Science.gov

Sample records for factor sp1 plays

  1. Interaction of Sp1 zinc finger with transport factor in the nuclear localization of transcription factor Sp1

    SciTech Connect

    Ito, Tatsuo; Kitamura, Haruka; Uwatoko, Chisana; Azumano, Makiko; Itoh, Kohji; Kuwahara, Jun

    2010-12-10

    Research highlights: {yields} Sp1 zinc fingers themselves interact with importin {alpha}. {yields} Sp1 zinc finger domains play an essential role as a nuclear localization signal. {yields} Sp1 can be transported into the nucleus in an importin-dependent manner. -- Abstract: Transcription factor Sp1 is localized in the nucleus and regulates the expression of many cellular genes, but the nuclear transport mechanism of Sp1 is not well understood. In this study, we revealed that GST-fused Sp1 protein bound to endogenous importin {alpha} in HeLa cells via the Sp1 zinc finger domains, which comprise the DNA binding domain of Sp1. It was found that the Sp1 zinc finger domains directly interacted with a wide range of importin {alpha} including the armadillo (arm) repeat domain and the C-terminal acidic domain. Furthermore, it turned out that all three zinc fingers of Sp1 are essential for binding to importin {alpha}. Taken together, these results suggest that the Sp1 zinc finger domains play an essential role as a NLS and Sp1 can be transported into the nucleus in an importin-dependent manner even though it possesses no classical NLSs.

  2. O-GlcNAc inhibits interaction between Sp1 and Elf-1 transcription factors

    SciTech Connect

    Lim, Kihong; Chang, Hyo-Ihl

    2009-03-13

    The novel protein modification, O-linked N-acetylglucosamine (O-GlcNAc), plays an important role in various aspects of cell regulation. Although most of nuclear transcription regulatory factors are modified by O-GlcNAc, O-GlcNAc effects on transcription remain largely undefined yet. In this study, we show that O-GlcNAc inhibits a physical interaction between Sp1 and Elf-1 transcription factors, and negatively regulates transcription of placenta and embryonic expression oncofetal protein gene (Pem). These findings suggest that O-GlcNAc inhibits Sp1-mediated gene transcription possibly by interrupting Sp1 interaction with its cooperative factor.

  3. Role of zinc finger structure in nuclear localization of transcription factor Sp1

    SciTech Connect

    Ito, Tatsuo; Azumano, Makiko; Uwatoko, Chisana; Itoh, Kohji Kuwahara, Jun

    2009-02-27

    Transcription factor Sp1 is localized in the nucleus and regulates gene expression. Our previous study demonstrated that the carboxyl terminal region of Sp1 containing 3-zinc finger region as DNA binding domain can also serve as nuclear localization signal (NLS). However, the nuclear transport mechanism of Sp1 has not been well understood. In this study, we performed a gene expression study on mutant Sp1 genes causing a set of amino acid substitutions in zinc finger domains to elucidate nuclear import activity. Nuclear localization of the GFP-fused mutant Sp1 proteins bearing concomitant substitutions in the first and third zinc fingers was highly inhibited. These mutant Sp1 proteins had also lost the binding ability as to the GC box sequence. The results suggest that the overall tertiary structure formed by the three zinc fingers is essential for nuclear localization of Sp1 as well as dispersed basic amino acids within the zinc fingers region.

  4. Elevated SP-1 transcription factor expression and activity drives basal and hypoxia-induced vascular endothelial growth factor (VEGF) expression in non-small cell lung cancer.

    PubMed

    Deacon, Karl; Onion, David; Kumari, Rajendra; Watson, Susan A; Knox, Alan J

    2012-11-16

    VEGF plays a central role in angiogenesis in cancer. Non-small cell lung cancer (NSCLC) tumors have increased microvascular density, localized hypoxia, and high VEGF expression levels; however, there is a lack of understanding of how oncogenic and tumor microenvironment changes such as hypoxia lead to greater VEGF expression in lung and other cancers. We show that NSCLC cells secreted higher levels of VEGF than normal airway epithelial cells. Actinomycin D inhibited all NSCLC VEGF secretion, and VEGF minimal promoter-luciferase reporter constructs were constitutively active until the last 85 base pairs before the transcription start site containing three SP-1 transcription factor-binding sites; mutation of these VEGF promoter SP-1-binding sites eliminated VEGF promoter activity. Furthermore, dominant negative SP-1, mithramycin A, and SP-1 shRNA decreased VEGF promoter activity, whereas overexpression of SP-1 increased VEGF promoter activity. Chromatin immunoprecipitation assays demonstrated SP-1, p300, and PCA/F histone acetyltransferase binding and histone H4 hyperacetylation at the VEGF promoter in NSCLC cells. Cultured NSCLC cells expressed higher levels of SP-1 protein than normal airway epithelial cells, and double-fluorescence immunohistochemistry showed a strong correlation between SP-1 and VEGF in human NSCLC tumors. In addition, hypoxia-driven VEGF expression in NSCLC cells was SP-1-dependent, with hypoxia increasing SP-1 activity and binding to the VEGF promoter. These studies are the first to demonstrate that overexpression of SP-1 plays a central role in hypoxia-induced VEGF secretion. PMID:22992725

  5. MPTP’s Pathway of Toxicity Indicates Central Role of Transcription Factor SP1

    PubMed Central

    Maertens, Alexandra; Luechtefeld, Thomas; Kleensang, Andre

    2015-01-01

    Deriving a Pathway of Toxicity from transcriptomic data remains a challenging task. We explore the use of weighted gene correlation network analysis (WGCNA) to extract an initial network from a small microarray study of MPTP toxicity in mice. Five modules were statistically significant; each module was analyzed for gene signatures in the Chemical and Genetic Perturbation subset of the Molecular Signatures Database as well as for over-represented transcription factor binding sites and WGCNA clustered probes by function and captured pathways relevant to neurodegenerative disorders. The resulting network was analyzed for transcription factor candidates, which were narrowed down via text-mining for relevance to the disease model, and then combined with the large-scale interaction FANTOM4 database to generate a genetic regulatory network. Modules were enriched for transcription factors relevant to Parkinson’s disease. Transcription factors significantly improved the number of genes that could be connected in a given component. For each module, the transcription factor that had, by far, the highest number of interactions was SP1, and it also had substantial experimental evidence of interactions. This analysis both captures much of the known biology of MPTP toxicity and suggests several candidates for further study. Furthermore, the analysis strongly suggests that SP1 plays a central role in coordinating the cellular response to MPTP toxicity. PMID:25851821

  6. MPTP's pathway of toxicity indicates central role of transcription factor SP1.

    PubMed

    Maertens, Alexandra; Luechtefeld, Thomas; Kleensang, Andre; Hartung, Thomas

    2015-05-01

    Deriving a Pathway of Toxicity from transcriptomic data remains a challenging task. We explore the use of weighted gene correlation network analysis (WGCNA) to extract an initial network from a small microarray study of MPTP toxicity in mice. Five modules were statistically significant; each module was analyzed for gene signatures in the Chemical and Genetic Perturbation subset of the Molecular Signatures Database as well as for over-represented transcription factor binding sites and WGCNA clustered probes by function and captured pathways relevant to neurodegenerative disorders. The resulting network was analyzed for transcription factor candidates, which were narrowed down via text-mining for relevance to the disease model, and then combined with the large-scale interaction FANTOM4 database to generate a genetic regulatory network. Modules were enriched for transcription factors relevant to Parkinson's disease. Transcription factors significantly improved the number of genes that could be connected in a given component. For each module, the transcription factor that had, by far, the highest number of interactions was SP1, and it also had substantial experimental evidence of interactions. This analysis both captures much of the known biology of MPTP toxicity and suggests several candidates for further study. Furthermore, the analysis strongly suggests that SP1 plays a central role in coordinating the cellular response to MPTP toxicity. PMID:25851821

  7. Overexpression of the Transcription Factor Sp1 Activates the OAS-RNAse L-RIG-I Pathway

    PubMed Central

    Dupuis-Maurin, Valéryane; Brinza, Lilia; Baguet, Joël; Plantamura, Emilie; Schicklin, Stéphane; Chambion, Solène; Macari, Claire; Tomkowiak, Martine; Deniaud, Emmanuelle; Leverrier, Yann

    2015-01-01

    Deregulated expression of oncogenes or transcription factors such as specificity protein 1 (Sp1) is observed in many human cancers and plays a role in tumor maintenance. Paradoxically in untransformed cells, Sp1 overexpression induces late apoptosis but the early intrinsic response is poorly characterized. In the present work, we studied increased Sp1 level consequences in untransformed cells and showed that it turns on an early innate immune transcriptome. Sp1 overexpression does not activate known cellular stress pathways such as DNA damage response or endoplasmic reticulum stress, but induces the activation of the OAS-RNase L pathway and the generation of small self-RNAs, leading to the upregulation of genes of the antiviral RIG-I pathway at the transcriptional and translational levels. Finally, Sp1-induced intrinsic innate immune response leads to the production of the chemokine CXCL4 and to the recruitment of inflammatory cells in vitro and in vivo. Altogether our results showed that increased Sp1 level in untransformed cells constitutes a novel danger signal sensed by the OAS-RNase L axis leading to the activation of the RIG-I pathway. These results suggested that the OAS-RNase L-RIG-I pathway may be activated in sterile condition in absence of pathogen. PMID:25738304

  8. The oncoprotein HBXIP upregulates PDGFB via activating transcription factor Sp1 to promote the proliferation of breast cancer cells

    SciTech Connect

    Zhang, Yingyi; Zhao, Yu; Li, Leilei; Shen, Yu; Cai, Xiaoli; Zhang, Xiaodong; Ye, Lihong

    2013-05-03

    Highlights: •HBXIP is able to upregulate the expression of PDGFB in breast cancer cells. •HBXIP serves as a coactivator of activating transcription factor Sp1. •HBXIP stimulates the PDGFB promoter via activating transcription factor Sp1. •HBXIP promotes the proliferation of breast cancer cell via upregulating PDGFB. -- Abstract: We have reported that the oncoprotein hepatitis B virus X-interacting protein (HBXIP) acts as a novel transcriptional coactivator to promote proliferation and migration of breast cancer cells. Previously, we showed that HBXIP was able to activate nuclear factor-κB (NF-κB) in breast cancer cells. As an oncogene, the platelet-derived growth factor beta polypeptide (PDGFB) plays crucial roles in carcinogenesis. In the present study, we found that both HBXIP and PDGFB were highly expressed in breast cancer cell lines. Interestingly, HBXIP was able to increase transcriptional activity of NF-κB through PDGFB, suggesting that HBXIP is associated with PDGFB in the cells. Moreover, HBXIP was able to upregulate PDGFB at the levels of mRNA, protein and promoter in the cells. Then, we identified that HBXIP stimulated the promoter of PDGFB through activating transcription factor Sp1. In function, HBXIP enhanced the proliferation of breast cancer cells through PDGFB in vitro. Thus, we conclude that HBXIP upregulates PDGFB via activating transcription factor Sp1 to promote proliferation of breast cancer cells.

  9. Negative Regulation of DsbA-L Gene Expression by the Transcription Factor Sp1

    PubMed Central

    Fang, Qichen; Yang, Wenjing; Li, Huating; Hu, Wenxiu; Chen, Lihui; Jiang, Shan; Dong, Kun; Song, Qianqian; Wang, Chen; Chen, Shuo; Liu, Feng

    2014-01-01

    Disulfide-bond A oxidoreductase-like protein (DsbA-L) possesses beneficial effects such as promoting adiponectin multimerization and stability, increasing insulin sensitivity, and enhancing energy metabolism. The expression level of DsbA-L is negatively correlated with obesity in mice and humans, but the underlying mechanisms remain unknown. To address this question, we generated reporter gene constructs containing the promoter sequence of the mouse DsbA-L gene. Deletion analysis showed that the proximal promoter of mouse DsbA-L is located between −186 and −34 bp relative to the transcription start site. In silico analysis identified a putative Sp1 transcription factor binding site in the first intron of the DsbA-L gene. Electrophoretic mobility shift assay and chromatin immunoprecipitation analysis indicated that Sp1 bound to this intron region in vitro and in intact cells. Overexpression of Sp1 or suppressing Sp1 expression by siRNA reduced or increased DsbA-L promoter activity, respectively. The binding activity of Sp1 was gradually decreased during 3T3-L1 cell differentiation and was significantly increased in adipose tissues of obese mice. Our results identify Sp1 as an inhibitor of DsbA-L gene transcription, and the Sp1-mediated inhibition of DsbA-L gene expression may provide a mechanism underlying obesity-induced adiponectin downregulation and insulin resistance. PMID:25024375

  10. Sequence-independent induction of Sp1 transcription factor activity by phosphorothioate oligodeoxynucleotides.

    PubMed Central

    Perez, J R; Li, Y; Stein, C A; Majumder, S; van Oorschot, A; Narayanan, R

    1994-01-01

    Modified analogues of antisense oligodeoxynucleotides (ODNs), particularly phosphorothioates ([S]ODNs), have been extensively used to inhibit gene expression. The potential sequence specificity of antisense oligomers makes them attractive as molecular drugs for human diseases. The use of antisense [S]ODNs to inhibit gene expression has been complicated by frequent nonspecific effects. In this study we show in diverse cell types that [S]ODNs, independent of their base sequence, mediated the induction of an Sp1 nuclear transcription factor. The [S]ODN-mediated Sp1 induction was rapid and was associated with elevated levels of Sp1 protein. This induction was dependent on NF-kappa B activity, since inhibition of NF-kappa B activity abolished the [S]ODN-induced Sp1 activity. [S]ODN-induced Sp1 activity was seen in mouse spleen cells following in vivo administration. Sp1 activity induced by [S]ODNs required the tyrosine kinase pathway and did not have transactivating potential. These results may help to explain some of the non-specific effects often seen with [S]ODNs. Images PMID:8016096

  11. A non-canonical DNA structure is a binding motif for the transcription factor SP1 in vitro

    PubMed Central

    Raiber, Eun-Ang; Kranaster, Ramon; Lam, Enid; Nikan, Mehran; Balasubramanian, Shankar

    2012-01-01

    SP1 is a ubiquitous transcription factor that is involved in the regulation of various house-keeping genes. It is known that it acts by binding to a double-stranded consensus motif. Here, we have discovered that SP1 binds also to a non-canonical DNA structure, a G-quadruplex, with high affinity. In particular, we have studied the SP1 binding site within the promoter region of the c-KIT oncogene and found that this site can fold into an anti-parallel two-tetrad G-quadruplex. SP1 pull-down experiments from cellular extracts, together with biophysical binding assays revealed that SP1 has a comparable binding affinity for this G-quadruplex structure and the canonical SP1 duplex sequence. Using SP1 ChIP-on-chip data sets, we have also found that 87% of SP1 binding sites overlap with G-quadruplex forming sequences. Furthermore, while many of these immuoprecipitated sequences (36%) even lack the minimal SP1 consensus motif, 5′-GGGCGG-3′, we have shown that 77% of them are putative G-quadruplexes. Collectively, these data suggest that SP1 is able to bind both, canonical SP1 duplex DNA as well as G-quadruplex structures in vitro and we hypothesize that both types of interactions may occur in cells. PMID:22021377

  12. Specificity protein (Sp) transcription factors Sp1, Sp3 and Sp4 are non-oncogene addiction genes in cancer cells

    PubMed Central

    Hedrick, Erik; Cheng, Yating; Jin, Un-Ho; Kim, Kyounghyun; Safe, Stephen

    2016-01-01

    Specificity protein (Sp) transcription factor (TF) Sp1 is overexpressed in multiple tumors and is a negative prognostic factor for patient survival. Sp1 and also Sp3 and Sp4 are highly expressed in cancer cells and in this study, we have used results of RNA interference (RNAi) to show that the three TFs individually play a role in the growth, survival and migration/invasion of breast, kidney, pancreatic, lung and colon cancer cell lines. Moreover, tumor growth in athymic nude mice bearing L3.6pL pancreatic cancer cells as xenografts were significantly decreased in cells depleted for Sp1, Sp3 and Sp4 (combined) or Sp1 alone. Ingenuity Pathway Analysis (IPA) of changes in gene expression in Panc1 pancreatic cancer cells after individual knockdown of Sp1, Sp3 and Sp4 demonstrates that these TFs regulate genes and pathways that correlated with the functional responses observed after knockdown but also some genes and pathways that inversely correlated with the functional responses. However, causal IPA analysis which integrates all pathway-dependent changes in all genes strongly predicted that Sp1-, Sp3- and Sp4-regulated genes were associated with the pro-oncogenic activity. These functional and genomic results coupled with overexpression of Sp transcription factors in tumor vs. non-tumor tissues and decreased Sp1 expression with age indicate that Sp1, Sp3 and Sp4 are non-oncogene addiction (NOA) genes and are attractive drug targets for individual and combined cancer chemotherapies. PMID:26967243

  13. Transcription factors nuclear factor I and Sp1 interact with the murine collagen alpha 1 (I) promoter.

    PubMed Central

    Nehls, M C; Rippe, R A; Veloz, L; Brenner, D A

    1991-01-01

    The collagen alpha 1(I) promoter, which is efficiently transcribed in NIH 3T3 fibroblasts, contains four binding sites for trans-acting factors, as demonstrated by DNase I protection assays (D. A. Brenner, R. A. Rippe, and L. Veloz, Nucleic Acids Res. 17:6055-6064, 1989). This study characterizes the DNA-binding proteins that interact with the two proximal footprinted regions, both of which contain a reverse CCAAT box and a G + C-rich 12-bp direct repeat. Analysis by DNase I protection assays, mobility shift assays, competition with specific oligonucleotides, binding with recombinant proteins, and reactions with specific antisera showed that the transcriptional factors nuclear factor I (NF-I) and Sp1 bind to these two footprinted regions. Because of overlapping binding sites, NF-I binding and Sp1 binding appear to be mutually exclusive. Overexpression of NF-I in cotransfection experiments with the alpha 1(I) promoter in NIH 3T3 fibroblasts increased alpha 1(I) expression, while Sp1 overexpression reduced this effect, as well as basal promoter activity. The herpes simplex virus thymidine kinase promoter, which contains independent NF-I- and Sp1-binding sites, was stimulated by both factors. Therefore, expression of the collagen alpha 1(I) gene may depend on the relative activities of NF-I and Sp1. Images PMID:2072909

  14. Androgen up-regulates vascular endothelial growth factor expression in prostate cancer cells via an Sp1 binding site

    PubMed Central

    2013-01-01

    Background Vascular Endothelial Growth Factor (VEGF) is regulated by a number of different factors, but the mechanism(s) behind androgen-mediated regulation of VEGF in prostate cancer are poorly understood. Results Three novel androgen receptor (AR) binding sites were discovered in the VEGF promoter and in vivo binding of AR to these sites was demonstrated by chromatin immunoprecipitation. Mutation of these sites attenuated activation of the VEGF promoter by the androgen analog, R1881 in prostate cancer cells. The transcription factors AR and Sp1 were shown to form a nuclear complex and both bound the VEGF core promoter in chromatin of hormone treated CWR22Rv1 prostate cancer cells. The importance of the Sp1 binding site in hormone mediated activation of VEGF expression was demonstrated by site directed mutagenesis. Mutation of a critical Sp1 binding site (Sp1.4) in the VEGF core promoter region prevented activation by androgen. Similarly, suppression of Sp1 binding by Mithramycin A treatment significantly reduced VEGF expression. Conclusions Our mechanistic study of androgen mediated induction of VEGF expression in prostate cancer cells revealed for the first time that this induction is mediated through the core promoter region and is dependent upon a critical Sp1 binding site. The importance of Sp1 binding suggests that therapy targeting the AR-Sp1 complex may dampen VEGF induced angiogenesis and, thereby, block prostate cancer progression, helping to maintain the indolent form of prostate cancer. PMID:23369005

  15. Molecular Characterisation, Evolution and Expression of Hypoxia-Inducible Factor in Aurelia sp.1

    PubMed Central

    Wang, Guoshan; Yu, Zhigang; Zhen, Yu; Mi, Tiezhu; Shi, Yan; Wang, Jianyan; Wang, Minxiao; Sun, Song

    2014-01-01

    The maintenance of physiological oxygen homeostasis is mediated by hypoxia-inducible factor (HIF), a key transcriptional factor of the PHD-HIF system in all metazoans. However, the molecular evolutionary origin of this central physiological regulatory system is not well characterized. As the earliest eumetazoans, Cnidarians can be served as an interesting model for exploring the HIF system from an evolutionary perspective. We identified the complete cDNA sequence of HIF-1α (ASHIF) from the Aurelia sp.1, and the predicted HIF-1α protein (pASHIF) was comprised of 674 amino acids originating from 2,025 bp nucleotides. A Pairwise comparison revealed that pASHIF not only possessed conserved basic helix-loop-helix (bHLH) and Per-Arnt-Sim (PAS) domains but also contained the oxygen dependent degradation (ODD) and the C-terminal transactivation domains (C-TAD), the key domains for hypoxia regulation. As indicated by sequence analysis, the ASHIF gene contains 8 exons interrupted by 7 introns. Western blot analysis indicated that pASHIF that existed in the polyps and medusa of Aurelia. sp.1 was more stable for a hypoxic response than normoxia. PMID:24926666

  16. DNA binding and regulatory effects of transcription factors SP1 and USF at the rat amyloid precursor protein gene promoter.

    PubMed Central

    Hoffman, P W; Chernak, J M

    1995-01-01

    Two DNA elements which we have termed SAA and GAG have been shown to control expression of the rat amyloid precursor protein (APP) gene, and the region containing the SAA element has been shown to interact with nuclear proteins [Hoffman and Chernak (1994) Biochem. Biophys. Res. Commun. 201, 610-617]. In this report we study DNA sequences and proteins which influence the activity of the SAA element. An oligonucleotide containing the SAA element is specifically bound by nuclear proteins derived from rat PC12 cells, consistently forming four complexes designated C25, C30, C35 and C40 in electrophoretic mobility shift assays (EMSAs). We demonstrate that the C25, C30 and C40 complexes involve the binding of nuclear proteins to an SP1 consensus sequence located within the SAA element and that the C25 complex contains a protein antigenically related to the human SP1 protein. We establish further that the C35 complex requires a USF recognition site located within the SAA element and contains a protein antigenically related to the human upstream stimulatory factor (USF) protein. Using APP promoter/luciferase reporter gene constructs, we demonstrate that both the SP1 and the USF sites can play a role in the transcriptional activity of the SAA element. Finally, we show that complexes similar to the C25, C30 and C35 complexes are formed by rat cortex nuclear extracts and the SAA element in EMSA experiments, suggesting the relevance of our in vitro observations to the in vivo functioning of the rat APP promoter. Images PMID:7610052

  17. Role of Transglutaminase 2 in Liver Injury via Cross-linking and Silencing of Transcription Factor Sp1

    PubMed Central

    TATSUKAWA, HIDEKI; FUKAYA, YAYOI; FRAMPTON, GORDON; MARTINEZ–FUENTES, ANTONIO; SUZUKI, KENJI; KUO, TING–FANG; NAGATSUMA, KEISUKE; SHIMOKADO, KENTARO; OKUNO, MASATAKA; WU, JIAN; IISMAA, SIIRI; MATSUURA, TOMOKAZU; TSUKAMOTO, HIDEKAZU; ZERN, MARK A.; GRAHAM, ROBERT M.; KOJIMA, SOICHI

    2016-01-01

    Background & Aims Despite high morbidity and mortality of alcoholic liver disease worldwide, the molecular mechanisms underlying alcohol-induced liver cell death are not fully understood. Transglutaminase 2 (TG2) is a cross-linking enzyme implicated in apoptosis. TG2 levels and activity are increased in association with various types of liver injury. However, how TG2 induces hepatic apoptosis is not known. Methods Human hepatic cells or primary hepatocytes from rats or TG2+/+ and TG2−/− mice were treated with ethanol. Mice were administered anti-Fas antibody or alcohol. Liver sections were prepared from patients with alcoholic steatohepatitis. Changes in TG2 levels, Sp1 cross-linking and its activities, expression of hepatocyte growth factor receptor, c-Met, and hepatic apoptosis were measured. Results Ethanol induced apoptosis in hepatic cells, enhanced activity and nuclear accumulation of TG2 as well as accumulation of cross-linked and inactivated Sp1, and reduced expression of the Sp1-responsive gene, c-Met. These effects were rescued by TG2 knockdown, restoration of functional Sp1, or addition of hepatocyte growth factor, whereas apoptosis was reproduced by Sp1 knockdown or TG2 overexpression. Compared with TG2+/+ mice, TG2−/− mice showed markedly reduced hepatocyte apoptosis and Sp1 cross-linking following ethanol or anti-Fas treatment. Treatment of TG2+/+ mice with the TG2 inhibitors putrescine or cystamine blocked anti-Fas–induced hepatic apoptosis and Sp1 silencing. Moreover, enhanced expression of cross-linked Sp1 and TG2 was evident in hepatocyte nuclei of patients with alcoholic steatohepatitis. Conclusions TG2 induces hepatocyte apoptosis via Sp1 cross-linking and inactivation, with resultant inhibition of the expression of c-Met required for hepatic cell viability. PMID:19208340

  18. 5-Azacytidine treatment of HA-A melanoma cells induces Sp1 activity and concomitant transforming growth factor alpha expression.

    PubMed Central

    Shin, T H; Paterson, A J; Grant, J H; Meluch, A A; Kudlow, J E

    1992-01-01

    Evidence indicates DNA methylation as a part of the regulatory machinery controlling mammalian gene expression. The human melanoma cell line HA-A expresses low levels of transforming growth factor alpha (TGF-alpha). TGF-alpha mRNA accumulated, however, in response to DNA demethylation induced by a nucleoside analog, 5-azacytidine (5-azaC). The importance of DNA methylation in the TGF-alpha promoter region was examined by a transient transfection assay with luciferase reporter plasmids containing a portion of the TGF-alpha promoter. 5-azaC treatment of HA-A cells before the transfection caused a significant increase in the luciferase activity. Since input plasmids were confirmed to remain unmethylated, DNA demethylation of the TGF-alpha promoter itself does not account for the observed increase in TGF-alpha mRNA. Using an electrophoretic mobility shift assay, enhanced formation of protein-TGF-alpha promoter complex was detected in response to 5-azaC treatment. This 5-azaC-induced complex was shown to contain the transcription factor Sp1 by the following criteria: the protein-DNA complex formed on the TGF-alpha promoter contained immunoreactive Sp1; the mobility of the complex in an electrophoretic mobility shift assay was similar to that formed by recombinant Sp1; and DNase I footprinting analysis demonstrated that the 5-azaC-induced complex produced a footprint on the TGF-alpha promoter identical to that of authentic Sp1. These observations suggest that 5-azaC induces TGF-alpha expression by augmenting the Sp1 activity. However, neither the Sp1 mRNA nor its protein was induced by 5-azaC. These results suggest that in HA-A cells, TGF-alpha expression is down-modulated by DNA methylation. In addition, this process may involve the specific regulation of Sp1 activity without altering the amount of the transcription factor. Images PMID:1380648

  19. Transcription factor Sp1 inhibition, memory, and cytokines in a mouse model of Alzheimer’s disease

    PubMed Central

    Citron, Bruce A; Saykally, Jessica N; Cao, Chuanhai; Dennis, John S; Runfeldt, Melissa; Arendash, Gary W

    2015-01-01

    Transcription factors are involved to varying extents in the health and survival of neurons in the brain and a better understanding of their roles with respect to the pathogenesis of Alzheimer’s disease (AD) could lead to the development of additional treatment strategies. Sp1 is a transcription factor that responds to inflammatory signals occurring in the AD brain. It is known to regulate genes with demonstrated importance in AD, and we have previously found it upregulated in the AD brain and in brains of transgenic AD model mice. To better understand the role of Sp1 in AD, we tested whether we could affect memory function (measured with a battery of behavioral tests discriminating different aspects of cognitive function) in a transgenic model of AD by pharmaceutical modulation of Sp1. We found that inhibition of Sp1 function in transgenic AD model mice increased memory deficits, while there were no changes in sensorimotor or anxiety tests. Aβ42 and Aβ40 peptide levels were significantly higher in the treated mice, indicating that Sp1 elevation in AD could be a functionally protective response. Circulating levels of CXCL1 (KC) decreased following treatment with mithramycin, while a battery of other cytokines, including IL-1α, IL-6, INF-γ and MCP-1, were unchanged. Gene expression levels for several genes important to neuronal health were determined by qRT-PCR, and none of these appeared to change at the transcriptional level. PMID:26807343

  20. Sp1 and the ets-related transcription factor complex GABP alpha/beta functionally cooperate to activate the utrophin promoter.

    PubMed

    Gyrd-Hansen, Mads; Krag, Thomas O B; Rosmarin, Alan G; Khurana, Tejvir S

    2002-05-15

    Duchenne muscular dystrophy (DMD) is a fatal neuromuscular disease caused by the absence of dystrophin. Utrophin is the autosomal homolog of dystrophin and capable of compensating for the absence of dystrophin, when overexpressed. In skeletal muscle, utrophin plays an important role in the formation of neuromuscular junctions. This selective enrichment occurs, in part by transcriptional regulation of the utrophin gene at the sub-synaptic nuclei in muscle. Utrophin's complex transcriptional regulation is not yet fully understood, however, GABP alpha / beta has recently been shown to bind the N box and activate the utrophin promoter in response to heregulin. In this study, we show that the transcription factor Sp1 binds and activates the utrophin promoter in Drosophila S2 cells as well as define a Sp1 response element. We demonstrate that heregulin treatment of cultured muscle cells activates the ERK pathway and phosphorylates serine residue(s) in the consensus ERK recognition site of Sp1. Finally, Sp1 is shown to functionally cooperate with GABP alpha / beta and cause a 58-fold increase of de novo utrophin promoter transcription. Taken together, these findings help define mechanisms used for transcriptional regulation of utrophin expression as well as identify new targets for achieving potentially therapeutic upregulation of utrophin in DMD. PMID:11997063

  1. Stimulation of ribosomal RNA gene promoter by transcription factor Sp1 involves active DNA demethylation by Gadd45-NER pathway.

    PubMed

    Rajput, Pallavi; Pandey, Vijaya; Kumar, Vijay

    2016-08-01

    The well-studied Pol II transcription factor Sp1 has not been investigated for its regulatory role in rDNA transcription. Here, we show that Sp1 bound to specific sites on rDNA and localized into the nucleoli during the G1 phase of cell cycle to activate rDNA transcription. It facilitated the recruitment of Pol I pre-initiation complex and impeded the binding of nucleolar remodeling complex (NoRC) to rDNA resulting in the formation of euchromatin active state. More importantly, Sp1 also orchestrated the site-specific binding of Gadd45a-nucleotide excision repair (NER) complex resulting in active demethylation and transcriptional activation of rDNA. Interestingly, knockdown of Sp1 impaired rDNA transcription due to reduced engagement of the Gadd45a-NER complex and hypermethylation of rDNA. Thus, the present study unveils a novel role of Sp1 in rDNA transcription involving promoter demethylation. PMID:27156884

  2. Starvation after Cobalt-60 γ-Ray Radiation Enhances Metastasis in U251 Glioma Cells by Regulating the Transcription Factor SP1

    PubMed Central

    Zhao, Tuo; Wang, Hailong; Ma, Hong; Wang, Hao; Chen, Bo; Deng, Yulin

    2016-01-01

    Radiation is of clinical importance during glioma therapy; however, vasculature damage is observed over the treatment course. This type of tissue damage might lead to starvation conditions, affecting tumor metastasis. To test this possibility, we compared starvation conditions in conjunction with radiation treatment to monitor metastatic ability in the U251 glioma cell line. Transcriptome, western blot, and immunofluorescence analyses were used to measure the RNA and protein expression changes of the U251 cells after various treatments. We found that starvation combined with radiation treatment yielded the most significant expression changes in metastasis-related factors compared to that in the control groups. In addition, a metastasis assay was used to directly measure the metastatic ability of the treated cells, which confirmed that the U251 cells treated with starvation combined with radiation possessed the highest metastatic ability. Furthermore, bioinformatics analysis demonstrated that SP1 represented a common transcription factor associated with changes in metastasis-related factors. Blocking SP1 activity by an inhibitor suppressed the starvation-plus-radiation treatment-mediated enhancement of U251 cell metastasis. Our study provides the first evidence that starvation caused by radiation might play a significant role in enhancing the ability of the glioma cell line U251 to metastasize via regulation of the transcription factor SP1. PMID:27058528

  3. Transcription Factors Sp1 and p73 Control the Expression of the Proapoptotic Protein NOXA in the Response of Testicular Embryonal Carcinoma Cells to Cisplatin*

    PubMed Central

    Grande, Lara; Bretones, Gabriel; Rosa-Garrido, Manuel; Garrido-Martin, Eva M.; Hernandez, Teresa; Fraile, Susana; Botella, Luisa; de Alava, Enrique; Vidal, August; Garcia del Muro, Xavier; Villanueva, Alberto; Delgado, M. Dolores; Fernandez-Luna, Jose L.

    2012-01-01

    Testicular germ cell tumors (TGCTs) are highly responsive to and curable by cisplatin-based chemotherapy even in advanced stages. We have studied the molecular mechanisms involved in the induction of apoptosis in response to cisplatin, and found that proapoptotic Noxa is transcriptionally up-regulated following cisplatin exposure, even in the absence of p53, in NTERA2 cisplatin-sensitive cells but not in 1411HP-resistant cells. Blockade of Noxa reduced the apoptotic response of embryonal carcinoma (EC) NTERA2 cells to cisplatin. A detailed analysis of the Noxa promoter revealed that p73 and Sp1-like factors, Sp1 and KLF6, played key roles in the transcriptional control of this gene. Overexpression of TAp73 induced Noxa whereas the dominant negative isoform ΔNp73, reduced the levels of Noxa after cisplatin exposure in NTERA2 and 2102EP. Interestingly, down-regulation of Sp1 increased Noxa expression in response to cisplatin. However, blockade of KLF6 decreased cisplatin-induced up-regulation of Noxa in EC cell lines. In addition, tissue microarray analyses of TGCTs revealed that expression of Noxa correlates with good clinical prognosis in patients with embryonal carcinoma. Thus, our data show the transcriptional network that regulates Noxa in EC cells, which is key for their apoptotic response to cisplatin-based chemotherapy, and propose Noxa as a predictive factor of therapeutic response. PMID:22718761

  4. Transcription factors Sp1 and p73 control the expression of the proapoptotic protein NOXA in the response of testicular embryonal carcinoma cells to cisplatin.

    PubMed

    Grande, Lara; Bretones, Gabriel; Rosa-Garrido, Manuel; Garrido-Martin, Eva M; Hernandez, Teresa; Fraile, Susana; Botella, Luisa; de Alava, Enrique; Vidal, August; Garcia del Muro, Xavier; Villanueva, Alberto; Delgado, M Dolores; Fernandez-Luna, Jose L

    2012-08-01

    Testicular germ cell tumors (TGCTs) are highly responsive to and curable by cisplatin-based chemotherapy even in advanced stages. We have studied the molecular mechanisms involved in the induction of apoptosis in response to cisplatin, and found that proapoptotic Noxa is transcriptionally up-regulated following cisplatin exposure, even in the absence of p53, in NTERA2 cisplatin-sensitive cells but not in 1411HP-resistant cells. Blockade of Noxa reduced the apoptotic response of embryonal carcinoma (EC) NTERA2 cells to cisplatin. A detailed analysis of the Noxa promoter revealed that p73 and Sp1-like factors, Sp1 and KLF6, played key roles in the transcriptional control of this gene. Overexpression of TAp73 induced Noxa whereas the dominant negative isoform ΔNp73, reduced the levels of Noxa after cisplatin exposure in NTERA2 and 2102EP. Interestingly, down-regulation of Sp1 increased Noxa expression in response to cisplatin. However, blockade of KLF6 decreased cisplatin-induced up-regulation of Noxa in EC cell lines. In addition, tissue microarray analyses of TGCTs revealed that expression of Noxa correlates with good clinical prognosis in patients with embryonal carcinoma. Thus, our data show the transcriptional network that regulates Noxa in EC cells, which is key for their apoptotic response to cisplatin-based chemotherapy, and propose Noxa as a predictive factor of therapeutic response. PMID:22718761

  5. Differences in the expression of cathepsin B in B16 melanoma metastatic variants depend on transcription factor Sp1.

    PubMed

    Sitabkhan, Yasmin; Frankfater, Allen

    2007-09-01

    Cathepsin B contributes to the invasiveness of B16 melanoma cells in mice, with the highly metastatic B16a melanoma producing six- to eightfold more cathepsin B mRNA and protein than the less metastatic B16F1 variant. The proximal promoter region of the cathepsin B (Ctsb) gene (-149 to +94) was previously found to be capable of reproducing this pattern of differential gene activation in B16 melanoma variants. The binding of B16 melanoma nuclear proteins to this promoter region has now been mapped to three GC-boxes (Sp1 transcription factor binding sites) and a potential X-box [tax response element (TRE)/c-AMP responsive element (CRE) site]. Mutation of the GC-boxes at -55 and -37 independently decreased the expression of a luciferase reporter gene in B16a cells to the level observed in B16F1 cells. Promoter activity was also attenuated by mutations within the GC-rich segment between +6 and +16, but not by mutation of the putative X-box. Both Sp1 and Sp3 bound the GC-boxes in the Ctsb promoter, and western blotting showed the level of Sp1 to be greater in B16a compared to B16F1 cells. B16F1 cells that were made to express Sp1 at levels observed in B16a cells produced corresponding increased amounts of endogenous cathepsin B mRNA and enzyme activity. Thus, the difference in cathepsin B expression between high and low metastatic B16 melanoma variants is largely due to different levels of Sp1. PMID:17691867

  6. The human papillomavirus type 16 E2 transcription factor binds with low cooperativity to two flanking sites and represses the E6 promoter through displacement of Sp1 and TFIID.

    PubMed Central

    Tan, S H; Leong, L E; Walker, P A; Bernard, H U

    1994-01-01

    The E6 promoters of all genital human papillomaviruses have a characteristic alignment of transcription factor binding sites. Activation of the basic transcription complex at the TATA box depends upon a sequence-aberrant Sp1 site. Repression of E6 promoters is achieved by two binding sites for the viral E2 protein positioned between the Sp1 site and the TATA box. We have purified the human papillomavirus type 16 E2 protein after expression in Escherichia coli and studied its binding and repression properties with oligonucleotides representing the homologous promoter sequences. A Kd value of 3 x 10(-10) M indicated binding properties expected for a native protein. We found low cooperativity in the binding of two E2 dimers to flanking sites, both when these sites were separated by 3 nucleotides, as in the natural promoter, and when they were further apart. E2 protein, bound close to the distal Sp1 site, displaced the Sp1 factor even when the aberrant sequence was replaced by a typical Sp1 core recognition site. The high affinity of E2 protein for its binding site even led to Sp1 displacement at concentrations of E2 protein nearly 2 orders of magnitude lower than those of Sp1. Functional analyses of mutated E6 promoter sequences showed repression by this distal E2 binding site in the complete absence of binding to the proximal E2 binding site. From our findings and observations published by others, we conclude that each of the E2 binding sites in the E6 promoter of genital human papillomaviruses plays a separate role by displacing the transcription factors Sp1 and TFIID. Images PMID:8083979

  7. miR-29b sensitizes multiple myeloma cells to bortezomib-induced apoptosis through the activation of a feedback loop with the transcription factor Sp1

    PubMed Central

    Amodio, N; Di Martino, M T; Foresta, U; Leone, E; Lionetti, M; Leotta, M; Gullà, A M; Pitari, M R; Conforti, F; Rossi, M; Agosti, V; Fulciniti, M; Misso, G; Morabito, F; Ferrarini, M; Neri, A; Caraglia, M; Munshi, N C; Anderson, K C; Tagliaferri, P; Tassone, P

    2012-01-01

    MicroRNAs (miRNAs) with tumor-suppressor potential might have therapeutic applications in multiple myeloma (MM) through the modulation of still undiscovered molecular pathways. Here, we investigated the effects of enforced expression of miR-29b on the apoptotic occurrence in MM and highlighted its role in the context of a new transcriptional loop that is finely tuned by the proteasome inhibitor bortezomib. In details, in vitro growth inhibition and apoptosis of MM cells was induced by either transient expression of synthetic miR-29b or its stable lentivirus-enforced expression. We identified Sp1, a transcription factor endowed with oncogenic activity, as a negative regulator of miR-29b expression in MM cells. Since Sp1 expression and functions are regulated via the 26S proteasome, we investigated the effects of bortezomib on miR-29b-Sp1 loop, showing that miR-29b levels were indeed upregulated by the drug. At the same time, the bortezomib/miR-29b combination produced significant pro-apoptotic effects. We also demonstrated that the PI3K/AKT pathway plays a major role in the regulation of miR-29b-Sp1 loop and induction of apoptosis in MM cells. Finally, MM xenografts constitutively expressing miR-29b showed significant reduction of their tumorigenic potential. Our findings indicate that miR-29b is involved in a regulatory loop amenable of pharmacologic intervention and modulates the anti-MM activity of bortezomib in MM cells. PMID:23190608

  8. miR-29b sensitizes multiple myeloma cells to bortezomib-induced apoptosis through the activation of a feedback loop with the transcription factor Sp1.

    PubMed

    Amodio, N; Di Martino, M T; Foresta, U; Leone, E; Lionetti, M; Leotta, M; Gullà, A M; Pitari, M R; Conforti, F; Rossi, M; Agosti, V; Fulciniti, M; Misso, G; Morabito, F; Ferrarini, M; Neri, A; Caraglia, M; Munshi, N C; Anderson, K C; Tagliaferri, P; Tassone, P

    2012-01-01

    MicroRNAs (miRNAs) with tumor-suppressor potential might have therapeutic applications in multiple myeloma (MM) through the modulation of still undiscovered molecular pathways. Here, we investigated the effects of enforced expression of miR-29b on the apoptotic occurrence in MM and highlighted its role in the context of a new transcriptional loop that is finely tuned by the proteasome inhibitor bortezomib. In details, in vitro growth inhibition and apoptosis of MM cells was induced by either transient expression of synthetic miR-29b or its stable lentivirus-enforced expression. We identified Sp1, a transcription factor endowed with oncogenic activity, as a negative regulator of miR-29b expression in MM cells. Since Sp1 expression and functions are regulated via the 26S proteasome, we investigated the effects of bortezomib on miR-29b-Sp1 loop, showing that miR-29b levels were indeed upregulated by the drug. At the same time, the bortezomib/miR-29b combination produced significant pro-apoptotic effects. We also demonstrated that the PI3K/AKT pathway plays a major role in the regulation of miR-29b-Sp1 loop and induction of apoptosis in MM cells. Finally, MM xenografts constitutively expressing miR-29b showed significant reduction of their tumorigenic potential. Our findings indicate that miR-29b is involved in a regulatory loop amenable of pharmacologic intervention and modulates the anti-MM activity of bortezomib in MM cells. PMID:23190608

  9. Transcription factors YY1, Sp1 and Sp3 modulate dystrophin Dp71 gene expression in hepatic cells.

    PubMed

    Peñuelas-Urquides, Katia; Becerril-Esquivel, Carolina; Mendoza-de-León, Laura C; Silva-Ramírez, Beatriz; Dávila-Velderrain, José; Cisneros, Bulmaro; de León, Mario Bermúdez

    2016-07-01

    Dystrophin Dp71, the smallest product encoded by the Duchenne muscular dystrophy gene, is ubiquitously expressed in all non-muscle cells. Although Dp71 is involved in various cellular processes, the mechanisms underlying its expression have been little studied. In hepatic cells, Dp71 expression is down-regulated by the xenobiotic β-naphthoflavone. However, the effectors of this regulation remain unknown. In the present study we aimed at identifying DNA elements and transcription factors involved in Dp71 expression in hepatic cells. Relevant DNA elements on the Dp71 promoter were identified by comparing Dp71 5'-end flanking regions between species. The functionality of these elements was demonstrated by site-directed mutagenesis. Using EMSAs and ChIP, we showed that the Sp1 (specificity protein 1), Sp3 (specificity protein 3) and YY1 (Yin and Yang 1) transcription factors bind to the Dp71 promoter region. Knockdown of Sp1, Sp3 and YY1 in hepatic cells increased endogenous Dp71 expression, but reduced Dp71 promoter activity. In summary, Dp71 expression in hepatic cells is carried out, in part, by YY1-, Sp1- and Sp3-mediated transcription from the Dp71 promoter. PMID:27143785

  10. Transcription factor Sp1 regulates T-type Ca(2+) channel CaV 3.1 gene expression.

    PubMed

    González-Ramírez, Ricardo; Martínez-Hernández, Elizabeth; Sandoval, Alejandro; Felix, Ricardo

    2014-05-01

    Voltage-gated T-type Ca(2+) (CaV 3) channels mediate a number of physiological events in developing and mature cells, and are implicated in neurological and cardiovascular diseases. In mammals, there are three distinct T-channel genes (CACNA1G, CACNA1H, and CACNA1I) encoding proteins (CaV 3.1-CaV 3.3) that differ in their localization as well as in molecular, biophysical, and pharmacological properties. The CACNA1G is a large gene that contains 38 exons and is localized in chromosome 17q22. Only basic characteristics of the CACNA1G gene promoter region have been investigated classifying it as a TATA-less sequence containing several potential transcription factor-binding motifs. Here, we cloned and characterized a proximal promoter region and initiated the analysis of transcription factors that control CaV 3.1 channel expression using the murine Cacna1g gene as a model. We isolated a ∼1.5 kb 5'-upstream region of Cacna1g and verified its transcriptional activity in the mouse neuroblastoma N1E-115 cell line. In silico analysis revealed that this region possesses a TATA-less minimal promoter that includes two potential transcription start sites and four binding sites for the transcription factor Sp1. The ability of one of these sites to interact with the transcription factor was confirmed by electrophoretic mobility shift assays. Consistent with this, Sp1 over-expression enhanced promoter activity while siRNA-mediated Sp1 silencing significantly decreased the level of CaV 3.1 protein and reduced the amplitude of whole-cell T-type Ca(2+) currents expressed in the N1E-115 cells. These results provide new insights into the molecular mechanisms that control CaV 3.1 channel expression. PMID:23868804

  11. Interplay of posttranslational modifications in Sp1 mediates Sp1 stability during cell cycle progression.

    PubMed

    Wang, Yi-Ting; Yang, Wen-Bin; Chang, Wen-Chang; Hung, Jan-Jong

    2011-11-18

    Although Sp1 is known to undergo posttranslational modifications such as phosphorylation, glycosylation, acetylation, sumoylation, and ubiquitination, little is known about the possible interplay between the different forms of Sp1 that may affect its overall levels. It is also unknown whether changes in the levels of Sp1 influence any biological cell processes. Here, we identified RNF4 as the ubiquitin E3 ligase of Sp1. From in vitro and in vivo experiments, we found that sumoylated Sp1 can recruit RNF4 as a ubiquitin E3 ligase that subjects sumoylated Sp1 to proteasomal degradation. Sp1 mapping revealed two ubiquitination-related domains: a small ubiquitin-like modifier in the N-terminus of Sp1(Lys16) and the C-terminus of Sp1 that directly interacts with RNF4. Interestingly, when Sp1 was phosphorylated at Thr739 by c-Jun NH(2)-terminal kinase 1 during mitosis, this phosphorylated form of Sp1 abolished the Sp1-RNF4 interaction. Our results show that, while sumoylated Sp1 subjects to proteasomal degradation, the phosphorylation that occurs during the cell cycle can protect Sp1 from degradation by repressing the Sp1-RNF4 interaction. Thus, we propose that the interplay between posttranslational modifications of Sp1 plays an important role in cell cycle progression and keeps Sp1 at a critical level for mitosis. PMID:21983342

  12. O-GlcNAc Modification of Transcription Factor Sp1 Mediates Hyperglycemia-Induced VEGF-A Upregulation in Retinal Cells

    PubMed Central

    Donovan, Kelly; Alekseev, Oleg; Qi, Xin; Cho, William; Azizkhan-Clifford, Jane

    2014-01-01

    Purpose. Proangiogenic protein VEGF-A contributes significantly to retinal lesions and neovascularization in diabetic retinopathy (DR). In preclinical DR, hyperglycemia can upregulate VEGF-A in retinal cells. The VEGF-A promoter is responsive to the transcription factor specificity protein 1 (Sp1). The O-GlcNAc modification is driven by glucose concentration and has a profound effect on Sp1 activity. This study investigated the effects of hyperglycemia on Sp1-mediated expression of VEGF-A in the retinal endothelium and pigment epithelium. Methods. Hyperglycemia-exposed ARPE-19 (human retinal pigment epithelial cells) and TR-iBRB (rat retinal microendothelial cells) were assayed for levels of VEGF-A by qRT-PCR, Western blot, and ELISA. Small molecule inhibitors of O-GlcNAc transferase (OGT) or O-GlcNAcase (OGA) were used to manipulate O-GlcNAc levels. Vascular endothelial growth factor–A protein and transcript were measured in cells depleted of OGT or Sp1 by shRNA. The proximal VEGF-A promoter was analyzed for glucose sensitivity by luciferase assay. Chromatin immunoprecipitation (ChIP) was used to assess Sp1 occupancy on the VEGF-A promoter. Results. Hyperglycemia increased VEGF-A promoter activity and upregulated VEGF-A transcript and protein. Elevation of O-GlcNAc by OGA inhibitors was sufficient to increase VEGF-A. O-GlcNAc transferase inhibition abrogated glucose-driven VEGF-A. Cellular depletion of OGT or Sp1 by shRNA significantly abrogated glucose-induced changes in VEGF-A. ChIP analysis showed that hyperglycemia significantly increased binding of Sp1 to the VEGF-A promoter. Conclusions. Hyperglycemia-driven VEGF-A production is mediated by elevated O-GlcNAc modification of the Sp1 transcription factor. This mechanism may be significant in the pathogenesis of preclinical DR through VEGF-A upregulation. PMID:25352121

  13. Involvement of PKC{alpha} in insulin-induced PKC{delta} expression: Importance of SP-1 and NF{kappa}B transcription factors

    SciTech Connect

    Horovitz-Fried, Miriam; Sampson, Sanford R. . E-mail: sampsos@mail.biu.ac.il

    2007-01-05

    Protein kinase C delta (PKC{delta}) is a key molecule in insulin signaling essential for insulin-induced glucose transport in skeletal muscle. Recent studies in our laboratory have shown that insulin rapidly stimulates PKC{delta} activity and increases PKC{delta} protein and RNA levels, and that the SP-1 transcription factor is involved in insulin-induced transcription of the PKC{delta} gene. Activation of SP-1 involves serine phosphorylation and translocation to the nucleus. In this study we examined the possibility that PKC{alpha} might be involved in serine phosphorylation and activation of SP-1. We found that insulin rapidly phosphorylates and translocates SP-1. In the cytoplasm, SP-1 was constitutively associated with PKC{alpha}, and insulin stimulation caused these proteins to dissociate. In contrast, in the nucleus insulin induced an increase in association between PKC{alpha} and SP-1. PKC{alpha} inhibition blocked insulin-induced serine phosphorylation of SP-1 and its association with PKC{alpha} in the nucleus. Inhibition of PKC{alpha} also reduced the insulin-induced increase in PKC{delta} RNA and protein in the cytoplasmic and nuclear fractions. We also attempted to determine if another transcription factor might be involved in regulation of PKC{delta} expression. We earlier showed that insulin did not affect nuclear NF{kappa}B levels. Inhibition of NF{kappa}B, however, increased insulin-induced increase in PKC{delta} RNA and protein in the cytoplasmic and nuclear fractions. Surprisingly, this inhibition reduced the insulin-induced increase in cytoplasmic and nuclear PKC{alpha} RNA and protein. Inhibition of PKC{delta} reduced I{kappa}B{alpha} phosphorylation as well as NF{kappa}B activation. Thus, PKC{alpha} regulates insulin-induced PKC{delta} expression levels and this regulation involves activation of SP-1 and NF{kappa}B.

  14. NF-κB Activation Limits Airway Branching through Inhibition of Sp1-Mediated Fibroblast Growth Factor-10 Expression

    PubMed Central

    Benjamin, John T.; Carver, Billy J.; Plosa, Erin J.; Yamamoto, Yasutoshi; Miller, J. Davin; Liu, Jin-Hua; van der Meer, Riet; Blackwell, Timothy S.; Prince, Lawrence S.

    2015-01-01

    Bronchopulmonary dysplasia (BPD) is a frequent complication of preterm birth. This chronic lung disease results from arrested saccular airway development and is most common in infants exposed to inflammatory stimuli. In experimental models, inflammation inhibits expression of fibroblast growth factor-10 (FGF-10) and impairs epithelial–mesenchymal interactions during lung development; however, the mechanisms connecting inflammatory signaling with reduced growth factor expression are not yet understood. In this study we found that soluble inflammatory mediators present in tracheal fluid from preterm infants can prevent saccular airway branching. In addition, LPS treatment led to local production of mediators that inhibited airway branching and FGF-10 expression in LPS-resistant C.C3-Tlr4Lpsd/J fetal mouse lung explants. Both direct NF-κB activation and inflammatory cytokines (IL-1β and TNF-α) that activate NF-κB reduced FGF-10 expression, whereas chemokines that signal via other inflammatory pathways had no effect. Mutational analysis of the FGF-10 promoter failed to identify genetic elements required for direct NF-κB–mediated FGF-10 inhibition. Instead, NF-κB activation appeared to interfere with the normal stimulation of FGF-10 expression by Sp1. Chromatin immunoprecipitation and nuclear coimmunoprecipitation studies demonstrated that the RelA subunit of NF-κB and Sp1 physically interact at the FGF-10 promoter. These findings indicate that inflammatory signaling through NF-κB disrupts the normal expression of FGF-10 in fetal lung mesenchyme by interfering with the transcriptional machinery critical for lung morphogenesis. PMID:20861353

  15. Hepatitis C virus nonstructural protein-5A activates sterol regulatory element-binding protein-1c through transcription factor Sp1

    SciTech Connect

    Xiang, Zhonghua; Qiao, Ling; Zhou, Yan; Babiuk, Lorne A.; Liu, Qiang

    2010-11-19

    Research highlights: {yields} A chimeric subgenomic HCV replicon expresses HCV-3a NS5A in an HCV-1b backbone. {yields} HCV-3a NS5A increases mature SREBP-1c protein level. {yields} HCV-3a NS5A activates SREBP-1c transcription. {yields} Domain II of HCV-3a NS5A is more effective in SREBP-1c promoter activation. {yields} Transcription factor Sp1 is required for SREBP-1c activation by HCV-3a NS5A. -- Abstract: Steatosis is an important clinical manifestation of hepatitis C virus (HCV) infection. The molecular mechanisms of HCV-associated steatosis are not well understood. Sterol regulatory element-binding protein-1c (SREBP-1c) is a key transcription factor which activates the transcription of lipogenic genes. Here we showed that the nuclear, mature SREBP-1c level increases in the nucleus of replicon cells expressing HCV-3a nonstructural protein-5A (NS5A). We further showed that HCV-3a NS5A up-regulates SREBP-1c transcription. Additional analysis showed that transcriptional factor Sp1 is involved in SREBP-1c activation by HCV-3a NS5A because inhibition of Sp1 activity by mithramycin A or a dominant-negative Sp1 construct abrogated SREBP-1c promoter activation by HCV-3a NS5A. In addition, chromatin immunoprecipitation (ChIP) assay demonstrated enhanced binding of Sp1 on the SREBP-1c promoter in HCV-3a NS5A replicon cells. These results showed that HCV-3a NS5A activates SREBP-1c transcription through Sp1. Taken together, our results suggest that HCV-3a NS5A is a contributing factor for steatosis caused by HCV-3a infection.

  16. Sp1 Transcription Factor Interaction with Accumulated Prelamin A Impairs Adipose Lineage Differentiation in Human Mesenchymal Stem Cells: Essential Role of Sp1 in the Integrity of Lipid Vesicles

    PubMed Central

    Ruiz de Eguino, Garbiñe; Infante, Arantza; Schlangen, Karin; Aransay, Ana M.; Fullaondo, Ane; Soriano, Mario; García-Verdugo, José Manuel; Martín, Ángel G.

    2012-01-01

    Lamin A (LMNA)-linked lipodystrophies may be either genetic (associated with LMNA mutations) or acquired (associated with the use of human immunodeficiency virus protease inhibitors [PIs]), and in both cases they share clinical features such as anomalous distribution of body fat or generalized loss of adipose tissue, metabolic alterations, and early cardiovascular complications. Both LMNA-linked lipodystrophies are characterized by the accumulation of the lamin A precursor prelamin A. The pathological mechanism by which prelamin A accumulation induces the lipodystrophy associated phenotypes remains unclear. Since the affected tissues in these disorders are of mesenchymal origin, we have generated an LMNA-linked experimental model using human mesenchymal stem cells treated with a PI, which recapitulates the phenotypes observed in patient biopsies. This model has been demonstrated to be a useful tool to unravel the pathological mechanism of the LMNA-linked lipodystrophies, providing an ideal system to identify potential targets to generate new therapies for drug discovery screening. We report for the first time that impaired adipogenesis is a consequence of the interaction between accumulated prelamin A and Sp1 transcription factor, sequestration of which results in altered extracellular matrix gene expression. In fact, our study shows a novel, essential, and finely tuned role for Sp1 in adipose lineage differentiation in human mesenchymal stem cells. These findings define a new physiological experimental model to elucidate the pathological mechanisms LMNA-linked lipodystrophies, creating new opportunities for research and treatment not only of LMNA-linked lipodystrophies but also of other adipogenesis-associated metabolic diseases. PMID:23197810

  17. Triptolide-induced Cell Death in Pancreatic Cancer Is Mediated by O-GlcNAc Modification of Transcription Factor Sp1*

    PubMed Central

    Banerjee, Sulagna; Sangwan, Veena; McGinn, Olivia; Chugh, Rohit; Dudeja, Vikas; Vickers, Selwyn M.; Saluja, Ashok K.

    2013-01-01

    Pancreatic cancer, the fourth most prevalent cancer-related cause of death in the United States, is a disease with a dismal survival rate of 5% 5 years after diagnosis. One of the survival proteins responsible for its extraordinary ability to evade cell death is HSP70. A naturally derived compound, triptolide, and its water-soluble prodrug, Minnelide, down-regulate the expression of this protein in pancreatic cancer cells, thereby causing cell death. However, the mechanism of action of triptolide has not been elucidated. Our study shows that triptolide-induced down-regulation of HSP70 expression is associated with a decrease in glycosylation of the transcription factor Sp1. We further show that triptolide inhibits glycosylation of Sp1, inhibiting the hexosamine biosynthesis pathway, particularly the enzyme O-GlcNAc transferase. Inhibition of O-GlcNAc transferase prevents nuclear localization of Sp1 and affects its DNA binding activity. This in turn down-regulates prosurvival pathways like NF-κB, leading to inhibition of HSF1 and HSP70 and eventually to cell death. In this study, we evaluated the mechanism by which triptolide affects glycosylation of Sp1, which in turn affects downstream pathways controlling survival of pancreatic cancer cells. PMID:24129563

  18. Triptolide-induced cell death in pancreatic cancer is mediated by O-GlcNAc modification of transcription factor Sp1.

    PubMed

    Banerjee, Sulagna; Sangwan, Veena; McGinn, Olivia; Chugh, Rohit; Dudeja, Vikas; Vickers, Selwyn M; Saluja, Ashok K

    2013-11-22

    Pancreatic cancer, the fourth most prevalent cancer-related cause of death in the United States, is a disease with a dismal survival rate of 5% 5 years after diagnosis. One of the survival proteins responsible for its extraordinary ability to evade cell death is HSP70. A naturally derived compound, triptolide, and its water-soluble prodrug, Minnelide, down-regulate the expression of this protein in pancreatic cancer cells, thereby causing cell death. However, the mechanism of action of triptolide has not been elucidated. Our study shows that triptolide-induced down-regulation of HSP70 expression is associated with a decrease in glycosylation of the transcription factor Sp1. We further show that triptolide inhibits glycosylation of Sp1, inhibiting the hexosamine biosynthesis pathway, particularly the enzyme O-GlcNAc transferase. Inhibition of O-GlcNAc transferase prevents nuclear localization of Sp1 and affects its DNA binding activity. This in turn down-regulates prosurvival pathways like NF-κB, leading to inhibition of HSF1 and HSP70 and eventually to cell death. In this study, we evaluated the mechanism by which triptolide affects glycosylation of Sp1, which in turn affects downstream pathways controlling survival of pancreatic cancer cells. PMID:24129563

  19. Transcription factor-pathway co-expression analysis reveals cooperation between SP1 and ESR1 on dysregulating cell cycle arrest in non-hyperdiploid multiple myeloma

    PubMed Central

    Wang, Xujun; Yan, Zhenyu; Fulciniti, Mariateresa; Li, Yingxiang; Gkotzamanidou, Maria; Amin, Samir B; Shah, Parantu K; Zhang, Yong

    2014-01-01

    Multiple myeloma is a hematological cancer of plasma B-cells and remains incurable. Two major subtypes of myeloma, hyperdiploid (HMM) and non-hyperdiploid myeloma (NHMM), have distinct chromosomal alterations and different survival outcomes. Transcription factors (TrFs) have been implicated in myeloma oncogenesis but their dysregulation in myeloma subtypes are less studied. Here we develop a TrF-pathway co-expression analysis to identify altered co-expression between two sample types. We apply the method to the two myeloma subtypes and the cell cycle arrest pathway, which is significantly differentially expressed between the two subtypes. We find that TrFs MYC, NF-κB and HOXA9 have significantly lower co-expression with cell cycle arrest in HMM, co-occurring with their over-activation in HMM. In contrast, TrFs ESR1, SP1 and E2F1 have significantly lower co-expression with cell cycle arrest in NHMM. SP1 ChIP targets are enriched by cell cycle arrest genes. These results motivate a cooperation model of ESR1 and SP1 in regulating cell cycle arrest, and a hypothesis that their over-activation in NHMM disrupts proper regulation of cell cycle arrest. Co-targeting ESR1 and SP1 shows a synergistic effect on inhibiting myeloma proliferation in NHMM cell lines. Therefore, studying TrF-pathway co-expression dysregulation in human cancers facilitates forming novel hypotheses towards clinical utility. PMID:23925045

  20. Transcriptional regulation of the human cystathionine beta-synthase -1b basal promoter: synergistic transactivation by transcription factors NF-Y and Sp1/Sp3.

    PubMed Central

    Ge, Y; Konrad, M A; Matherly, L H; Taub, J W

    2001-01-01

    Cystathionine beta-synthase (CBS) catalyses the condensation of serine and homocysteine to form cystathionine, an intermediate step in the synthesis of cysteine. Human CBS encodes five distinct 5' non-coding exons, the most frequent termed CBS -1a and CBS -1b, each transcribed from its own unique GC-rich TATA-less promoter. The minimal transcriptional region (-3792 to -3667) of the CBS -1b promoter was defined by 5'- and 3'-deletions, and transient transfections of reporter gene constructs in HepG2 cells, characterized by CBS transcription exclusively from the -1b promoter. Included in this 125 bp region are 3 GC-boxes (termed GC-a, GC-b and GC-c), an inverted CAAT-box and an E-box. By gel-shift and supershift assays, binding of specificity protein (Sp)1 and Sp3 to the GC-box elements, upstream stimulatory factor 1 (USF-1) to the E-box, and both nuclear factor (NF)-Y and an NF-1-like factor to the CAAT box could be demonstrated. By transient trans fections and reporter gene assays in HepG2 and Drosophila SL2 cells, a functional interplay was indicated between NF-Y binding to the CAAT-box, or between USF-1 binding to the E-box, and Sp1/Sp3 binding to the GC-box elements. In SL2 cells, NF-Y and Sp1/Sp3 were synergistic. Furthermore, both Sp1 and the long Sp3 isoform transactivated the CBS -1b minimal promoter; however, the short Sp3 isoforms were potent repressors. These results may explain the cell- or tissue-specific regulation of CBS transcription, and clarify the bases for alterations in CBS gene expression in human disease and Down's syndrome. PMID:11415440

  1. Arsenic trioxide-mediated growth inhibition in gallbladder carcinoma cells via down-regulation of Cyclin D1 transcription mediated by Sp1 transcription factor

    SciTech Connect

    Ai, Zhilong; Lu, Weiqi; Ton, Saixiong; Liu, Houbao; Sou, Tao; Shen, Zhenbin; Qin, Xinyu . E-mail: smc_jjh@yahoo.com.cn

    2007-08-31

    Gallbladder carcinoma (GBC), an aggressive and mostly lethal malignancy, is known to be resistant to a number of drug stimuli. Here, we demonstrated that arsenic trioxide inhibited the proliferation of gallbladder carcinoma in vivo and in vitro as well as the transcription of cell cycle-related protein Cyclin D1. And, Cyclin D1 overexpression inhibited the negative role of arsenic trioxide in cell cycle progression. We further explored the mechanisms by which arsenic trioxide affected Cyclin D1 transcription and found that the Sp1 transcription factor was down-regulated by arsenic trioxide, with a corresponding decrease in Cyclin D1 promoter activity. Taken together, these results suggested that arsenic trioxide inhibited gallbladder carcinoma cell proliferation via down-regulation of Cyclin D1 transcription in a Sp1-dependent manner, which provided a new mechanism of arsenic trioxide-involved cell proliferation and may have important therapeutic implications in gallbladder carcinoma patients.

  2. Brg-1 mediates the constitutive and fenretinide-induced expression of SPARC in mammary carcinoma cells via its interaction with transcription factor Sp1

    PubMed Central

    2010-01-01

    Background Secreted protein, acidic and rich in cysteine (SPARC) is a matricellular protein that mediates cell-matrix interactions. It has been shown, depending on the type of cancer, to possess either pro- or anti-tumorigenic properties. The transcriptional regulation of the SPARC gene expression has not been fully elucidated and the effects of anti-cancer drugs on this process have not been explored. Results In the present study, we demonstrated that chromatin remodeling factor Brg-1 is recruited to the proximal SPARC promoter region (-130/-56) through an interaction with transcription factor Sp1. We identified Brg-1 as a critical regulator for the constitutive expression levels of SPARC mRNA and protein in mammary carcinoma cell lines and for SPARC secretion into culture media. Furthermore, we found that Brg-1 cooperates with Sp1 to enhance SPARC promoter activity. Interestingly, fenretinide [N-4(hydroxyphenyl) retinamide, 4-HPR], a synthetic retinoid with anti-cancer properties, was found to up-regulate the transcription, expression and secretion of SPARC via induction of the Brg-1 in a dose-dependent manner. Finally, our results demonstrated that fenretinide-induced expression of SPARC contributes significantly to a decreased invasion of mammary carcinoma cells. Conclusions Overall, our results reveal a novel cooperative role of Brg-1 and Sp1 in mediating the constitutive and fenretinide-induced expression of SPARC, and provide new insights for the understanding of the anti-cancer effects of fenretinide. PMID:20687958

  3. Altered Expression of NF- κ B and SP1 after Exposure to Advanced Glycation End-Products and Effects of Neurotrophic Factors in AGEs Exposed Rat Retinas.

    PubMed

    Bikbova, Guzel; Oshitari, Toshiyuki; Baba, Takayuki; Yamamoto, Shuichi

    2015-01-01

    To determine the effect of advanced glycation end-products (AGEs) on neurite regeneration, and also to determine the regenerative effects of different neurotrophic factors (NTFs) on rat retinal explants, the retinas of SD rats were cultured in three-dimensional collagen gels and incubated in 6 types of media: (1) serum-free control culture media; (2) 100 μg/mL AGEs-BSA media; (3) AGEs-BSA + 100 ng/mL neurotrophin-4 (NT-4) media; (4) AGEs-BSA + 100 ng/mL hepatocyte growth factor media; (5) AGEs-BSA + 100 ng/mL glial cell line-derived neurotrophic factor media; or (6) AGEs-BSA + 100 µM tauroursodeoxycholic acid media. After 7 days, the number of regenerating neurites was counted. The explants were immunostained for nuclear factor-κB (NF-κB) and specificity protein 1 (SP1). Statistical analyses were performed by one-way ANOVA. In retinas incubated with AGEs, the numbers of neurites were fewer than in control. All of the NTFs increased the number of neurites, and the increase was more significant in the NT-4 group. The number of NF-κB and SP1 immunopositive cells was higher in retinas exposed to AGEs than in control. All of the NTFs decreased the number of NF-κB immunopositive cells but did not significantly affect SP1 expression. These results demonstrate the potential of the NTFs as axoprotectants in AGEs exposed retinal neurons. PMID:26078979

  4. Contribution of transcription factor, SP1, to the promotion of HB-EGF expression in defense mechanism against the treatment of irinotecan in ovarian clear cell carcinoma

    PubMed Central

    Miyata, Kohei; Yotsumoto, Fusanori; Nam, Sung Ouk; Odawara, Takashi; Manabe, Sadao; Ishikawa, Toyokazu; Itamochi, Hiroaki; Kigawa, Junzo; Takada, Shuji; Asahara, Hiroshi; Kuroki, Masahide; Miyamoto, Shingo

    2014-01-01

    Ovarian clear cell carcinoma (OCCC) is a worst histological subtype than other ovarian malignant tumor. Heparin-binding epidermal growth factor-like growth factor (HB-EGF) is a promising target for ovarian cancer therapy. The aims of this study were to validate the efficacy of HB-EGF–targeted therapy for OCCC and to identify the transcription factor that contributed to the induction of HB-EGF by SN38 treatment in OCCC cells. HB-EGF was highly expressed in OCCC cells, and an increase of HB-EGF was induced by SN38 which had only antitumor effect among conventional anticancer agents on OCCC. A specific inhibitor of HB-EGF, a cross-reacting material 197 (CRM197), led to a synergistic increase in the number of apoptotic OCCC cells with the treatment of SN38. The luciferase assay with 5′-deletion promoter constructs identified a GC-rich element between −125 and −178 (the distal transcription start site was denoted +1) as a cis-regulatory region, and the treatment of SN38 induced luciferase activity in this region. An in silico and chromatin immunoprecipitation analysis estimated that SP1 bound to the cis-regulatory region of HB-EGF in OCCC cells. Real-time PCR and cell viability assays showed that the transfection of a small interfering RNA targeting SP1 suppressed the expression of HB-EGF induced by SN38, resulting in the enhanced sensitivity of SN38. Taken together, these results indicate that induction of HB-EGF expression contributed to defense mechanism against treatment of SN38 through the transcriptional activity of SP1 in OCCC cells. PMID:25060396

  5. Regulation of the Cyclin-dependent Kinase Inhibitor 1A Gene (CDKN1A) by the Repressor BOZF1 through Inhibition of p53 Acetylation and Transcription Factor Sp1 Binding*

    PubMed Central

    Kim, Min-Kyeong; Jeon, Bu-Nam; Koh, Dong-In; Kim, Kyung-Sup; Park, So-Yoon; Yun, Chae-Ok; Hur, Man-Wook

    2013-01-01

    The human POZ domain and Krüppel-like zinc finger (POK) family proteins play important roles in the regulation of apoptosis, cell proliferation, differentiation, development, oncogenesis, and tumor suppression. A novel POK family transcription factor, BTB/POZ and zinc finger domains factor on chromosome 1 (BOZF-1; also called ZBTB8A), contains a POZ domain and two C2H2-type Krüppel-like zinc fingers and is localized at nuclear speckles. Compared with paired normal tissues, BOZF1 expression is increased in cancer tissues of the prostate, breast, and cervix. BOZF1 repressed the transcription of p21WAF/CDKN1A by acting on the proximal promoter concentrated with Sp1-binding GC boxes. BOZF1 competed with Sp1 in binding to GC boxes 1–5/6 of the CDKN1A proximal promoter. In addition, BOZF1 interacted with p53 and decreased the acetylation of p53 by p300, which reduced the DNA binding activity of p53 at the far distal p53-binding element. BOZF1 blocked the two major molecular events that are important in both constitutive and inducible transcription activation of CDKN1A. BOZF1 is unique in that it bound to all the proximal GC boxes to repress transcription, and it inhibited p53 acetylation without affecting p53 stability. BOZF1 might be a novel proto-oncoprotein that stimulates cell proliferation. PMID:23329847

  6. Reduced O glycosylation of Sp1 is associated with increased proteasome susceptibility.

    PubMed Central

    Han, I; Kudlow, J E

    1997-01-01

    Sp1 is a ubiquitously expressed transcription factor that is particularly important for the regulation of TATA-less genes that encode housekeeping proteins. Most growth factors and receptors are also encoded by such genes. Sp1 is multiply O glycosylated by covalent linkage of the monosaccharide N-acetylglucosamine (O-GlcNAc) to serine and threonine residues. Based on an earlier observation that growth factor gene transcription can be regulated by glucose and glucosamine in vascular smooth muscle cells, we determined whether Sp1 glycosylation could be regulated and if this modification altered Sp1 function. We found that Sp1 becomes hyperglycosylated when cells are exposed to 5 mM glucosamine, whereas under glucose starvation, stimulation with cyclic AMP (cAMP) results in nearly complete deglycosylation of this protein. Correlating with this hypoglycosylated state, Sp1 is rapidly proteolytically degraded by an enzyme(s) that can be inhibited by specific proteasome inhibitors, lactacystin and LLnL. Treatment of cells with glucose or glucosamine protects Sp1 from cAMP-mediated degradation, whereas blockade of glucosamine synthesis abrogates glucose but not glucosamine protection. This effect on Sp1 is specific, in that the Stat-3 and E2F transcription factors did not undergo degradation under these conditions. The O-GlcNAc modification of Sp1 may play a role as a nutritional checkpoint. In the absence of adequate nutrition, Sp1 becomes hypoglycosylated and thereby subject to proteasome degradation. This process could potentially result in reduced general transcription, thereby conserving nutrients. PMID:9111324

  7. Expression of the rat liver carnitine palmitoyltransferase I (CPT-Ialpha) gene is regulated by Sp1 and nuclear factor Y: chromosomal localization and promoter characterization.

    PubMed Central

    Steffen, M L; Harrison, W R; Elder, F F; Cook, G A; Park, E A

    1999-01-01

    Carnitine palmitoyltransferase (CPT)-I catalyses the transfer of long-chain fatty acids from CoA to carnitine for translocation across the mitochondrial inner membrane. Expression of the 'liver' isoform of the CPT-I gene (CPT-Ialpha) is subject to developmental, hormonal and tissue-specific regulation. To understand the basis for control of CPT-Ialpha gene expression, we have characterized the proximal promoter of the CPT-Ialpha gene. Here, we report the sequence of 6839 base pairs of the promoter and the localization of the rat CPT-Ialpha gene to region q43 on chromosome 1. Our studies show that the first 200 base pairs of the promoter are sufficient to drive transcription of the CPT-Ialpha gene. Within this region are two sites that bind both Sp1 and Sp3 transcription factors. In addition, nuclear factor Y (NF-Y) binds the proximal promoter. Mutation at the Sp1 or NF-Y sites severely decreases transcription from the CPT-Ialpha promoter. Other protein binding sites were identified within the first 200 base pairs of the promoter by DNase I footprinting, and these elements contribute to CPT-Ialpha gene expression. Our studies demonstrate that CPT-Ialpha is a TATA-less gene which utilizes NF-Y and Sp proteins to drive basal expression. PMID:10333485

  8. Indole-3-carbinol downregulation of telomerase gene expression requires the inhibition of estrogen receptor-alpha and Sp1 transcription factor interactions within the hTERT promoter and mediates the G1 cell cycle arrest of human breast cancer cells

    PubMed Central

    Marconett, Crystal N.; Sundar, Shyam N.; Tseng, Min; Tin, Antony S.; Tran, Kalvin Q.; Mahuron, Kelly M.; Bjeldanes, Leonard F.; Firestone, Gary L.

    2011-01-01

    Indole-3-carbinol (I3C), a naturally occurring hydrolysis product of glucobrassicin from cruciferous vegetables such as broccoli, cabbage and Brussels sprouts, is an anticancer phytochemical that triggers complementary sets of antiproliferative pathways to induce a cell cycle arrest of estrogen-responsive MCF7 breast cancer cells. I3C strongly downregulated transcript expression of the catalytic subunit of the human telomerase (hTERT) gene, which correlated with the dose-dependent indole-mediated G1 cell cycle arrest without altering the transcript levels of the RNA template (hTR) for telomerase elongation. Exogenous expression of hTERT driven by a constitutive promoter prevented the I3C-induced cell cycle arrest and rescued the I3C inhibition of telomerase enzymatic activity and activation of cellular senescence. Time course studies showed that I3C downregulated expression of estrogen receptor-alpha (ERα) and cyclin-dependent kinase-6 transcripts levels (which is regulated through the Sp1 transcription factor) prior to the downregulation of hTERT suggesting a mechanistic link. Chromatin immunoprecipitation assays demonstrated that I3C disrupted endogenous interactions of both ERα and Sp1 with an estrogen response element–Sp1 composite element within the hTERT promoter. I3C inhibited 17β-estradiol stimulated hTERT expression and stimulated the production of threonine-phosphorylated Sp1, which inhibits Sp1–DNA interactions. Exogenous expression of both ERα and Sp1, but not either alone, in MCF7 cells blocked the I3C-mediated downregulation of hTERT expression. These results demonstrate that I3C disrupts the combined ERα- and Sp1-driven transcription of hTERT gene expression, which plays a significant role in the I3C-induced cell cycle arrest of human breast cancer cells. PMID:21693539

  9. Co-operative interactions between NFAT (nuclear factor of activated T cells) c1 and the zinc finger transcription factors Sp1/Sp3 and Egr-1 regulate MT1-MMP (membrane type 1 matrix metalloproteinase) transcription by glomerular mesangial cells.

    PubMed Central

    Alfonso-Jaume, Maria Alejandra; Mahimkar, Rajeev; Lovett, David H

    2004-01-01

    The transition of normally quiescent glomerular MCs (mesangial cells) to a highly proliferative phenotype with characteristics of myofibroblasts is a process commonly observed in inflammatory diseases affecting the renal glomerulus, the ultimate result of which is glomerulosclerosis. Generation of proteolytically active MMP (matrix metalloproteinase)-2 by the membrane-associated membrane type 1 (MT1)-MMP is responsible for the transition of mesangial cells to the myofibroblast phenotype [Turck, Pollock, Lee, Marti and Lovett (1996) J. Biol. Chem. 271, 15074-15083]. In the present study, we show that the expression of MT1-MMP within the context of MCs is mediated by three discrete cis -acting elements: a proximal non-canonical Sp1 site that preferentially binds Sp1; an overlapping Sp1/Egr-1-binding site that preferentially binds Egr-1; and a more distal binding site for the NFAT (nuclear factor of activated T cells) that binds the NFAT c1 isoform present in MC nuclear extracts. Transfection with an NFAT c1 expression plasmid, or activation of calcineurin with a calcium ionophore, yielded major increases in NFAT c1 nuclear DNA-binding activity, MT1-MMP transcription and protein synthesis, which were additive with the lower levels of transactivation provided by the proximal Sp1 and the overlapping Sp1/Egr-1 sites. Specific binding of NFAT c1 to the MT1-MMP promoter was confirmed by chromatin immunoprecipitation studies, while MT1-MMP expression was suppressed by treatment with the calcineurin inhibitor, cyclosporin A. These studies are the first demonstration that a specific NFAT isoform enhances transcription of an MMP (MT1-MMP) that plays a major role in the proteolytic events that are a dominant feature of acute glomerular inflammation. Suppression of MT1-MMP by commonly used calcineurin inhibitors may play a role in the development of renal fibrosis following renal transplantation. PMID:14979875

  10. Regulation of Sp1 by cell cycle related proteins

    PubMed Central

    Tapias, Alicia; Ciudad, Carlos J.; Roninson, Igor B.; Noé, Véronique

    2009-01-01

    Sp1 transcription factor regulates the expression of multiple genes, including the Sp1 gene itself. We analyzed the ability of different cell cycle regulatory proteins to interact with Sp1 and to affect Sp1 promoter activity. Using an antibody array, we observed that CDK4, SKP2, Rad51, BRCA2 and p21 could interact with Sp1 and we confirmed these interactions by co-immunoprecipitation. CDK4, SKP2, Rad51, BRCA2 and p21 also activated the Sp1 promoter. Among the known Sp1-interacting proteins, E2F-DP1, Cyclin D1, Stat3 and Rb activated the Sp1 promoter, whereas p53 and NFκB inhibited it. The proteins that regulated Sp1 gene expression were shown by positive chromatin immunoprecipitation to be bound to the Sp1 promoter. Moreover, SKP2, BRCA2, p21, E2F-DP1, Stat3, Rb, p53 and NFκB had similar effects on an artificial promoter containing only Sp1 binding sites. Transient transfections of CDK4, Rad51, E2F-DP1, p21 and Stat3 increased mRNA expression from the endogenous Sp1 gene in HeLa cells whereas overexpression of NFκB, and p53 decreased Sp1 mRNA levels. p21 expression from a stably integrated inducible promoter in HT1080 cells activated Sp1 expression at the promoter and mRNA levels, but at the same time it decreased Sp1 protein levels due to the activation of Sp1 degradation. The observed multiple effects of cell cycle regulators on Sp1 suggest that Sp1 may be a key mediator of cell cycle associated changes in gene expression. PMID:18769160

  11. Fibroblast growth factor-2 up-regulates the expression of nestin through the Ras–Raf–ERK–Sp1 signaling axis in C6 glioma cells

    SciTech Connect

    Chang, Kai-Wei; Huang, Yuan-Li; Wong, Zong-Ruei; Su, Peng-Han; Huang, Bu-Miin; Ju, Tsai-Kai; Yang, Hsi-Yuan

    2013-05-17

    Highlights: •Nestin expression in C6 glioma cells is induced by FGF-2. •Nestin expression is induced by FGF-2 via de novo RNA and protein synthesis. •The FGFR inhibitor SU5402 blocks the FGF-2-induced nestin expression. •The mRNA of FGFR1 and 3 are detected in C6 glioma cells. •Ras–Raf–ERK–Sp1 signaling pathway is responsibe for FGF-2-induced nestin expression. -- Abstract: Nestin is a 240-kDa intermediate filament protein expressed mainly in neural and myogenic stem cells. Although a substantial number of studies have focused on the expression of nestin during development of the central nervous system, little is known about the factors that induce and regulate its expression. Fibroblast growth factor-2 (FGF-2) is an effective mitogen and stimulates the proliferation and differentiation of a subset of nestin-expressing cells, including neural progenitor cells, glial precursor cells, and smooth muscle cells. To assess whether FGF-2 is a potent factor that induces the expression of nestin, C6 glioma cells were used. The results showed that nestin expression was up-regulated by FGF-2 via de novo RNA and protein synthesis. Our RT-PCR results showed that C6 glioma cells express FGFR1/3, and FGFRs is required for FGF-2-induced nestin expression. Further signaling analysis also revealed that FGF-2-induced nestin expression is mediated through FGFR–MAPK–ERK signaling axis and the transcriptional factor Sp1. These findings provide new insight into the regulation of nestin in glial system and enable the further studies on the function of nestin in glial cells.

  12. Functional activity of the porcine Gnrhr2 gene promoter in testis-derived cells is partially conferred by nuclear factor-κB, specificity protein 1 and 3 (SP1/3) and overlapping early growth response 1/SP1/3 binding sites.

    PubMed

    Brauer, Vanessa M; Wiarda-Bell, Jocelyn R; Desaulniers, Amy T; Cederberg, Rebecca A; White, Brett R

    2016-08-10

    Unlike the classical gonadotropin-releasing hormone (GnRH1), the second mammalian isoform (GnRH2) is ubiquitously expressed, suggesting a divergent function. Indeed, we demonstrated that GnRH2 governs LH-independent testosterone secretion in porcine testes via interaction with its receptor (GnRHR2) on Leydig cells. Transient transfections with luciferase reporter vectors containing 3009bp of 5' flanking sequence for the porcine Gnrhr2 gene (-3009pGL3) revealed promoter activity in all 15 cell lines examined, including swine testis-derived (ST) cells. Therefore, ST cells were utilized to explore the molecular mechanisms underlying transcriptional regulation of the porcine Gnrhr2 gene in the testis. Reporter plasmids containing progressive 5' deletions of the Gnrhr2 promoter indicated that the -708/-490 region contained elements critical to promoter activity. Electrophoretic mobility shift assays (EMSAs) with radiolabeled oligonucleotides spanning the -708/-490bp region and ST nuclear extracts, identified specific binding complexes for the -513/-490, -591/-571 and -606/-581bp segments of promoter. Antibody addition to EMSAs indicated that the p65 and p52 subunits of nuclear factor-κB (NF-κB) comprised the specific complex bound to the oligonucleotide probe for the -513/-490bp promoter region, specificity protein (SP) 1 and 3 bound the -591/-571bp probe and early growth response 1 (EGR1), SP1 and SP3 bound the -606/-581 radiolabeled oligonucleotide. Transient transfections with vectors containing mutations of the NF-κB (-499/-493), SP1/3 (-582/-575) or overlapping EGR1/SP1/3 (-597/-587) binding sites reduced luciferase activity by 26%, 61% and 56%, respectively (P<0.05). Thus, NF-κB, SP1/3 and overlapping EGR1/SP1/3 binding sites are critical to expression of the porcine Gnrhr2 gene in ST cells. PMID:27134031

  13. EPAS-1 Mediates SP-1-Dependent FBI-1 Expression and Regulates Tumor Cell Survival and Proliferation

    PubMed Central

    Wang, Xiaogang; Cao, Peng; Li, Zhiqing; Wu, Dongyang; Wang, Xi; Liang, Guobiao

    2014-01-01

    Factor binding IST-1 (FBI-1) plays an important role in oncogenic transformation and tumorigenesis. As FBI-1 is over-expressed in multiple human cancers, the regulation of itself would provide new effective options for cancer intervention. In this work, we aimed to study the role that EPAS-1 plays in regulating FBI-1. We use the fact that specificity protein-1 (SP-1) is one of the crucial transcription factors of FBI-1, and that SP-1 can interact with the endothelial pas domain protein-1 (EPAS-1) for the induction of hypoxia related genes. The study showed that EPAS-1 plays an indispensible role in SP-1 transcription factor-mediated FBI-1 induction, and participated in tumor cell survival and proliferation. Thus, EPAS-1 could be a novel target for cancer therapeutics. PMID:25192290

  14. EPAS-1 mediates SP-1-dependent FBI-1 expression and regulates tumor cell survival and proliferation.

    PubMed

    Wang, Xiaogang; Cao, Peng; Li, Zhiqing; Wu, Dongyang; Wang, Xi; Liang, Guobiao

    2014-01-01

    Factor binding IST-1 (FBI-1) plays an important role in oncogenic transformation and tumorigenesis. As FBI-1 is over-expressed in multiple human cancers, the regulation of itself would provide new effective options for cancer intervention. In this work, we aimed to study the role that EPAS-1 plays in regulating FBI-1. We use the fact that specificity protein-1 (SP-1) is one of the crucial transcription factors of FBI-1, and that SP-1 can interact with the endothelial pas domain protein-1 (EPAS-1) for the induction of hypoxia related genes. The study showed that EPAS-1 plays an indispensible role in SP-1 transcription factor-mediated FBI-1 induction, and participated in tumor cell survival and proliferation. Thus, EPAS-1 could be a novel target for cancer therapeutics. PMID:25192290

  15. A functional polymorphism in the Eta-1 promoter is associated with allele specific binding to the transcription factor Sp1 and elevated gene expression.

    PubMed

    Hummelshoj, Tina; Ryder, Lars P; Madsen, Hans O; Odum, Niels; Svejgaard, Arne

    2006-03-01

    Early T lymphocyte activator 1 (Eta-1), also known as Osteopontin, is a cytokine produced by macrophages and T lymphocytes. It is involved in the regulation of IL-12 and IL-10 expression in macrophages and stimulates the polarization of T cells to the Th1 subset. Three promoter polymorphisms of the human Eta-1 gene, -443T/C, -156delG/G, -66T/G, were investigated for possible influence on gene expression. Electrophoretic mobility shift assays (EMSA) with nuclear extract from the human myeloid leukaemia premonocyte cell line, THP-1, revealed sequence specific binding of the transcription factor Sp1 to the -66T allele but not the -66G allele, and haplotype -443C/-156G/-66T showed a marked increase in promoter activity of a luciferase reporter gene. Thus, a substitution of the T-base with G at position -66 in the Eta-1 promoter modulates the promoter activity of the Eta-1 gene, which might influence the Th1 versus Th2 balance. These observations are discussed in relation to a recently reported related observation on the same gene, and it is argued that discrepancies between reporter gene assays in the two studies may be due to the use of different cell lines and may reflect requirements for different transcription factors in cells involved in immune responses compared with other cells. PMID:16009426

  16. Co-operation of the transcription factor hepatocyte nuclear factor-4 with Sp1 or Sp3 leads to transcriptional activation of the human haem oxygenase-1 gene promoter in a hepatoma cell line.

    PubMed Central

    Takahashi, Shigeru; Matsuura, Naomi; Kurokawa, Takako; Takahashi, Yuji; Miura, Takashi

    2002-01-01

    We reported previously that the 5'-flanking region (nucleotides -1976 to -1655) of the human haem oxygenase-1 ( hHO-1 ) gene enhances hHO-1 promoter activity in human hepatoma HepG2 cells, but not in HeLa cells [Takahashi, Takahashi, Ito, Nagano, Shibahara and Miura (1999) Biochim. Biophys. Acta 1447, 231-235]. To define more precisely the regulatory elements involved, in the present study we have functionally dissected this region and localized the enhancer to a 50 bp fragment (-1793 to -1744). Site-direct mutagenesis analysis revealed that two regions were responsible for this enhancer activity, i.e. a hepatocyte nuclear factor-4 (HNF-4) homologous region and a GC box motif homologous region. Mutation in either region alone moderately decreased enhancer activity. However, mutations in both regions reduced promoter activity to the basal level. Electrophoretic mobility-shift assays demonstrated that the P5-2 fragment (-1793 to -1744) interacted with at least two nuclear factors, i.e. HNF-4 and Sp1/Sp3. Co-transfection experiments using Drosophila SL2 cells revealed that HNF-4 and Sp1/Sp3 synergistically stimulated the enhancer activity of the P5-2 fragment. These results indicate that co-operation of HNF-4 with Sp1 or Sp3 leads to the activation of hHO-1 gene expression in hepatoma cells. PMID:12133007

  17. Co-operation of the transcription factor hepatocyte nuclear factor-4 with Sp1 or Sp3 leads to transcriptional activation of the human haem oxygenase-1 gene promoter in a hepatoma cell line.

    PubMed

    Takahashi, Shigeru; Matsuura, Naomi; Kurokawa, Takako; Takahashi, Yuji; Miura, Takashi

    2002-11-01

    We reported previously that the 5'-flanking region (nucleotides -1976 to -1655) of the human haem oxygenase-1 ( hHO-1 ) gene enhances hHO-1 promoter activity in human hepatoma HepG2 cells, but not in HeLa cells [Takahashi, Takahashi, Ito, Nagano, Shibahara and Miura (1999) Biochim. Biophys. Acta 1447, 231-235]. To define more precisely the regulatory elements involved, in the present study we have functionally dissected this region and localized the enhancer to a 50 bp fragment (-1793 to -1744). Site-direct mutagenesis analysis revealed that two regions were responsible for this enhancer activity, i.e. a hepatocyte nuclear factor-4 (HNF-4) homologous region and a GC box motif homologous region. Mutation in either region alone moderately decreased enhancer activity. However, mutations in both regions reduced promoter activity to the basal level. Electrophoretic mobility-shift assays demonstrated that the P5-2 fragment (-1793 to -1744) interacted with at least two nuclear factors, i.e. HNF-4 and Sp1/Sp3. Co-transfection experiments using Drosophila SL2 cells revealed that HNF-4 and Sp1/Sp3 synergistically stimulated the enhancer activity of the P5-2 fragment. These results indicate that co-operation of HNF-4 with Sp1 or Sp3 leads to the activation of hHO-1 gene expression in hepatoma cells. PMID:12133007

  18. Predictive factors of excessive online poker playing.

    PubMed

    Hopley, Anthony A B; Nicki, Richard M

    2010-08-01

    Despite the widespread rise of online poker playing, there is a paucity of research examining potential predictors for excessive poker playing. The aim of this study was to build on recent research examining motives for Texas Hold'em play in students by determining whether predictors of other kinds of excessive gambling apply to Texas Hold'em. Impulsivity, negative mood states, dissociation, and boredom proneness have been linked to general problem gambling and may play a role in online poker. Participants of this study were self-selected online poker players (N = 179) who completed an online survey. Results revealed that participants played an average of 20 hours of online poker a week and approximately 9% of the sample was classified as a problem gambler according to the Canadian Problem Gambling Index. Problem gambling, in this sample, was uniquely predicted by time played, dissociation, boredom proneness, impulsivity, and negative affective states, namely depression, anxiety, and stress. PMID:20712496

  19. Characterization of the human granulocyte-macrophage colony-stimulating factor gene promoter: an AP1 complex and an Sp1-related complex transactivate the promoter activity that is suppressed by a YY1 complex.

    PubMed Central

    Ye, J; Zhang, X; Dong, Z

    1996-01-01

    It is well documented that a repeated CATT element in the human granulocyte-macrophage colony-stimulating factor (GM-CSF) gene promoter is required for promoter activity. However, the transcription factors that are able to transactivate this enhancer element remain unidentified. Recently, we have found that nuclear factor YY1 can interact with the enhancer element. Here, we report that in addition to YY1, two other nuclear factors have been identified in the DNA-protein complexes formed by the CATT oligonucleotide and the Jurkat T-cell nuclear protein. One of these factors is AP1, and the other one is an Sp1-related protein. Results from transient transfection of Jurkat T cells have revealed that formation of both AP1 and the Sp1-related complex is required for the full enhancer activity of the CATT element. This result is supported by cotransfection of a c-jun expression vector and mutational analysis of the AP1 site or the Sp1-related protein binding site. In contrast, formation of the YY1 complex suppresses enhancer activity, since deletion of the YY1 complex induces an augmentation of the enhancer activity and overexpression of YY1 results in an attenuation of the enhancer activity. Results from the mechanism study have revealed that YY1 is able to inhibit transactivation mediated by either AP1 or the Sp1-related protein, and YY1 suppressive activity is DNA binding dependent. Taken together, these data support the ideas that AP1 and the Sp1-related nuclear protein are required for transactivation of the human GM-CSF gene promoter and that YY1 can suppress transactivation of the promoter even under inducible conditions. PMID:8524292

  20. O-Linked N-acetylglucosaminylation of Sp1 interferes with Sp1 activation of glycolytic genes.

    PubMed

    Lim, Kihong; Yoon, Bo Hyun; Ha, Chang Hoon

    Glycolysis, the primary pathway metabolizing glucose for energy production, is connected to the hexosamine biosynthetic pathway (HBP) which produces UDP-N-acetylglucosamine (UDP-GlcNAc), a GlcNAc donor for O-linked GlcNAc modification (O-GlcNAc), as well as for traditional elongated glycosylation. Thus, glycolysis and O-GlcNAc are intimately associated. The present study reports the transcriptional activation of glycolytic genes by the transcription factor Sp1 and the O-GlcNAc-mediated suppression of Sp1-dependent activation of glycolytic genes. O-GlcNAc-deficient mutant Sp1 stimulated the transcription of nine glycolytic genes and cellular production of pyruvate, the final product of glycolysis, to a greater extent than wild-type Sp1. Consistently, this mutant Sp1 increased the protein levels of the two key glycolytic enzymes, phosphofructokinase (PFK) and glyceraldehyde 3-phosphate dehydrogenase (GAPDH), to a greater extent than wild-type Sp1. Finally, the mutant Sp1 occupied GC-rich elements on PFK and GAPDH promoters more efficiently than wild-type Sp1. These results suggest that O-GlcNAcylation of Sp1 suppresses Sp1-mediated activation of glycolytic gene transcription. PMID:26499076

  1. LPS induces IL-10 production by human alveolar macrophages via MAPKinases- and Sp1-dependent mechanisms

    PubMed Central

    Chanteux, Hugues; Guisset, Amélie C; Pilette, Charles; Sibille, Yves

    2007-01-01

    Background IL-10 is a cytokine mainly produced by macrophages that plays key roles in tolerance to inhaled antigens and in lung homeostasis. Its regulation in alveolar macrophages (HAM), the resident lung phagocytes, remains however unknown. Methods The present study investigated the role of intracellular signalling and transcription factors controlling the production of IL-10 in LPS-activated HAM from normal nonsmoking volunteers. Results LPS (1–1000 pg/ml) induced in vitro IL-10 production by HAM, both at mRNA and protein levels. LPS also activated the phosphorylation of ERK, p38 and JNK MAPkinases (immunoblots) and Sp-1 nuclear activity (EMSA). Selective inhibitors of MAPKinases (respectively PD98059, SB203580 and SP600125) and of Sp-1 signaling (mithramycin) decreased IL-10 expression in HAM. In addition, whilst not affecting IL-10 mRNA degradation, the three MAPKinase inhibitors completely abolished Sp-1 activation by LPS in HAM. Conclusion These results demonstrate for the first time that expression of IL-10 in lung macrophages stimulated by LPS depends on the concomitant activation of ERK, p38 and JNK MAPKinases, which control downstream signalling to Sp-1 transcription factor. This study further points to Sp-1 as a key signalling pathway for IL-10 expression in the lung. PMID:17916230

  2. E6 and E7 oncoproteins from human papillomavirus type 16 induce activation of human transforming growth factor beta1 promoter throughout Sp1 recognition sequence.

    PubMed

    Peralta-Zaragoza, Oscar; Bermúdez-Morales, Víctor; Gutiérrez-Xicotencatl, Lourdes; Alcocer-González, Juan; Recillas-Targa, Félix; Madrid-Marina, Vicente

    2006-01-01

    Human Papillomavirus (HPV) infection is the main etiologic agent of cervical cancer and HPV E6 and E7 oncogenes trans-regulate many cellular genes. An association between TGF-beta1 gene expression and cervical cancer development has been suggested; however, the mechanisms by which HPV influences TGF-beta1 expression remain unclear. In the present study we analyzed the mechanism through which HPV-16 E6 and E7 oncoproteins regulate the TGF-beta1 promoter in cervical tumor cells. Our results showed that E6 and E7 increased TGF-beta1 promoter activity. Furthermore, we identified a specific DNA sequence motif in the TGF-beta1 core promoter that is responsible for trans-activation and that corresponds to the Sp1e-binding site associated with HPV-16 E6 and E7 oncoproteins. Mutational analysis showed that the Sp1e recognition site abolished the trans-activation caused by E6 and E7. These results suggest a physical interaction and functional cooperation between viral oncoproteins and cellular regulatory elements of the TGF-beta1 promoter, and may explain the contribution of HPV-16 to TGF-beta1 gene expression in cervical cancer. PMID:16987065

  3. Sp1 trans-activates the murine H(+)-K(+)-ATPase alpha(2)-subunit gene.

    PubMed

    Yu, Zhiyuan; Li, Mei; Zhang, Dongyu; Xu, William; Kone, Bruce C

    2009-07-01

    The H(+)-K(+)-ATPase alpha(2) (HKalpha2) gene of the renal collecting duct and distal colon plays a central role in potassium and acid-base homeostasis, yet its transcriptional control remains poorly characterized. We previously demonstrated that the proximal 177 bp of its 5'-flanking region confers basal transcriptional activity in murine inner medullary collecting duct (mIMCD3) cells and that NF-kappaB and CREB-1 bind this region to alter transcription. In the present study, we sought to determine whether the -144/-135 Sp element influences basal HKalpha2 gene transcription in these cells. Electrophoretic mobility shift and supershift assays using probes for -154/-127 revealed Sp1-containing DNA-protein complexes in nuclear extracts of mIMCD3 cells. Chromatin immunoprecipitation (ChIP) assays demonstrated that Sp1, but not Sp3, binds to this promoter region of the HKalpha2 gene in mIMCD3 cells in vivo. HKalpha2 minimal promoter-luciferase constructs with point mutations in the -144/-135 Sp element exhibited much lower activity than the wild-type promoter in transient transfection assays. Overexpression of Sp1, but not Sp3, trans-activated an HKalpha2 proximal promoter-luciferase construct in mIMCD3 cells as well as in SL2 insect cells, which lack Sp factors. Conversely, small interfering RNA knockdown of Sp1 inhibited endogenous HKalpha2 mRNA expression, and binding of Sp1 to chromatin associated with the proximal HKalpha2 promoter without altering the binding or regulatory influence of NF-kappaB p65 or CREB-1 on the proximal HKalpha2 promoter. We conclude that Sp1 plays an important and positive role in controlling basal HKalpha2 gene expression in mIMCD3 cells in vivo and in vitro. PMID:19420113

  4. The Sp(1)-Kepler problems

    SciTech Connect

    Meng Guowu

    2009-07-15

    Let n{>=}2 be a positive integer. To each irreducible representation {sigma} of Sp(1), an Sp(1)-Kepler problem in dimension (4n-3) is constructed and analyzed. This system is superintegrable, and when n=2 it is equivalent to a generalized MICZ-Kepler problem in dimension of 5. The dynamical symmetry group of this system is O-tilde*(4n) with the Hilbert space of bound states H({sigma}) being the unitary highest weight representation of O*-tilde(4n) with highest weight, (-1,{center_dot}{center_dot}{center_dot},-1,-(1+{sigma})), which occurs at the rightmost nontrivial reduction point in the Enright-Howe-Wallach classification diagram for the unitary highest weight modules. Here {sigma} is the highest weight of {sigma}. Furthermore, it is shown that the correspondence {sigma}{r_reversible}H({sigma}) is the theta-correspondence for dual pair (Sp(1),O*(4n))subset Sp(8n,R)

  5. Play.

    ERIC Educational Resources Information Center

    Rogers, Fred; Sharapan, Hedda

    1993-01-01

    Contends that, in childhood, work and play seem to come together. Says that for young children their play is their work, and the more adults encourage children to play, the more they emphasize important lifelong resource. Examines some uses of children's play, making and building, artwork, dramatic play, monsters and superheroes, gun play, and…

  6. Low-density lipoprotein upregulate SR-BI through Sp1 Ser702 phosphorylation in hepatic cells.

    PubMed

    Yang, Fan; Du, Yu; Zhang, Jin; Jiang, Zhibo; Wang, Li; Hong, Bin

    2016-09-01

    Scavenger receptor class B type I (SR-BI) is one of the key proteins in the process of reverse cholesterol transport (RCT), and its major function is to uptake high density lipoprotein (HDL) cholesterol from plasma into liver cells. The regulation of SR-BI expression is important for controlling serum lipid content and reducing the risks of cardiovascular diseases. Here we found that SR-BI expression was significantly increased by LDL in vivo and in vitro, and the transcription factor specific protein 1 (Sp1) plays a critical role in this process. Results from co-immunoprecipitation experiments indicate that the activation of SR-BI was associated with Sp1-recruited protein complexes in the promoter region of SR-BI, where histone acetyltransferase p300 was recruited and histone deacetylase HDAC1 was dismissed. As a result, histone acetylation increased, leading to activation of SR-BI transcription. With further investigation, we found that LDL phosphorylated Sp1 through ERK1/2 pathway, which affected Sp1 protein complexes formation in SR-BI promoter. Using mass spectrometry and site directed mutagenesis, a new Sp1 phosphorylation site Ser702 was defined to be associated with Sp1-HDAC1 interaction and may be important in SR-BI activation, shedding light on the knowledge of delicate mechanism of hepatic HDL receptor SR-BI gene modulation by LDL. PMID:27320013

  7. Essential role of an activator protein-2 (AP-2)/specificity protein 1 (Sp1) cluster in the UVB-mediated induction of the human vascular endothelial growth factor in HaCaT keratinocytes.

    PubMed Central

    Brenneisen, Peter; Blaudschun, Ralf; Gille, Jens; Schneider, Lars; Hinrichs, Ralf; Wlaschek, Meinhard; Eming, Sabine; Scharffetter-Kochanek, Karin

    2003-01-01

    Chronic sun exposure of the skin has long been postulated to enhance cutaneous angiogenesis, resulting in highly vascularized skin cancers. As the UVB component of sunlight is a major contributor to photocarcinogenesis, we aimed to explore the effects of UVB radiation on vascular endothelial growth factor (VEGF) gene expression, using the immortalized keratinocyte cell line HaCaT as a model for transformed premalignant epithelial cells. In the present paper, we studied the molecular mechanism of UVB-induced VEGF providing a major angiogenic activity in tumour progression and invasion. After 12-24 h of UVB irradiation, a 2.4- to 2.7-fold increase in endogenous VEGF protein level was measured, correlating with an up to 2.5-fold induction of promoter-based reporter gene constructs of VEGF. Furthermore, we identified a GC-rich UVB-responsive region between -87 and -65 bp of the VEGF promoter. In electrophoretic mobility-shift assays, this region binds Sp1-dependent protein complexes constitutively and an additional UVB-inducible protein complex distinct from Sp1 protein. The transcription factor AP-2 (activator protein-2) was detected as a component of the UVB-inducible protein complex. The critical role of the AP-2/Sp1 (specificity protein 1) cluster was supported by demonstration of a significant reduction of UVB-mediated promoter activity upon deletion of this recognition site. The specificity of this region for UVB irradiation was demonstrated using PMA, which increased VEGF activity in HaCaT cells after transient transfection of the deleted promoter construct. In conclusion, our data clarified regulatory mechanisms of UVB-dependent VEGF stimulation which may be critical for angiogenic processes in the skin. PMID:12358602

  8. Nucleolin enhances internal ribosomal entry site (IRES)-mediated translation of Sp1 in tumorigenesis.

    PubMed

    Hung, Chia-Yang; Yang, Wen-Bin; Wang, Shao-An; Hsu, Tsung-I; Chang, Wen-Chang; Hung, Jan-Jong

    2014-12-01

    Our previous study indicated that specificity protein-1 (Sp1) is accumulated during hypoxia in an internal ribosomal entry site (IRES)-dependent manner. Herein, we found that the Sp1 was induced strongly at the protein level, but not in the mRNA level, in lung tumor tissue, indicating that translational regulation might contribute to the Sp1 accumulation during tumorigenesis. A further study showed that the translation of Sp1 was dramatically induced through an IRES-dependent pathway. RNA immunoprecipitation analysis of proteins bound to the 5'-untranslated region (5'-UTR) of Sp1 identified interacting protein - nucleolin. Knockdown of nucleolin significantly inhibited IRES-mediated translation of Sp1, suggesting that nucleolin positively facilitates Sp1 IRES activation. Further analysis of the interaction between nucleolin and the 5'-UTR of Sp1 mRNA revealed that the GAR domain was important for IRES-mediated translation of Sp1. Moreover, gefitinib, and LY294002 and MK2206 compounds inhibited IRES-mediated Sp1 translation, implying that activation of the epithelial growth factor receptor (EGFR) pathway via Akt activation triggers the IRES pathway. In conclusion, EGFR activation-mediated nucleolin phosphorylated at Thr641 and Thr707 was recruited to the 5'-UTR of Sp1 as an IRES trans-acting factor to modulate Sp1 translation during lung cancer formation. PMID:25173817

  9. Transcription of the catalytic 180-kDa subunit gene of mouse DNA polymerase alpha is controlled by E2F, an Ets-related transcription factor, and Sp1.

    PubMed

    Izumi, M; Yokoi, M; Nishikawa, N S; Miyazawa, H; Sugino, A; Yamagishi, M; Yamaguchi, M; Matsukage, A; Yatagai, F; Hanaoka, F

    2000-07-24

    We have isolated a genomic DNA fragment spanning the 5'-end of the gene encoding the catalytic subunit of mouse DNA polymerase alpha. The nucleotide sequence of the upstream region was G/C-rich and lacked a TATA box. Transient expression assays in cycling NIH 3T3 cells demonstrated that the GC box of 20 bp (at nucleotides -112/-93 with respect to the transcription initiation site) and the palindromic sequence of 14 bp (at nucleotides -71/-58) were essential for basal promoter activity. Electrophoretic mobility shift assays showed that Sp1 binds to the GC box. We also purified a protein capable of binding to the palindrome and identified it as GA-binding protein (GABP), an Ets- and Notch-related transcription factor. Transient expression assays in synchronized NIH 3T3 cells revealed that three variant E2F sites near the transcription initiation site (at nucleotides -23/-16, -1/+7 and +17/+29) had no basal promoter activity by themselves, but were essential for growth-dependent stimulation of the gene expression. These data indicate that E2F, GABP and Sp1 regulate the gene expression of this principal replication enzyme. PMID:11004506

  10. Play

    NASA Astrophysics Data System (ADS)

    Harteveld, Casper

    Designing a game with a serious purpose involves considering the worlds of Reality and Meaning yet it is undeniably impossible to create a game without a third world, one that is specifically concerned with what makes a game a game: the play elements. This third world, the world of people like designers and artists, and disciplines as computer science and game design, I call the world of Play and this level is devoted to it. The level starts off with some of the misperceptions people have of play. Unlike some may think, we play all the time, even when we grow old—this was also very noticeable in designing the game Levee Patroller as the team exhibited very playful behavior at many occasions. From there, I go into the aspects that characterize this world. The first concerns the goal of the game. This relates to the objectives people have to achieve within the game. This is constituted by the second aspect: the gameplay. Taking actions and facing challenges is subsequently constituted by a gameworld, which concerns the third aspect. And all of it is not possible without the fourth and final aspect, the type of technology that creates and facilitates the game. The four aspects together make up a “game concept” and from this world such a concept can be judged on the basis of three closely interrelated criteria: engagement, immersion, and fun.

  11. Sumoylation differentially regulates Sp1 to control cell differentiation

    PubMed Central

    Gong, Lili; Ji, Wei-Ke; Hu, Xiao-Hui; Hu, Wen-Feng; Tang, Xiang-Cheng; Huang, Zhao-Xia; Li, Ling; Liu, Mugen; Xiang, Shi-Hua; Wu, Erxi; Woodward, Zachary; Liu, Yi-Zhi; Nguyen, Quan Dong; Li, David Wan-Cheng

    2014-01-01

    The mammalian small ubiquitin-like modifiers (SUMOs) are actively involved in regulating differentiation of different cell types. However, the functional differences between SUMO isoforms and their mechanisms of action remain largely unknown. Using the ocular lens as a model system, we demonstrate that different SUMOs display distinct functions in regulating differentiation of epithelial cells into fiber cells. During lens differentiation, SUMO1 and SUMO2/3 displayed different expression, localization, and targets, suggesting differential functions. Indeed, overexpression of SUMO2/3, but not SUMO1, inhibited basic (b) FGF-induced cell differentiation. In contrast, knockdown of SUMO1, but not SUMO2/3, also inhibited bFGF action. Mechanistically, specificity protein 1 (Sp1), a major transcription factor that controls expression of lens-specific genes such as β-crystallins, was positively regulated by SUMO1 but negatively regulated by SUMO2. SUMO2 was found to inhibit Sp1 functions through several mechanisms: sumoylating it at K683 to attenuate DNA binding, and at K16 to increase its turnover. SUMO2 also interfered with the interaction between Sp1 and the coactivator, p300, and recruited a repressor, Sp3 to β-crystallin gene promoters, to negatively regulate their expression. Thus, stable SUMO1, but diminishing SUMO2/3, during lens development is necessary for normal lens differentiation. In support of this conclusion, SUMO1 and Sp1 formed complexes during early and later stages of lens development. In contrast, an interaction between SUMO2/3 and Sp1 was detected only during the initial lens vesicle stage. Together, our results establish distinct roles of different SUMO isoforms and demonstrate for the first time, to our knowledge, that Sp1 acts as a major transcription factor target for SUMO control of cell differentiation. PMID:24706897

  12. Early experiences with the IBM SP-1

    SciTech Connect

    Gropp, W.

    1993-06-01

    The IBM SP-1 is IBM`s newest parallel distributed-memory computer. As part of a joint project with IBM, Argonne took delivery of an early system in order to evaluate the software environment and to begin porting programming packages and applications to this machine. This report discusses the results of those early efforts. Despite the newness of the machine and the lack of a fast interprocessor switch (part of the SP-1 but not yet available for the machine), every code that they attempted to port ran on the SP-1 with little or no modification. The report concludes with a discussion of expectations for the fast interconnect.

  13. Curcumin Suppresses Metastasis via Sp-1, FAK Inhibition, and E-Cadherin Upregulation in Colorectal Cancer

    PubMed Central

    Chen, Chun-Chieh; Sureshbabul, Munisamy; Chen, Huei-Wen; Lin, Yu-Shuang; Lee, Jen-Yi; Hong, Qi-Sheng; Yang, Ya-Chien

    2013-01-01

    Colorectal cancer (CRC) is a serious public health problem that results due to changes of diet and various environmental stress factors in the world. Curcumin is a traditional medicine used for treatment of a wide variety of tumors. However, antimetastasis mechanism of curcumin on CRC has not yet been completely investigated. Here, we explored the underlying molecular mechanisms of curcumin on metastasis of CRC cells in vitro and in vivo. Curcumin significantly inhibits cell migration, invasion, and colony formation in vitro and reduces tumor growth and liver metastasis in vivo. We found that curcumin suppresses Sp-1 transcriptional activity and Sp-1 regulated genes including ADEM10, calmodulin, EPHB2, HDAC4, and SEPP1 in CRC cells. Curcumin inhibits focal adhesion kinase (FAK) phosphorylation and enhances the expressions of several extracellular matrix components which play a critical role in invasion and metastasis. Curcumin reduces CD24 expression in a dose-dependent manner in CRC cells. Moreover, E-cadherin expression is upregulated by curcumin and serves as an inhibitor of EMT. These results suggest that curcumin executes its antimetastasis function through downregulation of Sp-1, FAK, and CD24 and by promoting E-cadherin expression in CRC cells. PMID:23970932

  14. Curcumin Suppresses Metastasis via Sp-1, FAK Inhibition, and E-Cadherin Upregulation in Colorectal Cancer.

    PubMed

    Chen, Chun-Chieh; Sureshbabul, Munisamy; Chen, Huei-Wen; Lin, Yu-Shuang; Lee, Jen-Yi; Hong, Qi-Sheng; Yang, Ya-Chien; Yu, Sung-Liang

    2013-01-01

    Colorectal cancer (CRC) is a serious public health problem that results due to changes of diet and various environmental stress factors in the world. Curcumin is a traditional medicine used for treatment of a wide variety of tumors. However, antimetastasis mechanism of curcumin on CRC has not yet been completely investigated. Here, we explored the underlying molecular mechanisms of curcumin on metastasis of CRC cells in vitro and in vivo. Curcumin significantly inhibits cell migration, invasion, and colony formation in vitro and reduces tumor growth and liver metastasis in vivo. We found that curcumin suppresses Sp-1 transcriptional activity and Sp-1 regulated genes including ADEM10, calmodulin, EPHB2, HDAC4, and SEPP1 in CRC cells. Curcumin inhibits focal adhesion kinase (FAK) phosphorylation and enhances the expressions of several extracellular matrix components which play a critical role in invasion and metastasis. Curcumin reduces CD24 expression in a dose-dependent manner in CRC cells. Moreover, E-cadherin expression is upregulated by curcumin and serves as an inhibitor of EMT. These results suggest that curcumin executes its antimetastasis function through downregulation of Sp-1, FAK, and CD24 and by promoting E-cadherin expression in CRC cells. PMID:23970932

  15. miRNA-223 inhibits epithelial-mesenchymal transition in gastric carcinoma cells via Sp1.

    PubMed

    Hu, Jing; Shan, Zhiyan; Hu, Kewei; Ren, Fengyun; Zhang, Wei; Han, Meiling; Li, Yuezhen; Feng, Kejian; Lei, Lei; Feng, Yukuan

    2016-07-01

    Sp1 plays critical roles in epithelial-mesenchymal transition (EMT) of certain cancer. However, few studies have indicated whether Sp1 is involved in the EMT of gastric cancer, and whether abnormal expression of Sp1 in gastric cancer EMT is regulated in a post-transcriptional manner, and the involvement of miRNAs in this regulation. In this study, we selected 20 cases of gastric cancers, their liver metastases and para-carcinoma tissues to examine the levels of Sp1 protein and mRNA by immunohistochemistry and fluorescent PCR, which showed that Sp1 was increased in gastric cancers and their metastases compared with adjacent tissues, but there was no difference in Sp1 mRNA between these three groups, suggesting changes in Sp1 may be attributed to inactivation of post-transcriptional regulation. We verified by a luciferase reporter system that miRNA-223 binds to 3'-UTR of Sp1 gene and inhibits its translation, in agreement with negative correlation between miRNA-223 and Sp1 protein levels in gastric cancer cells. By employing TGF-β1 to induce MGC-803, BGC-823 and SGC-7901, we successfully built cellular EMT model. Then, we overexpressed miRNA-223 in the model by using a lentiviral system, which diminished EMT indicators and suppressed proliferation and invasion ability, and induced apoptosis. Finally, we verified the specificity of the regulation pathway miRNA-223/Sp1/EMT. These findings suggest that low expression of miRNA-223 in gastric cancer cells is an important cause for EMT. miRNA-223 specifically regulates the EMT process of gastric cancer cells through its target gene Sp1. Overexpression of miRNA-223 in these cells inhibits EMT via the miRNA-223/Sp1/EMT pathway. PMID:27212195

  16. Sp1/3 and NF-1 mediate basal transcription of the human P2X1 gene in megakaryoblastic MEG-01 cells

    PubMed Central

    Zhao, Jiangqin; Ennion, Steven J

    2006-01-01

    Background P2X1 receptors play an important role in platelet function as they can induce shape change, granule centralization and are also involved in thrombus formation. As platelets have no nuclei, the level of P2X1 expression depends on transcriptional regulation in megakaryocytes, the platelet precursor cell. Since nothing is known about the molecular mechanisms regulating megakaryocytic P2X1 expression, this study aimed to identify and functionally characterize the P2X1 core promoter utilized in the human megakaryoblastic cell line MEG-01. Results In order to identify cis-acting elements involved in the transcriptional regulation of P2X1 expression, the ability of 4.7 kb P2X1 upstream sequence to drive luciferase reporter gene expression was tested. Low promoter activity was detected in proliferating MEG-01 cells. This activity increased 20-fold after phorbol-12-myristate-13-acetate (PMA) induced differentiation. A transcription start site was detected 365 bp upstream of the start codon by primer extension. Deletion analysis of reporter constructs indicated a core promoter located within the region -68 to +149 bp that contained two Sp1 sites (named Sp1a and Sp1b) and an NF-1 site. Individual mutations of Sp1b or NF-1 binding sites severely reduced promoter activity whereas triple mutation of Sp1a, Sp1b and NF-1 sites completely abolished promoter activity in both untreated and PMA treated cells. Sp1/3 and NF-1 proteins were shown to bind their respective sites by EMSA and interaction of Sp1/3, NF-1 and TFIIB with the endogenous P2X1 core promoter in MEG-01 cells was demonstrated by chromatin immunoprecipitation. Alignment of P2X1 genes from human, chimp, rat, mouse and dog revealed consensus Sp1a, Sp1b and NF-1 binding sites in equivalent positions thereby demonstrating evolutionary conservation of these functionally important sites. Conclusion This study has identified and characterized the P2X1 promoter utilized in MEG-01 cells and shown that binding of Sp1

  17. Curcumin decreases the expression of Pokemon by suppressing the binding activity of the Sp1 protein in human lung cancer cells.

    PubMed

    Cui, Jiajun; Meng, Xianfeng; Gao, Xudong; Tan, Guangxuan

    2010-03-01

    Pokemon, which stands for POK erythroid myeloid ontogenic factor, can regulate expression of many genes and plays an important role in tumorigenesis. Curcumin, a natural and non-toxic yellow compound, has capacity for antioxidant, free radical scavenger, anti-inflammatory properties. Recent studies shows it is a potential inhibitor of cell proliferation in a variety of tumour cells. To investigate whether curcumin can regulate the expression of Pokemon, a series of experiments were carried out. Transient transfection experiments demonstrated that curcumin could decrease the activity of the Pokemon promoter. Western blot analysis suggested that curcumin could significantly decrease the expression of the Pokemon. Overexpression of Sp1 could enhance the activity of the Pokemon promoter, whereas knockdown of Sp1 could decrease its activity. More important, we also found that curcumin could decrease the expression of the Pokemon by suppressing the stimulation of the Sp1 protein. Therefore, curcumin is a potential reagent for tumour therapy which may target Pokemon. PMID:19444642

  18. The Play Factor: Effect of Social Skills Group Play Therapy on Adolescent African-American Males

    ERIC Educational Resources Information Center

    Earls, Melissa K.

    2009-01-01

    The purpose of this study was to examine the effectiveness of Social Skills Group Play Therapy on remedying the social skills deficits of adolescent African-American males. Additionally, the study investigated whether age and grade level impacted the outcome of the intervention. The participants were adolescent African-American males ages 10 to…

  19. MiR-22/Sp-1 Links Estrogens With the Up-Regulation of Cystathionine γ-Lyase in Myocardium, Which Contributes to Estrogenic Cardioprotection Against Oxidative Stress.

    PubMed

    Wang, Long; Tang, Zhi-Ping; Zhao, Wei; Cong, Bing-Hai; Lu, Jian-Qiang; Tang, Xiao-Lu; Li, Xiao-Han; Zhu, Xiao-Yan; Ni, Xin

    2015-06-01

    Hydrogen sulfide, generated in the myocardium predominantly via cystathionine-γ-lyase (CSE), is cardioprotective. Our previous study has shown that estrogens enhance CSE expression in myocardium of female rats. The present study aims to explore the mechanisms by which estrogens regulate CSE expression, in particular to clarify the role of estrogen receptor subtypes and the transcriptional factor responsible for the estrogenic effects. We found that either the CSE inhibitor or the CSE small interfering RNA attenuated the protective effect of 17β-estradiol (E2) against H2O2- and hypoxia/reoxygenation-induced injury in primary cultured neonatal cardiomyocytes. E2 stimulates CSE expression via estrogen receptor (ER)-α both in cultured cardiomyocytes in vitro and in the myocardium of female mice in vivo. A specificity protein-1 (Sp-1) consensus site was identified in the rat CSE promoter and was found to mediate the E2-induced CSE expression. E2 increases ERα and Sp-1 and inhibits microRNA (miR)-22 expression in myocardium of ovariectomized rats. In primary cardiomyocytes, E2 stimulates Sp-1 expression through the ERα-mediated down-regulation of miR-22. It was confirmed that both ERα and Sp-1 were targeted by miR-22. In the myocardium of ovariectomized rats, the level of miR-22 inversely correlated to CSE, ERα, Sp-1, and antioxidant biomarkers and positively correlated to oxidative biomarkers. In summary, this study demonstrates that estrogens stimulate Sp-1 through the ERα-mediated down-regulation of miR-22 in cardiomyocytes, leading to the up-regulation of CSE, which in turn results in an increase of antioxidative defense. Interaction of ERα, miR-22, and Sp-1 may play a critical role in the control of oxidative stress status in the myocardium of female rats. PMID:25825815

  20. Sp1 Facilitates DNA Double-Strand Break Repair through a Nontranscriptional Mechanism

    PubMed Central

    Beishline, Kate; Kelly, Crystal M.; Olofsson, Beatrix A.; Koduri, Sravanthi; Emrich, Jacqueline; Greenberg, Roger A.

    2012-01-01

    Sp1 is a ubiquitously expressed transcription factor that is phosphorylated by ataxia telangiectasia mutated kinase (ATM) in response to ionizing radiation and H2O2. Here, we show by indirect immunofluorescence that Sp1 phosphorylated on serine 101 (pSp1) localizes to ionizing radiation-induced foci with phosphorylated histone variant γH2Ax and members of the MRN (Mre11, Rad50, and Nbs1) complex. More precise analysis of occupancy of DNA double-strand breaks (DSBs) by chromatin immunoprecipitation (ChIP) shows that Sp1, like Nbs1, resides within 200 bp of DSBs. Using laser microirradiation of cells, we demonstrate that pSp1 is present at DNA DSBs by 7.5 min after induction of damage and remains at the break site for at least 8 h. Depletion of Sp1 inhibits repair of site-specific DNA breaks, and the N-terminal 182-amino-acid peptide, which contains targets of ATM kinase but lacks the zinc finger DNA binding domain, is phosphorylated, localizes to DSBs, and rescues the repair defect resulting from Sp1 depletion. Together, these data demonstrate that Sp1 is rapidly recruited to the region immediately adjacent to sites of DNA DSBs and is required for DSB repair, through a mechanism independent of its sequence-directed transcriptional effects. PMID:22826432

  1. Comparative integromics on FZD7 orthologs: conserved binding sites for PU.1, SP1, CCAAT-box and TCF/LEF/SOX transcription factors within 5'-promoter region of mammalian FZD7 orthologs.

    PubMed

    Katoh, Masuko; Katoh, Masaru

    2007-03-01

    that the binding sites for PU.1, SP1/Krüppel-like, CCAAT-box, and TCF/LEF/SOX transcription factors were conserved among 5'-promoter regions of mammalian FZD7 orthologs. PMID:17273804

  2. Video Game Playing and Gambling in Adolescents: Common Risk Factors

    ERIC Educational Resources Information Center

    Wood, Richard T. A.; Gupta, Rina; Griffiths, Mark

    2004-01-01

    Video games and gambling often contain very similar elements with both providing intermittent rewards and elements of randomness. Furthermore, at a psychological and behavioral level, slot machine gambling, video lottery terminal (VLT) gambling and video game playing share many of the same features. Despite the similarities between video game…

  3. Play Therapy with Sexually Traumatized Children: Factors That Promote Healing.

    ERIC Educational Resources Information Center

    Kelly, Mary Margaret

    1995-01-01

    Proposes an alternative model of therapy for sexually abused children, and suggests envisioning the therapy process for children whose abuse therapies are particularly extreme as a series of cycles rather than progressive improvement through a number of stages. Discusses two cases to illustrate the proposed cyclic nature of play with this…

  4. Diverse Mechanisms of Sp1-Dependent Transcriptional Regulation Potentially Involved in the Adaptive Response of Cancer Cells to Oxygen-Deficient Conditions

    PubMed Central

    Koizume, Shiro; Miyagi, Yohei

    2015-01-01

    The inside of a tumor often contains a hypoxic area caused by a limited supply of molecular oxygen due to aberrant vasculature. Hypoxia-inducible factors (HIFs) are major transcription factors that are required for cancer cells to adapt to such stress conditions. HIFs, complexed with the aryl hydrocarbon receptor nuclear translocator, bind to and activate target genes as enhancers of transcription. In addition to this common mechanism, the induction of the unfolded protein response and mTOR signaling in response to endoplasmic reticulum stress is also known to be involved in the adaptation to hypoxia conditions. Sp1 is a ubiquitously-expressed transcription factor that plays a vital role in the regulation of numerous genes required for normal cell function. In addition to the well-characterized stress response mechanisms described above, increasing experimental evidence suggests that Sp1 and HIFs collaborate to drive gene expression in cancer cells in response to hypoxia, thereby regulating additional adaptive responses to cellular oxygen deficiency. However, these characteristics of Sp1 and their biological merits have not been summarized. In this review, we will discuss the diverse mechanisms of transcriptional regulation by Sp1 and their potential involvement in the adaptive response of cancer cells to hypoxic tumor microenvironments. PMID:26703734

  5. Vascular growth factors play critical roles in kidney glomeruli.

    PubMed

    Gnudi, Luigi; Benedetti, Sara; Woolf, Adrian S; Long, David A

    2015-12-01

    Kidney glomeruli ultrafilter blood to generate urine and they are dysfunctional in a variety of kidney diseases. There are two key vascular growth factor families implicated in glomerular biology and function, namely the vascular endothelial growth factors (VEGFs) and the angiopoietins (Angpt). We present examples showing not only how these molecules help generate and maintain healthy glomeruli but also how they drive disease when their expression is dysregulated. Finally, we review how manipulating VEGF and Angpt signalling may be used to treat glomerular disease. PMID:26561594

  6. Nucleolin regulates c-Jun/Sp1-dependent transcriptional activation of cPLA2alpha in phorbol ester-treated non-small cell lung cancer A549 cells.

    PubMed

    Tsou, Jen-Hui; Chang, Kwang-Yu; Wang, Wei-Chiao; Tseng, Joseph T; Su, Wu-Chou; Hung, Liang-Yi; Chang, Wen-Chang; Chen, Ben-Kuen

    2008-01-01

    The expression of cPLA2 is critical for transformed growth of non-small cell lung cancer (NSCLC). It is known that phorbol 12-myristate 13-acetate (PMA)-activated signal transduction pathway is thought to be involved in the oncogene action in NSCLC and enzymatic activation of cPLA2. However, the transcriptional regulation of cPLA2alpha in PMA-activated NSCLC is not clear. In this study, we found that PMA induced the mRNA level and protein expression of cPLA2alpha. In addition, two Sp1-binding sites of cPLA2alpha promoter were required for response to PMA and c-Jun overexpression. Small interfering RNA (siRNA) of c-Jun and nucleolin inhibited PMA induced the promoter activity and protein expression of cPLA2alpha. Furthermore, PMA stimulated the formation of c-Jun/Sp1 and c-Jun/nucleolin complexes as well as the binding of these transcription factor complexes to the cPLA2alpha promoter. Although Sp1-binding sites were required for the bindings of Sp1 and nucleolin to the promoter, the binding of nucleolin or Sp1 to the promoter was independent of each other. Our results revealed that c-Jun/nucleolin and c-Jun/Sp1 complexes play an important role in PMA-regulated cPLA2alpha gene expression. It is likely that nucleolin binding at place of Sp1 on gene promoter could also mediate the regulation of c-Jun/Sp1-activated genes. PMID:18025046

  7. The retinoblastoma gene product RB stimulates Sp1-mediated transcription by liberating Sp1 from a negative regulator.

    PubMed Central

    Chen, L I; Nishinaka, T; Kwan, K; Kitabayashi, I; Yokoyama, K; Fu, Y H; Grünwald, S; Chiu, R

    1994-01-01

    Studies have demonstrated that the retinoblastoma susceptibility gene product, RB, can either positively or negatively regulate expression of several genes through cis-acting elements in a cell-type-dependent manner. The nucleotide sequence of the retinoblastoma control element (RCE) motif, GCCACC or CCACCC, and the Sp1 consensus binding sequence, CCGCCC, can confer equal responsiveness to RB. Here, we report that RB activates transcription of the c-jun gene through the Sp1-binding site within the c-jun promoter. Preincubation of crude nuclear extracts with monoclonal antibodies to RB results in reduction of Sp1 complexes in a mobility shift assay, while addition of recombinant RB in mobility shift assay mixtures with CCL64 cell extracts leads to an enhancement of DNA-binding activity of SP1. These results suggest that RB is directly or indirectly involved in Sp1-DNA binding activity. A mechanism by which RB regulates transactivation is indicated by our detection of a heat-labile and protease-sensitive Sp1 negative regulator(s) (Sp1-I) that specifically inhibits Sp1 binding to a c-jun Sp1 site. This inhibition is reversed by addition of recombinant RB proteins, suggesting that RB stimulates Sp1-mediated transactivation by liberating Sp1 from Sp1-I. Additional evidence for Sp1-I involvement in Sp1-mediated transactivation was demonstrated by cotransfection of RB, GAL4-Sp1, and a GAL4-responsive template into CV-1 cells. Finally, we have identified Sp1-I, a approximately 20-kDa protein(s) that inhibits the Sp1 complexes from binding to DNA and that is also an RB-associated protein. These findings provide evidence for a functional link between two distinct classes of oncoproteins, RB and c-Jun, that are involved in the control of cell growth, and also define a novel mechanism for the regulation of c-jun expression. Images PMID:8007947

  8. Nuclear receptors modulate the interaction of Sp1 and GC-rich DNA via ternary complex formation.

    PubMed Central

    Husmann, M; Dragneva, Y; Romahn, E; Jehnichen, P

    2000-01-01

    Binding sites for transcription factor Sp1 have been implicated in the transcriptional regulation of several genes by hormones or vitamins, and here we show that a GC-rich element contributes to the retinoic acid response of the interleukin 1beta promoter. To explain such observations, it has been proposed that nuclear receptors can interact with Sp1 bound to GC-rich DNA. However, evidence supporting this model has remained indirect. So far, nuclear receptors have not been detected in a complex with Sp1 and GC-rich DNA, and the expected ternary complexes in non-denaturing gels were not seen. In search for these missing links we found that nuclear receptors [retinoic acid receptor (RAR), thyroid hormone receptor (TR), vitamin D(3) receptor, peroxisome-proliferator-activated receptor and retinoic X receptor] induce an electrophoretic mobility increase of Sp1-GC-rich DNA complexes. Concomitantly, binding of Sp1 to the GC-box is enhanced. It is proposed that nuclear receptors may partially replace Sp1 in homo-oligomers at the GC-box. RARs and Sp1 can also combine into a complex with a retinoic acid-response element. The presence of RAR and Sp1 in complexes with either cognate site was revealed in supershift experiments. The C-terminus of Sp1 interacts with nuclear receptors. Both the ligand- and DNA-binding domains of the receptor are important for complex formation with Sp1 and GC-rich DNA. In spite of similar capacity to form ternary complexes, RAR but not TR up-regulated an Sp1-driven reporter in a ligand-dependent way. Thus additional factors limit the transcriptional response mediated by nuclear receptors and Sp1. PMID:11104684

  9. Retinoid-induced apoptosis and Sp1 cleavage occur independently of transcription and require caspase activation.

    PubMed Central

    Piedrafita, F J; Pfahl, M

    1997-01-01

    Vitamin A and its derivatives, the retinoids, are essential regulators of many important biological functions, including cell growth and differentiation, development, homeostasis, and carcinogenesis. Natural retinoids such as all-trans retinoic acid can induce cell differentiation and inhibit growth of certain cancer cells. We recently identified a novel class of synthetic retinoids with strong anti-cancer cell activities in vitro and in vivo which can induce apoptosis in several cancer cell lines. Using an electrophoretic mobility shift assay, we analyzed the DNA binding activity of several transcription factors in T cells treated with apoptotic retinoids. We found that the DNA binding activity of the general transcription factor Sp1 is lost in retinoid-treated T cells undergoing apoptosis. A truncated Sp1 protein is detected by immunoblot analysis, and cytosolic protein extracts prepared from apoptotic cells contain a protease activity which specifically cleaves purified Sp1 in vitro. This proteolysis of Sp1 can be inhibited by N-ethylmaleimide and iodoacetamide, indicating that a cysteine protease mediates cleavage of Sp1. Furthermore, inhibition of Sp1 cleavage by ZVAD-fmk and ZDEVD-fmk suggests that caspases are directly involved in this event. In fact, caspases 2 and 3 are activated in T cells after treatment with apoptotic retinoids. The peptide inhibitors also blocked retinoid-induced apoptosis, as well as processing of caspases and proteolysis of Sp1 and poly(ADP-ribose) polymerase in intact cells. Degradation of Sp1 occurs early during apoptosis and is therefore likely to have profound effects on the basal transcription status of the cell. Interestingly, retinoid-induced apoptosis does not require de novo mRNA and protein synthesis, suggesting that a novel mechanism of retinoid signaling is involved, triggering cell death in a transcriptional activation-independent, caspase-dependent manner. PMID:9343396

  10. A novel functional interaction between the Sp1-like protein KLF13 and SREBP-Sp1 activation complex underlies regulation of low density lipoprotein receptor promoter function.

    PubMed

    Natesampillai, Sekar; Fernandez-Zapico, Martin E; Urrutia, Raul; Veldhuis, Johannes D

    2006-02-10

    Cholesterol homeostasis is regulated by a family of transcription factors designated sterol regulatory element-binding proteins (SREBPs). Precise control of SREBP-targeted genes requires additional interactions with co-regulatory transcription factors. In the case of the low density lipoprotein receptor (LDLR), SREBP cooperates with the specificity protein Sp1 to activate the promoter. In this report, we describe a novel pathway in LDLR transcriptional regulation distinct from the SREBP-Sp1 activation complex involving the Sp1-like protein Krueppel-like factor 13 (KLF13). Using a combination of RNA interference, electrophoretic mobility shift, chromatin immunoprecipitation, and reporter assays, deletion, and site-directed mutagenesis, we demonstrated that KLF13 mediates repression in a DNA context-selective manner. KLF13 repression of LDLR promoter activity appears to be needed to keep the receptor silent, a state that can be antagonized by Sp1, SREBP, and inhibitors of histone deacetylase activity. Chromatin immunoprecipitation assay confirmed that KLF13 binds proximal LDLR DNA sequences in vivo and that exogenous oxysterol up-regulates such binding. Together these studies identify a novel regulatory pathway in which gene repression by KLF13 must be overcome by the Sp1-SREBP complex to activate the LDLR promoter. Therefore, these data should replace a pre-existent and more simple paradigm that takes into consideration only the induction of the activator proteins Sp1-SREBP as necessary for LDLR promoter drive without including default repression, such as that by KLF13, of the LDLR gene. PMID:16303770

  11. Crosstalk of Sp1 and Stat3 signaling in pancreatic cancer pathogenesis

    PubMed Central

    Huang, Chen; Xie, Keping

    2012-01-01

    Pancreatic cancer progression is attributed to genetic and epigenetic alterations and a chaotic tumor microenvironment. Those diverse “upstream signal” factors appear to converge on specific sets of central nuclear regulators, namely, transcription factors. Specificity Protein 1 (Sp1) and signal transducer and activator of transcription 3 (Stat3) are central transcription factors that regulate a number of pathways important to tumorigenesis, including tumor cell-cycle progression, apoptosis, angiogenesis, metastasis, and evasion of the immune system. Recently, researchers demonstrated many types of crosstalk of Sp1 and Stat3 in tumor signal transduction and that these factors function cooperatively to activate targeted genes and promote tumorigenesis in pancreatic cancer. Therefore, targeting both Sp1 and Stat3 is a potential preventive and therapeutic strategy for pancreatic cancer. PMID:22342309

  12. Zac1, an Sp1-like protein, regulates human p21{sup WAF1/Cip1} gene expression in HeLa cells

    SciTech Connect

    Liu, Pei-Yao; Hsieh, Tsai-Yuan; Liu, Shu-Ting; Chang, Yung-Lung; Lin, Wei-Shiang; Wang, Wei-Ming; Huang, Shih-Ming

    2011-12-10

    Zac1 functions as both a transcription factor and a transcriptional cofactor for p53, nuclear receptors (NRs) and NR coactivators. Zac1 might also act as a transcriptional repressor via the recruitment of histone deacetylase 1 (HDAC1). The ability of Zac1 to interact directly with GC-specific elements indicates that Zac1 possibly binds to Sp1-responsive elements. In the present study, our data show that Zac1 is able to interact directly with the Sp1-responsive element in the p21{sup WAF1/Cip1} gene promoter and enhance the transactivation activity of Sp1 through direct physical interaction. Our data further demonstrate that Zac1 might enhance Sp1-specific promoter activity by interacting with the Sp1-responsive element, affecting the transactivation activity of Sp1 via a protein-protein interaction, or competing the HDAC1 protein away from the pre-existing Sp1/HDAC1 complex. Finally, the synergistic regulation of p21{sup WAF1/Cip1} gene expression by Zac1 and Sp1 is mediated by endogenous p53 protein and p53-responsive elements in HeLa cells. Our work suggests that Zac1 might serve as an Sp1-like protein that directly interacts with the Sp1-responsive element to oligomerize with and/or to coactivate Sp1.

  13. Arf Induction by Tgfβ Is Influenced by Sp1 and C/ebpβ in Opposing Directions

    PubMed Central

    Zheng, Yanbin; Devitt, Caitlin; Liu, Jing; Iqbal, Nida; Skapek, Stephen X.

    2013-01-01

    Recent studies show that Arf, a bona fide tumor suppressor, also plays an essential role during mouse eye development. Tgfβ is required for Arf promoter activation in developing mouse eyes, and its capacity to induce Arf depends on Smads 2/3 as well as p38 Mapk. Substantial delay between activation of these pathways and increased Arf transcription imply that changes in the binding of additional transcription factors help orchestrate changes in Arf expression. Focusing on proteins with putative DNA binding elements near the mouse Arf transcription start, we now show that Tgfβ induction of this gene correlated with decreased expression and DNA binding of C/ebpβ to the proximal Arf promoter. Ectopic expression of C/ebpβ in mouse embryo fibroblasts (MEFs) blocked Arf induction by Tgfβ. Although basal levels of Arf mRNA were increased by C/ebpβ loss in MEFs and in the developing eye, Tgfβ was still able to increase Arf, indicating that derepression was not the sole factor. Chromatin immunoprecipitation (ChIP) assay showed increased Sp1 binding to the Arf promotor at 24 and 48 hours after Tgfβ treatment, at which time points Arf expression was significantly induced by Tgfβ. Chemical inhibition of Sp1 and its knockdown by RNA interference blocked Arf induction by Tgfβ in MEFs. In summary, our results indicate that C/ebpβ and Sp1 are negative and positive Arf regulators that are influenced by Tgfβ. PMID:23940569

  14. Contributing Factors on Malaysia Preschool Teachers' Belief, Attitude and Competence in Using Play Activities

    ERIC Educational Resources Information Center

    Jantan, Hafsah Binti; Bin Hamdan, Abdul Rahim; Yahya, Fauziah Hj; Saleh, Halimatussadiah Binti; Ong, Mohd Hanafi Bin Azman

    2015-01-01

    This study focused on preschool teachers' belief, attitude, knowledge and competence in using play in Malaysia. Its purpose is to find out indicators significantly contribute to belief, attitude, knowledge and competence in play of preschool teachers in Malaysia. The method used was factor analysis in order to confirm indicators in each variable…

  15. Young Mothers' Play with Their Toddlers: Individual Variability as a Function of Psychosocial Factors

    ERIC Educational Resources Information Center

    Driscoll, Joan Riley; Easterbrooks, M. Ann

    2007-01-01

    There is no one style of parenting which characterizes young mothers as a group. In addition, life circumstances play an important role in shaping maternal behaviour. The aim of this study was to identify patterns of maternal play behaviour and contextual (social and personal) factors associated with these different patterns. In this study, 107…

  16. Bovine lactoferricin induces TIMP-3 via the ERK1/2-Sp1 axis in human articular chondrocytes

    PubMed Central

    Yan, Dongyao; Chen, Di; Hawse, John R; van Wijnen, Andre J; Im, Hee-Jeong

    2013-01-01

    Bovine lactoferricin (LfcinB) is a heparan sulfate-binding peptide with multiple bioactivities. In human articular cartilage, LfcinB antagonizes interleukin-1 β (IL-1β) and fibroblast growth factor 2 (FGF-2) in proteoglycan metabolism, catabolic protease expression, and induction of pro-inflammatory mediators. LfcinB specifically activates ERK1/2, p38 and Akt, but whether these signaling pathways control the expression of LfcinB target genes remained unknown. In this report, we characterized a novel aspect of LfcinB-mediated genetic response in human articular chondrocytes, tissue inhibitor of metalloproteinase 3 (TIMP-3) induction. Inhibition of individual signaling pathways revealed that ERK1/2 functions as the major pathway in TIMP-3 expression, whereas Akt plays a minor role. Further investigation identified Sp1 as a critical transcriptional activator in TIMP-3 regulation, and Sp1 activity is modulated by ERK1/2, not Akt. Comparative quantification indicates significant downregulation of TIMP-3 occurs in OA chondrocytes, suggesting a beneficial role of LfcinB in OA pathogenesis. Our results collectively provide new insights into the mechanism of action of LfcinB, and support the candidacy of LfcinB as a chondroprotective agent. PMID:23313877

  17. Modifying factors in sports-related concussion: dangerous style of play.

    PubMed

    Diamond, Alex B; Solomon, Gary S

    2014-09-01

    In its third iteration, the Concussion in Sport Group identified 10 modifying factors that were presumed clinically to influence the investigation and management of concussions in sports. "Dangerous style of play" was delineated as one of these factors, most likely based on clinical lore. These modifying factors were retained in a more recent Concussion in Sport Group statement. To date, there has been no concerted effort to support or refute the inclusion of this constellation of behaviors as a modifying factor in sports-related concussion. This article reviews and summarizes the limited evidence related to a dangerous style of play in sports-related concussion, offers a preliminary assessment of its relevance as a modifying factor, and provides additional information on other aspects of player, coach, and governing body behavior and their potential effect(s) on reducing concussive injuries. PMID:25295762

  18. Up-regulation of Hsp27 by ERα/Sp1 facilitates proliferation and confers resistance to apoptosis in human papillary thyroid cancer cells.

    PubMed

    Mo, Xiao-Mei; Li, Li; Zhu, Ping; Dai, Yu-Jie; Zhao, Ting-Ting; Liao, Ling-Yao; Chen, George G; Liu, Zhi-Min

    2016-08-15

    17β-estradiol (E2) has been suggested to play a role in the development and progression of papillary thyroid cancer. Heat shock protein 27 (Hsp27) is a member of the Hsp family that is responsible for cell survival under stressful conditions. Previous studies have shown that the 5'-promoter region of Hsp27 gene contains a specificity protein-1 (Spl) and estrogen response element half-site (ERE-half), which contributes to Hsp27 induction by E2 in breast cancer cells. However, it is unclear whether Hsp27 can be up-regulated by E2 and which estrogen receptor (ER) isoform and tethered transcription factor are involved in this regulation in papillary thyroid cancer cells. In the present study, we demonstrated that Hsp27 can be effectively up-regulated by E2 at mRNA and protein levels in human K1 and BCPAP papillary thyroid cancer cells which have more than two times higher level of ERα than that of ERβ. The up-regulation of Hsp27 by E2 is mediated by ERα/Sp1 and ERβ has repressive effect on this ERα/Sp1-mediated up-regulation of Hsp27. Moreover, we showed that the up-regulation of Hsp27 by ERα/Sp1 facilitates proliferation and confers resistance to apoptosis through interaction with procaspase-3. Targeting this pathway may be a potential strategy for therapy of papillary thyroid cancer. PMID:27179757

  19. Outdoor Play and Play Equipment.

    ERIC Educational Resources Information Center

    Naylor, Heather

    1985-01-01

    Discusses aspects of the play environment and its effect on children's play behavior. Indoor and outdoor play spaces are considered along with factors affecting the use of outdoor environments for play. Children's preferences for different outdoor play environments and for various play structures are explored. Guides for choosing play equipment…

  20. p53 inhibits the expression of p125 and the methylation of POLD1 gene promoter by downregulating the Sp1-induced DNMT1 activities in breast cancer

    PubMed Central

    Zhang, Liang; Yang, Weiping; Zhu, Xiao; Wei, Changyuan

    2016-01-01

    p125 is one of four subunits of human DNA polymerases – DNA Pol δ as well as one of p53 target protein encoded by POLD1. However, the function and significance of p125 and the role that p53 plays in regulating p125 expression are not fully understood in breast cancer. Tissue sections of human breast cancer obtained from 70 patients whose median age was 47.6 years (range: 38–69 years) with stage II–III breast cancer were studied with normal breast tissue from the same patients and two human breast cell lines (MCF-7 and MCF-10A). p53 expression levels were reduced, while p125 protein expression was increased in human breast cancer tissues and cell line detected by Western blot and quantitative reverse transcriptase-polymerase chain reaction. The methylation level of the POLD1 gene promoter was greater in breast cancer tissues and cells when compared with normal tissues and cells. In MCF-7 cell model, p53 overexpression caused a decrease in the level of p125 protein, while the methylation level of the p125 gene promoter was also inhibited by p53 overexpression. To further investigate the regulating mechanism of p53 on p125 expression, our study focused on DNA methyltransferase 1 (DNMT1) and transcription factor Sp1. Both DNMT1 and Sp1 protein expression were reduced when p53 was overexpressed in MCF-7 cells. The Sp1 binding site appears to be important for DNMT1 gene transcription; Sp1 and p53 can bind together, which means that DNMT1 gene expression may be downregulated by p53 through binding to Sp1. Because DNMT1 methylation level of the p125 gene promoter can affect p125 gene transcription, we propose that p53 may indirectly regulate p125 gene promoter expression through the control of DNMT1 gene transcription. In conclusion, the data from this preliminary study have shown that p53 inhibits the methylation of p125 gene promoter by downregulating the activities of Sp1 and DNMT1 in breast cancer. PMID:27022290

  1. Users guide for the ANL IBM SP1

    SciTech Connect

    Gropp, W.; Lusk, E.; Pieper, S.C.

    1994-10-01

    This guide presents the features of the IBM SP1 installed in the Mathematics and Computer Science Division at Argonne National Laboratory. The guide describes the available hardware and software, access policies, and hints for using the system productively.

  2. Transcriptional activation of human 12-lipoxygenase gene promoter is mediated through Sp1 consensus sites in A431 cells.

    PubMed Central

    Liu, Y W; Arakawa, T; Yamamoto, S; Chang, W C

    1997-01-01

    The functional 5' flanking region of the human 12-lipoxygenase in epidermoid carcinoma A431 cells was characterized. By a primer extension method, the transcription initiation sites were mapped at -47 adenosine, -48 guanosine and -55 guanosine upstream of the ATG translation start codon. Transient transfection with a series of 5' and 3' deletion constructs showed that the 5' flanking region spanning from -224 to -100 bp was important for the basal expression of 12-lipoxygenase gene. Gel mobility shift assays with antibodies of transcription factors showed that both Sp1 and Sp3 required highly GC-rich Sp1 sites within this region for binding. Disruption of two Sp1 recognition motifs residing at -158 to -150 bp and -123 to -114 bp by site-directed mutagenesis markedly reduced the basal 12-lipoxygenase promoter activity and abolished the retarded bands in a gel-shift assay, indicating that these two Sp1-binding sites were essential for gene expression. The same two Sp1-binding sites in this promoter region were also responsible for epidermal growth factor (EGF)-induced expression of 12-lipoxygenase gene. Moreover, EGF also induced the transcriptional activation of luciferase driven by SV40 early promoter, which contained rich Sp1-binding sites. Taken together, the results suggest that two specific Sp1 consensus sites are involved in the mediation of the basal promoter activity as well as EGF induction of the 12-lipoxygenase gene and that Sp1 and Sp3 transcription factors might have a role in their regulation. PMID:9164849

  3. Factors affecting return to play after anterior cruciate ligament reconstruction: a review of the current literature.

    PubMed

    Bauer, Matthew; Feeley, Brian T; Wawrzyniak, John R; Pinkowsky, Gregory; Gallo, Robert A

    2014-11-01

    Anterior cruciate ligament reconstruction has been reported to produce normal or near-normal knee results in > 90% of patients. A recent meta-analysis suggested that, despite normal or near-normal knees, many athletes do not return to sports. Rates and timing of return to competitive athletics are quite variable depending on the graft type, the age of the patient, the sport, and the level of play. Even when athletes do return to play, often they do not return to their previous level. Graft failure, subjective physical factors, and psychological factors, including fear of reinjury and lack of motivation, appear to play a large role in patients' ability to return to sporting activities. PMID:25419890

  4. Monoamine oxidase B levels are highly expressed in human gliomas and are correlated with the expression of HiF-1α and with transcription factors Sp1 and Sp3

    PubMed Central

    Sharpe, Martyn A.; Baskin, David S.

    2016-01-01

    Monoamine oxidases A and B (MAOA and MAOB) are highly expressed in many cancers. Here we investigated the level of MAOB in gliomas and confirmed its high expression. We found that MAOB levels correlated with tumor grade and hypoxia-inducible factor 1-alpha (HiF-1α) expression. HiF-1α was localized to the nuclei in high-grade gliomas, but it was primarily cytosolic in low-grade gliomas and normal human astrocytes. Expression of both glial fibrillary acidic protein (GFAP) and MAOB are correlated to HiF-1α expression levels. Levels of MAOB are correlated by the levels of transcription factor Sp3 in the majority of GBM examined, but this control of MAOB expression by Sp3 in low grade astrocytic gliomas is significantly different from control in the in the majority of glioblastomas. The current findings support previous suggestions that MAOB can be exploited for the killing of cancer cells. Selective cell toxicity can be achieved by designing non-toxic prodrugs that require MAOB for their catalytic conversion into mature cytotoxic chemotherapeutics. PMID:26689994

  5. Assessment of pretend play in preschool-aged children: validation and factor analysis of the affect in play scale-preschool version.

    PubMed

    Fehr, Karla K; Russ, Sandra W

    2014-01-01

    The Affect in Play Scale-Preschool (APS-P) and Affect in Play Scale-Preschool-Brief Rating (APS-P-BR) versions assess cognitive and affective play processes during a 5-min standardized play task. In this study, construct validity, external validity, and factor analyses for each scale were examined in 107 preschoolers. Reliability and validity were supported. Unlike results found with school-aged samples, positive affect loaded with the cognitive variables on factor analyses of the APS-P and APS-P-BR, suggesting that negative and undefined affect might represent a separate factor in preschool-aged children. Developmental significance and implications for use of the 2 scoring versions are discussed. PMID:24090344

  6. Sp1 is essential and its position is important for p120 gene transcription: a 35 bp juxtaposed positive regulatory element enhances transcription 2.5 fold.

    PubMed Central

    Haidar, M A; Henning, D; Busch, H

    1991-01-01

    Human proliferating cell nucleolar antigen p120 is expressed in tumor cells in the early G1 phase of the cell cycle. Deletion analyses of the essential cis-acting region -537/-278 showed that a 58 bp sequence from -457 to -400 is an important cis-acting element. An Sp1 transcription factor binds to the sequence AGAGGCGGGG (-425 to -416) within the -458/-400 cis-acting region. Deletion of the Sp1 binding sequence eliminated transcription. Substitution of the Sp1 box(-437/-406), containing the Sp1 recognition site, for the entire cis-acting region (-537/-278) restored transcription only at a very low level (18%). Deletion of the -537/-278 cis-acting region followed by substitutions showed that the Sp1 box (-437/-406) stimulated transcription 2.4 fold, when juxtaposed and downstream of a 35 bp (-472 GGGCGAGCGTAAGTTCCGGGTGCGGCGGCCGACTA -438) positive regulatory cis-element (PRE) over that by substitution of the Sp1 box alone. When the -406/-278 sequence was downstream of the PRE-Sp1 box, transcription was stimulated 4.4 fold over that produced by substitution of the Sp1 box alone. These results suggest that Sp1 is essential and its proper position in the 5' flanking sequence, juxtaposed and down stream of a 35 bp positive regulatory sequence, is required for efficient transcription. Images PMID:1754393

  7. Growth factor delivery methods in the management of sports injuries: the state of play.

    PubMed

    Creaney, L; Hamilton, B

    2008-05-01

    In recent years there have been rapid developments in the use of growth factors for accelerated healing of injury. Growth factors have been used in maxillo-facial and plastic surgery with success and the technology is now being developed for orthopaedics and sports medicine applications. Growth factors mediate the biological processes necessary for repair of soft tissues such as muscle, tendon and ligament following acute traumatic or overuse injury, and animal studies have demonstrated clear benefits in terms of accelerated healing. There are various ways of delivering higher doses of growth factors to injured tissue, but each has in common a reliance on release of growth factors from blood platelets. Platelets contain growth factors in their alpha-granules (insulin-like growth factor-1, basic fibroblast growth factor, platelet-derived growth factor, epidermal growth factor, vascular endothelial growth factor, transforming growth factor-beta(1)) and these are released upon injection at the site of an injury. Three commonly utilised techniques are known as platelet-rich plasma, autologous blood injections and autologous conditioned serum. Each of these techniques has been studied clinically in humans to a very limited degree so far, but results are promising in terms of earlier return to play following muscle and particularly tendon injury. The use of growth factors in sports medicine is restricted under the terms of the World Anti-Doping Agency (WADA) anti-doping code, particularly because of concerns regarding the insulin-like growth factor-1 content of such preparations, and the potential for abuse as performance-enhancing agents. The basic science and clinical trials related to the technology are reviewed, and the use of such agents in relation to the WADA code is discussed. PMID:17984193

  8. Contributing factors, prevention, and management of playing-related musculoskeletal disorders among flute players internationally.

    PubMed

    Lonsdale, Karen; Laakso, E-Liisa; Tomlinson, Vanessa

    2014-09-01

    Major studies have shown that flutists report playing-related pain in the neck, middle/upper back, shoulders, wrists, and hands. The current survey was designed to establish the injury concerns of flute players and teachers of all backgrounds, as well as their knowledge and awareness of injury prevention and management. Questions addressed a range of issues including education, history of injuries, preventative and management strategies, lifestyle factors, and teaching methods. At the time of the survey, 26.7% of all respondents were suffering from flute playing-related discomfort or pain; 49.7% had experienced flute playing-related discomfort or pain that was severe enough to distract while performing; and 25.8% had taken an extended period of time off playing because of discomfort or pain. Consistent with earlier studies, the most common pain sites were the fingers, hands, arms, neck, middle/upper back, and shoulders. Further research is needed to establish possible links between sex, instrument types, and ergonomic set up. Further investigation is recommended to ascertain whether certain types of physical training, education, and practice approaches may be more suitable than current methods. A longitudinal study researching the relationship between early education, playing position, ergonomic set-up, and prevalence of injury is recommended. PMID:25194113

  9. SP1 protein-based nanostructures and arrays.

    PubMed

    Medalsy, Izhar; Dgany, Or; Sowwan, Mukhles; Cohen, Hezy; Yukashevska, Alevtyna; Wolf, Sharon G; Wolf, Amnon; Koster, Abraham; Almog, Orna; Marton, Ira; Pouny, Yehonathan; Altman, Arie; Shoseyov, Oded; Porath, Danny

    2008-02-01

    Controlled formation of complex nanostructures is one of the main goals of nanoscience and nanotechnology. Stable Protein 1 (SP1) is a boiling-stable ring protein complex, 11 nm in diameter, which self-assembles from 12 identical monomers. SP1 can be utilized to form large ordered arrays; it can be easily modified by genetic engineering to produce various mutants; it is also capable of binding gold nanoparticles (GNPs) and thus forming protein-GNP chains made of alternating SP1s and GNPs. We report the formation and the protocols leading to the formation of those nanostructures and their characterization by transmission electron microscopy, atomic force microscopy, and electrostatic force microscopy. Further control over the GNP interdistances within the protein-GNP chains may lead to the formation of nanowires and structures that may be useful for nanoelectronics. PMID:18193911

  10. Pin1-mediated Sp1 phosphorylation by CDK1 increases Sp1 stability and decreases its DNA-binding activity during mitosis.

    PubMed

    Yang, Hang-Che; Chuang, Jian-Ying; Jeng, Wen-Yih; Liu, Chia-I; Wang, Andrew H-J; Lu, Pei-Jung; Chang, Wen-Chang; Hung, Jan-Jong

    2014-12-16

    We have shown that Sp1 phosphorylation at Thr739 decreases its DNA-binding activity. In this study, we found that phosphorylation of Sp1 at Thr739 alone is necessary, but not sufficient for the inhibition of its DNA-binding activity during mitosis. We demonstrated that Pin1 could be recruited to the Thr739(p)-Pro motif of Sp1 to modulate the interaction between phospho-Sp1 and CDK1, thereby facilitating CDK1-mediated phosphorylation of Sp1 at Ser720, Thr723 and Thr737 during mitosis. Loss of the C-terminal end of Sp1 (amino acids 741-785) significantly increased Sp1 phosphorylation, implying that the C-terminus inhibits CDK1-mediated Sp1 phosphorylation. Binding analysis of Sp1 peptides to Pin1 by isothermal titration calorimetry indicated that Pin1 interacts with Thr739(p)-Sp1 peptide but not with Thr739-Sp1 peptide. X-ray crystallography data showed that the Thr739(p)-Sp1 peptide occupies the active site of Pin1. Increased Sp1 phosphorylation by CDK1 during mitosis not only stabilized Sp1 levels by decreasing interaction with ubiquitin E3-ligase RNF4 but also caused Sp1 to move out of the chromosomes completely by decreasing its DNA-binding activity, thereby facilitating cell cycle progression. Thus, Pin1-mediated conformational changes in the C-terminal region of Sp1 are critical for increased CDK1-mediated Sp1 phosphorylation to facilitate cell cycle progression during mitosis. PMID:25398907

  11. Functional Interactions between C/EBP, Sp1, and COUP-TF Regulate Human Immunodeficiency Virus Type 1 Gene Transcription in Human Brain Cells

    PubMed Central

    Schwartz, Christian; Catez, Philippe; Rohr, Olivier; Lecestre, Dominique; Aunis, Dominique; Schaeffer, Evelyne

    2000-01-01

    Human immunodeficiency virus type 1 (HIV-1) infects the central nervous system (CNS) and plays a direct role in the pathogenesis of AIDS dementia. However, mechanisms underlying HIV-1 gene expression in the CNS are poorly understood. The importance of CCAAT/enhancer binding proteins (C/EBP) for HIV-1 expression in cells of the immune system has been recently reported. In this study, we have examined the role and the molecular mechanisms by which proteins of the C/EBP family regulate HIV-1 gene transcription in human brain cells. We found that NF-IL6 acts as a potent activator of the long terminal repeat (LTR)-driven transcription in microglial and oligodendroglioma cells. In contrast, C/EBPγ inhibits NF-IL6-induced activation. Consistent with previous data, our transient expression results show cell-type-specific NF-IL6-mediated transactivation. In glial cells, full activation needs the presence of the C/EBP binding sites; however, NF-IL6 is still able to function via the minimal −40/+80 region. In microglial cells, C/EBP sites are not essential, since NF-IL6 acts through the −68/+80 LTR region, containing two binding sites for the transcription factor Sp1. Moreover, we show that functional interactions between NF-IL6 and Sp1 lead to synergistic transcriptional activation of the LTR in oligodendroglioma and to mutual repression in microglial cells. We further demonstrate that NF-IL6 physically interacts with the nuclear receptor chicken ovalbumin upstream promoter transcription factor (COUP-TF), via its DNA binding domain, in vitro and in cells, which results in mutual transcriptional repression. These findings reveal how the interplay of NF-IL6 and C/EBPγ, together with Sp1 and COUP-TF, regulates HIV-1 gene transcription in brain cells. PMID:10590092

  12. A cooperative interaction between NF-kappa B and Sp1 is required for HIV-1 enhancer activation.

    PubMed Central

    Perkins, N D; Edwards, N L; Duckett, C S; Agranoff, A B; Schmid, R M; Nabel, G J

    1993-01-01

    The human immunodeficiency virus (HIV-1) long terminal repeat (LTR) contains two binding sites for NF-kappa B in close proximity to three binding sites for the constitutive transcription factor, Sp1. Previously, stimulation of the HIV enhancer in response to mitogens has been attributed to the binding of NF-kappa B to the viral enhancer. In this report, we show that the binding of NF-kappa B is not by itself sufficient to induce HIV gene expression. Instead, a protein-protein interaction must occur between NF-kappa B and Sp1 bound to an adjacent site. Cooperativity both in DNA binding and in transcriptional activation of NF-kappa B and Sp1 was confirmed by electrophoretic mobility shift gel analysis, DNase footprinting, chemical cross-linking and transfection studies in vivo. With a heterologous promoter, we find that the interaction of NF-kappa B with Sp1 is dependent on orientation and position, and is not observed with other elements, including GATA, CCAAT or octamer. An increase in the spacing between the kappa B and Sp1 elements virtually abolishes this functional interaction, which is not restored when these sites are brought back into the same helical position. Several other promoters regulated by NF-kappa B also contain kappa B in proximity to Sp1 binding sites. These findings suggest that an interaction between NF-kappa B and Sp1 is required for inducible HIV-1 gene expression and may serve as a regulatory mechanism to activate specific viral and cellular genes. Images PMID:8253080

  13. Bortezomib induces DNA hypomethylation and silenced gene transcription by interfering with Sp1/NF-κB–dependent DNA methyltransferase activity in acute myeloid leukemia

    PubMed Central

    Liu, Shujun; Liu, Zhongfa; Xie, Zhiliang; Pang, Jiuxia; Yu, Jianhua; Lehmann, Esther; Huynh, Lenguyen; Vukosavljevic, Tamara; Takeki, Mitsui; Klisovic, Rebecca B.; Baiocchi, Robert A.; Blum, William; Porcu, Pierluigi; Garzon, Ramiro; Byrd, John C.; Perrotti, Danilo; Caligiuri, Michael A.; Chan, Kenneth K.; Wu, Lai-Chu

    2008-01-01

    Bortezomib reversibly inhibits 26S proteasomal degradation, interferes with NF-κB, and exhibits antitumor activity in human malignancies. Zinc finger protein Sp1 transactivates DNMT1 gene in mice and is functionally regulated through protein abundance, posttranslational modifications (ie, ubiquitination), or interaction with other transcription factors (ie, NF-κB). We hypothesize that inhibition of proteasomal degradation and Sp1/NF-κB–mediated transactivation may impair aberrant DNA methyltransferase activity. We show here that, in addition to inducing accumulation of polyubiquitinated proteins and abolishment of NF-κB activities, bortezomib decreases Sp1 protein levels, disrupts the physical interaction of Sp1/NF-κB, and prevents binding of the Sp1/NF-κB complex to the DNMT1 gene promoter. Abrogation of Sp1/NF-κB complex by bortezomib causes transcriptional repression of DNMT1 gene and down-regulation of DNMT1 protein, which in turn induces global DNA hypomethylation in vitro and in vivo and re-expression of epigenetically silenced genes in human cancer cells. The involvement of Sp1/NF-κB in DNMT1 regulation is further demonstrated by the observation that Sp1 knockdown using mithramycin A or shRNA decreases DNMT1 protein levels, which instead are increased by Sp1 or NF-κB overexpression. Our results unveil the Sp1/NF-κB pathway as a modulator of DNA methyltransferase activity in human cancer and identify bortezomib as a novel epigenetic-targeting drug. PMID:18083845

  14. Kaempferol stimulates gene expression of low-density lipoprotein receptor through activation of Sp1 in cultured hepatocytes

    PubMed Central

    Ochiai, Ayasa; Miyata, Shingo; Iwase, Masamori; Shimizu, Makoto; Inoue, Jun; Sato, Ryuichiro

    2016-01-01

    A high level of plasma low-density lipoprotein (LDL) cholesterol is considered a risk factor for atherosclerosis. Because the hepatic LDL receptor (LDLR) is essential for clearing plasma LDL cholesterol, activation of LDLR is a promising therapeutic target for patients with atherosclerotic disease. Here we demonstrated how the flavonoid kaempferol stimulated the gene expression and activity of LDLR in HepG2 cells. The kaempferol-mediated stimulation of LDLR gene expression was completely inhibited by knockdown of Sp1 gene expression. Treatment of HepG2 cells with kaempferol stimulated the recruitment of Sp1 to the promoter region of the LDLR gene, as well as the phosphorylation of Sp1 on Thr-453 and Thr-739. Moreover, these kaempferol-mediated processes were inhibited in the presence of U0126, an ERK pathway inhibitor. These results suggest that kaempferol may increase the activity of Sp1 through stimulation of Sp1 phosphorylation by ERK1/2 and subsequent induction of LDLR expression and activity. PMID:27109240

  15. Sp1/NFκB/HDAC/miR-29b Regulatory Network in KIT-driven Myeloid Leukemia

    PubMed Central

    Liu, Shujun; Wu, Lai-Chu; Pang, Jiuxia; Santhanam, Ramasamy; Schwind, Sebastian; Wu, Yue-Zhong; Hickey, Christopher; Yu, Jianhua; Becker, Heiko; Maharry, Kati; Radmacher, Michael D; Li, Chenglong; Whitman, Susan P.; Mishra, Anjali; Stauffer, Nicole; Eiring, Anna M.; Briesewitz, Roger; Baiocchi, Robert A.; Chan, Kenneth K.; Paschka, Peter; Caligiuri, Michael A.; Byrd, John C.; Croce, Carlo M; Bloomfield, Clara D.; Perrotti, Danilo; Garzon, Ramiro; Marcucci, Guido

    2010-01-01

    SUMMARY The biologic and clinical significance of KIT overexpression that associates with KIT gain-of- function mutations occurring in subsets of acute myeloid leukemia (AML) (i.e., core binding factor AML) is unknown. Here, we show that KIT mutations lead to MYC-dependent miR-29b repression and increased levels of the miR-29b target Sp1 in KIT-driven leukemia. Sp1 enhances its own expression by participating in a NFκB/HDAC complex that further represses miR-29b transcription. Upregulated Sp1 then binds NFκB and transactivates KIT. Therefore, activated KIT ultimately induces its own transcription. Our results provide evidence that the mechanisms of Sp1/NFκB/HDAC/miR-29b-dependent KIT overexpression contribute to leukemia growth and can be successfully targeted by pharmacological disruption of the Sp1/NFκB/HDAC complex or synthetic miR-29b treatment in KIT-driven AML. PMID:20385359

  16. PTEN downregulates p75NTR expression by decreasing DNA-binding activity of Sp1

    SciTech Connect

    Rankin, Sherri L.; Guy, Clifford S.; Mearow, Karen M.

    2009-02-13

    p75NTR is expressed throughout the nervous system and its dysregulation is associated with pathological conditions. We have recently demonstrated a signalling cascade initiated by laminin (LN), which upregulates PTEN and downregulates p75NTR. Here we investigate the mechanism by which PTEN modulates p75NTR. Studies using PTEN mutants show that its protein phosphatase activity directly modulates p75NTR protein expression. Nuclear relocalization of PTEN subsequent to LN stimulation suggests transcriptional control of p75NTR expression, which was confirmed following EMSA and ChIP analysis of Sp1 transcription factor binding activity. LN and PTEN independently decrease the DNA-binding ability of PTEN to the p75NTR promoter. Sp1 regulation of p75NTR occurs via dephosphorylation of Sp1, thus reducing p75NTR transcription and protein expression. This mechanism represents a novel regulatory pathway which controls the expression level of a receptor with broad implications not only for the development of the nervous system but also for progression of pathological conditions.

  17. On the trajectories of Sp(1) -Kepler problems

    NASA Astrophysics Data System (ADS)

    Meng, Guowu

    2015-10-01

    The classical Sp(1) -Kepler problems are formulated with the help of an idea from S. Sternberg. The trajectories of these models are determined via an idea originated from Levi-Civita. It is found that, for a non-colliding trajectory, its shadow-its projection to the external configuration space-is an ellipse, a parabola or a branch of hyperbola according as the total energy is negative, zero or positive. Moreover, it is shown that, for the Sp(1) -Kepler problems at level n ≥ 2, the group SL(n, H) ×R+ acts transitively on both the set of elliptic shadow trajectories and the set of parabolic shadow trajectories.

  18. Treatment with Combination of Mithramycin A and Tolfenamic Acid Promotes Degradation of Sp1 Protein and Synergistic Antitumor Activity in Pancreatic Cancer

    PubMed Central

    Jia, Zhiliang; Gao, Yong; Wang, Liwei; Li, Qiang; Zhang, Jun; Le, Xiangdong; Wei, Daoyan; Yao, James C.; Chang, David Z.; Huang, Suyun; Xie, Keping

    2010-01-01

    Previous studies showed that both mithramycin (MIT) and tolfenamic acid (TA) inhibits the activity of the transcription factor Sp1. In the present study, we sought to determine whether treatment with a combination of these two compounds has a synergistic effect on Sp1 activity and pancreatic cancer growth and their underlying mechanisms. In xenograft mouse models of human pancreatic cancer, treatment with MIT and TA produced dose-dependent antitumor activity, and significant antitumor activity of either compound alone was directly associated with systemic side effects as determined according to overall weight loss. However, combination treatment with nontoxic doses of TA and MIT produced synergistic antitumor activity, whereas treatment with a nontoxic dose of either compound alone did not have a discernible antitumor effect. The synergistic therapeutic effects of MIT and TA correlated directly with synergistic antiproliferation and antiangiogenesis in vitro. Moreover, treatment with the combination of TA and MIT resulted in Sp1 protein degradation, leading to drastic downregulation of Sp1 and vascular endothelial growth factor protein expression. Our data demonstrated that Sp1 is a critical target of TA and MIT in human pancreatic cancer therapy. Further studies should be performed to determine the impact of existing pancreatic cancer therapy regimens on Sp1 signaling in tumors and normal pancreatic tissue and the ability of Sp1-targeting strategies to modify these responses and improve upon these regimens. PMID:20086170

  19. Domain II plays a crucial role in the function of ribosome recycling factor

    PubMed Central

    2005-01-01

    RRF (ribosome recycling factor) consists of two domains, and in concert with EF-G (elongation factor-G), triggers dissociation of the post-termination ribosomal complex. However, the function of the individual domains of RRF remains unclear. To clarify this, two RRF chimaeras, EcoDI/TteDII and TteDI/EcoDII, were created by domain swaps between the proteins from Escherichia coli and Thermoanaerobacter tengcongensis. The ribosome recycling activity of the RRF chimaeras was compared with their wild-type RRFs by using in vivo and in vitro activity assays. Like wild-type TteRRF (T. tengcongensis RRF), the EcoDI/TteDII chimaera is non-functional in E. coli, but both wild-type TteRRF, and EcoDI/TteDII can be activated by coexpression of T. tengcongensis EF-G in E. coli. By contrast, like wild-type E. coli RRF (EcoRRF), TteDI/EcoDII is fully functional in E. coli. These findings suggest that domain II of RRF plays a crucial role in the concerted action of RRF and EF-G for the post-termination complex disassembly, and the specific interaction between RRF and EF-G on ribosomes mainly depends on the interaction between domain II of RRF and EF-G. This study provides direct genetic and biochemical evidence for the function of the individual domains of RRF. PMID:16262604

  20. Transcription Factor ets-2 Plays an Important Role in the Pathogenesis of Pulmonary Fibrosis

    PubMed Central

    Baran, Christopher P.; Fischer, Sara N.; Nuovo, Gerard J.; Kabbout, Mohamed N.; Hitchcock, Charles L.; Bringardner, Benjamin D.; McMaken, Sara; Newland, Christie A.; Cantemir-Stone, Carmen Z.; Phillips, Gary S.; Ostrowski, Michael C.

    2011-01-01

    Ets-2 is a ubiquitous transcription factor activated after phosphorylation at threonine-72. Previous studies highlighted the importance of phosphorylated ets-2 in lung inflammation and extracellular matrix remodeling, two pathways involved in pulmonary fibrosis. We hypothesized that phosphorylated ets-2 played an important role in pulmonary fibrosis, and we sought to determine the role of ets-2 in its pathogenesis. We challenged ets-2 (A72/A72) transgenic mice (harboring a mutated form of ets-2 at phosphorylation site threonine-72) and ets-2 (wild-type/wild-type [WT/WT]) control mice with sequential intraperitoneal injections of bleomycin, followed by quantitative measurements of lung fibrosis and inflammation and primary cell in vitro assays. Concentrations of phosphorylated ets-2 were detected via the single and dual immunohistochemical staining of murine lungs and lung sections from patients with idiopathic pulmonary fibrosis. Ets-2 (A72/A72) mice were protected from bleomycin-induced pulmonary fibrosis, compared with ets-2 (WT/WT) mice. This protection was characterized by decreased lung pathological abnormalities and the fibrotic gene expression of Type I collagen, Type III collagen, α–smooth muscle actin, and connective tissue growth factor. Immunohistochemical staining of lung sections from bleomycin-treated ets-2 (WT/WT) mice and from patients with idiopathic pulmonary fibrosis demonstrated increased staining of phosphorylated ets-2 that colocalized with Type I collagen expression and to fibroblastic foci. Lastly, primary lung fibroblasts from ets-2 (A72/A72) mice exhibited decreased expression of Type I collagen in response to stimulation with TGF-β, compared with fibroblasts from ets-2 (WT/WT) mice. These data indicate the importance of phosphorylated ets-2 in the pathogenesis of pulmonary fibrosis through the expression of Type I collagen and (myo)fibroblast activation. PMID:21562315

  1. On the role played by magnetic expansion factor in the prediction of solar wind speed

    NASA Astrophysics Data System (ADS)

    Riley, Pete; Linker, Jon A.; Arge, C. Nick

    2015-03-01

    Over the last two decades, the Wang-Sheeley-Arge (WSA) model has evolved significantly. Beginning as a simple observed correlation between the expansion factor of coronal magnetic field lines and the measured speed of the solar wind at 1 AU (the Wang-Sheeley (WS) model), the WSA model now drives NOAA's first operational space weather model, providing real-time predictions of solar wind parameters in the vicinity of Earth. Here we demonstrate that the WSA model has evolved so much that the role played by the expansion factor term is now largely minimal, being supplanted by the distance from the coronal hole boundary (DCHB). We illustrate why and to what extent the three models (WS, DCHB, and WSA) differ. Under some conditions, all approaches are able to reproduce the grossest features of the observed quiet time solar wind. However, we show that, in general, the DCHB- and WSA-driven models tend to produce better estimates of solar parameters at 1 AU than the WS model, particularly when pseudostreamers are present. Additionally, we highlight that these empirical models are sensitive to the type and implementation of the magnetic field model used: In particular, the WS model can only reproduce in situ measurements when coupled with the potential field source surface model. While this clarification is important both in its own right and from an operational/predictive standpoint, because of the underlying physical ideas upon which the WS and DCHB models rest, these results provide support, albeit tentatively, for boundary layer theories for the origin of the slow solar wind.

  2. Transcription factor ets-2 plays an important role in the pathogenesis of pulmonary fibrosis.

    PubMed

    Baran, Christopher P; Fischer, Sara N; Nuovo, Gerard J; Kabbout, Mohamed N; Hitchcock, Charles L; Bringardner, Benjamin D; McMaken, Sara; Newland, Christie A; Cantemir-Stone, Carmen Z; Phillips, Gary S; Ostrowski, Michael C; Marsh, Clay B

    2011-11-01

    Ets-2 is a ubiquitous transcription factor activated after phosphorylation at threonine-72. Previous studies highlighted the importance of phosphorylated ets-2 in lung inflammation and extracellular matrix remodeling, two pathways involved in pulmonary fibrosis. We hypothesized that phosphorylated ets-2 played an important role in pulmonary fibrosis, and we sought to determine the role of ets-2 in its pathogenesis. We challenged ets-2 (A72/A72) transgenic mice (harboring a mutated form of ets-2 at phosphorylation site threonine-72) and ets-2 (wild-type/wild-type [WT/WT]) control mice with sequential intraperitoneal injections of bleomycin, followed by quantitative measurements of lung fibrosis and inflammation and primary cell in vitro assays. Concentrations of phosphorylated ets-2 were detected via the single and dual immunohistochemical staining of murine lungs and lung sections from patients with idiopathic pulmonary fibrosis. Ets-2 (A72/A72) mice were protected from bleomycin-induced pulmonary fibrosis, compared with ets-2 (WT/WT) mice. This protection was characterized by decreased lung pathological abnormalities and the fibrotic gene expression of Type I collagen, Type III collagen, α-smooth muscle actin, and connective tissue growth factor. Immunohistochemical staining of lung sections from bleomycin-treated ets-2 (WT/WT) mice and from patients with idiopathic pulmonary fibrosis demonstrated increased staining of phosphorylated ets-2 that colocalized with Type I collagen expression and to fibroblastic foci. Lastly, primary lung fibroblasts from ets-2 (A72/A72) mice exhibited decreased expression of Type I collagen in response to stimulation with TGF-β, compared with fibroblasts from ets-2 (WT/WT) mice. These data indicate the importance of phosphorylated ets-2 in the pathogenesis of pulmonary fibrosis through the expression of Type I collagen and (myo)fibroblast activation. PMID:21562315

  3. Methylation Status of SP1 Sites within miR-23a-27a-24-2 Promoter Region Influences Laryngeal Cancer Cell Proliferation and Apoptosis

    PubMed Central

    Wang, Ye; Zhang, Zhao-Xiong; Chen, Sheng; Qiu, Guang-Bin; Xu, Zhen-Ming

    2016-01-01

    DNA methylation plays critical roles in regulation of microRNA expression and function. miR-23a-27a-24-2 cluster has various functions and aberrant expression of the cluster is a common event in many cancers. However, whether DNA methylation influences the cluster expression and function is not reported. Here we found a CG-rich region spanning two SP1 sites in the cluster promoter region. The SP1 sites in the cluster were demethylated and methylated in Hep2 cells and HEK293 cells, respectively. Meanwhile, the cluster was significantly upregulated and downregulated in Hep2 cells and HEK293 cells, respectively. The SP1 sites were remethylated and the cluster was significantly downregulated in Hep2 cells into which methyl donor, S-adenosyl-L-methionine, was introduced. Moreover, S-adenosyl-L-methionine significantly increased Hep2 cell viability and repressed Hep2 cell early apoptosis. We also found that construct with two SP1 sites had highest luciferase activity and SP1 specifically bound the gene cluster promoter in vitro. We conclude that demethylated SP1 sites in miR-23a-27a-24-2 cluster upregulate the cluster expression, leading to proliferation promotion and early apoptosis inhibition in laryngeal cancer cells. PMID:27099864

  4. The Factors of Design on Playing Equipment in Young Children Schools by Viewpoint of Young Children Behavioral Development

    ERIC Educational Resources Information Center

    Kuo, Chuen-tzay

    2009-01-01

    The main purpose of this study was to explore the care-givers of preschool education institutions whose cognition on playing equipment functions, conditions of both setting and using, and the main factors which should beware of design. Besides, not only constructed the factors of design, but also provided suggestions about setting and designing of…

  5. Age, Sex and Socioeconomic Background as Factors in Preschool Children's Preference for Play Materials.

    ERIC Educational Resources Information Center

    Bogdanoff, Ruth F.; Peebles, Linda M.

    A total of 103 preschool children of lower and middle socioeconomic status families were observed in three preschool programs during 15 standardized free play periods for the purpose of investigating preschool children's preferences for different types of traditionally used play materials. The influence of age, sex, and socioeconomic status (SES)…

  6. The anti-proliferative effects of type I IFN involve STAT6-mediated regulation of SP1 and BCL6.

    PubMed

    Hsu, Yu-An; Huang, Chi-Chun; Kung, Yung-Jen; Lin, Hui-Ju; Chang, Ching-Yao; Lee, Kuan-Rong; Wan, Lei

    2016-06-01

    Type I IFN-induced STAT6 has been shown to have anti-proliferative effects in Daudi and B cells. IFN-sensitive (DS) and IFN-resistant (DR) subclones of Daudi cells were used to study the role of STAT6 in the anti-proliferative activities. Type I IFN significantly increased STAT6 mRNA and protein expression in DS but not DR cells. STAT6 knockdown significantly reduced the sensitivity to IFN in both cell lines. The molecular targets and functional importance of IFN-activated STAT6 were performed by chromatin immunoprecipitation-on-chip (ChIP-on-chip) experiments in type I IFN-treated Daudi cells. Two target genes (Sp1 and BCL6) were selected from the ChIP-on-chip data. IFN-induced STAT6 activation led to Sp1 upregulation and BCL6 downregulation in DS cells, with only minimal effects in DR cells. siRNA inhibition of STAT6 expression resulted in decreased Sp1 and BCL6 mRNA and protein levels in both DS and DR cells. IFN treatment did not increase Sp1 and BCL6 expression in a STAT2-deficient RST2 cell line, and this effect was mitigated by plasmid overexpression of STAT2, indicating that STAT2 is important for STAT6 activation. These results suggest that STAT6 plays an important role in regulating Sp1 and BCL6 through STAT2 to exert the anti-proliferative effects of type I IFN. PMID:26945968

  7. Sp1 and CREB regulate basal transcription of the human SNF2L gene

    SciTech Connect

    Xia Yu; Jiang Baichun; Zou Yongxin; Gao Guimin; Shang Linshan; Chen Bingxi; Liu Qiji; Gong Yaoqin

    2008-04-04

    Imitation Switch (ISWI) is a member of the SWI2/SNF2 superfamily of ATP-dependent chromatin remodelers, which are involved in multiple nuclear functions, including transcriptional regulation, replication, and chromatin assembly. Mammalian genomes encode two ISWI orthologs, SNF2H and SNF2L. In order to clarify the molecular mechanisms governing the expression of human SNF2L gene, we functionally examined the transcriptional regulation of human SNF2L promoter. Reporter gene assays demonstrated that the minimal SNF2L promoter was located between positions -152 to -86 relative to the transcription start site. In this region we have identified a cAMP-response element (CRE) located at -99 to -92 and a Sp1-binding site at -145 to -135 that play a critical role in regulating basal activity of human SNF2L gene, which were proven by deletion and mutation of specific binding sites, EMSA, and down-regulating Sp1 and CREB via RNAi. This study provides the first insight into the mechanisms that control basal expression of human SNF2L gene.

  8. Mineralocorticoid receptor interaction with SP1 generates a new response element for pathophysiologically relevant gene expression

    PubMed Central

    Meinel, Sandra; Ruhs, Stefanie; Schumann, Katja; Strätz, Nicole; Trenkmann, Kay; Schreier, Barbara; Grosse, Ivo; Keilwagen, Jens; Gekle, Michael; Grossmann, Claudia

    2013-01-01

    The mineralocorticoid receptor (MR) is a ligand-induced transcription factor belonging to the steroid receptor family and involved in water-electrolyte homeostasis, blood pressure regulation, inflammation and fibrosis in the renocardiovascular system. The MR shares a common hormone-response-element with the glucocorticoid receptor but nevertheless elicits MR-specific effects including enhanced epidermal growth factor receptor (EGFR) expression via unknown mechanisms. The EGFR is a receptor tyrosine kinase that leads to activation of MAP kinases, but that can also function as a signal transducer for other signaling pathways. In the present study, we mechanistically investigate the interaction between a newly discovered MR- but not glucocorticoid receptor- responsive-element (=MRE1) of the EGFR promoter, specificity protein 1 (SP1) and MR to gain general insights into MR-specificity. Biological relevance of the interaction for EGFR expression and consequently for different signaling pathways in general is demonstrated in human, rat and murine vascular smooth muscle cells and cells of EGFR knockout mice. A genome-wide promoter search for identical binding regions followed by quantitative PCR validation suggests that the identified MR-SP1–MRE1 interaction might be applicable to other genes. Overall, a novel principle of MR-specific gene expression is explored that applies to the pathophysiologically relevant expression of the EGFR and potentially also to other genes. PMID:23821666

  9. Life Cycle Reversal in Aurelia sp.1 (Cnidaria, Scyphozoa)

    PubMed Central

    He, Jinru; Zheng, Lianming; Zhang, Wenjing; Lin, Yuanshao

    2015-01-01

    The genus Aurelia is one of the major contributors to jellyfish blooms in coastal waters, possibly due in part to hydroclimatic and anthropogenic causes, as well as their highly adaptive reproductive traits. Despite the wide plasticity of cnidarian life cycles, especially those recognized in certain Hydroza species, the known modifications of Aurelia life history were mostly restricted to its polyp stage. In this study, we document the formation of polyps directly from the ectoderm of degenerating juvenile medusae, cell masses from medusa tissue fragments, and subumbrella of living medusae. This is the first evidence for back-transformation of sexually mature medusae into polyps in Aurelia sp.1. The resulting reconstruction of the schematic life cycle of Aurelia reveals the underestimated potential of life cycle reversal in scyphozoan medusae, with possible implications for biological and ecological studies. PMID:26690755

  10. SENP3 regulates the global protein turnover and the Sp1 level via antagonizing SUMO2/3-targeted ubiquitination and degradation.

    PubMed

    Wang, Ming; Sang, Jing; Ren, Yanhua; Liu, Kejia; Liu, Xinyi; Zhang, Jian; Wang, Haolu; Wang, Jian; Orian, Amir; Yang, Jie; Yi, Jing

    2016-01-01

    SUMOylation is recently found to function as a targeting signal for the degradation of substrates through the ubiquitin-proteasome system. RNF4 is the most studied human SUMO-targeted ubiquitin E3 ligase. However, the relationship between SUMO proteases, SENPs, and RNF4 remains obscure. There are limited examples of the SENP regulation of SUMO2/3-targeted proteolysis mediated by RNF4. The present study investigated the role of SENP3 in the global protein turnover related to SUMO2/3-targeted ubiquitination and focused in particular on the SENP3 regulation of the stability of Sp1. Our data demonstrated that SENP3 impaired the global ubiquitination profile and promoted the accumulation of many proteins. Sp1, a cancer-associated transcription factor, was among these proteins. SENP3 increased the level of Sp1 protein via antagonizing the SUMO2/3-targeted ubiquitination and the consequent proteasome-dependent degradation that was mediated by RNF4. De-conjugation of SUMO2/3 by SENP3 attenuated the interaction of Sp1 with RNF4. In gastric cancer cell lines and specimens derived from patients and nude mice, the level of Sp1 was generally increased in parallel to the level of SENP3. These results provided a new explanation for the enrichment of the Sp1 protein in various cancers, and revealed a regulation of SUMO2/3 conjugated proteins whose levels may be tightly controlled by SENP3 and RNF4. PMID:26511642

  11. Factors Related to Play Therapists' Social Justice Advocacy Attitudes

    ERIC Educational Resources Information Center

    Parikh, Sejal B.; Ceballos, Peggy; Post, Phyllis

    2013-01-01

    The authors used a correlational research design to examine how belief in a just world, political ideology, socioeconomic status of family of origin, and percentage of racial minority clients were related to social justice advocacy attitudes among play therapists. A multiple regression was used to analyze the data. Results indicated that belief in…

  12. Betulinic acid decreases specificity protein 1 (Sp1) level via increasing the sumoylation of sp1 to inhibit lung cancer growth.

    PubMed

    Hsu, Tsung-I; Wang, Mei-Chun; Chen, Szu-Yu; Huang, Shih-Ting; Yeh, Yu-Min; Su, Wu-Chou; Chang, Wen-Chang; Hung, Jan-Jong

    2012-12-01

    Previous studies have shown that the inhibitory effect of betulinic acid (BA) on specificity protein 1 (Sp1) expression is involved in the prevention of cancer progression, but the mechanism of this effect remains to be delineated. In this study, we determined that BA treatment in HeLa cells increased the sumoylation of Sp1 by inhibiting sentrin-specific protease 1 expression. The subsequent recruitment of E3 ubiquitin-protein ligase RING finger protein 4 resulted in ubiquitin-mediated degradation in a 26S-proteosome-dependent pathway. In addition, both BA treatment and mithramycin A (MMA) treatment inhibited lung tumor growth and down-regulated Sp1 protein expression in Kras(G12D)-induced lung cancers of bitransgenic mice. In gene expression profiles of Kras(G12D)-induced lung cancers in bitransgenic mice with and without Sp1 inhibition, 542 genes were affected by MMA treatment. One of the gene products, cyclin A2, which was involved in the S and G(2)/M phase transition during cell cycle progression, was investigated in detail because its expression was regulated by Sp1. The down-regulation of cyclin A2 by BA treatment resulted in decreased retinoblastoma protein phosphorylation and cell cycle G(2)/M arrest. The BA-mediated cellular Sp1 degradation and antitumor effect were also confirmed in a xenograft mouse model by using H1299 cells. The knockdown of Sp1 in lung cancer cells attenuated the tumor-suppressive effect of BA. Taken together, the results of this study clarify the mechanism of BA-mediated Sp1 degradation and identify a pivotal role for Sp1 in the BA-induced repression of lung cancer growth. PMID:22956772

  13. SP1 and USF differentially regulate ADAMTS1 gene expression under normoxic and hypoxic conditions in hepatoma cells.

    PubMed

    Turkoglu, Sumeyye Aydogan; Kockar, Feray

    2016-01-01

    ADAM metallopeptidase with thrombospondin type I motif, 1 (ADAMTS1) that has both antiangiogenic and aggrecanase activity was dysregulated in many pathophysiologic circumstances. However, there is limited information available on the transcriptional regulation of ADAMTS1 gene. Therefore, this study mainly aimed to identify regulatory regions important for the regulation of ADAMTS1 gene under normoxic and hypoxic conditions in human hepatoma cells (HEP3B). Cultured HEP3B cells were exposed to normal oxygen condition, and Cobalt chloride (CoCl2) induced the hypoxic condition, which is an HIF-1 inducer. The cocl2-induced hypoxic condition led to the induced ADAMTS1 mRNA and protein expression in Hepatoma cells. Differential regulation of SP1 and USF transcription factors on ADAMTS1 gene expression was determined by transcriptional activity, mRNA and protein level of ADAMTS1 gene. Ectopic expression of SP1 and USF transcription factors resulted in the decrease in ADAMTS1 transcriptional activity of all promoter constructs consistent with mRNA and protein level in normoxic condition. However, overexpression of SP1 and USF led to the increase of ADAMTS1 gene expressions at mRNA and protein level in hypoxic condition. On the other hand, C/EBPα transcription factor didn't show any statistically significant effect on ADAMTS1 gene expression at mRNA, protein and transcriptional level under normoxic and hypoxic condition. PMID:26299656

  14. Playing a Musical Instrument as a Protective Factor against Dementia and Cognitive Impairment: A Population-Based Twin Study

    PubMed Central

    Pedersen, Nancy L.

    2014-01-01

    Increasing evidence supports that playing a musical instrument may benefit cognitive development and health at young ages. Whether playing an instrument provides protection against dementia has not been established. In a population-based cotwin control study, we examined the association between playing a musical instrument and whether or not the twins developed dementia or cognitive impairment. Participation in playing an instrument was taken from informant-based reports of twins' leisure activities. Dementia diagnoses were based on a complete clinical workup using standard diagnostic criteria. Among 157 twin pairs discordant for dementia and cognitive impairment, 27 pairs were discordant for playing an instrument. Controlling for sex, education, and physical activity, playing a musical instrument was significantly associated with less likelihood of dementia and cognitive impairment (odds ratio [OR] = 0.36 [95% confidence interval 0.13–0.99]). These findings support further consideration of music as a modifiable protective factor against dementia and cognitive impairment. PMID:25544932

  15. First functional polymorphism in CFTR promoter that results in decreased transcriptional activity and Sp1/USF binding

    SciTech Connect

    Taulan, M. Lopez, E.; Guittard, C.; Rene, C.; Baux, D.; Altieri, J.P.; DesGeorges, M.; Claustres, M.; Romey, M.C.

    2007-09-28

    Growing evidences show that functionally relevant polymorphisms in various promoters alter both transcriptional activity and affinities of existing protein-DNA interactions, and thus influence disease progression in humans. We previously reported the -94G>T CFTR promoter variant in a female CF patient in whom any known disease-causing mutation has been detected. To investigate whether the -94G>T could be a regulatory variant, we have proceeded to in silico analyses and functional studies including EMSA and reporter gene assays. Our data indicate that the promoter variant decreases basal CFTR transcriptional activity in different epithelial cells and alters binding affinities of both Sp1 and USF nuclear proteins to the CFTR promoter. The present report provides evidence for the first functional polymorphism that negatively affects the CFTR transcriptional activity and demonstrates a cooperative role of Sp1 and USF transcription factors in transactivation of the CFTR gene promoter.

  16. Chromatin, TAFs, and a novel multiprotein coactivator are required for synergistic activation by Sp1 and SREBP-1a in vitro.

    PubMed

    Näär, A M; Beaurang, P A; Robinson, K M; Oliner, J D; Avizonis, D; Scheek, S; Zwicker, J; Kadonaga, J T; Tjian, R

    1998-10-01

    The promoter selectivity factor Sp1 often cooperates with other enhancer-binding proteins to activate transcription. To study the molecular underpinnings of these regulatory events, we have reconstituted in vitro the synergy observed in vivo between Sp1 and the sterol-regulated factor SREBP-1a at the low density lipoprotein receptor (LDLR) promoter. Using a highly purified human transcription system, we found that chromatin, TAFs, and a novel SREBP-binding coactivator activity, which includes CBP, are all required to mediate full synergistic activation by Sp1 and SREBP-1a. The SREBP-binding domain of CBP inhibits activation by SREBP-1a and Sp1 in a dominant-negative fashion that is both chromatin- and activator-specific. Whereas recombinant CBP alone is not sufficient to mediate activation, a human cellular fraction containing CBP can support high levels of chromatin-dependent synergistic activation. Purification of this activity to near homogeneity resulted in the identification of a multiprotein coactivator, including CBP, that selectively binds to the SREBP-1a activation domain and is capable of mediating high levels of synergistic activation by SREBP/Sp1 on chromatin templates. The development of a reconstituted chromatin transcription system has allowed us to isolate a novel coactivator that is recruited by the SREBP-1a activation domain and that functions in concert with TFIID to coordinate the action of multiple activators at complex promoters in the context of chromatin. PMID:9765204

  17. SP1-binding elements, within the common metaxin-thrombospondin 3 intergenic region, participate in the regulation of the metaxin gene.

    PubMed Central

    Collins, M; Bornstein, P

    1996-01-01

    Metaxin (Mtx) is an essential nuclear gene which is expressed ubiquitously in mice and encodes a mitochondrial protein. The gene is located upstream and is transcribed divergently from the thrombospondin 3 (Thbs3) gene; 1352 nucleotides separate the putative translation start sites. Although the Mtx and Thbs3 genes share a common intergenic region, transient transfection experiments in rat chondro-sarcoma cells and in NIH-3T3 fibroblasts demonstrated that the elements required for expression of the Mtx gene are situated within a short proximal promoter and have no major effect on the transcription of Thbs3. The metaxin --377 bp promoter contains four clustered GC boxes between nucleotides --146 and --58 and an inverted GT box between nucleotides --152 and --161, but does not contain TATA or CCAAT boxes. Like many genes regulated by a TATA-less promoter, the transcription start site of metaxin is heterogeneous. The major start site is only 13 bp upstream from the putative translation start site. Electrophoretic mobility shift, competition and supershift assays showed that the ubiquitous transcription factor, Sp1, and, to a lesser extent, the Sp1-related protein, Sp3, bind to four of these Sp1-binding motifs. Co-transfection of metaxin promoter-luciferase constructs and an Sp1 expression vector into Schneider Drosophila cells, which do not synthesize Sp1, demonstrated that the metaxin gene is activated by Sp1. Deletion of the four upstream Sp1-binding elements, on the other hand, demonstrated that these motifs are superfluous in context of the larger Mtx promoter. Thus, despite the potential for common regulatory mechanisms, the available evidence indicates that the Mtx minimal promoter does not significantly affect Thbs3 gene expression. PMID:8871542

  18. Nuclear Factor of Activated T-cells (NFAT) plays a role in SV40 infection

    PubMed Central

    Manley, Kate; O’Hara, Bethany A; Atwood, Walter J

    2008-01-01

    Recent evidence highlighted a role for the transcription factor, Nuclear Factor of Activated T-cells (NFAT), in the transcription of the human polyomavirus JCV. Here we show that NFAT is also important in the transcriptional control of the related polyomavirus, Simian Virus 40 (SV40). Inhibition of NFAT activity reduced SV40 infection of Vero, 293A and HeLa cells, and this block occurred at the stage of viral transcription. Both NFAT3 and NFAT4 bound to the SV40 promoter through κB sites located within the 72bp repeated enhancer region. In Vero cells NFAT was involved in late transcription, but in HeLa and 293A cells both early and late viral transcription required NFAT activity. SV40 large T-Ag was found to increase NFAT activity and provided a positive feedback loop to transactivate the SV40 promoter. PMID:18031784

  19. Nuclear factor of activated T-cells (NFAT) plays a role in SV40 infection

    SciTech Connect

    Manley, Kate; O'Hara, Bethany A.; Atwood, Walter J.

    2008-03-01

    Recent evidence highlighted a role for the transcription factor, nuclear factor of activated T-cells (NFAT), in the transcription of the human polyomavirus JCV. Here we show that NFAT is also important in the transcriptional control of the related polyomavirus, Simian Virus 40 (SV40). Inhibition of NFAT activity reduced SV40 infection of Vero, 293A, and HeLa cells, and this block occurred at the stage of viral transcription. Both NFAT3 and NFAT4 bound to the SV40 promoter through {kappa}B sites located within the 72 bp repeated enhancer region. In Vero cells, NFAT was involved in late transcription, but in HeLa and 293A cells both early and late viral transcription required NFAT activity. SV40 large T-Ag was found to increase NFAT activity and provided a positive feedback loop to transactivate the SV40 promoter.

  20. Mathematics performance and the role played by affective and background factors peter grootenboer and brian hemmings

    NASA Astrophysics Data System (ADS)

    Grootenboer, Peter; Hemmings, Brian

    2007-12-01

    In this article, we report on a study examining those factors which contribute to the mathematics performance of a sample of children aged between 8 and 13 years. The study was designed specifically to consider the potency of a number of mathematical affective factors, as well as background characteristics (viz., gender, ethnicity, and socioeconomic status), on children's mathematics performance. Data were collected by surveying the children and drawing on performance ratings from their teachers. A correlation analysis revealed that the relationships between the respective dispositional and background variables with mathematics performance were significant and in the direction as predicted. Moreover, the findings from a logistic regression showed that a combination of these variables was able to appropriately classify students who either were below-average or above-average mathematics performers. We pay particular attention to the influence of certain dispositions with respect to mathematics performance and conclude by detailing the implications of the study for teachers and researchers.

  1. Sp1-mediated nonmuscle myosin light chain kinase expression and enhanced activity in vascular endothelial growth factor–induced vascular permeability

    PubMed Central

    2015-01-01

    Abstract Despite the important role played by the nonmuscle isoform of myosin light chain kinase (nmMLCK) in vascular barrier regulation and the implication of both nmMLCK and vascular endothelial growth factor (VEGF) in the pathogenesis of acute respiratory distress syndrome (ARDS), the role played by nmMLCK in VEGF-induced vascular permeability is poorly understood. In this study, the role played by nmMLCK in VEGF-induced vascular hyperpermeability was investigated. Human lung endothelial cell barrier integrity in response to VEGF is examined in both the absence and the presence of nmMLCK small interfering RNAs. Levels of nmMLCK messenger RNA (mRNA), protein, and promoter activity expression were monitored after VEGF stimulation in lung endothelial cells. nmMYLK promoter activity was assessed using nmMYLK promoter luciferase reporter constructs with a series of nested deletions. nmMYLK transcriptional regulation was further characterized by examination of a key transcriptional factor. nmMLCK plays an important role in VEGF-induced permeability. We found that activation of the VEGF signaling pathway in lung endothelial cells increases MYLK gene product at both mRNA and protein levels. Increased nmMLCK mRNA and protein expression is a result of increased nmMYLK promoter activity, regulated in part by binding of the Sp1 transcription factor on triggering by the VEGF signaling pathway. Taken together, these findings suggest that MYLK is an important ARDS candidate gene and a therapeutic target that is highly influenced by excessive VEGF concentrations in the inflamed lung. PMID:26697178

  2. Down-regulation of EPHX2 gene transcription by Sp1 under high-glucose conditions.

    PubMed

    Oguro, Ami; Oida, Shoko; Imaoka, Susumu

    2015-09-15

    sEH (soluble epoxide hydrolase), which is encoded by the EPHX2 gene, regulates the actions of bioactive lipids, EETs (epoxyeicosatrienoic acids). Previously, we found that high-glucose-induced oxidative stress suppressed sEH levels in a hepatocarcinoma cell line (Hep3B) and sEH was decreased in streptozotocin-induced diabetic mice in vivo. In the present study, we investigated the regulatory mechanisms underlying EPHX2 transcriptional suppression under high-glucose conditions. The decrease in sEH was prevented by an Sp1 (specificity protein 1) inhibitor, mithramycin A, and overexpression or knockdown of Sp1 revealed that Sp1 suppressively regulated sEH expression, in contrast with the general role of Sp1 on transcriptional activation. In addition, we found that AP2α (activating protein 2α) promoted EPHX2 transcription. The nuclear transport of Sp1, but not that of AP2α, was increased under high glucose concomitantly with the decrease in sEH. Within the EPHX2 promoter -56/+32, five Sp1-binding sites were identified, and the mutation of each of these sites showed that the first one (SP1_1) was important in both suppression by Sp1 and activation by AP2α. Furthermore, overexpression of Sp1 diminished the binding of AP2α by DNA-affinity precipitation assay and ChIP, suggesting competition between Sp1 and AP2α on the EPHX2 promoter. These findings provide novel insights into the role of Sp1 in transcriptional suppression, which may be applicable to the transcriptional regulation of other genes. PMID:26341485

  3. Physiological TLR5 expression in the intestine is regulated by differential DNA binding of Sp1/Sp3 through simultaneous Sp1 dephosphorylation and Sp3 phosphorylation by two different PKC isoforms.

    PubMed

    Thakur, Bhupesh Kumar; Dasgupta, Nirmalya; Ta, Atri; Das, Santasabuj

    2016-07-01

    Toll-like receptor 5 (TLR5) expression in the intestinal epithelial cells (IECs) is critical to maintain health, as underscored by multiple intestinal and extra-intestinal diseases in mice genetically engineered for IEC-specific TLR5 knockout. A gradient of expression exists in the colonic epithelial cells from the cecum to the distal colon. Intriguingly, an identical gradient for the dietary metabolite, butyrate also exists in the luminal contents. However, both being critical for intestinal homeostasis and immune response, no studies examined the role of butyrate in the regulation of TLR5 expression. We showed that butyrate transcriptionally upregulates TLR5 in the IECs and augments flagellin-induced immune responses. Both basal and butyrate-induced transcription is regulated by differential binding of Sp-family transcription factors to the GC-box sequences over the TLR5 promoter. Butyrate activates two different protein kinase C isoforms to dephosphorylate/acetylate Sp1 by serine/threonine phosphatases and phosphorylate Sp3 by ERK-MAPK, respectively. This resulted in Sp1 displacement from the promoter and binding of Sp3 to it, leading to p300 recruitment and histone acetylation, activating transcription. This is the first study addressing the mechanisms of physiological TLR5 expression in the intestine. Additionally, a novel insight is gained into Sp1/Sp3-mediated gene regulation that may apply to other genes. PMID:27060138

  4. Physiological TLR5 expression in the intestine is regulated by differential DNA binding of Sp1/Sp3 through simultaneous Sp1 dephosphorylation and Sp3 phosphorylation by two different PKC isoforms

    PubMed Central

    Thakur, Bhupesh Kumar; Dasgupta, Nirmalya; Ta, Atri; Das, Santasabuj

    2016-01-01

    Toll-like receptor 5 (TLR5) expression in the intestinal epithelial cells (IECs) is critical to maintain health, as underscored by multiple intestinal and extra-intestinal diseases in mice genetically engineered for IEC-specific TLR5 knockout. A gradient of expression exists in the colonic epithelial cells from the cecum to the distal colon. Intriguingly, an identical gradient for the dietary metabolite, butyrate also exists in the luminal contents. However, both being critical for intestinal homeostasis and immune response, no studies examined the role of butyrate in the regulation of TLR5 expression. We showed that butyrate transcriptionally upregulates TLR5 in the IECs and augments flagellin-induced immune responses. Both basal and butyrate-induced transcription is regulated by differential binding of Sp-family transcription factors to the GC-box sequences over the TLR5 promoter. Butyrate activates two different protein kinase C isoforms to dephosphorylate/acetylate Sp1 by serine/threonine phosphatases and phosphorylate Sp3 by ERK-MAPK, respectively. This resulted in Sp1 displacement from the promoter and binding of Sp3 to it, leading to p300 recruitment and histone acetylation, activating transcription. This is the first study addressing the mechanisms of physiological TLR5 expression in the intestine. Additionally, a novel insight is gained into Sp1/Sp3-mediated gene regulation that may apply to other genes. PMID:27060138

  5. TRANSCRIPTION FACTOR Bmsage PLAYS A CRUCIAL ROLE IN SILK GLAND GENERATION IN SILKWORM, Bombyx mori.

    PubMed

    Xin, Hu-hu; Zhang, Deng-pan; Chen, Rui-ting; Cai, Zi-zheng; Lu, Yan; Liang, Shuang; Miao, Yun-gen

    2015-10-01

    Salivary gland secretion is altered in Drosophila embryos with loss of function of the sage gene. Saliva has a reduced volume and an increased electron density according to transmission electron microscopy, resulting in regions of tube dilation and constriction with intermittent tube closure. However, the precise functions of Bmsage in silkworm (Bombyx mori) are unknown, although its sequence had been deposited in SilkDB. From this, Bmsage is inferred to be a transcription factor that regulates the synthesis of silk fibroin and interacts with another silk gland-specific transcription factor, namely, silk gland factor-1. In this study, we introduced a germline mutation of Bmsage using the Cas9/sgRNA system, a genome-editing technology, resulting in deletion of Bmsage from the genome of B. mori. Of the 15 tested samples, seven displayed alterations at the target site. The mutagenesis efficiency was about 46.7% and there were no obvious off-target effects. In the screened homozygous mutants, silk glands developed poorly and the middle and posterior silk glands (MSG and PSG) were absent, which was significantly different from the wild type. The offspring of G0 mosaic silkworms had indel mutations causing 2- or 9-bp deletions at the target site, but exhibited the same abnormal silk gland structure. Mutant larvae containing different open-reading frames of Bmsage had the same silk gland phenotype. This illustrated that the mutant phenotype was due to Bmsage knockout. We conclude that Bmsage participates in embryonic development of the silk gland. PMID:25917878

  6. Which factors play a role in clinical decision-making in subfertility?

    PubMed

    van der Steeg, Jan W; Steures, Pieternel; Eijkemans, Marinus J C; Habbema, J Dik F; Bossuyt, Patrick M M; Hompes, Peter G A; van der Veen, Fulco; Mol, Ben W J

    2006-04-01

    Sixteen vignettes of subfertile couples were constructed by varying fertility history, post-coital test, sperm motility, FSH concentration and Chlamydia antibody titre (CAT). Thirty-five gynaecologists estimated probabilities of treatment-independent pregnancy, intrauterine insemination (IUI) and IVF. Thereafter, they chose IUI, IVF or no treatment. The relative contribution of each factor to probability estimates and to subsequent treatment decisions was calculated. Duration of subfertility and maternal age were the most important contributors for gynaecologists' estimates of treatment-independent pregnancy [relative contribution (RC) 41, 26%]. Maternal age and FSH concentration were the most important contributors in the estimates for IUI (RC: 51, 25%) and for IVF (RC: 64, 31%). The decision to start IVF was mainly determined by maternal age, duration of subfertility, FSH concentration and CAT. The relative contribution of maternal age and duration of subfertility was in concordance with existing prediction models, whereas previous pregnancy and FSH concentration were under- and overestimated respectively. In conclusion, maternal age, duration of subfertility and FSH concentration are the main factors in clinical decision-making in subfertility. Gynaecologists overestimate the importance of FSH concentration, but underestimate that of a previous pregnancy, as compared with their importance reported in prediction models and guidelines. PMID:16740221

  7. Basal transcription factor 3 plays an important role in seed germination and seedling growth of rice.

    PubMed

    Wang, Wenyi; Xu, Mengyun; Wang, Ya; Jamil, Muhammad

    2014-01-01

    BTF3 has been recognized to be involved in plant growth and development. But its function remains mostly unknown during seed germination and seedling stage. Here, we have analyzed OsBTF3-related sequences in Oryza sativa L. subspecies, japonica, which resembles with the conserved domain of a nascent polypeptide associated complex (NAC) with different homologs of OsBTF3 and human BTF3. Inhibition of Osj10gBTF3 has led to considerable morphological changes during seed germination and seedling growth. Germination percentage was not influenced by the application of GA3, ABA, and NaCl but all concentrations caused wild-type (WT) seeds to germinate more rapidly than the RNAi (Osj10gBTF3 (Ri)) transgenic lines. Seedling inhibition was more severe in the Osj10gBTF3 (Ri) seedlings compared with their WT especially when treated with 100 or 200 μM GA3; 50% reduction in shoots was observed in Osj10gBTF3 (Ri) seedlings. The expression of Osj3g1BTF3, Osj3g2BTF3 and Osj10gBTF3 was primarily constitutive and generally modulated by NaCl, ABA, and GA3 stresses in both Osj10gBTF3 (Ri) lines and WT at the early seedling stage, suggesting that Osj3g1BTF3 and Osj10gBTF3 are much similar but different from Osj3g2BTF3 in biological function. These results show that OsBTF3 plays an important role in seed germination and seedling growth gives a new perception demonstrating that more multifaceted regulatory functions are linked with BTF3 in plants. PMID:24971328

  8. Genome Sequence of the Microsporidian Species Nematocida sp1 Strain ERTm6 (ATCC PRA-372)

    PubMed Central

    Bakowski, Malina A.; Priest, Margaret; Young, Sarah

    2014-01-01

    Microsporidia comprise a phylum of obligate intracellular pathogens related to fungi. Microsporidia Nematocida sp1 strain ERTm6 was isolated from wild-caught Caenorhabditis briggsae and causes a lethal intestinal infection in Caenorhabditis nematodes. We report the genome sequence of N. sp1 ERTm6, which will facilitate study of the Nematocida genus and other Microsporidia. PMID:25237020

  9. Sex differences in visuospatial ability: do performance factors play such an important role?

    PubMed

    Delgado, A R; Prieto, G

    1996-07-01

    This study was designed to analyze some performance factors as a possible source of sex-related bias in psychometric tests of visuospatial aptitude. Goldstein, Haldane, and Mitchell (1990) explored the effect of two response styles-slowness of performance and reluctance to guess-by using a 3-D mental rotation test (the task showing the largest cognitive sex difference) and found that time limits and raw scores contributed substantially to the male advantage. We applied two tests in the speed-power continuum to a representative sample of 621 males and 821 females in their last year of high school in a 2 x 2 (gender x time) full factorial design. Reluctance to guess was similar for males and females. Males obtained more correct responses on both tests, and for both time conditions, than did females. These results are not only statistically significant but also are of substantial practical consequence. PMID:8757498

  10. Liver Stiffness Measurement in Psoriasis: Do Metabolic or Disease Factors Play the Important Role?

    PubMed Central

    Pongpit, Jamrus; Porntharukchareon, Saneerat; Kaewduang, Piyaporn; Promson, Kwannapa; Stitchantrakul, Wasana; Petraksa, Supanna; Thakkinstian, Ammarin; Kositchaiwat, Chomsri; Rajatanavin, Natta; Sobhonslidsuk, Abhasnee

    2016-01-01

    Background. An increased prevalence of metabolic syndrome including nonalcoholic fatty liver disease (NAFLD) was reported in psoriasis. NAFLD can progress to nonalcoholic steatohepatitis and fibrosis. Transient elastography (TE) is a noninvasive liver fibrosis assessment. We evaluated the prevalence of significant liver fibrosis or high liver stiffness measurement (LSM) using the LSM cutoff over 7 kPa and its associated factors in psoriatic patients. Methods. Subjects underwent TE and ultrasonography. Univariate and multivariate analysis were performed for the associated factors. Results. One hundred and sixty-eight patients were recruited. Three patients were excluded due to TE failure. Mean BMI was 24.8 ± 4.7 kg/m2. NAFLD, metabolic syndrome, and diabetes were seen in 105 (63.6%), 83 (50.3%), and 31 (18.8%) patients. The total cumulative dose of methotrexate over 1.5 g was seen in 39 (23.6%) patients. Mean LSM was 5.3 ± 2.9 kPa. High LSM was found in 18 (11.0%) patients. Waist circumference (OR: 1.24; 95% CI: 1.11–1.38; P = 0.0002), diabetes (OR: 12.70; 95% CI: 1.84–87.70; P = 0.010), and AST (OR: 1.08; 95% CI: 1.02–1.16; P = 0.017) were associated with high LSM. Conclusion. 11% of psoriatic patients had significant liver fibrosis by high LSM. Waist circumference, diabetes, and AST level were the independent predictors. PMID:27006950

  11. Liver Stiffness Measurement in Psoriasis: Do Metabolic or Disease Factors Play the Important Role?

    PubMed

    Pongpit, Jamrus; Porntharukchareon, Saneerat; Kaewduang, Piyaporn; Promson, Kwannapa; Stitchantrakul, Wasana; Petraksa, Supanna; Thakkinstian, Ammarin; Kositchaiwat, Chomsri; Rajatanavin, Natta; Sobhonslidsuk, Abhasnee

    2016-01-01

    Background. An increased prevalence of metabolic syndrome including nonalcoholic fatty liver disease (NAFLD) was reported in psoriasis. NAFLD can progress to nonalcoholic steatohepatitis and fibrosis. Transient elastography (TE) is a noninvasive liver fibrosis assessment. We evaluated the prevalence of significant liver fibrosis or high liver stiffness measurement (LSM) using the LSM cutoff over 7 kPa and its associated factors in psoriatic patients. Methods. Subjects underwent TE and ultrasonography. Univariate and multivariate analysis were performed for the associated factors. Results. One hundred and sixty-eight patients were recruited. Three patients were excluded due to TE failure. Mean BMI was 24.8 ± 4.7 kg/m(2). NAFLD, metabolic syndrome, and diabetes were seen in 105 (63.6%), 83 (50.3%), and 31 (18.8%) patients. The total cumulative dose of methotrexate over 1.5 g was seen in 39 (23.6%) patients. Mean LSM was 5.3 ± 2.9 kPa. High LSM was found in 18 (11.0%) patients. Waist circumference (OR: 1.24; 95% CI: 1.11-1.38; P = 0.0002), diabetes (OR: 12.70; 95% CI: 1.84-87.70; P = 0.010), and AST (OR: 1.08; 95% CI: 1.02-1.16; P = 0.017) were associated with high LSM. Conclusion. 11% of psoriatic patients had significant liver fibrosis by high LSM. Waist circumference, diabetes, and AST level were the independent predictors. PMID:27006950

  12. YY1 and Sp1 activate transcription of the human NDUFS8 gene encoding the mitochondrial complex I TYKY subunit.

    PubMed

    Lescuyer, Pierre; Martinez, Pascal; Lunardi, Joël

    2002-03-19

    Complex I is the most complicated of the multimeric enzymes that constitute the mitochondrial respiratory chain. It is encoded by both mitochondrial and nuclear genomes. We have previously characterized the human NDUFS8 gene that encodes the TYKY subunit. This essential subunit is thought to participate in the electron transfer and proton pumping activities of complex I. Here, we have analyzed the transcriptional regulation of the NDUFS8 gene. Using primer extension assays, we have identified two transcription start sites. The basal promoter was mapped to a 247 bp sequence upstream from the main transcription start site by reporter gene analysis in HeLa cells and in differentiated or non-differentiated C2C12 cells. Three Sp1 sites and one YY1 site were identified in this minimal promoter. Through gel shift analysis, all sites were shown to bind to their cognate transcription factors. Site-directed mutagenesis revealed that the YY1 site and two upstream adjacent Sp1 sites drive most of the promoter activity. This work represents the first promoter analysis for a complex I gene. Together with previous studies, our results indicate that YY1 and Sp1 control the expression of genes encoding proteins that are involved in almost all steps of the oxidative phosphorylation metabolism. PMID:11955626

  13. [Progression of arthrosis after alloplasty--what factors play a role?].

    PubMed

    Küllmer, K; Letsch, R; Schmit-Neuerburg, K P; Turowski, B

    1996-06-01

    From 87 patients who underwent anterior cruciate ligament (ACL) surgery with an alloplastic ligament (Trevira hochfest) the radiographs of 77 patients were examined by 2 physicians, who were not involved in the operation. They evaluated the increase of degenerative osteoarthritis according to the classification by Holz [12] finding a significant increase of degenerative osteoarthritis after surgery with a mean follow-up of 41.2 months. The ligament reconstruction was performed in 50 fresh ACL tears by reinsertion plus synthetic ligament protection and in 27 chronic instabilities with several failed previous operations by using the alloplastic ligament as an ACL prosthesis by means of a salvage procedure. Both investigators found a significant increase of degenerative osteoarthritis in both groups, but the chronically instable knees had a higher initial value. Patients with concomitant meniscus and/or posterior cruciate ligament (PCL) ruptures showed the highest increase of osteoarthritic changes; isolated ACL tears were found with very low degeneration. Considering the special profile of our collective, the factors that were found to as a risk of osteoarthritis and the comparison with the literature we could not find any indication for a relevantly increased risk of osteoarthritic progression using the Trevira hochfest ligament. PMID:8767384

  14. The ‘Perfect Storm’ and Acute Coronary Syndrome Onset: Do Psychosocial Factors Play a Role?

    PubMed Central

    Burg, Matthew M.; Edmondson, Donald; Shimbo, Daichi; Shaffer, Jonathan; Kronish, Ian M.; Whang, William; Alcántara, Carmela; Schwartz, Joseph E.; Muntner, Paul; Davidson, Karina W.

    2013-01-01

    The revolution in cardiac care over the past two decades, characterized by emergent revascularization, drug eluting stents, anti-platelet medications, and advanced imaging has had little impact on overall ACS recurrence, or ACS prevention. The “Perfect Storm” refers to a confluence of events and processes, including atherosclerotic plaque, coronary flow dynamics, hemostatic and fibrinolytic function, metabolic and inflammatory conditions, neurohormonal dysregulation, and environmental events that give rise to, and result in an ACS event. In this article we illustrate the limits of the traditional main effect research model, giving a brief description of the current state of knowledge regarding the development of atherosclerotic plaque and the rupturing of these plaques that defines an ACS event. We then apply the Perfect Storm conceptualization to describe a program of research concerning a psychosocial vulnerability factor that contributes to increased risk of recurrent ACS and early mortality, and that has defied our efforts to identify underlying pathophysiology and successfully mount efforts to fully mitigate this risk. PMID:23621970

  15. Cyclin A regulates a cell-cycle-dependent expression of CKAP2 through phosphorylation of Sp1

    SciTech Connect

    Kang, Du-Seock; Hong, Kyeong-Man; Park, Joobae; Bae, Chang-Dae

    2012-04-20

    Highlights: Black-Right-Pointing-Pointer We identified a GC box and a CHR element in human CKAP2 minimal promoter. Black-Right-Pointing-Pointer The CHR element repressed the CKAP2 minimal promoter activity at the G1/S phase. Black-Right-Pointing-Pointer The GC box was essential for the basic promoter activity of human CKAP2. Black-Right-Pointing-Pointer The GC box was also essential for the cyclic expression of human CKAP2. Black-Right-Pointing-Pointer The phosphorylation of Sp1, mediated by Cyclin A, underlies the cyclic expression. -- Abstract: CKAP2 plays crucial roles in proper chromosome segregation and maintaining genomic stability. CKAP2 protein showed cell-cycle-dependent expression, which reached a maximum level at the G2/M phase and disappeared at the onset of G1 phase. To elucidate the mechanisms underlying cell cycle-dependent expression of CKAP2, we cloned and analyzed the human CKAP2 promoter. The upstream 115-bp region from the transcription start site was sufficient for minimal CKAP2 promoter activity. We identified 2 regulatory sequences; a CHR (-110 to -104 bp) and a GC box (-41 to -32 bp). We confirmed Sp1 bound to the GC box using a supershift assay and a ChIP assay. Mutation in the GC box resulted in a near complete loss of CKAP2 promoter activity while mutation in the CHR decreased the promoter activity by 50%. The CHR mutation showed enhanced activity at the G1/S phase, but still retained cyclic activity. The Chromatin IP revealed that the amount of Sp1 bound to the GC box gradually increased and reached a maximum level at the G2/M phase. The amount of Sp1 bound to the GC box was greatly reduced when Cyclin A was depleted, which was restored by adding Cyclin A/Cdk2 complex back into the nuclear extracts. Together, we concluded that the GC box was responsible for the cyclic activity of human CKAP2 promoter through the phosphorylation of Sp1, possibly by Cyclin A/Cdk complex.

  16. Eukaryotic Initiation Factor 5A Plays an Essential Role in Luteinizing Hormone Receptor Regulation

    PubMed Central

    Menon, Bindu; Gulappa, Thippeswamy

    2014-01-01

    Down-regulation of LH receptor (LHR) in the ovary by its ligand is mediated by a specific RNA-binding protein, designated LH receptor mRNA–binding protein (LRBP), through translational suppression and mRNA degradation. Using yeast 2-hybrid screens, we previously identified eukaryotic initiation factor 5A (eIF5A) as one of the proteins that interacts with LRBP during LHR mRNA down-regulation. The present study examined the role of eIF5A and its hypusination in the context of LHR mRNA down-regulation. The association of eIF5A with LRBP or LHR mRNA was determined using immunoprecipitation and RNA immunoprecipitation assays. The results showed that the association of eIF5A with the LHR mRNA-LRBP complex increased significantly during down-regulation. Furthermore, gel fractionation and the hypusination activity assay both showed increased hypusination of eIF5A during LHR mRNA down-regulation. Abolishment of hypusination by pretreatment with the chemical inhibitor GC7 prevented the association of eIF5A with LHR mRNA and LRBP. Inhibition of hypusination also reduced the extent of ligand-induced down-regulation of LHR mRNA as well as the expression of functional LHRs assessed by real-time PCR and 125I-human chorionic gonadotropin (hCG) binding assays, respectively. The loss of human chorionic gonadotropin–mediated downstream signaling during LHR down-regulation was also restored by inhibition of hypusination of eIF5A. Thus, the present study, for the first time, reveals the crucial role of eIF5A and its hypusination in the regulation of LHR expression in the ovary. PMID:25216047

  17. PP2A inhibitors arrest G2/M transition through JNK/Sp1-dependent down-regulation of CDK1 and autophagy-dependent up-regulation of p21

    PubMed Central

    Zhi, Qiaoming; Xu, Ze-Kuan; Wang, Rong; Wang, Wen-Jie; Zong, Yang; Li, Zeng-Liang; Wu, Yadi; Zhou, Binhua P.; Chen, Kai; Tao, Min; Li, Wei

    2015-01-01

    Protein phosphatase 2A (PP2A) plays an important role in the control of the cell cycle. We previously reported that the PP2A inhibitors, cantharidin and okadaic acid (OA), efficiently repressed the growth of cancer cells. In the present study, we found that PP2A inhibitors arrested the cell cycle at the G2 phase through a mechanism that was dependent on the JNK pathway. Microarrays further showed that PP2A inhibitors induced expression changes in multiple genes that participate in cell cycle transition. To verify whether these expression changes were executed in a PP2A-dependent manner, we targeted the PP2A catalytic subunit (PP2Ac) using siRNA and evaluated gene expression with a microarray. After the cross comparison of these microarray data, we identified that CDK1 was potentially the same target when treated with either PP2A inhibitors or PP2Ac siRNA. In addition, we found that the down-regulation of CDK1 occurred in a JNK-dependent manner. Luciferase reporter gene assays demonstrated that repression of the transcription of CDK1 was executed through the JNK-dependent activation of the Sp1 transcription factor. By constructing deletion mutants of the CDK1 promoter and by using ChIP assays, we identified an element in the CDK1 promoter that responded to the JNK/Sp1 pathway after stimulation with PP2A inhibitors. Cantharidin and OA also up-regulated the expression of p21, an inhibitor of CDK1, via autophagy rather than PP2A/JNK pathway. Thus, this present study found that the PP2A/JNK/Sp1/CDK1 pathway and the autophagy/p21 pathway participated in G2/M cell cycle arrest triggered by PP2A inhibitors. PMID:26053095

  18. Yes and Lyn play a role in nuclear translocation of the epidermal growth factor receptor.

    PubMed

    Iida, M; Brand, T M; Campbell, D A; Li, C; Wheeler, D L

    2013-02-01

    The epidermal growth factor receptor (EGFR) is a central regulator of tumor progression in human cancers. Cetuximab is an anti-EGFR antibody that has been approved for use in oncology. Previously we investigated mechanisms of resistance to cetuximab using a model derived from the non-small cell lung cancer line NCI-H226. We demonstrated that cetuximab-resistant clones (Ctx(R)) had increased nuclear localization of the EGFR. This process was mediated by Src family kinases (SFKs), and nuclear EGFR had a role in resistance to cetuximab. To better understand SFK-mediated nuclear translocation of EGFR, we investigated which SFK member(s) controlled this process as well as the EGFR tyrosine residues that are involved. Analyses of mRNA and protein expression indicated upregulation of the SFK members Yes (v-Yes-1 yamaguchi sarcoma viral oncogene) and Lyn (v-yes-1 Yamaguchi sarcoma viral-related oncogene homolog) in all Ctx(R) clones. Further, immunoprecipitation analysis revealed that EGFR interacts with Yes and Lyn in Ctx(R) clones, but not in cetuximab-sensitive (Ctx(S)) parental cells. Using RNAi interference, we found that knockdown of either Yes or Lyn led to loss of EGFR translocation to the nucleus. Conversely, overexpression of Yes or Lyn in low nuclear EGFR-expressing Ctx(S) parental cells led to increased nuclear EGFR. Chromatin immunoprecipitation (ChIP) assays confirmed nuclear EGFR complexes associated with the promoter of the known EGFR target genes B-Myb and iNOS. Further, all Ctx(R) clones exhibited upregulation of B-Myb and iNOS at the mRNA and protein levels. siRNAs directed at Yes or Lyn led to decreased binding of EGFR complexes to the B-Myb and iNOS promoters based on ChIP analyses. SFKs have been shown to phosphorylate EGFR on tyrosines 845 and 1101 (Y845 and Y1101), and mutation of Y1101, but not Y845, impaired nuclear entry of the EGFR. Taken together, our findings demonstrate that Yes and Lyn phosphorylate EGFR at Y1101, which influences EGFR

  19. In vitro chromatin assembly of the HIV-1 promoter. ATP-dependent polar repositioning of nucleosomes by Sp1 and NFkappaB.

    PubMed

    Widlak, P; Gaynor, R B; Garrard, W T

    1997-07-11

    Nuclease hypersensitive sites exist in vivo in the chromatin of the integrated human immunodeficiency virus (HIV)-1 proviral genome, in the 5'-long terminal repeat (LTR) within the promoter/enhancer region near Sp1 and NFkappaB binding sites. Previous studies from the Kadonaga and Jones laboratories have shown that Sp1 and NFkappaB can establish hypersensitive sites in a truncated form of this LTR when added before in vitro chromatin assembly with Drosophila extracts, thus facilitating subsequent transcriptional activation of a linked reporter gene upon the association of additional factors (Pazin, M. J., Sheridan, P. L., Cannon, K., Cao, Z., Keck, J. G., Kadanaga, J. T., and Jones, K. A. (1996) Genes & Dev. 10, 37-49). Here we assess the role of a full-length LTR and 1 kilobase pair of downstream flanking HIV sequences in chromatin remodeling when these transcription factors are added after chromatin assembly. Using Xenopus laevis oocyte extracts to assemble chromatin in vitro, we have confirmed that Sp1 and NFkappaB can indeed induce sites hypersensitive to DNase I, micrococcal nuclease, or restriction enzymes on either side of factor binding sites in chromatin but not naked DNA. We extend these earlier studies by demonstrating that the process is ATP-dependent when the factors are added after chromatin assembly and that histone H1, AP1, TBP, or Tat had no effect on hypersensitive site formation. Furthermore, we have found that nucleosomes upstream of NFkappaB sites are rotationally positioned prior to factor binding and that their translational frame is registered after binding NFkappaB. On the other hand, binding of Sp1 positions adjacent downstream nucleosome(s). We term this polar repositioning because each factor aligns nucleosomes only on one side of its binding sites. Mutational analysis and oligonucleotide competition each demonstrated that this remodeling required Sp1 and NFkappaB binding sites. PMID:9211915

  20. Membrane Chaperone SecDF Plays a Role in the Secretion of Listeria monocytogenes Major Virulence Factors

    PubMed Central

    Burg-Golani, Tamar; Pozniak, Yair; Rabinovich, Lev; Sigal, Nadejda; Nir Paz, Ran

    2013-01-01

    Listeria monocytogenes is a Gram-positive human intracellular pathogen that infects diverse mammalian cells. Upon invasion, L. monocytogenes secretes multiple virulence factors that target host cellular processes and promote infection. It has been presumed, but was not empirically established, that the Sec translocation system is the primary mediator of this secretion. Here, we validate an important role for SecDF, a component of the Sec system, in the secretion of several critical L. monocytogenes virulence factors. A ΔsecDF mutant is demonstrated to exhibit impaired membrane translocation of listeriolysin O (LLO), PlcA, PlcB, and ActA, factors that mediate L. monocytogenes phagosomal escape and spread from cell to cell. This impaired translocation was monitored by accumulation of the factors on the bacterial membrane and by reduced activity upon secretion. This defect in secretion is shown to be associated with a severe intracellular growth defect of the ΔsecDF mutant in macrophages and a less virulent phenotype in mice, despite normal growth in laboratory medium. We further show that SecDF is upregulated when the bacteria reside in macrophage phagosomes and that it is necessary for efficient phagosomal escape. Taken together, these data support the premise that SecDF plays a role as a chaperone that facilitates the translocation of L. monocytogenes virulence factors during infection. PMID:24056100

  1. Transcriptional interference perturbs the binding of Sp1 to the HIV-1 promoter.

    PubMed Central

    Greger, I H; Demarchi, F; Giacca, M; Proudfoot, N J

    1998-01-01

    Transcriptional interference between adjacent genes has been demonstrated in a variety of biological systems. To study this process in RNA polymerase II (pol II) transcribed genes we have analysed the effect of transcription on tandem HIV-1 promoters integrated into the genome of HeLa cells. We show that transcriptional activation at the upstream promoter reduces transcription from the downstream promoter, as compared with basal transcription conditions (in the absence of an activator). Furthermore, insertion of a strong transcriptional termination element between the two promoters alleviates this transcriptional interference, resulting in elevated levels of transcription from the downstream promoter. Actual protein interactions with the downstream (occluded) promoter were analysed by in vivo footprinting. Binding of Sp1 transcription factors to the occluded promoter was reduced, when compared with the footprint pattern of the promoter protected by the terminator. This suggests that promoter occlusion is due to disruption of certain transcription factors and that it can be blocked by an intervening transcriptional terminator. Chromatin mapping with DNase I indicates that a factor binds to the termination element under both basal and induced conditions. PMID:9469840

  2. miR-23b/SP1/c-myc forms a feed-forward loop supporting multiple myeloma cell growth

    PubMed Central

    Fulciniti, M; Amodio, N; Bandi, R L; Cagnetta, A; Samur, M K; Acharya, C; Prabhala, R; D'Aquila, P; Bellizzi, D; Passarino, G; Adamia, S; Neri, A; Hunter, Z R; Treon, S P; Anderson, K C; Tassone, P; Munshi, N C

    2016-01-01

    Deregulated microRNA (miR)/transcription factor (TF)-based networks represent a hallmark of cancer. We report here a novel c-Myc/miR-23b/Sp1 feed-forward loop with a critical role in multiple myeloma (MM) and Waldenstrom's macroglobulinemia (WM) cell growth and survival. We have found miR-23b to be downregulated in MM and WM cells especially in the presence of components of the tumor bone marrow milieu. Promoter methylation is one mechanism of miR-23b suppression in myeloma. In gain-of-function studies using miR-23b mimics-transfected or in miR-23b-stably expressing MM and WM cell lines, we observed a significant decrease in cell proliferation and survival, along with induction of caspase-3/7 activity over time, thus supporting a tumor suppressor role for miR-23b. At the molecular level, miR-23b targeted Sp1 3′UTR and significantly reduced Sp1-driven nuclear factor-κB activity. Finally, c-Myc, an important oncogenic transcription factor known to stimulate MM cell proliferation, transcriptionally repressed miR-23b. Thus MYC-dependent miR-23b repression in myeloma cells may promote activation of oncogenic Sp1-mediated signaling, representing the first feed-forward loop with critical growth and survival role in myeloma. PMID:26771806

  3. Translational and transcriptional control of Sp1 against ischaemia through a hydrogen peroxide-activated internal ribosomal entry site pathway

    PubMed Central

    Yeh, Shiu Hwa; Yang, Wen Bin; Gean, Po Wu; Hsu, Chung Yi; Tseng, Joseph T.; Su, Tsung Ping; Chang, Wen Chang; Hung, Jan Jong

    2011-01-01

    The exact mechanism underlying increases in Sp1 and the physiological consequences thereafter remains unknown. In rat primary cortical neurons, oxygen-glucose deprivation (OGD) causes an increase in H2O2 as well as Sp1 in early ischaemia but apparently does not change mRNA level or Sp1 stability. We hereby identified a longer 5′-UTR in Sp1 mRNA that contains an internal ribosome entry site (IRES) that regulates rapid and efficient translation of existing mRNAs. By using polysomal fragmentation and bicistronic luciferase assays, we found that H2O2 activates IRES-dependent translation. Thus, H2O2 or tempol, a superoxide dismutase-mimetic, increases Sp1 levels in OGD-treated neurons. Further, early-expressed Sp1 binds to Sp1 promoter to cause a late rise in Sp1 in a feed-forward manner. Short hairpin RNA against Sp1 exacerbates OGD-induced apoptosis in primary neurons. While Sp1 levels increase in the cortex in a rat model of stroke, inhibition of Sp1 binding leads to enhanced apoptosis and cortical injury. These results demonstrate that neurons can use H2O2 as a signalling molecule to quickly induce Sp1 translation through an IRES-dependent translation pathway that, in cooperation with a late rise in Sp1 via feed-forward transcriptional activation, protects neurons against ischaemic damage. PMID:21441538

  4. All-trans retinoic acid increases expression of aquaporin-5 and plasma membrane water permeability via transactivation of Sp1 in mouse lung epithelial cells.

    PubMed

    Nomura, Johji; Horie, Ichiro; Seto, Mayumi; Nagai, Kazufumi; Hisatsune, Akinori; Miyata, Takeshi; Isohama, Yoichiro

    2006-12-29

    Aquaporin-5 (AQP5) is a water-selective channel protein that is expressed in lacrimal glands, salivary glands, and distal lung. Several studies using AQP5 knockout mice have revealed that AQP5 plays an important role in maintaining water homeostasis in the lung. We report here that all-trans retinoic acid (atRA) increases plasma membrane water permeability, AQP5 mRNA and protein expression, and AQP5 promoter activity in MLE-12 cells. The promoter activation induced by atRA was diminished by mutation at the Sp1/Sp3 binding element (SBE), suggesting that the SBE mediates the effects of atRA. In addition, atRA increased the binding of Sp1 to the SBE without changing the levels of Sp1 in the nucleus. Taken together, our data indicate that atRA increases AQP5 expression through transactivation of Sp1, leading to an increase in plasma membrane water permeability. PMID:17097063

  5. The conjugate gradient NAS parallel benchmark on the IBM SP1

    SciTech Connect

    Trefethen, A.E.; Zhang, T.

    1994-12-31

    The NAS Parallel Benchmarks are a suite of eight benchmark problems developed at the NASA Ames Research Center. They are specified in such a way that the benchmarkers are free to choose the language and method of implementation to suit the system in which they are interested. In this presentation the authors will discuss the Conjugate Gradient benchmark and its implementation on the IBM SP1. The SP1 is a parallel system which is comprised of RS/6000 nodes connected by a high performance switch. They will compare the results of the SP1 implementation with those reported for other machines. At this time, such a comparison shows the SP1 to be very competitive.

  6. An atomic model of HIV-1 capsid-SP1 reveals structures regulating assembly and maturation.

    PubMed

    Schur, Florian K M; Obr, Martin; Hagen, Wim J H; Wan, William; Jakobi, Arjen J; Kirkpatrick, Joanna M; Sachse, Carsten; Kräusslich, Hans-Georg; Briggs, John A G

    2016-07-29

    Immature HIV-1 assembles at and buds from the plasma membrane before proteolytic cleavage of the viral Gag polyprotein induces structural maturation. Maturation can be blocked by maturation inhibitors (MIs), thereby abolishing infectivity. The CA (capsid) and SP1 (spacer peptide 1) region of Gag is the key regulator of assembly and maturation and is the target of MIs. We applied optimized cryo-electron tomography and subtomogram averaging to resolve this region within assembled immature HIV-1 particles at 3.9 angstrom resolution and built an atomic model. The structure reveals a network of intra- and intermolecular interactions mediating immature HIV-1 assembly. The proteolytic cleavage site between CA and SP1 is inaccessible to protease. We suggest that MIs prevent CA-SP1 cleavage by stabilizing the structure, and MI resistance develops by destabilizing CA-SP1. PMID:27417497

  7. Epigenetic modification of TLR4 promotes activation of NF-κB by regulating methyl-CpG-binding domain protein 2 and Sp1 in gastric cancer.

    PubMed

    Kim, Tae Woo; Lee, Seon-Jin; Oh, Byung Moo; Lee, Heesoo; Uhm, Tae Gi; Min, Jeong-Ki; Park, Young-Jun; Yoon, Suk Ran; Kim, Bo-Yeon; Kim, Jong Wan; Choe, Yong-Kyung; Lee, Hee Gu

    2016-01-26

    Toll-like receptor 4 (TLR4) is important in promoting the immune response in various cancers. Recently, TLR4 is highly expressed in a stage-dependent manner in gastric cancer, but the regulatory mechanism of TLR4 expression has been not elucidated it. Here, we investigated the mechanism underlying regulation of TLR4 expression through promoter methylation and histone modification between transcriptional regulation and silencing of the TLR4 gene in gastric cancer cells. Chromatin immunoprecipitation was carried out to screen for factors related to TLR4 methylation such as MeCP2, HDAC1, and Sp1 on the TLR4 promoter. Moreover, DNA methyltransferase inhibitor 5-aza-deoxycytidine (5-aza-dC) induced demethylation of the TLR4 promoter and increased H3K4 trimethylation and Sp1 binding to reactivate silenced TLR4. In contrast, although the silence of TLR4 activated H3K9 trimethylation and MeCP2 complex, combined treatment with TLR4 agonist and 5-aza-dC upregulated H3K4 trimethylation and activated with transcription factors as Sp1 and NF-κB. This study demonstrates that recruitment of the MeCP2/HDAC1 repressor complex increases the low levels of TLR4 expression through epigenetic modification of DNA and histones on the TLR4 promoter, but Sp1 activates TLR4 high expression by hypomethylation and NF-κB signaling in gastric cancer cells. PMID:26675260

  8. Epigenetic modification of TLR4 promotes activation of NF-κB by regulating methyl-CpG-binding domain protein 2 and Sp1 in gastric cancer

    PubMed Central

    Oh, Byung Moo; Lee, Heesoo; Uhm, Tae Gi; Min, Jeong-Ki; Park, Young-Jun; Yoon, Suk Ran; Kim, Bo-Yeon; Kim, Jong Wan; Choe, Yong-Kyung; Lee, Hee Gu

    2016-01-01

    Toll-like receptor 4 (TLR4) is important in promoting the immune response in various cancers. Recently, TLR4 is highly expressed in a stage-dependent manner in gastric cancer, but the regulatory mechanism of TLR4 expression has been not elucidated it. Here, we investigated the mechanism underlying regulation of TLR4 expression through promoter methylation and histone modification between transcriptional regulation and silencing of the TLR4 gene in gastric cancer cells. Chromatin immunoprecipitation was carried out to screen for factors related to TLR4 methylation such as MeCP2, HDAC1, and Sp1 on the TLR4 promoter. Moreover, DNA methyltransferase inhibitor 5-aza-deoxycytidine (5-aza-dC) induced demethylation of the TLR4 promoter and increased H3K4 trimethylation and Sp1 binding to reactivate silenced TLR4. In contrast, although the silence of TLR4 activated H3K9 trimethylation and MeCP2 complex, combined treatment with TLR4 agonist and 5-aza-dC upregulated H3K4 trimethylation and activated with transcription factors as Sp1 and NF-κB. This study demonstrates that recruitment of the MeCP2/HDAC1 repressor complex increases the low levels of TLR4 expression through epigenetic modification of DNA and histones on the TLR4 promoter, but Sp1 activates TLR4 high expression by hypomethylation and NF-κB signaling in gastric cancer cells. PMID:26675260

  9. Draft Genome Sequences of Two Magnetotactic Bacteria, Magnetospirillum moscoviense BB-1 and Magnetospirillum marisnigri SP-1.

    PubMed

    Koziaeva, Veronika V; Dziuba, Marina V; Ivanov, Timophey M; Kuznetsov, Boris B; Skryabin, Konstantin G; Grouzdev, Denis S

    2016-01-01

    We report here the draft genome sequences of two recently isolated magnetotactic species, Magnetospirillum moscoviense BB-1 and Magnetospirillum marisnigri SP-1. The genome of M. moscoviense BB-1 has 4,164,497 bp, 65.2% G+C content, and comprises 207 contigs. The genome of M. marisnigri SP-1 consists of 131 contigs and has a length of 4,619,819 bp and 64.7% G+C content. PMID:27516508

  10. Draft Genome Sequences of Two Magnetotactic Bacteria, Magnetospirillum moscoviense BB-1 and Magnetospirillum marisnigri SP-1

    PubMed Central

    Koziaeva, Veronika V.; Dziuba, Marina V.; Ivanov, Timophey M.; Kuznetsov, Boris B.; Skryabin, Konstantin G.

    2016-01-01

    We report here the draft genome sequences of two recently isolated magnetotactic species, Magnetospirillum moscoviense BB-1 and Magnetospirillum marisnigri SP-1. The genome of M. moscoviense BB-1 has 4,164,497 bp, 65.2% G+C content, and comprises 207 contigs. The genome of M. marisnigri SP-1 consists of 131 contigs and has a length of 4,619,819 bp and 64.7% G+C content. PMID:27516508

  11. Single-molecule DNA detection using a novel SP1 protein nanopore.

    PubMed

    Wang, Hai-Yan; Li, Yang; Qin, Li-Xia; Heyman, Arnon; Shoseyov, Oded; Willner, Itamar; Long, Yi-Tao; Tian, He

    2013-02-28

    SP1 protein as a new type of biological nanopore is described and is utilized to distinguish single-stranded DNA at the single-molecule level. Using the SP1 nanopore to investigate single molecule detection broadens the existing research areas of pore-forming biomaterials from unsymmetrical biological nanopores to symmetrical biological nanopores. This novel nanopore could provide a good candidate for single-molecule detection and characterization of biomaterial applications. PMID:23340583

  12. Sp1 transcriptionally regulates BRK1 expression in non-small cell lung cancer cells.

    PubMed

    Li, Meng; Ling, Bing; Xiao, Ting; Tan, Jinjing; An, Ning; Han, Naijun; Guo, Suping; Cheng, Shujun; Zhang, Kaitai

    2014-06-01

    Following a previous study reporting that BRK1 is upregulated in non-small cell lung cancer (NSCLC), the present study sought to clarify the role of specificity protein 1 (Sp1) in the transcriptional regulation of the BRK1 gene. Therefore, a construct, named F8, consisting of the -1341 to -1 nt sequence upstream of the start codon of the BRK1 gene inserted into pGL4.26 was made. A series of truncated fragments was then constructed based on F8. Segment S831, which contained the -84 to -1 nt region, displayed the highest transcriptional activity in the A549, H1299 and H520 NSCLC cell lines. Bioinformatic analysis showed a potential Sp1-binding element at -73 to -64 nt, and a mutation in this region suppressed the transcriptional activity of S831. Then the RNAi assays of Sp1 and its coworkers Sp3 and Sp4 were performed, and suppression of Sp1 by siRNA inhibited the mRNA expression of BRK1. Both an electrophoretic mobility shift assay (EMSA) and a chromatin immunoprecipitation (ChIP) assay demonstrated that Sp1 bound to the promoter area of the BRK1 gene. Our data identified a functional and positive Sp1 regulatory element from -73 to -64 nt in the BRK1 promoter, which may likely explain the overexpression of BRK1 in NSCLC. PMID:24680773

  13. An interaction between the DNA-binding domains of RelA(p65) and Sp1 mediates human immunodeficiency virus gene activation.

    PubMed Central

    Perkins, N D; Agranoff, A B; Pascal, E; Nabel, G J

    1994-01-01

    Induction of human immunodeficiency virus type 1 (HIV-1) gene expression in stimulated T cells has been attributed to the activation of the transcription factor NF-kappa B. The twice-repeated kappa B sites within the HIV-1 long terminal repeat are in close proximity to three binding sites for Sp1. We have previously shown that a cooperative interaction of NF-kappa B with Sp1 is required for the efficient stimulation of HIV-1 transcription. In this report, we define the domains of each protein responsible for this effect. Although the transactivation domains seemed likely to mediate this interaction, we find, surprisingly, that this interaction occurs through the putative DNA-binding domains of both proteins. Sp1 specifically interacted with the amino-terminal region of RelA(p65). Similarly, RelA bound directly to the zinc finger region of Sp1. This interaction was specific and resulted in cooperative DNA binding to the kappa B and Sp1 sites in the HIV-1 long terminal repeat. Furthermore, the amino-terminal region of RelA did not associate with several other transcription factors, including MyoD, E12, or Kox15, another zinc finger protein. These findings suggest that the juxtaposition of DNA-binding sites promotes a specific protein interaction between the DNA-binding regions of these transcription factors. This interaction is required for HIV transcriptional activation and may provide a mechanism to allow for selective activation of kappa B-regulated genes. Images PMID:7935378

  14. NAC transcription factors play an important role in ethylene biosynthesis, reception and signaling of tomato fruit ripening.

    PubMed

    Kou, Xiaohong; Liu, Chen; Han, Lihua; Wang, Shuang; Xue, Zhaohui

    2016-06-01

    NAC proteins comprise a large family of transcription factors that play important roles in diverse physiological processes during development. To explore the role of NAC transcription factors in the ripening of fruits, we predicted the secondary and tertiary structure as well as regulative function of the SNAC4 (SlNAC48, Accession number: NM 001279348.2) and SNAC9 (SlNAC19, Accession number: XM 004236996.2) transcription factors in tomato. We found that the tertiary structure of SNAC9 was similar to that of ATNAP, which played an important role in the fruit senescence and was required for ethylene stimulation. Likewise, the bio-function prediction results indicated that SNAC4 and SNAC9 participated in various plant hormone signaling and senescence processes. More information about SNACs was obtained by the application of VIGS (virus-induced gene silencing). The silencing of SNAC4 and SNAC9 dramatically repressed the LeACS2, LeACS4 and LeACO1 expression, which consequently led to the inhibition of the ripening process. The silencing of SNACs down-regulated the mRNA levels of the ethylene perception genes and, at the same time, suppressed the expression of ethylene signaling-related genes except for LeERF2 which was induced by the silencing of SNAC4. The expressions of LeRIN were different in two silenced fruits. In addition, the silencing of SNAC4 reduced its mRNA level, while the silencing of SNAC9 induced its expression. Furthermore, the silencing of LeACS4, LeACO1 and LeERF2 reduced the expression of SNAC4 and SNAC9, while the silencing of NR induced the expression of all of them. In particular, these results indicate that SNAC transcription factors bind to the promoter of the ethylene synthesis genes in vitro. This experimental evidence demonstrates that SNAC4 and SNAC9 could positively regulate the tomato fruit ripening process by functioning upstream of ethylene synthesis genes. These outcomes will be helpful to provide a theoretical foundation for further

  15. Scaffolding, Analysis and Materials: Contributing Factors in an Unexpected Finding of Advanced Infant/Toddler Pretend Play?

    ERIC Educational Resources Information Center

    Morrissey, Anne-Marie

    2014-01-01

    As part of a longitudinal study, infant/toddler pretend play development and maternal play modelling were investigated in dyadic context. A total of 21 children were videotaped in monthly play sessions with their mothers, from age 8 to 17 months. Child and mother pretend play frequencies and levels were measured using Brown's Pretend Play…

  16. Maximal Expression of the Evolutionarily Conserved Slit2 Gene Promoter Requires Sp1.

    PubMed

    Saunders, Jacquelyn; Wisidagama, D Roonalika; Morford, Travis; Malone, Cindy S

    2016-08-01

    Slit2 is a neural axon guidance and chemorepellent protein that stimulates motility in a variety of cell types. The role of Slit2 in neural development and neoplastic growth and migration has been well established, while the genetic mechanisms underlying regulation of the Slit2 gene have not. We identified the core and proximal promoter of Slit2 by mapping multiple transcriptional start sites, analyzing transcriptional activity, and confirming sequence homology for the Slit2 proximal promoter among a number of species. Deletion series and transient transfection identified the Slit2 proximal promoter as within 399 base pairs upstream of the start of transcription. A crucial region for full expression of the Slit2 proximal promoter lies between 399 base pairs and 296 base pairs upstream of the start of transcription. Computer modeling identified three transcription factor-binding consensus sites within this region, of which only site-directed mutagenesis of one of the two identified Sp1 consensus sites inhibited transcriptional activity of the Slit2 proximal promoter (-399 to +253). Bioinformatics analysis of the Slit2 proximal promoter -399 base pair to -296 base pair region shows high sequence conservation over twenty-two species, and that this region follows an expected pattern of sequence divergence through evolution. PMID:26456684

  17. Cloning of the human activated leukocyte cell adhesion molecule promoter and identification of its tissue-independent transcriptional activation by Sp1.

    PubMed

    Tan, Fang; Mbunkui, Flaubert; Ofori-Acquah, Solomon F

    2012-12-01

    Activated leukocyte cell adhesion molecule (ALCAM) belongs to the immunoglobulin cell adhesion molecule super family. ALCAM is implicated in tumor progression, inflammation, and the differentiation of hematopoietic stem cells. Hitherto, the identity of regulatory DNA elements and cognate transcription factors responsible for ALCAM gene expression remained unknown. In this report, the human ALCAM promoter was cloned and its transcriptional mechanisms elucidated. The promoter is TATA-less and contains multiple GC-boxes. A proximal 650-bp promoter fragment conferred tissue-independent activation, whereas two contiguous regions upstream of this region negatively influenced promoter activity in a tissue-specific manner. The positive regulatory promoter region was mapped to a core 50 base pair sequence containing a conical Sp1 element. Mutation analysis revealed that this element alone or in tandem with elements immediately upstream was required for maximal promoter activity. Chromatin analysis revealed that Sp1 binds exclusively to the canonical binding sequence in vivo, but not to DNA sequence immediately upstream. Finally, we showed that over-expression of Sp1 significantly increased the basal promoter activity. Thus, Sp1 activated the ALCAM promoter in most cells. These findings have important ramifications for unraveling the roles of ALCAM in inflammation and tumorigenesis. PMID:22941204

  18. Transcription cofactor PC4 plays essential roles in collaboration with the small subunit of general transcription factor TFIIE.

    PubMed

    Akimoto, Yusuke; Yamamoto, Seiji; Iida, Satoshi; Hirose, Yutaka; Tanaka, Aki; Hanaoka, Fumio; Ohkuma, Yoshiaki

    2014-12-01

    In eukaryotes, positive cofactor 4 (PC4) stimulates activator-dependent transcription by facilitating transcription initiation and the transition from initiation to elongation. It also forms homodimers and binds to single-stranded DNA and various transcriptional activators, including the general transcription factor TFIIH. In this study, we further investigated PC4 from Homo sapiens and the nematode Caenorhabditis elegans (hPC4 and cePC4, respectively). hPC4 strongly stimulated transcription on a linearized template, whereas it alleviated transcription on a supercoiled template. Transcriptional stimulation by PC4 was also alleviated by increasing the amount of TFIID. GST pull-down studies with general transcription factors indicated that both hPC4 and cePC4 bind strongly to TFIIB, TFIIEβ, TFIIFα, TFIIFβ and TFIIH XPB subunits and weakly to TBP and TFIIH p62. However, only hPC4 bound to CDK7. The effect of each PC4 on transcription was studied in combination with TFIIEβ. hPC4 stimulated both basal and activated transcription, whereas cePC4 primarily stimulated activated transcription, especially in the presence of TFIIEβ from C. elegans. Finally, hPC4 bound to the C-terminal region of hTFIIEβ adjacent to the basic region. These results indicate that PC4 plays essential roles in the transition step from transcription initiation to elongation by binding to melted DNA in collaboration with TFIIEβ. PMID:25308091

  19. The impact of high co-expression of Sp1 and HIF1α on prognosis of patients with hepatocellular cancer

    PubMed Central

    LIU, LIANG; JI, PING; QU, NING; PU, WEI-LIN; JIANG, DAO-WEN; LIU, WEI-YAN; LI, YA-QI; SHI, RONG-LIANG

    2016-01-01

    Transcription factor specificity protein 1 (Sp1) and hypoxia-inducible factor 1α (HIF1α) serve vital roles in tumor growth and metastasis. The present study aimed to evaluate the impact of co-expression of Sp1 and HIF1α on the prognosis of patients with hepatocellular cancer (HCC) using The Cancer Genome Atlas (TCGA) database and to validate the association between the expression levels of Sp1/HIF1α in HCC specimens and patient survival using immunohistochemical analysis. A total of 214 eligible patients with HCC from TCGA database were collected for the study. The expression profile of Sp1 and HIF1α were obtained from the TCGA RNAseq database. Clinicopathological characteristics, including age, height, weight, gender, race, ethnicity, family cancer history, serum α-fetoprotein (AFP), surgical procedures and TNM stage were collected. The Cox proportional hazards regression model and Kaplan-Meier curves were used to assess the relative factors. Receiver operating characteristic (ROC) curves for cancer-specific survival (CSS) prediction were plotted to compare the prediction ability of expression of Sp1 and HIF1α and their co-expression. The location and expression of Sp1 and HIF1α in the HCC tissues were detected by immunohistochemistry (IHC) to verify the association between these two genes and CSS. The results demonstrated that the expressions of Sp1 and HIF1α were significantly increased in the succumbed group (P=0.001), compared with the surviving group. The CSS rates were 60.1% at 3 years (1,067 days), 35.8% at 5 years (1,823 days) and 9.5% at 10 years (3,528 days). Multivariate Cox regression analysis demonstrated that only the high expression levels of Sp1 and HIF1α (≥2×103) were independent predictors for cancer mortality, with P=0.001 and P=0.029, respectively. The area under the curve for the ROC was found to be higher using the combination testing for two genes (0.751) in predicting cancer mortality, compared to a single gene (0.632 for Sp1

  20. Artemisinin blocks prostate cancer growth and cell cycle progression by disrupting Sp1 interactions with the cyclin-dependent kinase-4 (CDK4) promoter and inhibiting CDK4 gene expression.

    PubMed

    Willoughby, Jamin A; Sundar, Shyam N; Cheung, Mark; Tin, Antony S; Modiano, Jaime; Firestone, Gary L

    2009-01-23

    Artemisinin, a naturally occurring component of Artemisia annua, or sweet wormwood, is a potent anti-malaria compound that has recently been shown to have anti-proliferative effects on a number of human cancer cell types, although little is know about the molecular mechanisms of this response. We have observed that artemisinin treatment triggers a stringent G1 cell cycle arrest of LNCaP (lymph node carcinoma of the prostate) human prostate cancer cells that is accompanied by a rapid down-regulation of CDK2 and CDK4 protein and transcript levels. Transient transfection with promoter-linked luciferase reporter plasmids revealed that artemisinin strongly inhibits CDK2 and CDK4 promoter activity. Deletion analysis of the CDK4 promoter revealed a 231-bp artemisinin-responsive region between -1737 and -1506. Site-specific mutations revealed that the Sp1 site at -1531 was necessary for artemisinin responsiveness in the context of the CDK4 promoter. DNA binding assays as well as chromatin immunoprecipitation assays demonstrated that this Sp1-binding site in the CDK4 promoter forms a specific artemisinin-responsive DNA-protein complex that contains the Sp1 transcription factor. Artemisinin reduced phosphorylation of Sp1, and when dephosphorylation of Sp1 was inhibited by treatment of cells with the phosphatase inhibitor okadaic acid, the ability of artemisinin to down-regulate Sp1 interactions with the CDK4 promoter was ablated, rendering the CDK4 promoter unresponsive to artemisinin. Finally, overexpression of Sp1 mostly reversed the artemisinin down-regulation of CDK4 promoter activity and partially reversed the cell cycle arrest. Taken together, our results demonstrate that a key event in the artemisinin anti-proliferative effects in prostate cancer cells is the transcriptional down-regulation of CDK4 expression by disruption of Sp1 interactions with the CDK4 promoter. PMID:19017637

  1. New Play.

    ERIC Educational Resources Information Center

    Lersten, Kenneth C.

    There have been many theories and hypotheses about play, one of which is the equation of play with "transcendence." Play may have the ingredients to allow us to transcend and, for a moment, remythologize life. There have been recent authors who have given play the status of theology, indicating that play contains elements also found in religion.…

  2. Playful Gaming.

    ERIC Educational Resources Information Center

    Makedon, Alexander

    A philosophical analysis of play and games is undertaken in this paper. Playful gaming, which is shown to be a synthesis of play and games, is utilized as a category for undertaking the examination of play and games. The significance of playful gaming to education is demonstrated through analyses of Plato's, Dewey's, Sartre's, and Marcuse's…

  3. Epidermal growth factor receptor plays a role in the regulation of liver and plasma lipid levels in adult male mice

    PubMed Central

    Zhang, Xiuqi; Garcia, Oscar A.; Wang, Rebecca F.; Stevenson, Mary C.; Threadgill, David W.; Russell, William E.

    2014-01-01

    Dsk5 mice have a gain of function in the epidermal growth factor receptor (EGFR), caused by a point mutation in the kinase domain. We analyzed the effect of this mutation on liver size, histology, and composition. We found that the livers of 12-wk-old male Dsk5 heterozygotes (+/Dsk5) were 62% heavier compared with those of wild-type controls (+/+). The livers of the +/Dsk5 mice compared with +/+ mice had larger hepatocytes with prominent, polyploid nuclei and showed modestly increased cell proliferation indices in both hepatocytes and nonparenchymal cells. An analysis of total protein, DNA, and RNA (expressed relative to liver weight) revealed no differences between the mutant and wild-type mice. However, the livers of the +/Dsk5 mice had more cholesterol but less phospholipid and fatty acid. Circulating cholesterol levels were twice as high in adult male +/Dsk5 mice but not in postweaned young male or female mice. The elevated total plasma cholesterol resulted mainly from an increase in low-density lipoprotein (LDL). The +/Dsk5 adult mouse liver expressed markedly reduced protein levels of LDL receptor, no change in proprotein convertase subtilisin/kexin type 9, and a markedly increased fatty acid synthase and 3-hydroxy-3-methyl-glutaryl-CoA reductase. Increased expression of transcription factors associated with enhanced cholesterol synthesis was also observed. Together, these findings suggest that the EGFR may play a regulatory role in hepatocyte proliferation and lipid metabolism in adult male mice, explaining why elevated levels of EGF or EGF-like peptides have been positively correlated to increased cholesterol levels in human studies. PMID:24407590

  4. Adjacent proline residues in the inhibitory domain of the Oct-2 transcription factor play distinct functional roles.

    PubMed Central

    Liu, Y Z; Lee, I K; Locke, I; Dawson, S J; Latchman, D S

    1998-01-01

    A 40 amino acid region of Oct-2 from amino acids 142 to 181 functions as an active repressor domain capable of inhibiting both basal activity and activation of promoters containing a TATA box, but not of those that contain an initiator element. Based on our observation that the equivalent region of the closely related Oct-1 factor does not act as an inhibitory domain, we have mutated specific residues in the Oct-2 domain in an attempt to probe their importance in repressor domain function. Although mutations of several residues have no or minimal effect, mutation of proline 175 to arginine abolishes the ability to inhibit both basal and activated transcription. In contrast, mutation of proline 174 to arginine confers upon the domain the ability to repress activation of an initiator-containing promoter by acidic activation domains, and also suppresses the effect of the proline 175 mutation. Hence, adjacent proline residues play key roles in the functioning of the inhibitory domain and in limiting its specificity to TATA-box-containing promoters. PMID:9580701

  5. Osteoblast Lineage Cells Play an Essential Role in Periodontal Bone Loss Through Activation of Nuclear Factor-Kappa B

    PubMed Central

    Pacios, Sandra; Xiao, Wenmei; Mattos, Marcelo; Lim, Jason; Tarapore, Rohinton S.; Alsadun, Sarah; Yu, Bo; Wang, Cun-Yu; Graves, Dana T.

    2015-01-01

    Bacterial pathogens stimulate periodontitis, the most common osteolytic disease in humans and the most common cause of tooth loss in adults. Previous studies identified leukocytes and their products as key factors in this process. We demonstrate for the first time that osteoblast lineage cells play a critical role in periodontal disease. Oral infection stimulated nuclear localization of NF-κB in osteoblasts and osteocytes in the periodontium of wild type but not transgenic mice that expressed a lineage specific dominant negative mutant of IKK (IKK-DN) in osteoblast lineage cells. Wild-type mice were also susceptible to bacteria induced periodontal bone loss but transgenic mice were not. The lack of bone loss in the experimental group was linked to reduced RANKL expression by osteoblast lineage cells that led to diminished osteoclast mediated bone resorption and greater coupled new bone formation. The results demonstrate that osteoblast lineage cells are key contributors to periodontal bone loss through an NF-κB mediated mechanism. PMID:26666569

  6. Loss of proteolytically processed filaggrin caused by epidermal deletion of Matriptase/MT-SP1

    PubMed Central

    List, Karin; Szabo, Roman; Wertz, Philip W.; Segre, Julie; Haudenschild, Christian C.; Kim, Soo-Youl; Bugge, Thomas H.

    2003-01-01

    Profilaggrin is a large epidermal polyprotein that is proteolytically processed during keratinocyte differentiation to release multiple filaggrin monomer units as well as a calcium-binding regulatory NH2-terminal filaggrin S-100 protein. We show that epidermal deficiency of the transmembrane serine protease Matriptase/MT-SP1 perturbs lipid matrix formation, cornified envelope morphogenesis, and stratum corneum desquamation. Surprisingly, proteomic analysis of Matriptase/MT-SP1–deficient epidermis revealed the selective loss of both proteolytically processed filaggrin monomer units and the NH2-terminal filaggrin S-100 regulatory protein. This was associated with a profound accumulation of profilaggrin and aberrant profilaggrin-processing products in the stratum corneum. The data identify keratinocyte Matriptase/MT-SP1 as an essential component of the profilaggrin-processing pathway and a key regulator of terminal epidermal differentiation. PMID:14638864

  7. An Sp1 binding site and the minimal promoter contribute to overexpression of the cytokeratin 18 gene in tumorigenic clones relative to that in nontumorigenic clones of a human carcinoma cell line.

    PubMed Central

    Gunther, M; Frebourg, T; Laithier, M; Fossar, N; Bouziane-Ouartini, M; Lavialle, C; Brison, O

    1995-01-01

    Clones of cells tumorigenic or nontumorigenic in nude mice have been previously isolated from the SW613-S human colon carcinoma cell line. We have already reported that tumorigenic cells overexpress the cytokeratin 18 (K18) gene in comparison with nontumorigenic cells and that this difference is mainly due to a transcriptional regulation. We now report that a 2,532-bp cloned human K18 gene promoter drives the differential expression of a reporter gene in a transient assay. A 62-bp minimal K18 promoter (TATA box and initiation site) has a low but differential activity. Analysis of deletion and substitution mutants as well as hybrid SV40-K18 promoters and reconstructed K18 promoters indicated that an important element for the activity of the K18 promoter is a high-affinity binding site for transcription factor Sp1 located just upstream of the TATA box. This Sp1 binding element, as well as the intron 1 enhancer element, stimulates the basal activity of the minimal promoter through mechanisms that maintain the differential activity. Gel shift assays and the use of an anti-Sp1 antibody have shown that both tumorigenic and nontumorigenic SW613-S cells contain three factors able to bind to the Sp1 binding element site and that one of them is Sp1. A hybrid GAL4-Sp1 protein transactivated to comparable extents in tumorigenic and nontumorigenic cells a reconstructed K18 promoter containing GAL4 binding sites and therefore without altering its differential behavior. These results indicate that the Sp1 transcription factor is involved in the overexpression of the K18 gene in tumorigenic SW613-S cells through its interaction with a component of the basal transcription machinery. PMID:7537848

  8. Early experiences with the IBM SP1 and the high-performance switch

    SciTech Connect

    Gropp, W.

    1993-11-01

    The IBM SP1 is IBM`s newest parallel distributed-memory computer. As part of a joint project with IBM, Argonne took delivery of an early system in order to evaluate the software environment and to begin porting programming packages and applications to this machine. This report discusses the results of those efforts once the high-performance switch was installed. An earlier report (ANL/MCS-TM-177) emphasized software usability and the initial ports to the SP1. This report contains performance results and discusses some applications and tools not covered in TM 177.

  9. Zinc Finger Independent Genome-Wide Binding of Sp2 Potentiates Recruitment of Histone-Fold Protein Nf-y Distinguishing It from Sp1 and Sp3

    PubMed Central

    Finkernagel, Florian; Stiewe, Thorsten; Nist, Andrea; Suske, Guntram

    2015-01-01

    Transcription factors are grouped into families based on sequence similarity within functional domains, particularly DNA-binding domains. The Specificity proteins Sp1, Sp2 and Sp3 are paradigmatic of closely related transcription factors. They share amino-terminal glutamine-rich regions and a conserved carboxy-terminal zinc finger domain that can bind to GC rich motifs in vitro. All three Sp proteins are ubiquitously expressed; yet they carry out unique functions in vivo raising the question of how specificity is achieved. Crucially, it is unknown whether they bind to distinct genomic sites and, if so, how binding site selection is accomplished. In this study, we have examined the genomic binding patterns of Sp1, Sp2 and Sp3 in mouse embryonic fibroblasts by ChIP-seq. Sp1 and Sp3 essentially occupy the same promoters and localize to GC boxes. The genomic binding pattern of Sp2 is different; Sp2 primarily localizes at CCAAT motifs. Consistently, re-expression of Sp2 and Sp3 mutants in corresponding knockout MEFs revealed strikingly different modes of genomic binding site selection. Most significantly, while the zinc fingers dictate genomic binding of Sp3, they are completely dispensable for binding of Sp2. Instead, the glutamine-rich amino-terminal region is sufficient for recruitment of Sp2 to its target promoters in vivo. We have identified the trimeric histone-fold CCAAT box binding transcription factor Nf-y as the major partner for Sp2-chromatin interaction. Nf-y is critical for recruitment of Sp2 to co-occupied regulatory elements. Equally, Sp2 potentiates binding of Nf-y to shared sites indicating the existence of an extensive Sp2-Nf-y interaction network. Our results unveil strikingly different recruitment mechanisms of Sp1/Sp2/Sp3 transcription factor members uncovering an unexpected layer of complexity in their binding to chromatin in vivo. PMID:25793500

  10. Platelet-Activating Factor Receptor Plays a Role in Lung Injury and Death Caused by Influenza A in Mice

    PubMed Central

    Garcia, Cristiana C.; Russo, Remo C.; Guabiraba, Rodrigo; Fagundes, Caio T.; Polidoro, Rafael B.; Tavares, Luciana P.; Salgado, Ana Paula C.; Cassali, Geovanni D.; Sousa, Lirlândia P.; Machado, Alexandre V.; Teixeira, Mauro M.

    2010-01-01

    Influenza A virus causes annual epidemics which affect millions of people worldwide. A recent Influenza pandemic brought new awareness over the health impact of the disease. It is thought that a severe inflammatory response against the virus contributes to disease severity and death. Therefore, modulating the effects of inflammatory mediators may represent a new therapy against Influenza infection. Platelet activating factor (PAF) receptor (PAFR) deficient mice were used to evaluate the role of the gene in a model of experimental infection with Influenza A/WSN/33 H1N1 or a reassortant Influenza A H3N1 subtype. The following parameters were evaluated: lethality, cell recruitment to the airways, lung pathology, viral titers and cytokine levels in lungs. The PAFR antagonist PCA4248 was also used after the onset of flu symptoms. Absence or antagonism of PAFR caused significant protection against flu-associated lethality and lung injury. Protection was correlated with decreased neutrophil recruitment, lung edema, vascular permeability and injury. There was no increase of viral load and greater recruitment of NK1.1+ cells. Antibody responses were similar in WT and PAFR-deficient mice and animals were protected from re-infection. Influenza infection induces the enzyme that synthesizes PAF, lyso-PAF acetyltransferase, an effect linked to activation of TLR7/8. Therefore, it is suggested that PAFR is a disease-associated gene and plays an important role in driving neutrophil influx and lung damage after infection of mice with two subtypes of Influenza A. Further studies should investigate whether targeting PAFR may be useful to reduce lung pathology associated with Influenza A virus infection in humans. PMID:21079759

  11. Sex Disparities in the Quality of Diabetes Care: Biological and Cultural Factors May Play a Different Role for Different Outcomes

    PubMed Central

    Rossi, Maria Chiara; Cristofaro, Maria Rosaria; Gentile, Sandro; Lucisano, Giuseppe; Manicardi, Valeria; Mulas, Maria Franca; Napoli, Angela; Nicolucci, Antonio; Pellegrini, Fabio; Suraci, Concetta; Giorda, Carlo

    2013-01-01

    OBJECTIVE To investigate the quality of type 2 diabetes care according to sex. RESEARCH DESIGN AND METHODS Clinical data collected during the year 2009 were extracted from electronic medical records; quality-of-care indicators were evaluated. Multilevel logistic regression analysis was applied to estimate the likelihood of women versus men to be monitored for selected parameters, to reach clinical outcomes, and to be treated with specific classes of drugs. The intercenter variability in the proportion of men and women achieving the targets was also investigated. RESULTS Overall, 415,294 patients from 236 diabetes outpatient centers were evaluated, of whom 188,125 (45.3%) were women and 227,169 (54.7%) were men. Women were 14% more likely than men to have HbA1c >9.0% in spite of insulin treatment (odds ratio 1.14 [95% CI 1.10–1.17]), 42% more likely to have LDL cholesterol (LDL-C) ≥130 mg/dL (1.42 [1.38–1.46]) in spite of lipid-lowering treatment, and 50% more likely to have BMI ≥30 kg/m2 (1.50 [1.50–1.54]). Women were less likely to be monitored for foot and eye complications. In 99% of centers, the percentage of men reaching the LDL-C target was higher than in women, the proportion of patients reaching the HbA1c target was in favor of men in 80% of the centers, and no differences emerged for blood pressure. CONCLUSIONS Women show a poorer quality of diabetes care than men. The attainment of the LDL-C target seems to be mainly related to pathophysiological factors, whereas patient and physician attitudes can play an important role in other process measures and outcomes. PMID:23835692

  12. Does Performance in Digital Reading Relate to Computer Game Playing? A Study of Factor Structure and Gender Patterns in 15-Year-Olds' Reading Literacy Performance

    ERIC Educational Resources Information Center

    Rasmusson, Maria; Åberg-Bengtsson, Lisbeth

    2015-01-01

    Data from a Swedish PISA-sample were used (1) to identify a digital reading factor, (2) to investigate gender differences in this factor (if found), and (3) to explore how computer game playing might relate to digital reading performance and gender. The analyses were conducted with structural equation modeling techniques. In addition to an overall…

  13. E-Ras improves the efficiency of reprogramming by facilitating cell cycle progression through JNK-Sp1 pathway.

    PubMed

    Kwon, Yoo-Wook; Jang, Seulgi; Paek, Jae-Seung; Lee, Jae-Woong; Cho, Hyun-Jai; Yang, Han-Mo; Kim, Hyo-Soo

    2015-11-01

    We have previously shown that pluripotent stem cells can be induced from adult somatic cells which were exposed to protein extracts isolated from mouse embryonic stem cells (mESC). Interestingly, generation of induced pluripotent stem (iPS) cells depended on the background of ES cell lines; possible by extracts from C57, but not from E14. Proteomic analysis of two different mES cell lines (C57 and E14) shows that embryonic Ras (E-Ras) is expressed differently in two mES cell lines; high level of E-Ras only in C57 mESC whose extracts allows iPS cells production from somatic cells. Here, we show that E-Ras augments the efficiency in reprogramming of fibroblast by promoting cell proliferation. We found that over-expression of E-Ras in fibroblast increased cell proliferation which was caused by specific up-regulation of cyclins D and E, not A or B, leading to the accelerated G1 to S phase transition. To figure out the common transcription factor of cyclins D and E, we used TRANSFAC database and selected SP1 as a candidate which was confirmed as enhancer of cyclins D and E by luciferase promoter assay using mutants. As downstream signaling pathways, E-Ras activated only c-Jun N-terminal kinases (JNK) but not ERK or p38. Inhibition of JNK prevented E-Ras-mediated induction of pSP1, cyclins D, E, and cell proliferation. Finally, E-Ras transduction to fibroblast enhanced the efficiency of iPS cell generation by 4 factors (Oct4/Klf4/Sox2/C-myc), which was prevented by JNK inhibitor. In conclusion, E-Ras stimulates JNK, enhances binding of Sp1 on the promoter of cyclins D and E, leading to cell proliferation. E-Ras/JNK axis is a critical mechanism to generate iPS cells by transduction of 4 factors or by treatment of mESC protein extracts. PMID:26413787

  14. Interactive Roles of Ets-1, Sp1, and Acetylated Histones in the Retinoic Acid-dependent Activation of Guanylyl Cyclase/Atrial Natriuretic Peptide Receptor-A Gene Transcription*

    PubMed Central

    Kumar, Prerna; Garg, Renu; Bolden, Gevoni; Pandey, Kailash N.

    2010-01-01

    Cardiac hormones atrial and brain natriuretic peptides activate guanylyl cyclase/natriuretic peptide receptor-A (GC-A/NPRA), which plays a critical role in reduction of blood pressure and blood volume. Currently, the mechanisms responsible for regulating the Npr1 gene (coding for GC-A/NPRA) transcription are not well understood. The present study was conducted to examine the interactive roles of all-trans retinoic acid (ATRA), Ets-1, Sp1, and histone acetylation on the transcriptional regulation and function of the Npr1 gene. Deletion analysis of the Npr1 promoter and luciferase assays showed that ATRA enhanced a 16-fold Npr1 promoter activity and greatly stimulated guanylyl cyclase (GC) activity of the receptor protein in both atrial natriuretic peptide (ANP)-dependent and -independent manner. As confirmed by gel shift and chromatin immunoprecipitation assays, ATRA enhanced the binding of both Ets-1 and Sp1 to the Npr1 promoter. The retinoic acid receptor α (RARα) was recruited by Ets-1 and Sp1 to form a transcriptional activator complex with their binding sites in the Npr1 promoter. Interestingly, ATRA also increased the acetylation of histones H3 and H4 and enhanced their recruitment to Ets-1 and Sp1 binding sites within the Npr1 promoter. Collectively, the present results demonstrate that ATRA regulates Npr1 gene transcription and GC activity of the receptor by involving the interactive actions of Ets-1, Sp1, and histone acetylation. PMID:20864529

  15. Histone deacetylase 3 represses p15{sup INK4b} and p21{sup WAF1/cip1} transcription by interacting with Sp1

    SciTech Connect

    Huang Weifeng; Tan Dapeng; Wang Xiuli; Han Songyan; Tan Jiang; Zhao Yanmei; Lu Jun . E-mail: ycsuo@nenu.edu.cn; Huang Baiqu

    2006-01-06

    Histone deacetylase 3 (HDAC3) has been implicated to play roles in governing cell proliferation. Here we demonstrated that the overexpression of HDAC3 repressed transcription of p15{sup INK4b} and p21{sup WAF1/cip1} genes in 293T cells, and that the recruitment of HDAC3 to the promoter regions of these genes was critical to this repression. We also showed that HDAC3 repressed GAL4-Sp1 transcriptional activity, and that Sp1 was co-immunoprecipitated with FLAG-tagged HDAC3. We conclude that HDAC3 can repress p15{sup INK4b} and p21{sup WAF1/cip1} transcription by interacting with Sp1. Furthermore, knockdown of HDAC3 by RNAi up-regulated the transcriptional expression of p15{sup INK4b}, but not that of p21{sup WAF1/cip1}, implicating the different roles of HDAC3 in repression of p15{sup INK4b} and p21{sup WAF1/cip1} transcription. Data from this study indicate that the inhibition of p15{sup INK4b} and p21{sup WAF1/cip1} may be one of the mechanisms by which HDAC3 participates in cell cycle regulation and oncogenesis.

  16. Characterization of the human activator protein-2gamma (AP-2gamma) gene: control of expression by Sp1/Sp3 in breast tumour cells.

    PubMed Central

    Hasleton, Mark D; Ibbitt, J Claire; Hurst, Helen C

    2003-01-01

    The activator protein-2 (AP-2) family of DNA-binding transcription factors are developmentally regulated and also play a role in human neoplasia. In particular, the AP-2gamma protein has been shown to be overexpressed in a high percentage of breast tumours. In the present study, we report the complete sequence determination of the human TFAP2C gene encoding the AP-2gamma transcription factor plus the mapping of the transcription start site used in breast tumour-derived cells. The 5'-end of the gene lies within a CpG island and transcription is initiated at a single site within a classical initiator motif. We have gone on to investigate why some breast tumour-derived cell lines readily express AP-2gamma, whereas others do not, and show that the proximal promoter (+191 to -312) is differentially active in the two cell phenotypes. DNase footprinting led to the identification of three Sp1/Sp3-binding sites within this region, two of which are absolutely required both for promoter function and cell-type-specific activity. By Western blotting a panel of expressing and non-expressing breast tumour lines we show that the latter have higher levels of Sp3. Furthermore, increasing Sp3 levels in AP-2gamma-expressing cells led to the repression of AP-2gamma promoter activity, particularly when Sp3 inhibitory function was maximized through sumoylation. We propose that differences in the level and activity of Sp3 between breast tumour lines can determine the expression level of their AP-2gamma gene. PMID:12733991

  17. AmeriFlux US-SP1 Slashpine-Austin Cary- 65yrs nat regen

    SciTech Connect

    Martin, Tim

    2016-01-01

    This is the AmeriFlux version of the carbon flux data for the site US-SP1 Slashpine-Austin Cary- 65yrs nat regen. Site Description - The ACMF site is a 67 hectare naturally regenerated Pinus palustris and Pinus elliottii mixed stand.

  18. Scalability study of parallel spatial direct numerical simulation code on IBM SP1 parallel supercomputer

    NASA Technical Reports Server (NTRS)

    Hanebutte, Ulf R.; Joslin, Ronald D.; Zubair, Mohammad

    1994-01-01

    The implementation and the performance of a parallel spatial direct numerical simulation (PSDNS) code are reported for the IBM SP1 supercomputer. The spatially evolving disturbances that are associated with laminar-to-turbulent in three-dimensional boundary-layer flows are computed with the PS-DNS code. By remapping the distributed data structure during the course of the calculation, optimized serial library routines can be utilized that substantially increase the computational performance. Although the remapping incurs a high communication penalty, the parallel efficiency of the code remains above 40% for all performed calculations. By using appropriate compile options and optimized library routines, the serial code achieves 52-56 Mflops on a single node of the SP1 (45% of theoretical peak performance). The actual performance of the PSDNS code on the SP1 is evaluated with a 'real world' simulation that consists of 1.7 million grid points. One time step of this simulation is calculated on eight nodes of the SP1 in the same time as required by a Cray Y/MP for the same simulation. The scalability information provides estimated computational costs that match the actual costs relative to changes in the number of grid points.

  19. SP1 as a novel scaffold building block for self-assembly nanofabrication of submicron enzymatic structures.

    PubMed

    Heyman, Arnon; Levy, Ilan; Altman, Arie; Shoseyov, Oded

    2007-06-01

    In this study, SP1, a ring-shaped highly stable homododecamer protein complex was utilized for the self-assembly of multiple domains in a predefined manner. Glucose oxidase (GOx) was fused in-frame to SP1 and expressed in Escherichia coli. Complexes where GOx encircled SP1 dodecamer were observed, and moreover, the enzymatic monomers self-assembled into active multienzyme nanotube particles containing hundreds of GOx molecules per tube. This work demonstrates the value of SP1 as a self-assembly scaffold. PMID:17530810

  20. Adult Play.

    ERIC Educational Resources Information Center

    Charles, John M.

    In its broadest context, play can be interpreted as any pleasurable use of discretionary time. Playfulness is an intrinsic feature of being human, and should be viewed in the light of a total lifestyle, not as an occurrence in an isolated time of life. Adult play appears to be an indefinable and controversial concept. A holistic approach should be…

  1. Wanna Play?

    ERIC Educational Resources Information Center

    Chenfeld, Mimi Brodsky

    2006-01-01

    In this article, the author talks about the importance of play in the lives of children and describes how games and imaginative play contribute to the development of children. From her decades-old collection of countless incidents demonstrating children's love for self-directed, informal, imaginative play, the author shares three incidents that…

  2. City Play.

    ERIC Educational Resources Information Center

    Dargan, Amanda; Zeitlin, Steve

    2000-01-01

    Today, fewer city blocks preserve the confidence of lifestyle and urban geography that sustain traditional games and outdoor play. Large groups of children choosing sides and organizing Red Rover games are no longer commonplace. Teachers must encourage free play; urban planners must build cities that are safe play havens. (MLH)

  3. Why people continue to play online games: in search of critical design factors to increase customer loyalty to online contents.

    PubMed

    Choi, Dongseong; Kim, Jinwoo

    2004-02-01

    As people increasingly play online games, numerous new features have been proposed to increase players' log-on time at online gaming sites. However, few studies have investigated why people continue to play certain online games or which design features are most closely related to the amount of time spent by players at particular online gaming sites. This study proposes a theoretical model using the concepts of customer loyalty, flow, personal interaction, and social interaction to explain why people continue to play online network games. The study then conducts a large-scale survey to validate the model. Finally, it analyzes current online games to identify design features that are closely related to the theoretical concepts. The results indicate that people continue to play online games if they have optimal experiences while playing the games. This optimal experience can be attained if the player has effective personal interaction with the system or pleasant social interactions with other people connected to the Internet. Personal interaction can be facilitated by providing appropriate goals, operators and feedback; social interaction can be facilitated through appropriate communication places and tools. This paper ends with the implications of applying the study results to other domains such as e-commerce and cyber communities. PMID:15006164

  4. Cadmium down-regulation of kidney Sp1 binding to mouse SGLT1 and SGLT2 gene promoters: Possible reaction of cadmium with the zinc finger domain of Sp1

    SciTech Connect

    Kothinti, Rajendra K.; Blodgett, Amy B.; Petering, David H.; Tabatabai, Niloofar M.

    2010-05-01

    Cadmium (Cd) exposure causes glucosuria (glucose in the urine). Previously, it was shown that Cd exposure of primary cultures of mouse kidney cells (PMKC) decreased mRNA levels of the glucose transporters, SGLT1 and SGLT2 and that Sp1 from Cd-exposed cells displayed reduced binding to the GC boxes of the mouse SGLT1 promoter in vitro. Here, we identified a GC box upstream of mouse SGLT2 gene. ChIP assays on PMKC revealed that exposure to 5 muM Cd abolished Sp1 binding to SGLT1 GC box while it decreased Sp1 binding to SGLT2 GC sequence by 30% in vivo. The in vitro DNA binding assay, EMSA, demonstrated that binding of Sp1 from Cd (7.5 muM)-treated PMKC to the SGLT2 GC probe was 86% lower than in untreated cells. Sp1 is a zinc finger protein. Compared to PMKC exposed to 5 muM Cd alone, inclusion of 5 muM Zn restored SGLT1 and 2 mRNA levels by 15% and 30%, respectively. Cd (10 muM) decreased the binding of recombinant Sp1 (rhSp1) to SGLT1 and SGLT2 GC probes to 12% and 8% of untreated controls. Cd exerted no effect on GC-bound rhSp1. Co-treatment with Cd and Zn showed that added Zn significantly restored rhSp1 binding to the SGLT1 and SGLT2. Addition of Zn post Cd treatment was not stimulatory. We conclude that Cd can replace Zn in Sp1 DNA binding domain to reduce its binding to GC sites in mouse SGLT1 and SGLT2 promoters.

  5. Aspen SP1, an exceptional thermal, protease and detergent-resistant self-assembled nano-particle.

    PubMed

    Wang, Wang-Xia; Dgany, Or; Wolf, Sharon Grayer; Levy, Ilan; Algom, Rachel; Pouny, Yehonathan; Wolf, Amnon; Marton, Ira; Altman, Arie; Shoseyov, Oded

    2006-09-01

    Stable protein 1 (SP1) is a homo-oligomeric protein isolated from aspen (Populus tremula aspen) plants which forms a ring-shape dodecameric particle with a central cavity. The oligomeric form of SP1 is an exceptionally stable structure that is resistant to proteases (e.g., trypsin, V8, and proteinase K), high temperatures, organic solvents, and high levels of ionic detergent. Analytical ultra-centrifugation, chemical cross-linking, matrix-assisted laser-desorption time-of-flight mass spectrometry (MALDI-TOF-MS), and transmission electron microscopy were used to further characterize the SP1 dodecamer. Introduction of a single cysteine at the N-terminus of SP1 enabled the formation of disulfide bridges within the SP1 dodecamer, concurrent with increased melting point. A six-histidine tag was introduced at the N-terminus of SP1 to generate 6HSP1, and the DeltaNSP1 mutant was generated by a deletion of amino acids 2-6 at the N-terminus. Both 6HSP1 and DeltaNSP1 maintained their ability to assemble a stable dodecamer. Remarkably, these SP1 homo-dodecamers were able to re-assemble into stable hetero-dodecamers following co-electro-elution from SDS-PAGE. The exceptional stability of the SP1-nano ring and its ability to self-assemble hetero-complexes paves the way to further research in utilizing this unique protein in nano-biotechnology. PMID:16732592

  6. Species-specific interaction of the glutamine-rich activation domains of Sp1 with the TATA box-binding protein.

    PubMed Central

    Emili, A; Greenblatt, J; Ingles, C J

    1994-01-01

    We have used protein-blotting and protein affinity chromatography to demonstrate that each of the two glutamine-rich activation domains of the human transcription factor Sp1 can bind specifically and directly to the C-terminal evolutionarily conserved domain of the human TATA box-binding protein (TBP). These activation domains of Sp1 also bind directly to Drosophila TBP but bind much less strongly to TBP from the yeast Saccharomyces cerevisiae. The abilities of the Sp1 activation domains to interact directly with the TBPs of various species correlate well with their abilities to activate transcription in extracts derived from the same species. We also show that a glutamine-rich transcriptional activating region of the Drosophila protein Antennapedia binds directly to TBP in a species-specific manner that reflects its ability to activate transcription in vivo. These results support the notion that TBP is a direct and important target of glutamine-rich transcriptional activators. Images PMID:8114696

  7. Capsaicin sensitizes TRAIL-induced apoptosis through Sp1-mediated DR5 up-regulation: Involvement of Ca{sup 2+} influx

    SciTech Connect

    Moon, Dong-Oh; Kang, Chang-Hee; Kang, Sang-Hyuck; Choi, Yung-Hyun; Hyun, Jin-Won; Chang, Weon-Young; Kang, Hee-Kyoung; Koh, Young-Sang; Maeng, Young-Hee; Kim, Young-Ree; Kim, Gi-Young

    2012-02-15

    Although tumor necrosis factor-related apoptosis-inducing ligand (TRAIL) induces apoptosis in various malignant cells, several cancers including human hepatocellular carcinoma (HCC) exhibit potent resistance to TRAIL-induced cell death. The aim of this study is to evaluate the anti-cancer potential of capsaicin in TRAIL-induced cancer cell death. As indicated by assays that measure phosphatidylserine exposure, mitochondrial activity and activation of caspases, capsaicin potentiated TRAIL-resistant cells to lead to cell death. In addition, we found that capsaicin induces the cell surface expression of TRAIL receptor DR5, but not DR4 through the activation Sp1 on its promoter region. Furthermore, we investigated that capsaicin-induced DR5 expression and apoptosis are inhibited by calcium chelator or inhibitors for calmodulin-dependent protein kinase. Taken together, our data suggest that capsaicin sensitizes TRAIL-mediated HCC cell apoptosis by DR5 up-regulation via calcium influx-dependent Sp1 activation. Highlights: ► Capsaicin sensitizes TRAIL-induced apoptosis through activation of caspases. ► Capsaicin induces expression of DR5 through Sp1 activation. ► Capsaicin activates calcium signaling pathway.

  8. Involvement of the GC-rich sequence and specific proteins (Sp1/Sp3) in the basal transcription activity of neurogranin gene

    SciTech Connect

    Gui Jingang; Song Yan; Han, N.-L.R.; Zhou Shufeng; Sheu, F.-S. . E-mail: dbssfs@nus.edu.sg

    2006-06-23

    Neurogranin (Ng), a neuronal protein implicated in learning and memory, contains a TATA-less promoter. Analysis of 5'-deletion mutations and site-directed mutations of the mouse Ng promoter revealed that a 258 bp 5'-flanking sequence (+3 to +260) conferred the basal transcription activity, and that the GC-rich sequence (+22 to +33) served as an important determinant of the promoter activity. Transient transfection of the Sp1 expression plasmid transactivated the reporter activity in neuroblastoma N2A cells while knocking down of endogenous Sp1 expression resulted in a 2.5-fold reduction of the reporter activity in HEK 293 cells. Exogenous expression of Sp3 in HEK 293 cells, however, repressed the reporter activity by 50%. Nevertheless, by gel shift assays, Sp1 and Sp3 were not found to be responsible for the protein-DNA complexes formed by the GC-rich sequence. Moreover, a nuclear factor from the mouse brain tissues was discovered to bind to multiple AT-rich regions in Ng promoter.

  9. CYP1B1 Enhances Cell Proliferation and Metastasis through Induction of EMT and Activation of Wnt/β-Catenin Signaling via Sp1 Upregulation.

    PubMed

    Kwon, Yeo-Jung; Baek, Hyoung-Seok; Ye, Dong-Jin; Shin, Sangyun; Kim, Donghak; Chun, Young-Jin

    2016-01-01

    Cytochrome P450 1B1 (CYP1B1) is a major E2 hydroxylase involved in the metabolism of potential carcinogens. CYP1B1 expression has been reported to be higher in tumors compared to normal tissues, especially in hormone-related cancers including breast, ovary, and prostate tumors. To explore the role of CYP1B1 in cancer progression, we investigated the action of CYP1B1 in cells with increased CYP1B1 via the inducer 7,12-dimethylbenz[α]anthracene (DMBA) or an overexpression vector, in addition to decreased CYP1B1 via the inhibitor tetramethoxystilbene (TMS) or siRNA knockdown. We observed that CYP1B1 promoted cell proliferation, migration, and invasion in MCF-7 and MCF-10A cells. To understand its molecular mechanism, we measured key oncogenic proteins including β-catenin, c-Myc, ZEB2, and matrix metalloproteinases following CYP1B1 modulation. CYP1B1 induced epithelial-mesenchymal transition (EMT) and activated Wnt/β-catenin signaling via upregulation of CTNNB1, ZEB2, SNAI1, and TWIST1. Sp1, a transcription factor involved in cell growth and metastasis, was positively regulated by CYP1B1, and suppression of Sp1 expression by siRNA or DNA binding activity using mithramycin A blocked oncogenic transformation by CYP1B1. Therefore, we suggest that Sp1 acts as a key mediator for CYP1B1 action. Treatment with 4-hydroxyestradiol (4-OHE2), a major metabolite generated by CYP1B1, showed similar effects as CYP1B1 overexpression, indicating that CYP1B1 activity mediated various oncogenic events in cells. In conclusion, our data suggests that CYP1B1 promotes cell proliferation and metastasis by inducing EMT and Wnt/β-catenin signaling via Sp1 induction. PMID:26981862

  10. CYP1B1 Enhances Cell Proliferation and Metastasis through Induction of EMT and Activation of Wnt/β-Catenin Signaling via Sp1 Upregulation

    PubMed Central

    Kwon, Yeo-Jung; Baek, Hyoung-Seok; Ye, Dong-Jin; Shin, Sangyun; Kim, Donghak; Chun, Young-Jin

    2016-01-01

    Cytochrome P450 1B1 (CYP1B1) is a major E2 hydroxylase involved in the metabolism of potential carcinogens. CYP1B1 expression has been reported to be higher in tumors compared to normal tissues, especially in hormone-related cancers including breast, ovary, and prostate tumors. To explore the role of CYP1B1 in cancer progression, we investigated the action of CYP1B1 in cells with increased CYP1B1 via the inducer 7,12-dimethylbenz[α]anthracene (DMBA) or an overexpression vector, in addition to decreased CYP1B1 via the inhibitor tetramethoxystilbene (TMS) or siRNA knockdown. We observed that CYP1B1 promoted cell proliferation, migration, and invasion in MCF-7 and MCF-10A cells. To understand its molecular mechanism, we measured key oncogenic proteins including β-catenin, c-Myc, ZEB2, and matrix metalloproteinases following CYP1B1 modulation. CYP1B1 induced epithelial-mesenchymal transition (EMT) and activated Wnt/β-catenin signaling via upregulation of CTNNB1, ZEB2, SNAI1, and TWIST1. Sp1, a transcription factor involved in cell growth and metastasis, was positively regulated by CYP1B1, and suppression of Sp1 expression by siRNA or DNA binding activity using mithramycin A blocked oncogenic transformation by CYP1B1. Therefore, we suggest that Sp1 acts as a key mediator for CYP1B1 action. Treatment with 4-hydroxyestradiol (4-OHE2), a major metabolite generated by CYP1B1, showed similar effects as CYP1B1 overexpression, indicating that CYP1B1 activity mediated various oncogenic events in cells. In conclusion, our data suggests that CYP1B1 promotes cell proliferation and metastasis by inducing EMT and Wnt/β-catenin signaling via Sp1 induction. PMID:26981862

  11. Pretend play.

    PubMed

    Weisberg, Deena Skolnick

    2015-01-01

    Pretend play is a form of playful behavior that involves nonliteral action. Although on the surface this activity appears to be merely for fun, recent research has discovered that children's pretend play has connections to important cognitive and social skills, such as symbolic thinking, theory of mind, and counterfactual reasoning. The current article first defines pretend play and then reviews the arguments and evidence for these three connections. Pretend play has a nonliteral correspondence to reality, hence pretending may provide children with practice with navigating symbolic relationships, which may strengthen their language skills. Pretend play and theory of mind reasoning share a focus on others' mental states in order to correctly interpret their behavior, hence pretending and theory of mind may be mutually supportive in development. Pretend play and counterfactual reasoning both involve representing nonreal states of affairs, hence pretending may facilitate children's counterfactual abilities. These connections make pretend play an important phenomenon in cognitive science: Studying children's pretend play can provide insight into these other abilities and their developmental trajectories, and thereby into human cognitive architecture and its development. PMID:26263228

  12. Sp1 mediates repression of the resistin gene by PPAR{gamma} agonists in 3T3-L1 adipocytes

    SciTech Connect

    Chung, S.S.; Choi, H.H.; Cho, Y.M.; Lee, H.K.; Park, K.S. . E-mail: kspark@snu.ac.kr

    2006-09-15

    Resistin is an adipokine related to obesity and insulin resistance. Expression of the resistin gene is repressed by the treatment of peroxisome proliferator-activated receptor {gamma} (PPAR{gamma}) agonists, thiazolidinediones (TZDs). In this study, we investigated the mechanism by which TZDs inhibit the resistin gene expression. Resistin gene expression was decreased by TZD in fully differentiated 3T3-L1 adipocytes, which was abolished after treatment of cycloheximide (a protein synthesis inhibitor). TZD could not repress the expression of the resistin gene in the presence of mithramycin A (an Sp1 binding inhibitor). Sp1 binding site of the resistin promoter (-122/-114 bp) was necessary for the repression. Further investigation of the effect of TZDs on the modification of Sp1 showed that the level of O-glycosylation of Sp1 was decreased in this process. These results suggest that PPAR{gamma} activation represses the expression of the resistin gene by modulating Sp1 activity.

  13. Complete genome sequence of Kosakonia sacchari type strain SP1T

    PubMed Central

    Chen, Mingyue; Zhu, Bo; Lin, Li; Yang, Litao; Li, Yangrui; An, Qianli

    2014-01-01

    Kosakonia sacchari sp. nov. is a new species within the new genus Kosakonia, which was included in the genus Enterobacter. K sacchari is a nitrogen-fixing bacterium named for its association with sugarcane (Saccharum officinarum L.). K sacchari bacteria are Gram-negative, aerobic, non-spore-forming, motile rods. Strain SP1T (=CGMCC1.12102T=LMG 26783T) is the type strain of the K sacchari sp. nov and is able to colonize and fix N2 in association with sugarcane plants, thus promoting plant growth. Here we summarize the features of strain SP1T and describe its complete genome sequence. The genome contains a single chromosome and no plasmids, 4,902,024 nucleotides with 53.7% GC content, 4,460 protein-coding genes and 105 RNA genes including 22 rRNA genes, 82 tRNA genes, and 1 ncRNA gene. PMID:25197499

  14. Characterization of SP1, a Stress-Responsive, Boiling-Soluble, Homo-Oligomeric Protein from Aspen1

    PubMed Central

    Wang, Wang-Xia; Pelah, Dan; Alergand, Tal; Shoseyov, Oded; Altman, Arie

    2002-01-01

    sp1 cDNA was isolated from aspen (Populus tremula) plants by immunoscreening an expression library using polyclonal antibodies against BspA protein. BspA, which is a boiling-stable protein, accumulates in aspen plants in response to water stress and abscisic acid application (Pelah et al., 1995). The sp1 cDNA was found to encode a 12.4-kD generally hydrophilic protein with a hydrophobic C terminus, which is different from the BspA protein and was termed SP1 (stable protein 1). Northern-blot analysis revealed that sp1 encodes a small mRNA (about 0.6 kb) that is expressed in aspen plants under non-stress conditions and is accumulated after salt, cold, heat, and desiccation stress, and during the recovery from stress. The SP1 detected in plants remained soluble upon boiling, migrated both as a 12.4-kD band and a much higher mass of 116 kD on a 17% (w/v) Tricine-sodium dodecyl sulfate-polyacrylamide gel. Comparative protease digestion patterns, amino acid analyses, and the N-terminal sequences of the 12.4- and 116-kD proteins revealed that SP1 is homo-oligomeric. Furthermore, gel filtration chromatography analysis indicated that SP1 exists in aspen plants as a complex, composed of 12 subunits of 12.4 kD. A large number of sequences deduced from expressed sequence tags and genomic sequences of other organisms with unknown function show high homology to SP1. Thus, SP1 may represent a new protein family. Here, we present the first report on this putative protein family: the cloning, isolation, and characterization of SP1, a stress-responsive, boiling-soluble, oligomeric protein. PMID:12376651

  15. Shadow Play

    ERIC Educational Resources Information Center

    Trundle, Kathy Cabe; Hilson, Margilee P.

    2012-01-01

    A bunny rabbit playfully hops across the wall. Then hands realign and fingers shift to make a hawk soar toward the ceiling. Most children have enjoyed the delightful experience of playing with shadow puppets. The authors build on this natural curiosity to help students link shadows to complex astronomical concepts such as seasons. The…

  16. Risk Factor Analysis in Low-Temperature Geothermal Play Fairway Analysis for the Appalachian Basin (GPFA-AB)

    DOE Data Explorer

    Teresa E. Jordan

    2015-09-30

    This submission contains information used to compute the risk factors for the GPFA-AB project (DE-EE0006726). The risk factors are natural reservoir quality, thermal resource quality, potential for induced seismicity, and utilization. The methods used to combine the risk factors included taking the product, sum, and minimum of the four risk factors. The files are divided into images, rasters, shapefiles, and supporting information. The image files show what the raster and shapefiles should look like. The raster files contain the input risk factors, calculation of the scaled risk factors, and calculation of the combined risk factors. The shapefiles include definition of the fairways, definition of the US Census Places, the center of the raster cells, and locations of industries. Supporting information contains details of the calculations or processing used in generating the files. An image of the raster will have the same name except *.png as the file ending instead of *.tif. Images with “fairways” or “industries” added to the name are composed of a raster with the relevant shapefile added. The file About_GPFA-AB_Phase1RiskAnalysisTask5DataUpload.pdf contains information the citation, special use considerations, authorship, etc. More details on each file are given in the spreadsheet “list_of_contents.csv” in the folder “SupportingInfo”. Code used to calculate values is available at https://github.com/calvinwhealton/geothermal_pfa under the folder “combining_metrics”.

  17. Transcriptional Regulation of Oncogenic Protein Kinase Cϵ (PKCϵ) by STAT1 and Sp1 Proteins*

    PubMed Central

    Wang, HongBin; Gutierrez-Uzquiza, Alvaro; Garg, Rachana; Barrio-Real, Laura; Abera, Mahlet B.; Lopez-Haber, Cynthia; Rosemblit, Cinthia; Lu, Huaisheng; Abba, Martin; Kazanietz, Marcelo G.

    2014-01-01

    Overexpression of PKCϵ, a kinase associated with tumor aggressiveness and widely implicated in malignant transformation and metastasis, is a hallmark of multiple cancers, including mammary, prostate, and lung cancer. To characterize the mechanisms that control PKCϵ expression and its up-regulation in cancer, we cloned an ∼1.6-kb promoter segment of the human PKCϵ gene (PRKCE) that displays elevated transcriptional activity in cancer cells. A comprehensive deletional analysis established two regions rich in Sp1 and STAT1 sites located between −777 and −105 bp (region A) and −921 and −796 bp (region B), respectively, as responsible for the high transcriptional activity observed in cancer cells. A more detailed mutagenesis analysis followed by EMSA and ChIP identified Sp1 sites in positions −668/−659 and −269/−247 as well as STAT1 sites in positions −880/−869 and −793/−782 as the elements responsible for elevated promoter activity in breast cancer cells relative to normal mammary epithelial cells. RNAi silencing of Sp1 and STAT1 in breast cancer cells reduced PKCϵ mRNA and protein expression, as well as PRKCE promoter activity. Moreover, a strong correlation was found between PKCϵ and phospho-Ser-727 (active) STAT1 levels in breast cancer cells. Our results may have significant implications for the development of approaches to target PKCϵ and its effectors in cancer therapeutics. PMID:24825907

  18. Molecular characterization of alkaline protease of Bacillus amyloliquefaciens SP1 involved in biocontrol of Fusarium oxysporum.

    PubMed

    Guleria, Shiwani; Walia, Abhishek; Chauhan, Anjali; Shirkot, C K

    2016-09-01

    An alkaline protease gene was amplified from genomic DNA of Bacillus amyloliquefaciens SP1 which was involved in effective biocontrol of Fusarium oxysporum. We investigated the antagonistic capacity of protease of B. amyloliquifaciens SP1, under in vitro conditions. The 5.62 fold purified enzyme with specific activity of 607.69U/mg reported 24.14% growth inhibition of F. oxysporum. However, no antagonistic activity was found after addition of protease inhibitor i.e. PMSF (15mM) to purified enzyme. An 1149bp nucleotide sequence of protease gene encoded 382 amino acids of 43kDa and calculated isoelectric point of 9.29. Analysis of deduced amino acid sequence revealed high homology (86%) with subtilisin E of Bacillus subtilis. The B. amyloliquefaciens SP1 protease gene was expressed in Escherichiax coli BL21. The expressed protease was secreted into culture medium by E. coli and exhibited optimum activity at pH8.0 and 60°C. The most reliable three dimensional structure of alkaline protease was determined using Phyre 2 server which was validated on the basis of Ramachandran plot and ERRAT value. The expression and structure prediction of the enzyme offers potential value for commercial application in agriculture and industry. PMID:27294522

  19. Transdiagnostic factors across fibromyalgia and mental disorders: sleep disturbances may play a key role. A clinical review.

    PubMed

    Palagini, Laura; Carmassi, Claudia; Conversano, Ciro; Gesi, Camilla; Bazzichi, Laura; Giacomelli, Camillo; Dell'Osso, Liliana

    2016-01-01

    Sleep disturbances, affective disorders, pain and fatigue are often present in individuals affected by fibromyalgia (FM). The pathophysiology of FM is not yet well understood and, to date, no treatment has been proven to be fully effective in alleviating all symptoms. Adopting a transdiagnostic perspective could thus be useful for clinicians: treatment would target a transdiagnostic process across a range of disturbances, not just a single disorder. The aim of this review is to revise the available literature about the potential role of sleep disturbances as a transdiagnostic process in FM symptomatology and mood or anxiety disorders comorbidity. We are proposing a model under which sleep disturbances can play a central role. Because conditions of sleep loss are related to the activation of the stress system, including the activation of the inflammation system, we propose this mechanism as a key one: it can be shared by mental, sleep disturbances and pain in FM and it may explain, in part, the high levels of comorbidity between them. In this frame-work sleep disturbances may play a key role and be the target of therapeutic strategies across FM symptomatology and mental disorders. PMID:27157399

  20. Overexpression of HDAC1 induces cellular senescence by Sp1/PP2A/pRb pathway

    SciTech Connect

    Chuang, Jian-Ying; Hung, Jan-Jong

    2011-04-15

    Highlights: {yields} Overexpression of HDAC1 induces Sp1 deacetylation and raises Sp1/p300 complex formation to bind to PP2Ac promoter. {yields} Overexpression of HDAC1 strongly inhibits the phosphorylation of pRb through up-regulation of PP2A. {yields} Overexpressed HDAC1 restrains cell proliferaction and induces cell senescence though a novel Sp1/PP2A/pRb pathway. -- Abstract: Senescence is associated with decreased activities of DNA replication, protein synthesis, and cellular division, which can result in deterioration of cellular functions. Herein, we report that the growth and division of tumor cells were significantly repressed by overexpression of histone deacetylase (HDAC) 1 with the Tet-off induced system or transient transfection. In addition, HDAC1 overexpression led to senescence through both an accumulation of hypophosphorylated active retinoblastoma protein (pRb) and an increase in the protein level of protein phosphatase 2A catalytic subunit (PP2Ac). HDAC1 overexpression also increased the level of Sp1 deacetylation and elevated the interaction between Sp1 and p300, and subsequently that Sp1/p300 complex bound to the promoter of PP2Ac, thus leading to induction of PP2Ac expression. Similar results were obtained in the HDAC1-Tet-off stable clone. Taken together, these results indicate that HDAC1 overexpression restrained cell proliferation and induced premature senescence in cervical cancer cells through a novel Sp1/PP2A/pRb pathway.

  1. Integrated high-throughput analysis identifies Sp1 as a crucial determinant of p53-mediated apoptosis

    PubMed Central

    Li, H; Zhang, Y; Ströse, A; Tedesco, D; Gurova, K; Selivanova, G

    2014-01-01

    The restoration of p53 tumor suppressor function is a promising therapeutic strategy to combat cancer. However, the biological outcomes of p53 activation, ranging from the promotion of growth arrest to the induction of cell death, are hard to predict, which limits the clinical application of p53-based therapies. In the present study, we performed an integrated analysis of genome-wide short hairpin RNA screen and gene expression data and uncovered a previously unrecognized role of Sp1 as a central modulator of the transcriptional response induced by p53 that leads to robust induction of apoptosis. Sp1 is indispensable for the pro-apoptotic transcriptional repression by p53, but not for the induction of pro-apoptotic genes. Furthermore, the p53-dependent pro-apoptotic transcriptional repression required the co-binding of Sp1 to p53 target genes. Our results also highlight that Sp1 shares with p53 a common regulator, MDM2, which targets Sp1 for proteasomal degradation. This uncovers a new mechanism of the tight control of apoptosis in cells. Our study advances the understanding of the molecular basis of p53-mediated apoptosis and implicates Sp1 as one of its key modulators. We found that small molecules reactivating p53 can differentially modulate Sp1, thus providing insights into how to manipulate p53 response in a controlled way. PMID:24971482

  2. The Role Played by the Interaction between Genetic Factors and Attachment in the Stress Response in Infancy

    ERIC Educational Resources Information Center

    Frigerio, Alessandra; Ceppi, Elisa; Rusconi, Marianna; Giorda, Roberto; Raggi, Maria Elisabetta; Fearon, Pasco

    2009-01-01

    Background: The importance of understanding which environmental and biological factors are involved in determining individual differences in physiological response to stress is widely recognized, given the impact that stress has on physical and mental health. Methods: The child-mother attachment relationship and some genetic polymorphisms…

  3. Draft genome sequence of Sphingomonas paucimobilis strain LCT-SP1 isolated from the Shenzhou X spacecraft of China.

    PubMed

    Pan, Lei; Zhou, Hong; Li, Jia; Huang, Bing; Guo, Jun; Zhang, Xue-Lin; Gao, Long-Cheng; Xu, Chou; Liu, Chang-Ting

    2016-01-01

    Sphingomonas paucimobilis strain LCT-SP1 is a glucose-nonfermenting Gram-negative, chemoheterotrophic, strictly aerobic bacterium. The major feature of strain LCT-SP1, isolated from the Chinese spacecraft Shenzhou X, together with the genome draft and annotation are described in this paper. The total size of strain LCT-SP1 is 4,302,226 bp with 3,864 protein-coding and 50 RNA genes. The information gained from its sequence is potentially relevant to the elucidation of microbially mediated corrosion of various materials. PMID:26918090

  4. Influenza A induces the major secreted airway mucin MUC5AC in a protease-EGFR-extracellular regulated kinase-Sp1-dependent pathway.

    PubMed

    Barbier, Diane; Garcia-Verdugo, Ignacio; Pothlichet, Julien; Khazen, Roxana; Descamps, Delphyne; Rousseau, Karine; Thornton, David; Si-Tahar, Mustapha; Touqui, Lhousseine; Chignard, Michel; Sallenave, Jean-Michel

    2012-08-01

    Mucins, the main glycoproteins present within mucus, modulate the rheologic properties of airways and participate in lung defense. They are thought to be able to trap and eliminate microorganisms from the lung. Among the mucins secreted in the lung, MUC5AC is the most prominent factor secreted by surface epithelial cells. Although much is known about the signaling pathways involved in the regulation of MUC5AC by host factors such as cytokines or proteases, less is known about the pathways triggered by microorganisms and, specifically, by influenza A virus (IAV). We therefore set up experiments to dissect the molecular mechanisms responsible for the potential modulation of MUC5AC by IAV. Using epithelial cells, C57/Bl6 mice, and IAV strains, we measured MUC5AC expression at the RNA and protein levels, specificity protein 1 (Sp1) activation, and protease activity. Intermediate molecular partners were confirmed using pharmacological inhibitors, blocking antibodies, and small interfering (si)RNAs. We showed in vitro and in vivo that IAV up-regulates epithelial cell-derived MUC5AC and Muc5ac expression in mice, both at transcriptional (through the induction of Sp1) and translational levels. In addition, we determined that this induction was dependent on a protease-epithelial growth factor receptor-extracellular regulated kinase-Sp1 signaling cascade, involving in particular the human airway trypsin. Our data point to MUC5AC as a potential modulatory mechanism by which the lung epithelia respond to IAV infection, and we dissect, for the first time to the best of our knowledge, the molecular partners involved. Future experiments using MUC5AC-targeted strategies should help further unravel the pathophysiological consequences of IAV-induced MUC5AC expression for lung homeostasis. PMID:22383584

  5. c-ETS transcription factors play an essential role in the licensing of human MCM4 origin of replication.

    PubMed

    Sidhu, Kaveri; Kumar, Vijay

    2015-11-01

    In metazoans, DNA replication is a highly regulated and ordered process that occurs during the S phase of cell cycle. It begins with the licensing of origins of replication usually found in close proximity of actively transcribing genes owing perhaps to a profound influence of transcription factors on the epigenetic signatures and architecture of chromatin. Here we show that ETS transcription factors are novel regulators of MCM4 origin, whose binding sites are localized between two divergently transcribing MCM4 and PRKDC genes. c-ETS1 and c-ETS2 were recruited to the MCM4 origin respectively during the S and G1 phases of cell cycle. c-ETS2 binding was facilitated by an active chromatin distinguished by acetylated histone H3 orchestrated by histone acetyl transferase GCN5 and followed by HBO1 mediated histone H4 acetylation. Interestingly, c-ETS2 overexpression led to increased BrdU incorporation in the S phase cells while its down-regulation by RNA interference compromised the loading of pre-replicative complex at the origin. Conversely, the recruitment of c-ETS1 at the origin coincided with histone H3 methylation signature characteristic of closed chromatin conformation. As expected, enforced expression of c-ETS1 severely compromised DNA replication whereas its down-regulation enhanced DNA replication as evident from increased BrdU incorporation. Thus, c-ETS transcription factors appear to be key regulators of MCM4 origin where c-ETS2 seems to promote DNA replication whereas c-ETS1 functions as a negative regulator. PMID:26365772

  6. Inheritance and memory of stress-induced epigenome change: roles played by the ATF-2 family of transcription factors

    PubMed Central

    Seong, Ki-Hyeon; Maekawa, Toshio; Ishii, Shunsuke

    2012-01-01

    Data on the inheritance-of-stress effect have been accumulating and some mechanistic insights, such as epigenetic regulation, have also been suggested. In particular, the modern view of Lamarckian inheritance appears to be affected by the finding that stress-induced epigenetic changes can be inherited. This review summarizes the current data on the inheritance of stress effect and possible mechanisms involved in this process. In particular, we focus on the stress-induced epigenetic changes mediated by the ATF-2 family of transcription factors. PMID:22380515

  7. Hypoxia-inducible factorplays a critical role in the formation of alveoli and surfactant.

    PubMed

    Huang, Yadi; Kempen, Marjon Buscop-van; Munck, Anne Boerema-de; Swagemakers, Sigrid; Driegen, Siska; Mahavadi, Poornima; Meijer, Dies; van Ijcken, Wilfred; van der Spek, Peter; Grosveld, Frank; Günther, Andreas; Tibboel, Dick; Rottier, Robbert J

    2012-02-01

    Alveolarization of the developing lung is an important step toward the switch from intrauterine life to breathing oxygen-rich air after birth. The distal airways structurally change to minimize the gas exchange path, and Type II pneumocytes increase the production of surfactants, which are required to reduce surface tension at the air-liquid interface in the alveolus. Hypoxia-inducible factor 2α (Hif2α) is an oxygen-regulated transcription factor expressed in endothelial and Type II cells, and its expression increases toward the end of gestation. We investigated the role of Hif2α in Type II cells by conditionally expressing an oxygen-insensitive mutant of Hif2α in airway epithelial cells during development. Newborn mice expressing the mutant Hif2α were born alive but quickly succumbed to respiratory distress. Subsequent analysis of the lungs revealed dilated alveoli covered with enlarged, aberrant Type II cells and a diminished number of Type I cells. The Type II cells accumulated glycogen in part by increased glucose uptake via the up-regulation of the glucose transporter 1. Furthermore, the cells lacked two crucial enzymes involved in the metabolism of glycogen into surfactant lipids, lysophosphatidylcholine acyltransferase and ATP-binding cassette sub-family A member 3. We conclude that Hif2α is a key regulator in alveolar maturation and the production of phospholipids by Type II cells. PMID:22298531

  8. Hypoxia-inducible factor-1 plays a role in phosphate-induced vascular smooth muscle cell calcification.

    PubMed

    Mokas, Sophie; Larivière, Richard; Lamalice, Laurent; Gobeil, Stéphane; Cornfield, David N; Agharazii, Mohsen; Richard, Darren E

    2016-09-01

    Medial vascular calcification is a common complication of chronic kidney disease (CKD). Although elevated inorganic phosphate stimulates vascular smooth muscle cell (VSMC) osteogenic transdifferentiation and calcification, the mechanisms involved in their calcification during CKD are not fully defined. Because hypoxic gene activation is linked to CKD and stimulates bone cell osteogenic differentiation, we used in vivo and in vitro rodent models to define the role of hypoxic signaling during elevated inorganic phosphate-induced VSMC calcification. Cell mineralization studies showed that elevated inorganic phosphate rapidly induced VSMC calcification. Hypoxia strongly enhanced elevated inorganic phosphate-induced VSMC calcification and osteogenic transdifferentiation, as seen by osteogenic marker expression. Hypoxia-inducible factor-1 (HIF-1), the key hypoxic transcription factor, was essential for enhanced VSMC calcification. Targeting HIF-1 expression in murine VSMC blocked calcification in hypoxia with elevated inorganic phosphate while HIF-1 activators, including clinically used FG-4592/Roxadustat, recreated a procalcifying environment. Elevated inorganic phosphate rapidly activated HIF-1, even in normal oxygenation; an effect mediated by HIF-1α subunit stabilization. Thus, hypoxia synergizes with elevated inorganic phosphate to enhance VSMC osteogenic transdifferentiation. Our work identifies HIF-1 as an early CKD-related pathological event, prospective marker, and potential target against vascular calcification in CKD-relevant conditions. PMID:27470678

  9. Spatial Factors Play a Major Role as Determinants of Endemic Ground Beetle Beta Diversity of Madeira Island Laurisilva

    PubMed Central

    Boieiro, Mário; Carvalho, José C.; Cardoso, Pedro; Aguiar, Carlos A. S.; Rego, Carla; de Faria e Silva, Israel; Amorim, Isabel R.; Pereira, Fernando; Azevedo, Eduardo B.; Borges, Paulo A. V.; Serrano, Artur R. M.

    2013-01-01

    The development in recent years of new beta diversity analytical approaches highlighted valuable information on the different processes structuring ecological communities. A crucial development for the understanding of beta diversity patterns was also its differentiation in two components: species turnover and richness differences. In this study, we evaluate beta diversity patterns of ground beetles from 26 sites in Madeira Island distributed throughout Laurisilva – a relict forest restricted to the Macaronesian archipelagos. We assess how the two components of ground beetle beta diversity (βrepl – species turnover and βrich - species richness differences) relate with differences in climate, geography, landscape composition matrix, woody plant species richness and soil characteristics and the relative importance of the effects of these variables at different spatial scales. We sampled 1025 specimens from 31 species, most of which are endemic to Madeira Island. A spatially explicit analysis was used to evaluate the contribution of pure environmental, pure spatial and environmental spatially structured effects on variation in ground beetle species richness and composition. Variation partitioning showed that 31.9% of species turnover (βrepl) and 40.7% of species richness variation (βrich) could be explained by the environmental and spatial variables. However, different environmental variables controlled the two types of beta diversity: βrepl was influenced by climate, disturbance and soil organic matter content whilst βrich was controlled by altitude and slope. Furthermore, spatial variables, represented through Moran’s eigenvector maps, played a significant role in explaining both βrepl and βrich, suggesting that both dispersal ability and Madeira Island complex orography are crucial for the understanding of beta diversity patterns in this group of beetles. PMID:23724065

  10. Play and Positive Group Dynamics

    ERIC Educational Resources Information Center

    Thompson, Pam; White, Samantha

    2010-01-01

    Play is an important part of a child's life and essential to learning and development (Vygotsky, 1978). It is vital that students participate in play and that play be conducted in a restorative manner. Play allows a variety of group dynamics to emerge. Irvin Yalom (1995) identifies 11 curative factors of the group experience. These factors include…

  11. Clay Play

    ERIC Educational Resources Information Center

    Rogers, Liz; Steffan, Dana

    2009-01-01

    This article describes how to use clay as a potential material for young children to explore. As teachers, the authors find that their dialogue about the potential of clay as a learning medium raises many questions: (1) What makes clay so enticing? (2) Why are teachers noticing different play and conversation around the clay table as compared to…

  12. Playing Teacher.

    ERIC Educational Resources Information Center

    Gilbert, Juan E.

    The acceptance of animation technologies is increasing. Video games, such as Sony PlayStation (SONY, 2002), have become part of the culture for young people from kindergarten through undergraduate school. Animation technologies have been implemented into educational systems in the form of animated pedagogical agents (Johnson, 2000). The research…

  13. Game playing.

    PubMed

    Rosin, Christopher D

    2014-03-01

    Game playing has been a core domain of artificial intelligence research since the beginnings of the field. Game playing provides clearly defined arenas within which computational approaches can be readily compared to human expertise through head-to-head competition and other benchmarks. Game playing research has identified several simple core algorithms that provide successful foundations, with development focused on the challenges of defeating human experts in specific games. Key developments include minimax search in chess, machine learning from self-play in backgammon, and Monte Carlo tree search in Go. These approaches have generalized successfully to additional games. While computers have surpassed human expertise in a wide variety of games, open challenges remain and research focuses on identifying and developing new successful algorithmic foundations. WIREs Cogn Sci 2014, 5:193-205. doi: 10.1002/wcs.1278 CONFLICT OF INTEREST: The author has declared no conflicts of interest for this article. For further resources related to this article, please visit the WIREs website. PMID:26304308

  14. Sweet Play

    ERIC Educational Resources Information Center

    Leung, Shuk-kwan S.; Lo, Jane-Jane

    2010-01-01

    This article features Sweet play math, a "math by the month" activity that involves decorating and making sugar cubes. Teachers may want to substitute straws, paper squares, alphabet blocks, or such commercially made manipulatives as Unifix[R] cubes for the real sweets. Given no allergy concerns, teachers and students alike would enjoy some sweet…

  15. Cardiovascular risk in lupus nephritis: Do renal disease-related and other traditional risk factors play a role?

    PubMed

    Atukorala, Inoshi; Weeratunga, Praveen; Kalubowila, Janaka; Ranasinghe, Hasanthika; Gunawardena, Nalika; Lanerolle, Rushika; Rathnamalala, Nadeeka

    2015-01-01

    This study was performed to evaluate the prevalence of thickened carotid intima media thickness (CIMT) in a Sri Lankan cohort of lupus nephritis (LN) patients and to identify associations between traditional cardiovascular disease (CVD) and LN-related risk factors with increased CIMT. Consecutive patients with biopsy-proven LN were evaluated for conventional CVD risk factors, renal parameters and extent of organ involvement in this cross-sectional study. Current disease activity and damage were assessed by the British Isles Lupus Activity Group (BILAG) score and the Systemic Lupus International Collaborative Clinics/American College of Rheumatology (SLICC/ACR) damage index, respectively. CIMT was assessed by B Mode grey scale ultrasonography. Increased CIMT was defined as CIMT more than the 75th percentile based on cutoffs from the "Carotid Atherosclerosis Progression Study." Forty patients (98% female), with a mean age of 38 years (age range of 20-50) and of South Asian descent, were evaluated. The mean duration of disease of 6.15 years (SD = 4.66). The overall prevalence of cardiovascular events was low and included previous acute coronary syndromes in 7.5%, stable angina in 5%, cerebrovascular accidents in 7.5% and transient ischemic attacks in 2.5% of the patients; 72.5% had hypertension (HTN) [mean blood pressure (BP) 140/80 mm Hg]; 32.5% had dyslipidemias (mean serum cholesterol 5.9; SD = 5.6) and 25% had diabetes (mean blood sugar 103.7; SD = 15.6). Forty percent were obese and 20% were overweight (Asian cutoffs). Increased CIMT (57.5%) and atherosclerotic plaques (15.36%) indicated a high CVD risk in this cohort. Diabetes (P = 0.016), HTN (P = 0.002), dyslipidemia (P = 0.002) and obesity (P = 0.048) were associated with thickened CIMT. The only LN-related risk factor associated with thickened CIMT (P <0.05) was the SLICC/ACR damage index. The independent predictors of thickened CIMT determined by logistic regression analysis were HTN and dyslipidemia. PMID

  16. Characterization of a family of cysteine rich proteins and development of a MaSp1 derived miniature fibroin

    NASA Astrophysics Data System (ADS)

    Chuang, Tyler Casey

    Spider silk displays a unique balance of high tensile strength and extensibility, making it one of the toughest materials on the planet. Dragline silk, also known as the lifeline of the spider, represents one of the best studied fiber types and many labs are attempting to produce synthetic dragline silk fibers for commercial applications. In these studies, we develop a minifibroin for expression studies in bacteria. Using recombinant DNA methodology and protein expression studies, we develop a natural minifibroin that contains the highly conserved N- and C-terminal domains, along with several internal block repeats of MaSp1. We also characterize a family of small cysteine-rich proteins (CRPs) and demonstrate that these factors are present within the spinning dope of the major ampullate gland using MS analysis. Biochemical studies and characterization of one of the family members, CRP1, demonstrate that this factor can self-polymerize into higher molecular weight complexes under oxidizing conditions, but can be converted into a monomeric species under reducing conditions. Self-polymerization of CRP1 is also shown to be independent of pH and salt concentration, two important chemical cues that help fibroin aggregation. Overall, our data demonstrate that the polymerization state of CRP1 is dependent upon redox state, suggesting that the redox environment during fiber extrusion may help regulate the oligomerization of CRP molecules during dragline silk production.

  17. [Probiotic features of carotene producing strains Bacillus sp. 1.1 and B. amyloliquefaciens UCM B-5113].

    PubMed

    Avdeeva, L V; Nechypurenko, O O; Kharhota, M A

    2015-01-01

    Researched probiotic properties of carotinproducing strains Bacillus sp. 1.1 and B. amyloliquefaciens UCM B-5113. It was established that Bacillus sp. 1.1 characterized by high and middle antagonistic activity against museums and actual test cultures and B. amyloliquefaciens UCM B-5113 shown middle and low activity. They grew up and formed a pigment at pH 6.0 in the presence of 0.4% bile. Bacillus sp. 1.1 and B. amyloliquefaciens UCM B-5113 were avirulent, had low antagonistic activity and characterized by susceptibility to antimicrobial agents, excluding colistin. The results suggested the possibility to create based on Bacillus sp. 1.1 and B. amyloliquefaciens UCM B-5113 probiotic preparation. PMID:26036029

  18. Propensity for HBZ-SP1 isoform of HTLV-I to inhibit c-Jun activity correlates with sequestration of c-Jun into nuclear bodies rather than inhibition of its DNA-binding activity

    SciTech Connect

    Clerc, Isabelle; Hivin, Patrick; Rubbo, Pierre-Alain; Lemasson, Isabelle; Barbeau, Benoit; Mesnard, Jean-Michel

    2009-09-01

    HTLV-I bZIP factor (HBZ) contains a C-terminal zipper domain involved in its interaction with c-Jun. This interaction leads to a reduction of c-Jun DNA-binding activity and prevents the protein from activating transcription of AP-1-dependent promoters. However, it remained unclear whether the negative effect of HBZ-SP1 was due to its weak DNA-binding activity or to its capacity to target cellular factors to transcriptionally-inactive nuclear bodies. To answer this question, we produced a mutant in which specific residues present in the modulatory and DNA-binding domain of HBZ-SP1 were substituted for the corresponding c-Fos amino acids to improve the DNA-binding activity of the c-Jun/HBZ-SP1 heterodimer. The stability of the mutant, its interaction with c-Jun, DNA-binding activity of the resulting heterodimer, and its effect on the c-Jun activity were tested. In conclusion, we demonstrate that the repression of c-Jun activity in vivo is mainly due to the HBZ-SP1-mediated sequestration of c-Jun to the HBZ-NBs.

  19. Proto-oncogene FBI-1 represses transcription of p21CIP1 by inhibition of transcription activation by p53 and Sp1.

    PubMed

    Choi, Won-Il; Jeon, Bu-Nam; Yun, Chae-Ok; Kim, Pyung-Hwan; Kim, Sung-Eun; Choi, Kang-Yell; Kim, Se Hoon; Hur, Man-Wook

    2009-05-01

    Aberrant transcriptional repression through chromatin remodeling and histone deacetylation has been postulated as the driving force for tumorigenesis. FBI-1 (formerly called Pokemon) is a member of the POK family of transcriptional repressors. Recently, FBI-1 was characterized as a critical oncogenic factor that specifically represses transcription of the tumor suppressor gene ARF, potentially leading indirectly to p53 inactivation. Our investigations on transcriptional repression of the p53 pathway revealed that FBI-1 represses transcription of ARF, Hdm2 (human analogue of mouse double minute oncogene), and p21CIP1 (hereafter indicated as p21) but not of p53. FBI-1 showed a more potent repressive effect on p21 than on p53. Our data suggested that FBI-1 is a master controller of the ARF-Hdm2-p53-p21 pathway, ultimately impinging on cell cycle arrest factor p21, by inhibiting upstream regulators at the transcriptional and protein levels. FBI-1 acted as a competitive transcriptional repressor of p53 and Sp1 and was shown to bind the proximal Sp1-3 GC-box and the distal p53-responsive elements of p21. Repression involved direct binding competition of FBI-1 with Sp1 and p53. FBI-1 also interacted with corepressors, such as mSin3A, NCoR, and SMRT, thereby deacetylating Ac-H3 and Ac-H4 histones at the promoter. FBI-1 caused cellular transformation, promoted cell cycle proliferation, and significantly increased the number of cells in S phase. FBI-1 is aberrantly overexpressed in many human solid tumors, particularly in adenocarcinomas and squamous carcinomas. The role of FBI-1 as a master controller of the p53 pathway therefore makes it an attractive therapeutic target. PMID:19244234

  20. Proto-oncogene FBI-1 Represses Transcription of p21CIP1 by Inhibition of Transcription Activation by p53 and Sp1*S⃞

    PubMed Central

    Choi, Won-Il; Jeon, Bu-Nam; Yun, Chae-Ok; Kim, Pyung-Hwan; Kim, Sung-Eun; Choi, Kang-Yell; Kim, Se Hoon; Hur, Man-Wook

    2009-01-01

    Aberrant transcriptional repression through chromatin remodeling and histone deacetylation has been postulated as the driving force for tumorigenesis. FBI-1 (formerly called Pokemon) is a member of the POK family of transcriptional repressors. Recently, FBI-1 was characterized as a critical oncogenic factor that specifically represses transcription of the tumor suppressor gene ARF, potentially leading indirectly to p53 inactivation. Our investigations on transcriptional repression of the p53 pathway revealed that FBI-1 represses transcription of ARF, Hdm2 (human analogue of mouse double minute oncogene), and p21CIP1 (hereafter indicated as p21) but not of p53. FBI-1 showed a more potent repressive effect on p21 than on p53. Our data suggested that FBI-1 is a master controller of the ARF-Hdm2-p53-p21 pathway, ultimately impinging on cell cycle arrest factor p21, by inhibiting upstream regulators at the transcriptional and protein levels. FBI-1 acted as a competitive transcriptional repressor of p53 and Sp1 and was shown to bind the proximal Sp1–3 GC-box and the distal p53-responsive elements of p21. Repression involved direct binding competition of FBI-1 with Sp1 and p53. FBI-1 also interacted with corepressors, such as mSin3A, NCoR, and SMRT, thereby deacetylating Ac-H3 and Ac-H4 histones at the promoter. FBI-1 caused cellular transformation, promoted cell cycle proliferation, and significantly increased the number of cells in S phase. FBI-1 is aberrantly overexpressed in many human solid tumors, particularly in adenocarcinomas and squamous carcinomas. The role of FBI-1 as a master controller of the p53 pathway therefore makes it an attractive therapeutic target. PMID:19244234

  1. Sp1 Sites in the Noncoding Control Region of BK Polyomavirus Are Key Regulators of Bidirectional Viral Early and Late Gene Expression

    PubMed Central

    Bethge, Tobias; Hachemi, Helen A.; Manzetti, Julia; Gosert, Rainer; Schaffner, Walter

    2015-01-01

    ABSTRACT In kidney transplant patients with BK polyomavirus (BKPyV) nephropathy, viral variants arise bearing rearranged noncoding control regions (rr-NCCRs) that increase viral early gene expression, replicative fitness, and cytopathology. rr-NCCRs result from various deletions and duplications of archetype NCCR (ww-NCCR) sequences, which alter transcription factor binding sites (TFBS). However, the role of specific TFBS is unclear. We inactivated 28 TFBS in the archetype NCCR by selective point mutations and examined viral gene expression in bidirectional reporter constructs. Compared to the archetype, group 1 mutations increased viral early gene expression similar to rr-NCCR and resulted from inactivating one Sp1 or one Ets1 TFBS near the late transcription start site (TSS). Group 2 mutations conferred intermediate early gene activation and affected NF1, YY1, and p53 sites between early and late TSS. Group 3 mutations decreased early and late gene expression and included two other Sp1 sites near the early TSS. Recombinant viruses bearing group 1 NCCRs showed increased replication in human renal epithelial cells similar to clinical rr-NCCR variants. Group 2 and 3 viruses showed intermediate or no replication, respectively. A literature search revealed unnoticed group 1 mutations in BKPyV nephropathy, hemorrhagic cystitis, and disseminated disease. IMPORTANCE The NCCRs of polyomaviruses mediate silent persistence of the viral genome as well as the appropriately timed (re)activation of the viral life cycle. This study indicates that the basal BKPyV NCCR is critically controlled by a hierarchy of single TFBS in the archetype NCCR that direct, modulate, and execute the bidirectional early and late viral gene expression. The results provide new insights into how BKPyV NCCR functions as a viral sensor of host cell signals and shed new light on how transcription factors like Sp1 control bidirectional viral gene expression and contribute to replication and pathology

  2. The NF-M transcription factor is related to C/EBP beta and plays a role in signal transduction, differentiation and leukemogenesis of avian myelomonocytic cells.

    PubMed

    Katz, S; Kowenz-Leutz, E; Müller, C; Meese, K; Ness, S A; Leutz, A

    1993-04-01

    Retroviral oncogenes encode nuclear regulators of gene expression or signal transduction molecules, such as protein kinases, which stimulate the activity of cellular transcription factors. Here we describe the cloning of NF-M, a myeloid-specific transcription factor related to C/EBP beta, which is a target of activated protein kinases. NF-M stimulates the expression of the gene encoding cMGF, a myeloid cell-specific growth factor, creating an autocrine growth loop crucial to oncogene transformation of myeloid cells. The NF-M protein bound directly to the cMGF gene promoter and activated its transcription, even in erythroid cells where the promoter is usually inactive. In addition, a truncated, dominant-negative form of NF-M inhibited cMGF expression in macrophages, indicating that NF-M is required for the normal activation of the gene. When multipotent hematopoietic progenitor cells were stimulated to differentiate, NF-M expression was induced at a very early stage, suggesting that the transcription factor plays a role in lineage commitment. The stimulation of transformed myelomonocytic cells or of normal peripheral blood macrophages with kinases or LPS or TPA respectively, led to the rapid redistribution of NF-M protein from the cell bodies to the nucleus, consistent with the notion that NF-M was directly affected by such treatments. Our data indicate that NF-M plays a key role in myelomonocytic differentiation, in signal transduction during macrophage activation and in the development of myelogenous leukemia. PMID:8467792

  3. Nerve growth factor induces facial heat hyperalgesia and plays a role in trigeminal neuropathic pain in rats.

    PubMed

    Dos Reis, Renata C; Kopruszinski, Caroline M; Nones, Carina F M; Chichorro, Juliana G

    2016-09-01

    There is preclinical evidence that nerve growth factor (NGF) contributes toward inflammatory hyperalgesia in the orofacial region, but the mechanisms underlying its hyperalgesic effect as well as its role in trigeminal neuropathic pain require further investigation. This study investigated the ability of NGF to induce facial heat hyperalgesia and the involvement of tyrosine kinase receptor A, transient receptor potential vanilloid 1, and mast cells in NGF pronociceptive effects. In addition, the role of NGF in heat hyperalgesia in a model of trigeminal neuropathic pain was evaluated. NGF injection into the upper lip of naive rats induced long-lasting heat hyperalgesia. Pretreatment with an antibody anti-NGF, antagonists of tyrosine kinase receptor A, and transient receptor potential vanilloid 1 receptors or compound 48/80, to induce mast-cell degranulation, all attenuated NGF-induced hyperalgesia. In a rat model of trigeminal neuropathic pain, local treatment with anti-NGF significantly reduced heat hyperalgesia. In addition, increased NGF levels were detected in the ipsilateral infraorbital nerve branch at the time point that represents the peak of heat hyperalgesia. The results suggest that NGF is a prominent hyperalgesic mediator in the trigeminal system and it may represent a potential therapeutic target for the management of painful orofacial conditions, including trigeminal neuropathic pain. PMID:27392124

  4. What factors play a role in preventing self-immolation? Results from a case-control study in Iran

    PubMed Central

    Karim, Hosein; Schwebel, David C.; Bazargan-Hejazi, Shahrzad; Mohammadi, Reza; Choubsaz, Mansour; Heidari Zadie, Zahra; Ahmadi, Alireza

    2015-01-01

    Abstract: Background: To investigate factors related to prevention of self-immolation in west of Iran. Methods: In a case-control study, 30 consecutive cases of deliberate self-inflicted burns admitted to the regional burn center (Imam Khomeini hospital in Kermanshah province, Iran) were compared with controls selected from the community and matched by sex, age, district-county of residence, and rural vs urban living environment. The following characteristics relevant to preventing self-immolation were collected from all cases and controls: main domestic fuel used in the household, awareness about complications of burn injuries, and use of counseling services. Results: Descriptive analyses revealed that kerosene was the main domestic fuel in the household for 83% of cases. Not surprisingly, the main means of self-immolation in 93% of the patients was kerosene, with other fuels such as petrol and domestic gas used in remaining cases. The majority of cases and controls were aware of the potential complications of burn injuries. Use of counseling services was more common in controls. Conclusions: All three aspects of preventing self-immolation – having kerosene and other fuels in the home, being aware of the complications of burn injuries, and using counseling services were present in both the cases and controls. This suggests a large portion of residents in rural Iran are potential self-immolation victims. Increasing preventive strategies may reduce risk of suicide by self-immolation. PMID:26081518

  5. The study of capacity fading processes of Li-ion batteries: major factors that play a role

    NASA Astrophysics Data System (ADS)

    Markovsky, B.; Rodkin, A.; Cohen, Y. S.; Palchik, O.; Levi, E.; Aurbach, D.; Kim, H.-J.; Schmidt, M.

    In this work, we studied the impact of some factors on the behavior of practical electrodes of Li-ion batteries. These included elevated temperatures (45-80 °C), prolonged storage of Li-ion cells, and additives in the electrolyte solution. The Li-ion battery systems studied included negative electrodes (anodes) comprising of mesocarbon microbeads (MCMB) and mesocarbon fibers (MCF), and Li xCoO 2 positive electrodes (cathodes) in an ethylene carbonate (EC)/ethyl-methyl carbonate (EMC) (1:2)/LiPF 6 1 M solution. Vinylene carbonate (VC) and a Li-organo-borate complex (Li-OBC) were tested as additives. It is shown that the electrochemical response of Li-C negative electrodes depends on the structure of the surface films controlling their behavior, which change upon storage, temperature, and cycling. We established that impedance of these electrodes increased with storage time due to the enrichment of the surface films by LiF and other fluorine-containing species. The capacity fading of the Li xCoO 2 electrodes in cycling/storage processes at elevated temperatures relates mostly to surface phenomena, whereas the bulk structural characteristics of the electrodes do not change.

  6. A petunia ethylene-responsive element binding factor, PhERF2, plays an important role in antiviral RNA silencing.

    PubMed

    Sun, Daoyang; Nandety, Raja Sekhar; Zhang, Yanlong; Reid, Michael S; Niu, Lixin; Jiang, Cai-Zhong

    2016-05-01

    Virus-induced RNA silencing is involved in plant antiviral defense and requires key enzyme components, including RNA-dependent RNA polymerases (RDRs), Dicer-like RNase III enzymes (DCLs), and Argonaute proteins (AGOs). However, the transcriptional regulation of these critical components is largely unknown. In petunia (Petunia hybrida), an ethylene-responsive element binding factor, PhERF2, is induced by Tobacco rattle virus (TRV) infection. Inclusion of a PhERF2 fragment in a TRV silencing construct containing reporter fragments of phytoene desaturase (PDS) or chalcone synthase (CHS) substantially impaired silencing efficiency of both the PDS and CHS reporters. Silencing was also impaired in PhERF2- RNAi lines, where TRV-PhPDS infection did not show the expected silencing phenotype (photobleaching). In contrast, photobleaching in response to infiltration with the TRV-PhPDS construct was enhanced in plants overexpressing PhERF2 Transcript abundance of the RNA silencing-related genes RDR2, RDR6, DCL2, and AGO2 was lower in PhERF2-silenced plants but higher in PhERF2-overexpressing plants. Moreover, PhERF2-silenced lines showed higher susceptibility to Cucumber mosaic virus (CMV) than wild-type (WT) plants, while plants overexpressing PhERF2 exhibited increased resistance. Interestingly, growth and development of PhERF2-RNAi lines were substantially slower, whereas the overexpressing lines were more vigorous than the controls. Taken together, our results indicate that PhERF2 functions as a positive regulator in antiviral RNA silencing. PMID:27099376

  7. A petunia ethylene-responsive element binding factor, PhERF2, plays an important role in antiviral RNA silencing

    PubMed Central

    Sun, Daoyang; Nandety, Raja Sekhar; Zhang, Yanlong; Reid, Michael S.; Niu, Lixin; Jiang, Cai-Zhong

    2016-01-01

    Virus-induced RNA silencing is involved in plant antiviral defense and requires key enzyme components, including RNA-dependent RNA polymerases (RDRs), Dicer-like RNase III enzymes (DCLs), and Argonaute proteins (AGOs). However, the transcriptional regulation of these critical components is largely unknown. In petunia (Petunia hybrida), an ethylene-responsive element binding factor, PhERF2, is induced by Tobacco rattle virus (TRV) infection. Inclusion of a PhERF2 fragment in a TRV silencing construct containing reporter fragments of phytoene desaturase (PDS) or chalcone synthase (CHS) substantially impaired silencing efficiency of both the PDS and CHS reporters. Silencing was also impaired in PhERF2- RNAi lines, where TRV-PhPDS infection did not show the expected silencing phenotype (photobleaching). In contrast, photobleaching in response to infiltration with the TRV-PhPDS construct was enhanced in plants overexpressing PhERF2. Transcript abundance of the RNA silencing-related genes RDR2, RDR6, DCL2, and AGO2 was lower in PhERF2-silenced plants but higher in PhERF2-overexpressing plants. Moreover, PhERF2-silenced lines showed higher susceptibility to Cucumber mosaic virus (CMV) than wild-type (WT) plants, while plants overexpressing PhERF2 exhibited increased resistance. Interestingly, growth and development of PhERF2-RNAi lines were substantially slower, whereas the overexpressing lines were more vigorous than the controls. Taken together, our results indicate that PhERF2 functions as a positive regulator in antiviral RNA silencing. PMID:27099376

  8. The Sigma Factor AlgU Plays a Key Role in Formation of Robust Biofilms by Nonmucoid Pseudomonas aeruginosa▿

    PubMed Central

    Bazire, Alexis; Shioya, Kouki; Soum-Soutéra, Emmanuelle; Bouffartigues, Emeline; Ryder, Cynthia; Guentas-Dombrowsky, Linda; Hémery, Gaëlle; Linossier, Isabelle; Chevalier, Sylvie; Wozniak, Daniel J.; Lesouhaitier, Olivier; Dufour, Alain

    2010-01-01

    The extracytoplasmic function sigma factor AlgU of Pseudomonas aeruginosa is responsible for alginate overproduction, leading to mucoidy and chronic infections of cystic fibrosis patients. We investigated here the role of AlgU in the formation of nonmucoid biofilms. The algU mutant of P. aeruginosa PAO1 (PAOU) showed a dramatic impairment in biofilm formation under dynamic conditions. PAOU was defective both in cell attachment to glass and in development of robust, shear-resistant biofilms. This was explained by an impaired production of extracellular matrix, specifically of the exopolysaccharide Psl, as revealed by microscopy and enzyme-linked immunosorbent assay. Complementing the algU mutation with a plasmid-borne algU gene restored wild-type phenotypes. Compared with that in PAO1, expression of the psl operon was reduced in the PAOU strain, and the biofilm formation ability of this strain was partially restored by inducing the transcription of the psl operon. Furthermore, expression of the lectin-encoding lecA and lecB genes was reduced in the PAOU strain. In agreement with the requirement of LecB for type IV pilus biogenesis, PAOU displayed impaired twitching motility. Collectively, these genetic downregulation events explain the biofilm formation defect of the PAOU mutant. Promoter mapping indicated that AlgU is probably not directly responsible for transcription of the psl operon and the lec genes, but AlgU is involved in the expression of the ppyR gene, whose product was reported to positively control psl expression. Expressing the ppyR gene in PAOU partially restored the formation of robust biofilms. PMID:20348252

  9. Diversity and distribution of transcription factors: their partner domains play an important role in regulatory plasticity in bacteria.

    PubMed

    Rivera-Gómez, Nancy; Segovia, Lorenzo; Pérez-Rueda, Ernesto

    2011-08-01

    The ability of bacteria to deal with diverse environmental changes depends on their repertoire of genes and their ability to regulate their expression. In this process, DNA-binding transcription factors (TFs) have a fundamental role because they affect gene expression positively and/or negatively depending on operator context and ligand-binding status. Here, we show an exhaustive analysis of winged helix-turn-helix domains (wHTHs), a class of DNA-binding TFs. These proteins were identified in high proportions and widely distributed in bacteria, representing around half of the total TFs identified so far. In addition, we evaluated the repertoire of wHTHs in terms of their partner domains (PaDos), identifying a similar trend, as with TFs, i.e. they are abundant and widely distributed in bacteria. Based on the PaDos, we defined three main groups of families: (i) monolithic, those families with little PaDo diversity, such as LysR; (ii) promiscuous, those families with a high PaDo diversity; and (iii) monodomain, with families of small sizes, such as MarR. These findings suggest that PaDos have a very important role in the diversification of regulatory responses in bacteria, probably contributing to their regulatory complexity. Thus, the TFs discriminate over longer regions on the DNA through their diverse DNA-binding domains. On the other hand, the PaDos would allow a great flexibility for transcriptional regulation due to their ability to sense diverse stimuli through a variety of ligand-binding compounds. PMID:21636649

  10. Achromobacter denitrificans strain SP1 efficiently remediates di(2-ethylhexyl)phthalate.

    PubMed

    Pradeep, S; Josh, M K Sarath; Binod, P; Devi, R Sudha; Balachandran, S; Anderson, Robin C; Benjamin, Sailas

    2015-02-01

    This study describes how Achromobacter denitrificans strain SP1, a novel isolate from heavily plastics-contaminated sewage sludge efficiently consumed the hazardous plasticizer, di(2-ethylhexyl)phthalate (DEHP) as carbon source supplemented in a simple basal salt medium (BSM). Response surface methodology was employed for the statistical optimization of the process parameters such as temperature (32°C), agitation (200 rpm), DEHP concentration (10 mM), time (72 h) and pH (8.0). At these optimized conditions, experimentally observed DEHP degradation was 63%, while the predicted value was 59.2%; and the correlation coefficient between them was 0.998, i.e., highly significant and fit to the predicted model. Employing GC-MS analysis, the degradation pathway was partially deduced with intermediates such as mono(2-ethylhexyl)phthalate and 2-ethyl hexanol. Briefly, this first report describes A. denitrificans strain SP1 as a highly efficient bacterium for completely remediating the hazardous DEHP (10 mM) in 96 h in BSM (50% consumed in 60 h), which offers great potentials for efficiently cleaning the DEHP-contaminated environments such as soil, sediments and water upon its deployment. PMID:25463861

  11. ERK-dependent activation of Sp1 is required for low-power laser irradiation-induced vascular endothelial cell proliferation

    NASA Astrophysics Data System (ADS)

    Feng, Jie; Xing, Da

    2012-12-01

    Here, we report that low-power laser irradiation (LPLI) activates ERK/Sp1 pathway to upregulate VEGF expression and promote vascular endothelial cell proliferation. We demonstrate for the first time that LPLI enhances DNA-binding activity and transactivation activity of Sp1 on VEGF promoter. Additionally, ERK translocates from cytoplasm to nucleus following LPLI. Moreover, activated ERK phosphorylates Sp1 and results in increased EKR-Sp1 interaction. Selective inhibition of Sp1 or ERK suppresses the effect of LPLI on the promotion of cell cycle progression and proliferation. These findings provide a novel link between LPLI and angiogenesis, supplying potential therapy strategies for angiogenesis with LPLI.

  12. Synthetic retinoid Am80 up-regulates apelin expression by promoting interaction of RARα with KLF5 and Sp1 in vascular smooth muscle cells.

    PubMed

    Lv, Xin-Rui; Zheng, Bin; Li, Shu-Ya; Han, Ai-Li; Wang, Chang; Shi, Jian-Hong; Zhang, Xin-Hua; Liu, Yan; Li, Yong-Hui; Wen, Jin-Kun

    2013-11-15

    Previous studies have demonstrated that both retinoids and apelin possess potent cardiovascular properties and that retinoids can mediate the expression of many genes in the cardiovascular system. However, it is not clear whether and how retinoids regulate apelin expression in rat VSMCs (vascular smooth muscle cells). In the present study, we investigated the molecular mechanism of apelin expression regulation by the synthetic retinoid Am80 in VSMCs. The results showed that Am80 markedly up-regulated apelin mRNA and protein levels in VSMCs. Furthermore, KLF5 (Krüppel-like factor 5) and Sp1 (stimulating protein-1) co-operatively mediated Am80-induced apelin expression through their direct binding to the TCE (transforming growth factor-β control element) on the apelin promoter. Interestingly, upon Am80 stimulation, the RARα (retinoic acid receptor α) was recruited to the apelin promoter by interacting with KLF5 and Sp1 prebound to the TCE site of the apelin promoter to form a transcriptional activation complex, subsequently leading to the up-regulation of apelin expression in VSMCs. An in vivo study indicated that Am80 increased apelin expression in balloon-injured arteries of rats, consistent with the results from the cultured VSMCs. Thus the results of the present study describe a novel mechanism of apelin regulation by Am80 and further expand the network of RARα in the retinoid pathway. PMID:23992409

  13. Kr-pok increases FASN expression by modulating the DNA binding of SREBP-1c and Sp1 at the proximal promoter[S

    PubMed Central

    Jeon, Bu-Nam; Kim, Yeon-Sook; Choi, Won-Il; Koh, Dong-In; Kim, Min-Kyeong; Yoon, Jae-Hyeon; Kim, Min-Young; Hur, Benjamin; Paik, Philip Dong-Hyun; Hur, Man-Wook

    2012-01-01

    Kr-pok (kidney cancer-related POZ domain and Krüppel-like protein) is a new proto-oncogenic POZ-domain transcription factor. Fatty acid synthase gene (FASN) encodes one of the key enzymes in fatty acids synthesis and is the only enzyme that synthesizes fatty acids in cancer cells. Sp1 and SREBP-1c are the two major transcription activators of FASN. We investigated whether Kr-pok modulates transcription of the FASN. FASN expression is significantly decreased in Kr-pok knockout murine embryonic fibroblasts. Coimmunoprecipitation, GST fusion protein pull-down, and immunocytochemistry assays show that the zinc-finger domain of Kr-pok interacts directly with the bZIP DNA binding domain of SREBP-1. Electrophoretic mobility shift assay, oligonucleotide pull-down, and chromatin immunoprecipitation assays showed that Kr-pok changes the transcription factor binding dynamics of Sp1 and SREBP-1c to the SRE/E-box elements of the proximal promoter. We found that Kr-pok expression increased during 3T3-L1 preadipocyte differentiation and that FASN expression is decreased by the knockdown of Kr-pok. Kr-pok facilitates the SREBP-1c-mediated preadipocyte differentiation and/or fatty acid synthesis. Kr-pok may act as an important regulator of fatty acid synthesis and may induce rapid cancer cell proliferation by increasing palmitate synthesis. PMID:22331133

  14. Scalability of Parallel Spatial Direct Numerical Simulations on Intel Hypercube and IBM SP1 and SP2

    NASA Technical Reports Server (NTRS)

    Joslin, Ronald D.; Hanebutte, Ulf R.; Zubair, Mohammad

    1995-01-01

    The implementation and performance of a parallel spatial direct numerical simulation (PSDNS) approach on the Intel iPSC/860 hypercube and IBM SP1 and SP2 parallel computers is documented. Spatially evolving disturbances associated with the laminar-to-turbulent transition in boundary-layer flows are computed with the PSDNS code. The feasibility of using the PSDNS to perform transition studies on these computers is examined. The results indicate that PSDNS approach can effectively be parallelized on a distributed-memory parallel machine by remapping the distributed data structure during the course of the calculation. Scalability information is provided to estimate computational costs to match the actual costs relative to changes in the number of grid points. By increasing the number of processors, slower than linear speedups are achieved with optimized (machine-dependent library) routines. This slower than linear speedup results because the computational cost is dominated by FFT routine, which yields less than ideal speedups. By using appropriate compile options and optimized library routines on the SP1, the serial code achieves 52-56 M ops on a single node of the SP1 (45 percent of theoretical peak performance). The actual performance of the PSDNS code on the SP1 is evaluated with a "real world" simulation that consists of 1.7 million grid points. One time step of this simulation is calculated on eight nodes of the SP1 in the same time as required by a Cray Y/MP supercomputer. For the same simulation, 32-nodes of the SP1 and SP2 are required to reach the performance of a Cray C-90. A 32 node SP1 (SP2) configuration is 2.9 (4.6) times faster than a Cray Y/MP for this simulation, while the hypercube is roughly 2 times slower than the Y/MP for this application. KEY WORDS: Spatial direct numerical simulations; incompressible viscous flows; spectral methods; finite differences; parallel computing.

  15. Which factors play a role in Dutch health promotion professionals’ decision to recruit actively primary schools to use a web-based smoking prevention programme?

    PubMed Central

    2013-01-01

    Background Municipal Health Promotion Organisations (MHPOs) play an important role in promoting and disseminating prevention programmes, such as smoking prevention programmes, in schools. This study identifies factors that may facilitate or hinder MHPOs’ willingness to recruit actively primary schools to use a smoking prevention programme. Methods In 2011, 31 Dutch MHPOs were invited to recruit schools to use a smoking prevention programme. All MHPO employees involved in smoking prevention activities (n = 68) were asked to complete a questionnaire assessing psychological factors and characteristics of their organisation that might affect their decision to be involved in active recruitment of schools. T-tests and multivariate analysis of variance assessed potential differences in psychological and organisational factors between active and non-active recruiters. Results A total of 45 professionals returned the questionnaire (66.2%). Active recruiters (n = 12) had more positive attitudes (p = 0.02), higher self-efficacy expectations (p < 0.01) and formulated more plans (p < 0.01) to recruit primary schools, compared with non-active recruiters. Organisational factors did not discriminate between active and non-active recruiters. Conclusions Primarily psychological factors seem to be associated with MHPOs’ decision to recruit schools actively. This indicates that creating more positive attitude, self-efficacy beliefs and formation of plans may help in getting more MHPOs involved in active recruitment procedures. PMID:24298942

  16. Development of the rhopalial nervous system in Aurelia sp.1 (Cnidaria, Scyphozoa).

    PubMed

    Nakanishi, Nagayasu; Hartenstein, Volker; Jacobs, David K

    2009-06-01

    We examined the development of the nervous system in the rhopalium, a medusa-specific sensory structure, in Aurelia sp.1 (Cnidaria, Scyphozoa) using confocal microscopy. The rhopalial nervous system appears primarily ectodermal and contains neurons immunoreactive to antibodies against tyrosinated tubulin, taurine, GLWamide, and FMRFamide. The rhopalial nervous system develops in an ordered manner: the presumptive gravity-sensing organ, consisting of the lithocyst and the touch plate, differentiates first; the "marginal center," which controls swimming activity, second; and finally, the ocelli, the presumptive photoreceptors. At least seven bilaterally arranged neuronal clusters consisting of sensory and ganglion cells and their neuronal processes became evident in the rhopalium during metamorphosis to the medusa stage. Our analysis provides an anatomical framework for future gene expression and experimental studies of development and functions of scyphozoan rhopalia. PMID:19543911

  17. The Sp1-mediaded allelic regulation of MMP13 expression by an ESCC susceptibility SNP rs2252070

    PubMed Central

    Shi, Meng; Xia, Jianhong; Xing, Huaixin; Yang, Wenjun; Xiong, Xiangyu; Pan, Wenting; Han, Sichong; Shang, Jinhua; Zhou, Changchun; Zhou, Liqing; Yang, Ming

    2016-01-01

    Metallopeptidase 13 (MMP13), a well-known and highly regulated zinc-dependent MMP collagenase, plays a crucial part in development and progression of esophageal squamous cell carcinoma (ESCC). Therefore, we examined associations between ESCC susceptibility and four haplotype-tagging single nucleotide polymorphisms (htSNPs) using a two stage case-control strategy. Odds ratios (OR) and 95% confidence intervals (95% CI) were computed by logistic regression model. After analyzing 1588 ESCC patients and frequency-matched 1600 unaffected controls, we found that MMP13 rs2252070 G > A genetic polymorphism is significantly associated with ESCC risk in Chinese Han populations (GA: OR = 0.63, 95% CI = 0.54–0.74, P = 1.7 × 10−6, AA: OR = 0.73, 95% CI = 0.66–0.81, P = 1.8 × 10−6). Interestingly, the rs2252070 G-to-A change was shown to diminish a Sp1-binding site in ESCC cells. Reporter gene assays indicated that the rs2252070 A allele locating in a potential MMP13 promoter has low promoter activities. After measuring MMP13 gene expression in sixty-six pairs of esophageal cancer and normal tissues, we observed that the rs2252070 A protective allele carriers showed decreased oncogene MMP13 expression. Results of these analyses underline the support of the notion that MMP13 might function as a key oncogene in esophageal carcinogenesis. PMID:27245877

  18. Estrogen Receptor beta binds Sp1 and recruits a Corepressor Complex to the Estrogen Receptor alpha Gene Promoter

    PubMed Central

    Bartella, V; Rizza, P; Barone, I; Zito, D; Giordano, F; Giordano, C; Catalano, S; Mauro, L; Sisci, D; Panno, ML; Fuqua, SA; Andò, Sebastiano

    2015-01-01

    Human estrogen receptors (ERs) alpha and beta are crucially involved in the regulation of mammary growth and development. Normal breast tissues display a prevalently expression of ER beta than ER alpha, which drastically increases during breast tumorogenesis. So, it is reasonable to assume how a dysregulation of the two estrogen receptor subtypes may induce breast cancer development. However, the molecular mechanism underlying the opposite role played by the two estrogen receptors on tumor cell growth remains to be elucidated. In the present study, we have demonstrated that ER beta overexpression in breast cancer cells decreases cell proliferation and down-regulates ER alpha mRNA and protein content along with a concomitant repression of estrogen-regulated genes. Transient transfection experiments, using a vector containing the human ER alpha promoter region, showed that elevated levels of the ER beta down-regulated basal ER alpha promoter activity. Furthermore, side-directed mutagenesis and deletion analysis have revealed that the proximal GC-rich motifs at −223 and −214 is crucial for the ER beta-induced ER alpha down-regulation in breast cancer cells. This occurred through ER beta-Sp1 protein-protein interaction within the ER alpha promoter region and the recruitment of a corepressor complex containing NCoR/SMRT (nuclear receptor corepressor/silencing mediator of retinoic acid and thyroid hormone receptor), accompanied by hypoacetylation of histone H4 and displacement of RNA polymerase II. Silencing of NCoR gene expression by RNA interference reversed the down-regulatory effect of ER beta on ER alpha gene expression and cell proliferation. Our results provide evidence for a novel mechanism by which overexpression of ER beta through NCoR is able to down regulate ER alpha gene expression, thus inhibiting ER alpha’s driving role on breast cancer cell growth. PMID:22622808

  19. Mithramycin inhibits SP1 binding and selectively inhibits transcriptional activity of the dihydrofolate reductase gene in vitro and in vivo.

    PubMed Central

    Blume, S W; Snyder, R C; Ray, R; Thomas, S; Koller, C A; Miller, D M

    1991-01-01

    The promoter of the human dihydrofolate reductase (DHFR) gene contains two consensus binding sites for the DNA binding protein Sp1. DNAse protection and gel mobility shift assays demonstrate binding of recombinant Sp1 to both decanucleotide Sp1 binding sequences which are located 49 and 14 base pairs upstream of the transcription start site. The more distal of the two binding sites exhibits a somewhat higher affinity for Sp1. The G-C specific DNA binding drug, mithramycin, binds to both consensus sequences and prevents subsequent Sp1 binding. Promoter-dependent in vitro transcription of a DHFR template is selectively inhibited by mithramycin when compared to the human H2b histone gene. A similar effect is also noted in vivo. Mithramycin treatment of MCF-7 human breast carcinoma cells containing an amplified DHFR gene induces selective inhibition of DHFR transcription initiation, resulting in a decline in DHFR mRNA level and enzyme activity. This selective inhibition of DHFR expression suggests that it is possible to modulate the overexpression of the DHFR gene in methotrexate resistant cells. Images PMID:1834700

  20. Cloning and Characterization of the Human Trefoil Factor 3 Gene Promoter

    PubMed Central

    Zhou, Yifang; Mao, Xuefei; Deng, Xiangdong

    2014-01-01

    Human trefoil factor 3 (hTFF3) is a small-molecule peptide with potential medicinal value. Its main pharmacological function is to alleviate gastrointestinal mucosal injuries caused by various factors and promote the repair of damaged mucosa. However, how its transcription is regulated is not yet known. The aim of this study was to clone the hTFF3 gene promoter region, identify the core promoter and any transcription factors that bind to the promoter, and begin to clarify the regulation of its expression. The 5′ flanking sequence of the hTFF3 gene was cloned from human whole blood genomic DNA by PCR. Truncated promoter fragments with different were cloned and inserted into the pGL3-Basic vector to determine the position of the core hTFF3 promoter. Transcription element maintaining basic transcriptional activity was assessed by mutation techniques. Protein-DNA interactions were analyzed by chromatin immunoprecipitation (ChIP). RNA interference and gene over-expression were performed to assay the effect of transcription factor on the hTFF3 expression. The results showed that approximately 1,826 bp of the fragment upstream of hTFF3 was successfully amplified, and its core promoter region was determined to be from −300 bp to −280 bp through analysis of truncated mutants. Mutation analysis confirmed that the sequence required to maintain basic transcriptional activity was accurately positioned from −300 bp to −296 bp. Bioinformatic analysis indicated that this area contained a Sp1 binding site. Sp1 binding to the hTFF3 promoter was confirmed by ChIP experiments. Sp1 over-expression and interference experiments showed that Sp1 enhanced the transcriptional activity of the hTFF3 promoter and increased hTFF3 expression. This study demonstrated that Sp1 plays an important role in maintaining the transcription of hTFF3. PMID:24743382

  1. Genome-Wide Occupancy of SREBP1 and Its Partners NFY and SP1 Reveals Novel Functional Roles and Combinatorial Regulation of Distinct Classes of Genes

    PubMed Central

    Reed, Brian D.; Charos, Alexandra E.; Szekely, Anna M.; Weissman, Sherman M.; Snyder, Michael

    2008-01-01

    The sterol regulatory element-binding protein (SREBP) family member SREBP1 is a critical transcriptional regulator of cholesterol and fatty acid metabolism and has been implicated in insulin resistance, diabetes, and other diet-related diseases. We globally identified the promoters occupied by SREBP1 and its binding partners NFY and SP1 in a human hepatocyte cell line using chromatin immunoprecipitation combined with genome tiling arrays (ChIP-chip). We find that SREBP1 occupies the promoters of 1,141 target genes involved in diverse biological pathways, including novel targets with roles in lipid metabolism and insulin signaling. We also identify a conserved SREBP1 DNA-binding motif in SREBP1 target promoters, and we demonstrate that many SREBP1 target genes are transcriptionally activated by treatment with insulin and glucose using gene expression microarrays. Finally, we show that SREBP1 cooperates extensively with NFY and SP1 throughout the genome and that unique combinations of these factors target distinct functional pathways. Our results provide insight into the regulatory circuitry in which SREBP1 and its network partners coordinate a complex transcriptional response in the liver with cues from the diet. PMID:18654640

  2. The tumor suppressor gene KCTD11REN is regulated by Sp1 and methylation and its expression is reduced in tumors.

    PubMed

    Mancarelli, M Michela; Zazzeroni, Francesca; Ciccocioppo, Lucia; Capece, Daria; Po, Agnese; Murgo, Simona; Di Camillo, Raffaello; Rinaldi, Christian; Ferretti, Elisabetta; Gulino, Alberto; Alesse, Edoardo

    2010-01-01

    A hallmark of several human cancers is loss of heterozygosity (LOH) of chromosome 17p13. The same chromosomal region is also frequently hypermethylated in cancer. Although loss of 17p13 has been often associated with p53 genetic alteration or Hypermethylated in Cancer 1 (HIC1) gene hypermethylation, other tumor suppressor genes (TSGs) located in this region have critical roles in tumorigenesis. A novel TSG mapping on human chromosome 17p13.2 is KCTD11REN (KCTD11). We have recently demonstrated that KCTD11 expression is frequently lost in human medulloblastoma (MB), in part by LOH and in part by uncharacterized epigenetic events. Using a panel of human 177 tumor samples and their normal matching samples representing 18 different types of cancer, we show here that the down-regulation of KCTD11 protein level is a specific and a diffusely common event in tumorigenesis. Additionally, in order to characterize the regulatory regions in KCTD11 promoter, we identified a CpG island and several Sp1 binding sites on this promoter, and demonstrated that Sp1 transcription factor and DNA methylation contribute, at least in part, to regulate KCTD11 expression. Our findings identify KCTD11 as a widely down-regulated gene in human cancers, and provide a basis to understand how its expression might be deregulated in tumor cells. PMID:20591193

  3. The tumor suppressor gene KCTD11REN is regulated by Sp1 and methylation and its expression is reduced in tumors

    PubMed Central

    2010-01-01

    A hallmark of several human cancers is loss of heterozygosity (LOH) of chromosome 17p13. The same chromosomal region is also frequently hypermethylated in cancer. Although loss of 17p13 has been often associated with p53 genetic alteration or Hypermethylated in Cancer 1 (HIC1) gene hypermethylation, other tumor suppressor genes (TSGs) located in this region have critical roles in tumorigenesis. A novel TSG mapping on human chromosome 17p13.2 is KCTD11REN (KCTD11). We have recently demonstrated that KCTD11 expression is frequently lost in human medulloblastoma (MB), in part by LOH and in part by uncharacterized epigenetic events. Using a panel of human 177 tumor samples and their normal matching samples representing 18 different types of cancer, we show here that the down-regulation of KCTD11 protein level is a specific and a diffusely common event in tumorigenesis. Additionally, in order to characterize the regulatory regions in KCTD11 promoter, we identified a CpG island and several Sp1 binding sites on this promoter, and demonstrated that Sp1 transcription factor and DNA methylation contribute, at least in part, to regulate KCTD11 expression. Our findings identify KCTD11 as a widely down-regulated gene in human cancers, and provide a basis to understand how its expression might be deregulated in tumor cells. PMID:20591193

  4. Basal expression of the human MAPEG members microsomal glutathione transferase 1 and prostaglandin E synthase genes is mediated by Sp1 and Sp3.

    PubMed

    Ekström, Lena; Lyrenäs, Louise; Jakobsson, Per-Johan; Morgenstern, Ralf; Kelner, Michael J

    2003-06-19

    Microsomal glutathione transferase (MGST1) and prostaglandin E synthase (PGES) are both members of the MAPEG (Membrane Associated Proteins involved in Eicosanoid and Glutathione metabolism) superfamily. In humans, their organ distribution is quite distinct with the former being widely and constitutively expressed whereas PGES is largely inducible. In order to study the basal expression of these genes, we characterized the promoter regions and identified the elements and the transcription factors required using in vitro assays, including reporter analysis of deletion and mutant clones and EMSA. The results indicate that Sp1 is the protein mediating the basal transcription of MGST1. It appears that both the Sp1 and Sp3 proteins are important for the basal expression of PGES. In addition, mutational analysis of two Barbie-box elements in the PGES promoter showed that these were not involved in the down-regulation of PGES by phenobarbital (PB). These results provide the first description of the basal regulation of these genes in humans. PMID:12818425

  5. Sp1 binds two sites in the CD11c promoter in vivo specifically in myeloid cells and cooperates with AP1 to activate transcription.

    PubMed Central

    Noti, J D; Reinemann, B C; Petrus, M N

    1996-01-01

    The leukocyte integrin gene, CD11c, is transcriptionally regulated and is expressed predominantly on differentiated cells of the myelomonocytic lineage. In this study we have demonstrated that the regions -72 to -63 and -132 to -104 of the CD11c promoter contain elements responsible for phorbol ester-induced differentiation of the myeloid cell line HL60. DNase I footprinting analysis revealed that these regions can bind purified Sp1, and supershift analysis with Sp1 antibody confirmed that Sp1 in HL60 nuclear extracts could bind these regions. Transfection analysis of CD11c promoter-chloramphenicol acetyltransferase constructs containing deletions of these Sp1-binding sites revealed that these sites are essential for expression of the CD11c gene in HL60 cells but not in the T-cell line Molt4 or the cervical carcinoma cell line HeLa. Moreover, cotransfection of pPacSp1 along with these CD11c promoter-chloramphenicol acetyltransferase constructs into Sp1-deficient Drosophila Schneider 2 cells verified that these sites are essential for Sp1-dependent expression of the CD11c promoter. In vivo genomic footprinting revealed that Sp1 contacts the CD11c promoter within the regions -69 to -63 and -116 to -105 in phorbol 12-myristate 13-acetate-differentiated HL60 cells but not in undifferentiated HL60 cells or in Molt4 or HeLa cells. Cotransfection assays in HL60 cells revealed that Sp1 acts synergistically with Ap1 to activate CD11c. Further, both Sp1 sites are capable of cooperating with AP1. In vitro DNase I footprinting analysis with purified Sp1 and c-jun proteins showed that Sp1 binding could facilitate binding of c-jun. We propose that myeloid-specific expression of the CD11c promoter and is facilitated by cooperative interaction between the Sp1- and Ap1-binding sites. PMID:8649405

  6. Transcriptional profiling of Medicago truncatula under salt stress identified a novel CBF transcription factor MtCBF4 that plays an important role in abiotic stress responses

    PubMed Central

    2011-01-01

    Background Salt stress hinders the growth of plants and reduces crop production worldwide. However, different plant species might possess different adaptive mechanisms to mitigate salt stress. We conducted a detailed pathway analysis of transcriptional dynamics in the roots of Medicago truncatula seedlings under salt stress and selected a transcription factor gene, MtCBF4, for experimental validation. Results A microarray experiment was conducted using root samples collected 6, 24, and 48 h after application of 180 mM NaCl. Analysis of 11 statistically significant expression profiles revealed different behaviors between primary and secondary metabolism pathways in response to external stress. Secondary metabolism that helps to maintain osmotic balance was induced. One of the highly induced transcription factor genes was successfully cloned, and was named MtCBF4. Phylogenetic analysis revealed that MtCBF4, which belongs to the AP2-EREBP transcription factor family, is a novel member of the CBF transcription factor in M. truncatula. MtCBF4 is shown to be a nuclear-localized protein. Expression of MtCBF4 in M. truncatula was induced by most of the abiotic stresses, including salt, drought, cold, and abscisic acid, suggesting crosstalk between these abiotic stresses. Transgenic Arabidopsis over-expressing MtCBF4 enhanced tolerance to drought and salt stress, and activated expression of downstream genes that contain DRE elements. Over-expression of MtCBF4 in M. truncatula also enhanced salt tolerance and induced expression level of corresponding downstream genes. Conclusion Comprehensive transcriptomic analysis revealed complex mechanisms exist in plants in response to salt stress. The novel transcription factor gene MtCBF4 identified here played an important role in response to abiotic stresses, indicating that it might be a good candidate gene for genetic improvement to produce stress-tolerant plants. PMID:21718548

  7. Formation of hydrophilic nanochannels in the membrane of living cells by the ringlike stable protein-SP1.

    PubMed

    Khoutorsky, Arkady; Heyman, Arnon; Shoseyov, Oded; Spira, Micha E

    2011-07-13

    The assembly of functional junction between nerve cells and electronic sensing pads is a critical problem in the construction of effective neuroelectronic hybrid systems. Here, we demonstrate for the first time that the ringlike Stable Protein 1 (Sp1) and its derivatives can be used to generate hydrophilic nanochannels in the plasma membrane of living cells. Since SP1-derivatives can be linked to both the plasma membrane, gold or silicon surfaces, they may serve to ohmically link between cells interior and electronic sensing devices. PMID:21651305

  8. Arabidopsis Small Rubber Particle Protein Homolog SRPs Play Dual Roles as Positive Factors for Tissue Growth and Development and in Drought Stress Responses.

    PubMed

    Kim, Eun Yu; Park, Ki Youl; Seo, Young Sam; Kim, Woo Taek

    2016-04-01

    Lipid droplets (LDs) act as repositories for fatty acids and sterols, which are used for various cellular processes such as energy production and membrane and hormone synthesis. LD-associated proteins play important roles in seed development and germination, but their functions in postgermination growth are not well understood. Arabidopsis (Arabidopsis thaliana) contains three SRP homologs (SRP1, SRP2, and SRP3) that share sequence identities with small rubber particle proteins of the rubber tree (Hevea brasiliensis). In this report, the possible cellular roles of SRPs in postgermination growth and the drought tolerance response were investigated. Arabidopsis SRPs appeared to be LD-associated proteins and displayed polymerization properties in vivo and in vitro. SRP-overexpressing transgenic Arabidopsis plants (35S:SRP1, 35S:SRP2, and 35S:SRP3) exhibited higher vegetative and reproductive growth and markedly better tolerance to drought stress than wild-type Arabidopsis. In addition, constitutive over-expression of SRPs resulted in increased numbers of large LDs in postgermination seedlings. In contrast, single (srp1, 35S:SRP2-RNAi, and srp3) and triple (35S:SRP2-RNAi/srp1srp3) loss-of-function mutant lines exhibited the opposite phenotypes. Our results suggest that Arabidopsis SRPs play dual roles as positive factors in postgermination growth and the drought stress tolerance response. The possible relationships between LD-associated proteins and the drought stress response are discussed. PMID:26903535

  9. Arabidopsis Small Rubber Particle Protein Homolog SRPs Play Dual Roles as Positive Factors for Tissue Growth and Development and in Drought Stress Responses1[OPEN

    PubMed Central

    Kim, Eun Yu; Park, Ki Youl; Seo, Young Sam; Kim, Woo Taek

    2016-01-01

    Lipid droplets (LDs) act as repositories for fatty acids and sterols, which are used for various cellular processes such as energy production and membrane and hormone synthesis. LD-associated proteins play important roles in seed development and germination, but their functions in postgermination growth are not well understood. Arabidopsis (Arabidopsis thaliana) contains three SRP homologs (SRP1, SRP2, and SRP3) that share sequence identities with small rubber particle proteins of the rubber tree (Hevea brasiliensis). In this report, the possible cellular roles of SRPs in postgermination growth and the drought tolerance response were investigated. Arabidopsis SRPs appeared to be LD-associated proteins and displayed polymerization properties in vivo and in vitro. SRP-overexpressing transgenic Arabidopsis plants (35S:SRP1, 35S:SRP2, and 35S:SRP3) exhibited higher vegetative and reproductive growth and markedly better tolerance to drought stress than wild-type Arabidopsis. In addition, constitutive over-expression of SRPs resulted in increased numbers of large LDs in postgermination seedlings. In contrast, single (srp1, 35S:SRP2-RNAi, and srp3) and triple (35S:SRP2-RNAi/srp1srp3) loss-of-function mutant lines exhibited the opposite phenotypes. Our results suggest that Arabidopsis SRPs play dual roles as positive factors in postgermination growth and the drought stress tolerance response. The possible relationships between LD-associated proteins and the drought stress response are discussed. PMID:26903535

  10. The Child's Right To Play.

    ERIC Educational Resources Information Center

    Guddemi, Marcy

    Several factors are eroding children's right to play. The first is continuing poverty throughout the world. This factor is evident in underdeveloped countries and the inner cities of industrialized countries. Changing cultural values are a second factor in developed societies where indifference toward the importance of play is prevalent. The many…

  11. B Cell-Activating Transcription Factor Plays a Critical Role in the Pathogenesis of Anti-Major Histocompatibility Complex-Induced Obliterative Airway Disease.

    PubMed

    Xu, Z; Ramachandran, S; Gunasekaran, M; Nayak, D; Benshoff, N; Hachem, R; Gelman, A; Mohanakumar, T

    2016-04-01

    Antibodies (Abs) against major histocompatibility complex (MHC) results in T helper-17 (Th17)-mediated immunity against lung self-antigens (SAgs), K-α1 tubulin and collagen V and obliterative airway disease (OAD). Because B cell-activating transcription factor (BATF) controls Th17 and autoimmunity, we proposed that BATF may play a critical role in OAD. Anti-H2K(b) was administered intrabronchially into Batf (-/-) and C57BL/6 mice. Histopathology of the lungs on days 30 and 45 after Ab administration to Batf (-/-) mice resulted in decreased cellular infiltration, epithelial metaplasia, fibrosis, and obstruction. There was lack of Abs to SAgs, reduction of Sag-specific interleukin (IL)-17 T cells, IL-6, IL-23, IL-17, IL-1β, fibroblast growth factor-6, and CXCL12 and decreased Janus kinase 2, signal transducer and activator of transcription 3 (STAT3), and retinoid-related orphan receptor γT. Further, micro-RNA (miR)-301a, a regulator of Th17, was reduced in Batf (-/-) mice in contrast to upregulation of miR-301a and downregulation of protein inhibitor of activated STAT3 (PIAS3) in anti-MHC-induced OAD animals. We also demonstrate an increase in miR-301a in the bronchoalveolar lavage cells from lung transplant recipients with Abs to human leukocyte antigen. This was accompanied by reduction in PIAS3 mRNA. Therefore, we conclude that BATF plays a critical role in the immune responses to SAgs and pathogenesis of anti-MHC-induced rejection. Targeting BATF should be considered for preventing chronic rejection after human lung transplantation. PMID:26844425

  12. Measles Virus Infection Inactivates Cellular Protein Phosphatase 5 with Consequent Suppression of Sp1 and c-Myc Activities

    PubMed Central

    Sato, Hiroki; Yoneda, Misako; Honma, Reiko; Ikeda, Fusako; Watanabe, Shinya

    2015-01-01

    ABSTRACT Measles virus (MeV) causes several unique syndromes, including transient immunosuppression. To clarify the cellular responses to MeV infection, we previously analyzed a MeV-infected epithelial cell line and a lymphoid cell line by microarray and showed that the expression of numerous genes was up- or downregulated in the epithelial cells. In particular, there was a characteristic comprehensive downregulation of housekeeping genes during late stage infection. To identify the mechanism underlying this phenomenon, we examined the phosphorylation status of transcription factors and kinase/phosphatase activities in epithelial cells after infection. MeV infection inactivated cellular protein phosphatase 5 (PP5) that consequently inactivated DNA-dependent protein kinase, which reduced Sp1 phosphorylation levels, and c-Myc degradation, both of which downregulated the expression of many housekeeping genes. In addition, intracellular accumulation of viral nucleocapsid inactivated PP5 and subsequent downstream responses. These findings demonstrate a novel strategy of MeV during infection, which causes the collapse of host cellular functions. IMPORTANCE Measles virus (MeV) is one of the most important pathogens in humans. We previously showed that MeV infection induces the comprehensive downregulation of housekeeping genes in epithelial cells. By examining this phenomenon, we clarified the molecular mechanism underlying the constitutive expression of housekeeping genes in cells, which is maintained by cellular protein phosphatase 5 (PP5) and DNA-dependent protein kinase. We also demonstrated that MeV targets PP5 for downregulation in epithelial cells. This is the first report to show how MeV infection triggers a reduction in overall cellular functions of infected host cells. Our findings will help uncover unique pathogenicities caused by MeV. PMID:26157124

  13. Identification by In Vivo Genomic Footprinting of a Transcriptional Switch Containing NF-κB and Sp1 That Regulates the IκBα Promoter

    PubMed Central

    Algarté, Michèle; Kwon, Hakju; Génin, Pierre; Hiscott, John

    1999-01-01

    In unstimulated cells, NF-κB transcription factors are retained in the cytoplasm by inhibitory IκB proteins. Upon stimulation by multiple inducers including cytokines or viruses, IκBα is rapidly phosphorylated and degraded, resulting in the release of NF-κB and the subsequent increase in NF-κB-regulated gene expression. IκBα gene expression is also regulated by an NF-κB autoregulatory mechanism, via NF-κB binding sites in the IκBα promoter. In previous studies, tetracycline-inducible expression of transdominant repressors of IκBα (TD-IκBα) progressively decreased endogenous IκBα protein levels. In the present study, we demonstrate that expression of TD-IκBα blocked phorbol myristate acetate-phytohemagglutinin or tumor necrosis factor alpha-induced IκBα gene transcription and abolished NF-κB DNA binding activity, due to the continued cytoplasmic sequestration of RelA(p65) by TD-IκBα. In vivo genomic footprinting revealed stimulus-responsive protein-DNA binding not only to the −63 to −53 κB1 site but also to the adjacent −44 to −36 Sp1 site of the IκBα promoter. In vivo protection of both sites was inhibited by tetracycline-inducible TD-IκBα expression. Prolonged NF-κB binding and a temporal switch in the composition of NF-κB complexes bound to the −63 to −53 κB1 site of the IκBα promoter were also observed; with time after induction, decreased levels of transcriptionally active p50-p65 and increased p50–c-Rel heterodimers were detected at the κB1 site. Mutation of either the κB1 site or the Sp1 site abolished transcription factor binding to the respective sites and the inducibility of the IκBα promoter in transient transfection studies. These observations provide the first in vivo characterization of a promoter proximal transcriptional switch involving NF-κB and Sp1 that is essential for autoregulation of the IκBα promoter. PMID:10454561

  14. Role of SP1-binding domains in in vivo transcriptional regulation of the human immunodeficiency virus type 1 long terminal repeat.

    PubMed

    Harrich, D; Garcia, J; Wu, F; Mitsuyasu, R; Gonazalez, J; Gaynor, R

    1989-06-01

    Five regions of the human immunodeficiency virus type 1 (HIV-1) long terminal repeat (LTR) have been shown to be important in the transcriptional regulation of HIV in HeLa cells. These include the negative regulatory, enhancer, SP1, TATA, and TAR regions. Previous studies in which purified SP1 was used showed that the three SP1-binding sites in the HIV LTR were important in the in vitro transcription of this promoter. However, no studies to ascertain the role of each of these SP1-binding sites in basal and tat-induced transcriptional activation in vivo have been reported. To determine the role of SP1 sites in transcriptional regulation of the HIV LTR in vivo, these sites were subjected to oligonucleotide mutagenesis both individually and in groups. The constructs were tested by DNase I footprinting with both oligonucleotide affinity column-purified SP1 and partially purified HeLa extract and by chloramphenicol acetyltransferase assays in both the presence and absence of the tat gene. Mutagenesis of each SP1-binding site resulted in minimal changes in basal and tat-induced transcriptional activation. Mutations involving alterations of SP1 sites I and II, I and III, or II and III also resulted in minimal decreases in basal and tat-induced transcriptional activation. However, mutagenesis of all three SP1-binding sites resulted in a marked decrease in tat induction. The latter mutation also greatly decreased DNase I protection over the enhancer, TATA, and TAR regions when partially purified HeLa nuclear extract was used. Mutagenesis of the HIV LTR SP1 sites which converted them to consensus high-affinity SP1-binding sites with the sequence GGGGCGGGGC resulted in increased tat-induced gene expression compared with the wild-type HIV LTR template. These results suggest that SP1, through its interaction with other DNA-binding proteins, is critical for in vivo transcriptional regulation of HIV. PMID:2657100

  15. The Vascular Endothelial Growth Factors-Expressing Character of Mesenchymal Stem Cells Plays a Positive Role in Treatment of Acute Lung Injury In Vivo

    PubMed Central

    Yang, Yi; Hu, Shuling; Xu, Xiuping; Li, Jinze; Liu, Airan; Han, Jibin; Liu, Songqiao; Liu, Ling; Qiu, Haibo

    2016-01-01

    Recently, mesenchymal stem cells (MSC) have been proved to be beneficial in acute respiratory distress syndrome (ARDS). Vascular endothelial growth factor (VEGF) is an important angiogenesis factor that MSC release. However, the precise role of VEGF-expressing character of MSC in the MSC treatment for ARDS remains obscure. Here, we firstly knocked down the gene VEGF in MSC (MSC-ShVEGF) with lentiviral transduction. Then we injected the MSC-ShVEGF to rats with lipopolysaccharide-induced acute lung injury (ALI) via the tail vein. Data showed that MSC transplantation significantly increased VEGF levels in the lung, reduced lung permeability, protected lung endothelium from apoptosis, facilitated VE-cadherin recovery, controlled inflammation, and attenuated lung injury. However, VEGF gene knockdown in MSC led to relatively insufficient VEGF expression in the injured lung and significantly diminished the therapeutic effects of MSC on ALI, suggesting an important role of VEGF-expressing behavior of MSC in the maintenance of VEGF in the lung and the MSC treatment for ALI. Hence, we conclude that MSC restores the lung permeability and attenuates lung injury in rats with ALI in part by maintaining a “sufficient” VEGF level in the lung and the VEGF-expressing character of MSC plays a positive role in the therapeutic effects of MSC on ARDS. PMID:27313398

  16. Significance of different microalgal species for growth of moon jellyfish ephyrae, Aurelia sp.1

    NASA Astrophysics Data System (ADS)

    Zheng, Shan; Sun, Xiaoxia; Wang, Yantao; Sun, Song

    2015-10-01

    The scyphozoan Aurelia aurita (Linnaeus) sp. l., is a cosmopolitan species-complex which blooms seasonally in a variety of coastal and shelf sea environments around the world. The effects of different microalgal species on the growth of newly-released Aurelia sp.1 ephyrae were studied under laboratory conditions. We fed ephyrae with four different microalgal species (diatom, autotrophic dinoflagellate, heterotrophic dinoflagellate, and chlorophyta) plus Artemia nauplii for 12-24 d at 18°C. Results showed that the growth rate diverged significantly for Artemia nauplii compared to other food types. In addition, there was no significant variation between the growth rates for Skeletonema costatum and Prorocentrum donghaiense, and no significant variation was found in the growth rates for N. scintillans and P. subcordiformis. Artemia nauplii could support the energy requirement for the newly-released ephyrae to develop to meduase, and the ephyrae with Artemia nauplii showed a significant average growth rate of 25.85% d-1. Newly-released ephyrae could grow slightly with some species of microalgae in the earliest development stage. Chain diatom Skeletonema costatum and autotrophic dinoflagellate Prorocentrum donghaiense, could not support the growth of the ephyrae, while heterotrophic dinoflagellate Noctiluca scintillans and chlorophyta Platymonas subcordiformis could support the growth of the ephyrae. However, none of the ephyrae fed with the tested phytoplankton could mature to medusae.

  17. Achromobactor denitrificans SP1 produces pharmaceutically active 25C prodigiosin upon utilizing hazardous di(2-ethylhexyl)phthalate

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Achromobacter denitrificans SP1 isolated from soil sludge heavily contaminated with plastic waste produced a novel pharmaceutically-active 25C prodigiosin analog during growth in a simple mineral salt medium supplemented with hazardous di(2-ethylhexyl)phthalate (DEHP) blended PVC plastics (in situ) ...

  18. Quantitative Analysis of Estrogen Receptor Expression Shows SP1 antibody is more sensitive than 1D5

    PubMed Central

    Welsh, Allison W.; Harigopal, Malini; Wimberly, Hallie; Prasad, Manju; Rimm, David L.

    2012-01-01

    Studies comparing rabbit monoclonal SP1 antibody to 1D5 for ER immunohistochemical (IHC) testing show conflicting results. Here we use a standardized quantitative immunofluorescent (QIF) ER assay to determine the level and significance of discordance between antibodies. Both antibodies are assessed by QIF on our Index TMA of cell lines and case controls, followed by QIF and IHC on two retrospective cohorts from Yale. On the Index TMA, SP1 displayed stronger signal-to-noise than 1D5. On the patient cohorts, the range of discrepancy between the two antibodies is 8% to 16.9%, with the majority of discrepant cases being SP1-positive/1D5-negative. Kaplan Meier analysis of the discrepant cases shows outcome comparable to double positive cases, suggesting that SP1 is more sensitive than 1D5. A series of cases with high levels of ER-beta shows that neither antibody cross-reacts, suggesting equivalent specificity. Future efforts are needed to determine if response to endocrine therapies show superiority of either antibody as a companion diagnostic test. PMID:22820659

  19. Playing It Safe.

    ERIC Educational Resources Information Center

    O'Neill, Steve

    2000-01-01

    Provides tips on how to avoid accidents and injuries on school playgrounds. Tips include removing of old, dangerous equipment; relocating play areas to safer ground; choosing the right surface; factoring in long-term costs for replenishing and redistributing loose materials; and considering Americans with Disabilities Act issues. (GR)

  20. Hypoxia-Inducible Factors Modulate the Stemness and Malignancy of Colon Cancer Cells by Playing Opposite Roles in Canonical Wnt Signaling

    PubMed Central

    Santoyo-Ramos, Paula; Likhatcheva, María; García-Zepeda, Eduardo A.; Castañeda-Patlán, M. Cristina; Robles-Flores, Martha

    2014-01-01

    This study examined the role played by hypoxia-inducible factors (HIFs) in malignant phenotype maintenance and canonical Wnt signaling. Under normoxia, we determined that both HIF-1α and HIF-2α are expressed in human colon cancer cells but not in their non-malignant counterparts. The stable knockdown of HIF-1α or HIF-2α expression induced negative effects on the malignant phenotype of colon cancer cells, with lactate production, the rate of apoptosis, migration, CXCR4-mediated chemotaxis, and tumorigenic activity all being significantly affected by HIF knockdown and with HIF-1α depletion exerting greater effects. Knockdown of these two HIF transcripts induced different and even opposite effects on β-catenin transcriptional activity in colon cancer cells with different genetic Wnt signaling pathways. In SW480 cells, HIF-2α knockdown did not affect β-catenin levels, increasing the transcriptional activity of β-catenin by inducing its nuclear accumulation, whereas HIF-1α silencing negatively affected the stability and transcriptional activity of β-catenin, inducing its exit from the nuclei and its recruitment to the cell membrane by E-cadherin. In addition, although HIF-1α depletion induced a reversal of the epithelial-to-mesenchymal transition (EMT), HIF-2α silencing altered the expression of the stem cell markers CD44, Oct4, and CD24 and of the differentiation marker CK20 in the opposite direction as HIF-1α silencing. Remarkably, HIF-2α knockdown also enhanced β-catenin transcriptional activity under hypoxia in cells that displayed normal Wnt signaling, suggesting that the gene negatively modulates canonical Wnt signaling in colon cancer cells. Taken together, our results indicate that HIFs play opposing roles in canonical Wnt signaling and are essential for the stemness and malignancy maintenance of colon cancer cells. PMID:25396735

  1. EMMPRIN, SP1 and microRNA-27a mediate physcion 8-O-β-glucopyranoside-induced apoptosis in osteosarcoma cells.

    PubMed

    Wang, Zhaohong; Yang, Huilin

    2016-01-01

    Physcion 8-O-β-glucopyranoside (PG), the main active ingredient of Rumex japonicus, induces apoptosis and causes cell cycle arrest in human lung cancer cells. However, its anti-tumor effects are not fully understood. In this study, we explored the mechanisms underlying PG induced apoptosis in the osteosarcoma cell line MG-63. Our results showed that PG exerted anti-proliferative effects and induced apoptosis in MG-63 cells via the intrinsic mitochondrial pathway, accompanied by loss of mitochondrial membrane potential (MMP) and cytochrome C release from the mitochondria. In addition, physcion treatment significantly inhibited extracellular matrix metalloproteinase inducer (EMMPRIN) expression in MG-63 cells, in a dose-dependent manner; meanwhile, EMMPRIN protein overexpression markedly reduced PG-induced apoptosis. Moreover, our findings suggested that the modulatory effects of PG on EMMPRIN were due, at least in part, to regulation of an ROS-miR-27a/ZBTB10-Sp1 transcription factor pathway. PMID:27429847

  2. EMMPRIN, SP1 and microRNA-27a mediate physcion 8-O-β-glucopyranoside-induced apoptosis in osteosarcoma cells

    PubMed Central

    Wang, Zhaohong; Yang, Huilin

    2016-01-01

    Physcion 8-O-β-glucopyranoside (PG), the main active ingredient of Rumex japonicus, induces apoptosis and causes cell cycle arrest in human lung cancer cells. However, its anti-tumor effects are not fully understood. In this study, we explored the mechanisms underlying PG induced apoptosis in the osteosarcoma cell line MG-63. Our results showed that PG exerted anti-proliferative effects and induced apoptosis in MG-63 cells via the intrinsic mitochondrial pathway, accompanied by loss of mitochondrial membrane potential (MMP) and cytochrome C release from the mitochondria. In addition, physcion treatment significantly inhibited extracellular matrix metalloproteinase inducer (EMMPRIN) expression in MG-63 cells, in a dose-dependent manner; meanwhile, EMMPRIN protein overexpression markedly reduced PG-induced apoptosis. Moreover, our findings suggested that the modulatory effects of PG on EMMPRIN were due, at least in part, to regulation of an ROS-miR-27a/ZBTB10-Sp1 transcription factor pathway. PMID:27429847

  3. Overexpression of histone deacetylases in cancer cells is controlled by interplay of transcription factors and epigenetic modulators

    PubMed Central

    Yang, Hui; Salz, Tal; Zajac-Kaye, Maria; Liao, Daiqing; Huang, Suming; Qiu, Yi

    2014-01-01

    Histone deacetylases (HDACs) that deacetylate histone and nonhistone proteins play crucial roles in a variety of cellular processes. The overexpression of HDACs is reported in many cancer types and is directly linked to accelerated cell proliferation and survival. However, little is known about how HDAC expression is regulated in cancer cells. In this study, we found that HDAC1 and HDAC2 promoters are regulated through collaborative binding of transcription factors Sp1/Sp3 and epigenetic modulators, including histone H3K4 methyltransferase SET1 and histone acetyltransferase p300, whose levels are also elevated in colon cancer cell lines and patient samples. Interestingly, Sp1 and Sp3 differentially regulate HDAC1 and HDAC2 promoter activity. In addition, Sp1/Sp3 recruits SET1 and p300 to the promoters. SET1 knockdown (KD) results in a loss of the H3K4 trimethylation mark at the promoters, as well as destabilizes p300 at the promoters. Conversely, p300 also influences SET1 recruitment and H3K4me3 level, indicating a crosstalk between p300 and SET1. Further, SET1 KD reduces Sp1 binding to the HDAC1 promoter through the increase of Sp1 acetylation. These results indicate that interactions among transcription factors and epigenetic modulators orchestrate the activation of HDAC1 and HDAC2 promoter activity in colon cancer cells.—Yang, H., Salz, T., Zajac-Kaye, M., Liao, D., Huang, S., and Qiu, Y. Overexpression of histone deacetylases in cancer cells is controlled by interplay of transcription factors and epigenetic modulators. PMID:24948597

  4. Fibroblast growth factor-inducible 14 (Fn14) is expressed in the lower genital tract and may play a role in amplifying inflammation during infection.

    PubMed

    Han, Eugene S; Mekasha, Samrawit; Ingalls, Robin R

    2010-01-01

    TNF-like weak inducer of apoptosis (TWEAK) is a member of the tumor necrosis factor (TNF) cytokine superfamily which regulates a number of cellular responses, including inflammation and proliferation. TWEAK is primarily secreted by phagocytic cells and its receptor, fibroblast growth factor-inducible 14 (Fn14), is expressed on non-lymphoid cells, including epithelial, endothelial and mesenchymal cells. The TWEAK/Fn14 pathway is highly conserved from an evolutionary standpoint, and has been shown to play a role in tissue regeneration and inflammation in the liver, kidney, lung and skeletal muscle. We hypothesized that TWEAK/Fn14 might have a physiological role in regulating infection-induced inflammation in the lower female genital tract. To test this hypothesis, we examined expression of the receptor Fn14 in relevant cells and tissue. Receptor function was tested by treating cells with recombinant TWEAK, with and without other known proinflammatory stimuli. Flow cytometric analysis of vaginal and cervical epithelial cells revealed that Fn14 was highly expressed at the cell surface. We also detected both Fn14 and TWEAK in whole cervical tissue by RT-PCR. Treatment of vaginal and cervical epithelial cells with recombinant TWEAK led to a weak induction of the chemokine IL-8. However, TWEAK potentiated the effects of IL-1ss, the TLR2 ligand Pam(3)CysSK(4), and live Neisseria gonorrhoeae in a synergistic manner. These data reveal a novel pathway for regulation of microbial-induced inflammation in the female reproductive tract and suggest that interference with the TWEAK/Fn14 pathway might be an approach to abrogate excessive infection-induced inflammation caused by sexually transmitted pathogens. PMID:19963275

  5. The Theobroma cacao B3 domain transcription factor TcLEC2 plays a duel role in control of embryo development and maturation

    PubMed Central

    2014-01-01

    Background The Arabidopsis thaliana LEC2 gene encodes a B3 domain transcription factor, which plays critical roles during both zygotic and somatic embryogenesis. LEC2 exerts significant impacts on determining embryogenic potential and various metabolic processes through a complicated genetic regulatory network. Results An ortholog of the Arabidopsis Leafy Cotyledon 2 gene (AtLEC2) was characterized in Theobroma cacao (TcLEC2). TcLEC2 encodes a B3 domain transcription factor preferentially expressed during early and late zygotic embryo development. The expression of TcLEC2 was higher in dedifferentiated cells competent for somatic embryogenesis (embryogenic calli), compared to non-embryogenic calli. Transient overexpression of TcLEC2 in immature zygotic embryos resulted in changes in gene expression profiles and fatty acid composition. Ectopic expression of TcLEC2 in cacao leaves changed the expression levels of several seed related genes. The overexpression of TcLEC2 in cacao explants greatly increased the frequency of regeneration of stably transformed somatic embryos. TcLEC2 overexpressing cotyledon explants exhibited a very high level of embryogenic competency and when cultured on hormone free medium, exhibited an iterative embryogenic chain-reaction. Conclusions Our study revealed essential roles of TcLEC2 during both zygotic and somatic embryo development. Collectively, our evidence supports the conclusion that TcLEC2 is a functional ortholog of AtLEC2 and that it is involved in similar genetic regulatory networks during cacao somatic embryogenesis. To our knowledge, this is the first detailed report of the functional analysis of a LEC2 ortholog in a species other then Arabidopsis. TcLEC2 could potentially be used as a biomarker for the improvement of the SE process and screen for elite varieties in cacao germplasm. PMID:24758406

  6. Complement factor B is the downstream effector of TLRs and plays an important role in a mouse model of severe sepsis.

    PubMed

    Zou, Lin; Feng, Yan; Li, Yan; Zhang, Ming; Chen, Chan; Cai, Jiayan; Gong, Yu; Wang, Larry; Thurman, Joshua M; Wu, Xiaobo; Atkinson, John P; Chao, Wei

    2013-12-01

    Severe sepsis involves massive activation of the innate immune system and leads to high mortality. Previous studies have demonstrated that various types of TLRs mediate a systemic inflammatory response and contribute to organ injury and mortality in animal models of severe sepsis. However, the downstream mechanisms responsible for TLR-mediated septic injury are poorly understood. In this article, we show that activation of TLR2, TLR3, and TLR4 markedly enhanced complement factor B (cfB) synthesis and release by macrophages and cardiac cells. Polymicrobial sepsis, created by cecal ligation and puncture in a mouse model, augmented cfB levels in the serum, peritoneal cavity, and major organs including the kidney and heart. Cecal ligation and puncture also led to the alternative pathway activation, C3 fragment deposition in the kidney and heart, and cfB-dependent C3dg elevation. Bacteria isolated from septic mice activated the serum alternative pathway via a factor D-dependent manner. MyD88 deletion attenuated cfB/C3 upregulation as well as cleavage induced by polymicrobial infection. Importantly, during sepsis, absence of cfB conferred a protective effect with improved survival and cardiac function and markedly attenuated acute kidney injury. cfB deletion also led to increased neutrophil migratory function during the early phase of sepsis, decreased local and systemic bacterial load, attenuated cytokine production, and reduced neutrophil reactive oxygen species production. Together, our data indicate that cfB acts as a downstream effector of TLR signaling and plays a critical role in the pathogenesis of severe bacterial sepsis. PMID:24154627

  7. Complement Factor B is the Downstream Effector of Toll-Like Receptors and Plays an Important Role in a Mouse Model of Severe Sepsis¶

    PubMed Central

    Zou, Lin; Feng, Yan; Li, Yan; Zhang, Ming; Chen, Chan; Cai, Jiayan; Gong, Yu; Wang, Larry; Thurman, Joshua M.; Wu, Xiaobo; Atkinson, John P.; Chao, Wei

    2013-01-01

    Severe sepsis involves massive activation of the innate immune system and leads to high mortality. Previous studies have demonstrated that various types of Toll-like receptors (TLRs) mediate a systemic inflammatory response and contribute to organ injury and mortality in animal models of severe sepsis. However, the downstream mechanisms responsible for TLR-mediated septic injury are poorly understood. Here, we show that activation of TLR2, TLR3 and TLR4 markedly enhanced complement factor B (cfB) synthesis and release by macrophages and cardiac cells. Polymicrobial sepsis, created by cecal ligation and puncture (CLP) in a mouse model, augmented cfB levels in the serum, peritoneal cavity and major organs including the kidney and heart. CLP also led to the alternative pathway (AP) activation, C3 fragment deposition in the kidney and heart, and cfB-dependent C3dg elevation. Bacteria isolated from septic mice activated the serum AP via a factor D-dependent manner. MyD88 deletion attenuated cfB/C3 up-regulation as well as cleavage induced by polymicrobial infection. Importantly, during sepsis, absence of cfB conferred a protective effect with improved survival and cardiac function, and markedly attenuated acute kidney injury. cfB deletion also led to increased neutrophil migratory function during the early phase of sepsis, decreased local and systemic bacterial load, attenuated cytokine production and reduced neutrophil reactive oxygen species production. Together, our data indicate that cfB acts as a downstream effector of TLR signaling and plays a critical role in the pathogenesis of severe bacterial sepsis. PMID:24154627

  8. Triptolide inhibits transcription of hTERT through down-regulation of transcription factor specificity protein 1 in primary effusion lymphoma cells.

    PubMed

    Long, Cong; Wang, Jingchao; Guo, Wei; Wang, Huan; Wang, Chao; Liu, Yu; Sun, Xiaoping

    2016-01-01

    Primary effusion lymphoma (PEL) is a rare and aggressive non-Hodgkin's lymphoma. Human telomerase reverse transcriptase (hTERT), a key component responsible for the regulation of telomerase activity, plays important roles in cellular immortalization and cancer development. Triptolide purified from Tripterygium extracts displays a broad-spectrum bioactivity profile, including immunosuppressive, anti-inflammatory, and anti-tumor. In this study, it is investigated whether triptolide reduces hTERT expression and suppresses its activity in PEL cells. The mRNA and protein levels of hTERT were examined by real time-PCR and Western blotting, respectively. The activity of hTERT promoter was determined by Dual luciferase reporter assay. Our results demonstrated that triptolide decreased expression of hTERT at both mRNA and protein levels. Further gene sequence analysis indicated that the activity of hTERT promoter was suppressed by triptolide. Triptolide also reduced the half-time of hTERT. Additionally, triptolide inhibited the expression of transcription factor specificity protein 1(Sp1) in PEL cells. Furthermore, knock-down of Sp1 by using specific shRNAs resulted in down-regulation of hTERT transcription and protein expression levels. Inhibition of Sp1 by specific shRNAs enhanced triptolide-induced cell growth inhibition and apoptosis. Collectively, our results demonstrate that the inhibitory effect of triptolide on hTERT transcription is possibly mediated by inhibition of transcription factor Sp1 in PEL cells. PMID:26631963

  9. CD1d induction in solid tumor cells by histone deacetylase inhibitors through inhibition of HDAC1/2 and activation of Sp1.

    PubMed

    Yang, Pei-Ming; Lin, Pei-Jie; Chen, Ching-Chow

    2012-04-01

    CD1d is a MHC class-like molecule that presents glycolipids to natural killer T (NKT) cells, then regulates innate and adaptive immunity. The regulation of CD1d gene expression in solid tumors is still largely unknown. Gene expression can be epigenetically regulated by DNA methylation and histone acetylation. We found that histone deacetylase inhibitors, trichostatin A (TSA) and suberoylanilide hydroxamic acid (SAHA), induced CD1d gene expression in human (A549 and NCI-H292) and mouse (TC-1 and B16/F0) cancer cells. Simultaneous knockdown of HDAC1 and 2 induced CD1d gene expression. Sp1 inhibitor mitramycin A (MTM) blocked TSA- and SAHA-induced CD1d mRNA expression and Sp1 luciferase activity. Co-transfection of GAL4-Sp1 and Fc-luciferase reporters demonstrated that TSA and SAHA induced Sp1 luciferase reporter activity by enhancing Sp1 transactivation activity. The binding of Sp1 to CD1d promoter and histone H3 acetylation on Sp1 sites were increased by TSA and SAHA. These results indicate that TSA and SAHA could up-regulate CD1d expression in tumor cells through inhibition of HDAC1/2 and activation of Sp1. PMID:22419072

  10. Nuclear factor kappa B plays a pivotal role in polyinosinic-polycytidylic acid-induced expression of human β-defensin 2 in intestinal epithelial cells

    PubMed Central

    Omagari, D; Takenouchi-Ohkubo, N; Endo, S; Ishigami, T; Sawada, A; Moro, I; Asano, M; Komiyama, K

    2011-01-01

    Intestinal epithelial cells (IECs) play an important role in protecting the intestinal surface from invading pathogens by producing effector molecules. IECs are one of the major sources of human beta-defensin 2 (hBD-2), and can produce it in response to a variety of stimuli. Although IECs express Toll-like receptor 3 (TLR-3) and can respond to its ligand, double-stranded RNA (dsRNA), hBD-2 expression in response to dsRNA has not been elucidated. In the present study, using an artificial analogue of dsRNA, polyinosinic-polycytidylic acid (poly I:C), we investigated whether the human IEC line, HT-29, can produce hBD-2 in response to poly I:C. HT-29 cells can express hBD-2 mRNA only when stimulated with poly I:C. The induction of hBD-2 mRNA expression was observed at 3 h after stimulation and peaked at 12 h of post-stimulation. Pre-incubation of the cells with nuclear factor kappa B (NF-κB)-specific inhibitor, l-1–4′-tosylamino-phenylethyl-chloromethyl ketone (TPCK) and isohelenine abolished the expression of hBD-2. Detection of the poly I:C signal by TLR-3 on the surface of HT-29 cells was revealed by pre-incubating the cells with anti-TLR-3 antibody. The 5′-regulatory region of the hBD-2 gene contains two NF-κB binding sites. A luciferase assay revealed the importance of the proximal NF-κB binding site for poly I:C-induced expression of hBD-2. Among NF-κB subunits, p65 and p50 were activated by poly I:C stimulation and accumulated in the nucleus. Activation of the p65 subunit was investigated further by determining its phosphorylation status, which revealed that poly I:C stimulation resulted in prolonged phosphorylation of p65. These results indicate clearly that NF-κB plays an indispensable role in poly I:C induced hBD-2 expression in HT-29 cells. PMID:21501152

  11. Proto-oncogene FBI-1 (Pokemon/ZBTB7A) represses transcription of the tumor suppressor Rb gene via binding competition with Sp1 and recruitment of co-repressors.

    PubMed

    Jeon, Bu-Nam; Yoo, Jung-Yoon; Choi, Won-Il; Lee, Choong-Eun; Yoon, Ho-Geun; Hur, Man-Wook

    2008-11-28

    FBI-1 (also called Pokemon/ZBTB7A) is a BTB/POZ-domain Krüppel-like zinc-finger transcription factor. Recently, FBI-1 was characterized as a proto-oncogenic protein, which represses tumor suppressor ARF gene transcription. The expression of FBI-1 is increased in many cancer tissues. We found that FBI-1 potently represses transcription of the Rb gene, a tumor suppressor gene important in cell cycle arrest. FBI-1 binds to four GC-rich promoter elements (FREs) located at bp -308 to -188 of the Rb promoter region. The Rb promoter also contains two Sp1 binding sites: GC-box 1 (bp -65 to -56) and GC-box 2 (bp -18 to -9), the latter of which is also bound by FBI-1. We found that FRE3 (bp -244 to -236) is also a Sp1 binding element. FBI-1 represses transcription of the Rb gene not only by binding to the FREs, but also by competing with Sp1 at the GC-box 2 and the FRE3. By binding to the FREs and/or the GC-box, FBI-1 represses transcription of the Rb gene through its POZ-domain, which recruits a co-repressor-histone deacetylase complex and deacetylates histones H3 and H4 at the Rb gene promoter. FBI-1 inhibits C2C12 myoblast cell differentiation by repressing Rb gene expression. PMID:18801742

  12. Proto-oncogene FBI-1 (Pokemon/ZBTB7A) Represses Transcription of the Tumor Suppressor Rb Gene via Binding Competition with Sp1 and Recruitment of Co-repressors*S⃞

    PubMed Central

    Jeon, Bu-Nam; Yoo, Jung-Yoon; Choi, Won-Il; Lee, Choong-Eun; Yoon, Ho-Geun; Hur, Man-Wook

    2008-01-01

    FBI-1 (also called Pokemon/ZBTB7A) is a BTB/POZ-domain Krüppel-like zinc-finger transcription factor. Recently, FBI-1 was characterized as a proto-oncogenic protein, which represses tumor suppressor ARF gene transcription. The expression of FBI-1 is increased in many cancer tissues. We found that FBI-1 potently represses transcription of the Rb gene, a tumor suppressor gene important in cell cycle arrest. FBI-1 binds to four GC-rich promoter elements (FREs) located at bp –308 to –188 of the Rb promoter region. The Rb promoter also contains two Sp1 binding sites: GC-box 1 (bp –65 to –56) and GC-box 2 (bp –18 to –9), the latter of which is also bound by FBI-1. We found that FRE3 (bp –244 to –236) is also a Sp1 binding element. FBI-1 represses transcription of the Rb gene not only by binding to the FREs, but also by competing with Sp1 at the GC-box 2 and the FRE3. By binding to the FREs and/or the GC-box, FBI-1 represses transcription of the Rb gene through its POZ-domain, which recruits a co-repressor-histone deacetylase complex and deacetylates histones H3 and H4 at the Rb gene promoter. FBI-1 inhibits C2C12 myoblast cell differentiation by repressing Rb gene expression. PMID:18801742

  13. Role played by paxillin and paxillin tyrosine phosphorylation in hepatocyte growth factor/sphingosine-1-phosphate-mediated reactive oxygen species generation, lamellipodia formation, and endothelial barrier function

    PubMed Central

    Usatyuk, Peter V.; Jacobson, Jeffrey; Cress, Anne E.; Garcia, Joe G. N.; Salgia, Ravi; Natarajan, Viswanathan

    2015-01-01

    Abstract Paxillin is a multifunctional and multidomain focal adhesion adaptor protein. It serves as an important scaffolding protein at focal adhesions by recruiting and binding to structural and signaling molecules. Paxillin tyrosine phosphorylation at Y31 and Y118 is important for paxillin redistribution to focal adhesions and angiogenesis. Hepatocyte growth factor (HGF) and sphingosine-1-phosphate (S1P) are potent stimulators of lamellipodia formation, a prerequisite for endothelial cell migration. The role played by paxillin and its tyrosine phosphorylated forms in HGF- or S1P-induced lamellipodia formation and barrier function is unclear. HGF or S1P stimulated lamellipodia formation, tyrosine phosphorylation of paxillin at Y31 and Y118, and c-Abl in human lung microvascular endothelial cells (HLMVECs). Knockdown of paxillin with small interfering RNA (siRNA) or transfection with paxillin mutants (Y31F or Y118F) mitigated HGF- or S1P-induced lamellipodia formation, translocation of p47phox to lamellipodia, and reactive oxygen species (ROS) generation in HLMVECs. Furthermore, exposure of HLMVECs to HGF or S1P stimulated c-Abl-mediated tyrosine phosphorylation of paxillin at Y31 and Y118 in a time-dependent fashion, and down-regulation of c-Abl with siRNA attenuated HGF- or S1P-mediated lamellipodia formation, translocation of p47phox to lamellipodia, and endothelial barrier enhancement. In vivo, knockdown of paxillin with siRNA in mouse lungs attenuated ventilator-induced lung injury. Together, these results suggest that c-Abl-mediated tyrosine phosphorylation of paxillin at Y31 and Y118 regulates HGF- or S1P-mediated lamellipodia formation, ROS generation in lamellipodia, and endothelial permeability. PMID:26697169

  14. Poly(ADP-ribose) Polymerase 1 Interacts with Nuclear Respiratory Factor 1 (NRF-1) and Plays a Role in NRF-1 Transcriptional Regulation*S⃞

    PubMed Central

    Hossain, Mohammad B.; Ji, Ping; Anish, Ramakrishnan; Jacobson, Raymond H.; Takada, Shinako

    2009-01-01

    Nuclear respiratory factor 1 (NRF-1) is one of the key transcriptional activators for nuclear-coded genes involved in mitochondrial biogenesis and function as well as for many housekeeping genes. A transcriptional co-activator PGC-1 and its related family member PRC have previously been shown to interact with NRF-1 and co-activate NRF-1. We show here that NRF-1 can also directly interact with poly(ADP-ribose) polymerase 1 (PARP-1) and co-purify the PARP-1·DNA-PK·Ku80·Ku70·topoisomerase IIβ-containing protein complex. Our in vitro binding experiments show that DNA-binding/dimerization domain of NRF-1 and the N-terminal half of PARP-1, which contains two Zinc fingers and the auto-modification domain, are responsible for the interaction, and that this interaction occurs with or without PARP-1 poly(ADP-ribosyl)ation (PARylation). DNA-bound NRF-1 can form a complex with PARP-1, suggesting that NRF-1 can recruit the PARP-1·DNA-PK·Ku80·Ku70·topoisomerase IIβ-containing protein complex to the promoter. PARP-1 can also PARylate the DNA-binding domain of NRF-1 and negatively regulate NRF-1·PARP-1 interaction. Transient transfection and chromatin immunoprecipitation experiments suggest that PARP-1 plays a role during transcriptional activation by NRF-1. Our finding identifies a new aspect of transcriptional regulation used by NRF-1. PMID:19181665

  15. Progesterone induces expression of the prolactin receptor gene through cooperative action of Sp1 and C/EBP

    PubMed Central

    Goldhar, Anita S.; Duan, Renqin; Ginsburg, Erika; Vonderhaar, Barbara K.

    2011-01-01

    Prolactin (Prl) and progesterone (P) cooperate synergistically during mammary gland development and tumorigenesis. We hypothesized that one mechanism for these effects may be through mutual induction of receptors (R). EpH4 mouse mammary epithelial cells stably transfected with PR-A express elevated levels of PrlR mRNA and protein compared to control EpH4 cells that lack the PR. Likewise, T47D human breast cancer cells treated with P overexpress the PrlR and activate PrlR promoter III. PrlR promoter III does not contain a classical P response element but contains several binding sites for transcription proteins, including C/EBP, Sp1 and AP1, which may also interact with the PR. Using promoter deletion and site directed mutagenesis analyses as well as gel shift assays, cooperative activation of the C/EBP and adjacent Sp1A, but not the Sp1B or AP1, sites by P is shown to confer P responsiveness leading to increased PrlR transcription. PMID:21238538

  16. Peritoneal Dissemination Requires an Sp1-Dependent CXCR4/CXCL12 Signaling Axis and Extracellular Matrix-Directed Spheroid Formation.

    PubMed

    Kasagi, Yuta; Harada, Yui; Morodomi, Yosuke; Iwai, Toshiki; Saito, Satoru; Yoshida, Kumi; Oki, Eiji; Saeki, Hiroshi; Ohgaki, Kippei; Sugiyama, Masahiko; Onimaru, Mitsuho; Maehara, Yoshihiko; Yonemitsu, Yoshikazu

    2016-01-15

    Peritonitis carcinomatosa is an advanced and intractable state of gastrointestinal and ovarian cancer, where mechanistic elucidation might enable the development of more effective therapies. Peritoneal dissemination of this type of malignancy has been generally thought to initiate from "milky spots" of primitive lymphoid tissues in the peritoneal cavity. In this study, we offer evidence challenging this idea, based on the finding that tumor implantation and directional dissemination was not required for the presence of milky spots, but rather SCF/CXCL12-expressing niche-like cells located at the border regions of perivascular adipose tissue. Interestingly, we found that peritoneal cavity lavage fluid, which specifically contains peritoneal collagen type IV and plasma fibronectin, dramatically facilitated spheroid formation of murine and human colon cancer cells. Spheroid formation strongly induced the expression of CXCR4 in an Sp1-dependent manner to promote niche-directed metastasis. Notably, disrupting sphere formation or inhibiting Sp1 activity was sufficient to suppress tumor dissemination and potentiated chemosensitivity to 5-fluorouracil. Our findings illuminate mechanisms of peritoneal cancer dissemination and highlight the Sp1/CXCR4/CXCL12 signaling axis as a rational target for the development of therapeutics to manage this intractable form of malignancy. PMID:26744523

  17. Purification and characterization of detergent stable alkaline protease from Bacillus amyloliquefaciens SP1 isolated from apple rhizosphere.

    PubMed

    Guleria, Shiwani; Walia, Abhishek; Chauhan, Anjali; Shirkot, Chand Karan

    2016-02-01

    A thermostable extracellular alkaline protease producing Bacillus amyloliquefaciens SP1 was isolated from apple rhizosphere having multifarious plant growth promoting activities. Strain SP1 was purified to 6.48-fold using four-step purification protocol and characterized in detail for its robustness and ecofriendly application in leather and detergent industries. Structural analysis revealed that the protease was monomeric and had a molecular weight of 43 kDa. It exhibited optimum activity at 60°C in alkaline environment (pH 8.0) and stable in the presence of surfactants and oxidizing agents. Enzyme was thermostable at 50°C and retained more than 70% activity after 30 min incubation. It has shown stain removal property and dehairing of goat skin without chemical assistance and hydrolyzing fibrous proteins. This protease showed Km of 0.125 mg ml(-1) and V(max) of 12820 μg ml(-1) indicating its excellent affinity and catalytic role. Thermal inactivation of the pure enzyme followed first-order kinetics. The half life of the pure enzyme at 50, 60, and 65°C was 77, 19.80, and 13.33 min, respectively. The activation energy was 37.19 KJ mol(-1). The results suggest that the B. amyloliquefaciens SP1 has a potential application in different industries. PMID:26375163

  18. LMO7 Mediates Cell-Specific Activation of the Rho-Myocardin-Related Transcription Factor-Serum Response Factor Pathway and Plays an Important Role in Breast Cancer Cell Migration ▿

    PubMed Central

    Hu, Qiande; Guo, Chun; Li, Yali; Aronow, Bruce J.; Zhang, Jinsong

    2011-01-01

    Serum response factor (SRF) is a ubiquitously expressed transcription factor that regulates cell-specific functions such as muscle development and breast cancer metastasis. The myocardin-related transcription factors (MRTFs), which are transcriptional coactivators mediating cell-specific functions of SRF, are also ubiquitously expressed. How MRTFs and SRF drive cell-specific transcription is still not fully understood. Here we show that LIM domain only 7 (LMO7) is a cell-specific regulator of MRTFs and plays an important role in breast cancer cell migration. LMO7 activates MRTFs by relieving actin-mediated inhibition in a manner that requires, and is synergistic with, Rho GTPase. Whereas Rho is required for LMO7 to activate full-length MRTFs that have three RPEL actin-binding motifs, the disruption of individual actin-RPEL interactions is sufficient to eliminate the Rho dependency and to allow the strong Rho-independent function of LMO7. Mechanistically, we show that LMO7 colocalizes with F-actin and reduces the G-actin/F-actin ratio via a Rho-independent mechanism. The knockdown of LMO7 in HeLa and MDA-MB-231 cells compromises both basal and Rho-stimulated MRTF activities and impairs the migration of MDA-MB-231 breast cancer cells. We also show that LMO7 is upregulated in the stroma of invasive breast carcinoma in a manner that correlates with the increased expression of SRF target genes that regulate muscle and actin cytoskeleton functions. Together, this study reveals a novel cell-specific mechanism regulating Rho-MRTF-SRF signaling and breast cancer cell migration and identifies a role for actin-RPEL interactions in integrating Rho and cell-specific signals to achieve both the synergistic and Rho-dependent activation of MRTFs. PMID:21670154

  19. Play-level distributions of estimates of recovery factors for a miscible carbon dioxide enhanced oil recovery method used in oil reservoirs in the conterminous United States

    USGS Publications Warehouse

    Attanasi, E.D.; Freeman, P.A.

    2016-01-01

    The retention factor is the percentage of injected CO2 that is naturally retained in the reservoir. Retention factors were also estimated in this study. For clastic reservoirs, 90 percent of the estimated retention factors were between 21.7 and 32.1 percent, and for carbonate reservoirs, 90 percent were between 23.7 and 38.2 percent. The respective median values were 22.9 for clastic reservoirs and 26.1 for carbonate reservoirs. Both distributions were right skewed. The recovery and retention factors that were calculated are consistent with the corresponding factors reported in the literature.

  20. Play Therapy: A Review

    ERIC Educational Resources Information Center

    Porter, Maggie L.; Hernandez-Reif, Maria; Jessee, Peggy

    2009-01-01

    This article discusses the current issues in play therapy and its implications for play therapists. A brief history of play therapy is provided along with the current play therapy approaches and techniques. This article also touches on current issues or problems that play therapists may face, such as interpreting children's play, implementing…

  1. Interleukin-18 induces EMMPRIN expression in primary cardiomyocytes via JNK/Sp1 signaling and MMP-9 in part via EMMPRIN and through AP-1 and NF-κB activation

    PubMed Central

    Reddy, Venkatapuram Seenu; Prabhu, Sumanth D.; Mummidi, Srinivas; Valente, Anthony J.; Venkatesan, Balachandar; Shanmugam, Prakashsrinivasan; Delafontaine, Patrice

    2010-01-01

    IL-18 and the extracellular matrix metalloproteinase (MMP) inducer (EMMPRIN) stimulate the expression of proinflammatory cytokines and MMPs and are elevated in myocardial hypertrophy, remodeling, and failure. Here, we report several novel findings in primary cardiomyocytes treated with IL-18. First, IL-18 activated multiple transcription factors, including NF-κB (p50 and p65), activator protein (AP)-1 (cFos, cJun, and JunD), GATA, CCAAT/enhancer-binding protein, myocyte-specific enhancer-binding factor, interferon regulatory factor-1, p53, and specific protein (Sp)-1. Second, IL-18 induced EMMPRIN expression via myeloid differentiation primary response gene 88/IL-1 receptor-associated kinase/TNF receptor-associated factor-6/JNK-dependent Sp1 activation. Third, IL-18 induced a number of MMP genes, particularly MMP-9, at a rapid rate as well as tissue inhibitor of metalloproteinase (TIMP)-1 and TIMP-3 at a slower rate. Finally, the IL-18 induction of MMP-9 was mediated in part via EMMPRIN and through JNK- and ERK-dependent AP-1 activation and p38 MAPK-dependent NF-κB activation. These results suggest that the elevated expression of IL-18 during myocardial injury and inflammation may favor EMMPRIN and MMP induction and extracellular matrix degradation. Therefore, targeting IL-18 or its signaling pathways may be of potential therapeutic benefit in adverse remodeling. PMID:20693392

  2. The genomic context and co-recruitment of SP1 affect ERRα co-activation by PGC-1α in muscle cells

    PubMed Central

    Baresic, Mario; van Nimwegen, Erik; Handschin, Christoph

    2016-01-01

    The peroxisome proliferator-activated receptor γ co-activator 1α (PGC-1α) coordinates the transcriptional network response to promote an improved endurance capacity in skeletal muscle, e.g. by co-activating the estrogen-related receptor α (ERRα) in the regulation of oxidative substrate metabolism. Despite a close functional relationship, the interaction between these two proteins has not been studied on a genomic level. We now mapped the genome-wide binding of ERRα to DNA in a skeletal muscle cell line with elevated PGC-1α and linked the DNA recruitment to global PGC-1α target gene regulation. We found that, surprisingly, ERRα co-activation by PGC-1α is only observed in the minority of all PGC-1α recruitment sites. Nevertheless, a majority of PGC-1α target gene expression is dependent on ERRα. Intriguingly, the interaction between these two proteins is controlled by the genomic context of response elements, in particular the relative GC and CpG content, monomeric and dimeric repeat binding site configuration for ERRα, and adjacent recruitment of the transcription factor SP1. These findings thus not only reveal a novel insight into the regulatory network underlying muscle cell plasticity, but also strongly link the genomic context of DNA response elements to control transcription factor – co-regulator interactions. PMID:27182621

  3. Des Regles et du Jeu. Complementarite des facteurs genetiques et epigenetiques dans le developpement cerebral (Of Rules and of Play. The Complementary Nature of Genetic and Epigenetic Factors in Brain Development).

    ERIC Educational Resources Information Center

    Lambert, Jean-Francois

    1997-01-01

    Discusses the importance of genetic and epigenetic factors in the development of the nervous system and the performances it conditions. From the perspective of rules, play, and relaxation of rules, learning and education are not considered as a kind of conditioning but as providing a content in which the cumulative expression of potential can take…

  4. Musical Instrument Choice and Playing History in Post-Secondary Level Music Students: Some Descriptive Data, Some Causes and Some Background Factors

    ERIC Educational Resources Information Center

    Chen, Simy Meng-Yu; Howard, Robert W.

    2004-01-01

    Why do musicians specialize in the specific instruments that they do? Research has shown effects of such factors as the perceived masculinity/femininity of instruments and musician's personality but there are little background data on other factors. The present study had two major aims. The first aim was to gather some useful background data on…

  5. Induction of truncated form of tenascin-X (XB-S) through dissociation of HDAC1 from SP-1/HDAC1 complex in response to hypoxic conditions

    SciTech Connect

    Kato, Akari; Endo, Toshiya; Abiko, Shun; Ariga, Hiroyoshi; Matsumoto, Ken-ichi

    2008-08-15

    ABSTRACT: XB-S is an amino-terminal truncated protein of tenascin-X (TNX) in humans. The levels of the XB-S transcript, but not those of TNX transcripts, were increased upon hypoxia. We identified a critical hypoxia-responsive element (HRE) localized to a GT-rich element positioned from - 1410 to - 1368 in the XB-S promoter. Using an electrophoretic mobility shift assay (EMSA), we found that the HRE forms a DNA-protein complex with Sp1 and that GG positioned in - 1379 and - 1378 is essential for the binding of the nuclear complex. Transfection experiments in SL2 cells, an Sp1-deficient model system, with an Sp1 expression vector demonstrated that the region from - 1380 to - 1371, an HRE, is sufficient for efficient activation of the XB-S promoter upon hypoxia. The EMSA and a chromatin immunoprecipitation (ChIP) assay showed that Sp1 together with the transcriptional repressor histone deacetylase 1 (HDAC1) binds to the HRE of the XB-S promoter under normoxia and that hypoxia causes dissociation of HDAC1 from the Sp1/HDAC1 complex. The HRE promoter activity was induced in the presence of a histone deacetylase inhibitor, trichostatin A, even under normoxia. Our results indicate that the hypoxia-induced activation of the XB-S promoter is regulated through dissociation of HDAC1 from an Sp1-binding HRE site.

  6. The Denial of Play.

    ERIC Educational Resources Information Center

    Sutton-Smith, Brian

    Well meaning parents and teachers often use children's play for the purposes of literacy and socialization. Yet, these attempts may deny play to children by subordinating play to some other concept. Evidence shows that even when parents play with their very young children they generally play games like shopping, cooking, and eating; whereas when…

  7. Why do adult dogs 'play'?

    PubMed

    Bradshaw, John W S; Pullen, Anne J; Rooney, Nicola J

    2015-01-01

    Among the Carnivora, play behaviour is usually made up of motor patterns characteristic of predatory, agonistic and courtship behaviour. Domestic dogs are unusual in that play is routinely performed by adults, both socially, with conspecifics and with humans, and also asocially, with objects. This enhanced playfulness is commonly thought to be a side effect of paedomorphosis, the perpetuation of juvenile traits into adulthood, but here we suggest that the functions of the different types of play are sufficiently distinct that they are unlikely to have arisen through a single evolutionary mechanism. Solitary play with objects appears to be derived from predatory behaviour: preferred toys are those that can be dismembered, and a complex habituation-like feedback system inhibits play with objects that are resistant to alteration. Intraspecific social play is structurally different from interspecific play and may therefore be motivationally distinct and serve different goals; for example, dogs often compete over objects when playing with other dogs, but are usually more cooperative when the play partner is human. The majority of dogs do not seem to regard competitive games played with a human partner as "dominance" contests: rather, winning possession of objects during games appears to be simply rewarding. Play may be an important factor in sociality, since dogs are capable of extracting social information not only from games in which they participate, but also from games that they observe between third parties. We suggest that the domestic dog's characteristic playfulness in social contexts is an adaptive trait, selected during domestication to facilitate both training for specific purposes, and the formation of emotionally-based bonds between dog and owner. Play frequency and form may therefore be an indicator of the quality of dog-owner relationships. PMID:25251020

  8. Interleukin-6-Specific Activation of the C/EBPδ Gene in Hepatocytes Is Mediated by Stat3 and Sp1

    PubMed Central

    Cantwell, Carrie A.; Sterneck, Esta; Johnson, Peter F.

    1998-01-01

    C/EBPδ (CCAAT/enhancer binding protein δ) has been implicated as a regulator of acute-phase response (APR) genes in hepatocytes. Its expression increases dramatically in liver during the APR and can be induced in hepatic cell lines by interleukin-6 (IL-6), an acute-phase mediator that activates transcription of many APR genes. Here we have investigated the mechanism by which C/EBPδ expression is regulated by IL-6 in hepatoma cells. C/EBPδ promoter sequences to −125 bp are sufficient for IL-6 inducibility of a reporter gene and include an APR element (APRE) that is essential for IL-6 responsiveness. DNA binding experiments and transactivation assays demonstrate that Stat3, but not Stat1, interacts with this APRE. Two Sp1 sites, one of which is adjacent to the APRE, are required for IL-6 induction and transactivation by Stat3. Thus, Stat3 and Sp1 function cooperatively to activate the C/EBPδ promoter. Replacement of the APRE with Stat binding elements (SBEs) from the ICAM-1 or C/EBPβ promoter, both of which recognize both Stat1 and Stat3, confers responsiveness to gamma interferon, a cytokine that selectively activates Stat1. Sequence comparisons suggest that the distinct Stat binding specificities of the C/EBPδ and C/EBPβ SBEs are determined primarily by a single base pair difference. Our findings indicate that the cytokine specificity of C/EBPδ gene expression is governed by the APRE sequence. PMID:9528783

  9. Complete genome sequence of Terriglobus saanensis type strain SP1PR4T, an Acidobacteria from tundra soil

    SciTech Connect

    Rawat, Suman R.; Mannisto, Minna; Starovoytov, Valentin; Goodwin, Lynne A.; Nolan, Matt; Hauser, Loren John; Land, Miriam L; Davenport, Karen W.; Woyke, Tanja; Haggblom, Max

    2012-01-01

    Terriglobus saanensis SP1PR4T is a novel species of the genus Terriglobus. T. saanensis is of ecological interest because it is a representative of the phylum Acidobacteria, which are dominant members of bacterial soil microbiota in Arctic ecosystems. T. saanensis is a cold-adapted acidophile and a versatile heterotroph utilizing a suite of simple sugars and complex polysaccharides. The genome contained an abundance of genes assigned to metabolism and transport of carbohydrates including gene modules encoding for carbohydrate-active enzyme (CAZyme) family involved in breakdown, utilization and biosynthesis of diverse structural and storage polysaccharides. T. saanensis SP1PR4T represents the first member of genus Terriglobus with a completed genome sequence, consisting of a single replicon of 5,095,226 base pairs (bp), 54 RNA genes and 4,279 protein-coding genes. We infer that the physiology and metabolic potential of T. saanensis is adapted to allow for resilience to the nutrient-deficient conditions and fluctuating temperatures of Arctic tundra soils.

  10. Bioactive metabolites produced by Penicillium sp. 1 and sp. 2, two endophytes associated with Alibertia macrophylla (Rubiaceae).

    PubMed

    Oliveira, Camila M; Silva, Geraldo H; Regasini, Luis O; Zanardi, Lisinéia M; Evangelista, Alana H; Young, Maria C M; Bolzani, Vanderlan S; Araujo, Angela R

    2009-01-01

    In the course of our continuous search for bioactive metabolites from endophytic fungi living in plants from the Brazilian flora, leaves of Alibertia macrophylla (Rubiaceae) were submitted to isolation of endophytes, and two species of Penicillium were isolated. The acetonitrile fraction obtained in corn from a culture of Penicillium sp. 1 afforded orcinol (1). On the other hand, Penicillium sp. 1 cultivated in potato-dextrose-broth furnished two different compounds, cyclo-(L-Pro-L-Val) (2) and uracil (3). The chromatographic fractionation of the acetonitrile fraction obtained from Penicillium sp. 2 led to three dihydroisocoumarins, 4-hydroxymellein (4), 8-methoxymellein (5) and 5-hydroxymellein (6). Compounds 5 and 6 were obtained from the Penicillium genus for the first time. Additionally, metabolites 1-6 were evaluated for their antifungal and acetylcholinesterase (AChE) inhibitory activities. The most active compounds 1 and 4 exhibited detection limits of 5.00 and 10.0 microg against Cladosporium cladosporioides and C. sphaerospermum, respectively. Compound 2 showed a detection limit of 10.0 microg, displaying potent AChE inhibitory activity. PMID:20158153

  11. War, Conflict and Play. Debating Play

    ERIC Educational Resources Information Center

    Hyder, Tina

    2004-01-01

    Young refugees from many parts of the world are increasingly present in UK early years settings. This book explores the crucial importance of play for young refugee children's development. It considers the implications of war and conflict on young children and notes how opportunities for play are denied. It provides a framework for early years…

  12. Playing the Play: What the Children Want

    ERIC Educational Resources Information Center

    Kraus, Jo Anne

    2006-01-01

    Playing the Play describes the experiences of a storyteller and teacher of literature who created a literature-based literacy program at Concourse House, a homeless shelter in Bronx, New York, for women and their young children. This program is based on the belief that pleasure is the primary reason children want to learn to read, and that where…

  13. Bibliography on Play Therapy and Children's Play.

    ERIC Educational Resources Information Center

    Rogers, Mary Brown; L'Abate, Luciano

    The references listed are: (1) journals, (2) dissertation abstracts, (3) books, (4) reports, and (5) monographs. The main subjects covered are: (1) children's play, (2) psychotherapy with disturbed children through the medium of play therapy, and (3) various aspects of child development, both normal and abnormal. The materials listed date from…

  14. The Uses of Play

    ERIC Educational Resources Information Center

    Cabaniss, Thomas

    2005-01-01

    Teaching artists have techniques for keeping play alive and vital in their work. But how do they think of play as TAs? In this article, the author examines the role of play in the work and life of teaching artists.

  15. Serum starvation-induced voltage-gated potassium channel Kv7.5 expression and its regulation by Sp1 in canine osteosarcoma cells.

    PubMed

    Lee, Bo Hyung; Ryu, Pan Dong; Lee, So Yeong

    2014-01-01

    The KCNQ gene family, whose members encode Kv7 channels, belongs to the voltage-gated potassium (Kv) channel group. The roles of this gene family have been widely investigated in nerve and muscle cells. In the present study, we investigated several characteristics of Kv7.5, which is strongly expressed in the canine osteosarcoma cell line, CCL-183. Serum starvation upregulated Kv7.5 expression, and the Kv7 channel opener, flupirtine, attenuated cell proliferation by arresting cells in the G0/G1 phase. We also showed that Kv7.5 knockdown helps CCL-183 cells to proliferate. In an effort to find an endogenous regulator of Kv7.5, we used mithramycin A to reduce the level of the transcription factor Sp1, and it strongly inhibited the induction of Kv7.5 in CCL-183 cells. These results suggest that the activation of Kv7.5 by flupirtine may exert an anti-proliferative effect in canine osteosarcoma. Therefore, Kv7.5 is a possible molecular target for canine osteosarcoma therapy. PMID:24434641

  16. Serum Starvation-Induced Voltage-Gated Potassium Channel Kv7.5 Expression and Its Regulation by Sp1 in Canine Osteosarcoma Cells

    PubMed Central

    Lee, Bo Hyung; Ryu, Pan Dong; Lee, So Yeong

    2014-01-01

    The KCNQ gene family, whose members encode Kv7 channels, belongs to the voltage-gated potassium (Kv) channel group. The roles of this gene family have been widely investigated in nerve and muscle cells. In the present study, we investigated several characteristics of Kv7.5, which is strongly expressed in the canine osteosarcoma cell line, CCL-183. Serum starvation upregulated Kv7.5 expression, and the Kv7 channel opener, flupirtine, attenuated cell proliferation by arresting cells in the G0/G1 phase. We also showed that Kv7.5 knockdown helps CCL-183 cells to proliferate. In an effort to find an endogenous regulator of Kv7.5, we used mithramycin A to reduce the level of the transcription factor Sp1, and it strongly inhibited the induction of Kv7.5 in CCL-183 cells. These results suggest that the activation of Kv7.5 by flupirtine may exert an anti-proliferative effect in canine osteosarcoma. Therefore, Kv7.5 is a possible molecular target for canine osteosarcoma therapy. PMID:24434641

  17. The key factor limiting plant growth in cold and humid alpine areas also plays a dominant role in plant carbon isotope discrimination

    PubMed Central

    Xu, Meng; Wang, Guoan; Li, Xiaoliang; Cai, Xiaobu; Li, Xiaolin; Christie, Peter; Zhang, Junling

    2015-01-01

    Many environmental factors affect carbon isotope discrimination in plants, yet the predominant factor influencing this process is generally assumed to be the key growth-limiting factor. However, to our knowledge this hypothesis has not been confirmed. We therefore determined the carbon isotope composition (δ13C) of plants growing in two cold and humid mountain regions where temperature is considered to be the key growth-limiting factor. Mean annual temperature (MAT) showed a significant impact on variation in carbon isotope discrimination value (Δ) irrespective of study area or plant functional type with either partial correlation or regression analysis, but the correlation between Δ and soil water content (SWC) was usually not significant. In multiple stepwise regression analysis, MAT was either the first or the only variable selected into the prediction model of Δ against MAT and SWC, indicating that the effect of temperature on carbon isotope discrimination was predominant. The results therefore provide evidence that the key growth-limiting factor is also crucial for plant carbon isotope discrimination. Changes in leaf morphology, water viscosity and carboxylation efficiency with temperature may be responsible for the observed positive correlation between Δ and temperature. PMID:26579188

  18. Functional analysis of basic transcription element (BTE)-binding protein (BTEB) 3 and BTEB4, a novel Sp1-like protein, reveals a subfamily of transcriptional repressors for the BTE site of the cytochrome P4501A1 gene promoter.

    PubMed Central

    Kaczynski, Joanna A; Conley, Abigail A; Fernandez Zapico, Martin; Delgado, Sharon M; Zhang, Jin-San; Urrutia, Raul

    2002-01-01

    The Sp1-like family of transcription factors is emerging as an integral part of the cellular machinery involved in the control of gene expression. Members of this family of proteins contain three highly homologous C-terminal zinc-finger motifs that bind GC-rich sequences found in the promoters of a diverse number of genes, such as the basic transcription element (BTE) in the promoter of the carcinogen-metabolizing cytochrome P4501A1 (CYP1A1) gene. In the present study, we report the molecular and functional characterization of BTE-binding protein (BTEB) 4, a novel ubiquitously expressed member of the Sp1-like proteins family. This protein represents a new homologue of BTEB1, originally described as a regulator of the BTE site in the CYP1A1 gene promoter. Similarly to the recently described BTEB3, we demonstrate that the N-terminal region of BTEB4 directly represses transcription and binds the co-repressor mSin3A. In addition, we show that the C-terminal zinc-finger domain of BTEB4 binds specifically the BTE site of the CYP1A1 promoter, similar to BTEB1 and BTEB3. Also, we show that both BTEB3 and BTEB4 repress the CYP1A1 gene promoter via the BTE site in HepG2 and BxPC3 cells. Thus the identification of this protein expands the repertoire of BTEB-like members of the Sp1-like protein family involved in transcriptional repression. Furthermore, our results demonstrate that the BTEB subfamily can repress the CYP1A1 gene promoter via the BTE site. PMID:12036432

  19. β-elemene inhibited expression of DNA methyltransferase 1 through activation of ERK1/2 and AMPKα signalling pathways in human lung cancer cells: the role of Sp1

    PubMed Central

    Zhao, ShunYu; Wu, Jingjing; Zheng, Fang; Tang, Qing; Yang, LiJun; Li, Liuning; Wu, WanYin; Hann, Swei Sunny

    2015-01-01

    β-elemene, a compound derived from Rhizoma zedoariae, is a promising new plant-derived drug with broad-spectrum anticancer activity. However, the underlying mechanism by which this agent inhibits human lung cancer cell growth has not been well elucidated. In this study, we showed that β-elemene inhibits human non-small cell lung carcinoma (NSCLC) cell growth, and increased phosphorylation of ERK1/2, Akt and AMPKα. Moreover, β-elemene inhibited expression of DNA methyltransferase 1 (DNMT1), which was not observed in the presence of the specific inhibitors of ERK (PD98059) or AMPK (compound C). Overexpression of DNMT1 reversed the effect of β-elemene on cell growth. Interestingly, metformin not only reversed the effect of β-elemene on phosphorylation of Akt but also strengthened the β-elemene-reduced DNMT1. In addition, β-elemene suppressed Sp1 protein expression, which was eliminated by either ERK1/2 or AMPK inhibitor. Conversely, overexpression of Sp1 antagonized the effect of β-elemene on DNMT1 protein expression and cell growth. Taken together, our results show that β-elemene inhibits NSCLC cell growth viaERK1/2- and AMPKα-mediated inhibition of transcription factor Sp1, followed by reduction in DNMT1 protein expression. Metformin augments the effect of β-elemene by blockade of Akt signalling and additively inhibition of DNMT1 protein expression. The reciprocal ERK1/2 and AMPKα signalling pathways contribute to the overall responses of β-elemene. This study reveals a potential novel mechanism by which β-elemene inhibits growth of NSCLC cells. PMID:25598321

  20. Vascular endothelial growth factor plays a critical role in the formation of the pre-metastatic niche via prostaglandin E2.

    PubMed

    Liu, Shili; Jiang, Man; Zhao, Qiang; Li, Shancheng; Peng, Yanping; Zhang, Pengfei; Han, Mingyong

    2014-12-01

    Factors secreted by primary tumors can alter the microenvironment at distant organ sites, generating pre-metastatic niches for subsequent metastatic cancer cell colonization. Breast cancer cells have a propensity to home preferentially to the lung, but the underlying molecular mechanisms whereby primary breast carcinoma-derived factors affect the pre-metastatic lung environment before the arrival of the tumor cells are poorly understood. In this study, 4T1 mammary carcinoma cells were subcutaneously injected into the mammary glands of mice, resulting in the induction of inflammation, increased total vessel density and recruitment of bone marrow-derived cells (BMDCs) in pre-metastatic lungs. Subsequent examination revealed that the sites of inflammatory cell clusters in the lungs were tumor metastasis sites. Moreover, vascular endothelial growth factor (VEGF) induced prostaglandin E2 (PGE2) production in mouse pulmonary microvascular endothelial cells (MPVECs) and enhanced the adhesion of 4T1 cells. Treatment with the cyclooxygenase-2 inhibitor celecoxib significantly reduced 4T1 cell adhesion to MPVECs, and also reduced cancer metastasis and the inflammatory response. These results suggest that VEGF may be an underlying carcinoma-derived factor responsible for formation of the pre-metastatic niche in the lung of 4T1 cell-bearing mice. This study, therefore, demonstrated that primary tumors can alter the lung microenvironment during the pre-metastatic phase by triggering an inflammatory response and PGE2 production. Primary tumor-derived VEGF might thus be a crucial factor responsible for the formation of the pre-metastatic niche by inducing PGE2 production. PMID:25333935

  1. The Play of Psychotherapy

    ERIC Educational Resources Information Center

    Marks-Tarlow, Terry

    2012-01-01

    The author reviews the role of play within psychotherapy. She does not discuss the formal play therapy especially popular for young children, nor play from the Jungian perspective that encourages the use of the sand tray with adults. Instead, she focuses on the informal use of play during psychotherapy as it is orchestrated intuitively. Because…

  2. Two people playing together: some thoughts on play, playing, and playfulness in psychoanalytic work.

    PubMed

    Vliegen, Nicole

    2009-01-01

    Children's play and the playfulness of adolescents and adults are important indicators of personal growth and development. When a child is not able to play, or an adolescent/adult is not able to be playful with thoughts and ideas, psychotherapy can help to find a more playful and creative stance. Elaborating Winnicott's (1968, p. 591) statement that "psychotherapy has to do with two people playing together," three perspectives on play in psychotherapy are discussed. In the first point of view, the child gets in touch with and can work through aspects of his or her inner world, while playing in the presence of the therapist. The power of play is then rooted in the playful communication with the self In a second perspective, in play the child is communicating aspects of his or her inner world to the therapist as a significant other. In a third view, in "playing together" child and therapist are coconstructing new meanings. These three perspectives on play are valid at different moments of a therapy process or for different children, depending on the complex vicissitudes of the child's constitution, life experiences, development, and psychic structure. Concerning these three perspectives, a parallel can be drawn between the therapist's attitude toward the child's play and the way the therapist responds to the verbal play of an adolescent or adult. We illustrate this with the case of Jacob, a late adolescent hardly able to play with ideas. PMID:20578437

  3. Child's Play: Therapist's Narrative

    PubMed Central

    Reddy, Rajakumari P.; Hirisave, Uma

    2014-01-01

    Play has been recognized as an essential component to children's healthy development. Schools of play therapy differ philosophically and technically, but they all embrace the therapeutic and developmental properties of play. This case report is an illustration of how a 6-year-old child with emotional disorder was facilitated to express concerns in child-centered play therapy. The paper discusses the therapist's narration of the child's play. PMID:24860228

  4. CHI3L1 plays a role in cancer through enhanced production of pro-inflammatory/pro-tumorigenic and angiogenic factors.

    PubMed

    Libreros, Stephania; Garcia-Areas, Ramon; Iragavarapu-Charyulu, Vijaya

    2013-12-01

    Elevated serum levels of a glycoprotein known as chitinase-3-like protein 1 (CHI3L1) have been correlated with poor prognosis and shorter survival of patients with cancer and inflammatory diseases. The biological and physiological functions of CHI3L1 in cancer have not yet been completely elucidated. In this review, we describe the role of CHI3L1 in inducing pro-inflammatory/pro-tumorigenic and angiogenic factors that could promote tumor growth and metastasis. PMID:24222276

  5. Increased Growth Factors Play a Role in Wound Healing Promoted by Noninvasive Oxygen-Ozone Therapy in Diabetic Patients with Foot Ulcers

    PubMed Central

    Zhang, Jing; Guan, Meiping; Xie, Cuihua; Luo, Xiangrong; Zhang, Qian; Xue, Yaoming

    2014-01-01

    Management of diabetic foot ulcers (DFUs) is a great challenge for clinicians. Although the oxygen-ozone treatment improves the diabetic outcome, there are few clinical trials to verify the efficacy and illuminate the underlying mechanisms of oxygen-ozone treatment on DFUs. In the present study, a total of 50 type 2 diabetic patients complicated with DFUs, Wagner stage 2~4, were randomized into control group treated by standard therapy only and ozone group treated by standard therapy plus oxygen-ozone treatment. The therapeutic effects were graded into 4 levels from grade 0 (no change) to grade 3 (wound healing). The wound sizes were measured at baseline and day 20, respectively. Tissue biopsies were performed at baseline and day 11. The expressions of vascular endothelial growth factor (VEGF), transforming growth factor-β (TGF-β), and platelet-derived growth factor (PDGF) proteins in the pathologic specimens were determined by immunohistochemical examinations. The effective rate of ozone group was significantly higher than that of control group (92% versus 64%, P < 0.05). The wound size reduction was significantly more in ozone group than in control group (P < 0.001). After treatment, the expressions of VEGF, TGF-β, and PDGF proteins at day 11 were significantly higher in ozone group than in control group. Ozone therapy promotes the wound healing of DFUs via potential induction of VEGF, TGF-β, and PDGF at early stage of the treatment. (Clinical trial registry number is ChiCTR-TRC-14004415). PMID:25089169

  6. 12-O-tetradecanoyl-phorbol-13-acetate down-regulates the Huntingtin promoter at Sp1 sites.

    PubMed

    Coles, R; Birdsall, M; Wyttenbach, A; Rubinsztein, D C

    2000-09-28

    We have studied the effects of the phorbol ester, 12-O-tetradecanoyl-phorbol-13-acetate (TPA) on Huntington's disease (HD) gene transcription in neuronal and non-neuronal cell lines, to investigate pathways regulating HD gene expression. TPA reduced transcription from the HD gene promoter in SK-N-SH (neuroblastoma) and HeLa cells but not in JEG3 (choriocarcinoma) cells. In SK-N-SH cells, the responsible cis-acting promoter sequences comprise the tandemly duplicated Sp1 sites in the region from -213 to -174, relative to the translation start site. The TPA-down-regulating region in HeLa cells was mapped to the sequence from -141 to -126. In conclusion, this demonstrates that HD gene transcription can be down-regulated in vitro in a cell-specific manner. PMID:11043541

  7. Play: early and eternal.

    PubMed Central

    Mears, C E; Harlow, H F

    1975-01-01

    A systematic 12-week investigation of development of play behavior was conducted with eight socially reared rhesus monkey infants. A new, basic and primary play form termed self-motion play or peragration was identified and examined. This behavior follows a human model which includes a wide range of pleasurable activities involving motion of the body through space, e.g., rocking, swinging, running, leaping, and water or snow skiing. It can be argued that self-motion play is the initial primate play form and because of its persistence constitutes a reinforcing agent for maintaining many complex patterns and even pastimes. Monkey self-motion play in the present study was divided into five separate patterns in order to compare the relative importance of social and individual peragration play, the role of apparatus and the overall developmental relationships between the different individual and social self-motion play patterns. The data showed that from 90 to 180 days of age self-motion play was independent of other forms of play, that individual self-motion play appeared earlier and with significantly greater increases in frequency than did social self-motion play, and that apparatus was a necessary component for significant increases in social self-motion play. Other findings were that self-motion play existed independent of locomotion and, though initiated by exploration, was separate from it. Therapeutic implications of self-motion play were discussed. Images PMID:1057178

  8. Ubiquitin (UbC) expression in muscle cells is increased by glucocorticoids through a mechanism involving Sp1 and MEK1.

    PubMed

    Marinovic, Anne C; Zheng, Bin; Mitch, William E; Price, S Russ

    2002-05-10

    The muscle protein catabolism present in rats with insulin-dependent diabetes and other catabolic conditions is generally associated with increased glucocorticoid production and mRNAs encoding components of the ubiquitin-proteasome system. The mechanisms that increase ubiquitin (UbC) expression have not been identified. We studied the regulation of UbC expression in L6 muscle cells because dexamethasone stimulates the transcription of this gene and others encoding components of the ubiquitin-proteasome pathway. Results of in vivo genomic DNA footprinting experiments indicate that a protein(s) binds to Sp1 sites approximately 50 bp upstream from the UbC transcription start site; dexamethasone changes the methylation pattern at these sites. Sp1 binds to DNA probes corresponding to the rat or human UbC promoter, and treating cells with dexamethasone increases this binding. Deletion and mutation analyses of the rat and human UbC promoters are consistent with an important role of Sp1 in UbC induction by glucocorticoids. Dexamethasone-induced ubiquitin expression is blocked by mithramycin, an inhibitor of Sp1 binding. UO126, a pharmacologic inhibitor of MEK1, also blocks UbC transcriptional activation by dexamethasone; L6 cells transfected to express constitutively active MEK1 exhibit increased UbC promoter activity. Thus, glucocorticoids increase UbC expression in muscle cells by a novel transcriptional mechanism involving Sp1 and MEK1. PMID:11872750

  9. Evidence that the pre-mRNA splicing factor Clf1p plays a role in DNA replication in Saccharomyces cerevisiae.

    PubMed Central

    Zhu, Wenge; Rainville, Irene R; Ding, Min; Bolus, Margaret; Heintz, Nicholas H; Pederson, David S

    2002-01-01

    Clf1p is an essential, highly conserved protein in S. cerevisiae that has been implicated in pre-mRNA splicing. Clf1p's ortholog in Drosophila, Crn, is required for normal cell proliferation. Cells depleted of Clf1p arrest primarily with large buds, a single nucleus, a 2C DNA content, and a short, intact mitotic spindle. We isolated temperature-sensitive clf1 mutants that exhibit similar mitotic defects when released to the restrictive temperature from an early S-phase block. While these mutants also accumulate unspliced pre-mRNA at the restrictive temperature, the mitotic arrest does not appear to result from a failure to splice tubulin pre-mRNA. Moreover, the same mutants exhibit a delayed entry into S phase when released to the restrictive temperature from a G1 phase block. This delay could not be suppressed by disruption of the S-phase CDK inhibitor SIC1, suggesting that Clf1p is involved in DNA replication. Consistent with this possibility, we find that Clf1p (but not the mutant clf1p) interacts with the DNA replication initiation protein Orc2p in two-hybrid and co-immunoprecipitation assays, that Clf1p preferentially associates with origins of DNA replication, and that this association is Orc2p dependent. These observations suggest that Clf1p plays a direct role in the initiation of DNA replication. PMID:11973290

  10. Egr1 protein acts downstream of estrogen-leukemia inhibitory factor (LIF)-STAT3 pathway and plays a role during implantation through targeting Wnt4.

    PubMed

    Liang, Xiao-Huan; Deng, Wen-Bo; Li, Ming; Zhao, Zhen-Ao; Wang, Tong-Song; Feng, Xu-Hui; Cao, Yu-Jing; Duan, En-Kui; Yang, Zeng-Ming

    2014-08-22

    Embryo implantation is a highly synchronized process between an activated blastocyst and a receptive uterus. Successful implantation relies on the dynamic interplay of estrogen and progesterone, but the key mediators underlying embryo implantation are not fully understood. Here we show that transcription factor early growth response 1 (Egr1) is regulated by estrogen as a downstream target through leukemia inhibitory factor (LIF) signal transducer and activator of transcription 3 (STAT3) pathway in mouse uterus. Egr1 is localized in the subluminal stromal cells surrounding the implanting embryo on day 5 of pregnancy. Estrogen rapidly, markedly, and transiently enhances Egr1 expression in uterine stromal cells, which fails in estrogen receptor α knock-out mouse uteri. STAT3 is phosphorylated by LIF and subsequently recruited on Egr1 promoter to induce its expression. Our results of Egr1 expression under induced decidualization in vivo and in vitro show that Egr1 is rapidly induced after deciduogenic stimulus. Egr1 knockdown can inhibit in vitro decidualization of cultured uterine stromal cells. Chromatin immunoprecipitation data show that Egr1 is recruited to the promoter of wingless-related murine mammary tumor virus integration site 4 (Wnt4). Collectively, our study presents for the first time that estrogen regulates Egr1 expression through LIF-STAT3 signaling pathway in mouse uterus, and Egr1 functions as a critical mediator of stromal cell decidualization by regulating Wnt4. PMID:25012664

  11. Learning through Role Play.

    ERIC Educational Resources Information Center

    Simmons, Sandra

    2001-01-01

    Explains how role playing can provide enriching experiences that develop children's literacy and numeracy skills. Lists key ingredients of good role playing and suggests ways to plan them and prepare space for them. (SK)

  12. Adlerian Play Therapy.

    ERIC Educational Resources Information Center

    Kottman, Terry; Warlick, Jayne

    1990-01-01

    Describes Adlerian method of play therapy. Claims Adlerian therapy represents an integration of the concepts and techniques of individual psychology into a method of using play to help troubled children. (Author/ABL)

  13. Role-Playing Mitosis.

    ERIC Educational Resources Information Center

    Wyn, Mark A.; Stegink, Steven J.

    2000-01-01

    Introduces a role playing activity that actively engages students in the learning process of mitosis. Students play either chromosomes carrying information, or cells in the cell membrane. (Contains 11 references.) (Author/YDS)

  14. Increased Expression of Colonic Wnt9A through Sp1-mediated Transcriptional Effects involving Arylsulfatase B, Chondroitin 4-Sulfate, and Galectin-3

    PubMed Central

    Bhattacharyya, Sumit; Feferman, Leo; Tobacman, Joanne K.

    2014-01-01

    In cultured human colonic epithelial cells and mouse colonic tissue, exposure to the common food additive carrageenan leads to inflammation, activation of Wnt signaling, increased Wnt9A expression, and decline in the activity of the enzyme arylsulfatase B (ARSB; N-acetylgalactosamine-4-sulfatase). In this study, the novel transcriptional mechanism by which carrageenan and decline in ARSB increase Wnt9A expression in NCM460 and HT-29 human colonic epithelial cells and in mouse colon is presented. Increased expression of Wnt9A has been associated with multiple malignancies, including colon carcinoma, and with ectodermal and mesoendodermal morphogenesis. When ARSB activity was reduced by siRNA or by exposure to carrageenan (1 μg/ml for 24 h), degradation of chondroitin 4-sulfate (C4S) was inhibited, leading to accumulation of more highly sulfated C4S, which binds less galectin-3, a β-galactoside-binding protein. Nuclear galectin-3 increased and mediated increased binding of Sp1 to the Sp1 consensus sequence in the Wnt9A promoter, shown by oligonucleotide-binding assay and by chromatin immunoprecipitation assay. When galectin-3 was silenced, the increases in Sp1 binding to the Wnt9A promoter and in Wnt9A expression, which followed carrageenan or ARSB silencing, were inhibited. Mithramycin A, a specific inhibitor of Sp1 oligonucleotide binding, and Sp1 siRNA blocked the carrageenan- and ARSB siRNA-induced increases in Wnt9A expression. These studies reveal how carrageenan exposure can lead to transcriptional events in colonic epithelial cells through decline in arylsulfatase B activity, with subsequent impact on C4S, galectin-3, Sp1, and Wnt9A and can exert significant effects on Wnt-initiated signaling and related vital cell processes. PMID:24778176

  15. Expression of microRNA-195 is transactivated by Sp1 but inhibited by histone deacetylase 3 in hepatocellular carcinoma cells.

    PubMed

    Zhao, Na; Li, Siwen; Wang, Ruizhi; Xiao, Manhuan; Meng, Yu; Zeng, Chunxian; Fang, Jian-Hong; Yang, Jine; Zhuang, Shi-Mei

    2016-07-01

    MiR-195 expression is frequently reduced in various cancers, but its underlying mechanisms remain unknown. To explore whether abnormal transcription contributed to miR-195 downregulation in hepatocellular carcinoma (HCC), we characterized the -2165-bp site upstream of mature miR-195 as transcription start site and the -2.4 to -2.0-kb fragment as the promoter of miR-195 gene. Subsequent investigation showed that deletion of the predicted Sp1 binding site decreased the miR-195 promoter activity; Sp1 silencing significantly reduced the miR-195 promoter activity and the endogenous miR-195 level; Sp1 directly interacted with the miR-195 promoter in vitro and in vivo. These data suggest Sp1 as a transactivator for miR-195 transcription. Interestingly, miR-195 expression was also subjected to epigenetic regulation. Histone deacetylase 3 (HDAC3) could anchor to the miR-195 promoter via interacting with Sp1 and consequently repress the Sp1-mediated miR-195 transactivation by deacetylating histone in HCC cells. Consistently, substantial increase of HDAC3 protein was detected in human HCC tissues and HDAC3 upregulation was significantly correlated with miR-195 downregulation, suggesting that HDAC3 elevation may represent an important cause for miR-195 reduction in HCC. Our findings uncover the mechanisms underlying the transcriptional regulation and expression deregulation of miR-195 in HCC cells and provide new insight into microRNA biogenesis in cancer cells. PMID:27179445

  16. Ancient Properties of Spider Silks Revealed by the Complete Gene Sequence of the Prey-Wrapping Silk Protein (AcSp1)

    PubMed Central

    Ayoub, Nadia A.; Garb, Jessica E.; Kuelbs, Amanda; Hayashi, Cheryl Y.

    2013-01-01

    Spider silk fibers have impressive mechanical properties and are primarily composed of highly repetitive structural proteins (termed spidroins) encoded by a single gene family. Most characterized spidroin genes are incompletely known because of their extreme size (typically >9 kb) and repetitiveness, limiting understanding of the evolutionary processes that gave rise to their unusual gene architectures. The only complete spidroin genes characterized thus far form the dragline in the Western black widow, Latrodectus hesperus. Here, we describe the first complete gene sequence encoding the aciniform spidroin AcSp1, the primary component of spider prey-wrapping fibers. L. hesperus AcSp1 contains a single enormous (∼19 kb) exon. The AcSp1 repeat sequence is exceptionally conserved between two widow species (∼94% identity) and between widows and distantly related orb-weavers (∼30% identity), consistent with a history of strong purifying selection on its amino acid sequence. Furthermore, the 16 repeats (each 371–375 amino acids long) found in black widow AcSp1 are, on average, >99% identical at the nucleotide level. A combination of stabilizing selection on amino acid sequence, selection on silent sites, and intragenic recombination likely explains the extreme homogenization of AcSp1 repeats. In addition, phylogenetic analyses of spidroin paralogs support a gene duplication event occurring concomitantly with specialization of the aciniform glands and the tubuliform glands, which synthesize egg-case silk. With repeats that are dramatically different in length and amino acid composition from dragline spidroins, our L. hesperus AcSp1 expands the knowledge base for developing silk-based biomimetic technologies. PMID:23155003

  17. Changes in spawning time led to the speciation of the broadcast spawning corals Acropora digitifera and the cryptic species Acropora sp. 1 with similar gamete recognition systems

    NASA Astrophysics Data System (ADS)

    Ohki, Shun; Kowalski, Radoslaw K.; Kitanobo, Seiya; Morita, Masaya

    2015-12-01

    Multi-species spawning is reported in the coral genus Acropora, but hybridization in nature rarely occurs because of the incompatibility of gametes and the timing of spawning. However, the evolutionary relationships between gamete compatibility and spawning time are obscure. Investigations of gamete compatibility in sister species that spawn at different times may provide clues to answering this question. Acropora sp. 1 has been defined as a cryptic species of Acropora digitifera, and they are morphologically similar, but spawn in different months, suggesting that they are either a cryptic species or a different species. We examined the morphology and conducted crossing experiments using cryopreserved sperm. The morphologies (branch length, branch width, and outer diameter of axial corallites) of A. digitifera and Acropora sp. 1 differed significantly. A phylogenetic tree of partial Pax- C nuclear sequences from A. digitifera and Acropora sp. 1 shows that they are monophyletic and closely related genetically, based on F ST values and P-distance. These results imply that these two species originated recently from a common ancestor. In addition, cryopreserved sperm from both A. digitifera and Acropora sp. 1 showed bidirectional inter-crossing (cryopreserved sperm of A. digitifera and eggs of Acropora sp. 1 from Sesoko: 32.1 ± 6.7 %, control-conspecific cryopreserved sperm and eggs: 46.1 ± 10.6 %; cryopreserved sperm of Acropora sp. 1 and eggs of A. digitifera from Oku: 63.3 ± 16.6 %, control: 83.6 ± 6.0 %). The results suggest that the gametes of these two species are compatible and that the pre-zygotic isolation mechanism is relaxed because their gametes do not interact. Overall, these two species should be classified as distinct species, and changes in spawning time are related to speciation in a similar gamete recognition system.

  18. Play, Policy & Practice.

    ERIC Educational Resources Information Center

    Klugman, Edgar, Ed.

    In 1992, the U.S.-Israel Binational Science Foundation (BSF), in conjunction with Wheelock College (Boston), sponsored its second workshop on children's play, entitled "Play and Cognitive Ability: The Cultural Context." This volume reflects the presentations and discussions held at the workshop, offering perspectives on children's play that, taken…

  19. The Pedagogy of Play

    ERIC Educational Resources Information Center

    Giesbrecht, Sheila

    2012-01-01

    Play is important. Environmental educators Sobel and Louv write about the relationship between children and outside play and suggest that early transcendental experiences within nature allow children to develop empathetic orientations towards the natural world. Children who play out-of-doors develop an appreciation for the environment and…

  20. Play Is the Way

    ERIC Educational Resources Information Center

    Gross, Steve; Sanderson, Rebecca Cornelli

    2012-01-01

    Historically, play has been viewed as a frivolous break from important endeavors like working and learning when, in fact, a child's ability to fully and freely engage in play is essential to their learning, productivity, and overall development. A natural drive to play is universal across all young mammals. Children from every society on earth…

  1. Stromal Cell-Derived Factor-1α Plays a Crucial Role Based on Neuroprotective Role in Neonatal Brain Injury in Rats

    PubMed Central

    Mori, Miki; Matsubara, Keiichi; Matsubara, Yuko; Uchikura, Yuka; Hashimoto, Hisashi; Fujioka, Toru; Matsumoto, Takashi

    2015-01-01

    Owing to progress in perinatal medicine, the survival of preterm newborns has markedly increased. However, the incidence of cerebral palsy has risen in association with increased preterm birth. Cerebral palsy is largely caused by cerebral hypoxic ischemia (HI), for which there are no effective medical treatments. We evaluated the effects of stromal cell-derived factor-1α (SDF-1α) on neonatal brain damage in rats. Left common carotid (LCC) arteries of seven-day-old Wistar rat pups were ligated, and animals were exposed to hypoxic gas to cause cerebral HI. Behavioral tests revealed that the memory and spatial perception abilities were disturbed in HI animals, and that SDF-1α treatment improved these cognitive functions. Motor coordination was also impaired after HI but was unimproved by SDF-1α treatment. SDF-1α reduced intracranial inflammation and induced cerebral remyelination, as indicated by the immunohistochemistry results. These data suggest that SDF-1α specifically influences spatial perception abilities in neonatal HI encephalopathy. PMID:26251894

  2. Store-operated Ca2+ Entry-associated Regulatory factor (SARAF) Plays an Important Role in the Regulation of Arachidonate-regulated Ca2+ (ARC) Channels.

    PubMed

    Albarran, Letizia; Lopez, Jose J; Woodard, Geoffrey E; Salido, Gines M; Rosado, Juan A

    2016-03-25

    The store-operated Ca(2+)entry-associated regulatory factor (SARAF) has recently been identified as a STIM1 regulatory protein that facilitates slow Ca(2+)-dependent inactivation of store-operated Ca(2+)entry (SOCE). Both the store-operated channels and the store-independent arachidonate-regulated Ca(2+)(ARC) channels are regulated by STIM1. In the present study, we show that, in addition to its location in the endoplasmic reticulum, SARAF is constitutively expressed in the plasma membrane, where it can interact with plasma membrane (PM)-resident ARC forming subunits in the neuroblastoma cell line SH-SY5Y. Using siRNA-based and overexpression approaches we report that SARAF negatively regulates store-independent Ca(2+)entry via the ARC channels. Arachidonic acid (AA) increases the association of PM-resident SARAF with Orai1. Finally, our results indicate that SARAF modulates the ability of AA to promote cell survival in neuroblastoma cells. In addition to revealing new insight into the biology of ARC channels in neuroblastoma cells, these findings provide evidence for an unprecedented location of SARAF in the plasma membrane. PMID:26817842

  3. Major Factors Affecting Incidence of Childhood Thyroid Cancer in Belarus after the Chernobyl Accident: Do Nitrates in Drinking Water Play a Role?

    PubMed Central

    Drozd, Valentina M.; Saenko, Vladimir A.; Brenner, Alina V.; Drozdovitch, Vladimir; Pashkevich, Vasilii I.; Kudelsky, Anatoliy V.; Demidchik, Yuri E.; Branovan, Igor; Shiglik, Nikolay; Rogounovitch, Tatiana I.; Yamashita, Shunichi; Biko, Johannes; Reiners, Christoph

    2015-01-01

    One of the major health consequences of the Chernobyl Nuclear Power Plant accident in 1986 was a dramatic increase in incidence of thyroid cancer among those who were aged less than 18 years at the time of the accident. This increase has been directly linked in several analytic epidemiological studies to iodine-131 (131I) thyroid doses received from the accident. However, there remains limited understanding of factors that modify the 131I-related risk. Focusing on post-Chernobyl pediatric thyroid cancer in Belarus, we reviewed evidence of the effects of radiation, thyroid screening, and iodine deficiency on regional differences in incidence rates of thyroid cancer. We also reviewed current evidence on content of nitrate in groundwater and thyroid cancer risk drawing attention to high levels of nitrates in open well water in several contaminated regions of Belarus, i.e. Gomel and Brest, related to the usage of nitrogen fertilizers. In this hypothesis generating study, based on ecological data and biological plausibility, we suggest that nitrate pollution may modify the radiation-related risk of thyroid cancer contributing to regional differences in rates of pediatric thyroid cancer in Belarus. Analytic epidemiological studies designed to evaluate joint effect of nitrate content in groundwater and radiation present a promising avenue of research and may provide useful insights into etiology of thyroid cancer. PMID:26397978

  4. The Stress-Induced Soybean NAC Transcription Factor GmNAC81 Plays a Positive Role in Developmentally Programmed Leaf Senescence.

    PubMed

    Pimenta, Maiana Reis; Silva, Priscila Alves; Mendes, Giselle Camargo; Alves, Janaína Roberta; Caetano, Hanna Durso Neves; Machado, Joao Paulo Batista; Brustolini, Otavio José Bernardes; Carpinetti, Paola Avelar; Melo, Bruno Paes; Silva, José Cleydson Ferreira; Rosado, Gustavo Leão; Ferreira, Márcia Flores Silva; Dal-Bianco, Maximillir; Picoli, Edgard Augusto de Toledo; Aragao, Francisco José Lima; Ramos, Humberto Josué Oliveira; Fontes, Elizabeth Pacheco Batista

    2016-05-01

    The onset of leaf senescence is a highly regulated developmental change that is controlled by both genetics and the environment. Senescence is triggered by massive transcriptional reprogramming, but functional information about its underlying regulatory mechanisms is limited. In the current investigation, we performed a functional analysis of the soybean (Glycine max) osmotic stress- and endoplasmic reticulum (ER) stress-induced NAC transcription factor GmNAC81 during natural leaf senescence using overexpression studies and reverse genetics. GmNAC81-overexpressing lines displayed accelerated flowering and leaf senescence but otherwise developed normally. The precocious leaf senescence of GmNAC81-overexpressing lines was associated with greater Chl loss, faster photosynthetic decay and higher expression of hydrolytic enzyme-encoding GmNAC81 target genes, including the vacuolar processing enzyme (VPE), an executioner of vacuole-triggered programmed cell death (PCD). Conversely, virus-induced gene silencing-mediated silencing of GmNAC81 delayed leaf senescence and was associated with reductions in Chl loss, lipid peroxidation and the expression of GmNAC81 direct targets. Promoter-reporter studies revealed that the expression pattern of GmNAC81 was associated with senescence in soybean leaves. Our data indicate that GmNAC81 is a positive regulator of age-dependent senescence and may integrate osmotic stress- and ER stress-induced PCD responses with natural leaf senescence through the GmNAC81/VPE regulatory circuit. PMID:27016095

  5. A stress-associated NAC transcription factor (SlNAC35) from tomato plays a positive role in biotic and abiotic stresses.

    PubMed

    Wang, Guodong; Zhang, Song; Ma, Xiaocui; Wang, Yong; Kong, Fanying; Meng, Qingwei

    2016-09-01

    The NAC transcription factor family participates in responses to various kinds of environmental stimuli in plants. Responses of NAC genes to abiotic stresses have been widely studied, but their functions in response to biotic stress are little reported in plants, especially in crops. In the present study, we examined the functions of a novel tomato (Solanum lycopersicum) NAC protein (SlNAC35) in abiotic and biotic stress resistance by using transgenic tobacco. Expression analysis found that SlNAC35 expression was induced by drought stress, salt stress, bacterial pathogen, and signaling molecules, suggesting its involvement in plant responses to biotic and abiotic stimuli. Moreover, transgenic lines exhibited a greater number of lateral roots and longer root length compared with Vec lines (empty vector lines) after drought and salt treatment. These results indicate that overexpression of SlNAC35 promoted root growth and development under drought and salt stresses. Higher expressions of NtARF1, NtARF2 and NtARF8 were observed under drought and salt stresses in transgenic lines, suggesting that overexpression of SlNAC35 promoted growth and development of roots in transgenic lines possibly by involving auxin signaling and by regulating NtARF expression. In addition, SlNAC35 overexpression improved resistance to bacterial pathogen in transgenic tobacco, and reactive oxygen species may be in the upstream of salicylic acid (SA) signaling in transgenic tobacco during defense response. PMID:26991441

  6. The Nucleus-Encoded trans-Acting Factor MCA1 Plays a Critical Role in the Regulation of Cytochrome f Synthesis in Chlamydomonas Chloroplasts[W

    PubMed Central

    Boulouis, Alix; Raynaud, Cécile; Bujaldon, Sandrine; Aznar, Aude; Wollman, Francis-André; Choquet, Yves

    2011-01-01

    Organelle gene expression is characterized by nucleus-encoded trans-acting factors that control posttranscriptional steps in a gene-specific manner. As a typical example, in Chlamydomonas reinhardtii, expression of the chloroplast petA gene encoding cytochrome f, a major subunit of the cytochrome b6f complex, depends on MCA1 and TCA1, required for the accumulation and translation of the petA mRNA. Here, we show that these two proteins associate in high molecular mass complexes that also contain the petA mRNA. We demonstrate that MCA1 is degraded upon interaction with unassembled cytochrome f that transiently accumulates during the biogenesis of the cytochrome b6f complex. Strikingly, this interaction relies on the very same residues that form the repressor motif involved in the Control by Epistasy of cytochrome f Synthesis (CES), a negative feedback mechanism that downregulates cytochrome f synthesis when its assembly within the cytochrome b6f complex is compromised. Based on these new findings, we present a revised picture for the CES regulation of petA mRNA translation that involves proteolysis of the translation enhancer MCA1, triggered by its interaction with unassembled cytochrome f. PMID:21216944

  7. Autophagy Plays a Protective Role in Tumor Necrosis Factor-α-Induced Apoptosis of Bone Marrow-Derived Mesenchymal Stem Cells.

    PubMed

    Yang, Rui; Ouyang, Yi; Li, Weiping; Wang, Peng; Deng, Haiquan; Song, Bin; Hou, Jingyi; Chen, Zhong; Xie, Zhongyu; Liu, Zhenhua; Li, Jinteng; Cen, Shuizhong; Wu, Yanfeng; Shen, Huiyong

    2016-05-15

    Bone marrow-derived mesenchymal stem cells (BMSCs) are being broadly investigated for treating numerous inflammatory diseases. However, the low survival rate of BMSCs during the transplantation process has limited their application. Autophagy can maintain cellular homeostasis and protect cells against environmental stresses. Tumor necrosis factor-α (TNF-α) is an important inflammatory cytokine that can induce both autophagy and apoptosis of BMSCs. However, the actual role of autophagy in TNF-α-induced apoptosis of BMSCs remains poorly understood. In the current study, BMSCs were treated with TNF-α/cycloheximide (CHX), and cell death was examined by the Cell Counting Kit-8, Hoechst 33342 staining, and flow cytometric analysis as well as by the level of caspase-3 and caspase-8. Meanwhile, autophagic flux was examined by analyzing the level of microtubule-associated protein light chain 3 B (LC3B)-II and SQSTEM1/p62 and by examining the amount of green fluorescent protein-LC3B by fluorescence microscopy. Then, the cell death and autophagic flux of BMSCs were examined after pretreatment and cotreatment with 3-methyladenine (3-MA, autophagy inhibitor) or rapamycin (Rap, autophagy activator) together with TNF-α/CHX. Moreover, BMSCs pretreated with lentiviruses encoding short hairpin RNA of beclin-1 (BECN1) were treated with TNF-α/CHX, and then cell death and autophagic flux were detected. We showed that BMSCs treated with TNF-α/CHX presented dramatically elevated autophagic flux and cell death. Furthermore, we showed that 3-MA and shBECN1 treatment accelerated TNF-α/CHX-induced apoptosis, but that Rap treatment ameliorated cell death. Our results demonstrate that autophagy protects BMSCs against TNF-α-induced apoptosis. Enhancing the autophagy of BMSCs may elevate cellular survival in an inflammatory microenvironment. PMID:26985709

  8. 14-3-3 sigma and 14-3-3 zeta plays an opposite role in cell growth inhibition mediated by transforming growth factor-beta 1.

    PubMed

    Hong, Hye-Young; Jeon, Woo-Kwang; Bae, Eun-Jin; Kim, Shin-Tae; Lee, Ho-Jae; Kim, Seong-Jin; Kim, Byung-Chul

    2010-03-01

    The expression of 14-3-3 proteins is dysregulated in various types of cancer. This study was undertaken to investigate the effects of 14-3-3 zeta and 14-3-3 sigma on cell growth inhibition mediated by transforming growth factor-beta 1 (TGF-beta1). Mouse mammary epithelial cells (Eph4) that are transformed with oncogenic c-H-Ras (EpRas) and no longer sensitive to TGF-beta1-mediated growth inhibition displayed increased expression of 14-3-3 zeta and decreased expression of 14-3-3 sigma compared with parental Eph4 cells. Using small interfering RNA-mediated knockdown and overexpression of 14-3-3 sigma or 14-3-3 zeta, we showed that 14-3-3 sigma is required for TGF-beta1-mediated growth inhibition whereas 14-3-3 zeta negatively modulates this growth inhibitory response. Notably, overexpression of 14-3-3 zeta increased the level of Smad3 protein that is phosphorylated at linker regions and cannot mediate the TGF-beta1 growth inhibitory response. Consistent with this finding, mutation of the 14-3-3 zeta phosphorylation sites in Smad3 markedly reduced the 14-3-3 zeta-mediated inhibition of TGF-beta1-induced p15 promoter-reporter activity and cell cycle arrest, suggesting that these residues are critical targets of 14-3-3 zeta in the suppression of TGF-beta1-mediated growth. Taken together, our findings indicate that dysregulation of 14-3-3 sigma or 14-3-3 zeta contributes to TGF-beta1 resistance in cancer cells. PMID:20082218

  9. Fibroblast Growth Factor Receptor 3 activation plays a causative role in urothelial cancer pathogenesis in cooperation with Pten loss in mice

    PubMed Central

    Foth, Mona; Ahmad, Imran; van Rhijn, Bas W. G.; van der Kwast, Theodorus; Bergman, Andre M.; King, Louise; Ridgway, Rachel; Leung, Hing Y.; Fraser, Sioban; Sansom, Owen J.; Iwata, Tomoko

    2015-01-01

    Although somatic mutations and overexpression of the tyrosine kinase Fibroblast Growth Factor Receptor 3 (FGFR3) are strongly associated with bladder cancer, evidence for their functional involvement in the pathogenesis remains elusive. Previously we showed that activation of Fgfr3 alone is not sufficient to initiate urothelial tumourigenesis in mice. Here we hypothesise that cooperating mutations are required for Fgfr3-dependent tumourigenesis in the urothelium and analyse a mouse model in which an inhibitor of Pi3k-Akt signalling, Pten, is deleted in concert with Fgfr3 activation (UroIICreFgfr3+/K644EPtenflox/flox). Two main phonotypical characteristics observed in the urothelium were increased urothelial thickness and abnormal cellular histopathology, including vacuolisation, condensed cellular appearance, enlargement of cells and nuclei, and loss of polarity. These changes were not observed when either mutation was present individually. Expression patterns of known urothelial proteins indicated the abnormal cellular differentiation. Furthermore, quantitative analysis showed that Fgfr3 and Pten mutations cooperatively caused cellular enlargement, while Pten contributed to an increased cell proliferation. Finally, FGFR3 overexpression was analysed along the level of phosphorylated mTOR in sixty-six T1 urothelial tumours in tissue microarray, which supported the occurrence of functional association of these two signalling pathways in urothelial pathogenesis. Taken together, this study provides evidence supporting a functional role of FGFR3 in the process of pathogenesis in urothelial neoplasm. Given the wide availability of inhibitors specific to FGF signalling pathways, our model may open the avenue for FGFR3-targeted translation in urothelial disease. PMID:24519156

  10. Caloric Cost of Playing Golf

    ERIC Educational Resources Information Center

    Lampley, James H.; And Others

    1977-01-01

    Women who play golf at the same rate of speed as men will use energy at a higher rate, but the rapidity with which the course is completed, which is dependent on the number of members of the golfing party, is a factor in the caloric expenditure of both sexes. (JD)

  11. African oil plays

    SciTech Connect

    Clifford, A.J. )

    1989-09-01

    The vast continent of Africa hosts over eight sedimentary basins, covering approximately half its total area. Of these basins, only 82% have entered a mature exploration phase, 9% have had little or no exploration at all. Since oil was first discovered in Africa during the mid-1950s, old play concepts continue to bear fruit, for example in Egypt and Nigeria, while new play concepts promise to become more important, such as in Algeria, Angola, Chad, Egypt, Gabon, and Sudan. The most exciting developments of recent years in African oil exploration are: (1) the Gamba/Dentale play, onshore Gabon; (2) the Pinda play, offshore Angola; (3) the Lucula/Toca play, offshore Cabinda; (4) the Metlaoui play, offshore Libya/Tunisia; (5) the mid-Cretaceous sand play, Chad/Sudan; and (6) the TAG-I/F6 play, onshore Algeria. Examples of these plays are illustrated along with some of the more traditional oil plays. Where are the future oil plays likely to develop No doubt, the Saharan basins of Algeria and Libya will feature strongly, also the presalt of Equatorial West Africa, the Central African Rift System and, more speculatively, offshore Ethiopia and Namibia, and onshore Madagascar, Mozambique, and Tanzania.

  12. Small constrained SP1-7 analogs bind to a unique site and promote anti-allodynic effects following systemic injection in mice.

    PubMed

    Jonsson, A; Fransson, R; Haramaki, Y; Skogh, A; Brolin, E; Watanabe, H; Nordvall, G; Hallberg, M; Sandström, A; Nyberg, F

    2015-07-01

    Previous results have shown that the substance P (SP) N-terminal fragment SP1-7 may attenuate hyperalgesia and produce anti-allodynia in animals using various experimental models for neuropathic pain. The heptapeptide was found to induce its effects through binding to and activating specific sites apart from any known neurokinin or opioid receptor. Furthermore, we have applied a medicinal chemistry program to develop lead compounds mimicking the effect of SP1-7. The present study was designed to evaluate the pharmacological effect of these compounds using the mouse spared nerve injury (SNI) model of chronic neuropathic pain. Also, as no comprehensive screen with the aim to identify the SP1-7 target has yet been performed we screened our lead compound H-Phe-Phe-NH2 toward a panel of drug targets. The extensive target screen, including 111 targets, did not reveal any hit for the binding site among a number of known receptors or enzymes involved in pain modulation. Our animal studies confirmed that SP1-7, but also synthetic analogs thereof, possesses anti-allodynic effects in the mouse SNI model of neuropathic pain. One of the lead compounds, a constrained H-Phe-Phe-NH2 analog, was shown to exhibit a significant anti-allodynic effect. PMID:25862586

  13. [EFFICIENCY OF INTRODUCING CAROTENE PRODUCING STRAINS BACILLUS SP. 1.1 AND B. AMYLOLIQUEFACIENS UCM B-5113 INTO THE CHIKENS DIET].

    PubMed

    Nechypurenko, O O; Kharhota M A; Avdeeva, L V

    2015-01-01

    It was shown the efficiency of carotene producing strains Bacillus sp. 1.1 and B. amyloliquefaciens UCM B-5113 in the diet of chickens. Also it was detected the lowering of the quantitative content of bacterial genera Enterococcus, Staphylococcus, family Enterobacteriaceae in the gut after eating by chickens cross "H&N Brown Nick" fodder with strains Bacillus sp. 1.1 and B. amyloliquefaciens UCM B-5113 alone and in composition in quantities 1 x 10(10) CFU per 1 g of feed. On the 18th day after introduction of cultures Bacillus sp. 1.1, B. amyloliquefaciens UCM B-5113 and their composition in the diet of poultry we revealed the increasing of body weight by 21.6, 7.6 and 22.0%, respectively, comparesing to controls. Also due to Bacillus sp. 1.1 it was detected the restore of intestinal villous structures, tissues of spleen, liver and heart. We found the additive effect of the composition of the investigated strains of bacteria genus Bacillus to the chickens. PMID:26214892

  14. Draft Genome Sequence of “Candidatus Methanomethylophilus” sp. 1R26, Enriched from Bovine Rumen, a Methanogenic Archaeon Belonging to the Methanomassiliicoccales Order

    PubMed Central

    Højberg, Ole; Urich, Tim

    2016-01-01

    Here, we present the draft genome of “Candidatus Methanomethylophilus” sp. 1R26, a member of the newly described Methanomassiliicoccales order of Euryarcheaota. The enrichment culture was established from bovine rumen contents and produced methane from trimethylamine and methanol. The draft genome contains genes for methanogenesis from methylated compounds. PMID:26893425

  15. Gap junctional communication modulates gene transcription by altering the recruitment of Sp1 and Sp3 to connexin-response elements in osteoblast promoters

    NASA Technical Reports Server (NTRS)

    Stains, Joseph P.; Lecanda, Fernando; Screen, Joanne; Towler, Dwight A.; Civitelli, Roberto

    2003-01-01

    Loss-of-function mutations of gap junction proteins, connexins, represent a mechanism of disease in a variety of tissues. We have shown that recessive (gene deletion) or dominant (connexin45 overexpression) disruption of connexin43 function results in osteoblast dysfunction and abnormal expression of osteoblast genes, including down-regulation of osteocalcin transcription. To elucidate the molecular mechanisms of gap junction-sensitive transcriptional regulation, we systematically analyzed the rat osteocalcin promoter for sensitivity to gap junctional intercellular communication. We identified an Sp1/Sp3 containing complex that assembles on a minimal element in the -70 to -57 region of the osteocalcin promoter in a gap junction-dependent manner. This CT-rich connexin-response element is necessary and sufficient to confer gap junction sensitivity to the osteocalcin proximal promoter. Repression of osteocalcin transcription occurs as a result of displacement of the stimulatory Sp1 by the inhibitory Sp3 on the promoter when gap junctional communication is perturbed. Modulation of Sp1/Sp3 recruitment also occurs on the collagen Ialpha1 promoter and translates into gap junction-sensitive transcriptional control of collagen Ialpha1 gene expression. Thus, regulation of Sp1/Sp3 recruitment to the promoter may represent a potential general mechanism for transcriptional control of target genes by signals passing through gap junctions.

  16. Draft Genome Sequence of "Candidatus Methanomethylophilus" sp. 1R26, Enriched from Bovine Rumen, a Methanogenic Archaeon Belonging to the Methanomassiliicoccales Order.

    PubMed

    Noel, Samantha Joan; Højberg, Ole; Urich, Tim; Poulsen, Morten

    2016-01-01

    Here, we present the draft genome of "Candidatus Methanomethylophilus" sp. 1R26, a member of the newly described Methanomassiliicoccales order of Euryarcheaota. The enrichment culture was established from bovine rumen contents and produced methane from trimethylamine and methanol. The draft genome contains genes for methanogenesis from methylated compounds. PMID:26893425

  17. Play and Digital Media

    ERIC Educational Resources Information Center

    Johnson, James E.; Christie, James F.

    2009-01-01

    This article examines how play is affected by computers and digital toys. Research indicates that when computer software targeted at children is problem-solving oriented and open-ended, children tend to engage in creative play and interact with peers in a positive manner. On the other hand, drill-and-practice programs can be quite boring and limit…

  18. Let's Just Play

    ERIC Educational Resources Information Center

    Schmidt, Janet

    2003-01-01

    Children have a right to play. The idea is so simple it seems self-evident. But a stroll through any toy superstore, or any half-hour of so-called "children's" programming on commercial TV, makes it clear that violence, not play, dominates what's being sold. In this article, the author discusses how teachers and parents share the responsibility in…

  19. Family Play Therapy.

    ERIC Educational Resources Information Center

    Ariel, Shlomo

    This paper examines a case study of family play therapy in Israel. The unique contributions of play therapy are evaluated including the therapy's accessibility to young children, its richness and flexibility, its exposure of covert patterns, its wealth of therapeutic means, and its therapeutic economy. The systematization of the therapy attempts…

  20. Clinical Intuition at Play

    ERIC Educational Resources Information Center

    Marks-Tarlow, Terry

    2014-01-01

    A clinical psychologist and consulting psychotherapist discusses how elements of play, inherent in the intuition required in analysis, can provide a cornerstone for serious therapeutic work. She argues that many aspects of play--its key roles in human development, individual growth, and personal creativity, among others--can help therapists and…

  1. Intergenerational Learning through Play.

    ERIC Educational Resources Information Center

    Davis, Lindsay; Larkin, Elizabeth; Graves, Stephen B.

    2002-01-01

    Argues that shared play experiences are a good way to build mutually beneficial relationships among older and younger generations. Outlines why intergenerational play is important, focusing on its cognitive, social, physical, and emotional benefits for both older adults and young children. Describes toys, materials, and games conducive to positive…

  2. Poetry and Play.

    ERIC Educational Resources Information Center

    Law, Richard A.

    Philosophers and poets from classical times to the present have argued that playful and amiable discourse are conducive to teaching and learning. The play principle enhances reading and study and should be applied by teachers to benefit their students. Teachers should help their students see that it is fun to enliven the imagination with good…

  3. The Fear of Play

    ERIC Educational Resources Information Center

    Almon, Joan

    2009-01-01

    Real play--play that is initiated and directed by children and that bubbles up from within the child rather than being imposed by adults--has largely disappeared from the landscape of childhood in the United States. There are many reasons for this, such as the long hours spent in front of screens each day or in activities organized by adults. In…

  4. Return to Play

    ERIC Educational Resources Information Center

    Mangan, Marianne

    2013-01-01

    Call it physical activity, call it games, or call it play. Whatever its name, it's a place we all need to return to. In the physical education, recreation, and dance professions, we need to redesign programs to address the need for and want of play that is inherent in all of us.

  5. Role Playing and Skits

    ERIC Educational Resources Information Center

    Letwin, Robert, Ed.

    1975-01-01

    Explores non-scripted role playing, dialogue role playing, sociodrama, and skits as variations of simulation techniques. Provides step-by-step guidelines for conducting such sessions. Successful Meetings, Bill Communications, Inc., 1422 Chestnut Street, Philadelphia, Pa. 19102. Subscription Rates: yearly (US, Canada, Mexico) $14.00; elsewhere,…

  6. Play as Experience

    ERIC Educational Resources Information Center

    Henricks, Thomas S.

    2015-01-01

    The author investigates what he believes one of the more important aspects of play--the experience it generates in its participants. He considers the quality of this experience in relation to five ways of viewing play--as action, interaction, activity, disposition, and within a context. He treats broadly the different forms of affect, including…

  7. Playing with Autistic Children.

    ERIC Educational Resources Information Center

    Casner, Mary W.; Marks, Susan F.

    The paper looks at the development of a play group for autistic children with descriptions of the autistic population, the daily program, the program's philosophy, the play group model, and actual lessons. Children, who ranged in age from 5 to 9 years, often chose activities which were self-stimulating and/or repetitive. The daily program included…

  8. Television at Play.

    ERIC Educational Resources Information Center

    Reid, Leonard N.; Frazer, Charles F.

    1980-01-01

    Discusses children as television viewers capable of manipulating the co-viewing setting by interpreting, constructing, and carrying out planned lines of play in relation to television and its content. Examples illustrate program-oriented and free-form improvisational play situations. (JMF)

  9. Involvement of Sp1 and SREBP-1a in transcriptional activation of the LDL receptor gene by insulin and LH in cultured porcine granulosa-luteal cells.

    PubMed

    Sekar, Natesampillai; Veldhuis, Johannes D

    2004-07-01

    Luteinizing hormone (LH) and insulin stimulate transcriptional activity of the porcine low-density lipoprotein (LDL) receptor (LDLR) promoter supra-additively in primary cultures of granulosa-luteal cells. The mechanistic basis of this bihormonal interaction is unknown. The pig LDLR gene promoter includes three putative Sp1/Sp3-binding sites and one sterol response element (SRE) site 5' upstream to the transcriptional start site. To assess the role of SRE-binding protein (SREBP) in LDLR gene regulation, swine granulosa-luteal cells were cotransfected with CMV/SREBP-1a or SREBP-2 and the pLDLR1076/luc promoter. SREBP-1a and SREBP-2 stimulated LDLR gene transcription eight- and fourfold, respectively. LH alone augmented stimulation by SREBP-1 twofold. Conversely, cotransfection of a dominant-negative mutant form of SREBP-1a repressed basal and hormonally stimulated LDLR promoter activity by >80% (P < 0.01). Mutation of the SRE -167 ATCACCCCATG -157 to -167 ATCACCgCATG -157 bp decreased basal expression by 50% and LH + insulin- and LH + IGF-I-stimulated transcriptional activity by 80% and >90%, respectively (both P < 0.01). Mutations within each of the three flanking putative Sp1/Sp3 sites at -216/-211, -201/-196, and -151/-146 bp in the LDLR gene promoter also reduced basal activity (by >85%) and hormonal responsiveness (>95%, P < 0.05). EMSA confirmed that presumptive SRE-1 and Sp1/Sp3 elements bind respective peptides. Mithramycin, an inhibitor of Sp1/Sp3 protein(s) binding, blocked hormonally induced LDLR promoter expression by 80%. Basal transcription and supra-additive stimulation of porcine LDLR gene transcription by LH and insulin in granulosa-luteal cells require SREBP-1a and Sp1/Sp3-binding elements. PMID:14998783

  10. Activation of TGF-β1 promoter by hepatitis C virus-induced AP-1 and Sp1: role of TGF-β1 in hepatic stellate cell activation and invasion.

    PubMed

    Presser, Lance D; McRae, Steven; Waris, Gulam

    2013-01-01

    Our previous studies have shown the induction and maturation of transforming growth factor-beta 1 (TGF-β1) in HCV-infected human hepatoma cells. In this study, we have investigated the molecular mechanism of TGF-β1 gene expression in response to HCV infection. We demonstrate that HCV-induced transcription factors AP-1, Sp1, NF-κB and STAT-3 are involved in TGF-β1 gene expression. Using chromatin immunoprecipitation (ChIP) assay, we further show that AP-1 and Sp1 interact with TGF-b1 promoter in vivo in HCV-infected cells. In addition, we demonstrate that HCV-induced TGF-β1 gene expression is mediated by the activation of cellular kinases such as p38 MAPK, Src, JNK, and MEK1/2. Next, we determined the role of secreted bioactive TGF-β1 in human hepatic stellate cells (HSCs) activation and invasion. Using siRNA approach, we show that HCV-induced bioactive TGF-β1 is critical for the induction of alpha smooth muscle actin (α-SMA) and type 1 collagen, the markers of HSCs activation and proliferation. We further demonstrate the potential role of HCV-induced bioactive TGF-β1 in HSCs invasion/cell migration using a transwell Boyden chamber. Our results also suggest the role of HCV-induced TGF-β1 in HCV replication and release. Collectively, these observations provide insight into the mechanism of TGF-β1 promoter activation, as well as HSCs activation and invasion, which likely manifests in liver fibrosis associated with HCV infection. PMID:23437118

  11. The Scottish Play.

    ERIC Educational Resources Information Center

    Wheat, Chris

    1999-01-01

    Recounts an episode when, as young schoolboys, Prince Charles and classmates presented "Macbeth" as an end-of-term-play. Traces the events at school that took on different meanings when viewed from maturity. (NH)

  12. The School Play

    ERIC Educational Resources Information Center

    Lathan, P. D.

    1977-01-01

    Offers a defense of the school play as a vastly underrated educational tool. Available from: Speech and Drama, Elizabeth Gradwell, Distribution Manager, The White Cottage, Allington, Chippenham, Wilts. (MH)

  13. Play Spaces in Denmark.

    ERIC Educational Resources Information Center

    Mitchell, Edna; Anderson, Robert T.

    1980-01-01

    Describes the variety of play spaces found in urban areas in Denmark: in banks, stores and individual businesses, neighborhood parks and small pocket playgrounds, specialized adventure and traffic playgrounds with supervised activities, and commercial amusement parks. (CM)

  14. Krüppel-like Factor 4 activates HBG gene expression in primary erythroid cells

    PubMed Central

    Kalra, Inderdeep S.; Alam, Md M.; Choudhary, Pankaj K.; Pace, Betty S.

    2014-01-01

    Summary The SP1/Krüppel-like Factor (SP1/KLF) family of transcription factors plays a role in diverse cellular processes, including proliferation, differentiation and control of gene transcription. The discovery of KLF1 (EKLF), a key regulator of HBB (β-globin) gene expression, expanded our understanding of the role of KLFs in erythropoiesis. In this study, we investigated a mechanism of HBG (γ-globin) regulation by KLF4. siRNA-mediated gene silencing and enforced expression of KLF4 in K562 cells substantiated the ability of KLF4 to positively regulate endogenous HBG gene transcription. The physiological significance of this finding was confirmed in primary erythroid cells, where KLF4 knockdown at day 11 significantly attenuated HBG mRNA levels and enforced expression at day 28 stimulated the silenced HBG genes. In vitro binding characterization using the γ-CACCC and β-CACCC probes demonstrated KLF4 preferentially binds the endogenous γ-CACCC, while CREB binding protein (CREBBP) binding was not selective. Co-immunoprecipitation studies confirmed protein-protein interaction between KLF4 and CREBBP. Furthermore, sequential chromatin immunoprecipitation assays showed co-localization of both factors in the γ-CACCC region. Subsequent luciferase reporter studies demonstrated that KLF4 trans-activated HBG promoter activity and that CREBBP enforced expression resulted in gene repression. Our data supports a model of antagonistic interaction of KLF4/CREBBP trans-factors in HBG regulation. PMID:21539536

  15. Play down protein to play up metabolism?

    PubMed Central

    Müller, Timo D.; Tschöp, Matthias H.

    2014-01-01

    Who among us hasn’t fantasized about a diet that allows ingestion of a surfeit of calories that are burned off effortlessly by ramping up energy expenditure? In this issue of the JCI, research led by Christopher Morrison suggests that this dream may become a reality; however, a complete understanding of the molecular interface that connects nutrient choices with our cellular metabolism will be required. Laeger et al. show that the expression and secretion of the weight-reducing hormone fibroblast growth factor 21 (FGF21) is regulated by dietary proteins and not, as has been heretofore assumed, simply triggered by reduced caloric intake. This study not only sheds new light on the role of FGF21 in systems metabolism, but also on the ways our bodies cope with the ever-changing availability of different dietary macronutrients. PMID:25133420

  16. Lipopolysaccharide Decreases Single Immunoglobulin Interleukin-1 Receptor-related Molecule (SIGIRR) Expression by Suppressing Specificity Protein 1 (Sp1) via the Toll-like Receptor 4 (TLR4)-p38 Pathway in Monocytes and Neutrophils*

    PubMed Central

    Ueno-Shuto, Keiko; Kato, Kosuke; Tasaki, Yukihiro; Sato, Miki; Sato, Keizo; Uchida, Yuji; Sakai, Hiromichi; Ono, Tomomi; Suico, Mary Ann; Mitsutake, Kazunori; Tokutomi, Naofumi; Kai, Hirofumi; Shuto, Tsuyoshi

    2014-01-01

    Single immunoglobulin interleukin-1 receptor-related molecule (SIGIRR) is one of the immunoglobulin-like membrane proteins that is crucial for negative regulation of toll-like receptor 4 (TLR4) and interleukin-1 receptor. Despite the importance of understanding its expression and function, knowledge is limited on the regulatory mechanism in the epithelial tissues, such as the liver, lung, and gut, where its predominant expression is originally described. Here, we found expression of SIGIRR in non-epithelial innate immune cells, including primary peripheral blood monocytes, polymorphonuclear neutrophils, monocytic RAW264 cells, and neutrophilic-differentiated HL-60 cells. Consistent with previous findings in epithelial tissues, SIGIRR gene and protein expression were also down-regulated by LPS treatment in a time-dependent manner in primary blood monocytes and polymorphonuclear neutrophils. A reduction was also observed in RAW264 and differentiated HL-60 cells. Notably, exogenous introduction of the dominant negative form of TLR4 and siRNA of p38 resulted in inhibition of LPS-induced SIGIRR down-regulation, whereas treatment with p38 activator anisomycin showed a dose-dependent decrease in SIGIRR expression, suggesting TLR4-p38 signal as a critical pathway for LPS-induced SIGIRR down-regulation. Finally, reporter gene and chromatin immunoprecipitation assays demonstrated that Sp1 is a key factor that directly binds to the proximal promoter of SIGIRR gene and consequently regulates basal SIGIRR expression, which is negatively regulated by the LPS-dependent TLR4-p38 pathway. In summary, the data precisely demonstrate how LPS down-regulates SIGIRR expression and provide a role of LPS signal that counteracts Sp1-dependent basal promoter activation of SIGIRR gene via TLR4-p38 pathway in non-epithelial innate immune cells. PMID:24821721

  17. Nuclear-factor-{kappa}B (NF-{kappa}B) and radical oxygen species play contrary roles in transforming growth factor-{beta}1 (TGF-{beta}1)-induced apoptosis in hepatocellular carcinoma (HCC) cells

    SciTech Connect

    Wang Fang Kaur, Swayamjot; Cavin, Lakita G.; Arsura, Marcello

    2008-12-26

    Nuclear-Factor-{kappa}B (NF-{kappa}{beta} can counteract transforming growth factor-{beta}1 (TGF-{beta}1)-induced apoptosis in malignant hepatocytes through up-regulation of its downstream genes, such as X-linked inhibitor of apoptosis protein (XIAP). Reports have demonstrated that TGF-{beta}1 can induce oxidative stress, and c-Jun N-terminal Kinase1 (JNK1) is indispensable for TGF-{beta}1-induced apoptosis pathway, but the relationship between radical oxygen species (ROS) and the activation of JNKs is still unclear. In the present study, we found that ROS can induce JNK activation in TGF-{beta}1 mediated apoptosis in hepatocytes. The inhibitors of hydrogen peroxide and superoxide, which were produced by mitochondria under stress, could inhibit the phosphorylation of c-Jun in XIAP knockdown cells. In conclusion, it is the first time to show that both NF-{kappa}B and antioxidants can counteract TGF-{beta}1-induced apoptosis in hepatic cell death through JNK1 pathway.

  18. Manumycin A induces apoptosis in malignant pleural mesothelioma through regulation of Sp1 and activation of the mitochondria-related apoptotic pathway.

    PubMed

    Kim, Ka Hwi; Chae, Jung-Il; Oh, Hana; Cho, Jin Hyoung; Lee, Ra-Ham; Yoon, Goo; Cho, Seung-Sik; Cho, Young-Sik; Lee, Mee-Hyun; Liu, Kangdong; Lee, Hyun-Jeong; Shim, Jung-Hyun

    2016-07-01

    Manumycin A (Manu A) is a natural product isolated from Streptomyces parvulus and has been reported to have anti-carcinogenic and anti-biotic properties. However, neither its molecular mechanism nor its molecular targets are well understood. Thus, the aim of the present study was to explore the possibility that Manu A has cancer preventive and chemotherapeutic effects on malignant pleural mesothelioma (MPM) through regulation of Sp1 and induction of mitochondrial cell death pathway. Manu A inhibited the cell viability of MSTO-211H and H28 cells in a concentration‑dependent manner as determined by MTS assay. IC50 values were calculated as 8.3 and 4.3 µM in the MSTO-311H and H28 cells following 48 h incubation, respectively. Manu A induced a significant increase in apoptotic indices as shown by DAPI staining, Annexin V assay, multi-caspase activity and mitochondrial membrane potential assay. The downregulation of Sp1 mRNA and protein expression by Manu A led to apoptosis by suppressing Sp1-regulated proteins (cyclin D1, Mcl-1 and survivin). Manu A decreased the protein levels of BID, Bcl-xL and PARP while it increased Bax levels. Manu A caused depolarization of the mitochondrial membrane with induction of CHOP, DR4 and DR5. Our results demonstrated that Manu A exerted anticancer effects by inducing apoptosis via inhibition of the Sp1-related signaling pathway in human MPM. PMID:27176604

  19. Predicting elections: child's play!

    PubMed

    Antonakis, John; Dalgas, Olaf

    2009-02-27

    In two experiments, children and adults rated pairs of faces from election races. Naïve adults judged a pair on competence; after playing a game, children chose who they would prefer to be captain of their boat. Children's (as well as adults') preferences accurately predicted actual election outcomes. PMID:19251621

  20. Want to Play Geometry?

    ERIC Educational Resources Information Center

    Kaufmann, Matthew L.; Bomer, Megan A.; Powell, Nancy Norem

    2009-01-01

    Students enter the geometry classroom with a strong concept of fairness and a sense of what it means to "play by the rules," yet many students have difficulty understanding the postulates, or rules, of geometry and their implications. Although they may never have articulated the properties of an axiomatic system, they have gained a practical…

  1. Statistics at Play

    ERIC Educational Resources Information Center

    English, Lyn D.

    2014-01-01

    An exciting event had occurred for the grade 3 classes at Woodlands State School. A new play space designated for the older grades had now been opened to the third graders. In sharing their excitement over this "real treat, real privilege," the teachers invited the children to find out more about playgrounds and, in particular, their new…

  2. "Playing" with Science

    ERIC Educational Resources Information Center

    Allen, Dave

    2012-01-01

    When faced with a multitude of tasks, any opportunity to "kill two birds with one stone" is welcome. Drama has always excited the author: as a child performing in plays, later as a student and now as a teacher directing performances and improvising within lessons. The author was lucky enough to have inspirational teachers during his primary and…

  3. Abstraction through Game Play

    ERIC Educational Resources Information Center

    Avraamidou, Antri; Monaghan, John; Walker, Aisha

    2012-01-01

    This paper examines the computer game play of an 11-year-old boy. In the course of building a virtual house he developed and used, without assistance, an artefact and an accompanying strategy to ensure that his house was symmetric. We argue that the creation and use of this artefact-strategy is a mathematical abstraction. The discussion…

  4. Who's Calling the Plays?

    ERIC Educational Resources Information Center

    Goldman, Jay P.

    1990-01-01

    Without an enforceable policy, school athletics programs are beset by politics, high finance, and public sentiment. The most nettlesome problems include loss of instructional time to sports and extracurricular activities; the appropriateness and effectiveness of no-pass/no-play rules; lack of sportsmanship; proliferation of interstate competition;…

  5. Playing with danger.

    PubMed

    Pearce, Lynne

    Young people who sit still for hours playing computer games can double their risk of potentially fatal blood clots. The charity Lifeblood is alerting nurses to 'e-thrombosis'. It is calling on them to ensure young people are aware of the risks of prolonged immobility and the need to take regular breaks from gaming or using a computer. PMID:23061127

  6. The Games Children Play

    ERIC Educational Resources Information Center

    Padak, Nancy; Rasinski, Timothy

    2008-01-01

    The games that children play are not just for fun-they often lead to important skill development. Likewise, word games are fun opportunities for parents and children to spend time together and for children to learn a lot about sounds and words. In this Family Involvement column, the authors describe 12 easy-to-implement word games that parents and…

  7. One Play a Day

    ERIC Educational Resources Information Center

    Blankenship, Mark

    2007-01-01

    Undergraduate theater students rarely get the chance to work on a major world premiere, but this year hundreds of them will. Currently, more than 70 colleges and universities are participating in "365 Days/365 Plays," an ambitious project from Pulitzer Prize-winning playwright Suzan-Lori Parks. Every week, as they mount their portion of this epic…

  8. Play's Importance in School

    ERIC Educational Resources Information Center

    Sandberg, Anette; Heden, Rebecca

    2011-01-01

    The purpose of this study is to contribute knowledge on and gain an understanding of elementary school teachers' perspectives on the function of play in children's learning processes. The study is qualitative with a hermeneutical approach and has George Herbert Mead as a theoretical frame of reference. Interviews have been carried out with seven…

  9. Playing It Safe.

    ERIC Educational Resources Information Center

    Jones, Rebecca

    1997-01-01

    Offers tips for avoiding sports-related injuries: (1) expect more of coaches; (2) develop an athletic-safety plan; (3) consider hiring an athletic trainer; (4) check facilities and equipment regularly; (5) recognize athletes' limitations; (6) take precautions beyond the playing field; and (7) check liability coverage and obtain informed consent.…

  10. Integrated Play Groups

    ERIC Educational Resources Information Center

    Glovak, Sandra

    2007-01-01

    As an occupational therapist running social play groups with sensory integration for children on the autism spectrum, the author frequently doubted the wisdom of combining several children on the spectrum into a group. In fact, as the owner of a clinic she said, "No more!" The groups seemed like a waste of parents' time and money, and she refused…

  11. Endangered Play, Endangered Development: A Constructivist View of the Role of Play in Development and Learning.

    ERIC Educational Resources Information Center

    Levin, Diane E.

    Piagetian and Vygotskian theories may be used as starting points to examine the role of play in development and learning from a constructivist perspective, including how children use play to deepen their understanding and skills, encounter new problems, and incorporate newly mastered skills into their play. Contemporary factors such as an emphasis…

  12. PI3K/Akt signaling pathway triggers P2X7 receptor expression as a pro-survival factor of neuroblastoma cells under limiting growth conditions

    PubMed Central

    Gómez-Villafuertes, Rosa; García-Huerta, Paula; Díaz-Hernández, Juan Ignacio; Miras-Portugal, Mª Teresa

    2015-01-01

    The expression of purinergic P2X7 receptor (P2X7R) in neuroblastoma cells is associated to accelerated growth rate, angiogenesis, metastasis and poor prognosis. Noticeably, P2X7R allows the survival of neuroblastoma cells under restrictive conditions, including serum and glucose deprivation. Previously we identified specificity protein 1 (Sp1) as the main factor involved in the transcriptional regulation of P2rx7 gene, reporting that serum withdrawal triggers the expression of P2X7R in Neuro-2a (N2a) neuroblastoma cell line. Here we demonstrate that PI3K/Akt pathway is crucial for the upregulation of P2X7R expression in serum-deprived neuroblastoma cells, circumstance that facilitates cell proliferation in the absence of trophic support. The effect exerted by PI3K/Akt is independent of both mTOR and GSK3, but requires the activation of EGF receptor (EGFR). Nuclear levels of Sp1 are strongly reduced by inhibition of PI3K/Akt pathway, and blockade of Sp1-dependent transcription with mithramycin A prevents upregulation of P2rx7 gene expression following serum withdrawal. Furthermore, atypical PKCζ plays a key role in the regulation of P2X7R expression by preventing phosphorylation and, consequently, activation of Akt. Altogether, these data indicate that activation of EGFR enhanced the expression of P2X7R in neuroblastoma cells lacking trophic support, being PI3K/Akt/PKCζ signaling pathway and Sp1 mediating this pro-survival outcome. PMID:26687764

  13. PI3K/Akt signaling pathway triggers P2X7 receptor expression as a pro-survival factor of neuroblastoma cells under limiting growth conditions.

    PubMed

    Gómez-Villafuertes, Rosa; García-Huerta, Paula; Díaz-Hernández, Juan Ignacio; Miras-Portugal, M Teresa

    2015-01-01

    The expression of purinergic P2X7 receptor (P2X7R) in neuroblastoma cells is associated to accelerated growth rate, angiogenesis, metastasis and poor prognosis. Noticeably, P2X7R allows the survival of neuroblastoma cells under restrictive conditions, including serum and glucose deprivation. Previously we identified specificity protein 1 (Sp1) as the main factor involved in the transcriptional regulation of P2rx7 gene, reporting that serum withdrawal triggers the expression of P2X7R in Neuro-2a (N2a) neuroblastoma cell line. Here we demonstrate that PI3K/Akt pathway is crucial for the upregulation of P2X7R expression in serum-deprived neuroblastoma cells, circumstance that facilitates cell proliferation in the absence of trophic support. The effect exerted by PI3K/Akt is independent of both mTOR and GSK3, but requires the activation of EGF receptor (EGFR). Nuclear levels of Sp1 are strongly reduced by inhibition of PI3K/Akt pathway, and blockade of Sp1-dependent transcription with mithramycin A prevents upregulation of P2rx7 gene expression following serum withdrawal. Furthermore, atypical PKCζ plays a key role in the regulation of P2X7R expression by preventing phosphorylation and, consequently, activation of Akt. Altogether, these data indicate that activation of EGFR enhanced the expression of P2X7R in neuroblastoma cells lacking trophic support, being PI3K/Akt/PKCζ signaling pathway and Sp1 mediating this pro-survival outcome. PMID:26687764

  14. Psychological Approaches to the Study of Play

    ERIC Educational Resources Information Center

    Bergen, Doris

    2015-01-01

    In this survey of the research on psychological approaches to play, the author outlines its various focuses on the similarities and differences in the thinking and behavior of individuals and groups in relation to play and on the environmental factors that influence these. She notes that although psychologists often use standard experimental…

  15. The RNA-Binding Chaperone Hfq Is an Important Global Regulator of Gene Expression in Pasteurella multocida and Plays a Crucial Role in Production of a Number of Virulence Factors, Including Hyaluronic Acid Capsule.

    PubMed

    Mégroz, Marianne; Kleifeld, Oded; Wright, Amy; Powell, David; Harrison, Paul; Adler, Ben; Harper, Marina; Boyce, John D

    2016-05-01

    The Gram-negative bacterium Pasteurella multocida is the causative agent of a number of economically important animal diseases, including avian fowl cholera. Numerous P. multocida virulence factors have been identified, including capsule, lipopolysaccharide (LPS), and filamentous hemagglutinin, but little is known about how the expression of these virulence factors is regulated. Hfq is an RNA-binding protein that facilitates riboregulation via interaction with small noncoding RNA (sRNA) molecules and their mRNA targets. Here, we show that a P. multocida hfq mutant produces significantly less hyaluronic acid capsule during all growth phases and displays reduced in vivo fitness. Transcriptional and proteomic analyses of the hfq mutant during mid-exponential-phase growth revealed altered transcript levels for 128 genes and altered protein levels for 78 proteins. Further proteomic analyses of the hfq mutant during the early exponential growth phase identified 106 proteins that were produced at altered levels. Both the transcript and protein levels for genes/proteins involved in capsule biosynthesis were reduced in the hfq mutant, as were the levels of the filamentous hemagglutinin protein PfhB2 and its secretion partner LspB2. In contrast, there were increased expression levels of three LPS biosynthesis genes, encoding proteins involved in phosphocholine and phosphoethanolamine addition to LPS, suggesting that these genes are negatively regulated by Hfq-dependent mechanisms. Taken together, these data provide the first evidence that Hfq plays a crucial role in regulating the global expression of P. multocida genes, including the regulation of key P. multocida virulence factors, capsule, LPS, and filamentous hemagglutinin. PMID:26883595

  16. Canada's east coast play

    SciTech Connect

    Doig, I.M.

    1984-02-01

    The intent of this paper is to give a basic overview presentation on Canada's east coast play - most likely the number one offshore play in the free world - and possibly the world. The play stretches 2,500 miles north and south, as it follows the Labrador Coast, past the Strait of Belle Isle and onto the Grand Banks of Newfoundland and as it makes a 90 degree turn, 1,000 miles east to west along the coast of Nova Scotia to the Georges Bank. 3,500 miles in all - which if placed in western Canada, would stretch from northern Alberta to southern Mexico. It's geologic potential is immense - 15-20 billion barrels of oil and 80-90 Tcf of natural gas. And so far only approximately 2 billion barrels of oil and 5 Tcf of natural gas have been found. There is more out there. And less than 200 wells have been drilled - still very virgin territory. Two world size discoveries have been made in the area. Hibernia, on the Grand Banks, is estimated to contain 1.8 billion barrels. Venture, on the Scotian Shelf, has a natural gas reserve of 2.5 Tcf - big by Canadian standards and significant in that Mobil Oil has also made some other interesting discoveries on the same Sable Island block which have not been delineated.

  17. Effects of Cu(II) and cisplatin on the stability of Specific protein 1 (Sp1)-DNA binding: Insights into the regulation of copper homeostasis and platinum drug transport.

    PubMed

    Yan, Dong; Aiba, Isamu; Chen, Helen H W; Kuo, Macus Tien

    2016-08-01

    The human high-affinity copper transporter 1 (hCtr1) transports both Cu(I) and cisplatin (cDDP). Because Cu deficiency is lethal yet Cu overload is poisonous, hCtr1 expression is transcriptionally upregulated in response to Cu deficiency but is downregulated under Cu replete conditions in controlling Cu homeostasis. The up- and down-regulation of hCtr1 is regulated by Specific protein 1 (Sp1), which itself is also correspondingly regulated under these Cu conditions. hCtr1 expression is also upregulated by cDDP via upregulation of Sp1. The underlying mechanisms of these regulations are unknown. Using gel-electrophoretic mobility shift assays, we demonstrated here that Sp1-DNA binding affinity is reduced under Cu replete conditions but increased under reduced Cu conditions. Similarly, Sp1-DNA binding affinity is increased by cDDP treatment. This in vitro system demonstrated, for the first time, that regulation of Sp1/hCtr1 expression by these agents is modulated by the stability of Sp1-DNA binding, the first step in the Sp1-mediated transcriptional regulation process. PMID:27172866

  18. bHLH-PAS family transcription factor methoprene-tolerant plays a key role in JH action in preventing the premature development of adult structures during larval-pupal metamorphosis

    PubMed Central

    Parthasarathy, R.; Tan, Anjiang; Palli, Subba R.

    2008-01-01

    The biological actions of juvenile hormones are well studied; they regulate almost all aspects of an insect’s life. However, the molecular actions of these hormones are not well understood. Recent studies in the red flour beetle, Tribolium castaneum, demonstrated the utility of this insect as a model system to study JH action. These studies confirmed that the bHLH-PAS family transcription factor, methoprene-tolerant (TcMet,) plays a key role in JH action during larval stages. In this study, we investigated the role of TcMet in JH action during larval-pupal metamorphosis. The phenotypes of TcMet RNAi insects shared similarity with the phenotypes of some allatectomized lepidopteran larvae that were attempting to undergo precocious larval-pupal metamorphosis. Knocking-down TcMet during the final instar also disrupted larval-pupal ecdysis, resulting in the development of adultoid underneath the larval skin. However, the loss of TcMet did not completely block remodeling of internal tissues such as midgut. T. castaneum larvae injected with TcMet dsRNA demonstrated a resistance to a JH analog (JHA), hydroprene, irrespective of time and route of application. Knocking-down TcMet also caused down regulation of JH-response genes, JHE and Kr-h1 suggesting that TcMet might be involved in the expression of these genes. Based on the phenotype, gene expression, and JHA action studies in TcMet RNAi insects, this study concludes that Met plays a key role in JH action for preventing the premature development of adult structures during larval-pupal metamorphosis. PMID:18450431

  19. Time perspective as a predictor of massive multiplayer online role-playing game playing.

    PubMed

    Lukavska, Katerina

    2012-01-01

    This article focuses on the relationship between the time perspective (TP) personality trait and massive multiplayer online role-playing game (MMORPG) playing. We investigate the question of frequency of playing. The TP was measured with Zimbardo's TP Inventory (ZTPI), which includes five factors-past negative, past positive, present hedonistic, present fatalistic, and future. The study used data from 154 MMORPG players. We demonstrated that TP partially explained differences within a group of players with respect to the frequency of playing. Significant positive correlations were found between present factors and the amount of time spent playing MMORPGs, and significant negative correlation was found between the future factor and the time spent playing MMORPGs. Our study also revealed the influence of future-present balance on playing time. Players who scored lower in future-present balance variables (their present score was relatively high compared with their future score) reported higher values in playing time. In contrast to referential studies on TP and drug abuse and gambling, present fatalistic TP was demonstrated to be a stronger predictor of extensive playing than present hedonistic TP, which opened the question of motivation for playing. The advantage of our study compared with other personality-based studies lies in the fact that TP is a stable but malleable personality trait with a direct link to playing behavior. Therefore, TP is a promising conceptual resource for excessive playing therapy. PMID:22032796

  20. Solar Power at Play

    NASA Astrophysics Data System (ADS)

    2007-03-01

    For the very first time, astronomers have witnessed the speeding up of an asteroid's rotation, and have shown that it is due to a theoretical effect predicted but never seen before. The international team of scientists used an armada of telescopes to discover that the asteroid's rotation period currently decreases by 1 millisecond every year, as a consequence of the heating of the asteroid's surface by the Sun. Eventually it may spin faster than any known asteroid in the solar system and even break apart. ESO PR Photo 11a/07 ESO PR Photo 11a/07 Asteroid 2000 PH5 "The Yarkovsky-O'Keefe-Radzievskii-Paddack (YORP) effect is believed to alter the way small bodies in the Solar System rotate," said Stephen Lowry (Queens University Belfast, UK), lead-author of one of the two companion papers in which this work is reported [1, 2]. "The warming caused by sunlight hitting the surfaces of asteroids and meteoroids leads to a gentle recoil effect as the heat is released," he added. "By analogy, if one were to shine light on a propeller over a long enough period, it would start spinning." Although this is an almost immeasurably weak force, its effect over millions of years is far from negligible. Astronomers believe the YORP effect may be responsible for spinning some asteroids up so fast that they break apart, perhaps leading to the formation of double asteroids. Others may be slowed down so that they take many days to complete a full turn. The YORP effect also plays an important role in changing the orbits of asteroids between Mars and Jupiter, including their delivery to planet-crossing orbits, such as those of near-Earth asteroids. Despite its importance, the effect has never been seen acting on a solar system body, until now. Using extensive optical and radar imaging from powerful Earth-based observatories, astronomers have directly observed the YORP effect in action on a small near-Earth asteroid, known as (54509) 2000 PH5. Shortly after its discovery in 2000, it was

  1. Return to Play After Lumbar Spine Surgery.

    PubMed

    Cook, Ralph W; Hsu, Wellington K

    2016-10-01

    Surgical management of lumbar spine conditions can produce excellent outcomes in athletes. Microdiscectomy for lumbar disc herniation has favorable outcomes; most athletes return to play at preoperative performance levels. Direct pars repair is successful in younger athletes, with high rates of return to play for a variety of fixation techniques. Fusion in athletes with scoliosis is a negative predictor. There are few evidence-based return to play criteria. Athletes should demonstrate full resolution of symptoms and flexibility, endurance, and strength before returning to play. Deciding when to return an athlete to sport depends on particular injury sustained, sport, and individual factors. PMID:27543402

  2. Pathways to Play: Developing Play Skills in Young Children.

    ERIC Educational Resources Information Center

    Heidemann, Sandra; Hewitt, Deborah

    Play skills are vital to a child's overall healthy development. However, the training many caregivers receive may not include extensive information on play skills. This book presents a play checklist to help caregivers observe children's play skills, pinpoint play skills on which children need to work, and plan goals for improving those play…

  3. Characterization of the promoter region of the bovine long-chain acyl-CoA synthetase 1 gene: Roles of E2F1, Sp1, KLF15, and E2F4

    PubMed Central

    Zhao, Zhi-Dong; Zan, Lin-Sen; Li, An-Ning; Cheng, Gong; Li, Shi-Jun; Zhang, Ya-Ran; Wang, Xiao-Yu; Zhang, Ying-Ying

    2016-01-01

    The nutritional value and eating qualities of beef are enhanced when the unsaturated fatty acid content of fat is increased. Long-chain acyl-CoA synthetase 1 (ACSL1) plays key roles in fatty acid transport and degradation, as well as lipid synthesis. It has been identified as a plausible functional and positional candidate gene for manipulations of fatty acid composition in bovine skeletal muscle. In the present study, we determined that bovine ACSL1was highly expressed in subcutaneous adipose tissue and longissimus thoracis. To elucidate the molecular mechanisms involved in bovine ACSL1 regulation, we cloned and characterized the promoter region of ACSL1. Applying 5′-rapid amplification of cDNA end analysis (RACE), we identified multiple transcriptional start sites (TSSs) in its promoter region. Using a series of 5′ deletion promoter plasmids in luciferase reporter assays, we found that the proximal minimal promoter of ACSL1 was located within the region −325/−141 relative to the TSS and it was also located in the predicted CpG island. Mutational analysis and electrophoretic mobility shift assays demonstrated that E2F1, Sp1, KLF15 and E2F4 binding to the promoter region drives ACSL1 transcription. Together these interactions integrate and frame a key functional role for ACSL1 in mediating the lipid composition of beef. PMID:26782942

  4. Conserved POU-binding site linked to SP1-binding site within FZD5 promoter: Transcriptional mechanisms of FZD5 in undifferentiated human ES cells, fetal liver/spleen, adult colon, pancreatic islet, and diffuse-type gastric cancer.

    PubMed

    Katoh, Yuriko; Katoh, Masaru

    2007-03-01

    Canonical WNT signals are transduced through Frizzled (FZD) family receptor and LRP5/LRP6 co-receptor to upregulate FGF20, JAG1, DKK1, WISP1, CCND1 and MYC genes for cell-fate determination, while non-canonical WNT signals are transduced through FZD family receptor and ROR2/PTK7/RYK co-receptor to activate RHOA/RHOU/RAC/CDC42, JNK, PKC, NLK and NFAT signaling cascades for the regulation of tissue polarity, cell movement, and adhesion. We previously reported molecular cloning and characterization of human FZD5, which showed six amino-acid substitutions with human Hfz5. FZD5, functioning as WNT5A receptor, is the key molecule in the fields of oncology, regenerative medicine, cardiology, rheumatology, diabetology, and gastroenterology. Here, comparative integromics analyses on FZD5 orthologs were performed by using bioinformatics (Techint) and human intelligence (Humint). Chimpanzee FZD5 and cow Fzd5 genes were identified within NW_104292.1 and AC166656.2 genome sequences, respectively. FZD5 orthologs were seven-transmembrane proteins with extracellular Frizzled domain, leucine zipper motif around the 5th transmembrane domain, and cytoplasmic DVL- and PDZ-binding motifs. Ser523 and Ser529 around the DVL-binding motif of FZD5 orthologs were putative aPKC phosphorylation sites. POU5F1 (OCT4)-binding site linked to SP1-binding site within the 5'-promoter region of human FZD5 gene was evolutionarily conserved among mammalian FZD5 orthologs. POU5F1 was more related to POU2F and POU3F subfamily members. POU5F1 was preferentially expressed in undifferentiated human embryonic stem (ES) cells, pancreatic islet, and diffuse-type gastric cancer. POU2F1 (OCT1) was expressed in ES cells, fetal liver/spleen, adult colon, POU2F2 in ES cells, fetal liver/spleen, and POU2F3 in diffuse-type gastric cancer. Multiple SP1/KLF family members, other than KLF2 or KLF4, were expressed in undifferentiated human ES cells. Together, these facts indicate that POU5F1 and POU2F subfamily members

  5. Development through Work and Play.

    ERIC Educational Resources Information Center

    Hartung, Paul J.

    2002-01-01

    Five proposals are made for incorporating a work-play perspective in career development research: (1) fuse work and play conceptually over the life course; (2) imbue developmental career theory with a work-play fusion; (3) study work and play across the life span; (4) investigate work and play within the life space; and (5) consider a work-play…

  6. Play Theories: A Contemporary Review.

    ERIC Educational Resources Information Center

    Mellou, Eleni

    1994-01-01

    Reviews two sets of play theories, classical and modern, noting that the reason and purpose for play are explained by classical theories; the role of play in child development, determined by modern theories. States that process of play has dual functions of personal expression and social adaptation. Examines the relationship between play and…

  7. Play: Working Partner of Growth.

    ERIC Educational Resources Information Center

    McKee, Judy Spitler, Ed.

    This volume is a collection of nine papers focusing on different aspects of play. The first section, "Play, Growth, Development, and Learning," contains discussions dealing with make-believe play and learning; an all-in-fun approach to thinking, playing, and language learning for young children; and ways children learn through play. The second…

  8. Development of a real-time PCR assay (SYBR Green I) for rapid identification and quantification of scyphomedusae Aurelia sp.1 planulae

    NASA Astrophysics Data System (ADS)

    Wang, Jianyan; Zhen, Yu; Mi, Tiezhu; Yu, Zhigang; Wang, Guoshan

    2015-07-01

    The complicated life cycle of Aurelia spp., comprising benthic asexually-reproducing polyps and sexually-reproducing medusae, makes it hard for researchers to identify and track them, especially for early stage individuals, such as planulae. To solve this problem, we developed a real-time PCR assay (SYBR Green I) to identify planulae in both cultured and natural seawater samples. Species-specific primers targeting Aurelia sp.1 mitochondrial 16S rDNA (mt 16S rDNA) regions were designed. Using a calibration curve constructed with plasmids containing the Aurelia sp.1 mt 16S rDNA fragment and a standard curve for planulae, the absolute number of mt 16S rDNA copies per planula was determined and from that the total number of planulae per sample was estimated. For the field samples, a 100-fold dilution of the sample DNA combined with a final concentration of 0.2 μg/μL BSA in the PCR reaction mixture was used to remove real-time PCR inhibitors. Samples collected in Jiaozhou Bay from July to September 2012 were subsequently analyzed using this assay. Peak Aurelia sp.1 planula abundance occurred in July 2012 at stations near Hongdao Island and Qingdao offshore; abundances were very low in August and September. The real-time PCR assay (SYBR Green I) developed here negates the need for traditional microscopic identification, which is laborious and time-consuming, and can detect and quantify jellyfish planulae in field plankton samples rapidly and specifically.

  9. Induction of p53-independent apoptosis by a novel synthetic hexahydrocannabinol analog is mediated via Sp1-dependent NSAID-activated gene-1 in colon cancer cells.

    PubMed

    Thapa, Dinesh; Babu, Dinesh; Park, Min-A; Kwak, Mi-Kyoung; Lee, Yong-Rok; Kim, Jeong Min; Kwon, Taeg Kyu; Kim, Jung-Ae

    2010-07-01

    Nonsteroidal anti-inflammatory drug (NSAID)-activated gene-1 (NAG-1) has received greater attention as a novel molecular target for anti-cancer therapeutics in recent years. We identified a novel synthetic hexahydrocannabinol analog, LYR-8 [(1-((9S)-1-hydroxy-6,6,9-trimethyl-6a,7,8,9,10,10a-hexahydro-6H-benzo[c]chromen-2-yl)ethanone)], as a potent NAG-1 and apoptosis inducer in a panel of human cancer cells. LYR-8 did not possess any affinity for cannabinoid receptor CB(1) or CB(2), which eliminates the concern about potential psychoactive side effects. LYR-8 dramatically induced NAG-1 expression and apoptosis in HCT116 (wild-type p53) and HT29 (mutant p53) colon cancer cells. The NAG-1 expression by LYR-8 was not blocked by pifithrin-alpha, a specific p53 inhibitor, which was different from doxorubicin that induced p53-dependent NAG-1 transcriptional activity. The induction of NAG-1 promoter activity by LYR-8 was strongly correlated with increased Sp1 activation as noted in various luc-promoter activities. Furthermore, pretreatment with the specific Sp1 inhibitor mithramycin A completely reversed the LYR-8-induced NAG-1 expression in both HCT116 and HT29 cells. Knockdown of NAG-1 using siRNA significantly reversed LYR-8-induced cell death in both wild-type and mutant p53-expressing colon cancer cells. Furthermore, sensitization with NAG-1 inducer sulindac sulfide synergized LYR-8-induced cell death in both colon cancer cells. These results suggest that induction of NAG-1 via Sp1 activation is a promising therapeutic approach in cancer treatment, and that a novel compound like LYR-8 could be a potent chemotherapeutic agent for colon cancers including p53-mutated cancer. PMID:20230799

  10. Farm Hall: The Play

    NASA Astrophysics Data System (ADS)

    Cassidy, David C.

    2013-03-01

    It's July 1945. Germany is in defeat and the atomic bombs are on their way to Japan. Under the direction of Samuel Goudsmit, the Allies are holding some of the top German nuclear scientists-among them Heisenberg, Hahn, and Gerlach-captive in Farm Hall, an English country manor near Cambridge, England. As secret microphones record their conversations, the scientists are unaware of why they are being held or for how long. Thinking themselves far ahead of the Allies, how will they react to the news of the atomic bombs? How will these famous scientists explain to themselves and to the world their failure to achieve even a chain reaction? How will they come to terms with the horror of the Third Reich, their work for such a regime, and their behavior during that period? This one-act play is based upon the transcripts of their conversations as well as the author's historical work on the subject.

  11. Play concepts-northwest Palawan, Philippines

    NASA Astrophysics Data System (ADS)

    Williams, Harold H.

    The offshore area of northwest Palawan, Philippines, contains a number of provenexploration plays. These include • pinnacle reefs developed on Nido carbonate platforms (e.g. Nido, Matinloc, Cadlao);• a seaward horst block reef fairway with large pinnacle reefs (e.g. Malampaya—Camago trend);• early Miocene Galoc Clastic Unit turbidites (e.g. Octon, Galoc); and• four-way dip closures (e.g. West Linapacan, Octon). The recent discovery by Fletcher Challenge Petroleum at Calauit Field has shown a potentialexploration play in deep-water Nido Limestone turbidites. The traditional and, to date, only economically productive play in northwest Palawan has been the Nido Limestone reefs. This paper presents a review of the old play types and presents new untested play types. These new play types include • pre-Nido syn-rift plays;• pre-Nido marine turbidite play: and• mid-Miocene reefs. It also presents new insights into factors controlling reef development on the carbonate platforms where four reef types are now recognized. The Galoc Clastic Unit turbidite play is discussed and new play fairways presented.

  12. Glucosamine-induced Sp1 O-GlcNAcylation ameliorates hypoxia-induced SGLT dysfunction in primary cultured renal proximal tubule cells.

    PubMed

    Suh, Han Na; Lee, Yu Jin; Kim, Mi Ok; Ryu, Jung Min; Han, Ho Jae

    2014-10-01

    The aim of this study is to determine whether GlcN could recover the endoplasmic reticulum (ER) stress-induced dysfunction of Na(+) /glucose cotransporter (SGLT) in renal proximal tubule cells (PTCs) under hypoxia. With the rabbit model, the renal ischemia induced tubulointerstitial abnormalities and decreased SGLTs expression in tubular brush-border, which were recovered by GlcN. Thus, the protective mechanism of GlcN against renal ischemia was being examined by using PTCs. Hypoxia decreased the level of protein O-GlcNAc and the expression of O-GlcNAc transferase (OGT) while increased O-GlcNAcase (OGA) and these were reversed by GlcN. Hypoxia also decreased the expression of SGLTs (SGLT1 and 2) and [(14) C]-α-methyl-D-glucopyranoside (α-MG) uptake which were recovered by GlcN and PUGNAc (OGA inhibitor). Hypoxia enhanced reactive oxygen species (ROS) and then ER stress proteins, glucose-regulated protein 78 (GRP78), and C/EBP-homologous protein (CHOP). However, the expression of GRP78 increased till 6 h and then decreased whereas CHOP increased gradually. Moreover, decreased GRP78 and increased CHOP were reversed by NAC (antioxidant) and GlcN. GlcN ameliorated hypoxia-induced decrease of O-GlcNAc modification of Sp1 but OGT or Sp1 siRNAs blocked the recovery effect of GlcN on SGLT expression and α-MG uptake. In addition, hypoxia-decreased GRP78 and HIF-1α expression was reversed by GlcN but OGT siRNA or Sp1 siRNA ameliorated the effect of GlcN. When PTCs were transfected with GRP78 siRNA or HIF-1α siRNA, SGLT expression and α-MG uptake was decreased. Taken together, these data suggest that GlcN-induced O-GlcNAc modified Sp1 with stimulating GRP78 and HIF-1α activity ameliorate hypoxia-induced SGLT dysfunction in renal PTCs. J. Cell. Physiol. 229: 1557-1568, 2014. © 2014 Wiley Periodicals, Inc. PMID:24591095

  13. Child's Play: Revisiting Play in Early Childhood Settings.

    ERIC Educational Resources Information Center

    Dau, Elizabeth, Ed.; Jones, Elizabeth, Ed.

    Noting that play is an essential aspect of learning for young children, this book presents a collection of articles on children's play in Australia. Part 1, "Play, Development, and Learning," contains the following chapters: (1) "The Role of Play in Development and Learning" (Ann Glover); (2) "Stop, Look, and Listen: Adopting an Investigative…

  14. Imagination, Playfulness, and Creativity in Children's Play with Different Toys

    ERIC Educational Resources Information Center

    Mo????ller, Signe?? Juhl?

    2015-01-01

    Based on a four-month experimental study of preschool children's play with creative-construction and social-fantasy toys, the author examines the in?uence of both types of toys on the play of preschool children. Her comparative analysis considers the impact of transformative play on the development of imagination during play activities and…

  15. Playing My Heart Out: Original Play as Adventure.

    ERIC Educational Resources Information Center

    Donaldson, O. Fred

    1999-01-01

    "Original" play denotes play that is pre-cultural--before conceptualizations and learned responses. Four anecdotes about play with an infant with Down's syndrome, a child with leukemia, a lioness, and a dying woman illustrate the connections between beings and between the ordinary and the sacred during trusting, fearless, playful encounters. (SV)

  16. Facilitation of Play Behavior from Associative to Cooperative Play Stages.

    ERIC Educational Resources Information Center

    Lounsbury, Karen Rasmussen; Bell, Corinne Reed

    An experimental investigation of the transition from associative play to cooperative play was conducted to determine if cooperative play in young children could be facilitated by (1) presenting a toy that required cooperative responses to make it operate, and (2) instructing the children in the use of the toy prior to having them play with it. A…

  17. Preferential binding of anti-cancer drug adriamycin to the Sp1 binding site in c-met promoter region: A spectroscopic and molecular modeling study

    NASA Astrophysics Data System (ADS)

    Singhal, Garima; Rajeswari, Moganty R.

    2009-02-01

    The c-met gene encodes a transmembrane glycoprotein receptor with tyrosine kinase activity and overexpression of MET receptor is found in a number of common human malignancies. Regulation of c-met oncogene expression in general can be controlled by several DNA binding anti-cancer drugs. Interaction of adriamycin with a short oligonucleotide (24RY), which is part of the positive regulatory element (-233 to -68) in c-met gene was studied using UV-Vis absorption and fluorescence spectroscopy, UV-thermal melting, and molecular modeling. Strong binding of adriamycin to 24RY (overall binding constant K, 1- 3 × 10 5 M -1) is thermodynamically favored and is accompanied by the following: a marked increase in the melting temperature of 24RY by +15 °C and ˜60% decrease in absorption at 480 nm, ˜80% quenching of fluorescence at 555 nm along with a blue shift of the λemimax to 522 nm of adriamycin. Present data reveals that adriamycin binds to ˜ 5 bp (GCGGG) of the Sp1 binding site in 24RY and thus competes with Sp1 binding to the promoter site which results in down-regulation of kinase. Therefore, targeting c-met is a promising approach as it is an attractive novel oncogene for cancer therapeutics.

  18. Molecular and functional characterization of the promoter region of the mouse LDH/C gene: enhancer-assisted, Sp1-mediated transcriptional activation.

    PubMed Central

    Yang, J; Thomas, K

    1997-01-01

    Molecular and functional studies of the LDH/C 5' upstream promoter elements were undertaken to elucidate the molecular mechanisms involved in temporal activation of LDH/C gene expression in differentiating germ cells. Ligation mediated-PCR (LM-PCR) gene walking techniques were exploited to isolate a 2.1 kb fragment of the mouse LDH/C 5' promoter region. DNA sequence analysis of this isolated genomic fragment indicated that the mouse LDH/C promoter contained TATA and CCAT boxes as well as a GC-box (Sp1-binding site) situated upstream from the transcription start site. PCR-based in vivo DNase I footprinting analysis of a 600 bp fragment of the proximal LDH/C promoter region (-524/+38) in isolated mouse pachytene spermatocytes identified a single footprint over the GC-box motif. Three DNase I hypersensitive sites were also detectable in vivo, in a region containing (CT)n(GA)n repeats upstream from the CCAT box domain. Functional characterization of the promoter region was carried out in a rat C6 glioma cell line and an SV40 transformed germ cell line (GC-1 spg) using wild-type and mutated LDH/C promoter CAT reporter constructs. These studies provide experimental evidence suggesting that transcriptional activation of the LDH/C promoter is regulated by enhancer-mediated coactivation of the Sp1 proteins bound to the GC-box motif footprinted in vivo in pachytene spermatocytes. PMID:9153323

  19. Playful Learning and Montessori Education

    ERIC Educational Resources Information Center

    Lillard, Angeline S.

    2013-01-01

    Although Montessori education is often considered a form of playful learning, Maria Montessori herself spoke negatively about a major component of playful learning--pretend play, or fantasy--for young children. In this essay, the author discusses this apparent contradiction: how and why Montessori education includes elements of playful learning…

  20. The Child's Right To Play.

    ERIC Educational Resources Information Center

    Morris, Beverley

    This paper argues that play is an important and fundamental educational process and that the child's right to play should be respected. The paper also comments on the 1990 Tokyo International Conference on the Child's Right to Play. Several issues related to children's play, both in and out of school, are discussed. The focus is on the state of…

  1. Music Learning and Child's Play.

    ERIC Educational Resources Information Center

    Littleton, Danette

    1998-01-01

    Reviews various studies on childs play and its relation to young childrens development in music learning processes and explores the role that cognitive and social play categories have in studying childrens play with music. Provides strategies for initiating music-play opportunities in a preschool classroom. (CMK)

  2. Toy Play, Play Tempo, and Reaction to Frustration in Infants.

    ERIC Educational Resources Information Center

    Longo, Josephine; And Others

    1982-01-01

    In two sessions, the duration and tempo of toy play of infants and reaction of frustration were measured. Correlations indicated a general relationship between response persistence during play and attempts to escape frustrating situations. (Author/CM)

  3. Playing with Switches, Birth through Two. Let's Play! Project.

    ERIC Educational Resources Information Center

    State Univ. of New York, Buffalo. Center for Assistive Technology.

    This guide to playing with switches for parents and early intervention personnel was developed by the "Let's Play! Project," a 3-year federally supported project that worked to promote play in infants and toddlers with disabilities through the use of assistive technology. Switches are used with electronic toys to help young children easily…

  4. Increasing Joint Attention, Play and Language through Peer Supported Play.

    ERIC Educational Resources Information Center

    Zercher, Craig; Hunt, Pam; Schuler, Adriana; Webster, Janice

    2001-01-01

    This study examined effects of participation in an integrated play group on the social skills of two 6-year-old twins with autism. Following intervention with adult coaching, typical peers implemented the play group techniques in weekly play group sessions. The autistic subjects showed dramatic increases in shared attention to objects, symbolic…

  5. Learning, Play, and Your Newborn

    MedlinePlus

    ... Story" 5 Things to Know About Zika & Pregnancy Learning, Play, and Your Newborn KidsHealth > For Parents > Learning, ... juega su recién nacido What Is My Newborn Learning? Play is the chief way that infants learn ...

  6. Medical Play for Young Children.

    ERIC Educational Resources Information Center

    Jessee, Peggy O.; Wilson, Heidi; Morgan, Dee

    2000-01-01

    Discusses young children's emotional responses during medical examinations and procedures, developmental changes in how they conceptualize illness causation, and the role of play to reduce stress. Describes how teachers can best facilitate structured dramatic medical play therapeutically. (KB)

  7. The Genomic Context and Corecruitment of SP1 Affect ERRα Coactivation by PGC-1α in Muscle Cells.

    PubMed

    Salatino, Silvia; Kupr, Barbara; Baresic, Mario; van Nimwegen, Erik; Handschin, Christoph

    2016-07-01

    The peroxisome proliferator-activated receptor-γ coactivator 1α (PGC-1α) coordinates the transcriptional network response to promote an improved endurance capacity in skeletal muscle, eg, by coactivating the estrogen-related receptor-α (ERRα) in the regulation of oxidative substrate metabolism. Despite a close functional relationship, the interaction between these 2 proteins has not been studied on a genomic level. We now mapped the genome-wide binding of ERRα to DNA in a skeletal muscle cell line with elevated PGC-1α and linked the DNA recruitment to global PGC-1α target gene regulation. We found that, surprisingly, ERRα coactivation by PGC-1α is only observed in the minority of all PGC-1α recruitment sites. Nevertheless, a majority of PGC-1α target gene expression is dependent on ERRα. Intriguingly, the interaction between these 2 proteins is controlled by the genomic context of response elements, in particular the relative GC and CpG content, monomeric and dimeric repeat-binding site configuration for ERRα, and adjacent recruitment of the transcription factor specificity protein 1. These findings thus not only reveal a novel insight into the regulatory network underlying muscle cell plasticity but also strongly link the genomic context of DNA-response elements to control transcription factor-coregulator interactions. PMID:27182621

  8. Problematic game play: the diagnostic value of playing motives, passion, and playing time in men.

    PubMed

    Kneer, Julia; Rieger, Diana

    2015-01-01

    Internet gaming disorder is currently listed in the DSM-not in order to diagnose such a disorder but to encourage research to investigate this phenomenon. Even whether it is still questionable if Internet Gaming Disorder exists and can be judged as a form of addiction, problematic game play is already very well researched to cause problems in daily life. Approaches trying to predict problematic tendencies in digital game play have mainly focused on playing time as a diagnostic criterion. However, motives to engage in digital game play and obsessive passion for game play have also been found to predict problematic game play but have not yet been investigated together. The present study aims at (1) analyzing if obsessive passion can be distinguished from problematic game play as separate concepts, and (2) testing motives of game play, passion, and playing time for their predictive values for problematic tendencies. We found (N = 99 males, Age: M = 22.80, SD = 3.81) that obsessive passion can be conceptually separated from problematic game play. In addition, the results suggest that compared to solely playing time immersion as playing motive and obsessive passion have added predictive value for problematic game play. The implications focus on broadening the criteria in order to diagnose problematic playing. PMID:25942516

  9. Problematic Game Play: The Diagnostic Value of Playing Motives, Passion, and Playing Time in Men

    PubMed Central

    Kneer, Julia; Rieger, Diana

    2015-01-01

    Internet gaming disorder is currently listed in the DSM—not in order to diagnose such a disorder but to encourage research to investigate this phenomenon. Even whether it is still questionable if Internet Gaming Disorder exists and can be judged as a form of addiction, problematic game play is already very well researched to cause problems in daily life. Approaches trying to predict problematic tendencies in digital game play have mainly focused on playing time as a diagnostic criterion. However, motives to engage in digital game play and obsessive passion for game play have also been found to predict problematic game play but have not yet been investigated together. The present study aims at (1) analyzing if obsessive passion can be distinguished from problematic game play as separate concepts, and (2) testing motives of game play, passion, and playing time for their predictive values for problematic tendencies. We found (N = 99 males, Age: M = 22.80, SD = 3.81) that obsessive passion can be conceptually separated from problematic game play. In addition, the results suggest that compared to solely playing time immersion as playing motive and obsessive passion have added predictive value for problematic game play. The implications focus on broadening the criteria in order to diagnose problematic playing. PMID:25942516

  10. Self-assembled semi-crystallinity at parallel β-sheet nanocrystal interfaces in clustered MaSp1 (spider silk) proteins.

    PubMed

    Sintya, Erly; Alam, Parvez

    2016-01-01

    In this communication, we use molecular dynamics methods to model the self-assembly of semi-crystalline domains at β-sheet nanocrystal interfaces in clusters of spider silk (MaSp1) proteins. Our research elucidates that the energetics at interfaces between crystalline and amorphous domains control effectively, the extent to which semi-crystalline domains can form at interfaces. Stability at nanocrystal interfaces is not linearly related to the internal (bulk) stability of the β-sheet nanocrystal. Rather, interfacial stability is found to be highly sensitive to the number of alanine repeat units that make up each sheet. Intriguingly, the most stable interface for the development of semi-crystallinity is built up of polyalanine β-sheets of a length similar to that which is spun naturally in spider dragline silk. PMID:26478322

  11. Play Memories and Place Identity.

    ERIC Educational Resources Information Center

    Sandberg, Anette

    2003-01-01

    This retrospective study examined play memories from childhood to adulthood of 478 university students between ages 20 and 62 as exhibited in drawings of play memories and questionnaire responses. The study focused on the role of the physical environment and place identity in play memories and individual identity development. Findings showed that…

  12. Meanings of Play among Children

    ERIC Educational Resources Information Center

    Glenn, Nicole M.; Knight, Camilla J.; Holt, Nicholas L.; Spence, John C.

    2013-01-01

    The purpose of this study was to examine meanings of play among children. Thirty-eight students aged 7-9 years from a suburban public school in Western Canada participated in focus groups. Data analysis revealed participants saw almost anything as an opportunity for play and would play almost anywhere with anyone. However, they perceived parents…

  13. Play Therapy in School Counseling

    ERIC Educational Resources Information Center

    Trice-Black, Shannon; Bailey, Carrie Lynn; Kiper Riechel, Morgan E.

    2013-01-01

    Play therapy is an empirically supported intervention used to address a number of developmental issues faced in childhood. Through the natural language of play, children and adolescents communicate feelings, thoughts, and experiences. Schools provide an ideal setting for play therapy in many ways; however, several challenges exist in implementing…

  14. Play in Evolution and Development

    ERIC Educational Resources Information Center

    Pellegrini, Anthony D.; Dupuis, Danielle; Smith, Peter K.

    2007-01-01

    In this paper we examine the role of play in human ontogeny and phylogeny, following Surplus Resource Theory. We consider how juveniles use play to sample their environment in order to develop adaptive behaviors. We speculate about how innovative behaviors developed in play in response to environmental novelty may influence subsequent evolutionary…

  15. Pretend Play and Creative Processes

    ERIC Educational Resources Information Center

    Russ, Sandra W.; Wallace, Claire E.

    2013-01-01

    The authors contend that many cognitive abilities and affective processes important in creativity also occur in pretend play and that pretend play in childhood affects the development of creativity in adulthood. They discuss a variety of theories and observations that attempt to explain the importance of pretend play to creativity. They argue that…

  16. Preschoolers' Thinking during Block Play

    ERIC Educational Resources Information Center

    Piccolo, Diana L.; Test, Joan

    2010-01-01

    Children build foundations for mathematical thinking in early play and exploration. During the preschool years, children enjoy exploring mathematical concepts--such as patterns, shape, spatial relationships, and measurement--leading them to spontaneously engage in mathematical thinking during play. Block play is one common example that engages…

  17. Serine proteases SP1 and SP13 mediate the melanization response of Asian corn borer, Ostrinia furnacalis, against entomopathogenic fungus Beauveria bassiana.

    PubMed

    Chu, Yuan; Liu, Yang; Shen, Dongxu; Hong, Fang; Wang, Guirong; An, Chunju

    2015-06-01

    Exposure to entomopathogenic fungi is one approach for insect pest control. Little is known about the immune interactions between fungus and its insect host. Melanization is a prominent immune response in insects in defending against pathogens such as bacteria and fungi. Clip domain serine proteases in insect plasma have been implicated in the activation of prophenoloxidase, a key enzyme in the melanization. The relationship between host melanization and the infection by a fungus needs to be established. We report here that the injection of entomopathogenic fungus Beauveria bassiana induced both melanin synthesis and phenoloxidase activity in its host insect, the Asian corn borer, Ostrinia furnacalis (Guenée). qRT-PCR analysis showed several distinct patterns of expression of 13 clip-domain serine proteases in response to the challenge of fungi, with seven increased, two decreased, and four unchanged. Of special interest among these clip-domain serine protease genes are SP1 and SP13, the orthologs of Manduca sexta HP6 and PAP1 which are involved in the prophenoloxidase activation pathway. Recombinant O. furnacalis SP1 was found to activate proSP13 and induce the phenoloxidase activity in corn borer plasma. Additionally, SP13 was determined to directly cleave prophenoloxidase and therefore act as the prophenoloxidase activating protease. Our work thus reveals a biochemical mechanism in the melanization in corn borer associated with the challenge by B. bassiana injection. These insights could provide valuable information for better understanding the immune responses of Asian corn borer against B. bassiana. PMID:25900291

  18. Sp1 and Sp3 Are the Transcription Activators of Human ek1 Promoter in TSA-Treated Human Colon Carcinoma Cells

    PubMed Central

    Kuan, Chee Sian; See Too, Wei Cun; Few, Ling Ling

    2016-01-01

    Background Ethanolamine kinase (EK) catalyzes the phosphorylation of ethanolamine, the first step in the CDP-ethanolamine pathway for the biosynthesis of phosphatidylethanolamine (PE). Human EK exists as EK1, EK2α and EK2β isoforms, encoded by two separate genes, named ek1 and ek2. EK activity is stimulated by carcinogens and oncogenes, suggesting the involvement of EK in carcinogenesis. Currently, little is known about EK transcriptional regulation by endogenous or exogenous signals, and the ek gene promoter has never been studied. Methodology/Principal Findings In this report, we mapped the important regulatory regions in the human ek1 promoter. 5’ deletion analysis and site-directed mutagenesis identified a Sp site at position (-40/-31) that was essential for the basal transcription of this gene. Treatment of HCT116 cells with trichostatin A (TSA), a histone deacetylase inhibitor, significantly upregulated the ek1 promoter activity through the Sp(-40/-31) site and increased the endogenous expression of ek1. Chromatin immunoprecipitation assay revealed that TSA increased the binding of Sp1, Sp3 and RNA polymerase II to the ek1 promoter in HCT116 cells. The effect of TSA on ek1 promoter activity was cell-line specific as TSA treatment did not affect ek1 promoter activity in HepG2 cells. Conclusion/Significance In conclusion, we showed that Sp1 and Sp3 are not only essential for the basal transcription of the ek1 gene, their accessibility to the target site on the ek1 promoter is regulated by histone protein modification in a cell line dependent manner. PMID:26807725

  19. Children's play provisions: time for change.

    PubMed

    Sharma, A; Khosla, R

    1992-01-01

    An overview is provided of essential features of play environments for children which enhance their creative development: play space, play environments, equipment for play, safe equipment, creative adult input, and time factors. Safety measures are described along with a list of do's and don'ts. Management of play areas and the training of educators were also discussed. Arguments are given as support for creative play provisions, but the conclusion is that the trend is to restrict children's expression, to limit their freedom, to impose limits to action and thought, to encourage normative behavior, and to inhibit creative thinking. Space requirements are that the area be ample. In rural and tribal areas, space is unlimited; in cities, creative use of space may involve use of terraces, enclosed courtyards, dead end road areas free of traffic, or a large open area away from traffic. In spite of space limitations, children tend to adapt to the space available. For instance, a pipe sticking out of a wall could be a bar to swing on. Effective use of space is dependent on organization and structuring. In rural areas, children learn by their own discoveries, and many are denied the exposure to educators who can organize their play or play objects to foster creativity. Play is divorced from work and learning, when it can also be structured to offer opportunities for development of cognitive skills. Stimulating play environments may include a mound of earth that separates one part of an open space from another; children find looking to see what is on the other side intriguing. Children can run up and down the hill. A sand pit with building and digging instruments can provide hours of fascination. A water hole with stones could provide a place to jump across and foster imaginative games. A tunnel could be carved out of the hill to provide a place of dramatic play. A low tree with a twisted trunk is inviting for climbing, swinging, jumping, or playing hide and seek. Play

  20. Safety in Children's Formal Play Environments.

    ERIC Educational Resources Information Center

    Wilkinson, Paul F.; Lockhart, Robert

    This study was designed to examine the issue of the safety of children's formal play environments. Safety was defined in terms of morbidity and mortality data. Protection and safety education were considered the prime factors in accident prevention while the goal of a safety program was considered to be the minimizing of injuries. Several data…

  1. Thinking about Children's Play: Play Is Not Work, Nor Is Work Play.

    ERIC Educational Resources Information Center

    Elkind, David

    2001-01-01

    Addresses the concept of "play as a child's work," from the viewpoints of Montessori, Freud, and Piaget. Contends that children's play: (1) like adult play, may be individual or social; (2) has immediate value for the child as a way of expressing feelings; and (3) is a healthy counterpoise to work. (SD)

  2. Multidimensional Correlates of Individual Variability in Play and Exploration.

    ERIC Educational Resources Information Center

    Wachs, Theodore D.

    1993-01-01

    Examines the relationship between play and environmental and biological factors and individual differences. Explores correlates of morbidity, nutrition, and caregiving environments on toddlers' play sophistication in Egypt. Suggests that variability in children's object versus social play may be a function of the goodness of fit between child and…

  3. A Profile of Children's Play in Urban India.

    ERIC Educational Resources Information Center

    Oke, Meera; Khattar, Archna; Pant, Prarthana; Saraswathi, T. S.

    1999-01-01

    Observed universal and culturally specific features of play conditioned by ecological factors, social class, and gender in India. Found that, although ecological constraints conspired against the urban child's natural propensity to play with joyous spontaneity, there were also conscious community endeavors to create play environments. Children…

  4. Playing with the Multiple Intelligences: How Play Helps Them Grow

    ERIC Educational Resources Information Center

    Eberle, Scott G.

    2011-01-01

    Howard Gardner first posited a list of "multiple intelligences" as a liberating alternative to the assumptions underlying traditional IQ testing in his widely read study "Frames of Mind" (1983). Play has appeared only in passing in Gardner's thinking about intelligence, however, even though play instructs and trains the verbal, interpersonal,…

  5. Understanding Young Children's Learning through Play: Building Playful Pedagogies

    ERIC Educational Resources Information Center

    Broadhead, Pat; Burt, Andy

    2011-01-01

    This timely and accessible text introduces, theorises and practically applies two important concepts which now underpin early years practice: those of "playful learning" and "playful pedagogies". Pat Broadhead and Andy Burt draw upon filmed material, conversations with children, reflection, observation, and parental and staff interviews, in their…

  6. Well Played: The Origins and Future of Playfulness

    ERIC Educational Resources Information Center

    Gordon, Gwen

    2014-01-01

    In this article, the author synthesizes research from several disciplines to shed light on play's central role in healthy development. Gordon builds on research in attachment theory that correlates secure attachment in infancy with adult well-being to demonstrate how playfulness might be a lifelong outcome of secure attachment and a primary…

  7. "Play for Real": Understanding Middle School Children's Dramatic Play.

    ERIC Educational Resources Information Center

    Sierra, Zayda

    2000-01-01

    Summarizes a dissertation that examines the theory and practice of dramatic play among middle school children. Finds that they are still adept and interested in dramatic play. Discusses four components describing the nature and product of the dramatic process (social interactions, metacognitive strategies, ideational processes, and content of…

  8. Playing To Get Smart. Viewpoint.

    ERIC Educational Resources Information Center

    Jones, Elizabeth

    2003-01-01

    Asserts that it is through play with materials and relationships, invention of classification systems, and solving problems in dialogue with others that young children develop the basic skills they will need to become effective contributors to the health of a changing world. Offers suggestions for teaching children play skills by providing…

  9. Sand and Water Table Play

    ERIC Educational Resources Information Center

    Wallace, Ann H.; White, Mary J.; Stone, Ryan

    2010-01-01

    The authors observed preschoolers engaged at the sand and water table to determine if math could be found within their play. Wanting to understand how children interact with provided materials and what kinds of math ideas they explore during these interactions, the authors offer practical examples of how such play can promote mathematical…

  10. Young Children and War Play.

    ERIC Educational Resources Information Center

    Carlsson-Paige, Nancy; Levin, Diane E.

    1988-01-01

    In a recent survey of parents and early childhood professionals the prevalence of war play among children and an increase in the amount of violence in children's play was noted. Outlines how the deregulation of children's television during the Reagan administration has affected children's exposure to violence in children's television programming.…

  11. Invention at Play. Educators' Manual.

    ERIC Educational Resources Information Center

    Judd, Michael; Lacasse, Jane; Smith, Monica; Reilly, Katie

    A Smithsonian exhibition was developed that looked at invention in an innovative way. It aimed to encourage visitors to make connections between their own lives and abilities and those of inventors. The role of play in the invention process was examined. Play is a universal and familiar activity and can help people find the link between their own…

  12. The Play of Socratic Dialogue

    ERIC Educational Resources Information Center

    Smith, Richard

    2011-01-01

    Proponents of philosophy for children generally see themselves as heirs to the "Socratic" tradition. They often claim too that children's aptitude for play leads them naturally to play with abstract, philosophical ideas. However in Plato's dialogues we find in the mouth of "Socrates" many warnings against philosophising with the young. Those…

  13. Playground Play: Educational and Inclusive

    ERIC Educational Resources Information Center

    Moore, Lisa

    2011-01-01

    It is easy to understand that fun is one of the key ingredients to any playground activity. But what one may not realize is that play systems--including slides, tunnels, activity panels, and more--encourage a lot more than just fun: there is learning at work in playground play, as well as the opportunity to include children of all abilities in…

  14. Empowering Groups that Enable Play

    ERIC Educational Resources Information Center

    Wilson, David Sloan; Marshall, Danielle; Iserhott, Hindi

    2011-01-01

    Creating play environments for children usually requires groups of adults working together. An extensive scientific literature describes how groups function to achieve shared goals in general terms, and groups attempting to empower play may find this literature useful. Design principles for managing natural resources, identified by Elinor Ostrom…

  15. Let's Play Three on Three!

    ERIC Educational Resources Information Center

    Kern, Jack; Calleja, Paul

    2008-01-01

    Over the course of nine years as a supervisor of intern teachers, the first author collected observations of game play during lessons taught by intern teachers or their mentors. In general, the observations indicated that the majority of students got limited practice opportunities during game play. A close look at the data revealed an interesting…

  16. Outdoor Play: Combating Sedentary Lifestyles

    ERIC Educational Resources Information Center

    Thigpen, Betsy

    2007-01-01

    Increasingly sedentary lifestyles are contributing to overweight and other health concerns as children spend less and less time outside engaged in active play. Outdoor play provides important opportunities to explore the natural world, interact with peers, engage in vigorous physical activity, and learn about our environment. However, outdoor…

  17. The Fractal Self at Play

    ERIC Educational Resources Information Center

    Marks-Tarlow, Terry

    2010-01-01

    In this article, the author draws on contemporary science to illuminate the relationship between early play experiences, processes of self-development, and the later emergence of the fractal self. She argues that orientation within social space is a primary function of early play and developmentally a two-step process. With other people and with…

  18. A Place for Block Play.

    ERIC Educational Resources Information Center

    Moore, Gary T.

    1997-01-01

    Discusses the importance of block play--including its contributions to perceptual, fine motor, and cognitive development--and components of a good preschool block play area. Recommends unit blocks complemented by stacking blocks, toys, beads, cubes, and Brio wooden toys. Makes recommendations for space, size, locations and connections to other…

  19. Niger Delta play types, Nigeria

    SciTech Connect

    Akinpelu, A.O.

    1995-08-01

    Exploration databases can be more valuable when sorted by play type. Play specific databases provide a system to organize E & P data used in evaluating the range of values of parameters for reserve estimation and risk assessment. It is important both in focusing the knowledge base and in orienting research effort. A play in this context is any unique combination of trap, reservoir and source properties with the right dynamics of migration and preservation that results in hydrocarbon accumulation. This definitions helps us to discriminate the subtle differences found with these accumulation settings. About 20 play types were identified around the Niger Delta oil province in Nigeria. These are grouped into three parts: (1) The proven plays-constituting the bulk of exploration prospects in Nigeria today. (2) The unproven or semi-proven plays usually with some successes recorded in a few tries but where knowledge is still inadequate. (3) The unproven or analogous play concept. These are untested but geologically sound ideas which may or may not have been tried elsewhere. With classification and sub grouping of these play types into specific databases, intrinsic attributes and uniqueness of each of them with respect to the four major risk elements and the eight parameters for reserve estimation can be better understood.

  20. Play Therapy with Special Populations.

    ERIC Educational Resources Information Center

    Carmichael, Karla D.

    This paper notes that therapists often feel unqualified to deal with special populations of children because of a lack of understanding of the universalness of play therapy. Suggestions are offered for beginning play therapists who may work with a number of special populations of children. It is recommended that the social learning approach to…

  1. Making Play Work for Education

    ERIC Educational Resources Information Center

    Weisberg, Deena Skolnick; Kittredge, Audrey K.; Hirsh-Pasek, Kathy; Golinkoff, Roberta Michnick; Klahr, David

    2015-01-01

    Children, especially in the preschool years, learn a tremendous amount through play. Research on guided play demonstrates how schools can couple a curriculum-centered preschool program with a developmentally appropriate pedagogical approach to classroom teaching. However, to fully test this claim, we need a clear definition of the term…

  2. Solitary Play: Some Functional Reconsiderations

    ERIC Educational Resources Information Center

    Moore, Nancy V.; And Others

    1974-01-01

    Solitary play in six kindergarten children was observed and coded for frequency and type in order to resolve iscrepancies in a Sex Birth Order interaction. Several facts concerning solitary play as indicative of independence and maturity are noted. (Author/ED)

  3. Engaging Families through Artful Play

    ERIC Educational Resources Information Center

    Brown, Robert

    2015-01-01

    This paper explores how aligned arts and play experiences can extend child and family engagement in a public outdoor space. The importance of outdoor play for children is strongly advocated and in response local governments provide playgrounds and recreational open spaces. To extend further the experiences afforded in such spaces some local…

  4. Three Plays from the Japanese.

    ERIC Educational Resources Information Center

    Mayfield, M. Kent

    This study is both an interpretation and a translation of three modern Japanese plays, providing an artistic perspective on the radical reordering of experience and thought with which modern man must grapple in cross-cultural encounters. An introductory essay prefaces each play, providing a historical, critical, or appreciative perspective from…

  5. Principles of Play for Soccer

    ERIC Educational Resources Information Center

    Ouellette, John

    2004-01-01

    Soccer coaches must understand the principles of play if they want to succeed. The principles of play are the rules of action that support the basic objectives of soccer and the foundation of a soccer coaching strategy. They serve as a set of permanent criteria that coaches can use to evaluate the efforts of their team. In this article, the author…

  6. Transmedia Play: Literacy across Media

    ERIC Educational Resources Information Center

    Alper, Meryl; Herr-Stephenson, Rebecca

    2013-01-01

    Transmedia play is a new way to understand how children develop critical media literacy and new media literacies through their interactions with contemporary media that links stories and structures across platforms. This essay highlights five characteristics of transmedia play that make it particularly useful for learning:…

  7. Neuroscience, Play, and Child Development.

    ERIC Educational Resources Information Center

    Frost, Joe L.

    This paper presents a brief overview of the array of neuroscience research as it applies to play and child development. The paper discusses research showing the importance of play for brain growth and child development, and recommends that families, schools and other social and corporate institutions rearrange their attitudes and priorities about…

  8. Dioscorea nipponica Attenuates Migration and Invasion by Inhibition of Urokinase-Type Plasminogen Activator through Involving PI3K/Akt and Transcriptional Inhibition of NF-[Formula: see text]B and SP-1 in Hepatocellular Carcinoma.

    PubMed

    Hsieh, Ming-Ju; Yeh, Chao-Bin; Chiou, Hui-Ling; Hsieh, Ming-Chang; Yang, Shun-Fa

    2016-01-01

    High mortality and morbidity rates for hepatocellular carcinoma (HCC) in Taiwan primarily result from uncontrolled tumor metastasis. In our previous studies, we have reported that Dioscorea nipponica Makino extract (DNE) has anti-metastasis effects on human oral cancer cells. However, the effect of DNE on hepatoma metastasis have not been thoroughly investigated and remains poorly understood. To determine the effects of DNE on the migration and invasion in HCC cells we used a wound healing model, Boyden chamber assays, gelatin/casein zymography and Western blotting. Transcriptional levels of matrix metalloproteinase-9 (MMP-9) and urokinase-type plasminogen activator (u-PA) were detected by real-time PCR and promoter assays. In this study, DNE treatment significantly inhibited the migration/invasion capacities of Huh7 cell lines. The results of gelatin/casein zymography and Western blotting revealed that the activities and protein levels of the MMP-9 and u-PA were inhibited by DNE. Tests of the mRNA levels, real-time PCR, and promoter assays evaluated the inhibitory effects of DNE on u-PA expression in human hepatoma cells. A chromatin immunoprecipitation (ChIP) assay showed not only that DNE inhibits u-PA expression, but also the inhibitory effects were associated with the down-regulation of the transcription factors of NF-[Formula: see text]B and SP-1 signaling pathways. Western blot analysis also showed that DNE inhibits PI3K and phosphorylation of Akt. In conclusion, these results show that u-PA expression may be a potent therapeutic target in the DNE-mediated suppression of HCC invasion/migration. DNE may have potential use as a chemo-preventive agent against liver cancer metastasis. PMID:26916922

  9. Playful biometrics: controversial technology through the lens of play.

    PubMed

    Ellerbrok, Ariane

    2011-01-01

    This article considers the role of play in the context of technological emergence and expansion, particularly as it relates to recently emerging surveillance technologies. As a case study, I consider the trajectory of automated face recognition—a biometric technology of numerous applications, from its more controversial manifestations under the rubric of national security to a clearly emerging orientation toward play. This shift toward “playful” biometrics—or from a technology traditionally coded as “hard” to one now increasingly coded as “soft”—is critical insofar as it renders problematic the traditional modes of critique that have, up until this point, challenged the expansion of biometric systems into increasingly ubiquitous realms of everyday life. In response to this dynamic, I propose theorizing the expansion of face recognition specifically in relation to “play,” a step that allows us to broaden the critical space around newly emerging playful biometrics, as well as playful surveillance more generally. In addition, play may also have relevance for theorizing other forms of controversial technology, particularly given its potential role in processes of obfuscation, normalization, and marginalization. PMID:22175066

  10. Terameprocol (tetra-O-methyl nordihydroguaiaretic acid), an inhibitor of Sp1-mediated survivin transcription, induces radiosensitization in non-small cell lung carcinoma

    PubMed Central

    Sun, Yunguang; Giacalone, Nicholas J.; Lu, Bo

    2010-01-01

    Introduction Survivin, an inhibitor of apoptosis protein (IAP) and key regulator of mitosis, is up-regulated in a variety of cancers and is often associated with a worse prognosis. Terameprocol down-regulates the Sp1-mediated transcription of survivin and Cdk1, which is important for cell cycle progression, as well as many other proteins. Survivin inhibition has previously been shown to result in the induction of apoptosis and radiosensitization. Methods This study examined the effects of terameprocol administration on survivin transcription and expression in HCC2429 and H460 lung cancer cells. We also examined the combined effects of radiation and terameprocol on apoptosis and radiosensitivity. Results Using immunoblot analysis and luciferase assays, we confirmed that terameprocol decreases survivin transcription and protein expression. Ultimately, however, decreases in survivin expression failed to correlate with an increase in apoptosis. Nonetheless, clonogenic assay revealed that terameprocol induces increased radiosensitization in HCC2429 (DER = 1.26, p = 0.019) and H460 (DER = 1.18, p = 0.001) cells. Additionally, the data show no effect of terameprocol on cell cycle in either HCC2429 or H460 cells. Conclusions Terameprocol significantly enhances the sensitivity of non-small cell lung carcinoma cell lines to radiation therapy, although the mechanism of action remains unclear. Further study is warranted to assess the potential of terameprocol as an agent that may enhance the therapeutic ratio of radiotherapy in lung cancer. PMID:21107289

  11. Seizures induced by playing music.

    PubMed

    Sutherling, W W; Hershman, L M; Miller, J Q; Lee, S I

    1980-09-01

    A 67-year-old organist and minister with diabetes mellitus had stereotyped focal seizures of the left lower face, jaw, and neck. Attacks occurred spontaneously or were induced when he played a specific hymn on the organ. The seizures were not induced by reading, singing, hearing, or playing the hymn silently. The patient had interictal weakness of the left lower face and left side of the tongue. Focal seizures were recorded on an electroencephalogram (EEG) at the right temporofrontal area. This patient illustrates partial seizures induced by playing music. PMID:6775246

  12. The New Face of the University of California: Undergraduate Admissions in the Aftermath of SP-1. [Background Information on the] Senate Select Committee on Higher Education Admissions and Outreach [and] Senate Select Committee on Higher Education (May 5, 1998).

    ERIC Educational Resources Information Center

    California State Legislature, Sacramento. Senate.

    This report provides background materials related to the California Senate Select Committee on Higher Education Admissions and Outreach and the California Senate Select Committee on Higher Education hearing on undergraduate admissions at the University of California (UC) and the Board of Regents' Special Proposal 1 (SP-1), which eliminated the use…

  13. Addiction of lung cancer cells to GOF p53 is promoted by up-regulation of epidermal growth factor receptor through multiple contacts with p53 transactivation domain and promoter

    PubMed Central

    Vaughan, Catherine A.; Pearsall, Isabella; Singh, Shilpa; Windle, Brad; Deb, Swati P.; Grossman, Steven R.; Yeudall, W. Andrew; Deb, Sumitra

    2016-01-01

    Human lung cancers harboring gain-of-function (GOF) p53 alleles express higher levels of the epidermal growth factor receptor (EGFR). We demonstrate that a number of GOF p53 alleles directly upregulate EGFR. Knock-down of p53 in lung cancer cells lowers EGFR expression and reduces tumorigenicity and other GOF p53 properties. However, addiction of lung cancer cells to GOF p53 can be compensated by overexpressing EGFR, suggesting that EGFR plays a critical role in addiction. Chromatin immunoprecipitation (ChIP) using lung cancer cells expressing GOF p53 alleles showed that GOF p53 localized to the EGFR promoter. The sequence where GOF p53 is found to interact by ChIP seq can act as a GOF p53 response element. The presence of GOF p53 on the EGFR promoter increased histone H3 acetylation, indicating a mechanism whereby GOF p53 enhances chromatin opening for improved access to transcription factors (TFs). ChIP and ChIP-re-ChIP with p53, Sp1 and CBP histone acetylase (HAT) antibodies revealed docking of GOF p53 on Sp1, leading to increased binding of Sp1 and CBP to the EGFR promoter. Up-regulation of EGFR can occur via GOF p53 contact at other novel sites in the EGFR promoter even when TAD-I is inactivated; these sites are used by both intact and TAD-I mutated GOF p53 and might reflect redundancy in GOF p53 mechanisms for EGFR transactivation. Thus, the oncogenic action of GOF p53 in lung cancer is highly dependent on transactivation of the EGFR promoter via a novel transcriptional mechanism involving coordinated interactions of TFs, HATs and GOF p53. PMID:26820293

  14. MAJOR OIL PLAYS IN UTAH AND VICINITY

    SciTech Connect

    Thomas C. Chidsey, Jr.

    2003-04-01

    Utah oil fields have produced a total of 1.2 billion barrels (191 million m{sup 3}). However, the 15 million barrels (2.4 million m{sup 3}) of production in 2000 was the lowest level in over 40 years and continued the steady decline that began in the mid-1980s. The Utah Geological Survey believes this trend can be reversed by providing play portfolios for the major oil producing provinces (Paradox Basin, Uinta Basin, and thrust belt) in Utah and adjacent areas in Colorado and Wyoming. Oil plays are geographic areas with petroleum potential caused by favorable combinations of source rock, migration paths, reservoir rock characteristics, and other factors. The play portfolios will include: descriptions and maps of the major oil plays by reservoir; production and reservoir data; case-study field evaluations; summaries of the state-of-the-art drilling, completion, and secondary/tertiary techniques for each play; locations of major oil pipelines; descriptions of reservoir outcrop analogs; and identification and discussion of land use constraints. All play maps, reports, databases, and so forth, produced for the project will be published in interactive, menu-driven digital (web-based and compact disc) and hard-copy formats. This report covers research activities for the second quarter of the first project year (October 1 through December 31, 2002). This work included (1) gathering field and pipeline data to produce a digital oil and gas field and pipeline map, and (2) Uinta Basin well database compilation. The oil and gas field map will help to delineate the various oil plays to be described later in the project. The map will also identify CO{sub 2} resources, and will be useful in the planning and economic evaluation of best practices using CO{sub 2} to flood mature oil reservoirs. The play descriptions will be enhanced with the updated oil and gas pipeline map. It can be used to plan economic evaluation of exploration activities and field development, particularly if H

  15. Self-playing musical instrument

    NASA Astrophysics Data System (ADS)

    Bouffard, Karen

    2001-05-01

    This do-ahead Physics Olympics competition is a musical challenge based on one designed by Dan Calder for a past New Hampshire Physics Olympics. The objective is to build a musical instrument that is self-playing.

  16. The Many Faces of Play.

    ERIC Educational Resources Information Center

    Werth, Louise H.

    1984-01-01

    Presents descriptions of play reflecting recent theories, including the psychoanalytic works of Freud, Erikson, and Peller; Piaget's developmental theory (with discussion of Sutton-Smith); and the views of Smilansky and Parten. (AS)

  17. A multiverse play divides opinion

    NASA Astrophysics Data System (ADS)

    Crease, Robert P.

    2015-03-01

    The stage lights rise. A man and woman meet in a cute way - "Do you know why it's impossible to lick the tips of your elbows?" she asks - they chat momentarily, and separate. The play is Constellations by Nick Payne.

  18. miR-7a/b attenuates post-myocardial infarction remodeling and protects H9c2 cardiomyoblast against hypoxia-induced apoptosis involving Sp1 and PARP-1

    PubMed Central

    Li, Rui; Geng, Hai-hua; Xiao, Jie; Qin, Xiao-teng; Wang, Fu; Xing, Jun-hui; Xia, Yan-fei; Mao, Yang; Liang, Jing-wen; Ji, Xiao-ping

    2016-01-01

    miRs (microRNAs, miRNAs) intricately regulate physiological and pathological processes. Although miR-7a/b protects against cardiomyocyte injury in ischemia/reperfusion injury, the function of miR-7a/b in myocardial infarction (MI)-induced cardiac remodeling remains unclear. Here, we sought to investigate the function of miR-7a/b in post-MI remodeling in a mouse model and to determine the underlying mechanisms involved. miR-7a/b overexpression improved cardiac function, attenuated cardiac remodeling and reduced fibrosis and apoptosis, whereas miR-7a/b silencing caused the opposite effects. Furthermore, miR-7a/b overexpression suppressed specific protein 1 (Sp1) and poly (ADP-ribose) polymerase (PARP-1) expression both in vivo and in vitro, and a luciferase reporter activity assay showed that miR-7a/b could directly bind to Sp1. Mithramycin, an inhibitor of the DNA binding activity of Sp1, effectively repressed PARP-1 and caspase-3, whereas knocking down miR-7a/b partially counteracted these beneficial effects. Additionally, an immunoprecipitation assay indicated that hypoxia triggered activation of the binding activity of Sp1 to the promoters of PARP-1 and caspase-3, which is abrogated by miR-7a/b. In summary, these findings identified miR-7a/b as protectors of cardiac remodeling and hypoxia-induced injury in H9c2 cardiomyoblasts involving Sp1 and PARP-1. PMID:27384152

  19. Sp1 Mediates a Therapeutic Role of MiR-7a/b in Angiotensin II-Induced Cardiac Fibrosis via Mechanism Involving the TGF-β and MAPKs Pathways in Cardiac Fibroblasts

    PubMed Central

    Li, Rui; Xiao, Jie; Qing, Xiaoteng; Xing, Junhui; Xia, Yanfei; Qi, Jia; Liu, Xiaojun; Zhang, Sen; Sheng, Xi; Zhang, Xinyu; Ji, Xiaoping

    2015-01-01

    MicroRNA-7a/b (miR-7a/b) protects cardiac myocytes from apoptosis during ischemia/reperfusion injury; however, its role in angiotensin II (ANG II)-stimulated cardiac fibroblasts (CFs) remains unknown. Therefore, the present study investigated the anti-fibrotic mechanism of miR-7a/b in ANG II-treated CFs. ANG II stimulated the expression of specific protein 1 (Sp1) and collagen I in a dose- and time-dependent manner, and the overexpression of miR-7a/b significantly down-regulated the expression of Sp1 and collagen I stimulated by ANG II (100 nM) for 24 h. miR-7a/b overexpression effectively inhibited MMP-2 expression/activity and MMP-9 expression, as well as CF proliferation and migration. In addition, miR-7a/b also repressed the activation of TGF-β, ERK, JNK and p38 by ANG II. The inhibition of Sp1 binding activity by mithramycin prevented collagen I overproduction; however, miR-7a/b down-regulation reversed this effect. Further studies revealed that Sp1 also mediated miR-7a/b-regulated MMP expression and CF migration, as well as TGF-β and ERK activation. In conclusion, miR-7a/b has an anti-fibrotic role in ANG II-treated CFs that is mediated by Sp1 mechanism involving the TGF-β and MAPKs pathways. PMID:25923922

  20. The sequence of the CA-SP1 junction accounts for the differential sensitivity of HIV-1 and SIV to the small molecule maturation inhibitor 3-O-{3',3'-dimethylsuccinyl}-betulinic acid

    PubMed Central

    Zhou, Jing; Chen, Chin Ho; Aiken, Christopher

    2004-01-01

    Background Despite the effectiveness of currently available antiretroviral therapies in the treatment of HIV-1 infection, a continuing need exists for novel compounds that can be used in combination with existing drugs to slow the emergence of drug-resistant viruses. We previously reported that the small molecule 3-O-{3',3'-dimethylsuccinyl}-betulinic acid (DSB) specifically inhibits HIV-1 replication by delaying the processing of the CA-SP1 junction in Pr55Gag. By contrast, SIVmac239 replicates efficiently in the presence of high concentrations of DSB. To determine whether sequence differences in the CA-SP1 junction can fully account for the differential sensitivity of HIV-1 and SIV to DSB, we engineered mutations in this region of two viruses and tested their sensitivity to DSB in replication assays using activated human primary CD4+ T cells. Results Substitution of the P2 and P1 residues of HIV-1 by the corresponding amino acids of SIV resulted in strong resistance to DSB, but the mutant virus replicated with reduced efficiency. Conversely, replication of an SIV mutant containing three amino acid substitutions in the CA-SP1 cleavage site was highly sensitive to DSB, and the mutations resulted in delayed cleavage of the CA-SP1 junction in the presence of the drug. Conclusions These results demonstrate that the CA-SP1 junction in Pr55Gag represents the primary viral target of DSB. They further suggest that the therapeutic application of DSB will be accompanied by emergence of mutant viruses that are highly resistant to the drug but which exhibit reduced fitness relative to wild type HIV-1. PMID:15225375

  1. Guided Play: Where Curricular Goals Meet a Playful Pedagogy

    ERIC Educational Resources Information Center

    Weisberg, Deena Skolnick; Hirsh-Pasek, Kathy; Golinkoff, Roberta Michnick

    2013-01-01

    Decades of research demonstrate that a strong curricular approach to preschool education is important for later developmental outcomes. Although these findings have often been used to support the implementation of educational programs based on direct instruction, we argue that "guided play" approaches can be equally effective at delivering content…

  2. Parent-Child Play across Cultures: Advancing Play Research

    ERIC Educational Resources Information Center

    Roopnarine, Jaipaul L.; Davidson, Kimberly L.

    2015-01-01

    In this article, the authors argue for a greater understanding of children's play across cultures through better integration of scientific thinking about the developed and developing societies, through consideration of socialization beliefs and goals, and, finally, through the use of more complex models in research investigations. They draw on…

  3. Sp1 is a co-activator with Ets-1, and Net is an important repressor of the transcription of CTP:phosphocholine cytidylyltransferase alpha.

    PubMed

    Sugimoto, Hiroyuki; Okamura, Koichi; Sugimoto, Sayaka; Satou, Motoyasu; Hattori, Tomoyasu; Vance, Dennis E; Izumi, Takashi

    2005-12-01

    Phosphatidylcholine biosynthesis via the CDP-choline pathway is primarily regulated by CTP:phosphocholine cytidylyltransferase (CT) encoded by the Pcyt1a and Pcyt1b genes. Previously, we identified an Ets-1-binding site located at -49/-47 in the promoter of Pcyt1a as an important transcriptional element involved in basal CTalpha transcription (Sugimoto, H., Sugimoto, S., Tatei, K., Obinata, H., Bakovic, M., Izumi, T., and Vance, D. E. (2003) J. Biol. Chem. 278, 19716-19722). In this study, we determined whether or not there were other important elements and binding proteins for basal CTalpha transcription in the Pcyt1a promoter, and if other Ets family proteins bind to the Ets-1-binding site. The results indicate the formation of a ternary complex with Ets-1 binding at -49/-47 and Sp1 binding at -58/-54 of the Pcyt1a promoter that is important for activating CTalpha transcription. When nuclear extracts of COS-7 cells expressing various Ets family repressors were incubated with DNA probes, binding of Net to the probes was observed. Net dose-dependently depressed the promoter-luciferase activity by 98%, even when co-expressed with Ets-1. RNA interference targeting Net caused an increase of endogenous CTalpha mRNA. After synchronizing the cell cycle in NIH3T3 cells, CTalpha mRNA increased at the S-M phase corresponding to an increase of Ets-1 mRNA and a decrease of Net mRNA. These results indicated that Net is an important endogenous repressor for CTalpha transcription. PMID:16157598

  4. Play Chinese Games. 1987, Revised.

    ERIC Educational Resources Information Center

    White, Caryn

    This document, designed to introduce all ages to a selection of popular Chinese games, describes these games and provides instructions and materials for making the items needed to play most of them. Section 1 suggests class activities that can be related to some of the games. Section 2 presents instructions for the physical or outdoor games of:…

  5. Moral Education through Play Therapy

    ERIC Educational Resources Information Center

    Mahalle, Salwa; Zakaria, Gamal Abdul Nasir; Nawi, Aliff

    2014-01-01

    This paper will discuss on how sand therapy (as one type of play therapies) can be applied as an additional technique or approach in counseling. The research questions for this study are to see what are the development, challenges faced by the therapist during the sessions given and how sand therapy can aid to the progress of the client. It is a…

  6. In Search of Serious Play

    ERIC Educational Resources Information Center

    Wallace, David

    2005-01-01

    All teaching artists have taken unexpected detours that lead to miracles. They have all created magical experiences in which people are too engaged to notice the incredible amount they are learning. As a TA, one searches for "serious play"--purposeful fun that stimulates exhilarating work and genuine learning. But how does it happen? How do TAs…

  7. Sculpting Cells with Play Doh.

    ERIC Educational Resources Information Center

    Way, Virginia A.

    1982-01-01

    Suggests using Play Doh to mold models of the nucleus, mitochondria, and inner cellular structures. Students can conceptualize the cell's structures as three-dimensional even though they appear two-dimensional under a microscope. Includes instructions for preparing homemade dough. (Author/JN)

  8. Children's Voices through Dramatic Play.

    ERIC Educational Resources Information Center

    Sierra, Zayda

    Dramatic play provides children an excellent way to express their feelings and perceptions of the world that surrounds them. It is also an alternative way for researchers and teachers to capture, understand, and interpret children's voices because of the difficulties that children have in expressing ideas through oral and written language. While…

  9. Building Curriculum during Block Play

    ERIC Educational Resources Information Center

    Andrews, Nicole

    2015-01-01

    Blocks are not just for play! In this article, Nicole Andrews describes observing the interactions of three young boys enthusiastically engaged in the kindergarten block center of their classroom, using blocks in a building project that displayed their ability to use critical thinking skills, physics exploration, and the development of language…

  10. Interpretive Reproduction in Children's Play

    ERIC Educational Resources Information Center

    Corsaro, William A.

    2012-01-01

    The author looks at children's play from the perspective of interpretive reproduction, emphasizing the way children create their own unique peer cultures, which he defines as a set of routines, artifacts, values, and concerns that children engage in with their playmates. The article focuses on two types of routines in the peer culture of preschool…

  11. Fort Play Children Recreate Recess

    ERIC Educational Resources Information Center

    Powell, Mark

    2007-01-01

    Recess beckons well before it actually arrives. Its allure can be heard in children's lunchtime conversations as they discuss imaginary roles, plans, alliances and teams, with an obvious appetite for play and its unbounded possibility. For some children, recess provides the most important reasons to come to school. In team sports, games of chase…

  12. Obama Plays Cheerleader for STEM

    ERIC Educational Resources Information Center

    Robelen, Erik W.

    2010-01-01

    Amid a struggling economy, a raft of foreign-policy headaches, and the tail end of a heated campaign season, President Barack Obama carved out time in his schedule last month to watch students in the State Dining Room demonstrate a solar-powered model car, a water-purification system, and a soccer-playing robot. The science fair was the fifth…

  13. Science Adventures in Children's Play.

    ERIC Educational Resources Information Center

    Rieger, Edythe

    The stated purpose of this pamphlet is to suggest simple, natural, interesting experiences in children's play that have science implications. It tells how the teacher may capitalize on the innate curiosity of children by incorporating science discovery in daily classroom experiences. This how-to-do-it manual directs map-making and activities for…

  14. Play Therapy with the Nonverbal.

    ERIC Educational Resources Information Center

    Leland, Henry

    Four developmental outcomes of children's play were identified as acquaintance with the environment and the development of cognitive activity, verification of incidental learning, the development through sensory and motoric activities of relationships with objects and persons, and experience with roles and rules. A child developing atypically may…

  15. Building Math through Play Everyday

    ERIC Educational Resources Information Center

    Clements, Douglas H.; Sarama, Julie

    2005-01-01

    This article focuses on how young children build math skills in everyday play and activities. Children focus on six categories of mathematical content including classifying, exploring magnitude, enumerating, investigating dynamics, studying patterns, and exploring spatial relations. The article gives advice to both teachers and parents on how they…

  16. Creating Outdoor Play & Learning Environments.

    ERIC Educational Resources Information Center

    White, Randy; Stoecklin, Vicki L.

    Why typical playgrounds are designed the way they are by adults is discussed, including what the ideal outdoor play/learning environment for children is and how the outdoor space should be considered as an extension of the classroom. The paper emphasizes the importance of nature to children, discusses the criteria playground designers should…

  17. Playing It Safe: Part II.

    ERIC Educational Resources Information Center

    Penman, Kenneth A.; Niccolai, Frances R.

    1985-01-01

    Explains how to prevent outdoor sports injuries; discusses related litigation and specific cases involving playing field turf, tennis, skiing, and pools; and sets out facility design and maintenance considerations and recommendations. A sidebar provides information about injury insurance available to NCAA schools. Part I of this article appeared…

  18. Child-Centered Play Therapy

    ERIC Educational Resources Information Center

    VanFleet, Rise; Sywulak, Andrea E.; Sniscak, Cynthia Caparosa

    2010-01-01

    Highly practical, instructive, and authoritative, this book vividly describes how to conduct child-centered play therapy. The authors are master clinicians who explain core therapeutic principles and techniques, using rich case material to illustrate treatment of a wide range of difficulties. The focus is on nondirective interventions that allow…

  19. Playing Piano across the Curriculum.

    ERIC Educational Resources Information Center

    Hamel, Barbara L.

    2000-01-01

    Contends that the amount of piano study required of music education majors to pass the piano proficiency examination is insufficient. States that keyboarding across the curriculum will enable music education majors to become proficient in playing the piano. Offers suggestions for including the keyboard within other courses. (CMK)

  20. Integrating Time, Place, and Play

    ERIC Educational Resources Information Center

    Gallavan, Nancy P.

    2004-01-01

    "Time, Place, and Play," is a short phrase, but is summarizes three very big concepts--history, geography, and culture--that are part of the elementary social studies curriculum. This article relates the story of how twenty-five elementary and middle school teachers, meeting over several weeks in a university class, designed a unit of study on the…