gliomas is significantly different from control in the in the majority of glioblastomas. The current findings support previous suggestions that MAOB can be exploited for the killing of cancer cells. Selective cell toxicity can be achieved by designing non-toxic prodrugs that require MAOB for their catalytic conversion into mature cytotoxic chemotherapeutics. PMID:26689994

  6. Propensity for HBZ-SP1 isoform of HTLV-I to inhibit c-Jun activity correlates with sequestration of c-Jun into nuclear bodies rather than inhibition of its DNA-binding activity

    SciTech Connect

    Clerc, Isabelle; Hivin, Patrick; Rubbo, Pierre-Alain; Lemasson, Isabelle; Barbeau, Benoit; Mesnard, Jean-Michel

    2009-09-01

    HTLV-I bZIP factor (HBZ) contains a C-terminal zipper domain involved in its interaction with c-Jun. This interaction leads to a reduction of c-Jun DNA-binding activity and prevents the protein from activating transcription of AP-1-dependent promoters. However, it remained unclear whether the negative effect of HBZ-SP1 was due to its weak DNA-binding activity or to its capacity to target cellular factors to transcriptionally-inactive nuclear bodies. To answer this question, we produced a mutant in which specific residues present in the modulatory and DNA-binding domain of HBZ-SP1 were substituted for the corresponding c-Fos amino acids to improve the DNA-binding activity of the c-Jun/HBZ-SP1 heterodimer. The stability of the mutant, its interaction with c-Jun, DNA-binding activity of the resulting heterodimer, and its effect on the c-Jun activity were tested. In conclusion, we demonstrate that the repression of c-Jun activity in vivo is mainly due to the HBZ-SP1-mediated sequestration of c-Jun to the HBZ-NBs.

  7. Capsaicin sensitizes TRAIL-induced apoptosis through Sp1-mediated DR5 up-regulation: Involvement of Ca{sup 2+} influx

    SciTech Connect

    Moon, Dong-Oh; Kang, Chang-Hee; Kang, Sang-Hyuck; Choi, Yung-Hyun; Hyun, Jin-Won; Chang, Weon-Young; Kang, Hee-Kyoung; Koh, Young-Sang; Maeng, Young-Hee; Kim, Young-Ree; Kim, Gi-Young

    2012-02-15

    Although tumor necrosis factor-related apoptosis-inducing ligand (TRAIL) induces apoptosis in various malignant cells, several cancers including human hepatocellular carcinoma (HCC) exhibit potent resistance to TRAIL-induced cell death. The aim of this study is to evaluate the anti-cancer potential of capsaicin in TRAIL-induced cancer cell death. As indicated by assays that measure phosphatidylserine exposure, mitochondrial activity and activation of caspases, capsaicin potentiated TRAIL-resistant cells to lead to cell death. In addition, we found that capsaicin induces the cell surface expression of TRAIL receptor DR5, but not DR4 through the activation Sp1 on its promoter region. Furthermore, we investigated that capsaicin-induced DR5 expression and apoptosis are inhibited by calcium chelator or inhibitors for calmodulin-dependent protein kinase. Taken together, our data suggest that capsaicin sensitizes TRAIL-mediated HCC cell apoptosis by DR5 up-regulation via calcium influx-dependent Sp1 activation. Highlights: ► Capsaicin sensitizes TRAIL-induced apoptosis through activation of caspases. ► Capsaicin induces expression of DR5 through Sp1 activation. ► Capsaicin activates calcium signaling pathway.

  8. Teaching the Factors Affecting Resistance Using Pencil Leads

    NASA Astrophysics Data System (ADS)

    Küçüközer, Asuman

    2015-01-01

    The aim of this paper is to provide a way of teaching the factors that affect resistance using mechanical pencil leads and the brightness of the light given out by a light bulb connected to an electrical circuit. The resistance of a conductor is directly proportional to its length (L) and inversely proportional to its cross-sectional area (A). Additionally, the resistance depends on the type of conductor. Resistance R can be thus be expressed as R = ρL/A, where ρ is the resistivity of the conductor.

  9. Sp1 is essential and its position is important for p120 gene transcription: a 35 bp juxtaposed positive regulatory element enhances transcription 2.5 fold.

    PubMed Central

    Haidar, M A; Henning, D; Busch, H

    1991-01-01

    Human proliferating cell nucleolar antigen p120 is expressed in tumor cells in the early G1 phase of the cell cycle. Deletion analyses of the essential cis-acting region -537/-278 showed that a 58 bp sequence from -457 to -400 is an important cis-acting element. An Sp1 transcription factor binds to the sequence AGAGGCGGGG (-425 to -416) within the -458/-400 cis-acting region. Deletion of the Sp1 binding sequence eliminated transcription. Substitution of the Sp1 box(-437/-406), containing the Sp1 recognition site, for the entire cis-acting region (-537/-278) restored transcription only at a very low level (18%). Deletion of the -537/-278 cis-acting region followed by substitutions showed that the Sp1 box (-437/-406) stimulated transcription 2.4 fold, when juxtaposed and downstream of a 35 bp (-472 GGGCGAGCGTAAGTTCCGGGTGCGGCGGCCGACTA -438) positive regulatory cis-element (PRE) over that by substitution of the Sp1 box alone. When the -406/-278 sequence was downstream of the PRE-Sp1 box, transcription was stimulated 4.4 fold over that produced by substitution of the Sp1 box alone. These results suggest that Sp1 is essential and its proper position in the 5' flanking sequence, juxtaposed and down stream of a 35 bp positive regulatory sequence, is required for efficient transcription. Images PMID:1754393

  10. E-Ras improves the efficiency of reprogramming by facilitating cell cycle progression through JNK-Sp1 pathway.

    PubMed

    Kwon, Yoo-Wook; Jang, Seulgi; Paek, Jae-Seung; Lee, Jae-Woong; Cho, Hyun-Jai; Yang, Han-Mo; Kim, Hyo-Soo

    2015-11-01

    We have previously shown that pluripotent stem cells can be induced from adult somatic cells which were exposed to protein extracts isolated from mouse embryonic stem cells (mESC). Interestingly, generation of induced pluripotent stem (iPS) cells depended on the background of ES cell lines; possible by extracts from C57, but not from E14. Proteomic analysis of two different mES cell lines (C57 and E14) shows that embryonic Ras (E-Ras) is expressed differently in two mES cell lines; high level of E-Ras only in C57 mESC whose extracts allows iPS cells production from somatic cells. Here, we show that E-Ras augments the efficiency in reprogramming of fibroblast by promoting cell proliferation. We found that over-expression of E-Ras in fibroblast increased cell proliferation which was caused by specific up-regulation of cyclins D and E, not A or B, leading to the accelerated G1 to S phase transition. To figure out the common transcription factor of cyclins D and E, we used TRANSFAC database and selected SP1 as a candidate which was confirmed as enhancer of cyclins D and E by luciferase promoter assay using mutants. As downstream signaling pathways, E-Ras activated only c-Jun N-terminal kinases (JNK) but not ERK or p38. Inhibition of JNK prevented E-Ras-mediated induction of pSP1, cyclins D, E, and cell proliferation. Finally, E-Ras transduction to fibroblast enhanced the efficiency of iPS cell generation by 4 factors (Oct4/Klf4/Sox2/C-myc), which was prevented by JNK inhibitor. In conclusion, E-Ras stimulates JNK, enhances binding of Sp1 on the promoter of cyclins D and E, leading to cell proliferation. E-Ras/JNK axis is a critical mechanism to generate iPS cells by transduction of 4 factors or by treatment of mESC protein extracts. PMID:26413787

  11. Photon impact factor and k{sub T} factorization in the next-to-leading order

    SciTech Connect

    Ian Balitsky

    2012-12-01

    The photon impact factor for the BFKL pomeron is calculated in the next-to-leading order (NLO) approximation using the operator expansion in Wilson lines. The result is represented as a NLO k{sub T}-factorization formula for the structure functions of small-x deep inelastic scattering.

  12. Lead Concentrations in Inner-City Soils as a Factor in the Child Lead Problem.

    ERIC Educational Resources Information Center

    Mielke, Howard W.; And Others

    1983-01-01

    Excess lead concentration (resulting primarily from vehicular emissions) in Baltimore's inner city soils probably has a bearing on that city's child lead poisoning problem. Soil lead concentrations were lower outside the inner city. (GC)

  13. Women and Alcohol Use Disorders: Factors That Lead to Harm.

    PubMed

    Brighton, Renee; Moxham, Lorna; Traynor, Victoria

    2016-01-01

    Women, alcohol, and alcohol use disorders are underresearched topics when compared with the plethora of literature exploring male alcohol consumption and its related harms. It is time to change the fact that women are underrepresented in research and programs targeting alcohol use disorders. Given the changing patterns of alcohol consumption by women, coupled with the fact that women experience a telescoping effect in alcohol-related harms, it is time that increasing attention be paid to the way gender influences the experience of alcohol-related harms, including the development of alcohol use disorders. Recovery-orientated systems are not possible without the voices of the consumers being heard. With this in mind, the purposes of this article are to explore factors that lead to alcohol-related harm in women and to highlight the gender-specific barriers to service engagement. PMID:27580194

  14. Leading concentration correction to polymer dynamic self-structure factor

    NASA Astrophysics Data System (ADS)

    Perico, Angelo; La Ferla, Roberto; Freed, Karl F.

    1989-10-01

    The discrete chain representation of multiple scattering theory of the concentration dependence of the hydrodynamics of polymer solutions is applied to the calculation of the leading concentration correction to the dynamic structure factor S(k,t) and its first and second cumulants of individual labeled Gaussian chains in theta solutions at nonzero concentrations. Contributions are separated into those from overall translational and internal chain motions as well as couplings between different internal modes and between translation and internal modes, coupling that are introduced by interchain hydrodynamic interactions. The separate contributions are analyzed as a function of k and of t in order to isolate regions where certain contributions are dominant. As expected, short times and larger k tend to favor contributions from internal chain dynamics, while longer times and smaller k make concentration dependent translational effects predominate. Computations for shorter chains are extrapolated to provide the asymptotic long chain behavior.

  15. Pin1-mediated Sp1 phosphorylation by CDK1 increases Sp1 stability and decreases its DNA-binding activity during mitosis.

    PubMed

    Yang, Hang-Che; Chuang, Jian-Ying; Jeng, Wen-Yih; Liu, Chia-I; Wang, Andrew H-J; Lu, Pei-Jung; Chang, Wen-Chang; Hung, Jan-Jong

    2014-12-16

    We have shown that Sp1 phosphorylation at Thr739 decreases its DNA-binding activity. In this study, we found that phosphorylation of Sp1 at Thr739 alone is necessary, but not sufficient for the inhibition of its DNA-binding activity during mitosis. We demonstrated that Pin1 could be recruited to the Thr739(p)-Pro motif of Sp1 to modulate the interaction between phospho-Sp1 and CDK1, thereby facilitating CDK1-mediated phosphorylation of Sp1 at Ser720, Thr723 and Thr737 during mitosis. Loss of the C-terminal end of Sp1 (amino acids 741-785) significantly increased Sp1 phosphorylation, implying that the C-terminus inhibits CDK1-mediated Sp1 phosphorylation. Binding analysis of Sp1 peptides to Pin1 by isothermal titration calorimetry indicated that Pin1 interacts with Thr739(p)-Sp1 peptide but not with Thr739-Sp1 peptide. X-ray crystallography data showed that the Thr739(p)-Sp1 peptide occupies the active site of Pin1. Increased Sp1 phosphorylation by CDK1 during mitosis not only stabilized Sp1 levels by decreasing interaction with ubiquitin E3-ligase RNF4 but also caused Sp1 to move out of the chromosomes completely by decreasing its DNA-binding activity, thereby facilitating cell cycle progression. Thus, Pin1-mediated conformational changes in the C-terminal region of Sp1 are critical for increased CDK1-mediated Sp1 phosphorylation to facilitate cell cycle progression during mitosis. PMID:25398907

  16. Next-to-leading-order correction to pion form factor in k{sub T} factorization

    SciTech Connect

    Li Hsiangnan; Shen Yuelong; Wang Yuming; Zou Hao

    2011-03-01

    We calculate the next-to-leading-order (NLO) correction to the pion electromagnetic form factor at leading twist in the k{sub T} factorization theorem. Partons off-shell by k{sub T}{sup 2} are considered in both quark diagrams and effective diagrams for the transverse-momentum-dependent pion wave function. The light-cone singularities in the transverse-momentum-dependent pion wave function are regularized by rotating the Wilson lines away from the light cone. The soft divergences from gluon exchanges among initial- and fal-state partons cancel exactly. We derive the infrared-finite k{sub T}-dependent NLO hard kernel for the pion electromagnetic form factor by taking the difference of the above two sets of diagrams. Varying the renormalization and factorization scales, we find that the NLO correction is smaller, when both the scales are set to the invariant masses of internal particles: it becomes lower than 40% of the leading-order contribution for momentum transfer squared Q{sup 2}>7 GeV{sup 2}. It is observed that the NLO leading-twist correction does not play an essential role in explaining the experimental data, but the leading-order higher-twist contribution does.

  17. Lead

    MedlinePlus

    ... Lead Share Facebook Twitter Google+ Pinterest Contact Us Lead Poisoning is Preventable If your home was built before ... of the RRP rule. Read more . Learn about Lead Poisoning Prevention Week . Report Uncertified Contractors and Environmental Violations ...

  18. A cooperative interaction between NF-kappa B and Sp1 is required for HIV-1 enhancer activation.

    PubMed Central

    Perkins, N D; Edwards, N L; Duckett, C S; Agranoff, A B; Schmid, R M; Nabel, G J

    1993-01-01

    The human immunodeficiency virus (HIV-1) long terminal repeat (LTR) contains two binding sites for NF-kappa B in close proximity to three binding sites for the constitutive transcription factor, Sp1. Previously, stimulation of the HIV enhancer in response to mitogens has been attributed to the binding of NF-kappa B to the viral enhancer. In this report, we show that the binding of NF-kappa B is not by itself sufficient to induce HIV gene expression. Instead, a protein-protein interaction must occur between NF-kappa B and Sp1 bound to an adjacent site. Cooperativity both in DNA binding and in transcriptional activation of NF-kappa B and Sp1 was confirmed by electrophoretic mobility shift gel analysis, DNase footprinting, chemical cross-linking and transfection studies in vivo. With a heterologous promoter, we find that the interaction of NF-kappa B with Sp1 is dependent on orientation and position, and is not observed with other elements, including GATA, CCAAT or octamer. An increase in the spacing between the kappa B and Sp1 elements virtually abolishes this functional interaction, which is not restored when these sites are brought back into the same helical position. Several other promoters regulated by NF-kappa B also contain kappa B in proximity to Sp1 binding sites. These findings suggest that an interaction between NF-kappa B and Sp1 is required for inducible HIV-1 gene expression and may serve as a regulatory mechanism to activate specific viral and cellular genes. Images PMID:8253080

  19. Lead

    MedlinePlus

    ... obvious symptoms, it frequently goes unrecognized. CDC’s Childhood Lead Poisoning Prevention Program is committed to the Healthy People ... Lead Levels Information for Parents Tips for preventing lead poisoning About Us Overview of CDC’s Childhood Lead Poisoning ...

  20. Bortezomib induces DNA hypomethylation and silenced gene transcription by interfering with Sp1/NF-κB–dependent DNA methyltransferase activity in acute myeloid leukemia

    PubMed Central

    Liu, Shujun; Liu, Zhongfa; Xie, Zhiliang; Pang, Jiuxia; Yu, Jianhua; Lehmann, Esther; Huynh, Lenguyen; Vukosavljevic, Tamara; Takeki, Mitsui; Klisovic, Rebecca B.; Baiocchi, Robert A.; Blum, William; Porcu, Pierluigi; Garzon, Ramiro; Byrd, John C.; Perrotti, Danilo; Caligiuri, Michael A.; Chan, Kenneth K.; Wu, Lai-Chu

    2008-01-01

    Bortezomib reversibly inhibits 26S proteasomal degradation, interferes with NF-κB, and exhibits antitumor activity in human malignancies. Zinc finger protein Sp1 transactivates DNMT1 gene in mice and is functionally regulated through protein abundance, posttranslational modifications (ie, ubiquitination), or interaction with other transcription factors (ie, NF-κB). We hypothesize that inhibition of proteasomal degradation and Sp1/NF-κB–mediated transactivation may impair aberrant DNA methyltransferase activity. We show here that, in addition to inducing accumulation of polyubiquitinated proteins and abolishment of NF-κB activities, bortezomib decreases Sp1 protein levels, disrupts the physical interaction of Sp1/NF-κB, and prevents binding of the Sp1/NF-κB complex to the DNMT1 gene promoter. Abrogation of Sp1/NF-κB complex by bortezomib causes transcriptional repression of DNMT1 gene and down-regulation of DNMT1 protein, which in turn induces global DNA hypomethylation in vitro and in vivo and re-expression of epigenetically silenced genes in human cancer cells. The involvement of Sp1/NF-κB in DNMT1 regulation is further demonstrated by the observation that Sp1 knockdown using mithramycin A or shRNA decreases DNMT1 protein levels, which instead are increased by Sp1 or NF-κB overexpression. Our results unveil the Sp1/NF-κB pathway as a modulator of DNA methyltransferase activity in human cancer and identify bortezomib as a novel epigenetic-targeting drug. PMID:18083845

  1. Kaempferol stimulates gene expression of low-density lipoprotein receptor through activation of Sp1 in cultured hepatocytes

    PubMed Central

    Ochiai, Ayasa; Miyata, Shingo; Iwase, Masamori; Shimizu, Makoto; Inoue, Jun; Sato, Ryuichiro

    2016-01-01

    A high level of plasma low-density lipoprotein (LDL) cholesterol is considered a risk factor for atherosclerosis. Because the hepatic LDL receptor (LDLR) is essential for clearing plasma LDL cholesterol, activation of LDLR is a promising therapeutic target for patients with atherosclerotic disease. Here we demonstrated how the flavonoid kaempferol stimulated the gene expression and activity of LDLR in HepG2 cells. The kaempferol-mediated stimulation of LDLR gene expression was completely inhibited by knockdown of Sp1 gene expression. Treatment of HepG2 cells with kaempferol stimulated the recruitment of Sp1 to the promoter region of the LDLR gene, as well as the phosphorylation of Sp1 on Thr-453 and Thr-739. Moreover, these kaempferol-mediated processes were inhibited in the presence of U0126, an ERK pathway inhibitor. These results suggest that kaempferol may increase the activity of Sp1 through stimulation of Sp1 phosphorylation by ERK1/2 and subsequent induction of LDLR expression and activity. PMID:27109240

  2. Curcumin Suppresses Metastasis via Sp-1, FAK Inhibition, and E-Cadherin Upregulation in Colorectal Cancer.

    PubMed

    Chen, Chun-Chieh; Sureshbabul, Munisamy; Chen, Huei-Wen; Lin, Yu-Shuang; Lee, Jen-Yi; Hong, Qi-Sheng; Yang, Ya-Chien; Yu, Sung-Liang

    2013-01-01

    Colorectal cancer (CRC) is a serious public health problem that results due to changes of diet and various environmental stress factors in the world. Curcumin is a traditional medicine used for treatment of a wide variety of tumors. However, antimetastasis mechanism of curcumin on CRC has not yet been completely investigated. Here, we explored the underlying molecular mechanisms of curcumin on metastasis of CRC cells in vitro and in vivo. Curcumin significantly inhibits cell migration, invasion, and colony formation in vitro and reduces tumor growth and liver metastasis in vivo. We found that curcumin suppresses Sp-1 transcriptional activity and Sp-1 regulated genes including ADEM10, calmodulin, EPHB2, HDAC4, and SEPP1 in CRC cells. Curcumin inhibits focal adhesion kinase (FAK) phosphorylation and enhances the expressions of several extracellular matrix components which play a critical role in invasion and metastasis. Curcumin reduces CD24 expression in a dose-dependent manner in CRC cells. Moreover, E-cadherin expression is upregulated by curcumin and serves as an inhibitor of EMT. These results suggest that curcumin executes its antimetastasis function through downregulation of Sp-1, FAK, and CD24 and by promoting E-cadherin expression in CRC cells. PMID:23970932

  3. Curcumin Suppresses Metastasis via Sp-1, FAK Inhibition, and E-Cadherin Upregulation in Colorectal Cancer

    PubMed Central

    Chen, Chun-Chieh; Sureshbabul, Munisamy; Chen, Huei-Wen; Lin, Yu-Shuang; Lee, Jen-Yi; Hong, Qi-Sheng; Yang, Ya-Chien

    2013-01-01

    Colorectal cancer (CRC) is a serious public health problem that results due to changes of diet and various environmental stress factors in the world. Curcumin is a traditional medicine used for treatment of a wide variety of tumors. However, antimetastasis mechanism of curcumin on CRC has not yet been completely investigated. Here, we explored the underlying molecular mechanisms of curcumin on metastasis of CRC cells in vitro and in vivo. Curcumin significantly inhibits cell migration, invasion, and colony formation in vitro and reduces tumor growth and liver metastasis in vivo. We found that curcumin suppresses Sp-1 transcriptional activity and Sp-1 regulated genes including ADEM10, calmodulin, EPHB2, HDAC4, and SEPP1 in CRC cells. Curcumin inhibits focal adhesion kinase (FAK) phosphorylation and enhances the expressions of several extracellular matrix components which play a critical role in invasion and metastasis. Curcumin reduces CD24 expression in a dose-dependent manner in CRC cells. Moreover, E-cadherin expression is upregulated by curcumin and serves as an inhibitor of EMT. These results suggest that curcumin executes its antimetastasis function through downregulation of Sp-1, FAK, and CD24 and by promoting E-cadherin expression in CRC cells. PMID:23970932

  4. PTEN downregulates p75NTR expression by decreasing DNA-binding activity of Sp1

    SciTech Connect

    Rankin, Sherri L.; Guy, Clifford S.; Mearow, Karen M.

    2009-02-13

    p75NTR is expressed throughout the nervous system and its dysregulation is associated with pathological conditions. We have recently demonstrated a signalling cascade initiated by laminin (LN), which upregulates PTEN and downregulates p75NTR. Here we investigate the mechanism by which PTEN modulates p75NTR. Studies using PTEN mutants show that its protein phosphatase activity directly modulates p75NTR protein expression. Nuclear relocalization of PTEN subsequent to LN stimulation suggests transcriptional control of p75NTR expression, which was confirmed following EMSA and ChIP analysis of Sp1 transcription factor binding activity. LN and PTEN independently decrease the DNA-binding ability of PTEN to the p75NTR promoter. Sp1 regulation of p75NTR occurs via dephosphorylation of Sp1, thus reducing p75NTR transcription and protein expression. This mechanism represents a novel regulatory pathway which controls the expression level of a receptor with broad implications not only for the development of the nervous system but also for progression of pathological conditions.

  5. Proto-oncogene FBI-1 represses transcription of p21CIP1 by inhibition of transcription activation by p53 and Sp1.

    PubMed

    Choi, Won-Il; Jeon, Bu-Nam; Yun, Chae-Ok; Kim, Pyung-Hwan; Kim, Sung-Eun; Choi, Kang-Yell; Kim, Se Hoon; Hur, Man-Wook

    2009-05-01

    Aberrant transcriptional repression through chromatin remodeling and histone deacetylation has been postulated as the driving force for tumorigenesis. FBI-1 (formerly called Pokemon) is a member of the POK family of transcriptional repressors. Recently, FBI-1 was characterized as a critical oncogenic factor that specifically represses transcription of the tumor suppressor gene ARF, potentially leading indirectly to p53 inactivation. Our investigations on transcriptional repression of the p53 pathway revealed that FBI-1 represses transcription of ARF, Hdm2 (human analogue of mouse double minute oncogene), and p21CIP1 (hereafter indicated as p21) but not of p53. FBI-1 showed a more potent repressive effect on p21 than on p53. Our data suggested that FBI-1 is a master controller of the ARF-Hdm2-p53-p21 pathway, ultimately impinging on cell cycle arrest factor p21, by inhibiting upstream regulators at the transcriptional and protein levels. FBI-1 acted as a competitive transcriptional repressor of p53 and Sp1 and was shown to bind the proximal Sp1-3 GC-box and the distal p53-responsive elements of p21. Repression involved direct binding competition of FBI-1 with Sp1 and p53. FBI-1 also interacted with corepressors, such as mSin3A, NCoR, and SMRT, thereby deacetylating Ac-H3 and Ac-H4 histones at the promoter. FBI-1 caused cellular transformation, promoted cell cycle proliferation, and significantly increased the number of cells in S phase. FBI-1 is aberrantly overexpressed in many human solid tumors, particularly in adenocarcinomas and squamous carcinomas. The role of FBI-1 as a master controller of the p53 pathway therefore makes it an attractive therapeutic target. PMID:19244234

  6. Proto-oncogene FBI-1 Represses Transcription of p21CIP1 by Inhibition of Transcription Activation by p53 and Sp1*S⃞

    PubMed Central

    Choi, Won-Il; Jeon, Bu-Nam; Yun, Chae-Ok; Kim, Pyung-Hwan; Kim, Sung-Eun; Choi, Kang-Yell; Kim, Se Hoon; Hur, Man-Wook

    2009-01-01

    Aberrant transcriptional repression through chromatin remodeling and histone deacetylation has been postulated as the driving force for tumorigenesis. FBI-1 (formerly called Pokemon) is a member of the POK family of transcriptional repressors. Recently, FBI-1 was characterized as a critical oncogenic factor that specifically represses transcription of the tumor suppressor gene ARF, potentially leading indirectly to p53 inactivation. Our investigations on transcriptional repression of the p53 pathway revealed that FBI-1 represses transcription of ARF, Hdm2 (human analogue of mouse double minute oncogene), and p21CIP1 (hereafter indicated as p21) but not of p53. FBI-1 showed a more potent repressive effect on p21 than on p53. Our data suggested that FBI-1 is a master controller of the ARF-Hdm2-p53-p21 pathway, ultimately impinging on cell cycle arrest factor p21, by inhibiting upstream regulators at the transcriptional and protein levels. FBI-1 acted as a competitive transcriptional repressor of p53 and Sp1 and was shown to bind the proximal Sp1–3 GC-box and the distal p53-responsive elements of p21. Repression involved direct binding competition of FBI-1 with Sp1 and p53. FBI-1 also interacted with corepressors, such as mSin3A, NCoR, and SMRT, thereby deacetylating Ac-H3 and Ac-H4 histones at the promoter. FBI-1 caused cellular transformation, promoted cell cycle proliferation, and significantly increased the number of cells in S phase. FBI-1 is aberrantly overexpressed in many human solid tumors, particularly in adenocarcinomas and squamous carcinomas. The role of FBI-1 as a master controller of the p53 pathway therefore makes it an attractive therapeutic target. PMID:19244234

  7. Functional Interactions between C/EBP, Sp1, and COUP-TF Regulate Human Immunodeficiency Virus Type 1 Gene Transcription in Human Brain Cells

    PubMed Central

    Schwartz, Christian; Catez, Philippe; Rohr, Olivier; Lecestre, Dominique; Aunis, Dominique; Schaeffer, Evelyne

    2000-01-01

    Human immunodeficiency virus type 1 (HIV-1) infects the central nervous system (CNS) and plays a direct role in the pathogenesis of AIDS dementia. However, mechanisms underlying HIV-1 gene expression in the CNS are poorly understood. The importance of CCAAT/enhancer binding proteins (C/EBP) for HIV-1 expression in cells of the immune system has been recently reported. In this study, we have examined the role and the molecular mechanisms by which proteins of the C/EBP family regulate HIV-1 gene transcription in human brain cells. We found that NF-IL6 acts as a potent activator of the long terminal repeat (LTR)-driven transcription in microglial and oligodendroglioma cells. In contrast, C/EBPγ inhibits NF-IL6-induced activation. Consistent with previous data, our transient expression results show cell-type-specific NF-IL6-mediated transactivation. In glial cells, full activation needs the presence of the C/EBP binding sites; however, NF-IL6 is still able to function via the minimal −40/+80 region. In microglial cells, C/EBP sites are not essential, since NF-IL6 acts through the −68/+80 LTR region, containing two binding sites for the transcription factor Sp1. Moreover, we show that functional interactions between NF-IL6 and Sp1 lead to synergistic transcriptional activation of the LTR in oligodendroglioma and to mutual repression in microglial cells. We further demonstrate that NF-IL6 physically interacts with the nuclear receptor chicken ovalbumin upstream promoter transcription factor (COUP-TF), via its DNA binding domain, in vitro and in cells, which results in mutual transcriptional repression. These findings reveal how the interplay of NF-IL6 and C/EBPγ, together with Sp1 and COUP-TF, regulates HIV-1 gene transcription in brain cells. PMID:10590092

  8. On the trajectories of Sp(1) -Kepler problems

    NASA Astrophysics Data System (ADS)

    Meng, Guowu

    2015-10-01

    The classical Sp(1) -Kepler problems are formulated with the help of an idea from S. Sternberg. The trajectories of these models are determined via an idea originated from Levi-Civita. It is found that, for a non-colliding trajectory, its shadow-its projection to the external configuration space-is an ellipse, a parabola or a branch of hyperbola according as the total energy is negative, zero or positive. Moreover, it is shown that, for the Sp(1) -Kepler problems at level n ≥ 2, the group SL(n, H) ×R+ acts transitively on both the set of elliptic shadow trajectories and the set of parabolic shadow trajectories.

  9. Lead poisoning and other mortality factors in trumpeter swans

    USGS Publications Warehouse

    Blus, L.J.; Stroud, R.K.; Reiswig, B.; McEneaney, T.

    1989-01-01

    Lead poisoning and other causes of mortality of trumpeter swans were investigated. Necropsies or Pb concentrations in livers were available for 72 trumpeter swans found dead in seven western states from 1976 to 1987; data from other published and unpublished sources also are summarized. Ingestion of lead artifacts accounted for about 20% of the known mortality of trumpeter swans in the tri-state area of Idaho, Montana and Wyoming, where the population has been declining for several decades.

  10. Factors affecting lead release in sodium silicate-treated partial lead service line replacements.

    PubMed

    Zhou, Emily; Payne, Sarah Jane O; Hofmann, Ron; Andrews, Robert C

    2015-01-01

    Water quality parameters affecting sodium silicate performance in partial lead service line replacements were examined using a fractional factorial experimental design and static pipe systems. An external copper wire was used to create a galvanic connection between a former lead service line and a new copper pipe. The pipe systems were filled with lab prepared water made to mimic real water quality. Water was changed on a three times per week basis. A 2(4-1) fractional factorial design was used to evaluate the impact of alkalinity (15 mg L(-1) or 250 mg L(-1) as CaCO3), nitrate (1 mg L(-1) or 7 mg L(-1) as N), natural organic matter (1 mg L(-1) or 7 mg L(-1) as dissolved organic carbon), and disinfectant type (1 mg L(-1) chlorine or 3 mg L(-1) monochloramine), resulting in eight treatment conditions. Fractional factorial analysis revealed that alkalinity, natural organic matter and monochloramine had a significant positive effect on galvanic current. Natural organic matter and monochloramine also had a significant positive effect with respect to both total and dissolved lead release. For the treatment conditions examined, 67-98% of the lead released through galvanic currents was stored as corrosion scales and predominantly comprised of particulate lead (96.1-99.9%) for all eight treatments. The use of monochloramine and the presence of natural organic matter (7 mg L(-1)) were not favourable for corrosion control in sodium silicate-treated partial lead service line replacements, although further studies would be required to characterize optimal water quality parameters for specific water quality types. For utilities operating with sodium silicate as a corrosion inhibitor, this work offers further evidence regarding the consideration of chlorine as a secondary disinfectant instead of monochloramine, as well as the value of controlling natural organic matter in distributed water. PMID:26061205

  11. Synthetic retinoid Am80 up-regulates apelin expression by promoting interaction of RARα with KLF5 and Sp1 in vascular smooth muscle cells.

    PubMed

    Lv, Xin-Rui; Zheng, Bin; Li, Shu-Ya; Han, Ai-Li; Wang, Chang; Shi, Jian-Hong; Zhang, Xin-Hua; Liu, Yan; Li, Yong-Hui; Wen, Jin-Kun

    2013-11-15

    Previous studies have demonstrated that both retinoids and apelin possess potent cardiovascular properties and that retinoids can mediate the expression of many genes in the cardiovascular system. However, it is not clear whether and how retinoids regulate apelin expression in rat VSMCs (vascular smooth muscle cells). In the present study, we investigated the molecular mechanism of apelin expression regulation by the synthetic retinoid Am80 in VSMCs. The results showed that Am80 markedly up-regulated apelin mRNA and protein levels in VSMCs. Furthermore, KLF5 (Krüppel-like factor 5) and Sp1 (stimulating protein-1) co-operatively mediated Am80-induced apelin expression through their direct binding to the TCE (transforming growth factor-β control element) on the apelin promoter. Interestingly, upon Am80 stimulation, the RARα (retinoic acid receptor α) was recruited to the apelin promoter by interacting with KLF5 and Sp1 prebound to the TCE site of the apelin promoter to form a transcriptional activation complex, subsequently leading to the up-regulation of apelin expression in VSMCs. An in vivo study indicated that Am80 increased apelin expression in balloon-injured arteries of rats, consistent with the results from the cultured VSMCs. Thus the results of the present study describe a novel mechanism of apelin regulation by Am80 and further expand the network of RARα in the retinoid pathway. PMID:23992409

  12. Factors Leading to Students' Satisfaction in the Higher Learning Institutions

    ERIC Educational Resources Information Center

    Siming, Luo; Niamatullah; Gao, Jianying; Xu, Dan; Shaf, Khurrum

    2015-01-01

    There is an increasing need to understand factors that affect satisfaction of students with learning. This study will explore the relationship between student satisfaction and teacher-student relationship, teacher preparedness, campus support facilities and experiences provided by the institute to the students. Study is a necessary activity that…

  13. Blood lead levels and risk factors for lead toxicity in children from schools and an urban slum in Delhi.

    PubMed

    Kalra, Veena; Chitralekha, K T; Dua, Tarun; Pandey, R M; Gupta, Yogesh

    2003-04-01

    This cross-sectional study was conducted to estimate the mean blood lead levels (BLL) and prevalence of lead toxicity in a representative sample of schoolchildren and children residing in an urban slum. In addition, the association of potential environmental risk factors with elevated BLL was studied. Children aged 4-6 years were selected from schools of the South zone of Delhi (n = 125) and from an urban slum (n = 65). Risk factors were recorded using a pre-tested questionnaire and blood lead and zinc protoporphyrin (ZPP) levels were estimated. The mean BLL was 7.8 microg/dl (SD 3.9) and the proportion of children with blood lead > or = 10 microg/dl was 18.4 per cent. Distance of the residence or school from a main road appeared to be associated with higher blood lead concentrations, but these differences were not statistically significant. In our setting, vehicular pollution may be a major contributing factor in lead contamination of the environment. PMID:12729296

  14. Impact of developmental lead exposure on splenic factors

    SciTech Connect

    Kasten-Jolly, Jane; Heo, Yong; Lawrence, David A.

    2010-09-01

    Lead (Pb) is known to alter the functions of numerous organ systems, including the hematopoietic and immune systems. Pb can induce anemia and can lower host resistance to bacterial and viral infections. The anemia is due to Pb's inhibition of hemoglobin synthesis and Pb's induction of membrane changes, leading to early erythrocyte senescence. Pb also increases B-cell activation/proliferation and skews T-cell help (Th) toward Th2 subset generation. The specific mechanisms for many of the Pb effects are, as yet, not completely understood. Therefore, we performed gene expression analysis, via microarray, on RNA from the spleens of developmentally Pb-exposed mice, in order to gain further insight into these Pb effects. Splenic RNA microarray analysis indicated strong up-regulation of genes coding for proteolytic enzymes, lipases, amylase, and RNaseA. The data also showed that Pb affected the expression of many genes associated with innate immunity. Analysis of the microarray results via GeneSifter software indicated that Pb increased apoptosis, B-cell differentiation, and Th2 development. Direct up-regulation by Pb of expression of the gene encoding the heme-regulated inhibitor (HRI) suggested that Pb can decrease erythropoiesis by blocking globin mRNA translation. Pb's high elevation of digestive/catabolizing enzymes could generate immunogenic self peptides. With Pb's potential to induce new self-peptides and to enhance the expression of caspases, cytokines, and other immunomodulators, further evaluation of Pb's involvement in autoimmune phenomena, especially Th2-mediated autoantibody production, and alteration of organ system activities is warranted.

  15. Investigation and Evaluation of Children’s Blood Lead Levels around a Lead Battery Factory and Influencing Factors

    PubMed Central

    Zhang, Feng; Liu, Yang; Zhang, Hengdong; Ban, Yonghong; Wang, Jianfeng; Liu, Jian; Zhong, Lixing; Chen, Xianwen; Zhu, Baoli

    2016-01-01

    Lead pollution incidents have occurred frequently in mainland China, which has caused many lead poisoning incidents. This paper took a battery recycling factory as the subject, and focused on measuring the blood lead levels of environmental samples and all the children living around the factory, and analyzed the relationship between them. We collected blood samples from the surrounding residential area, as well as soil, water, vegetables. The atomic absorption method was applied to measure the lead content in these samples. The basic information of the generation procedure, operation type, habit and personal protect equipment was collected by an occupational hygiene investigation. Blood lead levels in 43.12% of the subjects exceeded 100 μg/L. The 50th and the 95th percentiles were 89 μg/L and 232 μg/L for blood lead levels in children, respectively, and the geometric mean was 94 μg/L. Children were stratified into groups by age, gender, parents’ occupation, distance and direction from the recycling plant. The difference of blood lead levels between groups was significant (p < 0.05). Four risk factors for elevated blood lead levels were found by logistic regression analysis, including younger age, male, shorter distance from the recycling plant, and parents with at least one working in the recycling plant. The rate of excess lead concentration in water was 6.25%, 6.06% in soil and 44.44% in leaf vegetables, which were all higher than the Chinese environment standards. The shorter the distance to the factory, the higher the value of BLL and lead levels in vegetable and environment samples. The lead level in the environmental samples was higher downwind of the recycling plant. PMID:27240393

  16. Mortality factors and lead contamination of wild birds from Korea.

    PubMed

    Nam, Dong-Ha; Lee, Doo-Pyo

    2011-07-01

    Wild birds have frequently been found dead in their natural habitats, but little is known about what ecological stressors may impact health of wild populations. Here, we report the potentially harmful lead (Pb) levels in tissues along with necropsies on 69 individuals of cranes, raptors, and waterfowl found dead between 2000 and 2003 in Korea. In all samples diagnosed, trauma (n = 22), severe emaciation (n = 15), and infectious diseases (n = 11) were identified. In the survey, injury with Pb shot or bullet fragments was associated with three of the deaths; one of three showed lesions suggestive of Pb poisoning in the tissues. Of 69 birds, 12 had >25 ppm dry wt. (equivalent to 8 ppm wet wt.) in liver or kidney, which is known to be a potentially lethal level of Pb in wild birds. Three individuals had hepatic Pb levels of 101.3 ppm (Whooper swan), 120.4 ppm (Great white-fronted goose), and 1,059 ppm (Mandarin duck), with evidence of Pb pellets in their gizzard. This study suggests that many birds examined may be suffering from excessive Pb exposure that may be of health concern with respect to a potential cause of their mortality. The need for additional research is heightened when considering that some migrants are classified as a globally protected species by the International Union for the Conservation of Nature. PMID:20824331

  17. Methylation Status of SP1 Sites within miR-23a-27a-24-2 Promoter Region Influences Laryngeal Cancer Cell Proliferation and Apoptosis

    PubMed Central

    Wang, Ye; Zhang, Zhao-Xiong; Chen, Sheng; Qiu, Guang-Bin; Xu, Zhen-Ming

    2016-01-01

    DNA methylation plays critical roles in regulation of microRNA expression and function. miR-23a-27a-24-2 cluster has various functions and aberrant expression of the cluster is a common event in many cancers. However, whether DNA methylation influences the cluster expression and function is not reported. Here we found a CG-rich region spanning two SP1 sites in the cluster promoter region. The SP1 sites in the cluster were demethylated and methylated in Hep2 cells and HEK293 cells, respectively. Meanwhile, the cluster was significantly upregulated and downregulated in Hep2 cells and HEK293 cells, respectively. The SP1 sites were remethylated and the cluster was significantly downregulated in Hep2 cells into which methyl donor, S-adenosyl-L-methionine, was introduced. Moreover, S-adenosyl-L-methionine significantly increased Hep2 cell viability and repressed Hep2 cell early apoptosis. We also found that construct with two SP1 sites had highest luciferase activity and SP1 specifically bound the gene cluster promoter in vitro. We conclude that demethylated SP1 sites in miR-23a-27a-24-2 cluster upregulate the cluster expression, leading to proliferation promotion and early apoptosis inhibition in laryngeal cancer cells. PMID:27099864

  18. Life Cycle Reversal in Aurelia sp.1 (Cnidaria, Scyphozoa)

    PubMed Central

    He, Jinru; Zheng, Lianming; Zhang, Wenjing; Lin, Yuanshao

    2015-01-01

    The genus Aurelia is one of the major contributors to jellyfish blooms in coastal waters, possibly due in part to hydroclimatic and anthropogenic causes, as well as their highly adaptive reproductive traits. Despite the wide plasticity of cnidarian life cycles, especially those recognized in certain Hydroza species, the known modifications of Aurelia life history were mostly restricted to its polyp stage. In this study, we document the formation of polyps directly from the ectoderm of degenerating juvenile medusae, cell masses from medusa tissue fragments, and subumbrella of living medusae. This is the first evidence for back-transformation of sexually mature medusae into polyps in Aurelia sp.1. The resulting reconstruction of the schematic life cycle of Aurelia reveals the underestimated potential of life cycle reversal in scyphozoan medusae, with possible implications for biological and ecological studies. PMID:26690755

  19. SENP3 regulates the global protein turnover and the Sp1 level via antagonizing SUMO2/3-targeted ubiquitination and degradation.

    PubMed

    Wang, Ming; Sang, Jing; Ren, Yanhua; Liu, Kejia; Liu, Xinyi; Zhang, Jian; Wang, Haolu; Wang, Jian; Orian, Amir; Yang, Jie; Yi, Jing

    2016-01-01

    SUMOylation is recently found to function as a targeting signal for the degradation of substrates through the ubiquitin-proteasome system. RNF4 is the most studied human SUMO-targeted ubiquitin E3 ligase. However, the relationship between SUMO proteases, SENPs, and RNF4 remains obscure. There are limited examples of the SENP regulation of SUMO2/3-targeted proteolysis mediated by RNF4. The present study investigated the role of SENP3 in the global protein turnover related to SUMO2/3-targeted ubiquitination and focused in particular on the SENP3 regulation of the stability of Sp1. Our data demonstrated that SENP3 impaired the global ubiquitination profile and promoted the accumulation of many proteins. Sp1, a cancer-associated transcription factor, was among these proteins. SENP3 increased the level of Sp1 protein via antagonizing the SUMO2/3-targeted ubiquitination and the consequent proteasome-dependent degradation that was mediated by RNF4. De-conjugation of SUMO2/3 by SENP3 attenuated the interaction of Sp1 with RNF4. In gastric cancer cell lines and specimens derived from patients and nude mice, the level of Sp1 was generally increased in parallel to the level of SENP3. These results provided a new explanation for the enrichment of the Sp1 protein in various cancers, and revealed a regulation of SUMO2/3 conjugated proteins whose levels may be tightly controlled by SENP3 and RNF4. PMID:26511642

  20. Sp1/3 and NF-1 mediate basal transcription of the human P2X1 gene in megakaryoblastic MEG-01 cells

    PubMed Central

    Zhao, Jiangqin; Ennion, Steven J

    2006-01-01

    Background P2X1 receptors play an important role in platelet function as they can induce shape change, granule centralization and are also involved in thrombus formation. As platelets have no nuclei, the level of P2X1 expression depends on transcriptional regulation in megakaryocytes, the platelet precursor cell. Since nothing is known about the molecular mechanisms regulating megakaryocytic P2X1 expression, this study aimed to identify and functionally characterize the P2X1 core promoter utilized in the human megakaryoblastic cell line MEG-01. Results In order to identify cis-acting elements involved in the transcriptional regulation of P2X1 expression, the ability of 4.7 kb P2X1 upstream sequence to drive luciferase reporter gene expression was tested. Low promoter activity was detected in proliferating MEG-01 cells. This activity increased 20-fold after phorbol-12-myristate-13-acetate (PMA) induced differentiation. A transcription start site was detected 365 bp upstream of the start codon by primer extension. Deletion analysis of reporter constructs indicated a core promoter located within the region -68 to +149 bp that contained two Sp1 sites (named Sp1a and Sp1b) and an NF-1 site. Individual mutations of Sp1b or NF-1 binding sites severely reduced promoter activity whereas triple mutation of Sp1a, Sp1b and NF-1 sites completely abolished promoter activity in both untreated and PMA treated cells. Sp1/3 and NF-1 proteins were shown to bind their respective sites by EMSA and interaction of Sp1/3, NF-1 and TFIIB with the endogenous P2X1 core promoter in MEG-01 cells was demonstrated by chromatin immunoprecipitation. Alignment of P2X1 genes from human, chimp, rat, mouse and dog revealed consensus Sp1a, Sp1b and NF-1 binding sites in equivalent positions thereby demonstrating evolutionary conservation of these functionally important sites. Conclusion This study has identified and characterized the P2X1 promoter utilized in MEG-01 cells and shown that binding of Sp1

  1. Betulinic acid decreases specificity protein 1 (Sp1) level via increasing the sumoylation of sp1 to inhibit lung cancer growth.

    PubMed

    Hsu, Tsung-I; Wang, Mei-Chun; Chen, Szu-Yu; Huang, Shih-Ting; Yeh, Yu-Min; Su, Wu-Chou; Chang, Wen-Chang; Hung, Jan-Jong

    2012-12-01

    Previous studies have shown that the inhibitory effect of betulinic acid (BA) on specificity protein 1 (Sp1) expression is involved in the prevention of cancer progression, but the mechanism of this effect remains to be delineated. In this study, we determined that BA treatment in HeLa cells increased the sumoylation of Sp1 by inhibiting sentrin-specific protease 1 expression. The subsequent recruitment of E3 ubiquitin-protein ligase RING finger protein 4 resulted in ubiquitin-mediated degradation in a 26S-proteosome-dependent pathway. In addition, both BA treatment and mithramycin A (MMA) treatment inhibited lung tumor growth and down-regulated Sp1 protein expression in Kras(G12D)-induced lung cancers of bitransgenic mice. In gene expression profiles of Kras(G12D)-induced lung cancers in bitransgenic mice with and without Sp1 inhibition, 542 genes were affected by MMA treatment. One of the gene products, cyclin A2, which was involved in the S and G(2)/M phase transition during cell cycle progression, was investigated in detail because its expression was regulated by Sp1. The down-regulation of cyclin A2 by BA treatment resulted in decreased retinoblastoma protein phosphorylation and cell cycle G(2)/M arrest. The BA-mediated cellular Sp1 degradation and antitumor effect were also confirmed in a xenograft mouse model by using H1299 cells. The knockdown of Sp1 in lung cancer cells attenuated the tumor-suppressive effect of BA. Taken together, the results of this study clarify the mechanism of BA-mediated Sp1 degradation and identify a pivotal role for Sp1 in the BA-induced repression of lung cancer growth. PMID:22956772

  2. The Influence of Declining Air Lead Levels on Blood Lead–Air Lead Slope Factors in Children

    PubMed Central

    Richmond-Bryant, Jennifer; Davis, Allen; Cohen, Jonathan; Lu, Shou-En; Svendsgaard, David; Brown, James S.; Tuttle, Lauren; Hubbard, Heidi; Rice, Joann; Kirrane, Ellen; Vinikoor-Imler, Lisa C.; Kotchmar, Dennis; Hines, Erin P.; Ross, Mary

    2014-01-01

    Background: It is difficult to discern the proportion of blood lead (PbB) attributable to ambient air lead (PbA), given the multitude of lead (Pb) sources and pathways of exposure. The PbB–PbA relationship has previously been evaluated across populations. This relationship was a central consideration in the 2008 review of the Pb national ambient air quality standards. Objectives: The objectives of this study were to evaluate the relationship between PbB and PbA concentrations among children nationwide for recent years and to compare the relationship with those obtained from other studies in the literature. Methods: We merged participant-level data for PbB from the National Health and Nutrition Examination Survey (NHANES) III (1988–1994) and NHANES 9908 (1999–2008) with PbA data from the U.S. Environmental Protection Agency. We applied mixed-effects models, and we computed slope factor, d[PbB]/d[PbA] or the change in PbB per unit change in PbA, from the model results to assess the relationship between PbB and PbA. Results: Comparing the NHANES regression results with those from the literature shows that slope factor increased with decreasing PbA among children 0–11 years of age. Conclusion: These findings suggest that a larger relative public health benefit may be derived among children from decreases in PbA at low PbA exposures. Simultaneous declines in Pb from other sources, changes in PbA sampling uncertainties over time largely related to changes in the size distribution of Pb-bearing particulate matter, and limitations regarding sampling size and exposure error may contribute to the variability in slope factor observed across peer-reviewed studies. Citation: Richmond-Bryant J, Meng Q, Davis A, Cohen J, Lu SE, Svendsgaard D, Brown JS, Tuttle L, Hubbard H, Rice J, Kirrane E, Vinikoor-Imler LC, Kotchmar D, Hines EP, Ross M. 2014. The Influence of declining air lead levels on blood lead–air lead slope factors in children. Environ Health Perspect 122:754

  3. SP1 and USF differentially regulate ADAMTS1 gene expression under normoxic and hypoxic conditions in hepatoma cells.

    PubMed

    Turkoglu, Sumeyye Aydogan; Kockar, Feray

    2016-01-01

    ADAM metallopeptidase with thrombospondin type I motif, 1 (ADAMTS1) that has both antiangiogenic and aggrecanase activity was dysregulated in many pathophysiologic circumstances. However, there is limited information available on the transcriptional regulation of ADAMTS1 gene. Therefore, this study mainly aimed to identify regulatory regions important for the regulation of ADAMTS1 gene under normoxic and hypoxic conditions in human hepatoma cells (HEP3B). Cultured HEP3B cells were exposed to normal oxygen condition, and Cobalt chloride (CoCl2) induced the hypoxic condition, which is an HIF-1 inducer. The cocl2-induced hypoxic condition led to the induced ADAMTS1 mRNA and protein expression in Hepatoma cells. Differential regulation of SP1 and USF transcription factors on ADAMTS1 gene expression was determined by transcriptional activity, mRNA and protein level of ADAMTS1 gene. Ectopic expression of SP1 and USF transcription factors resulted in the decrease in ADAMTS1 transcriptional activity of all promoter constructs consistent with mRNA and protein level in normoxic condition. However, overexpression of SP1 and USF led to the increase of ADAMTS1 gene expressions at mRNA and protein level in hypoxic condition. On the other hand, C/EBPα transcription factor didn't show any statistically significant effect on ADAMTS1 gene expression at mRNA, protein and transcriptional level under normoxic and hypoxic condition. PMID:26299656

  4. miRNA-223 inhibits epithelial-mesenchymal transition in gastric carcinoma cells via Sp1.

    PubMed

    Hu, Jing; Shan, Zhiyan; Hu, Kewei; Ren, Fengyun; Zhang, Wei; Han, Meiling; Li, Yuezhen; Feng, Kejian; Lei, Lei; Feng, Yukuan

    2016-07-01

    Sp1 plays critical roles in epithelial-mesenchymal transition (EMT) of certain cancer. However, few studies have indicated whether Sp1 is involved in the EMT of gastric cancer, and whether abnormal expression of Sp1 in gastric cancer EMT is regulated in a post-transcriptional manner, and the involvement of miRNAs in this regulation. In this study, we selected 20 cases of gastric cancers, their liver metastases and para-carcinoma tissues to examine the levels of Sp1 protein and mRNA by immunohistochemistry and fluorescent PCR, which showed that Sp1 was increased in gastric cancers and their metastases compared with adjacent tissues, but there was no difference in Sp1 mRNA between these three groups, suggesting changes in Sp1 may be attributed to inactivation of post-transcriptional regulation. We verified by a luciferase reporter system that miRNA-223 binds to 3'-UTR of Sp1 gene and inhibits its translation, in agreement with negative correlation between miRNA-223 and Sp1 protein levels in gastric cancer cells. By employing TGF-β1 to induce MGC-803, BGC-823 and SGC-7901, we successfully built cellular EMT model. Then, we overexpressed miRNA-223 in the model by using a lentiviral system, which diminished EMT indicators and suppressed proliferation and invasion ability, and induced apoptosis. Finally, we verified the specificity of the regulation pathway miRNA-223/Sp1/EMT. These findings suggest that low expression of miRNA-223 in gastric cancer cells is an important cause for EMT. miRNA-223 specifically regulates the EMT process of gastric cancer cells through its target gene Sp1. Overexpression of miRNA-223 in these cells inhibits EMT via the miRNA-223/Sp1/EMT pathway. PMID:27212195

  5. First functional polymorphism in CFTR promoter that results in decreased transcriptional activity and Sp1/USF binding

    SciTech Connect

    Taulan, M. Lopez, E.; Guittard, C.; Rene, C.; Baux, D.; Altieri, J.P.; DesGeorges, M.; Claustres, M.; Romey, M.C.

    2007-09-28

    Growing evidences show that functionally relevant polymorphisms in various promoters alter both transcriptional activity and affinities of existing protein-DNA interactions, and thus influence disease progression in humans. We previously reported the -94G>T CFTR promoter variant in a female CF patient in whom any known disease-causing mutation has been detected. To investigate whether the -94G>T could be a regulatory variant, we have proceeded to in silico analyses and functional studies including EMSA and reporter gene assays. Our data indicate that the promoter variant decreases basal CFTR transcriptional activity in different epithelial cells and alters binding affinities of both Sp1 and USF nuclear proteins to the CFTR promoter. The present report provides evidence for the first functional polymorphism that negatively affects the CFTR transcriptional activity and demonstrates a cooperative role of Sp1 and USF transcription factors in transactivation of the CFTR gene promoter.

  6. Photon impact factor and k{sub T}-factorization for DIS in the next-to-leading order

    SciTech Connect

    Ian Balitsky, Giovanni Chirilli

    2013-01-01

    The photon impact factor for the BFKL pomeron is calculated in the next-to-leading order (NLO) approximation using the operator expansion in Wilson lines. The result is represented as an NLO k{sub T}-factorization formula for structure functions of small-x deep inelastic scattering.

  7. Chromatin, TAFs, and a novel multiprotein coactivator are required for synergistic activation by Sp1 and SREBP-1a in vitro.

    PubMed

    Näär, A M; Beaurang, P A; Robinson, K M; Oliner, J D; Avizonis, D; Scheek, S; Zwicker, J; Kadonaga, J T; Tjian, R

    1998-10-01

    The promoter selectivity factor Sp1 often cooperates with other enhancer-binding proteins to activate transcription. To study the molecular underpinnings of these regulatory events, we have reconstituted in vitro the synergy observed in vivo between Sp1 and the sterol-regulated factor SREBP-1a at the low density lipoprotein receptor (LDLR) promoter. Using a highly purified human transcription system, we found that chromatin, TAFs, and a novel SREBP-binding coactivator activity, which includes CBP, are all required to mediate full synergistic activation by Sp1 and SREBP-1a. The SREBP-binding domain of CBP inhibits activation by SREBP-1a and Sp1 in a dominant-negative fashion that is both chromatin- and activator-specific. Whereas recombinant CBP alone is not sufficient to mediate activation, a human cellular fraction containing CBP can support high levels of chromatin-dependent synergistic activation. Purification of this activity to near homogeneity resulted in the identification of a multiprotein coactivator, including CBP, that selectively binds to the SREBP-1a activation domain and is capable of mediating high levels of synergistic activation by SREBP/Sp1 on chromatin templates. The development of a reconstituted chromatin transcription system has allowed us to isolate a novel coactivator that is recruited by the SREBP-1a activation domain and that functions in concert with TFIID to coordinate the action of multiple activators at complex promoters in the context of chromatin. PMID:9765204

  8. Increased Expression of Colonic Wnt9A through Sp1-mediated Transcriptional Effects involving Arylsulfatase B, Chondroitin 4-Sulfate, and Galectin-3

    PubMed Central

    Bhattacharyya, Sumit; Feferman, Leo; Tobacman, Joanne K.

    2014-01-01

    In cultured human colonic epithelial cells and mouse colonic tissue, exposure to the common food additive carrageenan leads to inflammation, activation of Wnt signaling, increased Wnt9A expression, and decline in the activity of the enzyme arylsulfatase B (ARSB; N-acetylgalactosamine-4-sulfatase). In this study, the novel transcriptional mechanism by which carrageenan and decline in ARSB increase Wnt9A expression in NCM460 and HT-29 human colonic epithelial cells and in mouse colon is presented. Increased expression of Wnt9A has been associated with multiple malignancies, including colon carcinoma, and with ectodermal and mesoendodermal morphogenesis. When ARSB activity was reduced by siRNA or by exposure to carrageenan (1 μg/ml for 24 h), degradation of chondroitin 4-sulfate (C4S) was inhibited, leading to accumulation of more highly sulfated C4S, which binds less galectin-3, a β-galactoside-binding protein. Nuclear galectin-3 increased and mediated increased binding of Sp1 to the Sp1 consensus sequence in the Wnt9A promoter, shown by oligonucleotide-binding assay and by chromatin immunoprecipitation assay. When galectin-3 was silenced, the increases in Sp1 binding to the Wnt9A promoter and in Wnt9A expression, which followed carrageenan or ARSB silencing, were inhibited. Mithramycin A, a specific inhibitor of Sp1 oligonucleotide binding, and Sp1 siRNA blocked the carrageenan- and ARSB siRNA-induced increases in Wnt9A expression. These studies reveal how carrageenan exposure can lead to transcriptional events in colonic epithelial cells through decline in arylsulfatase B activity, with subsequent impact on C4S, galectin-3, Sp1, and Wnt9A and can exert significant effects on Wnt-initiated signaling and related vital cell processes. PMID:24778176

  9. SP1-binding elements, within the common metaxin-thrombospondin 3 intergenic region, participate in the regulation of the metaxin gene.

    PubMed Central

    Collins, M; Bornstein, P

    1996-01-01

    Metaxin (Mtx) is an essential nuclear gene which is expressed ubiquitously in mice and encodes a mitochondrial protein. The gene is located upstream and is transcribed divergently from the thrombospondin 3 (Thbs3) gene; 1352 nucleotides separate the putative translation start sites. Although the Mtx and Thbs3 genes share a common intergenic region, transient transfection experiments in rat chondro-sarcoma cells and in NIH-3T3 fibroblasts demonstrated that the elements required for expression of the Mtx gene are situated within a short proximal promoter and have no major effect on the transcription of Thbs3. The metaxin --377 bp promoter contains four clustered GC boxes between nucleotides --146 and --58 and an inverted GT box between nucleotides --152 and --161, but does not contain TATA or CCAAT boxes. Like many genes regulated by a TATA-less promoter, the transcription start site of metaxin is heterogeneous. The major start site is only 13 bp upstream from the putative translation start site. Electrophoretic mobility shift, competition and supershift assays showed that the ubiquitous transcription factor, Sp1, and, to a lesser extent, the Sp1-related protein, Sp3, bind to four of these Sp1-binding motifs. Co-transfection of metaxin promoter-luciferase constructs and an Sp1 expression vector into Schneider Drosophila cells, which do not synthesize Sp1, demonstrated that the metaxin gene is activated by Sp1. Deletion of the four upstream Sp1-binding elements, on the other hand, demonstrated that these motifs are superfluous in context of the larger Mtx promoter. Thus, despite the potential for common regulatory mechanisms, the available evidence indicates that the Mtx minimal promoter does not significantly affect Thbs3 gene expression. PMID:8871542

  10. Progesterone induces expression of the prolactin receptor gene through cooperative action of Sp1 and C/EBP

    PubMed Central

    Goldhar, Anita S.; Duan, Renqin; Ginsburg, Erika; Vonderhaar, Barbara K.

    2011-01-01

    Prolactin (Prl) and progesterone (P) cooperate synergistically during mammary gland development and tumorigenesis. We hypothesized that one mechanism for these effects may be through mutual induction of receptors (R). EpH4 mouse mammary epithelial cells stably transfected with PR-A express elevated levels of PrlR mRNA and protein compared to control EpH4 cells that lack the PR. Likewise, T47D human breast cancer cells treated with P overexpress the PrlR and activate PrlR promoter III. PrlR promoter III does not contain a classical P response element but contains several binding sites for transcription proteins, including C/EBP, Sp1 and AP1, which may also interact with the PR. Using promoter deletion and site directed mutagenesis analyses as well as gel shift assays, cooperative activation of the C/EBP and adjacent Sp1A, but not the Sp1B or AP1, sites by P is shown to confer P responsiveness leading to increased PrlR transcription. PMID:21238538

  11. PERSONAL AND ENVIRONMENTAL RISK FACTORS SIGNIFICANTLY ASSOCIATED WITH ELEVATED BLOOD LEAD LEVELS IN RURAL THAI CHILDREN.

    PubMed

    Swaddiwudhipong, Witaya; Kavinum, Suporn; Papwijitsil, Ratchadaporn; Tontiwattanasap, Worawit; Khunyotying, Wanlee; Umpan, Jiraporn; BoonthuM, Ratchaneekorn; Kaewnate, Yingyot; Boonmee, Sasis; Thongchub, Winai; Rodsung, Thassanee

    2014-11-01

    A community-based study was conducted to determine personal risk factors and environmental sources of lead exposure for elevated blood lead levels (≥ 10 µg/dl, EBLLs) among rural children living at the Thailand-Myanmar border in Tak Province, northwestern Thailand. Six hundred ninety-five children aged 1-14 years old were screened for BLLs. Environmental specimens for lead measurements included samples of water from the streams, taps, and household containers, house floor dust, and foods. Possible lead release from the cooking ware was determined using the leaching method with acetic acid. The overall prevalence of EBLLs was 47.1% and the geometric mean level of blood lead was 9.16 µg/dl. Personal risk factors significantly associated with EBLLs included being male, younger age, anemia, and low weight-for-age. Significant environmental risk factors were exposure to a lead-acid battery of solar energy system and use of a non-certified metal cooking pot. Some families whose children had high BLLs reported production of lead bullets from the used batteries at home. About one-third of the house dust samples taken near batteries contained lead content above the recommended value, compared with none of those taken from other areas and from the houses with no batteries. The metal pots were safe for cooking rice but might be unsafe for acidic food preparation. Both nutritional intervention and lead exposure prevention programs are essential to reduce EBLLs in this population. PMID:26466436

  12. Down-regulation of EPHX2 gene transcription by Sp1 under high-glucose conditions.

    PubMed

    Oguro, Ami; Oida, Shoko; Imaoka, Susumu

    2015-09-15

    sEH (soluble epoxide hydrolase), which is encoded by the EPHX2 gene, regulates the actions of bioactive lipids, EETs (epoxyeicosatrienoic acids). Previously, we found that high-glucose-induced oxidative stress suppressed sEH levels in a hepatocarcinoma cell line (Hep3B) and sEH was decreased in streptozotocin-induced diabetic mice in vivo. In the present study, we investigated the regulatory mechanisms underlying EPHX2 transcriptional suppression under high-glucose conditions. The decrease in sEH was prevented by an Sp1 (specificity protein 1) inhibitor, mithramycin A, and overexpression or knockdown of Sp1 revealed that Sp1 suppressively regulated sEH expression, in contrast with the general role of Sp1 on transcriptional activation. In addition, we found that AP2α (activating protein 2α) promoted EPHX2 transcription. The nuclear transport of Sp1, but not that of AP2α, was increased under high glucose concomitantly with the decrease in sEH. Within the EPHX2 promoter -56/+32, five Sp1-binding sites were identified, and the mutation of each of these sites showed that the first one (SP1_1) was important in both suppression by Sp1 and activation by AP2α. Furthermore, overexpression of Sp1 diminished the binding of AP2α by DNA-affinity precipitation assay and ChIP, suggesting competition between Sp1 and AP2α on the EPHX2 promoter. These findings provide novel insights into the role of Sp1 in transcriptional suppression, which may be applicable to the transcriptional regulation of other genes. PMID:26341485

  13. Lead in New York City Community Garden Chicken Eggs: Influential Factors and Health Implications

    PubMed Central

    Spliethoff, Henry M.; Mitchell, Rebecca G.; Ribaudo, Lisa N.; Taylor, Owen; Shayler, Hannah A.; Greene, Virginia; Oglesby, Debra

    2014-01-01

    Raising chickens for eggs in urban areas is becoming increasingly common. Urban chickens may be exposed to lead, a common urban soil contaminant. We measured lead concentrations in chicken eggs from New York City (NYC) community gardens and collected information on factors that might affect those concentrations. Lead was detected between 10 and 167 μg/kg in 48% of NYC eggs. Measures of lead in eggs from a henhouse were significantly associated (p<0.005) with lead concentrations in soil. The association between soil and egg lead has been evaluated only once before, by a study of a rural region in Belgium. In our study, the apparent lead soil-to-egg transfer efficiency was considerably lower than that found in Belgium, suggesting that there may be important geographic differences in this transfer. We developed models that suggested that, for sites like ours, lead concentrations in >50% of eggs from a henhouse would exceed store-bought egg concentrations (<7–13 μg/kg; 3% above detection limit) at soil lead concentrations >120 mg/kg, and that the concentration in one of six eggs from a henhouse would exceed a 100 μg/kg guidance value at soil lead concentrations >410 mg/kg. Our models also suggested that the availability of dietary calcium supplements was another influential factor that reduced egg lead concentrations. Estimates of health risk from consuming eggs with the lead concentrations we measured generally were not significant. However, soil lead concentrations in this study were <600 mg/kg, and considerably higher concentrations are not uncommon. Efforts to reduce lead transfer to chicken eggs and associated exposure are recommended for urban chicken keepers. PMID:24287691

  14. Factors Leading to Success in Diversified Occupation: A Livelihood Analysis in India

    ERIC Educational Resources Information Center

    Saha, Biswarup; Bahal, Ram

    2015-01-01

    Purpose: Livelihood diversification is a sound alternative for higher economic growth and its success or failure is conditioned by the interplay of a multitude of factors. The study of the profile of the farmers in which they operate is important to highlight the factors leading to success in diversified livelihoods. Design/Methodology/Approach: A…

  15. Benchmarking Potential Factors Leading to Education Quality: A Study of Cambodian Higher Education

    ERIC Educational Resources Information Center

    Chen, Ching-Yaw; Sok, Phyra; Sok, Keomony

    2007-01-01

    Purpose: To study the quality in higher education in Cambodia and explore the potential factors leading to quality in Cambodian higher education. Design/methodology/approach: Five main factors that were deemed relevant in providing quality in Cambodian higher education were proposed: academic curriculum and extra-curricular activities, teachers'…

  16. Genome Sequence of the Microsporidian Species Nematocida sp1 Strain ERTm6 (ATCC PRA-372)

    PubMed Central

    Bakowski, Malina A.; Priest, Margaret; Young, Sarah

    2014-01-01

    Microsporidia comprise a phylum of obligate intracellular pathogens related to fungi. Microsporidia Nematocida sp1 strain ERTm6 was isolated from wild-caught Caenorhabditis briggsae and causes a lethal intestinal infection in Caenorhabditis nematodes. We report the genome sequence of N. sp1 ERTm6, which will facilitate study of the Nematocida genus and other Microsporidia. PMID:25237020

  17. Risk factors for high levels of lead in blood of schoolchildren in Mexico City.

    PubMed

    Olaiz, G; Fortoul, T I; Rojas, R; Doyer, M; Palazuelos, E; Tapia, C R

    1996-01-01

    Risk factors associated with blood lead levels exceeding 15 microg/dl were analyzed in this report. This relatively high lead level was selected because, at the time the study commenced, it was considered to be a "safe" level. A total of 1583 schoolchildren were studied. The students were from (a) two areas in Mexico City (Tlalnepantla and Xalostoc) that have had historically high concentrations of lead in air, and (b) three areas (Pedregal, Iztalpalapa, and Centro) with less impressive air lead levels. Parents were presented with a questionnaire that solicited information about lead risk factors. A bivariate analysis and a multilogistic analysis were conducted to identify associations and to identify the model that most accurately explains the variability of the sample. High blood lead concentrations were found in children who lived in Xalostoc and Tlalnepantla (16.1 and 17.0 microg/dl, respectively), and the lowest concentration (i.e., 10 microg/dl) was found in children from Iztapalapa. The strongest association was with area of residence, followed by education level of parents, cooking of meals in glazed pottery, and chewing or sucking of yellow or other colored pencils. A child's area of residence is the most significant risk factor that must be accounted for when any study of lead and blood lead concentrations is undertaken. Follow-up in similar populations should assist greatly in the evaluation of the impact of governmental actions on public health. PMID:8638962

  18. YY1 and Sp1 activate transcription of the human NDUFS8 gene encoding the mitochondrial complex I TYKY subunit.

    PubMed

    Lescuyer, Pierre; Martinez, Pascal; Lunardi, Joël

    2002-03-19

    Complex I is the most complicated of the multimeric enzymes that constitute the mitochondrial respiratory chain. It is encoded by both mitochondrial and nuclear genomes. We have previously characterized the human NDUFS8 gene that encodes the TYKY subunit. This essential subunit is thought to participate in the electron transfer and proton pumping activities of complex I. Here, we have analyzed the transcriptional regulation of the NDUFS8 gene. Using primer extension assays, we have identified two transcription start sites. The basal promoter was mapped to a 247 bp sequence upstream from the main transcription start site by reporter gene analysis in HeLa cells and in differentiated or non-differentiated C2C12 cells. Three Sp1 sites and one YY1 site were identified in this minimal promoter. Through gel shift analysis, all sites were shown to bind to their cognate transcription factors. Site-directed mutagenesis revealed that the YY1 site and two upstream adjacent Sp1 sites drive most of the promoter activity. This work represents the first promoter analysis for a complex I gene. Together with previous studies, our results indicate that YY1 and Sp1 control the expression of genes encoding proteins that are involved in almost all steps of the oxidative phosphorylation metabolism. PMID:11955626

  19. Small constrained SP1-7 analogs bind to a unique site and promote anti-allodynic effects following systemic injection in mice.

    PubMed

    Jonsson, A; Fransson, R; Haramaki, Y; Skogh, A; Brolin, E; Watanabe, H; Nordvall, G; Hallberg, M; Sandström, A; Nyberg, F

    2015-07-01

    Previous results have shown that the substance P (SP) N-terminal fragment SP1-7 may attenuate hyperalgesia and produce anti-allodynia in animals using various experimental models for neuropathic pain. The heptapeptide was found to induce its effects through binding to and activating specific sites apart from any known neurokinin or opioid receptor. Furthermore, we have applied a medicinal chemistry program to develop lead compounds mimicking the effect of SP1-7. The present study was designed to evaluate the pharmacological effect of these compounds using the mouse spared nerve injury (SNI) model of chronic neuropathic pain. Also, as no comprehensive screen with the aim to identify the SP1-7 target has yet been performed we screened our lead compound H-Phe-Phe-NH2 toward a panel of drug targets. The extensive target screen, including 111 targets, did not reveal any hit for the binding site among a number of known receptors or enzymes involved in pain modulation. Our animal studies confirmed that SP1-7, but also synthetic analogs thereof, possesses anti-allodynic effects in the mouse SNI model of neuropathic pain. One of the lead compounds, a constrained H-Phe-Phe-NH2 analog, was shown to exhibit a significant anti-allodynic effect. PMID:25862586

  20. Curcumin decreases the expression of Pokemon by suppressing the binding activity of the Sp1 protein in human lung cancer cells.

    PubMed

    Cui, Jiajun; Meng, Xianfeng; Gao, Xudong; Tan, Guangxuan

    2010-03-01

    Pokemon, which stands for POK erythroid myeloid ontogenic factor, can regulate expression of many genes and plays an important role in tumorigenesis. Curcumin, a natural and non-toxic yellow compound, has capacity for antioxidant, free radical scavenger, anti-inflammatory properties. Recent studies shows it is a potential inhibitor of cell proliferation in a variety of tumour cells. To investigate whether curcumin can regulate the expression of Pokemon, a series of experiments were carried out. Transient transfection experiments demonstrated that curcumin could decrease the activity of the Pokemon promoter. Western blot analysis suggested that curcumin could significantly decrease the expression of the Pokemon. Overexpression of Sp1 could enhance the activity of the Pokemon promoter, whereas knockdown of Sp1 could decrease its activity. More important, we also found that curcumin could decrease the expression of the Pokemon by suppressing the stimulation of the Sp1 protein. Therefore, curcumin is a potential reagent for tumour therapy which may target Pokemon. PMID:19444642

  1. The Risk Factors of Child Lead Poisoning in China: A Meta-Analysis

    PubMed Central

    Li, You; Qin, Jian; Wei, Xiao; Li, Chunhong; Wang, Jian; Jiang, Meiyu; Liang, Xue; Xia, Tianlong; Zhang, Zhiyong

    2016-01-01

    Background: To investigate the risk factors of child lead poisoning in China. Methods: A document retrieval was performed using MeSH (Medical subject heading terms) and key words. The Newcastle-Ottawa Scale (NOS) was used to assess the quality of the studies, and the pooled odd ratios with a 95% confidence interval were used to identify the risk factors. We employed Review Manager 5.2 and Stata 10.0 to analyze the data. Heterogeneity was assessed by both the Chi-square and I2 tests, and publication bias was evaluated using a funnel plot and Egger’s test. Results: Thirty-four articles reporting 13,587 lead-poisoned children met the inclusion criteria. Unhealthy lifestyle and behaviors, environmental pollution around the home and potential for parents’ occupational exposure to lead were risk factors of child lead poisoning in the pooled analyses. Our assessments yielded no severe publication biases. Conclusions: Seventeen risk factors are associated with child lead poisoning, which can be used to identify high-risk children. Health education and promotion campaigns should be designed in order to minimize or prevent child lead poisoning in China. PMID:27005641

  2. Effect of lead factors on the embrittlement of RPV SA-508 cl 3 steel

    NASA Astrophysics Data System (ADS)

    Kempf, Rodolfo; Troiani, Horacio; Fortis, Ana Maria

    2013-03-01

    This paper presents a project to study the effect of lead factors on the mechanical behaviour of the SA-508 type 3 Reactor Pressure Vessel (RPV) steel used in the reactor under construction Atucha II in Argentina. Charpy-V notch specimens of this steel were irradiated at the RA1 experimental reactor at a temperature of 275 °C with two lead factors (186 and 93). The neutron flux was 3.71 × 1015 n m-2 s-1 and 1.85 × 1015 n m-2 s-1 (E > 1 MeV) respectively. In both cases, the fluence was 6.6 × 1021 n m-2, which is equivalent to that received by the PHWR Atucha II RPV in 10 years of full power irradiation. The results of Charpy tests revealed significant embrittlement both in the ΔT = 14 °C and ΔT = 21 °C shifts of the ductile-brittle transition temperatures (DBTT) and in the reduction of the maximum energy absorbed. This result shows that the shift of the DBTT with a lead factor of 93 is larger than that obtained with a lead factor of 186. Then, the results of irradiation in experimental reactors (MTR) with high lead factors may not be conservative with respect to the actual RPV embrittlement.

  3. In vitro chromatin assembly of the HIV-1 promoter. ATP-dependent polar repositioning of nucleosomes by Sp1 and NFkappaB.

    PubMed

    Widlak, P; Gaynor, R B; Garrard, W T

    1997-07-11

    Nuclease hypersensitive sites exist in vivo in the chromatin of the integrated human immunodeficiency virus (HIV)-1 proviral genome, in the 5'-long terminal repeat (LTR) within the promoter/enhancer region near Sp1 and NFkappaB binding sites. Previous studies from the Kadonaga and Jones laboratories have shown that Sp1 and NFkappaB can establish hypersensitive sites in a truncated form of this LTR when added before in vitro chromatin assembly with Drosophila extracts, thus facilitating subsequent transcriptional activation of a linked reporter gene upon the association of additional factors (Pazin, M. J., Sheridan, P. L., Cannon, K., Cao, Z., Keck, J. G., Kadanaga, J. T., and Jones, K. A. (1996) Genes & Dev. 10, 37-49). Here we assess the role of a full-length LTR and 1 kilobase pair of downstream flanking HIV sequences in chromatin remodeling when these transcription factors are added after chromatin assembly. Using Xenopus laevis oocyte extracts to assemble chromatin in vitro, we have confirmed that Sp1 and NFkappaB can indeed induce sites hypersensitive to DNase I, micrococcal nuclease, or restriction enzymes on either side of factor binding sites in chromatin but not naked DNA. We extend these earlier studies by demonstrating that the process is ATP-dependent when the factors are added after chromatin assembly and that histone H1, AP1, TBP, or Tat had no effect on hypersensitive site formation. Furthermore, we have found that nucleosomes upstream of NFkappaB sites are rotationally positioned prior to factor binding and that their translational frame is registered after binding NFkappaB. On the other hand, binding of Sp1 positions adjacent downstream nucleosome(s). We term this polar repositioning because each factor aligns nucleosomes only on one side of its binding sites. Mutational analysis and oligonucleotide competition each demonstrated that this remodeling required Sp1 and NFkappaB binding sites. PMID:9211915

  4. Lifestyle and environmental factors as determinants of blood lead levels in a Swiss population

    SciTech Connect

    Berode, M.; Wietlisbach, V.; Rickenbach, M.; Guillemin, M.P. )

    1991-06-01

    The determination of blood lead levels was included in a Swiss population survey on cardiovascular risk factors in 1984-1985; 931 men and 843 women aged 25 to 75 years participated in the study. Mean blood lead levels ({plus minus}SD) were 0.63 {plus minus} 0.27 {mu}mole/liter for men and 0.44 {plus minus} 0.19 {mu}mole/liter for women, respectively, with a slight increase with age for both sexes. These values are below the maximum level recommended by the Commission of the European Community in 1977; 18 cases were found with blood lead higher than 1.5 {mu}mole/liter and in six of these, a professional exposure was suspected. Smoking habits, drinking habits, and consumption of diary products were selected as lifestyle descriptors and educational level, occupational category, and size of the community as sociodemographic indicators. Smoking and alcohol consumption show a direct association with blood lead, consuming dairy products an inverse one. Occupation and level of education are significantly related to blood lead only for men, blue-collar workers and less-educated men being more exposed. A higher blood lead level in cities was only found for women. The lifestyle indicators showed a consistently stronger effect on blood lead than sociodemographic indicators. For mean, smoking has an effect on blood lead for blue-collar workers much stronger than that for nonindustrial employees and may compound in some way the professional exposure to lead.

  5. Nucleon form factors to next-to-leading order with light-cone sum rules

    SciTech Connect

    Passek-Kumericki, K.; Peters, G.

    2008-08-01

    We have calculated the leading-twist next-to-leading order (NLO), i.e., O({alpha}{sub s}), correction to the light-cone sum rules prediction for the electromagnetic form factors of the nucleon. We have used the Ioffe nucleon interpolation current and worked in M{sub N}=0 approximation, with M{sub N} being the mass of the nucleon. In this approximation, only the Pauli form factor F{sub 2} receives a correction and the calculated correction is quite sizable (ca. 60%). The numerical results for the proton form factors show the improved agreement with the experimental data. We also discuss the problems encountered when going away from M{sub N}=0 approximation at NLO, as well as gauge invariance of the perturbative results. This work presents the first step towards the NLO accuracy in the light-cone sum rules for baryon form factors.

  6. Inhibition of Phosphatase Activity Follows Decline in Sulfatase Activity and Leads to Transcriptional Effects through Sustained Phosphorylation of Transcription Factor MITF

    PubMed Central

    Bhattacharyya, Sumit; Feferman, Leo; Tobacman, Joanne K.

    2016-01-01

    Arylsulfatase B (B-acetylgalactosamine 4-sulfatase; ARSB) is the enzyme that removes 4-sulfate groups from the non-reducing end of the glycosaminoglycans chondroitin 4-sulfate and dermatan sulfate. Decline in ARSB has been shown in malignant prostate, colonic, and mammary cells and tissues, and decline in ARSB leads to transcriptional events mediated by galectin-3 with AP-1 and Sp1. Increased mRNA expression of GPNMB (transmembrane glycoprotein NMB) in HepG2 cells and in hepatic tissue from ARSB-deficient mice followed decline in expression of ARSB and was mediated by the microphthalmia-associated transcription factor (MITF), but was unaffected by silencing galectin-3. Since GPNMB is increased in multiple malignancies, studies were performed to determine how decline in ARSB increased GPNMB expression. The mechanism by which decline in ARSB increased nuclear phospho-MITF was due to reduced activity of SHP2, a protein tyrosine phosphatase with Src homology (SH2) domains that regulates multiple cellular processes. SHP2 activity declined due to increased binding with chondroitin 4-sulfate when ARSB was reduced. When SHP2 activity was inhibited, phosphorylations of p38 mitogen-associated phosphokinase (MAPK) and of MITF increased, leading to GPNMB promoter activation. A dominant negative SHP2 construct, the SHP2 inhibitor PHSP1, and silencing of ARSB increased phospho-p38, nuclear MITF, and GPNMB. In contrast, constitutively active SHP2 and overexpression of ARSB inhibited GPNMB expression. The interaction between chondroitin 4-sulfate and SHP2 is a novel intersection between sulfation and phosphorylation, by which decline in ARSB and increased chondroitin 4-sulfation can inhibit SHP2, thereby regulating downstream tyrosine phosphorylations by sustained phosphorylations with associated activation of signaling and transcriptional events. PMID:27078017

  7. Transcriptional interference perturbs the binding of Sp1 to the HIV-1 promoter.

    PubMed Central

    Greger, I H; Demarchi, F; Giacca, M; Proudfoot, N J

    1998-01-01

    Transcriptional interference between adjacent genes has been demonstrated in a variety of biological systems. To study this process in RNA polymerase II (pol II) transcribed genes we have analysed the effect of transcription on tandem HIV-1 promoters integrated into the genome of HeLa cells. We show that transcriptional activation at the upstream promoter reduces transcription from the downstream promoter, as compared with basal transcription conditions (in the absence of an activator). Furthermore, insertion of a strong transcriptional termination element between the two promoters alleviates this transcriptional interference, resulting in elevated levels of transcription from the downstream promoter. Actual protein interactions with the downstream (occluded) promoter were analysed by in vivo footprinting. Binding of Sp1 transcription factors to the occluded promoter was reduced, when compared with the footprint pattern of the promoter protected by the terminator. This suggests that promoter occlusion is due to disruption of certain transcription factors and that it can be blocked by an intervening transcriptional terminator. Chromatin mapping with DNase I indicates that a factor binds to the termination element under both basal and induced conditions. PMID:9469840

  8. miR-23b/SP1/c-myc forms a feed-forward loop supporting multiple myeloma cell growth

    PubMed Central

    Fulciniti, M; Amodio, N; Bandi, R L; Cagnetta, A; Samur, M K; Acharya, C; Prabhala, R; D'Aquila, P; Bellizzi, D; Passarino, G; Adamia, S; Neri, A; Hunter, Z R; Treon, S P; Anderson, K C; Tassone, P; Munshi, N C

    2016-01-01

    Deregulated microRNA (miR)/transcription factor (TF)-based networks represent a hallmark of cancer. We report here a novel c-Myc/miR-23b/Sp1 feed-forward loop with a critical role in multiple myeloma (MM) and Waldenstrom's macroglobulinemia (WM) cell growth and survival. We have found miR-23b to be downregulated in MM and WM cells especially in the presence of components of the tumor bone marrow milieu. Promoter methylation is one mechanism of miR-23b suppression in myeloma. In gain-of-function studies using miR-23b mimics-transfected or in miR-23b-stably expressing MM and WM cell lines, we observed a significant decrease in cell proliferation and survival, along with induction of caspase-3/7 activity over time, thus supporting a tumor suppressor role for miR-23b. At the molecular level, miR-23b targeted Sp1 3′UTR and significantly reduced Sp1-driven nuclear factor-κB activity. Finally, c-Myc, an important oncogenic transcription factor known to stimulate MM cell proliferation, transcriptionally repressed miR-23b. Thus MYC-dependent miR-23b repression in myeloma cells may promote activation of oncogenic Sp1-mediated signaling, representing the first feed-forward loop with critical growth and survival role in myeloma. PMID:26771806

  9. Diverse Mechanisms of Sp1-Dependent Transcriptional Regulation Potentially Involved in the Adaptive Response of Cancer Cells to Oxygen-Deficient Conditions

    PubMed Central

    Koizume, Shiro; Miyagi, Yohei

    2015-01-01

    The inside of a tumor often contains a hypoxic area caused by a limited supply of molecular oxygen due to aberrant vasculature. Hypoxia-inducible factors (HIFs) are major transcription factors that are required for cancer cells to adapt to such stress conditions. HIFs, complexed with the aryl hydrocarbon receptor nuclear translocator, bind to and activate target genes as enhancers of transcription. In addition to this common mechanism, the induction of the unfolded protein response and mTOR signaling in response to endoplasmic reticulum stress is also known to be involved in the adaptation to hypoxia conditions. Sp1 is a ubiquitously-expressed transcription factor that plays a vital role in the regulation of numerous genes required for normal cell function. In addition to the well-characterized stress response mechanisms described above, increasing experimental evidence suggests that Sp1 and HIFs collaborate to drive gene expression in cancer cells in response to hypoxia, thereby regulating additional adaptive responses to cellular oxygen deficiency. However, these characteristics of Sp1 and their biological merits have not been summarized. In this review, we will discuss the diverse mechanisms of transcriptional regulation by Sp1 and their potential involvement in the adaptive response of cancer cells to hypoxic tumor microenvironments. PMID:26703734

  10. Factors associated with elevated blood lead concentrations in children in Karachi, Pakistan.

    PubMed Central

    Rahbar, Mohammad Hossein; White, Franklin; Agboatwalla, Mubina; Hozhabri, Siroos; Luby, Stephen

    2002-01-01

    OBJECTIVES: To confirm whether blood lead concentrations in Karachi were as high as reported in 1989 and to identify which types of exposure to lead contribute most to elevated blood lead concentrations in children in Karachi. METHODS: A total of 430 children aged 36-60 months were selected through a geographically stratified design from the city centre, two suburbs, a rural community and an island situated within the harbour at Karachi. Blood samples were collected from children and a pretested questionnaire was administered to assess the effect of various types of exposure. Cooked food, drinking-water and house dust samples were collected from households. FINDINGS: About 80% of children had blood lead concentrations 10 g/dl, with an overall mean of 15.6 g/dl. At the 5% level of significance, houses nearer to the main intersection in the city centre, application of surma to children's eyes, father's exposure to lead at workplace, parents' illiteracy and child's habit of hand- to-mouth activity were among variables associated with elevated lead concentrations in blood. CONCLUSION: These findings are of public health concern, as most children in Karachi are likely to suffer some degree of intellectual impairment as a result of environmental lead exposure. We believe that there is enough evidence of the continuing problem of lead in petrol to prompt the petroleum industry to take action. The evidence also shows the need for appropriate interventions in reducing the burden due to other factors associated with this toxic element. PMID:12471396

  11. RELATION OF LEAD AND SOCIAL FACTORS TO IQ OF LOW-SES CHILDREN: A PARTIAL REPLICATION

    EPA Science Inventory

    An independent replication of a previous study (Schroeder et al., 1985) of the effects of interactive social environmental factors on the relationship of lead and Stanford-Binet IQ was performed on 75 of 80 low-Socioeconomic status black children screened by county health departm...

  12. Understanding Factors Leading to Participation in Supplemental Instruction Programs in Introductory Accounting Courses

    ERIC Educational Resources Information Center

    Goldstein, James; Sauer, Paul; O'Donnell, Joseph

    2014-01-01

    Although studies have shown that supplemental instruction (SI) programs can have positive effects in introductory accounting courses, these programs experience low participation rates. Thus, our study is the first to examine the factors leading to student participation in SI programs. We do this through a survey instrument based on the Theory of…

  13. Blood lead levels and risk factors in pregnant women from Durango, Mexico.

    PubMed

    La-Llave-León, Osmel; Estrada-Martínez, Sergio; Manuel Salas-Pacheco, José; Peña-Elósegui, Rocío; Duarte-Sustaita, Jaime; Candelas Rangel, Jorge-Luís; García Vargas, Gonzalo

    2011-01-01

    In this cross-sectional study the authors determined blood lead levels (BLLs) and some risk factors for lead exposure in pregnant women. Two hundred ninety-nine pregnant women receiving medical attention by the Secretary of Health, State of Durango, Mexico, participated in this study between 2007 and 2008. BLLs were evaluated with graphite furnace atomic absorption spectrometry. The authors used Student t test, 1-way analysis of variance (ANOVA), and linear regression as statistical treatments. BLLs ranged from 0.36 to 23.6 μg/dL (mean = 2.79 μg/dL, standard deviation = 2.14). Multivariate analysis showed that the main predictors of BLLs were working in a place where lead is used, using lead glazed pottery, and eating soil. PMID:24484368

  14. An atomic model of HIV-1 capsid-SP1 reveals structures regulating assembly and maturation.

    PubMed

    Schur, Florian K M; Obr, Martin; Hagen, Wim J H; Wan, William; Jakobi, Arjen J; Kirkpatrick, Joanna M; Sachse, Carsten; Kräusslich, Hans-Georg; Briggs, John A G

    2016-07-29

    Immature HIV-1 assembles at and buds from the plasma membrane before proteolytic cleavage of the viral Gag polyprotein induces structural maturation. Maturation can be blocked by maturation inhibitors (MIs), thereby abolishing infectivity. The CA (capsid) and SP1 (spacer peptide 1) region of Gag is the key regulator of assembly and maturation and is the target of MIs. We applied optimized cryo-electron tomography and subtomogram averaging to resolve this region within assembled immature HIV-1 particles at 3.9 angstrom resolution and built an atomic model. The structure reveals a network of intra- and intermolecular interactions mediating immature HIV-1 assembly. The proteolytic cleavage site between CA and SP1 is inaccessible to protease. We suggest that MIs prevent CA-SP1 cleavage by stabilizing the structure, and MI resistance develops by destabilizing CA-SP1. PMID:27417497

  15. The conjugate gradient NAS parallel benchmark on the IBM SP1

    SciTech Connect

    Trefethen, A.E.; Zhang, T.

    1994-12-31

    The NAS Parallel Benchmarks are a suite of eight benchmark problems developed at the NASA Ames Research Center. They are specified in such a way that the benchmarkers are free to choose the language and method of implementation to suit the system in which they are interested. In this presentation the authors will discuss the Conjugate Gradient benchmark and its implementation on the IBM SP1. The SP1 is a parallel system which is comprised of RS/6000 nodes connected by a high performance switch. They will compare the results of the SP1 implementation with those reported for other machines. At this time, such a comparison shows the SP1 to be very competitive.

  16. Epigenetic modification of TLR4 promotes activation of NF-κB by regulating methyl-CpG-binding domain protein 2 and Sp1 in gastric cancer.

    PubMed

    Kim, Tae Woo; Lee, Seon-Jin; Oh, Byung Moo; Lee, Heesoo; Uhm, Tae Gi; Min, Jeong-Ki; Park, Young-Jun; Yoon, Suk Ran; Kim, Bo-Yeon; Kim, Jong Wan; Choe, Yong-Kyung; Lee, Hee Gu

    2016-01-26

    Toll-like receptor 4 (TLR4) is important in promoting the immune response in various cancers. Recently, TLR4 is highly expressed in a stage-dependent manner in gastric cancer, but the regulatory mechanism of TLR4 expression has been not elucidated it. Here, we investigated the mechanism underlying regulation of TLR4 expression through promoter methylation and histone modification between transcriptional regulation and silencing of the TLR4 gene in gastric cancer cells. Chromatin immunoprecipitation was carried out to screen for factors related to TLR4 methylation such as MeCP2, HDAC1, and Sp1 on the TLR4 promoter. Moreover, DNA methyltransferase inhibitor 5-aza-deoxycytidine (5-aza-dC) induced demethylation of the TLR4 promoter and increased H3K4 trimethylation and Sp1 binding to reactivate silenced TLR4. In contrast, although the silence of TLR4 activated H3K9 trimethylation and MeCP2 complex, combined treatment with TLR4 agonist and 5-aza-dC upregulated H3K4 trimethylation and activated with transcription factors as Sp1 and NF-κB. This study demonstrates that recruitment of the MeCP2/HDAC1 repressor complex increases the low levels of TLR4 expression through epigenetic modification of DNA and histones on the TLR4 promoter, but Sp1 activates TLR4 high expression by hypomethylation and NF-κB signaling in gastric cancer cells. PMID:26675260

  17. Epigenetic modification of TLR4 promotes activation of NF-κB by regulating methyl-CpG-binding domain protein 2 and Sp1 in gastric cancer

    PubMed Central

    Oh, Byung Moo; Lee, Heesoo; Uhm, Tae Gi; Min, Jeong-Ki; Park, Young-Jun; Yoon, Suk Ran; Kim, Bo-Yeon; Kim, Jong Wan; Choe, Yong-Kyung; Lee, Hee Gu

    2016-01-01

    Toll-like receptor 4 (TLR4) is important in promoting the immune response in various cancers. Recently, TLR4 is highly expressed in a stage-dependent manner in gastric cancer, but the regulatory mechanism of TLR4 expression has been not elucidated it. Here, we investigated the mechanism underlying regulation of TLR4 expression through promoter methylation and histone modification between transcriptional regulation and silencing of the TLR4 gene in gastric cancer cells. Chromatin immunoprecipitation was carried out to screen for factors related to TLR4 methylation such as MeCP2, HDAC1, and Sp1 on the TLR4 promoter. Moreover, DNA methyltransferase inhibitor 5-aza-deoxycytidine (5-aza-dC) induced demethylation of the TLR4 promoter and increased H3K4 trimethylation and Sp1 binding to reactivate silenced TLR4. In contrast, although the silence of TLR4 activated H3K9 trimethylation and MeCP2 complex, combined treatment with TLR4 agonist and 5-aza-dC upregulated H3K4 trimethylation and activated with transcription factors as Sp1 and NF-κB. This study demonstrates that recruitment of the MeCP2/HDAC1 repressor complex increases the low levels of TLR4 expression through epigenetic modification of DNA and histones on the TLR4 promoter, but Sp1 activates TLR4 high expression by hypomethylation and NF-κB signaling in gastric cancer cells. PMID:26675260

  18. Single-molecule DNA detection using a novel SP1 protein nanopore.

    PubMed

    Wang, Hai-Yan; Li, Yang; Qin, Li-Xia; Heyman, Arnon; Shoseyov, Oded; Willner, Itamar; Long, Yi-Tao; Tian, He

    2013-02-28

    SP1 protein as a new type of biological nanopore is described and is utilized to distinguish single-stranded DNA at the single-molecule level. Using the SP1 nanopore to investigate single molecule detection broadens the existing research areas of pore-forming biomaterials from unsymmetrical biological nanopores to symmetrical biological nanopores. This novel nanopore could provide a good candidate for single-molecule detection and characterization of biomaterial applications. PMID:23340583

  19. Draft Genome Sequences of Two Magnetotactic Bacteria, Magnetospirillum moscoviense BB-1 and Magnetospirillum marisnigri SP-1.

    PubMed

    Koziaeva, Veronika V; Dziuba, Marina V; Ivanov, Timophey M; Kuznetsov, Boris B; Skryabin, Konstantin G; Grouzdev, Denis S

    2016-01-01

    We report here the draft genome sequences of two recently isolated magnetotactic species, Magnetospirillum moscoviense BB-1 and Magnetospirillum marisnigri SP-1. The genome of M. moscoviense BB-1 has 4,164,497 bp, 65.2% G+C content, and comprises 207 contigs. The genome of M. marisnigri SP-1 consists of 131 contigs and has a length of 4,619,819 bp and 64.7% G+C content. PMID:27516508

  20. Draft Genome Sequences of Two Magnetotactic Bacteria, Magnetospirillum moscoviense BB-1 and Magnetospirillum marisnigri SP-1

    PubMed Central

    Koziaeva, Veronika V.; Dziuba, Marina V.; Ivanov, Timophey M.; Kuznetsov, Boris B.; Skryabin, Konstantin G.

    2016-01-01

    We report here the draft genome sequences of two recently isolated magnetotactic species, Magnetospirillum moscoviense BB-1 and Magnetospirillum marisnigri SP-1. The genome of M. moscoviense BB-1 has 4,164,497 bp, 65.2% G+C content, and comprises 207 contigs. The genome of M. marisnigri SP-1 consists of 131 contigs and has a length of 4,619,819 bp and 64.7% G+C content. PMID:27516508

  1. Arf Induction by Tgfβ Is Influenced by Sp1 and C/ebpβ in Opposing Directions

    PubMed Central

    Zheng, Yanbin; Devitt, Caitlin; Liu, Jing; Iqbal, Nida; Skapek, Stephen X.

    2013-01-01

    Recent studies show that Arf, a bona fide tumor suppressor, also plays an essential role during mouse eye development. Tgfβ is required for Arf promoter activation in developing mouse eyes, and its capacity to induce Arf depends on Smads 2/3 as well as p38 Mapk. Substantial delay between activation of these pathways and increased Arf transcription imply that changes in the binding of additional transcription factors help orchestrate changes in Arf expression. Focusing on proteins with putative DNA binding elements near the mouse Arf transcription start, we now show that Tgfβ induction of this gene correlated with decreased expression and DNA binding of C/ebpβ to the proximal Arf promoter. Ectopic expression of C/ebpβ in mouse embryo fibroblasts (MEFs) blocked Arf induction by Tgfβ. Although basal levels of Arf mRNA were increased by C/ebpβ loss in MEFs and in the developing eye, Tgfβ was still able to increase Arf, indicating that derepression was not the sole factor. Chromatin immunoprecipitation (ChIP) assay showed increased Sp1 binding to the Arf promotor at 24 and 48 hours after Tgfβ treatment, at which time points Arf expression was significantly induced by Tgfβ. Chemical inhibition of Sp1 and its knockdown by RNA interference blocked Arf induction by Tgfβ in MEFs. In summary, our results indicate that C/ebpβ and Sp1 are negative and positive Arf regulators that are influenced by Tgfβ. PMID:23940569

  2. Sp1 transcriptionally regulates BRK1 expression in non-small cell lung cancer cells.

    PubMed

    Li, Meng; Ling, Bing; Xiao, Ting; Tan, Jinjing; An, Ning; Han, Naijun; Guo, Suping; Cheng, Shujun; Zhang, Kaitai

    2014-06-01

    Following a previous study reporting that BRK1 is upregulated in non-small cell lung cancer (NSCLC), the present study sought to clarify the role of specificity protein 1 (Sp1) in the transcriptional regulation of the BRK1 gene. Therefore, a construct, named F8, consisting of the -1341 to -1 nt sequence upstream of the start codon of the BRK1 gene inserted into pGL4.26 was made. A series of truncated fragments was then constructed based on F8. Segment S831, which contained the -84 to -1 nt region, displayed the highest transcriptional activity in the A549, H1299 and H520 NSCLC cell lines. Bioinformatic analysis showed a potential Sp1-binding element at -73 to -64 nt, and a mutation in this region suppressed the transcriptional activity of S831. Then the RNAi assays of Sp1 and its coworkers Sp3 and Sp4 were performed, and suppression of Sp1 by siRNA inhibited the mRNA expression of BRK1. Both an electrophoretic mobility shift assay (EMSA) and a chromatin immunoprecipitation (ChIP) assay demonstrated that Sp1 bound to the promoter area of the BRK1 gene. Our data identified a functional and positive Sp1 regulatory element from -73 to -64 nt in the BRK1 promoter, which may likely explain the overexpression of BRK1 in NSCLC. PMID:24680773

  3. An interaction between the DNA-binding domains of RelA(p65) and Sp1 mediates human immunodeficiency virus gene activation.

    PubMed Central

    Perkins, N D; Agranoff, A B; Pascal, E; Nabel, G J

    1994-01-01

    Induction of human immunodeficiency virus type 1 (HIV-1) gene expression in stimulated T cells has been attributed to the activation of the transcription factor NF-kappa B. The twice-repeated kappa B sites within the HIV-1 long terminal repeat are in close proximity to three binding sites for Sp1. We have previously shown that a cooperative interaction of NF-kappa B with Sp1 is required for the efficient stimulation of HIV-1 transcription. In this report, we define the domains of each protein responsible for this effect. Although the transactivation domains seemed likely to mediate this interaction, we find, surprisingly, that this interaction occurs through the putative DNA-binding domains of both proteins. Sp1 specifically interacted with the amino-terminal region of RelA(p65). Similarly, RelA bound directly to the zinc finger region of Sp1. This interaction was specific and resulted in cooperative DNA binding to the kappa B and Sp1 sites in the HIV-1 long terminal repeat. Furthermore, the amino-terminal region of RelA did not associate with several other transcription factors, including MyoD, E12, or Kox15, another zinc finger protein. These findings suggest that the juxtaposition of DNA-binding sites promotes a specific protein interaction between the DNA-binding regions of these transcription factors. This interaction is required for HIV transcriptional activation and may provide a mechanism to allow for selective activation of kappa B-regulated genes. Images PMID:7935378

  4. All-trans retinoic acid increases expression of aquaporin-5 and plasma membrane water permeability via transactivation of Sp1 in mouse lung epithelial cells.

    PubMed

    Nomura, Johji; Horie, Ichiro; Seto, Mayumi; Nagai, Kazufumi; Hisatsune, Akinori; Miyata, Takeshi; Isohama, Yoichiro

    2006-12-29

    Aquaporin-5 (AQP5) is a water-selective channel protein that is expressed in lacrimal glands, salivary glands, and distal lung. Several studies using AQP5 knockout mice have revealed that AQP5 plays an important role in maintaining water homeostasis in the lung. We report here that all-trans retinoic acid (atRA) increases plasma membrane water permeability, AQP5 mRNA and protein expression, and AQP5 promoter activity in MLE-12 cells. The promoter activation induced by atRA was diminished by mutation at the Sp1/Sp3 binding element (SBE), suggesting that the SBE mediates the effects of atRA. In addition, atRA increased the binding of Sp1 to the SBE without changing the levels of Sp1 in the nucleus. Taken together, our data indicate that atRA increases AQP5 expression through transactivation of Sp1, leading to an increase in plasma membrane water permeability. PMID:17097063

  5. Benjamin Franklin's risk factors for gout and stones: from genes and diet to possible lead poisoning.

    PubMed

    Finger, Stanley; Hagemann, Ian S

    2008-06-01

    Benjamin Franklin's medical history shows that he suffered from repeated attacks of gout and a large bladder stone. These conditions caused him considerable pain, markedly decreased his mobility, and likely contributed in indirect ways to his decline and eventual death from a pulmonary disorder. This article examines Franklin's risk factors for gout and stones, both as Franklin understood them and as we know them today. Significantly, both of these disorders are associated with high blood levels of uric acid, a metabolic by-product. Franklin's risk factors included his gender, genetics, diet, drinking, advanced age, psoriasis, and exposure to lead. Although it is impossible to assign a weight to each of these factors, it can be shown that a number of factors, each capable of raising uric acid levels, converged and conspired against him. PMID:19244863

  6. Relationship between orientation factor of lead zirconate titanate nanowires and dielectric permittivity of nanocomposites

    SciTech Connect

    Tang, Haixiong E-mail: hsodano@ufl.edu; Malakooti, Mohammad H.; Sodano, Henry A. E-mail: hsodano@ufl.edu

    2013-11-25

    The relationship between the orientation of lead zirconate titanate (PZT) nanowires dispersed in nanocomposites and the resulting dielectric constants are quantified. The orientation of the PZT nanowires embedded in a polymer matrix is controlled by varying the draw ratio and subsequently quantified using Herman's Orientation Factor. Consequently, it is demonstrated that the dielectric constants of nanocomposites are improved by increasing the orientation factor of the PZT nanowires. This technique is proposed to improve the dielectric constant of the nanocomposites without the need for additional filler volume fraction since the nanocomposites are utilized in a wide range of high dielectric permittivity electronic components.

  7. Maximal Expression of the Evolutionarily Conserved Slit2 Gene Promoter Requires Sp1.

    PubMed

    Saunders, Jacquelyn; Wisidagama, D Roonalika; Morford, Travis; Malone, Cindy S

    2016-08-01

    Slit2 is a neural axon guidance and chemorepellent protein that stimulates motility in a variety of cell types. The role of Slit2 in neural development and neoplastic growth and migration has been well established, while the genetic mechanisms underlying regulation of the Slit2 gene have not. We identified the core and proximal promoter of Slit2 by mapping multiple transcriptional start sites, analyzing transcriptional activity, and confirming sequence homology for the Slit2 proximal promoter among a number of species. Deletion series and transient transfection identified the Slit2 proximal promoter as within 399 base pairs upstream of the start of transcription. A crucial region for full expression of the Slit2 proximal promoter lies between 399 base pairs and 296 base pairs upstream of the start of transcription. Computer modeling identified three transcription factor-binding consensus sites within this region, of which only site-directed mutagenesis of one of the two identified Sp1 consensus sites inhibited transcriptional activity of the Slit2 proximal promoter (-399 to +253). Bioinformatics analysis of the Slit2 proximal promoter -399 base pair to -296 base pair region shows high sequence conservation over twenty-two species, and that this region follows an expected pattern of sequence divergence through evolution. PMID:26456684

  8. Cloning of the human activated leukocyte cell adhesion molecule promoter and identification of its tissue-independent transcriptional activation by Sp1.

    PubMed

    Tan, Fang; Mbunkui, Flaubert; Ofori-Acquah, Solomon F

    2012-12-01

    Activated leukocyte cell adhesion molecule (ALCAM) belongs to the immunoglobulin cell adhesion molecule super family. ALCAM is implicated in tumor progression, inflammation, and the differentiation of hematopoietic stem cells. Hitherto, the identity of regulatory DNA elements and cognate transcription factors responsible for ALCAM gene expression remained unknown. In this report, the human ALCAM promoter was cloned and its transcriptional mechanisms elucidated. The promoter is TATA-less and contains multiple GC-boxes. A proximal 650-bp promoter fragment conferred tissue-independent activation, whereas two contiguous regions upstream of this region negatively influenced promoter activity in a tissue-specific manner. The positive regulatory promoter region was mapped to a core 50 base pair sequence containing a conical Sp1 element. Mutation analysis revealed that this element alone or in tandem with elements immediately upstream was required for maximal promoter activity. Chromatin analysis revealed that Sp1 binds exclusively to the canonical binding sequence in vivo, but not to DNA sequence immediately upstream. Finally, we showed that over-expression of Sp1 significantly increased the basal promoter activity. Thus, Sp1 activated the ALCAM promoter in most cells. These findings have important ramifications for unraveling the roles of ALCAM in inflammation and tumorigenesis. PMID:22941204

  9. The impact of high co-expression of Sp1 and HIF1α on prognosis of patients with hepatocellular cancer

    PubMed Central

    LIU, LIANG; JI, PING; QU, NING; PU, WEI-LIN; JIANG, DAO-WEN; LIU, WEI-YAN; LI, YA-QI; SHI, RONG-LIANG

    2016-01-01

    Transcription factor specificity protein 1 (Sp1) and hypoxia-inducible factor 1α (HIF1α) serve vital roles in tumor growth and metastasis. The present study aimed to evaluate the impact of co-expression of Sp1 and HIF1α on the prognosis of patients with hepatocellular cancer (HCC) using The Cancer Genome Atlas (TCGA) database and to validate the association between the expression levels of Sp1/HIF1α in HCC specimens and patient survival using immunohistochemical analysis. A total of 214 eligible patients with HCC from TCGA database were collected for the study. The expression profile of Sp1 and HIF1α were obtained from the TCGA RNAseq database. Clinicopathological characteristics, including age, height, weight, gender, race, ethnicity, family cancer history, serum α-fetoprotein (AFP), surgical procedures and TNM stage were collected. The Cox proportional hazards regression model and Kaplan-Meier curves were used to assess the relative factors. Receiver operating characteristic (ROC) curves for cancer-specific survival (CSS) prediction were plotted to compare the prediction ability of expression of Sp1 and HIF1α and their co-expression. The location and expression of Sp1 and HIF1α in the HCC tissues were detected by immunohistochemistry (IHC) to verify the association between these two genes and CSS. The results demonstrated that the expressions of Sp1 and HIF1α were significantly increased in the succumbed group (P=0.001), compared with the surviving group. The CSS rates were 60.1% at 3 years (1,067 days), 35.8% at 5 years (1,823 days) and 9.5% at 10 years (3,528 days). Multivariate Cox regression analysis demonstrated that only the high expression levels of Sp1 and HIF1α (≥2×103) were independent predictors for cancer mortality, with P=0.001 and P=0.029, respectively. The area under the curve for the ROC was found to be higher using the combination testing for two genes (0.751) in predicting cancer mortality, compared to a single gene (0.632 for Sp1

  10. A Systematic Assessment of Blood Lead Level in Children and Associated Risk Factors in China.

    PubMed

    Wang, Lu; Li, Zhen; Huang, Shao Xin; DU, Chuang; Wang, Hong; He, Li Ping; Bi, Yong Yi; Shi, Yong; Wang, Chun Hong

    2015-08-01

    In this study, we searched multiple databases for all relevant original articles (1996-2013). To investigate blood lead levels (BLL) and possible risk factors for lead exposure among children in China A total of 388 articles met our inclusion criteria. The overall geometric mean (GM) BLL was 71 µg/L, and the prevalence of elevated BLL (EBLL, defined as BLL ⋝ 100 µg/L) was 18.48% among children. The prevalence of EBLL remained significantly higher among boys. In children less than 6 years of age, there were significantly increasing trends in both BLL and prevalence of EBLL in an age-dependent manner. The ban on leaded gasoline significantly reduced the BLL as well as EBLL prevalence; however, children whose parents had lower educational levels or were exposed to lead in the workplace had a higher EBLL prevalence. Despite its decline over time, the average BLL among children in China remains higher than the average level most recently reported in the United States. Childhood lead poisoning remains a public health problem in China. PMID:26383600

  11. Artemisinin blocks prostate cancer growth and cell cycle progression by disrupting Sp1 interactions with the cyclin-dependent kinase-4 (CDK4) promoter and inhibiting CDK4 gene expression.

    PubMed

    Willoughby, Jamin A; Sundar, Shyam N; Cheung, Mark; Tin, Antony S; Modiano, Jaime; Firestone, Gary L

    2009-01-23

    Artemisinin, a naturally occurring component of Artemisia annua, or sweet wormwood, is a potent anti-malaria compound that has recently been shown to have anti-proliferative effects on a number of human cancer cell types, although little is know about the molecular mechanisms of this response. We have observed that artemisinin treatment triggers a stringent G1 cell cycle arrest of LNCaP (lymph node carcinoma of the prostate) human prostate cancer cells that is accompanied by a rapid down-regulation of CDK2 and CDK4 protein and transcript levels. Transient transfection with promoter-linked luciferase reporter plasmids revealed that artemisinin strongly inhibits CDK2 and CDK4 promoter activity. Deletion analysis of the CDK4 promoter revealed a 231-bp artemisinin-responsive region between -1737 and -1506. Site-specific mutations revealed that the Sp1 site at -1531 was necessary for artemisinin responsiveness in the context of the CDK4 promoter. DNA binding assays as well as chromatin immunoprecipitation assays demonstrated that this Sp1-binding site in the CDK4 promoter forms a specific artemisinin-responsive DNA-protein complex that contains the Sp1 transcription factor. Artemisinin reduced phosphorylation of Sp1, and when dephosphorylation of Sp1 was inhibited by treatment of cells with the phosphatase inhibitor okadaic acid, the ability of artemisinin to down-regulate Sp1 interactions with the CDK4 promoter was ablated, rendering the CDK4 promoter unresponsive to artemisinin. Finally, overexpression of Sp1 mostly reversed the artemisinin down-regulation of CDK4 promoter activity and partially reversed the cell cycle arrest. Taken together, our results demonstrate that a key event in the artemisinin anti-proliferative effects in prostate cancer cells is the transcriptional down-regulation of CDK4 expression by disruption of Sp1 interactions with the CDK4 promoter. PMID:19017637

  12. Nucleolin regulates c-Jun/Sp1-dependent transcriptional activation of cPLA2alpha in phorbol ester-treated non-small cell lung cancer A549 cells.

    PubMed

    Tsou, Jen-Hui; Chang, Kwang-Yu; Wang, Wei-Chiao; Tseng, Joseph T; Su, Wu-Chou; Hung, Liang-Yi; Chang, Wen-Chang; Chen, Ben-Kuen

    2008-01-01

    The expression of cPLA2 is critical for transformed growth of non-small cell lung cancer (NSCLC). It is known that phorbol 12-myristate 13-acetate (PMA)-activated signal transduction pathway is thought to be involved in the oncogene action in NSCLC and enzymatic activation of cPLA2. However, the transcriptional regulation of cPLA2alpha in PMA-activated NSCLC is not clear. In this study, we found that PMA induced the mRNA level and protein expression of cPLA2alpha. In addition, two Sp1-binding sites of cPLA2alpha promoter were required for response to PMA and c-Jun overexpression. Small interfering RNA (siRNA) of c-Jun and nucleolin inhibited PMA induced the promoter activity and protein expression of cPLA2alpha. Furthermore, PMA stimulated the formation of c-Jun/Sp1 and c-Jun/nucleolin complexes as well as the binding of these transcription factor complexes to the cPLA2alpha promoter. Although Sp1-binding sites were required for the bindings of Sp1 and nucleolin to the promoter, the binding of nucleolin or Sp1 to the promoter was independent of each other. Our results revealed that c-Jun/nucleolin and c-Jun/Sp1 complexes play an important role in PMA-regulated cPLA2alpha gene expression. It is likely that nucleolin binding at place of Sp1 on gene promoter could also mediate the regulation of c-Jun/Sp1-activated genes. PMID:18025046

  13. A factorization approach to next-to-leading-power threshold logarithms

    NASA Astrophysics Data System (ADS)

    Bonocore, D.; Laenen, E.; Magnea, L.; Melville, S.; Vernazza, L.; White, C. D.

    2015-06-01

    Threshold logarithms become dominant in partonic cross sections when the selected final state forces gluon radiation to be soft or collinear. Such radiation factorizes at the level of scattering amplitudes, and this leads to the resummation of threshold logarithms which appear at leading power in the threshold variable. In this paper, we consider the extension of this factorization to include effects suppressed by a single power of the threshold variable. Building upon the Low-Burnett-Kroll-Del Duca (LBKD) theorem, we propose a decomposition of radiative amplitudes into universal building blocks, which contain all effects ultimately responsible for next-to-leading-power (NLP) threshold logarithms in hadronic cross sections for electroweak annihilation processes. In particular, we provide a NLO evaluation of the radiative jet function, responsible for the interference of next-to-soft and collinear effects in these cross sections. As a test, using our expression for the amplitude, we reproduce all abelian-like NLP threshold logarithms in the NNLO Drell-Yan cross section, including the interplay of real and virtual emissions. Our results are a significant step towards developing a generally applicable resummation formalism for NLP threshold effects, and illustrate the breakdown of next-to-soft theorems for gauge theory amplitudes at loop level.

  14. Lead exposure in children: levels in blood, prevalence of intoxication and related factors.

    PubMed

    Solé, E; Ballabriga, A; Domínguez, C

    1998-09-01

    Lead is a highly toxic metal, the main source of which is contamination from combustion of unleaded petrol. The aims of this work were to detect the degree of lead exposure in a large sample of children; determine the relationship between blood lead levels (BPb) and age, sex, habitat and season of the year; and correlate BPb with zinc protoporphyrin (ZPP) values. A cross-sectional study was carried out. Blood from routine extractions drawn at our centre was used. BPb and ZPP were measured by atomic absorption spectrophotometry and haematofluorimetry, respectively. We analysed 1158 blood samples from children. BPb (mean +/- SEM): 0.22 +/- 0.04 mumol l-1. Correlation BPb-age: BPb = 0.19 + 0.086 x age (months), r = 0.129, P < 0.0001. BPb was greater in boys (0.23 +/- 0.007 versus 0.20 +/- 0.006 mumol l-1, P < 0.0002). No differences were observed between habitats (urban versus rural). BPb were higher in the warm months (0.24 +/- 0.013 versus 0.21 +/- 0.007 mumol l-1, P < 0.0001). Prevalence of lead intoxication (BPb > 0.48 mumol l-1) was 4.2%. No differences in prevalence were found among the different groups. The correlation between BPb and ZPP showed r = 0.0969, P = 0.0024. Utility for screening: sensitivity of 53.7% and specificity of 59.3% (cut-off point of 60 mumol ZPP mol-1 haem). We can conclude that lead exposure in children in our sample was in the range reported in similar studies in other areas and countries, and below the toxic limit. None of the factors analysed significantly influenced lead intoxication prevalence. There was no good correlation between ZPP and BPb in our samples and the ZPP cut-off point used did not present good specificity and sensitivity values. PMID:9850561

  15. Analysis of lead/acid battery life cycle factors: their impact on society and the lead industry

    NASA Astrophysics Data System (ADS)

    Robertson, J. G. S.; Wood, J. R.; Ralph, B.; Fenn, R.

    The underlying theme of this paper is that society, globally, is undergoing a fundamental conceptual shift in the way it views the environment and the role of industry within it. There are views in certain quarters that this could result in the virtual elimination of the lead industry's entire product range. Despite these threats, it is argued that the prospects for the lead industry appear to be relatively favourable in a number of respects. The industry's future depends to a significant degree, however, upon its ability to argue its case in a number of key areas. It is contended, therefore, that if appropriate strategies and means are promulgated, the prospects of the industry would appear to be relatively healthy. But, for this to happen with optimal effectiveness, a conceptual change will be necessary within the industry. New strategies and tools will have to be developed. These will require a significantly more integrated, holistically based and 'reflexive' approach than previously. The main elements of such an approach are outlined. With reference to the authors' ongoing research into automotive lead/acid starting lighting ignition (SLI) batteries, the paper shows how the technique of in-depth life cycle assessment (LCA), appropriately adapted to the needs of the industry, will provide a crucial role in this new approach. It also shows how it may be used as an internal design and assessment tool to identify those stages in the battery life cycle that give rise to the greatest environmental burdens, and to assess the effects of changes in the cycle to those burdens. It is argued that the development of this approach requires the serious and urgent attention of the whole of the lead industry. Also to make the LCA tool fully effective, it must be based on a 'live' database that is produced, maintained and continually updated by the industry.

  16. Bovine lactoferricin induces TIMP-3 via the ERK1/2-Sp1 axis in human articular chondrocytes

    PubMed Central

    Yan, Dongyao; Chen, Di; Hawse, John R; van Wijnen, Andre J; Im, Hee-Jeong

    2013-01-01

    Bovine lactoferricin (LfcinB) is a heparan sulfate-binding peptide with multiple bioactivities. In human articular cartilage, LfcinB antagonizes interleukin-1 β (IL-1β) and fibroblast growth factor 2 (FGF-2) in proteoglycan metabolism, catabolic protease expression, and induction of pro-inflammatory mediators. LfcinB specifically activates ERK1/2, p38 and Akt, but whether these signaling pathways control the expression of LfcinB target genes remained unknown. In this report, we characterized a novel aspect of LfcinB-mediated genetic response in human articular chondrocytes, tissue inhibitor of metalloproteinase 3 (TIMP-3) induction. Inhibition of individual signaling pathways revealed that ERK1/2 functions as the major pathway in TIMP-3 expression, whereas Akt plays a minor role. Further investigation identified Sp1 as a critical transcriptional activator in TIMP-3 regulation, and Sp1 activity is modulated by ERK1/2, not Akt. Comparative quantification indicates significant downregulation of TIMP-3 occurs in OA chondrocytes, suggesting a beneficial role of LfcinB in OA pathogenesis. Our results collectively provide new insights into the mechanism of action of LfcinB, and support the candidacy of LfcinB as a chondroprotective agent. PMID:23313877

  17. Loss of proteolytically processed filaggrin caused by epidermal deletion of Matriptase/MT-SP1

    PubMed Central

    List, Karin; Szabo, Roman; Wertz, Philip W.; Segre, Julie; Haudenschild, Christian C.; Kim, Soo-Youl; Bugge, Thomas H.

    2003-01-01

    Profilaggrin is a large epidermal polyprotein that is proteolytically processed during keratinocyte differentiation to release multiple filaggrin monomer units as well as a calcium-binding regulatory NH2-terminal filaggrin S-100 protein. We show that epidermal deficiency of the transmembrane serine protease Matriptase/MT-SP1 perturbs lipid matrix formation, cornified envelope morphogenesis, and stratum corneum desquamation. Surprisingly, proteomic analysis of Matriptase/MT-SP1–deficient epidermis revealed the selective loss of both proteolytically processed filaggrin monomer units and the NH2-terminal filaggrin S-100 regulatory protein. This was associated with a profound accumulation of profilaggrin and aberrant profilaggrin-processing products in the stratum corneum. The data identify keratinocyte Matriptase/MT-SP1 as an essential component of the profilaggrin-processing pathway and a key regulator of terminal epidermal differentiation. PMID:14638864

  18. An Sp1 binding site and the minimal promoter contribute to overexpression of the cytokeratin 18 gene in tumorigenic clones relative to that in nontumorigenic clones of a human carcinoma cell line.

    PubMed Central

    Gunther, M; Frebourg, T; Laithier, M; Fossar, N; Bouziane-Ouartini, M; Lavialle, C; Brison, O

    1995-01-01

    Clones of cells tumorigenic or nontumorigenic in nude mice have been previously isolated from the SW613-S human colon carcinoma cell line. We have already reported that tumorigenic cells overexpress the cytokeratin 18 (K18) gene in comparison with nontumorigenic cells and that this difference is mainly due to a transcriptional regulation. We now report that a 2,532-bp cloned human K18 gene promoter drives the differential expression of a reporter gene in a transient assay. A 62-bp minimal K18 promoter (TATA box and initiation site) has a low but differential activity. Analysis of deletion and substitution mutants as well as hybrid SV40-K18 promoters and reconstructed K18 promoters indicated that an important element for the activity of the K18 promoter is a high-affinity binding site for transcription factor Sp1 located just upstream of the TATA box. This Sp1 binding element, as well as the intron 1 enhancer element, stimulates the basal activity of the minimal promoter through mechanisms that maintain the differential activity. Gel shift assays and the use of an anti-Sp1 antibody have shown that both tumorigenic and nontumorigenic SW613-S cells contain three factors able to bind to the Sp1 binding element site and that one of them is Sp1. A hybrid GAL4-Sp1 protein transactivated to comparable extents in tumorigenic and nontumorigenic cells a reconstructed K18 promoter containing GAL4 binding sites and therefore without altering its differential behavior. These results indicate that the Sp1 transcription factor is involved in the overexpression of the K18 gene in tumorigenic SW613-S cells through its interaction with a component of the basal transcription machinery. PMID:7537848

  19. Crucial Dimensions of Human Altruism. Affective vs. Conceptual Factors Leading to Helping or Reinforcing Others

    PubMed Central

    Szuster, Anna

    2016-01-01

    The aim of this article is to identify factors leading to favorable attitudes toward other people from different social categories. The parts of article reflect diverse levels of altruism regulation from primary affective responses to the environment, through social norms, to abstract moral concepts related to good and evil. The latter allow understanding of the perspective of other people (including those belonging to out-groups), acceptance of their values and engagement not only in helping behavior but also in supporting the development of others. PMID:27148127

  20. Crucial Dimensions of Human Altruism. Affective vs. Conceptual Factors Leading to Helping or Reinforcing Others.

    PubMed

    Szuster, Anna

    2016-01-01

    The aim of this article is to identify factors leading to favorable attitudes toward other people from different social categories. The parts of article reflect diverse levels of altruism regulation from primary affective responses to the environment, through social norms, to abstract moral concepts related to good and evil. The latter allow understanding of the perspective of other people (including those belonging to out-groups), acceptance of their values and engagement not only in helping behavior but also in supporting the development of others. PMID:27148127

  1. Imported Flood-Related Leptospirosis From Palau: Awareness of Risk Factors Leads to Early Treatment.

    PubMed

    Matono, Takashi; Kutsuna, Satoshi; Koizumi, Nobuo; Fujiya, Yoshihiro; Takeshita, Nozomi; Hayakawa, Kayoko; Kanagawa, Shuzo; Kato, Yasuyuki; Ohmagari, Norio

    2015-01-01

    We describe two Japanese travelers with leptospirosis who visited Palau. Both travelers swam in Ngardmau Falls, which was flooded for two days after typhoon Phanfone. The diagnoses were confirmed by microscopic agglutination test or polymerase chain reaction. This is the first report of leptospirosis in travelers who returned from Palau. It should be noted that choosing the appropriate test to biologically confirm leptospirosis was highly time-dependent. Awareness of the risk factors for leptospirosis, mainly that of the exposure to contaminated fresh water after a flooding, would lead to an early and appropriate treatment before the confirmed diagnosis. PMID:26503094

  2. Early experiences with the IBM SP1 and the high-performance switch

    SciTech Connect

    Gropp, W.

    1993-11-01

    The IBM SP1 is IBM`s newest parallel distributed-memory computer. As part of a joint project with IBM, Argonne took delivery of an early system in order to evaluate the software environment and to begin porting programming packages and applications to this machine. This report discusses the results of those efforts once the high-performance switch was installed. An earlier report (ANL/MCS-TM-177) emphasized software usability and the initial ports to the SP1. This report contains performance results and discusses some applications and tools not covered in TM 177.

  3. Zinc Finger Independent Genome-Wide Binding of Sp2 Potentiates Recruitment of Histone-Fold Protein Nf-y Distinguishing It from Sp1 and Sp3

    PubMed Central

    Finkernagel, Florian; Stiewe, Thorsten; Nist, Andrea; Suske, Guntram

    2015-01-01

    Transcription factors are grouped into families based on sequence similarity within functional domains, particularly DNA-binding domains. The Specificity proteins Sp1, Sp2 and Sp3 are paradigmatic of closely related transcription factors. They share amino-terminal glutamine-rich regions and a conserved carboxy-terminal zinc finger domain that can bind to GC rich motifs in vitro. All three Sp proteins are ubiquitously expressed; yet they carry out unique functions in vivo raising the question of how specificity is achieved. Crucially, it is unknown whether they bind to distinct genomic sites and, if so, how binding site selection is accomplished. In this study, we have examined the genomic binding patterns of Sp1, Sp2 and Sp3 in mouse embryonic fibroblasts by ChIP-seq. Sp1 and Sp3 essentially occupy the same promoters and localize to GC boxes. The genomic binding pattern of Sp2 is different; Sp2 primarily localizes at CCAAT motifs. Consistently, re-expression of Sp2 and Sp3 mutants in corresponding knockout MEFs revealed strikingly different modes of genomic binding site selection. Most significantly, while the zinc fingers dictate genomic binding of Sp3, they are completely dispensable for binding of Sp2. Instead, the glutamine-rich amino-terminal region is sufficient for recruitment of Sp2 to its target promoters in vivo. We have identified the trimeric histone-fold CCAAT box binding transcription factor Nf-y as the major partner for Sp2-chromatin interaction. Nf-y is critical for recruitment of Sp2 to co-occupied regulatory elements. Equally, Sp2 potentiates binding of Nf-y to shared sites indicating the existence of an extensive Sp2-Nf-y interaction network. Our results unveil strikingly different recruitment mechanisms of Sp1/Sp2/Sp3 transcription factor members uncovering an unexpected layer of complexity in their binding to chromatin in vivo. PMID:25793500

  4. Factors Leading to Variability of Emission Factors, Single Scattering Albedo, and Elemental Carbon Fraction from Biofuel Emissions

    NASA Astrophysics Data System (ADS)

    Roden, C. A.; Bond, T. C.; Conway, S.; Osorto Pinel, B.; Maccarty, N.

    2006-12-01

    In a three-year study of field and laboratory emissions of traditional and improved biofuel cookstoves, we found that field measured particulate emissions of actual cooking events average 2.5 times those of reproduced lab emissions. Emission factors are highly dependent on the care and skill of the operator, and the resulting combustion; these do not appear to be accurately reproduced in the lab. The single scatter albedo (SSA) of the emissions is very low in both lab and field measurements, averaging about 0.3 for lab tests and around 0.5 for field tests, indicating that the primary particles are climate warming. In Honduras, improved stoves generally had lower emission factors than traditional stoves. Over the course of 3 summers we have measured field emissions from traditional cookstoves, relatively-new improved cookstoves, and "broken-in" improved cookstoves. For improved stoves, the presence of a chimney generally resulted in lower emission factors but left the SSA unaffected. Traditional cookstoves had an average PM emission factor of 8.5 g/kg significantly larger than previous studies. Particulate emission factors for improved cookstoves without and with chimneys averaged about 5.7 g/kg and 3.5 g/kg respectively. The elemental carbon (EC) fraction of PM varied significantly between individual tests, but averaged about 25% for each of the categories. Wood type affects on the PM emission factor, the SSA of the emissions and EC fraction. During our 2006 field measurements, we performed multiple emission measurements on the same stove while varying the fuel. Pine wood generally produced more PM than oak per kilogram of fuel. Additionally, Ocote, a resinous pitch pine often used in Central America for lighting fires, produces emissions which have a very low SSA and high EC fraction. We present the elemental carbon fraction and mass emission factors for different type of stoves and testing conditions. We summarize the characteristics of the particles emitted

  5. Can mammographic assessments lead to consider density as a risk factor for breast cancer?

    PubMed

    Colin, C; Prince, V; Valette, P J

    2013-03-01

    Admitting that mammographic breast density is an important independent risk factor for breast cancer in the general population, has a crucial economical health care impact, since it might lead to increasing screening frequency or reinforcing additional modalities. Thus, the impact of density as a risk factor has to be carefully investigated and might be debated. Some authors suggested that high density would be either a weak factor or confused with a masking effect. Others concluded that most of the studies have methodological biases in basic physics to quantify percentage of breast density, as well as in mammographic acquisition parameters. The purpose of this review is to evaluate mammographic procedures and density assessments in published studies regarding density as a breast cancer risk. No standardization was found in breast density assessments and compared density categories. High density definitions varied widely from 25 to 75% of dense tissues on mammograms. Some studies showed an insufficient follow-up to reveal masking effect related to mammographic false negatives. Evaluating breast density impact needs thorough studies with consensual mammographic procedures, methods of density measurement, breast density classification as well as a standardized definition of high breast density. Digital mammography, more effective in dense breasts, should help to re-evaluate the issue of density as a risk factor for breast cancer. PMID:20133095

  6. Factorization for groomed jet substructure beyond the next-to-leading logarithm

    NASA Astrophysics Data System (ADS)

    Frye, Christopher; Larkoski, Andrew J.; Schwartz, Matthew D.; Yan, Kai

    2016-07-01

    Jet grooming algorithms are widely used in experimental analyses at hadron colliders to remove contaminating radiation from within jets. While the algorithms perform a great service to the experiments, their intricate algorithmic structure and multiple parameters has frustrated precision theoretic understanding. In this paper, we demonstrate that one particular groomer called soft drop actually makes precision jet substructure easier. In particular, we derive a factorization formula for a large class of soft drop jet substructure observables, including jet mass. The essential observation that allows for this factorization is that, without the soft wide-angle radiation groomed by soft drop, all singular contributions are collinear. The simplicity and universality of the collinear limit in QCD allows us to show that to all orders, the normalized differential cross section has no contributions from non-global logarithms. It is also independent of process, up to the relative fraction of quark and gluon jets. In fact, soft drop allows us to define this fraction precisely. The factorization theorem also explains why soft drop observables are less sensitive to hadronization than their ungroomed counterparts. Using the factorization theorem, we resum the soft drop jet mass to next-to-next-to-leading logarithmic accuracy. This requires calculating some clustering effects that are closely related to corresponding effects found in jet veto calculations. We match our resummed calculation to fixed order results for both e + e - → dijets and pp → Z + j events, producing the first jet substructure predictions (groomed or ungroomed) to this accuracy for the LHC.

  7. Lead halide perovskite nanowire lasers with low lasing thresholds and high quality factors.

    PubMed

    Zhu, Haiming; Fu, Yongping; Meng, Fei; Wu, Xiaoxi; Gong, Zizhou; Ding, Qi; Gustafsson, Martin V; Trinh, M Tuan; Jin, Song; Zhu, X-Y

    2015-06-01

    The remarkable performance of lead halide perovskites in solar cells can be attributed to the long carrier lifetimes and low non-radiative recombination rates, the same physical properties that are ideal for semiconductor lasers. Here, we show room-temperature and wavelength-tunable lasing from single-crystal lead halide perovskite nanowires with very low lasing thresholds (220 nJ cm(-2)) and high quality factors (Q ∼ 3,600). The lasing threshold corresponds to a charge carrier density as low as 1.5 × 10(16) cm(-3). Kinetic analysis based on time-resolved fluorescence reveals little charge carrier trapping in these single-crystal nanowires and gives estimated lasing quantum yields approaching 100%. Such lasing performance, coupled with the facile solution growth of single-crystal nanowires and the broad stoichiometry-dependent tunability of emission colour, makes lead halide perovskites ideal materials for the development of nanophotonics, in parallel with the rapid development in photovoltaics from the same materials. PMID:25849532

  8. Environmental Factors Predicting Blood Lead Levels in Pregnant Women in the UK: The ALSPAC Study

    PubMed Central

    Taylor, Caroline M.; Golding, Jean; Hibbeln, Joseph; Emond, Alan M.

    2013-01-01

    Background Lead is a widespread environmental toxin. The behaviour and academic performance of children can be adversely affected even at low blood lead levels (BLL) of 5–10 µg/dl. An important contribution to the infant's lead load is provided by maternal transfer during pregnancy. Objectives Our aim was to determine BLL in a large cohort of pregnant women in the UK and to identify the factors that contribute to BLL in pregnant women. Methods Pregnant women resident in the Avon area of the UK were enrolled in the Avon Longitudinal Study of Parents and Children (ALSPAC) in 1991–1992. Whole blood samples were collected at median gestational age of 11 weeks and analysed by inductively coupled plasma dynamic reaction cell mass spectrometry (n = 4285). Self-completion postal questionnaires were used to collect data during pregnancy on lifestyle, diet and other environmental exposures. Statistical analysis was carried out with SPSS v19. Results The mean±SD BLL was 3.67±1.47 (median 3.41, range 0.41–19.14) µg/dl. Higher educational qualification was found to be one of the strongest independent predictor of BLL in an adjusted backwards stepwise logistic regression to predict maternal BLL <5 or ≥5 µg/dl (odds ratio 1.26, 95% confidence interval 1.12–1.42; p<0.001). Other predictive factors included cigarette smoking, alcohol and coffee drinking, and heating the home with a coal fire, with some evidence for iron and calcium intake having protective effects. Conclusion The mean BLL in this group of pregnant women is higher than has been found in similar populations in developed countries. The finding that high education attainment was independently associated with higher BLL was unexpected and currently unexplained. Reduction in maternal lead levels can best be undertaken by reducing intake of the social drugs cigarettes, alcohol and caffeine, although further investigation of the effect of calcium on lead levels is needed. PMID:24039753

  9. Blood Lead Levels and Serum Insulin-Like Growth Factor 1 Concentrations in Peripubertal Boys

    PubMed Central

    Fleisch, Abby F.; Burns, Jane S.; Williams, Paige L.; Lee, Mary M.; Sergeyev, Oleg; Korrick, Susan A.

    2013-01-01

    Background: Childhood lead exposure has been associated with growth delay. However, the association between blood lead levels (BLLs) and insulin-like growth factor 1 (IGF-1) has not been characterized in a large cohort with low-level lead exposure. Methods: We recruited 394 boys 8–9 years of age from an industrial Russian town in 2003–2005 and followed them annually thereafter. We used linear regression models to estimate the association of baseline BLLs with serum IGF-1 concentration at two follow-up visits (ages 10–11 and 12–13 years), adjusting for demographic and socioeconomic covariates. Results: At study entry, median BLL was 3 μg/dL (range, < 0.5–31 μg/dL), most boys (86%) were prepubertal, and mean ± SD height and BMI z-scores were 0.14 ± 1.0 and –0.2 ± 1.3, respectively. After adjustment for covariates, the mean follow-up IGF-1 concentration was 29.2 ng/mL lower (95% CI: –43.8, –14.5) for boys with high versus low BLL (≥ 5 μg/dL or < 5 μg/dL); this difference persisted after further adjustment for pubertal status. The association of BLL with IGF-1 was stronger for mid-pubertal than prepubertal boys (p = 0.04). Relative to boys with BLLs < 2 μg/dL, adjusted mean IGF-1 concentrations decreased by 12.8 ng/mL (95% CI: –29.9, 4.4) for boys with BLLs of 3–4 μg/dL; 34.5 ng/mL (95% CI: –53.1, –16.0) for BLLs 5–9 μg/dL; and 60.4 ng/mL (95% CI: –90.9, –29.9) for BLLs ≥ 10 μg/dL. Conclusions: In peripubertal boys with low-level lead exposure, higher BLLs were associated with lower serum IGF-1. Inhibition of the hypothalamic–pituitary–growth axis may be one possible pathway by which lead exposure leads to growth delay. PMID:23632160

  10. Cardiovascular Risk Factors Promote Brain Hypoperfusion Leading to Cognitive Decline and Dementia

    PubMed Central

    de la Torre, Jack C.

    2012-01-01

    Heart disease is the major leading cause of death and disability in the world. Mainly affecting the elderly population, heart disease and its main outcome, cardiovascular disease, have become an important risk factor in the development of cognitive decline and Alzheimer's disease (AD). This paper examines the evidence linking chronic brain hypoperfusion induced by a variety of cardiovascular deficits in the development of cognitive impairment preceding AD. The evidence indicates a strong association between AD and cardiovascular risk factors, including ApoE4, atrial fibrillation, thrombotic events, hypertension, hypotension, heart failure, high serum markers of inflammation, coronary artery disease, low cardiac index, and valvular pathology. In elderly people whose cerebral perfusion is already diminished by their advanced age, additional reduction of cerebral blood flow stemming from abnormalities in the heart-brain vascular loop ostensibly increases the probability of developing AD. Evidence also suggests that a neuronal energy crisis brought on by relentless brain hypoperfusion may be responsible for protein synthesis abnormalities that later result in the classic neurodegenerative lesions involving the formation of amyloid-beta plaques and neurofibrillary tangles. Insight into how cardiovascular risk factors can induce progressive cognitive impairment offers an enhanced understanding of the multifactorial pathophysiology characterizing AD and ways at preventing or managing the cardiovascular precursors of this dementia. PMID:23243502

  11. AmeriFlux US-SP1 Slashpine-Austin Cary- 65yrs nat regen

    SciTech Connect

    Martin, Tim

    2016-01-01

    This is the AmeriFlux version of the carbon flux data for the site US-SP1 Slashpine-Austin Cary- 65yrs nat regen. Site Description - The ACMF site is a 67 hectare naturally regenerated Pinus palustris and Pinus elliottii mixed stand.

  12. Scalability study of parallel spatial direct numerical simulation code on IBM SP1 parallel supercomputer

    NASA Technical Reports Server (NTRS)

    Hanebutte, Ulf R.; Joslin, Ronald D.; Zubair, Mohammad

    1994-01-01

    The implementation and the performance of a parallel spatial direct numerical simulation (PSDNS) code are reported for the IBM SP1 supercomputer. The spatially evolving disturbances that are associated with laminar-to-turbulent in three-dimensional boundary-layer flows are computed with the PS-DNS code. By remapping the distributed data structure during the course of the calculation, optimized serial library routines can be utilized that substantially increase the computational performance. Although the remapping incurs a high communication penalty, the parallel efficiency of the code remains above 40% for all performed calculations. By using appropriate compile options and optimized library routines, the serial code achieves 52-56 Mflops on a single node of the SP1 (45% of theoretical peak performance). The actual performance of the PSDNS code on the SP1 is evaluated with a 'real world' simulation that consists of 1.7 million grid points. One time step of this simulation is calculated on eight nodes of the SP1 in the same time as required by a Cray Y/MP for the same simulation. The scalability information provides estimated computational costs that match the actual costs relative to changes in the number of grid points.

  13. SP1 as a novel scaffold building block for self-assembly nanofabrication of submicron enzymatic structures.

    PubMed

    Heyman, Arnon; Levy, Ilan; Altman, Arie; Shoseyov, Oded

    2007-06-01

    In this study, SP1, a ring-shaped highly stable homododecamer protein complex was utilized for the self-assembly of multiple domains in a predefined manner. Glucose oxidase (GOx) was fused in-frame to SP1 and expressed in Escherichia coli. Complexes where GOx encircled SP1 dodecamer were observed, and moreover, the enzymatic monomers self-assembled into active multienzyme nanotube particles containing hundreds of GOx molecules per tube. This work demonstrates the value of SP1 as a self-assembly scaffold. PMID:17530810

  14. Early factors leading to later obesity: interactions of the microbiome, epigenome, and nutrition.

    PubMed

    Chang, Lilly; Neu, Josef

    2015-05-01

    Obesity is a major public health problem in the United States and many other countries. Childhood obesity rates have risen extensively over the last several decades with the numbers continuing to rise. Obese and overweight children are at high risk of becoming overweight adolescents and adults. The causes are multifactorial and are affected by various genetic, behavioral, and environmental factors. This review aims to discuss a previously under-recognized antecedent of obesity and related chronic metabolic diseases such as heart disease and diabetes. Specifically, we highlight the relationship of the microbial ecology of the gastrointestinal tract during early development and the consequent effects on metabolism, epigenetics, and inflammatory responses that can subsequently result in metabolic syndrome. Although studies in this area are just beginning, this area of research is rapidly expanding and may lead to early life interventions that may have significant impacts in the prevention of obesity. PMID:26043042

  15. p53 inhibits the expression of p125 and the methylation of POLD1 gene promoter by downregulating the Sp1-induced DNMT1 activities in breast cancer

    PubMed Central

    Zhang, Liang; Yang, Weiping; Zhu, Xiao; Wei, Changyuan

    2016-01-01

    p125 is one of four subunits of human DNA polymerases – DNA Pol δ as well as one of p53 target protein encoded by POLD1. However, the function and significance of p125 and the role that p53 plays in regulating p125 expression are not fully understood in breast cancer. Tissue sections of human breast cancer obtained from 70 patients whose median age was 47.6 years (range: 38–69 years) with stage II–III breast cancer were studied with normal breast tissue from the same patients and two human breast cell lines (MCF-7 and MCF-10A). p53 expression levels were reduced, while p125 protein expression was increased in human breast cancer tissues and cell line detected by Western blot and quantitative reverse transcriptase-polymerase chain reaction. The methylation level of the POLD1 gene promoter was greater in breast cancer tissues and cells when compared with normal tissues and cells. In MCF-7 cell model, p53 overexpression caused a decrease in the level of p125 protein, while the methylation level of the p125 gene promoter was also inhibited by p53 overexpression. To further investigate the regulating mechanism of p53 on p125 expression, our study focused on DNA methyltransferase 1 (DNMT1) and transcription factor Sp1. Both DNMT1 and Sp1 protein expression were reduced when p53 was overexpressed in MCF-7 cells. The Sp1 binding site appears to be important for DNMT1 gene transcription; Sp1 and p53 can bind together, which means that DNMT1 gene expression may be downregulated by p53 through binding to Sp1. Because DNMT1 methylation level of the p125 gene promoter can affect p125 gene transcription, we propose that p53 may indirectly regulate p125 gene promoter expression through the control of DNMT1 gene transcription. In conclusion, the data from this preliminary study have shown that p53 inhibits the methylation of p125 gene promoter by downregulating the activities of Sp1 and DNMT1 in breast cancer. PMID:27022290

  16. Investigating factors leading to fogging of glass vials in lyophilized drug products.

    PubMed

    Abdul-Fattah, Ahmad M; Oeschger, Richard; Roehl, Holger; Bauer Dauphin, Isabelle; Worgull, Martin; Kallmeyer, Georg; Mahler, Hanns-Christian

    2013-10-01

    Vial "Fogging" is a phenomenon observed after lyophilization due to drug product creeping upwards along the inner vial surface. After the freeze-drying process, a haze of dried powder is visible inside the drug product vial, making it barely acceptable for commercial distribution from a cosmetic point of view. Development studies were performed to identify the root cause for fogging during manufacturing of a lyophilized monoclonal antibody drug product. The results of the studies indicate that drug product creeping occurs during the filling process, leading to vial fogging after lyophilization. Glass quality/inner surface, glass conversion/vial processing (vial "history") and formulation excipients, e.g., surfactants (three different surfactants were tested), all affect glass fogging to a certain degree. Results showed that the main factor to control fogging is primarily the inner vial surface hydrophilicity/hydrophobicity. While Duran vials were not capable of reliably improving the level of fogging, hydrophobic containers provided reliable means to improve the cosmetic appearance due to reduction in fogging. Varying vial depyrogenation treatment conditions did not lead to satisfying results in removal of the fogging effect. Processing conditions of the vial after filling with drug product had a strong impact on reducing but not eliminating fogging. PMID:23791681

  17. Levels of Aggression among Turkish Adolescents and Factors Leading to Aggression.

    PubMed

    Avci, Dilek; Kilic, Mahmut; Tari Selcuk, Kevser; Uzuncakmak, Tugba

    2016-07-01

    Aggression, an increasing problem among adolescents, is a potential threat to public health as it can lead to violence. Determining the factors causing aggression plays an important role in taking measures to reduce violence. This study aimed at determining the level of aggression among adolescents and at identifying the factors associated with high levels of aggression. This cross-sectional study was conducted with 2,409 Turkish adolescents. Data were collected with the Socio-demographic Questionnaire, Aggression Scale, Perceived Social Support Scale, and Communication Skills Attitude Scale. Data were analyzed using descriptive statistics, the chi-square test, t-test, and logistic regression. The participants' mean aggression score was 91.83 ± 24.05, and 24.0% of the adolescents' aggression levels rated high. According to the logistic regression model, aggression was 1.26 times higher among males, 1.92 times higher among those who perceived their mental health as poor, 1.58 times higher among those with suicidal ideation, 1.29 times higher among those who did not get prepared for university entrance exams, and 1.62 times higher among those who perceived their school performance as poor. Perceived family social support was a protective factor against high aggression. Approximately one out of every four adolescents in the two Turkish high schools where the study was conducted was determined to display high levels of aggression. Therefore, in order to reduce aggression among adolescents, programs such as coping management and coping with anger should be applied by nurses. Programs should include not only students but also families. PMID:27111434

  18. Numerical and experimental analysis of factors leading to suture dehiscence after Billroth II gastric resection.

    PubMed

    Cvetkovic, Aleksandar M; Milasinovic, Danko Z; Peulic, Aleksandar S; Mijailovic, Nikola V; Filipovic, Nenad D; Zdravkovic, Nebojsa D

    2014-11-01

    The main goal of this study was to numerically quantify risk of duodenal stump blowout after Billroth II (BII) gastric resection. Our hypothesis was that the geometry of the reconstructed tract after BII resection is one of the key factors that can lead to duodenal dehiscence. We used computational fluid dynamics (CFD) with finite element (FE) simulations of various models of BII reconstructed gastrointestinal (GI) tract, as well as non-perfused, ex vivo, porcine experimental models. As main geometrical parameters for FE postoperative models we have used duodenal stump length and inclination between gastric remnant and duodenal stump. Virtual gastric resection was performed on each of 3D FE models based on multislice Computer Tomography (CT) DICOM. According to our computer simulation the difference between maximal duodenal stump pressures for models with most and least preferable geometry of reconstructed GI tract is about 30%. We compared the resulting postoperative duodenal pressure from computer simulations with duodenal stump dehiscence pressure from the experiment. Pressure at duodenal stump after BII resection obtained by computer simulation is 4-5 times lower than the dehiscence pressure according to our experiment on isolated bowel segment. Our conclusion is that if the surgery is performed technically correct, geometry variations of the reconstructed GI tract by themselves are not sufficient to cause duodenal stump blowout. Pressure that develops in the duodenal stump after BII resection using omega loop, only in the conjunction with other risk factors can cause duodenal dehiscence. Increased duodenal pressure after BII resection is risk factor. Hence we recommend the routine use of Roux en Y anastomosis as a safer solution in terms of resulting intraluminal pressure. However, if the surgeon decides to perform BII reconstruction, results obtained with this methodology can be valuable. PMID:25201585

  19. Lead exposure in Laysan albatross adults and chicks in Hawaii: prevalence, risk factors, and biochemical effects.

    USGS Publications Warehouse

    Work, T.M.; Smith, M.R.

    1996-01-01

    Prevalence of lead exposure and elevated tissue lead was determined in Laysan albatross (Diomedea immutabilis) in Hawaii. The relationship between lead exposure and proximity to buildings, between elevated blood lead and droopwing status, and elevated liver lead and presence of lead-containing paint chips in the proventriculus in albatross chicks was also examined. Finally, the effects of lead on the enzyme δ-amino-levulinic acid dehydratase (ALAD) was determined. There was a significant association between lead exposure or elevated tissue lead and proximity to buildings in albatross chicks and presence of lead paint chips in the proventriculus and elevated liver lead in carcasses. Although there was a significant association between elevated blood lead and droopwing chicks, there were notable exceptions. Prevalence of elevated tissue lead in albatross chicks was highest on Sand Island Midway and much less so on Kauai and virtually nonexistent in other areas. Prevalence of lead exposure decreased as numbers of buildings to which chicks were exposed on a given island decreased. Laysan albatross adults had minimal to no lead exposure. There was a significant negative correlation between blood lead concentration and ALAD activity in chicks. Based on ALAD activity, 0.03-0.05 μg/ml was the no effect range for blood lead in albatross chicks.

  20. Venous Stenosis After Transvenous Lead Placement: A Study of Outcomes and Risk Factors in 212 Consecutive Patients

    PubMed Central

    Abu-El-Haija, Basil; Bhave, Prashant D; Campbell, Dwayne N; Mazur, Alexander; Hodgson-Zingman, Denice M; Cotarlan, Vlad; Giudici, Michael C

    2015-01-01

    Background Venous stenosis is a common complication of transvenous lead implantation, but the risk factors for venous stenosis have not been well defined to date. This study was designed to evaluate the incidence of and risk factors for venous stenosis in a large consecutive cohort. Methods and Results A total of 212 consecutive patients (136 male, 76 female; mean age 69 years) with existing pacing or implantable cardioverter-defibrillator systems presented for generator replacement, lead revision, or device upgrade with a mean time since implantation of 6.2 years. Venograms were performed and percentage of stenosis was determined. Variables studied included age, sex, number of leads, lead diameter, implant duration, insulation material, side of implant, and anticoagulant use. Overall, 56 of 212 patients had total occlusion of the subclavian or innominate vein (26%). There was a significant association between the number of leads implanted and percentage of venous stenosis (P =0.012). Lead diameter, as an independent variable, was not a risk factor; however, greater sum of the lead diameters implanted was a predictor of subsequent venous stenosis (P =0.009). Multiple lead implant procedures may be associated with venous stenosis (P =0.057). No other variables approached statistical significance. Conclusions A significant association exists between venous stenosis and the number of implanted leads and also the sum of the lead diameters. When combined with multiple implant procedures, the incidence of venous stenosis is increased. PMID:26231843

  1. Cadmium down-regulation of kidney Sp1 binding to mouse SGLT1 and SGLT2 gene promoters: Possible reaction of cadmium with the zinc finger domain of Sp1

    SciTech Connect

    Kothinti, Rajendra K.; Blodgett, Amy B.; Petering, David H.; Tabatabai, Niloofar M.

    2010-05-01

    Cadmium (Cd) exposure causes glucosuria (glucose in the urine). Previously, it was shown that Cd exposure of primary cultures of mouse kidney cells (PMKC) decreased mRNA levels of the glucose transporters, SGLT1 and SGLT2 and that Sp1 from Cd-exposed cells displayed reduced binding to the GC boxes of the mouse SGLT1 promoter in vitro. Here, we identified a GC box upstream of mouse SGLT2 gene. ChIP assays on PMKC revealed that exposure to 5 muM Cd abolished Sp1 binding to SGLT1 GC box while it decreased Sp1 binding to SGLT2 GC sequence by 30% in vivo. The in vitro DNA binding assay, EMSA, demonstrated that binding of Sp1 from Cd (7.5 muM)-treated PMKC to the SGLT2 GC probe was 86% lower than in untreated cells. Sp1 is a zinc finger protein. Compared to PMKC exposed to 5 muM Cd alone, inclusion of 5 muM Zn restored SGLT1 and 2 mRNA levels by 15% and 30%, respectively. Cd (10 muM) decreased the binding of recombinant Sp1 (rhSp1) to SGLT1 and SGLT2 GC probes to 12% and 8% of untreated controls. Cd exerted no effect on GC-bound rhSp1. Co-treatment with Cd and Zn showed that added Zn significantly restored rhSp1 binding to the SGLT1 and SGLT2. Addition of Zn post Cd treatment was not stimulatory. We conclude that Cd can replace Zn in Sp1 DNA binding domain to reduce its binding to GC sites in mouse SGLT1 and SGLT2 promoters.

  2. Aspen SP1, an exceptional thermal, protease and detergent-resistant self-assembled nano-particle.

    PubMed

    Wang, Wang-Xia; Dgany, Or; Wolf, Sharon Grayer; Levy, Ilan; Algom, Rachel; Pouny, Yehonathan; Wolf, Amnon; Marton, Ira; Altman, Arie; Shoseyov, Oded

    2006-09-01

    Stable protein 1 (SP1) is a homo-oligomeric protein isolated from aspen (Populus tremula aspen) plants which forms a ring-shape dodecameric particle with a central cavity. The oligomeric form of SP1 is an exceptionally stable structure that is resistant to proteases (e.g., trypsin, V8, and proteinase K), high temperatures, organic solvents, and high levels of ionic detergent. Analytical ultra-centrifugation, chemical cross-linking, matrix-assisted laser-desorption time-of-flight mass spectrometry (MALDI-TOF-MS), and transmission electron microscopy were used to further characterize the SP1 dodecamer. Introduction of a single cysteine at the N-terminus of SP1 enabled the formation of disulfide bridges within the SP1 dodecamer, concurrent with increased melting point. A six-histidine tag was introduced at the N-terminus of SP1 to generate 6HSP1, and the DeltaNSP1 mutant was generated by a deletion of amino acids 2-6 at the N-terminus. Both 6HSP1 and DeltaNSP1 maintained their ability to assemble a stable dodecamer. Remarkably, these SP1 homo-dodecamers were able to re-assemble into stable hetero-dodecamers following co-electro-elution from SDS-PAGE. The exceptional stability of the SP1-nano ring and its ability to self-assemble hetero-complexes paves the way to further research in utilizing this unique protein in nano-biotechnology. PMID:16732592

  3. Up-regulation of Hsp27 by ERα/Sp1 facilitates proliferation and confers resistance to apoptosis in human papillary thyroid cancer cells.

    PubMed

    Mo, Xiao-Mei; Li, Li; Zhu, Ping; Dai, Yu-Jie; Zhao, Ting-Ting; Liao, Ling-Yao; Chen, George G; Liu, Zhi-Min

    2016-08-15

    17β-estradiol (E2) has been suggested to play a role in the development and progression of papillary thyroid cancer. Heat shock protein 27 (Hsp27) is a member of the Hsp family that is responsible for cell survival under stressful conditions. Previous studies have shown that the 5'-promoter region of Hsp27 gene contains a specificity protein-1 (Spl) and estrogen response element half-site (ERE-half), which contributes to Hsp27 induction by E2 in breast cancer cells. However, it is unclear whether Hsp27 can be up-regulated by E2 and which estrogen receptor (ER) isoform and tethered transcription factor are involved in this regulation in papillary thyroid cancer cells. In the present study, we demonstrated that Hsp27 can be effectively up-regulated by E2 at mRNA and protein levels in human K1 and BCPAP papillary thyroid cancer cells which have more than two times higher level of ERα than that of ERβ. The up-regulation of Hsp27 by E2 is mediated by ERα/Sp1 and ERβ has repressive effect on this ERα/Sp1-mediated up-regulation of Hsp27. Moreover, we showed that the up-regulation of Hsp27 by ERα/Sp1 facilitates proliferation and confers resistance to apoptosis through interaction with procaspase-3. Targeting this pathway may be a potential strategy for therapy of papillary thyroid cancer. PMID:27179757

  4. Involvement of the GC-rich sequence and specific proteins (Sp1/Sp3) in the basal transcription activity of neurogranin gene

    SciTech Connect

    Gui Jingang; Song Yan; Han, N.-L.R.; Zhou Shufeng; Sheu, F.-S. . E-mail: dbssfs@nus.edu.sg

    2006-06-23

    Neurogranin (Ng), a neuronal protein implicated in learning and memory, contains a TATA-less promoter. Analysis of 5'-deletion mutations and site-directed mutations of the mouse Ng promoter revealed that a 258 bp 5'-flanking sequence (+3 to +260) conferred the basal transcription activity, and that the GC-rich sequence (+22 to +33) served as an important determinant of the promoter activity. Transient transfection of the Sp1 expression plasmid transactivated the reporter activity in neuroblastoma N2A cells while knocking down of endogenous Sp1 expression resulted in a 2.5-fold reduction of the reporter activity in HEK 293 cells. Exogenous expression of Sp3 in HEK 293 cells, however, repressed the reporter activity by 50%. Nevertheless, by gel shift assays, Sp1 and Sp3 were not found to be responsible for the protein-DNA complexes formed by the GC-rich sequence. Moreover, a nuclear factor from the mouse brain tissues was discovered to bind to multiple AT-rich regions in Ng promoter.

  5. Species-specific interaction of the glutamine-rich activation domains of Sp1 with the TATA box-binding protein.

    PubMed Central

    Emili, A; Greenblatt, J; Ingles, C J

    1994-01-01

    We have used protein-blotting and protein affinity chromatography to demonstrate that each of the two glutamine-rich activation domains of the human transcription factor Sp1 can bind specifically and directly to the C-terminal evolutionarily conserved domain of the human TATA box-binding protein (TBP). These activation domains of Sp1 also bind directly to Drosophila TBP but bind much less strongly to TBP from the yeast Saccharomyces cerevisiae. The abilities of the Sp1 activation domains to interact directly with the TBPs of various species correlate well with their abilities to activate transcription in extracts derived from the same species. We also show that a glutamine-rich transcriptional activating region of the Drosophila protein Antennapedia binds directly to TBP in a species-specific manner that reflects its ability to activate transcription in vivo. These results support the notion that TBP is a direct and important target of glutamine-rich transcriptional activators. Images PMID:8114696

  6. Creating Novel Activated Factor XI Inhibitors through Fragment Based Lead Generation and Structure Aided Drug Design

    PubMed Central

    Fjellström, Ola; Akkaya, Sibel; Beisel, Hans-Georg; Eriksson, Per-Olof; Erixon, Karl; Gustafsson, David; Jurva, Ulrik; Kang, Daiwu; Karis, David; Knecht, Wolfgang; Nerme, Viveca; Nilsson, Ingemar; Olsson, Thomas; Redzic, Alma; Roth, Robert; Sandmark, Jenny; Tigerström, Anna; Öster, Linda

    2015-01-01

    Activated factor XI (FXIa) inhibitors are anticipated to combine anticoagulant and profibrinolytic effects with a low bleeding risk. This motivated a structure aided fragment based lead generation campaign to create novel FXIa inhibitor leads. A virtual screen, based on docking experiments, was performed to generate a FXIa targeted fragment library for an NMR screen that resulted in the identification of fragments binding in the FXIa S1 binding pocket. The neutral 6-chloro-3,4-dihydro-1H-quinolin-2-one and the weakly basic quinolin-2-amine structures are novel FXIa P1 fragments. The expansion of these fragments towards the FXIa prime side binding sites was aided by solving the X-ray structures of reported FXIa inhibitors that we found to bind in the S1-S1’-S2’ FXIa binding pockets. Combining the X-ray structure information from the identified S1 binding 6-chloro-3,4-dihydro-1H-quinolin-2-one fragment and the S1-S1’-S2’ binding reference compounds enabled structure guided linking and expansion work to achieve one of the most potent and selective FXIa inhibitors reported to date, compound 13, with a FXIa IC50 of 1.0 nM. The hydrophilicity and large polar surface area of the potent S1-S1’-S2’ binding FXIa inhibitors compromised permeability. Initial work to expand the 6-chloro-3,4-dihydro-1H-quinolin-2-one fragment towards the prime side to yield molecules with less hydrophilicity shows promise to afford potent, selective and orally bioavailable compounds. PMID:25629509

  7. CYP1B1 Enhances Cell Proliferation and Metastasis through Induction of EMT and Activation of Wnt/β-Catenin Signaling via Sp1 Upregulation.

    PubMed

    Kwon, Yeo-Jung; Baek, Hyoung-Seok; Ye, Dong-Jin; Shin, Sangyun; Kim, Donghak; Chun, Young-Jin

    2016-01-01

    Cytochrome P450 1B1 (CYP1B1) is a major E2 hydroxylase involved in the metabolism of potential carcinogens. CYP1B1 expression has been reported to be higher in tumors compared to normal tissues, especially in hormone-related cancers including breast, ovary, and prostate tumors. To explore the role of CYP1B1 in cancer progression, we investigated the action of CYP1B1 in cells with increased CYP1B1 via the inducer 7,12-dimethylbenz[α]anthracene (DMBA) or an overexpression vector, in addition to decreased CYP1B1 via the inhibitor tetramethoxystilbene (TMS) or siRNA knockdown. We observed that CYP1B1 promoted cell proliferation, migration, and invasion in MCF-7 and MCF-10A cells. To understand its molecular mechanism, we measured key oncogenic proteins including β-catenin, c-Myc, ZEB2, and matrix metalloproteinases following CYP1B1 modulation. CYP1B1 induced epithelial-mesenchymal transition (EMT) and activated Wnt/β-catenin signaling via upregulation of CTNNB1, ZEB2, SNAI1, and TWIST1. Sp1, a transcription factor involved in cell growth and metastasis, was positively regulated by CYP1B1, and suppression of Sp1 expression by siRNA or DNA binding activity using mithramycin A blocked oncogenic transformation by CYP1B1. Therefore, we suggest that Sp1 acts as a key mediator for CYP1B1 action. Treatment with 4-hydroxyestradiol (4-OHE2), a major metabolite generated by CYP1B1, showed similar effects as CYP1B1 overexpression, indicating that CYP1B1 activity mediated various oncogenic events in cells. In conclusion, our data suggests that CYP1B1 promotes cell proliferation and metastasis by inducing EMT and Wnt/β-catenin signaling via Sp1 induction. PMID:26981862

  8. CYP1B1 Enhances Cell Proliferation and Metastasis through Induction of EMT and Activation of Wnt/β-Catenin Signaling via Sp1 Upregulation

    PubMed Central

    Kwon, Yeo-Jung; Baek, Hyoung-Seok; Ye, Dong-Jin; Shin, Sangyun; Kim, Donghak; Chun, Young-Jin

    2016-01-01

    Cytochrome P450 1B1 (CYP1B1) is a major E2 hydroxylase involved in the metabolism of potential carcinogens. CYP1B1 expression has been reported to be higher in tumors compared to normal tissues, especially in hormone-related cancers including breast, ovary, and prostate tumors. To explore the role of CYP1B1 in cancer progression, we investigated the action of CYP1B1 in cells with increased CYP1B1 via the inducer 7,12-dimethylbenz[α]anthracene (DMBA) or an overexpression vector, in addition to decreased CYP1B1 via the inhibitor tetramethoxystilbene (TMS) or siRNA knockdown. We observed that CYP1B1 promoted cell proliferation, migration, and invasion in MCF-7 and MCF-10A cells. To understand its molecular mechanism, we measured key oncogenic proteins including β-catenin, c-Myc, ZEB2, and matrix metalloproteinases following CYP1B1 modulation. CYP1B1 induced epithelial-mesenchymal transition (EMT) and activated Wnt/β-catenin signaling via upregulation of CTNNB1, ZEB2, SNAI1, and TWIST1. Sp1, a transcription factor involved in cell growth and metastasis, was positively regulated by CYP1B1, and suppression of Sp1 expression by siRNA or DNA binding activity using mithramycin A blocked oncogenic transformation by CYP1B1. Therefore, we suggest that Sp1 acts as a key mediator for CYP1B1 action. Treatment with 4-hydroxyestradiol (4-OHE2), a major metabolite generated by CYP1B1, showed similar effects as CYP1B1 overexpression, indicating that CYP1B1 activity mediated various oncogenic events in cells. In conclusion, our data suggests that CYP1B1 promotes cell proliferation and metastasis by inducing EMT and Wnt/β-catenin signaling via Sp1 induction. PMID:26981862

  9. Employing Lead Thiocyanate Additive to Reduce the Hysteresis and Boost the Fill Factor of Planar Perovskite Solar Cells.

    PubMed

    Ke, Weijun; Xiao, Chuanxiao; Wang, Changlei; Saparov, Bayrammurad; Duan, Hsin-Sheng; Zhao, Dewei; Xiao, Zewen; Schulz, Philip; Harvey, Steven P; Liao, Weiqiang; Meng, Weiwei; Yu, Yue; Cimaroli, Alexander J; Jiang, Chun-Sheng; Zhu, Kai; Al-Jassim, Mowafak; Fang, Guojia; Mitzi, David B; Yan, Yanfa

    2016-07-01

    Lead thiocyanate in the perovskite precursor can increase the grain size of a perovskite thin film and reduce the conductivity of the grain boundaries, leading to perovskite solar cells with reduced hysteresis and enhanced fill factor. A planar perovskite solar cell with grain boundary and interface passivation achieves a steady-state efficiency of 18.42%. PMID:27145346

  10. Sp1 mediates repression of the resistin gene by PPAR{gamma} agonists in 3T3-L1 adipocytes

    SciTech Connect

    Chung, S.S.; Choi, H.H.; Cho, Y.M.; Lee, H.K.; Park, K.S. . E-mail: kspark@snu.ac.kr

    2006-09-15

    Resistin is an adipokine related to obesity and insulin resistance. Expression of the resistin gene is repressed by the treatment of peroxisome proliferator-activated receptor {gamma} (PPAR{gamma}) agonists, thiazolidinediones (TZDs). In this study, we investigated the mechanism by which TZDs inhibit the resistin gene expression. Resistin gene expression was decreased by TZD in fully differentiated 3T3-L1 adipocytes, which was abolished after treatment of cycloheximide (a protein synthesis inhibitor). TZD could not repress the expression of the resistin gene in the presence of mithramycin A (an Sp1 binding inhibitor). Sp1 binding site of the resistin promoter (-122/-114 bp) was necessary for the repression. Further investigation of the effect of TZDs on the modification of Sp1 showed that the level of O-glycosylation of Sp1 was decreased in this process. These results suggest that PPAR{gamma} activation represses the expression of the resistin gene by modulating Sp1 activity.

  11. Lead contamination in tea leaves and non-edaphic factors affecting it.

    PubMed

    Jin, Chong Wei; He, Yun Feng; Zhang, Kai; Zhou, Gen Di; Shi, Jian Liang; Zheng, Shao Jian

    2005-11-01

    Recent tests have detected high lead (Pb) concentrations in some commercial brands of tea leaves and this finding has raised concerns due to the possible health-related problems associated with Pb poisoning. In present research, we investigated the Pb contamination in tea leaves produced in Zhejiang province in China. Pb concentrations in all tea leaves sampled were below 5 mg/kg, the permissible levels given by Chinese Ministry of Agriculture, indicating that Pb contamination in this province is not excessive. We then investigated the non-edaphic factors that may potentially contribute to Pb accumulation in tea leaves. Pb concentration in tea leaves was found to be positively correlated with the industrialization level of a district (R = 0.83, the significant level at P < 0.05), and greater amounts of Pb were washed from the leaves of plants in districts with more industrial activity. This suggests that Pb accumulation in tea leaves could, in part, be attributed to industrial activity through the precipitation of atmospheric Pb. Furthermore greater amounts of Pb were washed from the leaves of plants growing near road than those growing farther away from road. This trend indicates that automobile activity was another likely contributor to Pb accumulation in tea. Pb content of green tea was also affected by the processing of the leaves in the factory. In particular the twisting and water-removal stages caused increases in Pb content in the tea product. This study suggests that non-edaphic factors also contribute to the Pb accumulation in tea. PMID:16219507

  12. Complete genome sequence of Kosakonia sacchari type strain SP1T

    PubMed Central

    Chen, Mingyue; Zhu, Bo; Lin, Li; Yang, Litao; Li, Yangrui; An, Qianli

    2014-01-01

    Kosakonia sacchari sp. nov. is a new species within the new genus Kosakonia, which was included in the genus Enterobacter. K sacchari is a nitrogen-fixing bacterium named for its association with sugarcane (Saccharum officinarum L.). K sacchari bacteria are Gram-negative, aerobic, non-spore-forming, motile rods. Strain SP1T (=CGMCC1.12102T=LMG 26783T) is the type strain of the K sacchari sp. nov and is able to colonize and fix N2 in association with sugarcane plants, thus promoting plant growth. Here we summarize the features of strain SP1T and describe its complete genome sequence. The genome contains a single chromosome and no plasmids, 4,902,024 nucleotides with 53.7% GC content, 4,460 protein-coding genes and 105 RNA genes including 22 rRNA genes, 82 tRNA genes, and 1 ncRNA gene. PMID:25197499

  13. Characterization of SP1, a Stress-Responsive, Boiling-Soluble, Homo-Oligomeric Protein from Aspen1

    PubMed Central

    Wang, Wang-Xia; Pelah, Dan; Alergand, Tal; Shoseyov, Oded; Altman, Arie

    2002-01-01

    sp1 cDNA was isolated from aspen (Populus tremula) plants by immunoscreening an expression library using polyclonal antibodies against BspA protein. BspA, which is a boiling-stable protein, accumulates in aspen plants in response to water stress and abscisic acid application (Pelah et al., 1995). The sp1 cDNA was found to encode a 12.4-kD generally hydrophilic protein with a hydrophobic C terminus, which is different from the BspA protein and was termed SP1 (stable protein 1). Northern-blot analysis revealed that sp1 encodes a small mRNA (about 0.6 kb) that is expressed in aspen plants under non-stress conditions and is accumulated after salt, cold, heat, and desiccation stress, and during the recovery from stress. The SP1 detected in plants remained soluble upon boiling, migrated both as a 12.4-kD band and a much higher mass of 116 kD on a 17% (w/v) Tricine-sodium dodecyl sulfate-polyacrylamide gel. Comparative protease digestion patterns, amino acid analyses, and the N-terminal sequences of the 12.4- and 116-kD proteins revealed that SP1 is homo-oligomeric. Furthermore, gel filtration chromatography analysis indicated that SP1 exists in aspen plants as a complex, composed of 12 subunits of 12.4 kD. A large number of sequences deduced from expressed sequence tags and genomic sequences of other organisms with unknown function show high homology to SP1. Thus, SP1 may represent a new protein family. Here, we present the first report on this putative protein family: the cloning, isolation, and characterization of SP1, a stress-responsive, boiling-soluble, oligomeric protein. PMID:12376651

  14. Loss of runt-related transcription factor 3 expression leads hepatocellular carcinoma cells to escape apoptosis

    PubMed Central

    2011-01-01

    Background Runt-related transcription factor 3 (RUNX3) is known as a tumor suppressor gene for gastric cancer and other cancers, this gene may be involved in the development of hepatocellular carcinoma (HCC). Methods RUNX3 expression was analyzed by immunoblot and immunohistochemistry in HCC cells and tissues, respectively. Hep3B cells, lacking endogenous RUNX3, were introduced with RUNX3 constructs. Cell proliferation was measured using the MTT assay and apoptosis was evaluated using DAPI staining. Apoptosis signaling was assessed by immunoblot analysis. Results RUNX3 protein expression was frequently inactivated in the HCC cell lines (91%) and tissues (90%). RUNX3 expression inhibited 90 ± 8% of cell growth at 72 h in serum starved Hep3B cells. Forty-eight hour serum starvation-induced apoptosis and the percentage of apoptotic cells reached 31 ± 4% and 4 ± 1% in RUNX3-expressing Hep3B and control cells, respectively. Apoptotic activity was increased by Bim expression and caspase-3 and caspase-9 activation. Conclusion RUNX3 expression enhanced serum starvation-induced apoptosis in HCC cell lines. RUNX3 is deleted or weakly expressed in HCC, which leads to tumorigenesis by escaping apoptosis. PMID:21205319

  15. Noncovalent Mutant Selective Epidermal Growth Factor Receptor Inhibitors: A Lead Optimization Case Study.

    PubMed

    Heald, Robert; Bowman, Krista K; Bryan, Marian C; Burdick, Daniel; Chan, Bryan; Chan, Emily; Chen, Yuan; Clausen, Saundra; Dominguez-Fernandez, Belen; Eigenbrot, Charles; Elliott, Richard; Hanan, Emily J; Jackson, Philip; Knight, Jamie; La, Hank; Lainchbury, Michael; Malek, Shiva; Mann, Sam; Merchant, Mark; Mortara, Kyle; Purkey, Hans; Schaefer, Gabriele; Schmidt, Stephen; Seward, Eileen; Sideris, Steve; Shao, Lily; Wang, Shumei; Yeap, Kuen; Yen, Ivana; Yu, Christine; Heffron, Timothy P

    2015-11-25

    Because of their increased activity against activating mutants, first-generation epidermal growth factor receptor (EGFR) kinase inhibitors have had remarkable success in treating non-small-cell lung cancer (NSCLC) patients, but acquired resistance, through a secondary mutation of the gatekeeper residue, means that clinical responses only last for 8-14 months. Addressing this unmet medical need requires agents that can target both of the most common double mutants: T790M/L858R (TMLR) and T790M/del(746-750) (TMdel). Herein we describe how a noncovalent double mutant selective lead compound was optimized using a strategy focused on the structure-guided increase in potency without added lipophilicity or reduction of three-dimensional character. Following successive rounds of design and synthesis it was discovered that cis-fluoro substitution on 4-hydroxy- and 4-methoxypiperidinyl groups provided synergistic, substantial, and specific potency gain through direct interaction with the enzyme and/or effects on the proximal ligand oxygen atom. Further development of the fluorohydroxypiperidine series resulted in the identification of a pair of diastereomers that showed 50-fold enzyme and cell based selectivity for T790M mutants over wild-type EGFR (wtEGFR) in vitro and pathway knock-down in an in vivo xenograft model. PMID:26455919

  16. Molecular characterization of alkaline protease of Bacillus amyloliquefaciens SP1 involved in biocontrol of Fusarium oxysporum.

    PubMed

    Guleria, Shiwani; Walia, Abhishek; Chauhan, Anjali; Shirkot, C K

    2016-09-01

    An alkaline protease gene was amplified from genomic DNA of Bacillus amyloliquefaciens SP1 which was involved in effective biocontrol of Fusarium oxysporum. We investigated the antagonistic capacity of protease of B. amyloliquifaciens SP1, under in vitro conditions. The 5.62 fold purified enzyme with specific activity of 607.69U/mg reported 24.14% growth inhibition of F. oxysporum. However, no antagonistic activity was found after addition of protease inhibitor i.e. PMSF (15mM) to purified enzyme. An 1149bp nucleotide sequence of protease gene encoded 382 amino acids of 43kDa and calculated isoelectric point of 9.29. Analysis of deduced amino acid sequence revealed high homology (86%) with subtilisin E of Bacillus subtilis. The B. amyloliquefaciens SP1 protease gene was expressed in Escherichiax coli BL21. The expressed protease was secreted into culture medium by E. coli and exhibited optimum activity at pH8.0 and 60°C. The most reliable three dimensional structure of alkaline protease was determined using Phyre 2 server which was validated on the basis of Ramachandran plot and ERRAT value. The expression and structure prediction of the enzyme offers potential value for commercial application in agriculture and industry. PMID:27294522

  17. Transcriptional Regulation of Oncogenic Protein Kinase Cϵ (PKCϵ) by STAT1 and Sp1 Proteins*

    PubMed Central

    Wang, HongBin; Gutierrez-Uzquiza, Alvaro; Garg, Rachana; Barrio-Real, Laura; Abera, Mahlet B.; Lopez-Haber, Cynthia; Rosemblit, Cinthia; Lu, Huaisheng; Abba, Martin; Kazanietz, Marcelo G.

    2014-01-01

    Overexpression of PKCϵ, a kinase associated with tumor aggressiveness and widely implicated in malignant transformation and metastasis, is a hallmark of multiple cancers, including mammary, prostate, and lung cancer. To characterize the mechanisms that control PKCϵ expression and its up-regulation in cancer, we cloned an ∼1.6-kb promoter segment of the human PKCϵ gene (PRKCE) that displays elevated transcriptional activity in cancer cells. A comprehensive deletional analysis established two regions rich in Sp1 and STAT1 sites located between −777 and −105 bp (region A) and −921 and −796 bp (region B), respectively, as responsible for the high transcriptional activity observed in cancer cells. A more detailed mutagenesis analysis followed by EMSA and ChIP identified Sp1 sites in positions −668/−659 and −269/−247 as well as STAT1 sites in positions −880/−869 and −793/−782 as the elements responsible for elevated promoter activity in breast cancer cells relative to normal mammary epithelial cells. RNAi silencing of Sp1 and STAT1 in breast cancer cells reduced PKCϵ mRNA and protein expression, as well as PRKCE promoter activity. Moreover, a strong correlation was found between PKCϵ and phospho-Ser-727 (active) STAT1 levels in breast cancer cells. Our results may have significant implications for the development of approaches to target PKCϵ and its effectors in cancer therapeutics. PMID:24825907

  18. Quantitative and qualitative beta diversity measures lead to different insights into factors that structure microbial communities.

    PubMed

    Lozupone, Catherine A; Hamady, Micah; Kelley, Scott T; Knight, Rob

    2007-03-01

    The assessment of microbial diversity and distribution is a major concern in environmental microbiology. There are two general approaches for measuring community diversity: quantitative measures, which use the abundance of each taxon, and qualitative measures, which use only the presence/absence of data. Quantitative measures are ideally suited to revealing community differences that are due to changes in relative taxon abundance (e.g., when a particular set of taxa flourish because a limiting nutrient source becomes abundant). Qualitative measures are most informative when communities differ primarily by what can live in them (e.g., at high temperatures), in part because abundance information can obscure significant patterns of variation in which taxa are present. We illustrate these principles using two 16S rRNA-based surveys of microbial populations and two phylogenetic measures of community beta diversity: unweighted UniFrac, a qualitative measure, and weighted UniFrac, a new quantitative measure, which we have added to the UniFrac website (http://bmf.colorado.edu/unifrac). These studies considered the relative influences of mineral chemistry, temperature, and geography on microbial community composition in acidic thermal springs in Yellowstone National Park and the influences of obesity and kinship on microbial community composition in the mouse gut. We show that applying qualitative and quantitative measures to the same data set can lead to dramatically different conclusions about the main factors that structure microbial diversity and can provide insight into the nature of community differences. We also demonstrate that both weighted and unweighted UniFrac measurements are robust to the methods used to build the underlying phylogeny. PMID:17220268

  19. Blood Lead and Other Metal Biomarkers as Risk Factors for Cardiovascular Disease Mortality

    PubMed Central

    Aoki, Yutaka; Brody, Debra J.; Flegal, Katherine M.; Fakhouri, Tala H.I.; Parker, Jennifer D.; Axelrad, Daniel A.

    2016-01-01

    Abstract Analyses of the Third National Health and Nutrition Examination Survey (NHANES III) in 1988 to 1994 found an association of increasing blood lead levels <10 μg/dL with a higher risk of cardiovascular disease (CVD) mortality. The potential need to correct blood lead for hematocrit/hemoglobin and adjust for biomarkers for other metals, for example, cadmium and iron, had not been addressed in the previous NHANES III-based studies on blood lead-CVD mortality association. We analyzed 1999 to 2010 NHANES data for 18,602 participants who had a blood lead measurement, were ≥40 years of age at the baseline examination and were followed for mortality through 2011. We calculated the relative risk for CVD mortality as a function of hemoglobin- or hematocrit-corrected log-transformed blood lead through Cox proportional hazard regression analysis with adjustment for serum iron, blood cadmium, serum C-reactive protein, serum calcium, smoking, alcohol intake, race/Hispanic origin, and sex. The adjusted relative risk for CVD mortality was 1.44 (95% confidence interval = 1.05, 1.98) per 10-fold increase in hematocrit-corrected blood lead with little evidence of nonlinearity. Similar results were obtained with hemoglobin-corrected blood lead. Not correcting blood lead for hematocrit/hemoglobin resulted in underestimation of the lead-CVD mortality association while not adjusting for iron status and blood cadmium resulted in overestimation of the lead-CVD mortality association. In a nationally representative sample of U.S. adults, log-transformed blood lead was linearly associated with increased CVD mortality. Correcting blood lead for hematocrit/hemoglobin and adjustments for some biomarkers affected the association. PMID:26735529

  20. Draft genome sequence of Sphingomonas paucimobilis strain LCT-SP1 isolated from the Shenzhou X spacecraft of China.

    PubMed

    Pan, Lei; Zhou, Hong; Li, Jia; Huang, Bing; Guo, Jun; Zhang, Xue-Lin; Gao, Long-Cheng; Xu, Chou; Liu, Chang-Ting

    2016-01-01

    Sphingomonas paucimobilis strain LCT-SP1 is a glucose-nonfermenting Gram-negative, chemoheterotrophic, strictly aerobic bacterium. The major feature of strain LCT-SP1, isolated from the Chinese spacecraft Shenzhou X, together with the genome draft and annotation are described in this paper. The total size of strain LCT-SP1 is 4,302,226 bp with 3,864 protein-coding and 50 RNA genes. The information gained from its sequence is potentially relevant to the elucidation of microbially mediated corrosion of various materials. PMID:26918090

  1. THE SIGNIFICANCE OF "STAGNATION CURVES" FOR LEAD AND COPPER, AND WATER QUALITY FACTORS AFFECTING THEM

    EPA Science Inventory

    "Stagnation curves" are the response of metal levels, particularly lead and copper, to time under conditions of no water flow. Research on lead pipe in the early 1980's in the United States, Germany, and in the United Kingdom suggested that they were characterized by rapid incre...

  2. Influenza A induces the major secreted airway mucin MUC5AC in a protease-EGFR-extracellular regulated kinase-Sp1-dependent pathway.

    PubMed

    Barbier, Diane; Garcia-Verdugo, Ignacio; Pothlichet, Julien; Khazen, Roxana; Descamps, Delphyne; Rousseau, Karine; Thornton, David; Si-Tahar, Mustapha; Touqui, Lhousseine; Chignard, Michel; Sallenave, Jean-Michel

    2012-08-01

    Mucins, the main glycoproteins present within mucus, modulate the rheologic properties of airways and participate in lung defense. They are thought to be able to trap and eliminate microorganisms from the lung. Among the mucins secreted in the lung, MUC5AC is the most prominent factor secreted by surface epithelial cells. Although much is known about the signaling pathways involved in the regulation of MUC5AC by host factors such as cytokines or proteases, less is known about the pathways triggered by microorganisms and, specifically, by influenza A virus (IAV). We therefore set up experiments to dissect the molecular mechanisms responsible for the potential modulation of MUC5AC by IAV. Using epithelial cells, C57/Bl6 mice, and IAV strains, we measured MUC5AC expression at the RNA and protein levels, specificity protein 1 (Sp1) activation, and protease activity. Intermediate molecular partners were confirmed using pharmacological inhibitors, blocking antibodies, and small interfering (si)RNAs. We showed in vitro and in vivo that IAV up-regulates epithelial cell-derived MUC5AC and Muc5ac expression in mice, both at transcriptional (through the induction of Sp1) and translational levels. In addition, we determined that this induction was dependent on a protease-epithelial growth factor receptor-extracellular regulated kinase-Sp1 signaling cascade, involving in particular the human airway trypsin. Our data point to MUC5AC as a potential modulatory mechanism by which the lung epithelia respond to IAV infection, and we dissect, for the first time to the best of our knowledge, the molecular partners involved. Future experiments using MUC5AC-targeted strategies should help further unravel the pathophysiological consequences of IAV-induced MUC5AC expression for lung homeostasis. PMID:22383584

  3. Next-to-leading-order forward hadron production in the small-x regime: the role of rapidity factorization.

    PubMed

    Kang, Zhong-Bo; Vitev, Ivan; Xing, Hongxi

    2014-08-01

    Single inclusive hadron production at forward rapidity in high energy p+A collisions is an important probe of the high gluon density regime of QCD and the associated small-x formalism. We revisit an earlier one-loop calculation to illustrate the significance of the "rapidity factorization" approach in this regime. Such factorization separates the very small-x unintegrated gluon density evolution and leads to a new correction term to the physical cross section at one-loop level. Importantly, this rapidity factorization formalism remedies the previous unphysical negative next-to-leading-order contribution to the cross section. It is much more stable with respect to "rapidity" variation when compared to the leading-order calculation and provides improved agreement between theory and experiment in the forward rapidity region. PMID:25148318

  4. Characterization of a family of cysteine rich proteins and development of a MaSp1 derived miniature fibroin

    NASA Astrophysics Data System (ADS)

    Chuang, Tyler Casey

    Spider silk displays a unique balance of high tensile strength and extensibility, making it one of the toughest materials on the planet. Dragline silk, also known as the lifeline of the spider, represents one of the best studied fiber types and many labs are attempting to produce synthetic dragline silk fibers for commercial applications. In these studies, we develop a minifibroin for expression studies in bacteria. Using recombinant DNA methodology and protein expression studies, we develop a natural minifibroin that contains the highly conserved N- and C-terminal domains, along with several internal block repeats of MaSp1. We also characterize a family of small cysteine-rich proteins (CRPs) and demonstrate that these factors are present within the spinning dope of the major ampullate gland using MS analysis. Biochemical studies and characterization of one of the family members, CRP1, demonstrate that this factor can self-polymerize into higher molecular weight complexes under oxidizing conditions, but can be converted into a monomeric species under reducing conditions. Self-polymerization of CRP1 is also shown to be independent of pH and salt concentration, two important chemical cues that help fibroin aggregation. Overall, our data demonstrate that the polymerization state of CRP1 is dependent upon redox state, suggesting that the redox environment during fiber extrusion may help regulate the oligomerization of CRP molecules during dragline silk production.

  5. [Probiotic features of carotene producing strains Bacillus sp. 1.1 and B. amyloliquefaciens UCM B-5113].

    PubMed

    Avdeeva, L V; Nechypurenko, O O; Kharhota, M A

    2015-01-01

    Researched probiotic properties of carotinproducing strains Bacillus sp. 1.1 and B. amyloliquefaciens UCM B-5113. It was established that Bacillus sp. 1.1 characterized by high and middle antagonistic activity against museums and actual test cultures and B. amyloliquefaciens UCM B-5113 shown middle and low activity. They grew up and formed a pigment at pH 6.0 in the presence of 0.4% bile. Bacillus sp. 1.1 and B. amyloliquefaciens UCM B-5113 were avirulent, had low antagonistic activity and characterized by susceptibility to antimicrobial agents, excluding colistin. The results suggested the possibility to create based on Bacillus sp. 1.1 and B. amyloliquefaciens UCM B-5113 probiotic preparation. PMID:26036029

  6. Lead and PCBs as Risk Factors for Attention Deficit/Hyperactivity Disorder

    PubMed Central

    Eubig, Paul A.; Aguiar, Andréa; Schantz, Susan L.

    2010-01-01

    Objectives Attention deficit/hyperactivity disorder (ADHD) is the most frequently diagnosed neurobehavioral disorder of childhood, yet its etiology is not well understood. In this review we present evidence that environmental chemicals, particularly polychlorinated biphenyls (PCBs) and lead, are associated with deficits in many neurobehavioral functions that are also impaired in ADHD. Data sources Human and animal studies of developmental PCB or lead exposures that assessed specific functional domains shown to be impaired in ADHD children were identified via searches of PubMed using “lead” or “PCB exposure” in combination with key words, including “attention,” “working memory,” “response inhibition,” “executive function,” “cognitive function,” “behavior,” and “ADHD.” Data synthesis Children and laboratory animals exposed to lead or PCBs show deficits in many aspects of attention and executive function that have been shown to be impaired in children diagnosed with ADHD, including tests of working memory, response inhibition, vigilance, and alertness. Studies conducted to date suggest that lead may reduce both attention and response inhibition, whereas PCBs may impair response inhibition to a greater degree than attention. Low-level lead exposure has been associated with a clinical diagnosis of ADHD in several recent studies. Similar studies of PCBs have not been conducted. Conclusions We speculate that exposures to environmental contaminants, including lead and PCBs, may increase the prevalence of ADHD. PMID:20829149

  7. Sp1 Sites in the Noncoding Control Region of BK Polyomavirus Are Key Regulators of Bidirectional Viral Early and Late Gene Expression

    PubMed Central

    Bethge, Tobias; Hachemi, Helen A.; Manzetti, Julia; Gosert, Rainer; Schaffner, Walter

    2015-01-01

    ABSTRACT In kidney transplant patients with BK polyomavirus (BKPyV) nephropathy, viral variants arise bearing rearranged noncoding control regions (rr-NCCRs) that increase viral early gene expression, replicative fitness, and cytopathology. rr-NCCRs result from various deletions and duplications of archetype NCCR (ww-NCCR) sequences, which alter transcription factor binding sites (TFBS). However, the role of specific TFBS is unclear. We inactivated 28 TFBS in the archetype NCCR by selective point mutations and examined viral gene expression in bidirectional reporter constructs. Compared to the archetype, group 1 mutations increased viral early gene expression similar to rr-NCCR and resulted from inactivating one Sp1 or one Ets1 TFBS near the late transcription start site (TSS). Group 2 mutations conferred intermediate early gene activation and affected NF1, YY1, and p53 sites between early and late TSS. Group 3 mutations decreased early and late gene expression and included two other Sp1 sites near the early TSS. Recombinant viruses bearing group 1 NCCRs showed increased replication in human renal epithelial cells similar to clinical rr-NCCR variants. Group 2 and 3 viruses showed intermediate or no replication, respectively. A literature search revealed unnoticed group 1 mutations in BKPyV nephropathy, hemorrhagic cystitis, and disseminated disease. IMPORTANCE The NCCRs of polyomaviruses mediate silent persistence of the viral genome as well as the appropriately timed (re)activation of the viral life cycle. This study indicates that the basal BKPyV NCCR is critically controlled by a hierarchy of single TFBS in the archetype NCCR that direct, modulate, and execute the bidirectional early and late viral gene expression. The results provide new insights into how BKPyV NCCR functions as a viral sensor of host cell signals and shed new light on how transcription factors like Sp1 control bidirectional viral gene expression and contribute to replication and pathology

  8. The Effects of Occupational Work Adjustment on Factors Leading to High School Drop Out in Rural Northwest Ohio.

    ERIC Educational Resources Information Center

    Dietrich, Angela

    The effect of four Occupational Work Adjustment (OWA) programs on risk factors leading to students dropping out of high school was assessed. Data were gathered from four OWA teachers in high schools in Northwest Ohio; information was provided for 27 individual students and 2 groups of 28 students each for the 1992-93 school year. The following…

  9. Factors That Lead to Environmentally Sustainable Practices in the Restaurant Industry: A Qualitative Analysis of Two Green Restaurant Innovators

    ERIC Educational Resources Information Center

    Nyheim, Peter

    2012-01-01

    In recent years, more organizations, including restaurants, have concerned themselves with sustainability. As with any new endeavor, guidance is needed. The purpose of this study was to investigate factors that lead to environmentally sustainable practices in the restaurant industry. Using Rogers' Diffusion of Innovation Theory as a…

  10. Sp1 and CREB regulate basal transcription of the human SNF2L gene

    SciTech Connect

    Xia Yu; Jiang Baichun; Zou Yongxin; Gao Guimin; Shang Linshan; Chen Bingxi; Liu Qiji; Gong Yaoqin

    2008-04-04

    Imitation Switch (ISWI) is a member of the SWI2/SNF2 superfamily of ATP-dependent chromatin remodelers, which are involved in multiple nuclear functions, including transcriptional regulation, replication, and chromatin assembly. Mammalian genomes encode two ISWI orthologs, SNF2H and SNF2L. In order to clarify the molecular mechanisms governing the expression of human SNF2L gene, we functionally examined the transcriptional regulation of human SNF2L promoter. Reporter gene assays demonstrated that the minimal SNF2L promoter was located between positions -152 to -86 relative to the transcription start site. In this region we have identified a cAMP-response element (CRE) located at -99 to -92 and a Sp1-binding site at -145 to -135 that play a critical role in regulating basal activity of human SNF2L gene, which were proven by deletion and mutation of specific binding sites, EMSA, and down-regulating Sp1 and CREB via RNAi. This study provides the first insight into the mechanisms that control basal expression of human SNF2L gene.