Science.gov

Sample records for filament winding machine

  1. Filament winding

    NASA Astrophysics Data System (ADS)

    Shibley, A. M.

    The major aspects of filament winding are discussed, emphasizing basic reinforcement and matrix materials, winding procedures, process controls, and cured composite properties. Fiberglass (E-glass and S-glass strengths are 500,000 and 665,000 psi respectively) and polyester resins are the principal reinforcement constituent materials. Graphite and aramid reinforcements are being used more frequently, primarily for the more critical pressure vessels. Matrix systems are most commonly based on epoxy as it has superior mechanical properties, fatigue behavior, and heat resistance as compard with polyesters. A fiberglass overwrap of PVC pipe is an anticipated development in on-site winding and combination winding, and the compression molding of filament wound lay-ups will be investigated. The fabrication of weight-sensitive structural components may be achieved by using such moldings.

  2. Filament-induced laser machining (FILM)

    NASA Astrophysics Data System (ADS)

    Kiselev, D.; Woeste, L.; Wolf, J.-P.

    2010-09-01

    Laser filamentation provides high intensity plasma strings of micrometric diameters and lengths of tens of centimeters. We demonstrate that these filaments can be used for remotely drilling and cutting metals and biological materials such as flesh and bones. Since no tight focusing is needed, complex 3D shapes can be machined without any adjustment of the laser while processing.

  3. Filament winding cylinders. I - Process model

    NASA Technical Reports Server (NTRS)

    Lee, Soo-Yong; Springer, George S.

    1990-01-01

    A model was developed which describes the filament winding process of composite cylinders. The model relates the significant process variables such as winding speed, fiber tension, and applied temperature to the thermal, chemical and mechanical behavior of the composite cylinder and the mandrel. Based on the model, a user friendly code was written which can be used to calculate (1) the temperature in the cylinder and the mandrel, (2) the degree of cure and viscosity in the cylinder, (3) the fiber tensions and fiber positions, (4) the stresses and strains in the cylinder and in the mandrel, and (5) the void diameters in the cylinder.

  4. Inter-machine scalings of plasma filament electromagnetic features

    NASA Astrophysics Data System (ADS)

    Spolaore, M.; Vianello, N.; Agostini, M.; Cavazzana, R.; de Masi, G.; Martines, E.; Momo, B.; Scaggion, A.; Scarin, P.; Spagnolo, S.; Spizzo, G.; Zuin, M.; Furno, I.; Avino, F.; Fasoli, A.; Theiler, C.; Carralero, D.; Alonso, J. A.; Hidalgo, C.

    2012-10-01

    Electromagnetic features of turbulent filaments, emerging from turbulent background, have been studied in four different magnetic configurations: the stellarator TJ-II, the Reversed Field Pinch RFX-mod, a device that can be operated also as a ohmic tokamak, and the Simple Magnetized Torus TORPEX. In all cases, direct measurements of both field-aligned current density and vorticity were performed inside the filament. The inter-machine comparison revealed a clear dependence of the filament vorticity upon the local time-averaged ExB flow shear. Furthermore, a wide range of local beta was explored allowing concluding that this parameter plays a fundamental role in the appearance of filament electromagnetic features.

  5. Differentiation between coronal holes and filament channels from SDO image data using machine learning algorithms

    NASA Astrophysics Data System (ADS)

    Reiss, Martin; Hofmeister, Stefan; DeVisscher, Ruben; Temmer, Manuela; Veronig, Astrid; Delouille, Veronique; Rotter, Thomas

    2015-04-01

    In combination with the Sun's rotation, coronal holes and their associated high speed solar wind streams (HSSs) shape the solar wind distribution in the interplanetary space. The structuring of interplanetary space is especially important for deriving changes in the kinematics of coronal mass ejections. In order to forecast HSSs we empirically relate the fractional coronal hole area to the solar wind speed at 1AU. We apply an automated method for the identification and extraction of coronal hole regions in SDO/AIA 193Å images. Due to the almost equal low intensity of coronal holes and filament channels the intensity-based detection method cannot differentiation filament channels from coronal holes. Hence, to improve the HSS forecasting method we need to distinguish filament channels from coronal holes. Compared to coronal holes, filament channels are regions of closed magnetic field lines along a polarity inversion line and are therefore different in their magnetic field configuration. Acting on this physical background we investigate the benefits of using Haralick's textural features to analyze the intrinsic texture information contained with coronal holes and filament channels in AIA and HMI images. In combination with first order statistics and shape measures, we tested several classifiers to find the most suitable decision rule for a differentiation. In order to evaluate the performance of each classifier the Hanssen-Kuiper skill score, also called True Skill Statistic, was calculated. The results reveal that all classifiers, including Support Vector Machine (SVM), Linear SVM, Decision Tree and Random Forest classifier provide good results in general.

  6. Processing parameters for thermoplastic filament winding

    NASA Astrophysics Data System (ADS)

    Colton, J.; Leach, D.

    The consolidation pressure and winding speed for thermoplastic filament winding were studied. Thermoplastic composite parts were manufactured from tape prepreg (APC-2); powder-coated, semiconsolidated towpreg; and commingled fiber towpeg. The material used was carbon fiber (AS-4) (60 vol pct) in a PEEK matrix. The parts made were open-ended cylinders of the three materials, 177.8 mmID, 228.6 mm long, 17 plies thick with a 0 deg lay-up angle; and rings, 50 plies of APC-2 thick, 6.35 mm wide (one strip wide), 177.8 mm ID, and a lay-up of 0 deg. Their quality was determined by surface finish and void percentage. The tubes made from APC-2 appeared to have the best quality of the three prepregs. For the rings, the speed of lay down had a significant effect on both the final width of the parts and on the percentage of voids. The pressure of the roller had a significant effect on the final widths at a 99 percent confidence level, but only a significant effect on the percentage of voids at a 95 percent confidence level.

  7. On the mechanics of filament winding. I - A generalized model

    NASA Technical Reports Server (NTRS)

    Hamouda, Hechmi; Kang, Tae J.; El-Shiekh, Aly

    1989-01-01

    In this paper the filament winding process was analyzed to relate process variables to structural parameters. An analytical model has been developed for a filament wound preform by determining the necessary geometric and kinematic conditions. An equation of motion of winding was developed to predict layer by layer geometry using the mandrel shape as the initial boundary condition. This model provides the laws of motion of the traverse stroke relative to the mandrel to ensure that the filament laydown is of the predetermined geodesic path over the mandrel, that the winding density is distributed over the mandrel in the prearranged manner, and that the winding build is being formed to reproduce the preassigned shape or contour of the preform. From this analysis, the winding process parameters can be controlled accordingly to produce any given shape. The analytical model was used to produce computer simulation of the winding process. The dynamic simulation of the winding process visualizes and inspects the layer by layer path of the tow and provides process variables required to produce preforms of optimum structural parameters.

  8. Filament winding cylinders. III - Selection of the process variables

    NASA Technical Reports Server (NTRS)

    Lee, Soo-Yong; Springer, George S.

    1990-01-01

    By using the Lee-Springer filament winding model temperatures, degrees of cure, viscosities, stresses, strains, fiber tensions, fiber motions, and void diameters were calculated in graphite-epoxy composite cylinders during the winding and subsequent curing. The results demonstrate the type of information which can be generated by the model. It is shown, in reference to these results, how the model, and the corresponding WINDTHICK code, can be used to select the appropriate process variables.

  9. Filament winding S-glass/polyimide resin composite processing studies

    NASA Technical Reports Server (NTRS)

    Vaughan, R. W.; Jones, R. J.

    1974-01-01

    The work performed in selecting a TRW A-type polyimide resin that would be suitable for fabrication of filament wound reinforced plastic structures is described. Several different formulations were evaluated after which the P105AC formulation was selected as the most promising. Procedures then were developed for preparing P105AC/S-glass roving prepreg and for fabricating filament wound structural composites. Composites were fabricated and then tested in order to obtain tensile and shear strength information. Small, closed-end cylindrical pressure vessels then were fabricated using a stainless steel liner and end fittings with a P105AC/S-glass polar wound overwrap. These pressure vessels were cured in an air circulating oven without augmented pressure. It is concluded that the P105AC resin system is suitable for filament winding; that low void content, high strength composites are obtained by the filament winding process; and that augmented pressure is not required to effect the fabrication of filament wound P105AC composites.

  10. Wind machine fatigue analysis and life prediction

    NASA Astrophysics Data System (ADS)

    Waldon, C. A.

    Wind machines are, inherently, generators of fatigue. This is true for all types and sizes. Testing at the Rocky Flats Small Wind Systems Test Center has shown that fatigue is the dominant mode of structural failure and its prediction the hardest task for the manufacturer. The objective of this paper is to present a technique, developed by the author, for measuring fatigue and predicting fatigue life for different wind regimes. Presented herein are techniques for locating high stress measuring points, obtaining data, using computer programs for calculating fatigue reduction, and predicting fatigue life. This paper also presents current work which extends the life prediction technique to other wind regimes.

  11. Fiber-waviness Model in Filament Winding Process

    NASA Astrophysics Data System (ADS)

    Kiuchi, Takahiro; Todoroki, Akira; Matsuzaki, Ryosuke; Mizutani, Yoshihiro

    Fiber waviness is one of the initial defects in the filament winding process, and causes reduction of compressive strength of the composite structure. The mechanism of growth of fiber waviness is, however, not completely clear. In the present study, a model for generating fiber waviness is proposed. It is assumed to be due to local fiber micro-buckling arising from the compression load caused by shrinkage of a metal jig. Three faults are considered as causes of micro-buckling: bonding between metal jig and composite, insufficient cure of the resin, and initial deflection of fibers. Analysis and experiments based on this model have been carried out.

  12. Composite Pressure Vessel Variability in Geometry and Filament Winding Model

    NASA Technical Reports Server (NTRS)

    Green, Steven J.; Greene, Nathanael J.

    2012-01-01

    Composite pressure vessels (CPVs) are used in a variety of applications ranging from carbon dioxide canisters for paintball guns to life support and pressurant storage on the International Space Station. With widespread use, it is important to be able to evaluate the effect of variability on structural performance. Data analysis was completed on CPVs to determine the amount of variation that occurs among the same type of CPV, and a filament winding routine was developed to facilitate study of the effect of manufacturing variation on structural response.

  13. Multi-winding homopolar electric machine

    SciTech Connect

    Van Neste, Charles W

    2012-10-16

    A multi-winding homopolar electric machine and method for converting between mechanical energy and electrical energy. The electric machine includes a shaft defining an axis of rotation, first and second magnets, a shielding portion, and a conductor. First and second magnets are coaxial with the shaft and include a charged pole surface and an oppositely charged pole surface, the charged pole surfaces facing one another to form a repulsive field therebetween. The shield portion extends between the magnets to confine at least a portion of the repulsive field to between the first and second magnets. The conductor extends between first and second end contacts and is toroidally coiled about the first and second magnets and the shield portion to develop a voltage across the first and second end contacts in response to rotation of the electric machine about the axis of rotation.

  14. STARBURST-DRIVEN GALACTIC WINDS: FILAMENT FORMATION AND EMISSION PROCESSES

    SciTech Connect

    Cooper, Jackie L.; Bicknell, Geoffrey V.; Sutherland, Ralph S.; Bland-Hawthorn, Joss

    2009-09-20

    We have performed a series of three-dimensional simulations of the interaction of a supersonic wind with a nonspherical radiative cloud. These simulations are motivated by our recent three-dimensional model of a starburst-driven galactic wind interacting with an inhomogeneous disk, which shows that an optically emitting filament can be formed by the breakup and acceleration of a cloud into a supersonic wind. In this study, we consider the evolution of a cloud with two different geometries (fractal and spherical) and investigate the importance of radiative cooling on the cloud's survival. We have also undertaken a comprehensive resolution study in order to ascertain the effect of the assumed numerical resolution on the results. We find that the ability of the cloud to radiate heat is crucial for its survival, with a radiative cloud experiencing a lower degree of acceleration and having a higher relative Mach number to the flow than in the adiabatic case. This diminishes the destructive effect of the Kelvin-Helmholtz instability on the cloud. While an adiabatic cloud is destroyed over a short period of time, a radiative cloud is broken up via the Kelvin-Helmholtz instability into numerous small, dense cloudlets, which are drawn into the flow to form a filamentary structure. The degree of fragmentation is highly dependent on the resolution of the simulation, with the number of cloudlets formed increasing as the Kelvin-Helmholtz instability is better resolved. Nevertheless, there is a clear qualitative trend, with the filamentary structure still persistent at high resolution. The geometry of the cloud affects the speed at which the cloud fragments; a wind more rapidly breaks up the cloud in regions of least density. A cloud with a more inhomogeneous density distribution fragments faster than a cloud with a more uniform structure (e.g., a sphere). We confirm the mechanism behind the formation of the Halpha emitting filaments found in our global simulations of a starburst-driven wind. Based on our resolution study, we conclude that bow shocks around accelerated gas clouds, and their interaction, are the main source of the soft X-ray emission observed in these galactic-scale winds.

  15. Filament winding cylinders. II - Validation of the process model

    NASA Technical Reports Server (NTRS)

    Calius, Emilio P.; Lee, Soo-Yong; Springer, George S.

    1990-01-01

    Analytical and experimental studies were performed to validate the model developed by Lee and Springer for simulating the manufacturing process of filament wound composite cylinders. First, results calculated by the Lee-Springer model were compared to results of the Calius-Springer thin cylinder model. Second, temperatures and strains calculated by the Lee-Springer model were compared to data. The data used in these comparisons were generated during the course of this investigation with cylinders made of Hercules IM-6G/HBRF-55 and Fiberite T-300/976 graphite-epoxy tows. Good agreement was found between the calculated and measured stresses and strains, indicating that the model is a useful representation of the winding and curing processes.

  16. Electrical machine having controlled characteristics and its application to a wind-driven machine

    SciTech Connect

    Berna, M.; Kant, M.; Seger, R.; Vilain, J.P.

    1983-07-26

    The invention provides an electrical machine having an inductor and an armature, one of which has at least two independent winding assemblies. The switching into and out of circuit of each winding assembly is controlled by a processor which receives monitoring parameters of the machine and desired value parameters, thereby controlling in real time the operating characteristics of the machine. The machine may be a winddriven generator.

  17. Fields of Opportunity: Wind Machines Return to the Plains

    ERIC Educational Resources Information Center

    Sowers, Jacob

    2006-01-01

    The last two decades have seen a rebirth of wind machines on the rural landscape. In ironic fashion the wind's kinetic energy has grown in significance through its ability to generate commercial amounts of electricity, the commodity that a few generations earlier hastened the demise of the old Great Plains windmill. Yet the reemergence of wind…

  18. Fields of Opportunity: Wind Machines Return to the Plains

    ERIC Educational Resources Information Center

    Sowers, Jacob

    2006-01-01

    The last two decades have seen a rebirth of wind machines on the rural landscape. In ironic fashion the wind's kinetic energy has grown in significance through its ability to generate commercial amounts of electricity, the commodity that a few generations earlier hastened the demise of the old Great Plains windmill. Yet the reemergence of wind…

  19. Permanent magnet machine with windings having strand transposition

    DOEpatents

    Qu, Ronghai; Jansen, Patrick Lee

    2009-04-21

    This document discusses, among other things, a stator with transposition between the windings or coils. The coils are free from transposition to increase the fill factor of the stator slots. The transposition at the end connections between an inner coil and an outer coil provide transposition to reduce circulating current loss. The increased fill factor reduces further current losses. Such a stator is used in a dual rotor, permanent magnet machine, for example, in a compressor pump, wind turbine gearbox, wind turbine rotor.

  20. Stator for a rotating electrical machine having multiple control windings

    DOEpatents

    Shah, Manoj R.; Lewandowski, Chad R.

    2001-07-17

    A rotating electric machine is provided which includes multiple independent control windings for compensating for rotor imbalances and for levitating/centering the rotor. The multiple independent control windings are placed at different axial locations along the rotor to oppose forces created by imbalances at different axial locations along the rotor. The multiple control windings can also be used to levitate/center the rotor with a relatively small magnetic field per unit area since the rotor and/or the main power winding provides the bias field.

  1. Time dynamics of burst-train filamentation assisted femtosecond laser machining in glasses.

    PubMed

    Esser, Dagmar; Rezaei, Saeid; Li, Jianzhao; Herman, Peter R; Gottmann, Jens

    2011-12-01

    Bursts of femtosecond laser pulses with a repetition rate of f = 38.5MHz were created using a purpose-built optical resonator. Single Ti:Sapphire laser pulses, trapped inside a resonator and released into controllable burst profiles by computer generated trigger delays to a fast Pockels cell switch, drove filamentation-assisted laser machining of high aspect ratio holes deep into transparent glasses. The time dynamics of the hole formation and ablation plume physics on 2-ns to 400-ms time scales were examined in time-resolved side-view images recorded with an intensified-CCD camera during the laser machining process. Transient effects of photoluminescence and ablation plume emissions confirm the build-up of heat accumulation effects during the burst train, the formation of laser-generated filaments and plume-shielding effects inside the deeply etched vias. The small time interval between the pulses in the present burst train enabled a more gentle modification in the laser interaction volume that mitigated shock-induced microcracks compared with single pulses. PMID:22273956

  2. Intraseasonal variability in the summer South China Sea: Wind jet, cold filament, and recirculations

    NASA Astrophysics Data System (ADS)

    Xie, Shang-Ping; Chang, Chueh-Hsin; Xie, Qiang; Wang, Dongxiao

    2007-10-01

    A recent study shows that the blockage of the southwest monsoon by the mountain range on the east coast of Indochina triggers a chain of ocean-atmospheric response, including a wind jet and cold filament in the South China Sea (SCS). We extend this climatological analysis by using higher temporal resolution (weekly) to study intraseasonal variability in summer. Our analysis shows that the development of the wind jet and cold filament is not a smooth seasonal process but consists of several intraseasonal events each year at about 45-day intervals. In a typical intraseasonal event, the wind jet intensifies to above 12 m/s, followed in a week by the development of a cold filament advected by an offshore jet east of South Vietnam on the boundary of a double gyre circulation in the ocean. The double gyre circulation itself also strengthens in response to the intraseasonal wind event via Rossby wave adjustment, reaching the maximum strength in 2 to 3 weeks. The intraseasonal cold filaments appear to influence the surface wind, reducing the local wind speed because of the increased static stability in the near-surface atmosphere. To first order, the above sequence of events may be viewed as the SCS response to atmospheric intraseasonal wind pulses, which are part of the planetary-scale boreal summer intraseasonal oscillation characterized by the northeastward propagation of atmospheric deep convection. The intraseasonal anomalies of sea surface temperature and precipitation are in phase over the SCS, suggesting an oceanic feedback onto the atmosphere. As wind variations are now being routinely monitored by satellite, the lags of 1-3 weeks in oceanic response offer useful predictability that may be exploited.

  3. High pressure gas storage capacities. Example of a solution using filament windings

    NASA Technical Reports Server (NTRS)

    Phan, A.; Lamalle, J.

    1981-01-01

    The use of epoxy resin fiber glass and economic factors affecting the choice of materials for gas storage are discussed. The physical nature of the filament windings are described together with the results obtained. It is demonstrated that a substantial reduction in mass and an enhanced level of safety can be assured at a competitive cost by storing gases in this way.

  4. Liquid oxygen-compatible filament-winding matrix resin

    NASA Technical Reports Server (NTRS)

    Harrison, E. S.

    1973-01-01

    Polyurethanes derived from hydroxy terminated polyperfluoro propylene oxide prepolymers were evaluated as matrix resins for filament wound composites which would be exposed to liquid (and 100% gaseous) oxygen environments. A number of structural modifications were brought about by variations in prepolymer molecular weight, and alternative curing agents which allowed retention of the oxygen compatibility. Although satisfactory performance was achieved at sub-ambient temperatures, the derived composites suffered considerable property loss at ambient or slightly elevated temperatures. To attain overall effectiveness of the composite system, upgrading of the polymer thermomechanical properties must first be achieved.

  5. Filament formation in wind-cloud interactions - I. Spherical clouds in uniform magnetic fields

    NASA Astrophysics Data System (ADS)

    Banda-Barragán, W. E.; Parkin, E. R.; Federrath, C.; Crocker, R. M.; Bicknell, G. V.

    2016-01-01

    Filamentary structures are ubiquitous in the interstellar medium, yet their formation, internal structure, and longevity have not been studied in detail. We report the results from a comprehensive numerical study that investigates the characteristics, formation, and evolution of filaments arising from magnetohydrodynamic interactions between supersonic winds and dense clouds. Here, we improve on previous simulations by utilizing sharper density contrasts and higher numerical resolutions. By following multiple density tracers, we find that material in the envelopes of the clouds is removed and deposited downstream to form filamentary tails, while the cores of the clouds serve as footpoints and late-stage outer layers of these tails. Aspect ratios ?12, subsonic velocity dispersions ˜0.1-0.3 of the wind sound speed, and magnetic field amplifications ˜100 are found to be characteristic of these filaments. We also report the effects of different magnetic field strengths and orientations. The magnetic field strength regulates vorticity production: sinuous filamentary towers arise in non-magnetic environments, while strong magnetic fields inhibit small-scale perturbations at boundary layers making tails less turbulent. Magnetic field components aligned with the direction of the flow favour the formation of pressure-confined flux ropes inside the tails, whilst transverse components tend to form current sheets. Softening the equation of state to nearly isothermal leads to suppression of dynamical instabilities and further collimation of the tail. Towards the final stages of the evolution, we find that small cloudlets and distorted filaments survive the break-up of the clouds and become entrained in the winds, reaching velocities ˜0.1 of the wind speed.

  6. Development and use of an improved filament-winding process model

    NASA Astrophysics Data System (ADS)

    Kokan, Davis Rasheed

    Composite materials are being used to solve an ever-increasing variety of engineering problems because they provide greatly improved mechanical properties and the flexibility to tailor them. A process that is often used to fabricate cylindrical composite structures and other surfaces of revolution is filament-winding. The objective of this research is to develop a model of the filament-winding process. At a time when concurrent engineering philosophy is being accepted and implemented, design should incorporate as much of the manufacturing process as possible. This is critical in a process like filament-winding where the residual stresses associated with fabrication can be as significant as the stresses encountered during service. Thus the optimum design is dependent upon the physical and chemical phenomena that occur throughout manufacture as well as in the service life. Previous filament-winding process models relied on a linear elastic assumption to describe the material behavior during cure. However, it is known that many of today's polymeric resins exhibit a time dependent response even during the cure cycle. A major contribution of this work is the incorporation of this viscoelastic response into the process model. Although these materials and mechanics issues are a major focus, they are incorporated into a comprehensive multidisciplinary process model that includes heat transfer, chemorheology, and compaction. It predicts, as a function of position and time, the temperature, degree of cure, viscosity, and deformation of a thick composite cylinder of arbitrary lay-up as well as the resulting residual stress state. The model is validated through an experimental program consisting of a materials characterization study of an AT-400/Fiberite 934 graphite epoxy composite and the measurement of processing induced strains. Good correlation is achieved between model predictions and experimental results. The various geometric and material input parameters are also investigated to determine their impact and relative importance on the predicted residual stresses. Recommendations for future work such as cure cycle optimization and extension to other material systems and geometries are made.

  7. A machine-learning algorithm for wind gust prediction

    NASA Astrophysics Data System (ADS)

    Sallis, P. J.; Claster, W.; Hernández, S.

    2011-09-01

    Physical damage to property and crops caused by unanticipated wind gusts is a well understood phenomenon. Predicting its occurrence continues to be a challenge for meteorologists and climatologists. Various approaches to gust occurrence model building have been proposed. The very nature of the event is problematic because of its brief duration following a rapid change of state in wind velocity that immediately precedes it. Events classified as wind gusts have a typical duration of less than 20 s and are often much shorter. The rapidly accelerating wind velocity preceding them is often not apparent until the gust occurs. They come quickly, occur suddenly, and then end as abruptly as they began. Observations of 2000 gust events were made during the research to which this paper refers. These observations indicated a mean interval of 3.2 min between the beginning and end of wind velocity change and a noticeable linear progression in the acceleration pattern. It was also noted that state changes regularly occur, often over only seconds in time. In combination, these factors pose both a sampling and a data interpretation challenge, making reliable prediction difficult. This paper describes some new research undertaken to investigate methods of wind gust measurement and prediction. In particular, a machine-learning approach is taken to determine a satisfactory analytical process and to produce meaningful and useful results. An algorithm for use with real-time climate data collection and analysis is proposed, with a description of its implementation. Real-time data sampling provides input for this study using terrestrial sensor telemetry. Near-ground truth data are recorded independent of geostrophic upper atmosphere conditions.

  8. Short-term wind speed predictions with machine learning techniques

    NASA Astrophysics Data System (ADS)

    Ghorbani, M. A.; Khatibi, R.; FazeliFard, M. H.; Naghipour, L.; Makarynskyy, O.

    2015-09-01

    Hourly wind speed forecasting is presented by a modeling study with possible applications to practical problems including farming wind energy, aircraft safety and airport operations. Modeling techniques employed in this paper for such short-term predictions are based on the machine learning techniques of artificial neural networks (ANNs) and genetic expression programming (GEP). Recorded values of wind speed were used, which comprised 8 years of collected data at the Kersey site, Colorado, USA. The January data over the first 7 years (2005-2011) were used for model training; and the January data for 2012 were used for model testing. A number of model structures were investigated for the validation of the robustness of these two techniques. The prediction results were compared with those of a multiple linear regression (MLR) method and with the Persistence method developed for the data. The model performances were evaluated using the correlation coefficient, root mean square error, Nash-Sutcliffe efficiency coefficient and Akaike information criterion. The results indicate that forecasting wind speed is feasible using past records of wind speed alone, but the maximum lead time for the data was found to be 14 h. The results show that different techniques would lead to different results, where the choice between them is not easy. Thus, decision making has to be informed of these modeling results and decisions should be arrived at on the basis of an understanding of inherent uncertainties. The results show that both GEP and ANN are equally credible selections and even MLR should not be dismissed, as it has its uses.

  9. Short-term wind speed predictions with machine learning techniques

    NASA Astrophysics Data System (ADS)

    Ghorbani, M. A.; Khatibi, R.; FazeliFard, M. H.; Naghipour, L.; Makarynskyy, O.

    2016-02-01

    Hourly wind speed forecasting is presented by a modeling study with possible applications to practical problems including farming wind energy, aircraft safety and airport operations. Modeling techniques employed in this paper for such short-term predictions are based on the machine learning techniques of artificial neural networks (ANNs) and genetic expression programming (GEP). Recorded values of wind speed were used, which comprised 8 years of collected data at the Kersey site, Colorado, USA. The January data over the first 7 years (2005-2011) were used for model training; and the January data for 2012 were used for model testing. A number of model structures were investigated for the validation of the robustness of these two techniques. The prediction results were compared with those of a multiple linear regression (MLR) method and with the Persistence method developed for the data. The model performances were evaluated using the correlation coefficient, root mean square error, Nash-Sutcliffe efficiency coefficient and Akaike information criterion. The results indicate that forecasting wind speed is feasible using past records of wind speed alone, but the maximum lead time for the data was found to be 14 h. The results show that different techniques would lead to different results, where the choice between them is not easy. Thus, decision making has to be informed of these modeling results and decisions should be arrived at on the basis of an understanding of inherent uncertainties. The results show that both GEP and ANN are equally credible selections and even MLR should not be dismissed, as it has its uses.

  10. Mars vertical axis wind machines: The design of a tornado vortex machine for use on Mars

    NASA Astrophysics Data System (ADS)

    Carlin, Daun; Dyhr, Amy; Kelly, Jon; Schmirler, J. Eric; Carlin, Mike; Hong, Won E.; Mahoney, Kamin; Ralston, Michael

    1994-06-01

    Ever since Viking 1 and 2 landed on the surface of Mars in the summer of 1976, man has yearned to go back. But before man steps foot upon the surface of Mars, unmanned missions such as the Martian Soft Lander and Martian Subsurface Penetrator will precede him. Alternative renewable power sources must be developed to supply the next generation of surface exploratory spacecraft, since RTG's, solar cells, and long-life batteries all have their significant drawbacks. One such alternative is to take advantage of the unique Martian atmospheric conditions by designing a small scale, Martian wind power generator, capable of surviving impact and fulfilling the long term (2-5 years), low-level power requirements (1-2 Watts) of an unmanned surface probe. After investigation of several wind machines, a tornado vortex generator was chosen based upon its capability of theoretically augmenting and increasing the available power that may be extracted from average Martian wind speeds of approximately 7.5 m/s. The Martian Tornado Vortex Wind Generator stands 1 meter high and has a diameter of 0.5 m. Martian winds enter the base and shroud of the Tornado Vortex Generator at 7.5 m/s and are increased to an exit velocity of 13.657 m/s due to the vortex that is created. This results in a rapid pressure drop of 4.56 kg/s(exp 2) m across the vortex core which aids in producing a net power output of 1.1765 Watts. The report contains the necessary analysis and requirements needed to feasibly operate a low-level powered, unmanned, Martian surface probe.

  11. Mars vertical axis wind machines: The design of a tornado vortex machine for use on Mars

    NASA Technical Reports Server (NTRS)

    Carlin, Daun; Dyhr, Amy; Kelly, Jon; Schmirler, J. Eric; Carlin, Mike; Hong, Won E.; Mahoney, Kamin

    1994-01-01

    Ever since Viking 1 and 2 landed on the surface of Mars in the summer of 1976, man has yearned to go back. But before man steps foot upon the surface of Mars, unmanned missions such as the Martian Soft Lander and Martian Subsurface Penetrator will precede him. Alternative renewable power sources must be developed to supply the next generation of surface exploratory spacecraft, since RTG's, solar cells, and long-life batteries all have their significant drawbacks. One such alternative is to take advantage of the unique Martian atmospheric conditions by designing a small scale, Martian wind power generator, capable of surviving impact and fulfilling the long term (2-5 years), low-level power requirements (1-2 Watts) of an unmanned surface probe. After investigation of several wind machines, a tornado vortex generator was chosen based upon its capability of theoretically augmenting and increasing the available power that may be extracted from average Martian wind speeds of approximately 7.5 m/s. The Martian Tornado Vortex Wind Generator stands 1 meter high and has a diameter of 0.5 m. Martian winds enter the base and shroud of the Tornado Vortex Generator at 7.5 m/s and are increased to an exit velocity of 13.657 m/s due to the vortex that is created. This results in a rapid pressure drop of 4.56 kg/s(exp 2) m across the vortex core which aids in producing a net power output of 1.1765 Watts. The report contains the necessary analysis and requirements needed to feasibly operate a low-level powered, unmanned, Martian surface probe.

  12. Pole-phase modulated toroidal winding for an induction machine

    DOEpatents

    Miller, John Michael; Ostovic, Vlado

    1999-11-02

    A stator (10) for an induction machine for a vehicle has a cylindrical core (12) with inner and outer slots (26, 28) extending longitudinally along the inner and outer peripheries between the end faces (22, 24). Each outer slot is associated with several adjacent inner slots. A plurality of toroidal coils (14) are wound about the core and laid in the inner and outer slots. Each coil occupies a single inner slot and is laid in the associated outer slot thereby minimizing the distance the coil extends from the end faces and minimizing the length of the induction machine. The toroidal coils are configured for an arbitrary pole phase modulation wherein the coils are configured with variable numbers of phases and poles for providing maximum torque for cranking and switchable to a another phase and pole configuration for alternator operation. An adaptor ring (36) circumferentially positioned about the stator improves mechanical strength, and provides a coolant channel manifold (34) for removing heat produced in stator windings during operation.

  13. Formation and evolution of magnetised filaments in wind-swept turbulent clumps

    NASA Astrophysics Data System (ADS)

    Banda-Barragan, Wladimir Eduardo; Federrath, Christoph; Crocker, Roland M.; Bicknell, Geoffrey Vincent; Parkin, Elliot Ross

    2015-08-01

    Using high-resolution three-dimensional simulations, we examine the formation and evolution of filamentary structures arising from magnetohydrodynamic interactions between supersonic winds and turbulent clumps in the interstellar medium. Previous numerical studies assumed homogenous density profiles, null velocity fields, and uniformly distributed magnetic fields as the initial conditions for interstellar clumps. Here, we have, for the first time, incorporated fractal clumps with log-normal density distributions, random velocity fields and turbulent magnetic fields (superimposed on top of a uniform background field). Disruptive processes, instigated by dynamical instabilities and akin to those observed in simulations with uniform media, lead to stripping of clump material and the subsequent formation of filamentary tails. The evolution of filaments in uniform and turbulent models is, however, radically different as evidenced by comparisons of global quantities in both scenarios. We show, for example, that turbulent clumps produce tails with higher velocity dispersions, increased gas mixing, greater kinetic energy, and lower plasma beta than their uniform counterparts. We attribute the observed differences to: 1) the turbulence-driven enhanced growth of dynamical instabilities (e.g. Kelvin-Helmholtz and Rayleigh-Taylor instabilities) at fluid interfaces, and 2) the localised amplification of magnetic fields caused by the stretching of field lines trapped in the numerous surface deformations of fractal clumps. We briefly discuss the implications of this work to the physics of the optical filaments observed in the starburst galaxy M82.

  14. Processing parameters for filament winding thick-section PEEK/carbon fiber composites

    NASA Astrophysics Data System (ADS)

    Colton, J.; Leach, D.

    1992-12-01

    The consolidation pressure and winding speed for thermoplastic filament winding were studied. Thermoplastic composite parts were manufactured from tape prepreg (APC-2); powder-coated, semi-consolidated towpreg; and commingled fiber towpreg. The material used was carbon fiber (AS-4) (60 vol pct) in a PEEK matrix. The parts made were open-ended cylinders of the three materials, 177.8-mm ID, 228.6 mm long, 17 plies thick with a 0 deg lay-up angle; and rings, 50 plies of APC-2 thick, 6.35 mm wide (one strip wide), 177.8-mm ID, and a lay-up of 0 deg. Their quality was determined by surface finish and void percentage. The tubes made from APC-2 appeared to have the best quality of the three prepregs. For the rings, the speed of lay-down had a significant effect on both the final width of the parts and on the percentage of voids. The pressure of the roller had a significant effect on the final widths at a 99 percent confidence level, but a significant effect on the percentage of voids at only a 95 percent confidence level.

  15. Fabrication of pulsed magnets with a linear-type coil-winding machine

    NASA Astrophysics Data System (ADS)

    Suzuki, O.; Sakamoto, K.; Imanaka, Y.; Kido, G.

    2001-01-01

    We developed a linear-type coil-winding machine for the fabrication of pulsed magnets. This machine is compact and makes the process of winding a wire easier. The wire is led to a coil shaft through a pair of timing-belts. Kapton tape and Zylon fiber are wrapped on the wire by interlocking with the drive part of the timing-belts. A test magnet fabricated with the linear-type coil-winding machine generates magnetic fields above 63 T.

  16. Technological and economical analysis of salient pole and permanent magnet synchronous machines designed for wind turbines

    NASA Astrophysics Data System (ADS)

    Gündo?du, Tayfun; Kömürgöz, Güven

    2012-08-01

    Chinese export restrictions already reduced the planning reliability for investments in permanent magnet wind turbines. Today the production of permanent magnets consumes the largest proportion of rare earth elements, with 40% of the rare earth-based magnets used for generators and other electrical machines. The cost and availability of NdFeB magnets will likely determine the production rate of permanent magnet generators. The high volatility of rare earth metals makes it very difficult to quote a price. Prices may also vary from supplier to supplier to an extent of up to 50% for the same size, shape and quantity with a minor difference in quality. The paper presents the analysis and the comparison of salient pole with field winding and of peripheral winding synchronous electrical machines, presenting important advantages. A neodymium alloy magnet rotor structure has been considered and compared to the salient rotor case. The Salient Pole Synchronous Machine and the Permanent Magnet Synchronous Machine were designed so that the plate values remain constant. The Eddy current effect on the windings is taken into account during the design, and the efficiency, output power and the air-gap flux density obtained after the simulation were compared. The analysis results clearly indicate that Salient Pole Synchronous Machine designs would be attractive to wind power companies. Furthermore, the importance of the design of electrical machines and the determination of criteria are emphasized. This paper will be a helpful resource in terms of examination and comparison of the basic structure and magnetic features of the Salient Pole Synchronous Machine and Permanent Magnet Synchronous Machine. Furthermore, an economic analysis of the designed machines was conducted.

  17. Using machine learning to predict wind turbine power output

    NASA Astrophysics Data System (ADS)

    Clifton, A.; Kilcher, L.; Lundquist, J. K.; Fleming, P.

    2013-06-01

    Wind turbine power output is known to be a strong function of wind speed, but is also affected by turbulence and shear. In this work, new aerostructural simulations of a generic 1.5 MW turbine are used to rank atmospheric influences on power output. Most significant is the hub height wind speed, followed by hub height turbulence intensity and then wind speed shear across the rotor disk. These simulation data are used to train regression trees that predict the turbine response for any combination of wind speed, turbulence intensity, and wind shear that might be expected at a turbine site. For a randomly selected atmospheric condition, the accuracy of the regression tree power predictions is three times higher than that from the traditional power curve methodology. The regression tree method can also be applied to turbine test data and used to predict turbine performance at a new site. No new data are required in comparison to the data that are usually collected for a wind resource assessment. Implementing the method requires turbine manufacturers to create a turbine regression tree model from test site data. Such an approach could significantly reduce bias in power predictions that arise because of the different turbulence and shear at the new site, compared to the test site.

  18. A Climatological Assessment of the Utility of Wind Machines for Freeze Protection in Mountain Valleys.

    NASA Astrophysics Data System (ADS)

    Doesken, Nolan J.; Renquist, A. Richard

    1989-03-01

    The use of wind machines for frost protection is common in several large United States fruit producing areas. However, their potential usefulness in western Colorado's high elevation orchards has been uncertain due to the existence of terrain-generated prevailing nocturnal winds. To investigate this problem, wind speeds and temperature inversions were measured in an orchard area of western Colorado during the critical spring period 1982-1986.Results showed that temperature inversions strong enough to be beneficial in the use of wind machines at the time of the lowest temperature occurred on 4 1% of all nights sampled, on 58% of nights with below freezing temperatures and on 73% of nights with damaging freezes. A weather typing scheme was then employed to separate objectively freeze events that were primarily local in nature (good candidates for mechanical frost protection) from the more widespread advective freezes (difficult to combat with wind machines). Results showed that undisturbed weather patterns accompanied 54% of all nights but 79% of all freeze episodes. This suggests that freezes are predominantly controlled by local factors.An hour by hour computation of the likely fan effect during all 15 damaging freeze events during the experiment showed that orchard warming would occur during at least part of the night on 93% of the nights. It is now concluded that wind machines are likely to be very beneficial in western Colorado's commercial fruit growing areas.

  19. Short Circuit Analysis of Induction Machines Wind Power Application

    SciTech Connect

    Starke, Michael R; Smith, Travis M; Howard, Dustin; Harley, Ronald

    2012-01-01

    he short circuit behavior of Type I (fixed speed) wind turbine-generators is analyzed in this paper to aid in the protection coordination of wind plants of this type. A simple network consisting of one wind turbine-generator is analyzed for two network faults: a three phase short circuit and a phase A to ground fault. Electromagnetic transient simulations and sequence network calculations are compared for the two fault scenarios. It is found that traditional sequence network calculations give accurate results for the short circuit currents in the balanced fault case, but are inaccurate for the un-faulted phases in the unbalanced fault case. The time-current behavior of the fundamental frequency component of the short circuit currents for both fault cases are described, and found to differ significantly in the unbalanced and balanced fault cases

  20. A Mars 1 Watt vortex wind energy machine

    NASA Astrophysics Data System (ADS)

    Ralston, Michael; Crowley, Christopher; Thomson, Ronald; Gwynne, Owen

    A Martian wind power generator capable of surviving impact and fulfilling the long-term (2-5 yr) low-level power requirements (1-2 W) of an unmanned surface probe is presented. Attention is given to a tornado vortex generator that was chosen on the basis of its capability to theoretically augment the available power that may be extracted for average Martian wind speeds of about 7.5 m/s. The generator offers comparable mass-to-power ratios with solar power sources.

  1. A Mars 1 Watt vortex wind energy machine

    NASA Technical Reports Server (NTRS)

    Ralston, Michael; Crowley, Christopher; Thomson, Ronald; Gwynne, Owen

    1992-01-01

    A Martian wind power generator capable of surviving impact and fulfilling the long-term (2-5 yr) low-level power requirements (1-2 W) of an unmanned surface probe is presented. Attention is given to a tornado vortex generator that was chosen on the basis of its capability to theoretically augment the available power that may be extracted for average Martian wind speeds of about 7.5 m/s. The generator offers comparable mass-to-power ratios with solar power sources.

  2. A flux-mnemonic permanent magnet brushless machine for wind power generation

    NASA Astrophysics Data System (ADS)

    Yu, Chuang; Chau, K. T.; Jiang, J. Z.

    2009-04-01

    In this paper, the concept of flux mnemonics is newly extended to the wind power generator. By incorporating a small magnetizing winding into an outer-rotor doubly salient AlNiCo permanent magnet (PM) machine, a new flux-mnemonic PM brushless wind power generator is proposed and implemented. This generator can offer effective and efficient air-gap flux control. First, the characteristics of the proposed generator are analyzed by using the finite element method. Second, the closed-loop flux control is devised to achieve a constant generated voltage under time-varying wind speeds. Finally, the experimental results are given to verify the validity of the proposed generator and control system.

  3. Research on Potential of Advanced Technology for Housing. A Building System Based on Filament Winding and New Developments in Water and Waste Management.

    ERIC Educational Resources Information Center

    Michigan Univ., Ann Arbor.

    The University of Michigan and Aerojet Corporation report their development of a new building system which will offer the consumer a higher quality product at lower cost. To achieve this goal, the University-Aerojet proposal suggested filament winding (a process derived from the aerospace program for the manufacture of reinforced plastic…

  4. Application of extreme learning machine for estimation of wind speed distribution

    NASA Astrophysics Data System (ADS)

    Shamshirband, Shahaboddin; Mohammadi, Kasra; Tong, Chong Wen; Petkovi?, Dalibor; Porcu, Emilio; Mostafaeipour, Ali; Ch, Sudheer; Sedaghat, Ahmad

    2015-06-01

    The knowledge of the probabilistic wind speed distribution is of particular significance in reliable evaluation of the wind energy potential and effective adoption of site specific wind turbines. Among all proposed probability density functions, the two-parameter Weibull function has been extensively endorsed and utilized to model wind speeds and express wind speed distribution in various locations. In this research work, extreme learning machine (ELM) is employed to compute the shape (k) and scale (c) factors of Weibull distribution function. The developed ELM model is trained and tested based upon two widely successful methods used to estimate k and c parameters. The efficiency and accuracy of ELM is compared against support vector machine, artificial neural network and genetic programming for estimating the same Weibull parameters. The survey results reveal that applying ELM approach is eventuated in attaining further precision for estimation of both Weibull parameters compared to other methods evaluated. Mean absolute percentage error, mean absolute bias error and root mean square error for k are 8.4600 %, 0.1783 and 0.2371, while for c are 0.2143 %, 0.0118 and 0.0192 m/s, respectively. In conclusion, it is conclusively found that application of ELM is particularly promising as an alternative method to estimate Weibull k and c factors.

  5. Application of extreme learning machine for estimation of wind speed distribution

    NASA Astrophysics Data System (ADS)

    Shamshirband, Shahaboddin; Mohammadi, Kasra; Tong, Chong Wen; Petković, Dalibor; Porcu, Emilio; Mostafaeipour, Ali; Ch, Sudheer; Sedaghat, Ahmad

    2016-03-01

    The knowledge of the probabilistic wind speed distribution is of particular significance in reliable evaluation of the wind energy potential and effective adoption of site specific wind turbines. Among all proposed probability density functions, the two-parameter Weibull function has been extensively endorsed and utilized to model wind speeds and express wind speed distribution in various locations. In this research work, extreme learning machine (ELM) is employed to compute the shape ( k) and scale ( c) factors of Weibull distribution function. The developed ELM model is trained and tested based upon two widely successful methods used to estimate k and c parameters. The efficiency and accuracy of ELM is compared against support vector machine, artificial neural network and genetic programming for estimating the same Weibull parameters. The survey results reveal that applying ELM approach is eventuated in attaining further precision for estimation of both Weibull parameters compared to other methods evaluated. Mean absolute percentage error, mean absolute bias error and root mean square error for k are 8.4600 %, 0.1783 and 0.2371, while for c are 0.2143 %, 0.0118 and 0.0192 m/s, respectively. In conclusion, it is conclusively found that application of ELM is particularly promising as an alternative method to estimate Weibull k and c factors.

  6. Analysis of a single-phase induction machine with a shifted auxiliary winding

    SciTech Connect

    Walls, T.A.; Sudhoff, S.D.

    1996-12-01

    This paper extends the method of multiple reference frames to the analysis of asymmetrical induction motors with non-orthogonal stator windings, with particular emphasis on the permanent split capacitor (PSC) machine. The predictions of the method are verified by comparison to both experimental results and to results obtained using a machine variable computer simulation. Once verified, the method is used to derive the transfer function relating rotor speed to load torque disturbance, which is of particular interest when analyzing PSC machines driving compressor loads. It is shown that the transfer function exhibits a distinct resonant point, and that the magnitude of the resonant peak increases as the motor approaches synchronous speed. It is also shown that the magnitude of the resonant peak may be lowered by increasing rotational inertia or rotor resistance.

  7. System for maintaining the alignment of mandrels in filament winding operations

    DOEpatents

    Robinson, Samuel C. (Clinton, TN); Dodge, William G. (Oak Ridge, TN); Pollard, Roy E. (Powell, TN)

    1984-01-01

    The present invention is directed to a system for sensing and correcting the alignment of a mandrel being wound with filamentary material with respect to the filamentary material winding mechanism. A positioned reference pin attached to the mandrel is positioned in a beam of collimated light emanating from a laser so as to bisect the light beam and create a shadow therebetween. A pair of photocells are positioned to receive the bisected light beam with the shadow uniformly located between the photocells when the pin is in a selected position. The mandrel is supported in the selected position for the winding of a filamentary material by a position adjustable roller mechanism which is coupled by a screw drive to a reversible motor. Changes in the pin position such as caused by winding growth are sensed by the photocells to provide the displacement of the roller mechanism in the direction necessary to return the mandrel to the selected position.

  8. System for maintaining the alignment of mandrels in filament winding operations

    DOEpatents

    Robinson, S.C.; Dodge, W.G.; Pollard, R.E.

    1983-10-12

    The present invention is directed to a system for sensing and correcting the alignment of a mandrel being wound with filamentary material with respect to the filamentary material winding mechanism. A positioned reference pin attached to the mandrel is positioned in a beam of collimated light emanating from a laser so as to bisect the light beam and create a shadow therebetween. A pair of photocells are positioned to receive the bisected light beam with the shadow uniformly located between the photocells when the pin is in a selected position. The mandrel is supported in the selected position for the winding of a filamentary material by a position adjustable roller mechanism which is coupled by a screw drive to a reversible motor. Changes in the pin position such as caused by winding growth are sensed by the photocells to provide the displacement of the roller mechanism in the direction necessary to return the mandrel to the selected position.

  9. Fault diagnosis of direct-drive wind turbine based on support vector machine

    NASA Astrophysics Data System (ADS)

    An, X. L.; Jiang, D. X.; Li, S. H.; Chen, J.

    2011-07-01

    A fault diagnosis method of direct-drive wind turbine based on support vector machine (SVM) and feature selection is presented. The time-domain feature parameters of main shaft vibration signal in the horizontal and vertical directions are considered in the method. Firstly, in laboratory scale five experiments of direct-drive wind turbine with normal condition, wind wheel mass imbalance fault, wind wheel aerodynamic imbalance fault, yaw fault and blade airfoil change fault are carried out. The features of five experiments are analyzed. Secondly, the sensitive time-domain feature parameters in the horizontal and vertical directions of vibration signal in the five conditions are selected and used as feature samples. By training, the mapping relation between feature parameters and fault types are established in SVM model. Finally, the performance of the proposed method is verified through experimental data. The results show that the proposed method is effective in identifying the fault of wind turbine. It has good classification ability and robustness to diagnose the fault of direct-drive wind turbine.

  10. Analysis and mapping of monthly wind field patterns using machine learning

    NASA Astrophysics Data System (ADS)

    Robert, Sylvain; Foresti, Loris; Kanevski, Mikhail

    2010-05-01

    Spatial prediction/mapping of wind speed patterns is important for both renewable resources and natural hazards studies. Many different approaches were proposed in the literature: deterministic science-based models, geostatistical interpolations, data driven modelling based on machine learning algorithms (artificial neural networks of different architectures, support vector machines). Deterministic (science-based or physical) models suffer from computational burden and are hardly applicable over fine grids in complex regions. Geostatistical models depend on modelling of spatial correlations and are limited to the low dimensional spaces. The present study focuses on the use of machine learning algorithms for spatial mapping of monthly average wind speed in Switzerland. The real data were provided by Meteoswiss and presented complex relationships with topography. The topographic information was derived by filtering the Swiss DEM and was necessary to correctly describe wind speed patterns. Additional input variables, highlighting ridges, canyons, exposed flanks, were stacked to spatial coordinates (X, Y, Z). However, the integration of these "geo-features" considerably increased the dimensionality of the original input space (~10-30). Therefore the use of machine learning methods became crucial for providing robust nonlinear predictions of high quality. The generic methodology used includes the following important steps: exploratory spatial data analysis, including variography and detection of spatially structured patterns; automatic features selection/scaling using the adaptive/anisotropic generalized regression neural networks (GRNN); optimization of model hyper-parameters by minimizing cross-validation error using iterative gradient-based algorithms; modelling (mapping) of the functional relationships between the spatial locations and topography, comprehensive analysis of the residuals and visual interpretation of the results. It was shown that anisotropic GRNN considerably outperforms its isotropic version. Stability of adaptive GRNN in selecting features was assessed by analyzing the variance of the proposed solutions. Other observations concern the variation of the predictability of wind speed during the year: lower in summer and higher in winter. Finally, the results were compared with a support vector regression (SVR), which is a well known non-linear and robust model efficient in high dimensional spaces. The research was partly supported by SNSF project No. 200020-121835.

  11. A novel design of DC-AC electrical machine rotary converter for hybrid solar and wind energy applications

    NASA Astrophysics Data System (ADS)

    Mohammed, K. G.; Ramli, A. Q.; Amirulddin, U. A. U.

    2013-06-01

    This paper proposes the design of a new bi-directional DC-AC rotary converter machine to convert a d.c. voltage to three-phase voltage and vice-versa using a two-stage energy conversion machine. The rotary converter consists of two main stages which are combined into single frame. These two stages are constructed from three main electromagnetic components. The first inner electromagnetic component represents the input stage that enables the DC power generated by solar energy from photo-voltaic cells to be transformed by the second and third components electro-magnetically to produce multi-phase voltages at the output stage. At the same time, extra kinetic energy from wind, which is sufficiently available, can be added to existing torque on the second electromagnetic component. Both of these input energies will add up to the final energy generated at the output terminals. Therefore, the machine will be able to convert solar and wind energies to the output terminals simultaneously. If the solar energy is low, the available wind energy will be able to provide energy to the output terminals and at the same time charges the batteries which are connected as backup system. At this moment, the machine behaves as wind turbine. The energy output from the machine benefits from two energy sources which are solar and wind. At night when the solar energy is not available and also the load is low, the wind energy is able to charge the batteries and at the same time provides output electrical power to the remaining the load. Therefore, the proposed system will have high usage of available renewable energy as compared to separated wind or solar systems. MATLAB codes are used to calculate the required dimensions, the magnetic and electrical circuits parameters to design of the new bi-directional rotary converter machine.

  12. Eddy-current formulation for constructing transmission-line models for machine windings

    NASA Astrophysics Data System (ADS)

    de Gersem, H.; Henze, O.; Weiland, T.; Binder, A.

    2010-03-01

    In this paper, an eddy-current formulation is used to determine the transmission-line parameters of a machine winding. It is shown that this formulation covers a broader frequency range than the commonly used low-frequency magnetostatic and high-frequency magnetodynamic approximations. The eddy-current formulation, however, suffers from large computation times and may lead to severe inaccuracies if the finite-element mesh does not resolve the skin depth, a modelling concern that does not exist for the traditional formulations. The three finite-element models are compared according to the accuracy of the resulting transmission-line model applied to the winding of a permanent-magnet synchronous machine. This article has been submitted as part of “NUMELEC 2008 - 6e Conférence Européenne sur les Méthodes Numériques en Électromagnétisme”, 8-10 December 2008, LiègeThis work has been carried out in the collaborative research group (Forschergruppe 575) “High-frequency parasitic effects in inverter-fed electrical drives” funded by the German Research Foundation (Deutsche Forschungsgemeinschaft, DFG).

  13. Heat production in the windings of the stators of electric machines under stationary condition

    NASA Astrophysics Data System (ADS)

    Alebouyeh Samami, Behzad; Pieper, Martin; Breitbach, Gerd; Hodapp, Josef

    2014-12-01

    In electric machines due to high currents and resistive losses (joule heating) heat is produced. To avoid damages by overheating the design of effective cooling systems is required. Therefore the knowledge of heat sources and heat transfer processes is necessary. The purpose of this paper is to illustrate a good and effective calculation method for the temperature analysis based on homogenization techniques. These methods have been applied for the stator windings in a slot of an electric machine consisting of copper wires and resin. The key quantity here is an effective thermal conductivity, which characterizes the heterogeneous wire resin-arrangement inside the stator slot. To illustrate the applicability of the method, the analysis of a simplified, homogenized model is compared with the detailed analysis of temperature behavior inside a slot of an electric machine according to the heat generation. We considered here only the stationary situation. The achieved numerical results are accurate and show that the applied homogenization technique works in practice. Finally the results of simulations for the two cases, the original model of the slot and the homogenized model chosen for the slot (unit cell), are compared to experimental results.

  14. Fluid-structure interaction modeling of wind turbines: simulating the full machine

    NASA Astrophysics Data System (ADS)

    Hsu, Ming-Chen; Bazilevs, Yuri

    2012-12-01

    In this paper we present our aerodynamics and fluid-structure interaction (FSI) computational techniques that enable dynamic, fully coupled, 3D FSI simulation of wind turbines at full scale, and in the presence of the nacelle and tower (i.e., simulation of the "full machine"). For the interaction of wind and flexible blades we employ a nonmatching interface discretization approach, where the aerodynamics is computed using a low-order finite-element-based ALE-VMS technique, while the rotor blades are modeled as thin composite shells discretized using NURBS-based isogeometric analysis (IGA). We find that coupling FEM and IGA in this manner gives a good combination of efficiency, accuracy, and flexibility of the computational procedures for wind turbine FSI. The interaction between the rotor and tower is handled using a non-overlapping sliding-interface approach, where both moving- and stationary-domain formulations of aerodynamics are employed. At the fluid-structure and sliding interfaces, the kinematic and traction continuity is enforced weakly, which is a key ingredient of the proposed numerical methodology. We present several simulations of a three-blade 5~MW wind turbine, with and without the tower. We find that, in the case of no tower, the presence of the sliding interface has no effect on the prediction of aerodynamic loads on the rotor. From this we conclude that weak enforcement of the kinematics gives just as accurate results as the strong enforcement, and thus enables the simulation of rotor-tower interaction (as well as other applications involving mechanical components in relative motion). We also find that the blade passing the tower produces a 10-12 % drop (per blade) in the aerodynamic torque. We feel this finding may be important when it comes to the fatigue-life analysis and prediction for wind turbine blades.

  15. Induction machine

    DOEpatents

    Owen, Whitney H.

    1980-01-01

    A polyphase rotary induction machine for use as a motor or generator utilizing a single rotor assembly having two series connected sets of rotor windings, a first stator winding disposed around the first rotor winding and means for controlling the current induced in one set of the rotor windings compared to the current induced in the other set of the rotor windings. The rotor windings may be wound rotor windings or squirrel cage windings.

  16. A magnetically levitated synchronous permanent magnet planar motor with concentric structure winding used for lithography machine

    NASA Astrophysics Data System (ADS)

    Zhang, Lu; Kou, Baoquan; Xing, Feng; Jin, Yinxi; Zhang, Hailin; Zhu, Jianguo

    2015-05-01

    A novel magnetically levitated synchronous permanent magnet planar motor (MLSPMPM) with concentric structure winding, which can be used in lithography machine, is proposed in this paper. Topology and principle of the new MLSPMPM are introduced. The scalar magnetic potential is used to solve the magnetic system, and the differential equations are solved by the separation of variables method according to the boundary conditions. Characteristics, such as flux density, electromagnetic force, and back-EMF of the MLSPMPM, are obtained analytically. All of the results are validated by the finite element method. A prototype of the MLSPMPM is manufactured. Based on the prototype motor, some experiments are carried out. The measured results are used to showcase the validity of the analytical analysis.

  17. Failure assessment of aluminum liner based filament-wound hybrid riser subjected to internal hydrostatic pressure

    NASA Astrophysics Data System (ADS)

    Dikshit, Vishwesh; Seng, Ong Lin; Maheshwari, Muneesh; Asundi, A.

    2015-03-01

    The present study describes the burst behavior of aluminum liner based prototype filament-wound hybrid riser under internal hydrostatic pressure. The main objective of present study is to developed an internal pressure test rig set-up for filament-wound hybrid riser and investigate the failure modes of filament-wound hybrid riser under internal hydrostatic burst pressure loading. The prototype filament-wound hybrid riser used for burst test consists of an internal aluminum liner and outer composite layer. The carbon-epoxy composites as part of the filament-wound hybrid risers were manufactured with [±55o] lay-up pattern with total composite layer thickness of 1.6 mm using a CNC filament-winding machine. The burst test was monitored by video camera which helps to analyze the failure mechanism of the fractured filament-wound hybrid riser. The Fiber Bragg Grating (FBG) sensor was used to monitor and record the strain changes during burst test of prototype filament-wound hybrid riser. This study shows good improvements in burst strength of filament-wound hybrid riser compared to the monolithic metallic riser. Since, strain measurement using FBG sensors has been testified as a reliable method, we aim to further understand in detail using this technique.

  18. Hawaii 9 MW wind farm - fifteen 600 kW machines

    SciTech Connect

    VanBibber, L.E.; Andersen, T.S.

    1986-03-01

    In December 1984, Hawaiian Electric Renewable Systems Incorporated initiated an effort to develop a 9 MW wind farm consisting of fifteen of the 600 KWWWG-0600 wind turbines. The wind farm is located at Kahuku Point, a hilly area, located in the northern section of Oahu. The wind turbine design is discussed and a description of the wind farm is provided. The control mechanisms of the wind farm are outlined, and the current status of operations of the wind farm is discussed. 7 figures.

  19. Arrangement for cooling a superconducting field winding and a damper shield of the rotor of an electric machine

    SciTech Connect

    Weghaupt, E.; Intichar, L.; Schnapper, C.

    1983-08-02

    A cooling arrangement is disclosed for a superconducting field winding of an electric machine, especially a turbo-generator. It has a coolant space which contains a cryogenic coolant fed into it via a feed line, for cooling the field winding, and a coolant supply chamber which contains liquid coolant for cooling a damper shield. So that no separate feed and discharge lines are required for cooling the damper shield independently of the cooling of the field winding, the coolant supply chamber is connected directly to the coolant feed line via a radial connecting line, and the flow cross sections of the connecting line and of the section of the coolant feed line between the connecting head and the connecting point of the connecting line are made large.

  20. 380 kW synchronous machine with HTS rotor windings--development at Siemens and first test results

    NASA Astrophysics Data System (ADS)

    Nick, W.; Nerowski, G.; Neumüller, H.-W.; Frank, M.; van Hasselt, P.; Frauenhofer, J.; Steinmeyer, F.

    2002-08-01

    Applying HTS conductors in the rotor of synchronous machines allows the design of future motors or generators that are lighter, more compact and feature an improved coefficient of performance. To address these goals a project collaboration was installed within Siemens, including Automation & Drives, Large Drives as a leading supplier of electrical machines, Corporate Technology as a competence center for superconducting technology, and other partners. The main task of the project was to demonstrate the feasibility of basic concepts. The rotor was built from racetrack coils of Bi-2223 HTS tape conductor, these were assembled on a core and fixed by a bandage of glass-fibre composite. Rotor coil cooling is performed by thermal conduction, one end of the motor shaft is hollow to give access for the cooling system. Two cooling systems were designed and operated successfully: firstly an open circuit using cold gaseous helium from a storage vessel, but also a closed circuit system based on a cryogenerator. To take advantage of the increased rotor induction levels the stator winding was designed as an air gap winding. This was manufactured and fitted in a standard motor housing. After assembling of the whole system in a test facility with a DC machine load experiments have been started to prove the validity of our design, including operation with both cooling systems and driving the stator from the grid as well as by a power inverter.

  1. Device for cooling a superconducting field winding and a damper shield of the rotor of an electric machine

    SciTech Connect

    Intichar, L.; Schnapper, C.; Weghaupt, E.

    1983-05-31

    A cooling device for a superconducting field winding of an electric machine, especially a turbo-generator, contains an exhaust gas line connected to a coolant space for cooling an end piece at the end face of a torque transmitting rotor body part as well as a coolant line extending along a damper shield arranged around the field winding. In order to utilize the liquid coolant in a particularly economical and simple manner, the coolant line of the damper shield is a section of the coolant exhaust gas line , and this section is arranged, as seen in the flow direction of the coolant exhaust gas, ahead of the line section of the torque transmitting end piece.

  2. Understanding Power Electronics and Electrical Machines in Multidisciplinary Wind Energy Conversion System Courses

    ERIC Educational Resources Information Center

    Duran, M. J.; Barrero, F.; Pozo-Ruz, A.; Guzman, F.; Fernandez, J.; Guzman, H.

    2013-01-01

    Wind energy conversion systems (WECS) nowadays offer an extremely wide range of topologies, including various different types of electrical generators and power converters. Wind energy is also an application of great interest to students and with a huge potential for engineering employment. Making WECS the main center of interest when teaching…

  3. Understanding Power Electronics and Electrical Machines in Multidisciplinary Wind Energy Conversion System Courses

    ERIC Educational Resources Information Center

    Duran, M. J.; Barrero, F.; Pozo-Ruz, A.; Guzman, F.; Fernandez, J.; Guzman, H.

    2013-01-01

    Wind energy conversion systems (WECS) nowadays offer an extremely wide range of topologies, including various different types of electrical generators and power converters. Wind energy is also an application of great interest to students and with a huge potential for engineering employment. Making WECS the main center of interest when teaching…

  4. Effects of Aerospace Contaminants on EPIKOTE(TM) 862 / EPIKURE(TM)-W Filament Winding Resin System: An Experimental Study

    NASA Astrophysics Data System (ADS)

    Moffet, Mitchell Lee

    This thesis presents the findings of extensive experiments to determine the effects of various common aerospace chemicals on EPIKOTE(TM) 862 (resin) and EPIKURE(TM) W (curing agent), a resin system utilized in filament wound carbon fiber reinforced polymer (CRP) structures. Test specimens of the neat resin system were fabricated and exposed for up to 6 months at room temperature to 11 fluids representing typical aerospace chemicals found on the flight line, and to 74°C tap water. Post exposure the samples were tested in torsion using a rheometer, which performed strain sweeps and frequency sweeps on all the samples. In addition, a subset of the samples received a temperatures sweep. The rheology test parameters represented the nominal stress levels CRP structures would expect to see in operation. In addition to the rheological tests, dimensional and mass measurements were made of the samples both pre and post exposure to study the physical changes due to the chemical interactions. Based on the results, a common detergent, MEK on structures manufactured with the 862W resin system should be prevented or severely limited. It had a significant impact on the performance of the resin system within 3 months, with no visible indications of the degradation. The resins system had good chemical resistance to all the other chemicals used in this study including hot water.

  5. Helical filaments

    SciTech Connect

    Barbieri, Nicholas; Lim, Khan; Durand, Magali; Baudelet, Matthieu; Richardson, Martin; Hosseinimakarem, Zahra; Johnson, Eric

    2014-06-30

    The shaping of laser-induced filamenting plasma channels into helical structures by guiding the process with a non-diffracting beam is demonstrated. This was achieved using a Bessel beam superposition to control the phase of an ultrafast laser beam possessing intensities sufficient to induce Kerr effect driven non-linear self-focusing. Several experimental methods were used to characterize the resulting beams and confirm the observed structures are laser air filaments.

  6. Analysis of strong nocturnal shears for wind machine design. Final report

    SciTech Connect

    Mahrt, L.; Heald, R.C.

    1980-11-01

    Wind shear data at wind turbine heights from several sites is reviewed and new data is documented in terms of total and component shear. A variety of atmospheric scenarios may combine to give large persistent shear. Among these, strong boundary layer stability is foremost. It occurs with strong nocturnal surface cooling, in low level frontal and subsidence inversions, and in thunderstorm outflows. Strong shears resulting from surface radiation inversions are particularly evident over the High Plains where dry air and high altitude combine to result in strong radiational cooling. Terrain is also an important influence on shear but it is not well understood and is very site specific.

  7. FUZZY LOGIC BASED INTELLIGENT CONTROL OF A VARIABLE SPEED CAGE MACHINE WIND GENERATION SYSTEM

    EPA Science Inventory

    The report gives results of a demonstration of the successful application of fuzzy logic to enhance the performance and control of a variable-speed wind generation system. A squirrel cage induction generator feeds the power to either a double-sided pulse-width modulation converte...

  8. FUZZY LOGIC BASED INTELLIGENT CONTROL OF A VARIABLE SPEED CAGE MACHINE WIND GENERATION SYSTEM

    EPA Science Inventory

    The paper describes a variable-speed wind generation system where fuzzy logic principles are used to optimize efficiency and enhance performance control. A squirrel cage induction generator feeds the power to a double-sided pulse width modulated converter system which either pump...

  9. Magnetically driven filament probe.

    PubMed

    Schmid, A; Herrmann, A; Rohde, V; Maraschek, M; Müller, H W

    2007-05-01

    A radially movable probe has been developed for studies of filamentary transport in ASDEX Upgrade during edge localized modes (ELMs) by means of Langmuir tips and magnetic pickup coils. The probe is permanently installed at the low field side in the ASDEX Upgrade vacuum vessel and is not subject to limitations in probe size, as, for example, probes on a shared manipulator are. The probe is moved by a magnetic drive, which allows for easy installation in the vessel, and has moderate machine requirements, as it will only require an electric feedthrough and an external power supply. The drive gives a linear motion with a radial range of 5 cm within 50 ms, where range and velocity can be largely scaled according to experimental requirements. The probe has been installed in the outer midplane of the ASDEX Upgrade vessel, where ELM filaments are expected to have their maximum amplitude. Filaments are coherent substructures within an ELM, carrying a fraction of the ELM released energy towards the wall. The new probe allows to measure the structure of these filaments, in particular, parameters such as filament rotation (by time delay measurements) and size (by peak width analysis). Activating the drive moves the probe from a safe position behind the limiter to a position in front of the limiters, i.e., exposes the Langmuir pins to the scrape-off layer plasma. PMID:17552815

  10. Magnetically driven filament probe

    SciTech Connect

    Schmid, A.; Herrmann, A.; Rohde, V.; Maraschek, M.; Mueller, H. W.

    2007-05-15

    A radially movable probe has been developed for studies of filamentary transport in ASDEX Upgrade during edge localized modes (ELMs) by means of Langmuir tips and magnetic pickup coils. The probe is permanently installed at the low field side in the ASDEX Upgrade vacuum vessel and is not subject to limitations in probe size, as, for example, probes on a shared manipulator are. The probe is moved by a magnetic drive, which allows for easy installation in the vessel, and has moderate machine requirements, as it will only require an electric feedthrough and an external power supply. The drive gives a linear motion with a radial range of 5 cm within 50 ms, where range and velocity can be largely scaled according to experimental requirements. The probe has been installed in the outer midplane of the ASDEX Upgrade vessel, where ELM filaments are expected to have their maximum amplitude. Filaments are coherent substructures within an ELM, carrying a fraction of the ELM released energy towards the wall. The new probe allows to measure the structure of these filaments, in particular, parameters such as filament rotation (by time delay measurements) and size (by peak width analysis). Activating the drive moves the probe from a safe position behind the limiter to a position in front of the limiters, i.e., exposes the Langmuir pins to the scrape-off layer plasma.

  11. Analytical Modeling of a Novel Transverse Flux Machine for Direct Drive Wind Turbine Applications: Preprint

    SciTech Connect

    Hasan, IIftekhar; Husain, Tausif; Uddin, Md Wasi; Sozer, Yilmaz; Husain; Iqbal; Muljadi, Eduard

    2015-08-24

    This paper presents a nonlinear analytical model of a novel double-sided flux concentrating Transverse Flux Machine (TFM) based on the Magnetic Equivalent Circuit (MEC) model. The analytical model uses a series-parallel combination of flux tubes to predict the flux paths through different parts of the machine including air gaps, permanent magnets, stator, and rotor. The two-dimensional MEC model approximates the complex three-dimensional flux paths of the TFM and includes the effects of magnetic saturation. The model is capable of adapting to any geometry that makes it a good alternative for evaluating prospective designs of TFM compared to finite element solvers that are numerically intensive and require more computation time. A single-phase, 1-kW, 400-rpm machine is analytically modeled, and its resulting flux distribution, no-load EMF, and torque are verified with finite element analysis. The results are found to be in agreement, with less than 5% error, while reducing the computation time by 25 times.

  12. Final Report on Control Algorithm to Improve the Partial-Load Efficiency of Surface PM Machines with Fractional-Slot Concentrated Windings

    SciTech Connect

    McKeever, John W; Reddy, Patel; Jahns, Thomas M

    2007-05-01

    Surface permanent magnet (SPM) synchronous machines using fractional-slot concentrated windings are being investigated as candidates for high-performance traction machines for automotive electric propulsion systems. It has been shown analytically and experimentally that such designs can achieve very wide constant-power speed ratios (CPSR) [1,2]. This work has shown that machines of this type are capable of achieving very low cogging torque amplitudes as well as significantly increasing the machine power density [3-5] compared to SPM machines using conventional distributed windings. High efficiency can be achieved in this class of SPM machine by making special efforts to suppress the eddy-current losses in the magnets [6-8], accompanied by efforts to minimize the iron losses in the rotor and stator cores. Considerable attention has traditionally been devoted to maximizing the full-load efficiency of traction machines at their rated operating points and along their maximum-power vs. speed envelopes for higher speeds [9,10]. For example, on-line control approaches have been presented for maximizing the full-load efficiency of PM synchronous machines, including the use of negative d-axis stator current to reduce the core losses [11,12]. However, another important performance specification for electric traction applications is the machine's efficiency at partial loads. Partial-load efficiency is particularly important if the target traction application requires long periods of cruising operation at light loads that are significantly lower than the maximum drive capabilities. While the design of the machine itself is clearly important, investigation has shown that this is a case where the choice of the control algorithm plays a critical role in determining the maximum partial-load efficiency that the machine actually achieves in the traction drive system. There is no evidence that this important topic has been addressed for this type of SPM machine by any other authors. This topic takes on even greater significance for fractional-slot concentrated-winding SPM machine designs. In particular, maximizing the torque/power density of this class of SPM machines typically leads to machine designs with high numbers of poles. The resulting high electrical frequencies can easily result in high stator core losses unless special care is taken during the machine design process. The purpose of this report is to discuss a modified vector control algorithm for a fractional-slot concentrated winding SPM machine that has been developed to maximize the machine's partial-load efficiency over a wide range of operating conditions. For purposes of this discussion, a 55 kW (peak) SPM machine designed to meet requirements established in the US FreedomCar program [13] is used as the basis for demonstrating the proposed technique. A combination of closed-form analysis [14] and finite element analysis (FEA) is used during this investigation.

  13. FINAL REPORT ON CONTROL ALGORITHM TO IMPROVE THE PARTIAL-LOAD EFFICIENCY OFSURFACE PM MACHINES WITH FRACTIONAL-SLOT CONCENTRATED WINDINGS

    SciTech Connect

    Reddy, P.B.; Jahns, T.M.

    2007-04-30

    Surface permanent magnet (SPM) synchronous machines using fractional-slot concentrated windings are being investigated as candidates for high-performance traction machines for automotive electric propulsion systems. It has been shown analytically and experimentally that such designs can achieve very wide constant-power speed ratios (CPSR) [1,2]. This work has shown that machines of this type are capable of achieving very low cogging torque amplitudes as well as significantly increasing the machine power density [3-5] compared to SPM machines using conventional distributed windings. High efficiency can be achieved in this class of SPM machine by making special efforts to suppress the eddy-current losses in the magnets [6-8], accompanied by efforts to minimize the iron losses in the rotor and stator cores. Considerable attention has traditionally been devoted to maximizing the full-load efficiency of traction machines at their rated operating points and along their maximum-power vs. speed envelopes for higher speeds [9,10]. For example, on-line control approaches have been presented for maximizing the full-load efficiency of PM synchronous machines, including the use of negative d-axis stator current to reduce the core losses [11,12]. However, another important performance specification for electric traction applications is the machine's efficiency at partial loads. Partial-load efficiency is particularly important if the target traction application requires long periods of cruising operation at light loads that are significantly lower than the maximum drive capabilities. While the design of the machine itself is clearly important, investigation has shown that this is a case where the choice of the control algorithm plays a critical role in determining the maximum partial-load efficiency that the machine actually achieves in the traction drive system. There is no evidence that this important topic has been addressed for this type of SPM machine by any other authors. This topic takes on even greater significance for fractional-slot concentrated-winding SPM machine designs. In particular, maximizing the torque/power density of this class of SPM machines typically leads to machine designs with high numbers of poles. The resulting high electrical frequencies can easily result in high stator core losses unless special care is taken during the machine design process. The purpose of this report is to discuss a modified vector control algorithm for a fractional-slot concentrated winding SPM machine that has been developed to maximize the machine's partial-load efficiency over a wide range of operating conditions. For purposes of this discussion, a 55 kW (peak) SPM machine designed to meet requirements established in the US FreedomCar program [13] is used as the basis for demonstrating the proposed technique. A combination of closed-form analysis [14] and finite element analysis (FEA) is used during this investigation.

  14. Detection of stator winding faults in induction machines using flux and vibration analysis

    NASA Astrophysics Data System (ADS)

    Lamim Filho, P. C. M.; Pederiva, R.; Brito, J. N.

    2014-01-01

    This work aims at presenting the detection and diagnosis of electrical faults in the stator winding of three-phase induction motors using magnetic flux and vibration analysis techniques. A relationship was established between the main electrical faults (inter-turn short circuits and unbalanced voltage supplies) and the signals of magnetic flux and vibration, in order to identify the characteristic frequencies of those faults. The experimental results showed the efficiency of the conjugation of these techniques for detection, diagnosis and monitoring tasks. The results were undoubtedly impressive and can be adapted and used in real predictive maintenance programs in industries.

  15. Wind Energy Program: Top 10 Program Accomplishments

    SciTech Connect

    2009-01-18

    Brochure on the top accomplishments of the Wind Energy Program, including the development of large wind machines, small machines for the residential market, wind tunnel testing, computer codes for modeling wind systems, high definition wind maps, and successful collaborations.

  16. Mars vertical axis wind machines. The design of a Darreus and a Giromill for use on Mars

    NASA Astrophysics Data System (ADS)

    Brach, David; Dube, John; Kelly, Jon; Peterson, Joanna; Bollig, John; Gohr, Lisa; Mahoney, Kamin; Polidori, Dave

    1992-05-01

    This report contains the design of both a Darrieus and a Giromill for use on Mars. The report has been organized so that the interested reader may read only about one machine without having to read the entire report. Where components for the two machines differ greatly, separate sections have been allotted for each machine. Each section is complete; therefore, no relevant information is missed by reading only the section for the machine of interest. Also, when components for both machines are similar, both machines have been combined into one section. This is done so that the reader interested in both machines need not read the same information twice.

  17. Mars vertical axis wind machines. The design of a Darreus and a Giromill for use on Mars

    NASA Technical Reports Server (NTRS)

    Brach, David; Dube, John; Kelly, Jon; Peterson, Joanna; Bollig, John; Gohr, Lisa; Mahoney, Kamin; Polidori, Dave

    1992-01-01

    This report contains the design of both a Darrieus and a Giromill for use on Mars. The report has been organized so that the interested reader may read only about one machine without having to read the entire report. Where components for the two machines differ greatly, separate sections have been allotted for each machine. Each section is complete; therefore, no relevant information is missed by reading only the section for the machine of interest. Also, when components for both machines are similar, both machines have been combined into one section. This is done so that the reader interested in both machines need not read the same information twice.

  18. Analysis and design of a coreless permanent-magnet machine considering the winding shape by using a lumped equivalent magnetic circuit model

    NASA Astrophysics Data System (ADS)

    Seo, Jung-Moo; Jung, In-Soung; Jung, Hyun-Kyo; Ro, Jong-Suk

    2014-05-01

    A simple and rapid analysis and design method is proposed for a coreless permanent magnet machine (CPMM) using a hexagonal winding (HW). The HW, which combines a rectangular winding (RTW) and rhombic winding (RBW), can compensate for the disadvantages and maximize the advantages of the RTW and RBW. The CPMM is typically analyzed using complex differential equations or a timeconsuming finite element analysis (FEA). To address this problem, a relatively simpler and less timeconsuming analysis method is proposed by using a lumped equivalent magnetic circuit (LEMC) model. Furthermore, an effect of winding angle on a motor performance is analyzed via precise inspection of the relationship between the variables of the HW and the characteristics of motor. The validity and usefulness of the proposed method are verified via FEA and experiment.

  19. Graphite filament wound pressure vessels

    NASA Technical Reports Server (NTRS)

    Feldman, A.; Damico, J. J.

    1972-01-01

    Filament wound NOL rings, 4-inch and 8-inch diameter closed-end vessels involving three epoxy resin systems and three graphite fibers were tested to develop property data and fabrication technology for filament wound graphite/epoxy pressure vessels. Vessels were subjected to single-cycle burst tests at room temperature. Manufacturing parameters were established for tooling, winding, and curing that resulted in the development of a pressure/vessel performance factor (pressure x volume/weight) or more than 900,000 in. for an oblate spheroid specimen.

  20. Novel actin-like filament structure from Clostridium tetani.

    PubMed

    Popp, David; Narita, Akihiro; Lee, Lin Jie; Ghoshdastider, Umesh; Xue, Bo; Srinivasan, Ramanujam; Balasubramanian, Mohan K; Tanaka, Toshitsugu; Robinson, Robert C

    2012-06-15

    Eukaryotic F-actin is constructed from two protofilaments that gently wind around each other to form a helical polymer. Several bacterial actin-like proteins (Alps) are also known to form F-actin-like helical arrangements from two protofilaments, yet with varied helical geometries. Here, we report a unique filament architecture of Alp12 from Clostridium tetani that is constructed from four protofilaments. Through fitting of an Alp12 monomer homology model into the electron microscopy data, the filament was determined to be constructed from two antiparallel strands, each composed of two parallel protofilaments. These four protofilaments form an open helical cylinder separated by a wide cleft. The molecular interactions within single protofilaments are similar to F-actin, yet interactions between protofilaments differ from those in F-actin. The filament structure and assembly and disassembly kinetics suggest Alp12 to be a dynamically unstable force-generating motor involved in segregating the pE88 plasmid, which encodes the lethal tetanus toxin, and thus a potential target for drug design. Alp12 can be repeatedly cycled between states of polymerization and dissociation, making it a novel candidate for incorporation into fuel-propelled nanobiopolymer machines. PMID:22514279

  1. Novel Actin-like Filament Structure from Clostridium tetani*

    PubMed Central

    Popp, David; Narita, Akihiro; Lee, Lin Jie; Ghoshdastider, Umesh; Xue, Bo; Srinivasan, Ramanujam; Balasubramanian, Mohan K.; Tanaka, Toshitsugu; Robinson, Robert C.

    2012-01-01

    Eukaryotic F-actin is constructed from two protofilaments that gently wind around each other to form a helical polymer. Several bacterial actin-like proteins (Alps) are also known to form F-actin-like helical arrangements from two protofilaments, yet with varied helical geometries. Here, we report a unique filament architecture of Alp12 from Clostridium tetani that is constructed from four protofilaments. Through fitting of an Alp12 monomer homology model into the electron microscopy data, the filament was determined to be constructed from two antiparallel strands, each composed of two parallel protofilaments. These four protofilaments form an open helical cylinder separated by a wide cleft. The molecular interactions within single protofilaments are similar to F-actin, yet interactions between protofilaments differ from those in F-actin. The filament structure and assembly and disassembly kinetics suggest Alp12 to be a dynamically unstable force-generating motor involved in segregating the pE88 plasmid, which encodes the lethal tetanus toxin, and thus a potential target for drug design. Alp12 can be repeatedly cycled between states of polymerization and dissociation, making it a novel candidate for incorporation into fuel-propelled nanobiopolymer machines. PMID:22514279

  2. Machining of fiber reinforced composites

    NASA Astrophysics Data System (ADS)

    Komanduri, Ranga; Zhang, Bi; Vissa, Chandra M.

    Factors involved in machining of fiber-reinforced composites are reviewed. Consideration is given to properties of composites reinforced with boron filaments, glass fibers, aramid fibers, carbon fibers, and silicon carbide fibers and to polymer (organic) matrix composites, metal matrix composites, and ceramic matrix composites, as well as to the processes used in conventional machining of boron-titanium composites and of composites reinforced by each of these fibers. Particular attention is given to the methods of nonconventional machining, such as laser machining, water jet cutting, electrical discharge machining, and ultrasonic assisted machining. Also discussed are safety precautions which must be taken during machining of fiber-containing composites.

  3. Filaments on the Western Iberian Margin: A modeling study

    NASA Astrophysics Data System (ADS)

    Cordeiro, Nuno G. F.; Nolasco, Rita; Cordeiro-Pires, Ana; Barton, Eric D.; Dubert, Jesus

    2015-08-01

    Coastal upwelling filaments off the Western Iberian Margin, detected in AVHRR satellite imagery and in a realistic ROMS simulation of sea surface temperature, were studied in the upwelling seasons (May-October) of 2001-2010. Sea surface temperature data were retrieved from AVHRR satellite imagery and from a realistic ROMS numerical simulation. The development and variability of the observed filaments were characterized and analyzed during each upwelling season of the 10 year period. Filaments were generally found anchored to the main bathymetric and coastal features but off the more regular northern coast of the Western Iberian Margin their locations were more variable. The results from the modeling analysis reproduced well the general features of filament development. Moreover results of model and observation showed very similar characteristics as those found in the earlier study of Haynes et al. (1993). The model output was used to relate filament patterns, eddy activity, and wind forcing. There was a clear relation between upwelling-favorable wind strength and number and length of filaments, although the relation was weaker in the north of the region. Model filaments were clearly related to eddies only during periods of weak winds. The filament detection method was also applied to a climatologically forced ROMS simulation, which reproduced only gross features of the observed and interannually forced model filament development. This suggests that direct wind forcing and its spatial structure are highly important.

  4. Collaborative protein filaments

    PubMed Central

    Ghosal, Debnath; Löwe, Jan

    2015-01-01

    It is now well established that prokaryotic cells assemble diverse proteins into dynamic cytoskeletal filaments that perform essential cellular functions. Although most of the filaments assemble on their own to form higher order structures, growing evidence suggests that there are a number of prokaryotic proteins that polymerise only in the presence of a matrix such as DNA, lipid membrane or even another filament. Matrix-assisted filament systems are frequently nucleotide dependent and cytomotive but rarely considered as part of the bacterial cytoskeleton. Here, we categorise this family of filament-forming systems as collaborative filaments and introduce a simple nomenclature. Collaborative filaments are frequent in both eukaryotes and prokaryotes and are involved in vital cellular processes including chromosome segregation, DNA repair and maintenance, gene silencing and cytokinesis to mention a few. In this review, we highlight common principles underlying collaborative filaments and correlate these with known functions. PMID:26271102

  5. Filament Eruption Onset

    NASA Technical Reports Server (NTRS)

    Sterling, Alphonse C.; Moore, Ronald L.

    2011-01-01

    We have been investigating filament eruptions in recent years. Use filament eruptions as markers of the coronal field evolution. Data from SoHO, Yohkoh, TRACE, Hinode, and other sources. We and others have observed: (1)Filaments often show slow rise, followed by fast rise, (2) Brightenings, preflares, microflares during slow rise (3) Magnetic evolution in hours prior to eruption onset. We investigated What do Hinode and SDO show for filament eruptions?

  6. Filaments from L5

    NASA Technical Reports Server (NTRS)

    Sterling, Alphonse C.

    2011-01-01

    We've been investigating filament eruptions in recent years. Why do eruptions occur? Basic mechanism is magnetic, and can often include coronal mass ejections (CMEs), flares, and filament eruptions. Use filament eruptions as markers of the more-general eruption. From our studies, we can identify directions for future work to help predict when eruptions might occur.

  7. A Comparative Evaluation of Automated Solar Filament Detection

    NASA Astrophysics Data System (ADS)

    Schuh, M. A.; Banda, J. M.; Bernasconi, P. N.; Angryk, R. A.; Martens, P. C. H.

    2014-07-01

    We present a comparative evaluation for automated filament detection in H? solar images. By using metadata produced by the Advanced Automated Filament Detection and Characterization Code (AAFDCC) module, we adapted our trainable feature recognition (TFR) module to accurately detect regions in solar images containing filaments. We first analyze the AAFDCC module's metadata and then transform it into labeled datasets for machine-learning classification. Visualizations of data transformations and classification results are presented and accompanied by statistical findings. Our results confirm the reliable event reporting of the AAFDCC module and establishes our TFR module's ability to effectively detect solar filaments in H? solar images.

  8. A Comparative Evaluation of Automated Solar Filament Detection

    NASA Astrophysics Data System (ADS)

    Schuh, Michael; Banda, J.; Bernasconi, P.; Angryk, R.; Martens, P.

    2012-05-01

    We present a comparative evaluation for automated filament detection in H-alpha solar images. By using metadata produced by the Advanced Automated Filament Detection and Characterization Code (AAFDCC) module, we adapted our Trainable Feature Recognition (TFR) component to accurately detect regions in solar images containing filaments. We first analyze the module's metadata and then transform it into labeled datasets for machine learning classification. Visualizations of data transformations and classification results are presented and accompanied by statistical findings. Our results confirm the reliable event reporting of the AAFDCC module as well as our ability to effectively detect solar filaments with our TFR component.

  9. Nonisothermal filaments in equilibrium

    NASA Astrophysics Data System (ADS)

    Recchi, S.; Hacar, A.; Palestini, A.

    2013-10-01

    Context. The physical properties of the so-called Ostriker isothermal filament have been classically used as a benchmark to interpret the stability of the filaments observed in nearby clouds. However, recent continuum studies have shown that the internal structure of the filaments depart from the isothermality, typically exhibiting radially increasing temperature gradients. Aims: The presence of internal temperature gradients within filaments suggests that the equilibrium configuration of these objects should be therefore revisited. The main goal of this work is to theoretically explore how the equilibrium structure of a filament changes in a nonisothermal configuration. Methods: We solve the hydrostatic equilibrium equation by assuming temperature gradients similar to those derived from observations. Results: We obtain a new set of equilibrium solutions for nonisothermal filaments with both linear and asymptotically constant temperature gradients. For sufficiently large internal temperature gradients, our results show that a nonisothermal filament could present significantly larger masses per unit length and shallower density profiles than the isothermal filament without collapsing by its own gravity. Conclusions: We conclude that filaments can reach an equilibrium configuration under nonisothermal conditions. Detailed studies of both the internal mass distribution and temperature gradients within filaments are then needed to judge the physical state of filaments.

  10. Special issue on filamentation

    NASA Astrophysics Data System (ADS)

    Li, Ruxin; Milchberg, Howard; Mysyrowicz, André

    2014-05-01

    Journal of Physics B: Atomic, Molecular and Optical Physics is delighted to announce a forthcoming special issue on filamentation, to appear in the spring of 2015, and invites you to submit a paper. This special issue will attempt to give an overview of the present status of this field in order to create synergies and foster future developments. The issue is open to papers on the following issues: Theoretical advances on filamentation. Self-focusing and collapse. Filamentation in various media. Pulse self-compression and ultrafast processes in filaments. Molecular alignment and rotation. Filamentation tailoring. Interaction between filaments. Filament weather and pollution control. Filament induced condensation and precipitation. Terahertz science with filaments. Lasing in filaments. Filament induced molecular excitation and reaction. Electric discharge and plasma. Cross-disciplinary applications. Novel concepts related to these topics are particularly welcome. Please submit your article by 1 October 2014 (expected web publication: spring 2015) using our website http://mc04.manuscriptcentral.com/jphysb-iop. Submissions received after this date will be considered for the journal, but may not be included in the special issue. The issue will be edited by Ruxin Li, Howard Milchberg and André Mysyrowicz.

  11. Externally refuelled optical filaments

    NASA Astrophysics Data System (ADS)

    Scheller, Maik; Mills, Matthew S.; Miri, Mohammad-Ali; Cheng, Weibo; Moloney, Jerome V.; Kolesik, Miroslav; Polynkin, Pavel; Christodoulides, Demetrios N.

    2014-04-01

    Plasma channels produced in air through femtosecond laser filamentation hold great promise for a number of applications, including remote sensing, attosecond physics and spectroscopy, channelling microwaves and lightning protection. In such settings, extended filaments are desirable, yet their longitudinal span is limited by dissipative processes. Although various techniques aiming to prolong this process have been explored, the substantial extension of optical filaments remains a challenge. Here, we experimentally demonstrate that the natural range of a plasma column can be enhanced by at least an order of magnitude when the filament is prudently accompanied by an auxiliary beam. In this arrangement, the secondary low-intensity `dressing' beam propagates linearly and acts as a distributed energy reservoir, continuously refuelling the optical filament. Our approach offers an efficient and viable route towards the generation of extended light strings in air without inducing premature wave collapse or an undesirable beam break-up into multiple filaments.

  12. Silicon carbide filaments - Microstructure

    NASA Technical Reports Server (NTRS)

    Nutt, S. R.; Wawner, F. E.

    1985-01-01

    The microstructure of chemically vapor deposited silicon carbide filaments has been examined using transmission electron microscopy. The filament bulk consisted of heavily faulted columnar subgrains of beta-SiC which were preferentially oriented such that 1 1 1 planes were parallel to the surface of the carbon fiber substrate. The protective coating on the filament surface was characterized by several microstructurally distinct layers, all of which consisted primarily of carbon. The first layers of the coating contained small crystallites of SiC in addition to turbostratic carbon, while the outer layers showed no evidence of SiC. Implications of the filament microstructure with respect to mechanical properties are discussed.

  13. Processing and thermal properties of filament wound carbon-carbon composites for impact shell application

    NASA Astrophysics Data System (ADS)

    Zee, Ralph; Romanoski, Glenn; Gale, H. Shyam; Wang, Hsin

    2001-02-01

    The performance and safety of the radioisotope power source depend in part on the thermal and impact properties of the materials used in the general purpose heat source (GPHS) through the use of an impact shell, thermal insulation and an aeroshell. Results from an earlier study indicate the importance of circumferential fibers to the mechanical properties of cylindrical filament wound carbon-carbon composites for the impact shell application. Based on this study, an investigation was initiated to determine the processing characteristics and the mechanical and thermal response of three filament wound configurations with different percentages of circumferential fibers: 50%, 66% and 80%. The performs were fabricated using a 3-D filament winding machine followed by five cycles of resin impregnation and carbonization. In this paper, the processing sequence and the resulting microstructures of the composites will be described. The thermal conductivity values of the composites as a function of fiber configuration and density will be discussed. These results will be compared with the fine-weave pierced-fabric (FWPF) material and carbon-bonded carbon-fiber insulation. Finally, the relevance of the new configurations for applications in the general purpose heat source (GPHS) will also be inferred. .

  14. Structural design criteria for filament-wound composite shells

    NASA Technical Reports Server (NTRS)

    Hahn, H. T.; Jensen, D. W.; Claus, S. J.; Pai, S. P.; Hipp, P. A.

    1994-01-01

    Advanced composite cylinders, manufactured by filament winding, provide a cost effective solution to many present structural applications; however, the compressive performance of filament-wound cylinders is lower than comparable shells fabricated from unidirectional tape. The objective of this study was to determine the cause of this reduction in thin filament-wound cylinders by relating the manufacturing procedures to the quality of the cylinder and to its compressive performance. The experiments on cylinder buckling were complemented by eigenvalue buckling analysis using a detailed geometric model in a finite element analysis. The applicability of classical buckling analyses was also investigated as a design tool.

  15. Preliminary study on the applicability of semi-geodesic winding in the design and manufacturing of composite towers

    NASA Astrophysics Data System (ADS)

    Kayran, A.; ?brahimo?lu, C. S.

    2014-12-01

    During last twenty years, wind turbine manufacturers took the path of building larger machines to generate more electricity. However, the bigger the size became, the more material was required to support the loads, leading to great weight increases. Larger turbines and higher hub heights also resulted in larger tower base diameters which are limited considering their logistics. In many countries, the limit for transports with special permits maximizes the diameter to 4.5 metres. Considering this fact, the wind turbine market dominated by welded steel shell towers is looking for new structural solutions for their future turbines. Although, composite materials are not used as the structural material in the towers of today's turbines, the demand for larger wind turbines forces engineers to seek for alternative material systems with high specific strength and stiffness ratios to be used in towers. Inspired by the applicability of filament winding in tower production, in the present article we investigated the effect of semi-geodesic winding on the winding angle, thickness, stiffness coefficients and vibration characteristics of filament wound composite conical shells of revolution which simulate wind turbine towers at the structural level. Present study showed that the preset friction applied during semi-geodesic winding is an important design parameter which can be controlled to obtain gradually increasing thickness from tower top to the base of the tower, and favourably alter the dynamic characteristics of the composite towers.

  16. Wind at Work.

    ERIC Educational Resources Information Center

    Adams, Stephen

    1998-01-01

    Describes a project in which students create wind machines to harness the wind's power and do mechanical work. Demonstrates kinetic and potential energy conversions and makes work and power calculations meaningful. Students conduct hands-on investigations with their machines. (DDR)

  17. Evolution of filament barbs.

    NASA Astrophysics Data System (ADS)

    Liu, R.; Xu, Y.; Wang, H.

    We present a selected few cases in which the sense of chirality of filament barbs changed within periods as short as hours. We investigate in detail a quiescent filament on 2003 September 10 and 11. Of its four barbs displaying such changes, only one overlays a small polarity inversion line inside the EUV filament channel (EFC). No magnetic elements with magnitude above the noise level were detected at the endpoints of all barbs. In particular, a pair of barbs first approached toward, and then departed from, each other in Halpha , with the barb endpoints migrating as far as ˜ 10 arcsec. We conclude that the evolution of the barbs was driven by flux emergence and cancellation of small bipolar units at the EFC border.

  18. Aerogel-supported filament

    DOEpatents

    Wuest, Craig R.; Tillotson, Thomas M.; Johnson, III, Coleman V.

    1995-01-01

    The present invention is a thin filament embedded in a low density aerogel for use in radiation detection instruments and incandescent lamps. The aerogel provides a supportive matrix that is thermally and electrically nonconductive, mechanically strong, highly porous, gas-permeable, and transparent to ionizing radiation over short distances. A low density, open-cell aerogel is cast around a fine filament or wire, which allows the wire to be positioned with little or no tension and keeps the wire in place in the event of breakage. The aerogel support reduces the stresses on the wire caused by vibrational, gravitational, electrical, and mechanical forces.

  19. Aerogel-supported filament

    DOEpatents

    Wuest, C.R.; Tillotson, T.M.; Johnson, C.V. III

    1995-05-16

    The present invention is a thin filament embedded in a low density aerogel for use in radiation detection instruments and incandescent lamps. The aerogel provides a supportive matrix that is thermally and electrically nonconductive, mechanically strong, highly porous, gas-permeable, and transparent to ionizing radiation over short distances. A low density, open-cell aerogel is cast around a fine filament or wire, which allows the wire to be positioned with little or no tension and keeps the wire in place in the event of breakage. The aerogel support reduces the stresses on the wire caused by vibrational, gravitational, electrical, and mechanical forces. 6 Figs.

  20. Complex Flare Dynamics Initiated by a Filament-Filament Interaction

    NASA Astrophysics Data System (ADS)

    Zhu, Chunming; Liu, Rui; Alexander, David; Sun, Xudong; McAteer, R. T. James

    2015-11-01

    We report on an eruption involving a relatively rare filament–filament interaction on 2013 June 21, observed by SDO and STEREO-B. The two filaments were separated in height with a “double-decker” configuration. The eruption of the lower filament began simultaneously with a descent of the upper filament, resulting in a convergence and direct interaction of the two filaments. The interaction was accompanied by the heating of surrounding plasma and an apparent crossing of a loop-like structure through the upper filament. The subsequent coalescence of the filaments drove a bright front ahead of the erupting structures. The whole process was associated with a C3.0 flare followed immediately by an M2.9 flare. Shrinking loops and descending dark voids were observed during the M2.9 flare at different locations above a C-shaped flare arcade as part of the energy release, giving us unique insight into the flare dynamics.

  1. The Bearingless Electrical Machine

    NASA Technical Reports Server (NTRS)

    Bichsel, J.

    1992-01-01

    Electromagnetic bearings allow the suspension of solids. For rotary applications, the most important physical effect is the force of a magnetic circuit to a high permeable armature, called the MAXWELL force. Contrary to the commonly used MAXWELL bearings, the bearingless electrical machine will take advantage of the reaction force of a conductor carrying a current in a magnetic field. This kind of force, called Lorentz force, generates the torque in direct current, asynchronous and synchronous machines. The magnetic field, which already exists in electrical machines and helps to build up the torque, can also be used for the suspension of the rotor. Besides the normal winding of the stator, a special winding was added, which generates forces for levitation. So a radial bearing, which is integrated directly in the active part of the machine, and the motor use the laminated core simultaneously. The winding was constructed for the levitating forces in a special way so that commercially available standard ac inverters for drives can be used. Besides wholly magnetic suspended machines, there is a wide range of applications for normal drives with ball bearings. Resonances of the rotor, especially critical speeds, can be damped actively.

  2. Protein machines and self assembly in muscle organization

    NASA Technical Reports Server (NTRS)

    Barral, J. M.; Epstein, H. F.

    1999-01-01

    The remarkable order of striated muscle is the result of a complex series of protein interactions at different levels of organization. Within muscle, the thick filament and its major protein myosin are classical examples of functioning protein machines. Our understanding of the structure and assembly of thick filaments and their organization into the regular arrays of the A-band has recently been enhanced by the application of biochemical, genetic, and structural approaches. Detailed studies of the thick filament backbone have shown that the myosins are organized into a tubular structure. Additional protein machines and specific myosin rod sequences have been identified that play significant roles in thick filament structure, assembly, and organization. These include intrinsic filament components, cross-linking molecules of the M-band and constituents of the membrane-cytoskeleton system. Muscle organization is directed by the multistep actions of protein machines that take advantage of well-established self-assembly relationships. Copyright 1999 John Wiley & Sons, Inc.

  3. The filamentation of the TLE's

    NASA Astrophysics Data System (ADS)

    Blecki, J.; Mizerski, K.; Slominska, K.; Slominski, J.; Savin, S.

    2015-10-01

    The small scale structure of TLE's is discussed in the context of the filamentation processes. The discussion is focused around 3 mechanisms -pinch instability, filamentation of kinetic Alfven's waves and ionization instability.

  4. Power from the Wind

    ERIC Educational Resources Information Center

    Roman, Harry T.

    2004-01-01

    Wind energy is the fastest-growing renewable energy source in the world. Over the last 20 years, the wind industry has done a very good job of engineering machines, improving materials, and economies of production, and making this energy source a reality. Like all renewable energy forms, wind energy's successful application is site specific. Also,…

  5. Power from the Wind

    ERIC Educational Resources Information Center

    Roman, Harry T.

    2004-01-01

    Wind energy is the fastest-growing renewable energy source in the world. Over the last 20 years, the wind industry has done a very good job of engineering machines, improving materials, and economies of production, and making this energy source a reality. Like all renewable energy forms, wind energy's successful application is site specific. Also,…

  6. Wind Power Now!

    ERIC Educational Resources Information Center

    Inglis, David Rittenhouse

    1975-01-01

    The government promotes and heavily subsidizes research in nuclear power plants. Federal development of wind power is slow in comparison even though much research with large wind-electric machines has already been conducted. Unless wind power programs are accelerated it will not become a major energy alternative to nuclear power. (MR)

  7. Wind energy: An engineering survey

    SciTech Connect

    Nahas, M.N.; Mohamad, A.S.; Akyurt, M.; El-Kalay, A.K.

    1987-01-01

    This paper presents an extensive survey of literature about wind energy and wind machines, their design and their applications. The paper intends to provide those who plan for energy policy with thorough information about this renewable type of energy and the available machines that convert wind energy into useful mechanical or electrical work. The machines which are available at present range from the simple Savonius rotor to the powerful multi-blade windmills. The advantages and shortcomings of all types are discussed here.

  8. ORIGIN OF THE DENSE CORE MASS FUNCTION IN CONTRACTING FILAMENTS

    SciTech Connect

    Myers, Philip C.

    2013-02-20

    Mass functions of starless dense cores (CMFs) may arise from contraction and dispersal of core-forming filaments. In an illustrative model, a filament contracts radially by self-gravity, increasing the mass of its cores. During this contraction, FUV photoevaporation and ablation by shocks and winds disperse filament gas and limit core growth. The stopping times of core growth are described by a waiting-time distribution. The initial filament column density profile and the resulting CMF each match recent Herschel observations in detail. Then low-mass cores have short growth ages and arise from the innermost filament gas, while massive cores have long growth ages and draw from more extended filament gas. The model fits the initial density profile and CMF best for mean core density 2 Multiplication-Sign 10{sup 4} cm{sup -3} and filament dispersal timescale 0.5 Myr. Then the typical core mass, radius, mean column density, and contraction speed are respectively 0.8 solar masses, 0.06 pc, 6 Multiplication-Sign 10{sup 21} cm{sup -2}, and 0.07 km s{sup -1}, also in accord with observed values.

  9. Evolving Photospheric Flux Concentrations and Filament Dynamic Changes

    NASA Astrophysics Data System (ADS)

    Schmieder, B.; Aulanier, G.; Mein, P.; López Ariste, A.

    2006-11-01

    We analyze the role of weak photospheric flux concentrations that evolve in a filament channel, in the triggering of dynamic changes in the shape of a filament. The high polarimetric sensitivity of THEMIS allowed us to detect weak flux concentrations (few Gauss) associated with the filament development. The synoptic instruments (MDI, SOLIS) even if their sensitivity is much less than THEMIS were useful to follow any subsequent strengthening of these flux concentrations after their identification in the THEMIS magnetograms. We found that (1) the northern part of the filament develops an H? barb at the same time that weak minority polarity elements develop near a plage; (2) a section in the southern part of the H? filament gradually disappears and later reforms at the same time that several mixed-polarity magnetic elements appear, then subsequently cancel or spread away from each other. These changes correspond to increases in EUV emission, as observed by TRACE, EIT, and CDS. This suggests that the plasma is temporarily heated along the filament spine. An idealized sequence of force-free models of this filament channel, based on plasma-supporting magnetic dips occurring in the windings of a very weakly twisted flux tube, naturally explains the evolution of its southern part as being due to changes in the topology of the coronal magnetic field as the photospheric flux concentrations evolve.

  10. Hygrothermomechanical evaluation of transverse filament tape epoxy/polyester fiberglass composites

    NASA Technical Reports Server (NTRS)

    Lark, R. F.; Chamis, C. C.

    1984-01-01

    Transverse filament tape (TFT) fiberglass/epoxy and TFT polyester composites intended for low cost wind turbine blade fabrication have been subjected to static and cyclic load behavior tests whose results are presently evaluated on the basis of an integrated hygrothermomechanical response theory. Laminate testing employed simulated filament winding procedures. The results obtained show that the predicted hygrothermomechanical environmental effects on TFT composites are in good agreement with measured data for various properties, including fatigue at different R-ratio values.

  11. Axial gap rotating electrical machine

    DOEpatents

    None

    2016-02-23

    Direct drive rotating electrical machines with axial air gaps are disclosed. In these machines, a rotor ring and stator ring define an axial air gap between them. Sets of gap-maintaining rolling supports bear between the rotor ring and the stator ring at their peripheries to maintain the axial air gap. Also disclosed are wind turbines using these generators, and structures and methods for mounting direct drive rotating electrical generators to the hubs of wind turbines. In particular, the rotor ring of the generator may be carried directly by the hub of a wind turbine to rotate relative to a shaft without being mounted directly to the shaft.

  12. Solid friction between soft filaments.

    PubMed

    Ward, Andrew; Hilitski, Feodor; Schwenger, Walter; Welch, David; Lau, A W C; Vitelli, Vincenzo; Mahadevan, L; Dogic, Zvonimir

    2015-06-01

    Any macroscopic deformation of a filamentous bundle is necessarily accompanied by local sliding and/or stretching of the constituent filaments. Yet the nature of the sliding friction between two aligned filaments interacting through multiple contacts remains largely unexplored. Here, by directly measuring the sliding forces between two bundled F-actin filaments, we show that these frictional forces are unexpectedly large, scale logarithmically with sliding velocity as in solid-like friction, and exhibit complex dependence on the filaments' overlap length. We also show that a reduction of the frictional force by orders of magnitude, associated with a transition from solid-like friction to Stokes's drag, can be induced by coating F-actin with polymeric brushes. Furthermore, we observe similar transitions in filamentous microtubules and bacterial flagella. Our findings demonstrate how altering a filament's elasticity, structure and interactions can be used to engineer interfilament friction and thus tune the properties of fibrous composite materials. PMID:25730393

  13. Wind energy utilization: A bibliography

    NASA Technical Reports Server (NTRS)

    1975-01-01

    Bibliography cites documents published to and including 1974 with abstracts and references, and is indexed by topic, author, organization, title, and keywords. Topics include: Wind Energy Potential and Economic Feasibility, Utilization, Wind Power Plants and Generators, Wind Machines, Wind Data and Properties, Energy Storage, and related topics.

  14. [Filamentous overgrowth in aerobic granules].

    PubMed

    Wang, Shan-Quan; Kong, Yun-Hua; Yuan, Yuan; Dong, Xiao-Lei; Zhu, Jian-Rong

    2008-03-01

    Filamentous overgrowth has been observed after aerobic granulation in shaking sequencing batch reactors (SSBR). The factors affecting the filamentous overgrowth in aerobic granules and its possible control methods were investigated. It was found that both the influent and sludge inoculation largely influenced the filamentous overgrowth in aerobic granules. With the same activated sludge inoculation, the filamentous overgrowth in R3 treating fresh wastewater was much more severe than that in R1 treating saline wastewater. The filamentous overgrowth in R2 was the least among the three reactors, which was inoculated anaerobic granules and treated saline wastewater. When the filamentous overgrowth happened at the outer aerobic granules, Delta referring the degree of filamentous overgrowth achieved DeltaR1 = 1.4, DeltaR2 = 1.2 and DeltaR3 = 2.0, respectively. Filamentous identification showed that the filamentous microorganisms in R1 mainly composed of Eikelboom 0092 and Nocardia spp., Fungi spp. and Nocardia spp. in R2, S. natans and H. hydrossis in R3. The identified filamentous microorganisms likely occurred in conditions with long SRT, low dissolved oxygen and biodegradable substrates. However, due to the fact that filamentous overgrowth in aerobic granules initiated in the inner part of the granules and acted as frameworks with rod-shape or coccoid bacteria entrapping into in the granulation period, various strategies effectively in dealing with conventional bulking problems including shorting SRT, changing organic loading rate and enhancing aeration et al, could not effectively inhibit the filamentous growth in aerobic granules. The filamentous overgrowth was ultimately controlled through changing the substrate from synthetic glucose-rich wastewater to non-biodegradable wastewater. PMID:18649530

  15. Database machines

    NASA Technical Reports Server (NTRS)

    Stiefel, M. L.

    1983-01-01

    The functions and performance characteristics of data base machines (DBM), including machines currently being studied in research laboratories and those currently offered on a commerical basis are discussed. The cost/benefit considerations that must be recognized in selecting a DBM are discussed, as well as the future outlook for such machines.

  16. Production of Filaments by Surges

    NASA Astrophysics Data System (ADS)

    Liu, Yu; Kurokawa, Hiroki; Shibata, Kazunari

    2005-09-01

    We have recently developed a new method for automatic detection of solar surges and other dark dynamic features. For the first time we find that some filaments can be quickly formed by trapping the cold material supplied by surges originating from the chromosphere. Two clear examples are presented in this Letter, showing the special process for new filament formation by surge injection. The data used here were taken from Hida Observatory and the Global H? Network operated by Big Bear Solar Observatory. Both the filaments existed on the solar surface for not less than 20 hr, with an average length about 200", and had obvious helical structures and barbs. The surge material was injected from one terminal along the main axis of the filaments or the filament channels. We conclude that there are two necessary conditions for new filament formation by surges at one location: (1) an ``empty'' filament channel, or magnetic trap, and (2) enough mass supplied by surge activity. In most other surge-filament events, apart from our two examples, the surges are observed moving toward and acting on a preexisting nearby filament. The close relationship between surge activity and filament formation and maintenance suggests that there should be a direct link between the filament axial fields and the large-scale background fields along which the surge material can be driven into the filament channel. On the other hand, it also supports the idea that the frequent injection of flow from below is an important way to convey mass and energy into the corona through magnetic reconnections driven by successive emerging flux and converging flow.

  17. Chaperonin filaments: The archael cytoskeleton

    SciTech Connect

    Trent, J.D.; Kagawa, H.K.; Yaoi, Takuro; Olle, E.; Zaluzec, N.J.

    1997-08-01

    Chaperonins are multi-subunit double-ring complexed composed of 60-kDa proteins that are believed to mediate protein folding in vivo. The chaperonins in the hyperthermophilic archaeon Sulfolobus shibatae are composed of the organism`s two most abundant proteins, which represent 4% of its total protein and have an intracellular concentration of {ge} 3.0 mg/ml. At concentrations of 1.0 mg/ml, purified chaperonin proteins aggregate to form ordered filaments. Filament formation, which requires Mg{sup ++} and nucleotide binding (not hydrolysis), occurs at physiological temperatures under conditions suggesting filaments may exist in vivo. If the estimated 4,600 chaperonins per cell, formed filaments in vivo, they could create a matrix of filaments that would span the diameter of an average S. shibatae cell 100 times. Direct observations of unfixed, minimally treated cells by intermediate voltage electron microscopy (300 kV) revealed an intracellular network of filaments that resembles chaperonin filaments produced in vitro. The hypothesis that the intracellular network contains chaperonins is supported by immunogold analyses. The authors propose that chaperonin activity may be regulated in vivo by filament formation and that chaperonin filaments may serve a cytoskeleton-like function in archaea and perhaps in other prokaryotes.

  18. Acquisition of wind rights for wind energy development

    SciTech Connect

    Noun, R.J.

    1981-11-01

    Identifying suitable sites for large wind machine clusters, or wind farms, requires more than finding a location with an adequate wind resource. Consideration must also be given to the question of how land-use policies and regulations will affect the siting of wind system installations. In particular, the issue of acquiring wind rights, or guaranteed access to the wind resource for electric power generation, will be vital to the development of wind energy. This paper examines several methods for acquiring and preserving access to the wind resource and for dealing with related land-use issues.

  19. Acquisition of wind rights for wind energy development

    SciTech Connect

    Noun, R.J.

    1982-03-01

    Identifying suitable sites for large wind machine clusters, or wind farms, requires more than finding a location with an adequate wind resource. Consideration must also be given to the question of how land-use policies and regulations will affect the siting of wind system installations. In particular, the issue of acquiring wind rights or guaranteed access to the wind resource for electric power generation, will be vital to the development of wind energy. Several methods are examined for acquiring and preserving access to the wind resource and for dealing with related land-use issues.

  20. Analytical expressions for maximum wind turbine average power in a Rayleigh wind regime

    SciTech Connect

    Carlin, P.W.

    1996-12-01

    Average or expectation values for annual power of a wind turbine in a Rayleigh wind regime are calculated and plotted as a function of cut-out wind speed. This wind speed is expressed in multiples of the annual average wind speed at the turbine installation site. To provide a common basis for comparison of all real and imagined turbines, the Rayleigh-Betz wind machine is postulated. This machine is an ideal wind machine operating with the ideal Betz power coefficient of 0.593 in a Rayleigh probability wind regime. All other average annual powers are expressed in fractions of that power. Cases considered include: (1) an ideal machine with finite power and finite cutout speed, (2) real machines operating in variable speed mode at their maximum power coefficient, and (3) real machines operating at constant speed.

  1. Doubly fed machine review: agenda. Conference report, Washington, DC

    SciTech Connect

    Not Available

    1982-09-01

    The visual aids presented at the doubly fed machine review are presented. The doubly fed machine is a generating system either for wind turbines or hydro systems. Conceptual design and trade-offs are included, as well as testing. (LEW)

  2. Filament Eruptions, Jets, and Space Weather

    NASA Technical Reports Server (NTRS)

    Moore, Ronald; Sterling, Alphonse; Robe, Nick; Falconer, David; Cirtain, Jonathan

    2013-01-01

    Previously, from chromospheric H alpha and coronal X-ray movies of the Sun's polar coronal holes, it was found that nearly all coronal jets (greater than 90%) are one or the other of two roughly equally common different kinds, different in how they erupt: standard jets and blowout jets (Yamauchi et al 2004, Apl, 605, 5ll: Moore et all 2010, Apj, 720, 757). Here, from inspection of SDO/AIA He II 304 A movies of 54 polar x-ray jets observed in Hinode/XRT movies, we report, as Moore et al (2010) anticipated, that (1) most standard x-ray jets (greater than 80%) show no ejected plasma that is cool enough (T is less than or approximately 10(exp 5K) to be seen in the He II 304 A movies; (2) nearly all blownout X-ray jets (greater than 90%) show obvious ejection of such cool plasma; (3) whereas when cool plasma is ejected in standard X-ray jets, it shows no lateral expansion, the cool plasma ejected in blowout X-ray jets shows strong lateral expansion; and (4) in many blowout X-ray jets, the cool plasma ejection displays the erupting-magnetic-rope form of clasic filament eruptions and is thereby seen to be a miniature filament eruption. The XRT movies also showed most blowout X-ray jets to be larger and brighter, and hence to apparently have more energy, than most standard X-ray jets. These observations (1) confirm the dichotomy of coronal jets, (2) agree with the Shibata model for standard jets, and (3) support the conclusion of Moore et al (2010) that in blowout jets the magnetic-arch base of the jet erupts in the manner of the much larger magnetic arcades in which the core field, the field rooted along the arcade's polarity inversion line, is sheared and twisted (sigmoid), often carries a cool-plasma filament, and erupts to blowout the arcade, producing a CME. From Hinode/SOT Ca II movies of the polar limb, Sterling et al (2010, ApJ, 714, L1) found that chromospheric Type-II spicules show a dichotomy of eruption dynamics similar to that found here for the cool-plasma component of coronal X-ray jets. This favors the idea that Type-II spicules are miniature counterparts of coronal X-ray jets. In Moore et al (2011, ApJ, 731, L18), we pointed out that if Type-II spicules are magnetic eruptions that work like coronal X-ray jets, they carry an area-averaged mechanical energy flux of approximately 7x10)(exp 5) erg cm(exp -2) s(exp-1) into the corona in the form of MHD waves and jet outflow, enough to power the heating of the global corona and solar wind. On this basis, from our observations of mini-filament eruptions in blowout X-ray jets, we infer that magnetic explosions of the type that have erupting filaments in them are the main engines of both (1) the steady solar wind and (2) the CMEs that produce the most severe space weather by blasting out through the corona and solar wind, making solar energetic particle storms, and bashing the Earth's magnetosphere. We conclude that in focusing on prominences and filament eruptions, Einar had his eye on the main bet for understanding what powers all space weather, both the extreme and the normal.

  3. Solid friction between soft filaments

    PubMed Central

    Ward, Andrew; Hilitski, Feodor; Schwenger, Walter; Welch, David; Lau, A.W. C.; Vitelli, Vincenzo; Mahadevan, L.; Dogic, Zvonimir

    2015-01-01

    Any macroscopic deformation of a filamentous bundle is necessarily accompanied by local sliding and/or stretching of the constituent filaments1,2. Yet the nature of the sliding friction between two aligned filaments interacting through multiple contacts remains largely unexplored. Here, by directly measuring the sliding forces between two bundled F-actin filaments, we show that these frictional forces are unexpectedly large, scale logarithmically with sliding velocity as in solid-like friction, and exhibit complex dependence on the filaments’ overlap length. We also show that a reduction of the frictional force by orders of magnitude, associated with a transition from solid-like friction to Stokes’s drag, can be induced by coating F-actin with polymeric brushes. Furthermore, we observe similar transitions in filamentous microtubules and bacterial flagella. Our findings demonstrate how altering a filament’s elasticity, structure and interactions can be used to engineer interfilament friction and thus tune the properties of fibrous composite materials. PMID:25730393

  4. Capillary Force between Flexible Filaments.

    PubMed

    Soleimani, Majid; Hill, Reghan J; van de Ven, Theo G M

    2015-08-01

    Liquid droplets bridging filaments are ubiquitous in nature and technology. Although the liquid-surface shape and the capillary force and torque have been studied extensively, the effect of filament flexibility is poorly understood. Here, we show that elastic deformation (at large values of the elasto-capillary number) can significantly affect the liquid-surface shape and capillary force. The equilibrium state of parallel filaments is calculated using analytical approximations and numerical solutions for the fluid interface. The results compare well, and the numerical solution is then applied to crossing filaments. In the investigated range of parameters, the capillary force increases rapidly when the filaments touch. The force decreases continuously when decreasing the liquid volume for parallel hydrophilic filaments but produces a maximum for crossed filaments. The liquid volume at the maximum force is reported when changing the filament flexibility, crossing angle, and contact angle. These results may be beneficial in applications where the strength and structure of wet fibrous materials are important, such as in paper formation and when welding flexible components. PMID:26158380

  5. Surface manipulation of protein filaments

    NASA Astrophysics Data System (ADS)

    Kreplak, Laurent; Staple, Douglas; Loparic, Marko; Kreuzer, Hans-Juergen

    2009-03-01

    Within mammalian tissues, cells move by actively remodeling a dense network of collagen fibrils. In order to study this situation, we analyze the force response of two types of filamentous protein structures, desmin intermediate filaments 12 nm in diameter and collagen fibrils 80 nm in diameter. Both types of filaments were adsorbed at a solid-liquid interface and locally moved with an AFM tip at constant velocity against surface friction in the interfacial plane. In the case of collagen fibrils, that have an extensibility below 30% extension, we observed that microns long fibrils could be moved by the tip and deformed into shapes that could not be explain by the linear elastic theory for a stiff rod. In the case of desmin filaments that can be stretched up to 3.5 times there length, we observed local stretching of the filaments and discreet steps in the torsional force measured with the cantilever. In order to describe both types of filaments' behaviors, we described the protein filaments as a chain of beads of mass m linked together by a mass-less polymer linker. By solving the Newtonian equations of motions for the coupled beads in the presence of a point load and a viscous drag due to the surface-filament interactions we were able to reproduced our experimental data and extract information on friction.

  6. Connecting filaments: a historical prospective.

    PubMed

    Trombitás, K

    2000-01-01

    This short review covers the development of the extensible filament research from the very beginning until the most recent results. This work emphasizes the milestones of discovery, which led us from initial observations that were solely ultrastructural to the molecular understanding of the extensible process of these filaments. PMID:10987063

  7. Solid friction between soft filaments

    NASA Astrophysics Data System (ADS)

    Ward, Andrew; Hilitski, Feodor; Schwenger, Walter; Welch, David; Lau, A. W. C.; Vitelli, Vincenzo; Mahadevan, L.; Dogic, Zvonimir

    2015-06-01

    Any macroscopic deformation of a filamentous bundle is necessarily accompanied by local sliding and/or stretching of the constituent filaments. Yet the nature of the sliding friction between two aligned filaments interacting through multiple contacts remains largely unexplored. Here, by directly measuring the sliding forces between two bundled F-actin filaments, we show that these frictional forces are unexpectedly large, scale logarithmically with sliding velocity as in solid-like friction, and exhibit complex dependence on the filaments’ overlap length. We also show that a reduction of the frictional force by orders of magnitude, associated with a transition from solid-like friction to Stokes’s drag, can be induced by coating F-actin with polymeric brushes. Furthermore, we observe similar transitions in filamentous microtubules and bacterial flagella. Our findings demonstrate how altering a filament’s elasticity, structure and interactions can be used to engineer interfilament friction and thus tune the properties of fibrous composite materials.

  8. Quantification of Processing Effects on Filament Wound Pressure Vessels

    NASA Technical Reports Server (NTRS)

    Aiello, Robert A.; Chamis, Christos C.

    1999-01-01

    A computational simulation procedure is described which is designed specifically for the modeling and analysis of filament wound pressure vessels. Cylindrical vessels with spherical or elliptical end caps can be generated automatically. End caps other than spherical or elliptical may be modeled by varying circular sections along the x-axis according to the C C! end cap shape. The finite element model generated is composed of plate type quadrilateral shell elements on the entire vessel surface. This computational procedure can also be sued to generate grid, connectivity and material cards (bulk data) for component parts of a larger model. These bulk data are assigned to a user designated file for finite element structural/stress analysis of composite pressure vessels. The procedure accommodates filament would pressure vessels of all types of shells-of-revolution. It has provisions to readily evaluate initial stresses due to pretension in the winding filaments and residual stresses due to cure temperature.

  9. Quantification of Processing Effects on Filament Wound Pressure Vessels. Revision

    NASA Technical Reports Server (NTRS)

    Aiello, Robert A.; Chamis, Christos C.

    2002-01-01

    A computational simulation procedure is described which is designed specifically for the modeling and analysis of filament wound pressure vessels. Cylindrical vessels with spherical or elliptical end caps can be generated automatically. End caps other than spherical or elliptical may be modeled by varying circular sections along the x-axis according to the end cap shape. The finite element model generated is composed of plate type quadrilateral shell elements on the entire vessel surface. This computational procedure can also be used to generate grid, connectivity and material cards (bulk data) for component parts of a larger model. These bulk data are assigned to a user designated file for finite element structural/stress analysis of composite pressure vessels. The procedure accommodates filament wound pressure vessels of all types of shells-of -revolution. It has provisions to readily evaluate initial stresses due to pretension in the winding filaments and residual stresses due to cure temperature.

  10. Wind Energy Systems.

    ERIC Educational Resources Information Center

    Conservation and Renewable Energy Inquiry and Referral Service (DOE), Silver Spring, MD.

    During the 1920s and 1930s, millions of wind energy systems were used on farms and other locations far from utility lines. However, with passage of the Rural Electrification Act in 1939, cheap electricity was brought to rural areas. After that, the use of wind machines dramatically declined. Recently, the rapid rise in fuel prices has led to a…

  11. Perturbation growth in accreting filaments

    NASA Astrophysics Data System (ADS)

    Clarke, S. D.; Whitworth, A. P.; Hubber, D. A.

    2016-02-01

    We use smoothed particle hydrodynamic simulations to investigate the growth of perturbations in infinitely long filaments as they form and grow by accretion. The growth of these perturbations leads to filament fragmentation and the formation of cores. Most previous work on this subject has been confined to the growth and fragmentation of equilibrium filaments and has found that there exists a preferential fragmentation length scale which is roughly 4 times the filament's diameter. Our results show a more complicated dispersion relation with a series of peaks linking perturbation wavelength and growth rate. These are due to gravo-acoustic oscillations along the longitudinal axis during the sub-critical phase of growth. The positions of the peaks in growth rate have a strong dependence on both the mass accretion rate onto the filament and the temperature of the gas. When seeded with a multi-wavelength density power spectrum there exists a clear preferred core separation equal to the largest peak in the dispersion relation. Our results allow one to estimate a minimum age for a filament which is breaking up into regularly spaced fragments, as well as an average accretion rate. We apply the model to observations of filaments in Taurus by Tafalla & Hacar (2015) and find accretion rates consistent with those estimated by Palmeirim et al. (2013).

  12. Filament identification through mathematical morphology

    NASA Astrophysics Data System (ADS)

    Koch, Eric W.; Rosolowsky, Erik W.

    2015-10-01

    We present a new algorithm for detecting filamentary structure FILFINDER. The algorithm uses the techniques of mathematical morphology for filament identification, presenting a complementary approach to current algorithms which use matched filtering or critical manifolds. Unlike other methods, FILFINDER identifies filaments over a wide dynamic range in brightness. We apply the new algorithm to far-infrared imaging data of dust emission released by the Herschel Gould Belt Survey team. Our preliminary analysis characterizes both filaments and fainter striations. We find a typical filament width of 0.09 pc across the sample, but the brightness varies from cloud to cloud. Several regions show a bimodal filament brightness distribution, with the bright mode (filaments) being an order of magnitude brighter than the faint mode (striations). Using the Rolling Hough Transform, we characterize the orientations of the striations in the data, finding preferred directions that agree with magnetic field direction where data are available. There is a suggestive but noisy correlation between typical filament brightness and literature values of the star formation rates for clouds in the Gould Belt.

  13. Machine Learning.

    ERIC Educational Resources Information Center

    Kirrane, Diane E.

    1990-01-01

    As scientists seek to develop machines that can "learn," that is, solve problems by imitating the human brain, a gold mine of information on the processes of human learning is being discovered, expert systems are being improved, and human-machine interactions are being enhanced. (SK)

  14. Electric machine

    DOEpatents

    El-Refaie, Ayman Mohamed Fawzi; Reddy, Patel Bhageerath

    2012-07-17

    An interior permanent magnet electric machine is disclosed. The interior permanent magnet electric machine comprises a rotor comprising a plurality of radially placed magnets each having a proximal end and a distal end, wherein each magnet comprises a plurality of magnetic segments and at least one magnetic segment towards the distal end comprises a high resistivity magnetic material.

  15. Predicting Noise From Wind Turbines

    NASA Technical Reports Server (NTRS)

    Grosveld, Ferdinand W.

    1990-01-01

    Computer program WINDY predicts broadband noise spectra of horizontal-axis wind-turbine generators. Enables adequate assessment of impact of broadband wind-turbine noise. Effects of turbulence, trailing-edge wakes, and bluntness taken into account. Program has practical application in design and siting of wind-turbine machines acceptable to community. Written in GW-Basic.

  16. Wet Winding Improves Coil Encapsulation

    NASA Technical Reports Server (NTRS)

    Hill, A. J.

    1987-01-01

    Wet-winding process encapsulates electrical coils more uniformily than conventional processes. Process requires no vacuum pump and adapts easily to existing winding machines. Encapsulant applied to each layer of wire as soon as added to coil. Wet-winding process eliminates voids, giving more uniformly encapsulated coil.

  17. Centromeres of filamentous fungi

    PubMed Central

    Smith, Kristina M.; Galazka, Jonathan M.; Phatale, Pallavi A.; Connolly, Lanelle R.; Freitag, Michael

    2012-01-01

    How centromeres are assembled and maintained remains one of the fundamental questions in cell biology. Over the past 20 years the idea of centromeres as precise genetic loci has been replaced by the realization that it is predominantly the protein complement that defines centromere localization and function. Thus, placement and maintenance of centromeres are excellent examples of epigenetic phenomena in the strict sense. In contrast, the highly derived “point centromeres” of the budding yeast Saccharomyces cerevisiae and its close relatives are counterexamples for this general principle of centromere maintenance. While we have learned much in the past decade, it remains unclear if mechanisms for epigenetic centromere placement and maintenance are shared amongst various groups of organisms. For that reason it seems prudent to examine species from many different phylogenetic groups with the aim to extract comparative information that will yield a more complete picture of cell division in all eukaryotes. This review addresses what has been learned by studying the centromeres of filamentous fungi, a large, heterogeneous group of organisms that includes important plant, animal and human pathogens, saprobes and symbionts that fulfill essential roles in the biosphere, as well as a growing number of taxa that have become indispensable for industrial use. PMID:22752455

  18. Collisions of Vortex Filament Pairs

    NASA Astrophysics Data System (ADS)

    Banica, Valeria; Faou, Erwan; Miot, Evelyne

    2014-12-01

    We consider the problem of collisions of vortex filaments for a model introduced by Klein et al. (J Fluid Mech 288:201-248, 1995) and Zakharov (Sov Phys Usp 31(7):672-674, 1988, Lect. Notes Phys 536:369-385, 1999) to describe the interaction of almost parallel vortex filaments in three-dimensional fluids. Since the results of Crow (AIAA J 8:2172-2179, 1970) examples of collisions are searched as perturbations of antiparallel translating pairs of filaments, with initial perturbations related to the unstable mode of the linearized problem; most results are numerical calculations. In this article, we first consider a related model for the evolution of pairs of filaments, and we display another type of initial perturbation leading to collision in finite time. Moreover, we give numerical evidence that it also leads to collision through the initial model. We finally study the self-similar solutions of the model.

  19. Electron emitting filaments for electron discharge devices

    DOEpatents

    Leung, Ka-Ngo (Hercules, CA); Pincosy, Philip A. (Oakland, CA); Ehlers, Kenneth W. (Alamo, CA)

    1988-01-01

    Electrons are copiously emitted by a device comprising a loop-shaped filament made of lanthanum hexaboride. The filament is directly heated by an electrical current produced along the filament by a power supply connected to the terminal legs of the filament. To produce a filament, a diamond saw or the like is used to cut a slice from a bar made of lanthanum hexaboride. The diamond saw is then used to cut the slice into the shape of a loop which may be generally rectangular, U-shaped, hairpin-shaped, zigzag-shaped, or generally circular. The filaments provide high electron emission at a relatively low operating temperature, such as 1600.degree. C. To achieve uniform heating, the filament is formed with a cross section which is tapered between the opposite ends of the filament to compensate for non-uniform current distribution along the filament due to the emission of electrons from the filament.

  20. Electron emitting filaments for electron discharge devices

    DOEpatents

    Leung, K.N.; Pincosy, P.A.; Ehlers, K.W.

    1983-06-10

    Electrons are copiously emitted by a device comprising a loop-shaped filament made of lanthanum hexaboride. The filament is directly heated by an electrical current produced along the filament by a power supply connected to the terminal legs of the filament. To produce a filament, a diamond saw or the like is used to cut a slice from a bar made of lanthanum hexaboride. The diamond saw is then used to cut the slice into the shape of a loop which may be generally rectangular, U-shaped, hairpin-shaped, zigzag-shaped, or generally circular. The filaments provide high electron emission at a relatively low operating temperature, such as 1600/sup 0/C. To achieve uniform heating, the filament is formed with a cross section which is tapered between the opposite ends of the filament to compensate for nonuniform current distribution along the filament due to the emission of electrons from the filament.

  1. The Fluid Foil: The Seventh Simple Machine

    ERIC Educational Resources Information Center

    Mitts, Charles R.

    2012-01-01

    A simple machine does one of two things: create a mechanical advantage (lever) or change the direction of an applied force (pulley). Fluid foils are unique among simple machines because they not only change the direction of an applied force (wheel and axle); they convert fluid energy into mechanical energy (wind and Kaplan turbines) or vice versa,…

  2. The Fluid Foil: The Seventh Simple Machine

    ERIC Educational Resources Information Center

    Mitts, Charles R.

    2012-01-01

    A simple machine does one of two things: create a mechanical advantage (lever) or change the direction of an applied force (pulley). Fluid foils are unique among simple machines because they not only change the direction of an applied force (wheel and axle); they convert fluid energy into mechanical energy (wind and Kaplan turbines) or vice versa,…

  3. Wind energy conversion system

    DOEpatents

    Longrigg, Paul

    1987-01-01

    The wind energy conversion system includes a wind machine having a propeller connected to a generator of electric power, the propeller rotating the generator in response to force of an incident wind. The generator converts the power of the wind to electric power for use by an electric load. Circuitry for varying the duty factor of the generator output power is connected between the generator and the load to thereby alter a loading of the generator and the propeller by the electric load. Wind speed is sensed electro-optically to provide data of wind speed upwind of the propeller, to thereby permit tip speed ratio circuitry to operate the power control circuitry and thereby optimize the tip speed ratio by varying the loading of the propeller. Accordingly, the efficiency of the wind energy conversion system is maximized.

  4. Rotating electric machine with fluid supported parts

    DOEpatents

    Smith, Jr., Joseph L.; Kirtley, Jr., James L.

    1981-01-01

    A rotating electric machine in which the armature winding thereof and other parts are supported by a liquid to withstand the mechanical stresses applied during transient overloads and the like. In particular, a narrow gap is provided between the armature winding and the stator which supports it and this gap is filled with an externally pressurized viscous liquid. The liquid is externally pressurized sufficiently to balance the static loads on the armature winding. Transient mechanical loads which deform the armature winding alter the gap dimensions and thereby additionally pressurize the viscous liquid to oppose the armature winding deformation and more nearly uniformly to distribute the resulting mechanical stresses.

  5. Boolean gates on actin filaments

    NASA Astrophysics Data System (ADS)

    Siccardi, Stefano; Tuszynski, Jack A.; Adamatzky, Andrew

    2016-01-01

    Actin is a globular protein which forms long polar filaments in the eukaryotic cytoskeleton. Actin networks play a key role in cell mechanics and cell motility. They have also been implicated in information transmission and processing, memory and learning in neuronal cells. The actin filaments have been shown to support propagation of voltage pulses. Here we apply a coupled nonlinear transmission line model of actin filaments to study interactions between voltage pulses. To represent digital information we assign a logical TRUTH value to the presence of a voltage pulse in a given location of the actin filament, and FALSE to the pulse's absence, so that information flows along the filament with pulse transmission. When two pulses, representing Boolean values of input variables, interact, then they can facilitate or inhibit further propagation of each other. We explore this phenomenon to construct Boolean logical gates and a one-bit half-adder with interacting voltage pulses. We discuss implications of these findings on cellular process and technological applications.

  6. Buckling of Branched Cytoskeletal Filaments

    NASA Astrophysics Data System (ADS)

    Quint, D. A.; Schwarz, J. M.

    2011-03-01

    In vitro experiments of growing dendritic actin networks demonstrate reversible stress-softening at high loads, above some critical load. The transition to the stress-softening regime has been attributed to the elastic buckling of individual actin filaments. To estimate the critical load above which softening should occur, we extend the elastic theory of buckling of individual filaments embedded in a network to include the buckling of branched filaments, a signature trait of growing dendritic actin networks. Under certain assumptions, there will be approximately a seven-fold increase in the classical critical bucking load, when compared to the unbranched filament, which is entirely due to the presence of a branch. Moreover, we go beyond the classical buckling regime to investigate the effect of entropic fluctuations. The result of compressing the filament in this case leads to an increase in these fluctuations and eventually the harmonic approximation breaks down signifying the onset of the buckling transition. We compute corrections to the classical critical buckling load near this breakdown.

  7. The circulation dynamics associated with a northern Benguela upwelling filament during October 2010

    NASA Astrophysics Data System (ADS)

    Muller, Annethea A.; Mohrholz, Volker; Schmidt, Martin

    2013-07-01

    Upwelling filaments, a common feature in all the major upwelling systems, are also regularly observed in the Benguela upwelling system and are thought to provide an effective mechanism for the exchange of matter between the shelf and the open ocean. The mesoscale dynamics of a northern Benguela upwelling filament located at approximately 18.5°S were examined and the associated transport was quantified. The development of the filament was tracked using optimal interpolated SST satellite data and two transects were consequently sampled across the feature using a towed undulating CTD (ScanFish). Additional hydrographic, nutrient and biological parameters were investigated at several stations along each transect. Following 7 days of strong upwelling favorable winds, sampling coincided with a period of relative wind relaxation and the filament was presumably in a decaying state. The basic mesoscale structure of the investigated filament corresponded well to what had previously been described for filaments from other eastern boundary current systems. The cross-shore transport associated with the filament was found to be significantly greater than the integrated Ekman transport in the region. With the combination of the high resolution dataset and a MOM-4 ecosystem model the complex mesoscale flow field associated with the feature could be observed and the counterbalancing onshore transport, associated with subsurface dipole eddies, was revealed within the filament. The results further suggest that an interaction between the offshore bending of flow at the Angola-Benguela Front (ABF), the detachment of the strong poleward flow from the coast as the thermal front meanders and the observed dipole eddies may be driving filament occurrence in the region off Cape Frio.

  8. Self-assembling phospholipid filaments.

    PubMed

    Rudolph, A S; Ratna, B R; Kahn, B

    1991-07-01

    Aqueous dispersions of double-chain phospholipids spontaneously assemble into closed bilayers called vesicles (or liposomes). Although the vesicles are in general topologically spherical, cylindrical and helical liposomes have sometimes been observed. We present here video-enhanced microscopic studies of a diacetylenic phospholipid dispersed in ethanol/water, which reveal the existence of unusual bilayer morphologies. On cooling the dispersion from the isotropic phase, we have observed the formation of long (of the order of hundreds of micrometres), thin (0.2-2 microns) filaments, which fluctuate strongly. When the temperature is decreased further, the filaments rapidly retract into a mass of lipid. At constant temperature, on the other hand, the filaments transform into torus or ring-like vesicles. Such non-spherical structures have been predicted theoretically but not previously observed experimentally. PMID:2062377

  9. Workout Machine

    NASA Technical Reports Server (NTRS)

    1995-01-01

    The Orbotron is a tri-axle exercise machine patterned after a NASA training simulator for astronaut orientation in the microgravity of space. It has three orbiting rings corresponding to roll, pitch and yaw. The user is in the middle of the inner ring with the stomach remaining in the center of all axes, eliminating dizziness. Human power starts the rings spinning, unlike the NASA air-powered system. Marketed by Fantasy Factory (formerly Orbotron, Inc.), the machine can improve aerobic capacity, strength and endurance in five to seven minute workouts.

  10. Development of Nylon Based FDM Filament for Rapid Tooling Application

    NASA Astrophysics Data System (ADS)

    Singh, R.; Singh, S.

    2014-04-01

    There has been critical need for development of cost effective nylon based wire to be used as feed stock filament for fused deposition modelling (FDM) machine. But hitherto, very less work has been reported for development of alternate solution of acrylonitrile butadiene styrene (ABS) based wire which is presently used in most of FDM machines. The present research work is focused on development of nylon based wire as an alternative of ABS wire (which is to be used as feedstock filament on FDM) without changing any hardware or software of machine. For the present study aluminium oxide (Al2O3) as additive in different proportion has been used with nylon fibre. Single screw extruder was used for wire preparation and wire thus produced was tested on FDM. Mechanical properties i.e. tensile strength and percentage elongation of finally developed wire have been optimized by Taguchi L9 technique. The work represented major development in reducing cost and time in rapid tooling applications.

  11. Investigation on mechanical behavior of filament-wound CFRP tubes

    NASA Astrophysics Data System (ADS)

    Zhang, Liangquan; Li, Hui

    2011-04-01

    Firstly, two types of CFRP tubes are designed using the filament-wound forming technology. These tubes are winded by carbon fibers with a filament winding pattern of [(900/00)2]S. The compression and tensile test are also carried out to investigate the stress-strain relationship, ultimate strength and macroscopic failure mode of the former CFRP tube. The results demonstrate that the former CFRP tube has a much larger ultimate tensile stress and strain than compressive stress and strain. However, the elastic modules of CFRP tubes under tension and compression are similar and the failure mode of these CFRP tubes is brittle under compression and tension. Secondly, the stress and strain analysis method of filament-wound CFRP tube is investigated according to anisotropic elasticity theory and lamination theory of composite material. Then, the strength of carbon-fiber-reinforced plastic tubes is obtained. In addition, the comparison of theoretical analysis results and experimental results shows that the theoretical analysis results are reliable.

  12. Nonequilibrium transport in superconducting filaments

    NASA Technical Reports Server (NTRS)

    Arutyunov, K. YU.; Danilova, N. P.; Nikolaeva, A. A.

    1995-01-01

    The step-like current-voltage characteristics of highly homogeneous single-crystalline tin and indium thin filaments has been measured. The length of the samples L approximately 1 cm was much greater than the nonequilibrium quasiparticle relaxation length Lambda. It was found that the activation of a successive i-th voltage step occurs at current significantly greater than the one derived with the assumption that the phase slip centers are weakly interacting on a scale L much greater than Lambda. The observation of 'subharmonic' fine structure on the voltage-current characteristics of tin filaments confirms the hypothesis of the long-range phase slip centers interaction.

  13. Coiling of a viscous filament

    NASA Astrophysics Data System (ADS)

    Samuel, A. D. T.; Ryu, W. S.; Mahadevan, L.

    1997-11-01

    A classic demonstration of fluid buckling is a daily occurence at the breakfast table, where a continuous stream of viscous fluid (honey) is often poured onto a flat surface (toast) from a sufficient height. The thin fluid filament quickly settles into a steady state; near the surface it bends into a helical shape while simultaneously rotating about the vertical and is laid out in a regular coil. This behavior is reminiscent of the coiling of a falling flexible rope. We derive a simple scaling law that predicts the coiling frequency in terms of the filament radius and the flow rate. We also verify this scaling law with the results of experiments.

  14. Virtual filaments that mimic conventional light bulb filaments

    NASA Astrophysics Data System (ADS)

    Chaves, Julio; Munoz, Fernando; Minano, Juan Carlos; Benitez, Pablo; Parkyn, Bill; Falicoff, Waqidi; Sun, Yupin

    2004-09-01

    Conventional incandescent light bulbs have a wire filament acting as an extended light source with nearly constant intensity throughout its quasi-spherical emission pattern. Here we present a novel family of optical devices that make use of commercially available Lambertian or near-Lambertian LED light sources, in conjunction with tailored optical element bonded to the top surface of the LED. These hybrid devices can emulate the output of traditional incandescent filaments, or can be designed to produce a wide range of light output beam patterns. We call these new devices Virtual Filaments, as they can be designed to appear the same as an incandescent filament, with a similar light output pattern, and having a similar focal position above the base. These new lamps can then be used in the same applications as those they replace, thus eliminating the need to redesign or replace the original luminaire. We present several possible optical designs that can be used with a number of standard LEDs to replace standard incandescent bulbs. In one example we show a design that provides an output with near-uniform intensity across a full beam angle of 300 degrees, from a focal position 20 mm above an LED. Other major advantages of these new devices include their ability to be given sharp cutoffs, to homogenize non-uniform LED light sources and to color-mix the output of RGB LEDs.

  15. The influence of Filaments in the Private Flux Region on Divertor Power and Particle Deposition

    NASA Astrophysics Data System (ADS)

    Harrison, James

    2014-10-01

    Recent advances in imaging of the MAST divertor have revealed, for the first time, evidence for filaments in the private flux region (PFR). Detailed analysis of the image data shows 3 distinct types of fluctuations occurring within the divertor volume: highly sheared filaments in the SOL originating from the outer midplane, high frequency (>50 kHz) filaments near the separatrix of the outer divertor leg and filaments in the private flux region originating from inner divertor leg. With the need to extrapolate divertor performance from existing machines to future devices, these observations can contribute to our quantitative understanding of transport in the PFR. In particular, they suggest that transport in the PFR is, at least in part, driven by turbulence, which may not be well captured by the Eich/Wagner description of the divertor footprint, expressed in terms of exponential decay in space above the X-point and Gaussian spreading below the X-point. The PFR filaments are observed to move largely parallel with the flux surfaces in a way equivalent to a toroidal angular velocity of order 2 ×104 rad/s in H-mode, and slower by a factor of order 2 in L-mode. During their transit parallel to the flux surfaces across the PFR, the filaments eject plasma in bursts, away from the separatrix, deeper into the private flux region. Correlation analysis suggests that they are generated by processes local to the inner divertor leg, as there is a weak correlation between fluctuations in the SOL and PFR above what is expected from line integration effects. Scaling of filament properties with machine operating parameters, such as plasma current, density and auxiliary heating power will be presented, together with a comparison with data from divertor Langmuir probes and IR thermography to estimate the role PFR filaments play in determining the width of the divertor footprint.

  16. Wacky Machines

    ERIC Educational Resources Information Center

    Fendrich, Jean

    2002-01-01

    Collectors everywhere know that local antique shops and flea markets are treasure troves just waiting to be plundered. Science teachers might take a hint from these hobbyists, for the next community yard sale might be a repository of old, quirky items that are just the things to get students thinking about simple machines. By introducing some…

  17. Fatigue testing of low-cost fiberglass composite wind turbine blade materials

    NASA Astrophysics Data System (ADS)

    Hofer, K. E.; Bennett, L. C.

    1981-11-01

    The static and fatigue behavior of transverse filament tape (TFT) fiberglass/epoxy and TFT/polyester composites was established by the testing of specimens cut from panels fabricated by a filament winding process used for the construction of large experimental wind turbine blades.

  18. Fatigue testing of low-cost fiberglass composite wind turbine blade materials

    NASA Technical Reports Server (NTRS)

    Hofer, K. E.; Bennett, L. C.

    1981-01-01

    The static and fatigue behavior of transverse filament tape (TFT) fiberglass/epoxy and TFT/polyester composites was established by the testing of specimens cut from panels fabricated by a filament winding process used for the construction of large experimental wind turbine blades.

  19. The effect of L mode filaments on divertor heat flux profiles as measured by infrared thermography on MAST

    NASA Astrophysics Data System (ADS)

    Thornton, A. J.; Fishpool, G.; Kirk, A.; the MAST Team; the EUROfusion MST1 Team

    2015-11-01

    Filamentary transport across the scrape off layer is a key issue for the design and operation of future devices, such as ITER, DEMO and MAST-U, as it sets the power loadings to the divertor and first wall of the machine. Analysis has been performed on L mode filaments in MAST in order to gain an understanding of the spatial structure and attempt to reconcile the different scales of the filament width and the power fall off length ({λq} ). The L mode filament heat flux arriving at the divertor has been measured using high spatial resolution (1.5 mm) infrared (IR) thermography. The filaments form discrete spiral patterns at the divertor which can be seen as bands of increased heat flux in the IR measurements. Analysis of the width and spacing of these bands at the divertor has allowed the toroidal mode number of the filaments to be determined (7≤slant n≤slant 22 ). The size of the filaments at the midplane has been determined using the target filament radial width and the magnetic field geometry. The filament width perpendicular to the magnetic field at the midplane has been found to be between 3 and 5 cm. Direct calculation of the filament width from midplane visible imaging gives a range of 4-6 cm which agrees well with the IR data.

  20. Brownian microhydrodynamics of active filaments.

    PubMed

    Laskar, Abhrajit; Adhikari, R

    2015-12-21

    Slender bodies capable of spontaneous motion in the absence of external actuation in an otherwise quiescent fluid are common in biological, physical and technological contexts. The interplay between the spontaneous fluid flow, Brownian motion, and the elasticity of the body presents a challenging fluid-structure interaction problem. Here, we model this problem by approximating the slender body as an elastic filament that can impose non-equilibrium velocities or stresses at the fluid-structure interface. We derive equations of motion for such an active filament by enforcing momentum conservation in the fluid-structure interaction and assuming slow viscous flow in the fluid. The fluid-structure interaction is obtained, to any desired degree of accuracy, through the solution of an integral equation. A simplified form of the equations of motion, which allows for efficient numerical solutions, is obtained by applying the Kirkwood-Riseman superposition approximation to the integral equation. We use this form of equation of motion to study dynamical steady states in free and hinged minimally active filaments. Our model provides the foundation to study collective phenomena in momentum-conserving, Brownian, active filament suspensions. PMID:26497658

  1. ESCRT Filaments as Spiral Springs.

    PubMed

    Carlson, Lars-Anders; Shen, Qing-Tao; Pavlin, Mark Remec; Hurley, James H

    2015-11-23

    In a recent issue of Cell, Chiaruttini et al. (2015) reveal the mechanical properties of the mysterious spiral filaments formed by the yeast ESCRT-III protein Snf7. The spirals are shown to be springs whose bending drives membrane deformation and perhaps membrane scission. PMID:26609952

  2. Fixed pitch wind turbines

    NASA Technical Reports Server (NTRS)

    Fenn, D. B.; Viterna, L. A.

    1978-01-01

    Wind turbines designed for fixed pitch operation offer potential reductions in the cost of the machine by eliminating many costly components. It was shown that a rotor can be designed which produces the same energy annually as Mod-0 but which regulates its power automatically by progressively stalling the blades as wind speed increases. Effects of blade twist, taper, root cutout, and airfoil shape on performance are discussed as well as various starting technqiues.

  3. Protecting wind access: a preliminary assessment

    SciTech Connect

    Noun, R.J.

    1983-06-01

    Identifying suitable sites for large wind machine clusters, or wind farms, requires more than finding a location with an adequate wind resource. Consideration must also be given to the question of how land-use policies and regulations will affect the siting of wind system installations. In particular, the issue of acquiring wind rights, or guaranteed access to the wind resource for electric power generation, will be vital to the development of wind energy. This paper examines several methods for acquiring and preserving access to the wind resource and for dealing with related land-use issues.

  4. Protecting wind access: a preliminary assessment

    SciTech Connect

    Noun, R.J.; Perkins-Smith, D.

    1982-06-01

    Identifying suitable sites for large wind machine clusters, or wind farms, requires more than finding a location with an adequate wind resource. Consideration must also be given to the question of how land-use policies and regulations will affect the siting of wind system installations. In particular, the issue of acquiring wind rights, or guaranteed access to the wind resource for electric power generation, will be vital to the development of wind energy. Several methods for acquiring and preserving access to the wind resource and for dealing with related land-use issues are examined.

  5. Numerical simulation of vortex breakdown by the vortex-filament method

    NASA Technical Reports Server (NTRS)

    Nakamura, Y.; Leonard, A.; Spalart, P. R.

    1983-01-01

    The vortex filament method was applied to the simulation of vortex breakdown. The principal vortex region was represented by multiple filaments, and an axial velocity component was induced by a spiral winding of the filaments. First, an accuracy check was performed for a cylindrical swirling flow with simple analytical expressions for the axial and theta velocities. The result suggests that the flow field is simulated to any accuracy by increasing the number of filaments. Second, an axisymmetric type vortex breakdown was simulated, with experimental data serving as upstream conditions. The calculated axial and theta velocity contours show the breakdown of the vortex, including a rapid change in the vortex core, followed axially by a recovery zone and then a second breakdown. When three dimensional initial data are used the second breakdown appears to be of the spiral type in correspondence with experimental observations. The present method is easily used to simulate other types of vortex breakdown or other vortex flows with axial velocity.

  6. Diamond film by hot filament CVD method

    NASA Technical Reports Server (NTRS)

    Hirose, Y.

    1988-01-01

    Diamond synthesis by the hot filament CVD method is discussed. A hot filament decomposes gas mixtures and oxygen containing organic compounds such as alcohols. which are carbon sources. The resulting thin films, growth mechanisms, and characteristics and problems associated with the hot filament CVD method are analyzed and evaluated.

  7. Wind Fins: Novel Lower-Cost Wind Power System

    SciTech Connect

    David C. Morris; Dr. Will D. Swearingen

    2007-10-08

    This project evaluated the technical feasibility of converting energy from the wind with a novel “wind fin” approach. This patent-pending technology has three major components: (1) a mast, (2) a vertical, hinged wind structure or fin, and (3) a power takeoff system. The wing structure responds to the wind with an oscillating motion, generating power. The overall project goal was to determine the basic technical feasibility of the wind fin technology. Specific objectives were the following: (1) to determine the wind energy-conversion performance of the wind fin and the degree to which its performance could be enhanced through basic design improvements; (2) to determine how best to design the wind fin system to survive extreme winds; (3) to determine the cost-effectiveness of the best wind fin designs compared to state-of-the-art wind turbines; and (4) to develop conclusions about the overall technical feasibility of the wind fin system. Project work involved extensive computer modeling, wind-tunnel testing with small models, and testing of bench-scale models in a wind tunnel and outdoors in the wind. This project determined that the wind fin approach is technically feasible and likely to be commercially viable. Project results suggest that this new technology has the potential to harvest wind energy at approximately half the system cost of wind turbines in the 10kW range. Overall, the project demonstrated that the wind fin technology has the potential to increase the economic viability of small wind-power generation. In addition, it has the potential to eliminate lethality to birds and bats, overcome public objections to the aesthetics of wind-power machines, and significantly expand wind-power’s contribution to the national energy supply.

  8. Generation of the Cape Ghir upwelling filament: A numerical study

    NASA Astrophysics Data System (ADS)

    Troupin, Charles; Mason, Evan; Beckers, Jean-Marie; Sangrà, Pablo

    Filaments are narrow, shallow structures of cool water originating from the coast. They are typical features of the four main eastern boundary upwelling systems (EBUS). In spite of their significant biological and chemical roles, through the offshore exportation of nutrient-rich waters, the physical processes that generate them are still not completely understood. This paper is a process-oriented study of filament generation mechanisms. Our goal is twofold: firstly, to obtain a numerical solution able to correctly represent the characteristics of the filament off Cape Ghir (30°38'N, northwest Africa) in the Canary EBUS and secondly, to explain its formation by a simple mechanism based on the balance of potential vorticity. The first goal is achieved by the use of the ROMS model (Regional Ocean Modeling System) with embedded domains around Cape Ghir, with a horizontal resolution going up to 1.5 km for the finest domain. The latter gets its initial and boundary conditions from a parent solution and is forced by climatological, high-resolution atmospheric fields. The modeled filaments display spatial, temporal and physical characteristics in agreement with the available in situ and satellite observations. This model solution is used as a reference to compare the results with a set of process-oriented experiments. These experiments allow us to reach the second objective. The solutions serve to highlight the contributions of various processes on the filament generation. Since the study is focused on general processes present under climatological forcing conditions, inter-annual forcing is not necessary. The underlying idea for the filament generation is the balance of potential vorticity in the Canary EBUS: the upwelling jet is characterized by negative relative vorticity and flows southward along a narrow band of uniform potential vorticity. In the vicinity of the cape, an injection of relative vorticity induced by the wind breaks the existing vorticity balance. The upwelling jet is prevented from continuing its way southward and has to turn offshore to follow lines of equal potential vorticity. The model results highlight the essential role of wind, associated with the particular topography (coastline and bottom) around the cape. The mechanism presented here is general and thus can be applied to other EBUS.

  9. Charging machine

    DOEpatents

    Medlin, John B.

    1976-05-25

    A charging machine for loading fuel slugs into the process tubes of a nuclear reactor includes a tubular housing connected to the process tube, a charging trough connected to the other end of the tubular housing, a device for loading the charging trough with a group of fuel slugs, means for equalizing the coolant pressure in the charging trough with the pressure in the process tubes, means for pushing the group of fuel slugs into the process tube and a latch and a seal engaging the last object in the group of fuel slugs to prevent the fuel slugs from being ejected from the process tube when the pusher is removed and to prevent pressure liquid from entering the charging machine.

  10. Fullerene Machines

    NASA Technical Reports Server (NTRS)

    Globus, Al; Saini, Subhash (Technical Monitor)

    1998-01-01

    Fullerenes possess remarkable properties and many investigators have examined the mechanical, electronic and other characteristics of carbon SP2 systems in some detail. In addition, C-60 can be functionalized with many classes of molecular fragments and we may expect the caps of carbon nanotubes to have a similar chemistry. Finally, carbon nanotubes have been attached to t he end of scanning probe microscope (Spill) tips. Spills can be manipulated with sub-angstrom accuracy. Together, these investigations suggest that complex molecular machines made of fullerenes may someday be created and manipulated with very high accuracy. We have studied some such systems computationally (primarily functionalized carbon nanotube gears and computer components). If such machines can be combined appropriately, a class of materials may be created that can sense their environment, calculate a response, and act. The implications of such hypothetical materials are substantial.

  11. Fullerene Machines

    NASA Technical Reports Server (NTRS)

    Globus, Al; Saini, Subhash

    1998-01-01

    Recent computational efforts at NASA Ames Research Center and computation and experiment elsewhere suggest that a nanotechnology of machine phase functionalized fullerenes may be synthetically accessible and of great interest. We have computationally demonstrated that molecular gears fashioned from (14,0) single-walled carbon nanotubes and benzyne teeth should operate well at 50-100 gigahertz. Preliminary results suggest that these gears can be cooled by a helium atmosphere and a laser motor can power fullerene gears if a positive and negative charge have been added to form a dipole. In addition, we have unproven concepts based on experimental and computational evidence for support structures, computer control, a system architecture, a variety of components, and manufacture. Combining fullerene machines with the remarkable mechanical properties of carbon nanotubes, there is some reason to believe that a focused effort to develop fullerene nanotechnology could yield materials with tremendous properties.

  12. The state of wind energy development overseas

    SciTech Connect

    Divone, L.V.

    1983-06-01

    A brief ''grand tour'' of current wind machine development overseas is given. The International Energy Agency Agreement on Wind Energy R and D of 1978 and the IEA for Cooperation on Large Scale wind energy systems are outlined. Several examples of small machines in Denmark and Sweden are shown. The high technology approach of Germany features the 100 meter diameter Growian I, the largest windmill yet built, in Bremerhaven, on the North Sea. Development in the UK and Canada are also touched upon.

  13. Galaxy pairs align with Galactic filaments

    NASA Astrophysics Data System (ADS)

    Tempel, E.; Tamm, A.

    2015-04-01

    Context. Gravitational collapse theory and numerical simulations suggest that the velocity field within large-scale galaxy filaments is dominated by motions along the filaments. Aims: Our aim is to check whether observational data reveal any preferred orientation of galaxy pairs with respect to the underlying filaments as a result of the expectedly anisotropic velocity field. Methods: We use galaxy pairs and galaxy filaments identified from Sloan Digital Sky Survey data. For filament extraction, we use the Bisous model that is based on the marked point process technique. During the filament detection, we use the centre point of each pair instead of the positions of galaxies to avoid a built-in influence of pair orientation on the filament construction. For pairs lying within filaments (3012 cases), we calculate the angle between the line connecting the galaxies of each pair and their host filaments. To avoid redshift-space distortions, the angle is measured in the plane of the sky. Results: The alignment analysis shows that the orientation of galaxy pairs correlates strongly with their host filaments. The alignment signal is stronger for loose pairs, with at least 25% excess of aligned pairs compared to a random distribution. The alignment of galaxy pairs and filaments measured from the observational data is in good agreement with the alignment in the Millennium simulation and thus provides support to the ?CDM formalism.

  14. Partial Slingshot Reconnection between Two Filaments

    NASA Astrophysics Data System (ADS)

    Jiang, Yunchun; Hong, Junchao; Yang, Jiayan; Bi, Yi; Zheng, Ruisheng; Yang, Bo; Li, Haidong; Yang, Dan

    2013-02-01

    We present a rare observation of an interaction between two filaments around AR 11358 and AR 11361 on 2011 December 3 that is strongly suggestive of the occurrence of slingshot reconnection. A small elbow-shaped active-region filament (F12) underwent a failed eruption that brought it into contact with a nearby larger, thicker filament (F34). Accompanied by the appearance of complicated internal structures below the erupting F12, its two legs separated away from each other and then connected into F34. This process led the filaments to change their connectivity to form two newly linked filaments, and one of them showed a clear inverse ?-shape. However, the alteration in the filament connectivity was imperfect since F34 is discernible after the eruption. These observations can be interpreted as a partial slingshot reconnection between two filaments that had unequal axial magnetic flux.

  15. PARTIAL SLINGSHOT RECONNECTION BETWEEN TWO FILAMENTS

    SciTech Connect

    Jiang, Yunchun; Hong, Junchao; Yang, Jiayan; Bi, Yi; Zheng, Ruisheng; Yang, Bo; Li, Haidong; Yang, Dan

    2013-02-10

    We present a rare observation of an interaction between two filaments around AR 11358 and AR 11361 on 2011 December 3 that is strongly suggestive of the occurrence of slingshot reconnection. A small elbow-shaped active-region filament (F12) underwent a failed eruption that brought it into contact with a nearby larger, thicker filament (F34). Accompanied by the appearance of complicated internal structures below the erupting F12, its two legs separated away from each other and then connected into F34. This process led the filaments to change their connectivity to form two newly linked filaments, and one of them showed a clear inverse {gamma}-shape. However, the alteration in the filament connectivity was imperfect since F34 is discernible after the eruption. These observations can be interpreted as a partial slingshot reconnection between two filaments that had unequal axial magnetic flux.

  16. The stability of viscous liquid filaments

    NASA Astrophysics Data System (ADS)

    Driessen, Theo; Jeurissen, Roger; Wijshoff, Herman; Lohse, Detlef

    2012-11-01

    The stability of liquid filaments is relevant both in industrial applications, such as inkjet printing and atomization, and in nature, where the stability of filaments has a large influence on the final drop size distribution of rain droplets and waterfalls. The liquid filament may either stably collapse into a single droplet, or break up into multiple droplets. Which scenario is realized depends on the viscosity and the aspect ratio of the filament. Here we study the collapse of an axisymmetric liquid filament is analytically and with a numerical model. We find that a long, high viscous filament can only break up due to the Rayleigh-Plateau instability, whereas a low viscous filament can break up due to end-pinching. The theory shows quantitative agreement with recent experimental findings by Castréjon-Pita et al., PRL 108, 074506 (2012).

  17. Filamentation as primitive growth mode?

    PubMed

    Bigan, Erwan; Steyaert, Jean-Marc; Douady, Stéphane

    2015-01-01

    Osmotic pressure influences cellular shape. In a growing cell, chemical reactions and dilution induce changes in osmolarity, which in turn influence the cellular shape. Using a protocell model relying upon random conservative chemical reaction networks with arbitrary stoichiometry, we find that when the membrane is so flexible that its shape adjusts itself quasi-instantaneously to balance the osmotic pressure, the protocell either grows filamentous or fails to grow. This behavior is consistent with a mathematical proof. This suggests that filamentation may be a primitive growth mode resulting from the simple physical property of balanced osmotic pressure. We also find that growth is favored if some chemical species are only present inside the protocell, but not in the outside growth medium. Such an insulation requires specific chemical schemes. Modern evolved cells such as E. coli meet these requirements through active transport mechanisms such as the phosphotransferase system. PMID:26718101

  18. UNUSUAL FILAMENTS INSIDE THE UMBRA

    SciTech Connect

    Kleint, L.

    2013-06-10

    We analyze several unusual filamentary structures which appeared in the umbra of one of the sunspots in AR 11302. They do not resemble typical light bridges in morphology or in evolution. We analyze data from SDO/HMI to investigate their temporal evolution, Hinode/SP for photospheric inversions, IBIS for chromospheric imaging, and SDO/AIA for the overlying corona. Photospheric inversions reveal a horizontal, inverse Evershed flow along these structures, which we call umbral filaments. Chromospheric images show brightenings and energy dissipation, while coronal images indicate that bright coronal loops seem to end in these umbral filaments. These rapidly evolving features do not seem to be common, and are possibly related to the high flare-productivity of the active region. Their analysis could help to understand the complex evolution of active regions.

  19. Current filaments in magnetized plasmas

    NASA Astrophysics Data System (ADS)

    Vianello, N.; Spolaore, M.; Martines, E.; Agostini, M.; Cavazzana, R.; Scarin, P.; Zuin, M.; Naulin, V.; Rasmussen, J. J.; Schrittwieser, R.; Ionita, C.; Müller, H. W.; Rohde, V.; Furno, I.; Theiler, C.

    2010-11-01

    We present direct experimental evidence of the presence of filamentary current structures in turbulent magnetized plasmas. Experiments have been performed in different devices. In the the reversed field pinch RFX-mod device, small scales turbulent intermittent structures, have been interpreted as Drift-Kinetic Alfén vortices, resulting from the non-linear coupling of drift and Kinetic Alfvén waves, with a bipolar current filaments associated to a vorticity perturbation. In thee ASDEX Upgrade tokamak evidences of monopolar current filaments travelling in the SOL, have been observed in correspondance with type-I ELMs. An evaluation of the current carried by individual ELMs is presented. Finally preliminary direct measurements of the 2D structure of the blob-induced parallel current using magnetic probes, as obtain in the simple magnetized plasma TORPEX, will be presented.

  20. Filamentation as primitive growth mode?

    NASA Astrophysics Data System (ADS)

    Bigan, Erwan; Steyaert, Jean-Marc; Douady, Stéphane

    2015-12-01

    Osmotic pressure influences cellular shape. In a growing cell, chemical reactions and dilution induce changes in osmolarity, which in turn influence the cellular shape. Using a protocell model relying upon random conservative chemical reaction networks with arbitrary stoichiometry, we find that when the membrane is so flexible that its shape adjusts itself quasi-instantaneously to balance the osmotic pressure, the protocell either grows filamentous or fails to grow. This behavior is consistent with a mathematical proof. This suggests that filamentation may be a primitive growth mode resulting from the simple physical property of balanced osmotic pressure. We also find that growth is favored if some chemical species are only present inside the protocell, but not in the outside growth medium. Such an insulation requires specific chemical schemes. Modern evolved cells such as E. coli meet these requirements through active transport mechanisms such as the phosphotransferase system.

  1. Filament wound rocket motor chambers

    NASA Technical Reports Server (NTRS)

    1976-01-01

    The design, analysis, fabrication and testing of a Kevlar-49/HBRF-55A filament wound chamber is reported. The chamber was fabricated and successfully tested to 80% of the design burst pressure. Results of the data reduction and analysis from the hydrotest indicate that the chamber design and fabrication techniques used for the chamber were adequate and the chamber should perform adequately in a static test.

  2. Mechanics of vimentin intermediate filaments

    NASA Technical Reports Server (NTRS)

    Wang, Ning; Stamenovic, Dimitrijie

    2002-01-01

    It is increasingly evident that the cytoskeleton of living cells plays important roles in mechanical and biological functions of the cells. Here we focus on the contribution of intermediate filaments (IFs) to the mechanical behaviors of living cells. Vimentin, a major structural component of IFs in many cell types, is shown to play an important role in vital mechanical and biological functions such as cell contractility, migration, stiffness, stiffening, and proliferation.

  3. Lighting the universe with filaments.

    PubMed

    Gao, Liang; Theuns, Tom

    2007-09-14

    The first stars in the universe form when chemically pristine gas heats as it falls into dark-matter potential wells, cools radiatively because of the formation of molecular hydrogen, and becomes self-gravitating. Using supercomputer simulations, we demonstrated that the stars' properties depend critically on the currently unknown nature of the dark matter. If the dark-matter particles have intrinsic velocities that wipe out small-scale structure, then the first stars form in filaments with lengths on the order of the free-streaming scale, which can be approximately 10(20) meters (approximately 3 kiloparsecs, corresponding to a baryonic mass of approximately 10(7) solar masses) for realistic "warm dark matter" candidates. Fragmentation of the filaments forms stars with a range of masses, which may explain the observed peculiar element abundance pattern of extremely metal-poor stars, whereas coalescence of fragments and stars during the filament's ultimate collapse may seed the supermassive black holes that lurk in the centers of most massive galaxies. PMID:17872439

  4. TEMPO machine

    SciTech Connect

    Rohwein, G.J.; Lancaster, K.T.; Lawson, R.N.

    1986-06-01

    TEMPO is a transformer powered megavolt pulse generator with an output pulse of 100 ns duration. The machine was designed for burst mode operation at pulse repetition rates up to 10 Hz with minimum pulse-to-pulse voltage variations. To meet the requirement for pulse duration a nd a 20-..omega.. output impedance within reasonable size constraints, the pulse forming transmission line was designed as two parallel water-insulated, strip-type Blumleins. Stray capacitance and electric fields along the edges of the line elements were controlled by lining the tank with plastic sheet.

  5. Tunneling machine

    SciTech Connect

    Snyder, L.L.

    1980-02-19

    A diametrically compact tunneling machine for boring tunnels is disclosed. The machine includes a tubular support frame having a hollow piston mounted therein which is movable from a retracted position in the support frame to an extended position. A drive shaft is rotatably mounted in the hollow piston and carries a cutter head at one end. The hollow piston is restrained against rotational movement relative to the support frame and the drive shaft is constrained against longitudinal movement relative to the hollow piston. A plurality of radially extendible feet project from the support frame to the tunnel wall to grip the tunnel wall during a tunneling operation wherein the hollow piston is driven forwardly so that the cutter head works on the tunnel face. When the hollow piston is fully extended, a plurality of extendible support feet, which are fixed to the rearward and forward ends of the hollow piston, are extended, the radially extendible feet are retracted and the support frame is shifted forwardly by the piston so that a further tunneling operation may be initiated.

  6. Mechanical properties of branched actin filaments.

    PubMed

    Razbin, Mohammadhosein; Falcke, Martin; Benetatos, Panayotis; Zippelius, Annette

    2015-07-01

    Cells moving on a two dimensional substrate generate motion by polymerizing actin filament networks inside a flat membrane protrusion. New filaments are generated by branching off existing ones, giving rise to branched network structures. We investigate the force-extension relation of branched filaments, grafted on an elastic structure at one end and pushing with the free ends against the leading edge cell membrane. Single filaments are modeled as worm-like chains, whose thermal bending fluctuations are restricted by the leading edge cell membrane, resulting in an effective force. Branching can increase the stiffness considerably; however the effect depends on branch point position and filament orientation, being most pronounced for intermediate tilt angles and intermediate branch point positions. We describe filament networks without cross-linkers to focus on the effect of branching. We use randomly positioned branch points, as generated in the process of treadmilling, and orientation distributions as measured in lamellipodia. These networks reproduce both the weak and strong force response of lamellipodia as measured in force-velocity experiments. We compare properties of branched and unbranched networks. The ratio of the network average of the force per branched filament to the average force per unbranched filament depends on the orientation distribution of the filaments. The ratio exhibits compression dependence and may go up to about 4.5 in networks with a narrow orientation distribution. With orientation distributions measured in lamellipodia, it is about two and essentially independent from network compression, graft elasticity and filament persistence length. PMID:26040560

  7. Mechanical properties of branched actin filaments

    NASA Astrophysics Data System (ADS)

    Razbin, Mohammadhosein; Falcke, Martin; Benetatos, Panayotis; Zippelius, Annette

    2015-07-01

    Cells moving on a two dimensional substrate generate motion by polymerizing actin filament networks inside a flat membrane protrusion. New filaments are generated by branching off existing ones, giving rise to branched network structures. We investigate the force-extension relation of branched filaments, grafted on an elastic structure at one end and pushing with the free ends against the leading edge cell membrane. Single filaments are modeled as worm-like chains, whose thermal bending fluctuations are restricted by the leading edge cell membrane, resulting in an effective force. Branching can increase the stiffness considerably; however the effect depends on branch point position and filament orientation, being most pronounced for intermediate tilt angles and intermediate branch point positions. We describe filament networks without cross-linkers to focus on the effect of branching. We use randomly positioned branch points, as generated in the process of treadmilling, and orientation distributions as measured in lamellipodia. These networks reproduce both the weak and strong force response of lamellipodia as measured in force-velocity experiments. We compare properties of branched and unbranched networks. The ratio of the network average of the force per branched filament to the average force per unbranched filament depends on the orientation distribution of the filaments. The ratio exhibits compression dependence and may go up to about 4.5 in networks with a narrow orientation distribution. With orientation distributions measured in lamellipodia, it is about two and essentially independent from network compression, graft elasticity and filament persistence length.

  8. Impact of submesoscale processes on dynamics of phytoplankton filaments

    NASA Astrophysics Data System (ADS)

    Shulman, Igor; Penta, Bradley; Richman, James; Jacobs, Gregg; Anderson, Stephanie; Sakalaukus, Peter

    2015-03-01

    In Monterey Bay, CA, during northwesterly, upwelling favorable winds, the development of a southward flowing cold jet along the entrance to the Bay is often observed. This dense cold jet separates warm waters of the anticyclonic circulation offshore from the water masses inside the Bay. Interactions between the cold jet and the offshore anticyclonic circulation generate ageostrophic secondary circulation (ASC) cells due to submesoscale processes as, for example, flow interaction with the development of surface frontogenesis and nonlinear Ekman pumping. Based on observations and modeling studies, we evaluate the impact of these submesoscale processes on the formation of chlorophyll a filaments during late spring-earlier summer, and late summer time frames. We show that during the late summer time frame, ASC leads to the development of filaments with high values of chlorophyll a concentration along the edge of the cold jet-in contrast to the earlier summer time, when the ASC mixes phytoplankton much deeper to the area below of the euphotic depth, and chlorophyll a filaments are 3-4 times weaker.

  9. Generalization of Filament Braiding Model for Amyloid Fibril Assembly

    NASA Astrophysics Data System (ADS)

    Pope, Maighdlin; Ionescu-Zanetti, Cristian; Khurana, Ritu; Carter, Sue

    2001-03-01

    Research into the formation of amyloid fibrils is motivated by their association with several prominent diseases, among these Alzheimer's Disease, Parkinson's Disease and amyloidosis. Previous work in monitering the aggregation of immunoglobulin light chains to form amyloid fibrils suggests a braided structure where filaments and protofibrils wind together to form Type I and Type II fibrils. Non-contact atomic force microscopy is used to image and explore the kinetics of several other amyloid fibril forming proteins in an effort to generalize the filament braiding model. Included in this study are insulin and the B1 domain of G. Both of these have been shown to form fibrils in vitro. Alpha-synuclein is also included in this study. It is involved in the formation of Lewy bodies in Parkinson's Disease. The fourth protein used in this comparitive study is human amylin that is the cause of a systemic amyloidosis. Results from these four proteins and their associated fibrils are compared to the Ig light chain fibril structure in an effort to show the universality of the filament braiding model.

  10. Disappearing solar filaments: A useful predictor of geomagnetic activity

    SciTech Connect

    Joselyn, J.A.; McIntosh, P.S.

    1981-06-01

    Disappearing solar filaments have long been suspected as an indicator of terrestrial magnetic disturbances. However, because filament disappearances are a common solar event and because they failed as a candidate source for M region (recurrent) magnetic disturbances, their potential utility as a forecasting aid for geomagnetic storms has largely been neglected. A search for possible solar sources of geomagnetic storms from June 1976 through June 1979 has revealed that a significant number of the storms, including the two largest, can only be associated with filament disappearances. This result is supported by the many recent papers studying SKYLAB and other observations of coronal transients which always find a strong correlation between those transients and eruptive prominences. By analyzing the physical characteristics of those disapearances which procede magnetic storms and those which do not, some tentative guidelines for forecasting geomagnetic disturbances have been developed based on evidence of a significant restructuring of the implied coronal magnetic field which could release solar wind plasma favorably positioned to impact the earth.

  11. Diagnosis of femtosecond plasma filament by channeling microwaves along the filament

    NASA Astrophysics Data System (ADS)

    Alshershby, Mostafa; Ren, Yu; Qin, Jiang; Hao, Zuoqiang; Lin, Jingquan

    2013-05-01

    We introduce a simple, fast, and non-intrusive experimental method to obtain the basic parameters of femtosecond laser-generated plasma filament. The method is based on the channeling of microwaves along both a plasma filament and a well-defined conducting wire. By comparing the detected microwaves that propagate along the plasma filament and a copper wire with known conductivity and spatial dimension, the basic parameters of the plasma filament can be easily obtained. As a result of the possibility of channeling microwave radiation along the plasma filament, we were then able to obtain the plasma density distribution along the filament length.

  12. A penny-shaped crack in a filament reinforced matrix. 1: The filament model

    NASA Technical Reports Server (NTRS)

    Erdogan, F.; Pacella, A. H.

    1973-01-01

    The electrostatic problem of a penny-shaped crack in an elastic matrix which reinforced by filaments or fibers perpendicular to the plane of the crack was studied. The elastic filament model was developed for application to evaluation studies of the stress intensity factor along the periphery of the crack, the stresses in the filaments or fibers, and the interface shear between the matrix and the filaments or fibers. The requirements expected of the model are a sufficiently accurate representation of the filament and applicability to the interaction problems involving a cracked elastic continuum with multi-filament reinforcements. The technique for developing the model and numerical examples of it are shown.

  13. Diagnosis of femtosecond plasma filament by channeling microwaves along the filament

    SciTech Connect

    Alshershby, Mostafa; Ren, Yu; Qin, Jiang; Hao, Zuoqiang; Lin, Jingquan

    2013-05-20

    We introduce a simple, fast, and non-intrusive experimental method to obtain the basic parameters of femtosecond laser-generated plasma filament. The method is based on the channeling of microwaves along both a plasma filament and a well-defined conducting wire. By comparing the detected microwaves that propagate along the plasma filament and a copper wire with known conductivity and spatial dimension, the basic parameters of the plasma filament can be easily obtained. As a result of the possibility of channeling microwave radiation along the plasma filament, we were then able to obtain the plasma density distribution along the filament length.

  14. Are the satellite-observed narrow, streaky chlorophyll filaments locally intensified by the submesoscale processes?

    NASA Astrophysics Data System (ADS)

    Shulman, Igor; Penta, Bradley; Richman, James; Jacobs, Gregg; Anderson, Stephanie; Sakalaukus, Peter

    2015-05-01

    Based on observations and modeling studies we have evaluated the impact of submesoscale processes on the development and intensification of offshore narrow (5-10km wide) phytoplankton filaments during summer time in the Monterey Bay, CA. We have demonstrated that, submesoscale processes (surface frontogenesis and nonlinear Ekman transport) lead to the development of very productive phytoplankton patches along the edges between the cold jet and warm anticyclonic eddy. Our results illustrate that during persistent upwelling favorable winds, submesoscale processes can modulate the development and intensification of offshore narrow (5-10km wide) phytoplankton filaments. These processes can incubate the phytoplankton population offshore (as for example, bioluminescent dinoflagellates during August 2003). These offshore phytoplankton filaments can migrate onshore during relaxed winds following the upwelling, and be an additional source of phytoplankton bloom development in and around Monterey Bay. Therefore, the discussed offshore phytoplankton filaments may be a factor in the Bay ecosystem health, as for example, in the development of such events as harmful algae blooms (HABs). All these emphasize the importance of further observational and modeling studies of these submesoscale processes which impact the development and intensification of offshore phytoplankton filaments.

  15. Apparatus for cooling an electric machine

    SciTech Connect

    Palafox, Pepe; Gerstler, William Dwight; Shen, Xiaochun; El-Refaie, Ayman Mohamed Fawzi; Lokhandwalla, Murtuza; Salasoo, Lembit

    2013-07-16

    Provided is an apparatus, for example, for use with a rotating electric machine, that includes a housing. The housing can include a housing main portion and a housing end portion. The housing main portion can be configured to be disposed proximal to a body portion of a stator section of an electric machine. The housing main portion can define a main fluid channel that is configured to conduct fluid therethrough. The housing end portion can receive fluid from said main fluid channel and direct fluid into contact with a winding end portion of a conductive winding of the stator section.

  16. Design, fabrication, and test of a composite material wind turbine rotor blade

    NASA Technical Reports Server (NTRS)

    Griffee, D. G., Jr.; Gustafson, R. E.; More, E. R.

    1977-01-01

    The aerodynamic design, structural design, fabrication, and structural testing is described for a 60 foot long filament wound, fiberglass/epoxy resin matrix wind turbine rotor blade for a 125 foot diameter, 100 kW wind energy conversion system. One blade was fabricated which met all aerodynamic shape requirements and was structurally capable of operating under all specified design conditions. The feasibility of filament winding large rotor blades was demonstrated.

  17. The Geography of Wind Energy: Problem Solving Activities.

    ERIC Educational Resources Information Center

    Lahart, David E.; Allen, Rodney F.

    1985-01-01

    Today there are many attempts to use wind machines to confront the increasing costs of electricity. Described are activities to help secondary students understand wind energy, its distribution, applications, and limitations. (RM)

  18. Filament formation and evolution in buoyant coastal waters: Observation and modelling

    NASA Astrophysics Data System (ADS)

    Iermano, Ilaria; Liguori, Giovanni; Iudicone, Daniele; Buongiorno Nardelli, Bruno; Colella, Simone; Zingone, Adriana; Saggiomo, Vincenzo; Ribera d'Alcalà, Maurizio

    2012-11-01

    This paper presents a detailed analysis of the formation and subsequent evolution of filament-like structures observed in a relatively small area of the mid-Tyrrhenian Sea (Mediterranean Sea). The filament dynamics and potential impact on the cross-shelf exchange budget are investigated based on a combined use of remote sensing imagery, in situ data and numerical modelling. The complexity of these phenomena is shown by focusing on four distinct events that led to cross-shelf transport, each representative of a different dynamic process and a distinct expected impact on the coastal area. A systematic analysis of available observations for the years 1998-2006 underlines the role of the interplay of atmospheric freshwater fluxes, river loads and wind stress variations, which may create favourable conditions for the convergence of shelf waters (particularly at coastal capes) and the subsequent formation of short-lived filaments along the coast. The response of the buoyant coastal waters to periods of wind reversal and fluctuating freshwater discharge rates is examined through idealised Regional Ocean Modeling System (ROMS) simulations. The filaments observed in remote sensing imagery were well reproduced by the numerical exercise, where the filaments appear as organised submesoscale structures that possess high relative vorticity and develop at the river mouths or adjacent capes. In both scenarios, the filaments appear largely determined by (i) the presence of a buoyancy anomaly, (ii) the angle between the wind pulse direction and the coast and (iii) irregularities in the coastal profile. The ensemble of results suggests that the occurrence of such transient, intense structures may contribute considerably to the biological variability and cross-shelf exchange in coastal areas with similar traits.

  19. An HTS Machine Laboratory Prototype

    NASA Astrophysics Data System (ADS)

    Mijatovic, N.; Jensen, B. B.; Træholta, C.; Abrahamsen, A. B.; Zermeno, V. M. R.; Pedersen, N. F.

    This paper describes Superwind HTS machine laboratory setup which is a small scale HTS machine designed and build as a part of the efforts to identify and tackle some of the challenges the HTS machine design may face. One of the challenges of HTS machines is a Torque Transfer Element (TTE) which is in this design integral part of the cryostat. The discussion of the requirements for the TTE supported with a simple case study comparing a shaft and a cylinder as candidates for TTE are presented. The discussion resulted with a cylinder as a TTE design rated for a 250Nm and with more then 10 times lower heat conduction compared to a shaft. The HTS machine was successfully cooled to 77K and tests have been performed. The IV curves of the HTS field winding employing 6 HTS coils indicate that two of the coils had been damaged. The maximal value of the torque during experiments of 78Nm was recorded. Loaded with 33%, the TTE performed well and showed suffcient margin for future experiments.

  20. Femtosecond Laser Filamentation for Atmospheric Sensing

    PubMed Central

    Xu, Huai Liang; Chin, See Leang

    2011-01-01

    Powerful femtosecond laser pulses propagating in transparent materials result in the formation of self-guided structures called filaments. Such filamentation in air can be controlled to occur at a distance as far as a few kilometers, making it ideally suited for remote sensing of pollutants in the atmosphere. On the one hand, the high intensity inside the filaments can induce the fragmentation of all matters in the path of filaments, resulting in the emission of characteristic fluorescence spectra (fingerprints) from the excited fragments, which can be used for the identification of various substances including chemical and biological species. On the other hand, along with the femtosecond laser filamentation, white-light supercontinuum emission in the infrared to UV range is generated, which can be used as an ideal light source for absorption Lidar. In this paper, we present an overview of recent progress concerning remote sensing of the atmosphere using femtosecond laser filamentation. PMID:22346566

  1. Evolution of Barb Angle and Filament Eruption

    NASA Astrophysics Data System (ADS)

    Su, J. T.; Liu, Y.; Zhang, H. Q.; Kurokawa, H.; Yurchyshyn, V.; Shibata, K.; Bao, X. M.; Wang, G. P.; Li, C.

    2005-09-01

    H? observations of a quiescent U-shaped filament were obtained at Big Bear Solar Observatory and at Hida Observatory with the Flare Monitoring Telescope. The filament was located in the southern hemisphere on 1998 November 4. We study the evolution of the angle of a barb with respect to the axis of the filament and find the evolution can be divided into two phases: a rise from the acute phase to the obtuse phase and a fall. Thus, this indicates that the chirality of this barb changes with time. Moreover, in the process of evolution, we find that interconnection of the part of the filament bearing the barb with the whole filament became either weakened or strengthened. We impute the final eruption of the filament to the chirality evolution of the barb.

  2. Self-Organization of Treadmilling Filaments

    NASA Astrophysics Data System (ADS)

    Doubrovinski, K.; Kruse, K.

    2007-11-01

    The cytoskeleton is an active network of polar filaments. The activity can lead to the polymerization of filaments at one end and depolymerization at the other. This phenomenon is called treadmilling and is essential for many cellular processes, in particular, the crawling of cells on a substrate. We develop a microscopic theoretical framework for describing systems of treadmilling filaments. We show that such systems can self-organize into structures observed in cell fragments, in particular, asters and moving spots.

  3. Remote electrical arc suppression by laser filamentation.

    PubMed

    Schubert, Elise; Mongin, Denis; Kasparian, Jérôme; Wolf, Jean-Pierre

    2015-11-01

    We investigate the interaction of narrow plasma channels formed in the filamentation of ultrashort laser pulses, with a DC high voltage. The laser filaments prevent electrical arcs by triggering corona that neutralize the high-voltage electrodes. This phenomenon, that relies on the electric field modulation and free electron release around the filament, opens new prospects to lightning and over-voltage mitigation. PMID:26561133

  4. Vortex filament simulation for the crosslinking rings

    NASA Astrophysics Data System (ADS)

    Yamashita, Akiko; Oshima, Yuko

    1988-03-01

    When two vortex rings are arranged side by side coplanerly, they approach each other and join to one large ring due to their interaction. This process was numerically simulated using a three-dimensional vortex filament method. One vortex ring which has vorticity within the core was approximated by a bundle of seven vortex filament rings. Each pair of filaments were crosslinked in turn until a large vortex ring formed.

  5. Motion, decay and merging of vortex filaments

    NASA Technical Reports Server (NTRS)

    Liu, C. H.; Ting, L.

    1988-01-01

    The asymptotic solutions of Navier-Stokes equations for vortex filaments of finite strength with small effective vortical cores are summarized. Emphases are placed on the physical meaning and the practical limit to the applicability of the asymptotic solution. Finite-difference solutions of Navier-Stokes equations for the merging of the filament(s) are described. It is focused on the development of the approximate boundary conditions for the computational domain.

  6. Nonlinear theory of kinetic Alfven waves propagation and multiple filament formation

    SciTech Connect

    Sharma, R. P.; Malik, M.; Singh, H. D.

    2008-06-15

    In this paper, the filamentation of kinetic Alfven waves (KAWs) has been studied by assuming that the incident Gaussian beam of KAWs may not remain Gaussian during the filament formation. The solution of the nonlinear dynamical equation of KAWs has been obtained by developing the semi-analytical approach in solar wind plasma. Magnetic field structures of the KAW have been presented in x-z plane. The analytical theory using eikonal approximation has been used beyond the paraxial domain. The effect on spectral index of the turbulence has also been studied.

  7. Response of a flexible filament in a flowing soap film subject to a forced vibration

    NASA Astrophysics Data System (ADS)

    Jia, Laibing; Xiao, Qing; Wu, Haijun; Wu, Yanfeng; Yin, Xiezhen

    2015-01-01

    The interactions between flexible plates and fluids are important physical phenomena. A flag in wind is one of the most simplified and classical models for studying the problem. In this paper, we investigated the response of a flag in flow with an externally forced vibration by using flexible filaments and soap film. Experiments show that for a filament that is either in oscillation or stationary, the external forced vibration leads to its oscillation. A synchronization phenomenon occurs in the experiments. A small perturbation leads to a large response of flapping amplitude in response. The insight provided here is helpful to the applications in the flow control, energy harvesting, and bionic propulsion areas.

  8. Development of the WTS-4 wind turbine design

    NASA Astrophysics Data System (ADS)

    Hasbrouck, T. M.; Divalentin, E.

    Design features, developmental aspects, and financial projections for the WTS-4 4 MW wind turbine are presented. The WTS-4 is a horizontal axis, downwind, two-bladed, variable pitch machine. Start-up is at 7 m/s, rated power is reached at 15 m/s, and shut-down is set at 27 m/s, with all controls operating in a stand-alone mode by means of microprocessors. Each blade is 125 ft long, constructed of filament wound fiberglass reinforced epoxy, and attached at the root to a teetered steel alloy hub, which compensates for the shear caused by the tower shadow. Pitch is controlled by an electrohydraulic mechanism, and can be effected at a rate of 5 deg/s. Details of the nacelle components and costruction are provided, together with features of the system controller and design trade-offs. Cost comparisons with utility scale coal and oil baseload generation plants indicate that wind turbines will become cost competitive by 1985 and are favored thereafter.

  9. Methods for modeling cytoskeletal and DNA filaments

    NASA Astrophysics Data System (ADS)

    Andrews, Steven S.

    2014-02-01

    This review summarizes the models that researchers use to represent the conformations and dynamics of cytoskeletal and DNA filaments. It focuses on models that address individual filaments in continuous space. Conformation models include the freely jointed, Gaussian, angle-biased chain (ABC), and wormlike chain (WLC) models, of which the first three bend at discrete joints and the last bends continuously. Predictions from the WLC model generally agree well with experiment. Dynamics models include the Rouse, Zimm, stiff rod, dynamic WLC, and reptation models, of which the first four apply to isolated filaments and the last to entangled filaments. Experiments show that the dynamic WLC and reptation models are most accurate. They also show that biological filaments typically experience strong hydrodynamic coupling and/or constrained motion. Computer simulation methods that address filament dynamics typically compute filament segment velocities from local forces using the Langevin equation and then integrate these velocities with explicit or implicit methods; the former are more versatile and the latter are more efficient. Much remains to be discovered in biological filament modeling. In particular, filament dynamics in living cells are not well understood, and current computational methods are too slow and not sufficiently versatile. Although primarily a review, this paper also presents new statistical calculations for the ABC and WLC models. Additionally, it corrects several discrepancies in the literature about bending and torsional persistence length definitions, and their relations to flexural and torsional rigidities.

  10. Probing the Physical Structures of Dense Filaments

    NASA Astrophysics Data System (ADS)

    Li, Di

    2015-08-01

    Filament is a common feature in cosmological structures of various scales, ranging from dark matter cosmic web, galaxy clusters, inter-galactic gas flows, to Galactic ISM clouds. Even within cold dense molecular cores, filaments have been detected. Theories and simulations with (or without) different combination of physical principles, including gravity, thermal balance, turbulence, and magnetic field, can reproduce intriguing images of filaments. The ubiquity of filaments and the similarity in simulated ones make physical parameters, beyond dust column density, a necessity for understanding filament evolution. I report three projects attempting to measure physical parameters of filaments. We derive the volume density of a dense Taurus filament based on several cyanoacetylene transitions observed by GBT and ART. We measure the gas temperature of the OMC 2-3 filament based on combined GBT+VLA ammonia images. We also measured the sub-millimeter polarization vectors along OMC3. These filaments were found to be likely a cylinder-type structure, without dynamic heating, and likely accreting mass along the magnetic field lines.

  11. On the equilibrium of rotating filaments

    NASA Astrophysics Data System (ADS)

    Recchi, S.; Hacar, A.; Palestini, A.

    2014-10-01

    The physical properties of the so-called Ostriker isothermal, non-rotating filament have been classically used as benchmark to interpret the stability of the filaments observed in nearby clouds. However, such static picture seems to contrast with the more dynamical state observed in different filaments. In order to explore the physical conditions of filaments under realistic conditions, in this work we theoretically investigate how the equilibrium structure of a filament changes in a rotating configuration. To do so, we solve the hydrostatic equilibrium equation assuming both uniform and differential rotations independently. We obtain a new set of equilibrium solutions for rotating and pressure truncated filaments. These new equilibrium solutions are found to present both radial and projected column density profiles shallower than their Ostriker-like counterparts. Moreover, and for rotational periods similar to those found in the observations, the centrifugal forces present in these filaments are also able to sustain large amounts of mass (larger than the mass attained by the Ostriker filament) without being necessary unstable. Our results indicate that further analysis on the physical state of star-forming filaments should take into account rotational effects as stabilizing agents against gravity.

  12. Sensing combustion intermediates by femtosecond filament excitation.

    PubMed

    Li, He-Long; Xu, Huai-Liang; Yang, Bo-Si; Chen, Qi-Dai; Zhang, Tao; Sun, Hong-Bo

    2013-04-15

    Simultaneous monitoring of multiple combustion intermediates using femtosecond filament-induced nonlinear spectroscopy is demonstrated. Clean fluorescence emissions from free radicals CH, CN, NH, OH, and C(2), as well as atomic C and H, are observed when a femtosecond filament is formed in the laminar ethanol/air flame on an alcohol burner. The fluorescence signals of these species are found to vary as functions of the position of interaction of the filament with the flame along the vertical axis of the central combusting flow, opening up a possibility for remote combustion diagnostic in engines by the excitation of femtosecond laser filament. PMID:23595448

  13. Observations of an active region filament

    NASA Astrophysics Data System (ADS)

    Zong, W. G.; Tang, Y. H.; Fang, C.; Xu, A. A.

    An active region filament was well observed on September 4, 2002 with THEMIS at the Teide observatory and SOHO/MDI. The full Stokes parameters of the filament were obtained in H? and FeI 6302 Å lines. Using the data, we have studied the fine structure of the filament and obtained the parameters at the barb endpoints, including intensity, velocity and longitudinal magnetic field. Our results indicate: (a) the Doppler velocities are quiet different at barb endpoints; (b) the longitudinal magnetic fields at the barb endpoints are very weak; (c) there is a strong magnetic field structure under the filament spine.

  14. The Regulation of Filamentous Growth in Yeast

    PubMed Central

    Cullen, Paul J.; Sprague, George F.

    2012-01-01

    Filamentous growth is a nutrient-regulated growth response that occurs in many fungal species. In pathogens, filamentous growth is critical for host–cell attachment, invasion into tissues, and virulence. The budding yeast Saccharomyces cerevisiae undergoes filamentous growth, which provides a genetically tractable system to study the molecular basis of the response. Filamentous growth is regulated by evolutionarily conserved signaling pathways. One of these pathways is a mitogen activated protein kinase (MAPK) pathway. A remarkable feature of the filamentous growth MAPK pathway is that it is composed of factors that also function in other pathways. An intriguing challenge therefore has been to understand how pathways that share components establish and maintain their identity. Other canonical signaling pathways—rat sarcoma/protein kinase A (RAS/PKA), sucrose nonfermentable (SNF), and target of rapamycin (TOR)—also regulate filamentous growth, which raises the question of how signals from multiple pathways become integrated into a coordinated response. Together, these pathways regulate cell differentiation to the filamentous type, which is characterized by changes in cell adhesion, cell polarity, and cell shape. How these changes are accomplished is also discussed. High-throughput genomics approaches have recently uncovered new connections to filamentous growth regulation. These connections suggest that filamentous growth is a more complex and globally regulated behavior than is currently appreciated, which may help to pave the way for future investigations into this eukaryotic cell differentiation behavior. PMID:22219507

  15. High-Strength Undiffused Brushless (HSUB) Machine

    SciTech Connect

    Hsu, John S; Lee, Seong T; Tolbert, Leon M

    2008-01-01

    This paper introduces a new high-strength undiffused brushless machine that transfers the stationary excitation magnetomotive force to the rotor without any brushes. For a conventional permanent magnet (PM) machine, the air-gap flux density cannot be enhanced effectively but can be weakened. In the new machine, both the stationary excitation coil and the PM in the rotor produce an enhanced air-gap flux. The PM in the rotor prevents magnetic-flux diffusion between the poles and guides the reluctance flux path. The pole flux density in the air gap can be much higher than what the PM alone can produce. A high-strength machine is thus obtained. The air-gap flux density can be weakened through the stationary excitation winding. This type of machine is particularly suitable for electric and hybrid-electric vehicle applications. Patents of this new technology are either granted or pending.

  16. High-Strength Undiffused Brushless (HSUB) Machine

    SciTech Connect

    Hsu, John S; Tolbert, Leon M; Lee, Seong T

    2007-01-01

    This paper introduces a new high-strength undiffused brushless machine that transfers the stationary excitation magnetomotive force to the rotor without any brushes. For a conventional permanent magnet (PM) machine, the air gap flux density cannot be enhanced effectively but can be weakened. In the new machine, both the stationary excitation coil and the PM in the rotor produce an enhanced air gap flux. The PM in the rotor prevents magnetic flux diffusion between the poles and guides the reluctance flux path. The pole flux density in the air gap can be much higher than what the PM alone can produce. A high-strength machine is thus obtained. The air gap flux density can be weakened through the stationary excitation winding. This type of machine is particularly suitable for electric and hybrid-electric vehicle applications. Patents of this new technology are either granted or pending.

  17. Filamentation with nonlinear Bessel vortices.

    PubMed

    Jukna, V; Milián, C; Xie, C; Itina, T; Dudley, J; Courvoisier, F; Couairon, A

    2014-10-20

    We present a new type of ring-shaped filaments featured by stationary nonlinear high-order Bessel solutions to the laser beam propagation equation. Two different regimes are identified by direct numerical simulations of the nonlinear propagation of axicon focused Gaussian beams carrying helicity in a Kerr medium with multiphoton absorption: the stable nonlinear propagation regime corresponds to a slow beam reshaping into one of the stationary nonlinear high-order Bessel solutions, called nonlinear Bessel vortices. The region of existence of nonlinear Bessel vortices is found semi-analytically. The influence of the Kerr nonlinearity and nonlinear losses on the beam shape is presented. Direct numerical simulations highlight the role of attractors played by nonlinear Bessel vortices in the stable propagation regime. Large input powers or small cone angles lead to the unstable propagation regime where nonlinear Bessel vortices break up into an helical multiple filament pattern or a more irregular structure. Nonlinear Bessel vortices are shown to be sufficiently intense to generate a ring-shaped filamentary ionized channel in the medium which is foreseen as opening the way to novel applications in laser material processing of transparent dielectrics. PMID:25401574

  18. Machine wanting.

    PubMed

    McShea, Daniel W

    2013-12-01

    Wants, preferences, and cares are physical things or events, not ideas or propositions, and therefore no chain of pure logic can conclude with a want, preference, or care. It follows that no pure-logic machine will ever want, prefer, or care. And its behavior will never be driven in the way that deliberate human behavior is driven, in other words, it will not be motivated or goal directed. Therefore, if we want to simulate human-style interactions with the world, we will need to first understand the physical structure of goal-directed systems. I argue that all such systems share a common nested structure, consisting of a smaller entity that moves within and is driven by a larger field that contains it. In such systems, the smaller contained entity is directed by the field, but also moves to some degree independently of it, allowing the entity to deviate and return, to show the plasticity and persistence that is characteristic of goal direction. If all this is right, then human want-driven behavior probably involves a behavior-generating mechanism that is contained within a neural field of some kind. In principle, for goal directedness generally, the containment can be virtual, raising the possibility that want-driven behavior could be simulated in standard computational systems. But there are also reasons to believe that goal-direction works better when containment is also physical, suggesting that a new kind of hardware may be necessary. PMID:23792091

  19. Machine musicianship

    NASA Astrophysics Data System (ADS)

    Rowe, Robert

    2002-05-01

    The training of musicians begins by teaching basic musical concepts, a collection of knowledge commonly known as musicianship. Computer programs designed to implement musical skills (e.g., to make sense of what they hear, perform music expressively, or compose convincing pieces) can similarly benefit from access to a fundamental level of musicianship. Recent research in music cognition, artificial intelligence, and music theory has produced a repertoire of techniques that can make the behavior of computer programs more musical. Many of these were presented in a recently published book/CD-ROM entitled Machine Musicianship. For use in interactive music systems, we are interested in those which are fast enough to run in real time and that need only make reference to the material as it appears in sequence. This talk will review several applications that are able to identify the tonal center of musical material during performance. Beyond this specific task, the design of real-time algorithmic listening through the concurrent operation of several connected analyzers is examined. The presentation includes discussion of a library of C++ objects that can be combined to perform interactive listening and a demonstration of their capability.

  20. Growth of filaments and saturation of the filamentation instability

    SciTech Connect

    Gedalin, M.; Medvedev, M.; Spitkovsky, A.; Krasnoselskikh, V.; Vaivads, A.; Perri, S.

    2010-03-15

    The filamentation instability of counterstreaming beams is a nonresonant hydrodynamic-type instability whose growth rate is a smooth function of the wavelength (scale). As a result, perturbations with all unstable wavelengths develop, and the growth saturates due to the saturation of available current. For a given scale, the magnetic field at saturation is proportional to the scale. As a result, the instability develops in a nearly linear regime, where the unstable modes stop growing as soon as the saturation of the corresponding wavelength is reached. At each moment there exists a dominant scale of the magnetic field which is the scale that reached saturation at this particular time. The smaller scales do not disappear and can be easily distinguished in the current structure. The overall growth of the instability stops when the loss of the streaming ion energy because of deceleration is comparable to the initial ion energy.

  1. Wind Turbine Acoustics

    NASA Technical Reports Server (NTRS)

    Hubbard, Harvey H.; Shepherd, Kevin P.

    2009-01-01

    Wind turbine generators, ranging in size from a few kilowatts to several megawatts, are producing electricity both singly and in wind power stations that encompass hundreds of machines. Many installations are in uninhabited areas far from established residences, and therefore there are no apparent environmental impacts in terms of noise. There is, however, the potential for situations in which the radiated noise can be heard by residents of adjacent neighborhoods, particularly those neighborhoods with low ambient noise levels. A widely publicized incident of this nature occurred with the operation of the experimental Mod-1 2-MW wind turbine, which is described in detail elsewhere. Pioneering studies which were conducted at the Mod-1 site on the causes and remedies of noise from wind turbines form the foundation of much of the technology described in this chapter.

  2. A First Approach to Filament Dynamics

    ERIC Educational Resources Information Center

    Silva, P. E. S.; de Abreu, F. Vistulo; Simoes, R.; Dias, R. G.

    2010-01-01

    Modelling elastic filament dynamics is a topic of high interest due to the wide range of applications. However, it has reached a high level of complexity in the literature, making it unaccessible to a beginner. In this paper we explain the main steps involved in the computational modelling of the dynamics of an elastic filament. We first derive…

  3. A First Approach to Filament Dynamics

    ERIC Educational Resources Information Center

    Silva, P. E. S.; de Abreu, F. Vistulo; Simoes, R.; Dias, R. G.

    2010-01-01

    Modelling elastic filament dynamics is a topic of high interest due to the wide range of applications. However, it has reached a high level of complexity in the literature, making it unaccessible to a beginner. In this paper we explain the main steps involved in the computational modelling of the dynamics of an elastic filament. We first derive…

  4. Process for making silver metal filaments

    SciTech Connect

    Bamberger, C.E.

    1998-04-01

    This invention relates to a process for making filaments of metal compounds and more particularly to a process for making silver metal filaments. The United States Government has rights to this invention pursuant to Contract No. DE-AC05-8421400 with Lockheed Martin Energy Systems, Inc. awarded by the US Department of Energy.

  5. Lamp automatically switches to new filament on burnout

    NASA Technical Reports Server (NTRS)

    Ingle, W. B.

    1966-01-01

    Lamp with primary and secondary filaments has a means for automatic switching to the secondary filament at primary filament burnout. Lamp failures and resultant expenses during oscillograph printing are appreciably reduced.

  6. Non-Gaussian statistics of multiple filamentation.

    PubMed

    Lushnikov, Pavel M; Vladimirova, Natalia

    2010-06-15

    We consider the statistics of light amplitude fluctuations for the propagation of a laser beam subjected to multiple filamentation in an amplified Kerr media, with both linear and nonlinear dissipation. Dissipation arrests the catastrophic collapse of filaments, causing their disintegration into almost linear waves. These waves form a nearly Gaussian random field that seeds new filaments. For small amplitudes the probability density function (PDF) of light amplitude is close to Gaussian, while for large amplitudes the PDF has a long powerlike tail that corresponds to strong non-Gaussian fluctuations, i.e., intermittency of strong optical turbulence. This tail is determined by the universal form of near singular filaments and the PDF for the maximum amplitudes of the filaments. PMID:20548354

  7. Hydrodynamics of pairs of interacting cytoskeletal filaments

    NASA Astrophysics Data System (ADS)

    Shinar, Tamar; Shelley, Michael

    2011-11-01

    Pairwise filament interactions underlie the dynamics of complex cytoskeletal networks in cells. These networks in turn play a crucial role in many cellular processes such as formation of the mitotic spindle and cell cleavage in cytokinesis. We model interactions of pairs of filaments immersed in a viscous, fluidic environment. The filaments are modeled using a slender body approximation, capturing their indirect interactions mediated by the immersing fluid. Direct filament interactions via molecular motors complexes induce alignment and parallel or anti-parallel sliding. The motor proteins are modeled as simple spring-like structures that walk directionally toward one end of the filament. We examine the resulting stresses in the fluid to better understand how the microscopic interactions lead to bulk behavior of cytoskeletal networks.

  8. Influence of local fiber undulations on the global buckling behavior of filament-wound cylinders

    NASA Technical Reports Server (NTRS)

    Jensen, D. W.; Pai, S. P.

    1993-01-01

    The predicted compressive stiffness and buckling strength of filament-wound cylinders using classical lamination theory is significantly higher than those observed experimentally. This discrepancy is partially influenced by the variation of mechanical properties in the region of fiber undulations. These regions are localized geometric defects intrinsic to the filament-winding, weaving, and braiding processes. In the present work, the average mechanical properties of the fiber undulation region are quantified using modified models of woven-fabric composites to account for the 3-dimensional effects. The mechanical properties thus determined can be incorporated as local element properties into global finite-element models. Preliminary results from large-displacement analyses of filament-wound cylinders are relatively more accurate when fiber undulations are accounted for.

  9. Kinetics of filamentous phage assembly

    NASA Astrophysics Data System (ADS)

    Ploss, Martin; Kuhn, Andreas

    2010-12-01

    Filamentous phages release their progeny particles by a secretory process without lysing the bacterial cell. By this process about 6 viral particles per min are secreted from each cell. We show here that when the major coat protein (gp8) is provided from a plasmid we observe a phage progeny production rate depending on the induction of gp8 by IPTG. We also show that a transfection of Escherichia coli lacking F-pili is observed using a mutant of M13 that carries an ampicillin resistance gene, and phage particles are secreted in the absence of an F-plasmid. Extruding phage was visualized by atomic force microscopy (AFM) and by transmission electron microscopy (TEM) using gold-labeled antibodies to the major coat protein.

  10. Cell crawling on filamentous tracks

    NASA Astrophysics Data System (ADS)

    Lopez, Jorge; Schwarz, Jennifer; Das, Moumita

    2014-03-01

    Recent experiments suggest that the migration of some cells in three dimensions has strong resemblance to one-dimensional migration. Motivated by this observation, we simulate a one-dimensional model cell made of beads and springs that moves on a tense semiflexible filamentous track. Physical parameters, such as the spring constants and friction coefficients, are calculated using effective theories. We investigate the mechanical feedback between the model cell and this track, as mediated by the active myosin-driven contractility and the catch/slip bond behavior of the focal adhesions, as the model cell crawls. We then compare our calculations of cell speed and the amount of deformation in the track with experiments.

  11. Natural colorants from filamentous fungi.

    PubMed

    Torres, Fábio Aurélio Esteves; Zaccarim, Bruna Regina; de Lencastre Novaes, Letícia Celia; Jozala, Angela Faustino; Santos, Carolina Alves Dos; Teixeira, Maria Francisca Simas; Santos-Ebinuma, Valéria Carvalho

    2016-03-01

    In the last years, there is a trend towards the replacement of synthetic colorants by natural ones, mainly due to the increase of consumer demand for natural products. The natural colorants are used to enhance the appearance of pharmaceutical products, food, and different materials, making them preferable or attractive. This review intends to provide and describe a comprehensive overview of the history of colorants, from prehistory to modern time, of their market and their applications, as well as of the most important aspects of the fermentation process to obtain natural colorants. Focus is given to colorants produced by filamentous fungal species, aiming to demonstrate the importance of these microorganisms and biocompounds, highlighting the production performance to get high yields and the aspects of conclusion that should be taken into consideration in future studies about natural colorants. PMID:26780357

  12. Extensible Wind Towers

    NASA Astrophysics Data System (ADS)

    Sinagra, Marco; Tucciarelli, Tullio

    The diffusion of wind energy generators is restricted by their strong landscape impact. The PERIMA project is about the development of an extensible wind tower able to support a wind machine for several hundred kW at its optimal working height, up to more than 50 m. The wind tower has a telescopic structure, made by several tubes located inside each other with their axis in vertical direction. The lifting force is given by a jack-up system confined inside a shaft, drilled below the ground level. In the retracted tower configuration, at rest, tower tubes are hidden in the foundation of the telescopic structure, located below the ground surface, and the wind machine is the only emerging part of the system. The lifting system is based on a couple of oleodynamic cylinders that jack-up a central tube connected to the top of the tower by a spring, with a diameter smaller than the minimum tower diameter and with a length a bit greater than the length of the extended telescopic structure. The central tube works as plunger and lifts all telescopic elements. The constraint between the telescopic elements is ensured by special parts, which are kept in traction by the force of the spring and provide the resisting moment. The most evident benefit of the proposed system is attained with the use of a two-blade propeller, which can be kept horizontal in the retracted tower configuration.

  13. Filament Activation in Response to Magnetic Flux Emergence and Cancellation in Filament Channels

    NASA Astrophysics Data System (ADS)

    Li, Ting; Zhang, Jun; Ji, Haisheng

    2015-06-01

    We conducted a comparative analysis of two filaments that showed a quite different activation in response to the flux emergence within the filament channels. The observations from the Solar Dynamics Observatory (SDO) and Global Oscillation Network Group (GONG) were made to analyze the two filaments on 2013 August 17 - 20 (SOL2013-08-17) and September 29 (SOL2013-09-29). The first event showed that the main body of the filament was separated into two parts when an active region (AR) emerged with a maximum magnetic flux of about 6.4×1021 Mx underlying the filament. The close neighborhood and common direction of the bright threads in the filament and the open AR fan loops suggest a similar magnetic connectivity of these two flux systems. The equilibrium of the filament was not destroyed three days after the start of the emergence of the AR. To our knowledge, similar observations have never been reported before. In the second event, the emerging flux occurred nearby a barb of the filament with a maximum magnetic flux of 4.2×1020 Mx, about one order of magnitude lower than that of the first event. Two patches of parasitic polarity in the vicinity of the barb merged, then cancelled with nearby network fields. About 20 hours after the onset of the emergence, the filament erupted. Our findings imply that the location of emerging flux within the filament channel is probably crucial to filament evolution. If the flux emergence appears nearby the barbs, it is highly likely that the emerging flux and the filament magnetic fields will cancel, which may lead to the eruption of the filament. The comparison of the two events shows that the emergence of a small AR may still not be enough to disrupt the stability of a filament system, and the actual eruption only occurs after the flux cancellation sets in.

  14. The invertebrate myosin filament: subfilament arrangement of the solid filaments of insect flight muscles.

    PubMed Central

    Beinbrech, G; Ashton, F T; Pepe, F A

    1992-01-01

    Transverse sections (approximately 140 nm thick) of solid myosin filaments of the flight muscles of the fleshfly, Phormia terrae-novae, the honey bee, Apis mellifica, and the waterbug, Lethocerus uhleri, were photographed in a JEM model 200A electron microscope at 200 kV. The images were digitized and computer processed by rotational filtering. In each of these filaments it was found that the symmetry of the core and the wall was not the same. The power spectra of the images showed sixfold symmetry for the wall and threefold symmetry for the core of the filaments. The images of the filaments in each muscle were superimposed according to the sixfold center of the wall. These averaged images for all three muscles showed six pairs of subunits in the wall similar to those found in the wall of tubular filaments. From serial sections of the fleshfly filaments, we conclude that the subunits in the wall of the filaments represent subfilaments essentially parallel to the long axis of the filament. In each muscle there are additional subunits in the core, closely related to the subunits in the wall. Evaluation of serial sections through fleshfly filaments suggests that the relationship of the three subunits observed in the core to those in the wall varies along the length of the filaments. In waterbug filaments there are three dense and three less dense subunits for a total of six all closely related to the wall. Bee filaments have three subunits related to the wall and three subunits located eccentrically in the core of the filaments. The presence of core subunits can be related to the paramyosin content of the filaments. Images FIGURE 1 FIGURE 3 FIGURE 4 FIGURE 5 FIGURE 7 FIGURE 9 FIGURE 12 PMID:1617135

  15. On the Fatigue Analysis of Wind Turbines

    SciTech Connect

    Sutherland, Herbert J.

    1999-06-01

    Modern wind turbines are fatigue critical machines that are typically used to produce electrical power from the wind. Operational experiences with these large rotating machines indicated that their components (primarily blades and blade joints) were failing at unexpectedly high rates, which led the wind turbine community to develop fatigue analysis capabilities for wind turbines. Our ability to analyze the fatigue behavior of wind turbine components has matured to the point that the prediction of service lifetime is becoming an essential part of the design process. In this review paper, I summarize the technology and describe the ''best practices'' for the fatigue analysis of a wind turbine component. The paper focuses on U.S. technology, but cites European references that provide important insights into the fatigue analysis of wind turbines.

  16. Possibilities and limitations of wind energy utilisation

    NASA Astrophysics Data System (ADS)

    Feustel, J.

    1981-10-01

    The existing wind resource, the most favorable locations, applications, and designs of windpowered generators are reviewed, along with descriptions of current and historic wind turbines and lines of research. Coastal regions, plains, hill summits, and mountains with funneling regions are noted to have the highest annual wind averages, with energy densities exceeding the annual solar insolation at average wind speeds of 5-7.9 m/sec. Applications for utility-grade power production, for irrigation, for mechanical heat production, and for pumped storage in water towers or reservoirs are mentioned, as well as electrical power production in remote areas and for hydrogen production by electrolysis. Power coefficients are discussed, with attention given to the German Growian 3 MW machine. It is shown that the least economically sound wind turbines, the machines with outputs below 100 kW, can vie with diesel plant economics in a good wind regime if the wind turbine operates for 15 yr.

  17. Unwinding motion of a twisted active region filament

    SciTech Connect

    Yan, X. L.; Xue, Z. K.; Kong, D. F.; Liu, J. H.; Xu, C. L.

    2014-12-10

    To better understand the structures of active region filaments and the eruption process, we study an active region filament eruption in active region NOAA 11082 in detail on 2010 June 22. Before the filament eruption, the opposite unidirectional material flows appeared in succession along the spine of the filament. The rising of the filament triggered two B-class flares at the upper part of the filament. As the bright material was injected into the filament from the sites of the flares, the filament exhibited a rapid uplift accompanying the counterclockwise rotation of the filament body. From the expansion of the filament, we can see that the filament consisted of twisted magnetic field lines. The total twist of the filament is at least 5? obtained by using a time slice method. According to the morphology change during the filament eruption, it is found that the active region filament was a twisted flux rope and its unwinding motion was like a solar tornado. We also find that there was a continuous magnetic helicity injection before and during the filament eruption. It is confirmed that magnetic helicity can be transferred from the photosphere to the filament. Using the extrapolated potential fields, the average decay index of the background magnetic fields over the filament is 0.91. Consequently, these findings imply that the mechanism of solar filament eruption could be due to the kink instability and magnetic helicity accumulation.

  18. Unwinding Motion of a Twisted Active Region Filament

    NASA Astrophysics Data System (ADS)

    Yan, X. L.; Xue, Z. K.; Liu, J. H.; Kong, D. F.; Xu, C. L.

    2014-12-01

    To better understand the structures of active region filaments and the eruption process, we study an active region filament eruption in active region NOAA 11082 in detail on 2010 June 22. Before the filament eruption, the opposite unidirectional material flows appeared in succession along the spine of the filament. The rising of the filament triggered two B-class flares at the upper part of the filament. As the bright material was injected into the filament from the sites of the flares, the filament exhibited a rapid uplift accompanying the counterclockwise rotation of the filament body. From the expansion of the filament, we can see that the filament consisted of twisted magnetic field lines. The total twist of the filament is at least 5π obtained by using a time slice method. According to the morphology change during the filament eruption, it is found that the active region filament was a twisted flux rope and its unwinding motion was like a solar tornado. We also find that there was a continuous magnetic helicity injection before and during the filament eruption. It is confirmed that magnetic helicity can be transferred from the photosphere to the filament. Using the extrapolated potential fields, the average decay index of the background magnetic fields over the filament is 0.91. Consequently, these findings imply that the mechanism of solar filament eruption could be due to the kink instability and magnetic helicity accumulation.

  19. Automatic Detect and Trace of Solar Filaments

    NASA Astrophysics Data System (ADS)

    Fang, Cheng; Chen, P. F.; Tang, Yu-hua; Hao, Qi; Guo, Yang

    We developed a series of methods to automatically detect and trace solar filaments in solar H? images. The programs are able to not only recognize filaments and determine their properties, such as the position, the area and other relevant parameters, but also to trace the daily evolution of the filaments. For solar full disk H? images, the method consists of three parts: first, preprocessing is applied to correct the original images; second, the Canny edge-detection method is used to detect the filaments; third, filament properties are recognized through the morphological operators. For each H? filament and its barb features, we introduced the unweighted undirected graph concept and adopted Dijkstra shortest-path algorithm to recognize the filament spine; then, using polarity inversion line shift method for measuring the polarities in both sides of the filament to determine the filament axis chirality; finally, employing connected components labeling method to identify the barbs and calculating the angle between each barb and spine to indicate the barb chirality. Our algorithms are applied to the observations from varied observatories, including the Optical & Near Infrared Solar Eruption Tracer (ONSET) in Nanjing University, Mauna Loa Solar Observatory (MLSO) and Big Bear Solar Observatory (BBSO). The programs are demonstrated to be effective and efficient. We used our method to automatically process and analyze 3470 images obtained by MLSO from January 1998 to December 2009, and a butterfly diagram of filaments is obtained. It shows that the latitudinal migration of solar filaments has three trends in the Solar Cycle 23: The drift velocity was fast from 1998 to the solar maximum; after the solar maximum, it became relatively slow and after 2006, the migration became divergent, signifying the solar minimum. About 60% filaments with the latitudes larger than 50 degree migrate towards the Polar Regions with relatively high velocities, and the latitudinal migrating speeds in the northern and the southern hemispheres do not differ significantly in the Solar Cycle 23. We also processed a number of relatively high-resolution H? images obtained by BBSO. It is found that in some cases, the filament axis has single chirality and the associated magnetic field also has single helicity, while its barbs in different parts of it have opposite barb chirality.

  20. Hybrid-secondary uncluttered induction machine

    DOEpatents

    Hsu, John S.

    2001-01-01

    An uncluttered secondary induction machine (100) includes an uncluttered rotating transformer (66) which is mounted on the same shaft as the rotor (73) of the induction machine. Current in the rotor (73) is electrically connected to current in the rotor winding (67) of the transformer, which is not electrically connected to, but is magnetically coupled to, a stator secondary winding (40). The stator secondary winding (40) is alternately connected to an effective resistance (41), an AC source inverter (42) or a magnetic switch (43) to provide a cost effective slip-energy-controlled, adjustable speed, induction motor that operates over a wide speed range from below synchronous speed to above synchronous speed based on the AC line frequency fed to the stator.

  1. Comparison of hand laid-up tape and filament wound composite cylinders and panels with and without impact damage

    NASA Technical Reports Server (NTRS)

    Jegley, Dawn C.; Lopez, Osvaldo F.

    1991-01-01

    Experimentally determined axial compressive failure loads, strains and failure modes of composite flat panels and cylinders are presented. A comparison of two types of filament wound flat graphite-epoxy panels indicates that the winding pattern can influence structural response. A comparison of hand laid-up tape and filament wound composite cylinders indicates that fabrication method may not significantly influence the failure mode or average failure strain of thick-walled (radius-to-thickness ratio less than 15) graphite-epoxy cylinders. The interaction of manufacturing-induced features (fiber cross-overs) and low-speed impact damage for graphite-epoxy specimens is also presented. Filament would flat panels with many fiber cross-overs exhibited lower failure strains than filament wound panels without fiber cross-overs for all impact speeds examined. Graphite-thermoplastic cylinders exhibited a significantly different failure mode from the graphite-epoxy cylinders.

  2. DOE/NASA Lewis large wind turbine program

    NASA Technical Reports Server (NTRS)

    Thomas, R. L.

    1982-01-01

    An overview of the large wind turbine activities managed by NASA is given. These activities include resuls from the first and second generation field machines (Mod-0A, -1, and -2), the status of the Department of Interior WTS-4 machine for which NASA is responsible for technical management, and the design phase of the third generation wind turbines (Mod-5).

  3. WIND ENERGY RESEARCH AT UNIVERSITY AND FEDERAL LEVELS

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Modern wind energy research began not long after the 1973 oil embargo. The Federal government established programs for large machines, small machines, wind resources, and applications in rural and remote areas. The research for the applications in rural and remote areas was conducted by the USDA-Ag...

  4. Machine Shop Lathes.

    ERIC Educational Resources Information Center

    Dunn, James

    This guide, the second in a series of five machine shop curriculum manuals, was designed for use in machine shop courses in Oklahoma. The purpose of the manual is to equip students with basic knowledge and skills that will enable them to enter the machine trade at the machine-operator level. The curriculum is designed so that it can be used in…

  5. Applied machine vision

    SciTech Connect

    Not Available

    1984-01-01

    This book presents the papers given at a conference on robot vision. Topics considered at the conference included the link between fixed and flexible automation, general applications of machine vision, the development of a specification for a machine vision system, machine vision technology, machine vision non-contact gaging, and vision in electronics manufacturing.

  6. Filamentation of Campylobacter in broth cultures

    PubMed Central

    Ghaffar, Nacheervan M.; Connerton, Phillippa L.; Connerton, Ian F.

    2015-01-01

    The transition from rod to filamentous cell morphology has been identified as a response to stressful conditions in many bacterial species and has been ascribed to confer certain survival advantages. Filamentation of Campylobacter jejuni was demonstrated to occur spontaneously on entry in to stationary phase distinguishing it from many other bacteria where a reduction in size is more common. The aim of this study was to investigate the cues that give rise to filamentation of C. jejuni and C. coli and gain insights into the process. Using minimal medium, augmentation of filamentation occurred and it was observed that this morphological change was wide spread amongst C. jejuni strains tested but was not universal in C. coli strains. Filamentation did not appear to be due to release of diffusible molecules, toxic metabolites, or be in response to oxidative stress in the medium. Separated filaments exhibited greater intracellular ATP contents (2.66 to 17.4 fg) than spiral forms (0.99 to 1.7 fg) and showed enhanced survival in water at 4 and 37°C compared to spiral cells. These observations support the conclusion that the filaments are adapted to survive extra-intestinal environments. Differences in cell morphology and physiology need to be considered in the context of the design of experimental studies and the methods adopted for the isolation of campylobacters from food, clinical, and environmental sources. PMID:26175723

  7. Performance of filament-wound vessels from an organic fiber in several epoxy matrices

    NASA Technical Reports Server (NTRS)

    Chiao, T. T.; Jessop, E. S.; Hamstad, M. A.

    1975-01-01

    A study was carried out to select a state-of-the-art epoxy for wet filament winding. Ten epoxy systems were used to filament wind pressure vessels with a high-modulus, high-strength organic fiber. Data are reported on vessel performance, fiber strand strengths, and shear strengths for the different systems. Using our criteria (processibility, neat resin properties, and vessel performance), we find that an epoxy system based on the rubber-modified bis-phenol-F resin, diluted with vinyl cyclohexane dioxide and cured with mixed aromatic amines, can easily replace bis-phenol-A epoxies diluted with bis-(2, 3-epoxycyclopentyl) ether (such as ERL 2256 epoxy of Union Carbide) with comparable overall performance.

  8. Ultrasonic analysis of Kevlar-epoxy filament wound spherical test specimens

    SciTech Connect

    Brosey, W.D.

    1984-12-06

    Increased use of composite materials in enclosed geometries such as cylindrical, spherical, or conical shapes has led to the desire to transfer and further develop the most promising nondestructive evaluation (NDE) techniques used on nonenclosed geometries to enclosed geometries. Known defects were placed within spherical Kevlar-epoxy filament wound test specimens to determine the extent to which they could be detected. These defects included Teflon shim-simulated delaminations, macrosphere-simulated voids, dry-band sets, variable tension, Kevlar 29 fiber, and an alternate high void content winding pattern. Ultrasonic C-scan analysis of Kevlar-epoxy filament wound spheres was performed to determine detectability of normal winding patterns and implanted flaw conditions in the composite using this technique. Ultrasonic waveform analysis was performed in both the time and frequency domains to determine the detectability and locatability of structural flaws within the composite.

  9. THERMAL AND CHEMICAL EVOLUTION OF COLLAPSING FILAMENTS

    SciTech Connect

    Gray, William J.; Scannapieco, Evan

    2013-05-10

    Intergalactic filaments form the foundation of the cosmic web that connect galaxies together, and provide an important reservoir of gas for galaxy growth and accretion. Here we present very high resolution two-dimensional simulations of the thermal and chemical evolution of such filaments, making use of a 32 species chemistry network that tracks the evolution of key molecules formed from hydrogen, oxygen, and carbon. We study the evolution of filaments over a wide range of parameters including the initial density, initial temperature, strength of the dissociating UV background, and metallicity. In low-redshift, Z Almost-Equal-To 0.1 Z{sub Sun} filaments, the evolution is determined completely by the initial cooling time. If this is sufficiently short, the center of the filament always collapses to form a dense, cold core containing a substantial fraction of molecules. In high-redshift, Z = 10{sup -3} Z{sub Sun} filaments, the collapse proceeds much more slowly. This is mostly due to the lower initial temperatures, which lead to a much more modest increase in density before the atomic cooling limit is reached, making subsequent molecular cooling much less efficient. Finally, we study how the gravitational potential from a nearby dwarf galaxy affects the collapse of the filament and compare this to NGC 5253, a nearby starbursting dwarf galaxy thought to be fueled by the accretion of filament gas. In contrast to our fiducial case, a substantial density peak forms at the center of the potential. This peak evolves faster than the rest of the filament due to the increased rate at which chemical species form and cooling occurs. We find that we achieve similar accretion rates as NGC 5253 but our two-dimensional simulations do not recover the formation of the giant molecular clouds that are seen in radio observations.

  10. Filaments in simulations of molecular cloud formation

    SciTech Connect

    Gómez, Gilberto C.; Vázquez-Semadeni, Enrique

    2014-08-20

    We report on the filaments that develop self-consistently in a new numerical simulation of cloud formation by colliding flows. As in previous studies, the forming cloud begins to undergo gravitational collapse because it rapidly acquires a mass much larger than the average Jeans mass. Thus, the collapse soon becomes nearly pressureless, proceeding along its shortest dimension first. This naturally produces filaments in the cloud and clumps within the filaments. The filaments are not in equilibrium at any time, but instead are long-lived flow features through which the gas flows from the cloud to the clumps. The filaments are long-lived because they accrete from their environment while simultaneously accreting onto the clumps within them; they are essentially the locus where the flow changes from accreting in two dimensions to accreting in one dimension. Moreover, the clumps also exhibit a hierarchical nature: the gas in a filament flows onto a main, central clump but other, smaller-scale clumps form along the infalling gas. Correspondingly, the velocity along the filament exhibits a hierarchy of jumps at the locations of the clumps. Two prominent filaments in the simulation have lengths ?15 pc and masses ?600 M {sub ?} above density n ? 10{sup 3} cm{sup –3} (?2 × 10{sup 3} M {sub ?} at n > 50 cm{sup –3}). The density profile exhibits a central flattened core of size ?0.3 pc and an envelope that decays as r {sup –2.5} in reasonable agreement with observations. Accretion onto the filament reaches a maximum linear density rate of ?30 M {sub ?} Myr{sup –1} pc{sup –1}.

  11. Model Prediction for an Observed Filament

    NASA Astrophysics Data System (ADS)

    Aulanier, G.; Srivastava, N.; Martin, S. F.

    2000-11-01

    This paper presents the results of a ``blind test'' for modeling the structure of an observed filament using the three-dimensional magnetohydrostatic model recently developed by Aulanier et al. in 1999. The model uses a constant shear α, and it takes into account the effects of pressure and gravity. The test consisted of predicting the structure of a filament (observed in the southern hemisphere) with a minimum observational input: only a line-of-sight magnetogram, with a straight line drawn on it to show the location of the filament, was provided. The filament was chosen by the observers (N. S. and S. F. M.) because it had a definite overall left-handed structural pattern known as sinistral, but the direction of component of the magnetic field along the filament axis was uncertain from the combination of Hα data and magnetograms. The modeler (G. A.) evaluated and fixed the values of some of the free parameters of the model while some others were varied in reasonable ranges. The Hα image of the filament was revealed only after the modeling. For α>0, the three-dimensional distribution of magnetic dips computed by the model fairly well reproduces the structure of the filament and its barbs. Moreover, the models for which α<0 do not match well the observations. This study then shows the first successful theoretical prediction for the magnetic field of an observed filament. It shows that the method based on the Aulanier et al. model is a powerful tool, not only for purposes of modeling, but also for prediction of the chirality, helicity, and morphology of observed filaments.

  12. Wind-turbine aerodynamics

    NASA Astrophysics Data System (ADS)

    Wilson, R. E.

    1980-05-01

    The aerodynamics of wind turbines is reviewed starting with effects of lift and drag on translating devices and proceeding through the performance aerodynamics of the horizontal-axis and vertical-axis machines currently in service. Horizontal-axis rotor aerodynamics is outlined and the performance limits are presented along with key assumptions and problem areas. The Darrieus rotor multiple streamtube analysis is developed and compared with fixed and free wake analyses for an idealized case.

  13. Machine and process characterization

    SciTech Connect

    Love, L.W.

    1992-12-01

    A study was conducted to statistically characterize 11 precision machining centers to determine their operating characteristics and process capabilities. Measurement probes and a ball plate were used for measurement analysis. A generic test part designed with geometric features that the department typically manufactures was machined using various machining processes. A better understanding of each machine's characteristics and process capability was realized through repeating these methods on each machine.

  14. Sitting and land-use considerations in wind energy development

    SciTech Connect

    Noun, R.J.

    1981-09-01

    Identifying suitable sites for large wind machine clusters, or wind farms, requires more than finding a location with an adequate wind resource. Consideration must also be given to the question of how land-use policies and regulations will affect the siting of wind system installations. In particular, the issue of acquiring wind rights, or guaranteed access to the wind resource for electric power generation, will be vital to the development of wind energy. This paper examines several methods for acquiring and preserving access to the wind resource and for dealing with related land-use issues.

  15. Architecture of the type IVa pilus machine.

    PubMed

    Chang, Yi-Wei; Rettberg, Lee A; Treuner-Lange, Anke; Iwasa, Janet; Søgaard-Andersen, Lotte; Jensen, Grant J

    2016-03-11

    Type IVa pili are filamentous cell surface structures observed in many bacteria. They pull cells forward by extending, adhering to surfaces, and then retracting. We used cryo-electron tomography of intact Myxococcus xanthus cells to visualize type IVa pili and the protein machine that assembles and retracts them (the type IVa pilus machine, or T4PM) in situ, in both the piliated and nonpiliated states, at a resolution of 3 to 4 nanometers. We found that T4PM comprises an outer membrane pore, four interconnected ring structures in the periplasm and cytoplasm, a cytoplasmic disc and dome, and a periplasmic stem. By systematically imaging mutants lacking defined T4PM proteins or with individual proteins fused to tags, we mapped the locations of all 10 T4PM core components and the minor pilins, thereby providing insights into pilus assembly, structure, and function. PMID:26965631

  16. A construction technique for wind tunnel models

    NASA Technical Reports Server (NTRS)

    Lawing, P. L.; Sandefur, P. G., Jr.; Wood, W. H.

    1981-01-01

    High strength, good surface finish, and corrosion resistance are imparted to miniature wind tunnel models by machining pressure channels as integral part of model. Pattern for pressure channels is scribed, machined, or photoetched before channels are drilled. Mating surfaces for channels are flashed and then diffusion brazed together.

  17. Hybrid Wound Filaments for Greater Resistance to Impacts

    NASA Technical Reports Server (NTRS)

    DeLay, Thomas K.; Patterson, James E.; Olson, Michael A.

    2008-01-01

    A hybrid material containing wound filaments made of a hybrid of high-strength carbon fibers and poly(phenylene benzobisoxazole) [PBO] fibers is discussed. This hybrid material is chosen in an effort to increase the ability of the pressure vessel to resist damage by low-speed impacts (e.g., dropping of tools on the vessel or bumping of the vessel against hard objects during installation and use) without significantly increasing the weight of the vessel. While the basic concept of hybridizing fibers in filament-wound structures is not new, the use of hybridization to increase resistance to impacts is an innovation, and can be expected to be of interest in the composite-pressure-vessel industry. The precise types and the proportions of the high-strength carbon fibers and the PBO fibers in the hybrid are chosen, along with the filament-winding pattern, to maximize the advantageous effects and minimize the disadvantageous effects of each material. In particular, one seeks to (1) take advantage of the ability of the carbon fibers to resist stress rupture while minimizing their contribution to vulnerability of the vessel to impact damage and (2) take advantage of the toughness of the PBO fibers while minimizing their contribution to vulnerability of the vessel to stress rupture. Experiments on prototype vessels fabricated according to this concept have shown promising results. At the time of reporting the information for this article, research toward understanding and optimizing the performances of PBO fibers so as to minimize their contribution to vulnerability of the pressure vessel to stress rupture had yet to be performed.

  18. Wind Simulation

    Energy Science and Technology Software Center (ESTSC)

    2008-12-31

    The Software consists of a spreadsheet written in Microsoft Excel that provides an hourly simulation of a wind energy system, which includes a calculation of wind turbine output as a power-curve fit of wind speed.

  19. A double-sided linear primary permanent magnet vernier machine.

    PubMed

    Du, Yi; Zou, Chunhua; Liu, Xianxing

    2015-01-01

    The purpose of this paper is to present a new double-sided linear primary permanent magnet (PM) vernier (DSLPPMV) machine, which can offer high thrust force, low detent force, and improved power factor. Both PMs and windings of the proposed machine are on the short translator, while the long stator is designed as a double-sided simple iron core with salient teeth so that it is very robust to transmit high thrust force. The key of this new machine is the introduction of double stator and the elimination of translator yoke, so that the inductance and the volume of the machine can be reduced. Hence, the proposed machine offers improved power factor and thrust force density. The electromagnetic performances of the proposed machine are analyzed including flux, no-load EMF, thrust force density, and inductance. Based on using the finite element analysis, the characteristics and performances of the proposed machine are assessed. PMID:25874250

  20. A Double-Sided Linear Primary Permanent Magnet Vernier Machine

    PubMed Central

    2015-01-01

    The purpose of this paper is to present a new double-sided linear primary permanent magnet (PM) vernier (DSLPPMV) machine, which can offer high thrust force, low detent force, and improved power factor. Both PMs and windings of the proposed machine are on the short translator, while the long stator is designed as a double-sided simple iron core with salient teeth so that it is very robust to transmit high thrust force. The key of this new machine is the introduction of double stator and the elimination of translator yoke, so that the inductance and the volume of the machine can be reduced. Hence, the proposed machine offers improved power factor and thrust force density. The electromagnetic performances of the proposed machine are analyzed including flux, no-load EMF, thrust force density, and inductance. Based on using the finite element analysis, the characteristics and performances of the proposed machine are assessed. PMID:25874250

  1. Dual-rotor, radial-flux, toroidally-wound, permanent-magnet machine

    DOEpatents

    Qu, Ronghai; Lipo, Thomas A.

    2005-08-02

    The present invention provides a novel dual-rotor, radial-flux, toroidally-wound, permanent-magnet machine. The present invention improves electrical machine torque density and efficiency. At least one concentric surface-mounted permanent magnet dual-rotor is located inside and outside of a torus-shaped stator with back-to-back windings, respectively. The machine substantially improves machine efficiency by reducing the end windings and boosts the torque density by at least doubling the air gap and optimizing the machine aspect ratio.

  2. Do filaments cross core "boundaries"?

    NASA Astrophysics Data System (ADS)

    Goodman, Alyssa A.; Chen, Hope; Pineda, Jaime E.; Offner, Stella

    2015-01-01

    Thanks to extensive observations of the Perseus star-forming region, and the Barnard 5 (B5) star-forming core within it, we can study filamentary structure at scales from tens of pc down to to hundredths of pc using a wide variety of gas and dust tracers. Recently, in compositing Herschel dust emission maps of Perseus with GBT and JVLA maps of ammonia in B5, we noticed that the large scale (>1 pc) filaments that lead to the B5 core appear to continue across the "coherent core" boundary, right down into the sub 0.1 pc scales traced by ammonia. We find this result very surprising, since it suggests that the "core" is not as distinct from its filamentary surroundings as we--and current conventional wisdom--would have predicted. Numerical simulations on 1-10 pc scales typically create "sink" particles on scales small enough to correspond to our JVLA measurements. The new B5 results presented here should inspire new simulations which offer enough dynamic range to trace the morphology of self-gravitating, non-isothermal turbulence continuously from 10 to 0.01 pc scales, in order to see how, why, and how long filamentary structure is maintained across these scales.

  3. Natural plasmids of filamentous fungi.

    PubMed Central

    Griffiths, A J

    1995-01-01

    Among eukaryotes, plasmids have been found in fungi and plants but not in animals. Most plasmids are mitochondrial. In filamentous fungi, plasmids are commonly encountered in isolates from natural populations. Individual populations may show a predominance of one type, but some plasmids have a global distribution, often crossing species boundaries. Surveys have shown that strains can contain more than one type of plasmid and that different types appear to be distributed independently. In crosses, plasmids are generally inherited maternally. Horizontal transmission is by cell contact. Circular plasmids are common only in Neurospora spp., but linear plasmids have been found in many fungi. Circular plasmids have one open reading frame (ORF) coding for a DNA polymerase or a reverse transcriptase. Linear plasmids generally have two ORFs, coding for presumptive DNA and RNA polymerases with amino acid motifs showing homology to viral polymerases. Plasmids often attain a high copy number, in excess of that of mitochondrial DNA. Linear plasmids have a protein attached to their 5' end, and this is presumed to act as a replication primer. Most plasmids are neutral passengers, but several linear plasmids integrate into mitochondrial DNA, causing death of the host culture. Inferred amino acid sequences of linear plasmid ORFs have been used to plot phylogenetic trees, which show a fair concordance with conventional trees. The circular Neurospora plasmids have replication systems that seem to be evolutionary intermediates between the RNA and the DNA worlds. PMID:8531891

  4. Prediction of the far field noise from wind energy farms

    NASA Technical Reports Server (NTRS)

    Shepherd, K. P.; Hubbard, H. H.

    1986-01-01

    The basic physical factors involved in making predictions of wind turbine noise and an approach which allows for differences in the machines, the wind energy farm configurations and propagation conditions are reviewed. Example calculations to illustrate the sensitivity of the radiated noise to such variables as machine size, spacing and numbers, and such atmosphere variables as absorption and wind direction are presented. It is found that calculated far field distances to particular sound level contours are greater for lower values of atmospheric absorption, for a larger total number of machines, for additional rows of machines and for more powerful machines. At short and intermediate distances, higher sound pressure levels are calculated for closer machine spacings, for more powerful machines, for longer row lengths and for closer row spacings.

  5. Snake Filament Eruption - Duration: 5 seconds.

    NASA Video Gallery

    A very long solar filament that had been snaking around the Sun erupted on Dec. 6, 2010 with a flourish. NASA's Solar Dynamics Observatory (SDO) caught the action in dramatic detail in extreme ultr...

  6. Filamentous bacteria existence in aerobic granular reactors.

    PubMed

    Figueroa, M; Val del Río, A; Campos, J L; Méndez, R; Mosquera-Corral, A

    2015-05-01

    Filamentous bacteria are associated to biomass settling problems in wastewater treatment plants. In systems based on aerobic granular biomass they have been proposed to contribute to the initial biomass aggregation process. However, their development on mature aerobic granular systems has not been sufficiently studied. In the present research work, filamentous bacteria were studied for the first time after long-term operation (up to 300 days) of aerobic granular systems. Chloroflexi and Sphaerotilus natans have been observed in a reactor fed with synthetic wastewater. These filamentous bacteria could only come from the inoculated sludge. Thiothrix and Chloroflexi bacteria were observed in aerobic granular biomass treating wastewater from a fish canning industry. Meganema perideroedes was detected in a reactor treating wastewater from a plant processing marine products. As a conclusion, the source of filamentous bacteria in these mature aerobic granular systems fed with industrial effluents was the incoming wastewater. PMID:25533039

  7. ULTRASTRUCTURE OF PROTRUSIVE ACTIN FILAMENT ARRAYS

    PubMed Central

    Svitkina, Tatyana M.

    2013-01-01

    The actin cytoskeleton is the major force-generating machinery in the cell, which can produce pushing, pulling, and resistance forces. To accomplish these diverse functions, actin filaments, with help of numerous accessory proteins, form higher order ensembles, networks and bundles, adapted to specific tasks. Moreover, dynamic properties of the actin cytoskeleton allow a cell to constantly build, renew, and redesign actin structures according to its changing needs. High resolution architecture of actin filament arrays provides key information for understanding mechanisms of force generation. To generate pushing force, cells use coordinated polymerization of multiple actin filaments organized into branched (dendritic) networks or parallel bundles. This review summarizes our current knowledge of the structural organization of these two actin filament arrays. PMID:23639311

  8. Femtosecond filament array generated in air

    NASA Astrophysics Data System (ADS)

    Camino, Acner; Xi, Tingting; Hao, Zuoqiang; Lin, Jingquan

    2015-12-01

    Patterning multiple filamentation of femtosecond pulses in air is studied using a microlens array for modulation of the spatial profile and a single lens for power concentration. We generate a stable array of filaments containing a maximum of five hotspots per mm2 from a modest 68-GW input power. The evolution of the pattern along the axis of propagation as well as the means to control the inter-filament spacing is discussed. It is also shown in numerical simulations that besides the filamentation in the proximities of the focus, there is a region of early ionization around the central hotspots in the beam profile and a revival afterwards, caused by the spatial distribution of the laser energy.

  9. Pressure effects on the femtosecond laser filamentation

    NASA Astrophysics Data System (ADS)

    Qi, Xiexing; Ma, Cunliang; Lin, Wenbin

    2016-01-01

    We investigate the pressure effects on the propagation of the laser pulse with wavelength of 800 nm by numerical simulations. We consider the effects on the on-axis intensity, the beam radius and the energy of the filament, as well as the on-axis density of plasma. Numerical results show that when the pressures increase, the length, radius and energy of the light filament become shorter, narrower and lower, respectively. Moreover, we find that the length and the radius of filament are approximately inversely proportional to the pressure and the square root of pressure, respectively, and the pulse with shorter duration is easier to be affected by the pressure. We also obtain the conclusion that the plasma is not necessary to generate the filament in gases in various pressures, as stated by Béjot et al. [1] for the case of standard atmosphere pressure.

  10. Femtosecond filament array generated in air

    NASA Astrophysics Data System (ADS)

    Camino, Acner; Xi, Tingting; Hao, Zuoqiang; Lin, Jingquan

    2015-10-01

    Patterning multiple filamentation of femtosecond pulses in air is studied using a microlens array for modulation of the spatial profile and a single lens for power concentration. We generate a stable array of filaments containing a maximum of five hotspots per mm2 from a modest 68-GW input power. The evolution of the pattern along the axis of propagation as well as the means to control the inter-filament spacing is discussed. It is also shown in numerical simulations that besides the filamentation in the proximities of the focus, there is a region of early ionization around the central hotspots in the beam profile and a revival afterwards, caused by the spatial distribution of the laser energy.

  11. Physical properties of cytoplasmic intermediate filaments.

    PubMed

    Block, Johanna; Schroeder, Viktor; Pawelzyk, Paul; Willenbacher, Norbert; Köster, Sarah

    2015-11-01

    Intermediate filaments (IFs) constitute a sophisticated filament system in the cytoplasm of eukaryotes. They form bundles and networks with adapted viscoelastic properties and are strongly interconnected with the other filament types, microfilaments and microtubules. IFs are cell type specific and apart from biochemical functions, they act as mechanical entities to provide stability and resilience to cells and tissues. We review the physical properties of these abundant structural proteins including both in vitro studies and cell experiments. IFs are hierarchical structures and their physical properties seem to a large part be encoded in the very specific architecture of the biopolymers. Thus, we begin our review by presenting the assembly mechanism, followed by the mechanical properties of individual filaments, network and structure formation due to electrostatic interactions, and eventually the mechanics of in vitro and cellular networks. This article is part of a Special Issue entitled: Mechanobiology. PMID:25975455

  12. Intermediate Filaments in Small Configuration Spaces

    NASA Astrophysics Data System (ADS)

    Nöding, Bernd; Köster, Sarah

    2012-02-01

    Intermediate filaments play a key role in cell mechanics. Apart from their great importance from a biomedical point of view, they also act as a very suitable micrometer-sized model system for semiflexible polymers. We perform a statistical analysis of the thermal fluctuations of individual filaments confined in microchannels. The small channel width and the resulting deflections at the walls give rise to a reduction of the configuration space by about 2 orders of magnitude. This circumstance enables us to precisely measure the intrinsic persistence length of vimentin intermediate filaments and to show that they behave as ideal wormlike chains; we observe that small fluctuations in perpendicular planes decouple. Furthermore, the inclusion of results for confined actin filaments demonstrates that the Odijk confinement regime is valid over at least 1 order of magnitude in persistence length.

  13. Structural determinants of muscle thin filament cooperativity.

    PubMed

    Moore, Jeffrey R; Campbell, Stuart G; Lehman, William

    2016-03-15

    End-to-end connections between adjacent tropomyosin molecules along the muscle thin filament allow long-range conformational rearrangement of the multicomponent filament structure. This process is influenced by Ca(2+) and the troponin regulatory complexes, as well as by myosin crossbridge heads that bind to and activate the filament. Access of myosin crossbridges onto actin is gated by tropomyosin, and in the case of striated muscle filaments, troponin acts as a gatekeeper. The resulting tropomyosin-troponin-myosin on-off switching mechanism that controls muscle contractility is a complex cooperative and dynamic system with highly nonlinear behavior. Here, we review key information that leads us to view tropomyosin as central to the communication pathway that coordinates the multifaceted effectors that modulate and tune striated muscle contraction. We posit that an understanding of this communication pathway provides a framework for more in-depth mechanistic characterization of myopathy-associated mutational perturbations currently under investigation by many research groups. PMID:26891592

  14. Cross-shelf variability in the Iberian Peninsula Upwelling System: Impact of a mesoscale filament

    NASA Astrophysics Data System (ADS)

    Rossi, Vincent; Garçon, Véronique; Tassel, Joëlle; Romagnan, Jean-Baptiste; Stemmann, Lars; Jourdin, Frédéric; Morin, Pascal; Morel, Yves

    2013-05-01

    Based on a multidisciplinary survey in the Iberian upwelling during late summer 2007, this paper analysed comparatively the cross-shore variability and offshore transport across the upwelling front and within a mesoscale filament. Along the East-West (EW) sections, transient upwelling pulses bring regularly cold, fresh and nutrient-enriched waters to the surface, triggering intense biological responses. Offshore advection by wind-forced Ekman drift of the successive fronts, interrupted by relaxation periods, drive the variability of the planktonic communities. While the near-shore areas are dominated by relatively small phytoplankton controlled by mesozooplankton grazing, large cells of diatoms appear after a short decay. Although microphytoplankton dominates largely the shelf communities, the species composition varies during the offshore drift with the apparition of dinoflagellates and the gradual development of large zooplankton individuals. The oligotrophic ecosystem characterised by small organisms and low biomass (˜80km offshore) contrasts strongly with the transitional area and the coastal upwelling. The low density waters within the filament and the existence of a pair of opposite rotating eddies at its base and tip promote its generation and rapid seaward extension. The intensified offshore advection of coastal enriched waters considerably increases the area favouring a productive ecosystem (until ˜160km off the coast). Cross-shelf variability of bio-physical variables is observed in the filament as along EW sections, although a subsequent homogenisation within the mesoscale structure erases the sharp fronts. Off the shelf within the filament, the chlorophyll a is distinctly organised as a shallow subsurface maximum dominated by nano-phytoplankton. The relative physical isolation of a dynamical food-web in the filament is also promoting nutrient remineralisation under the structure. Finally, we estimate that mesoscale filaments, although being less extended meridionally than the upwelling front itself (˜40% of the length of the front) are responsible for a greater offshore transport of chlorophyll (˜60% of total cross-shelf exchanges) over the Iberian system. Despite the favourable wind pulses advecting westward the successive upwelling fronts, self-propelled filaments provide permanent offshore transport, even under wind relaxation period, thus playing a major role in cross-shelf exchanges.

  15. Actin Filament Attachments for Sustained Motility In Vitro Are Maintained by Filament Bundling

    PubMed Central

    Hu, Xiaohua; Kuhn, Jeffrey R.

    2012-01-01

    We reconstructed cellular motility in vitro from individual proteins to investigate how actin filaments are organized at the leading edge. Using total internal reflection fluorescence microscopy of actin filaments, we tested how profilin, Arp2/3, and capping protein (CP) function together to propel thin glass nanofibers or beads coated with N-WASP WCA domains. Thin nanofibers produced wide comet tails that showed more structural variation in actin filament organization than did bead substrates. During sustained motility, physiological concentrations of Mg2+ generated actin filament bundles that processively attached to the nanofiber. Reduction of total Mg2+ abolished particle motility and actin attachment to the particle surface without affecting actin polymerization, Arp2/3 nucleation, or filament capping. Analysis of similar motility of microspheres showed that loss of filament bundling did not affect actin shell formation or symmetry breaking but eliminated sustained attachments between the comet tail and the particle surface. Addition of Mg2+, Lys-Lys2+, or fascin restored both comet tail attachment and sustained particle motility in low Mg2+ buffers. TIRF microscopic analysis of filaments captured by WCA-coated beads in the absence of Arp2/3, profilin, and CP showed that filament bundling by polycation or fascin addition increased barbed end capture by WCA domains. We propose a model in which CP directs barbed ends toward the leading edge and polycation-induced filament bundling sustains processive barbed end attachment to the leading edge. PMID:22359589

  16. Can we determine the filament chirality by the filament footpoint location or the barb-bearing?

    NASA Astrophysics Data System (ADS)

    Hao, Qi; Guo, Yang; Fang, Cheng; Chen, Peng-Fei; Cao, Wen-Da

    2016-01-01

    We attempt to propose a method for automatically detecting the solar filament chirality and barb bearing. We first introduce the concept of an unweighted undirected graph and adopt the Dijkstra shortest path algorithm to recognize the filament spine. Then, we use the polarity inversion line (PIL) shift method for measuring the polarities on both sides of the filament, and employ the connected components labeling method to identify the barbs and calculate the angle between each barb and the spine to determine the bearing of the barbs, i.e., left or right. We test the automatic detection method with H? filtergrams from the Big Bear Solar Observatory (BBSO) H? archive and magnetograms observed with the Helioseismic and Magnetic Imager (HMI) on board the Solar Dynamics Observatory (SDO). Four filaments are automatically detected and illustrated to show the results. The barbs in different parts of a filament may have opposite bearings. The filaments in the southern hemisphere (northern hemisphere) mainly have left-bearing (right-bearing) barbs and positive (negative) magnetic helicity, respectively. The tested results demonstrate that our method is efficient and effective in detecting the bearing of filament barbs. It is demonstrated that the conventionally believed one-to-one correspondence between filament chirality and barb bearing is not valid. The correct detection of the filament axis chirality should be done by combining both imaging morphology and magnetic field observations.

  17. Can we determine the filament chirality by the filament footpoint location or the barb-bearing?

    NASA Astrophysics Data System (ADS)

    Hao, Qi; Guo, Yang; Fang, Cheng; Chen, Peng-Fei; Cao, Wen-Da

    2016-01-01

    We attempt to propose a method for automatically detecting the solar filament chirality and barb bearing. We first introduce the concept of an unweighted undirected graph and adopt the Dijkstra shortest path algorithm to recognize the filament spine. Then, we use the polarity inversion line (PIL) shift method for measuring the polarities on both sides of the filament, and employ the connected components labeling method to identify the barbs and calculate the angle between each barb and the spine to determine the bearing of the barbs, i.e., left or right. We test the automatic detection method with Hα filtergrams from the Big Bear Solar Observatory (BBSO) Hα archive and magnetograms observed with the Helioseismic and Magnetic Imager (HMI) on board the Solar Dynamics Observatory (SDO). Four filaments are automatically detected and illustrated to show the results. The barbs in different parts of a filament may have opposite bearings. The filaments in the southern hemisphere (northern hemisphere) mainly have left-bearing (right-bearing) barbs and positive (negative) magnetic helicity, respectively. The tested results demonstrate that our method is efficient and effective in detecting the bearing of filament barbs. It is demonstrated that the conventionally believed one-to-one correspondence between filament chirality and barb bearing is not valid. The correct detection of the filament axis chirality should be done by combining both imaging morphology and magnetic field observations.

  18. Designing highly tunable semiflexible filament networks

    NASA Astrophysics Data System (ADS)

    Pandolfi, Ronald J.; Edwards, Lauren; Johnston, David; Becich, Peter; Hirst, Linda S.

    2014-06-01

    Semiflexible polymers can generate a range of filamentous networks significantly different in structure from those seen in conventional polymer solutions. Our coarse-grained simulations with an implicit cross-linker potential show that networks of branching bundles, knotted morphologies, and structural chirality can be generated by a generalized approach independent of specific cross-linkers. Network structure depends primarily on filament flexibility and separation, with significant connectivity increase after percolation. Results should guide the design of engineered semiflexible polymers.

  19. Filament-wound, fiberglass cryogenic tank supports

    NASA Technical Reports Server (NTRS)

    Carter, J. S.; Timberlake, T. E.

    1971-01-01

    The design, fabrication, and testing of filament-wound, fiberglass cryogenic tank supports for a LH2 tank, a LF2/FLOX tank and a CH4 tank. These supports consist of filament-wound fiberglass tubes with titanium end fittings. These units were satisfactorily tested at cryogenic temperatures, thereby offering a design that can be reliably and economically produced in large or small quantities. The basic design concept is applicable to any situation where strong, lightweight axial load members are desired.

  20. Kinks, rings, and rackets in filamentous structures

    NASA Astrophysics Data System (ADS)

    Cohen, Adam E.; Mahadevan, L.

    2003-10-01

    Carbon nanotubes and biological filaments each spontaneously assemble into kinked helices, rings, and "tennis racket" shapes due to competition between elastic and interfacial effects. We show that the slender geometry is a more important determinant of the morphology than any molecular details. Our mesoscopic continuum theory is capable of quantifying observations of these structures and is suggestive of their occurrence in other filamentous assemblies as well.

  1. Large, low cost composite wind turbine blades

    NASA Technical Reports Server (NTRS)

    Gewehr, H. W.

    1979-01-01

    A woven roving E-glass tape, having all of its structural fibers oriented across the tape width was used in the manufacture of the spar for a wind turbine blade. Tests of a 150 ft composite blade show that the transverse filament tape is capable of meeting structural design requirements for wind turbine blades. Composite blades can be designed for interchangeability with steel blades in the MOD-1 wind generator system. The design, analysis, fabrication, and testing of the 150 ft blade are discussed.

  2. Filaments in the Lupus molecular clouds

    NASA Astrophysics Data System (ADS)

    Benedettini, M.; Schisano, E.; Pezzuto, S.; Elia, D.; André, P.; Könyves, V.; Schneider, N.; Tremblin, P.; Arzoumanian, D.; di Giorgio, A. M.; Di Francesco, J.; Hill, T.; Molinari, S.; Motte, F.; Nguyen-Luong, Q.; Palmeirim, P.; Rivera-Ingraham, A.; Roy, A.; Rygl, K. L. J.; Spinoglio, L.; Ward-Thompson, D.; White, G. J.

    2015-10-01

    We have studied the filaments extracted from the column density maps of the nearby Lupus 1, 3, and 4 molecular clouds, derived from photometric maps observed with the Herschel satellite. Filaments in the Lupus clouds have quite low column densities, with a median value of ˜1.5 × 1021 cm-2 and most have masses per unit length lower than the maximum critical value for radial gravitational collapse. Indeed, no evidence of filament contraction has been seen in the gas kinematics. We find that some filaments, that on average are thermally subcritical, contain dense cores that may eventually form stars. This is an indication that in the low column density regime, the critical condition for the formation of stars may be reached only locally and this condition is not a global property of the filament. Finally, in Lupus we find multiple observational evidences of the key role that the magnetic field plays in forming filaments, and determining their confinement and dynamical evolution.

  3. Harnessing wind power

    NASA Astrophysics Data System (ADS)

    Fagenbaum, J.

    1982-04-01

    The design goals, test results, operating mechanisms, and ultimate limits of large wind energy conversion systems (WECS) are explored. NASA is currently managing and monitoring the performance of the Mod O, Mod OA, Mod 1, and Mod 2 wind turbines, which produce from 100 kW-2.5 MWe for grid interconnection. The Mod 2 machines have a 300 ft diam rotor, begin producing at 14 mph and achieve the rated output at 20 mph. Testing has shown the necessity of incorporating partial span pitch control, a flexible shaft, yaw control, microprocessor monitored wind condition sensors, and a soft-shell tower to lower vibration hazards with WECS. Large WECS have proved to be relatively nonpolluting, although some television and radio interference is present. Institutional issues for the protection of land, of aircraft flight paths, and for utility interconnect are outlined, and large WECS development programs in Denmark, Sweden, Spain, and Germany are described.

  4. Multiple filamentation Ti:Sapphire-laser pulses in water

    NASA Astrophysics Data System (ADS)

    Apeksimov, D. V.; Bukin, O. A.; Golik, S. S.; Zemlyanov, A. A.; Kabanov, A. M.; Kuchinskaya, O. I.; Mayor, A. Yu.; Matvienko, G. G.; Petrov, A. V.; Sokolova, E. B.

    2015-11-01

    The results of experimental studies of the spatial characteristics of multiple filamentation terawatt femtosecond Ti:Salaser in water are presented. With an increase in initial power laser pulses increases the number of filaments, the length of the field is increased filamentation and reducing the length of the filaments have been shown. The distribution of the filaments in the longitudinal direction of the field of multiple filamentation has a maximum cross-sectional filament is shifted from the center to the periphery of the beam at the end region of filamentation. The minimum diameter of the beam on the track corresponds to the position of the maximum number of filaments. After the point of maximum impulse essentially loses energy in the initial direction of propagation. Upon reaching the pulse power 2 104 Pcr of multiple filamentation area is formed of a hollow cone, the apex directed to the radiation source.

  5. A wake detector for wind farm control

    NASA Astrophysics Data System (ADS)

    Bottasso, C. L.; Cacciola, S.; Schreiber, J.

    2015-06-01

    The paper describes an observer capable of detecting the impingement on a wind turbine rotor of the wake of an upstream machine. The observer estimates the local wind speed and turbulence intensity on the left and right parts of the rotor disk. The estimation is performed based on blade loads measured by strain gages or optical fibers, sensors which are becoming standard equipment on many modern machines. A lower wind speed and higher turbulence intensity on one part of the rotor, possibly in conjunction with other information, can then be used to infer the presence of a wake impinging on the disk. The wake state information is useful for wind plant control strategies, as for example wake deflection by active yawing. In addition, the local wind speed estimates may be used for a rough evaluation of the vertical wind shear.

  6. Hard Machinable Machining of Cobalt Super Alloys

    NASA Astrophysics Data System (ADS)

    ?ep, Robert; Janásek, Adam; Petr?, Jana; ?epová, Lenka; Sadílek, Marek; Kratochvíl, Ji?í

    2012-12-01

    The article deals with difficult-to-machine cobalt super alloys. The main aim is to test the basic properties of cobalt super alloys and propose suitable cutting materials and machining parameters under the designation 188 when machining. Although the development of technology in chipless machining such as moulding, precision casting and other manufacturing methods continues to advance, machining is still the leading choice for piece production, typical for energy and chemical engineering. Nowadays, super alloys are commonly used in turbine engines in regions that are subject to high temperatures, which require high strength, high temperature resistance, phase stability, as well as corrosion or oxidation resistance.

  7. Wind height distribution influence on offshore wind farm feasibility study

    NASA Astrophysics Data System (ADS)

    Benassai, Guido; Della Morte, Renata; Matarazzo, Antonio; Cozzolino, Luca

    2015-04-01

    The economic feasibility of offshore wind power utilization depends on the favourable wind conditions offshore as compared to sites on land. The higher wind speeds have to compensate the additional cost of offshore developments. However, not only the mean wind speed is different, but the whole flow regime, as can be seen in the vertical wind speed profile. The commonly used models to describe this profile have been developed mainly for land sites, so they have to be verified on the basis of field data. Monin-Obukhov theory is often used for the description of the wind speed profile at a different height with respect to a measurement height. Starting from the former, , the profile is predicted using two parameters, Obukhov length and sea surface roughness. For situations with near-neutral and stable atmospheric stratification and long (>30km) fetch, the wind speed increase with height is larger than what is predicted from Monin-Obukhov theory. It is also found that this deviation occurs at wind speeds important for wind power utilization, mainly at 5-9 ms-1. In the present study the influence of these aspects on the potential site productivity of an offshore wind farm were investigated, namely the deviation from the theory of Monin-Obukhov due to atmospheric stability and the influence of the fetch length on the Charnock model. Both these physical effects were discussed and examined in view of a feasibility study of a site for offshore wind farm in Southern Italy. Available data consisted of time histories of wind speeds and directions collected by National Tidegauge Network (Rete Mareografica Nazionale) at the height of 10m a.s.l. in ports. The theory of Monin-Obukhov was used to extrapolate the data to the height of the wind blades, while the Charnock model was used to extend the wind speed on the sea surface from the friction velocity on the ground. The models described were used to perform calculations for a feasibility study of an offshore wind farm in Southern Italy. The potential site productivity was established on the basis of the wind speed distribution function for different heights (site specific) and the power law of the wind turbine considered, as a function of the wind speed at the nacelle height (machine specific). The results of the optimization study for different sites and different wind turbines were compared with the power estimates of Italian Wind Atlas, which provided useful insights for further study.

  8. Erosion: Wind

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Wind erosion refers to the detachment, transport and deposition of sediment by wind. It is a dynamic, physical process where loose, dry, bare soils are transported by strong winds. Wind erosion is a soil degrading process that affects over 500 million ha of land worldwide and creates between 500 an...

  9. Meteorology (Wind)

    Atmospheric Science Data Center

    2014-09-25

    Wind speed at 50 m (m/s) The average and percent difference minimum and ... are given.   Percent of time for ranges of wind speed at 50 m (percent) Percentage [frequency] of time that wind ... be adjusted to heights from 10 to 300 meters using the Gipe power law. Wind speeds may be adjusted for different terrain by selecting from ...

  10. The HWP-300 wind turbine

    NASA Astrophysics Data System (ADS)

    Jamieson, P.; McLeish, D.

    1983-12-01

    A 300 kW, 22 m diameter wind turbine has been designed and erected (July 1983) on the site of the North of Scotland Hydro-Electric Board at Burgar Hill in Orkney. The machine and its design concepts are described.

  11. Stirling machine operating experience

    NASA Technical Reports Server (NTRS)

    Ross, Brad; Dudenhoefer, James E.

    1991-01-01

    Numerous Stirling machines have been built and operated, but the operating experience of these machines is not well known. It is important to examine this operating experience in detail, because it largely substantiates the claim that Stirling machines are capable of reliable and lengthy lives. The amount of data that exists is impressive, considering that many of the machines that have been built are developmental machines intended to show proof of concept, and were not expected to operate for any lengthy period of time. Some Stirling machines (typically free-piston machines) achieve long life through non-contact bearings, while other Stirling machines (typically kinematic) have achieved long operating lives through regular seal and bearing replacements. In addition to engine and system testing, life testing of critical components is also considered.

  12. Women, Men, and Machines.

    ERIC Educational Resources Information Center

    Form, William; McMillen, David Byron

    1983-01-01

    Data from the first national study of technological change show that proportionately more women than men operate machines, are more exposed to machines that have alienating effects, and suffer more from the negative effects of technological change. (Author/SSH)

  13. Reverse vending machine update

    SciTech Connect

    Rypins, S.; Papke, C.

    1986-02-01

    The document discusses reverse vending machines. Placed outdoors in supermarket parking lots or indoors in the lobby of the grocery market, these hightech machines exchange aluminum cans (or other containers in more specialized machines) for cash, coupons or redeemable receipts. The placement of reverse venders (RV) in or near supermarkets has made recycling more visible and more convenient, although the machines have yet to fully reach industry goals.

  14. Wind Power: A Turning Point. Worldwatch Paper 45.

    ERIC Educational Resources Information Center

    Flavin, Christopher

    Recent studies have shown wind power to be an eminently practical and potentially substantial source of electricity and direct mechanical power. Wind machines range from simple water-pumping devices made of wood and cloth to large electricity producing turbines with fiberglass blades nearly 300 feet long. Wind is in effect a form of solar…

  15. Basic Methods to Visualize Actin Filaments In Vitro Using Fluorescence Microscopy for Observation of Filament Severing and Bundling.

    PubMed

    Ono, Shoichiro

    2016-01-01

    Dynamics of actin filaments are regulated by a number of actin-binding proteins. To understand the function of an actin-binding protein, it is necessary to characterize effects of the protein on actin filament dynamics in vitro. This chapter describes basic microscopic methods to visualize fluorescently labeled actin filaments using commonly available fluorescence microscope settings. Direct microscopic observation of actin filaments provides strong evidence for severing or bundling of actin filaments. PMID:26498785

  16. Relationship of Species-Specific Filament Levels to Filamentous Bulking in Activated Sludge

    PubMed Central

    Liao, Jiangying; Lou, Inchio; de los Reyes, Francis L.

    2004-01-01

    To examine the relationship between activated-sludge bulking and levels of specific filamentous bacteria, we developed a statistics-based quantification method for estimating the biomass levels of specific filaments using 16S rRNA-targeted fluorescent in situ hybridization (FISH) probes. The results of quantitative FISH for the filament Sphaerotilus natans were similar to the results of quantitative membrane hybridization in a sample from a full-scale wastewater treatment plant. Laboratory-scale reactors were operated under different flow conditions to develop bulking and nonbulking sludge and were bioaugmented with S. natans cells to stimulate bulking. Instead of S. natans, the filament Eikelboom type 1851 became dominant in the reactors. Levels of type 1851 filaments extending out of the flocs correlated strongly with the sludge volume index, and extended filament lengths of approximately 6 × 108 ?m ml?1 resulted in bulking in laboratory-scale and full-scale activated-sludge samples. Quantitative FISH showed that high levels of filaments occurred inside the flocs in nonbulking sludge, supporting the “substrate diffusion limitation” hypothesis for bulking. The approach will allow the monitoring of incremental improvements in bulking control methods and the delineation of the operational conditions that lead to bulking due to specific filaments. PMID:15066840

  17. Apprentice Machine Theory Outline.

    ERIC Educational Resources Information Center

    Connecticut State Dept. of Education, Hartford. Div. of Vocational-Technical Schools.

    This volume contains outlines for 16 courses in machine theory that are designed for machine tool apprentices. Addressed in the individual course outlines are the following topics: basic concepts; lathes; milling machines; drills, saws, and shapers; heat treatment and metallurgy; grinders; quality control; hydraulics and pneumatics;…

  18. Your Sewing Machine.

    ERIC Educational Resources Information Center

    Peacock, Marion E.

    The programed instruction manual is designed to aid the student in learning the parts, uses, and operation of the sewing machine. Drawings of sewing machine parts are presented, and space is provided for the student's written responses. Following an introductory section identifying sewing machine parts, the manual deals with each part and its…

  19. Fiberglass composite blades for the 4 MW - WTS-4 wind turbine

    NASA Astrophysics Data System (ADS)

    Bussolari, R. J.

    The design and fabrication of composite blades for the WTS-4, a four-megawatt horizontal-axis wind turbine, is discussed. The blade consists of a two-cell, monolithic structure of filament-wound, fiberglass/epoxy composite. Filament winding is a low-cost process which can produce a blade with an aerodynamically efficient airfoil and planform with nonlinear twist to achieve high performance in terms of energy capture. Its retention provides a redundant attachment for long, durable life and safety. Advanced tooling concepts and as sophisticated computer control is used to achieve the unique filament-wound shape.

  20. On the nature of star-forming filaments - I. Filament morphologies

    NASA Astrophysics Data System (ADS)

    Smith, Rowan J.; Glover, Simon C. O.; Klessen, Ralf. S.

    2014-12-01

    We use a suite of high-resolution molecular cloud simulations carried out with the moving mesh code AREPO to explore the nature of star-forming filaments. The simulated filaments are identified and categorized from column density maps in the same manner as for recent Herschel observations. When fitted with a Plummer-like profile, the filaments are in excellent agreement with observations, and have shallow power-law profiles of p ˜ 2.2 without the need for magnetic support. When data within 1 pc of the filament centre are fitted with a Gaussian function, the average full width at half-maximum (FWHM) is ˜0.3 pc, in agreement with predictions for accreting filaments. However, if the fit is constructed using only the inner regions, as in Herschel observations, the resulting FWHM is only ˜0.2 pc. This value is larger than that measured in IC 5146 and Taurus, but is similar to that found in the Planck Galactic cold cores and in Cygnus X. The simulated filaments have a range of widths rather than a constant value. When the column density maps are compared to the 3D gas densities, the filaments seen in column density do not belong to a single structure. Instead, they are made up of a network of short ribbon-like sub-filaments reminiscent of those seen in Taurus. The sub-filaments are pre-existing within the simulated clouds, have radii similar to their Jeans radius, and are not primarily formed through fragmentation of the larger filament seen in column density. Instead, small filamentary clumps are swept together into a single column density structure by the large-scale collapse of the cloud.

  1. The Kinetics Underlying the Velocity of Smooth Muscle Myosin Filament Sliding on Actin Filaments in Vitro*

    PubMed Central

    Haldeman, Brian D.; Brizendine, Richard K.; Facemyer, Kevin C.; Baker, Josh E.; Cremo, Christine R.

    2014-01-01

    Actin-myosin interactions are well studied using soluble myosin fragments, but little is known about effects of myosin filament structure on mechanochemistry. We stabilized unphosphorylated smooth muscle myosin (SMM) and phosphorylated smooth muscle myosin (pSMM) filaments against ATP-induced depolymerization using a cross-linker and attached fluorescent rhodamine (XL-Rh-SMM). Electron micrographs showed that these side polar filaments are very similar to unmodified filaments. They are ?0.63 ?m long and contain ?176 molecules. Rate constants for ATP-induced dissociation and ADP release from acto-myosin for filaments and S1 heads were similar. Actin-activated ATPases of SMM and XL-Rh-SMM were similarly regulated. XL-Rh-pSMM filaments moved processively on F-actin that was bound to a PEG brush surface. ATP dependence of filament velocities was similar to that for solution ATPases at high [actin], suggesting that both processes are limited by the same kinetic step (weak to strong transition) and therefore are attachment-limited. This differs from actin sliding over myosin monomers, which is primarily detachment-limited. Fitting filament data to an attachment-limited model showed that approximately half of the heads are available to move the filament, consistent with a side polar structure. We suggest the low stiffness subfragment 2 (S2) domain remains unhindered during filament motion in our assay. Actin-bound negatively displaced heads will impart minimal drag force because of S2 buckling. Given the ADP release rate, the velocity, and the length of S2, these heads will detach from actin before slack is taken up into a backwardly displaced high stiffness position. This mechanism explains the lack of detachment-limited kinetics at physiological [ATP]. These findings address how nonlinear elasticity in assemblies of motors leads to efficient collective force generation. PMID:24907276

  2. Kinematics of Filaments in Serpens and Perseus

    NASA Astrophysics Data System (ADS)

    Dhabal, Arnab; Mundy, Lee G.; Rizzo, Maxime; Storm, Shaye; Teuben, Peter J.; Chen, Che-Yu; Ostriker, Eve C.

    2016-01-01

    Following up on the CARMA Large Area Star Formation Survey (CLASSy), we observed specific filaments in the Serpens and Perseus clouds using H13CO+, H13CN, and HNC J=1-0 transitions at 7" angular resolution and 0.16 km/s spectral resolution. The isotopologues containing 13C are optically thin; hence they trace the high column density regions of dense gas (ncrit ~ 105 cm-3) better than their more abundant 12C counterparts which were observed previously (Lee et al. 2014). The HNC lines show significant self-absorption features from overlying lower density gas along many lines of sight. Many of the filaments showed velocity gradients perpendicular to the long axis of filaments in H13CO+ and H13CN emission, thereby supporting the model by Chen and Ostriker (2014) in which filaments form in the dense layer created by colliding turbulent cells. The signature velocity gradient occurs because the filaments are primarily accreting material in a 2-D flow within the dense layer.

  3. Interaction and merging of two sinistral filaments

    SciTech Connect

    Jiang, Yunchun; Yang, Jiayan; Liu, Yu; Li, Haidong; Wang, Haimin; Ji, Haisheng; Li, Jianping

    2014-09-20

    In this paper, we report the interaction and subsequent merging of two sinistral filaments (F1 and F2) occurring at the boundary of AR 9720 on 2001 December 6. The two filaments were close and nearly perpendicular to each other. The interaction occurred after F1 was erupted and the eruption was impeded by a more extended filament channel (FC) standing in the way, in which F2 was embedded. The erupted material ran into FC along its axis, causing F1 and F2 to merge into a single structure that subsequently underwent a large-amplitude to-and-fro motion. A significant plasma heating process was observed in the merging process, making the mixed material largely disappear from the H? passband, but appear in Extreme Ultraviolet Telescope 195 Å images for a while. These observations can serve as strong evidence of merging reconnection between the two colliding magnetic structures. A new sinistral filament was formed along FC after the cooling of the merged and heated material. No coronal mass ejection was observed to be associated with the event; though, the eruption was accompanied by a two-ribbon flare with a separation motion, indicating that the eruption had failed. This event shows that, in addition to overlying magnetic fields, such an interaction is an effective restraint to make a filament eruption fail in this way.

  4. Sympathetic Filament Eruptions Connected by Coronal Dimmings

    NASA Astrophysics Data System (ADS)

    Jiang, Yunchun; Yang, Jiayan; Hong, Junchao; Bi, Yi; Zheng, Ruisheng

    2011-09-01

    We present for the first time detailed observations of three successive, interdependent filament eruptions that occurred one by one within 5 hr from different locations beyond the range of a single active region. The first eruption was observed from an active region and was associated with a coronal mass ejection (CME), during which diffuse and complex coronal dimmings formed, largely extending to the two other filaments located in quiet-Sun regions. Then, both quiescent filaments consecutively underwent the second and third eruptions, while the nearby dimmings were persistent. Comparing the result of a derived coronal magnetic configuration, the magnetic connectivity between the dimmings suggested that they were caused by the joint effect of simple expansion of overlying loop systems forced by the first eruption, as well as by its erupting field interacting or reconnecting with the surrounding magnetic structures. Note that the dimming process in the first eruption indicated a weakening and partial removal of an overlying magnetic field constraint on the two other filaments, and thus one can physically connect these eruptions as sympathetic. It appears that the peculiar magnetic field configuration in our event was largely favorable to the occurrence of sympathetic filament eruptions. Because coronal dimmings are frequent and common phenomena in solar eruptions, especially in CME events, it is very likely that they represent a universal agent that can link consecutive eruptions nearby with sympathetic eruptions.

  5. SYMPATHETIC FILAMENT ERUPTIONS CONNECTED BY CORONAL DIMMINGS

    SciTech Connect

    Jiang Yunchun; Yang Jiayan; Hong Junchao; Bi Yi; Zheng Ruisheng

    2011-09-10

    We present for the first time detailed observations of three successive, interdependent filament eruptions that occurred one by one within 5 hr from different locations beyond the range of a single active region. The first eruption was observed from an active region and was associated with a coronal mass ejection (CME), during which diffuse and complex coronal dimmings formed, largely extending to the two other filaments located in quiet-Sun regions. Then, both quiescent filaments consecutively underwent the second and third eruptions, while the nearby dimmings were persistent. Comparing the result of a derived coronal magnetic configuration, the magnetic connectivity between the dimmings suggested that they were caused by the joint effect of simple expansion of overlying loop systems forced by the first eruption, as well as by its erupting field interacting or reconnecting with the surrounding magnetic structures. Note that the dimming process in the first eruption indicated a weakening and partial removal of an overlying magnetic field constraint on the two other filaments, and thus one can physically connect these eruptions as sympathetic. It appears that the peculiar magnetic field configuration in our event was largely favorable to the occurrence of sympathetic filament eruptions. Because coronal dimmings are frequent and common phenomena in solar eruptions, especially in CME events, it is very likely that they represent a universal agent that can link consecutive eruptions nearby with sympathetic eruptions.

  6. Nebulin binding impedes mutant desmin filament assembly

    PubMed Central

    Baker, Laura K.; Gillis, David C.; Sharma, Sarika; Ambrus, Andy; Herrmann, Harald; Conover, Gloria M.

    2013-01-01

    Desmin intermediate filaments (DIFs) form an intricate meshwork that organizes myofibers within striated muscle cells. The mechanisms that regulate the association of desmin to sarcomeres and their role in desminopathy are incompletely understood. Here we compare the effect nebulin binding has on the assembly kinetics of desmin and three desminopathy-causing mutant desmin variants carrying mutations in the head, rod, or tail domains of desmin (S46F, E245D, and T453I). These mutants were chosen because the mutated residues are located within the nebulin-binding regions of desmin. We discovered that, although nebulin M160–164 bound to both desmin tetrameric complexes and mature filaments, all three mutants exhibited significantly delayed filament assembly kinetics when bound to nebulin. Correspondingly, all three mutants displayed enhanced binding affinities and capacities for nebulin relative to wild-type desmin. Electron micrographs showed that nebulin associates with elongated normal and mutant DIFs assembled in vitro. Moreover, we measured significantly delayed dynamics for the mutant desmin E245D relative to wild-type desmin in fluorescence recovery after photobleaching in live-cell imaging experiments. We propose a mechanism by which mutant desmin slows desmin remodeling in myocytes by retaining nebulin near the Z-discs. On the basis of these data, we suggest that for some filament-forming desmin mutants, the molecular etiology of desminopathy results from subtle deficiencies in their association with nebulin, a major actin-binding filament protein of striated muscle. PMID:23615443

  7. Membrane-induced bundling of actin filaments

    NASA Astrophysics Data System (ADS)

    Liu, Allen P.; Richmond, David L.; Maibaum, Lutz; Pronk, Sander; Geissler, Phillip L.; Fletcher, Daniel A.

    2008-10-01

    Dynamic interplay between the plasma membrane and underlying cytoskeleton is essential for cellular shape change. Spatial organization of actin filaments, the growth of which generates membrane deformations during motility, phagocytosis, endocytosis and cytokinesis, is mediated by specific protein-protein interactions that branch, crosslink and bundle filaments into networks that interact with the membrane. Although membrane curvature has been found to influence binding of proteins with curvature-sensitive domains, the direct effect of membrane elasticity on cytoskeletal network organization is not clear. Here, we show through in vitro reconstitution and elastic modelling that a lipid bilayer can drive the emergence of bundled actin filament protrusions from branched actin filament networks, thus playing a role normally attributed to actin-binding proteins. Formation of these filopodium-like protrusions with only a minimal set of purified proteins points to an active participation of the membrane in organizing actin filaments at the plasma membrane. In this way, elastic interactions between the membrane and cytoskeleton can cooperate with accessory proteins to drive cellular shape change.

  8. Feasibility of utilizing wind energy in Thailand

    SciTech Connect

    Jamkrajang, M.

    1984-01-01

    The purpose of this study was to ascertain the feasibility of utilizing wind energy to meet part of the energy demands related to pumping water and to generating electricity for the rural households in Thailand. The data for this study were divided into three different areas: (1) wind speed data, (2) the wind machine performance data, and (3) the rural energy demand data. The wind machine were divided into two categories of water-pumping windmills and electricity-generating wind machines. Three types of water pumping windmills and one type of electricity-generating wind machine were matched with the wind condition in Thailand. They were the multi-blade rotor, the sailwing rotor model (WE 002), the slow-speed sailwing rotor, and the Aerowatt model (1100 FP5G) respectively. It was concluded that, in Thailand: (1) the multiblade rotor and the sail-wing rotor (WE 002) windmill is suitable for pumping water for domestic use at 43 specified locations; (2) the slow-speed sailwing rotor windmill is suitable for pumping water for small irrigation at 32 specified locations; and (3) the Aerowatt model (1100 GP5G) is suitable for generating electricity for household use at 29 specified locations.

  9. Terahertz waves radiated from two noncollinear femtosecond plasma filaments

    NASA Astrophysics Data System (ADS)

    Du, Hai-Wei; Hoshina, Hiromichi; Otani, Chiko; Midorikawa, Katsumi

    2015-11-01

    Terahertz (THz) waves radiated from two noncollinear femtosecond plasma filaments with a crossing angle of 25° are investigated. The irradiated THz waves from the crossing filaments show a small THz pulse after the main THz pulse, which was not observed in those from single-filament scheme. Since the position of the small THz pulse changes with the time-delay of two filaments, this phenomenon can be explained by a model in which the small THz pulse is from the second filament. The denser plasma in the overlap region of the filaments changes the movement of space charges in the plasma, thereby changing the angular distribution of THz radiation. As a result, this schematic induces some THz wave from the second filament to propagate along the path of the THz wave from the first filament. Thus, this schematic alters the direction of the THz radiation from the filamentation, which can be used in THz wave remote sensing.

  10. Galaxy alignment as a probe of large-scale filaments

    NASA Astrophysics Data System (ADS)

    Rong, Yu; Liu, Yuan; Zhang, Shuang-Nan

    2016-01-01

    The orientations of the red galaxies in a filament are aligned with the orientation of the filament. We thus develop a location-alignment-method (LAM) of detecting filaments around clusters of galaxies, which uses both the alignments of red galaxies and their distributions in two-dimensional images. For the first time, the orientations of red galaxies are used as probes of filaments. We apply LAM to the environment of Coma cluster, and find four filaments (two filaments are located in sheets) in two selected regions, which are compared with the filaments detected with the method of Falco et al.. We find that LAM can effectively detect the filaments around a cluster, even with 3σ confidence level, and clearly reveal the number and overall orientations of the detected filaments. LAM is independent of the redshifts of galaxies, and thus can be applied at relatively high redshifts and to the samples of red galaxies without the information of redshifts.

  11. Void galaxy properties depending on void filament straightness

    NASA Astrophysics Data System (ADS)

    Shim, Junsup; Lee, Jounghun; Hoyle, Fiona

    2015-08-01

    We investigate the properties of galaxies belonging to the filaments in cosmic void regions, using the void catalogue constructed by Pan et al. (2012) from the SDSS DR7. To identify galaxy filaments within a void, voids with 30 or more galaxies are selected as a sample. We identify 3172 filaments in 1055 voids by applying the filament finding algorithm utilizing minimal spanning tree (MST) which is an unique linear pattern into which connects all the galaxies in a void. We study the correlations between galaxy properties and the specific size of filament which quantifies the degree of the filament straightness. For example, the average magnitude and the magnitude of the faintest galaxy in filament decrease as the straightness of the filament increases. We also find that the correlations become stronger in rich filaments with many member galaxies than in poor ones. We discuss a physical explanation to our findings and their cosmological implications.

  12. Stator for Rotating Electrical Machine Having Multiple Controlwindings

    SciTech Connect

    Shah, Manoj R.; Lewandowski, Chad R.

    1999-05-05

    A rotating electric machine is provided which includes multiple independent control windings for compensating for rotor imbalances and for levitating/centering the rotor. The multiple independent control windings are placed at different axial locations along the rotor to oppose forces created by imbalances at different axial locations along the rotor. The multiple control windings can also be used to levitate/center the rotor with a relatively small magnetic field per unit area since the rotor and/or the main power winding provides the biasfield.

  13. On the temperature, salinity, velocity and potential vorticity of a cold filament off the southern tip of Sicily

    NASA Astrophysics Data System (ADS)

    Salusti, E.; Bignami, F.

    2012-04-01

    Thermal satellite images relative to the years 1997-2000, analyzed by Bignami et al. (2006), identify the sites of higher frequency in cold filaments in the Mediterranean Sea. The main zones in which these phenomena are seen to occur are characterised by the funnelling of strong cold winds by an irregular coastal orography. Intense air-sea interaction in the coastal zone is indeed known to generate a particularly strong input of potential vorticity into the sea, and this in turn gives origin to cold filaments and jets. These propagate offshore, often driven by the local currents. We therefore analyze thermal satellite images and CTD casts from the SYMPLEX 99 cruise (21 October - 6 November 1999), across a cold filament off Cape Passero, in the Sicily Channel. The filament width is ? 20 km; the thermal anomaly is ? 2 °C; geostrophic and ADCP velocity data reveal that the filament is moving southward with velocities up to 60 cm s-1. Its salinity field has low values in the centre of the filament (about 37.4 psu at 40-60 m depth), while its temperature has classical outcropping isothermals (about 22-23.5 °C) along the centre of the filament. All this suggests the interest of a generalized analysis of temperature, SST, salinty, density, velocity and potential vorticity along-flow evolution of this filament, seen as a set of potential vorticity stream-tubes. The analysis of these jets' evolution gives further insight into the characteristics of their detachment from the coast, alongflow warming, thickening, time-evolution of their velocity and other offshore properties.

  14. Filament Twist in F-Actin Bundles

    NASA Astrophysics Data System (ADS)

    Angelini, Tommy; Sanders, Lori; Wong, Gerard

    2003-03-01

    The twist state of F-actin can modify specific binding sites and influence the hierarchy of interactions in cytoskeletal regulation. F-actin in the cytoskeleton is often organized into bundles, using a wide variety of cationic molecules and actin-linking proteins. The native helical symmetry of uncondensed f-actin filaments is not necessarily the preferred symmetry of bundled filaments, which will depend on the particular bundling mechanism and the kind of condensing agent used. In order to explore the role of filament distortion in the process of bundle formation, we have carried out a series of synchrotron x-ray measurements on systems of bundled f-actin, using multivalent cations, cationic globular proteins, and actin binding proteins. Preliminary results will be presented. This work was supported by NSF DMR-0071761, DOE, DEFG02-91ER45439, the Beckman Young Investigator Program, and the Cystic Fibrosis Foundation.

  15. Random bursts determine dynamics of active filaments.

    PubMed

    Weber, Christoph A; Suzuki, Ryo; Schaller, Volker; Aranson, Igor S; Bausch, Andreas R; Frey, Erwin

    2015-08-25

    Constituents of living or synthetic active matter have access to a local energy supply that serves to keep the system out of thermal equilibrium. The statistical properties of such fluctuating active systems differ from those of their equilibrium counterparts. Using the actin filament gliding assay as a model, we studied how nonthermal distributions emerge in active matter. We found that the basic mechanism involves the interplay between local and random injection of energy, acting as an analog of a thermal heat bath, and nonequilibrium energy dissipation processes associated with sudden jump-like changes in the system's dynamic variables. We show here how such a mechanism leads to a nonthermal distribution of filament curvatures with a non-Gaussian shape. The experimental curvature statistics and filament relaxation dynamics are reproduced quantitatively by stochastic computer simulations and a simple kinetic model. PMID:26261319

  16. Filamentous Bacteriophage Promote Biofilm Assembly and Function.

    PubMed

    Secor, Patrick R; Sweere, Johanna M; Michaels, Lia A; Malkovskiy, Andrey V; Lazzareschi, Daniel; Katznelson, Ethan; Rajadas, Jayakumar; Birnbaum, Michael E; Arrigoni, Allison; Braun, Kathleen R; Evanko, Stephen P; Stevens, David A; Kaminsky, Werner; Singh, Pradeep K; Parks, William C; Bollyky, Paul L

    2015-11-11

    Biofilms-communities of bacteria encased in a polymer-rich matrix-confer bacteria with the ability to persist in pathologic host contexts, such as the cystic fibrosis (CF) airways. How bacteria assemble polymers into biofilms is largely unknown. We find that the extracellular matrix produced by Pseudomonas aeruginosa self-assembles into a liquid crystal through entropic interactions between polymers and filamentous Pf bacteriophages, which are long, negatively charged filaments. This liquid crystalline structure enhances biofilm function by increasing adhesion and tolerance to desiccation and antibiotics. Pf bacteriophages are prevalent among P. aeruginosa clinical isolates and were detected in CF sputum. The addition of Pf bacteriophage to sputum polymers or serum was sufficient to drive their rapid assembly into viscous liquid crystals. Fd, a related bacteriophage of Escherichia coli, has similar biofilm-building capabilities. Targeting filamentous bacteriophage or the liquid crystalline organization of the biofilm matrix may represent antibacterial strategies. PMID:26567508

  17. Filament velocity scaling laws for warm ions

    SciTech Connect

    Manz, P.; Max-Planck-Institut für Plasmaphysik, EURATOM Assoziation, Boltzmannstr. 2, 85748 Garching ; Carralero, D.; Birkenmeier, G.; Müller, H. W.; Scott, B. D.; Müller, S. H.; Fuchert, G.; Stroth, U.; Physik-Department E28, Technische Universität München, James-Franck-Str. 1, 85748 Garching

    2013-10-15

    The dynamics of filaments or blobs in the scrape-off layer of magnetic fusion devices are studied by magnitude estimates of a comprehensive drift-interchange-Alfvén fluid model. The standard blob models are reproduced in the cold ion case. Even though usually neglected, in the scrape-off layer, the ion temperature can exceed the electron temperature by an order of magnitude. The ion pressure affects the dynamics of filaments amongst others by adding up to the interchange drive and the polarisation current. It is shown how both effects modify the scaling laws for filament velocity in dependence of its size. Simplifications for experimentally relevant limit regimes are given. These are the sheath dissipation, collisional, and electromagnetic regime.

  18. SOLAR MAGNETIZED 'TORNADOES': RELATION TO FILAMENTS

    SciTech Connect

    Su Yang; Veronig, Astrid; Temmer, Manuela; Wang Tongjiang; Gan Weiqun

    2012-09-10

    Solar magnetized 'tornadoes', a phenomenon discovered in the solar atmosphere, appear as tornado-like structures in the corona but are rooted in the photosphere. Like other solar phenomena, solar tornadoes are a feature of magnetized plasma and therefore differ distinctly from terrestrial tornadoes. Here we report the first analysis of solar 'tornadoes' (two papers which focused on different aspects of solar tornadoes were published in the Astrophysical Journal Letters and Nature, respectively, during the revision of this Letter). A detailed case study of two events indicates that they are rotating vertical magnetic structures probably driven by underlying vortex flows in the photosphere. They usually exist as a group and are related to filaments/prominences, another important solar phenomenon whose formation and eruption are still mysteries. Solar tornadoes may play a distinct role in the supply of mass and twists to filaments. These findings could lead to a new explanation of filament formation and eruption.

  19. Random bursts determine dynamics of active filaments

    PubMed Central

    Weber, Christoph A.; Suzuki, Ryo; Schaller, Volker; Aranson, Igor S.; Bausch, Andreas R.; Frey, Erwin

    2015-01-01

    Constituents of living or synthetic active matter have access to a local energy supply that serves to keep the system out of thermal equilibrium. The statistical properties of such fluctuating active systems differ from those of their equilibrium counterparts. Using the actin filament gliding assay as a model, we studied how nonthermal distributions emerge in active matter. We found that the basic mechanism involves the interplay between local and random injection of energy, acting as an analog of a thermal heat bath, and nonequilibrium energy dissipation processes associated with sudden jump-like changes in the system’s dynamic variables. We show here how such a mechanism leads to a nonthermal distribution of filament curvatures with a non-Gaussian shape. The experimental curvature statistics and filament relaxation dynamics are reproduced quantitatively by stochastic computer simulations and a simple kinetic model. PMID:26261319

  20. Introducing a selectively biodegradable filament wound arterial prosthesis: a short-term implantation study.

    PubMed

    Cohn, D; Elchai, Z; Gershon, B; Karck, M; Lazarovici, G; Sela, J; Chandra, M; Marom, G; Uretzky, G

    1992-09-01

    This article introduces a new compliant and selectively biodegradable filament wound vascular graft and reports the findings of a short-term implantation study. A basic feature of filament winding is its ability to tailor and better control the mechanical properties of the prosthesis, so that a closer match with the anisotropic properties of native arteries is achieved. The elastomeric vascular grafts comprise poly(ether urethane urea) fibers (Lycra) embedded in a two-component matrix consisting of poly(ether urethane) (Pellethane) and a highly flexible poly(ethylene glycol)/poly(lactic acid) biodegradable segmented copolymer (PELA). Typical tensile modulus values fall in the few megapascals (MPa) range, this being comparable to that of natural arteries. The wound graft exhibits excellent handling and suturability characteristics as well as enhanced burst strength. Furthermore, due to its biodegradable constituent, the prosthesis combines minimal intraoperative blood loss and high healing porosity. The graft displays initially negligible in vitro water permeation, which increases gradually with time. In this short-term study, the prostheses were implanted in the canine carotid, and their biological performance was compared to that of expanded Gore-Tex. The luminal surface of the wound grafts was coated with a thin layer of pseudointima, strongly adhered to the prosthesis surface. Contrasting with the very stiff Gore-Tex grafts, the filament wound prostheses retained their high compliance, being highly pulsatile upon explanation. Histological studies fully corroborated these findings, underscoring the healing properties of these new filament wound vascular prostheses. PMID:1429766

  1. Numerical simulation of vortex breakdown by the vortex-filament method

    NASA Technical Reports Server (NTRS)

    Nakamura, Y.; Leonard, A.; Spalart, P. R.

    1983-01-01

    The vortex-filament method was applied to the simulation of vortex breakdown. The principal vortex region was represented by multiple filaments, and an axial velocity component was induced by a spiral winding of the filaments. An accuracy check was performed for a cylindrical swirling flow with simple analytical expressions for the axial and theta velocities. The result suggests that the flow field can be simulated to any accuracy by increasing the number of filaments. An axisymmetric-type vortex breakdown was simulated, with experimental data serving as upstream conditions. The calculated axial- and theta-velocity contours show the breakdown of the vortex, including a rapid change in the vortex core, followed axially by a recovery zone and then a second breakdown. When three dimensional initial data are used the second breakdown appears to be of the spiral type in correspondence with experimental observations. The present method can easily be used to simulate other types of vortex breakdown or other vortex flows with axial velocity.

  2. ?-Helical architecture of cytoskeletal bactofilin filaments revealed by solid-state NMR

    PubMed Central

    Vasa, Suresh; Lin, Lin; Shi, Chaowei; Habenstein, Birgit; Riedel, Dietmar; Kühn, Juliane; Thanbichler, Martin; Lange, Adam

    2015-01-01

    Bactofilins are a widespread class of bacterial filament-forming proteins, which serve as cytoskeletal scaffolds in various cellular pathways. They are characterized by a conserved architecture, featuring a central conserved domain (DUF583) that is flanked by variable terminal regions. Here, we present a detailed investigation of bactofilin filaments from Caulobacter crescentus by high-resolution solid-state NMR spectroscopy. De novo sequential resonance assignments were obtained for residues Ala39 to Phe137, spanning the conserved DUF583 domain. Analysis of the secondary chemical shifts shows that this core region adopts predominantly ?-sheet secondary structure. Mutational studies of conserved hydrophobic residues located in the identified ?-strand segments suggest that bactofilin folding and polymerization is mediated by an extensive and redundant network of hydrophobic interactions, consistent with the high intrinsic stability of bactofilin polymers. Transmission electron microscopy revealed a propensity of bactofilin to form filament bundles as well as sheet-like, 2D crystalline assemblies, which may represent the supramolecular arrangement of bactofilin in the native context. Based on the diffraction pattern of these 2D crystalline assemblies, scanning transmission electron microscopy measurements of the mass per length of BacA filaments, and the distribution of ?-strand segments identified by solid-state NMR, we propose that the DUF583 domain adopts a ?-helical architecture, in which 18 ?-strand segments are arranged in six consecutive windings of a ?-helix. PMID:25550503

  3. Bending of nanoscale filament assemblies by elastocapillary densification

    NASA Astrophysics Data System (ADS)

    Zhao, Zhouzhou; Tawfick, Sameh H.; Park, Sei Jin; de Volder, Michael; Hart, A. John; Lu, Wei

    2010-10-01

    We report a mechanism by which nanoscale filaments self-assemble into asymmetric aggregates by elastocapillary action. Specifically, capillary rise of liquid into an asymmetric pattern of vertically aligned filaments causes the filaments to deflect laterally during elastocapillary densification. We quantitatively show that the lateral deflection can be controlled precisely by the pattern shape and the coupling strength among the filaments. We exploit this mechanism to fabricate asymmetric micropillars and multidirectional bridges of densely packed carbon nanotubes. Analogous behavior occurs as biological filaments interact with liquids, and these findings enable scalable fabrication of anisotropic filament assemblies for manipulating surface interactions between solids and liquids.

  4. Perspex machine: VII. The universal perspex machine

    NASA Astrophysics Data System (ADS)

    Anderson, James A. D. W.

    2006-01-01

    The perspex machine arose from the unification of projective geometry with the Turing machine. It uses a total arithmetic, called transreal arithmetic, that contains real arithmetic and allows division by zero. Transreal arithmetic is redefined here. The new arithmetic has both a positive and a negative infinity which lie at the extremes of the number line, and a number nullity that lies off the number line. We prove that nullity, 0/0, is a number. Hence a number may have one of four signs: negative, zero, positive, or nullity. It is, therefore, impossible to encode the sign of a number in one bit, as floating-point arithmetic attempts to do, resulting in the difficulty of having both positive and negative zeros and NaNs. Transrational arithmetic is consistent with Cantor arithmetic. In an extension to real arithmetic, the product of zero, an infinity, or nullity with its reciprocal is nullity, not unity. This avoids the usual contradictions that follow from allowing division by zero. Transreal arithmetic has a fixed algebraic structure and does not admit options as IEEE, floating-point arithmetic does. Most significantly, nullity has a simple semantics that is related to zero. Zero means "no value" and nullity means "no information." We argue that nullity is as useful to a manufactured computer as zero is to a human computer. The perspex machine is intended to offer one solution to the mind-body problem by showing how the computable aspects of mind and, perhaps, the whole of mind relates to the geometrical aspects of body and, perhaps, the whole of body. We review some of Turing's writings and show that he held the view that his machine has spatial properties. In particular, that it has the property of being a 7D lattice of compact spaces. Thus, we read Turing as believing that his machine relates computation to geometrical bodies. We simplify the perspex machine by substituting an augmented Euclidean geometry for projective geometry. This leads to a general-linear perspex-machine which is very much easier to program than the original perspex-machine. We then show how to map the whole of perspex space into a unit cube. This allows us to construct a fractal of perspex machines with the cardinality of a real-numbered line or space. This fractal is the universal perspex machine. It can solve, in unit time, the halting problem for itself and for all perspex machines instantiated in real-numbered space, including all Turing machines. We cite an experiment that has been proposed to test the physical reality of the perspex machine's model of time, but we make no claim that the physical universe works this way or that it has the cardinality of the perspex machine. We leave it that the perspex machine provides an upper bound on the computational properties of physical things, including manufactured computers and biological organisms, that have a cardinality no greater than the real-number line.

  5. Polarized radio filaments outside the Galactic plane

    NASA Astrophysics Data System (ADS)

    Vidal, Matias; Dickinson, C.; Davies, R. D.; Leahy, J. P.

    2015-09-01

    We used data from the WMAP satellite at 23, 33 and 41 GHz to study the diffuse polarized emission over the entire sky. The emission originates mostly from filamentary structures with well-ordered magnetic fields. Some of these structures have been known for decades in radio continuum maps. Their origin is not clear and there are many filaments that are visible for the first time. We have identified and studied 11 filaments. The polarization fraction of some of them can be as high as 40 per cent, which is a signature of a well-ordered magnetic field. The polarization spectral indices, averaged over 18 regions in the sky is ? = -3.06 ± 0.02, consistent with synchrotron radiation. There are significant variations in ? over the sky (?? ? 0.2). We explore the link between the large-scale filaments and the local interstellar medium, using the model of an expanding shell in the solar vicinity. We compared observed polarization angles with the predictions from the model and found good agreement. This strongly suggests that many large-scale filaments and loops are nearby structures. This is important in the context of the Galactic magnetic field as these structures are normally included in global models, neglecting the fact that they might be local. We also studied the level of contamination added by the diffuse filaments to the CMB (cosmic microwave background) polarization power spectra. We conclude that, even though these filaments present low radio brightness, a careful removal will be necessary for future all-sky CMB polarization analysis.

  6. Damage Model and Progressive Failure Analyses for Filament Wound Composite Laminates

    NASA Astrophysics Data System (ADS)

    Ribeiro, Marcelo Leite; Vandepitte, Dirk; Tita, Volnei

    2013-10-01

    Recent improvements in manufacturing processes and materials properties associated with excellent mechanical characteristics and low weight have made composite materials very attractive for application on civil aircraft structures. However, even new designs are still very conservative, because the composite failure phenomenon is very complex. Several failure criteria and theories have been developed to describe the damage process and how it evolves, but the solution of the problem is still open. Moreover, modern filament winding techniques have been used to produce a wide variety of structural shapes not only cylindrical parts, but also “flat” laminates. Therefore, this work presents the development of a damage model and its application to simulate the progressive failure of flat composite laminates made using a filament winding process. The damage model was implemented as a UMAT (User Material Subroutine), in ABAQUSTM Finite Element (FE) framework. Progressive failure analyses were carried out using FE simulation in order to simulate the failure of flat filament wound composite structures under different loading conditions. In addition, experimental tests were performed in order to identify parameters related to the material model, as well as to evaluate both the potential and the limitations of the model. The difference between numerical and the average experimental results in a four point bending set-up is only 1.6 % at maximum load amplitude. Another important issue is that the model parameters are not so complicated to be identified. This characteristic makes this model very attractive to be applied in an industrial environment.

  7. Filamentary structures in dense plasma focus: Current filaments or vortex filaments?

    NASA Astrophysics Data System (ADS)

    Soto, Leopoldo; Pavez, Cristian; Castillo, Fermin; Veloso, Felipe; Moreno, José; Auluck, S. K. H.

    2014-07-01

    Recent observations of an azimuthally distributed array of sub-millimeter size sources of fusion protons and correlation between extreme ultraviolet (XUV) images of filaments with neutron yield in PF-1000 plasma focus have re-kindled interest in their significance. These filaments have been described variously in literature as current filaments and vortex filaments, with very little experimental evidence in support of either nomenclature. This paper provides, for the first time, experimental observations of filaments on a table-top plasma focus device using three techniques: framing photography of visible self-luminosity from the plasma, schlieren photography, and interferometry. Quantitative evaluation of density profile of filaments from interferometry reveals that their radius closely agrees with the collision-less ion skin depth. This is a signature of relaxed state of a Hall fluid, which has significant mass flow with equipartition between kinetic and magnetic energy, supporting the "vortex filament" description. This interpretation is consistent with empirical evidence of an efficient energy concentration mechanism inferred from nuclear reaction yields.

  8. Geometrically frustrated filament assemblies: Unravelling the connection between bundle shape and inter-filament order

    NASA Astrophysics Data System (ADS)

    Grason, Gregory

    2014-03-01

    From steel cables and textile fibers to filamentous protein bundles in cells and tissues, densely-packed assemblies of filaments are vital structural elements of the worlds around us and inside of us. Despite the ubiquity and utility of dense-filament assemblies in such diverse materials (across 7 orders of magnitude in size!) surprisingly little is known about the fundamental rules that govern their structure. This talk will discuss recent progress in our understanding of the non-linear relationship between the geometry of a rope-like assembly and the structure and energetics of inter-filament packing. In particular, we focus on mathematical models of the geometric frustration between twist - as in macroscopic cables or chiral biofilament bundles - and the preference for isometric, or ``constant spacing,'' packing of filaments in the cross section. Any measure of twist makes it geometrically impossible to evenly space filaments in bundles, begging the question what is the optimal packing of a twisted bundle? We show that geometry of interfilament contact can be mapped formally onto a problem of packing on a 2D non-Euclidean surfaces, whose intrinsically-curved geometry points to the necessity of a complex spectrum defects in the ground-state packing. We confirm the existence of defects and their sensitivity to bundle twist and radius through simulations of energy-minimizing assemblies of cohesive filaments.

  9. Structure of Flexible Filamentous Plant Viruses

    SciTech Connect

    Kendall, Amy; McDonald, Michele; Bian, Wen; Bowles, Timothy; Baumgarten, Sarah C.; Shi, Jian; Stewart, Phoebe L.; Bullitt, Esther; Gore, David; Irving, Thomas C.; Havens, Wendy M.; Ghabrial, Said A.; Wall, Joseph S.; Stubbs, Gerald

    2008-10-23

    Flexible filamentous viruses make up a large fraction of the known plant viruses, but in comparison with those of other viruses, very little is known about their structures. We have used fiber diffraction, cryo-electron microscopy, and scanning transmission electron microscopy to determine the symmetry of a potyvirus, soybean mosaic virus; to confirm the symmetry of a potexvirus, potato virus X; and to determine the low-resolution structures of both viruses. We conclude that these viruses and, by implication, most or all flexible filamentous plant viruses share a common coat protein fold and helical symmetry, with slightly less than 9 subunits per helical turn.

  10. Current Filamentation Instability in Laser Wakefield Accelerators

    SciTech Connect

    Huntington, C. M.; Drake, R. P.; Thomas, A. G. R.; McGuffey, C.; Matsuoka, T.; Chvykov, V.; Kalintchenko, G.; Yanovsky, V.; Maksimchuk, A.; Krushelnick, K.; Kneip, S.; Najmudin, Z.; Palmer, C.; Katsouleas, T.

    2011-03-11

    Experiments using an electron beam produced by laser-wakefield acceleration have shown that varying the overall beam-plasma interaction length results in current filamentation at lengths that exceed the laser depletion length in the plasma. Three-dimensional simulations show this to be a combination of hosing, beam erosion, and filamentation of the decelerated beam. This work suggests the ability to perform scaled experiments of astrophysical instabilities. Additionally, understanding the processes involved with electron beam propagation is essential to the development of wakefield accelerator applications.

  11. Generation of Stable Overlaps between Antiparallel Filaments

    NASA Astrophysics Data System (ADS)

    Johann, D.; Goswami, D.; Kruse, K.

    2015-09-01

    During cell division, sister chromatids are segregated by the mitotic spindle, a bipolar assembly of interdigitating antiparallel polar filaments called microtubules. Establishing a stable overlap region is essential for maintenance of bipolarity, but the underlying mechanisms are poorly understood. Using a particle-based stochastic model, we find that the interplay of motors and passive cross-linkers can robustly generate partial overlaps between antiparallel filaments. In this situation, motors reduce the overlap in a length-dependent manner, whereas passive cross-linkers increase it independently of the length. In addition to maintaining structural integrity, passive cross-linkers can thus also have a dynamic role for overlap size regulation.

  12. Infrared Radiation Filament And Metnod Of Manufacture

    DOEpatents

    Johnson, Edward A.

    1998-11-17

    An improved IR radiation source is provided by the invention. A radiation filament has a textured surface produced by seeded ion bombardment of a metal foil which is cut to a serpentine shape and mounted in a windowed housing. Specific ion bombardment texturing techniques tune the surface to maximize emissions in the desired wavelength range and to limit emissions outside that narrow range, particularly at longer wavelengths. A combination of filament surface texture, thickness, material, shape and power circuit feedback control produce wavelength controlled and efficient radiation at much lower power requirements than devices of the prior art.

  13. Design, evaluation, and fabrication of low-cost composite blades for intermediate-size wind turbines

    SciTech Connect

    Weingart, O.

    1981-09-01

    The low-cost composite blade program is described, involving design, evaluation and fabrication of a pair of low-cost composite rotor blades (LCCB) for the MOD-0A wind turbine. The objectives of the program were to identify low cost approaches to the design and fabrication of blades for a two-bladed 200 kW wind turbine and to assess the applicability of the techniques to larger and smaller blades. In Phase I of the program, several blade designs were developed to the point where reasonably accurate estimates could be made of the structural properties and costs of tooling and fabrication. The most cost-effective design was selected for detailed design in Phase II. Structural analysis of the selected design was performed, with assistance from NASA in some of the more specialized techniques (e.g. flutter analysis). Subelement and subscale specimens were fabricated in Phase I for testing. Blade tooling was designed and fabricated. Major items included a 60 ft D-spar mandrel and its supports, a 60 ft cure oven with a 200 kW heater, and a transverse filament tape (TFT) pre-impregnation station. Two complete blades and a partial blade for tool tryout were built. A 100 ft long ring-winder machine was designed and built.

  14. Wind Turbine

    USGS Multimedia Gallery

    The species of bats that are most susceptible to wind turbines all roost in trees throughout the year, leading some scientists to speculate that they may be visually mistaking wind turbines for trees in which to roost....

  15. Fault Tolerant State Machines

    NASA Technical Reports Server (NTRS)

    Burke, Gary R.; Taft, Stephanie

    2004-01-01

    State machines are commonly used to control sequential logic in FPGAs and ASKS. An errant state machine can cause considerable damage to the device it is controlling. For example in space applications, the FPGA might be controlling Pyros, which when fired at the wrong time will cause a mission failure. Even a well designed state machine can be subject to random errors us a result of SEUs from the radiation environment in space. There are various ways to encode the states of a state machine, and the type of encoding makes a large difference in the susceptibility of the state machine to radiation. In this paper we compare 4 methods of state machine encoding and find which method gives the best fault tolerance, as well as determining the resources needed for each method.

  16. Machine tool locator

    DOEpatents

    Hanlon, John A.; Gill, Timothy J.

    2001-01-01

    Machine tools can be accurately measured and positioned on manufacturing machines within very small tolerances by use of an autocollimator on a 3-axis mount on a manufacturing machine and positioned so as to focus on a reference tooling ball or a machine tool, a digital camera connected to the viewing end of the autocollimator, and a marker and measure generator for receiving digital images from the camera, then displaying or measuring distances between the projection reticle and the reference reticle on the monitoring screen, and relating the distances to the actual position of the autocollimator relative to the reference tooling ball. The images and measurements are used to set the position of the machine tool and to measure the size and shape of the machine tool tip, and examine cutting edge wear. patent

  17. Machine-augmented composites

    NASA Astrophysics Data System (ADS)

    Hawkins, Gary F.; O'Brien, Michael; Zaldivar, Rafael; von Bremen, Hubertus

    2002-07-01

    We have recently demonstrated that composites with unique properties can be manufactured by embedding many small simple machines in a matrix instead of fibers. We have been referring to these as Machine Augmented Composites (MAC). The simple machines modify the forces inside the material in a manner chosen by the material designer. When these machines are densely packed, the MAC takes on the properties of the machines as a fiber-reinforced composite takes on the properties of the fibers. In this paper we describe the Machine Augmented Composite concept and give the results of both theoretical and experimental studies. Applications for the material in clamping mechanisms, fasteners, gaskets and seals are presented. In addition, manufacturing issues are discussed showing how the material can be produced inexpensively.

  18. Questions Concerning the Disconnection and Eruption of Filaments and CMEs

    NASA Technical Reports Server (NTRS)

    Kucera, Theresa

    2007-01-01

    Reviews examples of eruptions and failed eruptions of filaments and CMEs and review questions concerning the processes and mechanisms involved. Where and how does disconnection occur? What can we learn (if anything!) about CME eruptions by observing related filament eruptions?

  19. SDO Watches Giant Filament on the Sun - Duration: 13 seconds.

    NASA Video Gallery

    A snaking, extended filament of solar material currently lies on the front of the sun-- some 1 million miles across from end to end. Filaments are clouds of solar material suspended above the sun b...

  20. Dynamics of filament formation in a Kerr medium

    SciTech Connect

    Centurion, Martin; Pu Ye; Tsang, Mankei; Psaltis, Demetri

    2005-06-15

    We have studied the large-scale beam breakup and filamentation of femtosecond pulses in a Kerr medium. We have experimentally monitored the formation of stable light filaments, conical emission, and interactions between filaments. Three major stages lead to the formation of stable light filaments: First the beam breaks up into a pattern of connected lines (constellation), then filaments form on the constellations, and finally the filaments release a fraction of their energy through conical emission. We observed a phase transition to a faster filamentation rate at the onset of conical emission. We attribute this to the interaction of conical emissions with the constellation which creates additional filaments. Numerical simulations show good agreement with the experimental results.

  1. SDO Sees a Dark Filament Circle - Duration: 19 seconds.

    NASA Video Gallery

    A dark, almost circular filament broke away from the sun in a gauzy, feathery swirl, on Nov. 15, 2015, in this video from NASA’s Solar Dynamics Observatory. This filament eruption was followed by a...

  2. Ultrasonic evaluation of mechanical properties of thick, multilayered, filament wound composites

    NASA Technical Reports Server (NTRS)

    Kautz, H. E.

    1985-01-01

    A preliminary investigation is conducted to define capabilities and limitations of ultrasonic and acousto-ultrasonic measurements related to mechanical properties of filament wound graphite/epoxy composite structures. The structures studied are segments of filament wound cylinders formed of multiple layers of hoop and helical windings. The segments consist of 24 to 35 layers and range from 3.02 to 3.34 cm in wall thickness. The resultant structures are anisotropic, heterogeneous, porous, and highly attenuating to ultrasonic frequencies greater than 1 MHz. The segments represent structures to be used for space shuttle booster cases. Ultrasonic velocity and acousto-ultrasonic stress wave factor measurement approaches are discussed. Correlations among velocity, density, and porosity, and between the acousto-ultrasonic stress wave factor and interlaminar shear strength are presented.

  3. Variabilities detected by acoustic emission from filament-wound Aramid fiber/epoxy composite pressure vessels

    NASA Technical Reports Server (NTRS)

    Hamstad, M. A.

    1978-01-01

    Two hundred and fifty Aramid fiber/epoxy pressure vessels were filament-wound over spherical aluminum mandrels under controlled conditions typical for advanced filament-winding. A random set of 30 vessels was proof-tested to 74% of the expected burst pressure; acoustic emission data were obtained during the proof test. A specially designed fixture was used to permit in situ calibration of the acoustic emission system for each vessel by the fracture of a 4-mm length of pencil lead (0.3 mm in diameter) which was in contact with the vessel. Acoustic emission signatures obtained during testing showed larger than expected variabilities in the mechanical damage done during the proof tests. To date, identification of the cause of these variabilities has not been determined.

  4. Residual stress analysis in forming process of filament wound thick-walled CFRP pipes

    SciTech Connect

    Kondo, Toshimi; Sekine, Hideki; Nakano, Kunio

    1995-11-01

    Residual stress analysis for the cracking phenomenon of filament would thick-walled CFRP pipes, which frequently occurs in the forming process of curing and thermal cycling through the course of the wet filament winding, was made from both the experimental and theoretical points of view. A simple analytical model to study the cracking in the CFRP pipes was proposed. The pipes are multilayered and reinforced in the axial and circumferential directions alternatively by carbon fibers. Taking account of the anisotropy of mechanical and thermal properties including the shrinkage strain, which depend considerably on the temperature, the residual stresses in the CFRP pipes were elucidated in the forming process, particularly, in cooling of the cure process.

  5. SECONDARY METABOLIC GENE CLUSTERS IN FILAMENTOUS FUNGI

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Filamentous fungi produce a number of secondary metabolic compounds that have been shown to be both of great value (i.e. antibiotics and anti-hypercholesterolemics) and great harm (i.e. aflatoxins and trichothecenes). The genes responsible for producing the secondary metabolite are often clustered ...

  6. Light bullets from a femtosecond filament

    NASA Astrophysics Data System (ADS)

    Chekalin, S. V.; Dokukina, A. E.; Dormidonov, A. E.; Kompanets, V. O.; Smetanina, E. O.; Kandidov, V. P.

    2015-05-01

    The scenario of the formation of light bullets in the presence of anomalous group velocity dispersion is presented within the same general scenario for condensed matter and humid air. The temporal and spectral parameters of light bullets during filamentation in fused silica and humid air are obtained. A light bullet (LB) is a short-lived formation in a femtosecond filament with a high spatiotemporal light field localization. The sequence formation of the quasi-periodical LB is obtained numerically and is confirmed experimentally by autocorrelation measurements of the LB’s duration. The estimation of the LB duration reaches few-cycle value. It is established that the generation of each LB is accompanied by the ejection of a supercontinuum (SC) in the visible spectrum and an isolated anti-Stokes wing is formed in the visible area of the SC as a result of destructive interference of broadband spectral components. It was found that the energy of a visible SC increases discretely according to the number of LBs in the filament. We demonstrated that the model of ionization in solid dielectric which is used in numerical simulation fundamentally affects the obtained scenario of LB formation. The possibility of the formation of LBs under the filamentation of middle-IR pulses in the atmosphere was shown with numerical simulation.

  7. Filament Guides for Silicon-Ribbon Growth

    NASA Technical Reports Server (NTRS)

    Morrison, A. D.

    1985-01-01

    Contamination reduced in modified growth system. In Silicon-ribbongrowth apparatus, capillary filament guides are integral parts of crucible, extending from bottom to top of melt. Addition of guides expected to result in better thermal control of growth process and higher silicon purity.

  8. Using Drosophila for Studies of Intermediate Filaments.

    PubMed

    Bohnekamp, Jens; Cryderman, Diane E; Thiemann, Dylan A; Magin, Thomas M; Wallrath, Lori L

    2016-01-01

    Drosophila melanogaster is a useful organism for determining protein function and modeling human disease. Drosophila offers a rapid generation time and an abundance of genomic resources and genetic tools. Conservation in protein structure, signaling pathways, and developmental processes make studies performed in Drosophila relevant to other species, including humans. Drosophila models have been generated for neurodegenerative diseases, muscular dystrophy, cancer, and many other disorders. Recently, intermediate filament protein diseases have been modeled in Drosophila. These models have revealed novel mechanisms of pathology, illuminated potential new routes of therapy, and make whole organism compound screens feasible. The goal of this chapter is to outline steps to study intermediate filament function and model intermediate filament-associated diseases in Drosophila. The steps are general and can be applied to study the function of almost any protein. The protocols outlined here are for both the novice and experienced Drosophila researcher, allowing the rich developmental and cell biology that Drosophila offers to be applied to studies of intermediate filaments. PMID:26795490

  9. Light sources based on semiconductor current filaments

    DOEpatents

    Zutavern, Fred J.; Loubriel, Guillermo M.; Buttram, Malcolm T.; Mar, Alan; Helgeson, Wesley D.; O'Malley, Martin W.; Hjalmarson, Harold P.; Baca, Albert G.; Chow, Weng W.; Vawter, G. Allen

    2003-01-01

    The present invention provides a new type of semiconductor light source that can produce a high peak power output and is not injection, e-beam, or optically pumped. The present invention is capable of producing high quality coherent or incoherent optical emission. The present invention is based on current filaments, unlike conventional semiconductor lasers that are based on p-n junctions. The present invention provides a light source formed by an electron-hole plasma inside a current filament. The electron-hole plasma can be several hundred microns in diameter and several centimeters long. A current filament can be initiated optically or with an e-beam, but can be pumped electrically across a large insulating region. A current filament can be produced in high gain photoconductive semiconductor switches. The light source provided by the present invention has a potentially large volume and therefore a potentially large energy per pulse or peak power available from a single (coherent) semiconductor laser. Like other semiconductor lasers, these light sources will emit radiation at the wavelength near the bandgap energy (for GaAs 875 nm or near infra red). Immediate potential applications of the present invention include high energy, short pulse, compact, low cost lasers and other incoherent light sources.

  10. Conformational phases of membrane bound cytoskeletal filaments

    NASA Astrophysics Data System (ADS)

    Quint, David A.; Grason, Gregory; Gopinathan, Ajay

    2013-03-01

    Membrane bound cytoskeletal filaments found in living cells are employed to carry out many types of activities including cellular division, rigidity and transport. When these biopolymers are bound to a membrane surface they may take on highly non-trivial conformations as compared to when they are not bound. This leads to the natural question; What are the important interactions which drive these polymers to particular conformations when they are bound to a surface? Assuming that there are binding domains along the polymer which follow a periodic helical structure set by the natural monomeric handedness, these bound conformations must arise from the interplay of the intrinsic monomeric helicity and membrane binding. To probe this question, we study a continuous model of an elastic filament with intrinsic helicity and map out the conformational phases of this filament for various mechanical and structural parameters in our model, such as elastic stiffness and intrinsic twist of the filament. Our model allows us to gain insight into the possible mechanisms which drive real biopolymers such as actin and tubulin in eukaryotes and their prokaryotic cousins MreB and FtsZ to take on their functional conformations within living cells.

  11. Debugging the virtual machine

    SciTech Connect

    Miller, P.; Pizzi, R.

    1994-09-02

    A computer program is really nothing more than a virtual machine built to perform a task. The program`s source code expresses abstract constructs using low level language features. When a virtual machine breaks, it can be very difficult to debug because typical debuggers provide only low level machine implementation in formation to the software engineer. We believe that the debugging task can be simplified by introducing aspects of the abstract design into the source code. We introduce OODIE, an object-oriented language extension that allows programmers to specify a virtual debugging environment which includes the design and abstract data types of the virtual machine.

  12. Evaluation of machinability data

    SciTech Connect

    Jin, L.Z.; Sandstroem, R. . Division of Materials Technology)

    1994-05-01

    Systematic materials selection is essential to fulfill the design criteria. Reliable information on material properties, in turn, is a vital factor for approaching such an objective. The machinability of engineering metals, owing to the marked influence on the production costs, has to be taken into account in the process of materials selection. In an attempt to develop a method for estimating the machinability of engineering metals, machinability data collected from laboratory and literature are assessed. A rating system derived from the metal removal rate is proposed for estimating the relative machinability of carbon and alloy steels, stainless steels, and aluminum, copper, and magnesium alloys.

  13. Chaotic Boltzmann machines

    PubMed Central

    Suzuki, Hideyuki; Imura, Jun-ichi; Horio, Yoshihiko; Aihara, Kazuyuki

    2013-01-01

    The chaotic Boltzmann machine proposed in this paper is a chaotic pseudo-billiard system that works as a Boltzmann machine. Chaotic Boltzmann machines are shown numerically to have computing abilities comparable to conventional (stochastic) Boltzmann machines. Since no randomness is required, efficient hardware implementation is expected. Moreover, the ferromagnetic phase transition of the Ising model is shown to be characterised by the largest Lyapunov exponent of the proposed system. In general, a method to relate probabilistic models to nonlinear dynamics by derandomising Gibbs sampling is presented. PMID:23558425

  14. Perspex machine II: visualization

    NASA Astrophysics Data System (ADS)

    Anderson, James A. D. W.

    2005-01-01

    We review the perspex machine and improve it by reducing its halting conditions to one condition. We also introduce a data structure, called the "access column," that can accelerate a wide class of perspex programs. We show how the perspex can be visualised as a tetrahedron, artificial neuron, computer program, and as a geometrical transformation. We discuss the temporal properties of the perspex machine, dissolve the famous time travel paradox, and present a hypothetical time machine. Finally, we discuss some mental properties and show how the perspex machine solves the mind-body problem and, specifically, how it provides one physical explanation for the occurrence of paradigm shifts.

  15. Perspex machine II: visualization

    NASA Astrophysics Data System (ADS)

    Anderson, James A. D. W.

    2004-12-01

    We review the perspex machine and improve it by reducing its halting conditions to one condition. We also introduce a data structure, called the "access column," that can accelerate a wide class of perspex programs. We show how the perspex can be visualised as a tetrahedron, artificial neuron, computer program, and as a geometrical transformation. We discuss the temporal properties of the perspex machine, dissolve the famous time travel paradox, and present a hypothetical time machine. Finally, we discuss some mental properties and show how the perspex machine solves the mind-body problem and, specifically, how it provides one physical explanation for the occurrence of paradigm shifts.

  16. Going with the wind

    NASA Astrophysics Data System (ADS)

    Nesbit, W.; Demeo, E.; Goodman, F., Jr.

    1980-03-01

    The current status of wind generation of electricity is surveyed, noting that extracting electric power from such an abundant and inconsistent source requires the correct size, a reliable machine, and power system flexibility to adapt to the air stream. Attention is given to currently operating installations in New Mexico, North Carolina, Puerto Rico, and Rhode Island. Also discussed is the breadth of the federal program including NASA work for the DOE such as the 2.5 MW MOD-2, as well as Sandia work on Darreius design of vertical axis turbines. Other topics examined include siting considerations, private efforts, the depth of analysis required, and the establishing of utility requirements.

  17. Mechanical heterogeneity favors fragmentation of strained actin filaments.

    PubMed

    De La Cruz, Enrique M; Martiel, Jean-Louis; Blanchoin, Laurent

    2015-05-01

    We present a general model of actin filament deformation and fragmentation in response to compressive forces. The elastic free energy density along filaments is determined by their shape and mechanical properties, which were modeled in terms of bending, twisting, and twist-bend coupling elasticities. The elastic energy stored in filament deformation (i.e., strain) tilts the fragmentation-annealing reaction free-energy profile to favor fragmentation. The energy gradient introduces a local shear force that accelerates filament intersubunit bond rupture. The severing protein, cofilin, renders filaments more compliant in bending and twisting. As a result, filaments that are partially decorated with cofilin are mechanically heterogeneous (i.e., nonuniform) and display asymmetric shape deformations and energy profiles distinct from mechanically homogenous (i.e., uniform), bare actin, or saturated cofilactin filaments. The local buckling strain depends on the relative size of the compliant segment as well as the bending and twisting rigidities of flanking regions. Filaments with a single bare/cofilin-decorated boundary localize energy and force adjacent to the boundary, within the compliant cofilactin segment. Filaments with small cofilin clusters were predicted to fragment within the compliant cofilactin rather than at boundaries. Neglecting contributions from twist-bend coupling elasticity underestimates the energy density and gradients along filaments, and thus the net effects of filament strain to fragmentation. Spatial confinement causes compliant cofilactin segments and filaments to adopt higher deformation modes and store more elastic energy, thereby promoting fragmentation. The theory and simulations presented here establish a quantitative relationship between actin filament fragmentation thermodynamics and elasticity, and reveal how local discontinuities in filament mechanical properties introduced by regulatory proteins can modulate both the severing efficiency and location along filaments. The emergent behavior of mechanically heterogeneous filaments, particularly under confinement, emphasizes that severing in cells is likely to be influenced by multiple physical and chemical factors. PMID:25954884

  18. Multiple filamentation of laser pulses in the glass

    NASA Astrophysics Data System (ADS)

    Apeksimov, D. V.; Bukin, O. A.; Golik, S. S.; Zemlyanov, A. A.; Iglakova, A. N.; Kabanov, A. M.; Kuchinskaya, O. I.; Matvienko, G. G.; Oshlakov, V. K.; Petrov, A. V.; Sokolova, E. B.

    2015-11-01

    The results of experiments to study the spatial characteristics of multiple filamentation gigawatt laser pulses in the glass are presented. It is shown that with increasing pulse power multiple filamentation region increases in length and diameter, the distribution of filaments within the region has a maximum value when the power > 105 Pcr area filamentation takes the form of a hollow cone, the apex directed to the source of the laser radiation.

  19. SMART Observation of Magnetic Helicity in Solar Filaments

    NASA Astrophysics Data System (ADS)

    Hagino, M.; Kitai, R.; Shibata, K.

    2006-08-01

    We examined the magnetic helicity of solar filaments from their structure in the chromosphere and corona. The H-alpha telescope of the Solar Magnetic Activity Research Telescope (SMART) observed 239 intermediate filaments from 2005 July 1 to 2006 May 15. The intermediate filament usually locates between two active regions. Using these images, we identified the filament spine and its barbs, and determined the chromospheric filament helicity from the mean angle between each barbs and a spine. We found that 71% (78 of 110) of intermediate filaments in the northern hemisphere are negative helicity and 67% (87 of 129) of filaments in the southern hemisphere are positive, which agreed with the well-known hemispheric tendency of the magnetic helicity. Additionally, we studied the coronal helicity of intermediate filaments. The coronal filament helicity is defined as the crossing angle of threads formed a filament. The helicity pattern of coronal filaments obtained with EIT/SOHO 171A also shows the helicity hemispheric tendency. Namely, 65% (71 of 110) of coronal filaments in the northern hemisphere exhibit negative helicity and the 65% (84 of 129) of filaments in the southern hemisphere show negative helicity. These data were observed in the same day with the SMART H-alpha data. Moreover, we found 12 filament eruptions in our data. The 7 of 12 filaments show the clear opposite sign of the hemispheric tendency of the magnetic helicity. The helicity seems to be change during temporal evolution. This results suggest that filament instability may be driven by the opposite sign helicity injection from the foot point of the barb.

  20. Diamond machine tool face lapping machine

    DOEpatents

    Yetter, H.H.

    1985-05-06

    An apparatus for shaping, sharpening and polishing diamond-tipped single-point machine tools. The isolation of a rotating grinding wheel from its driving apparatus using an air bearing and causing the tool to be shaped, polished or sharpened to be moved across the surface of the grinding wheel so that it does not remain at one radius for more than a single rotation of the grinding wheel has been found to readily result in machine tools of a quality which can only be obtained by the most tedious and costly processing procedures, and previously unattainable by simple lapping techniques.

  1. FilTER: Filament Trait-Evalutated Reconstruction

    NASA Astrophysics Data System (ADS)

    Panopoulou, G. V.; Tassis, K.; Goldsmith, P. F.; Heyer, M. H.

    2016-02-01

    FilTER (Filament Trait-Evalutated Reconstruction) post-processes output from DisPerSE (ascl:1302.015) to produce a set of filaments that are well-defined and have measured properties (e.g. width), then cuts the profiles, fits and assesses them to reconstruct new filaments according to defined criteria.

  2. Electric events synchronized with laser filaments in thunderclouds.

    PubMed

    Kasparian, Jérôme; Ackermann, Roland; André, Yves-Bernard; Méchain, Grégoire; Méjean, Guillaume; Prade, Bernard; Rohwetter, Philipp; Salmon, Estelle; Stelmaszczyk, Kamil; Yu, Jin; Mysyrowicz, André; Sauerbrey, Roland; Wöste, Ludger; Wolf, Jean-Pierre

    2008-04-14

    We investigated the possibility to trigger real-scale lightning using ionized filaments generated by ultrashort laser pulses in the atmosphere. Under conditions of high electric field during two thunderstorms, we observed a statistically significant number of electric events synchronized with the laser pulses, at the location of the filaments. This observation suggests that corona discharges may have been triggered by filaments. PMID:18542684

  3. Solar filament material oscillations and drainage before eruption

    SciTech Connect

    Bi, Yi; Jiang, Yunchun; Yang, Jiayan; Hong, Junchao; Li, Haidong; Yang, Dan; Yang, Bo

    2014-08-01

    Both large-amplitude longitudinal (LAL) oscillations and material drainage in a solar filament are associated with the flow of material along the filament axis, often followed by an eruption. However, the relationship between these two motions and a subsequent eruption event is poorly understood. We analyze a filament eruption using EUV imaging data captured by the Atmospheric Imaging Array on board the Solar Dynamics Observatory and the Hα images from the Global Oscillation Network Group. Hours before the eruption, the filament was activated, with one of its legs undergoing a slow rising motion. The asymmetric activation inclined the filament relative to the solar surface. After the active phase, LAL oscillations were observed in the inclined filament. The oscillation period increased slightly over time, which may suggest that the magnetic fields supporting the filament evolve to be flatter during the slow rising phase. After the oscillations, a significant amount of filament material was drained toward one filament endpoint, followed immediately by the violent eruption of the filament. The material drainage may further support the change in magnetic topology prior to the eruption. Moreover, we suggest that the filament material drainage could play a role in the transition from a slow to a fast rise of the erupting filament.

  4. Calibration and Temperature Profile of a Tungsten Filament Lamp

    ERIC Educational Resources Information Center

    de Izarra, Charles; Gitton, Jean-Michel

    2010-01-01

    The goal of this work proposed for undergraduate students and teachers is the calibration of a tungsten filament lamp from electric measurements that are both simple and precise, allowing to determine the temperature of tungsten filament as a function of the current intensity. This calibration procedure was first applied to a conventional filament…

  5. A penny-shaped crack in a filament-reinforced matrix. I - The filament model. II - The crack problem

    NASA Technical Reports Server (NTRS)

    Erdogan, F.; Pacella, A. H.

    1974-01-01

    The study deals with the elastostatic problem of a penny-shaped crack in an elastic matrix which is reinforced by filaments or fibers perpendicular to the plane of the crack. An elastic filament model is first developed, followed by consideration of the application of the model to the penny-shaped crack problem in which the filaments of finite length are asymmetrically distributed around the crack. Since the primary interest is in the application of the results to studies relating to the fracture of fiber or filament-reinforced composites and reinforced concrete, the main emphasis of the study is on the evaluation of the stress intensity factor along the periphery of the crack, the stresses in the filaments or fibers, and the interface shear between the matrix and the filaments or fibers. Using the filament model developed, the elastostatic interaction problem between a penny-shaped crack and a slender inclusion or filament in an elastic matrix is formulated.

  6. Filamentary structures in dense plasma focus: Current filaments or vortex filaments?

    SciTech Connect

    Soto, Leopoldo Pavez, Cristian; Moreno, José; Castillo, Fermin; Veloso, Felipe; Auluck, S. K. H.

    2014-07-15

    Recent observations of an azimuthally distributed array of sub-millimeter size sources of fusion protons and correlation between extreme ultraviolet (XUV) images of filaments with neutron yield in PF-1000 plasma focus have re-kindled interest in their significance. These filaments have been described variously in literature as current filaments and vortex filaments, with very little experimental evidence in support of either nomenclature. This paper provides, for the first time, experimental observations of filaments on a table-top plasma focus device using three techniques: framing photography of visible self-luminosity from the plasma, schlieren photography, and interferometry. Quantitative evaluation of density profile of filaments from interferometry reveals that their radius closely agrees with the collision-less ion skin depth. This is a signature of relaxed state of a Hall fluid, which has significant mass flow with equipartition between kinetic and magnetic energy, supporting the “vortex filament” description. This interpretation is consistent with empirical evidence of an efficient energy concentration mechanism inferred from nuclear reaction yields.

  7. The Refined Shock Velocity of the X-Ray Filaments in the RCW 86 Northeast Rim

    NASA Astrophysics Data System (ADS)

    Yamaguchi, Hiroya; Katsuda, Satoru; Castro, Daniel; Williams, Brian J.; Lopez, Laura A.; Slane, Patrick O.; Smith, Randall K.; Petre, Robert

    2016-03-01

    A precise measurement of shock velocities is crucial for constraining the mechanism and efficiency of cosmic-ray (CR) acceleration at supernova remnant (SNR) shock fronts. The northeastern rim of the SNR RCW 86 is thought to be a particularly efficient CR acceleration site, owing to the recent result in which an extremely high shock velocity of ∼6000 km s‑1 was claimed. Here, we revisit the same SNR rim with the Chandra X-ray Observatory, 11 years after the first observation. This longer baseline than previously available allows us to determine a more accurate proper motion of the nonthermal X-ray filament, revealing a much lower velocity of 3000 ± 340 km s‑1 (and even slower at a brighter region). Although the value has dropped to one-half of that from the previous X-ray measurement, it is still higher than the mean velocity of the Hα filaments in this region (∼1200 km s‑1). This discrepancy implies that the filaments bright in nonthermal X-rays and Hα emission trace different velocity components, and thus a CR pressure constrained by combining the X-ray kinematics and the Hα spectroscopy can easily be overestimated. We also measure the proper motion of the thermal X-ray filament immediately to the south of the nonthermal one. The inferred velocity (720 ± 360 km s‑1) is significantly lower than that of the nonthermal filament, suggesting the presence of denser ambient material, possibly a wall formed by a wind from the progenitor, which has drastically slowed down the shock.

  8. Drum cutter mining machine

    SciTech Connect

    Oberste-beulmann, K.; Schupphaus, H.

    1980-02-19

    A drum cutter mining machine includes a machine frame with a winch having a drive wheel to engage a rack or chain which extends along the path of travel by the mining machine to propel the machine along a mine face. The mining machine is made up of discrete units which include a machine body and machine housings joined to opposite sides of the machine body. The winch is either coupled through a drive train with a feed drive motor or coupled to the drive motor for cutter drums. The machine housings each support a pivot shaft coupled by an arm to a drum cutter. One of these housings includes a removable end cover and a recess adapted to receive a support housing for a spur gear system used to transmit torque from a feed drive motor to a reduction gear system which is, in turn, coupled to the drive wheel of the winch. In one embodiment, a removable end cover on the machine housing provides access to the feed drive motor. The feed drive motor is arranged so that the rotational axis of its drive output shaft extends transversely to the stow side of the machine frame. In another embodiment, the reduction gear system is arranged at one side of the pivot shaft for the cutter drum while the drive motor therefor is arranged at the other side of the pivot shaft and coupled thereto through the spur gear system. In a further embodiment, the reduction gear system is disposed between the feed motor and the pivot shaft.

  9. Wire electric-discharge machining and other fabrication techniques

    NASA Technical Reports Server (NTRS)

    Morgan, W. H.

    1983-01-01

    Wire electric discharge machining and extrude honing were used to fabricate a two dimensional wing for cryogenic wind tunnel testing. Electric-discharge cutting is done with a moving wire electrode. The cut track is controlled by means of a punched-tape program and the cutting feed is regulated according to the progress of the work. Electric-discharge machining involves no contact with the work piece, and no mechanical force is exerted. Extrude hone is a process for honing finish-machined surfaces by the extrusion of an abrasive material (silly putty), which is forced through a restrictive fixture. The fabrication steps are described and production times are given.

  10. A new wind energy conversion system

    NASA Technical Reports Server (NTRS)

    Smetana, F. O.

    1975-01-01

    It is presupposed that vertical axis wind energy machines will be superior to horizontal axis machines on a power output/cost basis and the design of a new wind energy machine is presented. The design employs conical cones with sharp lips and smooth surfaces to promote maximum drag and minimize skin friction. The cones are mounted on a vertical axis in such a way as to assist torque development. Storing wind energy as compressed air is thought to be optimal and reasons are: (1) the efficiency of compression is fairly high compared to the conversion of mechanical energy to electrical energy in storage batteries; (2) the release of stored energy through an air motor has high efficiency; and (3) design, construction, and maintenance of an all-mechanical system is usually simpler than for a mechanical to electrical conversion system.

  11. Automatic soldering machine

    NASA Technical Reports Server (NTRS)

    Stein, J. A.

    1974-01-01

    Fully-automatic tube-joint soldering machine can be used to make leakproof joints in aluminum tubes of 3/16 to 2 in. in diameter. Machine consists of temperature-control unit, heater transformer and heater head, vibrator, and associated circuitry controls, and indicators.

  12. Simple Machines Made Simple.

    ERIC Educational Resources Information Center

    St. Andre, Ralph E.

    Simple machines have become a lost point of study in elementary schools as teachers continue to have more material to cover. This manual provides hands-on, cooperative learning activities for grades three through eight concerning the six simple machines: wheel and axle, inclined plane, screw, pulley, wedge, and lever. Most activities can be…

  13. Compound taper milling machine

    NASA Technical Reports Server (NTRS)

    Campbell, N. R.

    1969-01-01

    Simple, inexpensive milling machine tapers panels from a common apex to a uniform height at panel edge regardless of the panel perimeter configuration. The machine consists of an adjustable angled beam upon which the milling tool moves back and forth above a rotatable table upon which the workpiece is held.

  14. The Hooey Machine.

    ERIC Educational Resources Information Center

    Scarnati, James T.; Tice, Craig J.

    1992-01-01

    Describes how students can make and use Hooey Machines to learn how mechanical energy can be transferred from one object to another within a system. The Hooey Machine is made using a pencil, eight thumbtacks, one pushpin, tape, scissors, graph paper, and a plastic lid. (PR)

  15. Simple Machine Junk Cars

    ERIC Educational Resources Information Center

    Herald, Christine

    2010-01-01

    During the month of May, the author's eighth-grade physical science students study the six simple machines through hands-on activities, reading assignments, videos, and notes. At the end of the month, they can easily identify the six types of simple machine: inclined plane, wheel and axle, pulley, screw, wedge, and lever. To conclude this unit,…

  16. Simple Machine Junk Cars

    ERIC Educational Resources Information Center

    Herald, Christine

    2010-01-01

    During the month of May, the author's eighth-grade physical science students study the six simple machines through hands-on activities, reading assignments, videos, and notes. At the end of the month, they can easily identify the six types of simple machine: inclined plane, wheel and axle, pulley, screw, wedge, and lever. To conclude this unit,…

  17. Machine Translation Project

    NASA Technical Reports Server (NTRS)

    Bajis, Katie

    1993-01-01

    The characteristics and capabilities of existing machine translation systems were examined and procurement recommendations were developed. Four systems, SYSTRAN, GLOBALINK, PC TRANSLATOR, and STYLUS, were determined to meet the NASA requirements for a machine translation system. Initially, four language pairs were selected for implementation. These are Russian-English, French-English, German-English, and Japanese-English.

  18. Stirling machine operating experience

    SciTech Connect

    Ross, B.; Dudenhoefer, J.E.

    1994-09-01

    Numerous Stirling machines have been built and operated, but the operating experience of these machines is not well known. It is important to examine this operating experience in detail, because it largely substantiates the claim that stirling machines are capable of reliable and lengthy operating lives. The amount of data that exists is impressive, considering that many of the machines that have been built are developmental machines intended to show proof of concept, and are not expected to operate for lengthy periods of time. Some Stirling machines (typically free-piston machines) achieve long life through non-contact bearings, while other Stirling machines (typically kinematic) have achieved long operating lives through regular seal and bearing replacements. In addition to engine and system testing, life testing of critical components is also considered. The record in this paper is not complete, due to the reluctance of some organizations to release operational data and because several organizations were not contacted. The authors intend to repeat this assessment in three years, hoping for even greater participation.

  19. Machine tool evaluation and machining operation development

    SciTech Connect

    Morris, T.O.; Kegg, R.

    1997-03-15

    The purpose of this CRADA was to support Cincinnati Milacron`s needs in fabricating precision components, from difficult to machine materials, while maintaining and enhancing the precision manufacturing skills of the Oak Ridge Complex. Oak Ridge and Cincinnati Milacron personnel worked in a team relationship wherein each contributed equally to the success of the program. Process characterization, control technologies, machine tool capabilities, and environmental issues were the primary focus areas. In general, Oak Ridge contributed a wider range of expertise in machine tool testing and monitoring, and environmental testing on machining fluids to the defined tasks while Cincinnati Milacron personnel provided equipment, operations-specific knowledge and shop-floor services to each task. Cincinnati Milacron was very pleased with the results of all of the CRADA tasks. However, some of the environmental tasks were not carried through to a desired completion due to an expanding realization of need as the work progressed. This expansion of the desired goals then exceeded the time length of the CRADA. Discussions are underway on continuing these tasks under either a Work for Others agreement or some alternate funding.

  20. CO gas kinematics and excitation in a filamentary IRDC: Filament-filament interaction and accretion processes.

    NASA Astrophysics Data System (ADS)

    Jimenez-Serra, Izaskun; Caselli, Paola; Fontani, Francesco; Tan, Jonathan C.; Henshaw, Jonathan D.; Kainulainen, Jouni; Hernandez, Audra K.

    2013-07-01

    Some theories of molecular cloud formation propose that molecular clouds form in highly dynamical environments characterized by the interaction of converging gas flows or cloud-cloud collisions. The determination of the dynamics and physical conditions of the molecular gas in clouds at the early stages of their evolution is thus essential to establish the dynamical imprints of such collisions, and to infer the physical processes involved in their formation. We present large-scale (~1.7pc x 3.4 pc) multi-transition 13CO and C18O on-the-fly maps carried out with the IRAM 30m and JCMT telescopes toward the Infrared-Dark Cloud G035.39-00.33. This cloud shows a very filamentary structure and relatively little star formation activity, suggestive of its youth, and where evidence for a flow-flow collision has recently been reported. Consistent with previous studies, the 13CO and C18O line maps toward G035.39-00.33 reveal that the molecular gas in this cloud is distributed in three different filaments separated in velocity space by ~3 kms-1 (Filaments 1, 2 and 3). The massive dense cores in this IRDC are preferentially found at the intersecting regions between Filaments 1 and 3, where most of the CO gas is accumulated. The analysis of the 13CO and C18O lines show that the three filaments have a similar kinematic structure with relatively smooth velocity gradients (of ~0.4-0.8 kms-1pc-1) that seem to converge onto core H6, the most massive core in the region located in the center of the IRDC. Several possible scenarios are proposed to explain this velocity gradient, including rotation, global gas accretion along the filaments and large-scale turbulence motions with a steep turbulent power spetrum. The 13CO and C18O gas motions are supersonic across G035.39-00.33 with the line emission showing broader linewidths toward the edges of the IRDC. This may indicate energy dissipation at the densest regions in the IRDC as a consequence of the filament-filament interaction. The excitation analysis of the 13CO gas provides average H2 densities of ~5000-7000 cm-3 for the filaments, with Filaments 2 and 3 being denser and more massive than Filament 1. The C18O J=3-2 and J=2-1 line emission unveils three regions in the IRDC with high CO depletion factors (f_D~5-12), similar to those found in massive starless cores.

  1. Micro-machining.

    PubMed

    Brinksmeier, Ekkard; Preuss, Werner

    2012-08-28

    Manipulating bulk material at the atomic level is considered to be the domain of physics, chemistry and nanotechnology. However, precision engineering, especially micro-machining, has become a powerful tool for controlling the surface properties and sub-surface integrity of the optical, electronic and mechanical functional parts in a regime where continuum mechanics is left behind and the quantum nature of matter comes into play. The surprising subtlety of micro-machining results from the extraordinary precision of tools, machines and controls expanding into the nanometre range-a hundred times more precise than the wavelength of light. In this paper, we will outline the development of precision engineering, highlight modern achievements of ultra-precision machining and discuss the necessity of a deeper physical understanding of micro-machining. PMID:22802498

  2. Dictionary machine (for VLSI)

    SciTech Connect

    Ottmann, T.A.; Rosenberg, A.L.; Stockmeyer, L.J.

    1982-09-01

    The authors present the design of a dictionary machine that is suitable for VLSI implementation, and discusses how to realize this implementation efficiently. The machine supports the operations of search, insert, delete, and extractment on an arbitrary ordered set. Each of these operations takes time o(logn), where n is the number of entries present when the operation is performed. Moreover, arbitrary sequences of these instructions can be pipelined through the machine at a constant rate (i.e. independent of n and the capacity of the machine). The time o(logn) is an improvement over previous VLSI designs of dictionary machines which require time o(log n) per operation, where n is the maximum number of keys that can be stored. 10 references.

  3. 14. Interior, Machine Shop, Roundhouse Machine Shop Extension, Southern Pacific ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    14. Interior, Machine Shop, Roundhouse Machine Shop Extension, Southern Pacific Railroad Carlin Shops, view to north (90mm lens). - Southern Pacific Railroad, Carlin Shops, Roundhouse Machine Shop Extension, Foot of Sixth Street, Carlin, Elko County, NV

  4. BRITISH MOLDING MACHINE, PBQ AUTOMATIC COPE AND DRAG MOLDING MACHINE ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    BRITISH MOLDING MACHINE, PBQ AUTOMATIC COPE AND DRAG MOLDING MACHINE MAKES BOTH MOLD HALVES INDIVIDUALLY WHICH ARE LATER ROTATED, ASSEMBLED, AND LOWERED TO POURING CONVEYORS BY ASSISTING MACHINES. - Southern Ductile Casting Company, Casting, 2217 Carolina Avenue, Bessemer, Jefferson County, AL

  5. Complex dynamics of knotted filaments in shear flow

    NASA Astrophysics Data System (ADS)

    Matthews, R.; Louis, A. A.; Yeomans, J. M.

    2010-11-01

    Coarse-grained simulations are used to demonstrate that knotted filaments in shear flow at zero Reynolds number exhibit remarkably rich dynamic behaviour. For stiff filaments that are weakly deformed by the shear forces, the knotted filaments rotate like rigid objects in the flow. But away from this regime the interplay between shear forces and the flexibility of the filament leads to intricate regular and chaotic modes of motion that can be divided into distinct families. The set of accessible mode families depends to first order on a dimensionless number that relates the filament length, the elastic modulus, the friction per unit length and the shear rate.

  6. Large Wind Turbine Design Characteristics and R and D Requirements

    NASA Technical Reports Server (NTRS)

    Lieblein, S. (Editor)

    1979-01-01

    Detailed technical presentations on large wind turbine research and development activities sponsored by public and private organizations are presented. Both horizontal and vertical axis machines are considered with emphasis on their structural design.

  7. Wind turbine generator rotor blade concepts with low cost potential

    NASA Technical Reports Server (NTRS)

    Sullivan, T. L.; Cahill, T. P.; Griffee, D. G., Jr.; Gewehr, H. W.

    1977-01-01

    Four processed for producing blades are examined. Two use filament winding techniques and two involve filling a mold or form to produce all or part of a blade. The processes are described and a comparison is made of cost, material properties, design and free vibration characteristics. Conclusions are made regarding the feasibility of each process to produce low cost, structurally adequate blades.

  8. Wind sensor

    NASA Technical Reports Server (NTRS)

    Stephens, J. B.; Laue, E. G. (inventors)

    1976-01-01

    An apparatus is described for sensing the temperature, velocity, and direction of the wind, including four temperature-dependent crystal oscillators spaced about an axis, a heater centered on the axis, and a screen through which the wind blows to pass over the crystals. In one method of operation, the frequency of the oscillators is taken when the heater is not energized, to obtain the temperature of the wind, and the frequencies of the oscillators are taken after the heater is energized to determine the direction and velocity of the wind. When the heater is energized, the wind causes the downwind crystals to achieve a higher temperature than the upwind crystals, and with the magnitude of the difference indicating the velocity of the wind.

  9. A Comparison Study of an Active Region Eruptive Filament and a Neighboring Non-Eruptive Filament

    NASA Astrophysics Data System (ADS)

    Wu, S. T.; Jiang, C.; Feng, X. S.; Hu, Q.

    2014-12-01

    We perform a comparison study of an eruptive filament in the core region of AR 11283 and a nearby non-eruptive filament. The coronal magnetic field supporting these two filaments is extrapolated using our data-driven CESE-MHD-NLFFF code (Jiang et al. 2013, Jiang etal. 2014), which presents two magnetic flux ropes (FRs) in the same extrapolation box. The eruptive FR contains a bald-patch separatrix surface (BPSS) spatially co-aligned very well with a pre-eruption EUV sigmoid, which is consistent with the BPSS model for the coronal sigmoids. The numerically reproduced magnetic dips of the FRs match observations of the filaments strikingly well, which supports strongly the FR-dip model for filaments. The FR that supports the AR eruptive filament is much smaller (with a length of 3 Mm) compared with the large-scale FR holding the quiescent filament (with a length of 30 Mm). But the AR eruptive FR contains most of the magnetic free energy in the extrapolation box and holds a much higher magnetic energy density than the quiescent FR, because it resides along the main polarity inversion line (PIL) around sunspots with strong magnetic shear. Both the FRs are weakly twisted and cannot trigger kink instability. The AR eruptive FR is unstable because its axis reaches above a critical height for torus instability (TI), at which the overlying closed arcades can no longer confine the FR stably. To the contrary, the quiescent FR is firmly held down by its overlying field, as its axis apex is far below the TI threshold height. (This work is partially supported by NSF AGS-1153323 and 1062050)

  10. Control of polarized assembly of actin filaments in cell motility.

    PubMed

    Carlier, Marie-France; Pernier, Julien; Montaville, Pierre; Shekhar, Shashank; Kühn, Sonja

    2015-08-01

    Actin cytoskeleton remodeling, which drives changes in cell shape and motility, is orchestrated by a coordinated control of polarized assembly of actin filaments. Signal responsive, membrane-bound protein machineries initiate and regulate polarized growth of actin filaments by mediating transient links with their barbed ends, which elongate from polymerizable actin monomers. The barbed end of an actin filament thus stands out as a hotspot of regulation of filament assembly. It is the target of both soluble and membrane-bound agonists as well as antagonists of filament assembly. Here, we review the molecular mechanisms by which various regulators of actin dynamics bind, synergize or compete at filament barbed ends. Two proteins can compete for the barbed end via a mutually exclusive binding scheme. Alternatively, two regulators acting individually at barbed ends may be bound together transiently to terminal actin subunits at barbed ends, leading to the displacement of one by the other. The kinetics of these reactions is a key in understanding how filament length and membrane-filament linkage are controlled. It is also essential for understanding how force is produced to shape membranes by mechano-sensitive, processive barbed end tracking machineries like formins and by WASP-Arp2/3 branched filament arrays. A combination of biochemical and biophysical approaches, including bulk solution assembly measurements using pyrenyl-actin fluorescence, single filament dynamics, single molecule fluorescence imaging and reconstituted self-organized filament assemblies, have provided mechanistic insight into the role of actin polymerization in motile processes. PMID:25948416

  11. Transition from linear- to nonlinear-focusing regime in filamentation

    PubMed Central

    Lim, Khan; Durand, Magali; Baudelet, Matthieu; Richardson, Martin

    2014-01-01

    Laser filamentation in gases is often carried out in the laboratory with focusing optics to better stabilize the filament, whereas real-world applications of filaments frequently involve collimated or near-collimated beams. It is well documented that geometrical focusing can alter the properties of laser filaments and, consequently, a transition between a collimated and a strongly focused filament is expected. Nevertheless, this transition point has not been identified. Here, we propose an analytical method to determine the transition, and show that it corresponds to an actual shift in the balance of physical mechanisms governing filamentation. In high-NA conditions, filamentation is primarily governed by geometrical focusing and plasma effects, while the Kerr nonlinearity plays a more significant role as NA decreases. We find the transition between the two regimes to be relatively insensitive to the intrinsic laser parameters, and our analysis agrees well with a wide range of parameters found in published literature. PMID:25434678

  12. Ultraminiature broadband light source with spiral shaped filament

    NASA Technical Reports Server (NTRS)

    Tuma, Margaret L. (Inventor); Collura, Joseph S. (Inventor); Helvajian, Henry (Inventor); Pocha, Michael D. (Inventor); Meyer, Glenn A. (Inventor); McConaghy, Charles F. (Inventor); Olsen, Barry L. (Inventor); Hansen, William W (Inventor)

    2012-01-01

    An ultraminiature light source using a double-spiral shaped tungsten filament includes end contact portions which are separated to allow for radial and length-wise unwinding of the spiral. The double-spiral filament is spaced relatively far apart at the end portions thereof so that contact between portions of the filament upon expansion is avoided. The light source is made by fabricating a double-spiral ultraminiature tungsten filament from tungsten foil and housing the filament in a ceramic package having a reflective bottom and a well wherein the filament is suspended. A vacuum furnace brazing process attaches the filament to contacts of the ceramic package. Finally, a cover with a transparent window is attached onto the top of the ceramic package by solder reflow in a second vacuum furnace process to form a complete hermetically sealed package.

  13. Electrical machines and assemblies including a yokeless stator with modular lamination stacks

    DOEpatents

    Qu, Ronghai; Jansen, Patrick Lee; Bagepalli, Bharat Sampathkumar; Carl, Jr., Ralph James; Gadre, Aniruddha Dattatraya; Lopez, Fulton Jose

    2010-04-06

    An electrical machine includes a rotor with an inner rotor portion and an outer rotor portion, and a double-sided yokeless stator. The yokeless stator includes modular lamination stacks and is configured for radial magnetic flux flow. The double-sided yokeless stator is concentrically disposed between the inner rotor portion and the outer rotor portion of the electrical machine. Examples of particularly useful embodiments for the electrical machine include wind turbine generators, ship propulsion motors, switch reluctance machines and double-sided synchronous machines.

  14. Warpage prediction and elimination in filament-wound and fiber-placed composite shells

    NASA Astrophysics Data System (ADS)

    Meink, Troy Edward

    Filament winding and fiber placement are becoming common manufacturing processes throughout the aerospace industry for both launch vehicle and aircraft structures. The promise of significant weight reduction, compared to metallic structures, along with the advantages of automation, including reduced cost and increased quality control, make these attractive structural solutions. Recent demonstrations include: the Combined Experiments (CEP) sub-orbital demonstration flight, Boeing's Sea Launch orbital vehicle, and the Beach Starship. These vehicles employed filament winding or fiber placement manufacturing processes and substantiated large performance gains. However, as with many new technology development programs unforeseen complications often arise. In filament winding the tooling is generally in the form of a plug that has the composite fibers filament wound or fiber placed on the outer surface. Once the parts are released from the tooling they can demonstrate significant warpage. In many cases this warpage is large enough to make the part unusable. As the aerospace industry develops the need for larger composite structures with both the requirements of high performance and reduced manufacturing cost, understanding and controlling part warpage becomes an ever increasing necessity. This research has identified the residual stresses responsible for the large distortions. It will be shown that the stresses develop during manufacturing and result from cure consolidation. The magnitude is dependent on manufacturing parameters including cure pressure, winding tension, and material characteristics (i.e., pre-preg fiber volume fraction, resin viscosity, etc.). In this dissertation a systematic procedure, or methodology, is developed to eliminate the processing induced warpage. This is accomplished by first developing a through-thickness strain model based on fiber/resin cure consolidation and tooling thermal expansions. The strain model is then integrated with classical laminate theory and solutions for predicting and eliminating warpage obtained. The warpage elimination is accomplished by developing manufacturing tension control techniques that reduce and alter the residual stress profile to eliminate stress couples. The accuracy of the warpage prediction and elimination techniques are verified with experimental procedures. It was found that the predictions were accurate and the warpage could be reduced and eliminated in most cases.

  15. Viscoelastic response of contractile filament bundles

    NASA Astrophysics Data System (ADS)

    Besser, Achim; Colombelli, Julien; Stelzer, Ernst H. K.; Schwarz, Ulrich S.

    2011-05-01

    The actin cytoskeleton of adherent tissue cells often condenses into filament bundles contracted by myosin motors, so-called stress fibers, which play a crucial role in the mechanical interaction of cells with their environment. Stress fibers are usually attached to their environment at the endpoints, but possibly also along their whole length. We introduce a theoretical model for such contractile filament bundles which combines passive viscoelasticity with active contractility. The model equations are solved analytically for two different types of boundary conditions. A free boundary corresponds to stress fiber contraction dynamics after laser surgery and results in good agreement with experimental data. Imposing cyclic varying boundary forces allows us to calculate the complex modulus of a single stress fiber.

  16. Three Dimension Filamentous Human Cardiac Tissue Model

    PubMed Central

    Ma, Zhen; Koo, Sangmo; Finnegan, Micaela A.; Loskill, Peter; Huebsch, Nathaniel; Marks, Natalie C.; Conklin, Bruce R.; Grigoropoulos, Costas P.; Healy, Kevin E.

    2013-01-01

    A human in vitro cardiac tissue model would be a significant advancement for understanding, studying, and developing new strategies for treating cardiac arrhythmias and related cardiovascular diseases. We developed an in vitro model of three-dimensional (3D) human cardiac tissue by populating synthetic filamentous matrices with cardiomyocytes derived from healthy wild-type volunteer (WT) and patient-specific long QT syndrome type 3 (LQT3) induced pluripotent stem cells (iPS-CMs) to mimic the condensed and aligned human ventricular myocardium. Using such a highly controllable cardiac model, we studied the contractility malfunctions associated with the electrophysiological consequences of LQT3 and their response to a panel of drugs. By varying the stiffness of filamentous matrices, LQT3 iPS-CMs exhibited different level of contractility abnormality and susceptibility to drug-induced cardiotoxicity. PMID:24268663

  17. Merging and energy exchange between optical filaments

    NASA Astrophysics Data System (ADS)

    Georgieva, D. A.; Kovachev, L. M.

    2015-10-01

    We investigate nonlinear interaction between collinear femtosecond laser pulses with power slightly above the critical for self-focusing Pcr trough the processes of cross-phase modulation (CPM) and degenerate four-photon parametric mixing (FPPM). When there is no initial phase difference between the pulses we observe attraction between pulses due to CPM. The final result is merging between the pulses in a single filament with higher power. By method of moments it is found that the attraction depends on the distance between the pulses and has potential character. In the second case we study energy exchange between filaments. This process is described through FPPM scheme and requests initial phase difference between the waves.

  18. White-light filaments for atmospheric analysis.

    PubMed

    Kasparian, J; Rodriguez, M; Méjean, G; Yu, J; Salmon, E; Wille, H; Bourayou, R; Frey, S; Andre, Y B; Mysyrowicz, A; Sauerbrey, R; Wolf, J P; Wöste, L

    2003-07-01

    Most long-path remote spectroscopic studies of the atmosphere rely on ambient light or narrow-band lasers. High-power femtosecond laser pulses have been found to propagate in the atmosphere as dynamically self-guided filaments that emit in a continuum from the ultraviolet to the infrared. This white light exhibits a directional behavior with enhanced backward scattering and was detected from an altitude of more than 20 kilometers. This light source opens the way to white-light and nonlinear light detection and ranging applications for atmospheric trace-gas remote sensing or remote identification of aerosols. Air ionization inside the filaments also opens promising perspectives for laser-induced condensation and lightning control. The mobile femtosecond-terawatt laser system, Teramobile, has been constructed to study these applications. PMID:12843384

  19. Online Catalog for Filament-Sigmoid Correlation

    NASA Astrophysics Data System (ADS)

    Merriot, Ivy; Pevtsov, A.; Martens, P.

    2007-05-01

    A new online catalog correlating H-alpha filaments with SXT sigmoids gives researchers, teachers and pre-college students the ability to access digital H-alpha images online that were previously available only at the physical location of the NSO at Sunspot, NM. This web-based catalog correlates SOHO's SXT sigmoids from 1993-1998 as described in a non-online catalog created by Zach Blehm under the direction of Richard Canfield, MSU-Bozeman, with H-alpha filament activity as described by Ivy Merriot under the direction of Alexei Pevtsov, NSO, and Petrus Martens, MSU-Bozeman. The H-alpha images were digitized from film archives of the Flare Patrol Telescope at Sunspot, NM. Use of the online catalog will be demonstrated at the poster site with critical comments encouraged.

  20. Organizing Multiple Femtosecond Filaments in Air

    NASA Astrophysics Data System (ADS)

    Méchain, G.; Couairon, A.; Franco, M.; Prade, B.; Mysyrowicz, A.

    2004-07-01

    We show that it is possible to organize regular filamentation patterns in air by imposing either strong field gradients or phase distortions in the input-beam profile of an intense femtosecond laser pulse. A comparison between experiments and 3+1 dimensional numerical simulations confirms this concept and shows for the first time that a control of the transport of high intensities over long distances may be achieved by forcing this well ordered propagation regime. In this case, deterministic effects prevail in multiple femtosecond filamentation, and no transition to the optical turbulence regime is obtained [

    Mlejnek et al., Phys. Rev. Lett.PRLTAO0031-9007 83, 2938 (1999)10.1103/PhysRevLett.83.2938
    ].

  1. Experiments on the Propagation of Plasma Filaments

    SciTech Connect

    Katz, Noam; Egedal, Jan; Fox, Will; Le, Ari; Porkolab, Miklos

    2008-07-04

    We investigate experimentally the motion and structure of isolated plasma filaments propagating through neutral gas. Plasma filaments, or 'blobs,' arise from turbulent fluctuations in a range of plasmas. Our experimental geometry is toroidally symmetric, and the blobs expand to a larger major radius under the influence of a vertical electric field. The electric field, which is caused by {nabla}B and curvature drifts in a 1/R magnetic field, is limited by collisional damping on the neutral gas. The blob's electrostatic potential structure and the resulting ExB flow field give rise to a vortex pair and a mushroom shape, which are consistent with nonlinear plasma simulations. We observe experimentally this characteristic mushroom shape for the first time. We also find that the blob propagation velocity is inversely proportional to the neutral density and decreases with time as the blob cools.

  2. Nonlinear dynamics of filaments I. Dynamical instabilities

    NASA Astrophysics Data System (ADS)

    Goriely, Alain; Tabor, Michael

    1997-02-01

    The Kirchhoff model provides a well-established mathematical framework to study, both computationaly and theoretically, the dynamics of thin filaments within the approximations of linear elasticity theory. The study of static solutions to these equations has a long history and the usual approach to describing their instabilities is to study the time-dependent version of the Kirchhoff model in the Euler angle frame. Here we study the linear stability of the full, time-independent, equations by introducing a new are length preserving perturbation scheme. As an application, we consider the instabilities of various stationary solutions, such as the planar ring and straight rod, subjected to twisting perturbations. This scheme gives a direct proof of the existence of dynamical instabilities and provides the selection mechanism for the shape of unstable filaments.

  3. DOE large horizontal axis wind turbine development at NASA Lewis Research Center

    NASA Technical Reports Server (NTRS)

    Linscott, B. S.

    1982-01-01

    Large wind turbine activities managed by NASA Lewis are reviewed. These activities include results from the first and second generation field machines (Mod-OA, -1, and -2), the status of the Department of Interior WTS-4 machine for which NASA is responsible for technical management, and the design phase of the third generation wind turbines (Mod-5).

  4. Demonstration of an a-c utility connected wind generator in a urban setting

    NASA Astrophysics Data System (ADS)

    Kistler, A.; Hill, L.; Benjamin, H.

    1983-01-01

    The goal of the work reported was the visible demonstration of an archetypical small wind machine specifically designed for urban conditions. A concurrent education program about wind machines and their urban potential was to be given for manufacturers, marketers, and consumers. The intent of the project, changes and developments are chronicled, followed by technical appendices and copies of educational and publicity materials.

  5. Wind turbine

    SciTech Connect

    Abe, M.

    1982-01-19

    The improvement in a wind turbine comprises providing a tower with a freely liftable mount and adapting a nacelle which is fitted with a propeller windwheel consisting of a plurality of rotor blades and provided therein with means for conversion of wind energy to be shifted onto said mount attached to the tower. In case of a violent wind storm, the nacelle can be lowered down to the ground to protect the rotor blades from breakage due to the force of the wind. Required maintenance and inspection of the nacelle and replacement of rotor blades can be safely carried out on the ground.

  6. Viral detection using DNA functionalized gold filaments†

    PubMed Central

    Perez, Jonas W.; Haselton, Frederick R.

    2010-01-01

    Early detection of pediatric viruses is critical to effective intervention. A successful clinical tool must have a low detection limit, be simple to use and report results quickly. No current method meets all three of these criteria. In this report, we describe an approach that combines simple, rapid processing and label free detection. The method detects viral RNA using DNA hairpin structures covalently attached to a gold filament. In this design, the gold filament serves both to simplify processing and enable fluorescence detection. The approach was evaluated by assaying for the presence of respiratory syncytial virus (RSV) using the DNA hairpin probe 5? [C6Thiol]TTTTTTTTTTCGACGAAAAATGGGGCAAATACGTCG[CAL] 3? covalently attached to a 5 cm length of a 100 ?m diameter gold-clad filament. This sequence was designed to target a portion of the gene end-intergenic gene start signals which is repeated multiple times within the negative-sense genome giving multiple targets for each strand of genomic viral RNA present. The filament functionalized with probes was immersed in a 200 ?m capillary tube containing viral RNA, moved to subsequent capillary tubes for rinsing and then scanned for fluorescence. The response curve had a typical sigmoidal shape and plateaued at about 300 plaque forming units (PFU) of viral RNA in 20 ?L. The lower limit of detection was determined to be 11.9 PFU. This lower limit of detection was ~200 times better than a standard comparison ELISA. The simplicity of the core assay makes this approach attractive for further development as a viral detection platform in a clinical setting. PMID:20448919

  7. Continuous-Filament Isogrid Composite Panel

    NASA Technical Reports Server (NTRS)

    Williams, J. G.; Palmer, R. J.; Tucci, A. T.

    1985-01-01

    Damaged panels do not fail catastrophically when fabricated this way. Isogrid stiffener formed in slotted silicon-rubber tool. At grid intersections, slots offset to prevent excessive buildup of composite material and widened to give room for overlapping filaments to spread when compressed. Following total failure of skin, isogrid stiffener still carries 350 kN/m (2,000 1b/in.) and remains intact.

  8. Impact damage in filament wound composite bottles

    NASA Technical Reports Server (NTRS)

    Highsmith, Alton L.

    1993-01-01

    Increasingly, composite materials are being used in advanced structural applications because of the significant weight savings they offer when compared to more traditional engineering materials. The higher cost of composites must be offset by the increased performance that results from reduced structural weight if these new materials are to be used effectively. At present, there is considerable interest in fabricating solid rocket motor cases out of composite materials, and capitalizing on the reduced structural weight to increase rocket performance. However, one of the difficulties that arises when composite materials are used is that composites can develop significant amounts of internal damage during low velocity impacts. Such low velocity impacts may be encountered in routine handling of a structural component like a rocket motor case. The ability to assess the reduction in structural integrity of composite motor cases that experience accidental impacts is essential if composite rocket motor cases are to be certified for manned flight. While experimental studies of the post-impact performance of filament wound composite motor cases haven been proven performed (2,3), scaling impact data from small specimens to full scale structures has proven difficult. If such a scaling methodology is to be achieved, an increased understanding of the damage processes which influence residual strength is required. The study described herein was part of an ongoing investigation of damage development and reduction of tensile strength in filament wound composites subjected to low velocity impacts. The present study, which focused on documenting the damage that develops in filament wound composites as a result of such impacts, included two distinct tasks. The first task was to experimentally assess impact damage in small, filament wound pressure bottles using x-ray radiography. The second task was to study the feasibility of using digital image processing techniques to assist in determining the 3-D distribution of damage from stereo x-ray pairs.

  9. Origin and Evolution of Filament-Prominence Systems

    NASA Astrophysics Data System (ADS)

    Martens, Petrus C.; Zwaan, Cornelis

    2001-09-01

    We present a ``head-to-tail'' linkage model for the formation, evolution, and eruption of solar filaments. The magnetic field structure of our model is based on the observation that filaments form exclusively in filament channels with no apparent magnetic connections above the polarity inversion line. The formation of a filament in this configuration is driven by flux convergence and cancellation, which produces looplike filament segments with a half-turn. Filament segments of like chirality may connect and form long quiescent filaments. Such filaments are stabilized through footpoint anchoring until further cancellation at the footpoints causes their eruption. The eruption restores the original filament channel so that filament formation may resume immediately. We then demonstrate that the combined workings of Hale's polarity law, Joy's law, and differential rotation introduce a strong hemispheric preference in the chirality of filaments formed poleward of the sunspot belt, which is in agreement with observations. We analyze the magnetic fine structure of filaments formed through our model and find consistency with the observed hemispheric preference for barb orientation and a simple explanation for barb formation. Finally, we consider the flux tubes retracted below the surface in the process of filament formation. We show that every cancellation event that generates a filament obeying the hemispheric chirality preference injects a flux tube below the surface with a poloidal field opposite that of the ongoing cycle. We suggest that this pattern of submergence of flux represents the specific mechanism for the reversal of the poloidal flux in a Babcock-Leighton-Durney-type model for the solar dynamo.

  10. The Basic Anaesthesia Machine

    PubMed Central

    Gurudatt, CL

    2013-01-01

    After WTG Morton's first public demonstration in 1846 of use of ether as an anaesthetic agent, for many years anaesthesiologists did not require a machine to deliver anaesthesia to the patients. After the introduction of oxygen and nitrous oxide in the form of compressed gases in cylinders, there was a necessity for mounting these cylinders on a metal frame. This stimulated many people to attempt to construct the anaesthesia machine. HEG Boyle in the year 1917 modified the Gwathmey's machine and this became popular as Boyle anaesthesia machine. Though a lot of changes have been made for the original Boyle machine still the basic structure remains the same. All the subsequent changes which have been brought are mainly to improve the safety of the patients. Knowing the details of the basic machine will make the trainee to understand the additional improvements. It is also important for every practicing anaesthesiologist to have a thorough knowledge of the basic anaesthesia machine for safe conduct of anaesthesia. PMID:24249876

  11. Machine Learning and Radiology

    PubMed Central

    Wang, Shijun; Summers, Ronald M.

    2012-01-01

    In this paper, we give a short introduction to machine learning and survey its applications in radiology. We focused on six categories of applications in radiology: medical image segmentation, registration, computer aided detection and diagnosis, brain function or activity analysis and neurological disease diagnosis from fMR images, content-based image retrieval systems for CT or MRI images, and text analysis of radiology reports using natural language processing (NLP) and natural language understanding (NLU). This survey shows that machine learning plays a key role in many radiology applications. Machine learning identifies complex patterns automatically and helps radiologists make intelligent decisions on radiology data such as conventional radiographs, CT, MRI, and PET images and radiology reports. In many applications, the performance of machine learning-based automatic detection and diagnosis systems has shown to be comparable to that of a well-trained and experienced radiologist. Technology development in machine learning and radiology will benefit from each other in the long run. Key contributions and common characteristics of machine learning techniques in radiology are discussed. We also discuss the problem of translating machine learning applications to the radiology clinical setting, including advantages and potential barriers. PMID:22465077

  12. Nanomechanical properties of desmin intermediate filaments.

    PubMed

    Kiss, B; Karsai, A; Kellermayer, M S Z

    2006-08-01

    Desmin intermediate filaments play important role in the mechanical integrity and elasticity of muscle cells. The mechanisms of how desmin contributes to cellular mechanics are little understood. Here, we explored the nanomechanics of desmin by manipulating individual filaments with atomic force microscopy. In complex, hierarchical force responses we identified recurring features which likely correspond to distinct properties and structural transitions related to desmin's extensibility and elasticity. The most frequently observed feature is an initial unbinding transition that corresponds to the removal of approximately 45-nm-long coiled-coil dimers from the filament surface with 20-60 pN forces in usually two discrete steps. In tethers longer than 60 nm we most often observed force plateaus studded with bumps spaced approximately 16 nm apart, which are likely caused by a combination of protofilament unzipping, dimer-dimer sliding and coiled-coil-domain unfolding events. At high stresses and strains non-linear, entropic elasticity was dominant, and sometimes repetitive sawtooth force transitions were seen which might arise because of slippage within the desmin protofilament. A model is proposed in which mechanical yielding is caused by coiled-coil domain unfolding and dimer-dimer sliding/slippage, and strain hardening by the entropic elasticity of partially unfolded protofilaments. PMID:16714122

  13. Hot filament CVD of boron nitride films

    DOEpatents

    Rye, Robert R.

    1992-01-01

    Using a hot filament (.apprxeq.1400.degree. C.) to activate borazine (B.sub.3 N.sub.3 H.sub.6) molecules for subsequent reaction with a direct line-of-sight substrate, transparent boron ntiride films as thick as 25,000 angstroms are grown for a substrate temperature as low as 100.degree. C. The minimum temperature is determined by radiative heating from the adjacent hot filament. The low temperature BN films show no indication of crystallinity with X-ray diffraction (XRD). X-ray photoelectron spectra (XPS) show the films to have a B:N ratio of 0.97:1 with no other XPS detectable impurities above the 0.5% level. Both Raman and infrared (IR) spectroscopy are characteristic of h-BN with small amounts of hydrogen detected as N-H and B-H bands in the IR spectrum. An important feature of this method is the separation and localization of the thermal activation step at the hot filament from the surface reaction and film growth steps at the substrate surface. This allows both higher temperature thermal activation and lower temperature film growth.

  14. Contraction dynamics of planar liquid filaments

    NASA Astrophysics Data System (ADS)

    Devlin, Nicole; Sambath, Krishnaraj; Harris, Michael; Basaran, Osman

    2012-11-01

    Thin liquid sheets are ubiquitous in nature and urban landscapes, e.g. waterfalls, and industry, e.g. in various atomizers where sheets of liquid emanate from a nozzle or off a solid surface. These liquid sheets contract due to surface tension and may or may not break into smaller fragments depending on physical properties and flow conditions. The cross-section of a liquid sheet in a plane perpendicular to the main flow direction is a planar or 2D filament. Here, we study the contraction dynamics of an idealized 2D filament of an incompressible Newtonian fluid the initial shape of which is a rectangle terminated by two identical semi-circles. The dynamics are analyzed by solving the full 2D Navier-Stokes system and a1D, slender-jet approximation to it by a numerical technique based on the Galerkin finite element method. Simulation results are summarized by means of a phase diagram in the space of Reynolds number and initial filament aspect ratio. The talk will conclude with a discussion of the different modes of contraction and a critique of the capabilities and limitations of the 1D model.

  15. RNA interference Pathways in Filamentous Fungi

    PubMed Central

    Liu, Yi

    2015-01-01

    RNA interference is a conserved eukaryotic homology-dependent post-transcriptional gene silencing mechanism. The filamentous fungus Neurospora crassa is one of the first organisms used for RNAi studies. Quelling and Meiotic Silencing by Unpaired DNA (MSUD) are two RNAi related phenomena discovered in Neurospora and their characterizations have contributed significantly to our understanding of RNAi mechanisms in eukaryotes. More recently, a type of DNA damage-induced small RNA, microRNA-like small RNAs and Dicer-independent small silencing RNAs have been discovered in Neurospora crassa which can regulate gene expression. In addition, there are at least six different pathways responsible for the production of these small RNAs, indicating that this fungus is an important model system to study small RNA function and biogenesis. The RNAi studies in other filamentous fungi such as Cryphonectria paracitica and Aspergillus provide evidences that RNAi plays an important role in antiviral defense and RNAi mechanism is widely conserved in filamentous fungi, and RNAi has been commonly used as an efficient tool for studying the gene function. The discovery of the endogenous small RNAs from M. circinelloides further indicates the richness and complex of the RNAi field in eukaryotes. PMID:20680389

  16. Filament Channel Formation Via Magnetic Helicity Condensation

    NASA Astrophysics Data System (ADS)

    Knizhnik, Kalman Joshua; Antiochos, Spiro K.; DeVore, C. Richard

    2015-04-01

    A major unexplained feature of the solar atmosphere is the accumulation of magnetic shear, in the form of filament channels, at photospheric polarity inversion lines (PILs). In addition to free energy, this shear also represents magnetic helicity, which is conserved under reconnection. In this work, we address the problem of filament channel formation and show how they acquire their shear and magnetic helicity. The results of 3D simulations using the Adaptively Refined Magnetohydrodynamics Solver (ARMS) are presented that support the model of filament channel formation by magnetic helicity condensation developed by Antiochos (2013). We consider the convective twisting of a quasi-potential flux system that is bounded by a PIL and contains a coronal hole (CH). The magnetic helicity injected by the small-scale photospheric motions is shown to inverse-cascade up to the largest allowable scales that defined the closed flux system: the PIL and the CH. This process produces field lines that are both sheared and smooth, and are sheared in opposite senses at the PIL and the CH. The accumulated helicity and shear flux are shown to be in excellent quantitative agreement with the helicity-condensation model. We present a detailed analysis of the simulations, including comparisons of our analytical and numerical results, and discuss their implications for observations. Our research was supported by NASA's Earth and Space Science Fellowship (K.J.K.) and Heliophysics Supporting Research (S.K.A. and C.R.D.) programs.

  17. Filamentation and supercontinuum generation in tellurite glass

    NASA Astrophysics Data System (ADS)

    Liao, Meisong; Gao, Weiqing; Cheng, Tonglei; Duan, Zhongchao; Xue, Xiaojie; Kawashima, Hiroyasu; Suzuki, Takenobu; Ohishi, Yasutake

    2013-03-01

    Though soft glass such as tellurite or chalcogenide glass is transparent in the range of 3-6 ?m, fiber made of it is difficult to generate supercontinuum (SC) to that range because of the high loss, the wavelength limit of pump source, and the challenges in light-coupling. To circumvent these problems, we developed SC light source by using tellurite bulk glass through filamentation. For this scheme, the optical path length in the glass is very short due to the adopted high pump power, so the negative influence of material loss is reduced greatly. The light-coupling is straightforward, and the coupling efficiency is high. The bulk glass for SC generation is cheap, and can be fabricated easily. We adopted a pump wavelength of 1600 nm which is comparatively long. Such a long pump wavelength ensures a large energy ratio of the glass's bandgap to the incident photon, so the disadvantage of small bandgap of tellurite glass is reduced, and the twophoton absorption is avoided as well. We have shown that under suitable pump condition, the SC generation by filamentation can cover from visible to 6 ?m. It is the broadest SC generation by tellurite (including glass and fiber). For the suitable pump condition, the glass was free of optical breakdown. If the interface reflections were deducted, the SC conversion efficiency was 87%. The SC conversion efficiency was stable. To the best of our knowledge, this is the first report on filamentation in tellurite glass which has a comparatively small bandgap.

  18. Mechanical Properties of Intermediate Filament Proteins.

    PubMed

    Charrier, Elisabeth E; Janmey, Paul A

    2016-01-01

    Purified intermediate filament (IF) proteins can be reassembled in vitro to produce polymers closely resembling those found in cells, and these filaments form viscoelastic gels. The cross-links holding IFs together in the network include specific bonds between polypeptides extending from the filament surface and ionic interactions mediated by divalent cations. IF networks exhibit striking nonlinear elasticity with stiffness, as quantified by shear modulus, increasing an order of magnitude as the networks are deformed to large strains resembling those that soft tissues undergo in vivo. Individual IFs can be stretched to more than two or three times their resting length without breaking. At least 10 different rheometric methods have been used to quantify the viscoelasticity of IF networks over a wide range of timescales and strain magnitudes. The mechanical roles of different classes of cytoplasmic IFs on mesenchymal and epithelial cells in culture have also been studied by an even wider range of microrheological methods. These studies have documented the effects on cell mechanics when IFs are genetically or pharmacologically disrupted or when normal or mutant IF proteins are exogenously expressed in cells. Consistent with in vitro rheology, the mechanical role of IFs is more apparent as cells are subjected to larger and more frequent deformations. PMID:26795466

  19. DNA-based machines.

    PubMed

    Wang, Fuan; Willner, Bilha; Willner, Itamar

    2014-01-01

    The base sequence in nucleic acids encodes substantial structural and functional information into the biopolymer. This encoded information provides the basis for the tailoring and assembly of DNA machines. A DNA machine is defined as a molecular device that exhibits the following fundamental features. (1) It performs a fuel-driven mechanical process that mimics macroscopic machines. (2) The mechanical process requires an energy input, "fuel." (3) The mechanical operation is accompanied by an energy consumption process that leads to "waste products." (4) The cyclic operation of the DNA devices, involves the use of "fuel" and "anti-fuel" ingredients. A variety of DNA-based machines are described, including the construction of "tweezers," "walkers," "robots," "cranes," "transporters," "springs," "gears," and interlocked cyclic DNA structures acting as reconfigurable catenanes, rotaxanes, and rotors. Different "fuels", such as nucleic acid strands, pH (H?/OH?), metal ions, and light, are used to trigger the mechanical functions of the DNA devices. The operation of the devices in solution and on surfaces is described, and a variety of optical, electrical, and photoelectrochemical methods to follow the operations of the DNA machines are presented. We further address the possible applications of DNA machines and the future perspectives of molecular DNA devices. These include the application of DNA machines as functional structures for the construction of logic gates and computing, for the programmed organization of metallic nanoparticle structures and the control of plasmonic properties, and for controlling chemical transformations by DNA machines. We further discuss the future applications of DNA machines for intracellular sensing, controlling intracellular metabolic pathways, and the use of the functional nanostructures for drug delivery and medical applications. PMID:24647836

  20. Apparatus For Laminating Segmented Core For Electric Machine

    DOEpatents

    Lawrence, Robert Anthony; Stabel, Gerald R

    2003-06-17

    A segmented core for an electric machine includes segments stamped from coated electric steel. The segments each have a first end, a second end, and winding openings. A predetermined number of segments are placed end-to-end to form layers. The layers are stacked such that each of the layers is staggered from adjacent layers by a predetermined rotation angle. The winding openings of each of the layers are in vertical alignment with the winding openings of the adjacent layers. The stack of layers is secured to form the segmented core.

  1. Machinability of Titanium Alloys

    NASA Astrophysics Data System (ADS)

    Rahman, Mustafizur; Wong, Yoke San; Zareena, A. Rahmath

    Titanium and its alloys find wide application in many industries because of their excellent and unique combination of high strength-to-weight ratio and high resistance to corrosion. The machinability of titanium and its alloys is impaired by its high chemical reactivity, low modulus of elasticity and low thermal conductivity. A number of literatures on machining of titanium alloys with conventional tools and advanced cutting tool materials is reviewed. The results obtained from the study on high speed machining of Ti-6Al-4V alloys with cubic boron nitride (CBN), binderless cubic boron nitride (BCBN) and polycrystalline diamond (PCD) are also summarized.

  2. The pendulum wave machine

    NASA Astrophysics Data System (ADS)

    Zetie, K. P.

    2015-05-01

    There are many examples on the internet of videos of ‘pendulum wave machines’ and how to make them (for example, www.instructables.com/id/Wave-Pendulum/). The machine is simply a set of pendula of different lengths which, when viewed end on, produce wave-like patterns from the positions of the bobs. These patterns change with time, with new patterns emerging as the bobs change phase. In this article, the physics of the machine is explored and explained, along with tips on how to build such a device.

  3. Machine tools get smarter

    SciTech Connect

    Valenti, M.

    1995-11-01

    This article describes how, using software, sensors, and controllers, a new generation of intelligent machine tools are optimizing grinding, milling, and molding processes. A paradox of manufacturing parts is that the faster the parts are made, the less accurate they are--and vice versa. However, a combination of software, sensors, controllers, and mechanical innovations are being used to create a new generation of intelligent machine tools capable of optimizing their own grinding, milling, and molding processes. These brainy tools are allowing manufacturers to machine more-complex, higher-quality parts in shorter cycle times. The technology also lowers scrap rates and reduces or eliminates the need for polishing inadequately finished parts.

  4. Machine Tool Software

    NASA Technical Reports Server (NTRS)

    1988-01-01

    A NASA-developed software package has played a part in technical education of students who major in Mechanical Engineering Technology at William Rainey Harper College. Professor Hack has been using (APT) Automatically Programmed Tool Software since 1969 in his CAD/CAM Computer Aided Design and Manufacturing curriculum. Professor Hack teaches the use of APT programming languages for control of metal cutting machines. Machine tool instructions are geometry definitions written in APT Language to constitute a "part program." The part program is processed by the machine tool. CAD/CAM students go from writing a program to cutting steel in the course of a semester.

  5. OPTICAM machine design

    NASA Astrophysics Data System (ADS)

    Liedes, Jyrki T.

    1992-01-01

    Rank Pneumo has worked with the Center of Optics Manufacturing to design a multiple-axis flexible machining center for spherical lens fabrication. The OPTICAM/SM prototype machine has been developed in cooperation with the Center's Manufacturing Advisory Board. The SM will generate, fine grind, pre-polish, and center a spherical lens surface in one setup sequence. Unique features of the design incorporate machine resident metrology to provide RQM (Real-time Quality Management) and closed-loop feedback control that corrects for lens thickness, diameter, and centering error. SPC (Statistical Process Control) software can compensate for process drift and QA data collection is provided without additional labor.

  6. Machine phase fullerene nanotechnology

    NASA Astrophysics Data System (ADS)

    Globus, Al; Bauschlicher, Charles W., Jr.; Han, Jie; Jaffe, Richard L.; Levit, Creon; Srivastava, Deepak

    1998-09-01

    Recent advances in fullerene science and technology suggest that it may be possible, in the distant future, to design and build atomically precise programmable machines composed largely of functionalized fullerenes. Large numbers of such machines with appropriate interconnections could conceivably create a material able to react to the environment and repair itself. This paper reviews some of the experimental and theoretical work relating to these materials, sometimes called machine phase, including the fullerene gears and high-density memory recently designed and simulated in our laboratory.

  7. Formation of cold clumps and filaments around superbubbles

    NASA Astrophysics Data System (ADS)

    Ntormousi, Evangelia; Dawson, Joanne; Del Sordo, Fabio; Hennebelle, Patrick

    2015-08-01

    The combined feedback of supernova explosions and stellar winds from associations of massive stars has a dramatic impact on their environment: Large amounts of energy coming from the ejecta create dense shocks around the associations, compressing the surrounding ISM and triggering the formation of molecular clouds and new stars. In this work we employ high-resolution, three-dimensional simulations of this process with the MHD code RAMSES to explore the effects of self-gravity and magnetic fields on the structure of the shells. Two superbubbles expand and collide in a turbulent diffuse medium. In the expansion phase rich dense structure appears on the surface of the shocks due to hydrodynamic and hydromagnetic instabilities. Although gravity seems to play a minor role in the formation and evolution of these dense clumps, magnetic fields completely alter both the expansion of the superbubble and the morphology of the dense gas, slowing the expansion down and causing the appearance of large-scale filaments. The collision does not help increase the amount of cold gas, but rather destroys a lot of the pre-existing dense structures. Finally, we compare clouds formed in these simulations with observations of a molecular cloud crushed between two superbubbles.

  8. Coastal Ohio Wind Project

    SciTech Connect

    Gorsevski, Peter; Afjeh, Abdollah; Jamali, Mohsin; Bingman, Verner

    2014-04-04

    The Coastal Ohio Wind Project intends to address problems that impede deployment of wind turbines in the coastal and offshore regions of Northern Ohio. The project evaluates different wind turbine designs and the potential impact of offshore turbines on migratory and resident birds by developing multidisciplinary research, which involves wildlife biology, electrical and mechanical engineering, and geospatial science. Firstly, the project conducts cost and performance studies of two- and three-blade wind turbines using a turbine design suited for the Great Lakes. The numerical studies comprised an analysis and evaluation of the annual energy production of two- and three-blade wind turbines to determine the levelized cost of energy. This task also involved wind tunnel studies of model wind turbines to quantify the wake flow field of upwind and downwind wind turbine-tower arrangements. The experimental work included a study of a scaled model of an offshore wind turbine platform in a water tunnel. The levelized cost of energy work consisted of the development and application of a cost model to predict the cost of energy produced by a wind turbine system placed offshore. The analysis found that a floating two-blade wind turbine presents the most cost effective alternative for the Great Lakes. The load effects studies showed that the two-blade wind turbine model experiences less torque under all IEC Standard design load cases considered. Other load effects did not show this trend and depending on the design load cases, the two-bladed wind turbine showed higher or lower load effects. The experimental studies of the wake were conducted using smoke flow visualization and hot wire anemometry. Flow visualization studies showed that in the downwind turbine configuration the wake flow was insensitive to the presence of the blade and was very similar to that of the tower alone. On the other hand, in the upwind turbine configuration, increasing the rotor blade angle of attack reduced the wake size and enhanced the vortices in the flow downstream of the turbine-tower compared with the tower alone case. Mean and rms velocity distributions from hot wire anemometer data confirmed that in a downwind configuration, the wake of the tower dominates the flow, thus the flow fields of a tower alone and tower-turbine combinations are nearly the same. For the upwind configuration, the mean velocity shows a narrowing of the wake compared with the tower alone case. The downwind configuration wake persisted longer than that of an upwind configuration; however, it was not possible to quantify this difference because of the size limitation of the wind tunnel downstream of the test section. The water tunnel studies demonstrated that the scale model studies could be used to adequately produce accurate motions to model the motions of a wind turbine platform subject to large waves. It was found that the important factors that affect the platform is whether the platform is submerged or surface piercing. In the former, the loads on the platform will be relatively reduced whereas in the latter case, the structure pierces the wave free surface and gains stiffness and stability. The other important element that affects the movement of the platform is depth of the sea in which the wind turbine will be installed. Furthermore, the wildlife biology component evaluated migratory patterns by different monitoring systems consisting of marine radar, thermal IR camera and acoustic recorders. The types of radar used in the project are weather surveillance radar and marine radar. The weather surveillance radar (1988 Doppler), also known as Next Generation Radar (NEXRAD), provides a network of weather stations in the US. Data generated from this network were used to understand general migratory patterns, migratory stopover habitats, and other patterns caused by the effects of weather conditions. At a local scale our marine radar was used to complement the datasets from NEXRAD and to collect additional monitoring parameters such as passage rates, flight paths, flight directions, and flight altitudes of nocturnal migrating species. Our work focused on the design and development of custom built marine radar that used t-bar and parabolic dish antennas. The marine radar used in the project was Furuno (XANK250) which was coupled with a XIR3000B digitizing card from Russell Technologies for collection of the radar data. The radar data was processed by open source radR processing software using different computational techniques and methods. Additional data from thermal IR imaging cameras were collected to detect heat emitted from objects and provide information on movements of birds and bats, data which we used for different animal flight behavior analysis. Lastly, the data from the acoustic recorders were used to provide the number of bird calls for assessing patterns and peak passage rates during migration. The development of the geospatial database included collection of different data sources that are used to support offshore wind turbine development. Many different data sets were collected and organized using initial version of web-based repository software tools that can accommodate distribution of rectified pertinent data sets such as the lake depth, lake bottom engineering parameters, extent of ice, navigation pathways, wind speed, important bird habitats, fish efforts and other layers that are relevant for supporting robust offshore wind turbine developments. Additional geospatial products developed during the project included few different prototypes for offshore wind farm suitability which can involve different stakeholders and participants for solving complex planning problems and building consensus. Some of the prototypes include spatial decision support system (SDSS) for collaborative decision making, a web-based Participatory Geographic Information System (PGIS) framework for evaluating importance of different decision alternatives using different evaluation criteria, and an Android application for collection of field data using mobile and tablet devices . In summary, the simulations of two- and three-blade wind turbines suggested that two-bladed machines could produce comparable annual energy as the three-blade wind turbines but have a lighter tower top weight, which leads to lower cost of energy. In addition, the two-blade rotor configuration potentially costs 20% less than a three blade configuration that produces the same power at the same site. The cost model analysis predicted a potential cost savings of approximately 15% for offshore two-blade wind turbines. The foundation design for a wind turbine in Lake Erie is likely to be driven by ice loads based on the currently available ice data and ice mechanics models. Hence, for Lake Eire, the cost savings will be somewhat smaller than the other lakes in the Great Lakes. Considering the size of cranes and vessels currently available in the Great Lakes, the cost optimal wind turbine size should be 3 MW, not larger. The surveillance data from different monitoring systems suggested that bird and bat passage rates per hour were comparable during heavy migrations in both spring and fall seasons while passage rates were significantly correlated to wind directions and wind speeds. The altitude of migration was higher during heavy migrations and higher over water relative to over land. Notable portions of migration on some spring nights occurred parallel the shoreline, often moving perpendicular to southern winds. The birds approaching the Western basin have a higher propensity to cross than birds approaching the Central basin of Lake Erie and as such offshore turbine development might be a better option further east towards Cleveland than in the Western basin. The high stopover density was more strongly associated with migration volume the following night rather than the preceding night. The processed mean scalar wind speeds with temporal resolutions as fine as 10-minute intervals near turbine height showed that August is the month with the weakest winds while December is the month, which typically has the strongest winds. The ice data suggests that shallow western basin of Lake Erie has higher ice cover duration many times exceeding 90 days during some winters.

  9. Wind Engineering

    NASA Technical Reports Server (NTRS)

    1983-01-01

    Dr. Jack Cermak, Director of Fluid Dynamics and Diffusion Laboratory, developed the first wind tunnel to simulate the changing temperatures, directions and velocities of natural winds. In this work, Cermak benefited from NASA technology related to what is known as the atmospheric boundary layer (ABL).

  10. Data Machine Independence

    Energy Science and Technology Software Center (ESTSC)

    1994-12-30

    Data-machine independence achieved by using four technologies (ASN.1, XDR, SDS, and ZEBRA) has been evaluated by encoding two different applications in each of the above; and their results compared against the standard programming method using C.

  11. Tunnel boring machine

    SciTech Connect

    Snyder, L. L.

    1985-07-09

    A tunnel boring machine for controlled boring of a curvilinear tunnel including a rotating cutter wheel mounted on the forward end of a thrust cylinder assembly having a central longitudinal axis aligned with the cutter wheel axis of rotation; the thrust cylinder assembly comprising a cylinder barrel and an extendable and retractable thrust arm received therein. An anchoring assembly is pivotally attached to the rear end of the cylinder barrel for anchoring the machine during a cutting stroke and providing a rear end pivot axis during curved cutting strokes. A pair of laterally extending, extendable and retractable arms are fixedly mounted at a forward portion of the cylinder barrel for providing lateral displacement in a laterally curved cutting mode and for anchoring the machine between cutting strokes and during straight line boring. Forward and rear transverse displacement and support assemblies are provided to facilitate cutting in a transversely curved cutting mode and to facilitate machine movement between cutting strokes.

  12. Tropomyosin - master regulator of actin filament function in the cytoskeleton.

    PubMed

    Gunning, Peter W; Hardeman, Edna C; Lappalainen, Pekka; Mulvihill, Daniel P

    2015-08-15

    Tropomyosin (Tpm) isoforms are the master regulators of the functions of individual actin filaments in fungi and metazoans. Tpms are coiled-coil parallel dimers that form a head-to-tail polymer along the length of actin filaments. Yeast only has two Tpm isoforms, whereas mammals have over 40. Each cytoskeletal actin filament contains a homopolymer of Tpm homodimers, resulting in a filament of uniform Tpm composition along its length. Evidence for this 'master regulator' role is based on four core sets of observation. First, spatially and functionally distinct actin filaments contain different Tpm isoforms, and recent data suggest that members of the formin family of actin filament nucleators can specify which Tpm isoform is added to the growing actin filament. Second, Tpms regulate whole-organism physiology in terms of morphogenesis, cell proliferation, vesicle trafficking, biomechanics, glucose metabolism and organ size in an isoform-specific manner. Third, Tpms achieve these functional outputs by regulating the interaction of actin filaments with myosin motors and actin-binding proteins in an isoform-specific manner. Last, the assembly of complex structures, such as stress fibers and podosomes involves the collaboration of multiple types of actin filament specified by their Tpm composition. This allows the cell to specify actin filament function in time and space by simply specifying their Tpm isoform composition. PMID:26240174

  13. Microwave processing of ceramic oxide filaments. Annual report, FY1997

    SciTech Connect

    Vogt, G.J.

    1998-12-31

    The objective of the microwave filament processing project is to develop microwave techniques to manufacture continuous ceramic oxide filaments. Microwave processing uses the volumetric absorption of microwave power in oxide filament tows to drive off process solvents, to burn out organic binders, and to sinter the dried fibers to produce flexible, high-strength ceramic filaments. The technical goal is to advance filament processing technology by microwave heating more rapidly with less energy and at a lower cost than conventional processing, but with the same quality as conventional processing. The manufacturing goal is to collaborate with the 3M Company, a US manufacturer of ceramic oxide filaments, to evaluate the technology using a prototype filament system and to transfer the microwave technology to the 3M Company. Continuous ceramic filaments are a principal component in many advanced high temperature materials like continuous fiber ceramic composites (CFCC) and woven ceramic textiles. The use of continuous ceramic filaments in CFCC radiant burners, gas turbines, waste incineration, and hot gas filters in U.S. industry and power generation is estimated to save at least 2.16 quad/yr by year 2010 with energy cost savings of at least $8.1 billion. By year 2010, continuous ceramic filaments and CFCC`s have the potential to abate pollution emissions by 917,000 tons annually of nitrous oxide and 118 million tons annually of carbon dioxide (DOE Report OR-2002, February, 1994).

  14. Motions and oscillations in a filament preceding its eruption

    NASA Astrophysics Data System (ADS)

    Mashnich, G. P.; Bashkirtsev, V. S.

    2016-02-01

    The Doppler motions in a filament and the underlying photosphere over the several days before its eruption are analyzed. A large filament in the northern hemisphere near the central meridian observed from August 31-September 2, 2014 erupted on September 2, 2014. The filament lost the bulk of its mass as a result of its eruption, and the process of its reconstruction had begun a day later. Observations of this filament in a spectral range encompassing the Hβ λ 486.1 nm (chromospheric) and Fe I λ 485.9 nm (photospheric) lines were carried out on the Horizontal Solar Telescope of the Sayan Solar Observatory on August 31-September 2, 2014. Analysis of the Doppler motions in and beneath the filament yielded the following results. Strong rotational motions were present in the filament over a prolonged period (the entire three days of observations). The coincidence of the steady-state motions of the photosphere and filament was disrupted at the moment of destabilization of the filament by the emergence of new magnetic flux. Short-period (about five-minute) photospheric oscillationswith a train-like character arose in filament from time to time several hours before the eruption. Large segments underwent nearly vertical oscillations in the initial phase of the ascent of the filament.

  15. Microtubule-dependent transport and dynamics of vimentin intermediate filaments

    PubMed Central

    Hookway, Caroline; Ding, Liya; Davidson, Michael W.; Rappoport, Joshua Z.; Danuser, Gaudenz; Gelfand, Vladimir I.

    2015-01-01

    We studied two aspects of vimentin intermediate filament dynamics—transport of filaments and subunit exchange. We observed transport of long filaments in the periphery of cells using live-cell structured illumination microscopy. We studied filament transport elsewhere in cells using a photoconvertible-vimentin probe and total internal reflection microscopy. We found that filaments were rapidly transported along linear tracks in both anterograde and retrograde directions. Filament transport was microtubule dependent but independent of microtubule polymerization and/or an interaction with the plus end–binding protein APC. We also studied subunit exchange in filaments by long-term imaging after photoconversion. We found that converted vimentin remained in small clusters along the length of filaments rather than redistributing uniformly throughout the network, even in cells that divided after photoconversion. These data show that vimentin filaments do not depolymerize into individual subunits; they recompose by severing and reannealing. Together these results show that vimentin filaments are very dynamic and that their transport is required for network maintenance. PMID:25717187

  16. Disruption of the keratin filament network during epithelial cell division.

    PubMed Central

    Lane, E B; Goodman, S L; Trejdosiewicz, L K

    1982-01-01

    The behaviour of keratin filaments during cell division was examined in a wide range of epithelial lines from several species. Almost half of them show keratin disruption as described previously: by immunofluorescence, filaments are replaced during mitosis by a 'speckled' pattern of discrete cytoplasmic dots. In the electron microscope these ' speckles ' are seen as granules around the cell periphery, just below the actin cortical mesh, with no detectable 10 nm filament structure inside them and no keratin filament bundles in the rest of the cytoplasm. A time course of the filament reorganization was constructed from double immunofluorescence data; filaments are disrupted in prophase, and the filament network is intact again by cytokinesis. The phenomenon is restricted to cells rich in keratin filaments, such as keratinocytes; it is unrelated to the co-existence of vimentin in many of these cells, and vimentin is generally maintained as filaments while the keratin is restructured. Some resistance to the effect may be conferred by an extended cycle time. Filament reorganization takes place within minutes, so that a reversible mechanism seems more likely than one involving de novo protein synthesis, at this metabolically quiet stage of the cell cycle. Images Fig. 1. Fig. 2. Fig. 3. Fig. 4. Fig. 5. Fig. 6. PMID:6202508

  17. Nebulin regulates actin filament lengths by a stabilization mechanism

    PubMed Central

    Pappas, Christopher T.; Krieg, Paul A.

    2010-01-01

    Efficient muscle contraction requires regulation of actin filament lengths. In one highly cited model, the giant protein nebulin has been proposed to function as a molecular ruler specifying filament lengths. We directly challenged this hypothesis by constructing a unique, small version of nebulin (mini-nebulin). When endogenous nebulin was replaced with mini-nebulin in skeletal myocytes, thin filaments extended beyond the end of mini-nebulin, an observation which is inconsistent with a strict ruler function. However, under conditions that promote actin filament depolymerization, filaments associated with mini-nebulin were remarkably maintained at lengths either matching or longer than mini-nebulin. This indicates that mini-nebulin is able to stabilize portions of the filament it has no contact with. Knockdown of nebulin also resulted in more dynamic populations of thin filament components, whereas expression of mini-nebulin decreased the dynamics at both filament ends (i.e., recovered loss of endogenous nebulin). Thus, nebulin regulates thin filament architecture by a mechanism that includes stabilizing the filaments and preventing actin depolymerization. PMID:20498015

  18. Wind energy.

    PubMed

    Leithead, W E

    2007-04-15

    From its rebirth in the early 1980s, the rate of development of wind energy has been dramatic. Today, other than hydropower, it is the most important of the renewable sources of power. The UK Government and the EU Commission have adopted targets for renewable energy generation of 10 and 12% of consumption, respectively. Much of this, by necessity, must be met by wind energy. The US Department of Energy has set a goal of 6% of electricity supply from wind energy by 2020. For this potential to be fully realized, several aspects, related to public acceptance, and technical issues, related to the expected increase in penetration on the electricity network and the current drive towards larger wind turbines, need to be resolved. Nevertheless, these challenges will be met and wind energy will, very likely, become increasingly important over the next two decades. An overview of the technology is presented. PMID:17272245

  19. Zigzags in Turing Machines

    NASA Astrophysics Data System (ADS)

    Gajardo, Anahí; Guillon, Pierre

    We study one-head machines through symbolic and topological dynamics. In particular, a subshift is associated to the subshift, and we are interested in its complexity in terms of realtime recognition. We emphasize the class of one-head machines whose subshift can be recognized by a deterministic pushdown automaton. We prove that this class corresponds to particular restrictions on the head movement, and to equicontinuity in associated dynamical systems.

  20. Sealing intersecting vane machines

    DOEpatents

    Martin, Jedd N.; Chomyszak, Stephen M.

    2005-06-07

    The invention provides a toroidal intersecting vane machine incorporating intersecting rotors to form primary and secondary chambers whose porting configurations minimize friction and maximize efficiency. Specifically, it is an object of the invention to provide a toroidal intersecting vane machine that greatly reduces the frictional losses through intersecting surfaces without the need for external gearing by modifying the width of one or both tracks at the point of intermeshing. The inventions described herein relate to these improvements.

  1. Sealing intersecting vane machines

    DOEpatents

    Martin, Jedd N. (Providence, RI); Chomyszak, Stephen M. (Attleboro, MA)

    2007-06-05

    The invention provides a toroidal intersecting vane machine incorporating intersecting rotors to form primary and secondary chambers whose porting configurations minimize friction and maximize efficiency. Specifically, it is an object of the invention to provide a toroidal intersecting vane machine that greatly reduces the frictional losses through intersecting surfaces without the need for external gearing by modifying the width of one or both tracks at the point of intermeshing. The inventions described herein relate to these improvements.

  2. Human-machine interactions

    DOEpatents

    Forsythe, J. Chris; Xavier, Patrick G.; Abbott, Robert G.; Brannon, Nathan G.; Bernard, Michael L.; Speed, Ann E.

    2009-04-28

    Digital technology utilizing a cognitive model based on human naturalistic decision-making processes, including pattern recognition and episodic memory, can reduce the dependency of human-machine interactions on the abilities of a human user and can enable a machine to more closely emulate human-like responses. Such a cognitive model can enable digital technology to use cognitive capacities fundamental to human-like communication and cooperation to interact with humans.

  3. Flexible machining systems described

    NASA Astrophysics Data System (ADS)

    Butters, H. J.

    1985-03-01

    The rationalization and gradual automation of short rotationally symmetric parts in the Saalfeld VEB Machine Tool Factory was carried out in three stages: (1) part-specific manufacturing; (2) automated production line for manufacturing toothed gears; and (3) automated manufacturing section for short rotationally symmetric parts. The development of numerically controlled machine tools and of industrial robot technology made possible automated manufacturing. The design of current facilities is explored, manufacturing control is examined, experience is reported.

  4. Doubly fed induction machine

    DOEpatents

    Skeist, S. Merrill; Baker, Richard H.

    2005-10-11

    An electro-mechanical energy conversion system coupled between an energy source and an energy load including an energy converter device having a doubly fed induction machine coupled between the energy source and the energy load to convert the energy from the energy source and to transfer the converted energy to the energy load and an energy transfer multiplexer coupled to the energy converter device to control the flow of power or energy through the doubly fed induction machine.

  5. Metalworking and machining fluids

    SciTech Connect

    Erdemir, Ali; Sykora, Frank; Dorbeck, Mark

    2010-10-12

    Improved boron-based metal working and machining fluids. Boric acid and boron-based additives that, when mixed with certain carrier fluids, such as water, cellulose and/or cellulose derivatives, polyhydric alcohol, polyalkylene glycol, polyvinyl alcohol, starch, dextrin, in solid and/or solvated forms result in improved metalworking and machining of metallic work pieces. Fluids manufactured with boric acid or boron-based additives effectively reduce friction, prevent galling and severe wear problems on cutting and forming tools.

  6. A filament of energetic particles near the high-latitude dawn magnetopause

    NASA Technical Reports Server (NTRS)

    Lui, A. T. Y.; Williams, D. J.; Mcentire, R. W.; Christon, S. P.; Jacquey, C.; Angelopoulos, V.; Yamamoto, T.; Kokubun, S.; Frank, L. A.; Ackerson, K. L.

    1994-01-01

    The Geotail satelite detected a filament of tailward-streaming energetic particles spatially separated from the boundary layer of energetic particles at the high-latitude dawn magnetopause at a downstream distance of approximately 80 R(sub E) on October 27, 1992. During this event, the composition and charge states of energetic ions at energies above approximately 10 keV show significant intermix of ions from solar wind and ionospheric sources. Detailed analysis leads to the deduction that the filament was moving southward towards the neutral sheet at an average speed of approximately 80 km/s, implying an average duskward electric field of approximately 1 mV/m. Its north-south dimension was approximately 1 R(sub E) and it was associated with an earthward directed field-aligned current of approximately 5 mA/m. The filament was separated from the energetic particle boundary layer straddling the magnetopause by approximately 0.8 R(sub E) and was inferred to be detached from the boundary layer at downstream distance beyond approximately 70 R(sub E) in the distant tail.

  7. Filaments of Forming Star Cluster Complexes in the Heart of NGC~1808

    NASA Astrophysics Data System (ADS)

    Galliano, E.; Kissler-Patig, M.; Tacconi-Garmann, L.; Alloin, D.

    2014-09-01

    We present new ESO/VLT/SINFONI data of the central starburst region of NGC~1808. We highlight the detection of chaplets of embedded clusters forming along filaments of gas circling around the nucleus. The embedded clusters are detected as Br_gamma sources and have no K-band counterpart. The kinematic maps reveal an inward radial velocity component for the gas, which is more pronounced than that for the stars. This suggests a scenario in which clusters are formed in inward spiraling filaments of gas which are locally illuminated by the young massive clusters. After 4-8 Myr, the clusters, following the stellar kinematic pattern, drift away from the gas filaments and become detectable in the K-band. This mechanism may complement gas expulsion by winds and supernovae for explaining the transition from embedded to non-embedded state, and may be especially important in dense environments such as those observed in the central starburst region of barred spiral galaxies.

  8. The shape of strings to come: How topological defects twist, bend, and wrinkle filament bundles

    NASA Astrophysics Data System (ADS)

    Bruss, Isaac; Grason, Gregory

    2015-03-01

    Topological defects are crucial to the thermodynamics and structure of condensed matter systems. For instance, when incorporated into crystalline membranes like graphene, 5- and 7-fold disclinations produce conical- and saddle-like geometries respectively. A recently discovered mapping between the inter-filament spacing within a deformed bundle and the metric properties of curved surfaces, suggests previously unexplored parallels between the two, specifically in regards to how 2D patterning promotes 3D shape transitions. This discovery is poised to describe the structure of a host of filamentous materials-both biological and microfabricated-that exhibit distinctive shapes and packings. Motivated by the filamentous analogs to the conical and saddles shapes found in thin membranes, we investigate for the first time the interplay between defects in the cross section of a bundle and its global structure, using a combination of continuum elasticity theory and numerical simulation of cohesive bundles with a fixed packing topology. Focusing primarily on the instability response to disclinations, we predict a host of new equilibria structures, some of which are without direct parallel to the analogous membrane, including torsional wrinkling, radial kinking, and helical winding. Center for Hierarchical Manufacturing-CMMI 10-25020, NSF CAREER Award-DMR 09-55760, & UMass MRSEC.

  9. Impact damage detection in filament wound tubes utilizing embedded optical fibers

    NASA Astrophysics Data System (ADS)

    Martin, Anthony R.; Hayes, Simon A.; Fernando, Gerard F.; Hale, Ken F.

    1995-04-01

    Filament wound tubes are currently being used extensively in service because of their superior specific properties and the relatively simple manufacturing technique involved in their properties. However, the reinforcing fibers can suffer from low velocity impact damage (approximately 10 ms-1) during service. Such damage can result in poor post- impact properties which in certain applications can reduce the burst strength below safe working levels. This paper discusses the use of optical fiber sensors, embedded during the filament winding process, to provide information on specified levels of impact damage incurred by the tube during service. The sensors being developed use silica based optical fibers in composites made from E-glass reinforcing fibers and high temperature cure epoxy resins. Various methods of damage detection are being evaluated to select the optimum sensor arrangement. These systems detect changes in the transmission characteristics of the optical fiber. The objective being to produce a working damage detection system which provides sensitive, cheap, accurate and reliable information about the levels of impact damage sustained by the tube. This paper presents initial results from the impact damage detection systems being evaluated for use in filament wound tubes. Issues relating to chemical compatibility between optical fiber sensors and the epoxy resin system were also investigated as part of this study. These results aid selection of the correct optical fiber properties to achieve reliable and sensitive systems. The advantages of using a new profile sensor compared to an optical fiber are also discussed.

  10. Twisted ribbon structure of paired helical filaments revealed by atomic force microscopy.

    PubMed Central

    Pollanen, M. S.; Markiewicz, P.; Bergeron, C.; Goh, M. C.

    1994-01-01

    Progressive deposition of phosphorylated tau into the paired helical filaments (PHF) that compose neurofibrillary tangles, dystrophic neurites, and neuropil threads is an obligate feature of Alzheimer's disease. The standard model of PHF structure, derived from electron microscopic studies, suggests that two 8- to 10-nm filaments each composed of three to four protofilaments are wound into a helix with a maximal diameter of -20 nm and a half period of 65 to 80 nm. However, recent vertical platinum-carbon replicas of PHF more closely resemble a thin helical ribbon without constitutive protofilaments. Here we report that native PHF imaged with an atomic force microscope appear as twisted ribbons rather than the generally accepted structure derived from electron microscopic studies. These data imply that the assembly of PHF is not due to the twisting of pair-wise filaments but rather the helical winding of self-associated tau molecules arranged into a flattened structure. Future structural models of PHF should be based on quantitative data obtained from imaging techniques, such as scanning probe microscopy, which do not require harsh specimen preparation procedures. Images Figure 1 PMID:8178938

  11. Novel Transverse Flux Machine for Vehicle Traction Applications: Preprint

    SciTech Connect

    Wan, Z.; Ahmed, A.; Husain, I.; Muljadi, E.

    2015-04-02

    A novel transverse flux machine topology for electric vehicle traction applications using ferrite magnets is presented in this paper. The proposed transverse flux topology utilizes novel magnet arrangements in the rotor that are similar to the Halbach array to boost flux linkage; on the stator side, cores are alternately arranged around a pair of ring windings in each phase to make use of the entire rotor flux that eliminates end windings. Analytical design considerations and finite-element methods are used for an optimized design of a scooter in-wheel motor. Simulation results from finite element analysis (FEA) show that the motor achieved comparable torque density to conventional rare-earth permanent magnet (PM) machines. This machine is a viable candidate for direct-drive applications with low cost and high torque density.

  12. Flow filaments linking bright and dark filaments in a sunspot penumbra

    NASA Astrophysics Data System (ADS)

    Tritschler, A.; Schlichenmaier, R.; Bellot Rubio, L. R.

    2005-05-01

    We present two-dimensional spectroscopic sunspot observations of high spatial (≍ 0.5 arcsec) and high spectral resolution (λ/Δλ = 250000). The observations were taken with the Telecentric Solar Spectrometer (TESOS) operated at the German Vacuum Tower Telescope on Tenerife. We examine a single scan taken in the popular non-magnetic neutral iron line at 557.6 nm and concentrate our analysis on the unsettled issue of the relation between the Evershed flow and the intensity structure in a sunspot penumbra. At the end of the 20th century, observers concluded that the highest flow velocities are connected to the dark filaments which harbour more horizontal magnetic fields than the bright filaments. Based on a correlation analysis we find that the correlation between flows and intensity varies from the inner to the outer penumbra, from the center-side to the limb-side penumbra, and depends on the length of the trace used to perform the correlation. The line-of-sight velocity maps reveal that the Evershed flow on the center-side penumbra appears highly organised in narrow flow filaments, while the flows in the red-shifted limb-side penumbra do not show a filamentary fine-structure. A high correlation between flow speed and intensity is only observed over small spatial scales, i.e. considering short traces cutting individual features. The correlation is positive in the inner centre and limb-side penumbra, and tends to be negative in the outer penumbra. Our results imply that the Evershed flow is present in bright and dark filaments. In individual cases we find that flow filaments connect bright and dark filaments supporting the moving tube model for the penumbral fine structure.

  13. Could a machine think

    SciTech Connect

    Churchland, P.M.; Churchland, P.S. )

    1990-01-01

    There are many reasons for saying yes. One of the earliest and deepest reason lay in two important results in computational theory. The first was Church's thesis, which states that every effectively computable function is recursively computable. The second important result was Alan M. Turing's demonstration that any recursively computable function can be computed in finite time by a maximally simple sort of symbol-manipulating machine that has come to be called a universal Turing machine. This machine is guided by a set of recursively applicable rules that are sensitive to the identity, order and arrangement of the elementary symbols it encounters as input. The authors reject the Turing test as a sufficient condition for conscious intelligence. They base their position of the specific behavioral failures of the classical SM machines and on the specific virtues of machines with a more brain-like architecture. These contrasts show that certain computational strategies have vast and decisive advantages over others where typical cognitive tasks are concerned, advantages that are empirically inescapable. Clearly, the brain is making systematic use of these computational advantage. But it need not be the only physical system capable of doing so. Artificial intelligence, in a nonbiological but massively parallel machine, remain a compelling and discernible prospect.

  14. 16. Interior, Machine Shop, Roundhouse Machine Shop Extension, Southern Pacific ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    16. Interior, Machine Shop, Roundhouse Machine Shop Extension, Southern Pacific Railroad Carlin Shops, view to south (90mm lens). Note the large segmental-arched doorway to move locomotives in and out of Machine Shop. - Southern Pacific Railroad, Carlin Shops, Roundhouse Machine Shop Extension, Foot of Sixth Street, Carlin, Elko County, NV

  15. Multistage axial-flux PM machine for wheel direct drive

    SciTech Connect

    Caricchi, F.; Crescimbini, F.; Mezzetti, F.; Santini, E.

    1996-07-01

    The design of direct-drive wheel motors must comply with diameter restriction due to housing the motor in a wheel rim and allow the achievement of very high torque density and overload capability. Slotless axial-flux permanent magnet machines (AFPMs) prove to be the best candidate for application in electric vehicles as direct-drive wheel motors, as in comparison with conventional machines they allow designs with higher compactness, lightness and efficiency. The paper presents a newly conceived AFPM which has a multistage structure and a water-cooled ironless stator. In the proposed new topology of the machine the space formerly occupied by the toroidal core becomes a water duct, which removes heat directly from the interior surface of the stator winding. The high efficiency of the machine cooling arrangement allows long-term 100% overload operation and great reduction of the machine weight. The multistage structure of the machine is suited to overcome the restriction on the machine diameter and meet the torque required at the wheel shaft. The paper gives guidelines for the design of a multistage AFPM with water-cooled ironless stator, and describes characteristics of a two-stage prototype machine rated 215 N{center_dot}m, 1,100 r/min.

  16. Validity of using average diameter for determination of tensile strength and Weibull modulus of ceramic filaments

    SciTech Connect

    Petry, M.D.; Mah, T.I.; Kerans, R.J.

    1997-10-01

    Strengths and Weibull moduli for alumina/yttrium aluminum garnet eutectic (AYE) filaments and for Si-C-O (Nicalon) filaments were calculated using measured and average filament diameters. The strengths agreed closely. Thus an average filament diameter could be used instead of the measured filament diameter in calculating strengths. The Weibull modulus obtained from an average filament diameter approximates the Weibull modulus obtained using the measured filament diameter.

  17. Small wind systems (field evaluation). Volume 4: Small wind system performance data

    NASA Astrophysics Data System (ADS)

    Sherman, J. M.; Dodge, D. M.; Bollmeier, W. S.

    1983-07-01

    The operation, management, and results of the Field Evaluation Program (FEP) for small wind systems, is described. The FEP was initiated in early 1979 with the overall objective of installing wind systems in the states and territories (including those in the Pacific Basin) to assist local governments in evaluating and addressing the institutional concerns associated with the proliferation of small wind systems in utility interconnected applications. The report is presented in four volumes. In Volume 4 the data collection and analysis procedures followed during the FEP are described and performance data summaries are presented for each of the 38 sites. None of the FEP wind systems installed at good wind sites approached the expected energy output and, in aggregate, the machines produced about hallf the energy expected. The mean capacity factor for machines at sites with average winds of 4.5 m/s or greater was .10. Mean times between failures for three wind system models varied from 85 to 187 days. The poor performance of the FEP machines indicated that the technology required major improvement.

  18. [A new machinability test machine and the machinability of composite resins for core built-up].

    PubMed

    Iwasaki, N

    2001-06-01

    A new machinability test machine especially for dental materials was contrived. The purpose of this study was to evaluate the effects of grinding conditions on machinability of core built-up resins using this machine, and to confirm the relationship between machinability and other properties of composite resins. The experimental machinability test machine consisted of a dental air-turbine handpiece, a control weight unit, a driving unit of the stage fixing the test specimen, and so on. The machinability was evaluated as the change in volume after grinding using a diamond point. Five kinds of core built-up resins and human teeth were used in this study. The machinabilities of these composite resins increased with an increasing load during grinding, and decreased with repeated grinding. There was no obvious correlation between the machinability and Vickers' hardness; however, a negative correlation was observed between machinability and scratch width. PMID:11496409

  19. Product liability and wind system manufacturers: proposals for protection

    SciTech Connect

    Noun, R.

    1980-05-01

    Information is presented concerning product liability law and small wind machine manufacturers; judicial direction in product liability law; the role of standards is assessing potential liability; the impact of potential liability on wind system product liability insurance; the manufacturer's role in product liability prevention; and the federal role in policy alternatives to help minimize liability.

  20. Wind Energy Conversion Systems. A Unit of Instruction.

    ERIC Educational Resources Information Center

    Greenwald, Martin

    The number of secondary schools, colleges, and universities offering courses in wind energy machine construction, repair, and installation, continues to increase. It is the purpose of this unit to include the study of wind energy conversion systems (WECS) as an integral part of related vocational and technical curriculum materials. The unit's…

  1. Wind Energy Conversion Systems. A Unit of Instruction.

    ERIC Educational Resources Information Center

    Greenwald, Martin

    The number of secondary schools, colleges, and universities offering courses in wind energy machine construction, repair, and installation, continues to increase. It is the purpose of this unit to include the study of wind energy conversion systems (WECS) as an integral part of related vocational and technical curriculum materials. The unit's…

  2. Low cost composite materials for wind energy conversion systems

    NASA Astrophysics Data System (ADS)

    Weingart, O.

    1980-06-01

    A winding process utilizing a low-cost E-glass fabric called transverse-filament tape for low-cost production of wind turbine generators (WTG) is described. The process can be carried out continuously at high speed to produce large one-piece parts with tapered wall thicknesses on a tapered mandrel. It is being used to manufacture blades for the NASA/DOE 200-ft-diameter MOD-1 WTG and Rockwell/DOE 40-kW small wind energy conversion system (SWECS).

  3. Low cost composite materials for wind energy conversion systems

    NASA Technical Reports Server (NTRS)

    Weingart, O.

    1980-01-01

    A winding process utilizing a low-cost E-glass fabric called transverse-filament tape for low-cost production of wind turbine generators (WTG) is described. The process can be carried out continuously at high speed to produce large one-piece parts with tapered wall thicknesses on a tapered mandrel. It is being used to manufacture blades for the NASA/DOE 200-ft-diameter MOD-1 WTG and Rockwell/DOE 40-kW small wind energy conversion system (SWECS).

  4. Microwave guiding in air along single femtosecond laser filament

    SciTech Connect

    Ren Yu; Alshershby, Mostafa; Qin Jiang; Hao Zuoqiang; Lin Jingquan

    2013-03-07

    Microwave guiding along single plasma filament generated through the propagation of femtosecond (fs) laser pulses in air has been demonstrated over a distance of about 6.5 cm, corresponding to a microwave signal intensity enhancement of more than 3-fold over free space propagation. The current propagation distance along the fs laser filament is in agreement with the calculations and limited by the relatively high resistance of the single plasma filament. Using a single fs laser filament to channel microwave radiation considerably alleviate requirements to the power of fs laser pulses compared to the case of the circular filaments waveguide. In addition, it can be used as a simple and non-intrusive method to obtain the basic parameters of laser-generated plasma filament.

  5. A FILAMENT ERUPTION ON 2010 OCTOBER 21 FROM THREE VIEWPOINTS

    SciTech Connect

    Filippov, Boris

    2013-08-10

    A filament eruption on 2010 October 21 observed from three different viewpoints by the Solar Terrestrial Relations Observatory and the Solar Dynamic Observatory is analyzed by also invoking data from the Solar and Heliospheric Observatory and the Kanzelhoehe Solar Observatory. The position of the filament just before the eruption at the central meridian not far from the center of the solar disk was favorable for photospheric magnetic field measurements in the area below the filament. Because of this, we were able to calculate with high precision the distribution of the coronal potential magnetic field near the filament. We found that the filament began to erupt when it approached the height in the corona where the magnetic field decay index was greater than 1. We also determined that during the initial stage of the eruption the filament moved along the magnetic neutral surface.

  6. A filament supported by different magnetic field configurations

    NASA Astrophysics Data System (ADS)

    Guo, Y.; Schmieder, B.; Démoulin, P.; Wiegelmann, T.; Aulanier, G.; Török, T.; Bommier, V.

    2011-08-01

    A nonlinear force-free magnetic field extrapolation of vector magnetogram data obtained by THEMIS/MTR on 2005 May 27 suggests the simultaneous existence of different magnetic configurations within one active region filament: one part of the filament is supported by field line dips within a flux rope, while the other part is located in dips within an arcade structure. Although the axial field chirality (dextral) and the magnetic helicity (negative) are the same along the whole filament, the chiralities of the filament barbs at different sections are opposite, i.e., right-bearing in the flux rope part and left-bearing in the arcade part. This argues against past suggestions that different barb chiralities imply different signs of helicity of the underlying magnetic field. This new finding about the chirality of filaments will be useful to associate eruptive filaments and magnetic cloud using the helicity parameter in the Space Weather Science.

  7. Filamentation Instability of Counterpropagating Charged Particle Beams: Statistical Properties

    SciTech Connect

    Dieckmann, M. E.

    2008-10-15

    The filamentation instability (FI) driven by beams of counter-propagating electrons is examined with one-dimensional (1D) and two-dimensional (2D) particle-in-cell (PIC) simulations. The 1D simulation reveals the saturation mechanism of the FI. The magnetic pressure gradient displaces the electrons. The resulting electrostatic field inhibits together with the magnetic field a further growth of the filaments by suppressing the electron motion. The FI evolves into a stationary equilibrium in 1D, which shows a statistical distribution of the filament sizes that resembles a Gumbel distribution. The 2D PIC simulation allows the filaments to move around each other and filaments carrying currents of equal polarity can merge. The time-evolution of the characteristic size of the filaments in the 2D simulation is measured. It increases linearly with the time.

  8. The SERI wind energy program

    NASA Astrophysics Data System (ADS)

    Vas, I. E.

    The widespread implementation of wind energy is supported by conducting research and development studies. The activities fall into three general areas-planning, management and analysis; advanced and innovative concepts; and information development. In the first area, the work conducted relates to economic, application, legal, social and environmental studies which are generic and could be applied to a wide range of machine size and type. The second area of responsibility lies with the directing and managing of advanced and innovative concepts--those high risk concepts that offer the potential of improving upon the cost of energy of conventional systems and of increasing the wide spread implementation of wind systems into populated areas. The third area of responsibility relates to the development of informational documents which are designed for specific audiences. This activity generally supports the Solar Energy Information Data Bank in their efforts to provide general information in response to inquiries on wind energy.

  9. Wind energy - A utility perspective

    NASA Astrophysics Data System (ADS)

    Fung, K. T.; Scheffler, R. L.; Stolpe, J.

    1981-03-01

    Broad consideration is given to the siting, demand, capital and operating cost and wind turbine design factors involved in a utility company's incorporation of wind powered electrical generation into existing grids. With the requirements of the Southern California Edison service region in mind, it is concluded that although the economic and legal climate for major investments in windpower are favorable, the continued development of large only wind turbine machines (on the scale of NASA's 2.5 MW Mod-2 design) is imperative in order to reduce manpower and maintenance costs. Stress is also put on the use of demonstration projects for both vertical and horizontal axis devices, in order to build up operational experience and confidence.

  10. Envelope structure of four gliding filamentous cyanobacteria.

    PubMed Central

    Hoiczyk, E; Baumeister, W

    1995-01-01

    The cell walls of four gliding filamentous Oscillatoriaceae species comprising three different genera were studied by freeze substitution, freeze fracturing, and negative staining. In all species, the multilayered gram-negative cell wall is covered with a complex external double layer. The first layer is a tetragonal crystalline S-layer anchored on the outer membrane. The second array is formed by parallel, helically arranged surface fibrils with diameters of 8 to 12 nm. These fibrils have a serrated appearance in cross sections. In all cases, the orientation of the surface fibrils correlates with the sense of revolution of the filaments during gliding, i.e., clockwise in both Phormidium strains and counterclockwise in Oscillatoria princeps and Lyngbya aeruginosa. The lack of longitudinal corrugations or contractions of the surface fibrils and the identical appearances of motile and nonmotile filaments suggest that this structure plays a passive screw thread role in gliding. It is hypothesized that the necessary propulsive force is generated by shear forces between the surface fibrils and the continuing flow of secreted extracellular slime. Furthermore, the so-called junctional pores seem to be the extrusion sites of the slime. In motile cells, these pores exhibit a different staining behavior than that seen in nonmotile ones. In the former, the channels of the pores are filled with electron-dense material, whereas in the latter, the channels appear comparatively empty, highly contrasting the peptidoglycan. Finally, the presence of regular surface structures in other gliding prokaryotes is considered an indication that comparable structures are general features of the cell walls of gliding microbes. PMID:7730269

  11. Aggregation of wool keratin intermediate filament proteins.

    PubMed

    Woods, E F

    1989-10-01

    The wool keratin intermediate filament proteins were isolated as their S-carboxymethyl derivatives (S-carboxymethylkerateine A, SCMKA) and purified by gel filtration to remove residual non-helical protein of low molecular weight. The alpha-helix content of purified SCMKA was approximately 62% in agreement with that predicted for the alpha-helical coiled-coil segments from the amino acid sequences of the subunits. In aqueous buffer at pH 11 or in n-propanol (20% v/v) at pH 9.2 very large aggregates are dissociated and SCMKA exists largely as a mixture of the dimer (two-chain coiled-coil of Mr approximately 103,000) and the tetramer. The protein species are not in rapidly reversible equilibrium as judged from gel filtration and sedimentation equilibrium. It is probable that species with a range of association constants are present. The equilibrium is shifted towards the dimer with change of pH from 9.2 to 11 or by the addition of 20% (v/v) n-propanol. The tetrameric proteolytic digestion product which is derived from the 1B segment of the alpha-helical rod section of the keratin molecule dissociates in a similar way to intact SCMKA with increase of pH and in the presence of n-propanol. This indicates the importance of this region of the rod domain in the initial stages of the assembly of the filament. Electrostatic and hydrophobic interactions are implicated in the association of the two-chain coiled-coil to the tetramer both in intact SCMKA and the 1B segment tetramer. The results are discussed in relation to the intact dimeric and tetrameric complexes obtained from other intermediate filament types. PMID:2484965

  12. Mechanism of Actin Filament Bundling by Fascin

    SciTech Connect

    Jansen, Silvia; Collins, Agnieszka; Yang, Changsong; Rebowski, Grzegorz; Svitkina, Tatyana; Dominguez, Roberto

    2013-03-07

    Fascin is the main actin filament bundling protein in filopodia. Because of the important role filopodia play in cell migration, fascin is emerging as a major target for cancer drug discovery. However, an understanding of the mechanism of bundle formation by fascin is critically lacking. Fascin consists of four {beta}-trefoil domains. Here, we show that fascin contains two major actin-binding sites, coinciding with regions of high sequence conservation in {beta}-trefoil domains 1 and 3. The site in {beta}-trefoil-1 is located near the binding site of the fascin inhibitor macroketone and comprises residue Ser-39, whose phosphorylation by protein kinase C down-regulates actin bundling and formation of filopodia. The site in {beta}-trefoil-3 is related by pseudo-2-fold symmetry to that in {beta}-trefoil-1. The two sites are {approx}5 nm apart, resulting in a distance between actin filaments in the bundle of {approx}8.1 nm. Residue mutations in both sites disrupt bundle formation in vitro as assessed by co-sedimentation with actin and electron microscopy and severely impair formation of filopodia in cells as determined by rescue experiments in fascin-depleted cells. Mutations of other areas of the fascin surface also affect actin bundling and formation of filopodia albeit to a lesser extent, suggesting that, in addition to the two major actin-binding sites, fascin makes secondary contacts with other filaments in the bundle. In a high resolution crystal structure of fascin, molecules of glycerol and polyethylene glycol are bound in pockets located within the two major actin-binding sites. These molecules could guide the rational design of new anticancer fascin inhibitors.

  13. Wind turbine

    SciTech Connect

    Kodric, A. A.

    1985-01-29

    The invention provides a wind turbine rotatable about a vertical axis comprising a plurality of planar vanes each situated along the height of a vertical shaft at a separate level. Adjacent vanes are staggered at the same dihedral angle to one another. Each vane has a plurality of doors which pivot between an open and closed position. Auxiliary panels are provided above and below each set of doors to channel the flow of air along the vane thus increasing the power derivable from the wind. Automatic release means for the doors may be provided to prevent structural damage under high wind conditions.

  14. Non-traditional machining techniques

    SciTech Connect

    Day, Robert D; Fierro, Frank; Garcia, Felix P; Hatch, Douglass J; Randolph, Randall B; Reardon, Patrick T; Rivera, Gerald

    2008-01-01

    During the course of machining targets for various experiments it sometimes becomes necessary to adapt fixtures or machines, which are designed for one function, to another function. When adapting a machine or fixture is not adequate, it may be necessary to acquire a machine specifically designed to produce the component required. In addition to the above scenarios, the features of a component may dictate that multi-step machining processes are necessary to produce the component. This paper discusses the machining of four components where adaptation, specialized machine design, or multi-step processes were necessary to produce the components.

  15. Stepwise Sliding of Single Actin and Myosin Filaments

    PubMed Central

    Liu, Xiumei; Pollack, Gerald H.

    2004-01-01

    Dynamics of sliding were explored in isolated actin and myosin filaments. Sliding occurs in steps. The steps are integer multiples of 2.7 nm, which is equal to the monomeric repeat along the actin filament. When filaments were forced to slide in the reverse direction, the size paradigm was the same. This size paradigm is parallel to that seen in the kinesin-microtubule system, where step size is an integer multiple of the tubulin repeat along the microtubule. PMID:14695277

  16. Effects of optical smoothing techniques on filamentation in laser plasmas

    SciTech Connect

    Schmitt, A.J.

    1988-10-01

    The effect of the induced spatial incoherence (ISI) and the random phase screen (RPS) optical smoothing techniques on the filamentation instability in laser plasmas has been investigated numerically and analytically. A two-dimensional time-dependent laser--plasma propagation code, including both ponderomotive and thermal-conduction dominated filamentation, is used to simulate the laser--plasma interaction. The results of these simulations are compared to the predictions of a simple theory that describes the filamentation of both coherent light and spatially and temporally incoherent light. It is shown that filaments driven by the thermal mechanism tend to cluster together and produce greater large scale nonuniformities in the laser illumination than the ponderomotively driven filaments. The RPS optical smoothing technique is found to reduce filamentation only if fast focusing optics (f/numberapprox. <5) are used. The ISI smoothing method suppresses filamentation for fast or slow focusing optics, and requires only moderate laser bandwidth (..delta omega../..omega..approx. =0.1%). In general, the ISI smoothing method provides the best suppression of filamentation. Under common laboratory conditions, filamentation is pronounced at longer laser wavelengths (1.06 ..mu..m--0.53 ..mu..m), suggesting that current experiments may be dominated by filamentation effects. Optical smoothing methods can suppress, but not eradicate, filamentation effects at these wavelengths. The optical smoothing methods are most effective in short-wavelength (0.25 ..mu..m) laser-driven plasmas. At 0.25 ..mu..m laser wavelength, ISI is found to completely eliminate filamentation effects in both time-averaged and instantaneous intensity distributions.

  17. Large scale filaments associated with Milky Way spiral arms

    NASA Astrophysics Data System (ADS)

    Wang, Ke; Testi, Leonardo; Ginsburg, Adam; Walmsley, Malcolm; Molinari, Sergio; Schisano, Eugenio

    2015-08-01

    The ubiquity of filamentary structure at various scales through out the Galaxy has triggered a renewed interest in their formation, evolution, and role in star formation. The largest filaments can reach up to Galactic scale as part of the spiral arm structure. However, such large scale filaments are hard to identify systematically due to limitations in identifying methodology (i.e., as extinction features). We present a new approach to directly search for the largest, coldest, and densest filaments in the Galaxy, making use of sensitive Herschel Hi-GAL data complemented by spectral line cubes. We present a sample of the 9 most prominent Herschel filaments from a pilot search field. These filaments measure 37-99 pc long and 0.6-3.0 pc wide with masses (0.5-8.3)×104 Msun, and beam-averaged (28", or 0.4-0.7 pc) peak H2 column densities of (1.7-9.3)x1022 cm-2. The bulk of the filaments are relatively cold (17-21 K), while some local clumps have a dust temperature up to 25-47 K due to local star formation activities. All the filaments are located within <~60 pc from the Galactic mid-plane. Comparing the filaments to a recent spiral arm model incorporating the latest parallax measurements, we find that 7/9 of them reside within arms, but most are close to arm edges. These filaments are comparable in length to the Galactic scale height and therefore are not simply part of a grander turbulent cascade. These giant filaments, which often contain regularly spaced pc-scale clumps, are much larger than the filaments found in the Herschel Gould's Belt Survey, and they form the upper ends in the filamentary hierarchy. Full operational ALMA and NOEMA will be able to resolve and characterize similar filaments in nearby spiral galaxies, allowing us to compare the star formation in a uniform context of spiral arms.

  18. Numerical simulations of a filament in a flowing soap film

    NASA Astrophysics Data System (ADS)

    Farnell, D. J. J.; David, T.; Barton, D. C.

    2004-01-01

    Experiments concerning the properties of soap films have recently been carried out and these systems have been proposed as experimental versions of theoretical two-dimensional liquids. A silk filament introduced into a flowing soap film, was seen to demonstrate various stable modes, and these were, namely, a mode in which the filament oscillates and one in which the filament is stationary and aligns with the flow of the liquid. The system could be forced from the oscillatory mode into the non- oscillatory mode by varying the length of the filament. In this article we use numerical and computational techniques in order to simulate the strongly coupled behaviour of the filament and the fluid. Preliminary results are presented for the specific case in which the filament is seen to oscillate continuously for the duration of our simulation. We also find that the filament oscillations are strongly suppressed when we reduce the effective length of the filament. We believe that these results are reminiscent of the different oscillatory and non-oscillatory modes observed in experiment. The numerical solutions show that, in contrast to experiment, vortices are created at the leading edge of the filament and are preferentially grown in the curvature of the filament and are eventually released from the trailing edge of the filament. In a similar manner to oscillating hydrofoils, it seems that the oscillating filaments are in a minimal energy state, extracting sufficient energy from the fluid to oscillate. In comparing numerical and experimental results it is possible that the soap film does have an effect on the fluid flow especially in the boundary layer where surface tension forces are large.

  19. Characterization of Osmotically Induced Filaments of Salmonella enterica

    PubMed Central

    Pratt, Zachary L.; Chen, Bingming; Czuprynski, Charles J.; Wong, Amy C. L.

    2012-01-01

    Salmonella enterica forms aseptate filaments with multiple nucleoids when cultured in hyperosmotic conditions. These osmotic-induced filaments are viable and form single colonies on agar plates even though they contain multiple genomes and have the potential to divide into multiple daughter cells. Introducing filaments that are formed during osmotic stress into culture conditions without additional humectants results in the formation of septa and their division into individual cells, which could present challenges to retrospective analyses of infectious dose and risk assessments. We sought to characterize the underlying mechanisms of osmotic-induced filament formation. The concentration of proteins and chromosomal DNA in filaments and control cells was similar when standardized by biomass. Furthermore, penicillin-binding proteins in the membrane of salmonellae were active in vitro. The activity of penicillin-binding protein 2 was greater in filaments than in control cells, suggesting that it may have a role in osmotic-induced filament formation. Filaments contained more ATP than did control cells in standardized cell suspensions, though the levels of two F0F1-ATP synthase subunits were reduced. Furthermore, filaments could septate and divide within 8 h in 0.2× Luria-Bertani broth at 23°C, while nonfilamentous control cells did not replicate. Based upon the ability of filaments to septate and divide in this diluted broth, a method was developed to enumerate by plate count the number of individual, viable cells within a population of filaments. This method could aid in retrospective analyses of infectious dose of filamented salmonellae. PMID:22798362

  20. Tailoring femtosecond laser pulse filamentation using plasma photonic lattices

    SciTech Connect

    Suntsov, Sergiy; Abdollahpour, Daryoush; Panagiotopoulos, Paris; Papazoglou, Dimitrios G.; Tzortzakis, Stelios; Couairon, Arnaud

    2013-07-08

    We demonstrate experimentally that by using transient plasma photonic lattices, the attributes of intense femtosecond laser filaments, such as peak intensity and length, can be dynamically controlled. The extended plasma lattice structure is generated using two co-propagating non-diffracting intense Bessel beams in water. The use of such transient lattice structures to control the competition between linear and nonlinear effects involved in filamentation opens the way for extensive control of the filamentation process.

  1. A Conceptual Model of the Formation of Filament Barbs

    NASA Astrophysics Data System (ADS)

    Martin, S. F.

    1997-05-01

    Barbs are the structures along the sides of a filament that connect its horizontal axis to chromosphere. The barbs, previously called 'legs' can be considered as magnetic field conduits along which mass is continuously guided and transported to and from the chromosphere. In the model presented, the barbs represent a secondary stage in filament formation which follows an intial stage in which a nearly horizontal axial magnetic field is first formed along a filament channel. Barb formation is most effectively and readily illustrated where the filament channel is broad and well-developed such as exists among the decaying network remnants of active regions. In these circumstances, the filament channel is a region of relatively low magnetic flux density compared to adjacent areas further from the polarity inversion. H-alpha filtergrams show that the axial parts of the filament are low and nearly contiguous with the chromosphere. The low height of the axial field, and the relative absence of concentrations of network magnetic field, are favorable conditions for magnetic reconnection between the axial field of the filament and new ephemeral regions and intranetwork magnetic fields beneath the filament. These reconnections lead to the formation of the barbs joining parts of the newly emerged fields to the axial field of the filament. Barb formation and motions seen in H-alpha filtergrams provide the evidence for this initial part of the conceptual model. The remaining part of the model is a demonstration of why only right-bearing barbs are seen on dextral filaments and left-bearing barbs on sinistral filaments; this is due to the sinistral or dextral magnetic configuration of the filament channel which does not permit the survival of barbs of the non-observed chirality as will be illustrated.

  2. Dynamic fluctuations of dipolar semiflexible filaments

    NASA Astrophysics Data System (ADS)

    Belovs, M.; C?bers, A.

    2006-02-01

    On the basis of the model of a flexible magnetic filament, the characteristics of their thermal fluctuations are considered. The crossover of the time dependence of the mean quadratic displacement from t3/4 to t1/2 at the magnetic field increase is found. Two characteristic mechanisms of the magnetization relaxation time distribution—straightening of the thermal undulations and excitation of the bending modes of the free ends under the action of an ac magnetic field—are described. In both cases, the characteristic scaling law ?-3/4 of the magnetic susceptibility in a high-frequency range is found.

  3. Videos of light filamentation in air

    NASA Astrophysics Data System (ADS)

    Velten, Andreas; Schmitt-Sody, Andreas; Diels, Jean-Claude; Rostami, Shermineh; Rasoulof, Amin; Feng, Chengyong; Arissian, Ladan

    2015-05-01

    Light filaments are of interest for applications in remote sensing, communications, and the control of electronic discharges. Different plasma dynamics and emitted radiation have been observed according to the initial pulse characteristics and beam collimation. To help observing and understanding these observations, a new technique of creating a movie of the moving light pulse and the plasma emission in its wake is presented. Over 1,000 synchronized frames of a streak camera are combined to produce the 4D (2 D space, time in ps and wavelength) movie.

  4. Spatiotemporal rogue events in femtosecond filamentation

    SciTech Connect

    Majus, D.; Jukna, V.; Valiulis, G.; Dubietis, A.; Faccio, D.

    2011-02-15

    We present experimental and numerical investigations of optical extreme (rogue) event statistics recorded in the regime of femtosecond pulse filamentation in water. In the spectral domain, the extreme events manifest themselves as either large or small extremes of the spectral intensity, justified by right- or left-tailed statistical distributions, respectively. In the time domain, the observed extreme events are associated with pulse splitting and energy redistribution in space and therefore are exquisitely linked to three-dimensional, spatiotemporal dynamics and formation of the X waves.

  5. Filamentous Basidiomycetes in the Clinical Laboratory

    PubMed Central

    2015-01-01

    Filamentous basidiomycetes are difficult to identify in the clinical laboratory, mostly due to lack of sporulation, and their role as agents of fungal infection can be difficult to assess. More cases of infection with these agents are being reported as more laboratories gain proficiency with the recognition of their subtle morphologic features and the use of DNA-based methods for identification. Most infections occur in the respiratory tract and sinuses, although brain infection has been reported. Susceptibility testing suggests that these agents will respond well to azole drugs other than fluconazole. PMID:26512308

  6. Hamiltonian Dynamics of Protein Filament Formation

    NASA Astrophysics Data System (ADS)

    Michaels, Thomas C. T.; Cohen, Samuel I. A.; Vendruscolo, Michele; Dobson, Christopher M.; Knowles, Tuomas P. J.

    2016-01-01

    We establish the Hamiltonian structure of the rate equations describing the formation of protein filaments. We then show that this formalism provides a unified view of the behavior of a range of biological self-assembling systems as diverse as actin, prions, and amyloidogenic polypeptides. We further demonstrate that the time-translation symmetry of the resulting Hamiltonian leads to previously unsuggested conservation laws that connect the number and mass concentrations of fibrils and allow linear growth phenomena to be equated with autocatalytic growth processes. We finally show how these results reveal simple rate laws that provide the basis for interpreting experimental data in terms of specific mechanisms controlling the proliferation of fibrils.

  7. The bacterial cytoskeleton: more than twisted filaments

    PubMed Central

    Pilhofer, Martin; Jensen, Grant J.

    2012-01-01

    Far from being simple “bags” of enzymes, bacteria are richly endowed with ultrastructures that challenge and expand standard definitions of the cytoskeleton. Here we review rods, rings, twisted pairs, tubes, sheets, spirals, moving patches, meshes and composites, and suggest defining the term “bacterial cytoskeleton” as all cytoplasmic protein filaments and their superstructures that move or scaffold (stabilize/position/recruit) other cellular materials. The evolution of each superstructure has been driven by specific functional requirements. As a result, while homologous proteins with different functions have evolved to form surprisingly divergent superstructures, those of unrelated proteins with similar functions have converged. PMID:23183140

  8. Filamentous bacteria transport electrons over centimetre distances.

    PubMed

    Pfeffer, Christian; Larsen, Steffen; Song, Jie; Dong, Mingdong; Besenbacher, Flemming; Meyer, Rikke Louise; Kjeldsen, Kasper Urup; Schreiber, Lars; Gorby, Yuri A; El-Naggar, Mohamed Y; Leung, Kar Man; Schramm, Andreas; Risgaard-Petersen, Nils; Nielsen, Lars Peter

    2012-11-01

    Oxygen consumption in marine sediments is often coupled to the oxidation of sulphide generated by degradation of organic matter in deeper, oxygen-free layers. Geochemical observations have shown that this coupling can be mediated by electric currents carried by unidentified electron transporters across centimetre-wide zones. Here we present evidence that the native conductors are long, filamentous bacteria. They abounded in sediment zones with electric currents and along their length they contained strings with distinct properties in accordance with a function as electron transporters. Living, electrical cables add a new dimension to the understanding of interactions in nature and may find use in technology development. PMID:23103872

  9. Folding of viscous sheets and filaments

    NASA Astrophysics Data System (ADS)

    Skorobogatiy, M.; Mahadevan, L.

    2000-12-01

    We consider the nonlinear folding behavior of a viscous filament or a sheet under the influence of an external force such as gravity. Everyday examples of this phenomenon are provided by the periodic folding of a sheet of honey as it impinges on toast, or the folding of a stream of shampoo as it falls on one's hand. To understand the evolution of a fold, we formulate and solve a free-boundary problem for the phenomenon, give scaling laws for the size of the folds and the frequency with which they are laid out, and verify these experimentally.

  10. Assembly of Simple Epithelial Keratin Filaments: Deciphering the Ion Dependence in Filament Organization.

    PubMed

    Hémonnot, Clément Y J; Mauermann, Monika; Herrmann, Harald; Köster, Sarah

    2015-10-12

    The intermediate filament proteins keratin K8 and K18 constitute an essential part of the cytoskeleton in simple epithelial cell layers, structurally enforcing their mechanical resistance. K8/K18 heterodimers form extended filaments and higher-order structures including bundles and networks that bind to cell junctions. We study the assembly of these proteins in the presence of monovalent or divalent ions by small-angle X-ray scattering. We find that both ion species cause an increase of the filament diameter when their concentration is increased; albeit, much higher values are needed for the monovalent compared to the divalent ions for the same effect. Bundling occurs also for monovalent ions and at comparatively low concentrations of divalent ions, very different from vimentin intermediate filaments, a fibroblast-specific cytoskeleton component. We explain these differences by variations in charge and hydrophobicity patterns of the proteins. These differences may reflect the respective physiological situation in stationary cell layers versus single migrating fibroblasts. PMID:26327161

  11. An invertebrate smooth muscle with striated muscle myosin filaments.

    PubMed

    Sulbarán, Guidenn; Alamo, Lorenzo; Pinto, Antonio; Márquez, Gustavo; Méndez, Franklin; Padrón, Raúl; Craig, Roger

    2015-10-20

    Muscle tissues are classically divided into two major types, depending on the presence or absence of striations. In striated muscles, the actin filaments are anchored at Z-lines and the myosin and actin filaments are in register, whereas in smooth muscles, the actin filaments are attached to dense bodies and the myosin and actin filaments are out of register. The structure of the filaments in smooth muscles is also different from that in striated muscles. Here we have studied the structure of myosin filaments from the smooth muscles of the human parasite Schistosoma mansoni. We find, surprisingly, that they are indistinguishable from those in an arthropod striated muscle. This structural similarity is supported by sequence comparison between the schistosome myosin II heavy chain and known striated muscle myosins. In contrast, the actin filaments of schistosomes are similar to those of smooth muscles, lacking troponin-dependent regulation. We conclude that schistosome muscles are hybrids, containing striated muscle-like myosin filaments and smooth muscle-like actin filaments in a smooth muscle architecture. This surprising finding has broad significance for understanding how muscles are built and how they evolved, and challenges the paradigm that smooth and striated muscles always have distinctly different components. PMID:26443857

  12. Electron tunneling into superconducting filaments using mechanically adjustable barriers

    SciTech Connect

    Moreland, J.; Ekin, J.W.

    1985-07-15

    A new type of squeezable electron tunneling (SET) junction has been developed for tunneling into superconducting filaments. Stable, mechanically adjustable tunneling barriers between the native surfaces of sputtered Nb films and 30-..mu..m-diam Nb filaments were established in liquid helium at 4 K. The current versus voltage characteristics of these SET junctions were used to determine the superconducting energy gap at the surface of the filaments. Since the filaments were etched from commercial superconducting magnet wire, this type of tunnel junction shows promise as a diagnostic probe of superconducting materials for high-field magnets.

  13. Improving the electrochemical performance of carbon filaments by solvent cleansing

    SciTech Connect

    Shui, X.; Chung, D.D.L.; Frysz, C.A.

    1995-12-31

    Found inherent in the submicron-diameter vapor-grown carbon filament fabrication process was a tarry residue, which comprised polyaromatic hydrocarbons. Cyclic voltammetry conducted using carbon working electrodes and an iron cyanide electrolyte showed that the residue harmed the electrochemical performance. Removal of the residue from the filaments using a solvent resulted in increases in the electron transfer rate (to values as high as 0.2 cm/s) and reversibility of the iron cyanide redox species, increase in the packing density and decrease in the filament-filament contact electrical resistivity.

  14. Phenotypic Diversity of Multicellular Filamentation in Oral Streptococci

    PubMed Central

    Thurnheer, Thomas; Bagheri, Homayoun C.; Belibasakis, Georgios N.

    2013-01-01

    Filamentous multicellular bacteria are among the most ancient multicellular organisms. They inhabit a great variety of environments and are present in the human body, including the oral cavity. Beside the selective advantages related to the larger size achieved through filamentation, the development of multicellular bacteria can be also driven by simple ecological factors such as birth and death rates at the cellular level. In order to extend earlier results obtained in aquatic species, we investigate the filamentation process of four different strains of oral streptococci, namely S. mutans, S. salivarius, S. oralis and S. anginosus. The results indicate differences in the capacities of different streptococcus species to form filaments, manifested in terms of length and the time-scale of filament elongation. The filamentation pattern of these oral streptococci resembles that of aquatic bacteria, whereby filaments reach a peak length during exponential growth and become short when the population reaches a steady state. Hence, this study validates that multicellularity can be an emergent property of filamentous bacteria of different ecological niches, and that phenotypic differences in filamentation can occur within species of the same genus, in this case oral streptococci. Moreover, given the role that specific oral streptococci can play in the etiology of oral diseases, these results can possibly open new perspectives in the study of the virulence properties of these species. PMID:24086713

  15. C IV Doppler shifts observed in active region filaments

    NASA Technical Reports Server (NTRS)

    Klimchuk, J. A.

    1986-01-01

    The Doppler shift properties of 21 active region filaments were studied using C IV Dopplergram data. Most are associated with corridors of weak magnetic field that separate opposite polarity strong fields seen in photospheric magnetograms. A majority of the filaments are relatively blue shifted, although several lie very close to the dividing lines between blue and red shift. Only one filament in the samples is clearly red shifted. A new calibration procedure for Dopplergrams indicates that sizable zero point offsets are often required. The center-to-limb behavior of the resulting absolute Doppler shifts suggests that filament flows are usually quite small. It is possible that they vanish.

  16. Filament shape versus coronal potential magnetic field structure

    NASA Astrophysics Data System (ADS)

    Filippov, B.

    2016-01-01

    Solar filament shape in projection on disc depends on the structure of the coronal magnetic field. We calculate the position of polarity inversion lines (PILs) of coronal potential magnetic field at different heights above the photosphere, which compose the magnetic neutral surface, and compare with them the distribution of the filament material in Hα chromospheric images. We found that the most of the filament material is enclosed between two PILs, one at a lower height close to the chromosphere and one at a higher level, which can be considered as a height of the filament spine. Observations of the same filament on the limb by the Solar Terrestrial Relations Observatory spacecraft confirm that the height of the spine is really very close to the value obtained from the PIL and filament border matching. Such matching can be used for filament height estimations in on-disc observations. Filament barbs are housed within protruding sections of the low-level PIL. On the base of simple model, we show that the similarity of the neutral surfaces in potential and non-potential fields with the same sub-photospheric sources is the reason for the found tendency for the filament material to gather near the potential-field neutral surface.

  17. Photospheric and Chromospheric Gas Motions around a Dark Filament

    NASA Astrophysics Data System (ADS)

    Magara, Tetsuya; Kitai, Reizaburo

    1999-10-01

    In this paper, we investigate how photospheric material moves below a dark filament, and we study chromospheric gas motions inside the filament. In the photosphere we trace granular motions by means of a local correlation tracking (LCT) technique to derive horizontal velocity field, while inside the filament we obtain the line-of-sight velocity field by subtracting a blueshifted H? image from a redshifted H? image. We find that a typical value of horizontal photospheric velocity is 1 km s-1, and its divergence map maintains a large-scale pattern during several hours. We also find that photospheric motions around a filament channel are random in space and changeable in time. As for the motion inside the filament, our results show that there is an area of upward motions at one side of the filament axis and an area of downward motions at the other side, which means that filament material has a helical motion inside the filament. We think that these results provide new important information on theories of filament formation.

  18. Hollow cylindrical plasma filament waveguide with discontinuous finite thickness cladding

    SciTech Connect

    Alshershby, Mostafa; Hao Zuoqiang; Lin Jingquan

    2013-01-15

    We have explored here a hollow cylindrical laser plasma multifilament waveguide with discontinuous finite thickness cladding, in which the separation between individual filaments is in the range of several millimeters and the waveguide cladding thickness is in the order of the microwave penetration depth. Such parameters give a closer representation of a realistic laser filament waveguide sustained by a long stable propagation of femtosecond (fs) laser pulses. We report how the waveguide losses depend on structural parameters like normalized plasma filament spacing, filament to filament distance or pitch, normal spatial frequency, and radius of the plasma filament. We found that for typical plasma parameters, the proposed waveguide can support guided modes of microwaves in extremely high frequency even with a cladding consisting of only one ring of plasma filaments. The loss of the microwave radiation is mainly caused by tunneling through the discontinuous finite cladding, i.e., confinement loss, and is weakly dependent on the plasma absorption. In addition, the analysis indicates that the propagation loss is fairly large compared with the loss of a plasma waveguide with a continuous infinite thickness cladding, while they are comparable when using a cladding contains more than one ring. Compared to free space propagation, this waveguide still presents a superior microwave transmission to some distance in the order of the filamentation length; thus, the laser plasma filaments waveguide may be a potential channel for transporting pulsed-modulated microwaves if ensuring a long and stable propagation of fs laser pulses.

  19. Conducting polyaniline filaments in a mesoporous channel host

    SciTech Connect

    Wu, Chun-Guey; Bein, T. )

    1994-06-17

    Conducting filaments of polyaniline have been prepared in the 3-nanometer-wide hexagonal channel system of the aluminosilicate MCM-41. Adsorption of aniline vapor into the dehydrated host, followed by reaction with peroxydisulfate, leads to encapsulated polyaniline filaments. Spectroscopic data show that the filaments are in the protonated emeraldine salt form, and chromatography indicates chain lengths of several hundred aniline rings. The filaments have significant conductivity while encapsulated in the channels, as measured by microwave absorption at 2.6 gigahertz. This demonstration of conjugated polymers with mobile charge carriers in nanometer channels represents a step toward the design of nanometer electronic devices.

  20. Properties of cosmological filaments extracted from Eulerian simulations

    NASA Astrophysics Data System (ADS)

    Gheller, C.; Vazza, F.; Favre, J.; Brüggen, M.

    2015-10-01

    Using a new parallel algorithm implemented within the VisIt framework, we analysed large cosmological grid simulations to study the properties of baryons in filaments. The procedure allows us to build large catalogues with up to ˜3 × 104 filaments per simulated volume and to investigate the properties of cosmic filaments for very large volumes at high resolution (up to 3003 Mpc3 simulated with 20483 cells). We determined scaling relations for the mass, volume, length and temperature of filaments and compared them to those of galaxy clusters. The longest filaments have a total length of about 200 Mpc with a mass of several 1015 M?. We also investigated the effects of different gas physics. Radiative cooling significantly modifies the thermal properties of the warm-hot-intergalactic medium of filaments, mainly by lowering their mean temperature via line cooling. On the other hand, powerful feedback from active galactic nuclei in surrounding haloes can heat up the gas in filaments. The impact of shock-accelerated cosmic rays from diffusive shock acceleration on filaments is small and the ratio between cosmic ray and gas pressure within filaments is of the order of ˜10-20 per cent.