Note: This page contains sample records for the topic filament winding machine from Science.gov.
While these samples are representative of the content of Science.gov,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of Science.gov
to obtain the most current and comprehensive results.
Last update: August 15, 2014.
1

Design and fabrication of low cost filament winding machine  

Microsoft Academic Search

In general, the composite pipes are fabricated using glass fiber and polyester resin matrix by hand lay-up and also by 2-axis filament winding machine. In this work, a filament winding machine was designed and developed for the fabrication of pipes and round shape specimens. A lathe-type machine and a wet winding method were used in the design of the machine.

F. H. Abdalla; S. A. Mutasher; Y. A. Khalid; S. M. Sapuan; A. M. S. Hamouda; B. B. Sahari; M. M. Hamdan

2007-01-01

2

Filament winding  

NASA Astrophysics Data System (ADS)

The major aspects of filament winding are discussed, emphasizing basic reinforcement and matrix materials, winding procedures, process controls, and cured composite properties. Fiberglass (E-glass and S-glass strengths are 500,000 and 665,000 psi respectively) and polyester resins are the principal reinforcement constituent materials. Graphite and aramid reinforcements are being used more frequently, primarily for the more critical pressure vessels. Matrix systems are most commonly based on epoxy as it has superior mechanical properties, fatigue behavior, and heat resistance as compard with polyesters. A fiberglass overwrap of PVC pipe is an anticipated development in on-site winding and combination winding, and the compression molding of filament wound lay-ups will be investigated. The fabrication of weight-sensitive structural components may be achieved by using such moldings.

Shibley, A. M.

3

Filament Winding System.  

National Technical Information Service (NTIS)

An apparatus for winding fine filaments onto stationary long rods includes a supporting base having control mounting and filament mounting regions. The filament winding region includes first and second parallel bearing rods on which are slidably mounted a...

L. E. Sansone B. A. Blakely

1995-01-01

4

Optimum windings for linear induction machines.  

NASA Technical Reports Server (NTRS)

The matrix method of calculating linear induction machine performance as a function of winding current distribution was extended to determine the winding current distribution for maximum efficiency. Application of the method to typical magnetohydrodynamic generator geometries showed that electrical efficiencies of 0.5 to 0.6 are possible with fractional wavelength windings and without insulating vanes in the flow.

Elliott, D. G.

1973-01-01

5

On the mechanics of filament winding. I - A generalized model  

NASA Technical Reports Server (NTRS)

In this paper the filament winding process was analyzed to relate process variables to structural parameters. An analytical model has been developed for a filament wound preform by determining the necessary geometric and kinematic conditions. An equation of motion of winding was developed to predict layer by layer geometry using the mandrel shape as the initial boundary condition. This model provides the laws of motion of the traverse stroke relative to the mandrel to ensure that the filament laydown is of the predetermined geodesic path over the mandrel, that the winding density is distributed over the mandrel in the prearranged manner, and that the winding build is being formed to reproduce the preassigned shape or contour of the preform. From this analysis, the winding process parameters can be controlled accordingly to produce any given shape. The analytical model was used to produce computer simulation of the winding process. The dynamic simulation of the winding process visualizes and inspects the layer by layer path of the tow and provides process variables required to produce preforms of optimum structural parameters.

Hamouda, Hechmi; Kang, Tae J.; El-Shiekh, Aly

1989-01-01

6

Epoxy Resin-Elastomer System for Filament Winding.  

National Technical Information Service (NTIS)

Tests characterizing an epoxy system that contains 5% rubber and is suitable for wet-filament winding are described. The resin is a bisphenol-A rubberized epoxy diluted with an aliphatic diglycidyl ether and cured with an aromatic amine. The viscosity and...

J. A. Rinde E. T. Mones R. L. Moore H. A. Newey

1978-01-01

7

Epoxy resin-elastomer system for filament winding  

Microsoft Academic Search

Tests characterizing an epoxy system that contains 5% rubber and is suitable for wet-filament winding are described. The resin is a bisphenol-A rubberized epoxy diluted with an aliphatic diglycidyl ether and cured with an aromatic amine. The viscosity and pot life were measured and the progress of cure was monitored so an optimum cure could be chosen. Mechanical tests were

J. A. Rinde; E. T. Mones; R. L. Moore; H. A. Newey

1978-01-01

8

Filament-winding fabrication of QCSEE configuration fan blades  

NASA Technical Reports Server (NTRS)

The design and fabrication of twelve NASA-QCSEE type composite fan blades utilizing wet filament winding fabrication techniques is described. All composite fibers were continuous and attached to the root end. All components were formed, bonded, and co-cured in one molding process. Advanced fiber materials used in the blade fabrication were Thornel-300, Carbolon Z-2-1, and Carbolon Z-3 graphite in an epoxy resin matrix.

Yao, S.

1978-01-01

9

Architecture-independent parallelism for both shared- and distributed-memory machines using the Filaments package  

Microsoft Academic Search

This paper presents the Filaments package, which can be used to create architecture-independentparallel programs---that is, programs that are portable and efficient across vastlydifferent parallel machines. Filaments virtualizes the underlying machine in terms of the numberof processors and the interconnection. This simplifies parallel program design in two ways.First, programs can be written (or generated) with the focus on the parallelism inherent

David K. Lowenthal; Vincent W. Freeh

2000-01-01

10

Composite Pressure Vessel Variability in Geometry and Filament Winding Model  

NASA Technical Reports Server (NTRS)

Composite pressure vessels (CPVs) are used in a variety of applications ranging from carbon dioxide canisters for paintball guns to life support and pressurant storage on the International Space Station. With widespread use, it is important to be able to evaluate the effect of variability on structural performance. Data analysis was completed on CPVs to determine the amount of variation that occurs among the same type of CPV, and a filament winding routine was developed to facilitate study of the effect of manufacturing variation on structural response.

Green, Steven J.; Greene, Nathanael J.

2012-01-01

11

Multi-winding homopolar electric machine  

DOEpatents

A multi-winding homopolar electric machine and method for converting between mechanical energy and electrical energy. The electric machine includes a shaft defining an axis of rotation, first and second magnets, a shielding portion, and a conductor. First and second magnets are coaxial with the shaft and include a charged pole surface and an oppositely charged pole surface, the charged pole surfaces facing one another to form a repulsive field therebetween. The shield portion extends between the magnets to confine at least a portion of the repulsive field to between the first and second magnets. The conductor extends between first and second end contacts and is toroidally coiled about the first and second magnets and the shield portion to develop a voltage across the first and second end contacts in response to rotation of the electric machine about the axis of rotation.

Van Neste, Charles W

2012-10-16

12

Induction Machine Analysis for Arbitrary Displacement Between Multiple Winding Sets  

Microsoft Academic Search

The steps in t he applied voltages of a three-phase, inverter-induction motor drive system cause undesirable pulsations in motortor By using multiple inverters connected to a multiphase machine with appropriate winding displacements, significant improvement in system performance is possible. The winding displacements required, however, are not necessarily the symmetrical displacements used in standard multiphase machines. This paper sets forth an

R. H. Nelson; P. C. Krause

1974-01-01

13

Fields of Opportunity: Wind Machines Return to the Plains  

ERIC Educational Resources Information Center

The last two decades have seen a rebirth of wind machines on the rural landscape. In ironic fashion the wind's kinetic energy has grown in significance through its ability to generate commercial amounts of electricity, the commodity that a few generations earlier hastened the demise of the old Great Plains windmill. Yet the reemergence of wind

Sowers, Jacob

2006-01-01

14

Electrical machines with superconducting windings. Part 3: Homopolar dc machines  

NASA Astrophysics Data System (ADS)

The losses in rotating liquid metal contacts and the problems in including liquid metals were theoretically and experimentally studied. These machines are shown realiable. For electric ship propulsion, they are a more efficient method of power transmission than mechanical gearboxes. However, weight reduction as compared to mechanical gearboxes can hardly be achieved with machines fully shielded by magnetic iron.

Kullman, D.; Henninger, P.

1981-01-01

15

Filament Winding S-Glass/Polyimide Resin Composite Processing Studies.  

National Technical Information Service (NTIS)

The work performed in selecting a TRW A-type polyimide resin that would be suitable for fabrication of filament wound reinforced plastic structures is described. Several different formulations were evaluated after which the P105AC formulation was selected...

R. W. Vaughan R. J. Jones

1974-01-01

16

A general purpose electric coil-winding machine  

Microsoft Academic Search

A machine is described for winding coils covering a wide range of sizes and wire gauges, and details of the circuit for controlling the speed of the motor are given. This machine has hitherto been used solely for experimental coils, i.e. coils of which only a few of any one design are required, and hence no mechanical guide for feeding

H P Bloxam

1935-01-01

17

Filament  

NSDL National Science Digital Library

Filament is a collection of apps that can be seamlessly added to websites to enhance the visitor experience. These free apps include Ivy, which allows people to select text on the page and share it via Twitter, Facebook, and so on, and Flare, which gives users the ability to create a customizable social sharing bar to make sharing materials a snap. These various apps are compatible with all operating systems, including Linux.

2014-06-26

18

Permanent magnet machine with windings having strand transposition  

DOEpatents

This document discusses, among other things, a stator with transposition between the windings or coils. The coils are free from transposition to increase the fill factor of the stator slots. The transposition at the end connections between an inner coil and an outer coil provide transposition to reduce circulating current loss. The increased fill factor reduces further current losses. Such a stator is used in a dual rotor, permanent magnet machine, for example, in a compressor pump, wind turbine gearbox, wind turbine rotor.

Qu, Ronghai (Clifton Park, NY) [Clifton Park, NY; Jansen, Patrick Lee (Scotia, NY) [Scotia, NY

2009-04-21

19

Wind–Diesel Generation Using Doubly Fed Induction Machines  

Microsoft Academic Search

In this paper, the modeling and control strategy of a wind-diesel generation system are discussed. In the proposed topology, the diesel engine and the wind turbine are both variable-speed machines, allowing maximum fuel efficiency and optimal energy capture from the wind. A vector-controlled doubly fed induction generator is used in each generation system to provide fixed voltage and frequency to

RubÉn PeÑa; Roberto CÁrdenas; JosÉ Proboste; Jon Clare; Greg Asher

2008-01-01

20

Manufacture of Rocket Motor Cases Using Advanced Filament Winding Processes  

Microsoft Academic Search

Boeing Canada Technology Ltd., Winnipeg Division (BCTL-W) is involved in the development and production of filament wound composite airplane ducts and higher performance vessels. Through a contract with Bristol Aerospace Ltd. and the Canadian Government, a two stage composite rocket motor case was developed for air launch applications. The manufacture of this motor case required the development of several technologies

A. J. Lauder

1995-01-01

21

Time dynamics of burst-train filamentation assisted femtosecond laser machining in glasses.  

PubMed

Bursts of femtosecond laser pulses with a repetition rate of f = 38.5MHz were created using a purpose-built optical resonator. Single Ti:Sapphire laser pulses, trapped inside a resonator and released into controllable burst profiles by computer generated trigger delays to a fast Pockels cell switch, drove filamentation-assisted laser machining of high aspect ratio holes deep into transparent glasses. The time dynamics of the hole formation and ablation plume physics on 2-ns to 400-ms time scales were examined in time-resolved side-view images recorded with an intensified-CCD camera during the laser machining process. Transient effects of photoluminescence and ablation plume emissions confirm the build-up of heat accumulation effects during the burst train, the formation of laser-generated filaments and plume-shielding effects inside the deeply etched vias. The small time interval between the pulses in the present burst train enabled a more gentle modification in the laser interaction volume that mitigated shock-induced microcracks compared with single pulses. PMID:22273956

Esser, Dagmar; Rezaei, Saeid; Li, Jianzhao; Herman, Peter R; Gottmann, Jens

2011-12-01

22

Is titin a 'winding filament'? A new twist on muscle contraction.  

PubMed

Recent studies have demonstrated a role for the elastic protein titin in active muscle, but the mechanisms by which titin plays this role remain to be elucidated. In active muscle, Ca(2+)-binding has been shown to increase titin stiffness, but the observed increase is too small to explain the increased stiffness of parallel elastic elements upon muscle activation. We propose a 'winding filament' mechanism for titin's role in active muscle. First, we hypothesize that Ca(2+)-dependent binding of titin's N2A region to thin filaments increases titin stiffness by preventing low-force straightening of proximal immunoglobulin domains that occurs during passive stretch. This mechanism explains the difference in length dependence of force between skeletal myofibrils and cardiac myocytes. Second, we hypothesize that cross-bridges serve not only as motors that pull thin filaments towards the M-line, but also as rotors that wind titin on the thin filaments, storing elastic potential energy in PEVK during force development and active stretch. Energy stored during force development can be recovered during active shortening. The winding filament hypothesis accounts for force enhancement during stretch and force depression during shortening, and provides testable predictions that will encourage new directions for research on mechanisms of muscle contraction. PMID:21900329

Nishikawa, Kiisa C; Monroy, Jenna A; Uyeno, Theodore E; Yeo, Sang Hoon; Pai, Dinesh K; Lindstedt, Stan L

2012-03-01

23

Stator for a rotating electrical machine having multiple control windings  

DOEpatents

A rotating electric machine is provided which includes multiple independent control windings for compensating for rotor imbalances and for levitating/centering the rotor. The multiple independent control windings are placed at different axial locations along the rotor to oppose forces created by imbalances at different axial locations along the rotor. The multiple control windings can also be used to levitate/center the rotor with a relatively small magnetic field per unit area since the rotor and/or the main power winding provides the bias field.

Shah, Manoj R. (Latham, NY); Lewandowski, Chad R. (Amsterdam, NY)

2001-07-17

24

High pressure gas storage capacities. Example of a solution using filament windings  

NASA Technical Reports Server (NTRS)

The use of epoxy resin fiber glass and economic factors affecting the choice of materials for gas storage are discussed. The physical nature of the filament windings are described together with the results obtained. It is demonstrated that a substantial reduction in mass and an enhanced level of safety can be assured at a competitive cost by storing gases in this way.

Phan, A.; Lamalle, J.

1981-01-01

25

DEVELOPMENT OF AN ESTER VINYL POLYMERIC MATRIX FOR COMPOSITES DESIGNED FOR THE FILAMENT WINDING PROCESS  

Microsoft Academic Search

Present study reports the development of an ester vinyl polymeric matrix for composite material designated to the filament winding process (through of the addition of different amounts of cure agent and accelerator). The resin Derakane 411-350, supplied by Dow Chemical Company, was used in this study. Tensile properties such as tensile stress, percent elongation, Young's modulus and toughness were obtained

Ledjane Lima Sobrinho; Marysilvia Ferreira; Fernando Luiz Bastian

26

Liquid oxygen-compatible filament-winding matrix resin  

NASA Technical Reports Server (NTRS)

Polyurethanes derived from hydroxy terminated polyperfluoro propylene oxide prepolymers were evaluated as matrix resins for filament wound composites which would be exposed to liquid (and 100% gaseous) oxygen environments. A number of structural modifications were brought about by variations in prepolymer molecular weight, and alternative curing agents which allowed retention of the oxygen compatibility. Although satisfactory performance was achieved at sub-ambient temperatures, the derived composites suffered considerable property loss at ambient or slightly elevated temperatures. To attain overall effectiveness of the composite system, upgrading of the polymer thermomechanical properties must first be achieved.

Harrison, E. S.

1973-01-01

27

Modeling of Exterior Rotor Permanent Magnet Machines with Concentrated Windings  

Microsoft Academic Search

In this thesis modeling, analysis, design and measurement of exterior rotor permanent magnet (PM) machines with concentrated windings are dealt with. Special attention is paid to slotting effect. The PM machine is integrated in flywheel and used for small-scale ship application. Analytical model and automated nonlinear transient finite-element-model (FEM) including rotor motion are developed. A new hybrid model combining analytical

H. Vu Xuan

2012-01-01

28

WindTech TV: Bonus Materials- Machine Control Circuits  

NSDL National Science Digital Library

This section of the Wind Technician TV website provides bonus materials pertaining to machine control circuits. Users can review content on topics like electrical theory, magnetics, ladder diagrams and start-stop interlock example. Clicking on a subtopic will launch a pop up window demonstrating the concept.

2013-07-01

29

Inrush Current Simulation of Two Windings Power Transformer using Machine Parameters Estimated by Design Procedure of Winding Structure  

NASA Astrophysics Data System (ADS)

This paper presents estimation techniques of machine parameters for two windings power transformer using design procedure of winding structure. Especially, it is very difficult to obtain machine parameters for transformers in customers' facilities. Using estimation techniques, machine parameters could be calculated from the only nameplate data of these transformers. Subsequently, EMTP-ATP simulation of the inrush current was carried out using machine parameters estimated by design procedure of winding structure and simulation results were reproduced measured waveforms.

Tokunaga, Yoshitaka; Kubota, Kunihiro

30

Inrush Current Simulation of Two Windings Power Transformer using Machine Parameters Estimated by Design Procedure of Winding Structure  

Microsoft Academic Search

This paper presents estimation techniques of machine parameters for two windings power transformer using design procedure of winding structure. Especially, it is very difficult to obtain machine parameters for transformers in customers' facilities. Using estimation techniques, machine parameters could be calculated from the only nameplate data of these transformers. Subsequently, EMTP-ATP simulation of the inrush current was carried out using

Yoshitaka Tokunaga; Kunihiro Kubota

2008-01-01

31

Faulty Operations of a PM Fractional-Slot Machine With a Dual Three-Phase Winding  

Microsoft Academic Search

The permanent-magnet (PM) machine with dual three-phase windings is proposed for applications requiring con- tinuous operating even under a partial fault. The two windings are supplied by two separate inverters. Thus, in the event of a fault of one winding, this is disconnected, and the machine continues to be operated by means of the healthy winding. This paper investigates the

Massimo Barcaro; Nicola Bianchi; Freddy Magnussen

2011-01-01

32

The Inertial Response of Induction-Machine-Based Wind Turbines  

Microsoft Academic Search

The inertial response of a generator is influenced by the sensitivity of the generator's electromagnetic torque to changes in the power system frequency. This paper deals with the inertial response of wind turbines employing induction-machine-based generators. A model of a field-oriented controlled doubly fed induction generator based on a fifth-order induction-generator model is described. The proposed model is implemented in

Alan Mullane; Mark O'Malley

2005-01-01

33

Wet-filament winding fabrication of thick carbon fiber/polycyanate resin composite  

SciTech Connect

Polycyanate resins offer advantages as composite matrices because of their high thermal stability, low outgassing, low water absorption and radiation resistance. This report describes the fabrication of a thick (nominal 1 in.) hoop-wound composite cylinder that is manufactured by the wet-filament winding method using Toray T1000G carbon fiber and YLA RS-14 polycyanate resin as the constituent materials. An analytical model used to evaluate the fabrication process, estimate composite residual stresses and provide input toward mandrel design is presented and the construction of the mandrel used to wet-wind the cylinder is described. The composite cylinder quality is evaluated by dimensional inspection and measurements of density and composition.

Frame, B.J.; Dodge, W.G.

1997-06-01

34

A machine-learning algorithm for wind gust prediction  

NASA Astrophysics Data System (ADS)

Physical damage to property and crops caused by unanticipated wind gusts is a well understood phenomenon. Predicting its occurrence continues to be a challenge for meteorologists and climatologists. Various approaches to gust occurrence model building have been proposed. The very nature of the event is problematic because of its brief duration following a rapid change of state in wind velocity that immediately precedes it. Events classified as wind gusts have a typical duration of less than 20 s and are often much shorter. The rapidly accelerating wind velocity preceding them is often not apparent until the gust occurs. They come quickly, occur suddenly, and then end as abruptly as they began. Observations of 2000 gust events were made during the research to which this paper refers. These observations indicated a mean interval of 3.2 min between the beginning and end of wind velocity change and a noticeable linear progression in the acceleration pattern. It was also noted that state changes regularly occur, often over only seconds in time. In combination, these factors pose both a sampling and a data interpretation challenge, making reliable prediction difficult. This paper describes some new research undertaken to investigate methods of wind gust measurement and prediction. In particular, a machine-learning approach is taken to determine a satisfactory analytical process and to produce meaningful and useful results. An algorithm for use with real-time climate data collection and analysis is proposed, with a description of its implementation. Real-time data sampling provides input for this study using terrestrial sensor telemetry. Near-ground truth data are recorded independent of geostrophic upper atmosphere conditions.

Sallis, P. J.; Claster, W.; Hernández, S.

2011-09-01

35

Mars vertical axis wind machines: The design of a tornado vortex machine for use on Mars  

NASA Technical Reports Server (NTRS)

Ever since Viking 1 and 2 landed on the surface of Mars in the summer of 1976, man has yearned to go back. But before man steps foot upon the surface of Mars, unmanned missions such as the Martian Soft Lander and Martian Subsurface Penetrator will precede him. Alternative renewable power sources must be developed to supply the next generation of surface exploratory spacecraft, since RTG's, solar cells, and long-life batteries all have their significant drawbacks. One such alternative is to take advantage of the unique Martian atmospheric conditions by designing a small scale, Martian wind power generator, capable of surviving impact and fulfilling the long term (2-5 years), low-level power requirements (1-2 Watts) of an unmanned surface probe. After investigation of several wind machines, a tornado vortex generator was chosen based upon its capability of theoretically augmenting and increasing the available power that may be extracted from average Martian wind speeds of approximately 7.5 m/s. The Martian Tornado Vortex Wind Generator stands 1 meter high and has a diameter of 0.5 m. Martian winds enter the base and shroud of the Tornado Vortex Generator at 7.5 m/s and are increased to an exit velocity of 13.657 m/s due to the vortex that is created. This results in a rapid pressure drop of 4.56 kg/s(exp 2) m across the vortex core which aids in producing a net power output of 1.1765 Watts. The report contains the necessary analysis and requirements needed to feasibly operate a low-level powered, unmanned, Martian surface probe.

Carlin, Daun; Dyhr, Amy; Kelly, Jon; Schmirler, J. Eric; Carlin, Mike; Hong, Won E.; Mahoney, Kamin

1994-01-01

36

Optimal flux weakening in surface PM machines using fractional-slot concentrated windings  

Microsoft Academic Search

A design approach is presented for achieving optimal flux-weakening operation in surface permanent-magnet (SPM) synchronous machines by properly designing the machine's stator windings using concentrated, fractional-slot stator windings. This technique makes it possible to significantly increase the machine inductance in order to achieve the critical condition for providing wide speed ranges of constant-power operation. The conditions for optimal flux weakening

Ayman M. EL-Refaie; Thomas M. Jahns

2005-01-01

37

Pole-phase modulated toroidal winding for an induction machine  

SciTech Connect

A stator (10) for an induction machine for a vehicle has a cylindrical core (12) with inner and outer slots (26, 28) extending longitudinally along the inner and outer peripheries between the end faces (22, 24). Each outer slot is associated with several adjacent inner slots. A plurality of toroidal coils (14) are wound about the core and laid in the inner and outer slots. Each coil occupies a single inner slot and is laid in the associated outer slot thereby minimizing the distance the coil extends from the end faces and minimizing the length of the induction machine. The toroidal coils are configured for an arbitrary pole phase modulation wherein the coils are configured with variable numbers of phases and poles for providing maximum torque for cranking and switchable to a another phase and pole configuration for alternator operation. An adaptor ring (36) circumferentially positioned about the stator improves mechanical strength, and provides a coolant channel manifold (34) for removing heat produced in stator windings during operation.

Miller, John Michael (Saline, MI); Ostovic, Vlado (Weinheim, DE)

1999-11-02

38

Fine tuning support vector machines for short-term wind speed forecasting  

Microsoft Academic Search

Accurate forecasting of wind speed is critical to the effective harvesting of wind energy and the integration of wind power into the existing electric power grid. Least-squares support vector machines (LS-SVM), a powerful technique that is widely applied in a variety of classification and function estimation problems, carries great potential for the application of short-term wind speed forecasting. In this

Junyi Zhou; Jing Shi; Gong Li

2011-01-01

39

Coil connections and winding factors in flux-switching PM brushless AC machines  

Microsoft Academic Search

Purpose – The purpose of this paper is to analyze the phase coil connections and winding factors of flux-switching permanent magnet (FSPM) brushless AC machines with all poles and alternate poles wound, and different combinations of stator and rotor pole numbers. Design\\/methodology\\/approach – The coil-emf vectors, which are widely used for analyzing the conventional fractional-slot PM machines with non-overlapping windings,

Jin-Tao Chen; Zi-Qiang Zhu

2011-01-01

40

Doubly-fed induction machine models for stability assessment of wind farms  

Microsoft Academic Search

The increasing size of wind farms requires power system stability analysis including dynamic models of the wind power generation. Nowadays, the most widely used generator type for units above 1 MW is the doubly-fed induction machine. Doubly-fed induction machines allow active and reactive power control through a rotor-side converter, while the stator is directly connected to the grid. Detailed models

Markus A. Poller

2003-01-01

41

A new method to find the fractional slot windings structures from a distributed slot windings permanent magnet synchronous machine and comparative study for a HEV application  

Microsoft Academic Search

This paper presents a distributed slot permanent magnet synchronous machine (PMSM). It's a machine characterized by a distributed windings stator and a surface mounted PM rotor. First, a basic PMSM called “classical” has been studied. Then, we have developed a new method to find the others machines with the same winding distribution on stator but with different rotor pole number

Phi Hung Nguyen; Emmanuel HOANG; Mohamed GABSI; Michel LECRIVAIN

2010-01-01

42

The reliability model of thermo-aging of winding insulator in aero-electric machines  

NASA Astrophysics Data System (ADS)

A quantitative reliability model for the thermoaging process in a winding insulation of an aeroelectric machine is proposed. The formula for calculating R(t) and MTBF is derived. The model provides a basis for reliability and analysis and design of aeroelectric machines.

Mu, Xinhua

1993-02-01

43

The reliability model of thermo-aging of winding insulator in aero-electric machines  

Microsoft Academic Search

A quantitative reliability model for the thermoaging process in a winding insulation of an aeroelectric machine is proposed. The formula for calculating R(t) and MTBF is derived. The model provides a basis for reliability and analysis and design of aeroelectric machines.

Xinhua Mu

1993-01-01

44

Practical deployment of the Brushless Doubly-Fed Machine in a medium scale wind turbine  

Microsoft Academic Search

The Brushless Doubly-Fed Machine (BDFM) is a brushless electrical generator which allows variable speed operation with a power converter rated at only a fraction of the machine rating. This paper details an example implementation of the BDFM in a medium-scale wind turbine. Details of a simplified design procedure based on electrical and magnetic loadings are given along with the results

Thomas Logan; Joseph Warrington; Shiyi Shao; Richard McMahon

2009-01-01

45

TORQUE RIPPLE MINIMIZATION IN DOUBLY FED INDUCTION MACHINE USED IN WIND MILLS WITH ARTIFICIAL NEURAL NETWORK  

Microsoft Academic Search

This paper discusses an Artificial Neural Network (ANN) based method for reducing the torque ripple in a Doubly Fed Induction machine (DFIM) in which Direct Torque Control (DTC) scheme is applied. DFIM is gaining popularity as the best alternative for wind energy generation system. Often, wind energy generation demands good torque dynamic performance. ANN is used here to give pulses

GEETHA RAMADAS; T. THYAGARAJAN; VEDAM SUBRSHMANYAM

2009-01-01

46

Performance analysis of a neural flux observer for a bearingless induction machine with divided windings  

Microsoft Academic Search

This study presents a performance analysis of a neural observer applied to speed and radial position controls of an induction-type bearingless motor with divided windings. The speed and radial control actions are carried out in conjunction with current control in the windings. The neural flux observer aims at compensating possible parametric variations of the machine caused by agents such as

Valcí Ferreira Victor; José Álvaro de Paiva; Andrés Ortiz Salazar; André Laurindo Maitelli

2009-01-01

47

Improving three-phase induction machines power factor using single phase auxiliary winding fed by an active power filter  

Microsoft Academic Search

This paper presents a three-phase induction machine that employs a single phase auxiliary winding, which is only magnetically coupled to the stator main winding, and controlled by an active power filter. The active filter consists mainly of a two leg PWM voltage source inverter, which together with the auxiliary winding serves to supply leading reactive power to the machine. With

Mbika C. Muteba; Adisa A. Jimoh; Dan V. Nicolae

2007-01-01

48

Direct Drive Synchronous Machine Models for Stability Assessment of Wind Farms  

Microsoft Academic Search

The increasing size of wind farms requires power system stability analysis including dynamic wind generator mod- els. For turbines above 1MW, doubly-fed induction machines are the most widely used concept. However, especially in Ger- many, direct-drive wind generators based on converter-driven syn- chronous generator concepts have reached considerable market penetration. This paper presents converter driven synchronous generator models of various

Sebastian Achilles

49

Technological and economical analysis of salient pole and permanent magnet synchronous machines designed for wind turbines  

NASA Astrophysics Data System (ADS)

Chinese export restrictions already reduced the planning reliability for investments in permanent magnet wind turbines. Today the production of permanent magnets consumes the largest proportion of rare earth elements, with 40% of the rare earth-based magnets used for generators and other electrical machines. The cost and availability of NdFeB magnets will likely determine the production rate of permanent magnet generators. The high volatility of rare earth metals makes it very difficult to quote a price. Prices may also vary from supplier to supplier to an extent of up to 50% for the same size, shape and quantity with a minor difference in quality. The paper presents the analysis and the comparison of salient pole with field winding and of peripheral winding synchronous electrical machines, presenting important advantages. A neodymium alloy magnet rotor structure has been considered and compared to the salient rotor case. The Salient Pole Synchronous Machine and the Permanent Magnet Synchronous Machine were designed so that the plate values remain constant. The Eddy current effect on the windings is taken into account during the design, and the efficiency, output power and the air-gap flux density obtained after the simulation were compared. The analysis results clearly indicate that Salient Pole Synchronous Machine designs would be attractive to wind power companies. Furthermore, the importance of the design of electrical machines and the determination of criteria are emphasized. This paper will be a helpful resource in terms of examination and comparison of the basic structure and magnetic features of the Salient Pole Synchronous Machine and Permanent Magnet Synchronous Machine. Furthermore, an economic analysis of the designed machines was conducted.

Gündo?du, Tayfun; Kömürgöz, Güven

2012-08-01

50

Non-overlapping concentrated windings in homopolar inductor machines  

Microsoft Academic Search

The work considers the issues connected with application of non-overlapping coils in the homopolar inductor machines. The calculation and analysis are performed for the magnetic field in the tooth zone of such a machine, and, based on the results, recommendations are given on the choice of optimal parameters of the tooth zone. The sample under study is a 32 kW

Svetlana Orlova; Vladislav Pugachov; Nikolaj Levin; Marina Konuhova

2010-01-01

51

Development of Special Winding Machine for HT-7U Superconducting Tokamak  

NASA Astrophysics Data System (ADS)

A special winding machine with high accuracy has just been developed and applied to the construction of HT-7U Tokamak. It is one of the critical facilities for R & D of HT-7U construction. The machine mainly consists of five parts, including a CICC pay-off spool, a four-roller correcting assembly, a four-roller forming/bending assembly, a continuous winding structure and a CNC control system with three-axis AC servo motors. The facility is used for Cable in Conduit Conductor (CICC) magnet fabrication of HT-7U. The main requirements of the winding machine are: continuous winding to reduce joints inside the coils; pre-forming CICC conductor to avoid winding with tension; suitable for all TF & PF coils of various coil shapes and within the dimension limit; improving the configuration tolerance and the special flatness of the CICC conductor. This paper emphasizes on the design and fabrication of the special winding machine for HT-7U. Some analyses and techniques in winding process for trial D-shape coil are also presented.

Gao, Da-ming; Yu, Jie; Zhu, Wen-hua; Wen, Jun; Pan, Yin-nian; Chen, Le-ping; Tao, Yu-ming; Wang, Hai-jing; He, Wei

2000-02-01

52

Regulation of small wind machines: a local perspective  

SciTech Connect

The most common wind turbine issues that communities are concerned about and therefore might address in an ordnance are identified. These issues include noise, safety, communications interference, aesthetics, wind access, and height restrictions. How communities have addressed these issues as well as their approaches for dealing with small wind turbines in general are examined. In particular, the Riverside County, California, an ordinance recently prepared is explained in detail.

Perkins-Smith, D. (Black Hawk Associates, Denver, CO); Odland, R.

1982-01-01

53

Development status of rotating machines employing superconducting field windings  

Microsoft Academic Search

Superconducting rotating machines have looked promising since multifilamentary niobium-titanium (NbTi) superconductors became available in the mid-1960s. Both dc homopolar and ac synchronous machines were successfully tested from the 1970s to the 1990s. Three different 70-MW generators were recently demonstrated by the SuperGM project in Japan. However, economic considerations with respect to competitive cost combined with the requirement for liquid helium

SWARN S. KALSI; KONRAD WEEBER; H. Takesue; CLIVE LEWIS; HEINZ-WERNER NEUMUELLER; RICHARD D. BLAUGHER

2004-01-01

54

Dynamic modelling and analysis of multi-machine power systems including wind farms  

Microsoft Academic Search

This thesis introduces a small-signal dynamic model, based on a frequency response approach, for the analysis of a multi-machine power system with special focus on an induction machine based wind farm. The proposed approach is an alternative method to the conventional eigenvalue analysis method which is widely employed for small-signal dynamic analyses of power systems. The proposed modelling approach is

Ahmadreza Tabesh

2005-01-01

55

Fractional-Slot Concentrated-Windings Synchronous Permanent Magnet Machines: Opportunities and Challenges  

Microsoft Academic Search

Fractional-slot concentrated-winding (FSCW) synchronous permanent magnet (PM) machines have been gaining interest over the last few years. This is mainly due to the several advantages that this type of windings provides. These include high-power density, high efficiency, short end turns, high slot fill factor particularly when coupled with segmented stator structures, low cogging torque, flux-weakening capability, and fault tolerance. This

Ayman M. EL-Refaie

2010-01-01

56

Winding Configurations and Optimal Stator and Rotor Pole Combination of Flux-Switching PM Brushless AC Machines  

Microsoft Academic Search

A simple analytical method is developed to compare the combinations of stator and rotor pole numbers in flux-switching permanent magnet (PM) machines in terms of back electromotive force (EMF) and electromagnetic torque. The winding connections and winding factors of machines having all poles and alternate poles wound, and different numbers of phases, from two to six, are determined by the

J. T. Chen; Z. Q. Zhu

2010-01-01

57

Armature reaction effects on a high temperature superconducting field winding of an synchronous machine: experimental results  

NASA Astrophysics Data System (ADS)

This paper presents experimental results from the Superwind laboratory setup. Particular focus in the paper has been placed on describing and quantifying the influence of armature reaction on performance of the HTS filed winding. Presented experimental results have confirmed the HTS field winding sensitivity to both armature reaction intensity and angular position with respect to the HTS coils. Furthermore, the characterization of the HTS field winding has been correlated to the electromagnetic torque of the machine where the maximal Ic reduction of 21% has been observed for the maximum torque.

Mijatovic, Nenad; Jensen, Bogi Bech

2014-05-01

58

A Basic Study of Wind Generator Stabilization with Doubly-Fed Asynchronous Machine  

NASA Astrophysics Data System (ADS)

This paper investigates the function of DASM (Doubly-fed ASynchronous Machine) with emphasis placed on its ability to the stabilization of the power system including wind generators. P (active power) and Q (reactive power) compensation from DASM can be regulated independently through secondary-excitation controlling. Simulation results by PSCAD show that DASM can restore the wind-generator system to a normal operating condition rapidly even following severe transmission-line failures. Comparison studies have also been performed between wind turbine pitch control and proposed method.

Wu, Li; Takahashi, Rion; Nakagawa, Masaki; Murata, Toshiaki; Tamura, Junji

59

Simulation of a Wind Turbine with Doubly-Fed Induction Machine Using FAST and Simulink  

Microsoft Academic Search

In order to fully study the electrical, mechanical and aerodynamic aspects of a wind turbine with a doubly-fed induction machine (DFIM), a detailed model that considers all these aspects must be used. In general, however, detailed electrical models are combined with very simple mechanical and aerodynamic models or vice versa, so that the effects of interactions between all three aspects

Roohollah Fadaeinedjad; G. Moschopoulos; M. Moallem

2006-01-01

60

Field study of the aesthetics of small wind machines: a preliminary report  

SciTech Connect

A field study was conducted at the Rocky Flats Small Wind Systems Test Center to determine if aesthetic preferences exist for particular designs of small wind machines, and to gather data on the importance of aesthetics relative to other wind system issues. Participants on public tours of the Test Center were asked to answer several general questions and to rate the visual appearance of various working parts (rotor and nacelle), towers, and complete machines. Working parts included vertical- and horizontal-axis designs (both upwind and downwind), while towers included wood, concrete and steel columns, and various truss designs. In spite of a relatively small sample size (N = 139), the results indicate definite preferences for particular designs, with downwind horizontal-axis working parts and columnar towers receiving the highest ratings.

Strojan, C. L.; Lawrence, K.; O'Donnell, D.

1980-03-01

61

Research on Potential of Advanced Technology for Housing. A Building System Based on Filament Winding and New Developments in Water and Waste Management.  

ERIC Educational Resources Information Center

The University of Michigan and Aerojet Corporation report their development of a new building system which will offer the consumer a higher quality product at lower cost. To achieve this goal, the University-Aerojet proposal suggested filament winding (a process derived from the aerospace program for the manufacture of reinforced plastic…

Michigan Univ., Ann Arbor.

62

System for Maintaining the Alignment of Mandrels in Filament Winding Operations.  

National Technical Information Service (NTIS)

The present invention is directed to a system for sensing and correcting the alignment of a mandrel being wound with filamentary material with respect to the filamentary material winding mechanism. A positioned reference pin attached to the mandrel is pos...

S. C. Robinson W. G. Dodge R. E. Pollard

1983-01-01

63

A flux-mnemonic permanent magnet brushless machine for wind power generation  

NASA Astrophysics Data System (ADS)

In this paper, the concept of flux mnemonics is newly extended to the wind power generator. By incorporating a small magnetizing winding into an outer-rotor doubly salient AlNiCo permanent magnet (PM) machine, a new flux-mnemonic PM brushless wind power generator is proposed and implemented. This generator can offer effective and efficient air-gap flux control. First, the characteristics of the proposed generator are analyzed by using the finite element method. Second, the closed-loop flux control is devised to achieve a constant generated voltage under time-varying wind speeds. Finally, the experimental results are given to verify the validity of the proposed generator and control system.

Yu, Chuang; Chau, K. T.; Jiang, J. Z.

2009-04-01

64

Analysis of a novel stator winding structure minimizing harmonic current and torque ripple for dual six-step converter-fed high power AC machines  

Microsoft Academic Search

The authors study the causes of degraded converter current when dual six-step power converters feed a dual winding induction machine drive. They proposed an end winding structure and corresponding control strategy to solve the converter current problem while retaining the advantages of the dual winding induction machine drive. Principles associated with the stator winding are discussed, and a practical implementation

Lurong Ye; Longya Xu

1993-01-01

65

System for maintaining the alignment of mandrels in filament winding operations  

DOEpatents

The present invention is directed to a system for sensing and correcting the alignment of a mandrel being wound with filamentary material with respect to the filamentary material winding mechanism. A positioned reference pin attached to the mandrel is positioned in a beam of collimated light emanating from a laser so as to bisect the light beam and create a shadow therebetween. A pair of photocells are positioned to receive the bisected light beam with the shadow uniformly located between the photocells when the pin is in a selected position. The mandrel is supported in the selected position for the winding of a filamentary material by a position adjustable roller mechanism which is coupled by a screw drive to a reversible motor. Changes in the pin position such as caused by winding growth are sensed by the photocells to provide the displacement of the roller mechanism in the direction necessary to return the mandrel to the selected position.

Robinson, Samuel C. (Clinton, TN); Dodge, William G. (Oak Ridge, TN); Pollard, Roy E. (Powell, TN)

1984-01-01

66

System for maintaining the alignment of mandrels in filament winding operations  

DOEpatents

The present invention is directed to a system for sensing and correcting the alignment of a mandrel being wound with filamentary material with respect to the filamentary material winding mechanism. A positioned reference pin attached to the mandrel is positioned in a beam of collimated light emanating from a laser so as to bisect the light beam and create a shadow therebetween. A pair of photocells are positioned to receive the bisected light beam with the shadow uniformly located between the photocells when the pin is in a selected position. The mandrel is supported in the selected position for the winding of a filamentary material by a position adjustable roller mechanism which is coupled by a screw drive to a reversible motor. Changes in the pin position such as caused by winding growth are sensed by the photocells to provide the displacement of the roller mechanism in the direction necessary to return the mandrel to the selected position.

Robinson, S.C.; Dodge, W.G.; Pollard, R.E.

1983-10-12

67

The Application Of Superconductors In The Field Windings Of Large Synchronous Machines  

Microsoft Academic Search

In this paper, past experience and present knowledge are used to speculate on the applicability of superconductors in the field windings of large synchronous machines. The prospects look quite attractive for 3600 r\\/min and 1800 r\\/min turbine generators in the range of ratings from 1000-10,000 MVA. The prospects are also bright for synchronous condensers and peaking generators provided refrigeration can

H. H. Woodson; J. L. Smith; P. Thullen; J. L. Kirtley

1971-01-01

68

Forecasting of wind speed with least squares support vector machine based on genetic algorithm  

Microsoft Academic Search

Accurate short-term wind speed forecasting is very important to improve the security and stability of power grid and to reduce the running cost. In this paper, a method based on Least squares support vector machine (LS-SVM) was proposed to the short-term forecasting. In order to avoid the blindness and inaccuracy of Parameter selection, Genetic algorithm is used to select the

Li Ran; Ke Yong-qin; Zhang Xiao-qian

2011-01-01

69

Directly driven rare-earth permanent-magnet electrical-machine prototype for wind energy applications  

Microsoft Academic Search

This paper presents finite element design and analysis of two radial-flux high-energy rare-earth permanent magnet electrical machines with new topology. It allows for short endwindings, which contributes to higher efficiency, higher power to weight ratio and low active material cost. Locating the windings in flat slots has further reduced the cost of active material. The permanent magnets are sintered NdFeB

M. S. Widyan; R. E. Hanitsch

2007-01-01

70

Effect of number of layers on performance of fractional-slot concentrated-windings interior permanent magnet machines  

Microsoft Academic Search

Interior PM machines equipped with fractional-slot concentrated-windings are good candidates for high-speed traction applications. This is mainly due to the higher power density and efficiency that can be achieved. The main challenge with this type of machines is the high rotor losses at high speeds\\/frequencies. This paper will thoroughly investigate the effect of number of winding layers on the performance

Patel. B. Reddy; Ayman. M. El-Refaie; Kum-Kang Huh

2011-01-01

71

Fault diagnosis of direct-drive wind turbine based on support vector machine  

NASA Astrophysics Data System (ADS)

A fault diagnosis method of direct-drive wind turbine based on support vector machine (SVM) and feature selection is presented. The time-domain feature parameters of main shaft vibration signal in the horizontal and vertical directions are considered in the method. Firstly, in laboratory scale five experiments of direct-drive wind turbine with normal condition, wind wheel mass imbalance fault, wind wheel aerodynamic imbalance fault, yaw fault and blade airfoil change fault are carried out. The features of five experiments are analyzed. Secondly, the sensitive time-domain feature parameters in the horizontal and vertical directions of vibration signal in the five conditions are selected and used as feature samples. By training, the mapping relation between feature parameters and fault types are established in SVM model. Finally, the performance of the proposed method is verified through experimental data. The results show that the proposed method is effective in identifying the fault of wind turbine. It has good classification ability and robustness to diagnose the fault of direct-drive wind turbine.

An, X. L.; Jiang, D. X.; Li, S. H.; Chen, J.

2011-07-01

72

Analysis and mapping of monthly wind field patterns using machine learning  

NASA Astrophysics Data System (ADS)

Spatial prediction/mapping of wind speed patterns is important for both renewable resources and natural hazards studies. Many different approaches were proposed in the literature: deterministic science-based models, geostatistical interpolations, data driven modelling based on machine learning algorithms (artificial neural networks of different architectures, support vector machines). Deterministic (science-based or physical) models suffer from computational burden and are hardly applicable over fine grids in complex regions. Geostatistical models depend on modelling of spatial correlations and are limited to the low dimensional spaces. The present study focuses on the use of machine learning algorithms for spatial mapping of monthly average wind speed in Switzerland. The real data were provided by Meteoswiss and presented complex relationships with topography. The topographic information was derived by filtering the Swiss DEM and was necessary to correctly describe wind speed patterns. Additional input variables, highlighting ridges, canyons, exposed flanks, were stacked to spatial coordinates (X, Y, Z). However, the integration of these "geo-features" considerably increased the dimensionality of the original input space (~10-30). Therefore the use of machine learning methods became crucial for providing robust nonlinear predictions of high quality. The generic methodology used includes the following important steps: exploratory spatial data analysis, including variography and detection of spatially structured patterns; automatic features selection/scaling using the adaptive/anisotropic generalized regression neural networks (GRNN); optimization of model hyper-parameters by minimizing cross-validation error using iterative gradient-based algorithms; modelling (mapping) of the functional relationships between the spatial locations and topography, comprehensive analysis of the residuals and visual interpretation of the results. It was shown that anisotropic GRNN considerably outperforms its isotropic version. Stability of adaptive GRNN in selecting features was assessed by analyzing the variance of the proposed solutions. Other observations concern the variation of the predictability of wind speed during the year: lower in summer and higher in winter. Finally, the results were compared with a support vector regression (SVR), which is a well known non-linear and robust model efficient in high dimensional spaces. The research was partly supported by SNSF project No. 200020-121835.

Robert, Sylvain; Foresti, Loris; Kanevski, Mikhail

2010-05-01

73

Eddy-current formulation for constructing transmission-line models for machine windings  

NASA Astrophysics Data System (ADS)

In this paper, an eddy-current formulation is used to determine the transmission-line parameters of a machine winding. It is shown that this formulation covers a broader frequency range than the commonly used low-frequency magnetostatic and high-frequency magnetodynamic approximations. The eddy-current formulation, however, suffers from large computation times and may lead to severe inaccuracies if the finite-element mesh does not resolve the skin depth, a modelling concern that does not exist for the traditional formulations. The three finite-element models are compared according to the accuracy of the resulting transmission-line model applied to the winding of a permanent-magnet synchronous machine. This article has been submitted as part of “NUMELEC 2008 - 6e Conférence Européenne sur les Méthodes Numériques en Électromagnétisme”, 8-10 December 2008, LiègeThis work has been carried out in the collaborative research group (Forschergruppe 575) “High-frequency parasitic effects in inverter-fed electrical drives” funded by the German Research Foundation (Deutsche Forschungsgemeinschaft, DFG).

de Gersem, H.; Henze, O.; Weiland, T.; Binder, A.

2010-03-01

74

Induction machine  

DOEpatents

A polyphase rotary induction machine for use as a motor or generator utilizing a single rotor assembly having two series connected sets of rotor windings, a first stator winding disposed around the first rotor winding and means for controlling the current induced in one set of the rotor windings compared to the current induced in the other set of the rotor windings. The rotor windings may be wound rotor windings or squirrel cage windings.

Owen, Whitney H. (Ogden, UT)

1980-01-01

75

Heat production in the windings of the stators of electric machines under stationary condition  

NASA Astrophysics Data System (ADS)

In electric machines due to high currents and resistive losses (joule heating) heat is produced. To avoid damages by overheating the design of effective cooling systems is required. Therefore the knowledge of heat sources and heat transfer processes is necessary. The purpose of this paper is to illustrate a good and effective calculation method for the temperature analysis based on homogenization techniques. These methods have been applied for the stator windings in a slot of an electric machine consisting of copper wires and resin. The key quantity here is an effective thermal conductivity, which characterizes the heterogeneous wire resin-arrangement inside the stator slot. To illustrate the applicability of the method, the analysis of a simplified, homogenized model is compared with the detailed analysis of temperature behavior inside a slot of an electric machine according to the heat generation. We considered here only the stationary situation. The achieved numerical results are accurate and show that the applied homogenization technique works in practice. Finally the results of simulations for the two cases, the original model of the slot and the homogenized model chosen for the slot (unit cell), are compared to experimental results.

Alebouyeh Samami, Behzad; Pieper, Martin; Breitbach, Gerd; Hodapp, Josef

2014-05-01

76

Fluid-structure interaction modeling of wind turbines: simulating the full machine  

NASA Astrophysics Data System (ADS)

In this paper we present our aerodynamics and fluid-structure interaction (FSI) computational techniques that enable dynamic, fully coupled, 3D FSI simulation of wind turbines at full scale, and in the presence of the nacelle and tower (i.e., simulation of the "full machine"). For the interaction of wind and flexible blades we employ a nonmatching interface discretization approach, where the aerodynamics is computed using a low-order finite-element-based ALE-VMS technique, while the rotor blades are modeled as thin composite shells discretized using NURBS-based isogeometric analysis (IGA). We find that coupling FEM and IGA in this manner gives a good combination of efficiency, accuracy, and flexibility of the computational procedures for wind turbine FSI. The interaction between the rotor and tower is handled using a non-overlapping sliding-interface approach, where both moving- and stationary-domain formulations of aerodynamics are employed. At the fluid-structure and sliding interfaces, the kinematic and traction continuity is enforced weakly, which is a key ingredient of the proposed numerical methodology. We present several simulations of a three-blade 5~MW wind turbine, with and without the tower. We find that, in the case of no tower, the presence of the sliding interface has no effect on the prediction of aerodynamic loads on the rotor. From this we conclude that weak enforcement of the kinematics gives just as accurate results as the strong enforcement, and thus enables the simulation of rotor-tower interaction (as well as other applications involving mechanical components in relative motion). We also find that the blade passing the tower produces a 10-12 % drop (per blade) in the aerodynamic torque. We feel this finding may be important when it comes to the fatigue-life analysis and prediction for wind turbine blades.

Hsu, Ming-Chen; Bazilevs, Yuri

2012-12-01

77

A hybrid topology for a variable speed wind-diesel generation system using wound rotor induction machines  

Microsoft Academic Search

In this paper a energy system topology consisting of a diesel and wind turbine generation units is presented. Wound rotor induction machines are considered to provide energy to an isolated load at constant voltage and frequency. Both generator rotor currents are vector controlled and operate at variable speed. The scheme uses a common DC bus for the voltage source PWM

Ruben Peña; Roberto Cardenas; José Proboste; Jon Clare; Greg Asher

2005-01-01

78

Investigation of Ice Shape Measurement Technique Based on Laser Sheet and Machine Vision in Icing Wind Tunnel  

Microsoft Academic Search

For the sake of developing an ice shape profilometer in icing wind tunnel, the technique of ice shape measurement based on laser sheet and machine vision is studied. The measurement principle and computing theory have been demonstrated in detail. The instrument projects a thin sheet of laser light onto an ice shape and uses high resolution CCD cameras to detect

Long Zhang; Longde Guo; Jianjun Yang

2009-01-01

79

Emulation of Wind Power with a DC Machine to Provide Input to a Doubly- Fed Induction Machine.  

National Technical Information Service (NTIS)

The behavioral modeling of a separately excited direct current (DC) motor as a prime mover for a doubly-fed induction machine (DFIM) is studied in this thesis. The output torque of the DC motor is computed in the simulation under controlled parameters. Th...

J. T. Hines

2012-01-01

80

Winding for the wind  

NASA Technical Reports Server (NTRS)

The mechanical properties and construction of epoxy-impregnated fiber-glass blades for wind turbines are discussed, along with descriptions of blades for the Mod 0A and Mod 5A WECS and design goals for a 4 kW WECS. Multicell structure combined with transverse filament tape winding reduces labor and material costs, while placing a high percentage of 0 deg fibers spanwise in the blades yields improved strength and elastic properties. The longitudinal, transverse, and shear modulus are shown to resist stresses exceeding the 50 lb/sq ft requirements, with constant stress resistance expected until fatigue failure is approached. Regression analysis indicates a fatigue life of 400 million operating cycles. The small WECS under prototype development features composite blades, nacelle, and tower. Rated at 5.7 kW in a 15 mph wind, the machine operates over a speed range of 9-53.9 mph and is expected to produce 16,200 kWh annually in a 10 mph average wind measured at 30 ft.

Weingart, O.

1981-01-01

81

Winding for the wind  

NASA Astrophysics Data System (ADS)

The mechanical properties and construction of epoxy-impregnated fiber-glass blades for wind turbines are discussed, along with descriptions of blades for the Mod 0A and Mod 5A WECS and design goals for a 4 kW WECS. Multicell structure combined with transverse filament tape winding reduces labor and material costs, while placing a high percentage of 0 deg fibers spanwise in the blades yields improved strength and elastic properties. The longitudinal, transverse, and shear modulus are shown to resist stresses exceeding the 50 lb/sq ft requirements, with constant stress resistance expected until fatigue failure is approached. Regression analysis indicates a fatigue life of 400 million operating cycles. The small WECS under prototype development features composite blades, nacelle, and tower. Rated at 5.7 kW in a 15 mph wind, the machine operates over a speed range of 9-53.9 mph and is expected to produce 16,200 kWh annually in a 10 mph average wind measured at 30 ft.

Weingart, O.

82

Experimental Method for Determining Magnetically Nonlinear Characteristics of Electric Machines With Magnetically Nonlinear and Anisotropic Iron Core, Damping Windings, and Permanent Magnets  

Microsoft Academic Search

This work presents an experimental method appropriate for determining magnetically nonlinear characteristics of electric machines which contain magnetically nonlinear and anisotropic iron core, damping windings, and permanent magnets. The method is based on the two-axis dynamic model of a three-phase machine with wye-connected three-phase stator winding. The d-axis is defined with the magnetic axis of permanent magnets (ldquoflux linkage vectorrdquo

Gorazd Stumberger; Tine Marcic; Bojan Stumberger; Drago Dolinar

2008-01-01

83

HIERARCHAL CONTROL SYSTEM FOR A VARIABLE SPEED CAGE MACHINE WIND GENERATION UNIT USING NEURAL NETWORKS  

Microsoft Academic Search

A hierarchal control strategy, that addresses three control objectives for a wind generation system, is proposed in this paper. It controls the local bus voltage (to avoid voltage rise), captures the maximum power in the wind and also minimizes the power loss in the induction generator. In the first level, given the instantaneous wind speed, electrical torque and output power,

M. Karrari; W. Rosehart; O. P. Malik

2005-01-01

84

Wind Speed Forecasting Based on Support Vector Machine with Forecasting Error Estimation  

Microsoft Academic Search

An approach of a mean hourly wind speed forecasting in wind farm is proposed in this paper. It applies support vector regression as well as forecasting error estimation. Firstly, support vector regression is applied to the mean hourly wind speed forecasting. Secondly, a support vector classifier is trained to estimate the forecasting error. Finally, the forecasting results can tailor themselves

Guo-Rui Ji; Pu Han; Yong-Jie Zhai

2007-01-01

85

Filament disappearances  

NASA Technical Reports Server (NTRS)

The phenomenon of the sudden filament disappearance (Disparition Brusque) is a familiar one to observers at H alpha telescopes. Nevertherless, the importance in Disparition Brusques (DB) continues to grow for several reasons which are cited in the discussion. It is reported that there seems to be more interest on building and maintain filaments than in destroying them. As a consequence, this sub-group is smaller than most of the others. All the same, progress in this area of filament disapperences seems steady and assured. The importance and interest in DBs is discussed and future directions are indicated.

Wagner, William J.

1986-01-01

86

An Efficient Wind–Photovoltaic Hybrid Generation System Using Doubly Excited Permanent-Magnet Brushless Machine  

Microsoft Academic Search

With ever-increasing concerns on energy issues, the development of renewable energy sources is becoming more and more attractive. This paper first reviews both the wind power and photovoltaic (PV) power generation techniques and their maximum-power-point tracking (MPPT) methods. Then, a new stand-alone wind-PV hybrid generation system is proposed for application to remote and isolated areas. For the wind power generation

Chunhua Liu; K. T. Chau; Xiaodong Zhang

2010-01-01

87

Understanding Power Electronics and Electrical Machines in Multidisciplinary Wind Energy Conversion System Courses  

ERIC Educational Resources Information Center

Wind energy conversion systems (WECS) nowadays offer an extremely wide range of topologies, including various different types of electrical generators and power converters. Wind energy is also an application of great interest to students and with a huge potential for engineering employment. Making WECS the main center of interest when teaching…

Duran, M. J.; Barrero, F.; Pozo-Ruz, A.; Guzman, F.; Fernandez, J.; Guzman, H.

2013-01-01

88

Derivation and verification of a model of the synchronous machine with rectifier with two damper windings of the direct axis  

NASA Astrophysics Data System (ADS)

Starting with the derivation of the separate models of the synchronous machine and the rectifier, a steady state model and a dynamic model are derived. The dynamic model is a global model, in which very fast phenomena, such as the ripple on the direct current, are neglected. Due to the abscence of very fast behavior the model is well suited for implementation in a control system for a wind turbine: with a minimum of computational effort the global behavior of the system can be predicted. Since the model contains a number of unknown synchronous machine parameters, a simple method was designed to estimate these parameters. It is based on the stand still step response test with the stator voltage as excitation and the stator (and rotor) currents as responses. A least squares estimator is used to estimate the parameters from the measurements. From the comparison of measured and simulated behavior of the synchronous machine with rectifier it follows that the model (in combination with the parameter estimation method) is a good description of the actual system.

Hoeijmakers, M. J.; Vleeshouwers, J. M.

1990-12-01

89

Optimization of the magnetic circuit of the homopolar inductor machine with non-overlapping concentrated windings  

Microsoft Academic Search

The present work considers issues about optimization of the tooth zone of homopolar inductor generator with non-overlapping concentrated coils. The recommendations for the choice of optimal parameters of the tooth zone are made on the basis of the analysis of magnetic field in the machine's cross-section. The results of the experiment data of the inductor generator's test sample with the

Nikolaj Levin; Svetlana Orlova; Vladislav Pugachov; Leonids Ribickis

2010-01-01

90

Final Report on Control Algorithm to Improve the Partial-Load Efficiency of Surface PM Machines with Fractional-Slot Concentrated Windings  

SciTech Connect

Surface permanent magnet (SPM) synchronous machines using fractional-slot concentrated windings are being investigated as candidates for high-performance traction machines for automotive electric propulsion systems. It has been shown analytically and experimentally that such designs can achieve very wide constant-power speed ratios (CPSR) [1,2]. This work has shown that machines of this type are capable of achieving very low cogging torque amplitudes as well as significantly increasing the machine power density [3-5] compared to SPM machines using conventional distributed windings. High efficiency can be achieved in this class of SPM machine by making special efforts to suppress the eddy-current losses in the magnets [6-8], accompanied by efforts to minimize the iron losses in the rotor and stator cores. Considerable attention has traditionally been devoted to maximizing the full-load efficiency of traction machines at their rated operating points and along their maximum-power vs. speed envelopes for higher speeds [9,10]. For example, on-line control approaches have been presented for maximizing the full-load efficiency of PM synchronous machines, including the use of negative d-axis stator current to reduce the core losses [11,12]. However, another important performance specification for electric traction applications is the machine's efficiency at partial loads. Partial-load efficiency is particularly important if the target traction application requires long periods of cruising operation at light loads that are significantly lower than the maximum drive capabilities. While the design of the machine itself is clearly important, investigation has shown that this is a case where the choice of the control algorithm plays a critical role in determining the maximum partial-load efficiency that the machine actually achieves in the traction drive system. There is no evidence that this important topic has been addressed for this type of SPM machine by any other authors. This topic takes on even greater significance for fractional-slot concentrated-winding SPM machine designs. In particular, maximizing the torque/power density of this class of SPM machines typically leads to machine designs with high numbers of poles. The resulting high electrical frequencies can easily result in high stator core losses unless special care is taken during the machine design process. The purpose of this report is to discuss a modified vector control algorithm for a fractional-slot concentrated winding SPM machine that has been developed to maximize the machine's partial-load efficiency over a wide range of operating conditions. For purposes of this discussion, a 55 kW (peak) SPM machine designed to meet requirements established in the US FreedomCar program [13] is used as the basis for demonstrating the proposed technique. A combination of closed-form analysis [14] and finite element analysis (FEA) is used during this investigation.

McKeever, John W [ORNL; Reddy, Patel [University of Wisconsin; Jahns, Thomas M [ORNL

2007-05-01

91

FINAL REPORT ON CONTROL ALGORITHM TO IMPROVE THE PARTIAL-LOAD EFFICIENCY OFSURFACE PM MACHINES WITH FRACTIONAL-SLOT CONCENTRATED WINDINGS  

SciTech Connect

Surface permanent magnet (SPM) synchronous machines using fractional-slot concentrated windings are being investigated as candidates for high-performance traction machines for automotive electric propulsion systems. It has been shown analytically and experimentally that such designs can achieve very wide constant-power speed ratios (CPSR) [1,2]. This work has shown that machines of this type are capable of achieving very low cogging torque amplitudes as well as significantly increasing the machine power density [3-5] compared to SPM machines using conventional distributed windings. High efficiency can be achieved in this class of SPM machine by making special efforts to suppress the eddy-current losses in the magnets [6-8], accompanied by efforts to minimize the iron losses in the rotor and stator cores. Considerable attention has traditionally been devoted to maximizing the full-load efficiency of traction machines at their rated operating points and along their maximum-power vs. speed envelopes for higher speeds [9,10]. For example, on-line control approaches have been presented for maximizing the full-load efficiency of PM synchronous machines, including the use of negative d-axis stator current to reduce the core losses [11,12]. However, another important performance specification for electric traction applications is the machine's efficiency at partial loads. Partial-load efficiency is particularly important if the target traction application requires long periods of cruising operation at light loads that are significantly lower than the maximum drive capabilities. While the design of the machine itself is clearly important, investigation has shown that this is a case where the choice of the control algorithm plays a critical role in determining the maximum partial-load efficiency that the machine actually achieves in the traction drive system. There is no evidence that this important topic has been addressed for this type of SPM machine by any other authors. This topic takes on even greater significance for fractional-slot concentrated-winding SPM machine designs. In particular, maximizing the torque/power density of this class of SPM machines typically leads to machine designs with high numbers of poles. The resulting high electrical frequencies can easily result in high stator core losses unless special care is taken during the machine design process. The purpose of this report is to discuss a modified vector control algorithm for a fractional-slot concentrated winding SPM machine that has been developed to maximize the machine's partial-load efficiency over a wide range of operating conditions. For purposes of this discussion, a 55 kW (peak) SPM machine designed to meet requirements established in the US FreedomCar program [13] is used as the basis for demonstrating the proposed technique. A combination of closed-form analysis [14] and finite element analysis (FEA) is used during this investigation.

Reddy, P.B.; Jahns, T.M.

2007-04-30

92

Analysis of strong nocturnal shears for wind machine design. Final report  

SciTech Connect

Wind shear data at wind turbine heights from several sites is reviewed and new data is documented in terms of total and component shear. A variety of atmospheric scenarios may combine to give large persistent shear. Among these, strong boundary layer stability is foremost. It occurs with strong nocturnal surface cooling, in low level frontal and subsidence inversions, and in thunderstorm outflows. Strong shears resulting from surface radiation inversions are particularly evident over the High Plains where dry air and high altitude combine to result in strong radiational cooling. Terrain is also an important influence on shear but it is not well understood and is very site specific.

Mahrt, L.; Heald, R.C.

1980-11-01

93

Power quality improvement of wind turbines using doubly-fed induction machines  

Microsoft Academic Search

A novel approach to modelling doubly-fed induction machines facing (distorted) ac power networks is presented. It takes place in the frequency-domain and is based on frequency coupling matrices using tensor algebra. Benefits of this comprehensible and fast modelling approach are demonstrated by establishing a feed-forward control signal that reduces stator current harmonics and torque ripple thereby improving the network compatibility

C. Saniter; R. Grune; A. Wood; R. Hanitsch

94

FUZZY LOGIC BASED INTELLIGENT CONTROL OF A VARIABLE SPEED CAGE MACHINE WIND GENERATION SYSTEM  

EPA Science Inventory

The paper describes a variable-speed wind generation system where fuzzy logic principles are used to optimize efficiency and enhance performance control. A squirrel cage induction generator feeds the power to a double-sided pulse width modulated converter system which either pump...

95

Fuzzy logic based intelligent control of a variable speed cage machine wind generation system  

Microsoft Academic Search

The paper describes a variable speed wind generation system where fuzzy logic principles are used for efficiency optimization and performance enhancement control. A squirrel cage induction generator feeds the power to a double-sided pulse width modulated converter system which pumps power to a utility grid or can supply to an autonomous system. The generation system has fuzzy logic control with

M. G. Simoes; B. K. Bose; R. J. Spiegel

1997-01-01

96

Sensorless vector control of induction machines for variable-speed wind energy applications  

Microsoft Academic Search

A sensorless vector-control strategy for an induction generator in a grid-connected wind energy conversion system is presented. The sensorless control system is based on a model reference adaptive system (MRAS) observer to estimate the rotational speed. In order to tune the MRAS observer and compensate for the parameter variation and uncertainties, a separate estimation of the speed is obtained from

Roberto Cárdenas; Rubén Peña

2004-01-01

97

Permanent-magnet machines with powdered iron cores and prepressed windings  

Microsoft Academic Search

This paper presents a permanent-magnet servomotor, built with a powdered iron stator, which has been designed to take full advantage of the properties of the material. There are a number of important design features which are not possible with laminated cores. For example, the core back is axially extended over the end windings, the armature core components are subdivided and

Alan G. Jack; Barrie C. Mecrow; Phillip G. Dickinson; Dawn Stephenson; James S. Burdess; Neville Fawcett; J. T. Evans

2000-01-01

98

FUZZY LOGIC BASED INTELLIGENT CONTROL OF A VARIABLE SPEED CAGE MACHINE WIND GENERATION SYSTEM  

EPA Science Inventory

The report gives results of a demonstration of the successful application of fuzzy logic to enhance the performance and control of a variable-speed wind generation system. A squirrel cage induction generator feeds the power to either a double-sided pulse-width modulation converte...

99

Vector controlled induction machines for stand-alone wind energy applications  

Microsoft Academic Search

This paper describes the system and control structures for vector controlled induction generators used for variable speed, wind energy conversion (WEC) systems. The paper focuses on WEC systems feeding an isolated load or weak grid since for such systems the generated voltage and power flow must be regulated by the WEC system itself and the control structures are not trivial.

R. S. Pena; R. J. Cardenas; G. M. Asher; J. C. Clare

2000-01-01

100

Machine Learning Applications for Load, Price and Wind Power Prediction in Power Systems  

Microsoft Academic Search

This paper reviews main forecasting techniques used for power system applications. Available forecasting techniques have been discussed with focus on electricity load and price forecasting as well as wind power prediction. Forecasting problems have been classified based on time frame, application specific area and forecasting techniques. Appropriate examples based on data pertaining to the Victorian electricity market, Australia and the

Michael Negnevitsky; Paras Mandal; Anurag K. Srivastava

2009-01-01

101

Detection of stator winding faults in induction machines using flux and vibration analysis  

NASA Astrophysics Data System (ADS)

This work aims at presenting the detection and diagnosis of electrical faults in the stator winding of three-phase induction motors using magnetic flux and vibration analysis techniques. A relationship was established between the main electrical faults (inter-turn short circuits and unbalanced voltage supplies) and the signals of magnetic flux and vibration, in order to identify the characteristic frequencies of those faults. The experimental results showed the efficiency of the conjugation of these techniques for detection, diagnosis and monitoring tasks. The results were undoubtedly impressive and can be adapted and used in real predictive maintenance programs in industries.

Lamim Filho, P. C. M.; Pederiva, R.; Brito, J. N.

2014-01-01

102

Graphite filament wound pressure vessels  

NASA Technical Reports Server (NTRS)

Filament wound NOL rings, 4-inch and 8-inch diameter closed-end vessels involving three epoxy resin systems and three graphite fibers were tested to develop property data and fabrication technology for filament wound graphite/epoxy pressure vessels. Vessels were subjected to single-cycle burst tests at room temperature. Manufacturing parameters were established for tooling, winding, and curing that resulted in the development of a pressure/vessel performance factor (pressure x volume/weight) or more than 900,000 in. for an oblate spheroid specimen.

Feldman, A.; Damico, J. J.

1972-01-01

103

Novel actin-like filament structure from Clostridium tetani.  

PubMed

Eukaryotic F-actin is constructed from two protofilaments that gently wind around each other to form a helical polymer. Several bacterial actin-like proteins (Alps) are also known to form F-actin-like helical arrangements from two protofilaments, yet with varied helical geometries. Here, we report a unique filament architecture of Alp12 from Clostridium tetani that is constructed from four protofilaments. Through fitting of an Alp12 monomer homology model into the electron microscopy data, the filament was determined to be constructed from two antiparallel strands, each composed of two parallel protofilaments. These four protofilaments form an open helical cylinder separated by a wide cleft. The molecular interactions within single protofilaments are similar to F-actin, yet interactions between protofilaments differ from those in F-actin. The filament structure and assembly and disassembly kinetics suggest Alp12 to be a dynamically unstable force-generating motor involved in segregating the pE88 plasmid, which encodes the lethal tetanus toxin, and thus a potential target for drug design. Alp12 can be repeatedly cycled between states of polymerization and dissociation, making it a novel candidate for incorporation into fuel-propelled nanobiopolymer machines. PMID:22514279

Popp, David; Narita, Akihiro; Lee, Lin Jie; Ghoshdastider, Umesh; Xue, Bo; Srinivasan, Ramanujam; Balasubramanian, Mohan K; Tanaka, Toshitsugu; Robinson, Robert C

2012-06-15

104

Characteristic analysis and comparison of axial flux machines according to magnetization pattern for 500 W-class wind power generator application  

NASA Astrophysics Data System (ADS)

This paper presents the electromagnetic characteristic analysis of axial flux machines applied to 500(W) class wind power generators. For the dramatic analysis time reduction, analytical method is applied, and comparative analysis is performed according to magnetization patterns of permanent magnets. Due to their structural features, quasi 3-dimensional analysis is employed, and correction function is introduced to consider the flux leakage of the machines. The analysis results are compared with the results by finite element method and experiment to validate the suggested method performed in this paper showing high reliability.

Park, Yu-Seop; Jang, Seok-Myeong; Ko, Kyoung-Jin; Choi, Jang-Young; Sung, So-Young

2012-04-01

105

Analysis and design of a coreless permanent-magnet machine considering the winding shape by using a lumped equivalent magnetic circuit model  

NASA Astrophysics Data System (ADS)

A simple and rapid analysis and design method is proposed for a coreless permanent magnet machine (CPMM) using a hexagonal winding (HW). The HW, which combines a rectangular winding (RTW) and rhombic winding (RBW), can compensate for the disadvantages and maximize the advantages of the RTW and RBW. The CPMM is typically analyzed using complex differential equations or a timeconsuming finite element analysis (FEA). To address this problem, a relatively simpler and less timeconsuming analysis method is proposed by using a lumped equivalent magnetic circuit (LEMC) model. Furthermore, an effect of winding angle on a motor performance is analyzed via precise inspection of the relationship between the variables of the HW and the characteristics of motor. The validity and usefulness of the proposed method are verified via FEA and experiment.

Seo, Jung-Moo; Jung, In-Soung; Jung, Hyun-Kyo; Ro, Jong-Suk

2014-05-01

106

Filament turbulence  

NASA Astrophysics Data System (ADS)

How much information do you need to distinguish between different mechanisms for spatiotemporal chaos in three-dimensions? In this talk, I will show that the observation of the dynamics on the surface of a medium can be sufficient. Studying mechanisms for filament turbulence in the context of reaction-diffusion media, we found numerically that two major classes of instabilities leave a very different signature on what can be observed on the surface of a three-dimensional medium. These results are of direct relevance in the context of ventricular fibrillation - a turbulent electrical wave activity that destroys the coherent contraction of the ventricular muscle and its main pumping function leading to sudden cardiac death. While it has been proposed that the three-dimensional structure of the heart plays an important role in this type of filament turbulence, only the surface of the heart is currently accessible to experimental observation preventing the study of the full dynamics. Our results suggest that such observations might be sufficient.

Davidsen, Joern

2010-03-01

107

Inrush Current Simulation of Power Transformer using Machine Parameters Estimated by Design Procedure of Winding Structure and Genetic Algorithm  

NASA Astrophysics Data System (ADS)

This paper presents estimation techniques of machine parameters for power transformer using design procedure of transformer and genetic algorithm with real coding. Especially, it is very difficult to obtain machine parameters for transformers in customers' facilities. Using estimation techniques, machine parameters could be calculated from the only nameplate data of these transformers. Subsequently, EMTP-ATP simulation of the inrush current was carried out using machine parameters estimated by techniques developed in this study and simulation results were reproduced measured waveforms.

Tokunaga, Yoshitaka

108

Automated Detection and Identification of Solar Filaments and Sunspots  

NASA Astrophysics Data System (ADS)

We developed a procedure for the automatic detection and identification of filaments and their disappearance. Full-disk H? images from the Big Bear Solar Observatory (BBSO) in California are used as the data set for our procedure. Solar images are randomly selected starting from January 1, 1999 to September 1, 2004. We present an automatic solar filament detection procedure using advanced image enhancement, segmentation, pattern recognition and mathematical morphology. This procedure not only provides the detection results of filaments, but also identifies the spines, footpoints and disappearances of filaments. Low contrast filaments are emphasize and sharpen by the stabilized inverse diffusion equation (SIDE) which was introduced by Pollak et al. (2000). Adaptive image segmentation techniques are used for selecting the threshold based on the edge and local information. To distinguish sunspot from filaments, an efficient feature-based classifier, the Support Vector Machine (SVM), is utilized. Detail filament identification is achieved by morphological thinning, pruning and adaptive edge linking methods. Finally, the filament disappearances are detected by comparing the spine and footpoints of the filaments on two consecutive days. Comparing to Gao et al. (2002) and Shih and Kowalski (2003), our procedure utilizes the image enhancement techniques to enhance the low contrast filaments, and apply advanced pattern recognition and morphology techniques to identify filament and sunspots. Our work has shown the better and more complete results than other work on the automatic filament detection.

Qu, M.; Shih, F. Y.; Jing, J.; Denker, C.; Wang, H.

2005-05-01

109

380 kW synchronous machine with HTS rotor windings––development at Siemens and first test results  

Microsoft Academic Search

Applying HTS conductors in the rotor of synchronous machines allows the design of future motors or generators that are lighter, more compact and feature an improved coefficient of performance. To address these goals a project collaboration was installed within Siemens, including Automation & Drives, Large Drives as a leading supplier of electrical machines, Corporate Technology as a competence center for

W. Nick; G. Nerowski; H.-W Neumüller; M. Frank; P van Hasselt; J. Frauenhofer; F. Steinmeyer

2002-01-01

110

Analytical Calculation of the Magnetic Field in Electrical Machines due to the Current Density in an Airgap Winding  

Microsoft Academic Search

An electrical machine was designed for an energy storage flywheel in a load-levelling system for a city bus. This machine has a slotless stator, and was designed by the use of analytical field calculations. The calculation of the field due to the current distribution in the airgap forms the main contribu- tion of this paper. The results of the analytical

S. R. Holm; H. Polinder; J. A. Ferreira; M. J. Hoeijmakers; P. van Gelder; R. Dill

111

Neural preprocessing of auditory-wind sensory signals and modular neural control for auditory- and wind-evoked escape responses of walking machines  

Microsoft Academic Search

The flying crickets Teleogryllus oceanicus have sound sensitive organs to elicit an “acoustic startle response”. Another kind of the startle response is also evident in the cockroaches Periplaneta and the crickets Gryllus bimaculatus where they use their cercal filiform hairs (wind sensitive hairs) to trigger so called “wind-evoked escape behavior”. Similarly, in this paper a setup is described where an

Poramate Manoonpong; Florentin Worgotter; Frank Pasemann

2009-01-01

112

A Comparative Evaluation of Automated Solar Filament Detection  

NASA Astrophysics Data System (ADS)

We present a comparative evaluation for automated filament detection in H? solar images. By using metadata produced by the Advanced Automated Filament Detection and Characterization Code (AAFDCC) module, we adapted our trainable feature recognition (TFR) module to accurately detect regions in solar images containing filaments. We first analyze the AAFDCC module's metadata and then transform it into labeled datasets for machine-learning classification. Visualizations of data transformations and classification results are presented and accompanied by statistical findings. Our results confirm the reliable event reporting of the AAFDCC module and establishes our TFR module's ability to effectively detect solar filaments in H? solar images.

Schuh, M. A.; Banda, J. M.; Bernasconi, P. N.; Angryk, R. A.; Martens, P. C. H.

2014-07-01

113

A Comparative Evaluation of Automated Solar Filament Detection  

NASA Astrophysics Data System (ADS)

We present a comparative evaluation for automated filament detection in H-alpha solar images. By using metadata produced by the Advanced Automated Filament Detection and Characterization Code (AAFDCC) module, we adapted our Trainable Feature Recognition (TFR) component to accurately detect regions in solar images containing filaments. We first analyze the module's metadata and then transform it into labeled datasets for machine learning classification. Visualizations of data transformations and classification results are presented and accompanied by statistical findings. Our results confirm the reliable event reporting of the AAFDCC module as well as our ability to effectively detect solar filaments with our TFR component.

Schuh, Michael; Banda, J.; Bernasconi, P.; Angryk, R.; Martens, P.

2012-05-01

114

Lens Intermediate Filaments  

PubMed Central

The ocular lens assembles two separate Intermediate Filament systems sequentially with differentiation. Canonical 8–11 nm IFs composed of Vimentin are assembled in lens epithelial cells and younger fiber cells, while the fiber cell-specific Beaded Filaments are switched on as fiber cell elongation initiates. Some of the key features of both filament systems are reviewed.

2009-01-01

115

Comparison of 5th order and 3rd order machine models for doubly fed induction generator (DFIG) wind turbines  

Microsoft Academic Search

With increasing concern over climate change, a number of countries have implemented new renewable energy targets, which require significant amounts of wind generation. It is now recognized that much of this new wind generation plant will be variable speed type using doubly fed induction generators (DFIG). In order to investigate the impacts of these DFIG installations on the operation and

J. B. Ekanayake; L. Holdsworth; N. Jenkins

2003-01-01

116

Effects of rotor eccentricity and parallel windings on induction machine behavior: a study using finite element analysis  

Microsoft Academic Search

Rotor eccentricity and the effect of parallel windings in an induction motor are investigated by means of a transient finite element model. Magnetic flux density and force distribution harmonics generated by the model are presented for the cases of static and dynamic rotor eccentricity, with various combinations of series and parallel stator winding connections. These results are compared with those

M. J. DeBortoli; S. J. Salon; D. W. Burow; C. J. Slavik

1993-01-01

117

Filament Connectivity and ``Reconnection''  

NASA Astrophysics Data System (ADS)

Stable long lived solar filaments during their lives can approach each other, merge, and form circular structures. Since filaments follow large scale polarity inversion lines of the photospheric magnetic field, their evolution reflects changes of the photospheric field distribution. On the other hand, filament interaction depends on their internal magnetic structure reviled in particular by filament chirality. Possibility of magnetic field line reconnection of neighbor filaments is discussed. Many examples of connectivity changes in a course of photospheric field evolution were found in our analysis of daily H? filtergrams for the period of maximum activity of the solar cycle 23.

Filippov, Boris

2014-01-01

118

Special issue on filamentation  

NASA Astrophysics Data System (ADS)

Journal of Physics B: Atomic, Molecular and Optical Physics is delighted to announce a forthcoming special issue on filamentation, to appear in the spring of 2015, and invites you to submit a paper. This special issue will attempt to give an overview of the present status of this field in order to create synergies and foster future developments. The issue is open to papers on the following issues: Theoretical advances on filamentation. Self-focusing and collapse. Filamentation in various media. Pulse self-compression and ultrafast processes in filaments. Molecular alignment and rotation. Filamentation tailoring. Interaction between filaments. Filament weather and pollution control. Filament induced condensation and precipitation. Terahertz science with filaments. Lasing in filaments. Filament induced molecular excitation and reaction. Electric discharge and plasma. Cross-disciplinary applications. Novel concepts related to these topics are particularly welcome. Please submit your article by 1 October 2014 (expected web publication: spring 2015) using our website http://mc04.manuscriptcentral.com/jphysb-iop. Submissions received after this date will be considered for the journal, but may not be included in the special issue. The issue will be edited by Ruxin Li, Howard Milchberg and André Mysyrowicz.

Li, Ruxin; Milchberg, Howard; Mysyrowicz, André

2014-05-01

119

Simulation study of permanent magnet synchronous machine direct drive wind power generator using three level NPC converter system  

Microsoft Academic Search

In this paper, two three-phase three-level neutral point clamped (NPC) converters connected back-to-back are used for a direct drive wind power generator. A permanent magnet synchronous generator (PMSG) is used as the generator, which is driven by the wind turbine. Main problem of voltage unbalance in each electrolyte capacitor is controlled by using a simple chopper control circuit. A simple

Ranjan K. Behera; Wenzhong Gao; Olorunfemi Ojo

2009-01-01

120

Investigation of membrane theory for planar filament wound open-ended composite ellipsoidal shells  

Microsoft Academic Search

Membrane stresses and radial displacements for a filament wound composite ellipsoidal shells with internal pressure loading are developed. The ellipsoidal shell is open at the crown and is constructed by planar filament winding. The shell thickness and material properties vary along the meridional line due to the filament windng process. The membrane stress resultants are compared to the linear and

Kurt C. Gramoll

1992-01-01

121

Wind Mills  

Microsoft Academic Search

\\u000a Over 5,000 years ago, the ancient Egyptians used wind to sail ships on the Nile River. While the proliferation of water mills\\u000a was in full swing, windmills appeared to harness more inanimate energy by employing wind sails. The wind wheel of Heron of\\u000a Alexandria marks one of the first known instances in history of wind powering a machine [1]. The

J. S. Rao

122

Externally refuelled optical filaments  

NASA Astrophysics Data System (ADS)

Plasma channels produced in air through femtosecond laser filamentation hold great promise for a number of applications, including remote sensing, attosecond physics and spectroscopy, channelling microwaves and lightning protection. In such settings, extended filaments are desirable, yet their longitudinal span is limited by dissipative processes. Although various techniques aiming to prolong this process have been explored, the substantial extension of optical filaments remains a challenge. Here, we experimentally demonstrate that the natural range of a plasma column can be enhanced by at least an order of magnitude when the filament is prudently accompanied by an auxiliary beam. In this arrangement, the secondary low-intensity `dressing' beam propagates linearly and acts as a distributed energy reservoir, continuously refuelling the optical filament. Our approach offers an efficient and viable route towards the generation of extended light strings in air without inducing premature wave collapse or an undesirable beam break-up into multiple filaments.

Scheller, Maik; Mills, Matthew S.; Miri, Mohammad-Ali; Cheng, Weibo; Moloney, Jerome V.; Kolesik, Miroslav; Polynkin, Pavel; Christodoulides, Demetrios N.

2014-04-01

123

Dressed optical filaments.  

PubMed

In this Letter we show that by appropriately providing an auxiliary "dress" beam one can extend the longevity of an optical filament by almost one order of magnitude. These optical dressed filaments can propagate substantially further by judiciously harnessing energy from their secondary beam reservoir. This possibility is theoretically investigated in air when the filament is dressed with a conically convergent annular Gaussian beam. PMID:23282826

Mills, M S; Kolesik, M; Christodoulides, D N

2013-01-01

124

A Reconfigurable Motor for Experimental Emulation of Stator Winding Interturn and Broken Bar Faults in Polyphase Induction Machines  

Microsoft Academic Search

The benefits and drawbacks of a 5-hp reconfigurable induction motor, which was designed for experimental emulation of stator winding interturn and broken rotor bar faults, are presented in this paper. It was perceived that this motor had the potential of quick and easy reconfiguration to produce the desired stator and rotor faults in a variety of different fault combinations. Hence,

Chia-Chou Yeh; Gennadi Y. Sizov; Ahmed Sayed-Ahmed; Nabeel A. O. Demerdash; Richard J. Povinelli; Edwin E. Yaz; Dan M. Ionel

2008-01-01

125

PERFORMANCE EVALUATION OF PERMANENT MAGNET SYNCHRONOUS MACHINES WITH CONCENTRATED AND DISTRIBUTED WINDINGS INCLUDING THE EFFECT OF FIELD-WEAKENING  

Microsoft Academic Search

p T T i m e p e r i o d ( s ) t T i m e ( s ) ABSTRACT U P h a s e v o l t a g e ( V ) max U Maximum line-line voltage, RMS (V) The aim of this paper is to evaluate different concentrated fractional pitch winding

Freddy Magnussen; Peter Thelin; Chandur Sadarangani

126

Lightning Protection for Rotating Machines  

Microsoft Academic Search

The high monetary value and low insulation levels of rotating machines make it necessary to employ special protection. A rotating machine can be conceived as a transmission line with distributed constants, the essential difference being that the machine winding is wound back on itself in the form of turns, which may permit high voltage across the turn-to-turn insulation. The installation

G. D. McCann; E. Beck; L. A. Finzi

1944-01-01

127

Light Scattering from Filaments  

Microsoft Academic Search

Photo realistic visualization of a huge number of individual filaments like in the case of hair, fur or knitwear, is a challenging task: Explicit rendering approaches for simulating radiance transfer at a filament get totally impracticable with respect to rendering performance, and it is also not obvious how to derive efficient scattering functions for different levels of (geometric) abstraction or

Arno Zinke; Andreas Weber

2007-01-01

128

Filament proteins/A0292  

NSDL National Science Digital Library

Cytoplasmic intermediate filaments (IF), also known as A0292, can be divided into 5 subclasses based on their biochemical properties, immunologic specificity and tissue distribution: keratin filaments in epithelial cells, vimentin filaments in cells ...

2009-04-14

129

Rapid Filamentation Zones in Intense Tropical Cyclones.  

NASA Astrophysics Data System (ADS)

Intense tropical cyclones often possess relatively little convection around their cores. In radar composites, this surrounding region is usually echo-free or contains light stratiform precipitation. While subsidence is typically quite pronounced in this region, it is not the only mechanism suppressing convection. Another possible mechanism leading to weak-echo moats is presented in this paper. The basic idea is that the strain-dominated flow surrounding an intense vortex core creates an unfavorable environment for sustained deep, moist convection. Strain-dominated regions of a tropical cyclone can be distinguished from rotation-dominated regions by the sign of S21 + S22 - 2, where S1 = ux - y and S2 = x + uy are the rates of strain and = x - uy is the relative vorticity. Within the radius of maximum tangential wind, the flow tends to be rotation-dominated (2 > S21 + S22), so that coherent structures, such as mesovortices, can survive for long periods of time. Outside the radius of maximum tangential wind, the flow tends to be strain-dominated (S21 + S22 > 2), resulting in filaments of anomalous vorticity. In the regions of strain-dominated flow the filamentation time is defined as ?fil = 2(S21 + S22 - 2)-1/2. In a tropical cyclone, an approximately 30-km-wide annular region can exist just outside the radius of maximum tangential wind, where ?fil is less than 30 min and even as small as 5 min. This region is defined as the rapid filamentation zone. Since the time scale for deep moist convective overturning is approximately 30 min, deep convection can be significantly distorted and even suppressed in the rapid filamentation zone. A nondivergent barotropic model illustrates the effects of rapid filamentation zones in category 1 5 hurricanes and demonstrates the evolution of such zones during binary vortex interaction and mesovortex formation from a thin annular ring of enhanced vorticity.

Rozoff, Christopher M.; Schubert, Wayne H.; McNoldy, Brian D.; Kossin, James P.

2006-01-01

130

Winds  

NSDL National Science Digital Library

In this problem-based learning (PBL) scenario, students prepare a presentation for investors showing how their fishing company has a significant advantage because it locates upwelling zones and fishing areas using TRMM (Tropical Rainfall Measuring Mission) and other satellite data. Prior to launching the PBL, students learn about wind: the topics of air pressure, coriolis effect, upwelling and the role of differential heating on the atmosphere are explored in classroom demonstrations. Materials required include a beaker, coffee grounds, drinking straw, balloon, flashlight, and turntable. The resource includes teacher background information, glossary, assessment rubric, and an appendix introducing problem-based learning.

131

Ten MVA air-gap armature winding: Thermal, structural and dielectric results  

SciTech Connect

This paper describes the armature winding built as part of MIT's 10 MVA superconducting generator project. The winding has a helical winding form, is an air-gap winding having no iron teeth in the active region, employs a limited voltage gradient insulation scheme and is cooled by an insulating fluid. Structurally, the winding employs bonded joints between the conductors and structural tubes, which are of filament-wound fiber-reinforced plastic. Preliminary tests indicated that thermal performance of this winding was satisfactory. On the other hand, the winding suffered a catastrophic insulation failure after only a short time at high voltage. The resulting fault gave the structural system of the armature winding (and the rest of the machine) a good test. In this paper the authors review the major aspects of the design of the winding, describe the thermal tests and then tell of the insulation failure. They can, at best, speculate about the cause of that failure, but they can, on the basis of this experience, make recommendations for further development of machines of this type.

Kirtley, J.L. Jr.; Smith, J.L. Jr.; Umans, S.D.; Hagman, W.H. (Massachusetts Inst. of Technology, Cambridge, MA (United States))

1994-06-01

132

Snake Filament Eruption  

NASA Video Gallery

A very long solar filament that had been snaking around the Sun erupted on Dec. 6, 2010 with a flourish. NASA's Solar Dynamics Observatory (SDO) caught the action in dramatic detail in extreme ultr...

133

Organelles of Filamentous Fungi  

Microsoft Academic Search

Filamentous fungi are typical eukaryotes in many respects and contain a wide range of membrane-bounded subcellular compartments\\u000a which are the sites of specialised functions. These are organelles as defined by the possession of a bounding membrane. Filamentous\\u000a fungi contain all the major organelles with the key exception of the chloroplast, which is absent from all of these non-photosynthetic\\u000a organisms. In

P. Markham

134

Mean Machines.  

ERIC Educational Resources Information Center

Suggests scales as alternative representations of numerical concepts and operations that can be used as arithmetic-mean machines, adding machines, multiplication machines, and geometric-mean machines. (ASK)

Flores, Alfinio

1998-01-01

135

Actin filament severing by cofilin.  

PubMed

Cofilin is essential for cell viability and for actin-based motility. Cofilin severs actin filaments, which enhances the dynamics of filament assembly. We investigated the mechanism of filament severing by cofilin with direct fluorescence microscopy observation of single actin filaments in real time. In cells, actin filaments are likely to be attached at multiple points along their length, and we found that attaching filaments in such a manner greatly increased the efficiency of filament severing by cofilin. Cofilin severing increased and then decreased with increasing concentration of cofilin. Together, these results indicate that cofilin severs the actin filament by a mechanism of allosteric and cooperative destabilization. Severing is more efficient when relaxation of this cofilin-induced instability of the actin filament is inhibited by restricting the flexibility of the filament. These conclusions have particular relevance to cofilin function during actin-based motility in cells and in synthetic systems. PMID:17134718

Pavlov, Dmitry; Muhlrad, Andras; Cooper, John; Wear, Martin; Reisler, Emil

2007-02-01

136

Structural design criteria for filament-wound composite shells  

NASA Technical Reports Server (NTRS)

Advanced composite cylinders, manufactured by filament winding, provide a cost effective solution to many present structural applications; however, the compressive performance of filament-wound cylinders is lower than comparable shells fabricated from unidirectional tape. The objective of this study was to determine the cause of this reduction in thin filament-wound cylinders by relating the manufacturing procedures to the quality of the cylinder and to its compressive performance. The experiments on cylinder buckling were complemented by eigenvalue buckling analysis using a detailed geometric model in a finite element analysis. The applicability of classical buckling analyses was also investigated as a design tool.

Hahn, H. T.; Jensen, D. W.; Claus, S. J.; Pai, S. P.; Hipp, P. A.

1994-01-01

137

Practical Stability of a Reluctance Synchronous Machine.  

National Technical Information Service (NTIS)

The ideal reluctance synchronous machine with dual rotor windings is modeled mathematically and simulated on a digital computer. In addition, it is demonstrated that practical stability of the machine exists when the Liapunov theorem requirements have bee...

W. U. Borger

1975-01-01

138

Simple Machines  

NSDL National Science Digital Library

Online Simple Machines Assignment OBJECTIVES: Student\\'s will be able to name and describe all seven simple machines. Students will be able to identify simple machines that they use everyday. Example: Clock = Gear INSTRUCTIONS: 1. Click on the Simple Machines Glossary page and familiarize yourself with the seven simple machines. Simple Machines Glossary Page 2. Students are to click on ...

Oldroyd, Mr.

2007-09-26

139

Filament-Filament Switching Can Be Regulated by Separation Between Filaments Together with Cargo Motor Number  

PubMed Central

How intracellular transport controls the probability that cargos switch at intersections between filaments is not well understood. In one hypothesis some motors on the cargo attach to one filament while others attach to the intersecting filament, and the ensuing tug-of-war determines which filament is chosen. We investigate this hypothesis using 3D computer simulations, and discover that switching at intersections increases with the number of motors on the cargo, but is not strongly dependent on motor number when the filaments touch. Thus, simply controlling the number of active motors on the cargo cannot account for in vivo observations that found reduced switching with increasing motor number, suggesting additional mechanisms of regulation. We use simulations to show that one possible way to regulate switching is by simultaneously adjusting the separation between planes containing the crossing filaments and the total number of active motors on the cargo. Heretofore, the effect of filament-filament separation on switching has been unexplored. We find that the switching probability decreases with increasing filament separation. This effect is particularly strong for cargos with only a modest number of motors. As the filament separation increases past the maximum head-to-head distance of the motor, individual motors walking along a filament will be unable to reach the intersecting filament. Thus, any switching requires that other motors on the cargo attach to the intersecting filament and haul the cargo along it, while motor(s) engaged on the original filament detach. Further, if the filament separation is large enough, the cargo can have difficulty proceeding along the initial filament because the engaged motors can walk underneath the intersecting filament, but the cargo itself cannot fit between the filaments. Thus, the cargo either detaches entirely from the original filament, or must dip to the side of the initial filament and then pass below the crossing filament.

Erickson, Robert P.

2013-01-01

140

On the Fatigue Analysis of Wind Turbines  

Microsoft Academic Search

Modern wind turbines are fatigue critical machines that are typically used to produce electricalpower from the wind. Operational experiences with these large rotating machines indicated thattheir components (primarily blades and blade joints) were failing at unexpectedly high rates, whichled the wind turbine community to develop fatigue analysis capabilities for wind turbines. Ourability to analyze the fatigue behavior of wind turbine

Herbert J. Sutherland

1999-01-01

141

Evolution of filament barbs.  

NASA Astrophysics Data System (ADS)

We present a selected few cases in which the sense of chirality of filament barbs changed within periods as short as hours. We investigate in detail a quiescent filament on 2003 September 10 and 11. Of its four barbs displaying such changes, only one overlays a small polarity inversion line inside the EUV filament channel (EFC). No magnetic elements with magnitude above the noise level were detected at the endpoints of all barbs. In particular, a pair of barbs first approached toward, and then departed from, each other in Halpha , with the barb endpoints migrating as far as ˜ 10 arcsec. We conclude that the evolution of the barbs was driven by flux emergence and cancellation of small bipolar units at the EFC border.

Liu, R.; Xu, Y.; Wang, H.

142

Wind at Work.  

ERIC Educational Resources Information Center

Describes a project in which students create wind machines to harness the wind's power and do mechanical work. Demonstrates kinetic and potential energy conversions and makes work and power calculations meaningful. Students conduct hands-on investigations with their machines. (DDR)

Adams, Stephen

1998-01-01

143

Introspective Machine.  

National Technical Information Service (NTIS)

An introspective machine, capable of passing judgment on its own deductive performances, is modelled and analyzed. First, the class of ideal machines which is provided with unlimited resources is studied. Since ideal introspective machines are usually unf...

G. A. W. Vreeswijk

1989-01-01

144

Kilometer range filamentation.  

PubMed

We demonstrate for the first time the possibility to generate long plasma channels up to a distance of 1 km, using the terawatt femtosecond T&T laser facility. The plasma density was optimized by adjusting the chirp, the focusing and beam diameter. The interaction of filaments with transparent and opaque targets was studied. PMID:24216905

Durand, Magali; Houard, Aurélien; Prade, Bernard; Mysyrowicz, André; Durécu, Anne; Moreau, Bernard; Fleury, Didier; Vasseur, Olivier; Borchert, Hartmut; Diener, Karsten; Schmitt, Rudiger; Théberge, Francis; Chateauneuf, Marc; Daigle, Jean-François; Dubois, Jacques

2013-11-01

145

Light scattering from filaments.  

PubMed

Photo realistic visualization of a huge number of individual filaments like in the case of hair, fur, or knitwear is a challenging task: Explicit rendering approaches for simulating radiance transfer at a filament get totally impracticable with respect to rendering performance and it is also not obvious how to derive efficient scattering functions for different levels of (geometric) abstraction or how to deal with very complex scattering mechanisms. We present a novel uniform formalism for light scattering from filaments in terms of radiance, which we call the Bidirectional Fiber Scattering Distribution Function (BFSDF). We show that previous specialized approaches, which have been developed in the context of hair rendering, can be seen as instances of the BFSDF. Similar to the role of the BSSRDF for surface scattering functions, the BFSDF can be seen as a general approach for light scattering from filaments, which is suitable for deriving approximations in a canonic and systematic way. For the frequent cases of distant light sources and observers, we deduce an efficient far field approximation (Bidirectional Curve Scattering Distribution Function, BCSDF). We show that on the basis of the BFSDF, parameters for common rendering techniques can be estimated in a non-ad-hoc, but physically-based way. PMID:17218750

Zinke, Arno; Weber, Andreas

2007-01-01

146

Protein machines and self assembly in muscle organization  

NASA Technical Reports Server (NTRS)

The remarkable order of striated muscle is the result of a complex series of protein interactions at different levels of organization. Within muscle, the thick filament and its major protein myosin are classical examples of functioning protein machines. Our understanding of the structure and assembly of thick filaments and their organization into the regular arrays of the A-band has recently been enhanced by the application of biochemical, genetic, and structural approaches. Detailed studies of the thick filament backbone have shown that the myosins are organized into a tubular structure. Additional protein machines and specific myosin rod sequences have been identified that play significant roles in thick filament structure, assembly, and organization. These include intrinsic filament components, cross-linking molecules of the M-band and constituents of the membrane-cytoskeleton system. Muscle organization is directed by the multistep actions of protein machines that take advantage of well-established self-assembly relationships. Copyright 1999 John Wiley & Sons, Inc.

Barral, J. M.; Epstein, H. F.

1999-01-01

147

Fabrication of high-performance, filament-wound, fiber-composite rings  

Microsoft Academic Search

The manufacturing methodology for the composite ring of a disk\\/ring flywheel configuration is described. The disk may be a laminated composite construction as fabricated by General Electric or a Sheet Molding Compoung (SMC) construction as fabricated by Owens Corning. The ring is a wet filament winding of graphite fiber and epoxy. The objectives of this program were to: produce filament

Hannibal

1982-01-01

148

A method for direct harvest of bacterial cellulose filaments during continuous cultivation of Acetobacter xylinum  

Microsoft Academic Search

Continuous filamentation of bacterial cellulose (BC) was successfully achieved by using shallow pan for the incubation to regulate thickness of the BC gel produced by Acetobacter xylinum. The BC filament was harvested and prepared directly by picking up BC pellicles, the thin BC gel, and winding slowly from the surface of the culture medium passed through a preliminary bactericidal washing

Nobuo Sakairi; Hisashi Asano; Masato Ogawa; Norio Nishi; Seiichi Tokura

1998-01-01

149

The Bearingless Electrical Machine  

NASA Technical Reports Server (NTRS)

Electromagnetic bearings allow the suspension of solids. For rotary applications, the most important physical effect is the force of a magnetic circuit to a high permeable armature, called the MAXWELL force. Contrary to the commonly used MAXWELL bearings, the bearingless electrical machine will take advantage of the reaction force of a conductor carrying a current in a magnetic field. This kind of force, called Lorentz force, generates the torque in direct current, asynchronous and synchronous machines. The magnetic field, which already exists in electrical machines and helps to build up the torque, can also be used for the suspension of the rotor. Besides the normal winding of the stator, a special winding was added, which generates forces for levitation. So a radial bearing, which is integrated directly in the active part of the machine, and the motor use the laminated core simultaneously. The winding was constructed for the levitating forces in a special way so that commercially available standard ac inverters for drives can be used. Besides wholly magnetic suspended machines, there is a wide range of applications for normal drives with ball bearings. Resonances of the rotor, especially critical speeds, can be damped actively.

Bichsel, J.

1992-01-01

150

ORIGIN OF THE DENSE CORE MASS FUNCTION IN CONTRACTING FILAMENTS  

SciTech Connect

Mass functions of starless dense cores (CMFs) may arise from contraction and dispersal of core-forming filaments. In an illustrative model, a filament contracts radially by self-gravity, increasing the mass of its cores. During this contraction, FUV photoevaporation and ablation by shocks and winds disperse filament gas and limit core growth. The stopping times of core growth are described by a waiting-time distribution. The initial filament column density profile and the resulting CMF each match recent Herschel observations in detail. Then low-mass cores have short growth ages and arise from the innermost filament gas, while massive cores have long growth ages and draw from more extended filament gas. The model fits the initial density profile and CMF best for mean core density 2 Multiplication-Sign 10{sup 4} cm{sup -3} and filament dispersal timescale 0.5 Myr. Then the typical core mass, radius, mean column density, and contraction speed are respectively 0.8 solar masses, 0.06 pc, 6 Multiplication-Sign 10{sup 21} cm{sup -2}, and 0.07 km s{sup -1}, also in accord with observed values.

Myers, Philip C., E-mail: pmyers@cfa.harvard.edu [Harvard-Smithsonian Center for Astrophysics, 60 Garden Street, Cambridge, MA 02138 (United States)

2013-02-20

151

Evolving Photospheric Flux Concentrations and Filament Dynamic Changes  

NASA Astrophysics Data System (ADS)

We analyze the role of weak photospheric flux concentrations that evolve in a filament channel, in the triggering of dynamic changes in the shape of a filament. The high polarimetric sensitivity of THEMIS allowed us to detect weak flux concentrations (few Gauss) associated with the filament development. The synoptic instruments (MDI, SOLIS) even if their sensitivity is much less than THEMIS were useful to follow any subsequent strengthening of these flux concentrations after their identification in the THEMIS magnetograms. We found that (1) the northern part of the filament develops an H? barb at the same time that weak minority polarity elements develop near a plage; (2) a section in the southern part of the H? filament gradually disappears and later reforms at the same time that several mixed-polarity magnetic elements appear, then subsequently cancel or spread away from each other. These changes correspond to increases in EUV emission, as observed by TRACE, EIT, and CDS. This suggests that the plasma is temporarily heated along the filament spine. An idealized sequence of force-free models of this filament channel, based on plasma-supporting magnetic dips occurring in the windings of a very weakly twisted flux tube, naturally explains the evolution of its southern part as being due to changes in the topology of the coronal magnetic field as the photospheric flux concentrations evolve.

Schmieder, B.; Aulanier, G.; Mein, P.; López Ariste, A.

2006-11-01

152

Origin of the Dense Core Mass Function in Contracting Filaments  

NASA Astrophysics Data System (ADS)

Mass functions of starless dense cores (CMFs) may arise from contraction and dispersal of core-forming filaments. In an illustrative model, a filament contracts radially by self-gravity, increasing the mass of its cores. During this contraction, FUV photoevaporation and ablation by shocks and winds disperse filament gas and limit core growth. The stopping times of core growth are described by a waiting-time distribution. The initial filament column density profile and the resulting CMF each match recent Herschel observations in detail. Then low-mass cores have short growth ages and arise from the innermost filament gas, while massive cores have long growth ages and draw from more extended filament gas. The model fits the initial density profile and CMF best for mean core density 2 × 104 cm-3 and filament dispersal timescale 0.5 Myr. Then the typical core mass, radius, mean column density, and contraction speed are respectively 0.8 solar masses, 0.06 pc, 6 × 1021 cm-2, and 0.07 km s-1, also in accord with observed values.

Myers, Philip C.

2013-02-01

153

Machine Shop Grinding Machines.  

ERIC Educational Resources Information Center

This curriculum manual is one in a series of machine shop curriculum manuals intended for use in full-time secondary and postsecondary classes, as well as part-time adult classes. The curriculum can also be adapted to open-entry, open-exit programs. Its purpose is to equip students with basic knowledge and skills that will enable them to enter the…

Dunn, James

154

Hygrothermomechanical evaluation of transverse filament tape epoxy/polyester fiberglass composites  

NASA Technical Reports Server (NTRS)

Transverse filament tape (TFT) fiberglass/epoxy and TFT polyester composites intended for low cost wind turbine blade fabrication have been subjected to static and cyclic load behavior tests whose results are presently evaluated on the basis of an integrated hygrothermomechanical response theory. Laminate testing employed simulated filament winding procedures. The results obtained show that the predicted hygrothermomechanical environmental effects on TFT composites are in good agreement with measured data for various properties, including fatigue at different R-ratio values.

Lark, R. F.; Chamis, C. C.

1984-01-01

155

Wind energy: An engineering survey  

SciTech Connect

This paper presents an extensive survey of literature about wind energy and wind machines, their design and their applications. The paper intends to provide those who plan for energy policy with thorough information about this renewable type of energy and the available machines that convert wind energy into useful mechanical or electrical work. The machines which are available at present range from the simple Savonius rotor to the powerful multi-blade windmills. The advantages and shortcomings of all types are discussed here.

Nahas, M.N.; Mohamad, A.S.; Akyurt, M.; El-Kalay, A.K.

1987-01-01

156

Power from the Wind  

ERIC Educational Resources Information Center

Wind energy is the fastest-growing renewable energy source in the world. Over the last 20 years, the wind industry has done a very good job of engineering machines, improving materials, and economies of production, and making this energy source a reality. Like all renewable energy forms, wind energy's successful application is site specific. Also,…

Roman, Harry T.

2004-01-01

157

A Review of Modern Wind Turbine Technology  

Microsoft Academic Search

This article deals with a review of modern wind turbine technology. Wind energy for electricity production today is a mature, competitive, and virtually pollution-free technology widely used in many areas of the world. Wind technology converts the energy available in wind to electricity or mechanical power through the use of wind turbines. A wind turbine is a machine for converting

M. Balat

2009-01-01

158

Structure Research and Design of Brushless Doubly-Fed Machine  

Microsoft Academic Search

Having advanced in recent years, brushless doubly fed machine (BDFM) becomes a novel AC variable frequency control machine which has a broad vista of application in wind power generation system. Researchers focus on machine structure presently. Based on accurate analysis of electromagnetism relation, this paper firstly presents double-cage stator core structure in order to improve insulation of power winding and

Xianming Deng; Guojun Tan; Xiao Zhang; Zhixun Ma

2009-01-01

159

CVD-produced boron filaments  

NASA Technical Reports Server (NTRS)

A technique for producing boron filaments with an average tensile strength of 6.89 GPa has been developed which involves longitudinal splitting of the filament and core (substrate) removal by etching. Splitting is accomplished by a pinch wheel device which continuously splits filaments in lengths of 3.0 m by applying a force to the side of the filament to create a crack which is then propagated along the axis by a gentle sliding action. To facilitate the splitting, a single 10 mil tungsten substrate is used instead of the usual 0.5 mil substrate. A solution of hot 30% hydrogen peroxide is used to remove the core without attacking the boron. An alternative technique is to alter the residual stress by heavily etching the filament. Average strengths in the 4.83-5.52 GPa range have been obtained by etching an 8 mil filament to 4 mil.

Wawner, F. E.; Debolt, H. E.; Suplinskas, R. D.

1980-01-01

160

Differential rotation of solar filaments  

NASA Technical Reports Server (NTRS)

The latitudinal component of solar differential rotation and the possibility of a radial component are discussed and compared to the observed rotational velocities of solar filaments. The author's values of rotational rate versus heliographic latitude for 100 points in the solar atmosphere derived from 17 quiescent filaments are shown to be comparable to the rates found by d'Azambuja and d'Azambuja (1948). The filament rate is significantly greater than the spot rate (Newton and Nunn, 1951); the difference cannot be accounted for by the poleward migration of filaments and seems to reflect a true radial gradient of rotational velocity in the sun. It is shown that filaments in closer proximity to active regions usually exhibit no differential rotation, while those far from active regions generally show it clearly. Comparison with Mt. Wilson photospheric Doppler measurements shows that filaments rotate faster than the general photosphere and that the spot rate exceeds that for the general photosphere.

Glackin, D. L.

1974-01-01

161

Chaperonin filaments: The archael cytoskeleton  

SciTech Connect

Chaperonins are multi-subunit double-ring complexed composed of 60-kDa proteins that are believed to mediate protein folding in vivo. The chaperonins in the hyperthermophilic archaeon Sulfolobus shibatae are composed of the organism`s two most abundant proteins, which represent 4% of its total protein and have an intracellular concentration of {ge} 3.0 mg/ml. At concentrations of 1.0 mg/ml, purified chaperonin proteins aggregate to form ordered filaments. Filament formation, which requires Mg{sup ++} and nucleotide binding (not hydrolysis), occurs at physiological temperatures under conditions suggesting filaments may exist in vivo. If the estimated 4,600 chaperonins per cell, formed filaments in vivo, they could create a matrix of filaments that would span the diameter of an average S. shibatae cell 100 times. Direct observations of unfixed, minimally treated cells by intermediate voltage electron microscopy (300 kV) revealed an intracellular network of filaments that resembles chaperonin filaments produced in vitro. The hypothesis that the intracellular network contains chaperonins is supported by immunogold analyses. The authors propose that chaperonin activity may be regulated in vivo by filament formation and that chaperonin filaments may serve a cytoskeleton-like function in archaea and perhaps in other prokaryotes.

Trent, J.D.; Kagawa, H.K.; Yaoi, Takuro; Olle, E.; Zaluzec, N.J.

1997-08-01

162

Solar Filament Extraction and Characterizing  

NASA Astrophysics Data System (ADS)

This paper presents a new method to extract and characterize solar filaments from H-alpha full-disk images produced by Big Bear Solar Observatory. A cascading Hough Transform method is designed to identify solar disk center location and radius. Solar disks are segmented from the background, and unbalanced illumination on the surface of solar disks is removed using polynomial surface fitting. And then a localized adaptive thresholding is employed to extract solar filament candidates. After the removal of small solar filament candidates, the remaining larger candidates are used as the seeds of region growing. The procedure of region growing not only connects broken filaments but also generate complete shape for each filament. Mathematical morphology thinning is adopted to produce the skeleton of each filament, and graph theory is used to prune branches and barbs to get the main skeleton. The length and the location of the main skeleton is characterized. The proposed method can help scientists and researches study the evolution of solar filament, for instance, to detect solar filament eruption. The presented method has already been used by Space Weather Research Lab of New Jersey Institute of Technology (http://swrl.njit.edu) to generate the solar filament online catalog using H-alpha full-disk images of Global H-alpha Network (http://swrl.njit.edu/ghn_web/).

Yuan, Yuan; Shih, F. Y.; Jing, J.; Wang, H.

2010-05-01

163

Wind energy utilization: A bibliography  

NASA Technical Reports Server (NTRS)

Bibliography cites documents published to and including 1974 with abstracts and references, and is indexed by topic, author, organization, title, and keywords. Topics include: Wind Energy Potential and Economic Feasibility, Utilization, Wind Power Plants and Generators, Wind Machines, Wind Data and Properties, Energy Storage, and related topics.

1975-01-01

164

Kid Machine  

NSDL National Science Digital Library

This activity is on page 3 (continued on page 2) of the pdf, part of the Simple Machines Discovery Box. In this fun activity, learners "create" a complex machine by simulating the parts in action. Learners move their bodies and make sounds as if they are individual parts of a moving machine. Then learners discover what happens when part of a machine is broken and problem solve ways to fix it.

Omsi

2004-01-01

165

Voltage transient study of wind farm under power system fault  

Microsoft Academic Search

To study the voltage transient process of the wind farm when there is fault in the power system on which the wind farm connected, constant speed wind machine with squirrel cage induction generator and variable speed wind machine with double fed induction generator were discussed based on their operation principle and structure. Two kinds of wind farms built by only

Xin-yan Zhang; Wei-qing Wang

2008-01-01

166

Electrostatic Machines  

NSDL National Science Digital Library

This website from Antonio Carlos M. De Queiroz, an associate professor at the Federal University of Rio de Janeiro, illustrates a number of different electrostatic machines. The site includes details and images of machines built by the professor as well as many other historical machines of this type. Some information is also available in Portugese.

De Queiroz, Antonio C.

2011-07-13

167

Simple Machines  

NSDL National Science Digital Library

This is an online activity about simple machines. Learners will try their hand at putting these amazing devices to work. They will use several simple machines to help "build" a tree house. This is an excellent activity to demonstrate how science - in particular, simple machines - are at work in our everyday lives.

Cosi

2000-01-01

168

Filament Eruptions, Jets, and Space Weather  

NASA Technical Reports Server (NTRS)

Previously, from chromospheric H alpha and coronal X-ray movies of the Sun's polar coronal holes, it was found that nearly all coronal jets (greater than 90%) are one or the other of two roughly equally common different kinds, different in how they erupt: standard jets and blowout jets (Yamauchi et al 2004, Apl, 605, 5ll: Moore et all 2010, Apj, 720, 757). Here, from inspection of SDO/AIA He II 304 A movies of 54 polar x-ray jets observed in Hinode/XRT movies, we report, as Moore et al (2010) anticipated, that (1) most standard x-ray jets (greater than 80%) show no ejected plasma that is cool enough (T is less than or approximately 10(exp 5K) to be seen in the He II 304 A movies; (2) nearly all blownout X-ray jets (greater than 90%) show obvious ejection of such cool plasma; (3) whereas when cool plasma is ejected in standard X-ray jets, it shows no lateral expansion, the cool plasma ejected in blowout X-ray jets shows strong lateral expansion; and (4) in many blowout X-ray jets, the cool plasma ejection displays the erupting-magnetic-rope form of clasic filament eruptions and is thereby seen to be a miniature filament eruption. The XRT movies also showed most blowout X-ray jets to be larger and brighter, and hence to apparently have more energy, than most standard X-ray jets. These observations (1) confirm the dichotomy of coronal jets, (2) agree with the Shibata model for standard jets, and (3) support the conclusion of Moore et al (2010) that in blowout jets the magnetic-arch base of the jet erupts in the manner of the much larger magnetic arcades in which the core field, the field rooted along the arcade's polarity inversion line, is sheared and twisted (sigmoid), often carries a cool-plasma filament, and erupts to blowout the arcade, producing a CME. From Hinode/SOT Ca II movies of the polar limb, Sterling et al (2010, ApJ, 714, L1) found that chromospheric Type-II spicules show a dichotomy of eruption dynamics similar to that found here for the cool-plasma component of coronal X-ray jets. This favors the idea that Type-II spicules are miniature counterparts of coronal X-ray jets. In Moore et al (2011, ApJ, 731, L18), we pointed out that if Type-II spicules are magnetic eruptions that work like coronal X-ray jets, they carry an area-averaged mechanical energy flux of approximately 7x10)(exp 5) erg cm(exp -2) s(exp-1) into the corona in the form of MHD waves and jet outflow, enough to power the heating of the global corona and solar wind. On this basis, from our observations of mini-filament eruptions in blowout X-ray jets, we infer that magnetic explosions of the type that have erupting filaments in them are the main engines of both (1) the steady solar wind and (2) the CMEs that produce the most severe space weather by blasting out through the corona and solar wind, making solar energetic particle storms, and bashing the Earth's magnetosphere. We conclude that in focusing on prominences and filament eruptions, Einar had his eye on the main bet for understanding what powers all space weather, both the extreme and the normal.

Moore, Ronald; Sterling, Alphonse; Robe, Nick; Falconer, David; Cirtain, Jonathan

2013-01-01

169

Geoeffective CMEs, Filaments, and Sigmoids  

Microsoft Academic Search

Coronal mass ejections--particularly those with flux rope structures--have the potential to trigger geomagnetic storms, depending on the properties of the flux ropes. Eruptions of both filaments and coronal sigmoids have been indicated as important drivers of space weather, and both filaments and sigmoids have been modeled with flux rope structure. However, the analysis reported by Leamon et al. (2002) suggested

D. E. McKenzie; R. J. Leamon

2004-01-01

170

FILAMENT LENGTHS IN STRIATED MUSCLE  

Microsoft Academic Search

Filament lengths in resting and excited frog muscles have been measured in the electron microscope, and investigations made of the changes in length that are found under different conditions, to distinguish between those changes which arise during preparation and the actual differences in the living muscles. It is concluded that all the measured differences in filament length are caused by

SALLY G. PAGE; H. E. HUXLEY

1963-01-01

171

Structural Analysis and Strain Monitoring of the Filament Wound Motor Case  

Microsoft Academic Search

Filament wound structures such as pressure tanks, pipes and motor cases of rockets are widely used in aerospace applications. The determination of a proper winding angle and thickness is very important to decrease manufacturing difficulties and to increase structural efficiency. In this study, possible winding angles considering the slippage between a fiber and a mandrel surface are calculated using the

Jae-Sung Park; Cheol-Ung Kim; Hyun-Kyu Kang; Chang-Sun Hong; Chun-Gon Kim

2002-01-01

172

Scanning Doppler Lidar Measurements for Wind Energy Applications  

Microsoft Academic Search

The development of wind energy has increased rapidly along with the size and capacity of wind turbines. These larger machines require detailed wind resource measurements at higher and higher altitudes. Accurate wind speed, wind direction, and turbulence statistics are required for wind resource assessment and efficient wind farm operation. Tower measurements are limited in coverage and do not provide the

R. Frehlich; N. Kelley

2008-01-01

173

Quantification of Processing Effects on Filament Wound Pressure Vessels. Revision  

NASA Technical Reports Server (NTRS)

A computational simulation procedure is described which is designed specifically for the modeling and analysis of filament wound pressure vessels. Cylindrical vessels with spherical or elliptical end caps can be generated automatically. End caps other than spherical or elliptical may be modeled by varying circular sections along the x-axis according to the end cap shape. The finite element model generated is composed of plate type quadrilateral shell elements on the entire vessel surface. This computational procedure can also be used to generate grid, connectivity and material cards (bulk data) for component parts of a larger model. These bulk data are assigned to a user designated file for finite element structural/stress analysis of composite pressure vessels. The procedure accommodates filament wound pressure vessels of all types of shells-of -revolution. It has provisions to readily evaluate initial stresses due to pretension in the winding filaments and residual stresses due to cure temperature.

Aiello, Robert A.; Chamis, Christos C.

2002-01-01

174

Quantification of Processing Effects on Filament Wound Pressure Vessels  

NASA Technical Reports Server (NTRS)

A computational simulation procedure is described which is designed specifically for the modeling and analysis of filament wound pressure vessels. Cylindrical vessels with spherical or elliptical end caps can be generated automatically. End caps other than spherical or elliptical may be modeled by varying circular sections along the x-axis according to the C C! end cap shape. The finite element model generated is composed of plate type quadrilateral shell elements on the entire vessel surface. This computational procedure can also be sued to generate grid, connectivity and material cards (bulk data) for component parts of a larger model. These bulk data are assigned to a user designated file for finite element structural/stress analysis of composite pressure vessels. The procedure accommodates filament would pressure vessels of all types of shells-of-revolution. It has provisions to readily evaluate initial stresses due to pretension in the winding filaments and residual stresses due to cure temperature.

Aiello, Robert A.; Chamis, Christos C.

1999-01-01

175

Filamentation instability of large-amplitude Alfven waves  

NASA Technical Reports Server (NTRS)

An instability that leads to the filamentation of large-amplitude Alfven waves and gives rise to purely growing density and magnetic field fluctuations is studied. The dispersion relation of the instability is derived, from which the threshold conditions and the growth rates of the instability are analyzed quantitatively for applications to the solar wind plasma. Their dependence on the filamentation spectrum, the plasma beta, and the pump frequency and intensity was examined for both right-hand and left-hand circularly polarized Alfven waves. The excitation of filamentation instability for certain cases of interest is discussed and compared with that of the parametric decay and modulation instability. The relevance of the proposed instability to some observations is discussed.

Kuo, S. P.; Whang, M. H.; Lee, M. C.

1988-01-01

176

A Bipolar Spindle Of Antiparallel ParM Filaments Drives Bacterial Plasmid Segregation  

PubMed Central

To ensure their stable inheritance by daughter cells during cell division, bacterial low copy-number plasmids make simple DNA segregating machines that use an elongating protein filament between sister plasmids. In the ParMRC system of Escherichia coli R1 plasmid, ParM, an actin-like protein, forms the spindle between ParRC complexes on sister plasmids. Using a combination of structural work and total internal reflection fluorescence microscopy, we show that ParRC bound and could accelerate growth at only one end of polar ParM filaments, mechanistically resembling eukaryotic formins. The architecture of ParM filaments enabled two ParRC-bound filaments to associate in an antiparallel orientation, forming a bipolar spindle. The spindle elongated as a bundle of at least two antiparallel filaments, thereby pushing two plasmid clusters towards the poles.

Gayathri, P.; Fujii, T.; M?ller-Jensen, J.; van den Ent, F.; Namba, K.; Lowe, J.

2013-01-01

177

A bipolar spindle of antiparallel ParM filaments drives bacterial plasmid segregation.  

PubMed

To ensure their stable inheritance by daughter cells during cell division, bacterial low-copy-number plasmids make simple DNA segregating machines that use an elongating protein filament between sister plasmids. In the ParMRC system of the Escherichia coli R1 plasmid, ParM, an actinlike protein, forms the spindle between ParRC complexes on sister plasmids. By using a combination of structural work and total internal reflection fluorescence microscopy, we show that ParRC bound and could accelerate growth at only one end of polar ParM filaments, mechanistically resembling eukaryotic formins. The architecture of ParM filaments enabled two ParRC-bound filaments to associate in an antiparallel orientation, forming a bipolar spindle. The spindle elongated as a bundle of at least two antiparallel filaments, thereby pushing two plasmid clusters toward the poles. PMID:23112295

Gayathri, P; Fujii, T; Møller-Jensen, J; van den Ent, F; Namba, K; Löwe, J

2012-12-01

178

Intermediate Filaments: A Historical Perspective  

PubMed Central

Intracellular protein filaments intermediate in size between actin microfilaments and microtubules are composed of a surprising variety of tissue specific proteins commonly interconnected with other filamentous systems for mechanical stability and decorated by a variety of proteins that provide specialized functions. The sequence conservation of the coiled-coil, alpha-helical structure responsible for polymerization into individual 10 nm filaments defines the classification of intermediate filament proteins into a large gene family. Individual filaments further assemble into bundles and branched cytoskeletons visible in the light microscope. However, it is the diversity of the variable terminal domains that likely contributes most to different functions. The search for the functions of intermediate filament proteins has led to discoveries of roles in diseases of the skin, heart, muscle, liver, brain, adipose tissues and even premature aging. The diversity of uses of intermediate filaments as structural elements and scaffolds for organizing the distribution of decorating molecules contrasts with other cytoskeletal elements. This review is an attempt to provide some recollection of how such a diverse field emerged and changed over about 30 years.

Oshima, Robert G.

2007-01-01

179

Quiet-Region Filament Eruptions  

NASA Technical Reports Server (NTRS)

We report characteristics of quiescent filament eruptions that did not produce coronal mass ejections (CMEs). It is known that there is a dichotomy of quiescent filament eruptions: those that produce CMEs and those that do not. We examined the quiescent filament eruptions, each of which was located far from disk center (greater than or equal to 0.7 R(sub Sun)) in diffuse remnant magnetic fields of decayed active regions, was well observed in Ha observations and Fe XII, and had good coronagraph coverage. We present the similarity and differences of two classes of filament eruptions. From their lack of CME production and the appearance of their eruptive motion in Fe XII movies, we conclude that the non-CME-producing filament eruptions are confined eruptions like the confined filament eruptions in active regions. We take the similarity of the confined and eruptive quiescent filament eruptions with their active-region counterparts to favor runaway tether-cutting connection for unleashing the magnetic explosion in all these eruptions.

Choudhary, Debi Prasad; Moore, Ronald L.

2004-01-01

180

High Wind Power Plants.  

National Technical Information Service (NTIS)

In comparison to the usual power plants in which the machines are installed in special buildings, the high wind power plant is described as a power source in which the structure as a whole makes up the machine. New large structures are supports for genera...

H. Honnef

1974-01-01

181

Wind energy : energy from moving air  

NSDL National Science Digital Library

This resource focuses on the renewable resource of wind energy. This brief overview of wind energy explores how moving air is managed when it is formed. This resource will address such topics as (1) What is Wind?, (2) The History of Wind, (3) Windmill Mechanics, (4) Wind Machines Today, (5) Types of Windmills, (6) Wind Power Plants, (7) Wind Resources, (8) Wind Production, (9) Wind Energy Economics, (10) Wind and the Environment, and (11) the Future of Wind. Copyright 2005 International Technology Education Association

US Department of Energy (DOE). Energy Information Administration (EIA)

2003-01-01

182

Comparative Biomechanics of Thick Filaments and Thin Filaments with Functional Consequences for Muscle Contraction  

PubMed Central

The scaffold of striated muscle is predominantly comprised of myosin and actin polymers known as thick filaments and thin filaments, respectively. The roles these filaments play in muscle contraction are well known, but the extent to which variations in filament mechanical properties influence muscle function is not fully understood. Here we review information on the material properties of thick filaments, thin filaments, and their primary constituents; we also discuss ways in which mechanical properties of filaments impact muscle performance.

Miller, Mark S.; Tanner, Bertrand C. W.; Nyland, Lori R.; Vigoreaux, Jim O.

2010-01-01

183

Precision Machining  

NSDL National Science Digital Library

Basic machining processes are introduced on a Web site that is devoted to engineering fundamentals (1). Descriptions and illustrations of drilling, turning, grinding, and other common processes are provided for people with little to no prior machining knowledge. A waterjet is a non-traditional machining technology that uses high pressure streams of water with abrasive additives rather than solid cutting instruments to slice through metal and other materials. An in-depth discussion of waterjet operation and applications is available from Southern Methodist University (2). Waterjets are often cited as being much more precise than traditional machining techniques. The Waterjet Video Vault (3) contains clips of waterjet machines in action. The video of the foam cutting procedure is especially interesting, as it shows how quick and accurate the machining process can be. An online guide to cross process machining, which incorporates elements from various conventional and unconventional techniques, is provided by the Mechanical Engineering Department at Columbia University (4). Some remarkable and innovative techniques that have surfaced over the past few years are outlined, including underwater laser machining and plasma-assisted machining. Entirely different and exotic machining techniques are required for creating microelectromechanical systems (MEMS) and other extremely small devices. The Caltech Micromachining Laboratory (5) maintains an archive of research highlights and papers on its homepage, including a paper on a MEMS-driven flapping wing for a palm-sized aerial vehicle. An online article from Modern Machine Shop (6) outlines some new technologies and research in the area of high speed machining. A particularly interesting section of the article describes a system developed at the University of Florida that aims to enable micromachining to achieve rotational speeds of standard machining processes, specifically up to a half million rotations per minute. Cutting edge waterjet innovations are the subject of a February 2003 feature from a publication of the Society of Manufacturing Engineers (7). Extremely high pressure nozzles are being developed to improve cutting speed, and enhanced software for controlling machine movements is also a focus of study. This news article (8) from June 20, 2003 describes an electrochemical machining process that is being used to fabricate complex nanostructures. The work, produced by German and U.S. researchers, has the potential to compete with current lithographic processes.

Leske, Cavin.

184

Nonplanar machines  

SciTech Connect

This talk examines methods available to minimize, but never entirely eliminate, degradation of machine performance caused by terrain following. Breaking of planar machine symmetry for engineering convenience and/or monetary savings must be balanced against small performance degradation, and can only be decided on a case-by-case basis. 5 refs.

Ritson, D. (Stanford Linear Accelerator Center, Menlo Park, CA (USA))

1989-05-01

185

Electric machine  

DOEpatents

An interior permanent magnet electric machine is disclosed. The interior permanent magnet electric machine comprises a rotor comprising a plurality of radially placed magnets each having a proximal end and a distal end, wherein each magnet comprises a plurality of magnetic segments and at least one magnetic segment towards the distal end comprises a high resistivity magnetic material.

El-Refaie, Ayman Mohamed Fawzi (Niskayuna, NY); Reddy, Patel Bhageerath (Madison, WI)

2012-07-17

186

Excavating machines  

SciTech Connect

The excavating machine has a cutter carrying boom carried by a boom support member which can be swung about an axis extending in the direction of the roadway. The machine includes a cutter unit and a stay unit each of which is releasably anchorable in the roadway and each of which can be advanced relative to the other unit.

Plummer, D.

1980-10-21

187

Machine Learning.  

ERIC Educational Resources Information Center

As scientists seek to develop machines that can "learn," that is, solve problems by imitating the human brain, a gold mine of information on the processes of human learning is being discovered, expert systems are being improved, and human-machine interactions are being enhanced. (SK)

Kirrane, Diane E.

1990-01-01

188

Machine Learning  

Microsoft Academic Search

The purpose of this chapter is to present fundamental ideas and techniques of machine learning suitable for the field of this book, i.e., for automated scientific discovery. The chapter focuses on those symbolic machine learning methods, which produce results that are suitable to be interpreted and understood by humans. This is particularly important in the context of automated scientific discovery

Achim Hoffmann; Ashesh Mahidadia

2009-01-01

189

Analysis of a novel stator winding structure minimizing harmonic current and torque ripple for dual six-step converter-fed high power AC machines  

Microsoft Academic Search

Many attempts have been made to expand the application of AC motor drives to high-power levels. One way to use AC motor drives at high-power levels is to use multiple power converters together to supply power to a large machine. For a multiple converter combination scheme, the six-step power converter is competitive due to its robust structure and simplicity of

Longya Xu; Lurong Ye

1995-01-01

190

Adjustable speed generators for wind turbines based on doubly-fed induction machines and 4-quadrant IGBT converters linked to the rotor  

Microsoft Academic Search

Wind turbines are being built at power levels above 1.5 MW. Higher power levels are being anticipated for offshore applications. To limit mechanical stresses and power surges in these high power systems, speed control is necessary. The doubly-fed induction generator (DFIG) system is investigated as a viable alternative to adjust speed over a wide range while keeping the cost of

S. Muller; M. Deicke; Rik W. De Doncker

2000-01-01

191

The Electron Emission from Thoriated Tungsten Filaments  

Microsoft Academic Search

Electron emission from tungsten filaments containing thoria.-Ten years ago the erratic behavior of some tungsten filaments was traced to the thoria present and it was discovered that by suitable treatment the filaments, containing 1 to 2 per cent of thoria, could be activated so as to give an electron emission many thousand times that of a pure tungsten filament at

Irving Langmuir

1923-01-01

192

A confined flare above filaments  

NASA Astrophysics Data System (ADS)

We present the dynamics of two filaments and a C-class flare observed in NOAA 11589 on 2012 October 16. We used the multi-wavelength high-resolution data from SDO, as well as THEMIS and ARIES ground-based observations. The observations show that the filaments are progressively converging towards each other without merging. We find that the filaments have opposite chirality which may have prevented them from merging. On October 16, a C3.3 class flare occurred without the eruption of the filaments. According to the standard solar flare model, after the reconnection, post-flare loops form below the erupting filaments whether the eruption fails or not. However, the observations show the formation of post-flare loops above the filaments, which is not consistent with the standard flare model. We analyze the topology of the active region's magnetic field by computing the quasi-separatrix layers (QSLs) using a linear force-free field extrapolation. We find a good agreement between the photospheric footprints of the QSLs and the flare ribbons. We discuss how slipping or slip-running reconnection at the QSLs may explain the observed dynamics.

Dalmasse, K.; Chandra, R.; Schmieder, B.; Aulanier, G.

2014-01-01

193

Wind Energy Systems.  

ERIC Educational Resources Information Center

During the 1920s and 1930s, millions of wind energy systems were used on farms and other locations far from utility lines. However, with passage of the Rural Electrification Act in 1939, cheap electricity was brought to rural areas. After that, the use of wind machines dramatically declined. Recently, the rapid rise in fuel prices has led to a…

Conservation and Renewable Energy Inquiry and Referral Service (DOE), Silver Spring, MD.

194

Electron emitting filaments for electron discharge devices  

DOEpatents

Electrons are copiously emitted by a device comprising a loop-shaped filament made of lanthanum hexaboride. The filament is directly heated by an electrical current produced along the filament by a power supply connected to the terminal legs of the filament. To produce a filament, a diamond saw or the like is used to cut a slice from a bar made of lanthanum hexaboride. The diamond saw is then used to cut the slice into the shape of a loop which may be generally rectangular, U-shaped, hairpin-shaped, zigzag-shaped, or generally circular. The filaments provide high electron emission at a relatively low operating temperature, such as 1600/sup 0/C. To achieve uniform heating, the filament is formed with a cross section which is tapered between the opposite ends of the filament to compensate for nonuniform current distribution along the filament due to the emission of electrons from the filament.

Leung, K.N.; Pincosy, P.A.; Ehlers, K.W.

1983-06-10

195

Electron emitting filaments for electron discharge devices  

DOEpatents

Electrons are copiously emitted by a device comprising a loop-shaped filament made of lanthanum hexaboride. The filament is directly heated by an electrical current produced along the filament by a power supply connected to the terminal legs of the filament. To produce a filament, a diamond saw or the like is used to cut a slice from a bar made of lanthanum hexaboride. The diamond saw is then used to cut the slice into the shape of a loop which may be generally rectangular, U-shaped, hairpin-shaped, zigzag-shaped, or generally circular. The filaments provide high electron emission at a relatively low operating temperature, such as 1600.degree. C. To achieve uniform heating, the filament is formed with a cross section which is tapered between the opposite ends of the filament to compensate for non-uniform current distribution along the filament due to the emission of electrons from the filament.

Leung, Ka-Ngo (Hercules, CA); Pincosy, Philip A. (Oakland, CA); Ehlers, Kenneth W. (Alamo, CA)

1988-01-01

196

The Fluid Foil: The Seventh Simple Machine  

ERIC Educational Resources Information Center

A simple machine does one of two things: create a mechanical advantage (lever) or change the direction of an applied force (pulley). Fluid foils are unique among simple machines because they not only change the direction of an applied force (wheel and axle); they convert fluid energy into mechanical energy (wind and Kaplan turbines) or vice versa,…

Mitts, Charles R.

2012-01-01

197

Hybrid Excitation of the Axial Inductor Machine  

NASA Astrophysics Data System (ADS)

The paper considers the possibility to use permanent magnets in the rotor slots of axial inductor machine with the aim to create a hybrid excitation of such a machine - from the magnets and from the excitation winding which is placed between the stator cores. The hybrid excitation allows the weight and size parameters of the machine to be improved. Under consideration is a 32 kW under-carriage generator 2?B.13.Y1.

Orlova, S.; Pugachov, V.; Levin, N.

2012-01-01

198

Electromechanical interaction in a synchronous reluctance machine  

Microsoft Academic Search

Electromagnetic forces on a whirling rotor of a synchronous reluctance machine are studied using time-discretized 2D finite-element analysis. The whirling motion generates eccentricity harmonics in the air-gap field. These harmonics may further induce circulating currents in the windings of the machine. The dynamics of the induced currents is coupled with the dynamics of the rotor, especially, when the machine is

A. Arkkio; A. Sinervo

2010-01-01

199

Scribbling Machines  

NSDL National Science Digital Library

In this activity, learners explore electronics and motion by making a Scribbling Machine, a motorized contraption that moves in unusual ways and leaves a mark to trace its path. Itâs made from simple materials and is based on the idea of motion created by an offset motor. Try using harvested motors and switches from discarded toys and electronics to make your Scribbling Machine - this not only keeps costs down, but is a playful and inventive way to explore how everyday objects work. To take the activity further, you can also incorporate PicoCrickets to make your Scribbling Machine more intelligent and to explore computers.

Exploratorium

2013-01-30

200

Wet Winding Improves Coil Encapsulation  

NASA Technical Reports Server (NTRS)

Wet-winding process encapsulates electrical coils more uniformily than conventional processes. Process requires no vacuum pump and adapts easily to existing winding machines. Encapsulant applied to each layer of wire as soon as added to coil. Wet-winding process eliminates voids, giving more uniformly encapsulated coil.

Hill, A. J.

1987-01-01

201

Wind Energy for Human Needs.  

National Technical Information Service (NTIS)

A review of the history of wind utilization is presented. Wind machines that are in use or have been considered are categorized as small when the power output is up to 2 kW; medium, up to 100 kW; and large, when output is over 100 kW. The largest wind mac...

M. F. Merriam

1974-01-01

202

Predicting Noise From Wind Turbines  

NASA Technical Reports Server (NTRS)

Computer program WINDY predicts broadband noise spectra of horizontal-axis wind-turbine generators. Enables adequate assessment of impact of broadband wind-turbine noise. Effects of turbulence, trailing-edge wakes, and bluntness taken into account. Program has practical application in design and siting of wind-turbine machines acceptable to community. Written in GW-Basic.

Grosveld, Ferdinand W.

1990-01-01

203

Effects of Multiple Filament Geometry in the Hot Filament Deposition of Diamond Films.  

National Technical Information Service (NTIS)

Scaleup of hot filament chemical vapor deposition of diamond films requires knowledge of how filament geometry affects the deposition process. The effect of multiple filament geometry on the growth rate and surface morphology of diamond films is presented...

A. Feldman E. N. Farabaugh L. H. Robins

1991-01-01

204

Electromechanical Machining.  

National Technical Information Service (NTIS)

The purpose of this work was to adapt the new process of electromechanical machining (EMM), in which metal is cut by direct contact of the tool with an electrochemically polarized workpiece, to turning and drilling. This investigation, which followed expe...

R. M. Latanision K. C. Nielsen

1976-01-01

205

Math Machines  

NSDL National Science Digital Library

The mission of the Math Machines organization is to "improve the quality of mathematical education, enhance the transfer of mathematical thinking into other classes, and increase students' ability to apply rigorous mathematics outside the classroom." Their website supports a National Science Foundation ATE grant-supported project designed to improve teaching in the areas of Mathematics, Science, and Technology at the high school and college levels. This improved learning results from using math, science, and technology principles to build and control various machines such as pointers and robots or "math machines", which are simple devices that provide an immediate, physical, dynamic expression to abstract mathematical equations. The website provides information links on Educational Theory, Classroom Activities, Project Workshops, Calculators & Programs, and Machine Construction Instructions for Building: Closed Circuits, Servo Motors, Controllers, Robot Boards and more. There is also contact information, an FAQ section, as well as upcoming events.

2010-05-18

206

Mining machine  

SciTech Connect

A haulage system for a mining machine comprises a mining machine mounted on and/or guided by a conveyor and reciprocable with respect thereto, the conveyor being provided with a rack having plural rows of teeth of identical pitch, with the teeth of one row staggered with respect to an adjacent row(s), and the machine being provided with at least one power driven haulage sprocket comprising plural sets of peripherally arranged teeth of identical pitch, one set being angularly staggered with respect to an adjacent set(s), whereby one set is engageable with each row of teeth of the rack. The invention also includes a mining machine provided with such a power driven haulage sprocket, and a rack as above described and provided with end fittings for securing in articulated manner to an adjacent rack.

Parrott, G.A.

1985-05-07

207

Monel Machining  

NASA Astrophysics Data System (ADS)

Castle Industries, Inc. is a small machine shop manufacturing replacement plumbing repair parts, such as faucet, tub and ballcock seats. Therese Castley, president of Castle decided to introduce Monel because it offered a chance to improve competitiveness and expand the product line. Before expanding, Castley sought NERAC assistance on Monel technology. NERAC (New England Research Application Center) provided an information package which proved very helpful. The NASA database was included in NERAC's search and yielded a wealth of information on machining Monel.

1983-01-01

208

Droplets engulfing on a filament  

NASA Astrophysics Data System (ADS)

Two immiscible droplets wetting on a filament may assume engulfing, partial-engulfing, or non-engulfing morphology that depends on the wetting behavior and geometries of the resulting droplet-on-filament system. This paper studies the wetting behavior of two immiscible droplets contacting and sitting symmetrically on a straight filament. A set of ordinary differential equations (ODEs) is formulated for determining the wetting morphology of the droplet-on-filament system. In the limiting case of engulfing or non-engulfing, the morphology of the droplet-on-filament system is determined in explicit form. In the case of partial-engulfing, surface finite element method is further employed for determining the wetting morphology, surface energy, and internal pressures of droplets of the system. Numerical scaling study is performed to explore their dependencies upon the wetting properties and geometries of the system. The study can be applicable for analysis and design of textiles with tailorable wetting properties and development of novel multifunctional fibrous materials for environmental protection such as oil-spill sorption, etc.

Wu, Xiang-Fa; Yu, Meng; Zhou, Zhengping; Bedarkar, Amol; Zhao, Youhao

2014-03-01

209

Machine Vision  

NSDL National Science Digital Library

An overview of a generic image-based machine vision system is provided on this Web site (1). The tutorial describes the main components of such a system, how its accuracy is measured, and what scientific and industrial applications benefit from machine vision. A more technical perspective of machine vision technology is given in an online publication of the Automated Imaging Association (2). Monthly feature articles discuss breaking issues related to machine vision, and several technical papers can be downloaded, which are sorted into categories such as three dimensional imaging and nanotechnology. Researchers from the MIT's Artificial Intelligence Laboratory (3) are investigating how to enable a computer to interpret visual and audio signals from its human user. By using machine perception systems to track the user's gaze, for example, the computer could ascertain the focus of the user's attention, thereby facilitating interaction between the human and the computer. The project's homepage includes numerous research papers, as well as video demonstrations of some of its systems. Machine vision is also finding its way into vehicles. A March 2003 news article (4) highlights a field test in Michigan of a collision avoidance system that uses, among other things, machine vision to warn drivers that they are approaching a slower or stopped object too quickly. The 3D Computer Vision Group at Carnegie Mellon University (5) is involved in several projects, including three dimensional object recognition and humanoid robot vision. Many of the group's recent publications are available for download. NASA's Mars Exploration Rovers, the second of which was launched in July 2003, have vision systems that will let them safely navigate rough terrain. These systems are described in this conference paper (6), including specifics of the stereo vision algorithm and insights into future missions. A new implementation of machine vision comes from a former researcher from Cambridge University. His shape recognition system, which is detailed in this news article (7), is reportedly much more related to human visual processes than existing techniques. For additional developments related to this evolving technology, Machine Vision News (8) has information about worldwide research and new applications of machine vision systems.

Leske, Cavin.

210

Development of Nylon Based FDM Filament for Rapid Tooling Application  

NASA Astrophysics Data System (ADS)

There has been critical need for development of cost effective nylon based wire to be used as feed stock filament for fused deposition modelling (FDM) machine. But hitherto, very less work has been reported for development of alternate solution of acrylonitrile butadiene styrene (ABS) based wire which is presently used in most of FDM machines. The present research work is focused on development of nylon based wire as an alternative of ABS wire (which is to be used as feedstock filament on FDM) without changing any hardware or software of machine. For the present study aluminium oxide (Al2O3) as additive in different proportion has been used with nylon fibre. Single screw extruder was used for wire preparation and wire thus produced was tested on FDM. Mechanical properties i.e. tensile strength and percentage elongation of finally developed wire have been optimized by Taguchi L9 technique. The work represented major development in reducing cost and time in rapid tooling applications.

Singh, R.; Singh, S.

2014-04-01

211

Rotating electric machine with fluid supported parts  

DOEpatents

A rotating electric machine in which the armature winding thereof and other parts are supported by a liquid to withstand the mechanical stresses applied during transient overloads and the like. In particular, a narrow gap is provided between the armature winding and the stator which supports it and this gap is filled with an externally pressurized viscous liquid. The liquid is externally pressurized sufficiently to balance the static loads on the armature winding. Transient mechanical loads which deform the armature winding alter the gap dimensions and thereby additionally pressurize the viscous liquid to oppose the armature winding deformation and more nearly uniformly to distribute the resulting mechanical stresses.

Smith, Jr., Joseph L. (Concord, MA); Kirtley, Jr., James L. (Brookline, MA)

1981-01-01

212

Nonequilibrium transport in superconducting filaments  

NASA Technical Reports Server (NTRS)

The step-like current-voltage characteristics of highly homogeneous single-crystalline tin and indium thin filaments has been measured. The length of the samples L approximately 1 cm was much greater than the nonequilibrium quasiparticle relaxation length Lambda. It was found that the activation of a successive i-th voltage step occurs at current significantly greater than the one derived with the assumption that the phase slip centers are weakly interacting on a scale L much greater than Lambda. The observation of 'subharmonic' fine structure on the voltage-current characteristics of tin filaments confirms the hypothesis of the long-range phase slip centers interaction.

Arutyunov, K. YU.; Danilova, N. P.; Nikolaeva, A. A.

1995-01-01

213

High torque density low speed permanent magnet machine  

Microsoft Academic Search

This paper gives different solutions in order to increase torque density of permanent magnets machines. The study deals with low frequency machines and, in this case, iron losses are less important than copper losses, so that supplying the machines with square wave currents can be interesting. The authors identify an original structure in which the end winding parts are removed.

Stephane Mouty; Abdollah Mirzaian; Frederic Gustin; Alain Berthon; Daniel Depernet; Christophe Espanet

2011-01-01

214

Horizontal wind rotor. Final technical report  

Microsoft Academic Search

A vertical axis wind machine called, ''Horizontal Wind Rotor'' conceived in 1979 by the Grantee E.J. Guard was an effort to marry a new high tech carousel type wind rotor to a basic building design for the purpose of generating practical amounts of electricty. This was directed especially towards high performance power generation, relative to low average wind velocity fields,

Guard

1983-01-01

215

Fault features of centrally integrated wind farms  

Microsoft Academic Search

With the increasing development of wind power, the capacity of wind farms is larger and its impact on grid operation has become more prominent. The fault current that wind farms provide is much different from the traditional synchronous machines. Wind farms in China are mostly centrally connected to power system. The central integration enlarges the impacts on power system. The

J. Wang; B. H. Zhang; Z. G. Hao; G. H. Li; Z. Q. Bo; David Writer; Tony Yip

2011-01-01

216

One Half Million Mile Solar Filament  

NASA Video Gallery

NASAâ??s Solar Dynamics Observatory (SDO) captures a very long, whip-like solar filament extending over half a million miles in a long arc above the sunâ??s surface. Filaments are cooler clouds of ...

217

Culture Machine  

NSDL National Science Digital Library

Culture Machine is a new, refereed, electronic journal encompassing cultural studies and cultural theory. The international editorial board of the interactive journal aims to "generat[e] research in culture and theory" by promoting and publishing "the most provocative of new work." The theme of the inaugural issue is Taking Risks with the Future. Content includes articles such as Life After Death of the Text by Johan Fornas, Cultural Studies in the Clouds: Mourning for Detail by Tadeusz Slawek, and The Future States of Politics by Kenneth Surin. Culture Machine is hosted by the University of Teesside, England.

218

Laser filamentation in chalcogenide glass  

Microsoft Academic Search

We report laser filamentation in the bulk of chalcogenide glass with femtosecond laser pulses of energy on the nanojoule level. Spatially resolved measurements of the resulting refractive index modification are presented. The study of the pulse energy and focusing condition dependencies show that channels of positive refractive index variation of several millimeter length can easily be obtained.

P. Masselin; D. Le Coq; E. Bychkov; E. Lépine; C. Lin; L. Calvez

2010-01-01

219

Wind energy conversion system  

DOEpatents

The wind energy conversion system includes a wind machine having a propeller connected to a generator of electric power, the propeller rotating the generator in response to force of an incident wind. The generator converts the power of the wind to electric power for use by an electric load. Circuitry for varying the duty factor of the generator output power is connected between the generator and the load to thereby alter a loading of the generator and the propeller by the electric load. Wind speed is sensed electro-optically to provide data of wind speed upwind of the propeller, to thereby permit tip speed ratio circuitry to operate the power control circuitry and thereby optimize the tip speed ratio by varying the loading of the propeller. Accordingly, the efficiency of the wind energy conversion system is maximized.

Longrigg, Paul (Golden, CO) [Golden, CO

1987-01-01

220

Smooth transition from wind only to wind diesel mode in an autonomous wind diesel system with a battery-based energy storage system  

Microsoft Academic Search

High wind penetration wind diesel hybrid systems (WDHS) have three modes of operation: Diesel Only (DO), Wind Diesel (WD) and Wind Only (WO). The WDHS presented in this article consists of a wind turbine generator (WTG), a diesel engine (DE), a synchronous machine (SM), the consumer load, a battery-based energy storage system (BESS), a discrete dump load (DL) and a

R. Sebastián

2008-01-01

221

Diamond film by hot filament CVD method  

NASA Technical Reports Server (NTRS)

Diamond synthesis by the hot filament CVD method is discussed. A hot filament decomposes gas mixtures and oxygen containing organic compounds such as alcohols. which are carbon sources. The resulting thin films, growth mechanisms, and characteristics and problems associated with the hot filament CVD method are analyzed and evaluated.

Hirose, Y.

1988-01-01

222

Wacky Machines  

ERIC Educational Resources Information Center

Collectors everywhere know that local antique shops and flea markets are treasure troves just waiting to be plundered. Science teachers might take a hint from these hobbyists, for the next community yard sale might be a repository of old, quirky items that are just the things to get students thinking about simple machines. By introducing some…

Fendrich, Jean

2002-01-01

223

Simple Machines  

NSDL National Science Digital Library

A webquest about simple machines Please open microsoft word and re-type or copy and paste each question and then type your answer. Be sure to include your name at the top of the page!!! . . Follow the link below and click on the Start button. Go to either the house or the tool shed and go ...

Mr.rebello

2008-11-24

224

XML Machines  

NASA Astrophysics Data System (ADS)

In order to capture the dynamics of XML databases a general model of tree-based database transformations is required. In this paper such an abstract computational model is presented, which brings together ideas from Abstract State Machines and monadic second-order logic. The model captures all XML database transformations.

Wang, Qing; Ferrarotti, Flavio A.

225

Function Machine  

NSDL National Science Digital Library

This Java applet allows learners to explore simple linear functions. Students determine the algebraic form of a linear equation by entering inputs into the machine and by looking for patterns in the outputs. The function rules available are: integers from -10 to 10 are either added to, subtracted from, or multiplied by the input x to yield the output y.

2011-01-01

226

Fatigue life prediction for wind turbines: A case study on loading spectra and parameter sensitivity.  

National Technical Information Service (NTIS)

Wind turbines are fatigue-critical machines used to produce electrical energy from the wind. These rotating machines are subjected to environmental loadings that are highly irregular in nature. Historical examples of fatigue problems in both research and ...

H. J. Sutherland P. S. Veers T. D. Ashwill

1992-01-01

227

Numerical simulation of vortex breakdown by the vortex-filament method  

NASA Technical Reports Server (NTRS)

The vortex filament method was applied to the simulation of vortex breakdown. The principal vortex region was represented by multiple filaments, and an axial velocity component was induced by a spiral winding of the filaments. First, an accuracy check was performed for a cylindrical swirling flow with simple analytical expressions for the axial and theta velocities. The result suggests that the flow field is simulated to any accuracy by increasing the number of filaments. Second, an axisymmetric type vortex breakdown was simulated, with experimental data serving as upstream conditions. The calculated axial and theta velocity contours show the breakdown of the vortex, including a rapid change in the vortex core, followed axially by a recovery zone and then a second breakdown. When three dimensional initial data are used the second breakdown appears to be of the spiral type in correspondence with experimental observations. The present method is easily used to simulate other types of vortex breakdown or other vortex flows with axial velocity.

Nakamura, Y.; Leonard, A.; Spalart, P. R.

1983-01-01

228

Design Considerations for Tubular Flux-Switching Permanent Magnet Machines  

Microsoft Academic Search

This paper describes a tubular, three-phase, flux-switching permanent magnet (PM) brushless machine that combines salient features from switched reluctance (SR) and conventional PM brushless machines. Feasible slot-pole number combinations, which are also applicable to rotary flux-switching machines, are derived. This paper also examines an alternative stator winding configuration, which is unique to the tubular machine topology. It is shown that

Jiabin Wang; Weiya Wang; Kais Atallah; David Howe

2008-01-01

229

Filament poisoning at typical carbon nanotube deposition conditions by hot-filament CVD  

Microsoft Academic Search

We report on the poisoning of tungsten filaments during the hot-filament chemical vapour deposition process at typical carbon\\u000a nanotube (CNT) deposition conditions and filament temperatures ranging from 1400 to 2000 °C. The morphological and structural\\u000a changes of the filaments were investigated using scanning electron microscopy and X-ray diffraction, respectively. Our results\\u000a conclusively show that the W-filament is not stable during the

C. J. Oliphant; C. J. Arendse; G. F. Malgas; D. E. Motaung; T. F. G. Muller; S. Halindintwali; B. A. Julies; D. Knoesen

2009-01-01

230

Fatigue testing of low-cost fiberglass composite wind turbine blade materials  

NASA Technical Reports Server (NTRS)

The static and fatigue behavior of transverse filament tape (TFT) fiberglass/epoxy and TFT/polyester composites was established by the testing of specimens cut from panels fabricated by a filament winding process used for the construction of large experimental wind turbine blades.

Hofer, K. E.; Bennett, L. C.

1981-01-01

231

Fatigue testing of low-cost fiberglass composite wind turbine blade materials  

Microsoft Academic Search

The static and fatigue behavior of transverse filament tape (TFT) fiberglass\\/epoxy and TFT\\/polyester composites was established by the testing of specimens cut from panels fabricated by a filament winding process used for the construction of large experimental wind turbine blades.

K. E. Hofer; L. C. Bennett

1981-01-01

232

Fatigue testing of low-cost fiberglass composite wind turbine blade materials  

NASA Astrophysics Data System (ADS)

The static and fatigue behavior of transverse filament tape (TFT) fiberglass/epoxy and TFT/polyester composites was established by the testing of specimens cut from panels fabricated by a filament winding process used for the construction of large experimental wind turbine blades.

Hofer, K. E.; Bennett, L. C.

1981-11-01

233

Orinetation of the Magnetic Fields in Interplanetary Flux Ropes and Solar Filaments  

Microsoft Academic Search

Coronal mass ejections are often associated with erupting magnetic structures or disappearing filaments. Majority of CMEs headed directly toward the earth are observed at 1AU as magnetic clouds --- region in the solar wind where the magnetic field strength is higher than average and smooth rotation of the magnetic field vectors. The 3D structure of magnetic clouds can be represented

Vasyl B. Yurchyshyn; Haimin Wang; P. R. Goode; Yuanyong Deng

2001-01-01

234

Orientation of the Magnetic Fields in Interplanetary Flux Ropes and Solar Filaments  

Microsoft Academic Search

Coronal mass ejections (CMEs) are often associated with erupting magnetic structures or disappearing filaments. The majority of CMEs headed directly toward the Earth are observed at 1 AU as magnetic clouds-the region in the solar wind where the magnetic field strength is higher than average and there is a smooth rotation of the magnetic field vectors. The three-dimensional structure of

Vasyl B. Yurchyshyn; Haimin Wang; Philip R. Goode; Yuanyong Deng

2001-01-01

235

Compressor Case Made With Filaments Wound With V-CAP Resin  

NASA Technical Reports Server (NTRS)

Laminated cylindrical composite-material compressor case fabricated in process that includes winding of filaments wetted with matrix resins. Prototype of light-weight composite compressor cases required to withstand internal temperatures as high as 700 degrees F. Candidates for replacing titanium compressor cases in high-temperature turbines. Weights and costs reduced.

Vannucci, Raymond; Sutter, James; Humphrey, W. Donald; Ayorinde, A. John; Eaton, Jeremy; Westerman, Ted; Allred, Ron

1996-01-01

236

The generation of optical emission-line filaments in galaxy clusters  

NASA Astrophysics Data System (ADS)

Recent data support the idea that the filaments observed in H? emission near the centres of some galaxy clusters were shaped by bulk flows within their intracluster medium (ICM). We present numerical simulations of evaporated clump material interacting with impinging winds to investigate this possibility. In each simulation, a clump falls due to gravity while the drag of a wind retards the fall of evaporated material leading to elongation of the tail. However, we find that long filaments can only form if the outflowing wind velocity is sufficiently large, ~108cms-1. Otherwise, the tail material sinks almost as quickly as the cloud. For reasonable values of parameters, the morphological structure of a tail is qualitatively similar to those observed in clusters. Under certain conditions, the kinematics of the tail resemble those reported in Hatch et al. A comparison of the observations with the numerical results indicates that the filaments are likely to be a few tens of Myr old. We also present arguments which suggest that the momentum transfer, from an outflowing wind, in the formation of these filaments is probably significant. As a result, tail formation could play a role in dissipating some of the energy injected by a central active galactic nuclei (AGN) close to the cluster centre where it is needed most. The trapping of energy by the cold gas may provide an additional feedback mechanism that helps to regulate the heating of the central regions of galaxy clusters and couple the AGN to the ICM.

Pope, Edward C. D.; Pittard, Julian M.; Hartquist, Thomas W.; Falle, Sam A. E. G.

2008-04-01

237

Analysis of filament-wound cylindrical shells under combined centrifugal, pressure and axial loading  

Microsoft Academic Search

An analytical procedure is developed to assess the stresses and deformations of filament-wound structures under loading conditions particular to centrifuge rotors and to assess the effects of wind angle variation through the centrifuge wall. This procedure is based on classical laminated plate theory and models both plane stress and plane strain states of a cylindrical shell comprising a number of

G. W. Vickers

1997-01-01

238

Drilling Machines: Vocational Machine Shop.  

ERIC Educational Resources Information Center

The lessons and supportive information in this field tested instructional block provide a guide for teachers in developing a machine shop course of study in drilling. The document is comprised of operation sheets, information sheets, and transparency masters for 23 lessons. Each lesson plan includes a performance objective, material and tools,…

Thomas, John C.

239

Investigating the impact of wake effect on wind farm aggregation  

Microsoft Academic Search

Aggregation methodologies for creating equivalent wind farm models are needed for power system transient stability studies involving large wind farms. One strong argument in the literature suggests single machine equivalent representation of wind farm with the assumption that all wind turbines receive the same incoming wind speed and thus operate at the same loading condition. In this paper, we examine

Antonios Marinopoulos; Jiuping Pan; Mahyar Zarghami; Muhamad Reza; Kalid Yunus; ChengYan Yue; Kailash Srivastava

2011-01-01

240

Active dynamics of filaments in motility assays  

NASA Astrophysics Data System (ADS)

We study the active dynamics of single and interacting cytoskeletal filaments in motility assays, in which immobilized motor proteins bind the filaments to a surface and actively pull them along this surface. We present a model which couples the overdamped dynamics of filaments, the active dynamics of motor heads, and the elasticity of motor stalks and which can be used for Langevin dynamics simulations. Single filaments perform a persistent random walk, which we characterize by several simulation results. For interacting filaments with a repulsive interaction of filaments, the motor-driven dynamics of filaments leads to a non-equilibrium phase transition which generalizes the isotropic-nematic phase transition of the corresponding equilibrium system, the hard-rod fluid. Langevin dynamics simulations and analytical theory show that the motor activity enhances the tendency for nematic ordering.

Kierfeld, J.; Frentzel, K.; Kraikivski, P.; Lipowsky, R.

2008-04-01

241

Unusual Filaments inside the Umbra  

NASA Astrophysics Data System (ADS)

We analyze several unusual filamentary structures which appeared in the umbra of one of the sunspots in AR 11302. They do not resemble typical light bridges in morphology or in evolution. We analyze data from SDO/HMI to investigate their temporal evolution, Hinode/SP for photospheric inversions, IBIS for chromospheric imaging, and SDO/AIA for the overlying corona. Photospheric inversions reveal a horizontal, inverse Evershed flow along these structures, which we call umbral filaments. Chromospheric images show brightenings and energy dissipation, while coronal images indicate that bright coronal loops seem to end in these umbral filaments. These rapidly evolving features do not seem to be common, and are possibly related to the high flare-productivity of the active region. Their analysis could help to understand the complex evolution of active regions.

Kleint, L.; Sainz Dalda, A.

2013-06-01

242

UNUSUAL FILAMENTS INSIDE THE UMBRA  

SciTech Connect

We analyze several unusual filamentary structures which appeared in the umbra of one of the sunspots in AR 11302. They do not resemble typical light bridges in morphology or in evolution. We analyze data from SDO/HMI to investigate their temporal evolution, Hinode/SP for photospheric inversions, IBIS for chromospheric imaging, and SDO/AIA for the overlying corona. Photospheric inversions reveal a horizontal, inverse Evershed flow along these structures, which we call umbral filaments. Chromospheric images show brightenings and energy dissipation, while coronal images indicate that bright coronal loops seem to end in these umbral filaments. These rapidly evolving features do not seem to be common, and are possibly related to the high flare-productivity of the active region. Their analysis could help to understand the complex evolution of active regions.

Kleint, L. [High Altitude Observatory/NCAR, P.O. Box 3000, Boulder, CO 80307 (United States); Sainz Dalda, A., E-mail: kleintl@ucar.edu [Stanford-Lockheed Institute for Space Research, Stanford University, HEPL, 466 Via Ortega, Stanford, CA 94305 (United States)

2013-06-10

243

Fullerene Machines  

NASA Technical Reports Server (NTRS)

Recent computational efforts at NASA Ames Research Center and computation and experiment elsewhere suggest that a nanotechnology of machine phase functionalized fullerenes may be synthetically accessible and of great interest. We have computationally demonstrated that molecular gears fashioned from (14,0) single-walled carbon nanotubes and benzyne teeth should operate well at 50-100 gigahertz. Preliminary results suggest that these gears can be cooled by a helium atmosphere and a laser motor can power fullerene gears if a positive and negative charge have been added to form a dipole. In addition, we have unproven concepts based on experimental and computational evidence for support structures, computer control, a system architecture, a variety of components, and manufacture. Combining fullerene machines with the remarkable mechanical properties of carbon nanotubes, there is some reason to believe that a focused effort to develop fullerene nanotechnology could yield materials with tremendous properties.

Globus, Al; Saini, Subhash

1998-01-01

244

Fullerene Machines  

NASA Technical Reports Server (NTRS)

Fullerenes possess remarkable properties and many investigators have examined the mechanical, electronic and other characteristics of carbon SP2 systems in some detail. In addition, C-60 can be functionalized with many classes of molecular fragments and we may expect the caps of carbon nanotubes to have a similar chemistry. Finally, carbon nanotubes have been attached to t he end of scanning probe microscope (Spill) tips. Spills can be manipulated with sub-angstrom accuracy. Together, these investigations suggest that complex molecular machines made of fullerenes may someday be created and manipulated with very high accuracy. We have studied some such systems computationally (primarily functionalized carbon nanotube gears and computer components). If such machines can be combined appropriately, a class of materials may be created that can sense their environment, calculate a response, and act. The implications of such hypothetical materials are substantial.

Globus, Al; Saini, Subhash (Technical Monitor)

1998-01-01

245

Mechanics of vimentin intermediate filaments  

NASA Technical Reports Server (NTRS)

It is increasingly evident that the cytoskeleton of living cells plays important roles in mechanical and biological functions of the cells. Here we focus on the contribution of intermediate filaments (IFs) to the mechanical behaviors of living cells. Vimentin, a major structural component of IFs in many cell types, is shown to play an important role in vital mechanical and biological functions such as cell contractility, migration, stiffness, stiffening, and proliferation.

Wang, Ning; Stamenovic, Dimitrijie

2002-01-01

246

Simple Machines  

NSDL National Science Digital Library

Can you identify the six types of simple machines? 1. What do you know about Inclined Planes? Draw an example on your graphic organizer and state one fact.Inclined Plane 2. What do you know about levers? Draw an example on your graphic organizer and state one fact.Lever. 3. What do you know about pulleys? Draw an example on your graphic organizer and ...

Stewart, Miss

2010-03-24

247

Living Machines  

Microsoft Academic Search

\\u000a Ecological studies have revealed that nature has an in-built system to restore itself, thereby sustaining its continuity.\\u000a In other words, natural ecosystems can act as “Living Machines” in keeping the ecosystems habitable. The biological communities\\u000a – microbes, plants, and animals – serve as the driving force of several living technological innovations – constructed wetlands,\\u000a Lake Restores, Eco-Restorers, and Reedbeds. These

Yung-Tse Hung; Joseph F. Hawumba; Lawrence K. Wang

248

Wind Energy Conversion Using a Self-Excited Induction Generator  

Microsoft Academic Search

A wind energy conversion scheme using an induction machine driven by a variable speed wind turbine is described. Excitation control has been obtained by employing a single value capacitor and thyristor controlled inductor. Wind speed cube law is proposed to be followed in loading the induction machine for maximising energy conversion. Performance characteristics of the generation scheme have been evaluated

G. Raina; O. P. Malik

1983-01-01

249

The heat and cooling of electronically switching synchronous machine as a main drive of a car  

Microsoft Academic Search

The electromobil or hybrid-electromobil is equipped by an electric machine. This machine can work in a generator mode or in a motor mode. Because the size and weight of this type of machine are very limited, it is necessary (during the drive) to overload this machine for a short time. Consequently, the cooling system, the winding insulation system and power

Bohumil Skala

2011-01-01

250

Cortactin promotes and stabilizes Arp2/3-induced actin filament network formation.  

PubMed

Cortactin is a c-src substrate associated with sites of dynamic actin assembly at the leading edge of migrating cells. We previously showed that cortactin binds to Arp2/3 complex, the essential molecular machine for nucleating actin filament assembly. In this study, we demonstrate that cortactin activates Arp2/3 complex based on direct visualization of filament networks and pyrene actin assays. Strikingly, cortactin potently inhibited the debranching of filament networks. When cortactin was added in combination with the active VCA fragment of N-WASp, they synergistically enhanced Arp2/3-induced actin filament branching. The N-terminal acidic and F-actin binding domains of cortactin were both necessary to activate Arp2/3 complex. These results support a model in which cortactin modulates actin filament dendritic nucleation by two mechanisms, (1) direct activation of Arp2/3 complex and (2) stabilization of newly generated filament branch points. By these mechanisms, cortactin may promote the formation and stabilization of the actin network that drives protrusion at the leading edge of migrating cells. PMID:11267876

Weaver, A M; Karginov, A V; Kinley, A W; Weed, S A; Li, Y; Parsons, J T; Cooper, J A

2001-03-01

251

Actin filament curvature biases branching direction  

PubMed Central

Mechanical cues affect many important biological processes in metazoan cells, such as migration, proliferation, and differentiation. Such cues are thought to be detected by specialized mechanosensing molecules linked to the cytoskeleton, an intracellular network of protein filaments that provide mechanical rigidity to the cell and drive cellular shape change. The most abundant such filament, actin, forms branched networks nucleated by the actin-related protein (Arp) 2/3 complex that support or induce membrane protrusions and display adaptive behavior in response to compressive forces. Here we show that filamentous actin serves in a mechanosensitive capacity itself, by biasing the location of actin branch nucleation in response to filament bending. Using an in vitro assay to measure branching from curved sections of immobilized actin filaments, we observed preferential branch formation by the Arp2/3 complex on the convex face of the curved filament. To explain this behavior, we propose a fluctuation gating model in which filament binding or branch nucleation by Arp2/3 occur only when a sufficiently large, transient, local curvature fluctuation causes a favorable conformational change in the filament, and we show with Monte Carlo simulations that this model can quantitatively account for our experimental data. We also show how the branching bias can reinforce actin networks in response to compressive forces. These results demonstrate how filament curvature can alter the interaction of cytoskeletal filaments with regulatory proteins, suggesting that direct mechanotransduction by actin may serve as a general mechanism for organizing the cytoskeleton in response to force.

Risca, Viviana I.; Wang, Evan B.; Chaudhuri, Ovijit; Chia, Jia Jun; Geissler, Phillip L.; Fletcher, Daniel A.

2012-01-01

252

The state of wind energy development overseas  

SciTech Connect

A brief ''grand tour'' of current wind machine development overseas is given. The International Energy Agency Agreement on Wind Energy R and D of 1978 and the IEA for Cooperation on Large Scale wind energy systems are outlined. Several examples of small machines in Denmark and Sweden are shown. The high technology approach of Germany features the 100 meter diameter Growian I, the largest windmill yet built, in Bremerhaven, on the North Sea. Development in the UK and Canada are also touched upon.

Divone, L.V.

1983-06-01

253

TEMPO machine  

SciTech Connect

TEMPO is a transformer powered megavolt pulse generator with an output pulse of 100 ns duration. The machine was designed for burst mode operation at pulse repetition rates up to 10 Hz with minimum pulse-to-pulse voltage variations. To meet the requirement for pulse duration a nd a 20-..omega.. output impedance within reasonable size constraints, the pulse forming transmission line was designed as two parallel water-insulated, strip-type Blumleins. Stray capacitance and electric fields along the edges of the line elements were controlled by lining the tank with plastic sheet.

Rohwein, G.J.; Lancaster, K.T.; Lawson, R.N.

1986-06-01

254

Biophysics of Actin Filament Severing by Cofilin  

PubMed Central

The continuous assembly and disassembly of actin filament networks is vital for cellular processes including division, growth, and motility. Network remodeling is facilitated by cofilins, a family of essential regulatory proteins that fragment actin filaments. Cofilin induces net structural changes in filaments that render them more compliant in bending and twisting. A model in which local stress accumulation at mechanical discontinuities, such as boundaries of bare and cofilin-decorated filament segments, accounts for the cofilin concentration dependence of severing, including maximal activity at sub-stoichiometric binding densities. Real-time imaging of cofilin-mediated filament severing supports the boundary-fracture model. The severing model predicts that fragmentation is promoted by factors modulating filament mechanics (e.g. tethering, cross-linking, or deformation), possibly explaining enhanced in vivo severing activities.

Elam, W. Austin; Kang, Hyeran; De La Cruz, Enrique M.

2014-01-01

255

Femtosecond Laser Filamentation for Atmospheric Sensing  

PubMed Central

Powerful femtosecond laser pulses propagating in transparent materials result in the formation of self-guided structures called filaments. Such filamentation in air can be controlled to occur at a distance as far as a few kilometers, making it ideally suited for remote sensing of pollutants in the atmosphere. On the one hand, the high intensity inside the filaments can induce the fragmentation of all matters in the path of filaments, resulting in the emission of characteristic fluorescence spectra (fingerprints) from the excited fragments, which can be used for the identification of various substances including chemical and biological species. On the other hand, along with the femtosecond laser filamentation, white-light supercontinuum emission in the infrared to UV range is generated, which can be used as an ideal light source for absorption Lidar. In this paper, we present an overview of recent progress concerning remote sensing of the atmosphere using femtosecond laser filamentation.

Xu, Huai Liang; Chin, See Leang

2011-01-01

256

Evolution of Barb Angle and Filament Eruption  

NASA Astrophysics Data System (ADS)

H? observations of a quiescent U-shaped filament were obtained at Big Bear Solar Observatory and at Hida Observatory with the Flare Monitoring Telescope. The filament was located in the southern hemisphere on 1998 November 4. We study the evolution of the angle of a barb with respect to the axis of the filament and find the evolution can be divided into two phases: a rise from the acute phase to the obtuse phase and a fall. Thus, this indicates that the chirality of this barb changes with time. Moreover, in the process of evolution, we find that interconnection of the part of the filament bearing the barb with the whole filament became either weakened or strengthened. We impute the final eruption of the filament to the chirality evolution of the barb.

Su, J. T.; Liu, Y.; Zhang, H. Q.; Kurokawa, H.; Yurchyshyn, V.; Shibata, K.; Bao, X. M.; Wang, G. P.; Li, C.

2005-09-01

257

Apparatus for cooling an electric machine  

DOEpatents

Provided is an apparatus, for example, for use with a rotating electric machine, that includes a housing. The housing can include a housing main portion and a housing end portion. The housing main portion can be configured to be disposed proximal to a body portion of a stator section of an electric machine. The housing main portion can define a main fluid channel that is configured to conduct fluid therethrough. The housing end portion can receive fluid from said main fluid channel and direct fluid into contact with a winding end portion of a conductive winding of the stator section.

Palafox, Pepe; Gerstler, William Dwight; Shen, Xiaochun; El-Refaie, Ayman Mohamed Fawzi; Lokhandwalla, Murtuza; Salasoo, Lembit

2013-07-16

258

Plasticity of Intermediate Filament Subunits  

PubMed Central

Intermediate filaments (IFs) assembled in vitro from recombinantly expressed proteins have a diameter of 8–12 nm and can reach several micrometers in length. IFs assemble from a soluble pool of subunits, tetramers in the case of vimentin. Upon salt addition, the subunits form first unit length filaments (ULFs) within seconds and then assembly proceeds further by end-to-end fusion of ULFs and short filaments. So far, IF subunits have mainly been observed by electron microscopy of glycerol sprayed and rotary metal shadowed specimens. Due to the shear forces during spraying the IF subunits appear generally as straight thin rods. In this study, we used atomic force microscopy (AFM), cryo-electron microscopy (cryo-EM) combined with molecular modeling to investigate the conformation of the subunits of vimentin, desmin and keratin K5/K14 IFs in various conditions. Due to their anisotropic shape the subunits are difficult to image at high resolution by cryo-EM. In order to enhance contrast we used a cryo-negative staining approach. The subunits were clearly identified as thin, slightly curved rods. However the staining agent also forced the subunits to aggregate into two-dimensional networks of dot-like structures. To test this conformational change further, we imaged dried unfixed subunits on mica by AFM revealing a mixture of extended and dot-like conformations. The use of divalent ions such as calcium and magnesium, as well as glutaraldehyde exposure favored compact conformations over elongated ones. These experimental results as well as coarse-grained molecular dynamics simulations of a vimentin tetramer highlight the plasticity of IF subunits.

Hoenger, Andrea; Buehler, Markus J.; Kreplak, Laurent

2010-01-01

259

Studies on UV filaments in air  

SciTech Connect

UV filaments in air have been examined on the basis of the diameter and length of the filament, the generation of new spectral components, and the ionization by multiphoton processes. There have been numerous observations of filaments at 800 nm. The general perception is that, above a critical power, the beam focuses because nonlinear self-lensing overcomes diffraction. The self-focusing proceeds until an opposing higher order nonlinearity forms a stable balance.

Schwarz, J.; Rambo, P.; Diels, J.C.; Luk, T.S.; Bernstein, A.C.; Cameron, S.M.

2000-01-05

260

Experimental study of current filamentation instability.  

PubMed

Current filamentation instability is observed and studied in a laboratory environment with a 60 MeV electron beam and a plasma capillary discharge. Multiple filaments are observed and imaged transversely at the plasma exit with optical transition radiation. By varying the plasma density the transition between single and multiple filaments is found to be k(p)?(r)~2.2. Scaling of the transverse filament size with the plasma skin depth is predicted in theory and observed over a range of plasma densities. Lowering the bunch charge, and thus the bunch density, suppresses the instability. PMID:23215291

Allen, B; Yakimenko, V; Babzien, M; Fedurin, M; Kusche, K; Muggli, P

2012-11-01

261

Sensing combustion intermediates by femtosecond filament excitation.  

PubMed

Simultaneous monitoring of multiple combustion intermediates using femtosecond filament-induced nonlinear spectroscopy is demonstrated. Clean fluorescence emissions from free radicals CH, CN, NH, OH, and C(2), as well as atomic C and H, are observed when a femtosecond filament is formed in the laminar ethanol/air flame on an alcohol burner. The fluorescence signals of these species are found to vary as functions of the position of interaction of the filament with the flame along the vertical axis of the central combusting flow, opening up a possibility for remote combustion diagnostic in engines by the excitation of femtosecond laser filament. PMID:23595448

Li, He-Long; Xu, Huai-Liang; Yang, Bo-Si; Chen, Qi-Dai; Zhang, Tao; Sun, Hong-Bo

2013-04-15

262

Observations of an active region filament  

NASA Astrophysics Data System (ADS)

An active region filament was well observed on September 4, 2002 with THEMIS at the Teide observatory and SOHO/MDI. The full Stokes parameters of the filament were obtained in H? and FeI 6302 Å lines. Using the data, we have studied the fine structure of the filament and obtained the parameters at the barb endpoints, including intensity, velocity and longitudinal magnetic field. Our results indicate: (a) the Doppler velocities are quiet different at barb endpoints; (b) the longitudinal magnetic fields at the barb endpoints are very weak; (c) there is a strong magnetic field structure under the filament spine.

Zong, W. G.; Tang, Y. H.; Fang, C.; Xu, A. A.

263

The Regulation of Filamentous Growth in Yeast  

PubMed Central

Filamentous growth is a nutrient-regulated growth response that occurs in many fungal species. In pathogens, filamentous growth is critical for host–cell attachment, invasion into tissues, and virulence. The budding yeast Saccharomyces cerevisiae undergoes filamentous growth, which provides a genetically tractable system to study the molecular basis of the response. Filamentous growth is regulated by evolutionarily conserved signaling pathways. One of these pathways is a mitogen activated protein kinase (MAPK) pathway. A remarkable feature of the filamentous growth MAPK pathway is that it is composed of factors that also function in other pathways. An intriguing challenge therefore has been to understand how pathways that share components establish and maintain their identity. Other canonical signaling pathways—rat sarcoma/protein kinase A (RAS/PKA), sucrose nonfermentable (SNF), and target of rapamycin (TOR)—also regulate filamentous growth, which raises the question of how signals from multiple pathways become integrated into a coordinated response. Together, these pathways regulate cell differentiation to the filamentous type, which is characterized by changes in cell adhesion, cell polarity, and cell shape. How these changes are accomplished is also discussed. High-throughput genomics approaches have recently uncovered new connections to filamentous growth regulation. These connections suggest that filamentous growth is a more complex and globally regulated behavior than is currently appreciated, which may help to pave the way for future investigations into this eukaryotic cell differentiation behavior.

Cullen, Paul J.; Sprague, George F.

2012-01-01

264

Deep coronal hole associated with quiescent filament  

NASA Astrophysics Data System (ADS)

We present a study of the morphology of quiescent filament observed by H-alpha Solar Telescope at Bosscha Observatory in association with coronal hole observed by Atmospheric Imaging Assembly (AIA) instrument in 193 Å from Solar Dynamics Observatory. H-alpha images were processed by imaging softwares, namely Iris 5.59 and ImageJ, to enhance the signal to noise ratio and to identify the filament features associated with coronal hole. For images observed on October 12, 2011, November 14, 2011 and January 2, 2012, we identified distinct features of coronal holes above the quiescent filaments. This associated coronal holes have filament-like morphology with a thick long thread as it's `spine', defined as Deep Coronal Hole. Because of strong magnetic field of sunspot, these filaments and coronal holes emerged far from active region and lasted for several days. It is interesting as for segmented filament, deep coronal holes above the filaments lasted for a quite long period of time and merged. This association between filament and deep coronal hole can be explained by filament magnetic loop.

Kesumaningrum, Rasdewita; Herdiwidjaya, Dhani

2014-03-01

265

Methods for modeling cytoskeletal and DNA filaments.  

PubMed

This review summarizes the models that researchers use to represent the conformations and dynamics of cytoskeletal and DNA filaments. It focuses on models that address individual filaments in continuous space. Conformation models include the freely jointed, Gaussian, angle-biased chain (ABC), and wormlike chain (WLC) models, of which the first three bend at discrete joints and the last bends continuously. Predictions from the WLC model generally agree well with experiment. Dynamics models include the Rouse, Zimm, stiff rod, dynamic WLC, and reptation models, of which the first four apply to isolated filaments and the last to entangled filaments. Experiments show that the dynamic WLC and reptation models are most accurate. They also show that biological filaments typically experience strong hydrodynamic coupling and/or constrained motion. Computer simulation methods that address filament dynamics typically compute filament segment velocities from local forces using the Langevin equation and then integrate these velocities with explicit or implicit methods; the former are more versatile and the latter are more efficient. Much remains to be discovered in biological filament modeling. In particular, filament dynamics in living cells are not well understood, and current computational methods are too slow and not sufficiently versatile. Although primarily a review, this paper also presents new statistical calculations for the ABC and WLC models. Additionally, it corrects several discrepancies in the literature about bending and torsional persistence length definitions, and their relations to flexural and torsional rigidities. PMID:24476634

Andrews, Steven S

2014-02-01

266

Parallel machines: Parallel machine languages  

SciTech Connect

This book presents a framework for understanding the tradeoffs between the conventional view and the dataflow view with the objective of discovering the critical hardware structures which must be present in any scalable, general-purpose parallel computer to effectively tolerate latency and synchronization costs. The author presents an approach to scalable general purpose parallel computation. Linguistic Concerns, Compiling Issues, Intermediate Language Issues, and hardware/technological constraints are presented as a combined approach to architectural Develoement. This book presents the notion of a parallel machine language.

Iannucci, R.A. (IBM (US))

1990-01-01

267

Horizontal Wind Rotor. Final Technical Report.  

National Technical Information Service (NTIS)

A vertical axis wind machine called, ''Horizontal Wind Rotor'' conceived in 1979 by the Grantee E.J. Guard was an effort to marry a new high tech carousel type wind rotor to a basic building design for the purpose of generating practical amounts of electr...

E. J. Guard

1983-01-01

268

Harnessing the Wind.  

National Technical Information Service (NTIS)

The video describes a visual tour of large wind farms in California, showing samples of types of machines installed and the vastness of size of the farms. It also contains in narration the installed kW capacity of farms as of the time of shooting in April...

1994-01-01

269

Microcyle Conidiation in Filamentous Fungi  

PubMed Central

The typical life cycle of filamentous fungi commonly involves asexual sporulation after vegetative growth in response to environmental factors. The production of asexual spores is critical in the life cycle of most filamentous fungi. Normally, conidia are produced from vegetative hyphae (termed mycelia). However, fungal species subjected to stress conditions exhibit an extremely simplified asexual life cycle, in which the conidia that germinate directly generate further conidia, without forming mycelia. This phenomenon has been termed as microcycle conidiation, and to date has been reported in more than 100 fungal species. In this review, first, we present the morphological properties of fungi during microcycle conidiation, and divide microcycle conidiation into four simple categories, even though fungal species exhibit a wide variety of morphological differences during microcycle conidiogenesis. Second, we describe the factors that influence microcycle conidiation in various fungal species, and present recent genetic studies that have identified the genes responsible for this process. Finally, we discuss the biological meaning and application of microcycle conidiation.

Jung, Boknam; Kim, Soyeon

2014-01-01

270

The WSRT virgo filament survey  

NASA Astrophysics Data System (ADS)

In the last few years, the realization has emerged that the universal baryons are almost equally distributed by mass in three components: (1) galactic concentrations, (2) a warm-hot intergalactic medium (WHIM) and (3) a diffuse intergalactic medium. These three components are predicted by hydrodynamical simulations and are probed by QSO absorption lines. To observe the WHIM in neutral hydrogen, observations are needed which are deeper than log( NHI) = 18. The WHIM should appear as a Cosmic Web, underlying the galaxies with higher column densities. We have used the WSRT to simulate a filled aperture by observing at very high hour angles, to reach very high column density sensitivity. To achieve even higher image fidelity, an accurate model of the WSRT primary beam was developed. This will be used in the joint deconvolution of the observations. To get a good overview of the distribution and kinematics of the Cosmic Web, a deep survey of 1500 square degrees of sky was undertaken, containing the galaxy filament extending between the Local Group and the Virgo Cluster. The auto-correlation data have been reduced and has an RMS of ? NHI = 4.2 × 10 16 cm -2 over 20 km s -1. Several sources have been tentatively detected, which were previously unknown, as well as an indication for diffuse intergalactic filaments.

Popping, A.; Braun, R.

2007-02-01

271

Elastic filaments in skeletal muscle revealed by selective removal of thin filaments with plasma gelsolin  

PubMed Central

Muscle needs an elastic framework to maintain its mechanical stability. Removal of thin filaments in rabbit skeletal muscle with plasma gelsolin has revealed the essential features of elastic filaments. The selective removal of thin filaments was confirmed by staining with phalloidin-rhodamine for fluorescence microscopy, examination of arrowhead formation with myosin subfragment 1 by electron microscopy, and analysis by SDS-PAGE. Thin section electron microscopy revealed the elastic fine filaments (approximately 4 nm in diameter) connecting thick filaments and the Z line. After removal of thin filaments, both rigor stiffness and active tension generation were lost, but the resting tension remained. These observations indicate that the thin filament-free fibers maintain a framework composed of the serial connections of thick filaments, the elastic filaments, and the Z line, which gives passive elasticity to the contractile system of skeletal muscle. The resting tension that remained in the thin filament-free fibers was decreased by mild trypsin treatment. The only protein component that was digested in parallel with the decrease in the resting tension and the disappearance of the elastic filaments was alpha-connectin (also called titin 1), which was transformed from the alpha to the beta form (from titin 1 to 2, respectively). Thus, we conclude that the main protein component of the elastic filaments is alpha-connectin (titin 1).

1990-01-01

272

Mind & Machine  

NSDL National Science Digital Library

Mind & Machine is a weekly column provided by Ashley Dunn for the New York Times Cybertimes that discusses topics related to computing, technology, and the Internet. Recent columns have addressed the topics of the development of Internet telephony, possible futures of user interfaces, the history of technology and standards, and the Internet as a vehicle for community. Articles are well written, opinionated, and thought provoking. Mr. Dunn is a free lance writer who has written for such papers as the New York Times, the Los Angeles Times, the Seattle Post-Intelligencer, and the South China Morning Post. Note that the site is available only upon registration and is free of charge only in the US.

Dunn, Ashley.

1996-01-01

273

Fatigue case study and reliability analyses for wind turbines.  

National Technical Information Service (NTIS)

Modern wind turbines are fatigue critical machines used to produce electrical power. To insure long term, reliable operation, their structure must be optimized if they are to be economically viable. The fatigue and reliability projects in Sandia's Wind En...

H. J. Sutherland, P. S. Veers

1994-01-01

274

The Geography of Wind Energy: Problem Solving Activities.  

ERIC Educational Resources Information Center

Today there are many attempts to use wind machines to confront the increasing costs of electricity. Described are activities to help secondary students understand wind energy, its distribution, applications, and limitations. (RM)

Lahart, David E.; Allen, Rodney F.

1985-01-01

275

EXPERIMENTAL STUDY ON OUTSIDE FILAMENT WINDING REINFORCED FRP BRIDGE DECKS  

Microsoft Academic Search

Innovated FRP (Fiber Reinforced Polymer) bridge deck system is gradually applied widely in the recent years. Many FRP deck products by varied processes were created and manufactured. In the decks, local delamitation, debonding and buckling are usually the ultimate failure modes that cause the FRP strength not to be utilized fully and result in a sudden or brittle failure. In

P. Feng; L. P. Ye

276

Filamentation of light in carbon disulfide  

NASA Astrophysics Data System (ADS)

We report experimental observation of light filamentation in carbon disulfide (CS2). Accurate measurements of the nonlinear index show an unusual saturation law of the Kerr effect, which is used to build a model of light propagation in CS2, which describes the filamentation in good agreement with experimental observations.

Besse, V.; Leblond, H.; Boudebs, G.

2014-04-01

277

THICK FILAMENTS IN VASCULAR SMOOTH MUSCLE  

PubMed Central

Two sets of myofilaments were demonstrated after incubation of strips of rabbit portal-anterior mesenteric vein under moderate stretch in a physiological salt solution. Thick filaments had a mean diameter of 18 nm and reached a maximum length of 1.4 µm with a mean length of 0.61 µm. In transverse sections, 2.5–5 nm particles were resolved as subunits of the thick filaments. Thin filaments had an average diameter of 8.4 nm and generally conformed to the structure believed to represent actin filaments in smooth and striated muscles. In the areas of maximum concentration there were 160–328 thick filaments/µm2 and the lowest ratio of thin to thick filaments was 12:1. Thick filaments were present in approximately equal numbers in vascular smooth muscle relaxed by theophylline, in Ca++-free solution, or contracted by norepinephrine. The same preparatory procedures used with vascular smooth muscle also enabled us to visualize thick filaments in guinea pig and rabbit taenia coli and vas deferens.

Devine, Carrick E.; Somlyo, Andrew P.

1971-01-01

278

Scanning For Hotspots In Lamp Filaments  

NASA Technical Reports Server (NTRS)

Scanning photometer designed for use in investigation of failures of incandescent lamp filaments. Maps brightness as function of position along each filament to identify bright (hot) spots, occurring at notches and signifying incipient breaks or rewelds. Also used to measure nonuniformity in outputs of such linear devices as light-emitting diodes, and to measure diffraction patterns of lenses.

Powers, Charles E.; Van Sant, Tim; Leidecker, Henning

1993-01-01

279

A First Approach to Filament Dynamics  

ERIC Educational Resources Information Center

Modelling elastic filament dynamics is a topic of high interest due to the wide range of applications. However, it has reached a high level of complexity in the literature, making it unaccessible to a beginner. In this paper we explain the main steps involved in the computational modelling of the dynamics of an elastic filament. We first derive…

Silva, P. E. S.; de Abreu, F. Vistulo; Simoes, R.; Dias, R. G.

2010-01-01

280

Homology of Retractile Filaments of Vampire Squid  

Microsoft Academic Search

The axial filament nerves of Vampyroteuthis infernalis are joined to two separate parts of the brain. One branch of the nerve, apparently efferent, arises from the anterior portion of the middle subesophageal mass, and the other, apparently afferent, enters the ventral magnocellular lobe. Since this innervation is entirely different from that of the arms, the filaments can no longer be

Richard E. Young

1967-01-01

281

A review of the SERI wind energy innovative systems program  

Microsoft Academic Search

Features of innovative wind energy conversion systems evaluated and\\/or tested at the Solar Energy Research Institute are reviewed. Cost, performance, and engineering data were acquired for the machines, along with proof-of-concept demonstrations. Machines which were examined included a straight-bladed vertical axis wind turbine with circulation controlled airfoils, the Grumman tornado wind energy tower with louvers, a wind-powered charged aerosol generator

I. E. Vas; P. South

1980-01-01

282

Wear resistant hub for wind machines  

SciTech Connect

This patent describes an apparatus for reducing the wear and maintaining lubricated a fan blade hub supported upon a rotatable shaft, comprising: (a) a teeter pin for supporting the hub upon the shaft; (b) a pair of aligned spaced apart journals diametrically disposed within the hub for receiving opposed ends of the teeter pin; (c) a pair of retaining plates attachable to the hub, (d) an annular land disposed at each end of the teeter pin; (e) a thrust washer mounted upon each of the lands for supporting the respective end of the teeter pin against the respective one of the pair of retaining plates; (f) means disposed in each retaining plate of the pair of retaining plates for introducing a lubricant; (g) means disposed in each of the teeter pin for urging the lubricant from introducing means into the respective journal or the pair of journals to lubricate in a direction radially inwardly the journaled part of the teeter pin; and (h) seal means disposed proximate the radially inward end of each journal of the pair of journals and adjacent journaled teeter pin for restraining radially outward flow of foreign matter intermediate teeter pin and each journal of the pair of journals.

Wells, D.A.

1988-04-12

283

Vortex filament stability and boundary layer dynamics  

SciTech Connect

Coherent structures in fluid boundary layers at high Reynolds numbers are a prominent feature of these flows. The structures appear as concentrations of vorticity into hairpin'' and other shapes. We explore the inviscid interaction and stability of vortex filaments initially situated spanwise to the mean flow in a model of a boundary layer. Both for a single vortex filament and its image through the boundary and for an infinite line of such filaments with their images we find a linear instability associated with deformations of the filament along its length with maximum instability having a wavelength on the order of the height of the filament above the boundary. The linear unstable manifold for this instability points at approximately 45[degree] from the plane of the boundary in accord with experimental observations and numerical modeling of these coherent structures. This provides a dynamical origin to the observations of the orientation of these coherent structures.

Abarbanel, H.D.I. (Department of Physics, Institute for Nonlinear Science and Marine Physical Laboratory, Scripps Institution of Oceanography, University of California, San Diego, Mail Code 0402, La Jolla, California 92093-0402 (United States)); Lisi, A.G. (Department of Physics and Institute for Nonlinear Science, University of California, San Diego, Mail Code 0402, La Jolla, California 92093-0402 (United States)); Rouhi, A.; Wright, J.A. (Institute for Nonlinear Science, University of California, San Diego, Mail Code 0402, La Jolla, California 92093-0402 (United States))

1994-08-01

284

Microwave hybrid heating of alumina filaments  

SciTech Connect

Low loss oxide ceramics filaments are not readily heated to sintering temperatures (>900[degrees]C) by direct microwave heating at 2.45 GHz. Use of high power levels typically yields thermal runaway with catastrophic melting. In other studies, hybrid, or indirect, heating has been successfully applied to processing bulk oxide ceramics. In this work, commercial alumina-based filaments have been indirectly heated to 700[degrees]--900[degrees]C through a lossy carbon coating on the filament tow. Specific filaments can reach higher temperatures by direct coupling after preheating with a lossy coating. The results of microwave hybrid heating in a single mode TE[sub 102] cavity will be described for commercial alumina-based filaments.

Vogt, G.J.; Unruh, W.P.

1993-01-01

285

Microwave hybrid heating of alumina filaments  

SciTech Connect

Low loss oxide ceramics filaments are not readily heated to sintering temperatures (>900{degrees}C) by direct microwave heating at 2.45 GHz. Use of high power levels typically yields thermal runaway with catastrophic melting. In other studies, hybrid, or indirect, heating has been successfully applied to processing bulk oxide ceramics. In this work, commercial alumina-based filaments have been indirectly heated to 700{degrees}--900{degrees}C through a lossy carbon coating on the filament tow. Specific filaments can reach higher temperatures by direct coupling after preheating with a lossy coating. The results of microwave hybrid heating in a single mode TE{sub 102} cavity will be described for commercial alumina-based filaments.

Vogt, G.J.; Unruh, W.P.

1993-05-01

286

Stability of viscous long liquid filaments  

NASA Astrophysics Data System (ADS)

We study the collapse of an axisymmetric liquid filament both analytically and by means of a numerical model. The liquid filament, also known as ligament, may either collapse stably into a single droplet or break up into multiple droplets. The dynamics of the filament are governed by the viscosity and the aspect ratio, and the initial perturbations of its surface. We find that the instability of long viscous filaments can be completely explained by the Rayleigh-Plateau instability, whereas a low viscous filament can also break up due to end pinching. We analytically derive the transition between stable collapse and breakup in the Ohnesorge number versus aspect ratio phase space. Our result is confirmed by numerical simulations based on the slender jet approximation and explains recent experimental findings by Castréjon-Pita et al. [Phys. Rev. Lett. 108, 074506 (2012)].

Driessen, Theo; Jeurissen, Roger; Wijshoff, Herman; Toschi, Federico; Lohse, Detlef

2013-06-01

287

Actin Filaments as Tension Sensors  

PubMed Central

The field of mechanobiology has witnessed an explosive growth over the past several years as interest has greatly increased in understanding how mechanical forces are transduced by cells and how cells migrate, adhere and generate traction. Actin, a highly abundant and anomalously conserved protein, plays a large role in forming the dynamic cytoskeleton that is so essential for cell form, motility and mechanosensitivity. While the actin filament (F-actin) has been viewed as dynamic in terms of polymerization and depolymerization, new results suggest that F-actin itself may function as a highly dynamic tension sensor. This property may help explain the unusual conservation of actin’s sequence, as well as shed further light on actin’s essential role in structures from sarcomeres to stress fibers.

Galkin, Vitold E.; Orlova, Albina; Egelman, Edward H.

2012-01-01

288

Conductive Anodic Filament (CAF) Formation  

NASA Astrophysics Data System (ADS)

Conductive anodic filament (CAF) is a failure mode in printed wiring boards (PWBs) which occurs under high humidity and high voltage gradient conditions. The filament, a copper salt, grows from anode to cathode along the epoxy-glass interface. Ready and Turbini (2000) identified this copper salt as the Cu 2(OH)3Cl, atacamite compound. This work has investigated the influence of polyethylene glycol (PEG) and polyethylene propylene glycol (PEPG) fluxing agents on the chemical nature of CAF. For coupons processed with PEPG flux, with and without chloride, a copper-chloride containing compound was formed in the polymer matrix. This compound was characterized using x-ray photoelectron spectroscopy (XPS) as CuCl and an electrochemical mechanism for the formation of the chloride-containing CAF has been proposed. For PEG flux, with and without chloride, it has been shown that CAF only formed, but no copper containing compound formed in the matrix. It appears for PEG fluxed coupons, a PEG-Cu-Cl complex forms, binds the available Cu and acts as a barrier to the formation of CuCl in the polymer matrix. Meeker and Lu Valle (1995) have previously proposed that CAF failure is best represented by two competing reactions -- the formation of a copper chloride corrosion compound (now identified as Cu2(OH)3Cl) and the formation of innocuous trapped chlorine compounds. Since no evidence of any trapped chloride compounds has been found, we propose that the formation of CAF is best represented by a single non-reversible reaction. For coupons processed with a high bromide-containing flux, bromide containing CAF was created and characterized using transmission electron microscopy (TEM) to be Cu2(OH)3Br. In addition, a copper-containing compound was formed in the polymer matrix and characterized using XPS as CuBr. An electrochemical mechanism for the formation of bromide-containing CAF has been proposed based on the XPS data.

Caputo, Antonio

289

Advanced Flux-Switching Permanent Magnet Brushless Machines  

Microsoft Academic Search

This paper overviews the recent development and new topologies of flux-switching (FS) machines, with particularly emphasis on the permanent magnet (PM) type. Specific design issues, including winding configurations, combinations of stator and rotor pole numbers, rotor pole width, split ratio, etc., are investigated, while the torque capability of selected FSPM machines is also compared.

Z. Q. Zhu; J. T. Chen

2010-01-01

290

Novel electromagnetic rotor position sensor for aerospace brushless DC machine  

Microsoft Academic Search

In order to implement aerospace brushless DC machine servo control system in a high-temperature hostile environment, a novel electromagnetic rotor position sensing device was put forward. Concentrated excitation windings and detection ones were alternately mounted on the stator teeth. The rotor cylinder outer surface was notched at the corresponding positions of the magnetic S poles on the machine rotor. With

Qiang Fu; Bo He

2010-01-01

291

Machine musicianship  

NASA Astrophysics Data System (ADS)

The training of musicians begins by teaching basic musical concepts, a collection of knowledge commonly known as musicianship. Computer programs designed to implement musical skills (e.g., to make sense of what they hear, perform music expressively, or compose convincing pieces) can similarly benefit from access to a fundamental level of musicianship. Recent research in music cognition, artificial intelligence, and music theory has produced a repertoire of techniques that can make the behavior of computer programs more musical. Many of these were presented in a recently published book/CD-ROM entitled Machine Musicianship. For use in interactive music systems, we are interested in those which are fast enough to run in real time and that need only make reference to the material as it appears in sequence. This talk will review several applications that are able to identify the tonal center of musical material during performance. Beyond this specific task, the design of real-time algorithmic listening through the concurrent operation of several connected analyzers is examined. The presentation includes discussion of a library of C++ objects that can be combined to perform interactive listening and a demonstration of their capability.

Rowe, Robert

2002-05-01

292

Filament architectures in AC conductors: the influence of intergrowths  

NASA Astrophysics Data System (ADS)

Filament isolation is an extremely important factor in multi-filamentary conductors, and attempts have been made to achieve this by incorporating a resistive oxide sheath around individual filaments. However, filament-bridging intergrowths have been observed in conductors with and without the resistive sheath. We present magnetisation results on BSCCO-2223/Ag conductors with different filament configurations, and analyse the data taking into account the effects of magnetic coupling between filaments. All samples studied display some degree of filament bridging.

Everett, J.; Perkins, G.; Volkozub, A. V.; Caplin, A. D.; Dhallé, M.; Polcari, A.; Marti, F.; Huang, Y. B.; Flükiger, R.

1998-12-01

293

The invertebrate myosin filament: subfilament arrangement of the solid filaments of insect flight muscles.  

PubMed Central

Transverse sections (approximately 140 nm thick) of solid myosin filaments of the flight muscles of the fleshfly, Phormia terrae-novae, the honey bee, Apis mellifica, and the waterbug, Lethocerus uhleri, were photographed in a JEM model 200A electron microscope at 200 kV. The images were digitized and computer processed by rotational filtering. In each of these filaments it was found that the symmetry of the core and the wall was not the same. The power spectra of the images showed sixfold symmetry for the wall and threefold symmetry for the core of the filaments. The images of the filaments in each muscle were superimposed according to the sixfold center of the wall. These averaged images for all three muscles showed six pairs of subunits in the wall similar to those found in the wall of tubular filaments. From serial sections of the fleshfly filaments, we conclude that the subunits in the wall of the filaments represent subfilaments essentially parallel to the long axis of the filament. In each muscle there are additional subunits in the core, closely related to the subunits in the wall. Evaluation of serial sections through fleshfly filaments suggests that the relationship of the three subunits observed in the core to those in the wall varies along the length of the filaments. In waterbug filaments there are three dense and three less dense subunits for a total of six all closely related to the wall. Bee filaments have three subunits related to the wall and three subunits located eccentrically in the core of the filaments. The presence of core subunits can be related to the paramyosin content of the filaments. Images FIGURE 1 FIGURE 3 FIGURE 4 FIGURE 5 FIGURE 7 FIGURE 9 FIGURE 12

Beinbrech, G; Ashton, F T; Pepe, F A

1992-01-01

294

Improving vehicle aeroacoustics using machine learning  

Microsoft Academic Search

This paper presents a new approach to improving the overall aeroacoustic comfort of a vehicle, an important feature of vehicle design. The traditional improvement process is extended to benefit extensively from machine learning, information retrieval and information extraction technologies to assist the wind tunnel engineers with difficult tasks. The paper first describes the general approach and then focuses on providing

Damjan Kužnar; Martin Možina; Marina Giordanino; Ivan Bratko

295

Statistical analysis of wind characteristics at candidate wind-turbine sites  

Microsoft Academic Search

Accurate prediction for a wind turbine facility performance is dependent on appropriate wind characteristics data. This report presents preliminary recommendations of appropriate data recording procedures for initial site evaluation and for large machine performance evaluation. Conclusions are based on autocorrelation, autospectrum persistence, cross-correlation, and coherence analysis of a limited sample of wind speed and turbine power data collected at the

Corotis

1982-01-01

296

Origin of Enigmatic Galactic-center Filaments Revealed  

NASA Astrophysics Data System (ADS)

Twenty years ago, astronomers discovered a number of enigmatic radio-emitting filaments concentrated near the center of the Milky Way Galaxy. These features initially defied explanation, but a new study of radio images of the Galactic center may point to their possible source. By combining data from the National Science Foundation's Very Large Array (VLA) and Robert C. Byrd Green Bank Telescope (GBT) astronomer Farhad Yusef-Zadeh of Northwestern University has found evidence that at least some of the filaments spring from the concentrated star-formation regions that populate the Galactic center. Galatic Center Combined VLA and GBT image (green) of the Galactic center, with red inset of GBT data only (red). Bright region on right is location of supermassive black hole. Linear filaments are visible above this area. CREDIT: NRAO/AUI/NSF Yusef-Zadeh, et.al. (Click on Image for Larger Version) Yusef-Zadeh presented his findings at the Denver, Colorado, meeting of the American Astronomical Society. William Cotton of the National Radio Astronomy Observatory (NRAO) in Charlottesville, Virginia, and William Hewitt of Northwestern University also contributed to this research. "Astronomers have long puzzled over the cause of these striking features," said Yusef-Zadeh, "and the turbulent nature of the Galactic center has made detailed analysis difficult. With new multi-wavelength radio images of the Galactic center, however, we can finally see a link between areas of starburst activity and these long-linear filaments." The filaments, which range from 10 to 100 light-years in length and are perhaps little more than 1 to 3 light-years across, occur only in a very narrow area, within approximately two degrees of the Galactic center (which translates to approximately 900 light-years across). Early theories about the origin of these filaments suggested that they were somehow related to the Milky Way’s own magnetic field. This was due to the fact that the first filaments detected were oriented perpendicular to the plane of the Galaxy, which would have aligned them with the Galaxy’s own magnetic field. "The problem with this hypothesis is that more recent images have revealed a population of weaker filaments oriented randomly in relation to the plane of the Galaxy," said Yusef-Zadeh. "This makes it difficult to explain the origin of the filaments by an organized Galactic magnetic field." In March and June of 2004, a team of astronomers using the GBT made images of the Galactic center at various wavelengths. The purpose of these surveys was to help identify radio features produced by hot gas (thermal emission) and those produced in magnetic fields (non-thermal emission). In general, thermal features radiate more strongly at shorter wavelengths and non-thermal at longer wavelengths. By comparing the GBT images with earlier VLA data taken of the same region, Yusef-Zadeh determined that a number of the non-thermal filaments seemed to connect to concentrated areas of thermal emission, which identify pockets of star formation. Galatic Center Combined radio image from the Very Large Array and Green Bank Telescope. The linear filaments near the top are some of the nonthermal radio filaments (NRFs) studied by the researchers. Other features, such as supernova remnants (SNRs) and the area surrounding our Galaxy's supermassive black hole (Sgr A) are shown. CREDIT: NRAO/AUI/NSF Yusef-Zadeh, et.al. (Click on Image for Larger Version) "What this showed us is that two seemingly disparate processes, thermal and non-thermal radio emission, can be created by the very same phenomenon," said Yusef-Zadeh. "In this case, that phenomenon is pockets of starburst activity." Yusef-Zadeh notes that the exact mechanism for how the areas of starburst generate the magnetic fields is still being investigated. "There are many ideas about the mechanism that generates these filaments," added Yusef-Zadeh, "but one possibility is that they are produced by the collision of winds blown off from indi

2004-06-01

297

Polymeric filament thinning and breakup in microchannels  

NASA Astrophysics Data System (ADS)

The effects of elasticity on filament thinning and breakup are investigated in microchannel cross flow. When a viscous solution is stretched by an external immiscible fluid, a low 100ppm polymer concentration strongly affects the breakup process, compared to the Newtonian case. Qualitatively, polymeric filaments show much slower evolution, and their morphology features multiple connected drops. Measurements of filament thickness show two main temporal regimes: flow- and capillary-driven. At early times both polymeric and Newtonian fluids are flow-driven, and filament thinning is exponential. At later times, Newtonian filament thinning crosses over to a capillary-driven regime, in which the decay is algebraic. By contrast, the polymeric fluid first crosses over to a second type of flow-driven behavior, in which viscoelastic stresses inside the filament become important and the decay is again exponential. Finally, the polymeric filament becomes capillary-driven at late times with algebraic decay. We show that the exponential flow thinning behavior allows a measurement of the extensional viscosities of both Newtonian and polymeric fluids.

Arratia, P. E.; Gollub, J. P.; Durian, D. J.

2008-03-01

298

Polymeric filament thinning and breakup in microchannels.  

PubMed

The effects of elasticity on filament thinning and breakup are investigated in microchannel cross flow. When a viscous solution is stretched by an external immiscible fluid, a low 100 ppm polymer concentration strongly affects the breakup process, compared to the Newtonian case. Qualitatively, polymeric filaments show much slower evolution, and their morphology features multiple connected drops. Measurements of filament thickness show two main temporal regimes: flow- and capillary-driven. At early times both polymeric and Newtonian fluids are flow-driven, and filament thinning is exponential. At later times, Newtonian filament thinning crosses over to a capillary-driven regime, in which the decay is algebraic. By contrast, the polymeric fluid first crosses over to a second type of flow-driven behavior, in which viscoelastic stresses inside the filament become important and the decay is again exponential. Finally, the polymeric filament becomes capillary-driven at late times with algebraic decay. We show that the exponential flow thinning behavior allows a measurement of the extensional viscosities of both Newtonian and polymeric fluids. PMID:18517513

Arratia, P E; Gollub, J P; Durian, D J

2008-03-01

299

Automatic Solar Filament Segmentation and Characterization  

NASA Astrophysics Data System (ADS)

This paper presents a generic method to automatically segment and characterize solar filaments from various H? full-disk solar images, obtained by different solar observatories, with different dynamic ranges and statistical properties. First, a cascading Hough circle detector is designed to find the center location and radius of the solar disks. Second, polynomial surface fitting is adopted to correct unbalanced luminance. Third, an adaptive thresholding method is put forward to segment solar filaments. Finally, for each piece of a solar filament, its centroid location, area, and length are characterized, in which morphological thinning and graph theory are used for identifying the main skeletons of filaments. To test the performance of the proposed methods, a dataset composed of 125 H? images is considered. These images were obtained by four solar observatories from January 2000 to May 2010, one image per month. Experimental results show that the accuracy rate is above 95% as measured by filament number and above 99% as measured by filament area, indicating that only a few tiny filaments are not detected.

Yuan, Y.; Shih, F. Y.; Jing, J.; Wang, H.; Chae, J.

2011-08-01

300

THERMAL AND CHEMICAL EVOLUTION OF COLLAPSING FILAMENTS  

SciTech Connect

Intergalactic filaments form the foundation of the cosmic web that connect galaxies together, and provide an important reservoir of gas for galaxy growth and accretion. Here we present very high resolution two-dimensional simulations of the thermal and chemical evolution of such filaments, making use of a 32 species chemistry network that tracks the evolution of key molecules formed from hydrogen, oxygen, and carbon. We study the evolution of filaments over a wide range of parameters including the initial density, initial temperature, strength of the dissociating UV background, and metallicity. In low-redshift, Z Almost-Equal-To 0.1 Z{sub Sun} filaments, the evolution is determined completely by the initial cooling time. If this is sufficiently short, the center of the filament always collapses to form a dense, cold core containing a substantial fraction of molecules. In high-redshift, Z = 10{sup -3} Z{sub Sun} filaments, the collapse proceeds much more slowly. This is mostly due to the lower initial temperatures, which lead to a much more modest increase in density before the atomic cooling limit is reached, making subsequent molecular cooling much less efficient. Finally, we study how the gravitational potential from a nearby dwarf galaxy affects the collapse of the filament and compare this to NGC 5253, a nearby starbursting dwarf galaxy thought to be fueled by the accretion of filament gas. In contrast to our fiducial case, a substantial density peak forms at the center of the potential. This peak evolves faster than the rest of the filament due to the increased rate at which chemical species form and cooling occurs. We find that we achieve similar accretion rates as NGC 5253 but our two-dimensional simulations do not recover the formation of the giant molecular clouds that are seen in radio observations.

Gray, William J. [Lawrence Livermore National Laboratory, P.O. Box 808, L-038, Livermore, CA 94550 (United States); Scannapieco, Evan [School of Earth and Space Exploration, Arizona State University, P.O. Box 871404, Tempe, AZ 85287-1494 (United States)

2013-05-10

301

Vortex filament dynamics in plasmas and superconductors  

NASA Astrophysics Data System (ADS)

The dynamical description of a thin vortex filament in a perfect fluid is generalized to a charged fluid on a neutralizing background. The filament curvature and torsion evolve integrably according to a higher nonlinear Schrödinger equation, which is found using the Hasimoto transformation. Because of screening, local induction is accurate, and the logarithmic long-range divergency is removed. Linear waves, such as the Kelvin mode, are supported by the filament, as well as nonlinear waves and solitons. The effects of vortex stretching are briefly discussed. Applications of the results are found in electron magnetohydrodynamics and in type II superconductor theory.

Uby, Lars; Isichenko, Michael B.; Yankov, Vladimir V.

1995-07-01

302

Some Fundamental Concepts of Femtosecond Laser Filamentation  

NASA Astrophysics Data System (ADS)

Powerful femtosecond laser pulses propagate in an apparent form of filamentation in all transparent optical media. This universal nonlinear phenomenon is currently an interesting topic of research at the forefront of applied physics and attracts more and more people to enter this field. This paper attempts to clarify some of the fundamental physics behind filamentation. The basic concepts include the slice-by-slice self-focusing, intensity clamping, white light laser generation and background energy reservoir as well as multiple filamentation competition. Some important potential applications are also discussed.

Chin, See Leang; Liu, Weiwei; Théberge, Francis; Luo, Qi; Hosseini, Seyed A.; Kandidov, Valery P.; Kosareva, Olga G.; Aközbek, Neset; Becker, Andreas; Schroeder, Hartmut

303

A Study of Influence of Configurations of the Windings on the Performance of Single Phase Induction Motor with Capacitor Start  

Microsoft Academic Search

The single phase induction motors needs two stator windings to produce rotating magnetic field : one main winding and the other auxiliary winding. The aim of the auxiliary winding is to create the rotating electromagnetic field when the machine is started-up and is afterwards turned off, generally through the centrifugal switch coupled together with the shaft of the machine rotor.

Ademir Pelizari; I. E. Chabu

2009-01-01

304

Hybrid Wound Filaments for Greater Resistance to Impacts  

NASA Technical Reports Server (NTRS)

A hybrid material containing wound filaments made of a hybrid of high-strength carbon fibers and poly(phenylene benzobisoxazole) [PBO] fibers is discussed. This hybrid material is chosen in an effort to increase the ability of the pressure vessel to resist damage by low-speed impacts (e.g., dropping of tools on the vessel or bumping of the vessel against hard objects during installation and use) without significantly increasing the weight of the vessel. While the basic concept of hybridizing fibers in filament-wound structures is not new, the use of hybridization to increase resistance to impacts is an innovation, and can be expected to be of interest in the composite-pressure-vessel industry. The precise types and the proportions of the high-strength carbon fibers and the PBO fibers in the hybrid are chosen, along with the filament-winding pattern, to maximize the advantageous effects and minimize the disadvantageous effects of each material. In particular, one seeks to (1) take advantage of the ability of the carbon fibers to resist stress rupture while minimizing their contribution to vulnerability of the vessel to impact damage and (2) take advantage of the toughness of the PBO fibers while minimizing their contribution to vulnerability of the vessel to stress rupture. Experiments on prototype vessels fabricated according to this concept have shown promising results. At the time of reporting the information for this article, research toward understanding and optimizing the performances of PBO fibers so as to minimize their contribution to vulnerability of the pressure vessel to stress rupture had yet to be performed.

DeLay, Thomas K.; Patterson, James E.; Olson, Michael A.

2008-01-01

305

Influence of bottom topography on an upwelling current: Generation of long trapped filaments  

Microsoft Academic Search

We investigate the influence of bottom topography on the formation and trapping of long upwelling filaments using a 2-layer shallow water model on the f-plane. A wind forced along-shore current, associated with coastal upwelling along a vertical wall, encounters a promontory of finite width and length, perpendicular to the coast.In the lower layer, topographic eddies form, which are shown to

T. Meunier; V. Rossi; Y. Morel; X. Carton

2010-01-01

306

Filament overwrapped motor case technology  

NASA Astrophysics Data System (ADS)

Atlantic Research Corporation (ARC) joined with the French Societe Europeenne de Propulsion (SEP) to develop and deliver to the U.S. Navy a small quantity of composite filament wound rocket motors to demonstrate a manufacturing technique that was being applied at the two companies. It was perceived that the manufacturing technique could produce motors that would be light in weight, inexpensive to produce, and that had a good chance of meeting insensitive munitions (IM) requirements that were being formulated by the Navy in the early 1980s. Under subcontract to ARC, SEP designed, tested, and delivered 2.75-inch rocket motors to the U.S. Navy for IM tests that were conducted in 1989 at China Lake, California. The program was one of the first to be founded by Nunn Amendment money. The Government-to-Government program was sponsored by the Naval Air Systems Command and was monitored by the Naval Surface Warfare Center, Indian Head (NSWC-IH), Maryland. The motor propellant that was employed was a new, extruded composite formulation that was under development at the Naval Surface Warfare Center. The following paper describes the highlights of the program and gives the results of structural and ballistic static tests and insensitive munitions tests that were conducted on demonstration motors.

Compton, Joel P.

1993-11-01

307

Machine and process characterization  

SciTech Connect

A study was conducted to statistically characterize 11 precision machining centers to determine their operating characteristics and process capabilities. Measurement probes and a ball plate were used for measurement analysis. A generic test part designed with geometric features that the department typically manufactures was machined using various machining processes. A better understanding of each machine's characteristics and process capability was realized through repeating these methods on each machine.

Love, L.W.

1992-12-01

308

Darrieus Wind-Turbine Airfoil Configurations.  

National Technical Information Service (NTIS)

The purpose of this study was to determine what aerodynamic performance improvement, if any, could be achieved by judiciously choosing the airfoil sections for Darrieus wind turbine blades. Analysis was limited to machines using two blades of infinite asp...

P. G. Migliore J. R. Fritschen

1982-01-01

309

Elastic filaments in skeletal muscle revealed by selective removal of thin filaments with plasma gelsolin  

Microsoft Academic Search

Abstract. Muscle needs an elastic framework,to main- tain its mechanical,stability. Removal of thin filaments in rabbit skeletal muscle,with plasma,gelsolin has re- vealed the essential features of elastic filaments. The selective removal,of thin filaments was confirmed,by staining with phalloidin-rhodamine,for fluorescence microscopy, examination of arrowhead formation with myosin subfragment 1 by electron microscopy, and analysis by SDS-PAGE. Thin section electron micros- copy

Takashi Funatsu; Hideo Higuchi; Shin'ichi Ishiwata

1990-01-01

310

Intermediate filaments: a role in epithelial polarity  

PubMed Central

Intermediate filaments have long been considered mechanical components of the cell that provide resistance to deformation stress. Practical experimental problems, including insolubility, lack of good pharmacological antagonists, and the paucity of powerful genetic models, have handicapped the research of other functions. In single-layered epithelial cells, keratin intermediate filaments are cortical, either apically polarized or apico-lateral. This review analyzes phenotypes of genetic manipulations of simple epithelial cell keratins in mice and C. elegans that strongly suggest a role of keratins in apico-basal polarization and membrane traffic. Published evidence that intermediate filaments can act as scaffolds for proteins involved in membrane traffic and signaling is also discussed. Such a scaffolding function would generate a highly polarized compartment within the cytoplasm of simple epithelial cells. While in most cases mechanistic explanations for the keratin-null or overexpression phenotypes are still missing, it is hoped investigators will be encouraged to study these as yet poorly understood functions of intermediate filaments.

Oriolo, Andrea S.; Wald, Flavia A.; Ramsauer, Victoria P.; Salas, Pedro J.I.

2007-01-01

311

Hybrid molecular dynamics simulations of living filaments  

NASA Astrophysics Data System (ADS)

We propose a hybrid molecular dynamics/multi-particle collision dynamics model to simulate a set of self-assembled semiflexible filaments and free monomers. Further, we introduce a Monte Carlo scheme to deal with single monomer addition (polymerization) or removal (depolymerization), satisfying the detailed balance condition within a proper statistical mechanical framework. This model of filaments, based on the wormlike chain, aims to represent equilibrium polymers with distinct reaction rates at both ends, such as self-assembled adenosine diphosphate-actin filaments in the absence of adenosine triphosphate (ATP) hydrolysis and other proteins. We report the distribution of filament lengths and the corresponding dynamical fluctuations on an equilibrium trajectory. Potential generalizations of this method to include irreversible steps like ATP-actin hydrolysis are discussed.

Caby, Mathieu; Hardas, Priscilla; Ramachandran, Sanoop; Ryckaert, Jean-Paul

2012-03-01

312

Stretching of buckled filaments by thermal fluctuations  

NASA Astrophysics Data System (ADS)

We study the buckling instability of filaments or elastic rods in two spatial dimensions in the presence of thermal fluctuations. We present an analytical solution based on a renormalizationlike procedure where we integrate out short wavelength fluctuations in order to obtain an effective theory governing the buckling instability. We calculate the resulting shift of the critical force by fluctuation effects and the average projected filament length parallel to the force direction as a function of the applied force and of the contour length of the filament. We find that, in the buckled state, thermal fluctuations lead to an increase in the mean projected length of the filament in the force direction. As a function of the contour length, the mean projected length exhibits a cusp at the buckling instability, which becomes rounded by thermal fluctuations. Our analytic results are confirmed by Monte Carlo simulations.

Baczynski, Krzysztof; Lipowsky, Reinhard; Kierfeld, Jan

2007-12-01

313

Amine plasma modification of polyaramid filaments  

SciTech Connect

Amine plasmas offer a method to implant amine groups into the surface structure of polyaramid filaments. These amines will react with epoxy to form covalent bonds at composite interfaces. They may also be chemically modified for reaction with other polymerizing matrices. The covalently bound interface exhibits an increased resistance to peel forces. Fractured surfaces show a change in failure mode from interface dominated to a mixture of filament splitting and matrix cracking as amine content is increased. Thus, the weak link in determining off-axis strengths of polyaramid/epoxy is changed from the interface to the filament and matrix bulk strengths after amination. The covalently bonded interface should also exhibit improved hygrothermal stability. The kinetics of amination are rapid - surface saturation occurs in 30 s; however, the kinetics are sensitive to oxygen concentration. Filament tensile strength is unchanged by amine plasma treatment times less than 600 s. Spectroscopic analysis indicates that the surface structure may, nevertheless, be substantially altered.

Allred, R.E.; Merrill, E.W.; Roylance, D.K.

1983-01-01

314

Tension of freely suspended fluid filaments  

NASA Astrophysics Data System (ADS)

Stable fluid filaments with diameters of several micrometers and slenderness ratios well above 1000 are unique objects formed by some liquid crystalline phases of bent-core mesogens. We present a technique to determine filament tensions from their deflection under defined loads. A strong temperature dependence is observed, with a minimum near the clearing temperature. Both the nonlinear relation between filament tension and diameter and the substantial increase of the tension with lower temperatures indicate contributions of volume terms, in addition to surface capillary forces. We discuss a model that relates these bulk terms to elastic forces, originating from the undulated smectic layer structure. This model can explain the origin of the filament stability.

Morys, M.; Trittel, T.; Eremin, A.; Murphy, P.; Stannarius, R.

2012-10-01

315

Structure and Dynamics of the Actin Filament  

PubMed Central

We used all-atom molecular dynamics simulations to investigate the structure and properties of the actin filament, starting with either the recent Oda model or the older Holmes model. Simulations of monomeric and polymerized actin show that polymerization changes the nucleotide-binding cleft, bringing together the Q137 side chain and bound ATP in a way that may enhance ATP hydrolysis rate in the filament. Simulations with different bound nucleotides and conformations of the DNase I binding loop show that the persistence length of the filament depends only on the loop conformation. The computational modeling reveals how bound phalloidin stiffens actin filaments and inhibits the release of the ?-phosphate from ADP-Pi actin.

Pfaendtner, Jim; Lyman, Edward; Pollard, Thomas D.; Voth, Gregory A.

2009-01-01

316

A Summary of the Fatigue Properties of Wind Turbine Materials  

Microsoft Academic Search

Modern wind turbines are fatigue critical machines that are typically used to produce electrical power from the wind. The materials used to construct these machines are subjected to a unique loading spectrum that contains several orders of magnitude more cycles than other fatigue critical structures, e.g., an airplane. To facilitate fatigue designs, a large database of material properties has been

HERBERT J

1999-01-01

317

DOE/NASA Lewis large wind turbine program  

NASA Technical Reports Server (NTRS)

An overview of the large wind turbine activities managed by NASA is given. These activities include resuls from the first and second generation field machines (Mod-0A, -1, and -2), the status of the Department of Interior WTS-4 machine for which NASA is responsible for technical management, and the design phase of the third generation wind turbines (Mod-5).

Thomas, R. L.

1982-01-01

318

Harnessing Wind  

NSDL National Science Digital Library

Students are introduced to the ways that engineers study and harness the wind. They learn about the different kinds of winds and how to measure wind direction. In addition, they learn how air pressure creates winds and how engineers design and test wind turbines to harness renewable wind energy.

Integrated Teaching And Learning Program

319

Actin Filament Attachments for Sustained Motility In Vitro Are Maintained by Filament Bundling  

PubMed Central

We reconstructed cellular motility in vitro from individual proteins to investigate how actin filaments are organized at the leading edge. Using total internal reflection fluorescence microscopy of actin filaments, we tested how profilin, Arp2/3, and capping protein (CP) function together to propel thin glass nanofibers or beads coated with N-WASP WCA domains. Thin nanofibers produced wide comet tails that showed more structural variation in actin filament organization than did bead substrates. During sustained motility, physiological concentrations of Mg2+ generated actin filament bundles that processively attached to the nanofiber. Reduction of total Mg2+ abolished particle motility and actin attachment to the particle surface without affecting actin polymerization, Arp2/3 nucleation, or filament capping. Analysis of similar motility of microspheres showed that loss of filament bundling did not affect actin shell formation or symmetry breaking but eliminated sustained attachments between the comet tail and the particle surface. Addition of Mg2+, Lys-Lys2+, or fascin restored both comet tail attachment and sustained particle motility in low Mg2+ buffers. TIRF microscopic analysis of filaments captured by WCA-coated beads in the absence of Arp2/3, profilin, and CP showed that filament bundling by polycation or fascin addition increased barbed end capture by WCA domains. We propose a model in which CP directs barbed ends toward the leading edge and polycation-induced filament bundling sustains processive barbed end attachment to the leading edge.

Hu, Xiaohua; Kuhn, Jeffrey R.

2012-01-01

320

Kinks, rings, and rackets in filamentous structures  

PubMed Central

Carbon nanotubes and biological filaments each spontaneously assemble into kinked helices, rings, and “tennis racket” shapes due to competition between elastic and interfacial effects. We show that the slender geometry is a more important determinant of the morphology than any molecular details. Our mesoscopic continuum theory is capable of quantifying observations of these structures and is suggestive of their occurrence in other filamentous assemblies as well.

Cohen, Adam E.; Mahadevan, L.

2003-01-01

321

Study of filamentation threshold in zinc selenide.  

PubMed

The possibility of creating filaments with laser wavelengths ranging from 800 nm to 2.4 µm was investigated using an OPA laser system. Zinc Selenide's (ZnSe) unique characteristics - small band gap E(gZnSe)=2.67eV and positive dispersion for this wavelength range - are well suited for filamentation study where multi-photon absorption can be achieved with two to six photons. PMID:24663922

Durand, Magali; Houard, Aurélien; Lim, Khan; Durécu, Anne; Vasseur, Olivier; Richardson, Martin

2014-03-10

322

Consequence of filamentation on stimulated Raman scattering  

Microsoft Academic Search

In a plasma with long density scale length, a laser beam breaks up into a number of filaments, each having a size a?c\\/?p. The process of stimulated Raman scattering in these filaments involves a backscattered light wave of radial extent ?a and a Langmuir wave of extent b?(a?D)1\\/2≪a. The strong localization of the interaction region tends to severely suppress the

C. S. Liu; V. K. Tripathi

1986-01-01

323

Consequence of filamentation on stimulated Raman scattering  

Microsoft Academic Search

In a plasma with long density scale length, a laser beam breaks up into a number of filaments, each having a size a--c\\/..omega..\\/sub p\\/. The process of stimulated Raman scattering in these filaments involves a backscattered light wave of radial extent --a and a Langmuir wave of extent b--(alambda\\/sub D\\/)¹\\/sup \\/\\/²<

C. S. Liu; V. K. Tripathi

1986-01-01

324

Filament-wound, fiberglass cryogenic tank supports  

NASA Technical Reports Server (NTRS)

The design, fabrication, and testing of filament-wound, fiberglass cryogenic tank supports for a LH2 tank, a LF2/FLOX tank and a CH4 tank. These supports consist of filament-wound fiberglass tubes with titanium end fittings. These units were satisfactorily tested at cryogenic temperatures, thereby offering a design that can be reliably and economically produced in large or small quantities. The basic design concept is applicable to any situation where strong, lightweight axial load members are desired.

Carter, J. S.; Timberlake, T. E.

1971-01-01

325

Designing highly tunable semiflexible filament networks  

NASA Astrophysics Data System (ADS)

Semiflexible polymers can generate a range of filamentous networks significantly different in structure from those seen in conventional polymer solutions. Our coarse-grained simulations with an implicit cross-linker potential show that networks of branching bundles, knotted morphologies, and structural chirality can be generated by a generalized approach independent of specific cross-linkers. Network structure depends primarily on filament flexibility and separation, with significant connectivity increase after percolation. Results should guide the design of engineered semiflexible polymers.

Pandolfi, Ronald J.; Edwards, Lauren; Johnston, David; Becich, Peter; Hirst, Linda S.

2014-06-01

326

Homology of retractile filaments of vampire squid.  

PubMed

The axial filament nerves of Vampyroteuthis infernalis are joined to two separate parts of the brain. One branch of the nerve, apparently efferent, arises from the anterior portion of the middle subesophageal mass, and the other, apparently afferent. enters the ventral magnocellular lobe. Since this innervation is entirely different from that of the arms, the filaments can no longer be considered homologous with the arms. The validity and primitive nature of the order Vampyromorpha, therefore, needs to be reexamined. PMID:6025124

Young, R E

1967-06-23

327

Review of wind turbine control  

Microsoft Academic Search

The literature on the design of control sysems for medium- and large-scale wind turbine generators is reviewed. The vast majority of relevant literature is concerned with the control of horizontal-axis machines. Emphasis is given to public-utility service machines with power outputs in the range hundreds to thousands of kilowatts. This work was prompted by the need to determine specific objectives

S. A. DE LA SALLE; D. REARDON; W. E. LEITHEAD; M. J. GRlMBLE

1990-01-01

328

Filament Eruption without Coronal Mass Ejection  

NASA Technical Reports Server (NTRS)

We report characteristics of quiescent filament eruptions that did not produce coronal mass ejections (CMEs). We examined 12 quiescent filament eruptions, each of which was located far from disk center (greater than or equal to 0.7 R (sub sun)) in diffuse remnant magnetic fields of decayed active regions, was well observed in full-disk movies in H alpha and Fe XII, and had good coronagraph coverage. Of the 12 eruptions, 7 produced CMEs and 5 did not. Even though the two kinds of eruption were indistinguishable in their magnetic setting and in the eruptive motion of the filament in the H alpha movies, each of the CME-producing eruptions produced a two-ribbon flare in H alpha and a flare arcade in Fe XII, and each of the non-CME-producing eruptions did not. From this result, and the appearance of the eruptive motion in the Fe XII movies, we conclude that the non-CME-producing filament eruptions are confined eruptions like the confined filament eruptions in active regions. We take the similarity of the confined and eruptive quiescent filament eruptions with their active-region counterparts to favor runaway tether-cutting reconnection for unleashing the magnetic explosion in all these eruptions.

Choudhary, Debi Prasad; Moore, Ronald L.

2003-01-01

329

Transient Stability Simulation of Wind Generator Expressed by Two-Mass Model  

Microsoft Academic Search

Recently, wind power generation is increasing in the world. In the wind power stations, induction machines are mostly used as generators. Since induction generators have a stability problem similar to the transient stability of synchronous machines, it is important to analyze the transient stability of power systems including wind generators. Although there have been some reports analyzing the transient stability

Yoshikazu Shima; Rion Takahashi; Toshiaki Murata; Junji Tamura; Yuichi Tomaki; Shinobu Tominaga; Atsushi Sakahara

2005-01-01

330

A comparison of predicted wind turbine blade loads to test measurements  

Microsoft Academic Search

The accurate prediction of wind turbine blade loads and response is important in predicting the fatigue life of wind machines. At the SERI Wind Energy Research Center, a rotor code called FLAP (Force and Loads Analysis Program) is currently being validated by comparing predicted results to machine measurements. The FLAP code has been modified to allow the teetering degree of

A. D. Wright; R. W. Thresher

1988-01-01

331

A comparison of predicted wind turbine blade loads to test measurements  

Microsoft Academic Search

The accurate prediction of wind turbine blade loads and response is important in predicting the fatigue life of wind machines. At the SERI Wind Energy Research Center, a rotor code called FLAP (Force and Loads Analysis Program) is currently being validated by comparing predicted results to machine measurements. The FLAP code has been modified to allow the teetering degrees of

A. D. Wright; R. W. Thresher

1987-01-01

332

Experimental study of filamentation in laser-plasma interactions  

SciTech Connect

The filamentation instability can lead to regions of increased laser intensity when a spatially nonuniform laser beam interacts with a plasma. An experimental technique will be described which identifies the density perturbation produced by filaments. The growth of filaments has been investigated and, when the laser intensity is large enough, the transverse density profile of the filament can be measured. Evidence of filament growth influenced by plasma flow and density gradients is presented. 19 refs., 4 figs.

Young, P.E.

1991-01-07

333

Filament eruption in association with rotational motion near the filament footpoints  

NASA Astrophysics Data System (ADS)

The active region magnetic field surrounding the filament plays an important role in filament formation, their evolution and disruption. We investigated a filament eruption that occurred in southern hemisphere of the Sun on July 08, 2011 using AIA and HMI data. The filament was located in a region close to the active region NOAA 11247 with its West-most footpoint anchored in the negative polarity plage region and the East-most in the positive polarity plage region. During observations, the magnetic flux was emerging in the active region and also in the plage regions. The flux emergence was stopped in West-most footpoint of the plage region about an hour before the filament eruption. A converging motion was also observed for many hours in the Western footpoint of the filament. The filament had left-handed twist and the net injected magnetic helicity was positive in both footpoints. Both sign of magnetic helicity were observed in the Western footpoint of the filament where the eruption has initiated. Further, an anti-clockwise rotational motion was observed in both the footpoints just after the onset of filament eruption which lasted for 6 min during the eruption process. The emerging flux, converging motion and injection of opposite magnetic helicity could be responsible for destabilizing of the Western footpoint of the filament leading to eruption. The torque imbalance between the expanded portion of the flux tube and the photosphere may have caused the rotation in the footpoint region which changed the trend in the injected magnetic helicity after the filament eruption.

Dhara, Sajal Kumar; Ravindra, B.; Banyal, Ravinder Kumar

2014-01-01

334

A construction technique for wind tunnel models  

NASA Technical Reports Server (NTRS)

High strength, good surface finish, and corrosion resistance are imparted to miniature wind tunnel models by machining pressure channels as integral part of model. Pattern for pressure channels is scribed, machined, or photoetched before channels are drilled. Mating surfaces for channels are flashed and then diffusion brazed together.

Lawing, P. L.; Sandefur, P. G., Jr.; Wood, W. H.

1981-01-01

335

Prediction of the far field noise from wind energy farms  

NASA Technical Reports Server (NTRS)

The basic physical factors involved in making predictions of wind turbine noise and an approach which allows for differences in the machines, the wind energy farm configurations and propagation conditions are reviewed. Example calculations to illustrate the sensitivity of the radiated noise to such variables as machine size, spacing and numbers, and such atmosphere variables as absorption and wind direction are presented. It is found that calculated far field distances to particular sound level contours are greater for lower values of atmospheric absorption, for a larger total number of machines, for additional rows of machines and for more powerful machines. At short and intermediate distances, higher sound pressure levels are calculated for closer machine spacings, for more powerful machines, for longer row lengths and for closer row spacings.

Shepherd, K. P.; Hubbard, H. H.

1986-01-01

336

PM wind generator topologies  

Microsoft Academic Search

The objective of this paper is to provide a comparison among permanent magnet (PM) wind generators of different topologies. Seven configurations are chosen for the comparison, consisting of both radial-flux and axial-flux machines. The comparison is done at seven power levels ranging from 1 to 200 kW. The basis for the comparison is discussed and implemented in detail in the

Yicheng Chen; Pragasen Pillay; Azeem Khan

2005-01-01

337

Relationship of Species-Specific Filament Levels to Filamentous Bulking in Activated Sludge  

PubMed Central

To examine the relationship between activated-sludge bulking and levels of specific filamentous bacteria, we developed a statistics-based quantification method for estimating the biomass levels of specific filaments using 16S rRNA-targeted fluorescent in situ hybridization (FISH) probes. The results of quantitative FISH for the filament Sphaerotilus natans were similar to the results of quantitative membrane hybridization in a sample from a full-scale wastewater treatment plant. Laboratory-scale reactors were operated under different flow conditions to develop bulking and nonbulking sludge and were bioaugmented with S. natans cells to stimulate bulking. Instead of S. natans, the filament Eikelboom type 1851 became dominant in the reactors. Levels of type 1851 filaments extending out of the flocs correlated strongly with the sludge volume index, and extended filament lengths of approximately 6 × 108 ?m ml?1 resulted in bulking in laboratory-scale and full-scale activated-sludge samples. Quantitative FISH showed that high levels of filaments occurred inside the flocs in nonbulking sludge, supporting the “substrate diffusion limitation” hypothesis for bulking. The approach will allow the monitoring of incremental improvements in bulking control methods and the delineation of the operational conditions that lead to bulking due to specific filaments.

Liao, Jiangying; Lou, Inchio; de los Reyes, Francis L.

2004-01-01

338

Development of wind turbine towers using fiber reinforced polymers  

NASA Astrophysics Data System (ADS)

With an ongoing trend in the wind turbine market, the size of wind turbines has been increasing continuously. Larger wind turbines imply an increase in size, weight, and loads acting on the wind turbine tower. This requires towers to be stronger and stiffer, and consequently leads to bigger tower diameters. Because of their size and weight, transportation and erection require heavy equipment that makes the use of such towers prohibitive in remote communities. To tackle this problem, a research program was initiated at the University of Manitoba to develop the technology required for the fabrication of wind turbine towers constructed of fiber reinforced polymers (FRP) for use in remote communities in Canada. The research program was carried out in stages. During the first stage, a feasibility study and an analytical investigation on various shapes of FRP towers were conducted. The concept of a multi-cellular composite tower was examined in great detail and the finite element results showed that such a tower could result in almost 45 percent reduction in weight. In the second stage of this research program, a robotic filament winding machine was designed and constructed in the Composites Laboratory of the University of Manitoba. It was used to fabricate the multi-cell tower specimens for testing. The third stage of the research program involved the experimental investigation, which was carried out in three phases. In the first phase, two single cell specimens were tested to failure under lateral loading. The specimens were 8 ft (2.44 m) long. The second phase involved the testing of two single cells loaded in compression. The third phase of the experimental investigation involved the testing of two eight-cell jointed tower specimens. The specimens were octagonal and tapered, with a diameter of 21.4 in (543 mm) at the base and 17.4 in (441 mm) at the top. They were 16 ft (4.88 m) in height and tested as cantilever under static loading. Local buckling was the dominant failure mode of the specimens tested. One of these towers was subsequently repaired and retested to determine whether repairing would restore the original strength of the tower. The last stage of the research program, various finite element models were developed to analyze the structural behavior of tested specimens. The results from finite element models were validated through comparison with experimental results. The finite element models gave a very good prediction of the structural performance of the FRP towers tested.

Ungkurapinan, Nibong

339

Hard Machinable Machining of Cobalt Super Alloys  

NASA Astrophysics Data System (ADS)

The article deals with difficult-to-machine cobalt super alloys. The main aim is to test the basic properties of cobalt super alloys and propose suitable cutting materials and machining parameters under the designation 188 when machining. Although the development of technology in chipless machining such as moulding, precision casting and other manufacturing methods continues to advance, machining is still the leading choice for piece production, typical for energy and chemical engineering. Nowadays, super alloys are commonly used in turbine engines in regions that are subject to high temperatures, which require high strength, high temperature resistance, phase stability, as well as corrosion or oxidation resistance.

?ep, Robert; Janásek, Adam; Petr?, Jana; ?epová, Lenka; Sadílek, Marek; Kratochvíl, Ji?í

2012-12-01

340

Stirling machine operating experience  

NASA Technical Reports Server (NTRS)

Numerous Stirling machines have been built and operated, but the operating experience of these machines is not well known. It is important to examine this operating experience in detail, because it largely substantiates the claim that Stirling machines are capable of reliable and lengthy lives. The amount of data that exists is impressive, considering that many of the machines that have been built are developmental machines intended to show proof of concept, and were not expected to operate for any lengthy period of time. Some Stirling machines (typically free-piston machines) achieve long life through non-contact bearings, while other Stirling machines (typically kinematic) have achieved long operating lives through regular seal and bearing replacements. In addition to engine and system testing, life testing of critical components is also considered.

Ross, Brad; Dudenhoefer, James E.

1991-01-01

341

Nontraditional Machining of Beryllium.  

National Technical Information Service (NTIS)

The report deals with electrichemical machining (ECM), chemical milling, and electric-discharge machining (EDM). The general characteristics of these processes and their applications to the processing of beryllium parts are presented and covered in detail...

J. A. Gurklis

1972-01-01

342

Modeling and control of a wind turbine driven doubly fed induction generator  

Microsoft Academic Search

This paper presents the simulation results of a grid-connected wind driven doubly fed induction machine (DFIM) together with some real machine performance results. The modeling of the machine considers operating conditions below and above synchronous speed, which are actually achieved by means of a double-sided PWM converter joining the machine rotor to the grid. In order to decouple the active

Arantxa Tapia; Gerardo Tapia; J. Xabier Ostolaza; José Ramón Sáenz

2003-01-01

343

Network incorporation of intermediate filament molecules differs between preexisting and newly assembling filaments.  

PubMed

When studying the way in which intermediate filaments assemble in vivo, it is important to distinguish between the incorporation of intermediate filament proteins into an existing intermediate filament network and the ability to form a new network within cells. To distinguish between these alternatives, we have made a hybrid construct consisting of the rod and tail domains of murine glial fibrillary acidic protein (GFAP) coupled to the head domain of bovine keratin 19, called K19GFAP. The assembly characteristics of K19GFAP were analyzed in vitro and in vivo. Replacement of the head domain with the bovine K19 sequence did not prevent the incorporation of K19GFAP into the existing network of vimentin intermediate filaments in NIH 3T3 cells but it was incompatible with de novo formation of filament networks in the epithelial cell line MCF-7, which lacks an endogenous vimentin network. By in vitro assembly studies, it was confirmed that K19GFAP was unable to assemble into typical intermediate filaments. We also investigated the ability of an appropriate type II keratin partner to rescue K19GFAP from incorporation into a vimentin network and initiate de novo filament assembly, using the fibroblast cell line KF-K8(3), an NIH 3T3 fibroblast cell line expressing a single human keratin, K8. The results confirm the importance of the coiled coil interactions in determining the fate of intermediate filament proteins. The results also emphasize that filament networks can not only tolerate but also incorporate assembly-deficient intermediate filament protein subunits. PMID:7689477

Lu, X; Quinlan, R A; Steel, J B; Lane, E B

1993-09-01

344

Eruption of a Bifurcated Solar Filament  

NASA Astrophysics Data System (ADS)

We study the partial eruption of a solar filament observed by the Solar Dynamics Observatory (SDO) and the Solar TErrestrial RElations Observatory-Ahead (STEREO-A) spacecraft on 9 May 2012. This filament was located in Active Region NOAA 11475 and consisted of two distinct branches, separated in height above the active region's primary polarity-inversion line. For two days prior to the filament eruption, several threads of filament material were observed to connect the lower branch to the upper branch with evidence of a transfer of mass along them. The eruption commenced as a slow rise of the upper branch that began at 9 May 2012 23:40 UT, with the main eruption occurring half an hour later, producing a coronal mass ejection (CME). During the eruption, the upper branch was observed to rotate approximately 120 degrees in a counter-clockwise direction. We suggest that the mass transfer events also comprised a transfer of magnetic flux that led the upper branch of the filament to lose equilibrium as a result of a helical kink instability or torus instability.

Zhu, Chunming; Alexander, David

2014-01-01

345

Filament Eruption without Coronal Mass Ejection  

NASA Technical Reports Server (NTRS)

We report characteristics of quiescent filament eruptions that were not associated with coronal mass ejections (CMEs). We examined 12 quiescent filament eruptions, each of which was located far from disk center (20.7 R(sub sun)) in diffuse remnant magnetic fields of decayed active regions, was well observed in full-disk movies in Ha and Fe XI, and had good coronagraph coverage. Of the 12 events, 9 were associated with CMEs and 3 were not. Even though the two kinds of eruption were indistinguishable in their magnetic setting and in the eruptive motion of the filament in the Ha movies, each of the CME-producing eruptions produced a two-ribbon flare in Ha and a coronal arcade and/or two-ribbon flare in Fe XII, and each of the non-CME-producing eruptions did not. From this result, and the appearance of the eruptive motion in the Fe XII movies, we conclude that the non-CME-associated filament eruptions are confined eruptions like the confined filament eruptions in active regions.

Choudhary, Debi Prasad; Moore, Ronald L.

2003-01-01

346

Membrane-induced bundling of actin filaments  

NASA Astrophysics Data System (ADS)

Dynamic interplay between the plasma membrane and underlying cytoskeleton is essential for cellular shape change. Spatial organization of actin filaments, the growth of which generates membrane deformations during motility, phagocytosis, endocytosis and cytokinesis, is mediated by specific protein-protein interactions that branch, crosslink and bundle filaments into networks that interact with the membrane. Although membrane curvature has been found to influence binding of proteins with curvature-sensitive domains, the direct effect of membrane elasticity on cytoskeletal network organization is not clear. Here, we show through in vitro reconstitution and elastic modelling that a lipid bilayer can drive the emergence of bundled actin filament protrusions from branched actin filament networks, thus playing a role normally attributed to actin-binding proteins. Formation of these filopodium-like protrusions with only a minimal set of purified proteins points to an active participation of the membrane in organizing actin filaments at the plasma membrane. In this way, elastic interactions between the membrane and cytoskeleton can cooperate with accessory proteins to drive cellular shape change.

Liu, Allen P.; Richmond, David L.; Maibaum, Lutz; Pronk, Sander; Geissler, Phillip L.; Fletcher, Daniel A.

2008-10-01

347

Nebulin binding impedes mutant desmin filament assembly.  

PubMed

Desmin intermediate filaments (DIFs) form an intricate meshwork that organizes myofibers within striated muscle cells. The mechanisms that regulate the association of desmin to sarcomeres and their role in desminopathy are incompletely understood. Here we compare the effect nebulin binding has on the assembly kinetics of desmin and three desminopathy-causing mutant desmin variants carrying mutations in the head, rod, or tail domains of desmin (S46F, E245D, and T453I). These mutants were chosen because the mutated residues are located within the nebulin-binding regions of desmin. We discovered that, although nebulin M160-164 bound to both desmin tetrameric complexes and mature filaments, all three mutants exhibited significantly delayed filament assembly kinetics when bound to nebulin. Correspondingly, all three mutants displayed enhanced binding affinities and capacities for nebulin relative to wild-type desmin. Electron micrographs showed that nebulin associates with elongated normal and mutant DIFs assembled in vitro. Moreover, we measured significantly delayed dynamics for the mutant desmin E245D relative to wild-type desmin in fluorescence recovery after photobleaching in live-cell imaging experiments. We propose a mechanism by which mutant desmin slows desmin remodeling in myocytes by retaining nebulin near the Z-discs. On the basis of these data, we suggest that for some filament-forming desmin mutants, the molecular etiology of desminopathy results from subtle deficiencies in their association with nebulin, a major actin-binding filament protein of striated muscle. PMID:23615443

Baker, Laura K; Gillis, David C; Sharma, Sarika; Ambrus, Andy; Herrmann, Harald; Conover, Gloria M

2013-06-01

348

Fiberglass composite blades for the 4 MW - WTS-4 wind turbine  

Microsoft Academic Search

The design and fabrication of composite blades for the WTS-4, a four-megawatt horizontal-axis wind turbine, is discussed. The blade consists of a two-cell, monolithic structure of filament-wound, fiberglass\\/epoxy composite. Filament winding is a low-cost process which can produce a blade with an aerodynamically efficient airfoil and planform with nonlinear twist to achieve high performance in terms of energy capture. Its

R. J. Bussolari

1982-01-01

349

The Advantage of Machines  

NSDL National Science Digital Library

In this lesson, students learn about work as defined by physical science and see that work is made easier through the use of simple machines. Already encountering simple machines everyday, students will be learn about their widespread uses in improving everyday life. This lesson serves as the starting point for the Simple Machines Unit.

Integrated Teaching And Learning Program

350

Your Sewing Machine.  

ERIC Educational Resources Information Center

The programed instruction manual is designed to aid the student in learning the parts, uses, and operation of the sewing machine. Drawings of sewing machine parts are presented, and space is provided for the student's written responses. Following an introductory section identifying sewing machine parts, the manual deals with each part and its…

Peacock, Marion E.

351

Method for optimizing strategy for electric machines  

US Patent & Trademark Office Database

A method is provided to facilitate optimizing a winding and lamination configuration an electric machine. The method employs a computer including a microprocessor for executing computer functions, a database for storing optimization data, and a two-level optimization algorithm that has a first optimization module and a second optimization module. The method includes generating a plurality of data sets utilizing the first determining an optimum response surface based the data sets, utilizing the second module, determining an optimum data set based on the optimum response surface, utilizing the first module, and outputting an optimum winding and lamination configuration based on the optimum data set.

2005-08-23

352

Modeling stochastic wind loads on vertical axis wind turbines  

NASA Astrophysics Data System (ADS)

The Vertical Axis Wind Turbine (VAWT) is a machine which extracts energy from the wind. Since random turbulence is always present, the effect of this turbulence on the wind turbine fatigue life must be evaluated. This problem is approached by numerically simulating the turbulence and calculating, in the time domain, the aerodynamic loads on the turbine blades. These loads are reduced to the form of power and cross spectral densities which can be used in standard linear structural analysis codes. The relative importance of the turbulence on blade loads is determined.

Veers, P. S.

353

Dark cores in sunspot penumbral filaments.  

PubMed

Sunspot umbrae--the dark central regions of the spots--are surrounded by brighter filamentary penumbrae, the existence of which remains largely inexplicable. The penumbral filaments contain magnetic fields with varying inclinations and are associated with flowing gas, but discriminating between theoretical models has been difficult because the structure of the filaments has not hitherto been resolved. Here we report observations of penumbral filaments that reveal dark cores inside them. We cannot determine the nature of these dark cores, but their very existence provides a crucial test for any model of penumbrae. Our images also reveal other very small structures, in line with the view that many of the fundamental physical processes in the solar photosphere occur on scales smaller than 100 km. PMID:12432384

Scharmer, Göran B; Gudiksen, Boris V; Kiselman, Dan; Löfdahl, Mats G; van der Voort, Luc H M Rouppe

2002-11-14

354

The Physics of Intense Femtosecond Laser Filamentation  

NASA Astrophysics Data System (ADS)

When a powerful femtosecond laser pulse propagates in a transparent optical medium, be it a gas or a condensed medium, the pulse will self-focus into a series of self-foci, giving rise to the perception of a filament. This universal nonlinear propagation phenomenon is currently an interesting research topic at the forefront of applied physics and attracts more and more people into this field. In this chapter some fundamental physical concepts underlying femtosecond laser filamentation are discussed. These include slice-by-slice self-focusing, intensity clamping, self-transformation into a white light laser pulse (supercontinuum generation), background reservoir and multiple filamentation competition. Some important potential applications are also briefly mentioned.

Chin, See Leang; Liu, Weiwei; Kosareva, Olga G.; Kandidov, Valerii P.

355

Filament velocity scaling laws for warm ions  

NASA Astrophysics Data System (ADS)

The dynamics of filaments or blobs in the scrape-off layer of magnetic fusion devices are studied by magnitude estimates of a comprehensive drift-interchange-Alfvén fluid model. The standard blob models are reproduced in the cold ion case. Even though usually neglected, in the scrape-off layer, the ion temperature can exceed the electron temperature by an order of magnitude. The ion pressure affects the dynamics of filaments amongst others by adding up to the interchange drive and the polarisation current. It is shown how both effects modify the scaling laws for filament velocity in dependence of its size. Simplifications for experimentally relevant limit regimes are given. These are the sheath dissipation, collisional, and electromagnetic regime.

Manz, P.; Carralero, D.; Birkenmeier, G.; Müller, H. W.; Müller, S. H.; Fuchert, G.; Scott, B. D.; Stroth, U.

2013-10-01

356

Solar Magnetized "Tornadoes:" Relation to Filaments  

NASA Astrophysics Data System (ADS)

Solar magnetized "tornadoes," a phenomenon discovered in the solar atmosphere, appear as tornado-like structures in the corona but are rooted in the photosphere. Like other solar phenomena, solar tornadoes are a feature of magnetized plasma and therefore differ distinctly from terrestrial tornadoes. Here we report the first analysis of solar "tornadoes" (two papers which focused on different aspects of solar tornadoes were published in the Astrophysical Journal Letters and Nature, respectively, during the revision of this Letter). A detailed case study of two events indicates that they are rotating vertical magnetic structures probably driven by underlying vortex flows in the photosphere. They usually exist as a group and are related to filaments/prominences, another important solar phenomenon whose formation and eruption are still mysteries. Solar tornadoes may play a distinct role in the supply of mass and twists to filaments. These findings could lead to a new explanation of filament formation and eruption.

Su, Yang; Wang, Tongjiang; Veronig, Astrid; Temmer, Manuela; Gan, Weiqun

2012-09-01

357

Filament velocity scaling laws for warm ions  

SciTech Connect

The dynamics of filaments or blobs in the scrape-off layer of magnetic fusion devices are studied by magnitude estimates of a comprehensive drift-interchange-Alfvén fluid model. The standard blob models are reproduced in the cold ion case. Even though usually neglected, in the scrape-off layer, the ion temperature can exceed the electron temperature by an order of magnitude. The ion pressure affects the dynamics of filaments amongst others by adding up to the interchange drive and the polarisation current. It is shown how both effects modify the scaling laws for filament velocity in dependence of its size. Simplifications for experimentally relevant limit regimes are given. These are the sheath dissipation, collisional, and electromagnetic regime.

Manz, P. [Physik-Department E28, Technische Universität München, James-Franck-Str. 1, 85748 Garching (Germany) [Physik-Department E28, Technische Universität München, James-Franck-Str. 1, 85748 Garching (Germany); Max-Planck-Institut für Plasmaphysik, EURATOM Assoziation, Boltzmannstr. 2, 85748 Garching (Germany); Carralero, D.; Birkenmeier, G.; Müller, H. W.; Scott, B. D. [Max-Planck-Institut für Plasmaphysik, EURATOM Assoziation, Boltzmannstr. 2, 85748 Garching (Germany)] [Max-Planck-Institut für Plasmaphysik, EURATOM Assoziation, Boltzmannstr. 2, 85748 Garching (Germany); Müller, S. H. [Center for Momentum Transport and Flow Organization, University of California at San Diego, San Diego 92093 (United States)] [Center for Momentum Transport and Flow Organization, University of California at San Diego, San Diego 92093 (United States); Fuchert, G. [Insitut für Grenzflächenverfahrenstechnik und Plasmatechnologie, Universität Stuttgart, 70569 Stuttgart (Germany)] [Insitut für Grenzflächenverfahrenstechnik und Plasmatechnologie, Universität Stuttgart, 70569 Stuttgart (Germany); Stroth, U. [Max-Planck-Institut für Plasmaphysik, EURATOM Assoziation, Boltzmannstr. 2, 85748 Garching (Germany) [Max-Planck-Institut für Plasmaphysik, EURATOM Assoziation, Boltzmannstr. 2, 85748 Garching (Germany); Physik-Department E28, Technische Universität München, James-Franck-Str. 1, 85748 Garching (Germany)

2013-10-15

358

Filament Twist in F-Actin Bundles  

NASA Astrophysics Data System (ADS)

The twist state of F-actin can modify specific binding sites and influence the hierarchy of interactions in cytoskeletal regulation. F-actin in the cytoskeleton is often organized into bundles, using a wide variety of cationic molecules and actin-linking proteins. The native helical symmetry of uncondensed f-actin filaments is not necessarily the preferred symmetry of bundled filaments, which will depend on the particular bundling mechanism and the kind of condensing agent used. In order to explore the role of filament distortion in the process of bundle formation, we have carried out a series of synchrotron x-ray measurements on systems of bundled f-actin, using multivalent cations, cationic globular proteins, and actin binding proteins. Preliminary results will be presented. This work was supported by NSF DMR-0071761, DOE, DEFG02-91ER45439, the Beckman Young Investigator Program, and the Cystic Fibrosis Foundation.

Angelini, Tommy; Sanders, Lori; Wong, Gerard

2003-03-01

359

SOLAR MAGNETIZED 'TORNADOES': RELATION TO FILAMENTS  

SciTech Connect

Solar magnetized 'tornadoes', a phenomenon discovered in the solar atmosphere, appear as tornado-like structures in the corona but are rooted in the photosphere. Like other solar phenomena, solar tornadoes are a feature of magnetized plasma and therefore differ distinctly from terrestrial tornadoes. Here we report the first analysis of solar 'tornadoes' (two papers which focused on different aspects of solar tornadoes were published in the Astrophysical Journal Letters and Nature, respectively, during the revision of this Letter). A detailed case study of two events indicates that they are rotating vertical magnetic structures probably driven by underlying vortex flows in the photosphere. They usually exist as a group and are related to filaments/prominences, another important solar phenomenon whose formation and eruption are still mysteries. Solar tornadoes may play a distinct role in the supply of mass and twists to filaments. These findings could lead to a new explanation of filament formation and eruption.

Su Yang; Veronig, Astrid; Temmer, Manuela [IGAM-Kanzelhoehe Observatory, Institute of Physics, University of Graz, Universitaetsplatz 5, A-8010 Graz (Austria); Wang Tongjiang [Department of Physics, Catholic University of America, Washington, DC 20064 (United States); Gan Weiqun, E-mail: yang.su@uni-graz.at [Key Laboratory of Dark Matter and Space Astronomy, Purple Mountain Observatory, Chinese Academy of Sciences, Nanjing 210008 (China)

2012-09-10

360

Autocalibration of an SMT machine by machine vision  

Microsoft Academic Search

An SMT machine has many working coordinate frames—the fiducial mark camera frame, component camera frame, machine table frame, PCB frame, and reference frame. Because of many influences such as mechanical dimension errors, machine assembling errors, and camera lens distortions, all frames on the SMT machine must be calibrated to compensate for these machine errors. This paper applies machine vision techniques

C.-L. Shih; C.-W. Ruo

2005-01-01

361

Dynamic behavior of variable speed wind turbines under stochastic wind  

Microsoft Academic Search

It is recognized that the most important advantage of the variable speed wind turbines (VS WTs) over the conventional constant speed (CS) machines are the improved dynamic characteristics, resulting in the reduction of the drive train mechanical stresses and output power fluctuations. In this paper alternative configurations of the electrical part of a VS WT are considered, using a squirrel

S. A. Papathanassiou; M. P. Papadopoulos

1999-01-01

362

Axial Flux Permanent Magnet Generator with Concentrated Winding for Small Wind Power Applications  

Microsoft Academic Search

An axial flux permanent magnet machine, designed to operate as a generator in a small-scale wind-power applications, is described in this paper. The machine is realized by using consecrated stator winding with open slots and surface mounted permanent magnets on rotor disk. Such a novel generator structure is simple to construct and its performance is good; it offers sinusoidal back-emf

A. Parviainen; J. Pyrhonen; P. Kontkanen

2005-01-01

363

U. radio emission from quiescent filaments  

NASA Technical Reports Server (NTRS)

Full-disk Very Large Array (VLA) synthesis maps of the quiet Sun indicate that filaments can be seen in emission at 91.6 cm wavelength; they are detected in absorption at shorter microwave wavelengths. The 91.6 cm emission has a brightness temperature of T sub B = 3 x 10(exp 5) K. It is hotter, wider and longer than the underlying filament detected at H alpha wavelengths, but the similarity between the shape, position, elongation and orientation of the radio and optical features suggests their close association. The 91.6 cm emission is attributed to the thermal-bremsstrahlung of a hot transition sheath that envelopes the H alpha filament and acts as an interface between the cool, dense H alpha filament and the hotter, rarefied corona. The transition sheath is seen in emission because of the lower optical depth of the corona at 90 cm wavelength, and the width of this sheet is 10(exp 9) cm. A power law gradient in pressure provides a better match to the observations than a constant pressure model; definitive tests of theoretical models await simultaneous multi-wavelength studies of filaments at different observing angles. When the thermal bremsstrahlung is optically thin, the magnetic field strength in the transition sheath can be inferred from the observed circular polarization. Variable physical parameters of the sheath, such as width, electron density, and electron temperature, can explain controversial reports of the detection of, or the failure to detect, the meter-wavelength counterpart of H alpha filaments.

Lang, Kenneth R.

1989-01-01

364

Numerical simulation of vortex breakdown by the vortex-filament method  

NASA Technical Reports Server (NTRS)

The vortex-filament method was applied to the simulation of vortex breakdown. The principal vortex region was represented by multiple filaments, and an axial velocity component was induced by a spiral winding of the filaments. An accuracy check was performed for a cylindrical swirling flow with simple analytical expressions for the axial and theta velocities. The result suggests that the flow field can be simulated to any accuracy by increasing the number of filaments. An axisymmetric-type vortex breakdown was simulated, with experimental data serving as upstream conditions. The calculated axial- and theta-velocity contours show the breakdown of the vortex, including a rapid change in the vortex core, followed axially by a recovery zone and then a second breakdown. When three dimensional initial data are used the second breakdown appears to be of the spiral type in correspondence with experimental observations. The present method can easily be used to simulate other types of vortex breakdown or other vortex flows with axial velocity.

Nakamura, Y.; Leonard, A.; Spalart, P. R.

1983-01-01

365

Edheads: The Compound Machine  

NSDL National Science Digital Library

This resource is a collection of interactive animations designed to help kids learn how forces and simple machines can work together to create the compound machine. Child-centered animated activities enhance understanding of how compound machines function and how they are differentiated from simple machines. Additionally the site includes a glossary of important terms, lesson plans, a teacher's guide and information about professionals who work with compound machines. This page is part of a larger collection of animated education resources for the elementary level.

2007-09-18

366

Harnessing wind power  

NASA Astrophysics Data System (ADS)

The design goals, test results, operating mechanisms, and ultimate limits of large wind energy conversion systems (WECS) are explored. NASA is currently managing and monitoring the performance of the Mod O, Mod OA, Mod 1, and Mod 2 wind turbines, which produce from 100 kW-2.5 MWe for grid interconnection. The Mod 2 machines have a 300 ft diam rotor, begin producing at 14 mph and achieve the rated output at 20 mph. Testing has shown the necessity of incorporating partial span pitch control, a flexible shaft, yaw control, microprocessor monitored wind condition sensors, and a soft-shell tower to lower vibration hazards with WECS. Large WECS have proved to be relatively nonpolluting, although some television and radio interference is present. Institutional issues for the protection of land, of aircraft flight paths, and for utility interconnect are outlined, and large WECS development programs in Denmark, Sweden, Spain, and Germany are described.

Fagenbaum, J.

1982-04-01

367

Survey of a Gulf Stream frontal filament  

SciTech Connect

An assortment of data is used to map and characterize a Gul Stream filament. During 21--25 April 1980, a filament was captured as it moved through an array of moored current meters on the northeast Florida continental shelf. Current and temperature time series along with satellite VHRR and aircraft ART are used to reconstruct the event. The event is found to consist of an anticyclonically rotating, warm tongue inshore of a cold dome. The rotational scheme of the current in the warm tongue is opposite to previous hypotheses. Upwelling occurs in both the cold dome region and below the warm tongue.

Pietrafesa, L.J.

1983-03-01

368

Structure of Flexible Filamentous Plant Viruses  

SciTech Connect

Flexible filamentous viruses make up a large fraction of the known plant viruses, but in comparison with those of other viruses, very little is known about their structures. We have used fiber diffraction, cryo-electron microscopy, and scanning transmission electron microscopy to determine the symmetry of a potyvirus, soybean mosaic virus; to confirm the symmetry of a potexvirus, potato virus X; and to determine the low-resolution structures of both viruses. We conclude that these viruses and, by implication, most or all flexible filamentous plant viruses share a common coat protein fold and helical symmetry, with slightly less than 9 subunits per helical turn.

Kendall, Amy; McDonald, Michele; Bian, Wen; Bowles, Timothy; Baumgarten, Sarah C.; Shi, Jian; Stewart, Phoebe L.; Bullitt, Esther; Gore, David; Irving, Thomas C.; Havens, Wendy M.; Ghabrial, Said A.; Wall, Joseph S.; Stubbs, Gerald (IIT); (BU-M); (Vanderbilt); (Kentucky); (BNL)

2008-10-23

369

Infrared Radiation Filament And Metnod Of Manufacture  

DOEpatents

An improved IR radiation source is provided by the invention. A radiation filament has a textured surface produced by seeded ion bombardment of a metal foil which is cut to a serpentine shape and mounted in a windowed housing. Specific ion bombardment texturing techniques tune the surface to maximize emissions in the desired wavelength range and to limit emissions outside that narrow range, particularly at longer wavelengths. A combination of filament surface texture, thickness, material, shape and power circuit feedback control produce wavelength controlled and efficient radiation at much lower power requirements than devices of the prior art.

Johnson, Edward A. (Bedford, MA)

1998-11-17

370

Growth of Flagellar Filaments of Escherichia coli Is Independent of Filament Length  

PubMed Central

Bacterial flagellar filaments grow at their distal ends, from flagellin that travels through a central channel ?2 nm in diameter. The flagellin is extruded from the cytoplasm by a pump powered by a proton motive force (PMF). We measured filament growth in cells near the mid-exponential-phase with flagellin bearing a specific cysteine-for-serine substitution, allowing filaments to be labeled with sulfhydryl-specific fluorescent dyes. We labeled filaments first with a green maleimide dye and then, following an additional period of growth, with a red maleimide dye. The contour lengths of the green and red segments were measured. The average lengths of red segments (?2.3 ?m) were the same regardless of the lengths of the green segments from which they grew (ranging from less than 1 to more than 9 ?m in length). Thus, flagellar filaments do not grow at a rate that decreases exponentially with length, as formerly supposed. If flagellar filaments were broken by viscous shear, the broken filaments continued to grow. Identical results were obtained whether flagellin was expressed from fliC on the chromosome under the control of its native promoter or on a plasmid under the control of the arabinose promoter.

Turner, Linda; Stern, Alan S.

2012-01-01

371

Influence of dispersion in myosin filament orientation and anisotropic filament contractions in smooth muscle.  

PubMed

A new constitutive model for the biomechanical behaviour of smooth muscle tissue is proposed. The active muscle contraction is accomplished by the relative sliding between actin and myosin filaments, comprising contractile units in the smooth muscle cells. The orientation of the myosin filaments, and thereby the contractile units, are taken to exhibit a statistical dispersion around a preferred direction. The number of activated cross-bridges between the actin and myosin filaments governs the contractile force generated by the muscle and also the contraction speed. A strain-energy function is used to describe the mechanical behaviour of the smooth muscle tissue. Besides the active contractile apparatus, the mechanical model also incorporates a passive elastic part. The constitutive model was compared to histological and isometric tensile test results for smooth muscle tissue from swine carotid artery. In order to be able to predict the active stress at different muscle lengths, a filament dispersion significantly larger than the one observed experimentally was required. Furthermore, a comparison of the predicted active stress for a case of uniaxially oriented myosin filaments and a case of filaments with a dispersion based on the experimental histological data shows that the difference in generated stress is noticeable but limited. Thus, the results suggest that myosin filament dispersion alone cannot explain the increase in active muscle stress with increasing muscle stretch. PMID:21130097

Kroon, Martin

2011-03-01

372

A STORAGE MANAGEMENT ALGORITHM FOR IMPROVED WIND GENERATOR PERFORMANCE  

Microsoft Academic Search

Energy storage has been proposed as a po- tential solution to counter the short-term variations of wind, thereby providing a more stable output power from wind generators. This paper presents a fuzzy logic based energy management structure for a doubly-fed induction machine based wind generator with an integrated energy storage system. The energy management algorithm com- pensates for limitations in

Chad Abbey; Géza Joos

2005-01-01

373

Electric power from vertical-axis wind turbines  

Microsoft Academic Search

Significant advancements have occurred in vertical axis wind turbine (VAWT) technology for electrical power generation over the last decade; in particular, well-proven aerodynamic and structural analysis codes have been developed for Darrieus-principle wind turbines. Machines of this type have been built by at least three companies, and about 550 units of various designs are currently in service in California wind

K. J. Touryan; J. H. Strickland; D. E. Berg

1987-01-01

374

Damage Model and Progressive Failure Analyses for Filament Wound Composite Laminates  

NASA Astrophysics Data System (ADS)

Recent improvements in manufacturing processes and materials properties associated with excellent mechanical characteristics and low weight have made composite materials very attractive for application on civil aircraft structures. However, even new designs are still very conservative, because the composite failure phenomenon is very complex. Several failure criteria and theories have been developed to describe the damage process and how it evolves, but the solution of the problem is still open. Moreover, modern filament winding techniques have been used to produce a wide variety of structural shapes not only cylindrical parts, but also “flat” laminates. Therefore, this work presents the development of a damage model and its application to simulate the progressive failure of flat composite laminates made using a filament winding process. The damage model was implemented as a UMAT (User Material Subroutine), in ABAQUSTM Finite Element (FE) framework. Progressive failure analyses were carried out using FE simulation in order to simulate the failure of flat filament wound composite structures under different loading conditions. In addition, experimental tests were performed in order to identify parameters related to the material model, as well as to evaluate both the potential and the limitations of the model. The difference between numerical and the average experimental results in a four point bending set-up is only 1.6 % at maximum load amplitude. Another important issue is that the model parameters are not so complicated to be identified. This characteristic makes this model very attractive to be applied in an industrial environment.

Ribeiro, Marcelo Leite; Vandepitte, Dirk; Tita, Volnei

2013-10-01

375

17—AN ANALYSIS OF THE AIR-JET YARN-TEXTURING PROCESS PART III: FILAMENT BEHAVIOUR DURING TEXTURING  

Microsoft Academic Search

Experiments performed with a current industrial-texturing nozzle on a specially designed singlehead texturing machine are described. These involve the use of high-speed still and cine photography, together with measurements of yarn speed on emergence from the nozzle and yarn-tension measurements at various stages of the process. The results of these experiments provide a better understanding of the filament behaviour during

M. Acar; R. K. Turton; G. R. Wray

1986-01-01

376

The Monitoring of Machines Surveillance des Machines.  

National Technical Information Service (NTIS)

The application of classical vibration analysis to the surveillance of the mechanical condition of machines is described. Automated procedures handled by specialized computers, using advanced signal processing techniques, are sought. Vibration measurement...

M. Gaillochet

1980-01-01

377

AWG-Detector: A machine learning tool for the accurate detection of Anomalies due to Wind Gusts (AWG) in the adaptive Altitude control unit of an Aerosonde unmanned Aerial Vehicle  

Microsoft Academic Search

Use of unmanned Aerial Vehicles (UAVs) has gained significant importance in the recent years because of their ability to remotely monitor and perform various tasks in an autonomous manner. However, the control unit of such UAVs fails to adapt quickly when the UAVs are exposed to unpredictable and violent external disturbances such as violent wind gusts and extreme weather conditions.

M. Jamal Afridi; Ahsan Javed Awan; Javaid Iqbal

2010-01-01

378

Feasibility of utilizing wind energy in Thailand  

SciTech Connect

The purpose of this study was to ascertain the feasibility of utilizing wind energy to meet part of the energy demands related to pumping water and to generating electricity for the rural households in Thailand. The data for this study were divided into three different areas: (1) wind speed data, (2) the wind machine performance data, and (3) the rural energy demand data. The wind machine were divided into two categories of water-pumping windmills and electricity-generating wind machines. Three types of water pumping windmills and one type of electricity-generating wind machine were matched with the wind condition in Thailand. They were the multi-blade rotor, the sailwing rotor model (WE 002), the slow-speed sailwing rotor, and the Aerowatt model (1100 FP5G) respectively. It was concluded that, in Thailand: (1) the multiblade rotor and the sail-wing rotor (WE 002) windmill is suitable for pumping water for domestic use at 43 specified locations; (2) the slow-speed sailwing rotor windmill is suitable for pumping water for small irrigation at 32 specified locations; and (3) the Aerowatt model (1100 GP5G) is suitable for generating electricity for household use at 29 specified locations.

Jamkrajang, M.

1984-01-01

379

Sidewall clean effect upon titanium salicide filaments  

Microsoft Academic Search

The susceptibility of a self-aligned titanium silicide (salicide) process to the occurrence of conductive sidewall filaments is shown to depend upon the type of wafer cleans that are used prior to the titanium deposition. Aggressive cleans that are predominantly used for resist stripping were implemented immediately following the blanket plasma etch processes that define the sidewall nitride spacers on polysilicon

John P. Campbell; Michelle Boyer; A. J. Griffin; Z. Imam; H. Lee; C. Montgomery; R. Pak; B. Vialpando

2002-01-01

380

Light sources based on semiconductor current filaments  

DOEpatents

The present invention provides a new type of semiconductor light source that can produce a high peak power output and is not injection, e-beam, or optically pumped. The present invention is capable of producing high quality coherent or incoherent optical emission. The present invention is based on current filaments, unlike conventional semiconductor lasers that are based on p-n junctions. The present invention provides a light source formed by an electron-hole plasma inside a current filament. The electron-hole plasma can be several hundred microns in diameter and several centimeters long. A current filament can be initiated optically or with an e-beam, but can be pumped electrically across a large insulating region. A current filament can be produced in high gain photoconductive semiconductor switches. The light source provided by the present invention has a potentially large volume and therefore a potentially large energy per pulse or peak power available from a single (coherent) semiconductor laser. Like other semiconductor lasers, these light sources will emit radiation at the wavelength near the bandgap energy (for GaAs 875 nm or near infra red). Immediate potential applications of the present invention include high energy, short pulse, compact, low cost lasers and other incoherent light sources.

Zutavern, Fred J. (Albuquerque, NM); Loubriel, Guillermo M. (Albuquerque, NM); Buttram, Malcolm T. (Sandia Park, NM); Mar, Alan (Albuquerque, NM); Helgeson, Wesley D. (Albuquerque, NM); O'Malley, Martin W. (Edgewood, NM); Hjalmarson, Harold P. (Albuquerque, NM); Baca, Albert G. (Albuquerque, NM); Chow, Weng W. (Cedar Crest, NM); Vawter, G. Allen (Albuquerque, NM)

2003-01-01

381

Stretching of buckled filaments by thermal fluctuations  

Microsoft Academic Search

We study the buckling instability of filaments or elastic rods in two spatial dimensions in the presence of thermal fluctuations. We present an analytical solution based on a renormalizationlike procedure where we integrate out short wavelength fluctuations in order to obtain an effective theory governing the buckling instability. We calculate the resulting shift of the critical force by fluctuation effects

Krzysztof Baczynski; Reinhard Lipowsky; Jan Kierfeld

2007-01-01

382

Magnetic field strength of active region filaments  

NASA Astrophysics Data System (ADS)

Aims: We study the vector magnetic field of a filament observed over a compact active region neutral line. Methods: Spectropolarimetric data acquired with TIP-II (VTT, Tenerife, Spain) of the 10 830 Å spectral region provide full Stokes vectors that were analyzed using three different methods: magnetograph analysis, Milne-Eddington inversions, and PCA-based atomic polarization inversions. Results: The inferred magnetic field strengths in the filament are around 600-700 G by all these three methods. Longitudinal fields are found in the range of 100-200 G whereas the transverse components become dominant, with fields as high as 500-600 G. We find strong transverse fields near the neutral line also at photospheric levels. Conclusions: Our analysis indicates that strong (higher than 500 G, but below kG) transverse magnetic fields are present in active region filaments. This corresponds to the highest field strengths reliably measured in these structures. The profiles of the helium 10 830 Å lines observed in this active region filament are dominated by the Zeeman effect.

Kuckein, C.; Centeno, R.; Martínez Pillet, V.; Casini, R.; Manso Sainz, R.; Shimizu, T.

2009-07-01

383

Polarized Thermal Emission from Narrow Tungsten Filaments  

Microsoft Academic Search

FROM experimental work carried out by Fresnel many years ago and a theoretical investigation made by K. Schwarzschild1, it is well known that light transmitted through a narrow slit is more or less polarized. Though conditions are rather different in the case of thermal emission from a narrow filament the idea has occurred to me that polarized emission may be

Yngve Öhman

1961-01-01

384

Radial interchange motions of plasma filaments  

SciTech Connect

Radial convection of isolated filamentary structures due to interchange motions in magnetized plasmas is investigated. Following a basic discussion of vorticity generation, ballooning, and the role of sheaths, a two-field interchange model is studied by means of numerical simulations on a biperiodic domain perpendicular to the magnetic field. It is demonstrated that a blob-like plasma structure develops dipolar vorticity and electrostatic potential fields, resulting in rapid radial acceleration and formation of a steep front and a trailing wake. While the dynamical evolution strongly depends on the amount of collisional diffusion and viscosity, the structure travels a radial distance many times its initial size in all parameter regimes in the absence of sheath dissipation. In the ideal limit, there is an inertial scaling for the maximum radial velocity of isolated filaments. This velocity scales as the acoustic speed times the square root of the structure size relative to the length scale of the magnetic field. The plasma filament eventually decelerates due to mixing and collisional dissipation. Finally, the role of sheath dissipation is investigated. When included in the simulations, it significantly reduces the radial velocity of isolated filaments. The results are discussed in the context of convective transport in scrape-off layer plasmas, comprising both blob-like structures in low confinement modes and edge localized mode filaments in unstable high confinement regimes.

Garcia, O. E.; Bian, N. H.; Fundamenski, W. [Association EURATOM-Risoe National Laboratory, P.O. Box 49, OPL-128 Risoe, DK-4000 Roskilde (Denmark); School of Physics and Astronomy, University of Manchester, Manchester M60 1QD (United Kingdom); EURATOM/UKAEA Fusion Association, Culham Science Centre, Abingdon OX14 3DB (United Kingdom)

2006-08-15

385

Applications of Submicron Diameter Carbon Filaments  

Microsoft Academic Search

\\u000a The applications of submicron diameter carbon filaments grown catalytically from carbonaceous gases are reviewed. These relate\\u000a to structural applications, electromagnetic interference shielding, electromagnetic reflection, surface electrical conduction,\\u000a DC electrical conduction, field emission, electrochemical applications, thermal conduction, strain sensors, porous carbons\\u000a and catalyst supports.

D. D. L. Chung

386

Relativistic Filamentation of Intense Laser Beam in Inhomogeneous Plasma  

NASA Astrophysics Data System (ADS)

In the paper, relativistic filamentation of intense laser beam in inhomogeneous plasma is investigated based on the nonparaxial region theory. The results show that, relativistic nonlinearity plays a main role in beam filamentation, and plasma inhomogeneity further reinforces the beam filamentation. The combination effects of relativistic nonlinearity and plasma inhomogeneity can generate particularly intense and short pulse laser. However, plasma inhomogeneity leads to obvious filamentation instability.

Xia, Xiongping; Yi, Lin

2012-12-01

387

SMART Observation of Magnetic Helicity in Solar Filaments  

NASA Astrophysics Data System (ADS)

We examined the magnetic helicity of solar filaments from their structure in the chromosphere and corona. The H-alpha telescope of the Solar Magnetic Activity Research Telescope (SMART) observed 239 intermediate filaments from 2005 July 1 to 2006 May 15. The intermediate filament usually locates between two active regions. Using these images, we identified the filament spine and its barbs, and determined the chromospheric filament helicity from the mean angle between each barbs and a spine. We found that 71% (78 of 110) of intermediate filaments in the northern hemisphere are negative helicity and 67% (87 of 129) of filaments in the southern hemisphere are positive, which agreed with the well-known hemispheric tendency of the magnetic helicity. Additionally, we studied the coronal helicity of intermediate filaments. The coronal filament helicity is defined as the crossing angle of threads formed a filament. The helicity pattern of coronal filaments obtained with EIT/SOHO 171A also shows the helicity hemispheric tendency. Namely, 65% (71 of 110) of coronal filaments in the northern hemisphere exhibit negative helicity and the 65% (84 of 129) of filaments in the southern hemisphere show negative helicity. These data were observed in the same day with the SMART H-alpha data. Moreover, we found 12 filament eruptions in our data. The 7 of 12 filaments show the clear opposite sign of the hemispheric tendency of the magnetic helicity. The helicity seems to be change during temporal evolution. This results suggest that filament instability may be driven by the opposite sign helicity injection from the foot point of the barb.

Hagino, M.; Kitai, R.; Shibata, K.

2006-08-01

388

Wild Wind  

NSDL National Science Digital Library

Students learn the difference between global, prevailing and local winds. They make wind vanes out of paper, straws and soda bottles and use them to measure wind direction over time. They analyze their data to draw conclusions about the local prevailing winds.

Integrated Teaching And Learning Program

389

Wind Whistlers  

NSDL National Science Digital Library

In this activity, learners make wind whistlers, or objects that interact with wind to make different noises. Learners make their whistlers out of a paper plate, yarn, and bells or buttons and then hang them from a tree. Learners listen to the sounds from the whistler interacting with the wind. The activity guide contains questions to explore while using the wind whistlers.

Houston, Children'S M.

2013-05-15

390

Machine tool locator  

DOEpatents

Machine tools can be accurately measured and positioned on manufacturing machines within very small tolerances by use of an autocollimator on a 3-axis mount on a manufacturing machine and positioned so as to focus on a reference tooling ball or a machine tool, a digital camera connected to the viewing end of the autocollimator, and a marker and measure generator for receiving digital images from the camera, then displaying or measuring distances between the projection reticle and the reference reticle on the monitoring screen, and relating the distances to the actual position of the autocollimator relative to the reference tooling ball. The images and measurements are used to set the position of the machine tool and to measure the size and shape of the machine tool tip, and examine cutting edge wear. patent

Hanlon, John A. (Los Alamos, NM); Gill, Timothy J. (Stanley, NM)

2001-01-01

391

Electric events synchronized with laser filaments in thunderclouds.  

PubMed

We investigated the possibility to trigger real-scale lightning using ionized filaments generated by ultrashort laser pulses in the atmosphere. Under conditions of high electric field during two thunderstorms, we observed a statistically significant number of electric events synchronized with the laser pulses, at the location of the filaments. This observation suggests that corona discharges may have been triggered by filaments. PMID:18542684

Kasparian, Jérôme; Ackermann, Roland; André, Yves-Bernard; Méchain, Grégoire; Méjean, Guillaume; Prade, Bernard; Rohwetter, Philipp; Salmon, Estelle; Stelmaszczyk, Kamil; Yu, Jin; Mysyrowicz, André; Sauerbrey, Roland; Wöste, Ludger; Wolf, Jean-Pierre

2008-04-14

392

A complete inventory of fungal kinesins in representative filamentous ascomycetes  

Microsoft Academic Search

Complete inventories of kinesins from three pathogenic filamentous ascomycetes, Botryotinia fuckeliana, Cochliobolus heterostrophus, and Gibberella moniliformis, are described. These protein sequences were compared with those of the filamentous saprophyte, Neurospora crassa and the two yeasts Saccharomyces cerevisiae and Schizosaccharomyces pombe. Data mining and phylogenetic analysis of the motor domain yielded a constant set of 10 kinesins in the filamentous fungal

Conrad L. Schoch; James R. Aist; Olen C. Yoder; B. Gillian Turgeona

2003-01-01

393

Paranemin and the organization of desmin filament networks.  

PubMed

De novo expression of vimentin, GFAP or peripherin leads to the assembly of an extended intermediate filament network in intermediate filament-free SW13/cl.2 cells. Desmin, in contrast, does not form extended filament networks in either SW13/cl.2 or intermediate filament-free mouse fibroblasts. Rather, desmin formed short thickened filamentous structures and prominent spot-like cytoplasmic aggregates that were composed of densely packed 9-11 nm diameter filaments. Analysis of stably transfected cell lines indicates that the inability of desmin to form extended networks is not due to a difference in the level of transgene expression. Nestin, paranemin and synemin are large intermediate filament proteins that coassemble with desmin in muscle cells. Although each of these large intermediate filament proteins colocalized with desmin when coexpressed in SW-13 cells, expression of paranemin, but not synemin or nestin, led to the formation of an extended desmin network. A similar rescue of desmin network organization was observed when desmin was coexpressed with vimentin, which coassembles with desmin, or with keratins, which formed a distinct filament network. These studies demonstrate that desmin filaments differ in their organizational properties from the other vimentin-like intermediate filament proteins and appear to depend upon coassembly with paranemin, at least when they are expressed in non-muscle cells, in order to form an extended filament network. PMID:11228152

Schweitzer, S C; Klymkowsky, M W; Bellin, R M; Robson, R M; Capetanaki, Y; Evans, R M

2001-03-01

394

Coexpression of intermediate filament proteins in the chick embryo heart.  

PubMed

We studied the distribution of intermediate filament proteins during several stages of chick embryo heart development by indirect immunofluorescence and fluorescence-activated cell surface analysis. Vimentin is the predominant intermediate filament during the early stages of cardiac genesis, while desmin appears essentially with maturation. Desmin is the main subunit protein of intermediate filaments in the mature myocyte. PMID:2077803

Vélez, C; Muros, M A; Aránega, A E; Fernández, J E; González, F J; Alvarez, L; Aránega, A

1990-01-01

395

Thermionic Emission from Tungsten and Thoriated Tungsten Filaments  

Microsoft Academic Search

The electron emission from pure and thoriated tungsten filaments has been investigated as a function of the applied potential over the entire range from a few volts retarding to 1400 volts accelerating including careful studies at zero field. The filaments were heated with pulsating currents from thyratrons to eliminate during the measurements any drop in potential along the filament. The

W. B. Nottingham

1936-01-01

396

Calibration and Temperature Profile of a Tungsten Filament Lamp  

ERIC Educational Resources Information Center

The goal of this work proposed for undergraduate students and teachers is the calibration of a tungsten filament lamp from electric measurements that are both simple and precise, allowing to determine the temperature of tungsten filament as a function of the current intensity. This calibration procedure was first applied to a conventional filament

de Izarra, Charles; Gitton, Jean-Michel

2010-01-01

397

Design, evaluation, and fabrication of low-cost composite blades for intermediate-size wind turbines  

SciTech Connect

The low-cost composite blade program is described, involving design, evaluation and fabrication of a pair of low-cost composite rotor blades (LCCB) for the MOD-0A wind turbine. The objectives of the program were to identify low cost approaches to the design and fabrication of blades for a two-bladed 200 kW wind turbine and to assess the applicability of the techniques to larger and smaller blades. In Phase I of the program, several blade designs were developed to the point where reasonably accurate estimates could be made of the structural properties and costs of tooling and fabrication. The most cost-effective design was selected for detailed design in Phase II. Structural analysis of the selected design was performed, with assistance from NASA in some of the more specialized techniques (e.g. flutter analysis). Subelement and subscale specimens were fabricated in Phase I for testing. Blade tooling was designed and fabricated. Major items included a 60 ft D-spar mandrel and its supports, a 60 ft cure oven with a 200 kW heater, and a transverse filament tape (TFT) pre-impregnation station. Two complete blades and a partial blade for tool tryout were built. A 100 ft long ring-winder machine was designed and built.

Weingart, O.

1981-09-01

398

Finite-element analysis and design of a radial-field brushless PM machine utilizing soft magnetic composites  

Microsoft Academic Search

Soft magnetic composites (SMC) are emerging in electrical machine design offering the potential for innovative machine geometries and lower cost manufacturing. This paper examines the design and analysis of a SMC-based radial-field fractional-slot concentrated-winding permanent magnet machine using 2D finite-element analysis. Its performance is compared with an existing conventionally-laminated, distributed-winding baseline design for two cases, firstly with the same active

G. S. Liew; C. Tang; W. L. Soong; N. Ertugrul; D. B. Gehlert

2011-01-01

399

Power in the wind. [Techniques for estimation of wind potential energy  

SciTech Connect

Techniques are described which can be used by engineers, technicians and homeowners for the estimation of potential energy in wind and in particular wind machines. They are suitable for onsite calculations with the use of nothing more than a pocket calculator. (JMT)

Gipe, P.

1981-04-01

400

Wind speed sensorless maximum power point tracking control of variable speed wind energy conversion systems  

Microsoft Academic Search

A maximum power point tracking (MPPT) controller for variable speed wind energy conversion system (WECS) is proposed. The proposed method, without requiring the knowledge of wind speed, air density or turbine parameters, generates at its output the optimum speed command for speed control loop of rotor flux oriented vector controlled machine side converter control system using only the instantaneous active

J. S. Thongam; P. Bouchard; H. Ezzaidi; M. Ouhrouche

2009-01-01

401

Straightening-stretching machine  

SciTech Connect

A straightening-stretching machine has been designed at the All Union Design and Research Institute for Chemical Engineering. It straightens metal strips in the cold state by stretching beyond their limit with a maximum extension deformation of 3%. A sketch indicates stand, drive for untwisting strip, power cylinder, slide block, and front clamping head, among other aspects of the machine. The technical characteristics are specified and the process is explained. The economy affected on introducing the straightening-stretching machine is indicated.

Deryabin, G.N.; Kuz'min, G.G.

1983-07-01

402

Edheads: Simple Machines  

NSDL National Science Digital Library

This interactive Flash activity invites kids to learn about simple and compound machines by investigating common household objects found in the kitchen and tool shed. The animated activities help them understand how the machines work and how to differentiate the various types of simple machine. Additionally the site provides a glossary of important terms, lesson plans and a teacher's guide. This page is part of a larger collection of game-like animations developed to teach children about science.

2007-08-16

403

Machining: An Introduction  

NSDL National Science Digital Library

Basic machining processes are introduced on this site that is devoted to engineering fundamentals. Descriptions and illustrations of drilling, turning, grinding, and other common processes are provided for people with little to no prior machining knowledge. A waterjet is a non-traditional machining technology that uses high pressure streams of water with abrasive additives rather than solid cutting instruments to slice through metal and other materials.

2008-04-23

404

Production, characterization, and modeling of mineral filled polypropylene filaments  

NASA Astrophysics Data System (ADS)

This research produced mineral filled polypropylene filaments using a variety of fillers, characterized these filaments, and attempted to model their mechanical properties with current composite models. Also, these filaments were compared with bone to determine if they are suitable for modeling the mechanical properties of bone. Fillers used consist of wollastonite, talc, calcium carbonate, titanium dioxide, and hydroxyapatite. Fillers and polypropylene chips were combined and extruded into rods with the use of a mixer. The rods were chipped up and then formed into filaments through melt extrusion utilizing a piston extruder. Filaments with volume fractions of filler of 0.05, 0.10, 0.15, and 0.20 were produced. Additionally, some methods of trying to improve the properties of these filaments were attempted, but did not result in any significant property improvements. The fillers and filaments were visually characterized with a scanning electron microscope. Cross-sections, filament outer surfaces, fracture surfaces, and longitudinal cut open surfaces were viewed in this manner. Those filaments with anisotropic filler had some oriented filler particles, while all filaments suffered from poor adhesion between the polypropylene and the filler as well as agglomerations of filler particles. Twenty specimens of each filament were tensile tested and the average tenacity, strain, and modulus were calculated. Filaments containing talc, talc and wollastonite, titanium dioxide, or hydroxyapatite suffered from a drastic transition from ductile to brittle with the addition of 0.05 volume fraction of filler. This is evidenced by the sharp decrease in strain at this volume fraction of filler when compared to the strain of the unfilled polypropylene filament. Additionally, these same filaments suffered a sharp decrease in tenacity at the same volume fraction. These instant decreases are attributed to the agglomerations of filler in the filament. Generally, the modulus of the filaments increased with the increase in concentration of filler. The tensile tenacity, strain, and modulus were modeled with current composite models for particulate filled composites. The tenacity and strain models did not accurately predict the properties of the filaments, while the modulus models were more accurate, perhaps because the agglomerations of filler did not affect the modulus as much as it affected the tenacity and strain of the filaments. Production, characterization, and modeling of these filaments indicates that there are many areas for improvements, such as improved mixing of the filler and polypropylene, increased adhesion between matrix and filler, and decreased agglomerations of filler. Mechanically, these filaments can not match the properties of bone. However, they do have many structural similarities at the micro-mechanical level, so with some improvements in properties these filaments may be suitable models for modeling bone behavior.

George, Brian Robert

1999-11-01

405

Performance of a 3 kW wind turbine generator with variable pitch control system  

Microsoft Academic Search

A prototype 3kW horizontal upwind type wind turbine generator of 4m in diameter has been designed and examined under real wind conditions. The machine was designed based on the concept that even small wind turbines should have a variable pitch control system just as large wind turbines, especially in Japan where typhoons occur at least once a year. A characteristic

Baku M. Nagai; Kazumasa Ameku; Jitendro Nath Roy

2009-01-01

406

Wire electric-discharge machining and other fabrication techniques  

NASA Technical Reports Server (NTRS)

Wire electric discharge machining and extrude honing were used to fabricate a two dimensional wing for cryogenic wind tunnel testing. Electric-discharge cutting is done with a moving wire electrode. The cut track is controlled by means of a punched-tape program and the cutting feed is regulated according to the progress of the work. Electric-discharge machining involves no contact with the work piece, and no mechanical force is exerted. Extrude hone is a process for honing finish-machined surfaces by the extrusion of an abrasive material (silly putty), which is forced through a restrictive fixture. The fabrication steps are described and production times are given.

Morgan, W. H.

1983-01-01

407

15 CFR 700.31 - Metalworking machines.  

Code of Federal Regulations, 2013 CFR

...machines Miscellaneous machine tools Miscellaneous secondary metal forming and cutting machines Planers and shapers Polishing, lapping, boring, and finishing machines Punching and shearing machines Riveting machines Saws and filing...

2013-01-01

408

Entrainment process at the base of the upper ocean layer in an upwelling filament area  

NASA Astrophysics Data System (ADS)

Entrainment is responsible for the deepening of the mixed layer and controls the transport of momentum, heat, salinity and nutrients across the interface between the turbulent mixed layer and non-turbulent layer below. This process, which is not yet well understood, can be mechanically forced by wind stirring and buoyancy forced through vertical heat fluxes. In strongly dynamical areas such as eastern boundary upwelling systems and their associated filaments, entrainment rates can also be influenced by vertical shear at the base of the mixed layer that may results from advected baroclinic instabilities. We investigate these processes in the Northwest African upwelling region and Cape Ghir filament using CTD, XBT, ADCP, a meteorological station on board for the wind data and heat flux measurements taken during October 2010, as well as one of the first microturbulent profile (TurboMAP) measurements taken in this area in order to obtain the TKE dissipation rate. We find that buoyancy production dominates over the wind induced mixing in the mixed layer of this region as indicate the Monin Obukhov length scale. To determine entrainment rates we compare four parameterizations based on the turbulent kinetic energy (TKE) balance and one based on the relation of the bulk Richardson number. Although there is no clear consensus between these four parameterizations, they provide evidence that vertical shear at the base of the mixed layer acts to enhance the entrainment rate, especially at stations effected by the upwelling filament or mesoscalar structures. We further compare the measured TKE dissipation rates to those parameterized of Gaspar (1988) and Deardorff (1983). Moreover, some relevant aspect relative to the study of turbulent process in the upper ocean layer, such as the choice of an algorithm or criteria to find the mixed layer depth and the difference between mixing and mixed layer are addressed. This work was funded by Spanish Government (PROMECA: CTM2008-04057/MAR and CTM2009-06993-E/MAR).

Estrada-Allis, Sheila; Rodríguez-Santana, Ángel

2014-05-01

409

Isolation of intermediate filament assemblies from human hair follicles  

PubMed Central

We used developing human hair follicle cells for the isolation of hard alpha-keratin structural components. Intracellular dispersions examined by electron microscopy contained both individual alpha-keratin filaments and the tactoid-like filament assemblies observed in situ organized along subfibrillar arms of macrofibrils. The assemblies of average width 47 nm were composed of closely packed alpha-keratin filaments and originated from the initial filament arrays observed in sections of developing mammalian hair follicles. We have distinguished two types of assemblies: the para-like or hexagonally packed and the ortho-like spiral or whorl type. Axial banding extended across the width of filament assemblies, which suggested that hard alpha-keratin filaments pack in lateral register and form a lattice that contains interfilamentous bridges. We observed axial banding patterns with periods ranging from 20 to 22 nm, consistent with the 22-nm periodic structure deduced from x-ray diffraction studies and present in models proposed for hard alpha-keratin and other intermediate filaments. Preliminary biochemical studies of filaments and filament assemblies indicate that they consist of the closely related group of proteins (low-sulfur proteins) ubiquitous among extracts of hard mammalian keratins. Isolated hard alpha-keratin filament assemblies provide a new and valuable structural entity for investigating the assembly mechanisms involved in the formation of the filament-matrix framework found in hard mammalian keratin appendages.

1985-01-01

410

Properties of Interstellar Filaments as Derived from Herschel Observations  

NASA Astrophysics Data System (ADS)

We present a scenario for filament formation and evolution motivated by recent observational results of nearby molecular clouds. The analysis of more than 250 filaments observed in 7 regions by the Herschel Gould Belt Survey show that the filaments are characterized by a narrow distribution of central width sharply peaked at ˜ 0.1 pc. This typical filament width corresponds, within a factor of ˜ 2 to the sonic scale below which interstellar turbulence becomes subsonic in diffuse gas, which may suggest that the filaments form as a result of the dissipation of large-scale turbulence. The analysis of IRAM 30 m molecular line observations of a sample of these filaments show evidence of an increase in non-thermal velocity dispersion with column density which suggest an evolution of the supercritical filaments in mass per unit length while accreting surrounding material.

Arzoumanian, Doris; André, Philippe; Peretto, Nicolas; Könyves, Vera

411

Ultraminiature broadband light source with spiral shaped filament  

NASA Technical Reports Server (NTRS)

An ultraminiature light source using a double-spiral shaped tungsten filament includes end contact portions which are separated to allow for radial and length-wise unwinding of the spiral. The double-spiral filament is spaced relatively far apart at the end portions thereof so that contact between portions of the filament upon expansion is avoided. The light source is made by fabricating a double-spiral ultraminiature tungsten filament from tungsten foil and housing the filament in a ceramic package having a reflective bottom and a well wherein the filament is suspended. A vacuum furnace brazing process attaches the filament to contacts of the ceramic package. Finally, a cover with a transparent window is attached onto the top of the ceramic package by solder reflow in a second vacuum furnace process to form a complete hermetically sealed package.

Tuma, Margaret L. (Inventor); Collura, Joseph S. (Inventor); Helvajian, Henry (Inventor); Pocha, Michael D. (Inventor); Meyer, Glenn A. (Inventor); McConaghy, Charles F. (Inventor); Olsen, Barry L. (Inventor); Hansen, William W (Inventor)

2012-01-01

412

Stone Picking Machines.  

National Technical Information Service (NTIS)

Stone picking machines are compared on the basis of their capabilities. Machines are classified as having a cyclic action which removes stones or a direct action which continuously loosens and sieves a layer of soil. The direct acting pickers have better ...

K. I. Preobrazhenskii V. S. Liflyandskii

1970-01-01

413

Fril++ for Machine Learning  

Microsoft Academic Search

Machine learning is one of the successful application areas of fuzzy set theory and fuzzy logic, which provide soft, and thus tolerant, way of partitioning attribute domains. Theoretical results have shown that there is no (fuzzy) machine learning algorithm that is the best for all tasks. Therefore, for a particular task, it is very useful to have a tool to

T. H. Cao; J. M. Rossiter

414

Semantics via Machine Translation  

ERIC Educational Resources Information Center

Recent experiments in machine translation have given the semantic elements of collocation in Russian more objective criteria. Soviet linguists in search of semantic relationships have attempted to devise a semantic synthesis for construction of a basic language for machine translation. One such effort is summarized. (CHK)

Culhane, P. T.

1977-01-01

415

Multimodal interactive machine translation  

Microsoft Academic Search

Interactive machine translation (IMT) [1] is an alternative approach to machine translation, integrating human expertise into the automatic translation process. In this framework, a human iteratively interacts with a system until the output desired by the human is completely generated. Traditionally, interaction has been performed using a keyboard and a mouse. However, the use of touchscreens has been popularised recently.

Vicent Alabau; Daniel Ortiz-Martínez; Alberto Sanchis; Francisco Casacuberta

2010-01-01

416

Stirling machine operating experience  

SciTech Connect

Numerous Stirling machines have been built and operated, but the operating experience of these machines is not well known. It is important to examine this operating experience in detail, because it largely substantiates the claim that stirling machines are capable of reliable and lengthy operating lives. The amount of data that exists is impressive, considering that many of the machines that have been built are developmental machines intended to show proof of concept, and are not expected to operate for lengthy periods of time. Some Stirling machines (typically free-piston machines) achieve long life through non-contact bearings, while other Stirling machines (typically kinematic) have achieved long operating lives through regular seal and bearing replacements. In addition to engine and system testing, life testing of critical components is also considered. The record in this paper is not complete, due to the reluctance of some organizations to release operational data and because several organizations were not contacted. The authors intend to repeat this assessment in three years, hoping for even greater participation.

Ross, B. [Stirling Technology Co., Richland, WA (United States); Dudenhoefer, J.E. [Lewis Research Center, Cleveland, OH (United States)

1994-09-01

417

The Hooey Machine.  

ERIC Educational Resources Information Center

Describes how students can make and use Hooey Machines to learn how mechanical energy can be transferred from one object to another within a system. The Hooey Machine is made using a pencil, eight thumbtacks, one pushpin, tape, scissors, graph paper, and a plastic lid. (PR)

Scarnati, James T.; Tice, Craig J.

1992-01-01

418

Simple Machine Junk Cars  

ERIC Educational Resources Information Center

During the month of May, the author's eighth-grade physical science students study the six simple machines through hands-on activities, reading assignments, videos, and notes. At the end of the month, they can easily identify the six types of simple machine: inclined plane, wheel and axle, pulley, screw, wedge, and lever. To conclude this unit,…

Herald, Christine

2010-01-01

419

Relational Algebra Machine GRACE  

Microsoft Academic Search

Most of the data base machines proposed so far which adopts a filter processor as their basic unit show poor performance for the heavy load operation such as join and projection etc., while they can process the light load operations such as selection and update for which a full scan of a file suffices. These machines which incorporates n processors

Masaru Kitsuregawa; Hidehiko Tanaka; Tohru Moto-oka

1982-01-01

420

Automatic soldering machine  

NASA Technical Reports Server (NTRS)

Fully-automatic tube-joint soldering machine can be used to make leakproof joints in aluminum tubes of 3/16 to 2 in. in diameter. Machine consists of temperature-control unit, heater transformer and heater head, vibrator, and associated circuitry controls, and indicators.

Stein, J. A.

1974-01-01

421

BRITISH MOLDING MACHINE, PBQ AUTOMATIC COPE AND DRAG MOLDING MACHINE ...  

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

BRITISH MOLDING MACHINE, PBQ AUTOMATIC COPE AND DRAG MOLDING MACHINE MAKES BOTH MOLD HALVES INDIVIDUALLY WHICH ARE LATER ROTATED, ASSEMBLED, AND LOWERED TO POURING CONVEYORS BY ASSISTING MACHINES. - Southern Ductile Casting Company, Casting, 2217 Carolina Avenue, Bessemer, Jefferson County, AL

422

Helicity and Filament Channels? The Straight Twist!  

NASA Technical Reports Server (NTRS)

One of the most important and most puzzling features of the coronal magnetic field is that it appears to have smooth magnetic structure with little evidence for non-potentiality except at special locations, photospheric polarity inversions lines where the non-potentiality is observed as a filament channel. This characteristic feature of the closed-field corona is highly unexpected given that photospheric motions continuously tangle its magnetic field. Although reconnection can eliminate some of the injected structure, it cannot destroy the helicity, which should build up to produce observable complexity. We propose that an inverse cascade process transports the injected helicity from the interior of closed flux regions to their boundaries, polarity inversion lines, creating filament channels. We describe how the helicity is injected and transported and calculate the relevant rates. We argue that one process, helicity transport, can explain both the observed lack and presence of structure in the coronal magnetic field.

Antiochos, Spiro K.

2010-01-01

423

White-light filaments for atmospheric analysis.  

PubMed

Most long-path remote spectroscopic studies of the atmosphere rely on ambient light or narrow-band lasers. High-power femtosecond laser pulses have been found to propagate in the atmosphere as dynamically self-guided filaments that emit in a continuum from the ultraviolet to the infrared. This white light exhibits a directional behavior with enhanced backward scattering and was detected from an altitude of more than 20 kilometers. This light source opens the way to white-light and nonlinear light detection and ranging applications for atmospheric trace-gas remote sensing or remote identification of aerosols. Air ionization inside the filaments also opens promising perspectives for laser-induced condensation and lightning control. The mobile femtosecond-terawatt laser system, Teramobile, has been constructed to study these applications. PMID:12843384

Kasparian, J; Rodriguez, M; Méjean, G; Yu, J; Salmon, E; Wille, H; Bourayou, R; Frey, S; Andre, Y B; Mysyrowicz, A; Sauerbrey, R; Wolf, J P; Wöste, L

2003-07-01

424

SWAYING THREADS OF A SOLAR FILAMENT  

SciTech Connect

From recent high-resolution observations obtained with the Swedish 1 m Solar Telescope in La Palma, we detect swaying motions of individual filament threads in the plane of the sky. The oscillatory characters of these motions are comparable with oscillatory Doppler signals obtained from corresponding filament threads. Simultaneous recordings of motions in the line of sight and in the plane of the sky give information about the orientation of the oscillatory plane. These oscillations are interpreted in the context of the magnetohydrodynamic (MHD) theory. Kink MHD waves supported by the thread body are proposed as an explanation of the observed thread oscillations. On the basis of this interpretation and by means of seismological arguments, we give an estimation of the thread Alfven speed and magnetic field strength by means of seismological arguments.

Lin, Y.; Engvold, O.; Langangen, Oe.; Rouppe van der Voort, L. H. M. [Institute of Theoretical Astrophysics, University of Oslo, P.O. Box 1029, Blindern, N-0315 Oslo (Norway); Soler, R.; Ballester, J. L.; Oliver, R. [Departament de FIsica, Universitat de les Illes Balears, E-07122, Palma de Mallorca (Spain)

2009-10-10

425

Active compaction of crosslinked driven filament networks*  

PubMed Central

The contractile ability of active materials relies on the interplay of force-exerting and force-bearing structures. However, the complexity of interactions and limited parameter control of many model systems are major obstacles in advancing our understanding of the underlying fundamental principles. To shed light on these principles we introduce and analyse a minimal reconstituted system, consisting of highly concentrated actin filaments that are crosslinked by ?-actinin and actively transported in the two-dimensional geometry of a motility assay. This minimal system actively compacts and evolves into highly compact fibres that exceed the length of the individual filaments by two orders of magnitude. We identify the interplay between active transport and crosslinking to be responsible for the observed active compaction. This enables us to control the structure and the length scale of active compaction.

Schaller, V.; Hammerich, B.; Bausch, A.R.

2013-01-01

426

Filament-wound composite vessels material technology  

NASA Technical Reports Server (NTRS)

Programs are reviewed that were conducted to establish a technology base for applying advanced fibers or resins to high performance filament-wound pressure vessels for containment of cryogens and high pressure gases. Materials evaluated included boron, graphite, PRD 49-1 and 3/epoxy and S-glass/polyimide composites. Closed-end cylindrical, and oblate spheroid-shaped vessels were fabricated in 4- and 8-inch diameter sizes. Vessels were subjected to single-cycle burst, low-cycle fatigue, and sustained loading tests over a -423 F to room temperature range for epoxy composites and a -423 to 500 F temperature range for the polyimide composites. Vessels tested at cryogenic and/or 500 F had thin (3 to 20 mils) metallic liners whereas vessels tested at room temperature had elastomeric liners. Correlations between acoustic emissions and burst and cyclic properties of PRD 49-1 filament-wound vessels are discussed.

Lark, R. F.

1973-01-01

427

Filament-driven impulsive Raman spectroscopy.  

PubMed

Vibrational Raman spectroscopy is performed in the gas phase using a femtosecond laser pulse undergoing filamentation as an impulsive excitation source. The molecular coherence induced by the filamentary pulse is subsequently probed using a narrowband, sub-picosecond laser pulse to produce Raman spectra of gas phase species in a few tens of milliseconds (~10 laser shots). Pulse shortening with concomitant spectral broadening during filamentation results in a pulse that is both sufficiently short and of sufficient spectral power density to impulsively excite the highest energy ground state vibrations (up to 4158 cm(-1) corresponding to H(2)). Gas phase detection of chloroform, methylene chloride, cyclohexane, toluene, pentane, triethylamine, ammonia, nitromethane, and gasoline is performed. PMID:21977899

Odhner, Johanan H; McCole, Erin T; Levis, Robert J

2011-11-24

428

Transverse-mode dependence of femtosecond filamentation.  

PubMed

We theoretically investigate the transverse-mode dependence of femtosecond filamentation in Ar gas. Three different transverse modes, Bessel, Gaussian, and Laguerre modes, are considered for incident laser pulses. By solving the extended nonlinear Schrödinger equation coupled with the electron density equation, we find that the lengths of the filament and the plasma channel induced by the Bessel incident beam is much longer than the other transverse modes with the same peak intensity, pulse duration, and beam diameter. Moreover we find that the temporal profile of the pulse with the Bessel incident mode is nearly undistorted during the propagation. Since the pulse energy that the Bessel beam can carry is more than one order of magnitude larger than the other modes for the same peak intensity, pulse duration, and beam diameter, the Bessel beam can be a very powerful tool in ultrafast nonlinear optics involving propagation in a Kerr medium. PMID:19654624

Song, Zhenming; Zhang, Zhigang; Nakajima, Takashi

2009-07-20

429

Antibody to intermediate filaments of the cytoskeleton.  

PubMed Central

IgM antibodies against cultures of intermediate filaments (IMF) of the cytoskeleton were demonstrated by immunofluorescence in the sera of 94 (80%) of 118 patients with seropositive rheumatoid arthritis. These antibodies reacted with IMF in cultures of both human fetal fibroblasts and laryngeal carcinoma (HEp2) cells. Of 10 patients from whom paired synovial fluids were also available 8 had anti-IMF antibodies in both serum and fluid. In seronegative RA the incidence of anti-IMF was 40%, in ankylosing spondylitis 25%, in osteoarthrosis 16%, and in normal subjects 14%. Only a minority of RA sera positive for anti-IMF antibodies were also positive for smooth muscle antibody. Absorption experiments suggest that in RA anti-IMF is directed at the intermediate filament protein, vimentin. Images

Osung, O A; Chandra, M; Holborow, E J

1982-01-01

430

Flapping dynamics of a flexible filament  

NASA Astrophysics Data System (ADS)

This paper investigates the dynamics of the flapping regime of a filament placed in a two-dimensional soap-film flow for different filament lengths and flow speeds. It was found that the onset of flapping is quasiperiodic, with the main flapping amplitude and frequency modulated by low-amplitude, low-frequency oscillation. At higher flow velocities, the oscillation becomes chaotic. The transition to chaos occurs via the quasiperiodic route to chaos. A new bistability phenomenon was discovered in which the system alternates between the stretched-straight and oscillatory states, which is here referred to as “switching oscillation.” Unlike some previously reported forms of bistability, in this case the system alternates between the two states continuously, without any external perturbation.

Ait Abderrahmane, H.; Paidoussis, M. P.; Fayed, M.; Ng, H. D.

2011-12-01

431

Cooperating reduction machines  

SciTech Connect

This paper presents a concept and a system architecture for the concurrent execution of program expressions of a concrete reduction language based on lamda-expressions. If formulated appropriately, these expressions are well-suited for concurrent execution, following a demand-driven model of computation. In particular, recursive program expressions with nonlinear expansion may, at run time, recursively be partitioned into a hierarchy of independent subexpressions which can be reduced by a corresponding hierarchy of virtual reduction machines. This hierarchy unfolds and collapses dynamically, with virtual machines recursively assuming the role of masters that create and eventually terminate, or synchronize with, slaves. The paper also proposes a nonhierarchically organized system of reduction machines, each featuring a stack architecture, that effectively supports the allocation of virtual machines to the real machines of the system in compliance with their hierarchical order of creation and termination. 25 references.

Kluge, W.E.

1983-11-01

432

Impact damage in filament wound composite bottles  

NASA Technical Reports Server (NTRS)

Increasingly, composite materials are being used in advanced structural applications because of the significant weight savings they offer when compared to more traditional engineering materials. The higher cost of composites must be offset by the increased performance that results from reduced structural weight if these new materials are to be used effectively. At present, there is considerable interest in fabricating solid rocket motor cases out of composite materials, and capitalizing on the reduced structural weight to increase rocket performance. However, one of the difficulties that arises when composite materials are used is that composites can develop significant amounts of internal damage during low velocity impacts. Such low velocity impacts may be encountered in routine handling of a structural component like a rocket motor case. The ability to assess the reduction in structural integrity of composite motor cases that experience accidental impacts is essential if composite rocket motor cases are to be certified for manned flight. While experimental studies of the post-impact performance of filament wound composite motor cases haven been proven performed (2,3), scaling impact data from small specimens to full scale structures has proven difficult. If such a scaling methodology is to be achieved, an increased understanding of the damage processes which influence residual strength is required. The study described herein was part of an ongoing investigation of damage development and reduction of tensile strength in filament wound composites subjected to low velocity impacts. The present study, which focused on documenting the damage that develops in filament wound composites as a result of such impacts, included two distinct tasks. The first task was to experimentally assess impact damage in small, filament wound pressure bottles using x-ray radiography. The second task was to study the feasibility of using digital image processing techniques to assist in determining the 3-D distribution of damage from stereo x-ray pairs.

Highsmith, Alton L.

1993-01-01

433

Plasma filamentation in the Rijnhuizen tokamak RTP  

SciTech Connect

Evidence for small scale magnetic structures in the Rijnhuizen tokamak RTP is presented. These are manifest through steps and peaks in the electron temperature and pressure, measured with multiposition Thomson scattering. During central electron cyclotron heating, several filaments of high pressure are found in the power deposition region. They live hundreds of microseconds. Near the sawtooth inversion radius a step'' in the temperature profile occurs. Further out, quasiperiodic structures are observed, in both Ohmic and heated discharges.

Lopes Cardozo, N.J.; Schueller, F.C.; Barth, C.J.; Chu, C.C.; Pijper, F.J.; Lok, J.; Oomens, A.A.M. (FOM-Instituut voor Plasmafysica Rijnhuizen,'' P.O. Box 1207, 3430 BE Nieuwegein (Netherlands))

1994-07-11

434

[Elimination of microscopic filamentous fungi with disinfectants].  

PubMed

The antifungal effectivity of three single-component (Persteril, Septonex, Glutaraldehyd) and of three combined (Persteril+Septonex, Pesteril+Glutaraldehyd, Glutaraldehyd+Septonex) commercially available disinfectants was monitored by the diffuse method on five fen of the microscopic filamentous fungi Aspergillus alternata, Aspergillus niger, Mucor fragillis, Fusarium moniliforme, Penicillium glabrum. The highest antifungal activity was observed in 2% Persteril while 2% Persteril + 1% Septonex were the most effective among the combined disinfectants. M. fragilis was the most resistant strain. PMID:7863573

Laciaková, A; Laciak, V

1994-01-01

435

Viral detection using DNA functionalized gold filaments.  

PubMed

Early detection of pediatric viruses is critical to effective intervention. A successful clinical tool must have a low detection limit, be simple to use and report results quickly. No current method meets all three of these criteria. In this report, we describe an approach that combines simple, rapid processing and label free detection. The method detects viral RNA using DNA hairpin structures covalently attached to a gold filament. In this design, the gold filament serves both to simplify processing and enable fluorescence detection. The approach was evaluated by assaying for the presence of respiratory syncytial virus (RSV) using the DNA hairpin probe 5' [C6Thiol]TTTTTTTTTTCGACGAAAAATGGGGCAAATACGTCG[CAL] 3' covalently attached to a 5 cm length of a 100 microm diameter gold-clad filament. This sequence was designed to target a portion of the gene end-intergenic gene start signals which is repeated multiple times within the negative-sense genome giving multiple targets for each strand of genomic viral RNA present. The filament functionalized with probes was immersed in a 200 microm capillary tube containing viral RNA, moved to subsequent capillary tubes for rinsing and then scanned for fluorescence. The response curve had a typical sigmoidal shape and plateaued at about 300 plaque forming units (PFU) of viral RNA in 20 microL. The lower limit of detection was determined to be 11.9 PFU. This lower limit of detection was approximately 200 times better than a standard comparison ELISA. The simplicity of the core assay makes this approach attractive for further development as a viral detection platform in a clinical setting. PMID:20448919

Perez, Jonas W; Haselton, Frederick R; Wright, David W

2009-08-01

436

Gasification behavior of catalytic filamentous carbon  

Microsoft Academic Search

The paper reports on the effect of the catalytic filamentous carbon (CFC) gasification on its textural properties. CFC samples were prepared by methane decomposition over metal catalysts (Ni, Co, Ni–Cu, Fe–Co-alumina) at 500–625 °C. With respect to the ease of hydrogasification, CFC samples of different types can be arranged in the following order: CFC (Co)>CFC (Fe–Co)=CFC (Ni)?CFC (Ni–Cu, 575 °C).

L. B. Avdeeva; T. V. Reshetenko; V. B. Fenelonov; A. L. Chuvilin; Z. R. Ismagilov

2004-01-01

437

Performance Experiments for the Filaments Package  

Microsoft Academic Search

Ten representative benchmarks were run on two shared-memory multiprocessors usingan efficient, fine-grain threads package called Filaments. This paper describes the implementationand performance of the applications and compares them to both coarse-grainand sequential counterparts. It also analyzes the results and explains why the fine-grainprograms were faster or slower than the coarse-grain ones.September 2, 1993Department of Computer ScienceThe University of ArizonaTucson, AZ

David K. Lowenthal; Dawson R. Engler

1993-01-01

438

Origin and Evolution of Filament-Prominence Systems  

NASA Astrophysics Data System (ADS)

We present a ``head-to-tail'' linkage model for the formation, evolution, and eruption of solar filaments. The magnetic field structure of our model is based on the observation that filaments form exclusively in filament channels with no apparent magnetic connections above the polarity inversion line. The formation of a filament in this configuration is driven by flux convergence and cancellation, which produces looplike filament segments with a half-turn. Filament segments of like chirality may connect and form long quiescent filaments. Such filaments are stabilized through footpoint anchoring until further cancellation at the footpoints causes their eruption. The eruption restores the original filament channel so that filament formation may resume immediately. We then demonstrate that the combined workings of Hale's polarity law, Joy's law, and differential rotation introduce a strong hemispheric preference in the chirality of filaments formed poleward of the sunspot belt, which is in agreement with observations. We analyze the magnetic fine structure of filaments formed through our model and find consistency with the observed hemispheric preference for barb orientation and a simple explanation for barb formation. Finally, we consider the flux tubes retracted below the surface in the process of filament formation. We show that every cancellation event that generates a filament obeying the hemispheric chirality preference injects a flux tube below the surface with a poloidal field opposite that of the ongoing cycle. We suggest that this pattern of submergence of flux represents the specific mechanism for the reversal of the poloidal flux in a Babcock-Leighton-Durney-type model for the solar dynamo.

Martens, Petrus C.; Zwaan, Cornelis

2001-09-01

439

Nonlinear Ballooning Filament: Structure and Growth  

NASA Astrophysics Data System (ADS)

Experiments and simulations indicate the persistent presence of ballooning filamentary structures well into the nonlinear stage of edge localized modes (ELMs). Recent analytic theory developed for the nonlinear ballooning instability suggests that the solutions of the associated local linear ballooning mode equations continue to be valid solutions of the equations governing the intermediate nonlinear regime [1]. This implies that a perturbation that evolves from a linear ballooning instability will continue to grow exponentially at the same growth rate, and maintain its filament mode structure of the corresponding linear phase in the intermediate nonlinear stage. This may explain why in experiments and in simulations, particularly in the precursor and pre-collapse phases, the ELM filament, which is a nonlinear structure, strongly resembles the structure of a linear ballooning filament. The persistence of linear growth is consistent with previous findings for the nonlinear line-tied g-mode in slab geometry [2]. Comparison between the analytic theory and direct ideal MHD simulations will be discussed. [1] P. Zhu and C. C. Hegna, submitted to Phys. Plasmas (2008). [2] P. Zhu, C. C. Hegna, C. R. Sovinec, A. Bhattacharjee, and K. Germaschewski, Phys. Plasmas, 14, 055903 (2007).

Zhu, P.; Hegna, C. C.; Sovinec, C. R.

2008-11-01

440

Hot filament CVD of boron nitride films  

DOEpatents

Using a hot filament (.apprxeq.1400.degree. C.) to activate borazine (B.sub.3 N.sub.3 H.sub.6) molecules for subsequent reaction with a direct line-of-sight substrate, transparent boron ntiride films as thick as 25,000 angstroms are grown for a substrate temperature as low as 100.degree. C. The minimum temperature is determined by radiative heating from the adjacent hot filament. The low temperature BN films show no indication of crystallinity with X-ray diffraction (XRD). X-ray photoelectron spectra (XPS) show the films to have a B:N ratio of 0.97:1 with no other XPS detectable impurities above the 0.5% level. Both Raman and infrared (IR) spectroscopy are characteristic of h-BN with small amounts of hydrogen detected as N-H and B-H bands in the IR spectrum. An important feature of this method is the separation and localization of the thermal activation step at the hot filament from the surface reaction and film growth steps at the substrate surface. This allows both higher temperature thermal activation and lower temperature film growth.

Rye, Robert R. (Albuquerque, NM)

1992-01-01

441

Filament-stretching rheometry of complex fluids  

NASA Astrophysics Data System (ADS)

Filament-stretching rheometers are devices for measuring the extensional viscosity of moderately viscous non-Newtonian fluids such as polymer solutions. In these devices, a cylindrical liquid bridge is initially formed between two circular end-plates. The plates are then moved apart in a prescribed manner such that the fluid sample is subjected to a strong extensional deformation. Asymptotic analysis and numerical computation show that the resulting kinematics closely approximate those of an ideal homogeneous uniaxial elongation. The evolution in the tensile stress (measured mechanically) and the molecular conformation (measured optically) can be followed as functions of the rate of stretching and the total strain imposed. The resulting rheological measurements are a sensitive discriminant of molecularly based constitutive equations proposed for complex fluids. The dynamical response of the elongating filament is also coupled to the extensional rheology of the polymeric test fluid, and this can lead to complex viscoelastic-flow instabilities such as filament necking and rupture or elastic peeling from the rigid end-plates.

McKinley, Gareth H.; Sridhar, Tamarapu

442

Controlled Filament Non-Local Discharge (CFND) .  

NASA Astrophysics Data System (ADS)

Recently there has been increased interest in methods to achieve non-local electron effects to tailor the electron energy distribution (EED) for special applications like singlet delta oxygen (SDO) generation. However, a way to favor SDO production ( requires an E/N ˜ 10 Td = 10-16 Vcm^2) while still having a high pressure and large volume has not been achieved. Here we present an innovative new concept -- the controlled filament non-local discharge (CFND) in an effort to overcome these shortcomings. The CFND uses micro protrusions on the cathode surface to produce a multi-filament breakdown. The filaments create highly non-equilibrium beam-like electrons embedded in the background plasma discharge, providing control over the volume E/N. The micro-projection cathode design will be discussed and is the key to achieving the CFND. The high electric fields at the projection tips imitate micro arc discharges, enabling discharge breakdown with a relatively low applied voltage despite a high pressure. Once initiated, the discharge voltage drops as a non-local discharge develops over the volume. It is estimated that after initial breakdown at 600 V, an E/N of 10-16 Vcm^2 is obtained at roughly atmospheric pressure in oxygen with an applied voltage of 100 V in planar electrode geometry at a spacing of 10 cm.

Miley, George H.

2006-10-01

443

A first approach to filament dynamics  

NASA Astrophysics Data System (ADS)

Modelling elastic filament dynamics is a topic of high interest due to the wide range of applications. However, it has reached a high level of complexity in the literature, making it unaccessible to a beginner. In this paper we explain the main steps involved in the computational modelling of the dynamics of an elastic filament. We first derive equations governing the dynamics of an elastic lament suitable for a computer simulation implementation. The derivation starts from the relation between forces and potential energy in conservative systems in order to derive the equation of motion of any bead in the filament. Only two-dimensional movements are considered, but extensions to three dimensions can follow similar lines. Suggestions for computer implementations are provided in Matlab as well as an example of application related to the generation of musical sounds. This example allows a critical analysis of the numerical results obtained using a cross-disciplinary perspective. Since derivations start from basic physics equations, use simple calculus and computational implementations are straightforward, this paper proposes a different approach to introduce simple molecular dynamics simulations or animations of real systems in undergraduate elasticity or computer modelling courses.

Silva, P. E. S.; Vistulo de Abreu, F.; Simões, R.; Dias, R. G.

2010-11-01

444

The actin filament severing protein actophorin promotes the formation of rigid bundles of actin filaments crosslinked with alpha-actinin  

PubMed Central

The actin filament severing protein, Acanthamoeba actophorin, decreases the viscosity of actin filaments, but increases the stiffness and viscosity of mixtures of actin filaments and the crosslinking protein alpha-actinin. The explanation of this paradox is that in the presence of both the severing protein and crosslinker the actin filaments aggregate into an interlocking meshwork of bundles large enough to be visualized by light microscopy. The size of these bundles depends on the size of the containing vessel. The actin filaments in these bundles are tightly packed in some areas while in others they are more disperse. The bundles form a continuous reticulum that fills the container, since the filaments from a particular bundle may interdigitate with filaments from other bundles at points where they intersect. The same phenomena are seen when rabbit muscle aldolase rather than alpha-actinin is used as the crosslinker. We propose that actophorin promotes bundling by shortening the actin filaments enough to allow them to rotate into positions favorable for lateral interactions with each other via alpha-actinin. The network of bundles is more rigid and less thixotropic than the corresponding network of single actin filaments linked by alpha-actinin. One explanation may be that alpha-actinin (or aldolase) normally in rapid equilibria with actin filaments may become trapped between the filaments increasing the effective concentration of the crosslinker.

1991-01-01

445

Independent Control of Two Five-Phase Induction Machines Connected in Parallel to a Single Inverter Supply  

Microsoft Academic Search

Multi-phase machines possess additional degrees of freedom, which can be utilised to control other machines within a multi-motor drive system. The stator windings of the multi-phase machines can be connected in series in such a manner as to enable independent control of each machine using vector control principles, although the complete multi-motor drive system is supplied from a single multi-phase

Martin Jones; Emil Levi; Slobodan N. Vukosavic

2006-01-01

446

RDM: A Relational Database Machine.  

National Technical Information Service (NTIS)

There is felt a need in the data processing industry for computing machines which are designed specifically to handle information retrieval and storage. One concept of such a database machine, called a Relational Database Machine (RDM), is presented. The ...

H. S. Ames

1977-01-01

447

Integrated Machine Translation System PIVOT,  

National Technical Information Service (NTIS)

The Integrated Machine Translation System PIVOT is a machine translation system using a knowledge base that accumulates knowledge of what is to be translated. The use of the epochal PIVOT system for machine translation system (inter mediate expression by ...

K. Muraki S. Ichiyama Y. Okazaki Y. Nagao Y. Aoki

1988-01-01

448

Single-Machine Bicriteria Scheduling.  

National Technical Information Service (NTIS)

Contents: Machine scheduling and multicriteria optimization: an introduction; Complexity of single-machine bicriteria scheduling: a survey; Minimizing maximum promptness and maximum lateness on a single machine; Polynomial-time algorithms for single-machi...

H. Hoogeveen

1992-01-01

449

The half-speed linear machine: A new form of linear synchronous motor  

NASA Astrophysics Data System (ADS)

The behavior of an unorthodox form of linear synchronous induction machine is investigated in asynchronous and synchronous modes. The machine is inherently brushless, its single stator winding being fed with alternating and direct current for synchronous operation. The machine was studied because of the prospect it offered of controllable power factor. A mathematical model based on the two axis theory which is appropriate to the segmental form of construction of its secondary winding is developed. The model enables a critical assessment to be made of its performance particularly with regard to important machine circuit parameters. Experiments on an experimental machine confirm model validity. Notwithstanding the relatively high resistance and leakage parameters of the trial machine, the possibility of good performance, including high power factor, obtainable in larger sizes is demonstrated.

Manuk, Abde-Karim

1986-02-01

450

Wind Turbine  

USGS Multimedia Gallery

The species of bats that are most susceptible to wind turbines all roost in trees throughout the year, leading some scientists to speculate that they may be visually mistaking wind turbines for trees in which to roost....

2009-10-19

451

Wind Energy  

NSDL National Science Digital Library

Students learn about wind energy by making a pinwheel to model a wind turbine. Just like engineers, they decide where and how their turbine works best by testing it in different areas of the playground.

Integrated Teaching And Learning Program

452

Wind Power!  

NSDL National Science Digital Library

Students learn how engineers transform wind energy into electrical energy by building their own miniature wind turbines and measuring the electrical current it produces. They explore how design and position affect the electrical energy production.

Integrated Teaching And Learning Program

453

A new wind energy conversion system  

NASA Technical Reports Server (NTRS)

It is presupposed that vertical axis wind energy machines will be superior to horizontal axis machines on a power output/cost basis and the design of a new wind energy machine is presented. The design employs conical cones with sharp lips and smooth surfaces to promote maximum drag and minimize skin friction. The cones are mounted on a vertical axis in such a way as to assist torque development. Storing wind energy as compressed air is thought to be optimal and reasons are: (1) the efficiency of compression is fairly high compared to the conversion of mechanical energy to electrical energy in storage batteries; (2) the release of stored energy through an air motor has high efficiency; and (3) design, construction, and maintenance of an all-mechanical system is usually simpler than for a mechanical to electrical conversion system.

Smetana, F. O.

1975-01-01

454

The Basic Anaesthesia Machine  

PubMed Central

After WTG Morton's first public demonstration in 1846 of use of ether as an anaesthetic agent, for many years anaesthesiologists did not require a machine to deliver anaesthesia to the patients. After the introduction of oxygen and nitrous oxide in the form of compressed gases in cylinders, there was a necessity for mounting these cylinders on a metal frame. This stimulated many people to attempt to construct the anaesthesia machine. HEG Boyle in the year 1917 modified the Gwathmey's machine and this became popular as Boyle anaesthesia machine. Though a lot of changes have been made for the original Boyle machine still the basic structure remains the same. All the subsequent changes which have been brought are mainly to improve the safety of the patients. Knowing the details of the basic machine will make the trainee to understand the additional improvements. It is also important for every practicing anaesthesiologist to have a thorough knowledge of the basic anaesthesia machine for safe conduct of anaesthesia.

Gurudatt, CL

2013-01-01

455

Machine learning and radiology.  

PubMed

In this paper, we give a short introduction to machine learning and survey its applications in radiology. We focused on six categories of applications in radiology: medical image segmentation, registration, computer aided detection and diagnosis, brain function or activity analysis and neurological disease diagnosis from fMR images, content-based image retrieval systems for CT or MRI images, and text analysis of radiology reports using natural language processing (NLP) and natural language understanding (NLU). This survey shows that machine learning plays a key role in many radiology applications. Machine learning identifies complex patterns automatically and helps radiologists make intelligent decisions on radiology data such as conventional radiographs, CT, MRI, and PET images and radiology reports. In many applications, the performance of machine learning-based automatic detection and diagnosis systems has shown to be comparable to that of a well-trained and experienced radiologist. Technology development in machine learning and radiology will benefit from each other in the long run. Key contributions and common characteristics of machine learning techniques in radiology are discussed. We also discuss the problem of translating machine learning applications to the radiology clinical setting, including advantages and potential barriers. PMID:22465077

Wang, Shijun; Summers, Ronald M

2012-07-01

456

The basic anaesthesia machine.  

PubMed

After WTG Morton's first public demonstration in 1846 of use of ether as an anaesthetic agent, for many years anaesthesiologists did not require a machine to deliver anaesthesia to the patients. After the introduction of oxygen and nitrous oxide in the form of compressed gases in cylinders, there was a necessity for mounting these cylinders on a metal frame. This stimulated many people to attempt to construct the anaesthesia machine. HEG Boyle in the year 1917 modified the Gwathmey's machine and this became popular as Boyle anaesthesia machine. Though a lot of changes have been made for the original Boyle machine still the basic structure remains the same. All the subsequent changes which have been brought are mainly to improve the safety of the patients. Knowing the details of the basic machine will make the trainee to understand the additional improvements. It is also important for every practicing anaesthesiologist to have a thorough knowledge of the basic anaesthesia machine for safe conduct of anaesthesia. PMID:24249876

Gurudatt, Cl

2013-09-01

457

Machine Learning and Radiology  

PubMed Central

In this paper, we give a short introduction to machine learning and survey its applications in radiology. We focused on six categories of applications in radiology: medical image segmentation, registration, computer aided detection and diagnosis, brain function or activity analysis and neurological disease diagnosis from fMR images, content-based image retrieval systems for CT or MRI images, and text analysis of radiology reports using natural language processing (NLP) and natural language understanding (NLU). This survey shows that machine learning plays a key role in many radiology applications. Machine learning identifies complex patterns automatically and helps radiologists make intelligent decisions on radiology data such as conventional radiographs, CT, MRI, and PET images and radiology reports. In many applications, the performance of machine learning-based automatic detection and diagnosis systems has shown to be comparable to that of a well-trained and experienced radiologist. Technology development in machine learning and radiology will benefit from each other in the long run. Key contributions and common characteristics of machine learning techniques in radiology are discussed. We also discuss the problem of translating machine learning applications to the radiology clinical setting, including advantages and potential barriers.

Wang, Shijun; Summers, Ronald M.

2012-01-01

458

Verticality in hydroelectric machines  

SciTech Connect

Everyone who erects a vertical hydroelectric machine makes an effort to put the machine together so that its elements are vertical. A plumb line (or its optical equivalent) is a practical starting point for aligning the stationary parts of the machine - the generator stator, turbine case, and bearings. This does not mean, though, that the machine parts must be in near-perfect vertical orientation for the machine to perform well. Verticality is sometimes over-emphasized when procedures are undertaken to achieve good machine alignment. If the generator rotor, the connecting shaft, and the turbine runner are centered in stationary parts that are well-aligned along the same axis angle, this angle can depart from true vertical by a significant amount without ill effect. Mechanical balance does not often play a large part in determining how well a generator rotor is centered in the air gap. Magnetic forces are much more important. This is why it is desirable to maintain air gap variations around the machine to less than 5 percent from the average. However, this is sometimes difficult, especially if bearing clearances are large.

O'Kelly, F.

1991-12-01

459

Apparatus For Laminating Segmented Core For Electric Machine  

DOEpatents

A segmented core for an electric machine includes segments stamped from coated electric steel. The segments each have a first end, a second end, and winding openings. A predetermined number of segments are placed end-to-end to form layers. The layers are stacked such that each of the layers is staggered from adjacent layers by a predetermined rotation angle. The winding openings of each of the layers are in vertical alignment with the winding openings of the adjacent layers. The stack of layers is secured to form the segmented core.

Lawrence, Robert Anthony (Kokomo, IN) [Kokomo, IN; Stabel, Gerald R (Swartz Creek, MI) [Swartz Creek, MI

2003-06-17

460

Modeling and analysis of fractional slot axial flux permanent-magnet machine considering overhang effect  

Microsoft Academic Search

This paper presents the study of a novel axial flux permanent magnet (AFPM) machine, which consist of the segmented stator and fractioned slot windings, with one rotor and double stator. In addition, the overhang effect of permanent magnet of the motor has been analyzed quantitatively. The overhang is used to enhance the force density in permanent magnet machine. According to

Jian Li; Yunhyun Cho

2010-01-01

461

Optimisation of Low-Speed Permanent-Magnet Synchronous Machines with Different Rotor Designs.  

National Technical Information Service (NTIS)

This paper deals with the optimization of multipole, low-speed permanent-magnet synchronous generators for gearless wind turbines. The main emphasis of the study is on comparing machines having different rotor designs. The machines are optimized using a g...

P. Lampola

2000-01-01

462

A STATIONARY THERMAL MODEL FOR SMOOTH AIR-GAP ROTATING ELECTRIC MACHINES  

Microsoft Academic Search

A steady state heat transfer model applicable to rotating electrical machines with non salient poles is presented. Several cooling options are accounted for, ranging from the totally enclosed machine running in a high vacuum to the open ventilated one with axial and radial ducts. Sophisticated cooling systems, such as gas or water cooled windings, are not considered. The model includes

I. J. PEREZ; J. G. KASSAKIAN

1979-01-01

463

Implementation of the Three-Phase Switched Reluctance Machine System for Motors and Generators  

Microsoft Academic Search

This paper presents two three-phase switched reluctance machine systems. One is the dual motors drive for the electric locomotive traction; the other is the variable-speed generator system for wind power applications. The principles of the switched reluctance machine system operated at four quadrants, the scheme of the symmetrical traction at quadrant I and quadrant III, and the scheme of the

Hao Chen; Jason J. Gu

2010-01-01

464

Induction Machine\\/Syn-Rel Two-Motor Five-Phase Series-Connected Drive  

Microsoft Academic Search

Multimotor drives, based on utilization of multiphase machines, have been proposed recently. Independent vector control of all the machines of the group can be achieved while using a single multiphase voltage source inverter supply, provided that the stator windings are connected in series in an appropriate manner. The concept is applicable to any system phase number greater than or equal

Emil Levi; Martin Jones; Atif Iqbal; Slobodan N. Vukosavic; Hamid A. Toliyat

2007-01-01

465

Disruption of the keratin filament network during epithelial cell division.  

PubMed

The behaviour of keratin filaments during cell division was examined in a wide range of epithelial lines from several species. Almost half of them show keratin disruption as described previously: by immunofluorescence, filaments are replaced during mitosis by a 'speckled' pattern of discrete cytoplasmic dots. In the electron microscope these ' speckles ' are seen as granules around the cell periphery, just below the actin cortical mesh, with no detectable 10 nm filament structure inside them and no keratin filament bundles in the rest of the cytoplasm. A time course of the filament reorganization was constructed from double immunofluorescence data; filaments are disrupted in prophase, and the filament network is intact again by cytokinesis. The phenomenon is restricted to cells rich in keratin filaments, such as keratinocytes; it is unrelated to the co-existence of vimentin in many of these cells, and vimentin is generally maintained as filaments while the keratin is restructured. Some resistance to the effect may be conferred by an extended cycle time. Filament reorganization takes place within minutes, so that a reversible mechanism seems more likely than one involving de novo protein synthesis, at this metabolically quiet stage of the cell cycle. PMID:6202508

Lane, E B; Goodman, S L; Trejdosiewicz, L K

1982-01-01

466

Nebulin regulates actin filament lengths by a stabilization mechanism.  

PubMed

Efficient muscle contraction requires regulation of actin filament lengths. In one highly cited model, the giant protein nebulin has been proposed to function as a molecular ruler specifying filament lengths. We directly challenged this hypothesis by constructing a unique, small version of nebulin (mini-nebulin). When endogenous nebulin was replaced with mini-nebulin in skeletal myocytes, thin filaments extended beyond the end of mini-nebulin, an observation which is inconsistent with a strict ruler function. However, under conditions that promote actin filament depolymerization, filaments associated with mini-nebulin were remarkably maintained at lengths either matching or longer than mini-nebulin. This indicates that mini-nebulin is able to stabilize portions of the filament it has no contact with. Knockdown of nebulin also resulted in more dynamic populations of thin filament components, whereas expression of mini-nebulin decreased the dynamics at both filament ends (i.e., recovered loss of endogenous nebulin). Thus, nebulin regulates thin filament architecture by a mechanism that includes stabilizing the filaments and preventing actin depolymerization. PMID:20498015

Pappas, Christopher T; Krieg, Paul A; Gregorio, Carol C

2010-05-31

467

MITOSIS AND INTERMEDIATE-SIZED FILAMENTS IN DEVELOPING SKELETAL MUSCLE  

PubMed Central

A new class of filaments intermediate in diameter between actin and myosin filaments has been demonstrated in skeletal muscle cells cultured from chick embryos. These filaments, which account for the majority of free filaments, average 100 A in diameter. They may run for more than 2 µ in a single section and can be distinguished in size and appearance from the thick and thin filaments assembled into myofibrils. The 100-A filaments are seen scattered throughout the sarcoplasm at all stages of development and show no obvious association with the myofibrils. The 100-A filaments are particularly conspicuous in myotubes fragmented by the mitotic inhibitors, colchicine and Colcemid. In addition, filaments similar in size and appearance to those found in myotubes are present in fibroblasts, chondrocytes, and proliferating mononucleated myoblasts. The 100-A filaments are present in cells arrested in metaphase by mitotic inhibitors. Definitive thick (about 150 A) or thin (about 60 A) myofilaments are not found in skeletal myogenic cells arrested in metaphase. Myogenic cells arrested in metaphase do not bind fluorescein-labeled antibody directed against myosin or actin. For these reasons, it is concluded that not all "thin" filaments in myogenic cells are uniquely associated with myogenesis.

Ishikawa, H.; Bischoff, R.; Holtzer, H.

1968-01-01

468

Wind turbine  

Microsoft Academic Search

A wind turbine to convert wind energy into hydraulic energy by a positive displacement hydraulic pump driven by a wind mill. To the oil outlet of the hydraulic pump, a thermo-sensitive control element is attached, which functions when the oil temperature exceeds a certain limit. By the control element, the oil outlet is closed, suppressed, or opened to ensure safety

Kita

1983-01-01

469

Wind Whispers  

NSDL National Science Digital Library

The Advanced Technology Environmental and Energy Center (ATEEC) provides this presentation on the career and technical aspects of wind energy. In addition to discussing careers in wind, the presentation covers the siting of wind turbines and some electricity basics. Users must download this resource for viewing, which requires a free log-in. There is no cost to download the item.

2011-03-09

470

Toasty Wind  

NSDL National Science Digital Library

In this quick activity, learners use a toaster to investigate the source for the Earth's wind. Learners hold a pinwheel above a toaster to discover that rising heat causes wind. Use this activity to introduce learners to the process of convection as a source for wind. This resource also explains how convection causes thunderstorms and lists important thunderstorm safety tips.

Service, National W.

2012-07-24

471

Low-Speed Permanent-Magnet Generators for Gearless Wind Turbines.  

National Technical Information Service (NTIS)

The paper deals with the optimization and comparison of two types of low-speed surface-mounted permanent-magnet generators for gearless wind turbines. The machines have different kinds of stator winding. The conventional machine has a three-phase, fractio...

P. Lampola

2001-01-01

472

DOE\\/NASA Mod0 100KW wind turbine test results  

Microsoft Academic Search

The Wind Turbine demonstrates the capability of automatic unattended operation, including startup, achieving synchronism, and shutdown as dictated by wind conditions. During the course of these operations, a wealth of engineering data was generated. Some of the data which is associated with rotor and machine dynamics problems encountered, and the machine modifications incorporated as a solution are presented. These include

J. C. Glasgow

1978-01-01

473

Transient stability simulation of power system including wind generator by PSCAD\\/EMTDC  

Microsoft Academic Search

Induction machines are mostly used as generators in wind power stations. Since induction machines also have a stability problem, it is important to analyze the transient stability of the power system including wind power stations. This paper presents simulation analyses of transient stability of a power system including an induction generator performed by PSCAD\\/EMTDC

Junji Tamura; T. Yamazaki; M. Ueno; Y. Matsumura; S. I. Kimoto

2001-01-01

474

DOE large horizontal axis wind turbine development at NASA Lewis Research Center  

NASA Technical Reports Server (NTRS)

Large wind turbine activities managed by NASA Lewis are reviewed. These activities include results from the first and second generation field machines (Mod-OA, -1, and -2), the status of the Department of Interior WTS-4 machine for which NASA is responsible for technical management, and the design phase of the third generation wind turbines (Mod-5).

Linscott, B. S.

1982-01-01

475

Engineering: Simple Machines  

NSDL National Science Digital Library

Simple machines are devices with few or no moving parts that make work easier. Students are introduced to the six types of simple machines â the wedge, wheel and axle, lever, inclined plane, screw, and pulley â in the context of the construction of a pyramid, gaining high-level insights into tools that have been used since ancient times and are still in use today. In two hands-on activities, students begin their own pyramid design by performing materials calculations, and evaluating and selecting a construction site. The six simple machines are examined in more depth in subsequent lessons in this unit.

Integrated Teaching And Learning Program

476

Machinability of Titanium Alloys  

NASA Astrophysics Data System (ADS)

Titanium and its alloys find wide application in many industries because of their excellent and unique combination of high strength-to-weight ratio and high resistance to corrosion. The machinability of titanium and its alloys is impaired by its high chemical reactivity, low modulus of elasticity and low thermal conductivity. A number of literatures on machining of titanium alloys with conventional tools and advanced cutting tool materials is reviewed. The results obtained from the study on high speed machining of Ti-6Al-4V alloys with cubic boron nitride (CBN), binderless cubic boron nitride (BCBN) and polycrystalline diamond (PCD) are also summarized.

Rahman, Mustafizur; Wong, Yoke San; Zareena, A. Rahmath

477

Virtual Turing Machine 2  

NSDL National Science Digital Library

A Turing machine is theoretical computer consisting of a finite set of internal states, a finite alphabet that includes a blank symbol, and a finite set of instructions. It has a physical head and a physical infinitely long tape, which is divided into cells. The cell values consist of the alphabet. The tape has a finite number of non-blank cells. The head can read and write to the cells and move the tape one cell to the left and one cell to the right. The Virtual Turing Machine lets you input tape values and an instruction set to see the output of a turing machine.

Ming, Paul R.

478

Mark Making Machines  

NSDL National Science Digital Library

In this activity, learners create a Mark Making Machine, a motorized writing tool that seems to walk about using an off-balanced DC moto