Science.gov

Sample records for factor sp1 plays

  1. Interaction of Sp1 zinc finger with transport factor in the nuclear localization of transcription factor Sp1

    SciTech Connect

    Ito, Tatsuo; Kitamura, Haruka; Uwatoko, Chisana; Azumano, Makiko; Itoh, Kohji; Kuwahara, Jun

    2010-12-10

    Research highlights: {yields} Sp1 zinc fingers themselves interact with importin {alpha}. {yields} Sp1 zinc finger domains play an essential role as a nuclear localization signal. {yields} Sp1 can be transported into the nucleus in an importin-dependent manner. -- Abstract: Transcription factor Sp1 is localized in the nucleus and regulates the expression of many cellular genes, but the nuclear transport mechanism of Sp1 is not well understood. In this study, we revealed that GST-fused Sp1 protein bound to endogenous importin {alpha} in HeLa cells via the Sp1 zinc finger domains, which comprise the DNA binding domain of Sp1. It was found that the Sp1 zinc finger domains directly interacted with a wide range of importin {alpha} including the armadillo (arm) repeat domain and the C-terminal acidic domain. Furthermore, it turned out that all three zinc fingers of Sp1 are essential for binding to importin {alpha}. Taken together, these results suggest that the Sp1 zinc finger domains play an essential role as a NLS and Sp1 can be transported into the nucleus in an importin-dependent manner even though it possesses no classical NLSs.

  2. O-GlcNAc inhibits interaction between Sp1 and Elf-1 transcription factors

    SciTech Connect

    Lim, Kihong; Chang, Hyo-Ihl

    2009-03-13

    The novel protein modification, O-linked N-acetylglucosamine (O-GlcNAc), plays an important role in various aspects of cell regulation. Although most of nuclear transcription regulatory factors are modified by O-GlcNAc, O-GlcNAc effects on transcription remain largely undefined yet. In this study, we show that O-GlcNAc inhibits a physical interaction between Sp1 and Elf-1 transcription factors, and negatively regulates transcription of placenta and embryonic expression oncofetal protein gene (Pem). These findings suggest that O-GlcNAc inhibits Sp1-mediated gene transcription possibly by interrupting Sp1 interaction with its cooperative factor.

  3. Role of zinc finger structure in nuclear localization of transcription factor Sp1

    SciTech Connect

    Ito, Tatsuo; Azumano, Makiko; Uwatoko, Chisana; Itoh, Kohji Kuwahara, Jun

    2009-02-27

    Transcription factor Sp1 is localized in the nucleus and regulates gene expression. Our previous study demonstrated that the carboxyl terminal region of Sp1 containing 3-zinc finger region as DNA binding domain can also serve as nuclear localization signal (NLS). However, the nuclear transport mechanism of Sp1 has not been well understood. In this study, we performed a gene expression study on mutant Sp1 genes causing a set of amino acid substitutions in zinc finger domains to elucidate nuclear import activity. Nuclear localization of the GFP-fused mutant Sp1 proteins bearing concomitant substitutions in the first and third zinc fingers was highly inhibited. These mutant Sp1 proteins had also lost the binding ability as to the GC box sequence. The results suggest that the overall tertiary structure formed by the three zinc fingers is essential for nuclear localization of Sp1 as well as dispersed basic amino acids within the zinc fingers region.

  4. Elevated SP-1 transcription factor expression and activity drives basal and hypoxia-induced vascular endothelial growth factor (VEGF) expression in non-small cell lung cancer.

    PubMed

    Deacon, Karl; Onion, David; Kumari, Rajendra; Watson, Susan A; Knox, Alan J

    2012-11-16

    VEGF plays a central role in angiogenesis in cancer. Non-small cell lung cancer (NSCLC) tumors have increased microvascular density, localized hypoxia, and high VEGF expression levels; however, there is a lack of understanding of how oncogenic and tumor microenvironment changes such as hypoxia lead to greater VEGF expression in lung and other cancers. We show that NSCLC cells secreted higher levels of VEGF than normal airway epithelial cells. Actinomycin D inhibited all NSCLC VEGF secretion, and VEGF minimal promoter-luciferase reporter constructs were constitutively active until the last 85 base pairs before the transcription start site containing three SP-1 transcription factor-binding sites; mutation of these VEGF promoter SP-1-binding sites eliminated VEGF promoter activity. Furthermore, dominant negative SP-1, mithramycin A, and SP-1 shRNA decreased VEGF promoter activity, whereas overexpression of SP-1 increased VEGF promoter activity. Chromatin immunoprecipitation assays demonstrated SP-1, p300, and PCA/F histone acetyltransferase binding and histone H4 hyperacetylation at the VEGF promoter in NSCLC cells. Cultured NSCLC cells expressed higher levels of SP-1 protein than normal airway epithelial cells, and double-fluorescence immunohistochemistry showed a strong correlation between SP-1 and VEGF in human NSCLC tumors. In addition, hypoxia-driven VEGF expression in NSCLC cells was SP-1-dependent, with hypoxia increasing SP-1 activity and binding to the VEGF promoter. These studies are the first to demonstrate that overexpression of SP-1 plays a central role in hypoxia-induced VEGF secretion. PMID:22992725

  5. Overexpression of the Transcription Factor Sp1 Activates the OAS-RNAse L-RIG-I Pathway

    PubMed Central

    Dupuis-Maurin, Valéryane; Brinza, Lilia; Baguet, Joël; Plantamura, Emilie; Schicklin, Stéphane; Chambion, Solène; Macari, Claire; Tomkowiak, Martine; Deniaud, Emmanuelle; Leverrier, Yann

    2015-01-01

    Deregulated expression of oncogenes or transcription factors such as specificity protein 1 (Sp1) is observed in many human cancers and plays a role in tumor maintenance. Paradoxically in untransformed cells, Sp1 overexpression induces late apoptosis but the early intrinsic response is poorly characterized. In the present work, we studied increased Sp1 level consequences in untransformed cells and showed that it turns on an early innate immune transcriptome. Sp1 overexpression does not activate known cellular stress pathways such as DNA damage response or endoplasmic reticulum stress, but induces the activation of the OAS-RNase L pathway and the generation of small self-RNAs, leading to the upregulation of genes of the antiviral RIG-I pathway at the transcriptional and translational levels. Finally, Sp1-induced intrinsic innate immune response leads to the production of the chemokine CXCL4 and to the recruitment of inflammatory cells in vitro and in vivo. Altogether our results showed that increased Sp1 level in untransformed cells constitutes a novel danger signal sensed by the OAS-RNase L axis leading to the activation of the RIG-I pathway. These results suggested that the OAS-RNase L-RIG-I pathway may be activated in sterile condition in absence of pathogen. PMID:25738304

  6. MPTP's pathway of toxicity indicates central role of transcription factor SP1.

    PubMed

    Maertens, Alexandra; Luechtefeld, Thomas; Kleensang, Andre; Hartung, Thomas

    2015-05-01

    Deriving a Pathway of Toxicity from transcriptomic data remains a challenging task. We explore the use of weighted gene correlation network analysis (WGCNA) to extract an initial network from a small microarray study of MPTP toxicity in mice. Five modules were statistically significant; each module was analyzed for gene signatures in the Chemical and Genetic Perturbation subset of the Molecular Signatures Database as well as for over-represented transcription factor binding sites and WGCNA clustered probes by function and captured pathways relevant to neurodegenerative disorders. The resulting network was analyzed for transcription factor candidates, which were narrowed down via text-mining for relevance to the disease model, and then combined with the large-scale interaction FANTOM4 database to generate a genetic regulatory network. Modules were enriched for transcription factors relevant to Parkinson's disease. Transcription factors significantly improved the number of genes that could be connected in a given component. For each module, the transcription factor that had, by far, the highest number of interactions was SP1, and it also had substantial experimental evidence of interactions. This analysis both captures much of the known biology of MPTP toxicity and suggests several candidates for further study. Furthermore, the analysis strongly suggests that SP1 plays a central role in coordinating the cellular response to MPTP toxicity. PMID:25851821

  7. MPTP’s Pathway of Toxicity Indicates Central Role of Transcription Factor SP1

    PubMed Central

    Maertens, Alexandra; Luechtefeld, Thomas; Kleensang, Andre

    2015-01-01

    Deriving a Pathway of Toxicity from transcriptomic data remains a challenging task. We explore the use of weighted gene correlation network analysis (WGCNA) to extract an initial network from a small microarray study of MPTP toxicity in mice. Five modules were statistically significant; each module was analyzed for gene signatures in the Chemical and Genetic Perturbation subset of the Molecular Signatures Database as well as for over-represented transcription factor binding sites and WGCNA clustered probes by function and captured pathways relevant to neurodegenerative disorders. The resulting network was analyzed for transcription factor candidates, which were narrowed down via text-mining for relevance to the disease model, and then combined with the large-scale interaction FANTOM4 database to generate a genetic regulatory network. Modules were enriched for transcription factors relevant to Parkinson’s disease. Transcription factors significantly improved the number of genes that could be connected in a given component. For each module, the transcription factor that had, by far, the highest number of interactions was SP1, and it also had substantial experimental evidence of interactions. This analysis both captures much of the known biology of MPTP toxicity and suggests several candidates for further study. Furthermore, the analysis strongly suggests that SP1 plays a central role in coordinating the cellular response to MPTP toxicity. PMID:25851821

  8. The oncoprotein HBXIP upregulates PDGFB via activating transcription factor Sp1 to promote the proliferation of breast cancer cells

    SciTech Connect

    Zhang, Yingyi; Zhao, Yu; Li, Leilei; Shen, Yu; Cai, Xiaoli; Zhang, Xiaodong; Ye, Lihong

    2013-05-03

    Highlights: •HBXIP is able to upregulate the expression of PDGFB in breast cancer cells. •HBXIP serves as a coactivator of activating transcription factor Sp1. •HBXIP stimulates the PDGFB promoter via activating transcription factor Sp1. •HBXIP promotes the proliferation of breast cancer cell via upregulating PDGFB. -- Abstract: We have reported that the oncoprotein hepatitis B virus X-interacting protein (HBXIP) acts as a novel transcriptional coactivator to promote proliferation and migration of breast cancer cells. Previously, we showed that HBXIP was able to activate nuclear factor-κB (NF-κB) in breast cancer cells. As an oncogene, the platelet-derived growth factor beta polypeptide (PDGFB) plays crucial roles in carcinogenesis. In the present study, we found that both HBXIP and PDGFB were highly expressed in breast cancer cell lines. Interestingly, HBXIP was able to increase transcriptional activity of NF-κB through PDGFB, suggesting that HBXIP is associated with PDGFB in the cells. Moreover, HBXIP was able to upregulate PDGFB at the levels of mRNA, protein and promoter in the cells. Then, we identified that HBXIP stimulated the promoter of PDGFB through activating transcription factor Sp1. In function, HBXIP enhanced the proliferation of breast cancer cells through PDGFB in vitro. Thus, we conclude that HBXIP upregulates PDGFB via activating transcription factor Sp1 to promote proliferation of breast cancer cells.

  9. Negative Regulation of DsbA-L Gene Expression by the Transcription Factor Sp1

    PubMed Central

    Fang, Qichen; Yang, Wenjing; Li, Huating; Hu, Wenxiu; Chen, Lihui; Jiang, Shan; Dong, Kun; Song, Qianqian; Wang, Chen; Chen, Shuo; Liu, Feng

    2014-01-01

    Disulfide-bond A oxidoreductase-like protein (DsbA-L) possesses beneficial effects such as promoting adiponectin multimerization and stability, increasing insulin sensitivity, and enhancing energy metabolism. The expression level of DsbA-L is negatively correlated with obesity in mice and humans, but the underlying mechanisms remain unknown. To address this question, we generated reporter gene constructs containing the promoter sequence of the mouse DsbA-L gene. Deletion analysis showed that the proximal promoter of mouse DsbA-L is located between −186 and −34 bp relative to the transcription start site. In silico analysis identified a putative Sp1 transcription factor binding site in the first intron of the DsbA-L gene. Electrophoretic mobility shift assay and chromatin immunoprecipitation analysis indicated that Sp1 bound to this intron region in vitro and in intact cells. Overexpression of Sp1 or suppressing Sp1 expression by siRNA reduced or increased DsbA-L promoter activity, respectively. The binding activity of Sp1 was gradually decreased during 3T3-L1 cell differentiation and was significantly increased in adipose tissues of obese mice. Our results identify Sp1 as an inhibitor of DsbA-L gene transcription, and the Sp1-mediated inhibition of DsbA-L gene expression may provide a mechanism underlying obesity-induced adiponectin downregulation and insulin resistance. PMID:25024375

  10. Sequence-independent induction of Sp1 transcription factor activity by phosphorothioate oligodeoxynucleotides.

    PubMed Central

    Perez, J R; Li, Y; Stein, C A; Majumder, S; van Oorschot, A; Narayanan, R

    1994-01-01

    Modified analogues of antisense oligodeoxynucleotides (ODNs), particularly phosphorothioates ([S]ODNs), have been extensively used to inhibit gene expression. The potential sequence specificity of antisense oligomers makes them attractive as molecular drugs for human diseases. The use of antisense [S]ODNs to inhibit gene expression has been complicated by frequent nonspecific effects. In this study we show in diverse cell types that [S]ODNs, independent of their base sequence, mediated the induction of an Sp1 nuclear transcription factor. The [S]ODN-mediated Sp1 induction was rapid and was associated with elevated levels of Sp1 protein. This induction was dependent on NF-kappa B activity, since inhibition of NF-kappa B activity abolished the [S]ODN-induced Sp1 activity. [S]ODN-induced Sp1 activity was seen in mouse spleen cells following in vivo administration. Sp1 activity induced by [S]ODNs required the tyrosine kinase pathway and did not have transactivating potential. These results may help to explain some of the non-specific effects often seen with [S]ODNs. Images PMID:8016096

  11. A non-canonical DNA structure is a binding motif for the transcription factor SP1 in vitro

    PubMed Central

    Raiber, Eun-Ang; Kranaster, Ramon; Lam, Enid; Nikan, Mehran; Balasubramanian, Shankar

    2012-01-01

    SP1 is a ubiquitous transcription factor that is involved in the regulation of various house-keeping genes. It is known that it acts by binding to a double-stranded consensus motif. Here, we have discovered that SP1 binds also to a non-canonical DNA structure, a G-quadruplex, with high affinity. In particular, we have studied the SP1 binding site within the promoter region of the c-KIT oncogene and found that this site can fold into an anti-parallel two-tetrad G-quadruplex. SP1 pull-down experiments from cellular extracts, together with biophysical binding assays revealed that SP1 has a comparable binding affinity for this G-quadruplex structure and the canonical SP1 duplex sequence. Using SP1 ChIP-on-chip data sets, we have also found that 87% of SP1 binding sites overlap with G-quadruplex forming sequences. Furthermore, while many of these immuoprecipitated sequences (36%) even lack the minimal SP1 consensus motif, 5′-GGGCGG-3′, we have shown that 77% of them are putative G-quadruplexes. Collectively, these data suggest that SP1 is able to bind both, canonical SP1 duplex DNA as well as G-quadruplex structures in vitro and we hypothesize that both types of interactions may occur in cells. PMID:22021377

  12. Specificity protein (Sp) transcription factors Sp1, Sp3 and Sp4 are non-oncogene addiction genes in cancer cells

    PubMed Central

    Hedrick, Erik; Cheng, Yating; Jin, Un-Ho; Kim, Kyounghyun; Safe, Stephen

    2016-01-01

    Specificity protein (Sp) transcription factor (TF) Sp1 is overexpressed in multiple tumors and is a negative prognostic factor for patient survival. Sp1 and also Sp3 and Sp4 are highly expressed in cancer cells and in this study, we have used results of RNA interference (RNAi) to show that the three TFs individually play a role in the growth, survival and migration/invasion of breast, kidney, pancreatic, lung and colon cancer cell lines. Moreover, tumor growth in athymic nude mice bearing L3.6pL pancreatic cancer cells as xenografts were significantly decreased in cells depleted for Sp1, Sp3 and Sp4 (combined) or Sp1 alone. Ingenuity Pathway Analysis (IPA) of changes in gene expression in Panc1 pancreatic cancer cells after individual knockdown of Sp1, Sp3 and Sp4 demonstrates that these TFs regulate genes and pathways that correlated with the functional responses observed after knockdown but also some genes and pathways that inversely correlated with the functional responses. However, causal IPA analysis which integrates all pathway-dependent changes in all genes strongly predicted that Sp1-, Sp3- and Sp4-regulated genes were associated with the pro-oncogenic activity. These functional and genomic results coupled with overexpression of Sp transcription factors in tumor vs. non-tumor tissues and decreased Sp1 expression with age indicate that Sp1, Sp3 and Sp4 are non-oncogene addiction (NOA) genes and are attractive drug targets for individual and combined cancer chemotherapies. PMID:26967243

  13. Transcription factors nuclear factor I and Sp1 interact with the murine collagen alpha 1 (I) promoter.

    PubMed Central

    Nehls, M C; Rippe, R A; Veloz, L; Brenner, D A

    1991-01-01

    The collagen alpha 1(I) promoter, which is efficiently transcribed in NIH 3T3 fibroblasts, contains four binding sites for trans-acting factors, as demonstrated by DNase I protection assays (D. A. Brenner, R. A. Rippe, and L. Veloz, Nucleic Acids Res. 17:6055-6064, 1989). This study characterizes the DNA-binding proteins that interact with the two proximal footprinted regions, both of which contain a reverse CCAAT box and a G + C-rich 12-bp direct repeat. Analysis by DNase I protection assays, mobility shift assays, competition with specific oligonucleotides, binding with recombinant proteins, and reactions with specific antisera showed that the transcriptional factors nuclear factor I (NF-I) and Sp1 bind to these two footprinted regions. Because of overlapping binding sites, NF-I binding and Sp1 binding appear to be mutually exclusive. Overexpression of NF-I in cotransfection experiments with the alpha 1(I) promoter in NIH 3T3 fibroblasts increased alpha 1(I) expression, while Sp1 overexpression reduced this effect, as well as basal promoter activity. The herpes simplex virus thymidine kinase promoter, which contains independent NF-I- and Sp1-binding sites, was stimulated by both factors. Therefore, expression of the collagen alpha 1(I) gene may depend on the relative activities of NF-I and Sp1. Images PMID:2072909

  14. Androgen up-regulates vascular endothelial growth factor expression in prostate cancer cells via an Sp1 binding site

    PubMed Central

    2013-01-01

    Background Vascular Endothelial Growth Factor (VEGF) is regulated by a number of different factors, but the mechanism(s) behind androgen-mediated regulation of VEGF in prostate cancer are poorly understood. Results Three novel androgen receptor (AR) binding sites were discovered in the VEGF promoter and in vivo binding of AR to these sites was demonstrated by chromatin immunoprecipitation. Mutation of these sites attenuated activation of the VEGF promoter by the androgen analog, R1881 in prostate cancer cells. The transcription factors AR and Sp1 were shown to form a nuclear complex and both bound the VEGF core promoter in chromatin of hormone treated CWR22Rv1 prostate cancer cells. The importance of the Sp1 binding site in hormone mediated activation of VEGF expression was demonstrated by site directed mutagenesis. Mutation of a critical Sp1 binding site (Sp1.4) in the VEGF core promoter region prevented activation by androgen. Similarly, suppression of Sp1 binding by Mithramycin A treatment significantly reduced VEGF expression. Conclusions Our mechanistic study of androgen mediated induction of VEGF expression in prostate cancer cells revealed for the first time that this induction is mediated through the core promoter region and is dependent upon a critical Sp1 binding site. The importance of Sp1 binding suggests that therapy targeting the AR-Sp1 complex may dampen VEGF induced angiogenesis and, thereby, block prostate cancer progression, helping to maintain the indolent form of prostate cancer. PMID:23369005

  15. Molecular Characterisation, Evolution and Expression of Hypoxia-Inducible Factor in Aurelia sp.1

    PubMed Central

    Wang, Guoshan; Yu, Zhigang; Zhen, Yu; Mi, Tiezhu; Shi, Yan; Wang, Jianyan; Wang, Minxiao; Sun, Song

    2014-01-01

    The maintenance of physiological oxygen homeostasis is mediated by hypoxia-inducible factor (HIF), a key transcriptional factor of the PHD-HIF system in all metazoans. However, the molecular evolutionary origin of this central physiological regulatory system is not well characterized. As the earliest eumetazoans, Cnidarians can be served as an interesting model for exploring the HIF system from an evolutionary perspective. We identified the complete cDNA sequence of HIF-1α (ASHIF) from the Aurelia sp.1, and the predicted HIF-1α protein (pASHIF) was comprised of 674 amino acids originating from 2,025 bp nucleotides. A Pairwise comparison revealed that pASHIF not only possessed conserved basic helix-loop-helix (bHLH) and Per-Arnt-Sim (PAS) domains but also contained the oxygen dependent degradation (ODD) and the C-terminal transactivation domains (C-TAD), the key domains for hypoxia regulation. As indicated by sequence analysis, the ASHIF gene contains 8 exons interrupted by 7 introns. Western blot analysis indicated that pASHIF that existed in the polyps and medusa of Aurelia. sp.1 was more stable for a hypoxic response than normoxia. PMID:24926666

  16. DNA binding and regulatory effects of transcription factors SP1 and USF at the rat amyloid precursor protein gene promoter.

    PubMed Central

    Hoffman, P W; Chernak, J M

    1995-01-01

    Two DNA elements which we have termed SAA and GAG have been shown to control expression of the rat amyloid precursor protein (APP) gene, and the region containing the SAA element has been shown to interact with nuclear proteins [Hoffman and Chernak (1994) Biochem. Biophys. Res. Commun. 201, 610-617]. In this report we study DNA sequences and proteins which influence the activity of the SAA element. An oligonucleotide containing the SAA element is specifically bound by nuclear proteins derived from rat PC12 cells, consistently forming four complexes designated C25, C30, C35 and C40 in electrophoretic mobility shift assays (EMSAs). We demonstrate that the C25, C30 and C40 complexes involve the binding of nuclear proteins to an SP1 consensus sequence located within the SAA element and that the C25 complex contains a protein antigenically related to the human SP1 protein. We establish further that the C35 complex requires a USF recognition site located within the SAA element and contains a protein antigenically related to the human upstream stimulatory factor (USF) protein. Using APP promoter/luciferase reporter gene constructs, we demonstrate that both the SP1 and the USF sites can play a role in the transcriptional activity of the SAA element. Finally, we show that complexes similar to the C25, C30 and C35 complexes are formed by rat cortex nuclear extracts and the SAA element in EMSA experiments, suggesting the relevance of our in vitro observations to the in vivo functioning of the rat APP promoter. Images PMID:7610052

  17. Role of Transglutaminase 2 in Liver Injury via Cross-linking and Silencing of Transcription Factor Sp1

    PubMed Central

    TATSUKAWA, HIDEKI; FUKAYA, YAYOI; FRAMPTON, GORDON; MARTINEZ–FUENTES, ANTONIO; SUZUKI, KENJI; KUO, TING–FANG; NAGATSUMA, KEISUKE; SHIMOKADO, KENTARO; OKUNO, MASATAKA; WU, JIAN; IISMAA, SIIRI; MATSUURA, TOMOKAZU; TSUKAMOTO, HIDEKAZU; ZERN, MARK A.; GRAHAM, ROBERT M.; KOJIMA, SOICHI

    2016-01-01

    Background & Aims Despite high morbidity and mortality of alcoholic liver disease worldwide, the molecular mechanisms underlying alcohol-induced liver cell death are not fully understood. Transglutaminase 2 (TG2) is a cross-linking enzyme implicated in apoptosis. TG2 levels and activity are increased in association with various types of liver injury. However, how TG2 induces hepatic apoptosis is not known. Methods Human hepatic cells or primary hepatocytes from rats or TG2+/+ and TG2−/− mice were treated with ethanol. Mice were administered anti-Fas antibody or alcohol. Liver sections were prepared from patients with alcoholic steatohepatitis. Changes in TG2 levels, Sp1 cross-linking and its activities, expression of hepatocyte growth factor receptor, c-Met, and hepatic apoptosis were measured. Results Ethanol induced apoptosis in hepatic cells, enhanced activity and nuclear accumulation of TG2 as well as accumulation of cross-linked and inactivated Sp1, and reduced expression of the Sp1-responsive gene, c-Met. These effects were rescued by TG2 knockdown, restoration of functional Sp1, or addition of hepatocyte growth factor, whereas apoptosis was reproduced by Sp1 knockdown or TG2 overexpression. Compared with TG2+/+ mice, TG2−/− mice showed markedly reduced hepatocyte apoptosis and Sp1 cross-linking following ethanol or anti-Fas treatment. Treatment of TG2+/+ mice with the TG2 inhibitors putrescine or cystamine blocked anti-Fas–induced hepatic apoptosis and Sp1 silencing. Moreover, enhanced expression of cross-linked Sp1 and TG2 was evident in hepatocyte nuclei of patients with alcoholic steatohepatitis. Conclusions TG2 induces hepatocyte apoptosis via Sp1 cross-linking and inactivation, with resultant inhibition of the expression of c-Met required for hepatic cell viability. PMID:19208340

  18. 5-Azacytidine treatment of HA-A melanoma cells induces Sp1 activity and concomitant transforming growth factor alpha expression.

    PubMed Central

    Shin, T H; Paterson, A J; Grant, J H; Meluch, A A; Kudlow, J E

    1992-01-01

    Evidence indicates DNA methylation as a part of the regulatory machinery controlling mammalian gene expression. The human melanoma cell line HA-A expresses low levels of transforming growth factor alpha (TGF-alpha). TGF-alpha mRNA accumulated, however, in response to DNA demethylation induced by a nucleoside analog, 5-azacytidine (5-azaC). The importance of DNA methylation in the TGF-alpha promoter region was examined by a transient transfection assay with luciferase reporter plasmids containing a portion of the TGF-alpha promoter. 5-azaC treatment of HA-A cells before the transfection caused a significant increase in the luciferase activity. Since input plasmids were confirmed to remain unmethylated, DNA demethylation of the TGF-alpha promoter itself does not account for the observed increase in TGF-alpha mRNA. Using an electrophoretic mobility shift assay, enhanced formation of protein-TGF-alpha promoter complex was detected in response to 5-azaC treatment. This 5-azaC-induced complex was shown to contain the transcription factor Sp1 by the following criteria: the protein-DNA complex formed on the TGF-alpha promoter contained immunoreactive Sp1; the mobility of the complex in an electrophoretic mobility shift assay was similar to that formed by recombinant Sp1; and DNase I footprinting analysis demonstrated that the 5-azaC-induced complex produced a footprint on the TGF-alpha promoter identical to that of authentic Sp1. These observations suggest that 5-azaC induces TGF-alpha expression by augmenting the Sp1 activity. However, neither the Sp1 mRNA nor its protein was induced by 5-azaC. These results suggest that in HA-A cells, TGF-alpha expression is down-modulated by DNA methylation. In addition, this process may involve the specific regulation of Sp1 activity without altering the amount of the transcription factor. Images PMID:1380648

  19. Transcription factor Sp1 inhibition, memory, and cytokines in a mouse model of Alzheimer’s disease

    PubMed Central

    Citron, Bruce A; Saykally, Jessica N; Cao, Chuanhai; Dennis, John S; Runfeldt, Melissa; Arendash, Gary W

    2015-01-01

    Transcription factors are involved to varying extents in the health and survival of neurons in the brain and a better understanding of their roles with respect to the pathogenesis of Alzheimer’s disease (AD) could lead to the development of additional treatment strategies. Sp1 is a transcription factor that responds to inflammatory signals occurring in the AD brain. It is known to regulate genes with demonstrated importance in AD, and we have previously found it upregulated in the AD brain and in brains of transgenic AD model mice. To better understand the role of Sp1 in AD, we tested whether we could affect memory function (measured with a battery of behavioral tests discriminating different aspects of cognitive function) in a transgenic model of AD by pharmaceutical modulation of Sp1. We found that inhibition of Sp1 function in transgenic AD model mice increased memory deficits, while there were no changes in sensorimotor or anxiety tests. Aβ42 and Aβ40 peptide levels were significantly higher in the treated mice, indicating that Sp1 elevation in AD could be a functionally protective response. Circulating levels of CXCL1 (KC) decreased following treatment with mithramycin, while a battery of other cytokines, including IL-1α, IL-6, INF-γ and MCP-1, were unchanged. Gene expression levels for several genes important to neuronal health were determined by qRT-PCR, and none of these appeared to change at the transcriptional level. PMID:26807343

  20. Sp1 and the ets-related transcription factor complex GABP alpha/beta functionally cooperate to activate the utrophin promoter.

    PubMed

    Gyrd-Hansen, Mads; Krag, Thomas O B; Rosmarin, Alan G; Khurana, Tejvir S

    2002-05-15

    Duchenne muscular dystrophy (DMD) is a fatal neuromuscular disease caused by the absence of dystrophin. Utrophin is the autosomal homolog of dystrophin and capable of compensating for the absence of dystrophin, when overexpressed. In skeletal muscle, utrophin plays an important role in the formation of neuromuscular junctions. This selective enrichment occurs, in part by transcriptional regulation of the utrophin gene at the sub-synaptic nuclei in muscle. Utrophin's complex transcriptional regulation is not yet fully understood, however, GABP alpha / beta has recently been shown to bind the N box and activate the utrophin promoter in response to heregulin. In this study, we show that the transcription factor Sp1 binds and activates the utrophin promoter in Drosophila S2 cells as well as define a Sp1 response element. We demonstrate that heregulin treatment of cultured muscle cells activates the ERK pathway and phosphorylates serine residue(s) in the consensus ERK recognition site of Sp1. Finally, Sp1 is shown to functionally cooperate with GABP alpha / beta and cause a 58-fold increase of de novo utrophin promoter transcription. Taken together, these findings help define mechanisms used for transcriptional regulation of utrophin expression as well as identify new targets for achieving potentially therapeutic upregulation of utrophin in DMD. PMID:11997063

  1. Stimulation of ribosomal RNA gene promoter by transcription factor Sp1 involves active DNA demethylation by Gadd45-NER pathway.

    PubMed

    Rajput, Pallavi; Pandey, Vijaya; Kumar, Vijay

    2016-08-01

    The well-studied Pol II transcription factor Sp1 has not been investigated for its regulatory role in rDNA transcription. Here, we show that Sp1 bound to specific sites on rDNA and localized into the nucleoli during the G1 phase of cell cycle to activate rDNA transcription. It facilitated the recruitment of Pol I pre-initiation complex and impeded the binding of nucleolar remodeling complex (NoRC) to rDNA resulting in the formation of euchromatin active state. More importantly, Sp1 also orchestrated the site-specific binding of Gadd45a-nucleotide excision repair (NER) complex resulting in active demethylation and transcriptional activation of rDNA. Interestingly, knockdown of Sp1 impaired rDNA transcription due to reduced engagement of the Gadd45a-NER complex and hypermethylation of rDNA. Thus, the present study unveils a novel role of Sp1 in rDNA transcription involving promoter demethylation. PMID:27156884

  2. Starvation after Cobalt-60 γ-Ray Radiation Enhances Metastasis in U251 Glioma Cells by Regulating the Transcription Factor SP1

    PubMed Central

    Zhao, Tuo; Wang, Hailong; Ma, Hong; Wang, Hao; Chen, Bo; Deng, Yulin

    2016-01-01

    Radiation is of clinical importance during glioma therapy; however, vasculature damage is observed over the treatment course. This type of tissue damage might lead to starvation conditions, affecting tumor metastasis. To test this possibility, we compared starvation conditions in conjunction with radiation treatment to monitor metastatic ability in the U251 glioma cell line. Transcriptome, western blot, and immunofluorescence analyses were used to measure the RNA and protein expression changes of the U251 cells after various treatments. We found that starvation combined with radiation treatment yielded the most significant expression changes in metastasis-related factors compared to that in the control groups. In addition, a metastasis assay was used to directly measure the metastatic ability of the treated cells, which confirmed that the U251 cells treated with starvation combined with radiation possessed the highest metastatic ability. Furthermore, bioinformatics analysis demonstrated that SP1 represented a common transcription factor associated with changes in metastasis-related factors. Blocking SP1 activity by an inhibitor suppressed the starvation-plus-radiation treatment-mediated enhancement of U251 cell metastasis. Our study provides the first evidence that starvation caused by radiation might play a significant role in enhancing the ability of the glioma cell line U251 to metastasize via regulation of the transcription factor SP1. PMID:27058528

  3. Transcription Factors Sp1 and p73 Control the Expression of the Proapoptotic Protein NOXA in the Response of Testicular Embryonal Carcinoma Cells to Cisplatin*

    PubMed Central

    Grande, Lara; Bretones, Gabriel; Rosa-Garrido, Manuel; Garrido-Martin, Eva M.; Hernandez, Teresa; Fraile, Susana; Botella, Luisa; de Alava, Enrique; Vidal, August; Garcia del Muro, Xavier; Villanueva, Alberto; Delgado, M. Dolores; Fernandez-Luna, Jose L.

    2012-01-01

    Testicular germ cell tumors (TGCTs) are highly responsive to and curable by cisplatin-based chemotherapy even in advanced stages. We have studied the molecular mechanisms involved in the induction of apoptosis in response to cisplatin, and found that proapoptotic Noxa is transcriptionally up-regulated following cisplatin exposure, even in the absence of p53, in NTERA2 cisplatin-sensitive cells but not in 1411HP-resistant cells. Blockade of Noxa reduced the apoptotic response of embryonal carcinoma (EC) NTERA2 cells to cisplatin. A detailed analysis of the Noxa promoter revealed that p73 and Sp1-like factors, Sp1 and KLF6, played key roles in the transcriptional control of this gene. Overexpression of TAp73 induced Noxa whereas the dominant negative isoform ΔNp73, reduced the levels of Noxa after cisplatin exposure in NTERA2 and 2102EP. Interestingly, down-regulation of Sp1 increased Noxa expression in response to cisplatin. However, blockade of KLF6 decreased cisplatin-induced up-regulation of Noxa in EC cell lines. In addition, tissue microarray analyses of TGCTs revealed that expression of Noxa correlates with good clinical prognosis in patients with embryonal carcinoma. Thus, our data show the transcriptional network that regulates Noxa in EC cells, which is key for their apoptotic response to cisplatin-based chemotherapy, and propose Noxa as a predictive factor of therapeutic response. PMID:22718761

  4. Transcription factors Sp1 and p73 control the expression of the proapoptotic protein NOXA in the response of testicular embryonal carcinoma cells to cisplatin.

    PubMed

    Grande, Lara; Bretones, Gabriel; Rosa-Garrido, Manuel; Garrido-Martin, Eva M; Hernandez, Teresa; Fraile, Susana; Botella, Luisa; de Alava, Enrique; Vidal, August; Garcia del Muro, Xavier; Villanueva, Alberto; Delgado, M Dolores; Fernandez-Luna, Jose L

    2012-08-01

    Testicular germ cell tumors (TGCTs) are highly responsive to and curable by cisplatin-based chemotherapy even in advanced stages. We have studied the molecular mechanisms involved in the induction of apoptosis in response to cisplatin, and found that proapoptotic Noxa is transcriptionally up-regulated following cisplatin exposure, even in the absence of p53, in NTERA2 cisplatin-sensitive cells but not in 1411HP-resistant cells. Blockade of Noxa reduced the apoptotic response of embryonal carcinoma (EC) NTERA2 cells to cisplatin. A detailed analysis of the Noxa promoter revealed that p73 and Sp1-like factors, Sp1 and KLF6, played key roles in the transcriptional control of this gene. Overexpression of TAp73 induced Noxa whereas the dominant negative isoform ΔNp73, reduced the levels of Noxa after cisplatin exposure in NTERA2 and 2102EP. Interestingly, down-regulation of Sp1 increased Noxa expression in response to cisplatin. However, blockade of KLF6 decreased cisplatin-induced up-regulation of Noxa in EC cell lines. In addition, tissue microarray analyses of TGCTs revealed that expression of Noxa correlates with good clinical prognosis in patients with embryonal carcinoma. Thus, our data show the transcriptional network that regulates Noxa in EC cells, which is key for their apoptotic response to cisplatin-based chemotherapy, and propose Noxa as a predictive factor of therapeutic response. PMID:22718761

  5. Differences in the expression of cathepsin B in B16 melanoma metastatic variants depend on transcription factor Sp1.

    PubMed

    Sitabkhan, Yasmin; Frankfater, Allen

    2007-09-01

    Cathepsin B contributes to the invasiveness of B16 melanoma cells in mice, with the highly metastatic B16a melanoma producing six- to eightfold more cathepsin B mRNA and protein than the less metastatic B16F1 variant. The proximal promoter region of the cathepsin B (Ctsb) gene (-149 to +94) was previously found to be capable of reproducing this pattern of differential gene activation in B16 melanoma variants. The binding of B16 melanoma nuclear proteins to this promoter region has now been mapped to three GC-boxes (Sp1 transcription factor binding sites) and a potential X-box [tax response element (TRE)/c-AMP responsive element (CRE) site]. Mutation of the GC-boxes at -55 and -37 independently decreased the expression of a luciferase reporter gene in B16a cells to the level observed in B16F1 cells. Promoter activity was also attenuated by mutations within the GC-rich segment between +6 and +16, but not by mutation of the putative X-box. Both Sp1 and Sp3 bound the GC-boxes in the Ctsb promoter, and western blotting showed the level of Sp1 to be greater in B16a compared to B16F1 cells. B16F1 cells that were made to express Sp1 at levels observed in B16a cells produced corresponding increased amounts of endogenous cathepsin B mRNA and enzyme activity. Thus, the difference in cathepsin B expression between high and low metastatic B16 melanoma variants is largely due to different levels of Sp1. PMID:17691867

  6. The human papillomavirus type 16 E2 transcription factor binds with low cooperativity to two flanking sites and represses the E6 promoter through displacement of Sp1 and TFIID.

    PubMed Central

    Tan, S H; Leong, L E; Walker, P A; Bernard, H U

    1994-01-01

    The E6 promoters of all genital human papillomaviruses have a characteristic alignment of transcription factor binding sites. Activation of the basic transcription complex at the TATA box depends upon a sequence-aberrant Sp1 site. Repression of E6 promoters is achieved by two binding sites for the viral E2 protein positioned between the Sp1 site and the TATA box. We have purified the human papillomavirus type 16 E2 protein after expression in Escherichia coli and studied its binding and repression properties with oligonucleotides representing the homologous promoter sequences. A Kd value of 3 x 10(-10) M indicated binding properties expected for a native protein. We found low cooperativity in the binding of two E2 dimers to flanking sites, both when these sites were separated by 3 nucleotides, as in the natural promoter, and when they were further apart. E2 protein, bound close to the distal Sp1 site, displaced the Sp1 factor even when the aberrant sequence was replaced by a typical Sp1 core recognition site. The high affinity of E2 protein for its binding site even led to Sp1 displacement at concentrations of E2 protein nearly 2 orders of magnitude lower than those of Sp1. Functional analyses of mutated E6 promoter sequences showed repression by this distal E2 binding site in the complete absence of binding to the proximal E2 binding site. From our findings and observations published by others, we conclude that each of the E2 binding sites in the E6 promoter of genital human papillomaviruses plays a separate role by displacing the transcription factors Sp1 and TFIID. Images PMID:8083979

  7. miR-29b sensitizes multiple myeloma cells to bortezomib-induced apoptosis through the activation of a feedback loop with the transcription factor Sp1

    PubMed Central

    Amodio, N; Di Martino, M T; Foresta, U; Leone, E; Lionetti, M; Leotta, M; Gullà, A M; Pitari, M R; Conforti, F; Rossi, M; Agosti, V; Fulciniti, M; Misso, G; Morabito, F; Ferrarini, M; Neri, A; Caraglia, M; Munshi, N C; Anderson, K C; Tagliaferri, P; Tassone, P

    2012-01-01

    MicroRNAs (miRNAs) with tumor-suppressor potential might have therapeutic applications in multiple myeloma (MM) through the modulation of still undiscovered molecular pathways. Here, we investigated the effects of enforced expression of miR-29b on the apoptotic occurrence in MM and highlighted its role in the context of a new transcriptional loop that is finely tuned by the proteasome inhibitor bortezomib. In details, in vitro growth inhibition and apoptosis of MM cells was induced by either transient expression of synthetic miR-29b or its stable lentivirus-enforced expression. We identified Sp1, a transcription factor endowed with oncogenic activity, as a negative regulator of miR-29b expression in MM cells. Since Sp1 expression and functions are regulated via the 26S proteasome, we investigated the effects of bortezomib on miR-29b-Sp1 loop, showing that miR-29b levels were indeed upregulated by the drug. At the same time, the bortezomib/miR-29b combination produced significant pro-apoptotic effects. We also demonstrated that the PI3K/AKT pathway plays a major role in the regulation of miR-29b-Sp1 loop and induction of apoptosis in MM cells. Finally, MM xenografts constitutively expressing miR-29b showed significant reduction of their tumorigenic potential. Our findings indicate that miR-29b is involved in a regulatory loop amenable of pharmacologic intervention and modulates the anti-MM activity of bortezomib in MM cells. PMID:23190608

  8. miR-29b sensitizes multiple myeloma cells to bortezomib-induced apoptosis through the activation of a feedback loop with the transcription factor Sp1.

    PubMed

    Amodio, N; Di Martino, M T; Foresta, U; Leone, E; Lionetti, M; Leotta, M; Gullà, A M; Pitari, M R; Conforti, F; Rossi, M; Agosti, V; Fulciniti, M; Misso, G; Morabito, F; Ferrarini, M; Neri, A; Caraglia, M; Munshi, N C; Anderson, K C; Tagliaferri, P; Tassone, P

    2012-01-01

    MicroRNAs (miRNAs) with tumor-suppressor potential might have therapeutic applications in multiple myeloma (MM) through the modulation of still undiscovered molecular pathways. Here, we investigated the effects of enforced expression of miR-29b on the apoptotic occurrence in MM and highlighted its role in the context of a new transcriptional loop that is finely tuned by the proteasome inhibitor bortezomib. In details, in vitro growth inhibition and apoptosis of MM cells was induced by either transient expression of synthetic miR-29b or its stable lentivirus-enforced expression. We identified Sp1, a transcription factor endowed with oncogenic activity, as a negative regulator of miR-29b expression in MM cells. Since Sp1 expression and functions are regulated via the 26S proteasome, we investigated the effects of bortezomib on miR-29b-Sp1 loop, showing that miR-29b levels were indeed upregulated by the drug. At the same time, the bortezomib/miR-29b combination produced significant pro-apoptotic effects. We also demonstrated that the PI3K/AKT pathway plays a major role in the regulation of miR-29b-Sp1 loop and induction of apoptosis in MM cells. Finally, MM xenografts constitutively expressing miR-29b showed significant reduction of their tumorigenic potential. Our findings indicate that miR-29b is involved in a regulatory loop amenable of pharmacologic intervention and modulates the anti-MM activity of bortezomib in MM cells. PMID:23190608

  9. Transcription factors YY1, Sp1 and Sp3 modulate dystrophin Dp71 gene expression in hepatic cells.

    PubMed

    Peñuelas-Urquides, Katia; Becerril-Esquivel, Carolina; Mendoza-de-León, Laura C; Silva-Ramírez, Beatriz; Dávila-Velderrain, José; Cisneros, Bulmaro; de León, Mario Bermúdez

    2016-07-01

    Dystrophin Dp71, the smallest product encoded by the Duchenne muscular dystrophy gene, is ubiquitously expressed in all non-muscle cells. Although Dp71 is involved in various cellular processes, the mechanisms underlying its expression have been little studied. In hepatic cells, Dp71 expression is down-regulated by the xenobiotic β-naphthoflavone. However, the effectors of this regulation remain unknown. In the present study we aimed at identifying DNA elements and transcription factors involved in Dp71 expression in hepatic cells. Relevant DNA elements on the Dp71 promoter were identified by comparing Dp71 5'-end flanking regions between species. The functionality of these elements was demonstrated by site-directed mutagenesis. Using EMSAs and ChIP, we showed that the Sp1 (specificity protein 1), Sp3 (specificity protein 3) and YY1 (Yin and Yang 1) transcription factors bind to the Dp71 promoter region. Knockdown of Sp1, Sp3 and YY1 in hepatic cells increased endogenous Dp71 expression, but reduced Dp71 promoter activity. In summary, Dp71 expression in hepatic cells is carried out, in part, by YY1-, Sp1- and Sp3-mediated transcription from the Dp71 promoter. PMID:27143785

  10. Transcription factor Sp1 regulates T-type Ca(2+) channel CaV 3.1 gene expression.

    PubMed

    González-Ramírez, Ricardo; Martínez-Hernández, Elizabeth; Sandoval, Alejandro; Felix, Ricardo

    2014-05-01

    Voltage-gated T-type Ca(2+) (CaV 3) channels mediate a number of physiological events in developing and mature cells, and are implicated in neurological and cardiovascular diseases. In mammals, there are three distinct T-channel genes (CACNA1G, CACNA1H, and CACNA1I) encoding proteins (CaV 3.1-CaV 3.3) that differ in their localization as well as in molecular, biophysical, and pharmacological properties. The CACNA1G is a large gene that contains 38 exons and is localized in chromosome 17q22. Only basic characteristics of the CACNA1G gene promoter region have been investigated classifying it as a TATA-less sequence containing several potential transcription factor-binding motifs. Here, we cloned and characterized a proximal promoter region and initiated the analysis of transcription factors that control CaV 3.1 channel expression using the murine Cacna1g gene as a model. We isolated a ∼1.5 kb 5'-upstream region of Cacna1g and verified its transcriptional activity in the mouse neuroblastoma N1E-115 cell line. In silico analysis revealed that this region possesses a TATA-less minimal promoter that includes two potential transcription start sites and four binding sites for the transcription factor Sp1. The ability of one of these sites to interact with the transcription factor was confirmed by electrophoretic mobility shift assays. Consistent with this, Sp1 over-expression enhanced promoter activity while siRNA-mediated Sp1 silencing significantly decreased the level of CaV 3.1 protein and reduced the amplitude of whole-cell T-type Ca(2+) currents expressed in the N1E-115 cells. These results provide new insights into the molecular mechanisms that control CaV 3.1 channel expression. PMID:23868804

  11. Interplay of posttranslational modifications in Sp1 mediates Sp1 stability during cell cycle progression.

    PubMed

    Wang, Yi-Ting; Yang, Wen-Bin; Chang, Wen-Chang; Hung, Jan-Jong

    2011-11-18

    Although Sp1 is known to undergo posttranslational modifications such as phosphorylation, glycosylation, acetylation, sumoylation, and ubiquitination, little is known about the possible interplay between the different forms of Sp1 that may affect its overall levels. It is also unknown whether changes in the levels of Sp1 influence any biological cell processes. Here, we identified RNF4 as the ubiquitin E3 ligase of Sp1. From in vitro and in vivo experiments, we found that sumoylated Sp1 can recruit RNF4 as a ubiquitin E3 ligase that subjects sumoylated Sp1 to proteasomal degradation. Sp1 mapping revealed two ubiquitination-related domains: a small ubiquitin-like modifier in the N-terminus of Sp1(Lys16) and the C-terminus of Sp1 that directly interacts with RNF4. Interestingly, when Sp1 was phosphorylated at Thr739 by c-Jun NH(2)-terminal kinase 1 during mitosis, this phosphorylated form of Sp1 abolished the Sp1-RNF4 interaction. Our results show that, while sumoylated Sp1 subjects to proteasomal degradation, the phosphorylation that occurs during the cell cycle can protect Sp1 from degradation by repressing the Sp1-RNF4 interaction. Thus, we propose that the interplay between posttranslational modifications of Sp1 plays an important role in cell cycle progression and keeps Sp1 at a critical level for mitosis. PMID:21983342

  12. O-GlcNAc Modification of Transcription Factor Sp1 Mediates Hyperglycemia-Induced VEGF-A Upregulation in Retinal Cells

    PubMed Central

    Donovan, Kelly; Alekseev, Oleg; Qi, Xin; Cho, William; Azizkhan-Clifford, Jane

    2014-01-01

    Purpose. Proangiogenic protein VEGF-A contributes significantly to retinal lesions and neovascularization in diabetic retinopathy (DR). In preclinical DR, hyperglycemia can upregulate VEGF-A in retinal cells. The VEGF-A promoter is responsive to the transcription factor specificity protein 1 (Sp1). The O-GlcNAc modification is driven by glucose concentration and has a profound effect on Sp1 activity. This study investigated the effects of hyperglycemia on Sp1-mediated expression of VEGF-A in the retinal endothelium and pigment epithelium. Methods. Hyperglycemia-exposed ARPE-19 (human retinal pigment epithelial cells) and TR-iBRB (rat retinal microendothelial cells) were assayed for levels of VEGF-A by qRT-PCR, Western blot, and ELISA. Small molecule inhibitors of O-GlcNAc transferase (OGT) or O-GlcNAcase (OGA) were used to manipulate O-GlcNAc levels. Vascular endothelial growth factor–A protein and transcript were measured in cells depleted of OGT or Sp1 by shRNA. The proximal VEGF-A promoter was analyzed for glucose sensitivity by luciferase assay. Chromatin immunoprecipitation (ChIP) was used to assess Sp1 occupancy on the VEGF-A promoter. Results. Hyperglycemia increased VEGF-A promoter activity and upregulated VEGF-A transcript and protein. Elevation of O-GlcNAc by OGA inhibitors was sufficient to increase VEGF-A. O-GlcNAc transferase inhibition abrogated glucose-driven VEGF-A. Cellular depletion of OGT or Sp1 by shRNA significantly abrogated glucose-induced changes in VEGF-A. ChIP analysis showed that hyperglycemia significantly increased binding of Sp1 to the VEGF-A promoter. Conclusions. Hyperglycemia-driven VEGF-A production is mediated by elevated O-GlcNAc modification of the Sp1 transcription factor. This mechanism may be significant in the pathogenesis of preclinical DR through VEGF-A upregulation. PMID:25352121

  13. Involvement of PKC{alpha} in insulin-induced PKC{delta} expression: Importance of SP-1 and NF{kappa}B transcription factors

    SciTech Connect

    Horovitz-Fried, Miriam; Sampson, Sanford R. . E-mail: sampsos@mail.biu.ac.il

    2007-01-05

    Protein kinase C delta (PKC{delta}) is a key molecule in insulin signaling essential for insulin-induced glucose transport in skeletal muscle. Recent studies in our laboratory have shown that insulin rapidly stimulates PKC{delta} activity and increases PKC{delta} protein and RNA levels, and that the SP-1 transcription factor is involved in insulin-induced transcription of the PKC{delta} gene. Activation of SP-1 involves serine phosphorylation and translocation to the nucleus. In this study we examined the possibility that PKC{alpha} might be involved in serine phosphorylation and activation of SP-1. We found that insulin rapidly phosphorylates and translocates SP-1. In the cytoplasm, SP-1 was constitutively associated with PKC{alpha}, and insulin stimulation caused these proteins to dissociate. In contrast, in the nucleus insulin induced an increase in association between PKC{alpha} and SP-1. PKC{alpha} inhibition blocked insulin-induced serine phosphorylation of SP-1 and its association with PKC{alpha} in the nucleus. Inhibition of PKC{alpha} also reduced the insulin-induced increase in PKC{delta} RNA and protein in the cytoplasmic and nuclear fractions. We also attempted to determine if another transcription factor might be involved in regulation of PKC{delta} expression. We earlier showed that insulin did not affect nuclear NF{kappa}B levels. Inhibition of NF{kappa}B, however, increased insulin-induced increase in PKC{delta} RNA and protein in the cytoplasmic and nuclear fractions. Surprisingly, this inhibition reduced the insulin-induced increase in cytoplasmic and nuclear PKC{alpha} RNA and protein. Inhibition of PKC{delta} reduced I{kappa}B{alpha} phosphorylation as well as NF{kappa}B activation. Thus, PKC{alpha} regulates insulin-induced PKC{delta} expression levels and this regulation involves activation of SP-1 and NF{kappa}B.

  14. NF-κB Activation Limits Airway Branching through Inhibition of Sp1-Mediated Fibroblast Growth Factor-10 Expression

    PubMed Central

    Benjamin, John T.; Carver, Billy J.; Plosa, Erin J.; Yamamoto, Yasutoshi; Miller, J. Davin; Liu, Jin-Hua; van der Meer, Riet; Blackwell, Timothy S.; Prince, Lawrence S.

    2015-01-01

    Bronchopulmonary dysplasia (BPD) is a frequent complication of preterm birth. This chronic lung disease results from arrested saccular airway development and is most common in infants exposed to inflammatory stimuli. In experimental models, inflammation inhibits expression of fibroblast growth factor-10 (FGF-10) and impairs epithelial–mesenchymal interactions during lung development; however, the mechanisms connecting inflammatory signaling with reduced growth factor expression are not yet understood. In this study we found that soluble inflammatory mediators present in tracheal fluid from preterm infants can prevent saccular airway branching. In addition, LPS treatment led to local production of mediators that inhibited airway branching and FGF-10 expression in LPS-resistant C.C3-Tlr4Lpsd/J fetal mouse lung explants. Both direct NF-κB activation and inflammatory cytokines (IL-1β and TNF-α) that activate NF-κB reduced FGF-10 expression, whereas chemokines that signal via other inflammatory pathways had no effect. Mutational analysis of the FGF-10 promoter failed to identify genetic elements required for direct NF-κB–mediated FGF-10 inhibition. Instead, NF-κB activation appeared to interfere with the normal stimulation of FGF-10 expression by Sp1. Chromatin immunoprecipitation and nuclear coimmunoprecipitation studies demonstrated that the RelA subunit of NF-κB and Sp1 physically interact at the FGF-10 promoter. These findings indicate that inflammatory signaling through NF-κB disrupts the normal expression of FGF-10 in fetal lung mesenchyme by interfering with the transcriptional machinery critical for lung morphogenesis. PMID:20861353

  15. Hepatitis C virus nonstructural protein-5A activates sterol regulatory element-binding protein-1c through transcription factor Sp1

    SciTech Connect

    Xiang, Zhonghua; Qiao, Ling; Zhou, Yan; Babiuk, Lorne A.; Liu, Qiang

    2010-11-19

    Research highlights: {yields} A chimeric subgenomic HCV replicon expresses HCV-3a NS5A in an HCV-1b backbone. {yields} HCV-3a NS5A increases mature SREBP-1c protein level. {yields} HCV-3a NS5A activates SREBP-1c transcription. {yields} Domain II of HCV-3a NS5A is more effective in SREBP-1c promoter activation. {yields} Transcription factor Sp1 is required for SREBP-1c activation by HCV-3a NS5A. -- Abstract: Steatosis is an important clinical manifestation of hepatitis C virus (HCV) infection. The molecular mechanisms of HCV-associated steatosis are not well understood. Sterol regulatory element-binding protein-1c (SREBP-1c) is a key transcription factor which activates the transcription of lipogenic genes. Here we showed that the nuclear, mature SREBP-1c level increases in the nucleus of replicon cells expressing HCV-3a nonstructural protein-5A (NS5A). We further showed that HCV-3a NS5A up-regulates SREBP-1c transcription. Additional analysis showed that transcriptional factor Sp1 is involved in SREBP-1c activation by HCV-3a NS5A because inhibition of Sp1 activity by mithramycin A or a dominant-negative Sp1 construct abrogated SREBP-1c promoter activation by HCV-3a NS5A. In addition, chromatin immunoprecipitation (ChIP) assay demonstrated enhanced binding of Sp1 on the SREBP-1c promoter in HCV-3a NS5A replicon cells. These results showed that HCV-3a NS5A activates SREBP-1c transcription through Sp1. Taken together, our results suggest that HCV-3a NS5A is a contributing factor for steatosis caused by HCV-3a infection.

  16. Sp1 Transcription Factor Interaction with Accumulated Prelamin A Impairs Adipose Lineage Differentiation in Human Mesenchymal Stem Cells: Essential Role of Sp1 in the Integrity of Lipid Vesicles

    PubMed Central

    Ruiz de Eguino, Garbiñe; Infante, Arantza; Schlangen, Karin; Aransay, Ana M.; Fullaondo, Ane; Soriano, Mario; García-Verdugo, José Manuel; Martín, Ángel G.

    2012-01-01

    Lamin A (LMNA)-linked lipodystrophies may be either genetic (associated with LMNA mutations) or acquired (associated with the use of human immunodeficiency virus protease inhibitors [PIs]), and in both cases they share clinical features such as anomalous distribution of body fat or generalized loss of adipose tissue, metabolic alterations, and early cardiovascular complications. Both LMNA-linked lipodystrophies are characterized by the accumulation of the lamin A precursor prelamin A. The pathological mechanism by which prelamin A accumulation induces the lipodystrophy associated phenotypes remains unclear. Since the affected tissues in these disorders are of mesenchymal origin, we have generated an LMNA-linked experimental model using human mesenchymal stem cells treated with a PI, which recapitulates the phenotypes observed in patient biopsies. This model has been demonstrated to be a useful tool to unravel the pathological mechanism of the LMNA-linked lipodystrophies, providing an ideal system to identify potential targets to generate new therapies for drug discovery screening. We report for the first time that impaired adipogenesis is a consequence of the interaction between accumulated prelamin A and Sp1 transcription factor, sequestration of which results in altered extracellular matrix gene expression. In fact, our study shows a novel, essential, and finely tuned role for Sp1 in adipose lineage differentiation in human mesenchymal stem cells. These findings define a new physiological experimental model to elucidate the pathological mechanisms LMNA-linked lipodystrophies, creating new opportunities for research and treatment not only of LMNA-linked lipodystrophies but also of other adipogenesis-associated metabolic diseases. PMID:23197810

  17. Triptolide-induced Cell Death in Pancreatic Cancer Is Mediated by O-GlcNAc Modification of Transcription Factor Sp1*

    PubMed Central

    Banerjee, Sulagna; Sangwan, Veena; McGinn, Olivia; Chugh, Rohit; Dudeja, Vikas; Vickers, Selwyn M.; Saluja, Ashok K.

    2013-01-01

    Pancreatic cancer, the fourth most prevalent cancer-related cause of death in the United States, is a disease with a dismal survival rate of 5% 5 years after diagnosis. One of the survival proteins responsible for its extraordinary ability to evade cell death is HSP70. A naturally derived compound, triptolide, and its water-soluble prodrug, Minnelide, down-regulate the expression of this protein in pancreatic cancer cells, thereby causing cell death. However, the mechanism of action of triptolide has not been elucidated. Our study shows that triptolide-induced down-regulation of HSP70 expression is associated with a decrease in glycosylation of the transcription factor Sp1. We further show that triptolide inhibits glycosylation of Sp1, inhibiting the hexosamine biosynthesis pathway, particularly the enzyme O-GlcNAc transferase. Inhibition of O-GlcNAc transferase prevents nuclear localization of Sp1 and affects its DNA binding activity. This in turn down-regulates prosurvival pathways like NF-κB, leading to inhibition of HSF1 and HSP70 and eventually to cell death. In this study, we evaluated the mechanism by which triptolide affects glycosylation of Sp1, which in turn affects downstream pathways controlling survival of pancreatic cancer cells. PMID:24129563

  18. Triptolide-induced cell death in pancreatic cancer is mediated by O-GlcNAc modification of transcription factor Sp1.

    PubMed

    Banerjee, Sulagna; Sangwan, Veena; McGinn, Olivia; Chugh, Rohit; Dudeja, Vikas; Vickers, Selwyn M; Saluja, Ashok K

    2013-11-22

    Pancreatic cancer, the fourth most prevalent cancer-related cause of death in the United States, is a disease with a dismal survival rate of 5% 5 years after diagnosis. One of the survival proteins responsible for its extraordinary ability to evade cell death is HSP70. A naturally derived compound, triptolide, and its water-soluble prodrug, Minnelide, down-regulate the expression of this protein in pancreatic cancer cells, thereby causing cell death. However, the mechanism of action of triptolide has not been elucidated. Our study shows that triptolide-induced down-regulation of HSP70 expression is associated with a decrease in glycosylation of the transcription factor Sp1. We further show that triptolide inhibits glycosylation of Sp1, inhibiting the hexosamine biosynthesis pathway, particularly the enzyme O-GlcNAc transferase. Inhibition of O-GlcNAc transferase prevents nuclear localization of Sp1 and affects its DNA binding activity. This in turn down-regulates prosurvival pathways like NF-κB, leading to inhibition of HSF1 and HSP70 and eventually to cell death. In this study, we evaluated the mechanism by which triptolide affects glycosylation of Sp1, which in turn affects downstream pathways controlling survival of pancreatic cancer cells. PMID:24129563

  19. Transcription factor-pathway co-expression analysis reveals cooperation between SP1 and ESR1 on dysregulating cell cycle arrest in non-hyperdiploid multiple myeloma

    PubMed Central

    Wang, Xujun; Yan, Zhenyu; Fulciniti, Mariateresa; Li, Yingxiang; Gkotzamanidou, Maria; Amin, Samir B; Shah, Parantu K; Zhang, Yong

    2014-01-01

    Multiple myeloma is a hematological cancer of plasma B-cells and remains incurable. Two major subtypes of myeloma, hyperdiploid (HMM) and non-hyperdiploid myeloma (NHMM), have distinct chromosomal alterations and different survival outcomes. Transcription factors (TrFs) have been implicated in myeloma oncogenesis but their dysregulation in myeloma subtypes are less studied. Here we develop a TrF-pathway co-expression analysis to identify altered co-expression between two sample types. We apply the method to the two myeloma subtypes and the cell cycle arrest pathway, which is significantly differentially expressed between the two subtypes. We find that TrFs MYC, NF-κB and HOXA9 have significantly lower co-expression with cell cycle arrest in HMM, co-occurring with their over-activation in HMM. In contrast, TrFs ESR1, SP1 and E2F1 have significantly lower co-expression with cell cycle arrest in NHMM. SP1 ChIP targets are enriched by cell cycle arrest genes. These results motivate a cooperation model of ESR1 and SP1 in regulating cell cycle arrest, and a hypothesis that their over-activation in NHMM disrupts proper regulation of cell cycle arrest. Co-targeting ESR1 and SP1 shows a synergistic effect on inhibiting myeloma proliferation in NHMM cell lines. Therefore, studying TrF-pathway co-expression dysregulation in human cancers facilitates forming novel hypotheses towards clinical utility. PMID:23925045

  20. Transcriptional regulation of the human cystathionine beta-synthase -1b basal promoter: synergistic transactivation by transcription factors NF-Y and Sp1/Sp3.

    PubMed Central

    Ge, Y; Konrad, M A; Matherly, L H; Taub, J W

    2001-01-01

    Cystathionine beta-synthase (CBS) catalyses the condensation of serine and homocysteine to form cystathionine, an intermediate step in the synthesis of cysteine. Human CBS encodes five distinct 5' non-coding exons, the most frequent termed CBS -1a and CBS -1b, each transcribed from its own unique GC-rich TATA-less promoter. The minimal transcriptional region (-3792 to -3667) of the CBS -1b promoter was defined by 5'- and 3'-deletions, and transient transfections of reporter gene constructs in HepG2 cells, characterized by CBS transcription exclusively from the -1b promoter. Included in this 125 bp region are 3 GC-boxes (termed GC-a, GC-b and GC-c), an inverted CAAT-box and an E-box. By gel-shift and supershift assays, binding of specificity protein (Sp)1 and Sp3 to the GC-box elements, upstream stimulatory factor 1 (USF-1) to the E-box, and both nuclear factor (NF)-Y and an NF-1-like factor to the CAAT box could be demonstrated. By transient trans fections and reporter gene assays in HepG2 and Drosophila SL2 cells, a functional interplay was indicated between NF-Y binding to the CAAT-box, or between USF-1 binding to the E-box, and Sp1/Sp3 binding to the GC-box elements. In SL2 cells, NF-Y and Sp1/Sp3 were synergistic. Furthermore, both Sp1 and the long Sp3 isoform transactivated the CBS -1b minimal promoter; however, the short Sp3 isoforms were potent repressors. These results may explain the cell- or tissue-specific regulation of CBS transcription, and clarify the bases for alterations in CBS gene expression in human disease and Down's syndrome. PMID:11415440

  1. Arsenic trioxide-mediated growth inhibition in gallbladder carcinoma cells via down-regulation of Cyclin D1 transcription mediated by Sp1 transcription factor

    SciTech Connect

    Ai, Zhilong; Lu, Weiqi; Ton, Saixiong; Liu, Houbao; Sou, Tao; Shen, Zhenbin; Qin, Xinyu . E-mail: smc_jjh@yahoo.com.cn

    2007-08-31

    Gallbladder carcinoma (GBC), an aggressive and mostly lethal malignancy, is known to be resistant to a number of drug stimuli. Here, we demonstrated that arsenic trioxide inhibited the proliferation of gallbladder carcinoma in vivo and in vitro as well as the transcription of cell cycle-related protein Cyclin D1. And, Cyclin D1 overexpression inhibited the negative role of arsenic trioxide in cell cycle progression. We further explored the mechanisms by which arsenic trioxide affected Cyclin D1 transcription and found that the Sp1 transcription factor was down-regulated by arsenic trioxide, with a corresponding decrease in Cyclin D1 promoter activity. Taken together, these results suggested that arsenic trioxide inhibited gallbladder carcinoma cell proliferation via down-regulation of Cyclin D1 transcription in a Sp1-dependent manner, which provided a new mechanism of arsenic trioxide-involved cell proliferation and may have important therapeutic implications in gallbladder carcinoma patients.

  2. Brg-1 mediates the constitutive and fenretinide-induced expression of SPARC in mammary carcinoma cells via its interaction with transcription factor Sp1

    PubMed Central

    2010-01-01

    Background Secreted protein, acidic and rich in cysteine (SPARC) is a matricellular protein that mediates cell-matrix interactions. It has been shown, depending on the type of cancer, to possess either pro- or anti-tumorigenic properties. The transcriptional regulation of the SPARC gene expression has not been fully elucidated and the effects of anti-cancer drugs on this process have not been explored. Results In the present study, we demonstrated that chromatin remodeling factor Brg-1 is recruited to the proximal SPARC promoter region (-130/-56) through an interaction with transcription factor Sp1. We identified Brg-1 as a critical regulator for the constitutive expression levels of SPARC mRNA and protein in mammary carcinoma cell lines and for SPARC secretion into culture media. Furthermore, we found that Brg-1 cooperates with Sp1 to enhance SPARC promoter activity. Interestingly, fenretinide [N-4(hydroxyphenyl) retinamide, 4-HPR], a synthetic retinoid with anti-cancer properties, was found to up-regulate the transcription, expression and secretion of SPARC via induction of the Brg-1 in a dose-dependent manner. Finally, our results demonstrated that fenretinide-induced expression of SPARC contributes significantly to a decreased invasion of mammary carcinoma cells. Conclusions Overall, our results reveal a novel cooperative role of Brg-1 and Sp1 in mediating the constitutive and fenretinide-induced expression of SPARC, and provide new insights for the understanding of the anti-cancer effects of fenretinide. PMID:20687958

  3. Altered Expression of NF- κ B and SP1 after Exposure to Advanced Glycation End-Products and Effects of Neurotrophic Factors in AGEs Exposed Rat Retinas.

    PubMed

    Bikbova, Guzel; Oshitari, Toshiyuki; Baba, Takayuki; Yamamoto, Shuichi

    2015-01-01

    To determine the effect of advanced glycation end-products (AGEs) on neurite regeneration, and also to determine the regenerative effects of different neurotrophic factors (NTFs) on rat retinal explants, the retinas of SD rats were cultured in three-dimensional collagen gels and incubated in 6 types of media: (1) serum-free control culture media; (2) 100 μg/mL AGEs-BSA media; (3) AGEs-BSA + 100 ng/mL neurotrophin-4 (NT-4) media; (4) AGEs-BSA + 100 ng/mL hepatocyte growth factor media; (5) AGEs-BSA + 100 ng/mL glial cell line-derived neurotrophic factor media; or (6) AGEs-BSA + 100 µM tauroursodeoxycholic acid media. After 7 days, the number of regenerating neurites was counted. The explants were immunostained for nuclear factor-κB (NF-κB) and specificity protein 1 (SP1). Statistical analyses were performed by one-way ANOVA. In retinas incubated with AGEs, the numbers of neurites were fewer than in control. All of the NTFs increased the number of neurites, and the increase was more significant in the NT-4 group. The number of NF-κB and SP1 immunopositive cells was higher in retinas exposed to AGEs than in control. All of the NTFs decreased the number of NF-κB immunopositive cells but did not significantly affect SP1 expression. These results demonstrate the potential of the NTFs as axoprotectants in AGEs exposed retinal neurons. PMID:26078979

  4. Contribution of transcription factor, SP1, to the promotion of HB-EGF expression in defense mechanism against the treatment of irinotecan in ovarian clear cell carcinoma

    PubMed Central

    Miyata, Kohei; Yotsumoto, Fusanori; Nam, Sung Ouk; Odawara, Takashi; Manabe, Sadao; Ishikawa, Toyokazu; Itamochi, Hiroaki; Kigawa, Junzo; Takada, Shuji; Asahara, Hiroshi; Kuroki, Masahide; Miyamoto, Shingo

    2014-01-01

    Ovarian clear cell carcinoma (OCCC) is a worst histological subtype than other ovarian malignant tumor. Heparin-binding epidermal growth factor-like growth factor (HB-EGF) is a promising target for ovarian cancer therapy. The aims of this study were to validate the efficacy of HB-EGF–targeted therapy for OCCC and to identify the transcription factor that contributed to the induction of HB-EGF by SN38 treatment in OCCC cells. HB-EGF was highly expressed in OCCC cells, and an increase of HB-EGF was induced by SN38 which had only antitumor effect among conventional anticancer agents on OCCC. A specific inhibitor of HB-EGF, a cross-reacting material 197 (CRM197), led to a synergistic increase in the number of apoptotic OCCC cells with the treatment of SN38. The luciferase assay with 5′-deletion promoter constructs identified a GC-rich element between −125 and −178 (the distal transcription start site was denoted +1) as a cis-regulatory region, and the treatment of SN38 induced luciferase activity in this region. An in silico and chromatin immunoprecipitation analysis estimated that SP1 bound to the cis-regulatory region of HB-EGF in OCCC cells. Real-time PCR and cell viability assays showed that the transfection of a small interfering RNA targeting SP1 suppressed the expression of HB-EGF induced by SN38, resulting in the enhanced sensitivity of SN38. Taken together, these results indicate that induction of HB-EGF expression contributed to defense mechanism against treatment of SN38 through the transcriptional activity of SP1 in OCCC cells. PMID:25060396

  5. Regulation of the Cyclin-dependent Kinase Inhibitor 1A Gene (CDKN1A) by the Repressor BOZF1 through Inhibition of p53 Acetylation and Transcription Factor Sp1 Binding*

    PubMed Central

    Kim, Min-Kyeong; Jeon, Bu-Nam; Koh, Dong-In; Kim, Kyung-Sup; Park, So-Yoon; Yun, Chae-Ok; Hur, Man-Wook

    2013-01-01

    The human POZ domain and Krüppel-like zinc finger (POK) family proteins play important roles in the regulation of apoptosis, cell proliferation, differentiation, development, oncogenesis, and tumor suppression. A novel POK family transcription factor, BTB/POZ and zinc finger domains factor on chromosome 1 (BOZF-1; also called ZBTB8A), contains a POZ domain and two C2H2-type Krüppel-like zinc fingers and is localized at nuclear speckles. Compared with paired normal tissues, BOZF1 expression is increased in cancer tissues of the prostate, breast, and cervix. BOZF1 repressed the transcription of p21WAF/CDKN1A by acting on the proximal promoter concentrated with Sp1-binding GC boxes. BOZF1 competed with Sp1 in binding to GC boxes 1–5/6 of the CDKN1A proximal promoter. In addition, BOZF1 interacted with p53 and decreased the acetylation of p53 by p300, which reduced the DNA binding activity of p53 at the far distal p53-binding element. BOZF1 blocked the two major molecular events that are important in both constitutive and inducible transcription activation of CDKN1A. BOZF1 is unique in that it bound to all the proximal GC boxes to repress transcription, and it inhibited p53 acetylation without affecting p53 stability. BOZF1 might be a novel proto-oncoprotein that stimulates cell proliferation. PMID:23329847

  6. Reduced O glycosylation of Sp1 is associated with increased proteasome susceptibility.

    PubMed Central

    Han, I; Kudlow, J E

    1997-01-01

    Sp1 is a ubiquitously expressed transcription factor that is particularly important for the regulation of TATA-less genes that encode housekeeping proteins. Most growth factors and receptors are also encoded by such genes. Sp1 is multiply O glycosylated by covalent linkage of the monosaccharide N-acetylglucosamine (O-GlcNAc) to serine and threonine residues. Based on an earlier observation that growth factor gene transcription can be regulated by glucose and glucosamine in vascular smooth muscle cells, we determined whether Sp1 glycosylation could be regulated and if this modification altered Sp1 function. We found that Sp1 becomes hyperglycosylated when cells are exposed to 5 mM glucosamine, whereas under glucose starvation, stimulation with cyclic AMP (cAMP) results in nearly complete deglycosylation of this protein. Correlating with this hypoglycosylated state, Sp1 is rapidly proteolytically degraded by an enzyme(s) that can be inhibited by specific proteasome inhibitors, lactacystin and LLnL. Treatment of cells with glucose or glucosamine protects Sp1 from cAMP-mediated degradation, whereas blockade of glucosamine synthesis abrogates glucose but not glucosamine protection. This effect on Sp1 is specific, in that the Stat-3 and E2F transcription factors did not undergo degradation under these conditions. The O-GlcNAc modification of Sp1 may play a role as a nutritional checkpoint. In the absence of adequate nutrition, Sp1 becomes hypoglycosylated and thereby subject to proteasome degradation. This process could potentially result in reduced general transcription, thereby conserving nutrients. PMID:9111324

  7. Expression of the rat liver carnitine palmitoyltransferase I (CPT-Ialpha) gene is regulated by Sp1 and nuclear factor Y: chromosomal localization and promoter characterization.

    PubMed Central

    Steffen, M L; Harrison, W R; Elder, F F; Cook, G A; Park, E A

    1999-01-01

    Carnitine palmitoyltransferase (CPT)-I catalyses the transfer of long-chain fatty acids from CoA to carnitine for translocation across the mitochondrial inner membrane. Expression of the 'liver' isoform of the CPT-I gene (CPT-Ialpha) is subject to developmental, hormonal and tissue-specific regulation. To understand the basis for control of CPT-Ialpha gene expression, we have characterized the proximal promoter of the CPT-Ialpha gene. Here, we report the sequence of 6839 base pairs of the promoter and the localization of the rat CPT-Ialpha gene to region q43 on chromosome 1. Our studies show that the first 200 base pairs of the promoter are sufficient to drive transcription of the CPT-Ialpha gene. Within this region are two sites that bind both Sp1 and Sp3 transcription factors. In addition, nuclear factor Y (NF-Y) binds the proximal promoter. Mutation at the Sp1 or NF-Y sites severely decreases transcription from the CPT-Ialpha promoter. Other protein binding sites were identified within the first 200 base pairs of the promoter by DNase I footprinting, and these elements contribute to CPT-Ialpha gene expression. Our studies demonstrate that CPT-Ialpha is a TATA-less gene which utilizes NF-Y and Sp proteins to drive basal expression. PMID:10333485

  8. Indole-3-carbinol downregulation of telomerase gene expression requires the inhibition of estrogen receptor-alpha and Sp1 transcription factor interactions within the hTERT promoter and mediates the G1 cell cycle arrest of human breast cancer cells

    PubMed Central

    Marconett, Crystal N.; Sundar, Shyam N.; Tseng, Min; Tin, Antony S.; Tran, Kalvin Q.; Mahuron, Kelly M.; Bjeldanes, Leonard F.; Firestone, Gary L.

    2011-01-01

    Indole-3-carbinol (I3C), a naturally occurring hydrolysis product of glucobrassicin from cruciferous vegetables such as broccoli, cabbage and Brussels sprouts, is an anticancer phytochemical that triggers complementary sets of antiproliferative pathways to induce a cell cycle arrest of estrogen-responsive MCF7 breast cancer cells. I3C strongly downregulated transcript expression of the catalytic subunit of the human telomerase (hTERT) gene, which correlated with the dose-dependent indole-mediated G1 cell cycle arrest without altering the transcript levels of the RNA template (hTR) for telomerase elongation. Exogenous expression of hTERT driven by a constitutive promoter prevented the I3C-induced cell cycle arrest and rescued the I3C inhibition of telomerase enzymatic activity and activation of cellular senescence. Time course studies showed that I3C downregulated expression of estrogen receptor-alpha (ERα) and cyclin-dependent kinase-6 transcripts levels (which is regulated through the Sp1 transcription factor) prior to the downregulation of hTERT suggesting a mechanistic link. Chromatin immunoprecipitation assays demonstrated that I3C disrupted endogenous interactions of both ERα and Sp1 with an estrogen response element–Sp1 composite element within the hTERT promoter. I3C inhibited 17β-estradiol stimulated hTERT expression and stimulated the production of threonine-phosphorylated Sp1, which inhibits Sp1–DNA interactions. Exogenous expression of both ERα and Sp1, but not either alone, in MCF7 cells blocked the I3C-mediated downregulation of hTERT expression. These results demonstrate that I3C disrupts the combined ERα- and Sp1-driven transcription of hTERT gene expression, which plays a significant role in the I3C-induced cell cycle arrest of human breast cancer cells. PMID:21693539

  9. Co-operative interactions between NFAT (nuclear factor of activated T cells) c1 and the zinc finger transcription factors Sp1/Sp3 and Egr-1 regulate MT1-MMP (membrane type 1 matrix metalloproteinase) transcription by glomerular mesangial cells.

    PubMed Central

    Alfonso-Jaume, Maria Alejandra; Mahimkar, Rajeev; Lovett, David H

    2004-01-01

    The transition of normally quiescent glomerular MCs (mesangial cells) to a highly proliferative phenotype with characteristics of myofibroblasts is a process commonly observed in inflammatory diseases affecting the renal glomerulus, the ultimate result of which is glomerulosclerosis. Generation of proteolytically active MMP (matrix metalloproteinase)-2 by the membrane-associated membrane type 1 (MT1)-MMP is responsible for the transition of mesangial cells to the myofibroblast phenotype [Turck, Pollock, Lee, Marti and Lovett (1996) J. Biol. Chem. 271, 15074-15083]. In the present study, we show that the expression of MT1-MMP within the context of MCs is mediated by three discrete cis -acting elements: a proximal non-canonical Sp1 site that preferentially binds Sp1; an overlapping Sp1/Egr-1-binding site that preferentially binds Egr-1; and a more distal binding site for the NFAT (nuclear factor of activated T cells) that binds the NFAT c1 isoform present in MC nuclear extracts. Transfection with an NFAT c1 expression plasmid, or activation of calcineurin with a calcium ionophore, yielded major increases in NFAT c1 nuclear DNA-binding activity, MT1-MMP transcription and protein synthesis, which were additive with the lower levels of transactivation provided by the proximal Sp1 and the overlapping Sp1/Egr-1 sites. Specific binding of NFAT c1 to the MT1-MMP promoter was confirmed by chromatin immunoprecipitation studies, while MT1-MMP expression was suppressed by treatment with the calcineurin inhibitor, cyclosporin A. These studies are the first demonstration that a specific NFAT isoform enhances transcription of an MMP (MT1-MMP) that plays a major role in the proteolytic events that are a dominant feature of acute glomerular inflammation. Suppression of MT1-MMP by commonly used calcineurin inhibitors may play a role in the development of renal fibrosis following renal transplantation. PMID:14979875

  10. Regulation of Sp1 by cell cycle related proteins

    PubMed Central

    Tapias, Alicia; Ciudad, Carlos J.; Roninson, Igor B.; Noé, Véronique

    2009-01-01

    Sp1 transcription factor regulates the expression of multiple genes, including the Sp1 gene itself. We analyzed the ability of different cell cycle regulatory proteins to interact with Sp1 and to affect Sp1 promoter activity. Using an antibody array, we observed that CDK4, SKP2, Rad51, BRCA2 and p21 could interact with Sp1 and we confirmed these interactions by co-immunoprecipitation. CDK4, SKP2, Rad51, BRCA2 and p21 also activated the Sp1 promoter. Among the known Sp1-interacting proteins, E2F-DP1, Cyclin D1, Stat3 and Rb activated the Sp1 promoter, whereas p53 and NFκB inhibited it. The proteins that regulated Sp1 gene expression were shown by positive chromatin immunoprecipitation to be bound to the Sp1 promoter. Moreover, SKP2, BRCA2, p21, E2F-DP1, Stat3, Rb, p53 and NFκB had similar effects on an artificial promoter containing only Sp1 binding sites. Transient transfections of CDK4, Rad51, E2F-DP1, p21 and Stat3 increased mRNA expression from the endogenous Sp1 gene in HeLa cells whereas overexpression of NFκB, and p53 decreased Sp1 mRNA levels. p21 expression from a stably integrated inducible promoter in HT1080 cells activated Sp1 expression at the promoter and mRNA levels, but at the same time it decreased Sp1 protein levels due to the activation of Sp1 degradation. The observed multiple effects of cell cycle regulators on Sp1 suggest that Sp1 may be a key mediator of cell cycle associated changes in gene expression. PMID:18769160

  11. Fibroblast growth factor-2 up-regulates the expression of nestin through the Ras–Raf–ERK–Sp1 signaling axis in C6 glioma cells

    SciTech Connect

    Chang, Kai-Wei; Huang, Yuan-Li; Wong, Zong-Ruei; Su, Peng-Han; Huang, Bu-Miin; Ju, Tsai-Kai; Yang, Hsi-Yuan

    2013-05-17

    Highlights: •Nestin expression in C6 glioma cells is induced by FGF-2. •Nestin expression is induced by FGF-2 via de novo RNA and protein synthesis. •The FGFR inhibitor SU5402 blocks the FGF-2-induced nestin expression. •The mRNA of FGFR1 and 3 are detected in C6 glioma cells. •Ras–Raf–ERK–Sp1 signaling pathway is responsibe for FGF-2-induced nestin expression. -- Abstract: Nestin is a 240-kDa intermediate filament protein expressed mainly in neural and myogenic stem cells. Although a substantial number of studies have focused on the expression of nestin during development of the central nervous system, little is known about the factors that induce and regulate its expression. Fibroblast growth factor-2 (FGF-2) is an effective mitogen and stimulates the proliferation and differentiation of a subset of nestin-expressing cells, including neural progenitor cells, glial precursor cells, and smooth muscle cells. To assess whether FGF-2 is a potent factor that induces the expression of nestin, C6 glioma cells were used. The results showed that nestin expression was up-regulated by FGF-2 via de novo RNA and protein synthesis. Our RT-PCR results showed that C6 glioma cells express FGFR1/3, and FGFRs is required for FGF-2-induced nestin expression. Further signaling analysis also revealed that FGF-2-induced nestin expression is mediated through FGFR–MAPK–ERK signaling axis and the transcriptional factor Sp1. These findings provide new insight into the regulation of nestin in glial system and enable the further studies on the function of nestin in glial cells.

  12. Functional activity of the porcine Gnrhr2 gene promoter in testis-derived cells is partially conferred by nuclear factor-κB, specificity protein 1 and 3 (SP1/3) and overlapping early growth response 1/SP1/3 binding sites.

    PubMed

    Brauer, Vanessa M; Wiarda-Bell, Jocelyn R; Desaulniers, Amy T; Cederberg, Rebecca A; White, Brett R

    2016-08-10

    Unlike the classical gonadotropin-releasing hormone (GnRH1), the second mammalian isoform (GnRH2) is ubiquitously expressed, suggesting a divergent function. Indeed, we demonstrated that GnRH2 governs LH-independent testosterone secretion in porcine testes via interaction with its receptor (GnRHR2) on Leydig cells. Transient transfections with luciferase reporter vectors containing 3009bp of 5' flanking sequence for the porcine Gnrhr2 gene (-3009pGL3) revealed promoter activity in all 15 cell lines examined, including swine testis-derived (ST) cells. Therefore, ST cells were utilized to explore the molecular mechanisms underlying transcriptional regulation of the porcine Gnrhr2 gene in the testis. Reporter plasmids containing progressive 5' deletions of the Gnrhr2 promoter indicated that the -708/-490 region contained elements critical to promoter activity. Electrophoretic mobility shift assays (EMSAs) with radiolabeled oligonucleotides spanning the -708/-490bp region and ST nuclear extracts, identified specific binding complexes for the -513/-490, -591/-571 and -606/-581bp segments of promoter. Antibody addition to EMSAs indicated that the p65 and p52 subunits of nuclear factor-κB (NF-κB) comprised the specific complex bound to the oligonucleotide probe for the -513/-490bp promoter region, specificity protein (SP) 1 and 3 bound the -591/-571bp probe and early growth response 1 (EGR1), SP1 and SP3 bound the -606/-581 radiolabeled oligonucleotide. Transient transfections with vectors containing mutations of the NF-κB (-499/-493), SP1/3 (-582/-575) or overlapping EGR1/SP1/3 (-597/-587) binding sites reduced luciferase activity by 26%, 61% and 56%, respectively (P<0.05). Thus, NF-κB, SP1/3 and overlapping EGR1/SP1/3 binding sites are critical to expression of the porcine Gnrhr2 gene in ST cells. PMID:27134031

  13. EPAS-1 Mediates SP-1-Dependent FBI-1 Expression and Regulates Tumor Cell Survival and Proliferation

    PubMed Central

    Wang, Xiaogang; Cao, Peng; Li, Zhiqing; Wu, Dongyang; Wang, Xi; Liang, Guobiao

    2014-01-01

    Factor binding IST-1 (FBI-1) plays an important role in oncogenic transformation and tumorigenesis. As FBI-1 is over-expressed in multiple human cancers, the regulation of itself would provide new effective options for cancer intervention. In this work, we aimed to study the role that EPAS-1 plays in regulating FBI-1. We use the fact that specificity protein-1 (SP-1) is one of the crucial transcription factors of FBI-1, and that SP-1 can interact with the endothelial pas domain protein-1 (EPAS-1) for the induction of hypoxia related genes. The study showed that EPAS-1 plays an indispensible role in SP-1 transcription factor-mediated FBI-1 induction, and participated in tumor cell survival and proliferation. Thus, EPAS-1 could be a novel target for cancer therapeutics. PMID:25192290

  14. EPAS-1 mediates SP-1-dependent FBI-1 expression and regulates tumor cell survival and proliferation.

    PubMed

    Wang, Xiaogang; Cao, Peng; Li, Zhiqing; Wu, Dongyang; Wang, Xi; Liang, Guobiao

    2014-01-01

    Factor binding IST-1 (FBI-1) plays an important role in oncogenic transformation and tumorigenesis. As FBI-1 is over-expressed in multiple human cancers, the regulation of itself would provide new effective options for cancer intervention. In this work, we aimed to study the role that EPAS-1 plays in regulating FBI-1. We use the fact that specificity protein-1 (SP-1) is one of the crucial transcription factors of FBI-1, and that SP-1 can interact with the endothelial pas domain protein-1 (EPAS-1) for the induction of hypoxia related genes. The study showed that EPAS-1 plays an indispensible role in SP-1 transcription factor-mediated FBI-1 induction, and participated in tumor cell survival and proliferation. Thus, EPAS-1 could be a novel target for cancer therapeutics. PMID:25192290

  15. A functional polymorphism in the Eta-1 promoter is associated with allele specific binding to the transcription factor Sp1 and elevated gene expression.

    PubMed

    Hummelshoj, Tina; Ryder, Lars P; Madsen, Hans O; Odum, Niels; Svejgaard, Arne

    2006-03-01

    Early T lymphocyte activator 1 (Eta-1), also known as Osteopontin, is a cytokine produced by macrophages and T lymphocytes. It is involved in the regulation of IL-12 and IL-10 expression in macrophages and stimulates the polarization of T cells to the Th1 subset. Three promoter polymorphisms of the human Eta-1 gene, -443T/C, -156delG/G, -66T/G, were investigated for possible influence on gene expression. Electrophoretic mobility shift assays (EMSA) with nuclear extract from the human myeloid leukaemia premonocyte cell line, THP-1, revealed sequence specific binding of the transcription factor Sp1 to the -66T allele but not the -66G allele, and haplotype -443C/-156G/-66T showed a marked increase in promoter activity of a luciferase reporter gene. Thus, a substitution of the T-base with G at position -66 in the Eta-1 promoter modulates the promoter activity of the Eta-1 gene, which might influence the Th1 versus Th2 balance. These observations are discussed in relation to a recently reported related observation on the same gene, and it is argued that discrepancies between reporter gene assays in the two studies may be due to the use of different cell lines and may reflect requirements for different transcription factors in cells involved in immune responses compared with other cells. PMID:16009426

  16. Co-operation of the transcription factor hepatocyte nuclear factor-4 with Sp1 or Sp3 leads to transcriptional activation of the human haem oxygenase-1 gene promoter in a hepatoma cell line.

    PubMed Central

    Takahashi, Shigeru; Matsuura, Naomi; Kurokawa, Takako; Takahashi, Yuji; Miura, Takashi

    2002-01-01

    We reported previously that the 5'-flanking region (nucleotides -1976 to -1655) of the human haem oxygenase-1 ( hHO-1 ) gene enhances hHO-1 promoter activity in human hepatoma HepG2 cells, but not in HeLa cells [Takahashi, Takahashi, Ito, Nagano, Shibahara and Miura (1999) Biochim. Biophys. Acta 1447, 231-235]. To define more precisely the regulatory elements involved, in the present study we have functionally dissected this region and localized the enhancer to a 50 bp fragment (-1793 to -1744). Site-direct mutagenesis analysis revealed that two regions were responsible for this enhancer activity, i.e. a hepatocyte nuclear factor-4 (HNF-4) homologous region and a GC box motif homologous region. Mutation in either region alone moderately decreased enhancer activity. However, mutations in both regions reduced promoter activity to the basal level. Electrophoretic mobility-shift assays demonstrated that the P5-2 fragment (-1793 to -1744) interacted with at least two nuclear factors, i.e. HNF-4 and Sp1/Sp3. Co-transfection experiments using Drosophila SL2 cells revealed that HNF-4 and Sp1/Sp3 synergistically stimulated the enhancer activity of the P5-2 fragment. These results indicate that co-operation of HNF-4 with Sp1 or Sp3 leads to the activation of hHO-1 gene expression in hepatoma cells. PMID:12133007

  17. Co-operation of the transcription factor hepatocyte nuclear factor-4 with Sp1 or Sp3 leads to transcriptional activation of the human haem oxygenase-1 gene promoter in a hepatoma cell line.

    PubMed

    Takahashi, Shigeru; Matsuura, Naomi; Kurokawa, Takako; Takahashi, Yuji; Miura, Takashi

    2002-11-01

    We reported previously that the 5'-flanking region (nucleotides -1976 to -1655) of the human haem oxygenase-1 ( hHO-1 ) gene enhances hHO-1 promoter activity in human hepatoma HepG2 cells, but not in HeLa cells [Takahashi, Takahashi, Ito, Nagano, Shibahara and Miura (1999) Biochim. Biophys. Acta 1447, 231-235]. To define more precisely the regulatory elements involved, in the present study we have functionally dissected this region and localized the enhancer to a 50 bp fragment (-1793 to -1744). Site-direct mutagenesis analysis revealed that two regions were responsible for this enhancer activity, i.e. a hepatocyte nuclear factor-4 (HNF-4) homologous region and a GC box motif homologous region. Mutation in either region alone moderately decreased enhancer activity. However, mutations in both regions reduced promoter activity to the basal level. Electrophoretic mobility-shift assays demonstrated that the P5-2 fragment (-1793 to -1744) interacted with at least two nuclear factors, i.e. HNF-4 and Sp1/Sp3. Co-transfection experiments using Drosophila SL2 cells revealed that HNF-4 and Sp1/Sp3 synergistically stimulated the enhancer activity of the P5-2 fragment. These results indicate that co-operation of HNF-4 with Sp1 or Sp3 leads to the activation of hHO-1 gene expression in hepatoma cells. PMID:12133007

  18. Predictive factors of excessive online poker playing.

    PubMed

    Hopley, Anthony A B; Nicki, Richard M

    2010-08-01

    Despite the widespread rise of online poker playing, there is a paucity of research examining potential predictors for excessive poker playing. The aim of this study was to build on recent research examining motives for Texas Hold'em play in students by determining whether predictors of other kinds of excessive gambling apply to Texas Hold'em. Impulsivity, negative mood states, dissociation, and boredom proneness have been linked to general problem gambling and may play a role in online poker. Participants of this study were self-selected online poker players (N = 179) who completed an online survey. Results revealed that participants played an average of 20 hours of online poker a week and approximately 9% of the sample was classified as a problem gambler according to the Canadian Problem Gambling Index. Problem gambling, in this sample, was uniquely predicted by time played, dissociation, boredom proneness, impulsivity, and negative affective states, namely depression, anxiety, and stress. PMID:20712496

  19. Characterization of the human granulocyte-macrophage colony-stimulating factor gene promoter: an AP1 complex and an Sp1-related complex transactivate the promoter activity that is suppressed by a YY1 complex.

    PubMed Central

    Ye, J; Zhang, X; Dong, Z

    1996-01-01

    It is well documented that a repeated CATT element in the human granulocyte-macrophage colony-stimulating factor (GM-CSF) gene promoter is required for promoter activity. However, the transcription factors that are able to transactivate this enhancer element remain unidentified. Recently, we have found that nuclear factor YY1 can interact with the enhancer element. Here, we report that in addition to YY1, two other nuclear factors have been identified in the DNA-protein complexes formed by the CATT oligonucleotide and the Jurkat T-cell nuclear protein. One of these factors is AP1, and the other one is an Sp1-related protein. Results from transient transfection of Jurkat T cells have revealed that formation of both AP1 and the Sp1-related complex is required for the full enhancer activity of the CATT element. This result is supported by cotransfection of a c-jun expression vector and mutational analysis of the AP1 site or the Sp1-related protein binding site. In contrast, formation of the YY1 complex suppresses enhancer activity, since deletion of the YY1 complex induces an augmentation of the enhancer activity and overexpression of YY1 results in an attenuation of the enhancer activity. Results from the mechanism study have revealed that YY1 is able to inhibit transactivation mediated by either AP1 or the Sp1-related protein, and YY1 suppressive activity is DNA binding dependent. Taken together, these data support the ideas that AP1 and the Sp1-related nuclear protein are required for transactivation of the human GM-CSF gene promoter and that YY1 can suppress transactivation of the promoter even under inducible conditions. PMID:8524292

  20. O-Linked N-acetylglucosaminylation of Sp1 interferes with Sp1 activation of glycolytic genes.

    PubMed

    Lim, Kihong; Yoon, Bo Hyun; Ha, Chang Hoon

    Glycolysis, the primary pathway metabolizing glucose for energy production, is connected to the hexosamine biosynthetic pathway (HBP) which produces UDP-N-acetylglucosamine (UDP-GlcNAc), a GlcNAc donor for O-linked GlcNAc modification (O-GlcNAc), as well as for traditional elongated glycosylation. Thus, glycolysis and O-GlcNAc are intimately associated. The present study reports the transcriptional activation of glycolytic genes by the transcription factor Sp1 and the O-GlcNAc-mediated suppression of Sp1-dependent activation of glycolytic genes. O-GlcNAc-deficient mutant Sp1 stimulated the transcription of nine glycolytic genes and cellular production of pyruvate, the final product of glycolysis, to a greater extent than wild-type Sp1. Consistently, this mutant Sp1 increased the protein levels of the two key glycolytic enzymes, phosphofructokinase (PFK) and glyceraldehyde 3-phosphate dehydrogenase (GAPDH), to a greater extent than wild-type Sp1. Finally, the mutant Sp1 occupied GC-rich elements on PFK and GAPDH promoters more efficiently than wild-type Sp1. These results suggest that O-GlcNAcylation of Sp1 suppresses Sp1-mediated activation of glycolytic gene transcription. PMID:26499076

  1. LPS induces IL-10 production by human alveolar macrophages via MAPKinases- and Sp1-dependent mechanisms

    PubMed Central

    Chanteux, Hugues; Guisset, Amélie C; Pilette, Charles; Sibille, Yves

    2007-01-01

    Background IL-10 is a cytokine mainly produced by macrophages that plays key roles in tolerance to inhaled antigens and in lung homeostasis. Its regulation in alveolar macrophages (HAM), the resident lung phagocytes, remains however unknown. Methods The present study investigated the role of intracellular signalling and transcription factors controlling the production of IL-10 in LPS-activated HAM from normal nonsmoking volunteers. Results LPS (1–1000 pg/ml) induced in vitro IL-10 production by HAM, both at mRNA and protein levels. LPS also activated the phosphorylation of ERK, p38 and JNK MAPkinases (immunoblots) and Sp-1 nuclear activity (EMSA). Selective inhibitors of MAPKinases (respectively PD98059, SB203580 and SP600125) and of Sp-1 signaling (mithramycin) decreased IL-10 expression in HAM. In addition, whilst not affecting IL-10 mRNA degradation, the three MAPKinase inhibitors completely abolished Sp-1 activation by LPS in HAM. Conclusion These results demonstrate for the first time that expression of IL-10 in lung macrophages stimulated by LPS depends on the concomitant activation of ERK, p38 and JNK MAPKinases, which control downstream signalling to Sp-1 transcription factor. This study further points to Sp-1 as a key signalling pathway for IL-10 expression in the lung. PMID:17916230

  2. E6 and E7 oncoproteins from human papillomavirus type 16 induce activation of human transforming growth factor beta1 promoter throughout Sp1 recognition sequence.

    PubMed

    Peralta-Zaragoza, Oscar; Bermúdez-Morales, Víctor; Gutiérrez-Xicotencatl, Lourdes; Alcocer-González, Juan; Recillas-Targa, Félix; Madrid-Marina, Vicente

    2006-01-01

    Human Papillomavirus (HPV) infection is the main etiologic agent of cervical cancer and HPV E6 and E7 oncogenes trans-regulate many cellular genes. An association between TGF-beta1 gene expression and cervical cancer development has been suggested; however, the mechanisms by which HPV influences TGF-beta1 expression remain unclear. In the present study we analyzed the mechanism through which HPV-16 E6 and E7 oncoproteins regulate the TGF-beta1 promoter in cervical tumor cells. Our results showed that E6 and E7 increased TGF-beta1 promoter activity. Furthermore, we identified a specific DNA sequence motif in the TGF-beta1 core promoter that is responsible for trans-activation and that corresponds to the Sp1e-binding site associated with HPV-16 E6 and E7 oncoproteins. Mutational analysis showed that the Sp1e recognition site abolished the trans-activation caused by E6 and E7. These results suggest a physical interaction and functional cooperation between viral oncoproteins and cellular regulatory elements of the TGF-beta1 promoter, and may explain the contribution of HPV-16 to TGF-beta1 gene expression in cervical cancer. PMID:16987065

  3. Sp1 trans-activates the murine H(+)-K(+)-ATPase alpha(2)-subunit gene.

    PubMed

    Yu, Zhiyuan; Li, Mei; Zhang, Dongyu; Xu, William; Kone, Bruce C

    2009-07-01

    The H(+)-K(+)-ATPase alpha(2) (HKalpha2) gene of the renal collecting duct and distal colon plays a central role in potassium and acid-base homeostasis, yet its transcriptional control remains poorly characterized. We previously demonstrated that the proximal 177 bp of its 5'-flanking region confers basal transcriptional activity in murine inner medullary collecting duct (mIMCD3) cells and that NF-kappaB and CREB-1 bind this region to alter transcription. In the present study, we sought to determine whether the -144/-135 Sp element influences basal HKalpha2 gene transcription in these cells. Electrophoretic mobility shift and supershift assays using probes for -154/-127 revealed Sp1-containing DNA-protein complexes in nuclear extracts of mIMCD3 cells. Chromatin immunoprecipitation (ChIP) assays demonstrated that Sp1, but not Sp3, binds to this promoter region of the HKalpha2 gene in mIMCD3 cells in vivo. HKalpha2 minimal promoter-luciferase constructs with point mutations in the -144/-135 Sp element exhibited much lower activity than the wild-type promoter in transient transfection assays. Overexpression of Sp1, but not Sp3, trans-activated an HKalpha2 proximal promoter-luciferase construct in mIMCD3 cells as well as in SL2 insect cells, which lack Sp factors. Conversely, small interfering RNA knockdown of Sp1 inhibited endogenous HKalpha2 mRNA expression, and binding of Sp1 to chromatin associated with the proximal HKalpha2 promoter without altering the binding or regulatory influence of NF-kappaB p65 or CREB-1 on the proximal HKalpha2 promoter. We conclude that Sp1 plays an important and positive role in controlling basal HKalpha2 gene expression in mIMCD3 cells in vivo and in vitro. PMID:19420113

  4. The Sp(1)-Kepler problems

    SciTech Connect

    Meng Guowu

    2009-07-15

    Let n{>=}2 be a positive integer. To each irreducible representation {sigma} of Sp(1), an Sp(1)-Kepler problem in dimension (4n-3) is constructed and analyzed. This system is superintegrable, and when n=2 it is equivalent to a generalized MICZ-Kepler problem in dimension of 5. The dynamical symmetry group of this system is O-tilde*(4n) with the Hilbert space of bound states H({sigma}) being the unitary highest weight representation of O*-tilde(4n) with highest weight, (-1,{center_dot}{center_dot}{center_dot},-1,-(1+{sigma})), which occurs at the rightmost nontrivial reduction point in the Enright-Howe-Wallach classification diagram for the unitary highest weight modules. Here {sigma} is the highest weight of {sigma}. Furthermore, it is shown that the correspondence {sigma}{r_reversible}H({sigma}) is the theta-correspondence for dual pair (Sp(1),O*(4n))subset Sp(8n,R)

  5. Play.

    ERIC Educational Resources Information Center

    Rogers, Fred; Sharapan, Hedda

    1993-01-01

    Contends that, in childhood, work and play seem to come together. Says that for young children their play is their work, and the more adults encourage children to play, the more they emphasize important lifelong resource. Examines some uses of children's play, making and building, artwork, dramatic play, monsters and superheroes, gun play, and…

  6. Low-density lipoprotein upregulate SR-BI through Sp1 Ser702 phosphorylation in hepatic cells.

    PubMed

    Yang, Fan; Du, Yu; Zhang, Jin; Jiang, Zhibo; Wang, Li; Hong, Bin

    2016-09-01

    Scavenger receptor class B type I (SR-BI) is one of the key proteins in the process of reverse cholesterol transport (RCT), and its major function is to uptake high density lipoprotein (HDL) cholesterol from plasma into liver cells. The regulation of SR-BI expression is important for controlling serum lipid content and reducing the risks of cardiovascular diseases. Here we found that SR-BI expression was significantly increased by LDL in vivo and in vitro, and the transcription factor specific protein 1 (Sp1) plays a critical role in this process. Results from co-immunoprecipitation experiments indicate that the activation of SR-BI was associated with Sp1-recruited protein complexes in the promoter region of SR-BI, where histone acetyltransferase p300 was recruited and histone deacetylase HDAC1 was dismissed. As a result, histone acetylation increased, leading to activation of SR-BI transcription. With further investigation, we found that LDL phosphorylated Sp1 through ERK1/2 pathway, which affected Sp1 protein complexes formation in SR-BI promoter. Using mass spectrometry and site directed mutagenesis, a new Sp1 phosphorylation site Ser702 was defined to be associated with Sp1-HDAC1 interaction and may be important in SR-BI activation, shedding light on the knowledge of delicate mechanism of hepatic HDL receptor SR-BI gene modulation by LDL. PMID:27320013

  7. Essential role of an activator protein-2 (AP-2)/specificity protein 1 (Sp1) cluster in the UVB-mediated induction of the human vascular endothelial growth factor in HaCaT keratinocytes.

    PubMed Central

    Brenneisen, Peter; Blaudschun, Ralf; Gille, Jens; Schneider, Lars; Hinrichs, Ralf; Wlaschek, Meinhard; Eming, Sabine; Scharffetter-Kochanek, Karin

    2003-01-01

    Chronic sun exposure of the skin has long been postulated to enhance cutaneous angiogenesis, resulting in highly vascularized skin cancers. As the UVB component of sunlight is a major contributor to photocarcinogenesis, we aimed to explore the effects of UVB radiation on vascular endothelial growth factor (VEGF) gene expression, using the immortalized keratinocyte cell line HaCaT as a model for transformed premalignant epithelial cells. In the present paper, we studied the molecular mechanism of UVB-induced VEGF providing a major angiogenic activity in tumour progression and invasion. After 12-24 h of UVB irradiation, a 2.4- to 2.7-fold increase in endogenous VEGF protein level was measured, correlating with an up to 2.5-fold induction of promoter-based reporter gene constructs of VEGF. Furthermore, we identified a GC-rich UVB-responsive region between -87 and -65 bp of the VEGF promoter. In electrophoretic mobility-shift assays, this region binds Sp1-dependent protein complexes constitutively and an additional UVB-inducible protein complex distinct from Sp1 protein. The transcription factor AP-2 (activator protein-2) was detected as a component of the UVB-inducible protein complex. The critical role of the AP-2/Sp1 (specificity protein 1) cluster was supported by demonstration of a significant reduction of UVB-mediated promoter activity upon deletion of this recognition site. The specificity of this region for UVB irradiation was demonstrated using PMA, which increased VEGF activity in HaCaT cells after transient transfection of the deleted promoter construct. In conclusion, our data clarified regulatory mechanisms of UVB-dependent VEGF stimulation which may be critical for angiogenic processes in the skin. PMID:12358602

  8. Nucleolin enhances internal ribosomal entry site (IRES)-mediated translation of Sp1 in tumorigenesis.

    PubMed

    Hung, Chia-Yang; Yang, Wen-Bin; Wang, Shao-An; Hsu, Tsung-I; Chang, Wen-Chang; Hung, Jan-Jong

    2014-12-01

    Our previous study indicated that specificity protein-1 (Sp1) is accumulated during hypoxia in an internal ribosomal entry site (IRES)-dependent manner. Herein, we found that the Sp1 was induced strongly at the protein level, but not in the mRNA level, in lung tumor tissue, indicating that translational regulation might contribute to the Sp1 accumulation during tumorigenesis. A further study showed that the translation of Sp1 was dramatically induced through an IRES-dependent pathway. RNA immunoprecipitation analysis of proteins bound to the 5'-untranslated region (5'-UTR) of Sp1 identified interacting protein - nucleolin. Knockdown of nucleolin significantly inhibited IRES-mediated translation of Sp1, suggesting that nucleolin positively facilitates Sp1 IRES activation. Further analysis of the interaction between nucleolin and the 5'-UTR of Sp1 mRNA revealed that the GAR domain was important for IRES-mediated translation of Sp1. Moreover, gefitinib, and LY294002 and MK2206 compounds inhibited IRES-mediated Sp1 translation, implying that activation of the epithelial growth factor receptor (EGFR) pathway via Akt activation triggers the IRES pathway. In conclusion, EGFR activation-mediated nucleolin phosphorylated at Thr641 and Thr707 was recruited to the 5'-UTR of Sp1 as an IRES trans-acting factor to modulate Sp1 translation during lung cancer formation. PMID:25173817

  9. Transcription of the catalytic 180-kDa subunit gene of mouse DNA polymerase alpha is controlled by E2F, an Ets-related transcription factor, and Sp1.

    PubMed

    Izumi, M; Yokoi, M; Nishikawa, N S; Miyazawa, H; Sugino, A; Yamagishi, M; Yamaguchi, M; Matsukage, A; Yatagai, F; Hanaoka, F

    2000-07-24

    We have isolated a genomic DNA fragment spanning the 5'-end of the gene encoding the catalytic subunit of mouse DNA polymerase alpha. The nucleotide sequence of the upstream region was G/C-rich and lacked a TATA box. Transient expression assays in cycling NIH 3T3 cells demonstrated that the GC box of 20 bp (at nucleotides -112/-93 with respect to the transcription initiation site) and the palindromic sequence of 14 bp (at nucleotides -71/-58) were essential for basal promoter activity. Electrophoretic mobility shift assays showed that Sp1 binds to the GC box. We also purified a protein capable of binding to the palindrome and identified it as GA-binding protein (GABP), an Ets- and Notch-related transcription factor. Transient expression assays in synchronized NIH 3T3 cells revealed that three variant E2F sites near the transcription initiation site (at nucleotides -23/-16, -1/+7 and +17/+29) had no basal promoter activity by themselves, but were essential for growth-dependent stimulation of the gene expression. These data indicate that E2F, GABP and Sp1 regulate the gene expression of this principal replication enzyme. PMID:11004506

  10. Play

    NASA Astrophysics Data System (ADS)

    Harteveld, Casper

    Designing a game with a serious purpose involves considering the worlds of Reality and Meaning yet it is undeniably impossible to create a game without a third world, one that is specifically concerned with what makes a game a game: the play elements. This third world, the world of people like designers and artists, and disciplines as computer science and game design, I call the world of Play and this level is devoted to it. The level starts off with some of the misperceptions people have of play. Unlike some may think, we play all the time, even when we grow old—this was also very noticeable in designing the game Levee Patroller as the team exhibited very playful behavior at many occasions. From there, I go into the aspects that characterize this world. The first concerns the goal of the game. This relates to the objectives people have to achieve within the game. This is constituted by the second aspect: the gameplay. Taking actions and facing challenges is subsequently constituted by a gameworld, which concerns the third aspect. And all of it is not possible without the fourth and final aspect, the type of technology that creates and facilitates the game. The four aspects together make up a “game concept” and from this world such a concept can be judged on the basis of three closely interrelated criteria: engagement, immersion, and fun.

  11. Sumoylation differentially regulates Sp1 to control cell differentiation

    PubMed Central

    Gong, Lili; Ji, Wei-Ke; Hu, Xiao-Hui; Hu, Wen-Feng; Tang, Xiang-Cheng; Huang, Zhao-Xia; Li, Ling; Liu, Mugen; Xiang, Shi-Hua; Wu, Erxi; Woodward, Zachary; Liu, Yi-Zhi; Nguyen, Quan Dong; Li, David Wan-Cheng

    2014-01-01

    The mammalian small ubiquitin-like modifiers (SUMOs) are actively involved in regulating differentiation of different cell types. However, the functional differences between SUMO isoforms and their mechanisms of action remain largely unknown. Using the ocular lens as a model system, we demonstrate that different SUMOs display distinct functions in regulating differentiation of epithelial cells into fiber cells. During lens differentiation, SUMO1 and SUMO2/3 displayed different expression, localization, and targets, suggesting differential functions. Indeed, overexpression of SUMO2/3, but not SUMO1, inhibited basic (b) FGF-induced cell differentiation. In contrast, knockdown of SUMO1, but not SUMO2/3, also inhibited bFGF action. Mechanistically, specificity protein 1 (Sp1), a major transcription factor that controls expression of lens-specific genes such as β-crystallins, was positively regulated by SUMO1 but negatively regulated by SUMO2. SUMO2 was found to inhibit Sp1 functions through several mechanisms: sumoylating it at K683 to attenuate DNA binding, and at K16 to increase its turnover. SUMO2 also interfered with the interaction between Sp1 and the coactivator, p300, and recruited a repressor, Sp3 to β-crystallin gene promoters, to negatively regulate their expression. Thus, stable SUMO1, but diminishing SUMO2/3, during lens development is necessary for normal lens differentiation. In support of this conclusion, SUMO1 and Sp1 formed complexes during early and later stages of lens development. In contrast, an interaction between SUMO2/3 and Sp1 was detected only during the initial lens vesicle stage. Together, our results establish distinct roles of different SUMO isoforms and demonstrate for the first time, to our knowledge, that Sp1 acts as a major transcription factor target for SUMO control of cell differentiation. PMID:24706897

  12. Early experiences with the IBM SP-1

    SciTech Connect

    Gropp, W.

    1993-06-01

    The IBM SP-1 is IBM`s newest parallel distributed-memory computer. As part of a joint project with IBM, Argonne took delivery of an early system in order to evaluate the software environment and to begin porting programming packages and applications to this machine. This report discusses the results of those early efforts. Despite the newness of the machine and the lack of a fast interprocessor switch (part of the SP-1 but not yet available for the machine), every code that they attempted to port ran on the SP-1 with little or no modification. The report concludes with a discussion of expectations for the fast interconnect.

  13. Curcumin Suppresses Metastasis via Sp-1, FAK Inhibition, and E-Cadherin Upregulation in Colorectal Cancer.

    PubMed

    Chen, Chun-Chieh; Sureshbabul, Munisamy; Chen, Huei-Wen; Lin, Yu-Shuang; Lee, Jen-Yi; Hong, Qi-Sheng; Yang, Ya-Chien; Yu, Sung-Liang

    2013-01-01

    Colorectal cancer (CRC) is a serious public health problem that results due to changes of diet and various environmental stress factors in the world. Curcumin is a traditional medicine used for treatment of a wide variety of tumors. However, antimetastasis mechanism of curcumin on CRC has not yet been completely investigated. Here, we explored the underlying molecular mechanisms of curcumin on metastasis of CRC cells in vitro and in vivo. Curcumin significantly inhibits cell migration, invasion, and colony formation in vitro and reduces tumor growth and liver metastasis in vivo. We found that curcumin suppresses Sp-1 transcriptional activity and Sp-1 regulated genes including ADEM10, calmodulin, EPHB2, HDAC4, and SEPP1 in CRC cells. Curcumin inhibits focal adhesion kinase (FAK) phosphorylation and enhances the expressions of several extracellular matrix components which play a critical role in invasion and metastasis. Curcumin reduces CD24 expression in a dose-dependent manner in CRC cells. Moreover, E-cadherin expression is upregulated by curcumin and serves as an inhibitor of EMT. These results suggest that curcumin executes its antimetastasis function through downregulation of Sp-1, FAK, and CD24 and by promoting E-cadherin expression in CRC cells. PMID:23970932

  14. Curcumin Suppresses Metastasis via Sp-1, FAK Inhibition, and E-Cadherin Upregulation in Colorectal Cancer

    PubMed Central

    Chen, Chun-Chieh; Sureshbabul, Munisamy; Chen, Huei-Wen; Lin, Yu-Shuang; Lee, Jen-Yi; Hong, Qi-Sheng; Yang, Ya-Chien

    2013-01-01

    Colorectal cancer (CRC) is a serious public health problem that results due to changes of diet and various environmental stress factors in the world. Curcumin is a traditional medicine used for treatment of a wide variety of tumors. However, antimetastasis mechanism of curcumin on CRC has not yet been completely investigated. Here, we explored the underlying molecular mechanisms of curcumin on metastasis of CRC cells in vitro and in vivo. Curcumin significantly inhibits cell migration, invasion, and colony formation in vitro and reduces tumor growth and liver metastasis in vivo. We found that curcumin suppresses Sp-1 transcriptional activity and Sp-1 regulated genes including ADEM10, calmodulin, EPHB2, HDAC4, and SEPP1 in CRC cells. Curcumin inhibits focal adhesion kinase (FAK) phosphorylation and enhances the expressions of several extracellular matrix components which play a critical role in invasion and metastasis. Curcumin reduces CD24 expression in a dose-dependent manner in CRC cells. Moreover, E-cadherin expression is upregulated by curcumin and serves as an inhibitor of EMT. These results suggest that curcumin executes its antimetastasis function through downregulation of Sp-1, FAK, and CD24 and by promoting E-cadherin expression in CRC cells. PMID:23970932

  15. miRNA-223 inhibits epithelial-mesenchymal transition in gastric carcinoma cells via Sp1.

    PubMed

    Hu, Jing; Shan, Zhiyan; Hu, Kewei; Ren, Fengyun; Zhang, Wei; Han, Meiling; Li, Yuezhen; Feng, Kejian; Lei, Lei; Feng, Yukuan

    2016-07-01

    Sp1 plays critical roles in epithelial-mesenchymal transition (EMT) of certain cancer. However, few studies have indicated whether Sp1 is involved in the EMT of gastric cancer, and whether abnormal expression of Sp1 in gastric cancer EMT is regulated in a post-transcriptional manner, and the involvement of miRNAs in this regulation. In this study, we selected 20 cases of gastric cancers, their liver metastases and para-carcinoma tissues to examine the levels of Sp1 protein and mRNA by immunohistochemistry and fluorescent PCR, which showed that Sp1 was increased in gastric cancers and their metastases compared with adjacent tissues, but there was no difference in Sp1 mRNA between these three groups, suggesting changes in Sp1 may be attributed to inactivation of post-transcriptional regulation. We verified by a luciferase reporter system that miRNA-223 binds to 3'-UTR of Sp1 gene and inhibits its translation, in agreement with negative correlation between miRNA-223 and Sp1 protein levels in gastric cancer cells. By employing TGF-β1 to induce MGC-803, BGC-823 and SGC-7901, we successfully built cellular EMT model. Then, we overexpressed miRNA-223 in the model by using a lentiviral system, which diminished EMT indicators and suppressed proliferation and invasion ability, and induced apoptosis. Finally, we verified the specificity of the regulation pathway miRNA-223/Sp1/EMT. These findings suggest that low expression of miRNA-223 in gastric cancer cells is an important cause for EMT. miRNA-223 specifically regulates the EMT process of gastric cancer cells through its target gene Sp1. Overexpression of miRNA-223 in these cells inhibits EMT via the miRNA-223/Sp1/EMT pathway. PMID:27212195

  16. Sp1/3 and NF-1 mediate basal transcription of the human P2X1 gene in megakaryoblastic MEG-01 cells

    PubMed Central

    Zhao, Jiangqin; Ennion, Steven J

    2006-01-01

    Background P2X1 receptors play an important role in platelet function as they can induce shape change, granule centralization and are also involved in thrombus formation. As platelets have no nuclei, the level of P2X1 expression depends on transcriptional regulation in megakaryocytes, the platelet precursor cell. Since nothing is known about the molecular mechanisms regulating megakaryocytic P2X1 expression, this study aimed to identify and functionally characterize the P2X1 core promoter utilized in the human megakaryoblastic cell line MEG-01. Results In order to identify cis-acting elements involved in the transcriptional regulation of P2X1 expression, the ability of 4.7 kb P2X1 upstream sequence to drive luciferase reporter gene expression was tested. Low promoter activity was detected in proliferating MEG-01 cells. This activity increased 20-fold after phorbol-12-myristate-13-acetate (PMA) induced differentiation. A transcription start site was detected 365 bp upstream of the start codon by primer extension. Deletion analysis of reporter constructs indicated a core promoter located within the region -68 to +149 bp that contained two Sp1 sites (named Sp1a and Sp1b) and an NF-1 site. Individual mutations of Sp1b or NF-1 binding sites severely reduced promoter activity whereas triple mutation of Sp1a, Sp1b and NF-1 sites completely abolished promoter activity in both untreated and PMA treated cells. Sp1/3 and NF-1 proteins were shown to bind their respective sites by EMSA and interaction of Sp1/3, NF-1 and TFIIB with the endogenous P2X1 core promoter in MEG-01 cells was demonstrated by chromatin immunoprecipitation. Alignment of P2X1 genes from human, chimp, rat, mouse and dog revealed consensus Sp1a, Sp1b and NF-1 binding sites in equivalent positions thereby demonstrating evolutionary conservation of these functionally important sites. Conclusion This study has identified and characterized the P2X1 promoter utilized in MEG-01 cells and shown that binding of Sp1

  17. Curcumin decreases the expression of Pokemon by suppressing the binding activity of the Sp1 protein in human lung cancer cells.

    PubMed

    Cui, Jiajun; Meng, Xianfeng; Gao, Xudong; Tan, Guangxuan

    2010-03-01

    Pokemon, which stands for POK erythroid myeloid ontogenic factor, can regulate expression of many genes and plays an important role in tumorigenesis. Curcumin, a natural and non-toxic yellow compound, has capacity for antioxidant, free radical scavenger, anti-inflammatory properties. Recent studies shows it is a potential inhibitor of cell proliferation in a variety of tumour cells. To investigate whether curcumin can regulate the expression of Pokemon, a series of experiments were carried out. Transient transfection experiments demonstrated that curcumin could decrease the activity of the Pokemon promoter. Western blot analysis suggested that curcumin could significantly decrease the expression of the Pokemon. Overexpression of Sp1 could enhance the activity of the Pokemon promoter, whereas knockdown of Sp1 could decrease its activity. More important, we also found that curcumin could decrease the expression of the Pokemon by suppressing the stimulation of the Sp1 protein. Therefore, curcumin is a potential reagent for tumour therapy which may target Pokemon. PMID:19444642

  18. The Play Factor: Effect of Social Skills Group Play Therapy on Adolescent African-American Males

    ERIC Educational Resources Information Center

    Earls, Melissa K.

    2009-01-01

    The purpose of this study was to examine the effectiveness of Social Skills Group Play Therapy on remedying the social skills deficits of adolescent African-American males. Additionally, the study investigated whether age and grade level impacted the outcome of the intervention. The participants were adolescent African-American males ages 10 to…

  19. MiR-22/Sp-1 Links Estrogens With the Up-Regulation of Cystathionine γ-Lyase in Myocardium, Which Contributes to Estrogenic Cardioprotection Against Oxidative Stress.

    PubMed

    Wang, Long; Tang, Zhi-Ping; Zhao, Wei; Cong, Bing-Hai; Lu, Jian-Qiang; Tang, Xiao-Lu; Li, Xiao-Han; Zhu, Xiao-Yan; Ni, Xin

    2015-06-01

    Hydrogen sulfide, generated in the myocardium predominantly via cystathionine-γ-lyase (CSE), is cardioprotective. Our previous study has shown that estrogens enhance CSE expression in myocardium of female rats. The present study aims to explore the mechanisms by which estrogens regulate CSE expression, in particular to clarify the role of estrogen receptor subtypes and the transcriptional factor responsible for the estrogenic effects. We found that either the CSE inhibitor or the CSE small interfering RNA attenuated the protective effect of 17β-estradiol (E2) against H2O2- and hypoxia/reoxygenation-induced injury in primary cultured neonatal cardiomyocytes. E2 stimulates CSE expression via estrogen receptor (ER)-α both in cultured cardiomyocytes in vitro and in the myocardium of female mice in vivo. A specificity protein-1 (Sp-1) consensus site was identified in the rat CSE promoter and was found to mediate the E2-induced CSE expression. E2 increases ERα and Sp-1 and inhibits microRNA (miR)-22 expression in myocardium of ovariectomized rats. In primary cardiomyocytes, E2 stimulates Sp-1 expression through the ERα-mediated down-regulation of miR-22. It was confirmed that both ERα and Sp-1 were targeted by miR-22. In the myocardium of ovariectomized rats, the level of miR-22 inversely correlated to CSE, ERα, Sp-1, and antioxidant biomarkers and positively correlated to oxidative biomarkers. In summary, this study demonstrates that estrogens stimulate Sp-1 through the ERα-mediated down-regulation of miR-22 in cardiomyocytes, leading to the up-regulation of CSE, which in turn results in an increase of antioxidative defense. Interaction of ERα, miR-22, and Sp-1 may play a critical role in the control of oxidative stress status in the myocardium of female rats. PMID:25825815

  20. Sp1 Facilitates DNA Double-Strand Break Repair through a Nontranscriptional Mechanism

    PubMed Central

    Beishline, Kate; Kelly, Crystal M.; Olofsson, Beatrix A.; Koduri, Sravanthi; Emrich, Jacqueline; Greenberg, Roger A.

    2012-01-01

    Sp1 is a ubiquitously expressed transcription factor that is phosphorylated by ataxia telangiectasia mutated kinase (ATM) in response to ionizing radiation and H2O2. Here, we show by indirect immunofluorescence that Sp1 phosphorylated on serine 101 (pSp1) localizes to ionizing radiation-induced foci with phosphorylated histone variant γH2Ax and members of the MRN (Mre11, Rad50, and Nbs1) complex. More precise analysis of occupancy of DNA double-strand breaks (DSBs) by chromatin immunoprecipitation (ChIP) shows that Sp1, like Nbs1, resides within 200 bp of DSBs. Using laser microirradiation of cells, we demonstrate that pSp1 is present at DNA DSBs by 7.5 min after induction of damage and remains at the break site for at least 8 h. Depletion of Sp1 inhibits repair of site-specific DNA breaks, and the N-terminal 182-amino-acid peptide, which contains targets of ATM kinase but lacks the zinc finger DNA binding domain, is phosphorylated, localizes to DSBs, and rescues the repair defect resulting from Sp1 depletion. Together, these data demonstrate that Sp1 is rapidly recruited to the region immediately adjacent to sites of DNA DSBs and is required for DSB repair, through a mechanism independent of its sequence-directed transcriptional effects. PMID:22826432

  1. Comparative integromics on FZD7 orthologs: conserved binding sites for PU.1, SP1, CCAAT-box and TCF/LEF/SOX transcription factors within 5'-promoter region of mammalian FZD7 orthologs.

    PubMed

    Katoh, Masuko; Katoh, Masaru

    2007-03-01

    that the binding sites for PU.1, SP1/Krüppel-like, CCAAT-box, and TCF/LEF/SOX transcription factors were conserved among 5'-promoter regions of mammalian FZD7 orthologs. PMID:17273804

  2. Video Game Playing and Gambling in Adolescents: Common Risk Factors

    ERIC Educational Resources Information Center

    Wood, Richard T. A.; Gupta, Rina; Griffiths, Mark

    2004-01-01

    Video games and gambling often contain very similar elements with both providing intermittent rewards and elements of randomness. Furthermore, at a psychological and behavioral level, slot machine gambling, video lottery terminal (VLT) gambling and video game playing share many of the same features. Despite the similarities between video game…

  3. Play Therapy with Sexually Traumatized Children: Factors That Promote Healing.

    ERIC Educational Resources Information Center

    Kelly, Mary Margaret

    1995-01-01

    Proposes an alternative model of therapy for sexually abused children, and suggests envisioning the therapy process for children whose abuse therapies are particularly extreme as a series of cycles rather than progressive improvement through a number of stages. Discusses two cases to illustrate the proposed cyclic nature of play with this…

  4. Diverse Mechanisms of Sp1-Dependent Transcriptional Regulation Potentially Involved in the Adaptive Response of Cancer Cells to Oxygen-Deficient Conditions

    PubMed Central

    Koizume, Shiro; Miyagi, Yohei

    2015-01-01

    The inside of a tumor often contains a hypoxic area caused by a limited supply of molecular oxygen due to aberrant vasculature. Hypoxia-inducible factors (HIFs) are major transcription factors that are required for cancer cells to adapt to such stress conditions. HIFs, complexed with the aryl hydrocarbon receptor nuclear translocator, bind to and activate target genes as enhancers of transcription. In addition to this common mechanism, the induction of the unfolded protein response and mTOR signaling in response to endoplasmic reticulum stress is also known to be involved in the adaptation to hypoxia conditions. Sp1 is a ubiquitously-expressed transcription factor that plays a vital role in the regulation of numerous genes required for normal cell function. In addition to the well-characterized stress response mechanisms described above, increasing experimental evidence suggests that Sp1 and HIFs collaborate to drive gene expression in cancer cells in response to hypoxia, thereby regulating additional adaptive responses to cellular oxygen deficiency. However, these characteristics of Sp1 and their biological merits have not been summarized. In this review, we will discuss the diverse mechanisms of transcriptional regulation by Sp1 and their potential involvement in the adaptive response of cancer cells to hypoxic tumor microenvironments. PMID:26703734

  5. Vascular growth factors play critical roles in kidney glomeruli.

    PubMed

    Gnudi, Luigi; Benedetti, Sara; Woolf, Adrian S; Long, David A

    2015-12-01

    Kidney glomeruli ultrafilter blood to generate urine and they are dysfunctional in a variety of kidney diseases. There are two key vascular growth factor families implicated in glomerular biology and function, namely the vascular endothelial growth factors (VEGFs) and the angiopoietins (Angpt). We present examples showing not only how these molecules help generate and maintain healthy glomeruli but also how they drive disease when their expression is dysregulated. Finally, we review how manipulating VEGF and Angpt signalling may be used to treat glomerular disease. PMID:26561594

  6. Nucleolin regulates c-Jun/Sp1-dependent transcriptional activation of cPLA2alpha in phorbol ester-treated non-small cell lung cancer A549 cells.

    PubMed

    Tsou, Jen-Hui; Chang, Kwang-Yu; Wang, Wei-Chiao; Tseng, Joseph T; Su, Wu-Chou; Hung, Liang-Yi; Chang, Wen-Chang; Chen, Ben-Kuen

    2008-01-01

    The expression of cPLA2 is critical for transformed growth of non-small cell lung cancer (NSCLC). It is known that phorbol 12-myristate 13-acetate (PMA)-activated signal transduction pathway is thought to be involved in the oncogene action in NSCLC and enzymatic activation of cPLA2. However, the transcriptional regulation of cPLA2alpha in PMA-activated NSCLC is not clear. In this study, we found that PMA induced the mRNA level and protein expression of cPLA2alpha. In addition, two Sp1-binding sites of cPLA2alpha promoter were required for response to PMA and c-Jun overexpression. Small interfering RNA (siRNA) of c-Jun and nucleolin inhibited PMA induced the promoter activity and protein expression of cPLA2alpha. Furthermore, PMA stimulated the formation of c-Jun/Sp1 and c-Jun/nucleolin complexes as well as the binding of these transcription factor complexes to the cPLA2alpha promoter. Although Sp1-binding sites were required for the bindings of Sp1 and nucleolin to the promoter, the binding of nucleolin or Sp1 to the promoter was independent of each other. Our results revealed that c-Jun/nucleolin and c-Jun/Sp1 complexes play an important role in PMA-regulated cPLA2alpha gene expression. It is likely that nucleolin binding at place of Sp1 on gene promoter could also mediate the regulation of c-Jun/Sp1-activated genes. PMID:18025046

  7. The retinoblastoma gene product RB stimulates Sp1-mediated transcription by liberating Sp1 from a negative regulator.

    PubMed Central

    Chen, L I; Nishinaka, T; Kwan, K; Kitabayashi, I; Yokoyama, K; Fu, Y H; Grünwald, S; Chiu, R

    1994-01-01

    Studies have demonstrated that the retinoblastoma susceptibility gene product, RB, can either positively or negatively regulate expression of several genes through cis-acting elements in a cell-type-dependent manner. The nucleotide sequence of the retinoblastoma control element (RCE) motif, GCCACC or CCACCC, and the Sp1 consensus binding sequence, CCGCCC, can confer equal responsiveness to RB. Here, we report that RB activates transcription of the c-jun gene through the Sp1-binding site within the c-jun promoter. Preincubation of crude nuclear extracts with monoclonal antibodies to RB results in reduction of Sp1 complexes in a mobility shift assay, while addition of recombinant RB in mobility shift assay mixtures with CCL64 cell extracts leads to an enhancement of DNA-binding activity of SP1. These results suggest that RB is directly or indirectly involved in Sp1-DNA binding activity. A mechanism by which RB regulates transactivation is indicated by our detection of a heat-labile and protease-sensitive Sp1 negative regulator(s) (Sp1-I) that specifically inhibits Sp1 binding to a c-jun Sp1 site. This inhibition is reversed by addition of recombinant RB proteins, suggesting that RB stimulates Sp1-mediated transactivation by liberating Sp1 from Sp1-I. Additional evidence for Sp1-I involvement in Sp1-mediated transactivation was demonstrated by cotransfection of RB, GAL4-Sp1, and a GAL4-responsive template into CV-1 cells. Finally, we have identified Sp1-I, a approximately 20-kDa protein(s) that inhibits the Sp1 complexes from binding to DNA and that is also an RB-associated protein. These findings provide evidence for a functional link between two distinct classes of oncoproteins, RB and c-Jun, that are involved in the control of cell growth, and also define a novel mechanism for the regulation of c-jun expression. Images PMID:8007947

  8. Nuclear receptors modulate the interaction of Sp1 and GC-rich DNA via ternary complex formation.

    PubMed Central

    Husmann, M; Dragneva, Y; Romahn, E; Jehnichen, P

    2000-01-01

    Binding sites for transcription factor Sp1 have been implicated in the transcriptional regulation of several genes by hormones or vitamins, and here we show that a GC-rich element contributes to the retinoic acid response of the interleukin 1beta promoter. To explain such observations, it has been proposed that nuclear receptors can interact with Sp1 bound to GC-rich DNA. However, evidence supporting this model has remained indirect. So far, nuclear receptors have not been detected in a complex with Sp1 and GC-rich DNA, and the expected ternary complexes in non-denaturing gels were not seen. In search for these missing links we found that nuclear receptors [retinoic acid receptor (RAR), thyroid hormone receptor (TR), vitamin D(3) receptor, peroxisome-proliferator-activated receptor and retinoic X receptor] induce an electrophoretic mobility increase of Sp1-GC-rich DNA complexes. Concomitantly, binding of Sp1 to the GC-box is enhanced. It is proposed that nuclear receptors may partially replace Sp1 in homo-oligomers at the GC-box. RARs and Sp1 can also combine into a complex with a retinoic acid-response element. The presence of RAR and Sp1 in complexes with either cognate site was revealed in supershift experiments. The C-terminus of Sp1 interacts with nuclear receptors. Both the ligand- and DNA-binding domains of the receptor are important for complex formation with Sp1 and GC-rich DNA. In spite of similar capacity to form ternary complexes, RAR but not TR up-regulated an Sp1-driven reporter in a ligand-dependent way. Thus additional factors limit the transcriptional response mediated by nuclear receptors and Sp1. PMID:11104684

  9. Retinoid-induced apoptosis and Sp1 cleavage occur independently of transcription and require caspase activation.

    PubMed Central

    Piedrafita, F J; Pfahl, M

    1997-01-01

    Vitamin A and its derivatives, the retinoids, are essential regulators of many important biological functions, including cell growth and differentiation, development, homeostasis, and carcinogenesis. Natural retinoids such as all-trans retinoic acid can induce cell differentiation and inhibit growth of certain cancer cells. We recently identified a novel class of synthetic retinoids with strong anti-cancer cell activities in vitro and in vivo which can induce apoptosis in several cancer cell lines. Using an electrophoretic mobility shift assay, we analyzed the DNA binding activity of several transcription factors in T cells treated with apoptotic retinoids. We found that the DNA binding activity of the general transcription factor Sp1 is lost in retinoid-treated T cells undergoing apoptosis. A truncated Sp1 protein is detected by immunoblot analysis, and cytosolic protein extracts prepared from apoptotic cells contain a protease activity which specifically cleaves purified Sp1 in vitro. This proteolysis of Sp1 can be inhibited by N-ethylmaleimide and iodoacetamide, indicating that a cysteine protease mediates cleavage of Sp1. Furthermore, inhibition of Sp1 cleavage by ZVAD-fmk and ZDEVD-fmk suggests that caspases are directly involved in this event. In fact, caspases 2 and 3 are activated in T cells after treatment with apoptotic retinoids. The peptide inhibitors also blocked retinoid-induced apoptosis, as well as processing of caspases and proteolysis of Sp1 and poly(ADP-ribose) polymerase in intact cells. Degradation of Sp1 occurs early during apoptosis and is therefore likely to have profound effects on the basal transcription status of the cell. Interestingly, retinoid-induced apoptosis does not require de novo mRNA and protein synthesis, suggesting that a novel mechanism of retinoid signaling is involved, triggering cell death in a transcriptional activation-independent, caspase-dependent manner. PMID:9343396

  10. A novel functional interaction between the Sp1-like protein KLF13 and SREBP-Sp1 activation complex underlies regulation of low density lipoprotein receptor promoter function.

    PubMed

    Natesampillai, Sekar; Fernandez-Zapico, Martin E; Urrutia, Raul; Veldhuis, Johannes D

    2006-02-10

    Cholesterol homeostasis is regulated by a family of transcription factors designated sterol regulatory element-binding proteins (SREBPs). Precise control of SREBP-targeted genes requires additional interactions with co-regulatory transcription factors. In the case of the low density lipoprotein receptor (LDLR), SREBP cooperates with the specificity protein Sp1 to activate the promoter. In this report, we describe a novel pathway in LDLR transcriptional regulation distinct from the SREBP-Sp1 activation complex involving the Sp1-like protein Krueppel-like factor 13 (KLF13). Using a combination of RNA interference, electrophoretic mobility shift, chromatin immunoprecipitation, and reporter assays, deletion, and site-directed mutagenesis, we demonstrated that KLF13 mediates repression in a DNA context-selective manner. KLF13 repression of LDLR promoter activity appears to be needed to keep the receptor silent, a state that can be antagonized by Sp1, SREBP, and inhibitors of histone deacetylase activity. Chromatin immunoprecipitation assay confirmed that KLF13 binds proximal LDLR DNA sequences in vivo and that exogenous oxysterol up-regulates such binding. Together these studies identify a novel regulatory pathway in which gene repression by KLF13 must be overcome by the Sp1-SREBP complex to activate the LDLR promoter. Therefore, these data should replace a pre-existent and more simple paradigm that takes into consideration only the induction of the activator proteins Sp1-SREBP as necessary for LDLR promoter drive without including default repression, such as that by KLF13, of the LDLR gene. PMID:16303770

  11. Crosstalk of Sp1 and Stat3 signaling in pancreatic cancer pathogenesis

    PubMed Central

    Huang, Chen; Xie, Keping

    2012-01-01

    Pancreatic cancer progression is attributed to genetic and epigenetic alterations and a chaotic tumor microenvironment. Those diverse “upstream signal” factors appear to converge on specific sets of central nuclear regulators, namely, transcription factors. Specificity Protein 1 (Sp1) and signal transducer and activator of transcription 3 (Stat3) are central transcription factors that regulate a number of pathways important to tumorigenesis, including tumor cell-cycle progression, apoptosis, angiogenesis, metastasis, and evasion of the immune system. Recently, researchers demonstrated many types of crosstalk of Sp1 and Stat3 in tumor signal transduction and that these factors function cooperatively to activate targeted genes and promote tumorigenesis in pancreatic cancer. Therefore, targeting both Sp1 and Stat3 is a potential preventive and therapeutic strategy for pancreatic cancer. PMID:22342309

  12. Zac1, an Sp1-like protein, regulates human p21{sup WAF1/Cip1} gene expression in HeLa cells

    SciTech Connect

    Liu, Pei-Yao; Hsieh, Tsai-Yuan; Liu, Shu-Ting; Chang, Yung-Lung; Lin, Wei-Shiang; Wang, Wei-Ming; Huang, Shih-Ming

    2011-12-10

    Zac1 functions as both a transcription factor and a transcriptional cofactor for p53, nuclear receptors (NRs) and NR coactivators. Zac1 might also act as a transcriptional repressor via the recruitment of histone deacetylase 1 (HDAC1). The ability of Zac1 to interact directly with GC-specific elements indicates that Zac1 possibly binds to Sp1-responsive elements. In the present study, our data show that Zac1 is able to interact directly with the Sp1-responsive element in the p21{sup WAF1/Cip1} gene promoter and enhance the transactivation activity of Sp1 through direct physical interaction. Our data further demonstrate that Zac1 might enhance Sp1-specific promoter activity by interacting with the Sp1-responsive element, affecting the transactivation activity of Sp1 via a protein-protein interaction, or competing the HDAC1 protein away from the pre-existing Sp1/HDAC1 complex. Finally, the synergistic regulation of p21{sup WAF1/Cip1} gene expression by Zac1 and Sp1 is mediated by endogenous p53 protein and p53-responsive elements in HeLa cells. Our work suggests that Zac1 might serve as an Sp1-like protein that directly interacts with the Sp1-responsive element to oligomerize with and/or to coactivate Sp1.

  13. Arf Induction by Tgfβ Is Influenced by Sp1 and C/ebpβ in Opposing Directions

    PubMed Central

    Zheng, Yanbin; Devitt, Caitlin; Liu, Jing; Iqbal, Nida; Skapek, Stephen X.

    2013-01-01

    Recent studies show that Arf, a bona fide tumor suppressor, also plays an essential role during mouse eye development. Tgfβ is required for Arf promoter activation in developing mouse eyes, and its capacity to induce Arf depends on Smads 2/3 as well as p38 Mapk. Substantial delay between activation of these pathways and increased Arf transcription imply that changes in the binding of additional transcription factors help orchestrate changes in Arf expression. Focusing on proteins with putative DNA binding elements near the mouse Arf transcription start, we now show that Tgfβ induction of this gene correlated with decreased expression and DNA binding of C/ebpβ to the proximal Arf promoter. Ectopic expression of C/ebpβ in mouse embryo fibroblasts (MEFs) blocked Arf induction by Tgfβ. Although basal levels of Arf mRNA were increased by C/ebpβ loss in MEFs and in the developing eye, Tgfβ was still able to increase Arf, indicating that derepression was not the sole factor. Chromatin immunoprecipitation (ChIP) assay showed increased Sp1 binding to the Arf promotor at 24 and 48 hours after Tgfβ treatment, at which time points Arf expression was significantly induced by Tgfβ. Chemical inhibition of Sp1 and its knockdown by RNA interference blocked Arf induction by Tgfβ in MEFs. In summary, our results indicate that C/ebpβ and Sp1 are negative and positive Arf regulators that are influenced by Tgfβ. PMID:23940569

  14. Young Mothers' Play with Their Toddlers: Individual Variability as a Function of Psychosocial Factors

    ERIC Educational Resources Information Center

    Driscoll, Joan Riley; Easterbrooks, M. Ann

    2007-01-01

    There is no one style of parenting which characterizes young mothers as a group. In addition, life circumstances play an important role in shaping maternal behaviour. The aim of this study was to identify patterns of maternal play behaviour and contextual (social and personal) factors associated with these different patterns. In this study, 107…

  15. Contributing Factors on Malaysia Preschool Teachers' Belief, Attitude and Competence in Using Play Activities

    ERIC Educational Resources Information Center

    Jantan, Hafsah Binti; Bin Hamdan, Abdul Rahim; Yahya, Fauziah Hj; Saleh, Halimatussadiah Binti; Ong, Mohd Hanafi Bin Azman

    2015-01-01

    This study focused on preschool teachers' belief, attitude, knowledge and competence in using play in Malaysia. Its purpose is to find out indicators significantly contribute to belief, attitude, knowledge and competence in play of preschool teachers in Malaysia. The method used was factor analysis in order to confirm indicators in each variable…

  16. Bovine lactoferricin induces TIMP-3 via the ERK1/2-Sp1 axis in human articular chondrocytes

    PubMed Central

    Yan, Dongyao; Chen, Di; Hawse, John R; van Wijnen, Andre J; Im, Hee-Jeong

    2013-01-01

    Bovine lactoferricin (LfcinB) is a heparan sulfate-binding peptide with multiple bioactivities. In human articular cartilage, LfcinB antagonizes interleukin-1 β (IL-1β) and fibroblast growth factor 2 (FGF-2) in proteoglycan metabolism, catabolic protease expression, and induction of pro-inflammatory mediators. LfcinB specifically activates ERK1/2, p38 and Akt, but whether these signaling pathways control the expression of LfcinB target genes remained unknown. In this report, we characterized a novel aspect of LfcinB-mediated genetic response in human articular chondrocytes, tissue inhibitor of metalloproteinase 3 (TIMP-3) induction. Inhibition of individual signaling pathways revealed that ERK1/2 functions as the major pathway in TIMP-3 expression, whereas Akt plays a minor role. Further investigation identified Sp1 as a critical transcriptional activator in TIMP-3 regulation, and Sp1 activity is modulated by ERK1/2, not Akt. Comparative quantification indicates significant downregulation of TIMP-3 occurs in OA chondrocytes, suggesting a beneficial role of LfcinB in OA pathogenesis. Our results collectively provide new insights into the mechanism of action of LfcinB, and support the candidacy of LfcinB as a chondroprotective agent. PMID:23313877

  17. Modifying factors in sports-related concussion: dangerous style of play.

    PubMed

    Diamond, Alex B; Solomon, Gary S

    2014-09-01

    In its third iteration, the Concussion in Sport Group identified 10 modifying factors that were presumed clinically to influence the investigation and management of concussions in sports. "Dangerous style of play" was delineated as one of these factors, most likely based on clinical lore. These modifying factors were retained in a more recent Concussion in Sport Group statement. To date, there has been no concerted effort to support or refute the inclusion of this constellation of behaviors as a modifying factor in sports-related concussion. This article reviews and summarizes the limited evidence related to a dangerous style of play in sports-related concussion, offers a preliminary assessment of its relevance as a modifying factor, and provides additional information on other aspects of player, coach, and governing body behavior and their potential effect(s) on reducing concussive injuries. PMID:25295762

  18. Outdoor Play and Play Equipment.

    ERIC Educational Resources Information Center

    Naylor, Heather

    1985-01-01

    Discusses aspects of the play environment and its effect on children's play behavior. Indoor and outdoor play spaces are considered along with factors affecting the use of outdoor environments for play. Children's preferences for different outdoor play environments and for various play structures are explored. Guides for choosing play equipment…

  19. Up-regulation of Hsp27 by ERα/Sp1 facilitates proliferation and confers resistance to apoptosis in human papillary thyroid cancer cells.

    PubMed

    Mo, Xiao-Mei; Li, Li; Zhu, Ping; Dai, Yu-Jie; Zhao, Ting-Ting; Liao, Ling-Yao; Chen, George G; Liu, Zhi-Min

    2016-08-15

    17β-estradiol (E2) has been suggested to play a role in the development and progression of papillary thyroid cancer. Heat shock protein 27 (Hsp27) is a member of the Hsp family that is responsible for cell survival under stressful conditions. Previous studies have shown that the 5'-promoter region of Hsp27 gene contains a specificity protein-1 (Spl) and estrogen response element half-site (ERE-half), which contributes to Hsp27 induction by E2 in breast cancer cells. However, it is unclear whether Hsp27 can be up-regulated by E2 and which estrogen receptor (ER) isoform and tethered transcription factor are involved in this regulation in papillary thyroid cancer cells. In the present study, we demonstrated that Hsp27 can be effectively up-regulated by E2 at mRNA and protein levels in human K1 and BCPAP papillary thyroid cancer cells which have more than two times higher level of ERα than that of ERβ. The up-regulation of Hsp27 by E2 is mediated by ERα/Sp1 and ERβ has repressive effect on this ERα/Sp1-mediated up-regulation of Hsp27. Moreover, we showed that the up-regulation of Hsp27 by ERα/Sp1 facilitates proliferation and confers resistance to apoptosis through interaction with procaspase-3. Targeting this pathway may be a potential strategy for therapy of papillary thyroid cancer. PMID:27179757

  20. p53 inhibits the expression of p125 and the methylation of POLD1 gene promoter by downregulating the Sp1-induced DNMT1 activities in breast cancer

    PubMed Central

    Zhang, Liang; Yang, Weiping; Zhu, Xiao; Wei, Changyuan

    2016-01-01

    p125 is one of four subunits of human DNA polymerases – DNA Pol δ as well as one of p53 target protein encoded by POLD1. However, the function and significance of p125 and the role that p53 plays in regulating p125 expression are not fully understood in breast cancer. Tissue sections of human breast cancer obtained from 70 patients whose median age was 47.6 years (range: 38–69 years) with stage II–III breast cancer were studied with normal breast tissue from the same patients and two human breast cell lines (MCF-7 and MCF-10A). p53 expression levels were reduced, while p125 protein expression was increased in human breast cancer tissues and cell line detected by Western blot and quantitative reverse transcriptase-polymerase chain reaction. The methylation level of the POLD1 gene promoter was greater in breast cancer tissues and cells when compared with normal tissues and cells. In MCF-7 cell model, p53 overexpression caused a decrease in the level of p125 protein, while the methylation level of the p125 gene promoter was also inhibited by p53 overexpression. To further investigate the regulating mechanism of p53 on p125 expression, our study focused on DNA methyltransferase 1 (DNMT1) and transcription factor Sp1. Both DNMT1 and Sp1 protein expression were reduced when p53 was overexpressed in MCF-7 cells. The Sp1 binding site appears to be important for DNMT1 gene transcription; Sp1 and p53 can bind together, which means that DNMT1 gene expression may be downregulated by p53 through binding to Sp1. Because DNMT1 methylation level of the p125 gene promoter can affect p125 gene transcription, we propose that p53 may indirectly regulate p125 gene promoter expression through the control of DNMT1 gene transcription. In conclusion, the data from this preliminary study have shown that p53 inhibits the methylation of p125 gene promoter by downregulating the activities of Sp1 and DNMT1 in breast cancer. PMID:27022290

  1. Users guide for the ANL IBM SP1

    SciTech Connect

    Gropp, W.; Lusk, E.; Pieper, S.C.

    1994-10-01

    This guide presents the features of the IBM SP1 installed in the Mathematics and Computer Science Division at Argonne National Laboratory. The guide describes the available hardware and software, access policies, and hints for using the system productively.

  2. Transcriptional activation of human 12-lipoxygenase gene promoter is mediated through Sp1 consensus sites in A431 cells.

    PubMed Central

    Liu, Y W; Arakawa, T; Yamamoto, S; Chang, W C

    1997-01-01

    The functional 5' flanking region of the human 12-lipoxygenase in epidermoid carcinoma A431 cells was characterized. By a primer extension method, the transcription initiation sites were mapped at -47 adenosine, -48 guanosine and -55 guanosine upstream of the ATG translation start codon. Transient transfection with a series of 5' and 3' deletion constructs showed that the 5' flanking region spanning from -224 to -100 bp was important for the basal expression of 12-lipoxygenase gene. Gel mobility shift assays with antibodies of transcription factors showed that both Sp1 and Sp3 required highly GC-rich Sp1 sites within this region for binding. Disruption of two Sp1 recognition motifs residing at -158 to -150 bp and -123 to -114 bp by site-directed mutagenesis markedly reduced the basal 12-lipoxygenase promoter activity and abolished the retarded bands in a gel-shift assay, indicating that these two Sp1-binding sites were essential for gene expression. The same two Sp1-binding sites in this promoter region were also responsible for epidermal growth factor (EGF)-induced expression of 12-lipoxygenase gene. Moreover, EGF also induced the transcriptional activation of luciferase driven by SV40 early promoter, which contained rich Sp1-binding sites. Taken together, the results suggest that two specific Sp1 consensus sites are involved in the mediation of the basal promoter activity as well as EGF induction of the 12-lipoxygenase gene and that Sp1 and Sp3 transcription factors might have a role in their regulation. PMID:9164849

  3. Factors affecting return to play after anterior cruciate ligament reconstruction: a review of the current literature.

    PubMed

    Bauer, Matthew; Feeley, Brian T; Wawrzyniak, John R; Pinkowsky, Gregory; Gallo, Robert A

    2014-11-01

    Anterior cruciate ligament reconstruction has been reported to produce normal or near-normal knee results in > 90% of patients. A recent meta-analysis suggested that, despite normal or near-normal knees, many athletes do not return to sports. Rates and timing of return to competitive athletics are quite variable depending on the graft type, the age of the patient, the sport, and the level of play. Even when athletes do return to play, often they do not return to their previous level. Graft failure, subjective physical factors, and psychological factors, including fear of reinjury and lack of motivation, appear to play a large role in patients' ability to return to sporting activities. PMID:25419890

  4. Monoamine oxidase B levels are highly expressed in human gliomas and are correlated with the expression of HiF-1α and with transcription factors Sp1 and Sp3

    PubMed Central

    Sharpe, Martyn A.; Baskin, David S.

    2016-01-01

    Monoamine oxidases A and B (MAOA and MAOB) are highly expressed in many cancers. Here we investigated the level of MAOB in gliomas and confirmed its high expression. We found that MAOB levels correlated with tumor grade and hypoxia-inducible factor 1-alpha (HiF-1α) expression. HiF-1α was localized to the nuclei in high-grade gliomas, but it was primarily cytosolic in low-grade gliomas and normal human astrocytes. Expression of both glial fibrillary acidic protein (GFAP) and MAOB are correlated to HiF-1α expression levels. Levels of MAOB are correlated by the levels of transcription factor Sp3 in the majority of GBM examined, but this control of MAOB expression by Sp3 in low grade astrocytic gliomas is significantly different from control in the in the majority of glioblastomas. The current findings support previous suggestions that MAOB can be exploited for the killing of cancer cells. Selective cell toxicity can be achieved by designing non-toxic prodrugs that require MAOB for their catalytic conversion into mature cytotoxic chemotherapeutics. PMID:26689994

  5. Assessment of pretend play in preschool-aged children: validation and factor analysis of the affect in play scale-preschool version.

    PubMed

    Fehr, Karla K; Russ, Sandra W

    2014-01-01

    The Affect in Play Scale-Preschool (APS-P) and Affect in Play Scale-Preschool-Brief Rating (APS-P-BR) versions assess cognitive and affective play processes during a 5-min standardized play task. In this study, construct validity, external validity, and factor analyses for each scale were examined in 107 preschoolers. Reliability and validity were supported. Unlike results found with school-aged samples, positive affect loaded with the cognitive variables on factor analyses of the APS-P and APS-P-BR, suggesting that negative and undefined affect might represent a separate factor in preschool-aged children. Developmental significance and implications for use of the 2 scoring versions are discussed. PMID:24090344

  6. Sp1 is essential and its position is important for p120 gene transcription: a 35 bp juxtaposed positive regulatory element enhances transcription 2.5 fold.

    PubMed Central

    Haidar, M A; Henning, D; Busch, H

    1991-01-01

    Human proliferating cell nucleolar antigen p120 is expressed in tumor cells in the early G1 phase of the cell cycle. Deletion analyses of the essential cis-acting region -537/-278 showed that a 58 bp sequence from -457 to -400 is an important cis-acting element. An Sp1 transcription factor binds to the sequence AGAGGCGGGG (-425 to -416) within the -458/-400 cis-acting region. Deletion of the Sp1 binding sequence eliminated transcription. Substitution of the Sp1 box(-437/-406), containing the Sp1 recognition site, for the entire cis-acting region (-537/-278) restored transcription only at a very low level (18%). Deletion of the -537/-278 cis-acting region followed by substitutions showed that the Sp1 box (-437/-406) stimulated transcription 2.4 fold, when juxtaposed and downstream of a 35 bp (-472 GGGCGAGCGTAAGTTCCGGGTGCGGCGGCCGACTA -438) positive regulatory cis-element (PRE) over that by substitution of the Sp1 box alone. When the -406/-278 sequence was downstream of the PRE-Sp1 box, transcription was stimulated 4.4 fold over that produced by substitution of the Sp1 box alone. These results suggest that Sp1 is essential and its proper position in the 5' flanking sequence, juxtaposed and down stream of a 35 bp positive regulatory sequence, is required for efficient transcription. Images PMID:1754393

  7. Growth factor delivery methods in the management of sports injuries: the state of play.

    PubMed

    Creaney, L; Hamilton, B

    2008-05-01

    In recent years there have been rapid developments in the use of growth factors for accelerated healing of injury. Growth factors have been used in maxillo-facial and plastic surgery with success and the technology is now being developed for orthopaedics and sports medicine applications. Growth factors mediate the biological processes necessary for repair of soft tissues such as muscle, tendon and ligament following acute traumatic or overuse injury, and animal studies have demonstrated clear benefits in terms of accelerated healing. There are various ways of delivering higher doses of growth factors to injured tissue, but each has in common a reliance on release of growth factors from blood platelets. Platelets contain growth factors in their alpha-granules (insulin-like growth factor-1, basic fibroblast growth factor, platelet-derived growth factor, epidermal growth factor, vascular endothelial growth factor, transforming growth factor-beta(1)) and these are released upon injection at the site of an injury. Three commonly utilised techniques are known as platelet-rich plasma, autologous blood injections and autologous conditioned serum. Each of these techniques has been studied clinically in humans to a very limited degree so far, but results are promising in terms of earlier return to play following muscle and particularly tendon injury. The use of growth factors in sports medicine is restricted under the terms of the World Anti-Doping Agency (WADA) anti-doping code, particularly because of concerns regarding the insulin-like growth factor-1 content of such preparations, and the potential for abuse as performance-enhancing agents. The basic science and clinical trials related to the technology are reviewed, and the use of such agents in relation to the WADA code is discussed. PMID:17984193

  8. Contributing factors, prevention, and management of playing-related musculoskeletal disorders among flute players internationally.

    PubMed

    Lonsdale, Karen; Laakso, E-Liisa; Tomlinson, Vanessa

    2014-09-01

    Major studies have shown that flutists report playing-related pain in the neck, middle/upper back, shoulders, wrists, and hands. The current survey was designed to establish the injury concerns of flute players and teachers of all backgrounds, as well as their knowledge and awareness of injury prevention and management. Questions addressed a range of issues including education, history of injuries, preventative and management strategies, lifestyle factors, and teaching methods. At the time of the survey, 26.7% of all respondents were suffering from flute playing-related discomfort or pain; 49.7% had experienced flute playing-related discomfort or pain that was severe enough to distract while performing; and 25.8% had taken an extended period of time off playing because of discomfort or pain. Consistent with earlier studies, the most common pain sites were the fingers, hands, arms, neck, middle/upper back, and shoulders. Further research is needed to establish possible links between sex, instrument types, and ergonomic set up. Further investigation is recommended to ascertain whether certain types of physical training, education, and practice approaches may be more suitable than current methods. A longitudinal study researching the relationship between early education, playing position, ergonomic set-up, and prevalence of injury is recommended. PMID:25194113

  9. SP1 protein-based nanostructures and arrays.

    PubMed

    Medalsy, Izhar; Dgany, Or; Sowwan, Mukhles; Cohen, Hezy; Yukashevska, Alevtyna; Wolf, Sharon G; Wolf, Amnon; Koster, Abraham; Almog, Orna; Marton, Ira; Pouny, Yehonathan; Altman, Arie; Shoseyov, Oded; Porath, Danny

    2008-02-01

    Controlled formation of complex nanostructures is one of the main goals of nanoscience and nanotechnology. Stable Protein 1 (SP1) is a boiling-stable ring protein complex, 11 nm in diameter, which self-assembles from 12 identical monomers. SP1 can be utilized to form large ordered arrays; it can be easily modified by genetic engineering to produce various mutants; it is also capable of binding gold nanoparticles (GNPs) and thus forming protein-GNP chains made of alternating SP1s and GNPs. We report the formation and the protocols leading to the formation of those nanostructures and their characterization by transmission electron microscopy, atomic force microscopy, and electrostatic force microscopy. Further control over the GNP interdistances within the protein-GNP chains may lead to the formation of nanowires and structures that may be useful for nanoelectronics. PMID:18193911

  10. Pin1-mediated Sp1 phosphorylation by CDK1 increases Sp1 stability and decreases its DNA-binding activity during mitosis.

    PubMed

    Yang, Hang-Che; Chuang, Jian-Ying; Jeng, Wen-Yih; Liu, Chia-I; Wang, Andrew H-J; Lu, Pei-Jung; Chang, Wen-Chang; Hung, Jan-Jong

    2014-12-16

    We have shown that Sp1 phosphorylation at Thr739 decreases its DNA-binding activity. In this study, we found that phosphorylation of Sp1 at Thr739 alone is necessary, but not sufficient for the inhibition of its DNA-binding activity during mitosis. We demonstrated that Pin1 could be recruited to the Thr739(p)-Pro motif of Sp1 to modulate the interaction between phospho-Sp1 and CDK1, thereby facilitating CDK1-mediated phosphorylation of Sp1 at Ser720, Thr723 and Thr737 during mitosis. Loss of the C-terminal end of Sp1 (amino acids 741-785) significantly increased Sp1 phosphorylation, implying that the C-terminus inhibits CDK1-mediated Sp1 phosphorylation. Binding analysis of Sp1 peptides to Pin1 by isothermal titration calorimetry indicated that Pin1 interacts with Thr739(p)-Sp1 peptide but not with Thr739-Sp1 peptide. X-ray crystallography data showed that the Thr739(p)-Sp1 peptide occupies the active site of Pin1. Increased Sp1 phosphorylation by CDK1 during mitosis not only stabilized Sp1 levels by decreasing interaction with ubiquitin E3-ligase RNF4 but also caused Sp1 to move out of the chromosomes completely by decreasing its DNA-binding activity, thereby facilitating cell cycle progression. Thus, Pin1-mediated conformational changes in the C-terminal region of Sp1 are critical for increased CDK1-mediated Sp1 phosphorylation to facilitate cell cycle progression during mitosis. PMID:25398907

  11. Functional Interactions between C/EBP, Sp1, and COUP-TF Regulate Human Immunodeficiency Virus Type 1 Gene Transcription in Human Brain Cells

    PubMed Central

    Schwartz, Christian; Catez, Philippe; Rohr, Olivier; Lecestre, Dominique; Aunis, Dominique; Schaeffer, Evelyne

    2000-01-01

    Human immunodeficiency virus type 1 (HIV-1) infects the central nervous system (CNS) and plays a direct role in the pathogenesis of AIDS dementia. However, mechanisms underlying HIV-1 gene expression in the CNS are poorly understood. The importance of CCAAT/enhancer binding proteins (C/EBP) for HIV-1 expression in cells of the immune system has been recently reported. In this study, we have examined the role and the molecular mechanisms by which proteins of the C/EBP family regulate HIV-1 gene transcription in human brain cells. We found that NF-IL6 acts as a potent activator of the long terminal repeat (LTR)-driven transcription in microglial and oligodendroglioma cells. In contrast, C/EBPγ inhibits NF-IL6-induced activation. Consistent with previous data, our transient expression results show cell-type-specific NF-IL6-mediated transactivation. In glial cells, full activation needs the presence of the C/EBP binding sites; however, NF-IL6 is still able to function via the minimal −40/+80 region. In microglial cells, C/EBP sites are not essential, since NF-IL6 acts through the −68/+80 LTR region, containing two binding sites for the transcription factor Sp1. Moreover, we show that functional interactions between NF-IL6 and Sp1 lead to synergistic transcriptional activation of the LTR in oligodendroglioma and to mutual repression in microglial cells. We further demonstrate that NF-IL6 physically interacts with the nuclear receptor chicken ovalbumin upstream promoter transcription factor (COUP-TF), via its DNA binding domain, in vitro and in cells, which results in mutual transcriptional repression. These findings reveal how the interplay of NF-IL6 and C/EBPγ, together with Sp1 and COUP-TF, regulates HIV-1 gene transcription in brain cells. PMID:10590092

  12. A cooperative interaction between NF-kappa B and Sp1 is required for HIV-1 enhancer activation.

    PubMed Central

    Perkins, N D; Edwards, N L; Duckett, C S; Agranoff, A B; Schmid, R M; Nabel, G J

    1993-01-01

    The human immunodeficiency virus (HIV-1) long terminal repeat (LTR) contains two binding sites for NF-kappa B in close proximity to three binding sites for the constitutive transcription factor, Sp1. Previously, stimulation of the HIV enhancer in response to mitogens has been attributed to the binding of NF-kappa B to the viral enhancer. In this report, we show that the binding of NF-kappa B is not by itself sufficient to induce HIV gene expression. Instead, a protein-protein interaction must occur between NF-kappa B and Sp1 bound to an adjacent site. Cooperativity both in DNA binding and in transcriptional activation of NF-kappa B and Sp1 was confirmed by electrophoretic mobility shift gel analysis, DNase footprinting, chemical cross-linking and transfection studies in vivo. With a heterologous promoter, we find that the interaction of NF-kappa B with Sp1 is dependent on orientation and position, and is not observed with other elements, including GATA, CCAAT or octamer. An increase in the spacing between the kappa B and Sp1 elements virtually abolishes this functional interaction, which is not restored when these sites are brought back into the same helical position. Several other promoters regulated by NF-kappa B also contain kappa B in proximity to Sp1 binding sites. These findings suggest that an interaction between NF-kappa B and Sp1 is required for inducible HIV-1 gene expression and may serve as a regulatory mechanism to activate specific viral and cellular genes. Images PMID:8253080

  13. Bortezomib induces DNA hypomethylation and silenced gene transcription by interfering with Sp1/NF-κB–dependent DNA methyltransferase activity in acute myeloid leukemia

    PubMed Central

    Liu, Shujun; Liu, Zhongfa; Xie, Zhiliang; Pang, Jiuxia; Yu, Jianhua; Lehmann, Esther; Huynh, Lenguyen; Vukosavljevic, Tamara; Takeki, Mitsui; Klisovic, Rebecca B.; Baiocchi, Robert A.; Blum, William; Porcu, Pierluigi; Garzon, Ramiro; Byrd, John C.; Perrotti, Danilo; Caligiuri, Michael A.; Chan, Kenneth K.; Wu, Lai-Chu

    2008-01-01

    Bortezomib reversibly inhibits 26S proteasomal degradation, interferes with NF-κB, and exhibits antitumor activity in human malignancies. Zinc finger protein Sp1 transactivates DNMT1 gene in mice and is functionally regulated through protein abundance, posttranslational modifications (ie, ubiquitination), or interaction with other transcription factors (ie, NF-κB). We hypothesize that inhibition of proteasomal degradation and Sp1/NF-κB–mediated transactivation may impair aberrant DNA methyltransferase activity. We show here that, in addition to inducing accumulation of polyubiquitinated proteins and abolishment of NF-κB activities, bortezomib decreases Sp1 protein levels, disrupts the physical interaction of Sp1/NF-κB, and prevents binding of the Sp1/NF-κB complex to the DNMT1 gene promoter. Abrogation of Sp1/NF-κB complex by bortezomib causes transcriptional repression of DNMT1 gene and down-regulation of DNMT1 protein, which in turn induces global DNA hypomethylation in vitro and in vivo and re-expression of epigenetically silenced genes in human cancer cells. The involvement of Sp1/NF-κB in DNMT1 regulation is further demonstrated by the observation that Sp1 knockdown using mithramycin A or shRNA decreases DNMT1 protein levels, which instead are increased by Sp1 or NF-κB overexpression. Our results unveil the Sp1/NF-κB pathway as a modulator of DNA methyltransferase activity in human cancer and identify bortezomib as a novel epigenetic-targeting drug. PMID:18083845

  14. Kaempferol stimulates gene expression of low-density lipoprotein receptor through activation of Sp1 in cultured hepatocytes

    PubMed Central

    Ochiai, Ayasa; Miyata, Shingo; Iwase, Masamori; Shimizu, Makoto; Inoue, Jun; Sato, Ryuichiro

    2016-01-01

    A high level of plasma low-density lipoprotein (LDL) cholesterol is considered a risk factor for atherosclerosis. Because the hepatic LDL receptor (LDLR) is essential for clearing plasma LDL cholesterol, activation of LDLR is a promising therapeutic target for patients with atherosclerotic disease. Here we demonstrated how the flavonoid kaempferol stimulated the gene expression and activity of LDLR in HepG2 cells. The kaempferol-mediated stimulation of LDLR gene expression was completely inhibited by knockdown of Sp1 gene expression. Treatment of HepG2 cells with kaempferol stimulated the recruitment of Sp1 to the promoter region of the LDLR gene, as well as the phosphorylation of Sp1 on Thr-453 and Thr-739. Moreover, these kaempferol-mediated processes were inhibited in the presence of U0126, an ERK pathway inhibitor. These results suggest that kaempferol may increase the activity of Sp1 through stimulation of Sp1 phosphorylation by ERK1/2 and subsequent induction of LDLR expression and activity. PMID:27109240

  15. Sp1/NFκB/HDAC/miR-29b Regulatory Network in KIT-driven Myeloid Leukemia

    PubMed Central

    Liu, Shujun; Wu, Lai-Chu; Pang, Jiuxia; Santhanam, Ramasamy; Schwind, Sebastian; Wu, Yue-Zhong; Hickey, Christopher; Yu, Jianhua; Becker, Heiko; Maharry, Kati; Radmacher, Michael D; Li, Chenglong; Whitman, Susan P.; Mishra, Anjali; Stauffer, Nicole; Eiring, Anna M.; Briesewitz, Roger; Baiocchi, Robert A.; Chan, Kenneth K.; Paschka, Peter; Caligiuri, Michael A.; Byrd, John C.; Croce, Carlo M; Bloomfield, Clara D.; Perrotti, Danilo; Garzon, Ramiro; Marcucci, Guido

    2010-01-01

    SUMMARY The biologic and clinical significance of KIT overexpression that associates with KIT gain-of- function mutations occurring in subsets of acute myeloid leukemia (AML) (i.e., core binding factor AML) is unknown. Here, we show that KIT mutations lead to MYC-dependent miR-29b repression and increased levels of the miR-29b target Sp1 in KIT-driven leukemia. Sp1 enhances its own expression by participating in a NFκB/HDAC complex that further represses miR-29b transcription. Upregulated Sp1 then binds NFκB and transactivates KIT. Therefore, activated KIT ultimately induces its own transcription. Our results provide evidence that the mechanisms of Sp1/NFκB/HDAC/miR-29b-dependent KIT overexpression contribute to leukemia growth and can be successfully targeted by pharmacological disruption of the Sp1/NFκB/HDAC complex or synthetic miR-29b treatment in KIT-driven AML. PMID:20385359

  16. PTEN downregulates p75NTR expression by decreasing DNA-binding activity of Sp1

    SciTech Connect

    Rankin, Sherri L.; Guy, Clifford S.; Mearow, Karen M.

    2009-02-13

    p75NTR is expressed throughout the nervous system and its dysregulation is associated with pathological conditions. We have recently demonstrated a signalling cascade initiated by laminin (LN), which upregulates PTEN and downregulates p75NTR. Here we investigate the mechanism by which PTEN modulates p75NTR. Studies using PTEN mutants show that its protein phosphatase activity directly modulates p75NTR protein expression. Nuclear relocalization of PTEN subsequent to LN stimulation suggests transcriptional control of p75NTR expression, which was confirmed following EMSA and ChIP analysis of Sp1 transcription factor binding activity. LN and PTEN independently decrease the DNA-binding ability of PTEN to the p75NTR promoter. Sp1 regulation of p75NTR occurs via dephosphorylation of Sp1, thus reducing p75NTR transcription and protein expression. This mechanism represents a novel regulatory pathway which controls the expression level of a receptor with broad implications not only for the development of the nervous system but also for progression of pathological conditions.

  17. Treatment with Combination of Mithramycin A and Tolfenamic Acid Promotes Degradation of Sp1 Protein and Synergistic Antitumor Activity in Pancreatic Cancer

    PubMed Central

    Jia, Zhiliang; Gao, Yong; Wang, Liwei; Li, Qiang; Zhang, Jun; Le, Xiangdong; Wei, Daoyan; Yao, James C.; Chang, David Z.; Huang, Suyun; Xie, Keping

    2010-01-01

    Previous studies showed that both mithramycin (MIT) and tolfenamic acid (TA) inhibits the activity of the transcription factor Sp1. In the present study, we sought to determine whether treatment with a combination of these two compounds has a synergistic effect on Sp1 activity and pancreatic cancer growth and their underlying mechanisms. In xenograft mouse models of human pancreatic cancer, treatment with MIT and TA produced dose-dependent antitumor activity, and significant antitumor activity of either compound alone was directly associated with systemic side effects as determined according to overall weight loss. However, combination treatment with nontoxic doses of TA and MIT produced synergistic antitumor activity, whereas treatment with a nontoxic dose of either compound alone did not have a discernible antitumor effect. The synergistic therapeutic effects of MIT and TA correlated directly with synergistic antiproliferation and antiangiogenesis in vitro. Moreover, treatment with the combination of TA and MIT resulted in Sp1 protein degradation, leading to drastic downregulation of Sp1 and vascular endothelial growth factor protein expression. Our data demonstrated that Sp1 is a critical target of TA and MIT in human pancreatic cancer therapy. Further studies should be performed to determine the impact of existing pancreatic cancer therapy regimens on Sp1 signaling in tumors and normal pancreatic tissue and the ability of Sp1-targeting strategies to modify these responses and improve upon these regimens. PMID:20086170

  18. On the trajectories of Sp(1) -Kepler problems

    NASA Astrophysics Data System (ADS)

    Meng, Guowu

    2015-10-01

    The classical Sp(1) -Kepler problems are formulated with the help of an idea from S. Sternberg. The trajectories of these models are determined via an idea originated from Levi-Civita. It is found that, for a non-colliding trajectory, its shadow-its projection to the external configuration space-is an ellipse, a parabola or a branch of hyperbola according as the total energy is negative, zero or positive. Moreover, it is shown that, for the Sp(1) -Kepler problems at level n ≥ 2, the group SL(n, H) ×R+ acts transitively on both the set of elliptic shadow trajectories and the set of parabolic shadow trajectories.

  19. Domain II plays a crucial role in the function of ribosome recycling factor

    PubMed Central

    2005-01-01

    RRF (ribosome recycling factor) consists of two domains, and in concert with EF-G (elongation factor-G), triggers dissociation of the post-termination ribosomal complex. However, the function of the individual domains of RRF remains unclear. To clarify this, two RRF chimaeras, EcoDI/TteDII and TteDI/EcoDII, were created by domain swaps between the proteins from Escherichia coli and Thermoanaerobacter tengcongensis. The ribosome recycling activity of the RRF chimaeras was compared with their wild-type RRFs by using in vivo and in vitro activity assays. Like wild-type TteRRF (T. tengcongensis RRF), the EcoDI/TteDII chimaera is non-functional in E. coli, but both wild-type TteRRF, and EcoDI/TteDII can be activated by coexpression of T. tengcongensis EF-G in E. coli. By contrast, like wild-type E. coli RRF (EcoRRF), TteDI/EcoDII is fully functional in E. coli. These findings suggest that domain II of RRF plays a crucial role in the concerted action of RRF and EF-G for the post-termination complex disassembly, and the specific interaction between RRF and EF-G on ribosomes mainly depends on the interaction between domain II of RRF and EF-G. This study provides direct genetic and biochemical evidence for the function of the individual domains of RRF. PMID:16262604

  20. On the role played by magnetic expansion factor in the prediction of solar wind speed

    NASA Astrophysics Data System (ADS)

    Riley, Pete; Linker, Jon A.; Arge, C. Nick

    2015-03-01

    Over the last two decades, the Wang-Sheeley-Arge (WSA) model has evolved significantly. Beginning as a simple observed correlation between the expansion factor of coronal magnetic field lines and the measured speed of the solar wind at 1 AU (the Wang-Sheeley (WS) model), the WSA model now drives NOAA's first operational space weather model, providing real-time predictions of solar wind parameters in the vicinity of Earth. Here we demonstrate that the WSA model has evolved so much that the role played by the expansion factor term is now largely minimal, being supplanted by the distance from the coronal hole boundary (DCHB). We illustrate why and to what extent the three models (WS, DCHB, and WSA) differ. Under some conditions, all approaches are able to reproduce the grossest features of the observed quiet time solar wind. However, we show that, in general, the DCHB- and WSA-driven models tend to produce better estimates of solar parameters at 1 AU than the WS model, particularly when pseudostreamers are present. Additionally, we highlight that these empirical models are sensitive to the type and implementation of the magnetic field model used: In particular, the WS model can only reproduce in situ measurements when coupled with the potential field source surface model. While this clarification is important both in its own right and from an operational/predictive standpoint, because of the underlying physical ideas upon which the WS and DCHB models rest, these results provide support, albeit tentatively, for boundary layer theories for the origin of the slow solar wind.

  1. Transcription factor ets-2 plays an important role in the pathogenesis of pulmonary fibrosis.

    PubMed

    Baran, Christopher P; Fischer, Sara N; Nuovo, Gerard J; Kabbout, Mohamed N; Hitchcock, Charles L; Bringardner, Benjamin D; McMaken, Sara; Newland, Christie A; Cantemir-Stone, Carmen Z; Phillips, Gary S; Ostrowski, Michael C; Marsh, Clay B

    2011-11-01

    Ets-2 is a ubiquitous transcription factor activated after phosphorylation at threonine-72. Previous studies highlighted the importance of phosphorylated ets-2 in lung inflammation and extracellular matrix remodeling, two pathways involved in pulmonary fibrosis. We hypothesized that phosphorylated ets-2 played an important role in pulmonary fibrosis, and we sought to determine the role of ets-2 in its pathogenesis. We challenged ets-2 (A72/A72) transgenic mice (harboring a mutated form of ets-2 at phosphorylation site threonine-72) and ets-2 (wild-type/wild-type [WT/WT]) control mice with sequential intraperitoneal injections of bleomycin, followed by quantitative measurements of lung fibrosis and inflammation and primary cell in vitro assays. Concentrations of phosphorylated ets-2 were detected via the single and dual immunohistochemical staining of murine lungs and lung sections from patients with idiopathic pulmonary fibrosis. Ets-2 (A72/A72) mice were protected from bleomycin-induced pulmonary fibrosis, compared with ets-2 (WT/WT) mice. This protection was characterized by decreased lung pathological abnormalities and the fibrotic gene expression of Type I collagen, Type III collagen, α-smooth muscle actin, and connective tissue growth factor. Immunohistochemical staining of lung sections from bleomycin-treated ets-2 (WT/WT) mice and from patients with idiopathic pulmonary fibrosis demonstrated increased staining of phosphorylated ets-2 that colocalized with Type I collagen expression and to fibroblastic foci. Lastly, primary lung fibroblasts from ets-2 (A72/A72) mice exhibited decreased expression of Type I collagen in response to stimulation with TGF-β, compared with fibroblasts from ets-2 (WT/WT) mice. These data indicate the importance of phosphorylated ets-2 in the pathogenesis of pulmonary fibrosis through the expression of Type I collagen and (myo)fibroblast activation. PMID:21562315

  2. Transcription Factor ets-2 Plays an Important Role in the Pathogenesis of Pulmonary Fibrosis

    PubMed Central

    Baran, Christopher P.; Fischer, Sara N.; Nuovo, Gerard J.; Kabbout, Mohamed N.; Hitchcock, Charles L.; Bringardner, Benjamin D.; McMaken, Sara; Newland, Christie A.; Cantemir-Stone, Carmen Z.; Phillips, Gary S.; Ostrowski, Michael C.

    2011-01-01

    Ets-2 is a ubiquitous transcription factor activated after phosphorylation at threonine-72. Previous studies highlighted the importance of phosphorylated ets-2 in lung inflammation and extracellular matrix remodeling, two pathways involved in pulmonary fibrosis. We hypothesized that phosphorylated ets-2 played an important role in pulmonary fibrosis, and we sought to determine the role of ets-2 in its pathogenesis. We challenged ets-2 (A72/A72) transgenic mice (harboring a mutated form of ets-2 at phosphorylation site threonine-72) and ets-2 (wild-type/wild-type [WT/WT]) control mice with sequential intraperitoneal injections of bleomycin, followed by quantitative measurements of lung fibrosis and inflammation and primary cell in vitro assays. Concentrations of phosphorylated ets-2 were detected via the single and dual immunohistochemical staining of murine lungs and lung sections from patients with idiopathic pulmonary fibrosis. Ets-2 (A72/A72) mice were protected from bleomycin-induced pulmonary fibrosis, compared with ets-2 (WT/WT) mice. This protection was characterized by decreased lung pathological abnormalities and the fibrotic gene expression of Type I collagen, Type III collagen, α–smooth muscle actin, and connective tissue growth factor. Immunohistochemical staining of lung sections from bleomycin-treated ets-2 (WT/WT) mice and from patients with idiopathic pulmonary fibrosis demonstrated increased staining of phosphorylated ets-2 that colocalized with Type I collagen expression and to fibroblastic foci. Lastly, primary lung fibroblasts from ets-2 (A72/A72) mice exhibited decreased expression of Type I collagen in response to stimulation with TGF-β, compared with fibroblasts from ets-2 (WT/WT) mice. These data indicate the importance of phosphorylated ets-2 in the pathogenesis of pulmonary fibrosis through the expression of Type I collagen and (myo)fibroblast activation. PMID:21562315

  3. Methylation Status of SP1 Sites within miR-23a-27a-24-2 Promoter Region Influences Laryngeal Cancer Cell Proliferation and Apoptosis

    PubMed Central

    Wang, Ye; Zhang, Zhao-Xiong; Chen, Sheng; Qiu, Guang-Bin; Xu, Zhen-Ming

    2016-01-01

    DNA methylation plays critical roles in regulation of microRNA expression and function. miR-23a-27a-24-2 cluster has various functions and aberrant expression of the cluster is a common event in many cancers. However, whether DNA methylation influences the cluster expression and function is not reported. Here we found a CG-rich region spanning two SP1 sites in the cluster promoter region. The SP1 sites in the cluster were demethylated and methylated in Hep2 cells and HEK293 cells, respectively. Meanwhile, the cluster was significantly upregulated and downregulated in Hep2 cells and HEK293 cells, respectively. The SP1 sites were remethylated and the cluster was significantly downregulated in Hep2 cells into which methyl donor, S-adenosyl-L-methionine, was introduced. Moreover, S-adenosyl-L-methionine significantly increased Hep2 cell viability and repressed Hep2 cell early apoptosis. We also found that construct with two SP1 sites had highest luciferase activity and SP1 specifically bound the gene cluster promoter in vitro. We conclude that demethylated SP1 sites in miR-23a-27a-24-2 cluster upregulate the cluster expression, leading to proliferation promotion and early apoptosis inhibition in laryngeal cancer cells. PMID:27099864

  4. The Factors of Design on Playing Equipment in Young Children Schools by Viewpoint of Young Children Behavioral Development

    ERIC Educational Resources Information Center

    Kuo, Chuen-tzay

    2009-01-01

    The main purpose of this study was to explore the care-givers of preschool education institutions whose cognition on playing equipment functions, conditions of both setting and using, and the main factors which should beware of design. Besides, not only constructed the factors of design, but also provided suggestions about setting and designing of…

  5. Age, Sex and Socioeconomic Background as Factors in Preschool Children's Preference for Play Materials.

    ERIC Educational Resources Information Center

    Bogdanoff, Ruth F.; Peebles, Linda M.

    A total of 103 preschool children of lower and middle socioeconomic status families were observed in three preschool programs during 15 standardized free play periods for the purpose of investigating preschool children's preferences for different types of traditionally used play materials. The influence of age, sex, and socioeconomic status (SES)…

  6. The anti-proliferative effects of type I IFN involve STAT6-mediated regulation of SP1 and BCL6.

    PubMed

    Hsu, Yu-An; Huang, Chi-Chun; Kung, Yung-Jen; Lin, Hui-Ju; Chang, Ching-Yao; Lee, Kuan-Rong; Wan, Lei

    2016-06-01

    Type I IFN-induced STAT6 has been shown to have anti-proliferative effects in Daudi and B cells. IFN-sensitive (DS) and IFN-resistant (DR) subclones of Daudi cells were used to study the role of STAT6 in the anti-proliferative activities. Type I IFN significantly increased STAT6 mRNA and protein expression in DS but not DR cells. STAT6 knockdown significantly reduced the sensitivity to IFN in both cell lines. The molecular targets and functional importance of IFN-activated STAT6 were performed by chromatin immunoprecipitation-on-chip (ChIP-on-chip) experiments in type I IFN-treated Daudi cells. Two target genes (Sp1 and BCL6) were selected from the ChIP-on-chip data. IFN-induced STAT6 activation led to Sp1 upregulation and BCL6 downregulation in DS cells, with only minimal effects in DR cells. siRNA inhibition of STAT6 expression resulted in decreased Sp1 and BCL6 mRNA and protein levels in both DS and DR cells. IFN treatment did not increase Sp1 and BCL6 expression in a STAT2-deficient RST2 cell line, and this effect was mitigated by plasmid overexpression of STAT2, indicating that STAT2 is important for STAT6 activation. These results suggest that STAT6 plays an important role in regulating Sp1 and BCL6 through STAT2 to exert the anti-proliferative effects of type I IFN. PMID:26945968

  7. Sp1 and CREB regulate basal transcription of the human SNF2L gene

    SciTech Connect

    Xia Yu; Jiang Baichun; Zou Yongxin; Gao Guimin; Shang Linshan; Chen Bingxi; Liu Qiji; Gong Yaoqin

    2008-04-04

    Imitation Switch (ISWI) is a member of the SWI2/SNF2 superfamily of ATP-dependent chromatin remodelers, which are involved in multiple nuclear functions, including transcriptional regulation, replication, and chromatin assembly. Mammalian genomes encode two ISWI orthologs, SNF2H and SNF2L. In order to clarify the molecular mechanisms governing the expression of human SNF2L gene, we functionally examined the transcriptional regulation of human SNF2L promoter. Reporter gene assays demonstrated that the minimal SNF2L promoter was located between positions -152 to -86 relative to the transcription start site. In this region we have identified a cAMP-response element (CRE) located at -99 to -92 and a Sp1-binding site at -145 to -135 that play a critical role in regulating basal activity of human SNF2L gene, which were proven by deletion and mutation of specific binding sites, EMSA, and down-regulating Sp1 and CREB via RNAi. This study provides the first insight into the mechanisms that control basal expression of human SNF2L gene.

  8. Mineralocorticoid receptor interaction with SP1 generates a new response element for pathophysiologically relevant gene expression

    PubMed Central

    Meinel, Sandra; Ruhs, Stefanie; Schumann, Katja; Strätz, Nicole; Trenkmann, Kay; Schreier, Barbara; Grosse, Ivo; Keilwagen, Jens; Gekle, Michael; Grossmann, Claudia

    2013-01-01

    The mineralocorticoid receptor (MR) is a ligand-induced transcription factor belonging to the steroid receptor family and involved in water-electrolyte homeostasis, blood pressure regulation, inflammation and fibrosis in the renocardiovascular system. The MR shares a common hormone-response-element with the glucocorticoid receptor but nevertheless elicits MR-specific effects including enhanced epidermal growth factor receptor (EGFR) expression via unknown mechanisms. The EGFR is a receptor tyrosine kinase that leads to activation of MAP kinases, but that can also function as a signal transducer for other signaling pathways. In the present study, we mechanistically investigate the interaction between a newly discovered MR- but not glucocorticoid receptor- responsive-element (=MRE1) of the EGFR promoter, specificity protein 1 (SP1) and MR to gain general insights into MR-specificity. Biological relevance of the interaction for EGFR expression and consequently for different signaling pathways in general is demonstrated in human, rat and murine vascular smooth muscle cells and cells of EGFR knockout mice. A genome-wide promoter search for identical binding regions followed by quantitative PCR validation suggests that the identified MR-SP1–MRE1 interaction might be applicable to other genes. Overall, a novel principle of MR-specific gene expression is explored that applies to the pathophysiologically relevant expression of the EGFR and potentially also to other genes. PMID:23821666

  9. Life Cycle Reversal in Aurelia sp.1 (Cnidaria, Scyphozoa)

    PubMed Central

    He, Jinru; Zheng, Lianming; Zhang, Wenjing; Lin, Yuanshao

    2015-01-01

    The genus Aurelia is one of the major contributors to jellyfish blooms in coastal waters, possibly due in part to hydroclimatic and anthropogenic causes, as well as their highly adaptive reproductive traits. Despite the wide plasticity of cnidarian life cycles, especially those recognized in certain Hydroza species, the known modifications of Aurelia life history were mostly restricted to its polyp stage. In this study, we document the formation of polyps directly from the ectoderm of degenerating juvenile medusae, cell masses from medusa tissue fragments, and subumbrella of living medusae. This is the first evidence for back-transformation of sexually mature medusae into polyps in Aurelia sp.1. The resulting reconstruction of the schematic life cycle of Aurelia reveals the underestimated potential of life cycle reversal in scyphozoan medusae, with possible implications for biological and ecological studies. PMID:26690755

  10. SENP3 regulates the global protein turnover and the Sp1 level via antagonizing SUMO2/3-targeted ubiquitination and degradation.

    PubMed

    Wang, Ming; Sang, Jing; Ren, Yanhua; Liu, Kejia; Liu, Xinyi; Zhang, Jian; Wang, Haolu; Wang, Jian; Orian, Amir; Yang, Jie; Yi, Jing

    2016-01-01

    SUMOylation is recently found to function as a targeting signal for the degradation of substrates through the ubiquitin-proteasome system. RNF4 is the most studied human SUMO-targeted ubiquitin E3 ligase. However, the relationship between SUMO proteases, SENPs, and RNF4 remains obscure. There are limited examples of the SENP regulation of SUMO2/3-targeted proteolysis mediated by RNF4. The present study investigated the role of SENP3 in the global protein turnover related to SUMO2/3-targeted ubiquitination and focused in particular on the SENP3 regulation of the stability of Sp1. Our data demonstrated that SENP3 impaired the global ubiquitination profile and promoted the accumulation of many proteins. Sp1, a cancer-associated transcription factor, was among these proteins. SENP3 increased the level of Sp1 protein via antagonizing the SUMO2/3-targeted ubiquitination and the consequent proteasome-dependent degradation that was mediated by RNF4. De-conjugation of SUMO2/3 by SENP3 attenuated the interaction of Sp1 with RNF4. In gastric cancer cell lines and specimens derived from patients and nude mice, the level of Sp1 was generally increased in parallel to the level of SENP3. These results provided a new explanation for the enrichment of the Sp1 protein in various cancers, and revealed a regulation of SUMO2/3 conjugated proteins whose levels may be tightly controlled by SENP3 and RNF4. PMID:26511642

  11. Factors Related to Play Therapists' Social Justice Advocacy Attitudes

    ERIC Educational Resources Information Center

    Parikh, Sejal B.; Ceballos, Peggy; Post, Phyllis

    2013-01-01

    The authors used a correlational research design to examine how belief in a just world, political ideology, socioeconomic status of family of origin, and percentage of racial minority clients were related to social justice advocacy attitudes among play therapists. A multiple regression was used to analyze the data. Results indicated that belief in…

  12. Betulinic acid decreases specificity protein 1 (Sp1) level via increasing the sumoylation of sp1 to inhibit lung cancer growth.

    PubMed

    Hsu, Tsung-I; Wang, Mei-Chun; Chen, Szu-Yu; Huang, Shih-Ting; Yeh, Yu-Min; Su, Wu-Chou; Chang, Wen-Chang; Hung, Jan-Jong

    2012-12-01

    Previous studies have shown that the inhibitory effect of betulinic acid (BA) on specificity protein 1 (Sp1) expression is involved in the prevention of cancer progression, but the mechanism of this effect remains to be delineated. In this study, we determined that BA treatment in HeLa cells increased the sumoylation of Sp1 by inhibiting sentrin-specific protease 1 expression. The subsequent recruitment of E3 ubiquitin-protein ligase RING finger protein 4 resulted in ubiquitin-mediated degradation in a 26S-proteosome-dependent pathway. In addition, both BA treatment and mithramycin A (MMA) treatment inhibited lung tumor growth and down-regulated Sp1 protein expression in Kras(G12D)-induced lung cancers of bitransgenic mice. In gene expression profiles of Kras(G12D)-induced lung cancers in bitransgenic mice with and without Sp1 inhibition, 542 genes were affected by MMA treatment. One of the gene products, cyclin A2, which was involved in the S and G(2)/M phase transition during cell cycle progression, was investigated in detail because its expression was regulated by Sp1. The down-regulation of cyclin A2 by BA treatment resulted in decreased retinoblastoma protein phosphorylation and cell cycle G(2)/M arrest. The BA-mediated cellular Sp1 degradation and antitumor effect were also confirmed in a xenograft mouse model by using H1299 cells. The knockdown of Sp1 in lung cancer cells attenuated the tumor-suppressive effect of BA. Taken together, the results of this study clarify the mechanism of BA-mediated Sp1 degradation and identify a pivotal role for Sp1 in the BA-induced repression of lung cancer growth. PMID:22956772

  13. SP1 and USF differentially regulate ADAMTS1 gene expression under normoxic and hypoxic conditions in hepatoma cells.

    PubMed

    Turkoglu, Sumeyye Aydogan; Kockar, Feray

    2016-01-01

    ADAM metallopeptidase with thrombospondin type I motif, 1 (ADAMTS1) that has both antiangiogenic and aggrecanase activity was dysregulated in many pathophysiologic circumstances. However, there is limited information available on the transcriptional regulation of ADAMTS1 gene. Therefore, this study mainly aimed to identify regulatory regions important for the regulation of ADAMTS1 gene under normoxic and hypoxic conditions in human hepatoma cells (HEP3B). Cultured HEP3B cells were exposed to normal oxygen condition, and Cobalt chloride (CoCl2) induced the hypoxic condition, which is an HIF-1 inducer. The cocl2-induced hypoxic condition led to the induced ADAMTS1 mRNA and protein expression in Hepatoma cells. Differential regulation of SP1 and USF transcription factors on ADAMTS1 gene expression was determined by transcriptional activity, mRNA and protein level of ADAMTS1 gene. Ectopic expression of SP1 and USF transcription factors resulted in the decrease in ADAMTS1 transcriptional activity of all promoter constructs consistent with mRNA and protein level in normoxic condition. However, overexpression of SP1 and USF led to the increase of ADAMTS1 gene expressions at mRNA and protein level in hypoxic condition. On the other hand, C/EBPα transcription factor didn't show any statistically significant effect on ADAMTS1 gene expression at mRNA, protein and transcriptional level under normoxic and hypoxic condition. PMID:26299656

  14. Playing a Musical Instrument as a Protective Factor against Dementia and Cognitive Impairment: A Population-Based Twin Study

    PubMed Central

    Pedersen, Nancy L.

    2014-01-01

    Increasing evidence supports that playing a musical instrument may benefit cognitive development and health at young ages. Whether playing an instrument provides protection against dementia has not been established. In a population-based cotwin control study, we examined the association between playing a musical instrument and whether or not the twins developed dementia or cognitive impairment. Participation in playing an instrument was taken from informant-based reports of twins' leisure activities. Dementia diagnoses were based on a complete clinical workup using standard diagnostic criteria. Among 157 twin pairs discordant for dementia and cognitive impairment, 27 pairs were discordant for playing an instrument. Controlling for sex, education, and physical activity, playing a musical instrument was significantly associated with less likelihood of dementia and cognitive impairment (odds ratio [OR] = 0.36 [95% confidence interval 0.13–0.99]). These findings support further consideration of music as a modifiable protective factor against dementia and cognitive impairment. PMID:25544932

  15. First functional polymorphism in CFTR promoter that results in decreased transcriptional activity and Sp1/USF binding

    SciTech Connect

    Taulan, M. Lopez, E.; Guittard, C.; Rene, C.; Baux, D.; Altieri, J.P.; DesGeorges, M.; Claustres, M.; Romey, M.C.

    2007-09-28

    Growing evidences show that functionally relevant polymorphisms in various promoters alter both transcriptional activity and affinities of existing protein-DNA interactions, and thus influence disease progression in humans. We previously reported the -94G>T CFTR promoter variant in a female CF patient in whom any known disease-causing mutation has been detected. To investigate whether the -94G>T could be a regulatory variant, we have proceeded to in silico analyses and functional studies including EMSA and reporter gene assays. Our data indicate that the promoter variant decreases basal CFTR transcriptional activity in different epithelial cells and alters binding affinities of both Sp1 and USF nuclear proteins to the CFTR promoter. The present report provides evidence for the first functional polymorphism that negatively affects the CFTR transcriptional activity and demonstrates a cooperative role of Sp1 and USF transcription factors in transactivation of the CFTR gene promoter.

  16. Chromatin, TAFs, and a novel multiprotein coactivator are required for synergistic activation by Sp1 and SREBP-1a in vitro.

    PubMed

    Näär, A M; Beaurang, P A; Robinson, K M; Oliner, J D; Avizonis, D; Scheek, S; Zwicker, J; Kadonaga, J T; Tjian, R

    1998-10-01

    The promoter selectivity factor Sp1 often cooperates with other enhancer-binding proteins to activate transcription. To study the molecular underpinnings of these regulatory events, we have reconstituted in vitro the synergy observed in vivo between Sp1 and the sterol-regulated factor SREBP-1a at the low density lipoprotein receptor (LDLR) promoter. Using a highly purified human transcription system, we found that chromatin, TAFs, and a novel SREBP-binding coactivator activity, which includes CBP, are all required to mediate full synergistic activation by Sp1 and SREBP-1a. The SREBP-binding domain of CBP inhibits activation by SREBP-1a and Sp1 in a dominant-negative fashion that is both chromatin- and activator-specific. Whereas recombinant CBP alone is not sufficient to mediate activation, a human cellular fraction containing CBP can support high levels of chromatin-dependent synergistic activation. Purification of this activity to near homogeneity resulted in the identification of a multiprotein coactivator, including CBP, that selectively binds to the SREBP-1a activation domain and is capable of mediating high levels of synergistic activation by SREBP/Sp1 on chromatin templates. The development of a reconstituted chromatin transcription system has allowed us to isolate a novel coactivator that is recruited by the SREBP-1a activation domain and that functions in concert with TFIID to coordinate the action of multiple activators at complex promoters in the context of chromatin. PMID:9765204

  17. SP1-binding elements, within the common metaxin-thrombospondin 3 intergenic region, participate in the regulation of the metaxin gene.

    PubMed Central

    Collins, M; Bornstein, P

    1996-01-01

    Metaxin (Mtx) is an essential nuclear gene which is expressed ubiquitously in mice and encodes a mitochondrial protein. The gene is located upstream and is transcribed divergently from the thrombospondin 3 (Thbs3) gene; 1352 nucleotides separate the putative translation start sites. Although the Mtx and Thbs3 genes share a common intergenic region, transient transfection experiments in rat chondro-sarcoma cells and in NIH-3T3 fibroblasts demonstrated that the elements required for expression of the Mtx gene are situated within a short proximal promoter and have no major effect on the transcription of Thbs3. The metaxin --377 bp promoter contains four clustered GC boxes between nucleotides --146 and --58 and an inverted GT box between nucleotides --152 and --161, but does not contain TATA or CCAAT boxes. Like many genes regulated by a TATA-less promoter, the transcription start site of metaxin is heterogeneous. The major start site is only 13 bp upstream from the putative translation start site. Electrophoretic mobility shift, competition and supershift assays showed that the ubiquitous transcription factor, Sp1, and, to a lesser extent, the Sp1-related protein, Sp3, bind to four of these Sp1-binding motifs. Co-transfection of metaxin promoter-luciferase constructs and an Sp1 expression vector into Schneider Drosophila cells, which do not synthesize Sp1, demonstrated that the metaxin gene is activated by Sp1. Deletion of the four upstream Sp1-binding elements, on the other hand, demonstrated that these motifs are superfluous in context of the larger Mtx promoter. Thus, despite the potential for common regulatory mechanisms, the available evidence indicates that the Mtx minimal promoter does not significantly affect Thbs3 gene expression. PMID:8871542

  18. Nuclear Factor of Activated T-cells (NFAT) plays a role in SV40 infection

    PubMed Central

    Manley, Kate; O’Hara, Bethany A; Atwood, Walter J

    2008-01-01

    Recent evidence highlighted a role for the transcription factor, Nuclear Factor of Activated T-cells (NFAT), in the transcription of the human polyomavirus JCV. Here we show that NFAT is also important in the transcriptional control of the related polyomavirus, Simian Virus 40 (SV40). Inhibition of NFAT activity reduced SV40 infection of Vero, 293A and HeLa cells, and this block occurred at the stage of viral transcription. Both NFAT3 and NFAT4 bound to the SV40 promoter through κB sites located within the 72bp repeated enhancer region. In Vero cells NFAT was involved in late transcription, but in HeLa and 293A cells both early and late viral transcription required NFAT activity. SV40 large T-Ag was found to increase NFAT activity and provided a positive feedback loop to transactivate the SV40 promoter. PMID:18031784

  19. Nuclear factor of activated T-cells (NFAT) plays a role in SV40 infection

    SciTech Connect

    Manley, Kate; O'Hara, Bethany A.; Atwood, Walter J.

    2008-03-01

    Recent evidence highlighted a role for the transcription factor, nuclear factor of activated T-cells (NFAT), in the transcription of the human polyomavirus JCV. Here we show that NFAT is also important in the transcriptional control of the related polyomavirus, Simian Virus 40 (SV40). Inhibition of NFAT activity reduced SV40 infection of Vero, 293A, and HeLa cells, and this block occurred at the stage of viral transcription. Both NFAT3 and NFAT4 bound to the SV40 promoter through {kappa}B sites located within the 72 bp repeated enhancer region. In Vero cells, NFAT was involved in late transcription, but in HeLa and 293A cells both early and late viral transcription required NFAT activity. SV40 large T-Ag was found to increase NFAT activity and provided a positive feedback loop to transactivate the SV40 promoter.

  20. Mathematics performance and the role played by affective and background factors peter grootenboer and brian hemmings

    NASA Astrophysics Data System (ADS)

    Grootenboer, Peter; Hemmings, Brian

    2007-12-01

    In this article, we report on a study examining those factors which contribute to the mathematics performance of a sample of children aged between 8 and 13 years. The study was designed specifically to consider the potency of a number of mathematical affective factors, as well as background characteristics (viz., gender, ethnicity, and socioeconomic status), on children's mathematics performance. Data were collected by surveying the children and drawing on performance ratings from their teachers. A correlation analysis revealed that the relationships between the respective dispositional and background variables with mathematics performance were significant and in the direction as predicted. Moreover, the findings from a logistic regression showed that a combination of these variables was able to appropriately classify students who either were below-average or above-average mathematics performers. We pay particular attention to the influence of certain dispositions with respect to mathematics performance and conclude by detailing the implications of the study for teachers and researchers.

  1. Sp1-mediated nonmuscle myosin light chain kinase expression and enhanced activity in vascular endothelial growth factor–induced vascular permeability

    PubMed Central

    2015-01-01

    Abstract Despite the important role played by the nonmuscle isoform of myosin light chain kinase (nmMLCK) in vascular barrier regulation and the implication of both nmMLCK and vascular endothelial growth factor (VEGF) in the pathogenesis of acute respiratory distress syndrome (ARDS), the role played by nmMLCK in VEGF-induced vascular permeability is poorly understood. In this study, the role played by nmMLCK in VEGF-induced vascular hyperpermeability was investigated. Human lung endothelial cell barrier integrity in response to VEGF is examined in both the absence and the presence of nmMLCK small interfering RNAs. Levels of nmMLCK messenger RNA (mRNA), protein, and promoter activity expression were monitored after VEGF stimulation in lung endothelial cells. nmMYLK promoter activity was assessed using nmMYLK promoter luciferase reporter constructs with a series of nested deletions. nmMYLK transcriptional regulation was further characterized by examination of a key transcriptional factor. nmMLCK plays an important role in VEGF-induced permeability. We found that activation of the VEGF signaling pathway in lung endothelial cells increases MYLK gene product at both mRNA and protein levels. Increased nmMLCK mRNA and protein expression is a result of increased nmMYLK promoter activity, regulated in part by binding of the Sp1 transcription factor on triggering by the VEGF signaling pathway. Taken together, these findings suggest that MYLK is an important ARDS candidate gene and a therapeutic target that is highly influenced by excessive VEGF concentrations in the inflamed lung. PMID:26697178

  2. Down-regulation of EPHX2 gene transcription by Sp1 under high-glucose conditions.

    PubMed

    Oguro, Ami; Oida, Shoko; Imaoka, Susumu

    2015-09-15

    sEH (soluble epoxide hydrolase), which is encoded by the EPHX2 gene, regulates the actions of bioactive lipids, EETs (epoxyeicosatrienoic acids). Previously, we found that high-glucose-induced oxidative stress suppressed sEH levels in a hepatocarcinoma cell line (Hep3B) and sEH was decreased in streptozotocin-induced diabetic mice in vivo. In the present study, we investigated the regulatory mechanisms underlying EPHX2 transcriptional suppression under high-glucose conditions. The decrease in sEH was prevented by an Sp1 (specificity protein 1) inhibitor, mithramycin A, and overexpression or knockdown of Sp1 revealed that Sp1 suppressively regulated sEH expression, in contrast with the general role of Sp1 on transcriptional activation. In addition, we found that AP2α (activating protein 2α) promoted EPHX2 transcription. The nuclear transport of Sp1, but not that of AP2α, was increased under high glucose concomitantly with the decrease in sEH. Within the EPHX2 promoter -56/+32, five Sp1-binding sites were identified, and the mutation of each of these sites showed that the first one (SP1_1) was important in both suppression by Sp1 and activation by AP2α. Furthermore, overexpression of Sp1 diminished the binding of AP2α by DNA-affinity precipitation assay and ChIP, suggesting competition between Sp1 and AP2α on the EPHX2 promoter. These findings provide novel insights into the role of Sp1 in transcriptional suppression, which may be applicable to the transcriptional regulation of other genes. PMID:26341485

  3. Physiological TLR5 expression in the intestine is regulated by differential DNA binding of Sp1/Sp3 through simultaneous Sp1 dephosphorylation and Sp3 phosphorylation by two different PKC isoforms.

    PubMed

    Thakur, Bhupesh Kumar; Dasgupta, Nirmalya; Ta, Atri; Das, Santasabuj

    2016-07-01

    Toll-like receptor 5 (TLR5) expression in the intestinal epithelial cells (IECs) is critical to maintain health, as underscored by multiple intestinal and extra-intestinal diseases in mice genetically engineered for IEC-specific TLR5 knockout. A gradient of expression exists in the colonic epithelial cells from the cecum to the distal colon. Intriguingly, an identical gradient for the dietary metabolite, butyrate also exists in the luminal contents. However, both being critical for intestinal homeostasis and immune response, no studies examined the role of butyrate in the regulation of TLR5 expression. We showed that butyrate transcriptionally upregulates TLR5 in the IECs and augments flagellin-induced immune responses. Both basal and butyrate-induced transcription is regulated by differential binding of Sp-family transcription factors to the GC-box sequences over the TLR5 promoter. Butyrate activates two different protein kinase C isoforms to dephosphorylate/acetylate Sp1 by serine/threonine phosphatases and phosphorylate Sp3 by ERK-MAPK, respectively. This resulted in Sp1 displacement from the promoter and binding of Sp3 to it, leading to p300 recruitment and histone acetylation, activating transcription. This is the first study addressing the mechanisms of physiological TLR5 expression in the intestine. Additionally, a novel insight is gained into Sp1/Sp3-mediated gene regulation that may apply to other genes. PMID:27060138

  4. Physiological TLR5 expression in the intestine is regulated by differential DNA binding of Sp1/Sp3 through simultaneous Sp1 dephosphorylation and Sp3 phosphorylation by two different PKC isoforms

    PubMed Central

    Thakur, Bhupesh Kumar; Dasgupta, Nirmalya; Ta, Atri; Das, Santasabuj

    2016-01-01

    Toll-like receptor 5 (TLR5) expression in the intestinal epithelial cells (IECs) is critical to maintain health, as underscored by multiple intestinal and extra-intestinal diseases in mice genetically engineered for IEC-specific TLR5 knockout. A gradient of expression exists in the colonic epithelial cells from the cecum to the distal colon. Intriguingly, an identical gradient for the dietary metabolite, butyrate also exists in the luminal contents. However, both being critical for intestinal homeostasis and immune response, no studies examined the role of butyrate in the regulation of TLR5 expression. We showed that butyrate transcriptionally upregulates TLR5 in the IECs and augments flagellin-induced immune responses. Both basal and butyrate-induced transcription is regulated by differential binding of Sp-family transcription factors to the GC-box sequences over the TLR5 promoter. Butyrate activates two different protein kinase C isoforms to dephosphorylate/acetylate Sp1 by serine/threonine phosphatases and phosphorylate Sp3 by ERK-MAPK, respectively. This resulted in Sp1 displacement from the promoter and binding of Sp3 to it, leading to p300 recruitment and histone acetylation, activating transcription. This is the first study addressing the mechanisms of physiological TLR5 expression in the intestine. Additionally, a novel insight is gained into Sp1/Sp3-mediated gene regulation that may apply to other genes. PMID:27060138

  5. TRANSCRIPTION FACTOR Bmsage PLAYS A CRUCIAL ROLE IN SILK GLAND GENERATION IN SILKWORM, Bombyx mori.

    PubMed

    Xin, Hu-hu; Zhang, Deng-pan; Chen, Rui-ting; Cai, Zi-zheng; Lu, Yan; Liang, Shuang; Miao, Yun-gen

    2015-10-01

    Salivary gland secretion is altered in Drosophila embryos with loss of function of the sage gene. Saliva has a reduced volume and an increased electron density according to transmission electron microscopy, resulting in regions of tube dilation and constriction with intermittent tube closure. However, the precise functions of Bmsage in silkworm (Bombyx mori) are unknown, although its sequence had been deposited in SilkDB. From this, Bmsage is inferred to be a transcription factor that regulates the synthesis of silk fibroin and interacts with another silk gland-specific transcription factor, namely, silk gland factor-1. In this study, we introduced a germline mutation of Bmsage using the Cas9/sgRNA system, a genome-editing technology, resulting in deletion of Bmsage from the genome of B. mori. Of the 15 tested samples, seven displayed alterations at the target site. The mutagenesis efficiency was about 46.7% and there were no obvious off-target effects. In the screened homozygous mutants, silk glands developed poorly and the middle and posterior silk glands (MSG and PSG) were absent, which was significantly different from the wild type. The offspring of G0 mosaic silkworms had indel mutations causing 2- or 9-bp deletions at the target site, but exhibited the same abnormal silk gland structure. Mutant larvae containing different open-reading frames of Bmsage had the same silk gland phenotype. This illustrated that the mutant phenotype was due to Bmsage knockout. We conclude that Bmsage participates in embryonic development of the silk gland. PMID:25917878

  6. Which factors play a role in clinical decision-making in subfertility?

    PubMed

    van der Steeg, Jan W; Steures, Pieternel; Eijkemans, Marinus J C; Habbema, J Dik F; Bossuyt, Patrick M M; Hompes, Peter G A; van der Veen, Fulco; Mol, Ben W J

    2006-04-01

    Sixteen vignettes of subfertile couples were constructed by varying fertility history, post-coital test, sperm motility, FSH concentration and Chlamydia antibody titre (CAT). Thirty-five gynaecologists estimated probabilities of treatment-independent pregnancy, intrauterine insemination (IUI) and IVF. Thereafter, they chose IUI, IVF or no treatment. The relative contribution of each factor to probability estimates and to subsequent treatment decisions was calculated. Duration of subfertility and maternal age were the most important contributors for gynaecologists' estimates of treatment-independent pregnancy [relative contribution (RC) 41, 26%]. Maternal age and FSH concentration were the most important contributors in the estimates for IUI (RC: 51, 25%) and for IVF (RC: 64, 31%). The decision to start IVF was mainly determined by maternal age, duration of subfertility, FSH concentration and CAT. The relative contribution of maternal age and duration of subfertility was in concordance with existing prediction models, whereas previous pregnancy and FSH concentration were under- and overestimated respectively. In conclusion, maternal age, duration of subfertility and FSH concentration are the main factors in clinical decision-making in subfertility. Gynaecologists overestimate the importance of FSH concentration, but underestimate that of a previous pregnancy, as compared with their importance reported in prediction models and guidelines. PMID:16740221

  7. Basal transcription factor 3 plays an important role in seed germination and seedling growth of rice.

    PubMed

    Wang, Wenyi; Xu, Mengyun; Wang, Ya; Jamil, Muhammad

    2014-01-01

    BTF3 has been recognized to be involved in plant growth and development. But its function remains mostly unknown during seed germination and seedling stage. Here, we have analyzed OsBTF3-related sequences in Oryza sativa L. subspecies, japonica, which resembles with the conserved domain of a nascent polypeptide associated complex (NAC) with different homologs of OsBTF3 and human BTF3. Inhibition of Osj10gBTF3 has led to considerable morphological changes during seed germination and seedling growth. Germination percentage was not influenced by the application of GA3, ABA, and NaCl but all concentrations caused wild-type (WT) seeds to germinate more rapidly than the RNAi (Osj10gBTF3 (Ri)) transgenic lines. Seedling inhibition was more severe in the Osj10gBTF3 (Ri) seedlings compared with their WT especially when treated with 100 or 200 μM GA3; 50% reduction in shoots was observed in Osj10gBTF3 (Ri) seedlings. The expression of Osj3g1BTF3, Osj3g2BTF3 and Osj10gBTF3 was primarily constitutive and generally modulated by NaCl, ABA, and GA3 stresses in both Osj10gBTF3 (Ri) lines and WT at the early seedling stage, suggesting that Osj3g1BTF3 and Osj10gBTF3 are much similar but different from Osj3g2BTF3 in biological function. These results show that OsBTF3 plays an important role in seed germination and seedling growth gives a new perception demonstrating that more multifaceted regulatory functions are linked with BTF3 in plants. PMID:24971328

  8. Sex differences in visuospatial ability: do performance factors play such an important role?

    PubMed

    Delgado, A R; Prieto, G

    1996-07-01

    This study was designed to analyze some performance factors as a possible source of sex-related bias in psychometric tests of visuospatial aptitude. Goldstein, Haldane, and Mitchell (1990) explored the effect of two response styles-slowness of performance and reluctance to guess-by using a 3-D mental rotation test (the task showing the largest cognitive sex difference) and found that time limits and raw scores contributed substantially to the male advantage. We applied two tests in the speed-power continuum to a representative sample of 621 males and 821 females in their last year of high school in a 2 x 2 (gender x time) full factorial design. Reluctance to guess was similar for males and females. Males obtained more correct responses on both tests, and for both time conditions, than did females. These results are not only statistically significant but also are of substantial practical consequence. PMID:8757498

  9. Genome Sequence of the Microsporidian Species Nematocida sp1 Strain ERTm6 (ATCC PRA-372)

    PubMed Central

    Bakowski, Malina A.; Priest, Margaret; Young, Sarah

    2014-01-01

    Microsporidia comprise a phylum of obligate intracellular pathogens related to fungi. Microsporidia Nematocida sp1 strain ERTm6 was isolated from wild-caught Caenorhabditis briggsae and causes a lethal intestinal infection in Caenorhabditis nematodes. We report the genome sequence of N. sp1 ERTm6, which will facilitate study of the Nematocida genus and other Microsporidia. PMID:25237020

  10. Liver Stiffness Measurement in Psoriasis: Do Metabolic or Disease Factors Play the Important Role?

    PubMed Central

    Pongpit, Jamrus; Porntharukchareon, Saneerat; Kaewduang, Piyaporn; Promson, Kwannapa; Stitchantrakul, Wasana; Petraksa, Supanna; Thakkinstian, Ammarin; Kositchaiwat, Chomsri; Rajatanavin, Natta; Sobhonslidsuk, Abhasnee

    2016-01-01

    Background. An increased prevalence of metabolic syndrome including nonalcoholic fatty liver disease (NAFLD) was reported in psoriasis. NAFLD can progress to nonalcoholic steatohepatitis and fibrosis. Transient elastography (TE) is a noninvasive liver fibrosis assessment. We evaluated the prevalence of significant liver fibrosis or high liver stiffness measurement (LSM) using the LSM cutoff over 7 kPa and its associated factors in psoriatic patients. Methods. Subjects underwent TE and ultrasonography. Univariate and multivariate analysis were performed for the associated factors. Results. One hundred and sixty-eight patients were recruited. Three patients were excluded due to TE failure. Mean BMI was 24.8 ± 4.7 kg/m2. NAFLD, metabolic syndrome, and diabetes were seen in 105 (63.6%), 83 (50.3%), and 31 (18.8%) patients. The total cumulative dose of methotrexate over 1.5 g was seen in 39 (23.6%) patients. Mean LSM was 5.3 ± 2.9 kPa. High LSM was found in 18 (11.0%) patients. Waist circumference (OR: 1.24; 95% CI: 1.11–1.38; P = 0.0002), diabetes (OR: 12.70; 95% CI: 1.84–87.70; P = 0.010), and AST (OR: 1.08; 95% CI: 1.02–1.16; P = 0.017) were associated with high LSM. Conclusion. 11% of psoriatic patients had significant liver fibrosis by high LSM. Waist circumference, diabetes, and AST level were the independent predictors. PMID:27006950

  11. Liver Stiffness Measurement in Psoriasis: Do Metabolic or Disease Factors Play the Important Role?

    PubMed

    Pongpit, Jamrus; Porntharukchareon, Saneerat; Kaewduang, Piyaporn; Promson, Kwannapa; Stitchantrakul, Wasana; Petraksa, Supanna; Thakkinstian, Ammarin; Kositchaiwat, Chomsri; Rajatanavin, Natta; Sobhonslidsuk, Abhasnee

    2016-01-01

    Background. An increased prevalence of metabolic syndrome including nonalcoholic fatty liver disease (NAFLD) was reported in psoriasis. NAFLD can progress to nonalcoholic steatohepatitis and fibrosis. Transient elastography (TE) is a noninvasive liver fibrosis assessment. We evaluated the prevalence of significant liver fibrosis or high liver stiffness measurement (LSM) using the LSM cutoff over 7 kPa and its associated factors in psoriatic patients. Methods. Subjects underwent TE and ultrasonography. Univariate and multivariate analysis were performed for the associated factors. Results. One hundred and sixty-eight patients were recruited. Three patients were excluded due to TE failure. Mean BMI was 24.8 ± 4.7 kg/m(2). NAFLD, metabolic syndrome, and diabetes were seen in 105 (63.6%), 83 (50.3%), and 31 (18.8%) patients. The total cumulative dose of methotrexate over 1.5 g was seen in 39 (23.6%) patients. Mean LSM was 5.3 ± 2.9 kPa. High LSM was found in 18 (11.0%) patients. Waist circumference (OR: 1.24; 95% CI: 1.11-1.38; P = 0.0002), diabetes (OR: 12.70; 95% CI: 1.84-87.70; P = 0.010), and AST (OR: 1.08; 95% CI: 1.02-1.16; P = 0.017) were associated with high LSM. Conclusion. 11% of psoriatic patients had significant liver fibrosis by high LSM. Waist circumference, diabetes, and AST level were the independent predictors. PMID:27006950

  12. YY1 and Sp1 activate transcription of the human NDUFS8 gene encoding the mitochondrial complex I TYKY subunit.

    PubMed

    Lescuyer, Pierre; Martinez, Pascal; Lunardi, Joël

    2002-03-19

    Complex I is the most complicated of the multimeric enzymes that constitute the mitochondrial respiratory chain. It is encoded by both mitochondrial and nuclear genomes. We have previously characterized the human NDUFS8 gene that encodes the TYKY subunit. This essential subunit is thought to participate in the electron transfer and proton pumping activities of complex I. Here, we have analyzed the transcriptional regulation of the NDUFS8 gene. Using primer extension assays, we have identified two transcription start sites. The basal promoter was mapped to a 247 bp sequence upstream from the main transcription start site by reporter gene analysis in HeLa cells and in differentiated or non-differentiated C2C12 cells. Three Sp1 sites and one YY1 site were identified in this minimal promoter. Through gel shift analysis, all sites were shown to bind to their cognate transcription factors. Site-directed mutagenesis revealed that the YY1 site and two upstream adjacent Sp1 sites drive most of the promoter activity. This work represents the first promoter analysis for a complex I gene. Together with previous studies, our results indicate that YY1 and Sp1 control the expression of genes encoding proteins that are involved in almost all steps of the oxidative phosphorylation metabolism. PMID:11955626

  13. [Progression of arthrosis after alloplasty--what factors play a role?].

    PubMed

    Küllmer, K; Letsch, R; Schmit-Neuerburg, K P; Turowski, B

    1996-06-01

    From 87 patients who underwent anterior cruciate ligament (ACL) surgery with an alloplastic ligament (Trevira hochfest) the radiographs of 77 patients were examined by 2 physicians, who were not involved in the operation. They evaluated the increase of degenerative osteoarthritis according to the classification by Holz [12] finding a significant increase of degenerative osteoarthritis after surgery with a mean follow-up of 41.2 months. The ligament reconstruction was performed in 50 fresh ACL tears by reinsertion plus synthetic ligament protection and in 27 chronic instabilities with several failed previous operations by using the alloplastic ligament as an ACL prosthesis by means of a salvage procedure. Both investigators found a significant increase of degenerative osteoarthritis in both groups, but the chronically instable knees had a higher initial value. Patients with concomitant meniscus and/or posterior cruciate ligament (PCL) ruptures showed the highest increase of osteoarthritic changes; isolated ACL tears were found with very low degeneration. Considering the special profile of our collective, the factors that were found to as a risk of osteoarthritis and the comparison with the literature we could not find any indication for a relevantly increased risk of osteoarthritic progression using the Trevira hochfest ligament. PMID:8767384

  14. The ‘Perfect Storm’ and Acute Coronary Syndrome Onset: Do Psychosocial Factors Play a Role?

    PubMed Central

    Burg, Matthew M.; Edmondson, Donald; Shimbo, Daichi; Shaffer, Jonathan; Kronish, Ian M.; Whang, William; Alcántara, Carmela; Schwartz, Joseph E.; Muntner, Paul; Davidson, Karina W.

    2013-01-01

    The revolution in cardiac care over the past two decades, characterized by emergent revascularization, drug eluting stents, anti-platelet medications, and advanced imaging has had little impact on overall ACS recurrence, or ACS prevention. The “Perfect Storm” refers to a confluence of events and processes, including atherosclerotic plaque, coronary flow dynamics, hemostatic and fibrinolytic function, metabolic and inflammatory conditions, neurohormonal dysregulation, and environmental events that give rise to, and result in an ACS event. In this article we illustrate the limits of the traditional main effect research model, giving a brief description of the current state of knowledge regarding the development of atherosclerotic plaque and the rupturing of these plaques that defines an ACS event. We then apply the Perfect Storm conceptualization to describe a program of research concerning a psychosocial vulnerability factor that contributes to increased risk of recurrent ACS and early mortality, and that has defied our efforts to identify underlying pathophysiology and successfully mount efforts to fully mitigate this risk. PMID:23621970

  15. Cyclin A regulates a cell-cycle-dependent expression of CKAP2 through phosphorylation of Sp1

    SciTech Connect

    Kang, Du-Seock; Hong, Kyeong-Man; Park, Joobae; Bae, Chang-Dae

    2012-04-20

    Highlights: Black-Right-Pointing-Pointer We identified a GC box and a CHR element in human CKAP2 minimal promoter. Black-Right-Pointing-Pointer The CHR element repressed the CKAP2 minimal promoter activity at the G1/S phase. Black-Right-Pointing-Pointer The GC box was essential for the basic promoter activity of human CKAP2. Black-Right-Pointing-Pointer The GC box was also essential for the cyclic expression of human CKAP2. Black-Right-Pointing-Pointer The phosphorylation of Sp1, mediated by Cyclin A, underlies the cyclic expression. -- Abstract: CKAP2 plays crucial roles in proper chromosome segregation and maintaining genomic stability. CKAP2 protein showed cell-cycle-dependent expression, which reached a maximum level at the G2/M phase and disappeared at the onset of G1 phase. To elucidate the mechanisms underlying cell cycle-dependent expression of CKAP2, we cloned and analyzed the human CKAP2 promoter. The upstream 115-bp region from the transcription start site was sufficient for minimal CKAP2 promoter activity. We identified 2 regulatory sequences; a CHR (-110 to -104 bp) and a GC box (-41 to -32 bp). We confirmed Sp1 bound to the GC box using a supershift assay and a ChIP assay. Mutation in the GC box resulted in a near complete loss of CKAP2 promoter activity while mutation in the CHR decreased the promoter activity by 50%. The CHR mutation showed enhanced activity at the G1/S phase, but still retained cyclic activity. The Chromatin IP revealed that the amount of Sp1 bound to the GC box gradually increased and reached a maximum level at the G2/M phase. The amount of Sp1 bound to the GC box was greatly reduced when Cyclin A was depleted, which was restored by adding Cyclin A/Cdk2 complex back into the nuclear extracts. Together, we concluded that the GC box was responsible for the cyclic activity of human CKAP2 promoter through the phosphorylation of Sp1, possibly by Cyclin A/Cdk complex.

  16. Eukaryotic Initiation Factor 5A Plays an Essential Role in Luteinizing Hormone Receptor Regulation

    PubMed Central

    Menon, Bindu; Gulappa, Thippeswamy

    2014-01-01

    Down-regulation of LH receptor (LHR) in the ovary by its ligand is mediated by a specific RNA-binding protein, designated LH receptor mRNA–binding protein (LRBP), through translational suppression and mRNA degradation. Using yeast 2-hybrid screens, we previously identified eukaryotic initiation factor 5A (eIF5A) as one of the proteins that interacts with LRBP during LHR mRNA down-regulation. The present study examined the role of eIF5A and its hypusination in the context of LHR mRNA down-regulation. The association of eIF5A with LRBP or LHR mRNA was determined using immunoprecipitation and RNA immunoprecipitation assays. The results showed that the association of eIF5A with the LHR mRNA-LRBP complex increased significantly during down-regulation. Furthermore, gel fractionation and the hypusination activity assay both showed increased hypusination of eIF5A during LHR mRNA down-regulation. Abolishment of hypusination by pretreatment with the chemical inhibitor GC7 prevented the association of eIF5A with LHR mRNA and LRBP. Inhibition of hypusination also reduced the extent of ligand-induced down-regulation of LHR mRNA as well as the expression of functional LHRs assessed by real-time PCR and 125I-human chorionic gonadotropin (hCG) binding assays, respectively. The loss of human chorionic gonadotropin–mediated downstream signaling during LHR down-regulation was also restored by inhibition of hypusination of eIF5A. Thus, the present study, for the first time, reveals the crucial role of eIF5A and its hypusination in the regulation of LHR expression in the ovary. PMID:25216047

  17. Yes and Lyn play a role in nuclear translocation of the epidermal growth factor receptor.

    PubMed

    Iida, M; Brand, T M; Campbell, D A; Li, C; Wheeler, D L

    2013-02-01

    The epidermal growth factor receptor (EGFR) is a central regulator of tumor progression in human cancers. Cetuximab is an anti-EGFR antibody that has been approved for use in oncology. Previously we investigated mechanisms of resistance to cetuximab using a model derived from the non-small cell lung cancer line NCI-H226. We demonstrated that cetuximab-resistant clones (Ctx(R)) had increased nuclear localization of the EGFR. This process was mediated by Src family kinases (SFKs), and nuclear EGFR had a role in resistance to cetuximab. To better understand SFK-mediated nuclear translocation of EGFR, we investigated which SFK member(s) controlled this process as well as the EGFR tyrosine residues that are involved. Analyses of mRNA and protein expression indicated upregulation of the SFK members Yes (v-Yes-1 yamaguchi sarcoma viral oncogene) and Lyn (v-yes-1 Yamaguchi sarcoma viral-related oncogene homolog) in all Ctx(R) clones. Further, immunoprecipitation analysis revealed that EGFR interacts with Yes and Lyn in Ctx(R) clones, but not in cetuximab-sensitive (Ctx(S)) parental cells. Using RNAi interference, we found that knockdown of either Yes or Lyn led to loss of EGFR translocation to the nucleus. Conversely, overexpression of Yes or Lyn in low nuclear EGFR-expressing Ctx(S) parental cells led to increased nuclear EGFR. Chromatin immunoprecipitation (ChIP) assays confirmed nuclear EGFR complexes associated with the promoter of the known EGFR target genes B-Myb and iNOS. Further, all Ctx(R) clones exhibited upregulation of B-Myb and iNOS at the mRNA and protein levels. siRNAs directed at Yes or Lyn led to decreased binding of EGFR complexes to the B-Myb and iNOS promoters based on ChIP analyses. SFKs have been shown to phosphorylate EGFR on tyrosines 845 and 1101 (Y845 and Y1101), and mutation of Y1101, but not Y845, impaired nuclear entry of the EGFR. Taken together, our findings demonstrate that Yes and Lyn phosphorylate EGFR at Y1101, which influences EGFR

  18. PP2A inhibitors arrest G2/M transition through JNK/Sp1-dependent down-regulation of CDK1 and autophagy-dependent up-regulation of p21

    PubMed Central

    Zhi, Qiaoming; Xu, Ze-Kuan; Wang, Rong; Wang, Wen-Jie; Zong, Yang; Li, Zeng-Liang; Wu, Yadi; Zhou, Binhua P.; Chen, Kai; Tao, Min; Li, Wei

    2015-01-01

    Protein phosphatase 2A (PP2A) plays an important role in the control of the cell cycle. We previously reported that the PP2A inhibitors, cantharidin and okadaic acid (OA), efficiently repressed the growth of cancer cells. In the present study, we found that PP2A inhibitors arrested the cell cycle at the G2 phase through a mechanism that was dependent on the JNK pathway. Microarrays further showed that PP2A inhibitors induced expression changes in multiple genes that participate in cell cycle transition. To verify whether these expression changes were executed in a PP2A-dependent manner, we targeted the PP2A catalytic subunit (PP2Ac) using siRNA and evaluated gene expression with a microarray. After the cross comparison of these microarray data, we identified that CDK1 was potentially the same target when treated with either PP2A inhibitors or PP2Ac siRNA. In addition, we found that the down-regulation of CDK1 occurred in a JNK-dependent manner. Luciferase reporter gene assays demonstrated that repression of the transcription of CDK1 was executed through the JNK-dependent activation of the Sp1 transcription factor. By constructing deletion mutants of the CDK1 promoter and by using ChIP assays, we identified an element in the CDK1 promoter that responded to the JNK/Sp1 pathway after stimulation with PP2A inhibitors. Cantharidin and OA also up-regulated the expression of p21, an inhibitor of CDK1, via autophagy rather than PP2A/JNK pathway. Thus, this present study found that the PP2A/JNK/Sp1/CDK1 pathway and the autophagy/p21 pathway participated in G2/M cell cycle arrest triggered by PP2A inhibitors. PMID:26053095

  19. In vitro chromatin assembly of the HIV-1 promoter. ATP-dependent polar repositioning of nucleosomes by Sp1 and NFkappaB.

    PubMed

    Widlak, P; Gaynor, R B; Garrard, W T

    1997-07-11

    Nuclease hypersensitive sites exist in vivo in the chromatin of the integrated human immunodeficiency virus (HIV)-1 proviral genome, in the 5'-long terminal repeat (LTR) within the promoter/enhancer region near Sp1 and NFkappaB binding sites. Previous studies from the Kadonaga and Jones laboratories have shown that Sp1 and NFkappaB can establish hypersensitive sites in a truncated form of this LTR when added before in vitro chromatin assembly with Drosophila extracts, thus facilitating subsequent transcriptional activation of a linked reporter gene upon the association of additional factors (Pazin, M. J., Sheridan, P. L., Cannon, K., Cao, Z., Keck, J. G., Kadanaga, J. T., and Jones, K. A. (1996) Genes & Dev. 10, 37-49). Here we assess the role of a full-length LTR and 1 kilobase pair of downstream flanking HIV sequences in chromatin remodeling when these transcription factors are added after chromatin assembly. Using Xenopus laevis oocyte extracts to assemble chromatin in vitro, we have confirmed that Sp1 and NFkappaB can indeed induce sites hypersensitive to DNase I, micrococcal nuclease, or restriction enzymes on either side of factor binding sites in chromatin but not naked DNA. We extend these earlier studies by demonstrating that the process is ATP-dependent when the factors are added after chromatin assembly and that histone H1, AP1, TBP, or Tat had no effect on hypersensitive site formation. Furthermore, we have found that nucleosomes upstream of NFkappaB sites are rotationally positioned prior to factor binding and that their translational frame is registered after binding NFkappaB. On the other hand, binding of Sp1 positions adjacent downstream nucleosome(s). We term this polar repositioning because each factor aligns nucleosomes only on one side of its binding sites. Mutational analysis and oligonucleotide competition each demonstrated that this remodeling required Sp1 and NFkappaB binding sites. PMID:9211915

  20. Membrane Chaperone SecDF Plays a Role in the Secretion of Listeria monocytogenes Major Virulence Factors

    PubMed Central

    Burg-Golani, Tamar; Pozniak, Yair; Rabinovich, Lev; Sigal, Nadejda; Nir Paz, Ran

    2013-01-01

    Listeria monocytogenes is a Gram-positive human intracellular pathogen that infects diverse mammalian cells. Upon invasion, L. monocytogenes secretes multiple virulence factors that target host cellular processes and promote infection. It has been presumed, but was not empirically established, that the Sec translocation system is the primary mediator of this secretion. Here, we validate an important role for SecDF, a component of the Sec system, in the secretion of several critical L. monocytogenes virulence factors. A ΔsecDF mutant is demonstrated to exhibit impaired membrane translocation of listeriolysin O (LLO), PlcA, PlcB, and ActA, factors that mediate L. monocytogenes phagosomal escape and spread from cell to cell. This impaired translocation was monitored by accumulation of the factors on the bacterial membrane and by reduced activity upon secretion. This defect in secretion is shown to be associated with a severe intracellular growth defect of the ΔsecDF mutant in macrophages and a less virulent phenotype in mice, despite normal growth in laboratory medium. We further show that SecDF is upregulated when the bacteria reside in macrophage phagosomes and that it is necessary for efficient phagosomal escape. Taken together, these data support the premise that SecDF plays a role as a chaperone that facilitates the translocation of L. monocytogenes virulence factors during infection. PMID:24056100

  1. Transcriptional interference perturbs the binding of Sp1 to the HIV-1 promoter.

    PubMed Central

    Greger, I H; Demarchi, F; Giacca, M; Proudfoot, N J

    1998-01-01

    Transcriptional interference between adjacent genes has been demonstrated in a variety of biological systems. To study this process in RNA polymerase II (pol II) transcribed genes we have analysed the effect of transcription on tandem HIV-1 promoters integrated into the genome of HeLa cells. We show that transcriptional activation at the upstream promoter reduces transcription from the downstream promoter, as compared with basal transcription conditions (in the absence of an activator). Furthermore, insertion of a strong transcriptional termination element between the two promoters alleviates this transcriptional interference, resulting in elevated levels of transcription from the downstream promoter. Actual protein interactions with the downstream (occluded) promoter were analysed by in vivo footprinting. Binding of Sp1 transcription factors to the occluded promoter was reduced, when compared with the footprint pattern of the promoter protected by the terminator. This suggests that promoter occlusion is due to disruption of certain transcription factors and that it can be blocked by an intervening transcriptional terminator. Chromatin mapping with DNase I indicates that a factor binds to the termination element under both basal and induced conditions. PMID:9469840

  2. miR-23b/SP1/c-myc forms a feed-forward loop supporting multiple myeloma cell growth

    PubMed Central

    Fulciniti, M; Amodio, N; Bandi, R L; Cagnetta, A; Samur, M K; Acharya, C; Prabhala, R; D'Aquila, P; Bellizzi, D; Passarino, G; Adamia, S; Neri, A; Hunter, Z R; Treon, S P; Anderson, K C; Tassone, P; Munshi, N C

    2016-01-01

    Deregulated microRNA (miR)/transcription factor (TF)-based networks represent a hallmark of cancer. We report here a novel c-Myc/miR-23b/Sp1 feed-forward loop with a critical role in multiple myeloma (MM) and Waldenstrom's macroglobulinemia (WM) cell growth and survival. We have found miR-23b to be downregulated in MM and WM cells especially in the presence of components of the tumor bone marrow milieu. Promoter methylation is one mechanism of miR-23b suppression in myeloma. In gain-of-function studies using miR-23b mimics-transfected or in miR-23b-stably expressing MM and WM cell lines, we observed a significant decrease in cell proliferation and survival, along with induction of caspase-3/7 activity over time, thus supporting a tumor suppressor role for miR-23b. At the molecular level, miR-23b targeted Sp1 3′UTR and significantly reduced Sp1-driven nuclear factor-κB activity. Finally, c-Myc, an important oncogenic transcription factor known to stimulate MM cell proliferation, transcriptionally repressed miR-23b. Thus MYC-dependent miR-23b repression in myeloma cells may promote activation of oncogenic Sp1-mediated signaling, representing the first feed-forward loop with critical growth and survival role in myeloma. PMID:26771806

  3. Translational and transcriptional control of Sp1 against ischaemia through a hydrogen peroxide-activated internal ribosomal entry site pathway

    PubMed Central

    Yeh, Shiu Hwa; Yang, Wen Bin; Gean, Po Wu; Hsu, Chung Yi; Tseng, Joseph T.; Su, Tsung Ping; Chang, Wen Chang; Hung, Jan Jong

    2011-01-01

    The exact mechanism underlying increases in Sp1 and the physiological consequences thereafter remains unknown. In rat primary cortical neurons, oxygen-glucose deprivation (OGD) causes an increase in H2O2 as well as Sp1 in early ischaemia but apparently does not change mRNA level or Sp1 stability. We hereby identified a longer 5′-UTR in Sp1 mRNA that contains an internal ribosome entry site (IRES) that regulates rapid and efficient translation of existing mRNAs. By using polysomal fragmentation and bicistronic luciferase assays, we found that H2O2 activates IRES-dependent translation. Thus, H2O2 or tempol, a superoxide dismutase-mimetic, increases Sp1 levels in OGD-treated neurons. Further, early-expressed Sp1 binds to Sp1 promoter to cause a late rise in Sp1 in a feed-forward manner. Short hairpin RNA against Sp1 exacerbates OGD-induced apoptosis in primary neurons. While Sp1 levels increase in the cortex in a rat model of stroke, inhibition of Sp1 binding leads to enhanced apoptosis and cortical injury. These results demonstrate that neurons can use H2O2 as a signalling molecule to quickly induce Sp1 translation through an IRES-dependent translation pathway that, in cooperation with a late rise in Sp1 via feed-forward transcriptional activation, protects neurons against ischaemic damage. PMID:21441538

  4. All-trans retinoic acid increases expression of aquaporin-5 and plasma membrane water permeability via transactivation of Sp1 in mouse lung epithelial cells.

    PubMed

    Nomura, Johji; Horie, Ichiro; Seto, Mayumi; Nagai, Kazufumi; Hisatsune, Akinori; Miyata, Takeshi; Isohama, Yoichiro

    2006-12-29

    Aquaporin-5 (AQP5) is a water-selective channel protein that is expressed in lacrimal glands, salivary glands, and distal lung. Several studies using AQP5 knockout mice have revealed that AQP5 plays an important role in maintaining water homeostasis in the lung. We report here that all-trans retinoic acid (atRA) increases plasma membrane water permeability, AQP5 mRNA and protein expression, and AQP5 promoter activity in MLE-12 cells. The promoter activation induced by atRA was diminished by mutation at the Sp1/Sp3 binding element (SBE), suggesting that the SBE mediates the effects of atRA. In addition, atRA increased the binding of Sp1 to the SBE without changing the levels of Sp1 in the nucleus. Taken together, our data indicate that atRA increases AQP5 expression through transactivation of Sp1, leading to an increase in plasma membrane water permeability. PMID:17097063

  5. An atomic model of HIV-1 capsid-SP1 reveals structures regulating assembly and maturation.

    PubMed

    Schur, Florian K M; Obr, Martin; Hagen, Wim J H; Wan, William; Jakobi, Arjen J; Kirkpatrick, Joanna M; Sachse, Carsten; Kräusslich, Hans-Georg; Briggs, John A G

    2016-07-29

    Immature HIV-1 assembles at and buds from the plasma membrane before proteolytic cleavage of the viral Gag polyprotein induces structural maturation. Maturation can be blocked by maturation inhibitors (MIs), thereby abolishing infectivity. The CA (capsid) and SP1 (spacer peptide 1) region of Gag is the key regulator of assembly and maturation and is the target of MIs. We applied optimized cryo-electron tomography and subtomogram averaging to resolve this region within assembled immature HIV-1 particles at 3.9 angstrom resolution and built an atomic model. The structure reveals a network of intra- and intermolecular interactions mediating immature HIV-1 assembly. The proteolytic cleavage site between CA and SP1 is inaccessible to protease. We suggest that MIs prevent CA-SP1 cleavage by stabilizing the structure, and MI resistance develops by destabilizing CA-SP1. PMID:27417497

  6. The conjugate gradient NAS parallel benchmark on the IBM SP1

    SciTech Connect

    Trefethen, A.E.; Zhang, T.

    1994-12-31

    The NAS Parallel Benchmarks are a suite of eight benchmark problems developed at the NASA Ames Research Center. They are specified in such a way that the benchmarkers are free to choose the language and method of implementation to suit the system in which they are interested. In this presentation the authors will discuss the Conjugate Gradient benchmark and its implementation on the IBM SP1. The SP1 is a parallel system which is comprised of RS/6000 nodes connected by a high performance switch. They will compare the results of the SP1 implementation with those reported for other machines. At this time, such a comparison shows the SP1 to be very competitive.

  7. Epigenetic modification of TLR4 promotes activation of NF-κB by regulating methyl-CpG-binding domain protein 2 and Sp1 in gastric cancer.

    PubMed

    Kim, Tae Woo; Lee, Seon-Jin; Oh, Byung Moo; Lee, Heesoo; Uhm, Tae Gi; Min, Jeong-Ki; Park, Young-Jun; Yoon, Suk Ran; Kim, Bo-Yeon; Kim, Jong Wan; Choe, Yong-Kyung; Lee, Hee Gu

    2016-01-26

    Toll-like receptor 4 (TLR4) is important in promoting the immune response in various cancers. Recently, TLR4 is highly expressed in a stage-dependent manner in gastric cancer, but the regulatory mechanism of TLR4 expression has been not elucidated it. Here, we investigated the mechanism underlying regulation of TLR4 expression through promoter methylation and histone modification between transcriptional regulation and silencing of the TLR4 gene in gastric cancer cells. Chromatin immunoprecipitation was carried out to screen for factors related to TLR4 methylation such as MeCP2, HDAC1, and Sp1 on the TLR4 promoter. Moreover, DNA methyltransferase inhibitor 5-aza-deoxycytidine (5-aza-dC) induced demethylation of the TLR4 promoter and increased H3K4 trimethylation and Sp1 binding to reactivate silenced TLR4. In contrast, although the silence of TLR4 activated H3K9 trimethylation and MeCP2 complex, combined treatment with TLR4 agonist and 5-aza-dC upregulated H3K4 trimethylation and activated with transcription factors as Sp1 and NF-κB. This study demonstrates that recruitment of the MeCP2/HDAC1 repressor complex increases the low levels of TLR4 expression through epigenetic modification of DNA and histones on the TLR4 promoter, but Sp1 activates TLR4 high expression by hypomethylation and NF-κB signaling in gastric cancer cells. PMID:26675260

  8. Epigenetic modification of TLR4 promotes activation of NF-κB by regulating methyl-CpG-binding domain protein 2 and Sp1 in gastric cancer

    PubMed Central

    Oh, Byung Moo; Lee, Heesoo; Uhm, Tae Gi; Min, Jeong-Ki; Park, Young-Jun; Yoon, Suk Ran; Kim, Bo-Yeon; Kim, Jong Wan; Choe, Yong-Kyung; Lee, Hee Gu

    2016-01-01

    Toll-like receptor 4 (TLR4) is important in promoting the immune response in various cancers. Recently, TLR4 is highly expressed in a stage-dependent manner in gastric cancer, but the regulatory mechanism of TLR4 expression has been not elucidated it. Here, we investigated the mechanism underlying regulation of TLR4 expression through promoter methylation and histone modification between transcriptional regulation and silencing of the TLR4 gene in gastric cancer cells. Chromatin immunoprecipitation was carried out to screen for factors related to TLR4 methylation such as MeCP2, HDAC1, and Sp1 on the TLR4 promoter. Moreover, DNA methyltransferase inhibitor 5-aza-deoxycytidine (5-aza-dC) induced demethylation of the TLR4 promoter and increased H3K4 trimethylation and Sp1 binding to reactivate silenced TLR4. In contrast, although the silence of TLR4 activated H3K9 trimethylation and MeCP2 complex, combined treatment with TLR4 agonist and 5-aza-dC upregulated H3K4 trimethylation and activated with transcription factors as Sp1 and NF-κB. This study demonstrates that recruitment of the MeCP2/HDAC1 repressor complex increases the low levels of TLR4 expression through epigenetic modification of DNA and histones on the TLR4 promoter, but Sp1 activates TLR4 high expression by hypomethylation and NF-κB signaling in gastric cancer cells. PMID:26675260

  9. Single-molecule DNA detection using a novel SP1 protein nanopore.

    PubMed

    Wang, Hai-Yan; Li, Yang; Qin, Li-Xia; Heyman, Arnon; Shoseyov, Oded; Willner, Itamar; Long, Yi-Tao; Tian, He

    2013-02-28

    SP1 protein as a new type of biological nanopore is described and is utilized to distinguish single-stranded DNA at the single-molecule level. Using the SP1 nanopore to investigate single molecule detection broadens the existing research areas of pore-forming biomaterials from unsymmetrical biological nanopores to symmetrical biological nanopores. This novel nanopore could provide a good candidate for single-molecule detection and characterization of biomaterial applications. PMID:23340583

  10. Draft Genome Sequences of Two Magnetotactic Bacteria, Magnetospirillum moscoviense BB-1 and Magnetospirillum marisnigri SP-1.

    PubMed

    Koziaeva, Veronika V; Dziuba, Marina V; Ivanov, Timophey M; Kuznetsov, Boris B; Skryabin, Konstantin G; Grouzdev, Denis S

    2016-01-01

    We report here the draft genome sequences of two recently isolated magnetotactic species, Magnetospirillum moscoviense BB-1 and Magnetospirillum marisnigri SP-1. The genome of M. moscoviense BB-1 has 4,164,497 bp, 65.2% G+C content, and comprises 207 contigs. The genome of M. marisnigri SP-1 consists of 131 contigs and has a length of 4,619,819 bp and 64.7% G+C content. PMID:27516508

  11. Draft Genome Sequences of Two Magnetotactic Bacteria, Magnetospirillum moscoviense BB-1 and Magnetospirillum marisnigri SP-1

    PubMed Central

    Koziaeva, Veronika V.; Dziuba, Marina V.; Ivanov, Timophey M.; Kuznetsov, Boris B.; Skryabin, Konstantin G.

    2016-01-01

    We report here the draft genome sequences of two recently isolated magnetotactic species, Magnetospirillum moscoviense BB-1 and Magnetospirillum marisnigri SP-1. The genome of M. moscoviense BB-1 has 4,164,497 bp, 65.2% G+C content, and comprises 207 contigs. The genome of M. marisnigri SP-1 consists of 131 contigs and has a length of 4,619,819 bp and 64.7% G+C content. PMID:27516508

  12. Sp1 transcriptionally regulates BRK1 expression in non-small cell lung cancer cells.

    PubMed

    Li, Meng; Ling, Bing; Xiao, Ting; Tan, Jinjing; An, Ning; Han, Naijun; Guo, Suping; Cheng, Shujun; Zhang, Kaitai

    2014-06-01

    Following a previous study reporting that BRK1 is upregulated in non-small cell lung cancer (NSCLC), the present study sought to clarify the role of specificity protein 1 (Sp1) in the transcriptional regulation of the BRK1 gene. Therefore, a construct, named F8, consisting of the -1341 to -1 nt sequence upstream of the start codon of the BRK1 gene inserted into pGL4.26 was made. A series of truncated fragments was then constructed based on F8. Segment S831, which contained the -84 to -1 nt region, displayed the highest transcriptional activity in the A549, H1299 and H520 NSCLC cell lines. Bioinformatic analysis showed a potential Sp1-binding element at -73 to -64 nt, and a mutation in this region suppressed the transcriptional activity of S831. Then the RNAi assays of Sp1 and its coworkers Sp3 and Sp4 were performed, and suppression of Sp1 by siRNA inhibited the mRNA expression of BRK1. Both an electrophoretic mobility shift assay (EMSA) and a chromatin immunoprecipitation (ChIP) assay demonstrated that Sp1 bound to the promoter area of the BRK1 gene. Our data identified a functional and positive Sp1 regulatory element from -73 to -64 nt in the BRK1 promoter, which may likely explain the overexpression of BRK1 in NSCLC. PMID:24680773

  13. An interaction between the DNA-binding domains of RelA(p65) and Sp1 mediates human immunodeficiency virus gene activation.

    PubMed Central

    Perkins, N D; Agranoff, A B; Pascal, E; Nabel, G J

    1994-01-01

    Induction of human immunodeficiency virus type 1 (HIV-1) gene expression in stimulated T cells has been attributed to the activation of the transcription factor NF-kappa B. The twice-repeated kappa B sites within the HIV-1 long terminal repeat are in close proximity to three binding sites for Sp1. We have previously shown that a cooperative interaction of NF-kappa B with Sp1 is required for the efficient stimulation of HIV-1 transcription. In this report, we define the domains of each protein responsible for this effect. Although the transactivation domains seemed likely to mediate this interaction, we find, surprisingly, that this interaction occurs through the putative DNA-binding domains of both proteins. Sp1 specifically interacted with the amino-terminal region of RelA(p65). Similarly, RelA bound directly to the zinc finger region of Sp1. This interaction was specific and resulted in cooperative DNA binding to the kappa B and Sp1 sites in the HIV-1 long terminal repeat. Furthermore, the amino-terminal region of RelA did not associate with several other transcription factors, including MyoD, E12, or Kox15, another zinc finger protein. These findings suggest that the juxtaposition of DNA-binding sites promotes a specific protein interaction between the DNA-binding regions of these transcription factors. This interaction is required for HIV transcriptional activation and may provide a mechanism to allow for selective activation of kappa B-regulated genes. Images PMID:7935378

  14. NAC transcription factors play an important role in ethylene biosynthesis, reception and signaling of tomato fruit ripening.

    PubMed

    Kou, Xiaohong; Liu, Chen; Han, Lihua; Wang, Shuang; Xue, Zhaohui

    2016-06-01

    NAC proteins comprise a large family of transcription factors that play important roles in diverse physiological processes during development. To explore the role of NAC transcription factors in the ripening of fruits, we predicted the secondary and tertiary structure as well as regulative function of the SNAC4 (SlNAC48, Accession number: NM 001279348.2) and SNAC9 (SlNAC19, Accession number: XM 004236996.2) transcription factors in tomato. We found that the tertiary structure of SNAC9 was similar to that of ATNAP, which played an important role in the fruit senescence and was required for ethylene stimulation. Likewise, the bio-function prediction results indicated that SNAC4 and SNAC9 participated in various plant hormone signaling and senescence processes. More information about SNACs was obtained by the application of VIGS (virus-induced gene silencing). The silencing of SNAC4 and SNAC9 dramatically repressed the LeACS2, LeACS4 and LeACO1 expression, which consequently led to the inhibition of the ripening process. The silencing of SNACs down-regulated the mRNA levels of the ethylene perception genes and, at the same time, suppressed the expression of ethylene signaling-related genes except for LeERF2 which was induced by the silencing of SNAC4. The expressions of LeRIN were different in two silenced fruits. In addition, the silencing of SNAC4 reduced its mRNA level, while the silencing of SNAC9 induced its expression. Furthermore, the silencing of LeACS4, LeACO1 and LeERF2 reduced the expression of SNAC4 and SNAC9, while the silencing of NR induced the expression of all of them. In particular, these results indicate that SNAC transcription factors bind to the promoter of the ethylene synthesis genes in vitro. This experimental evidence demonstrates that SNAC4 and SNAC9 could positively regulate the tomato fruit ripening process by functioning upstream of ethylene synthesis genes. These outcomes will be helpful to provide a theoretical foundation for further

  15. Scaffolding, Analysis and Materials: Contributing Factors in an Unexpected Finding of Advanced Infant/Toddler Pretend Play?

    ERIC Educational Resources Information Center

    Morrissey, Anne-Marie

    2014-01-01

    As part of a longitudinal study, infant/toddler pretend play development and maternal play modelling were investigated in dyadic context. A total of 21 children were videotaped in monthly play sessions with their mothers, from age 8 to 17 months. Child and mother pretend play frequencies and levels were measured using Brown's Pretend Play…

  16. Maximal Expression of the Evolutionarily Conserved Slit2 Gene Promoter Requires Sp1.

    PubMed

    Saunders, Jacquelyn; Wisidagama, D Roonalika; Morford, Travis; Malone, Cindy S

    2016-08-01

    Slit2 is a neural axon guidance and chemorepellent protein that stimulates motility in a variety of cell types. The role of Slit2 in neural development and neoplastic growth and migration has been well established, while the genetic mechanisms underlying regulation of the Slit2 gene have not. We identified the core and proximal promoter of Slit2 by mapping multiple transcriptional start sites, analyzing transcriptional activity, and confirming sequence homology for the Slit2 proximal promoter among a number of species. Deletion series and transient transfection identified the Slit2 proximal promoter as within 399 base pairs upstream of the start of transcription. A crucial region for full expression of the Slit2 proximal promoter lies between 399 base pairs and 296 base pairs upstream of the start of transcription. Computer modeling identified three transcription factor-binding consensus sites within this region, of which only site-directed mutagenesis of one of the two identified Sp1 consensus sites inhibited transcriptional activity of the Slit2 proximal promoter (-399 to +253). Bioinformatics analysis of the Slit2 proximal promoter -399 base pair to -296 base pair region shows high sequence conservation over twenty-two species, and that this region follows an expected pattern of sequence divergence through evolution. PMID:26456684

  17. Transcription cofactor PC4 plays essential roles in collaboration with the small subunit of general transcription factor TFIIE.

    PubMed

    Akimoto, Yusuke; Yamamoto, Seiji; Iida, Satoshi; Hirose, Yutaka; Tanaka, Aki; Hanaoka, Fumio; Ohkuma, Yoshiaki

    2014-12-01

    In eukaryotes, positive cofactor 4 (PC4) stimulates activator-dependent transcription by facilitating transcription initiation and the transition from initiation to elongation. It also forms homodimers and binds to single-stranded DNA and various transcriptional activators, including the general transcription factor TFIIH. In this study, we further investigated PC4 from Homo sapiens and the nematode Caenorhabditis elegans (hPC4 and cePC4, respectively). hPC4 strongly stimulated transcription on a linearized template, whereas it alleviated transcription on a supercoiled template. Transcriptional stimulation by PC4 was also alleviated by increasing the amount of TFIID. GST pull-down studies with general transcription factors indicated that both hPC4 and cePC4 bind strongly to TFIIB, TFIIEβ, TFIIFα, TFIIFβ and TFIIH XPB subunits and weakly to TBP and TFIIH p62. However, only hPC4 bound to CDK7. The effect of each PC4 on transcription was studied in combination with TFIIEβ. hPC4 stimulated both basal and activated transcription, whereas cePC4 primarily stimulated activated transcription, especially in the presence of TFIIEβ from C. elegans. Finally, hPC4 bound to the C-terminal region of hTFIIEβ adjacent to the basic region. These results indicate that PC4 plays essential roles in the transition step from transcription initiation to elongation by binding to melted DNA in collaboration with TFIIEβ. PMID:25308091

  18. Cloning of the human activated leukocyte cell adhesion molecule promoter and identification of its tissue-independent transcriptional activation by Sp1.

    PubMed

    Tan, Fang; Mbunkui, Flaubert; Ofori-Acquah, Solomon F

    2012-12-01

    Activated leukocyte cell adhesion molecule (ALCAM) belongs to the immunoglobulin cell adhesion molecule super family. ALCAM is implicated in tumor progression, inflammation, and the differentiation of hematopoietic stem cells. Hitherto, the identity of regulatory DNA elements and cognate transcription factors responsible for ALCAM gene expression remained unknown. In this report, the human ALCAM promoter was cloned and its transcriptional mechanisms elucidated. The promoter is TATA-less and contains multiple GC-boxes. A proximal 650-bp promoter fragment conferred tissue-independent activation, whereas two contiguous regions upstream of this region negatively influenced promoter activity in a tissue-specific manner. The positive regulatory promoter region was mapped to a core 50 base pair sequence containing a conical Sp1 element. Mutation analysis revealed that this element alone or in tandem with elements immediately upstream was required for maximal promoter activity. Chromatin analysis revealed that Sp1 binds exclusively to the canonical binding sequence in vivo, but not to DNA sequence immediately upstream. Finally, we showed that over-expression of Sp1 significantly increased the basal promoter activity. Thus, Sp1 activated the ALCAM promoter in most cells. These findings have important ramifications for unraveling the roles of ALCAM in inflammation and tumorigenesis. PMID:22941204

  19. The impact of high co-expression of Sp1 and HIF1α on prognosis of patients with hepatocellular cancer

    PubMed Central

    LIU, LIANG; JI, PING; QU, NING; PU, WEI-LIN; JIANG, DAO-WEN; LIU, WEI-YAN; LI, YA-QI; SHI, RONG-LIANG

    2016-01-01

    Transcription factor specificity protein 1 (Sp1) and hypoxia-inducible factor 1α (HIF1α) serve vital roles in tumor growth and metastasis. The present study aimed to evaluate the impact of co-expression of Sp1 and HIF1α on the prognosis of patients with hepatocellular cancer (HCC) using The Cancer Genome Atlas (TCGA) database and to validate the association between the expression levels of Sp1/HIF1α in HCC specimens and patient survival using immunohistochemical analysis. A total of 214 eligible patients with HCC from TCGA database were collected for the study. The expression profile of Sp1 and HIF1α were obtained from the TCGA RNAseq database. Clinicopathological characteristics, including age, height, weight, gender, race, ethnicity, family cancer history, serum α-fetoprotein (AFP), surgical procedures and TNM stage were collected. The Cox proportional hazards regression model and Kaplan-Meier curves were used to assess the relative factors. Receiver operating characteristic (ROC) curves for cancer-specific survival (CSS) prediction were plotted to compare the prediction ability of expression of Sp1 and HIF1α and their co-expression. The location and expression of Sp1 and HIF1α in the HCC tissues were detected by immunohistochemistry (IHC) to verify the association between these two genes and CSS. The results demonstrated that the expressions of Sp1 and HIF1α were significantly increased in the succumbed group (P=0.001), compared with the surviving group. The CSS rates were 60.1% at 3 years (1,067 days), 35.8% at 5 years (1,823 days) and 9.5% at 10 years (3,528 days). Multivariate Cox regression analysis demonstrated that only the high expression levels of Sp1 and HIF1α (≥2×103) were independent predictors for cancer mortality, with P=0.001 and P=0.029, respectively. The area under the curve for the ROC was found to be higher using the combination testing for two genes (0.751) in predicting cancer mortality, compared to a single gene (0.632 for Sp1

  20. Artemisinin blocks prostate cancer growth and cell cycle progression by disrupting Sp1 interactions with the cyclin-dependent kinase-4 (CDK4) promoter and inhibiting CDK4 gene expression.

    PubMed

    Willoughby, Jamin A; Sundar, Shyam N; Cheung, Mark; Tin, Antony S; Modiano, Jaime; Firestone, Gary L

    2009-01-23

    Artemisinin, a naturally occurring component of Artemisia annua, or sweet wormwood, is a potent anti-malaria compound that has recently been shown to have anti-proliferative effects on a number of human cancer cell types, although little is know about the molecular mechanisms of this response. We have observed that artemisinin treatment triggers a stringent G1 cell cycle arrest of LNCaP (lymph node carcinoma of the prostate) human prostate cancer cells that is accompanied by a rapid down-regulation of CDK2 and CDK4 protein and transcript levels. Transient transfection with promoter-linked luciferase reporter plasmids revealed that artemisinin strongly inhibits CDK2 and CDK4 promoter activity. Deletion analysis of the CDK4 promoter revealed a 231-bp artemisinin-responsive region between -1737 and -1506. Site-specific mutations revealed that the Sp1 site at -1531 was necessary for artemisinin responsiveness in the context of the CDK4 promoter. DNA binding assays as well as chromatin immunoprecipitation assays demonstrated that this Sp1-binding site in the CDK4 promoter forms a specific artemisinin-responsive DNA-protein complex that contains the Sp1 transcription factor. Artemisinin reduced phosphorylation of Sp1, and when dephosphorylation of Sp1 was inhibited by treatment of cells with the phosphatase inhibitor okadaic acid, the ability of artemisinin to down-regulate Sp1 interactions with the CDK4 promoter was ablated, rendering the CDK4 promoter unresponsive to artemisinin. Finally, overexpression of Sp1 mostly reversed the artemisinin down-regulation of CDK4 promoter activity and partially reversed the cell cycle arrest. Taken together, our results demonstrate that a key event in the artemisinin anti-proliferative effects in prostate cancer cells is the transcriptional down-regulation of CDK4 expression by disruption of Sp1 interactions with the CDK4 promoter. PMID:19017637

  1. Playful Gaming.

    ERIC Educational Resources Information Center

    Makedon, Alexander

    A philosophical analysis of play and games is undertaken in this paper. Playful gaming, which is shown to be a synthesis of play and games, is utilized as a category for undertaking the examination of play and games. The significance of playful gaming to education is demonstrated through analyses of Plato's, Dewey's, Sartre's, and Marcuse's…

  2. New Play.

    ERIC Educational Resources Information Center

    Lersten, Kenneth C.

    There have been many theories and hypotheses about play, one of which is the equation of play with "transcendence." Play may have the ingredients to allow us to transcend and, for a moment, remythologize life. There have been recent authors who have given play the status of theology, indicating that play contains elements also found in religion.…

  3. Epidermal growth factor receptor plays a role in the regulation of liver and plasma lipid levels in adult male mice

    PubMed Central

    Zhang, Xiuqi; Garcia, Oscar A.; Wang, Rebecca F.; Stevenson, Mary C.; Threadgill, David W.; Russell, William E.

    2014-01-01

    Dsk5 mice have a gain of function in the epidermal growth factor receptor (EGFR), caused by a point mutation in the kinase domain. We analyzed the effect of this mutation on liver size, histology, and composition. We found that the livers of 12-wk-old male Dsk5 heterozygotes (+/Dsk5) were 62% heavier compared with those of wild-type controls (+/+). The livers of the +/Dsk5 mice compared with +/+ mice had larger hepatocytes with prominent, polyploid nuclei and showed modestly increased cell proliferation indices in both hepatocytes and nonparenchymal cells. An analysis of total protein, DNA, and RNA (expressed relative to liver weight) revealed no differences between the mutant and wild-type mice. However, the livers of the +/Dsk5 mice had more cholesterol but less phospholipid and fatty acid. Circulating cholesterol levels were twice as high in adult male +/Dsk5 mice but not in postweaned young male or female mice. The elevated total plasma cholesterol resulted mainly from an increase in low-density lipoprotein (LDL). The +/Dsk5 adult mouse liver expressed markedly reduced protein levels of LDL receptor, no change in proprotein convertase subtilisin/kexin type 9, and a markedly increased fatty acid synthase and 3-hydroxy-3-methyl-glutaryl-CoA reductase. Increased expression of transcription factors associated with enhanced cholesterol synthesis was also observed. Together, these findings suggest that the EGFR may play a regulatory role in hepatocyte proliferation and lipid metabolism in adult male mice, explaining why elevated levels of EGF or EGF-like peptides have been positively correlated to increased cholesterol levels in human studies. PMID:24407590

  4. Adjacent proline residues in the inhibitory domain of the Oct-2 transcription factor play distinct functional roles.

    PubMed Central

    Liu, Y Z; Lee, I K; Locke, I; Dawson, S J; Latchman, D S

    1998-01-01

    A 40 amino acid region of Oct-2 from amino acids 142 to 181 functions as an active repressor domain capable of inhibiting both basal activity and activation of promoters containing a TATA box, but not of those that contain an initiator element. Based on our observation that the equivalent region of the closely related Oct-1 factor does not act as an inhibitory domain, we have mutated specific residues in the Oct-2 domain in an attempt to probe their importance in repressor domain function. Although mutations of several residues have no or minimal effect, mutation of proline 175 to arginine abolishes the ability to inhibit both basal and activated transcription. In contrast, mutation of proline 174 to arginine confers upon the domain the ability to repress activation of an initiator-containing promoter by acidic activation domains, and also suppresses the effect of the proline 175 mutation. Hence, adjacent proline residues play key roles in the functioning of the inhibitory domain and in limiting its specificity to TATA-box-containing promoters. PMID:9580701

  5. Osteoblast Lineage Cells Play an Essential Role in Periodontal Bone Loss Through Activation of Nuclear Factor-Kappa B

    PubMed Central

    Pacios, Sandra; Xiao, Wenmei; Mattos, Marcelo; Lim, Jason; Tarapore, Rohinton S.; Alsadun, Sarah; Yu, Bo; Wang, Cun-Yu; Graves, Dana T.

    2015-01-01

    Bacterial pathogens stimulate periodontitis, the most common osteolytic disease in humans and the most common cause of tooth loss in adults. Previous studies identified leukocytes and their products as key factors in this process. We demonstrate for the first time that osteoblast lineage cells play a critical role in periodontal disease. Oral infection stimulated nuclear localization of NF-κB in osteoblasts and osteocytes in the periodontium of wild type but not transgenic mice that expressed a lineage specific dominant negative mutant of IKK (IKK-DN) in osteoblast lineage cells. Wild-type mice were also susceptible to bacteria induced periodontal bone loss but transgenic mice were not. The lack of bone loss in the experimental group was linked to reduced RANKL expression by osteoblast lineage cells that led to diminished osteoclast mediated bone resorption and greater coupled new bone formation. The results demonstrate that osteoblast lineage cells are key contributors to periodontal bone loss through an NF-κB mediated mechanism. PMID:26666569

  6. Loss of proteolytically processed filaggrin caused by epidermal deletion of Matriptase/MT-SP1

    PubMed Central

    List, Karin; Szabo, Roman; Wertz, Philip W.; Segre, Julie; Haudenschild, Christian C.; Kim, Soo-Youl; Bugge, Thomas H.

    2003-01-01

    Profilaggrin is a large epidermal polyprotein that is proteolytically processed during keratinocyte differentiation to release multiple filaggrin monomer units as well as a calcium-binding regulatory NH2-terminal filaggrin S-100 protein. We show that epidermal deficiency of the transmembrane serine protease Matriptase/MT-SP1 perturbs lipid matrix formation, cornified envelope morphogenesis, and stratum corneum desquamation. Surprisingly, proteomic analysis of Matriptase/MT-SP1–deficient epidermis revealed the selective loss of both proteolytically processed filaggrin monomer units and the NH2-terminal filaggrin S-100 regulatory protein. This was associated with a profound accumulation of profilaggrin and aberrant profilaggrin-processing products in the stratum corneum. The data identify keratinocyte Matriptase/MT-SP1 as an essential component of the profilaggrin-processing pathway and a key regulator of terminal epidermal differentiation. PMID:14638864

  7. An Sp1 binding site and the minimal promoter contribute to overexpression of the cytokeratin 18 gene in tumorigenic clones relative to that in nontumorigenic clones of a human carcinoma cell line.

    PubMed Central

    Gunther, M; Frebourg, T; Laithier, M; Fossar, N; Bouziane-Ouartini, M; Lavialle, C; Brison, O

    1995-01-01

    Clones of cells tumorigenic or nontumorigenic in nude mice have been previously isolated from the SW613-S human colon carcinoma cell line. We have already reported that tumorigenic cells overexpress the cytokeratin 18 (K18) gene in comparison with nontumorigenic cells and that this difference is mainly due to a transcriptional regulation. We now report that a 2,532-bp cloned human K18 gene promoter drives the differential expression of a reporter gene in a transient assay. A 62-bp minimal K18 promoter (TATA box and initiation site) has a low but differential activity. Analysis of deletion and substitution mutants as well as hybrid SV40-K18 promoters and reconstructed K18 promoters indicated that an important element for the activity of the K18 promoter is a high-affinity binding site for transcription factor Sp1 located just upstream of the TATA box. This Sp1 binding element, as well as the intron 1 enhancer element, stimulates the basal activity of the minimal promoter through mechanisms that maintain the differential activity. Gel shift assays and the use of an anti-Sp1 antibody have shown that both tumorigenic and nontumorigenic SW613-S cells contain three factors able to bind to the Sp1 binding element site and that one of them is Sp1. A hybrid GAL4-Sp1 protein transactivated to comparable extents in tumorigenic and nontumorigenic cells a reconstructed K18 promoter containing GAL4 binding sites and therefore without altering its differential behavior. These results indicate that the Sp1 transcription factor is involved in the overexpression of the K18 gene in tumorigenic SW613-S cells through its interaction with a component of the basal transcription machinery. PMID:7537848

  8. Early experiences with the IBM SP1 and the high-performance switch

    SciTech Connect

    Gropp, W.

    1993-11-01

    The IBM SP1 is IBM`s newest parallel distributed-memory computer. As part of a joint project with IBM, Argonne took delivery of an early system in order to evaluate the software environment and to begin porting programming packages and applications to this machine. This report discusses the results of those efforts once the high-performance switch was installed. An earlier report (ANL/MCS-TM-177) emphasized software usability and the initial ports to the SP1. This report contains performance results and discusses some applications and tools not covered in TM 177.

  9. Zinc Finger Independent Genome-Wide Binding of Sp2 Potentiates Recruitment of Histone-Fold Protein Nf-y Distinguishing It from Sp1 and Sp3

    PubMed Central

    Finkernagel, Florian; Stiewe, Thorsten; Nist, Andrea; Suske, Guntram

    2015-01-01

    Transcription factors are grouped into families based on sequence similarity within functional domains, particularly DNA-binding domains. The Specificity proteins Sp1, Sp2 and Sp3 are paradigmatic of closely related transcription factors. They share amino-terminal glutamine-rich regions and a conserved carboxy-terminal zinc finger domain that can bind to GC rich motifs in vitro. All three Sp proteins are ubiquitously expressed; yet they carry out unique functions in vivo raising the question of how specificity is achieved. Crucially, it is unknown whether they bind to distinct genomic sites and, if so, how binding site selection is accomplished. In this study, we have examined the genomic binding patterns of Sp1, Sp2 and Sp3 in mouse embryonic fibroblasts by ChIP-seq. Sp1 and Sp3 essentially occupy the same promoters and localize to GC boxes. The genomic binding pattern of Sp2 is different; Sp2 primarily localizes at CCAAT motifs. Consistently, re-expression of Sp2 and Sp3 mutants in corresponding knockout MEFs revealed strikingly different modes of genomic binding site selection. Most significantly, while the zinc fingers dictate genomic binding of Sp3, they are completely dispensable for binding of Sp2. Instead, the glutamine-rich amino-terminal region is sufficient for recruitment of Sp2 to its target promoters in vivo. We have identified the trimeric histone-fold CCAAT box binding transcription factor Nf-y as the major partner for Sp2-chromatin interaction. Nf-y is critical for recruitment of Sp2 to co-occupied regulatory elements. Equally, Sp2 potentiates binding of Nf-y to shared sites indicating the existence of an extensive Sp2-Nf-y interaction network. Our results unveil strikingly different recruitment mechanisms of Sp1/Sp2/Sp3 transcription factor members uncovering an unexpected layer of complexity in their binding to chromatin in vivo. PMID:25793500

  10. Does Performance in Digital Reading Relate to Computer Game Playing? A Study of Factor Structure and Gender Patterns in 15-Year-Olds' Reading Literacy Performance

    ERIC Educational Resources Information Center

    Rasmusson, Maria; Åberg-Bengtsson, Lisbeth

    2015-01-01

    Data from a Swedish PISA-sample were used (1) to identify a digital reading factor, (2) to investigate gender differences in this factor (if found), and (3) to explore how computer game playing might relate to digital reading performance and gender. The analyses were conducted with structural equation modeling techniques. In addition to an overall…

  11. Platelet-Activating Factor Receptor Plays a Role in Lung Injury and Death Caused by Influenza A in Mice

    PubMed Central

    Garcia, Cristiana C.; Russo, Remo C.; Guabiraba, Rodrigo; Fagundes, Caio T.; Polidoro, Rafael B.; Tavares, Luciana P.; Salgado, Ana Paula C.; Cassali, Geovanni D.; Sousa, Lirlândia P.; Machado, Alexandre V.; Teixeira, Mauro M.

    2010-01-01

    Influenza A virus causes annual epidemics which affect millions of people worldwide. A recent Influenza pandemic brought new awareness over the health impact of the disease. It is thought that a severe inflammatory response against the virus contributes to disease severity and death. Therefore, modulating the effects of inflammatory mediators may represent a new therapy against Influenza infection. Platelet activating factor (PAF) receptor (PAFR) deficient mice were used to evaluate the role of the gene in a model of experimental infection with Influenza A/WSN/33 H1N1 or a reassortant Influenza A H3N1 subtype. The following parameters were evaluated: lethality, cell recruitment to the airways, lung pathology, viral titers and cytokine levels in lungs. The PAFR antagonist PCA4248 was also used after the onset of flu symptoms. Absence or antagonism of PAFR caused significant protection against flu-associated lethality and lung injury. Protection was correlated with decreased neutrophil recruitment, lung edema, vascular permeability and injury. There was no increase of viral load and greater recruitment of NK1.1+ cells. Antibody responses were similar in WT and PAFR-deficient mice and animals were protected from re-infection. Influenza infection induces the enzyme that synthesizes PAF, lyso-PAF acetyltransferase, an effect linked to activation of TLR7/8. Therefore, it is suggested that PAFR is a disease-associated gene and plays an important role in driving neutrophil influx and lung damage after infection of mice with two subtypes of Influenza A. Further studies should investigate whether targeting PAFR may be useful to reduce lung pathology associated with Influenza A virus infection in humans. PMID:21079759

  12. Sex Disparities in the Quality of Diabetes Care: Biological and Cultural Factors May Play a Different Role for Different Outcomes

    PubMed Central

    Rossi, Maria Chiara; Cristofaro, Maria Rosaria; Gentile, Sandro; Lucisano, Giuseppe; Manicardi, Valeria; Mulas, Maria Franca; Napoli, Angela; Nicolucci, Antonio; Pellegrini, Fabio; Suraci, Concetta; Giorda, Carlo

    2013-01-01

    OBJECTIVE To investigate the quality of type 2 diabetes care according to sex. RESEARCH DESIGN AND METHODS Clinical data collected during the year 2009 were extracted from electronic medical records; quality-of-care indicators were evaluated. Multilevel logistic regression analysis was applied to estimate the likelihood of women versus men to be monitored for selected parameters, to reach clinical outcomes, and to be treated with specific classes of drugs. The intercenter variability in the proportion of men and women achieving the targets was also investigated. RESULTS Overall, 415,294 patients from 236 diabetes outpatient centers were evaluated, of whom 188,125 (45.3%) were women and 227,169 (54.7%) were men. Women were 14% more likely than men to have HbA1c >9.0% in spite of insulin treatment (odds ratio 1.14 [95% CI 1.10–1.17]), 42% more likely to have LDL cholesterol (LDL-C) ≥130 mg/dL (1.42 [1.38–1.46]) in spite of lipid-lowering treatment, and 50% more likely to have BMI ≥30 kg/m2 (1.50 [1.50–1.54]). Women were less likely to be monitored for foot and eye complications. In 99% of centers, the percentage of men reaching the LDL-C target was higher than in women, the proportion of patients reaching the HbA1c target was in favor of men in 80% of the centers, and no differences emerged for blood pressure. CONCLUSIONS Women show a poorer quality of diabetes care than men. The attainment of the LDL-C target seems to be mainly related to pathophysiological factors, whereas patient and physician attitudes can play an important role in other process measures and outcomes. PMID:23835692

  13. E-Ras improves the efficiency of reprogramming by facilitating cell cycle progression through JNK-Sp1 pathway.

    PubMed

    Kwon, Yoo-Wook; Jang, Seulgi; Paek, Jae-Seung; Lee, Jae-Woong; Cho, Hyun-Jai; Yang, Han-Mo; Kim, Hyo-Soo

    2015-11-01

    We have previously shown that pluripotent stem cells can be induced from adult somatic cells which were exposed to protein extracts isolated from mouse embryonic stem cells (mESC). Interestingly, generation of induced pluripotent stem (iPS) cells depended on the background of ES cell lines; possible by extracts from C57, but not from E14. Proteomic analysis of two different mES cell lines (C57 and E14) shows that embryonic Ras (E-Ras) is expressed differently in two mES cell lines; high level of E-Ras only in C57 mESC whose extracts allows iPS cells production from somatic cells. Here, we show that E-Ras augments the efficiency in reprogramming of fibroblast by promoting cell proliferation. We found that over-expression of E-Ras in fibroblast increased cell proliferation which was caused by specific up-regulation of cyclins D and E, not A or B, leading to the accelerated G1 to S phase transition. To figure out the common transcription factor of cyclins D and E, we used TRANSFAC database and selected SP1 as a candidate which was confirmed as enhancer of cyclins D and E by luciferase promoter assay using mutants. As downstream signaling pathways, E-Ras activated only c-Jun N-terminal kinases (JNK) but not ERK or p38. Inhibition of JNK prevented E-Ras-mediated induction of pSP1, cyclins D, E, and cell proliferation. Finally, E-Ras transduction to fibroblast enhanced the efficiency of iPS cell generation by 4 factors (Oct4/Klf4/Sox2/C-myc), which was prevented by JNK inhibitor. In conclusion, E-Ras stimulates JNK, enhances binding of Sp1 on the promoter of cyclins D and E, leading to cell proliferation. E-Ras/JNK axis is a critical mechanism to generate iPS cells by transduction of 4 factors or by treatment of mESC protein extracts. PMID:26413787

  14. Interactive Roles of Ets-1, Sp1, and Acetylated Histones in the Retinoic Acid-dependent Activation of Guanylyl Cyclase/Atrial Natriuretic Peptide Receptor-A Gene Transcription*

    PubMed Central

    Kumar, Prerna; Garg, Renu; Bolden, Gevoni; Pandey, Kailash N.

    2010-01-01

    Cardiac hormones atrial and brain natriuretic peptides activate guanylyl cyclase/natriuretic peptide receptor-A (GC-A/NPRA), which plays a critical role in reduction of blood pressure and blood volume. Currently, the mechanisms responsible for regulating the Npr1 gene (coding for GC-A/NPRA) transcription are not well understood. The present study was conducted to examine the interactive roles of all-trans retinoic acid (ATRA), Ets-1, Sp1, and histone acetylation on the transcriptional regulation and function of the Npr1 gene. Deletion analysis of the Npr1 promoter and luciferase assays showed that ATRA enhanced a 16-fold Npr1 promoter activity and greatly stimulated guanylyl cyclase (GC) activity of the receptor protein in both atrial natriuretic peptide (ANP)-dependent and -independent manner. As confirmed by gel shift and chromatin immunoprecipitation assays, ATRA enhanced the binding of both Ets-1 and Sp1 to the Npr1 promoter. The retinoic acid receptor α (RARα) was recruited by Ets-1 and Sp1 to form a transcriptional activator complex with their binding sites in the Npr1 promoter. Interestingly, ATRA also increased the acetylation of histones H3 and H4 and enhanced their recruitment to Ets-1 and Sp1 binding sites within the Npr1 promoter. Collectively, the present results demonstrate that ATRA regulates Npr1 gene transcription and GC activity of the receptor by involving the interactive actions of Ets-1, Sp1, and histone acetylation. PMID:20864529

  15. Histone deacetylase 3 represses p15{sup INK4b} and p21{sup WAF1/cip1} transcription by interacting with Sp1

    SciTech Connect

    Huang Weifeng; Tan Dapeng; Wang Xiuli; Han Songyan; Tan Jiang; Zhao Yanmei; Lu Jun . E-mail: ycsuo@nenu.edu.cn; Huang Baiqu

    2006-01-06

    Histone deacetylase 3 (HDAC3) has been implicated to play roles in governing cell proliferation. Here we demonstrated that the overexpression of HDAC3 repressed transcription of p15{sup INK4b} and p21{sup WAF1/cip1} genes in 293T cells, and that the recruitment of HDAC3 to the promoter regions of these genes was critical to this repression. We also showed that HDAC3 repressed GAL4-Sp1 transcriptional activity, and that Sp1 was co-immunoprecipitated with FLAG-tagged HDAC3. We conclude that HDAC3 can repress p15{sup INK4b} and p21{sup WAF1/cip1} transcription by interacting with Sp1. Furthermore, knockdown of HDAC3 by RNAi up-regulated the transcriptional expression of p15{sup INK4b}, but not that of p21{sup WAF1/cip1}, implicating the different roles of HDAC3 in repression of p15{sup INK4b} and p21{sup WAF1/cip1} transcription. Data from this study indicate that the inhibition of p15{sup INK4b} and p21{sup WAF1/cip1} may be one of the mechanisms by which HDAC3 participates in cell cycle regulation and oncogenesis.

  16. Characterization of the human activator protein-2gamma (AP-2gamma) gene: control of expression by Sp1/Sp3 in breast tumour cells.

    PubMed Central

    Hasleton, Mark D; Ibbitt, J Claire; Hurst, Helen C

    2003-01-01

    The activator protein-2 (AP-2) family of DNA-binding transcription factors are developmentally regulated and also play a role in human neoplasia. In particular, the AP-2gamma protein has been shown to be overexpressed in a high percentage of breast tumours. In the present study, we report the complete sequence determination of the human TFAP2C gene encoding the AP-2gamma transcription factor plus the mapping of the transcription start site used in breast tumour-derived cells. The 5'-end of the gene lies within a CpG island and transcription is initiated at a single site within a classical initiator motif. We have gone on to investigate why some breast tumour-derived cell lines readily express AP-2gamma, whereas others do not, and show that the proximal promoter (+191 to -312) is differentially active in the two cell phenotypes. DNase footprinting led to the identification of three Sp1/Sp3-binding sites within this region, two of which are absolutely required both for promoter function and cell-type-specific activity. By Western blotting a panel of expressing and non-expressing breast tumour lines we show that the latter have higher levels of Sp3. Furthermore, increasing Sp3 levels in AP-2gamma-expressing cells led to the repression of AP-2gamma promoter activity, particularly when Sp3 inhibitory function was maximized through sumoylation. We propose that differences in the level and activity of Sp3 between breast tumour lines can determine the expression level of their AP-2gamma gene. PMID:12733991

  17. AmeriFlux US-SP1 Slashpine-Austin Cary- 65yrs nat regen

    SciTech Connect

    Martin, Tim

    2016-01-01

    This is the AmeriFlux version of the carbon flux data for the site US-SP1 Slashpine-Austin Cary- 65yrs nat regen. Site Description - The ACMF site is a 67 hectare naturally regenerated Pinus palustris and Pinus elliottii mixed stand.

  18. Scalability study of parallel spatial direct numerical simulation code on IBM SP1 parallel supercomputer

    NASA Technical Reports Server (NTRS)

    Hanebutte, Ulf R.; Joslin, Ronald D.; Zubair, Mohammad

    1994-01-01

    The implementation and the performance of a parallel spatial direct numerical simulation (PSDNS) code are reported for the IBM SP1 supercomputer. The spatially evolving disturbances that are associated with laminar-to-turbulent in three-dimensional boundary-layer flows are computed with the PS-DNS code. By remapping the distributed data structure during the course of the calculation, optimized serial library routines can be utilized that substantially increase the computational performance. Although the remapping incurs a high communication penalty, the parallel efficiency of the code remains above 40% for all performed calculations. By using appropriate compile options and optimized library routines, the serial code achieves 52-56 Mflops on a single node of the SP1 (45% of theoretical peak performance). The actual performance of the PSDNS code on the SP1 is evaluated with a 'real world' simulation that consists of 1.7 million grid points. One time step of this simulation is calculated on eight nodes of the SP1 in the same time as required by a Cray Y/MP for the same simulation. The scalability information provides estimated computational costs that match the actual costs relative to changes in the number of grid points.

  19. SP1 as a novel scaffold building block for self-assembly nanofabrication of submicron enzymatic structures.

    PubMed

    Heyman, Arnon; Levy, Ilan; Altman, Arie; Shoseyov, Oded

    2007-06-01

    In this study, SP1, a ring-shaped highly stable homododecamer protein complex was utilized for the self-assembly of multiple domains in a predefined manner. Glucose oxidase (GOx) was fused in-frame to SP1 and expressed in Escherichia coli. Complexes where GOx encircled SP1 dodecamer were observed, and moreover, the enzymatic monomers self-assembled into active multienzyme nanotube particles containing hundreds of GOx molecules per tube. This work demonstrates the value of SP1 as a self-assembly scaffold. PMID:17530810

  20. Adult Play.

    ERIC Educational Resources Information Center

    Charles, John M.

    In its broadest context, play can be interpreted as any pleasurable use of discretionary time. Playfulness is an intrinsic feature of being human, and should be viewed in the light of a total lifestyle, not as an occurrence in an isolated time of life. Adult play appears to be an indefinable and controversial concept. A holistic approach should be…

  1. Wanna Play?

    ERIC Educational Resources Information Center

    Chenfeld, Mimi Brodsky

    2006-01-01

    In this article, the author talks about the importance of play in the lives of children and describes how games and imaginative play contribute to the development of children. From her decades-old collection of countless incidents demonstrating children's love for self-directed, informal, imaginative play, the author shares three incidents that…

  2. City Play.

    ERIC Educational Resources Information Center

    Dargan, Amanda; Zeitlin, Steve

    2000-01-01

    Today, fewer city blocks preserve the confidence of lifestyle and urban geography that sustain traditional games and outdoor play. Large groups of children choosing sides and organizing Red Rover games are no longer commonplace. Teachers must encourage free play; urban planners must build cities that are safe play havens. (MLH)

  3. Why people continue to play online games: in search of critical design factors to increase customer loyalty to online contents.

    PubMed

    Choi, Dongseong; Kim, Jinwoo

    2004-02-01

    As people increasingly play online games, numerous new features have been proposed to increase players' log-on time at online gaming sites. However, few studies have investigated why people continue to play certain online games or which design features are most closely related to the amount of time spent by players at particular online gaming sites. This study proposes a theoretical model using the concepts of customer loyalty, flow, personal interaction, and social interaction to explain why people continue to play online network games. The study then conducts a large-scale survey to validate the model. Finally, it analyzes current online games to identify design features that are closely related to the theoretical concepts. The results indicate that people continue to play online games if they have optimal experiences while playing the games. This optimal experience can be attained if the player has effective personal interaction with the system or pleasant social interactions with other people connected to the Internet. Personal interaction can be facilitated by providing appropriate goals, operators and feedback; social interaction can be facilitated through appropriate communication places and tools. This paper ends with the implications of applying the study results to other domains such as e-commerce and cyber communities. PMID:15006164

  4. Cadmium down-regulation of kidney Sp1 binding to mouse SGLT1 and SGLT2 gene promoters: Possible reaction of cadmium with the zinc finger domain of Sp1

    SciTech Connect

    Kothinti, Rajendra K.; Blodgett, Amy B.; Petering, David H.; Tabatabai, Niloofar M.

    2010-05-01

    Cadmium (Cd) exposure causes glucosuria (glucose in the urine). Previously, it was shown that Cd exposure of primary cultures of mouse kidney cells (PMKC) decreased mRNA levels of the glucose transporters, SGLT1 and SGLT2 and that Sp1 from Cd-exposed cells displayed reduced binding to the GC boxes of the mouse SGLT1 promoter in vitro. Here, we identified a GC box upstream of mouse SGLT2 gene. ChIP assays on PMKC revealed that exposure to 5 muM Cd abolished Sp1 binding to SGLT1 GC box while it decreased Sp1 binding to SGLT2 GC sequence by 30% in vivo. The in vitro DNA binding assay, EMSA, demonstrated that binding of Sp1 from Cd (7.5 muM)-treated PMKC to the SGLT2 GC probe was 86% lower than in untreated cells. Sp1 is a zinc finger protein. Compared to PMKC exposed to 5 muM Cd alone, inclusion of 5 muM Zn restored SGLT1 and 2 mRNA levels by 15% and 30%, respectively. Cd (10 muM) decreased the binding of recombinant Sp1 (rhSp1) to SGLT1 and SGLT2 GC probes to 12% and 8% of untreated controls. Cd exerted no effect on GC-bound rhSp1. Co-treatment with Cd and Zn showed that added Zn significantly restored rhSp1 binding to the SGLT1 and SGLT2. Addition of Zn post Cd treatment was not stimulatory. We conclude that Cd can replace Zn in Sp1 DNA binding domain to reduce its binding to GC sites in mouse SGLT1 and SGLT2 promoters.

  5. Aspen SP1, an exceptional thermal, protease and detergent-resistant self-assembled nano-particle.

    PubMed

    Wang, Wang-Xia; Dgany, Or; Wolf, Sharon Grayer; Levy, Ilan; Algom, Rachel; Pouny, Yehonathan; Wolf, Amnon; Marton, Ira; Altman, Arie; Shoseyov, Oded

    2006-09-01

    Stable protein 1 (SP1) is a homo-oligomeric protein isolated from aspen (Populus tremula aspen) plants which forms a ring-shape dodecameric particle with a central cavity. The oligomeric form of SP1 is an exceptionally stable structure that is resistant to proteases (e.g., trypsin, V8, and proteinase K), high temperatures, organic solvents, and high levels of ionic detergent. Analytical ultra-centrifugation, chemical cross-linking, matrix-assisted laser-desorption time-of-flight mass spectrometry (MALDI-TOF-MS), and transmission electron microscopy were used to further characterize the SP1 dodecamer. Introduction of a single cysteine at the N-terminus of SP1 enabled the formation of disulfide bridges within the SP1 dodecamer, concurrent with increased melting point. A six-histidine tag was introduced at the N-terminus of SP1 to generate 6HSP1, and the DeltaNSP1 mutant was generated by a deletion of amino acids 2-6 at the N-terminus. Both 6HSP1 and DeltaNSP1 maintained their ability to assemble a stable dodecamer. Remarkably, these SP1 homo-dodecamers were able to re-assemble into stable hetero-dodecamers following co-electro-elution from SDS-PAGE. The exceptional stability of the SP1-nano ring and its ability to self-assemble hetero-complexes paves the way to further research in utilizing this unique protein in nano-biotechnology. PMID:16732592

  6. Involvement of the GC-rich sequence and specific proteins (Sp1/Sp3) in the basal transcription activity of neurogranin gene

    SciTech Connect

    Gui Jingang; Song Yan; Han, N.-L.R.; Zhou Shufeng; Sheu, F.-S. . E-mail: dbssfs@nus.edu.sg

    2006-06-23

    Neurogranin (Ng), a neuronal protein implicated in learning and memory, contains a TATA-less promoter. Analysis of 5'-deletion mutations and site-directed mutations of the mouse Ng promoter revealed that a 258 bp 5'-flanking sequence (+3 to +260) conferred the basal transcription activity, and that the GC-rich sequence (+22 to +33) served as an important determinant of the promoter activity. Transient transfection of the Sp1 expression plasmid transactivated the reporter activity in neuroblastoma N2A cells while knocking down of endogenous Sp1 expression resulted in a 2.5-fold reduction of the reporter activity in HEK 293 cells. Exogenous expression of Sp3 in HEK 293 cells, however, repressed the reporter activity by 50%. Nevertheless, by gel shift assays, Sp1 and Sp3 were not found to be responsible for the protein-DNA complexes formed by the GC-rich sequence. Moreover, a nuclear factor from the mouse brain tissues was discovered to bind to multiple AT-rich regions in Ng promoter.

  7. Species-specific interaction of the glutamine-rich activation domains of Sp1 with the TATA box-binding protein.

    PubMed Central

    Emili, A; Greenblatt, J; Ingles, C J

    1994-01-01

    We have used protein-blotting and protein affinity chromatography to demonstrate that each of the two glutamine-rich activation domains of the human transcription factor Sp1 can bind specifically and directly to the C-terminal evolutionarily conserved domain of the human TATA box-binding protein (TBP). These activation domains of Sp1 also bind directly to Drosophila TBP but bind much less strongly to TBP from the yeast Saccharomyces cerevisiae. The abilities of the Sp1 activation domains to interact directly with the TBPs of various species correlate well with their abilities to activate transcription in extracts derived from the same species. We also show that a glutamine-rich transcriptional activating region of the Drosophila protein Antennapedia binds directly to TBP in a species-specific manner that reflects its ability to activate transcription in vivo. These results support the notion that TBP is a direct and important target of glutamine-rich transcriptional activators. Images PMID:8114696

  8. Capsaicin sensitizes TRAIL-induced apoptosis through Sp1-mediated DR5 up-regulation: Involvement of Ca{sup 2+} influx

    SciTech Connect

    Moon, Dong-Oh; Kang, Chang-Hee; Kang, Sang-Hyuck; Choi, Yung-Hyun; Hyun, Jin-Won; Chang, Weon-Young; Kang, Hee-Kyoung; Koh, Young-Sang; Maeng, Young-Hee; Kim, Young-Ree; Kim, Gi-Young

    2012-02-15

    Although tumor necrosis factor-related apoptosis-inducing ligand (TRAIL) induces apoptosis in various malignant cells, several cancers including human hepatocellular carcinoma (HCC) exhibit potent resistance to TRAIL-induced cell death. The aim of this study is to evaluate the anti-cancer potential of capsaicin in TRAIL-induced cancer cell death. As indicated by assays that measure phosphatidylserine exposure, mitochondrial activity and activation of caspases, capsaicin potentiated TRAIL-resistant cells to lead to cell death. In addition, we found that capsaicin induces the cell surface expression of TRAIL receptor DR5, but not DR4 through the activation Sp1 on its promoter region. Furthermore, we investigated that capsaicin-induced DR5 expression and apoptosis are inhibited by calcium chelator or inhibitors for calmodulin-dependent protein kinase. Taken together, our data suggest that capsaicin sensitizes TRAIL-mediated HCC cell apoptosis by DR5 up-regulation via calcium influx-dependent Sp1 activation. Highlights: ► Capsaicin sensitizes TRAIL-induced apoptosis through activation of caspases. ► Capsaicin induces expression of DR5 through Sp1 activation. ► Capsaicin activates calcium signaling pathway.

  9. CYP1B1 Enhances Cell Proliferation and Metastasis through Induction of EMT and Activation of Wnt/β-Catenin Signaling via Sp1 Upregulation.

    PubMed

    Kwon, Yeo-Jung; Baek, Hyoung-Seok; Ye, Dong-Jin; Shin, Sangyun; Kim, Donghak; Chun, Young-Jin

    2016-01-01

    Cytochrome P450 1B1 (CYP1B1) is a major E2 hydroxylase involved in the metabolism of potential carcinogens. CYP1B1 expression has been reported to be higher in tumors compared to normal tissues, especially in hormone-related cancers including breast, ovary, and prostate tumors. To explore the role of CYP1B1 in cancer progression, we investigated the action of CYP1B1 in cells with increased CYP1B1 via the inducer 7,12-dimethylbenz[α]anthracene (DMBA) or an overexpression vector, in addition to decreased CYP1B1 via the inhibitor tetramethoxystilbene (TMS) or siRNA knockdown. We observed that CYP1B1 promoted cell proliferation, migration, and invasion in MCF-7 and MCF-10A cells. To understand its molecular mechanism, we measured key oncogenic proteins including β-catenin, c-Myc, ZEB2, and matrix metalloproteinases following CYP1B1 modulation. CYP1B1 induced epithelial-mesenchymal transition (EMT) and activated Wnt/β-catenin signaling via upregulation of CTNNB1, ZEB2, SNAI1, and TWIST1. Sp1, a transcription factor involved in cell growth and metastasis, was positively regulated by CYP1B1, and suppression of Sp1 expression by siRNA or DNA binding activity using mithramycin A blocked oncogenic transformation by CYP1B1. Therefore, we suggest that Sp1 acts as a key mediator for CYP1B1 action. Treatment with 4-hydroxyestradiol (4-OHE2), a major metabolite generated by CYP1B1, showed similar effects as CYP1B1 overexpression, indicating that CYP1B1 activity mediated various oncogenic events in cells. In conclusion, our data suggests that CYP1B1 promotes cell proliferation and metastasis by inducing EMT and Wnt/β-catenin signaling via Sp1 induction. PMID:26981862

  10. CYP1B1 Enhances Cell Proliferation and Metastasis through Induction of EMT and Activation of Wnt/β-Catenin Signaling via Sp1 Upregulation

    PubMed Central

    Kwon, Yeo-Jung; Baek, Hyoung-Seok; Ye, Dong-Jin; Shin, Sangyun; Kim, Donghak; Chun, Young-Jin

    2016-01-01

    Cytochrome P450 1B1 (CYP1B1) is a major E2 hydroxylase involved in the metabolism of potential carcinogens. CYP1B1 expression has been reported to be higher in tumors compared to normal tissues, especially in hormone-related cancers including breast, ovary, and prostate tumors. To explore the role of CYP1B1 in cancer progression, we investigated the action of CYP1B1 in cells with increased CYP1B1 via the inducer 7,12-dimethylbenz[α]anthracene (DMBA) or an overexpression vector, in addition to decreased CYP1B1 via the inhibitor tetramethoxystilbene (TMS) or siRNA knockdown. We observed that CYP1B1 promoted cell proliferation, migration, and invasion in MCF-7 and MCF-10A cells. To understand its molecular mechanism, we measured key oncogenic proteins including β-catenin, c-Myc, ZEB2, and matrix metalloproteinases following CYP1B1 modulation. CYP1B1 induced epithelial-mesenchymal transition (EMT) and activated Wnt/β-catenin signaling via upregulation of CTNNB1, ZEB2, SNAI1, and TWIST1. Sp1, a transcription factor involved in cell growth and metastasis, was positively regulated by CYP1B1, and suppression of Sp1 expression by siRNA or DNA binding activity using mithramycin A blocked oncogenic transformation by CYP1B1. Therefore, we suggest that Sp1 acts as a key mediator for CYP1B1 action. Treatment with 4-hydroxyestradiol (4-OHE2), a major metabolite generated by CYP1B1, showed similar effects as CYP1B1 overexpression, indicating that CYP1B1 activity mediated various oncogenic events in cells. In conclusion, our data suggests that CYP1B1 promotes cell proliferation and metastasis by inducing EMT and Wnt/β-catenin signaling via Sp1 induction. PMID:26981862

  11. Pretend play.

    PubMed

    Weisberg, Deena Skolnick

    2015-01-01

    Pretend play is a form of playful behavior that involves nonliteral action. Although on the surface this activity appears to be merely for fun, recent research has discovered that children's pretend play has connections to important cognitive and social skills, such as symbolic thinking, theory of mind, and counterfactual reasoning. The current article first defines pretend play and then reviews the arguments and evidence for these three connections. Pretend play has a nonliteral correspondence to reality, hence pretending may provide children with practice with navigating symbolic relationships, which may strengthen their language skills. Pretend play and theory of mind reasoning share a focus on others' mental states in order to correctly interpret their behavior, hence pretending and theory of mind may be mutually supportive in development. Pretend play and counterfactual reasoning both involve representing nonreal states of affairs, hence pretending may facilitate children's counterfactual abilities. These connections make pretend play an important phenomenon in cognitive science: Studying children's pretend play can provide insight into these other abilities and their developmental trajectories, and thereby into human cognitive architecture and its development. PMID:26263228

  12. Sp1 mediates repression of the resistin gene by PPAR{gamma} agonists in 3T3-L1 adipocytes

    SciTech Connect

    Chung, S.S.; Choi, H.H.; Cho, Y.M.; Lee, H.K.; Park, K.S. . E-mail: kspark@snu.ac.kr

    2006-09-15

    Resistin is an adipokine related to obesity and insulin resistance. Expression of the resistin gene is repressed by the treatment of peroxisome proliferator-activated receptor {gamma} (PPAR{gamma}) agonists, thiazolidinediones (TZDs). In this study, we investigated the mechanism by which TZDs inhibit the resistin gene expression. Resistin gene expression was decreased by TZD in fully differentiated 3T3-L1 adipocytes, which was abolished after treatment of cycloheximide (a protein synthesis inhibitor). TZD could not repress the expression of the resistin gene in the presence of mithramycin A (an Sp1 binding inhibitor). Sp1 binding site of the resistin promoter (-122/-114 bp) was necessary for the repression. Further investigation of the effect of TZDs on the modification of Sp1 showed that the level of O-glycosylation of Sp1 was decreased in this process. These results suggest that PPAR{gamma} activation represses the expression of the resistin gene by modulating Sp1 activity.

  13. Complete genome sequence of Kosakonia sacchari type strain SP1T

    PubMed Central

    Chen, Mingyue; Zhu, Bo; Lin, Li; Yang, Litao; Li, Yangrui; An, Qianli

    2014-01-01

    Kosakonia sacchari sp. nov. is a new species within the new genus Kosakonia, which was included in the genus Enterobacter. K sacchari is a nitrogen-fixing bacterium named for its association with sugarcane (Saccharum officinarum L.). K sacchari bacteria are Gram-negative, aerobic, non-spore-forming, motile rods. Strain SP1T (=CGMCC1.12102T=LMG 26783T) is the type strain of the K sacchari sp. nov and is able to colonize and fix N2 in association with sugarcane plants, thus promoting plant growth. Here we summarize the features of strain SP1T and describe its complete genome sequence. The genome contains a single chromosome and no plasmids, 4,902,024 nucleotides with 53.7% GC content, 4,460 protein-coding genes and 105 RNA genes including 22 rRNA genes, 82 tRNA genes, and 1 ncRNA gene. PMID:25197499

  14. Characterization of SP1, a Stress-Responsive, Boiling-Soluble, Homo-Oligomeric Protein from Aspen1

    PubMed Central

    Wang, Wang-Xia; Pelah, Dan; Alergand, Tal; Shoseyov, Oded; Altman, Arie

    2002-01-01

    sp1 cDNA was isolated from aspen (Populus tremula) plants by immunoscreening an expression library using polyclonal antibodies against BspA protein. BspA, which is a boiling-stable protein, accumulates in aspen plants in response to water stress and abscisic acid application (Pelah et al., 1995). The sp1 cDNA was found to encode a 12.4-kD generally hydrophilic protein with a hydrophobic C terminus, which is different from the BspA protein and was termed SP1 (stable protein 1). Northern-blot analysis revealed that sp1 encodes a small mRNA (about 0.6 kb) that is expressed in aspen plants under non-stress conditions and is accumulated after salt, cold, heat, and desiccation stress, and during the recovery from stress. The SP1 detected in plants remained soluble upon boiling, migrated both as a 12.4-kD band and a much higher mass of 116 kD on a 17% (w/v) Tricine-sodium dodecyl sulfate-polyacrylamide gel. Comparative protease digestion patterns, amino acid analyses, and the N-terminal sequences of the 12.4- and 116-kD proteins revealed that SP1 is homo-oligomeric. Furthermore, gel filtration chromatography analysis indicated that SP1 exists in aspen plants as a complex, composed of 12 subunits of 12.4 kD. A large number of sequences deduced from expressed sequence tags and genomic sequences of other organisms with unknown function show high homology to SP1. Thus, SP1 may represent a new protein family. Here, we present the first report on this putative protein family: the cloning, isolation, and characterization of SP1, a stress-responsive, boiling-soluble, oligomeric protein. PMID:12376651

  15. Shadow Play

    ERIC Educational Resources Information Center

    Trundle, Kathy Cabe; Hilson, Margilee P.

    2012-01-01

    A bunny rabbit playfully hops across the wall. Then hands realign and fingers shift to make a hawk soar toward the ceiling. Most children have enjoyed the delightful experience of playing with shadow puppets. The authors build on this natural curiosity to help students link shadows to complex astronomical concepts such as seasons. The…

  16. Risk Factor Analysis in Low-Temperature Geothermal Play Fairway Analysis for the Appalachian Basin (GPFA-AB)

    DOE Data Explorer

    Teresa E. Jordan

    2015-09-30

    This submission contains information used to compute the risk factors for the GPFA-AB project (DE-EE0006726). The risk factors are natural reservoir quality, thermal resource quality, potential for induced seismicity, and utilization. The methods used to combine the risk factors included taking the product, sum, and minimum of the four risk factors. The files are divided into images, rasters, shapefiles, and supporting information. The image files show what the raster and shapefiles should look like. The raster files contain the input risk factors, calculation of the scaled risk factors, and calculation of the combined risk factors. The shapefiles include definition of the fairways, definition of the US Census Places, the center of the raster cells, and locations of industries. Supporting information contains details of the calculations or processing used in generating the files. An image of the raster will have the same name except *.png as the file ending instead of *.tif. Images with “fairways” or “industries” added to the name are composed of a raster with the relevant shapefile added. The file About_GPFA-AB_Phase1RiskAnalysisTask5DataUpload.pdf contains information the citation, special use considerations, authorship, etc. More details on each file are given in the spreadsheet “list_of_contents.csv” in the folder “SupportingInfo”. Code used to calculate values is available at https://github.com/calvinwhealton/geothermal_pfa under the folder “combining_metrics”.

  17. Molecular characterization of alkaline protease of Bacillus amyloliquefaciens SP1 involved in biocontrol of Fusarium oxysporum.

    PubMed

    Guleria, Shiwani; Walia, Abhishek; Chauhan, Anjali; Shirkot, C K

    2016-09-01

    An alkaline protease gene was amplified from genomic DNA of Bacillus amyloliquefaciens SP1 which was involved in effective biocontrol of Fusarium oxysporum. We investigated the antagonistic capacity of protease of B. amyloliquifaciens SP1, under in vitro conditions. The 5.62 fold purified enzyme with specific activity of 607.69U/mg reported 24.14% growth inhibition of F. oxysporum. However, no antagonistic activity was found after addition of protease inhibitor i.e. PMSF (15mM) to purified enzyme. An 1149bp nucleotide sequence of protease gene encoded 382 amino acids of 43kDa and calculated isoelectric point of 9.29. Analysis of deduced amino acid sequence revealed high homology (86%) with subtilisin E of Bacillus subtilis. The B. amyloliquefaciens SP1 protease gene was expressed in Escherichiax coli BL21. The expressed protease was secreted into culture medium by E. coli and exhibited optimum activity at pH8.0 and 60°C. The most reliable three dimensional structure of alkaline protease was determined using Phyre 2 server which was validated on the basis of Ramachandran plot and ERRAT value. The expression and structure prediction of the enzyme offers potential value for commercial application in agriculture and industry. PMID:27294522

  18. Transcriptional Regulation of Oncogenic Protein Kinase Cϵ (PKCϵ) by STAT1 and Sp1 Proteins*

    PubMed Central

    Wang, HongBin; Gutierrez-Uzquiza, Alvaro; Garg, Rachana; Barrio-Real, Laura; Abera, Mahlet B.; Lopez-Haber, Cynthia; Rosemblit, Cinthia; Lu, Huaisheng; Abba, Martin; Kazanietz, Marcelo G.

    2014-01-01

    Overexpression of PKCϵ, a kinase associated with tumor aggressiveness and widely implicated in malignant transformation and metastasis, is a hallmark of multiple cancers, including mammary, prostate, and lung cancer. To characterize the mechanisms that control PKCϵ expression and its up-regulation in cancer, we cloned an ∼1.6-kb promoter segment of the human PKCϵ gene (PRKCE) that displays elevated transcriptional activity in cancer cells. A comprehensive deletional analysis established two regions rich in Sp1 and STAT1 sites located between −777 and −105 bp (region A) and −921 and −796 bp (region B), respectively, as responsible for the high transcriptional activity observed in cancer cells. A more detailed mutagenesis analysis followed by EMSA and ChIP identified Sp1 sites in positions −668/−659 and −269/−247 as well as STAT1 sites in positions −880/−869 and −793/−782 as the elements responsible for elevated promoter activity in breast cancer cells relative to normal mammary epithelial cells. RNAi silencing of Sp1 and STAT1 in breast cancer cells reduced PKCϵ mRNA and protein expression, as well as PRKCE promoter activity. Moreover, a strong correlation was found between PKCϵ and phospho-Ser-727 (active) STAT1 levels in breast cancer cells. Our results may have significant implications for the development of approaches to target PKCϵ and its effectors in cancer therapeutics. PMID:24825907

  19. Transdiagnostic factors across fibromyalgia and mental disorders: sleep disturbances may play a key role. A clinical review.

    PubMed

    Palagini, Laura; Carmassi, Claudia; Conversano, Ciro; Gesi, Camilla; Bazzichi, Laura; Giacomelli, Camillo; Dell'Osso, Liliana

    2016-01-01

    Sleep disturbances, affective disorders, pain and fatigue are often present in individuals affected by fibromyalgia (FM). The pathophysiology of FM is not yet well understood and, to date, no treatment has been proven to be fully effective in alleviating all symptoms. Adopting a transdiagnostic perspective could thus be useful for clinicians: treatment would target a transdiagnostic process across a range of disturbances, not just a single disorder. The aim of this review is to revise the available literature about the potential role of sleep disturbances as a transdiagnostic process in FM symptomatology and mood or anxiety disorders comorbidity. We are proposing a model under which sleep disturbances can play a central role. Because conditions of sleep loss are related to the activation of the stress system, including the activation of the inflammation system, we propose this mechanism as a key one: it can be shared by mental, sleep disturbances and pain in FM and it may explain, in part, the high levels of comorbidity between them. In this frame-work sleep disturbances may play a key role and be the target of therapeutic strategies across FM symptomatology and mental disorders. PMID:27157399

  20. Integrated high-throughput analysis identifies Sp1 as a crucial determinant of p53-mediated apoptosis

    PubMed Central

    Li, H; Zhang, Y; Ströse, A; Tedesco, D; Gurova, K; Selivanova, G

    2014-01-01

    The restoration of p53 tumor suppressor function is a promising therapeutic strategy to combat cancer. However, the biological outcomes of p53 activation, ranging from the promotion of growth arrest to the induction of cell death, are hard to predict, which limits the clinical application of p53-based therapies. In the present study, we performed an integrated analysis of genome-wide short hairpin RNA screen and gene expression data and uncovered a previously unrecognized role of Sp1 as a central modulator of the transcriptional response induced by p53 that leads to robust induction of apoptosis. Sp1 is indispensable for the pro-apoptotic transcriptional repression by p53, but not for the induction of pro-apoptotic genes. Furthermore, the p53-dependent pro-apoptotic transcriptional repression required the co-binding of Sp1 to p53 target genes. Our results also highlight that Sp1 shares with p53 a common regulator, MDM2, which targets Sp1 for proteasomal degradation. This uncovers a new mechanism of the tight control of apoptosis in cells. Our study advances the understanding of the molecular basis of p53-mediated apoptosis and implicates Sp1 as one of its key modulators. We found that small molecules reactivating p53 can differentially modulate Sp1, thus providing insights into how to manipulate p53 response in a controlled way. PMID:24971482

  1. Overexpression of HDAC1 induces cellular senescence by Sp1/PP2A/pRb pathway

    SciTech Connect

    Chuang, Jian-Ying; Hung, Jan-Jong

    2011-04-15

    Highlights: {yields} Overexpression of HDAC1 induces Sp1 deacetylation and raises Sp1/p300 complex formation to bind to PP2Ac promoter. {yields} Overexpression of HDAC1 strongly inhibits the phosphorylation of pRb through up-regulation of PP2A. {yields} Overexpressed HDAC1 restrains cell proliferaction and induces cell senescence though a novel Sp1/PP2A/pRb pathway. -- Abstract: Senescence is associated with decreased activities of DNA replication, protein synthesis, and cellular division, which can result in deterioration of cellular functions. Herein, we report that the growth and division of tumor cells were significantly repressed by overexpression of histone deacetylase (HDAC) 1 with the Tet-off induced system or transient transfection. In addition, HDAC1 overexpression led to senescence through both an accumulation of hypophosphorylated active retinoblastoma protein (pRb) and an increase in the protein level of protein phosphatase 2A catalytic subunit (PP2Ac). HDAC1 overexpression also increased the level of Sp1 deacetylation and elevated the interaction between Sp1 and p300, and subsequently that Sp1/p300 complex bound to the promoter of PP2Ac, thus leading to induction of PP2Ac expression. Similar results were obtained in the HDAC1-Tet-off stable clone. Taken together, these results indicate that HDAC1 overexpression restrained cell proliferation and induced premature senescence in cervical cancer cells through a novel Sp1/PP2A/pRb pathway.

  2. The Role Played by the Interaction between Genetic Factors and Attachment in the Stress Response in Infancy

    ERIC Educational Resources Information Center

    Frigerio, Alessandra; Ceppi, Elisa; Rusconi, Marianna; Giorda, Roberto; Raggi, Maria Elisabetta; Fearon, Pasco

    2009-01-01

    Background: The importance of understanding which environmental and biological factors are involved in determining individual differences in physiological response to stress is widely recognized, given the impact that stress has on physical and mental health. Methods: The child-mother attachment relationship and some genetic polymorphisms…

  3. Draft genome sequence of Sphingomonas paucimobilis strain LCT-SP1 isolated from the Shenzhou X spacecraft of China.

    PubMed

    Pan, Lei; Zhou, Hong; Li, Jia; Huang, Bing; Guo, Jun; Zhang, Xue-Lin; Gao, Long-Cheng; Xu, Chou; Liu, Chang-Ting

    2016-01-01

    Sphingomonas paucimobilis strain LCT-SP1 is a glucose-nonfermenting Gram-negative, chemoheterotrophic, strictly aerobic bacterium. The major feature of strain LCT-SP1, isolated from the Chinese spacecraft Shenzhou X, together with the genome draft and annotation are described in this paper. The total size of strain LCT-SP1 is 4,302,226 bp with 3,864 protein-coding and 50 RNA genes. The information gained from its sequence is potentially relevant to the elucidation of microbially mediated corrosion of various materials. PMID:26918090

  4. Influenza A induces the major secreted airway mucin MUC5AC in a protease-EGFR-extracellular regulated kinase-Sp1-dependent pathway.

    PubMed

    Barbier, Diane; Garcia-Verdugo, Ignacio; Pothlichet, Julien; Khazen, Roxana; Descamps, Delphyne; Rousseau, Karine; Thornton, David; Si-Tahar, Mustapha; Touqui, Lhousseine; Chignard, Michel; Sallenave, Jean-Michel

    2012-08-01

    Mucins, the main glycoproteins present within mucus, modulate the rheologic properties of airways and participate in lung defense. They are thought to be able to trap and eliminate microorganisms from the lung. Among the mucins secreted in the lung, MUC5AC is the most prominent factor secreted by surface epithelial cells. Although much is known about the signaling pathways involved in the regulation of MUC5AC by host factors such as cytokines or proteases, less is known about the pathways triggered by microorganisms and, specifically, by influenza A virus (IAV). We therefore set up experiments to dissect the molecular mechanisms responsible for the potential modulation of MUC5AC by IAV. Using epithelial cells, C57/Bl6 mice, and IAV strains, we measured MUC5AC expression at the RNA and protein levels, specificity protein 1 (Sp1) activation, and protease activity. Intermediate molecular partners were confirmed using pharmacological inhibitors, blocking antibodies, and small interfering (si)RNAs. We showed in vitro and in vivo that IAV up-regulates epithelial cell-derived MUC5AC and Muc5ac expression in mice, both at transcriptional (through the induction of Sp1) and translational levels. In addition, we determined that this induction was dependent on a protease-epithelial growth factor receptor-extracellular regulated kinase-Sp1 signaling cascade, involving in particular the human airway trypsin. Our data point to MUC5AC as a potential modulatory mechanism by which the lung epithelia respond to IAV infection, and we dissect, for the first time to the best of our knowledge, the molecular partners involved. Future experiments using MUC5AC-targeted strategies should help further unravel the pathophysiological consequences of IAV-induced MUC5AC expression for lung homeostasis. PMID:22383584

  5. c-ETS transcription factors play an essential role in the licensing of human MCM4 origin of replication.

    PubMed

    Sidhu, Kaveri; Kumar, Vijay

    2015-11-01

    In metazoans, DNA replication is a highly regulated and ordered process that occurs during the S phase of cell cycle. It begins with the licensing of origins of replication usually found in close proximity of actively transcribing genes owing perhaps to a profound influence of transcription factors on the epigenetic signatures and architecture of chromatin. Here we show that ETS transcription factors are novel regulators of MCM4 origin, whose binding sites are localized between two divergently transcribing MCM4 and PRKDC genes. c-ETS1 and c-ETS2 were recruited to the MCM4 origin respectively during the S and G1 phases of cell cycle. c-ETS2 binding was facilitated by an active chromatin distinguished by acetylated histone H3 orchestrated by histone acetyl transferase GCN5 and followed by HBO1 mediated histone H4 acetylation. Interestingly, c-ETS2 overexpression led to increased BrdU incorporation in the S phase cells while its down-regulation by RNA interference compromised the loading of pre-replicative complex at the origin. Conversely, the recruitment of c-ETS1 at the origin coincided with histone H3 methylation signature characteristic of closed chromatin conformation. As expected, enforced expression of c-ETS1 severely compromised DNA replication whereas its down-regulation enhanced DNA replication as evident from increased BrdU incorporation. Thus, c-ETS transcription factors appear to be key regulators of MCM4 origin where c-ETS2 seems to promote DNA replication whereas c-ETS1 functions as a negative regulator. PMID:26365772

  6. Inheritance and memory of stress-induced epigenome change: roles played by the ATF-2 family of transcription factors

    PubMed Central

    Seong, Ki-Hyeon; Maekawa, Toshio; Ishii, Shunsuke

    2012-01-01

    Data on the inheritance-of-stress effect have been accumulating and some mechanistic insights, such as epigenetic regulation, have also been suggested. In particular, the modern view of Lamarckian inheritance appears to be affected by the finding that stress-induced epigenetic changes can be inherited. This review summarizes the current data on the inheritance of stress effect and possible mechanisms involved in this process. In particular, we focus on the stress-induced epigenetic changes mediated by the ATF-2 family of transcription factors. PMID:22380515

  7. Hypoxia-inducible factor-1 plays a role in phosphate-induced vascular smooth muscle cell calcification.

    PubMed

    Mokas, Sophie; Larivière, Richard; Lamalice, Laurent; Gobeil, Stéphane; Cornfield, David N; Agharazii, Mohsen; Richard, Darren E

    2016-09-01

    Medial vascular calcification is a common complication of chronic kidney disease (CKD). Although elevated inorganic phosphate stimulates vascular smooth muscle cell (VSMC) osteogenic transdifferentiation and calcification, the mechanisms involved in their calcification during CKD are not fully defined. Because hypoxic gene activation is linked to CKD and stimulates bone cell osteogenic differentiation, we used in vivo and in vitro rodent models to define the role of hypoxic signaling during elevated inorganic phosphate-induced VSMC calcification. Cell mineralization studies showed that elevated inorganic phosphate rapidly induced VSMC calcification. Hypoxia strongly enhanced elevated inorganic phosphate-induced VSMC calcification and osteogenic transdifferentiation, as seen by osteogenic marker expression. Hypoxia-inducible factor-1 (HIF-1), the key hypoxic transcription factor, was essential for enhanced VSMC calcification. Targeting HIF-1 expression in murine VSMC blocked calcification in hypoxia with elevated inorganic phosphate while HIF-1 activators, including clinically used FG-4592/Roxadustat, recreated a procalcifying environment. Elevated inorganic phosphate rapidly activated HIF-1, even in normal oxygenation; an effect mediated by HIF-1α subunit stabilization. Thus, hypoxia synergizes with elevated inorganic phosphate to enhance VSMC osteogenic transdifferentiation. Our work identifies HIF-1 as an early CKD-related pathological event, prospective marker, and potential target against vascular calcification in CKD-relevant conditions. PMID:27470678

  8. Hypoxia-inducible factorplays a critical role in the formation of alveoli and surfactant.

    PubMed

    Huang, Yadi; Kempen, Marjon Buscop-van; Munck, Anne Boerema-de; Swagemakers, Sigrid; Driegen, Siska; Mahavadi, Poornima; Meijer, Dies; van Ijcken, Wilfred; van der Spek, Peter; Grosveld, Frank; Günther, Andreas; Tibboel, Dick; Rottier, Robbert J

    2012-02-01

    Alveolarization of the developing lung is an important step toward the switch from intrauterine life to breathing oxygen-rich air after birth. The distal airways structurally change to minimize the gas exchange path, and Type II pneumocytes increase the production of surfactants, which are required to reduce surface tension at the air-liquid interface in the alveolus. Hypoxia-inducible factor 2α (Hif2α) is an oxygen-regulated transcription factor expressed in endothelial and Type II cells, and its expression increases toward the end of gestation. We investigated the role of Hif2α in Type II cells by conditionally expressing an oxygen-insensitive mutant of Hif2α in airway epithelial cells during development. Newborn mice expressing the mutant Hif2α were born alive but quickly succumbed to respiratory distress. Subsequent analysis of the lungs revealed dilated alveoli covered with enlarged, aberrant Type II cells and a diminished number of Type I cells. The Type II cells accumulated glycogen in part by increased glucose uptake via the up-regulation of the glucose transporter 1. Furthermore, the cells lacked two crucial enzymes involved in the metabolism of glycogen into surfactant lipids, lysophosphatidylcholine acyltransferase and ATP-binding cassette sub-family A member 3. We conclude that Hif2α is a key regulator in alveolar maturation and the production of phospholipids by Type II cells. PMID:22298531

  9. Play and Positive Group Dynamics

    ERIC Educational Resources Information Center

    Thompson, Pam; White, Samantha

    2010-01-01

    Play is an important part of a child's life and essential to learning and development (Vygotsky, 1978). It is vital that students participate in play and that play be conducted in a restorative manner. Play allows a variety of group dynamics to emerge. Irvin Yalom (1995) identifies 11 curative factors of the group experience. These factors include…

  10. Spatial Factors Play a Major Role as Determinants of Endemic Ground Beetle Beta Diversity of Madeira Island Laurisilva

    PubMed Central

    Boieiro, Mário; Carvalho, José C.; Cardoso, Pedro; Aguiar, Carlos A. S.; Rego, Carla; de Faria e Silva, Israel; Amorim, Isabel R.; Pereira, Fernando; Azevedo, Eduardo B.; Borges, Paulo A. V.; Serrano, Artur R. M.

    2013-01-01

    The development in recent years of new beta diversity analytical approaches highlighted valuable information on the different processes structuring ecological communities. A crucial development for the understanding of beta diversity patterns was also its differentiation in two components: species turnover and richness differences. In this study, we evaluate beta diversity patterns of ground beetles from 26 sites in Madeira Island distributed throughout Laurisilva – a relict forest restricted to the Macaronesian archipelagos. We assess how the two components of ground beetle beta diversity (βrepl – species turnover and βrich - species richness differences) relate with differences in climate, geography, landscape composition matrix, woody plant species richness and soil characteristics and the relative importance of the effects of these variables at different spatial scales. We sampled 1025 specimens from 31 species, most of which are endemic to Madeira Island. A spatially explicit analysis was used to evaluate the contribution of pure environmental, pure spatial and environmental spatially structured effects on variation in ground beetle species richness and composition. Variation partitioning showed that 31.9% of species turnover (βrepl) and 40.7% of species richness variation (βrich) could be explained by the environmental and spatial variables. However, different environmental variables controlled the two types of beta diversity: βrepl was influenced by climate, disturbance and soil organic matter content whilst βrich was controlled by altitude and slope. Furthermore, spatial variables, represented through Moran’s eigenvector maps, played a significant role in explaining both βrepl and βrich, suggesting that both dispersal ability and Madeira Island complex orography are crucial for the understanding of beta diversity patterns in this group of beetles. PMID:23724065

  11. Playing Teacher.

    ERIC Educational Resources Information Center

    Gilbert, Juan E.

    The acceptance of animation technologies is increasing. Video games, such as Sony PlayStation (SONY, 2002), have become part of the culture for young people from kindergarten through undergraduate school. Animation technologies have been implemented into educational systems in the form of animated pedagogical agents (Johnson, 2000). The research…

  12. Clay Play

    ERIC Educational Resources Information Center

    Rogers, Liz; Steffan, Dana

    2009-01-01

    This article describes how to use clay as a potential material for young children to explore. As teachers, the authors find that their dialogue about the potential of clay as a learning medium raises many questions: (1) What makes clay so enticing? (2) Why are teachers noticing different play and conversation around the clay table as compared to…

  13. Game playing.

    PubMed

    Rosin, Christopher D

    2014-03-01

    Game playing has been a core domain of artificial intelligence research since the beginnings of the field. Game playing provides clearly defined arenas within which computational approaches can be readily compared to human expertise through head-to-head competition and other benchmarks. Game playing research has identified several simple core algorithms that provide successful foundations, with development focused on the challenges of defeating human experts in specific games. Key developments include minimax search in chess, machine learning from self-play in backgammon, and Monte Carlo tree search in Go. These approaches have generalized successfully to additional games. While computers have surpassed human expertise in a wide variety of games, open challenges remain and research focuses on identifying and developing new successful algorithmic foundations. WIREs Cogn Sci 2014, 5:193-205. doi: 10.1002/wcs.1278 CONFLICT OF INTEREST: The author has declared no conflicts of interest for this article. For further resources related to this article, please visit the WIREs website. PMID:26304308

  14. Sweet Play

    ERIC Educational Resources Information Center

    Leung, Shuk-kwan S.; Lo, Jane-Jane

    2010-01-01

    This article features Sweet play math, a "math by the month" activity that involves decorating and making sugar cubes. Teachers may want to substitute straws, paper squares, alphabet blocks, or such commercially made manipulatives as Unifix[R] cubes for the real sweets. Given no allergy concerns, teachers and students alike would enjoy some sweet…

  15. Cardiovascular risk in lupus nephritis: Do renal disease-related and other traditional risk factors play a role?

    PubMed

    Atukorala, Inoshi; Weeratunga, Praveen; Kalubowila, Janaka; Ranasinghe, Hasanthika; Gunawardena, Nalika; Lanerolle, Rushika; Rathnamalala, Nadeeka

    2015-01-01

    This study was performed to evaluate the prevalence of thickened carotid intima media thickness (CIMT) in a Sri Lankan cohort of lupus nephritis (LN) patients and to identify associations between traditional cardiovascular disease (CVD) and LN-related risk factors with increased CIMT. Consecutive patients with biopsy-proven LN were evaluated for conventional CVD risk factors, renal parameters and extent of organ involvement in this cross-sectional study. Current disease activity and damage were assessed by the British Isles Lupus Activity Group (BILAG) score and the Systemic Lupus International Collaborative Clinics/American College of Rheumatology (SLICC/ACR) damage index, respectively. CIMT was assessed by B Mode grey scale ultrasonography. Increased CIMT was defined as CIMT more than the 75th percentile based on cutoffs from the "Carotid Atherosclerosis Progression Study." Forty patients (98% female), with a mean age of 38 years (age range of 20-50) and of South Asian descent, were evaluated. The mean duration of disease of 6.15 years (SD = 4.66). The overall prevalence of cardiovascular events was low and included previous acute coronary syndromes in 7.5%, stable angina in 5%, cerebrovascular accidents in 7.5% and transient ischemic attacks in 2.5% of the patients; 72.5% had hypertension (HTN) [mean blood pressure (BP) 140/80 mm Hg]; 32.5% had dyslipidemias (mean serum cholesterol 5.9; SD = 5.6) and 25% had diabetes (mean blood sugar 103.7; SD = 15.6). Forty percent were obese and 20% were overweight (Asian cutoffs). Increased CIMT (57.5%) and atherosclerotic plaques (15.36%) indicated a high CVD risk in this cohort. Diabetes (P = 0.016), HTN (P = 0.002), dyslipidemia (P = 0.002) and obesity (P = 0.048) were associated with thickened CIMT. The only LN-related risk factor associated with thickened CIMT (P <0.05) was the SLICC/ACR damage index. The independent predictors of thickened CIMT determined by logistic regression analysis were HTN and dyslipidemia. PMID

  16. Characterization of a family of cysteine rich proteins and development of a MaSp1 derived miniature fibroin

    NASA Astrophysics Data System (ADS)

    Chuang, Tyler Casey

    Spider silk displays a unique balance of high tensile strength and extensibility, making it one of the toughest materials on the planet. Dragline silk, also known as the lifeline of the spider, represents one of the best studied fiber types and many labs are attempting to produce synthetic dragline silk fibers for commercial applications. In these studies, we develop a minifibroin for expression studies in bacteria. Using recombinant DNA methodology and protein expression studies, we develop a natural minifibroin that contains the highly conserved N- and C-terminal domains, along with several internal block repeats of MaSp1. We also characterize a family of small cysteine-rich proteins (CRPs) and demonstrate that these factors are present within the spinning dope of the major ampullate gland using MS analysis. Biochemical studies and characterization of one of the family members, CRP1, demonstrate that this factor can self-polymerize into higher molecular weight complexes under oxidizing conditions, but can be converted into a monomeric species under reducing conditions. Self-polymerization of CRP1 is also shown to be independent of pH and salt concentration, two important chemical cues that help fibroin aggregation. Overall, our data demonstrate that the polymerization state of CRP1 is dependent upon redox state, suggesting that the redox environment during fiber extrusion may help regulate the oligomerization of CRP molecules during dragline silk production.

  17. [Probiotic features of carotene producing strains Bacillus sp. 1.1 and B. amyloliquefaciens UCM B-5113].

    PubMed

    Avdeeva, L V; Nechypurenko, O O; Kharhota, M A

    2015-01-01

    Researched probiotic properties of carotinproducing strains Bacillus sp. 1.1 and B. amyloliquefaciens UCM B-5113. It was established that Bacillus sp. 1.1 characterized by high and middle antagonistic activity against museums and actual test cultures and B. amyloliquefaciens UCM B-5113 shown middle and low activity. They grew up and formed a pigment at pH 6.0 in the presence of 0.4% bile. Bacillus sp. 1.1 and B. amyloliquefaciens UCM B-5113 were avirulent, had low antagonistic activity and characterized by susceptibility to antimicrobial agents, excluding colistin. The results suggested the possibility to create based on Bacillus sp. 1.1 and B. amyloliquefaciens UCM B-5113 probiotic preparation. PMID:26036029

  18. Propensity for HBZ-SP1 isoform of HTLV-I to inhibit c-Jun activity correlates with sequestration of c-Jun into nuclear bodies rather than inhibition of its DNA-binding activity

    SciTech Connect

    Clerc, Isabelle; Hivin, Patrick; Rubbo, Pierre-Alain; Lemasson, Isabelle; Barbeau, Benoit; Mesnard, Jean-Michel

    2009-09-01

    HTLV-I bZIP factor (HBZ) contains a C-terminal zipper domain involved in its interaction with c-Jun. This interaction leads to a reduction of c-Jun DNA-binding activity and prevents the protein from activating transcription of AP-1-dependent promoters. However, it remained unclear whether the negative effect of HBZ-SP1 was due to its weak DNA-binding activity or to its capacity to target cellular factors to transcriptionally-inactive nuclear bodies. To answer this question, we produced a mutant in which specific residues present in the modulatory and DNA-binding domain of HBZ-SP1 were substituted for the corresponding c-Fos amino acids to improve the DNA-binding activity of the c-Jun/HBZ-SP1 heterodimer. The stability of the mutant, its interaction with c-Jun, DNA-binding activity of the resulting heterodimer, and its effect on the c-Jun activity were tested. In conclusion, we demonstrate that the repression of c-Jun activity in vivo is mainly due to the HBZ-SP1-mediated sequestration of c-Jun to the HBZ-NBs.

  19. Proto-oncogene FBI-1 represses transcription of p21CIP1 by inhibition of transcription activation by p53 and Sp1.

    PubMed

    Choi, Won-Il; Jeon, Bu-Nam; Yun, Chae-Ok; Kim, Pyung-Hwan; Kim, Sung-Eun; Choi, Kang-Yell; Kim, Se Hoon; Hur, Man-Wook

    2009-05-01

    Aberrant transcriptional repression through chromatin remodeling and histone deacetylation has been postulated as the driving force for tumorigenesis. FBI-1 (formerly called Pokemon) is a member of the POK family of transcriptional repressors. Recently, FBI-1 was characterized as a critical oncogenic factor that specifically represses transcription of the tumor suppressor gene ARF, potentially leading indirectly to p53 inactivation. Our investigations on transcriptional repression of the p53 pathway revealed that FBI-1 represses transcription of ARF, Hdm2 (human analogue of mouse double minute oncogene), and p21CIP1 (hereafter indicated as p21) but not of p53. FBI-1 showed a more potent repressive effect on p21 than on p53. Our data suggested that FBI-1 is a master controller of the ARF-Hdm2-p53-p21 pathway, ultimately impinging on cell cycle arrest factor p21, by inhibiting upstream regulators at the transcriptional and protein levels. FBI-1 acted as a competitive transcriptional repressor of p53 and Sp1 and was shown to bind the proximal Sp1-3 GC-box and the distal p53-responsive elements of p21. Repression involved direct binding competition of FBI-1 with Sp1 and p53. FBI-1 also interacted with corepressors, such as mSin3A, NCoR, and SMRT, thereby deacetylating Ac-H3 and Ac-H4 histones at the promoter. FBI-1 caused cellular transformation, promoted cell cycle proliferation, and significantly increased the number of cells in S phase. FBI-1 is aberrantly overexpressed in many human solid tumors, particularly in adenocarcinomas and squamous carcinomas. The role of FBI-1 as a master controller of the p53 pathway therefore makes it an attractive therapeutic target. PMID:19244234

  20. Proto-oncogene FBI-1 Represses Transcription of p21CIP1 by Inhibition of Transcription Activation by p53 and Sp1*S⃞

    PubMed Central

    Choi, Won-Il; Jeon, Bu-Nam; Yun, Chae-Ok; Kim, Pyung-Hwan; Kim, Sung-Eun; Choi, Kang-Yell; Kim, Se Hoon; Hur, Man-Wook

    2009-01-01

    Aberrant transcriptional repression through chromatin remodeling and histone deacetylation has been postulated as the driving force for tumorigenesis. FBI-1 (formerly called Pokemon) is a member of the POK family of transcriptional repressors. Recently, FBI-1 was characterized as a critical oncogenic factor that specifically represses transcription of the tumor suppressor gene ARF, potentially leading indirectly to p53 inactivation. Our investigations on transcriptional repression of the p53 pathway revealed that FBI-1 represses transcription of ARF, Hdm2 (human analogue of mouse double minute oncogene), and p21CIP1 (hereafter indicated as p21) but not of p53. FBI-1 showed a more potent repressive effect on p21 than on p53. Our data suggested that FBI-1 is a master controller of the ARF-Hdm2-p53-p21 pathway, ultimately impinging on cell cycle arrest factor p21, by inhibiting upstream regulators at the transcriptional and protein levels. FBI-1 acted as a competitive transcriptional repressor of p53 and Sp1 and was shown to bind the proximal Sp1–3 GC-box and the distal p53-responsive elements of p21. Repression involved direct binding competition of FBI-1 with Sp1 and p53. FBI-1 also interacted with corepressors, such as mSin3A, NCoR, and SMRT, thereby deacetylating Ac-H3 and Ac-H4 histones at the promoter. FBI-1 caused cellular transformation, promoted cell cycle proliferation, and significantly increased the number of cells in S phase. FBI-1 is aberrantly overexpressed in many human solid tumors, particularly in adenocarcinomas and squamous carcinomas. The role of FBI-1 as a master controller of the p53 pathway therefore makes it an attractive therapeutic target. PMID:19244234

  1. Sp1 Sites in the Noncoding Control Region of BK Polyomavirus Are Key Regulators of Bidirectional Viral Early and Late Gene Expression

    PubMed Central

    Bethge, Tobias; Hachemi, Helen A.; Manzetti, Julia; Gosert, Rainer; Schaffner, Walter

    2015-01-01

    ABSTRACT In kidney transplant patients with BK polyomavirus (BKPyV) nephropathy, viral variants arise bearing rearranged noncoding control regions (rr-NCCRs) that increase viral early gene expression, replicative fitness, and cytopathology. rr-NCCRs result from various deletions and duplications of archetype NCCR (ww-NCCR) sequences, which alter transcription factor binding sites (TFBS). However, the role of specific TFBS is unclear. We inactivated 28 TFBS in the archetype NCCR by selective point mutations and examined viral gene expression in bidirectional reporter constructs. Compared to the archetype, group 1 mutations increased viral early gene expression similar to rr-NCCR and resulted from inactivating one Sp1 or one Ets1 TFBS near the late transcription start site (TSS). Group 2 mutations conferred intermediate early gene activation and affected NF1, YY1, and p53 sites between early and late TSS. Group 3 mutations decreased early and late gene expression and included two other Sp1 sites near the early TSS. Recombinant viruses bearing group 1 NCCRs showed increased replication in human renal epithelial cells similar to clinical rr-NCCR variants. Group 2 and 3 viruses showed intermediate or no replication, respectively. A literature search revealed unnoticed group 1 mutations in BKPyV nephropathy, hemorrhagic cystitis, and disseminated disease. IMPORTANCE The NCCRs of polyomaviruses mediate silent persistence of the viral genome as well as the appropriately timed (re)activation of the viral life cycle. This study indicates that the basal BKPyV NCCR is critically controlled by a hierarchy of single TFBS in the archetype NCCR that direct, modulate, and execute the bidirectional early and late viral gene expression. The results provide new insights into how BKPyV NCCR functions as a viral sensor of host cell signals and shed new light on how transcription factors like Sp1 control bidirectional viral gene expression and contribute to replication and pathology

  2. The NF-M transcription factor is related to C/EBP beta and plays a role in signal transduction, differentiation and leukemogenesis of avian myelomonocytic cells.

    PubMed

    Katz, S; Kowenz-Leutz, E; Müller, C; Meese, K; Ness, S A; Leutz, A

    1993-04-01

    Retroviral oncogenes encode nuclear regulators of gene expression or signal transduction molecules, such as protein kinases, which stimulate the activity of cellular transcription factors. Here we describe the cloning of NF-M, a myeloid-specific transcription factor related to C/EBP beta, which is a target of activated protein kinases. NF-M stimulates the expression of the gene encoding cMGF, a myeloid cell-specific growth factor, creating an autocrine growth loop crucial to oncogene transformation of myeloid cells. The NF-M protein bound directly to the cMGF gene promoter and activated its transcription, even in erythroid cells where the promoter is usually inactive. In addition, a truncated, dominant-negative form of NF-M inhibited cMGF expression in macrophages, indicating that NF-M is required for the normal activation of the gene. When multipotent hematopoietic progenitor cells were stimulated to differentiate, NF-M expression was induced at a very early stage, suggesting that the transcription factor plays a role in lineage commitment. The stimulation of transformed myelomonocytic cells or of normal peripheral blood macrophages with kinases or LPS or TPA respectively, led to the rapid redistribution of NF-M protein from the cell bodies to the nucleus, consistent with the notion that NF-M was directly affected by such treatments. Our data indicate that NF-M plays a key role in myelomonocytic differentiation, in signal transduction during macrophage activation and in the development of myelogenous leukemia. PMID:8467792

  3. What factors play a role in preventing self-immolation? Results from a case-control study in Iran

    PubMed Central

    Karim, Hosein; Schwebel, David C.; Bazargan-Hejazi, Shahrzad; Mohammadi, Reza; Choubsaz, Mansour; Heidari Zadie, Zahra; Ahmadi, Alireza

    2015-01-01

    Abstract: Background: To investigate factors related to prevention of self-immolation in west of Iran. Methods: In a case-control study, 30 consecutive cases of deliberate self-inflicted burns admitted to the regional burn center (Imam Khomeini hospital in Kermanshah province, Iran) were compared with controls selected from the community and matched by sex, age, district-county of residence, and rural vs urban living environment. The following characteristics relevant to preventing self-immolation were collected from all cases and controls: main domestic fuel used in the household, awareness about complications of burn injuries, and use of counseling services. Results: Descriptive analyses revealed that kerosene was the main domestic fuel in the household for 83% of cases. Not surprisingly, the main means of self-immolation in 93% of the patients was kerosene, with other fuels such as petrol and domestic gas used in remaining cases. The majority of cases and controls were aware of the potential complications of burn injuries. Use of counseling services was more common in controls. Conclusions: All three aspects of preventing self-immolation – having kerosene and other fuels in the home, being aware of the complications of burn injuries, and using counseling services were present in both the cases and controls. This suggests a large portion of residents in rural Iran are potential self-immolation victims. Increasing preventive strategies may reduce risk of suicide by self-immolation. PMID:26081518

  4. The study of capacity fading processes of Li-ion batteries: major factors that play a role

    NASA Astrophysics Data System (ADS)

    Markovsky, B.; Rodkin, A.; Cohen, Y. S.; Palchik, O.; Levi, E.; Aurbach, D.; Kim, H.-J.; Schmidt, M.

    In this work, we studied the impact of some factors on the behavior of practical electrodes of Li-ion batteries. These included elevated temperatures (45-80 °C), prolonged storage of Li-ion cells, and additives in the electrolyte solution. The Li-ion battery systems studied included negative electrodes (anodes) comprising of mesocarbon microbeads (MCMB) and mesocarbon fibers (MCF), and Li xCoO 2 positive electrodes (cathodes) in an ethylene carbonate (EC)/ethyl-methyl carbonate (EMC) (1:2)/LiPF 6 1 M solution. Vinylene carbonate (VC) and a Li-organo-borate complex (Li-OBC) were tested as additives. It is shown that the electrochemical response of Li-C negative electrodes depends on the structure of the surface films controlling their behavior, which change upon storage, temperature, and cycling. We established that impedance of these electrodes increased with storage time due to the enrichment of the surface films by LiF and other fluorine-containing species. The capacity fading of the Li xCoO 2 electrodes in cycling/storage processes at elevated temperatures relates mostly to surface phenomena, whereas the bulk structural characteristics of the electrodes do not change.

  5. Nerve growth factor induces facial heat hyperalgesia and plays a role in trigeminal neuropathic pain in rats.

    PubMed

    Dos Reis, Renata C; Kopruszinski, Caroline M; Nones, Carina F M; Chichorro, Juliana G

    2016-09-01

    There is preclinical evidence that nerve growth factor (NGF) contributes toward inflammatory hyperalgesia in the orofacial region, but the mechanisms underlying its hyperalgesic effect as well as its role in trigeminal neuropathic pain require further investigation. This study investigated the ability of NGF to induce facial heat hyperalgesia and the involvement of tyrosine kinase receptor A, transient receptor potential vanilloid 1, and mast cells in NGF pronociceptive effects. In addition, the role of NGF in heat hyperalgesia in a model of trigeminal neuropathic pain was evaluated. NGF injection into the upper lip of naive rats induced long-lasting heat hyperalgesia. Pretreatment with an antibody anti-NGF, antagonists of tyrosine kinase receptor A, and transient receptor potential vanilloid 1 receptors or compound 48/80, to induce mast-cell degranulation, all attenuated NGF-induced hyperalgesia. In a rat model of trigeminal neuropathic pain, local treatment with anti-NGF significantly reduced heat hyperalgesia. In addition, increased NGF levels were detected in the ipsilateral infraorbital nerve branch at the time point that represents the peak of heat hyperalgesia. The results suggest that NGF is a prominent hyperalgesic mediator in the trigeminal system and it may represent a potential therapeutic target for the management of painful orofacial conditions, including trigeminal neuropathic pain. PMID:27392124

  6. The Sigma Factor AlgU Plays a Key Role in Formation of Robust Biofilms by Nonmucoid Pseudomonas aeruginosa▿

    PubMed Central

    Bazire, Alexis; Shioya, Kouki; Soum-Soutéra, Emmanuelle; Bouffartigues, Emeline; Ryder, Cynthia; Guentas-Dombrowsky, Linda; Hémery, Gaëlle; Linossier, Isabelle; Chevalier, Sylvie; Wozniak, Daniel J.; Lesouhaitier, Olivier; Dufour, Alain

    2010-01-01

    The extracytoplasmic function sigma factor AlgU of Pseudomonas aeruginosa is responsible for alginate overproduction, leading to mucoidy and chronic infections of cystic fibrosis patients. We investigated here the role of AlgU in the formation of nonmucoid biofilms. The algU mutant of P. aeruginosa PAO1 (PAOU) showed a dramatic impairment in biofilm formation under dynamic conditions. PAOU was defective both in cell attachment to glass and in development of robust, shear-resistant biofilms. This was explained by an impaired production of extracellular matrix, specifically of the exopolysaccharide Psl, as revealed by microscopy and enzyme-linked immunosorbent assay. Complementing the algU mutation with a plasmid-borne algU gene restored wild-type phenotypes. Compared with that in PAO1, expression of the psl operon was reduced in the PAOU strain, and the biofilm formation ability of this strain was partially restored by inducing the transcription of the psl operon. Furthermore, expression of the lectin-encoding lecA and lecB genes was reduced in the PAOU strain. In agreement with the requirement of LecB for type IV pilus biogenesis, PAOU displayed impaired twitching motility. Collectively, these genetic downregulation events explain the biofilm formation defect of the PAOU mutant. Promoter mapping indicated that AlgU is probably not directly responsible for transcription of the psl operon and the lec genes, but AlgU is involved in the expression of the ppyR gene, whose product was reported to positively control psl expression. Expressing the ppyR gene in PAOU partially restored the formation of robust biofilms. PMID:20348252

  7. A petunia ethylene-responsive element binding factor, PhERF2, plays an important role in antiviral RNA silencing.

    PubMed

    Sun, Daoyang; Nandety, Raja Sekhar; Zhang, Yanlong; Reid, Michael S; Niu, Lixin; Jiang, Cai-Zhong

    2016-05-01

    Virus-induced RNA silencing is involved in plant antiviral defense and requires key enzyme components, including RNA-dependent RNA polymerases (RDRs), Dicer-like RNase III enzymes (DCLs), and Argonaute proteins (AGOs). However, the transcriptional regulation of these critical components is largely unknown. In petunia (Petunia hybrida), an ethylene-responsive element binding factor, PhERF2, is induced by Tobacco rattle virus (TRV) infection. Inclusion of a PhERF2 fragment in a TRV silencing construct containing reporter fragments of phytoene desaturase (PDS) or chalcone synthase (CHS) substantially impaired silencing efficiency of both the PDS and CHS reporters. Silencing was also impaired in PhERF2- RNAi lines, where TRV-PhPDS infection did not show the expected silencing phenotype (photobleaching). In contrast, photobleaching in response to infiltration with the TRV-PhPDS construct was enhanced in plants overexpressing PhERF2 Transcript abundance of the RNA silencing-related genes RDR2, RDR6, DCL2, and AGO2 was lower in PhERF2-silenced plants but higher in PhERF2-overexpressing plants. Moreover, PhERF2-silenced lines showed higher susceptibility to Cucumber mosaic virus (CMV) than wild-type (WT) plants, while plants overexpressing PhERF2 exhibited increased resistance. Interestingly, growth and development of PhERF2-RNAi lines were substantially slower, whereas the overexpressing lines were more vigorous than the controls. Taken together, our results indicate that PhERF2 functions as a positive regulator in antiviral RNA silencing. PMID:27099376

  8. A petunia ethylene-responsive element binding factor, PhERF2, plays an important role in antiviral RNA silencing

    PubMed Central

    Sun, Daoyang; Nandety, Raja Sekhar; Zhang, Yanlong; Reid, Michael S.; Niu, Lixin; Jiang, Cai-Zhong

    2016-01-01

    Virus-induced RNA silencing is involved in plant antiviral defense and requires key enzyme components, including RNA-dependent RNA polymerases (RDRs), Dicer-like RNase III enzymes (DCLs), and Argonaute proteins (AGOs). However, the transcriptional regulation of these critical components is largely unknown. In petunia (Petunia hybrida), an ethylene-responsive element binding factor, PhERF2, is induced by Tobacco rattle virus (TRV) infection. Inclusion of a PhERF2 fragment in a TRV silencing construct containing reporter fragments of phytoene desaturase (PDS) or chalcone synthase (CHS) substantially impaired silencing efficiency of both the PDS and CHS reporters. Silencing was also impaired in PhERF2- RNAi lines, where TRV-PhPDS infection did not show the expected silencing phenotype (photobleaching). In contrast, photobleaching in response to infiltration with the TRV-PhPDS construct was enhanced in plants overexpressing PhERF2. Transcript abundance of the RNA silencing-related genes RDR2, RDR6, DCL2, and AGO2 was lower in PhERF2-silenced plants but higher in PhERF2-overexpressing plants. Moreover, PhERF2-silenced lines showed higher susceptibility to Cucumber mosaic virus (CMV) than wild-type (WT) plants, while plants overexpressing PhERF2 exhibited increased resistance. Interestingly, growth and development of PhERF2-RNAi lines were substantially slower, whereas the overexpressing lines were more vigorous than the controls. Taken together, our results indicate that PhERF2 functions as a positive regulator in antiviral RNA silencing. PMID:27099376

  9. Diversity and distribution of transcription factors: their partner domains play an important role in regulatory plasticity in bacteria.

    PubMed

    Rivera-Gómez, Nancy; Segovia, Lorenzo; Pérez-Rueda, Ernesto

    2011-08-01

    The ability of bacteria to deal with diverse environmental changes depends on their repertoire of genes and their ability to regulate their expression. In this process, DNA-binding transcription factors (TFs) have a fundamental role because they affect gene expression positively and/or negatively depending on operator context and ligand-binding status. Here, we show an exhaustive analysis of winged helix-turn-helix domains (wHTHs), a class of DNA-binding TFs. These proteins were identified in high proportions and widely distributed in bacteria, representing around half of the total TFs identified so far. In addition, we evaluated the repertoire of wHTHs in terms of their partner domains (PaDos), identifying a similar trend, as with TFs, i.e. they are abundant and widely distributed in bacteria. Based on the PaDos, we defined three main groups of families: (i) monolithic, those families with little PaDo diversity, such as LysR; (ii) promiscuous, those families with a high PaDo diversity; and (iii) monodomain, with families of small sizes, such as MarR. These findings suggest that PaDos have a very important role in the diversification of regulatory responses in bacteria, probably contributing to their regulatory complexity. Thus, the TFs discriminate over longer regions on the DNA through their diverse DNA-binding domains. On the other hand, the PaDos would allow a great flexibility for transcriptional regulation due to their ability to sense diverse stimuli through a variety of ligand-binding compounds. PMID:21636649

  10. Achromobacter denitrificans strain SP1 efficiently remediates di(2-ethylhexyl)phthalate.

    PubMed

    Pradeep, S; Josh, M K Sarath; Binod, P; Devi, R Sudha; Balachandran, S; Anderson, Robin C; Benjamin, Sailas

    2015-02-01

    This study describes how Achromobacter denitrificans strain SP1, a novel isolate from heavily plastics-contaminated sewage sludge efficiently consumed the hazardous plasticizer, di(2-ethylhexyl)phthalate (DEHP) as carbon source supplemented in a simple basal salt medium (BSM). Response surface methodology was employed for the statistical optimization of the process parameters such as temperature (32°C), agitation (200 rpm), DEHP concentration (10 mM), time (72 h) and pH (8.0). At these optimized conditions, experimentally observed DEHP degradation was 63%, while the predicted value was 59.2%; and the correlation coefficient between them was 0.998, i.e., highly significant and fit to the predicted model. Employing GC-MS analysis, the degradation pathway was partially deduced with intermediates such as mono(2-ethylhexyl)phthalate and 2-ethyl hexanol. Briefly, this first report describes A. denitrificans strain SP1 as a highly efficient bacterium for completely remediating the hazardous DEHP (10 mM) in 96 h in BSM (50% consumed in 60 h), which offers great potentials for efficiently cleaning the DEHP-contaminated environments such as soil, sediments and water upon its deployment. PMID:25463861