Sample records for filament winding machine

  1. Wind motor machine

    Microsoft Academic Search

    Goedecke

    1984-01-01

    An improved wind motor machine having a wind rotor rotatable about a vertical axis. The rotor core body of the machine is provided with convexly curved wind application surfaces and coacting outer wing bodies having load supporting airplane wing-shaped cross-sections. The efficiency of the machine is improved by means of stream guiding bodies disposed in the intermediate space between the

  2. Variable geometry Darrieus wind machine

    NASA Astrophysics Data System (ADS)

    Pytlinski, J. T.; Serrano, D.

    1983-08-01

    A variable geometry Darrieus wind machine is proposed. The lower attachment of the blades to the rotor can move freely up and down the axle allowing the blades of change shape during rotation. Experimental data for a 17 m. diameter Darrieus rotor and a theoretical model for multiple streamtube performance prediction were used to develop a computer simulation program for studying parameters that affect the machine's performance. This new variable geometry concept is described and interrelated with multiple streamtube theory through aerodynamic parameters. The computer simulation study shows that governor behavior of a Darrieus turbine can not be attained by a standard turbine operating within normally occurring rotational velocity limits. A second generation variable geometry Darrieus wind turbine which uses a telescopic blade is proposed as a potential improvement on the studied concept.

  3. Filament winding S-glass/polyimide resin composite processing studies

    NASA Technical Reports Server (NTRS)

    Vaughan, R. W.; Jones, R. J.

    1974-01-01

    The work performed in selecting a TRW A-type polyimide resin that would be suitable for fabrication of filament wound reinforced plastic structures is described. Several different formulations were evaluated after which the P105AC formulation was selected as the most promising. Procedures then were developed for preparing P105AC/S-glass roving prepreg and for fabricating filament wound structural composites. Composites were fabricated and then tested in order to obtain tensile and shear strength information. Small, closed-end cylindrical pressure vessels then were fabricated using a stainless steel liner and end fittings with a P105AC/S-glass polar wound overwrap. These pressure vessels were cured in an air circulating oven without augmented pressure. It is concluded that the P105AC resin system is suitable for filament winding; that low void content, high strength composites are obtained by the filament winding process; and that augmented pressure is not required to effect the fabrication of filament wound P105AC composites.

  4. Development of controller strategies for a robotized filament winding equipment

    NASA Astrophysics Data System (ADS)

    Lobo, Edgar; Machado, José; Mendonça, João P.

    2013-10-01

    The composites reinforced with continuous fibers of polymeric material are increasingly used in applications where it is essential to reduce weight, mainly due to their high ratio of strength/weight and rigidity/weight. A conventional application are pressure vessels, used for storing liquids or gases subjected to low or high pressure, where the tape continuous fiber-reinforced polymeric matrix material is wound around a mandrel defining the final geometry. In this context the filament winding process is a very attractive process for the production of composite components. For optimal structural performance, and greater weight saving, an optimal path should be adopted, resulting only in axial tension in the longitudinal direction (slip). Such path is the geodesic winding and diverse equipment may be used to guarantee the process automation of the winding. This work herein presented is focused on the study and development of the controller program for a robotized filament winding equipment, taking into account customization of possible trajectories controlling filament winding. The automation of the custom path according to user needs increases exponentially the capabilities, where the use of a robotized solution increases process flexibility and repeatability.

  5. Composite Pressure Vessel Variability in Geometry and Filament Winding Model

    NASA Technical Reports Server (NTRS)

    Green, Steven J.; Greene, Nathanael J.

    2012-01-01

    Composite pressure vessels (CPVs) are used in a variety of applications ranging from carbon dioxide canisters for paintball guns to life support and pressurant storage on the International Space Station. With widespread use, it is important to be able to evaluate the effect of variability on structural performance. Data analysis was completed on CPVs to determine the amount of variation that occurs among the same type of CPV, and a filament winding routine was developed to facilitate study of the effect of manufacturing variation on structural response.

  6. Electrical machine having controlled characteristics and its application to a wind-driven machine

    SciTech Connect

    Berna, M.; Kant, M.; Seger, R.; Vilain, J.P.

    1983-07-26

    The invention provides an electrical machine having an inductor and an armature, one of which has at least two independent winding assemblies. The switching into and out of circuit of each winding assembly is controlled by a processor which receives monitoring parameters of the machine and desired value parameters, thereby controlling in real time the operating characteristics of the machine. The machine may be a winddriven generator.

  7. Filamentous \\

    Microsoft Academic Search

    Annette Summers Engel; Natuschka Lee; Megan L. Porter; Libby A. Stern; Philip C. Bennett; Michael Wagner

    2003-01-01

    Hydrogen sulfide-rich groundwater discharges from springs into Lower Kane Cave, Wyoming, where mi- crobial mats dominated by filamentous morphotypes are found. The full-cycle rRNA approach, including 16S rRNA gene retrieval and fluorescence in situ hybridization (FISH), was used to identify these filaments. The majority of the obtained 16S rRNA gene clones from the mats were affiliated with the \\

  8. Fields of Opportunity: Wind Machines Return to the Plains

    ERIC Educational Resources Information Center

    Sowers, Jacob

    2006-01-01

    The last two decades have seen a rebirth of wind machines on the rural landscape. In ironic fashion the wind's kinetic energy has grown in significance through its ability to generate commercial amounts of electricity, the commodity that a few generations earlier hastened the demise of the old Great Plains windmill. Yet the reemergence of wind

  9. Is titin a ‘winding filament’? A new twist on muscle contraction

    PubMed Central

    Nishikawa, Kiisa C.; Monroy, Jenna A.; Uyeno, Theodore E.; Yeo, Sang Hoon; Pai, Dinesh K.; Lindstedt, Stan L.

    2012-01-01

    Recent studies have demonstrated a role for the elastic protein titin in active muscle, but the mechanisms by which titin plays this role remain to be elucidated. In active muscle, Ca2+-binding has been shown to increase titin stiffness, but the observed increase is too small to explain the increased stiffness of parallel elastic elements upon muscle activation. We propose a ‘winding filament’ mechanism for titin's role in active muscle. First, we hypothesize that Ca2+-dependent binding of titin's N2A region to thin filaments increases titin stiffness by preventing low-force straightening of proximal immunoglobulin domains that occurs during passive stretch. This mechanism explains the difference in length dependence of force between skeletal myofibrils and cardiac myocytes. Second, we hypothesize that cross-bridges serve not only as motors that pull thin filaments towards the M-line, but also as rotors that wind titin on the thin filaments, storing elastic potential energy in PEVK during force development and active stretch. Energy stored during force development can be recovered during active shortening. The winding filament hypothesis accounts for force enhancement during stretch and force depression during shortening, and provides testable predictions that will encourage new directions for research on mechanisms of muscle contraction. PMID:21900329

  10. Winding design for pole-phase modulation of induction machines

    Microsoft Academic Search

    Dongsen Sun; Baoming Ge; Daqiang Bi

    2010-01-01

    Induction machines with pole-phase modulation (PPM) can extend speed \\/ torque capabilities for applications in integrated starter\\/generator and hybrid electric vehicles. In this paper, a general winding design rule for the PPM of induction machines is proposed. A prototype is used to verify the proposed method and the feasibility of the designed pole-changing winding. Besides, the characteristics of three different

  11. High pressure gas storage capacities. Example of a solution using filament windings

    NASA Technical Reports Server (NTRS)

    Phan, A.; Lamalle, J.

    1981-01-01

    The use of epoxy resin fiber glass and economic factors affecting the choice of materials for gas storage are discussed. The physical nature of the filament windings are described together with the results obtained. It is demonstrated that a substantial reduction in mass and an enhanced level of safety can be assured at a competitive cost by storing gases in this way.

  12. Filament

    NSDL National Science Digital Library

    2014-06-26

    Filament is a collection of apps that can be seamlessly added to websites to enhance the visitor experience. These free apps include Ivy, which allows people to select text on the page and share it via Twitter, Facebook, and so on, and Flare, which gives users the ability to create a customizable social sharing bar to make sharing materials a snap. These various apps are compatible with all operating systems, including Linux.

  13. Permanent magnet machine with windings having strand transposition

    DOEpatents

    Qu, Ronghai (Clifton Park, NY); Jansen, Patrick Lee (Scotia, NY)

    2009-04-21

    This document discusses, among other things, a stator with transposition between the windings or coils. The coils are free from transposition to increase the fill factor of the stator slots. The transposition at the end connections between an inner coil and an outer coil provide transposition to reduce circulating current loss. The increased fill factor reduces further current losses. Such a stator is used in a dual rotor, permanent magnet machine, for example, in a compressor pump, wind turbine gearbox, wind turbine rotor.

  14. Liquid oxygen-compatible filament-winding matrix resin

    NASA Technical Reports Server (NTRS)

    Harrison, E. S.

    1973-01-01

    Polyurethanes derived from hydroxy terminated polyperfluoro propylene oxide prepolymers were evaluated as matrix resins for filament wound composites which would be exposed to liquid (and 100% gaseous) oxygen environments. A number of structural modifications were brought about by variations in prepolymer molecular weight, and alternative curing agents which allowed retention of the oxygen compatibility. Although satisfactory performance was achieved at sub-ambient temperatures, the derived composites suffered considerable property loss at ambient or slightly elevated temperatures. To attain overall effectiveness of the composite system, upgrading of the polymer thermomechanical properties must first be achieved.

  15. Stator for a rotating electrical machine having multiple control windings

    DOEpatents

    Shah, Manoj R. (Latham, NY); Lewandowski, Chad R. (Amsterdam, NY)

    2001-07-17

    A rotating electric machine is provided which includes multiple independent control windings for compensating for rotor imbalances and for levitating/centering the rotor. The multiple independent control windings are placed at different axial locations along the rotor to oppose forces created by imbalances at different axial locations along the rotor. The multiple control windings can also be used to levitate/center the rotor with a relatively small magnetic field per unit area since the rotor and/or the main power winding provides the bias field.

  16. Time dynamics of burst-train filamentation assisted femtosecond laser machining in glasses.

    PubMed

    Esser, Dagmar; Rezaei, Saeid; Li, Jianzhao; Herman, Peter R; Gottmann, Jens

    2011-12-01

    Bursts of femtosecond laser pulses with a repetition rate of f = 38.5MHz were created using a purpose-built optical resonator. Single Ti:Sapphire laser pulses, trapped inside a resonator and released into controllable burst profiles by computer generated trigger delays to a fast Pockels cell switch, drove filamentation-assisted laser machining of high aspect ratio holes deep into transparent glasses. The time dynamics of the hole formation and ablation plume physics on 2-ns to 400-ms time scales were examined in time-resolved side-view images recorded with an intensified-CCD camera during the laser machining process. Transient effects of photoluminescence and ablation plume emissions confirm the build-up of heat accumulation effects during the burst train, the formation of laser-generated filaments and plume-shielding effects inside the deeply etched vias. The small time interval between the pulses in the present burst train enabled a more gentle modification in the laser interaction volume that mitigated shock-induced microcracks compared with single pulses. PMID:22273956

  17. WindTech TV: Bonus Materials- Machine Control Circuits

    NSDL National Science Digital Library

    This section of the Wind Technician TV website provides bonus materials pertaining to machine control circuits. Users can review content on topics like electrical theory, magnetics, ladder diagrams and start-stop interlock example. Clicking on a subtopic will launch a pop up window demonstrating the concept.

  18. Making Linked, Wound-Filament Bands

    NASA Technical Reports Server (NTRS)

    Bamford, Robert M.; Stephens, James B.

    1987-01-01

    Chains produced by use of rotating mandrel. Mandrel and locating and driving disks assembled around first band. Mandrel and band then mounted in respective positions on filament-winding machine. Second band linked to first by winding filament around first band on rotating mandrel. Short chains made this way have variety of uses; example, thermal isolators, each consisting of two linked bands of insulating material, used to support two separated insulating sheilds surrounding container of liquid helium.

  19. Fabrication of low cost composite tooling for filament winding large structures

    NASA Astrophysics Data System (ADS)

    Miller, Timothy S.; Fortin, Christopher J.

    A TQM/concurrent engineering approach has been used to create a low cost filament-winding mandrel for large launch-vehicle structure fabrication. The process involves the fabrication of a low cost/low temperature master model, followed by the building of the mandrel and its backup structure within the master. Mandrels fabricated by these means are able to maintain full vacuum integrity and dimensional stability throughout high-temperature cure cycles; the reduced thermal mass of the mandrel results in part-cure cycles that are shorter than those associated with conventional mandrel materials.

  20. Wet-filament winding fabrication of thick carbon fiber/polycyanate resin composite

    SciTech Connect

    Frame, B.J.; Dodge, W.G.

    1997-06-01

    Polycyanate resins offer advantages as composite matrices because of their high thermal stability, low outgassing, low water absorption and radiation resistance. This report describes the fabrication of a thick (nominal 1 in.) hoop-wound composite cylinder that is manufactured by the wet-filament winding method using Toray T1000G carbon fiber and YLA RS-14 polycyanate resin as the constituent materials. An analytical model used to evaluate the fabrication process, estimate composite residual stresses and provide input toward mandrel design is presented and the construction of the mandrel used to wet-wind the cylinder is described. The composite cylinder quality is evaluated by dimensional inspection and measurements of density and composition.

  1. Beam Filamentation Instability of Interacting Current Sheets in Striped Relativistic Winds: The Origin of Low Sigma?

    NASA Astrophysics Data System (ADS)

    Arons, Jonathan

    Several lines of evidence suggest that relativistic winds from pulsars have flow energy dominated by kinetic energy at their termination, even though they emerge from the light cylinder as Poynting flux dominated flows. The wind sources are oblique rotators, thus the winds are "striped" - composed of interleaved sectors of oppositely directed B in a wide sector of latitude around the rotational equator. The electric current in the sheets separating the oppositely directed magnetic fields of the stripes, which provide the star's electric return current, is composed of a high energy particle beam, propagating across the magnetic field in an almost unmagnetized channel of thickness comparable to the particles' formal Larmor radius. The beams in neighboring sheets have opposite propagation directions, and interact across the stripes through the long range electromagnetic field. Thus the beams are subject to an electromagnetic shear instability which has strong kinship to Weibel beam filamentation instabilities in unmagnetized plasmas. I outline the physics of this instability, apply it to the pair dominated winds from pulsars, both in the case when the return current is composed of ions or high energy positrons (angle between the angular velocity and the magnetic moment less than 90 degrees, an "acute" pulsar) and also in the electron beam return current case (angle between the angular velocity and the magnetic moment greater than 90 degrees, an "obtuse" pulsar). I argue that the instability saturates through magnetic trapping, which leads to the appearance of an anomalous resistance in the pulsar circuit, and show that this resistance can account for the reduction of the striped component of the winds' magnetic fields, through broadening of the current layers until they merge and the stripes disappear. I discuss some possible observational consequences of this magnetic dissipation in the apparently dark region between the light cylinder and the winds' termination shocks.

  2. HD 50896 - Blobs in a wind with a collapsed companion or rotating disk with central filaments?

    NASA Astrophysics Data System (ADS)

    Underhill, Anne B.; Yang, Stephenson

    1991-02-01

    Twelve 40 A/mm blue-violet spectrograms of HD 50896 taken over 199 cycles in 1980 and 1982 were measured for radial velocity, and profiles of the major lines are presented. Binary motion about a collapsed companion in a period of 3.763 days is not demonstrated. It is argued that what is being seen is inflow from a disk in the case of the He lines and outflow in a wind in the case of the N IV and N V lines, with the shapes of the line profiles changing systematically in a period of 3.763 days. HD 50896 appears to be a single star which lies within a ringlike, rotating disk which is connected to the central star by a few ever-changing filaments which are supported by magnetic field lines.

  3. Double Side Control of Wound Rotor Induction Machine for Wind Energy Application Employing Half Controlled

    E-print Network

    Lipo, Thomas

    2005-27 Double Side Control of Wound Rotor Induction Machine for Wind Energy Application Employing side control of wound rotor induction machine for wind energy application employing half controlled of Wisconsin, Madison, WI 53706, USA, lipo@engr.wisc.edu Abstract ­ A double side converter fed wound rotor

  4. Magnetic forces and vibration in permanent magnet machines with non-overlapping concentrated windings: A review

    Microsoft Academic Search

    Mostafa Valavi; Arne Nysveen; Robert Nilssen

    2012-01-01

    Permanent magnet machines with non-overlapping concentrated windings have been gaining importance in the last few years. Significant advantages such as short end-windings, high efficiency and low cogging torque make them an attractive option in several applications. However, due to a large harmonic content in the MMF and also particular pole and slot combinations, the vibration level of these machines is

  5. The Paradox of Filamented Coronal Hole Flow but Uniform High Speed Wind

    NASA Technical Reports Server (NTRS)

    Suess, Steven T.; Parhi, Shyamsundar; Moore, Ronald L.

    1998-01-01

    Plumes and rays in coronal holes are nearly radially aligned density striations that follow the ambient magnetic field. They have long been known, but have gained new interest with growing awareness that coronal hole flow is inherently filamentary. In retrospect, filamentary flow should have been no surprise. This is because,Beta much less than 1 in coronal holes inside approximately 10 Solar radius, allowing the flow to be filamentary down to the smallest scale of photospheric magnetic activity. While the magnetic field itself is locally smooth across any height above ca. 50,000 km, SOHO/MDI has shown that the photospheric magnetic field is a complex array of rapidly evolving small bipoles that are constantly emerging, evolving, and cancelling. The resulting activity is manifested in microflares, concentrated in the magnetic network, that produce Impulsive injections at the footpoints of coronal field lines. The uneven distribution of this activity in space and time is the source of coronal hole filamentation. What is surprising is that the radial flow speed also exhibits filamentary structure. It is not well described as smooth, spherically symmetric, diverging flow, but instead ranges from 300 to over 1000 km/s at 5.5 Solar radius among field-aligned filaments like those seen in plumes and rays [Feldman et al., JGR, Dec. 1997]. This is completely unlike the constant high speed solar wind reported beyond 0.3 AU. Consequently, plumes and filamentary structure must be strongly mixed, and the mixing must be far along by 0.3 AU to be consistent with Helios observations. The paradox is what causes the mixing? Existing models of coronal heating and solar wind acceleration hardly address this issue. One possibility we are investigating is the MHD Kelvin-Helmholtz instability, to which the shear between plumes and interplume corona is expected to become unstable at 5-10 Solar radius. This instability can be simulated and followed far into the nonlinear regime and may lead to Alfvenic fluctuations like those seen at 1 AU.

  6. Mars vertical axis wind machines: The design of a tornado vortex machine for use on Mars

    NASA Astrophysics Data System (ADS)

    Carlin, Daun; Dyhr, Amy; Kelly, Jon; Schmirler, J. Eric; Carlin, Mike; Hong, Won E.; Mahoney, Kamin; Ralston, Michael

    1994-06-01

    Ever since Viking 1 and 2 landed on the surface of Mars in the summer of 1976, man has yearned to go back. But before man steps foot upon the surface of Mars, unmanned missions such as the Martian Soft Lander and Martian Subsurface Penetrator will precede him. Alternative renewable power sources must be developed to supply the next generation of surface exploratory spacecraft, since RTG's, solar cells, and long-life batteries all have their significant drawbacks. One such alternative is to take advantage of the unique Martian atmospheric conditions by designing a small scale, Martian wind power generator, capable of surviving impact and fulfilling the long term (2-5 years), low-level power requirements (1-2 Watts) of an unmanned surface probe. After investigation of several wind machines, a tornado vortex generator was chosen based upon its capability of theoretically augmenting and increasing the available power that may be extracted from average Martian wind speeds of approximately 7.5 m/s. The Martian Tornado Vortex Wind Generator stands 1 meter high and has a diameter of 0.5 m. Martian winds enter the base and shroud of the Tornado Vortex Generator at 7.5 m/s and are increased to an exit velocity of 13.657 m/s due to the vortex that is created. This results in a rapid pressure drop of 4.56 kg/s(exp 2) m across the vortex core which aids in producing a net power output of 1.1765 Watts. The report contains the necessary analysis and requirements needed to feasibly operate a low-level powered, unmanned, Martian surface probe.

  7. Mars vertical axis wind machines: The design of a tornado vortex machine for use on Mars

    NASA Technical Reports Server (NTRS)

    Carlin, Daun; Dyhr, Amy; Kelly, Jon; Schmirler, J. Eric; Carlin, Mike; Hong, Won E.; Mahoney, Kamin

    1994-01-01

    Ever since Viking 1 and 2 landed on the surface of Mars in the summer of 1976, man has yearned to go back. But before man steps foot upon the surface of Mars, unmanned missions such as the Martian Soft Lander and Martian Subsurface Penetrator will precede him. Alternative renewable power sources must be developed to supply the next generation of surface exploratory spacecraft, since RTG's, solar cells, and long-life batteries all have their significant drawbacks. One such alternative is to take advantage of the unique Martian atmospheric conditions by designing a small scale, Martian wind power generator, capable of surviving impact and fulfilling the long term (2-5 years), low-level power requirements (1-2 Watts) of an unmanned surface probe. After investigation of several wind machines, a tornado vortex generator was chosen based upon its capability of theoretically augmenting and increasing the available power that may be extracted from average Martian wind speeds of approximately 7.5 m/s. The Martian Tornado Vortex Wind Generator stands 1 meter high and has a diameter of 0.5 m. Martian winds enter the base and shroud of the Tornado Vortex Generator at 7.5 m/s and are increased to an exit velocity of 13.657 m/s due to the vortex that is created. This results in a rapid pressure drop of 4.56 kg/s(exp 2) m across the vortex core which aids in producing a net power output of 1.1765 Watts. The report contains the necessary analysis and requirements needed to feasibly operate a low-level powered, unmanned, Martian surface probe.

  8. Condition assessment of rotating machine winding insulation by analysis of charging and discharging currents

    Microsoft Academic Search

    G. R. Soltani; E. David

    2006-01-01

    In order to assess winding insulation condition, a field instrument measuring the charge and discharge current of rotating machine stator winding insulation under DC high-voltage was developed at Niroo Research Institute (NRI). This method that is known as PDCA (polarization and depolarization current analysis) was applied on the stator winding insulation of an 87 MW gas-turbine generator and results were

  9. Analytical expressions for estimating resonant frequencies of machine and transformer windings

    Microsoft Academic Search

    L. M. Popovic

    1992-01-01

    The paper presents an original analytical procedure for obtaining an algorithm for the simple and rapid estimation of resonant frequencies of machine and transformer windings. In deriving the algorithm the winding is represented by a finite number of sections with distributed parameters. The only difference in respect to the real winding emerges from the assumption that the parameters of these

  10. Stator field oriented control of doubly-excited induction machine in wind power generating system

    Microsoft Academic Search

    Yifan Tang; Longya Xu

    1992-01-01

    Optimal operation of a wind power generating system is featured by the variable-speed constant-frequency mode in which maximum-power capturing from the wind turbine and constant-frequency interfacing with the power system are the primary concerns. A slip power recovery system with a doubly excited wound rotor induction machine is attractive in this situation. Field orientation control for doubly excited induction machines

  11. Short-Term Wind Power Prediction Using a Wavelet Support Vector Machine

    Microsoft Academic Search

    Jianwu Zeng; Wei Qiao

    2012-01-01

    This paper proposes a wavelet support vector machine (WSVM)-based model for short-term wind power prediction (WPP). A new wavelet kernel is proposed to improve the generalization ability of the support vector machine (SVM). The proposed kernel has such a general characteristic that some commonly used kernels are its special cases. Simulation studies are carried to validate the proposed model with

  12. High performance VOC-FOC based wind generator system with induction machine

    Microsoft Academic Search

    Marcello Pucci; G. Vitale

    2009-01-01

    This paper presents a high performance wind generator with induction machine. A back-to-back configuration with two voltage source converters has been considered, one on the machine side and the other on the grid side. Each converter has been controlled with a high performance vector control technique, respectively Field Oriented Control (FOC) and Voltage Oriented Control (VOC). A test setup has

  13. Unbalanced magnetic forces in permanent magnet brushless machines with diametrically asymmetric phase windings

    Microsoft Academic Search

    D. Ishak; Z. Q. Zhu; D. Howe

    2005-01-01

    A general analytical model, formulated in 2-D polar coordinates, is developed to predict the unbalanced magnetic force which results in permanent magnet brushless AC and DC machines having a diametrically asymmetric disposition of slots and phase windings. It is shown that the unbalanced magnetic force can be significant in machines having a fractional ratio of slot number to pole number,

  14. Unbalanced Magnetic Forces in Permanent-Magnet Brushless Machines With Diametrically Asymmetric Phase Windings

    Microsoft Academic Search

    Z. Q. Zhu; Dahaman Ishak; David Howe; Chen Jintao

    2007-01-01

    A general analytical model, formulated in 2-D polar coordinates, is developed to predict the unbalanced magnetic force, which results in permanent-magnet brushless ac and dc machines having a diametrically asymmetric disposition of slots and phase windings. It is shown that the unbalanced magnetic force can be significant in machines having a fractional ratio of slot number to pole number, particularly

  15. Dynamic stability of wind turbines with permanent magnet machines and power-electronic converters

    Microsoft Academic Search

    R. Melicio; V. M. F. Mendes; J. P. S. Catalao

    2009-01-01

    This paper is concerned with the transient stability of variable-speed wind turbines with permanent magnet synchronous machines at a pitch control malfunction. As wind power generation undergoes rapid growth, new technical challenges emerge: dynamic stability and power quality. We study the influence of a pitch control malfunction on the quality of the energy injected into the electrical grid, analyzing the

  16. Development of Special Winding Machine for HT-7U Superconducting Tokamak

    NASA Astrophysics Data System (ADS)

    Gao, Da-ming; Yu, Jie; Zhu, Wen-hua; Wen, Jun; Pan, Yin-nian; Chen, Le-ping; Tao, Yu-ming; Wang, Hai-jing; He, Wei

    2000-02-01

    A special winding machine with high accuracy has just been developed and applied to the construction of HT-7U Tokamak. It is one of the critical facilities for R & D of HT-7U construction. The machine mainly consists of five parts, including a CICC pay-off spool, a four-roller correcting assembly, a four-roller forming/bending assembly, a continuous winding structure and a CNC control system with three-axis AC servo motors. The facility is used for Cable in Conduit Conductor (CICC) magnet fabrication of HT-7U. The main requirements of the winding machine are: continuous winding to reduce joints inside the coils; pre-forming CICC conductor to avoid winding with tension; suitable for all TF & PF coils of various coil shapes and within the dimension limit; improving the configuration tolerance and the special flatness of the CICC conductor. This paper emphasizes on the design and fabrication of the special winding machine for HT-7U. Some analyses and techniques in winding process for trial D-shape coil are also presented.

  17. Technological and economical analysis of salient pole and permanent magnet synchronous machines designed for wind turbines

    NASA Astrophysics Data System (ADS)

    Gündo?du, Tayfun; Kömürgöz, Güven

    2012-08-01

    Chinese export restrictions already reduced the planning reliability for investments in permanent magnet wind turbines. Today the production of permanent magnets consumes the largest proportion of rare earth elements, with 40% of the rare earth-based magnets used for generators and other electrical machines. The cost and availability of NdFeB magnets will likely determine the production rate of permanent magnet generators. The high volatility of rare earth metals makes it very difficult to quote a price. Prices may also vary from supplier to supplier to an extent of up to 50% for the same size, shape and quantity with a minor difference in quality. The paper presents the analysis and the comparison of salient pole with field winding and of peripheral winding synchronous electrical machines, presenting important advantages. A neodymium alloy magnet rotor structure has been considered and compared to the salient rotor case. The Salient Pole Synchronous Machine and the Permanent Magnet Synchronous Machine were designed so that the plate values remain constant. The Eddy current effect on the windings is taken into account during the design, and the efficiency, output power and the air-gap flux density obtained after the simulation were compared. The analysis results clearly indicate that Salient Pole Synchronous Machine designs would be attractive to wind power companies. Furthermore, the importance of the design of electrical machines and the determination of criteria are emphasized. This paper will be a helpful resource in terms of examination and comparison of the basic structure and magnetic features of the Salient Pole Synchronous Machine and Permanent Magnet Synchronous Machine. Furthermore, an economic analysis of the designed machines was conducted.

  18. Regulation of small wind machines: a local perspective

    SciTech Connect

    Perkins-Smith, D. (Black Hawk Associates, Denver, CO); Odland, R.

    1982-01-01

    The most common wind turbine issues that communities are concerned about and therefore might address in an ordnance are identified. These issues include noise, safety, communications interference, aesthetics, wind access, and height restrictions. How communities have addressed these issues as well as their approaches for dealing with small wind turbines in general are examined. In particular, the Riverside County, California, an ordinance recently prepared is explained in detail.

  19. A Climatological Assessment of the Utility of Wind Machines for Freeze Protection in Mountain Valleys.

    NASA Astrophysics Data System (ADS)

    Doesken, Nolan J.; Renquist, A. Richard

    1989-03-01

    The use of wind machines for frost protection is common in several large United States fruit producing areas. However, their potential usefulness in western Colorado's high elevation orchards has been uncertain due to the existence of terrain-generated prevailing nocturnal winds. To investigate this problem, wind speeds and temperature inversions were measured in an orchard area of western Colorado during the critical spring period 1982-1986.Results showed that temperature inversions strong enough to be beneficial in the use of wind machines at the time of the lowest temperature occurred on 4 1% of all nights sampled, on 58% of nights with below freezing temperatures and on 73% of nights with damaging freezes. A weather typing scheme was then employed to separate objectively freeze events that were primarily local in nature (good candidates for mechanical frost protection) from the more widespread advective freezes (difficult to combat with wind machines). Results showed that undisturbed weather patterns accompanied 54% of all nights but 79% of all freeze episodes. This suggests that freezes are predominantly controlled by local factors.An hour by hour computation of the likely fan effect during all 15 damaging freeze events during the experiment showed that orchard warming would occur during at least part of the night on 93% of the nights. It is now concluded that wind machines are likely to be very beneficial in western Colorado's commercial fruit growing areas.

  20. Development status of rotating machines employing superconducting field windings

    Microsoft Academic Search

    SWARN S. KALSI; KONRAD WEEBER; H. Takesue; CLIVE LEWIS; HEINZ-WERNER NEUMUELLER; RICHARD D. BLAUGHER

    2004-01-01

    Superconducting rotating machines have looked promising since multifilamentary niobium-titanium (NbTi) superconductors became available in the mid-1960s. Both dc homopolar and ac synchronous machines were successfully tested from the 1970s to the 1990s. Three different 70-MW generators were recently demonstrated by the SuperGM project in Japan. However, economic considerations with respect to competitive cost combined with the requirement for liquid helium

  1. A new three-phase doubly salient permanent magnet machine for wind power generation

    Microsoft Academic Search

    Ying Fan; K. T. Chau; Ming Cheng

    2006-01-01

    This paper presents a new three-phase 12\\/8-pole doubly salient permanent-magnet (DSPM) machine for application to wind power generation. The key is to design and analyze the proposed DSPM generator, namely, the design of a new machine structure to achieve high power density and high robustness and the device of system operation to attain high efficiency. By using finite element analysis,

  2. Dynamic modelling and analysis of multi-machine power systems including wind farms

    NASA Astrophysics Data System (ADS)

    Tabesh, Ahmadreza

    2005-11-01

    This thesis introduces a small-signal dynamic model, based on a frequency response approach, for the analysis of a multi-machine power system with special focus on an induction machine based wind farm. The proposed approach is an alternative method to the conventional eigenvalue analysis method which is widely employed for small-signal dynamic analyses of power systems. The proposed modelling approach is successfully applied and evaluated for a power system that (i) includes multiple synchronous generators, and (ii) a wind farm based on either fixed-speed, variable-speed, or doubly-fed induction machine based wind energy conversion units. The salient features of the proposed method, as compared with the conventional eigenvalue analysis method, are: (i) computational efficiency since the proposed method utilizes the open-loop transfer-function matrix of the system, (ii) performance indices that are obtainable based on frequency response data and quantitatively describe the dynamic behavior of the system, and (iii) capability to formulate various wind energy conversion unit, within a wind farm, in a modular form. The developed small-signal dynamic model is applied to a set of multi-machine study systems and the results are validated based on comparison (i) with digital time-domain simulation results obtained from PSCAD/EMTDC software tool, and (ii) where applicable with eigenvalue analysis results.

  3. Stabilization of wind farms connected with multi-machine power system by using STATCOM\\/BESS

    Microsoft Academic Search

    S. M. Muyeen; R. Takahashi; J. Tamura

    2007-01-01

    In this paper, the stabilization of wind farms connected with multi-machine power system in which a severe network disturbance occurs is analyzed. For this purpose, the STATCOM incorporated with battery energy storage system (BESS), i.e., STATCOM\\/BESS topology is proposed to enhance the transient stability of entire power system. At each wind farm terminal one PWM based STATCOM\\/BESS is connected. Two-mass

  4. Cogging torque reduction in axial flux machines for small wind turbines

    Microsoft Academic Search

    Min-Fu Hsieh; D. G. Dorrell; Yu-Han Yeh; Samsul Ekram

    2009-01-01

    This paper presents a technique for cogging torque reduction in an axial-flux permanent-magnet (PM) generator suitable for use in a small wind turbine. These machines can be compact and have high power density; they are axially short with larger diameter which makes then very suitable for a wind turbine. The inherent cogging torque can cause problems during turbine start-up and

  5. Fractional-Slot Concentrated-Windings Synchronous Permanent Magnet Machines: Opportunities and Challenges

    Microsoft Academic Search

    Ayman M. EL-Refaie

    2010-01-01

    Fractional-slot concentrated-winding (FSCW) synchronous permanent magnet (PM) machines have been gaining interest over the last few years. This is mainly due to the several advantages that this type of windings provides. These include high-power density, high efficiency, short end turns, high slot fill factor particularly when coupled with segmented stator structures, low cogging torque, flux-weakening capability, and fault tolerance. This

  6. End-Winding Vibrations Caused by Steady-State Magnetic Forces in an Induction Machine

    Microsoft Academic Search

    Ranran Lin; Antti Nestori Laiho; Ari Haavisto; Antero Arkkio

    2010-01-01

    We conducted a 3-D electromagnetic analysis coupled with a 3-D mechanical analysis to analyze end-winding vibrations and deformation in an induction machine caused by steady-state magnetic forces on the end winding. Both the analyses were based on the finite-element method. The electromagnetic analysis was used to calculate magnetic forces. During the mechanical analysis, complex support structures in the end region

  7. Research on Potential of Advanced Technology for Housing. A Building System Based on Filament Winding and New Developments in Water and Waste Management.

    ERIC Educational Resources Information Center

    Michigan Univ., Ann Arbor.

    The University of Michigan and Aerojet Corporation report their development of a new building system which will offer the consumer a higher quality product at lower cost. To achieve this goal, the University-Aerojet proposal suggested filament winding (a process derived from the aerospace program for the manufacture of reinforced plastic…

  8. Short Circuit Analysis of Induction Machines Wind Power Application

    SciTech Connect

    Starke, Michael R [ORNL; Smith, Travis M [ORNL; Howard, Dustin [Georgia Institute of Technology; Harley, Ronald [Georgia Institute of Technology

    2012-01-01

    he short circuit behavior of Type I (fixed speed) wind turbine-generators is analyzed in this paper to aid in the protection coordination of wind plants of this type. A simple network consisting of one wind turbine-generator is analyzed for two network faults: a three phase short circuit and a phase A to ground fault. Electromagnetic transient simulations and sequence network calculations are compared for the two fault scenarios. It is found that traditional sequence network calculations give accurate results for the short circuit currents in the balanced fault case, but are inaccurate for the un-faulted phases in the unbalanced fault case. The time-current behavior of the fundamental frequency component of the short circuit currents for both fault cases are described, and found to differ significantly in the unbalanced and balanced fault cases

  9. A Basic Study of Wind Generator Stabilization with Doubly-Fed Asynchronous Machine

    NASA Astrophysics Data System (ADS)

    Wu, Li; Takahashi, Rion; Nakagawa, Masaki; Murata, Toshiaki; Tamura, Junji

    This paper investigates the function of DASM (Doubly-fed ASynchronous Machine) with emphasis placed on its ability to the stabilization of the power system including wind generators. P (active power) and Q (reactive power) compensation from DASM can be regulated independently through secondary-excitation controlling. Simulation results by PSCAD show that DASM can restore the wind-generator system to a normal operating condition rapidly even following severe transmission-line failures. Comparison studies have also been performed between wind turbine pitch control and proposed method.

  10. A Mars 1 Watt vortex wind energy machine

    NASA Technical Reports Server (NTRS)

    Ralston, Michael; Crowley, Christopher; Thomson, Ronald; Gwynne, Owen

    1992-01-01

    A Martian wind power generator capable of surviving impact and fulfilling the long-term (2-5 yr) low-level power requirements (1-2 W) of an unmanned surface probe is presented. Attention is given to a tornado vortex generator that was chosen on the basis of its capability to theoretically augment the available power that may be extracted for average Martian wind speeds of about 7.5 m/s. The generator offers comparable mass-to-power ratios with solar power sources.

  11. Maximum likelihood estimation of high frequency machine and transformer winding parameters

    Microsoft Academic Search

    A. Keyhani; H. Tsai; A. Abur

    1990-01-01

    This paper presents a method to establish a multisection network model for study of high frequency transient behavior of transformer and machine windings. The parameters of the network model are estimated using maximum likelihood estimation technique. In order to verify the proposed estimation method, the parameters of a six-section network model are estimated.

  12. Field study of the aesthetics of small wind machines: a preliminary report

    SciTech Connect

    Strojan, C. L.; Lawrence, K.; O'Donnell, D.

    1980-03-01

    A field study was conducted at the Rocky Flats Small Wind Systems Test Center to determine if aesthetic preferences exist for particular designs of small wind machines, and to gather data on the importance of aesthetics relative to other wind system issues. Participants on public tours of the Test Center were asked to answer several general questions and to rate the visual appearance of various working parts (rotor and nacelle), towers, and complete machines. Working parts included vertical- and horizontal-axis designs (both upwind and downwind), while towers included wood, concrete and steel columns, and various truss designs. In spite of a relatively small sample size (N = 139), the results indicate definite preferences for particular designs, with downwind horizontal-axis working parts and columnar towers receiving the highest ratings.

  13. Multi-star multi-phase winding for a high power naval propulsion machine with low ripple torques

    E-print Network

    Boyer, Edmond

    1 Multi-star multi-phase winding for a high power naval propulsion machine with low ripple torques with a fractional-slot concentrated winding made up of four 3-phase windings each one being star-connected, each star being magnetically shifted by an angle of 15 degrees. This 4-star 3-phase configuration allows

  14. System for maintaining the alignment of mandrels in filament winding operations

    DOEpatents

    Robinson, Samuel C. (Clinton, TN); Dodge, William G. (Oak Ridge, TN); Pollard, Roy E. (Powell, TN)

    1984-01-01

    The present invention is directed to a system for sensing and correcting the alignment of a mandrel being wound with filamentary material with respect to the filamentary material winding mechanism. A positioned reference pin attached to the mandrel is positioned in a beam of collimated light emanating from a laser so as to bisect the light beam and create a shadow therebetween. A pair of photocells are positioned to receive the bisected light beam with the shadow uniformly located between the photocells when the pin is in a selected position. The mandrel is supported in the selected position for the winding of a filamentary material by a position adjustable roller mechanism which is coupled by a screw drive to a reversible motor. Changes in the pin position such as caused by winding growth are sensed by the photocells to provide the displacement of the roller mechanism in the direction necessary to return the mandrel to the selected position.

  15. System for maintaining the alignment of mandrels in filament winding operations

    DOEpatents

    Robinson, S.C.; Dodge, W.G.; Pollard, R.E.

    1983-10-12

    The present invention is directed to a system for sensing and correcting the alignment of a mandrel being wound with filamentary material with respect to the filamentary material winding mechanism. A positioned reference pin attached to the mandrel is positioned in a beam of collimated light emanating from a laser so as to bisect the light beam and create a shadow therebetween. A pair of photocells are positioned to receive the bisected light beam with the shadow uniformly located between the photocells when the pin is in a selected position. The mandrel is supported in the selected position for the winding of a filamentary material by a position adjustable roller mechanism which is coupled by a screw drive to a reversible motor. Changes in the pin position such as caused by winding growth are sensed by the photocells to provide the displacement of the roller mechanism in the direction necessary to return the mandrel to the selected position.

  16. Basic concepts, status, opportunities, and challenges of electrical machines utilizing high-temperature superconducting (HTS) windings

    NASA Astrophysics Data System (ADS)

    Frauenhofer, J.; Grundmann, J.; Klaus, G.; Nick, W.

    2008-02-01

    An overview of the different approaches towards achieving a marketable application of a superconducting electrical machine, either as synchronous motor or generator, will be given. This field ranges from relatively small industrial drives to utility generators with large power ratings, from the low speed and high torque of wind power generators and ship propulsion motors, to high speed generators attached to turbines. Essentially HTS machine technology offers several advantages such as compactness (weight and volume reduction), increased efficiency, and other operational benefits. The machine features have to be optimized with regard to the specific application, and different concepts were developed by internationally competing teams, with Siemens being one of them. The achieved status in these fields will be summarized, pointing to the specific technical challenges to overcome. For this purpose we have not only to consider the technology of manufacturing the HTS rotor winding itself, but also to check requirements and availability of supporting technologies. This ranges from new challenges posed to the non-superconducting ("conventional") components of such innovative HTS machines, manufacturing superconducting material in the coming transition from 1st to 2nd generation HTS tape, cryogenic technology including material behavior, to new and challenging tasks in simulating and predicting the performance of such machines by computational tools. The question of market opportunities for this technology obviously is a function of all these aspects; however, a strong tendency for the near future is seen in the area of high-torque ship propulsion.

  17. Application of the AC Commutator Machine in Wind Energy Conversion Systems

    E-print Network

    El-Jamous, Sami Georges

    1981-01-01

    APPLICATION OF THE AC OOMM3TATOR MACHINE IN WIND ENERGY CONVKGION SYSTB3S A Thesis By SAMI GF33RGES EL-Jhl'3OUS Submitted to the Graduate College of Twas AW University in partial fulfillment of the requirement for the degree of MASTER... Application of the AC Comnutator Nachine in Wind Energy Conversion Systems. (Nay 1981) Semi Georges El-Jasnus, B. A. Nathenatics, Texas ASN University; Chairman of Advisory Comnittee: Dr. A. K. Ayoub The thesis investigates the tectudcal feasibility...

  18. Variable-speed wind power generation using doubly fed wound rotor induction machine-a comparison with alternative schemes

    Microsoft Academic Search

    Rajib Datta; V. T. Ranganathan

    2002-01-01

    In this paper, a wind energy conversion system (WECS) using a grid-connected wound rotor induction machine controlled from the rotor side is compared with both fixed speed and variable speed systems using a cage rotor induction machine. The comparison is done on, the basis of: (1) major hardware components required; (2) operating region; and (3) energy output due to a

  19. Growing Neural Gas (GNG) based Maximum Power Point Tracking for high performance VOC-FOC based wind generator system with an induction machine

    Microsoft Academic Search

    Maurizio Cirrincione; Marcello Pucci; Gianpaolo Vitale

    2009-01-01

    This paper presents a MPPT technique for high performance wind generator with induction machine based on the Growing Neural Gas (GNG) network. Here a GNG network has been trained off-line to learn the turbine characteristic surface torque versus wind speed and machine speed, and implemented on-line so to perform the inversion of this function obtaining the wind free speed on

  20. A novel wind-power generating system using field orientation controlled doubly-excited brushless reluctance machine

    Microsoft Academic Search

    Longya Xu; Yifan Tang

    1992-01-01

    A novel variable-speed constant-frequency wind power generating system using a doubly-excited brushless reluctance machine is proposed. A field orientation control method is proposed to track the optimal torque-speed profile of the wind turbine and to realize flexible reactive power control. The proposed wind power generating system has the potentials of high efficiency, good flexibility, and low cost

  1. Fluid-structure interaction modeling of wind turbines: simulating the full machine

    NASA Astrophysics Data System (ADS)

    Hsu, Ming-Chen; Bazilevs, Yuri

    2012-12-01

    In this paper we present our aerodynamics and fluid-structure interaction (FSI) computational techniques that enable dynamic, fully coupled, 3D FSI simulation of wind turbines at full scale, and in the presence of the nacelle and tower (i.e., simulation of the "full machine"). For the interaction of wind and flexible blades we employ a nonmatching interface discretization approach, where the aerodynamics is computed using a low-order finite-element-based ALE-VMS technique, while the rotor blades are modeled as thin composite shells discretized using NURBS-based isogeometric analysis (IGA). We find that coupling FEM and IGA in this manner gives a good combination of efficiency, accuracy, and flexibility of the computational procedures for wind turbine FSI. The interaction between the rotor and tower is handled using a non-overlapping sliding-interface approach, where both moving- and stationary-domain formulations of aerodynamics are employed. At the fluid-structure and sliding interfaces, the kinematic and traction continuity is enforced weakly, which is a key ingredient of the proposed numerical methodology. We present several simulations of a three-blade 5~MW wind turbine, with and without the tower. We find that, in the case of no tower, the presence of the sliding interface has no effect on the prediction of aerodynamic loads on the rotor. From this we conclude that weak enforcement of the kinematics gives just as accurate results as the strong enforcement, and thus enables the simulation of rotor-tower interaction (as well as other applications involving mechanical components in relative motion). We also find that the blade passing the tower produces a 10-12 % drop (per blade) in the aerodynamic torque. We feel this finding may be important when it comes to the fatigue-life analysis and prediction for wind turbine blades.

  2. Heat production in the windings of the stators of electric machines under stationary condition

    NASA Astrophysics Data System (ADS)

    Alebouyeh Samami, Behzad; Pieper, Martin; Breitbach, Gerd; Hodapp, Josef

    2014-12-01

    In electric machines due to high currents and resistive losses (joule heating) heat is produced. To avoid damages by overheating the design of effective cooling systems is required. Therefore the knowledge of heat sources and heat transfer processes is necessary. The purpose of this paper is to illustrate a good and effective calculation method for the temperature analysis based on homogenization techniques. These methods have been applied for the stator windings in a slot of an electric machine consisting of copper wires and resin. The key quantity here is an effective thermal conductivity, which characterizes the heterogeneous wire resin-arrangement inside the stator slot. To illustrate the applicability of the method, the analysis of a simplified, homogenized model is compared with the detailed analysis of temperature behavior inside a slot of an electric machine according to the heat generation. We considered here only the stationary situation. The achieved numerical results are accurate and show that the applied homogenization technique works in practice. Finally the results of simulations for the two cases, the original model of the slot and the homogenized model chosen for the slot (unit cell), are compared to experimental results.

  3. Multivariate analysis and prediction of wind turbine response to varying wind field characteristics based on machine learning

    E-print Network

    Stanford University

    acquisition units and an on-site server located in the wind turbine. The wind turbine has a hub height of 65 mMultivariate analysis and prediction of wind turbine response to varying wind field characteristics characteristics have a significant impact on the structural response and the lifespan of wind turbines. This paper

  4. Winding for the wind

    NASA Technical Reports Server (NTRS)

    Weingart, O.

    1981-01-01

    The mechanical properties and construction of epoxy-impregnated fiber-glass blades for wind turbines are discussed, along with descriptions of blades for the Mod 0A and Mod 5A WECS and design goals for a 4 kW WECS. Multicell structure combined with transverse filament tape winding reduces labor and material costs, while placing a high percentage of 0 deg fibers spanwise in the blades yields improved strength and elastic properties. The longitudinal, transverse, and shear modulus are shown to resist stresses exceeding the 50 lb/sq ft requirements, with constant stress resistance expected until fatigue failure is approached. Regression analysis indicates a fatigue life of 400 million operating cycles. The small WECS under prototype development features composite blades, nacelle, and tower. Rated at 5.7 kW in a 15 mph wind, the machine operates over a speed range of 9-53.9 mph and is expected to produce 16,200 kWh annually in a 10 mph average wind measured at 30 ft.

  5. Winding for the wind

    NASA Astrophysics Data System (ADS)

    Weingart, O.

    The mechanical properties and construction of epoxy-impregnated fiber-glass blades for wind turbines are discussed, along with descriptions of blades for the Mod 0A and Mod 5A WECS and design goals for a 4 kW WECS. Multicell structure combined with transverse filament tape winding reduces labor and material costs, while placing a high percentage of 0 deg fibers spanwise in the blades yields improved strength and elastic properties. The longitudinal, transverse, and shear modulus are shown to resist stresses exceeding the 50 lb/sq ft requirements, with constant stress resistance expected until fatigue failure is approached. Regression analysis indicates a fatigue life of 400 million operating cycles. The small WECS under prototype development features composite blades, nacelle, and tower. Rated at 5.7 kW in a 15 mph wind, the machine operates over a speed range of 9-53.9 mph and is expected to produce 16,200 kWh annually in a 10 mph average wind measured at 30 ft.

  6. Impact of Winding Layer Number and Magnet Type on Synchronous Surface PM Machines Designed for Wide Constant-Power Speed Range Operation

    Microsoft Academic Search

    Ayman M. EL-Refaie; T. M. Jahns

    2006-01-01

    This paper thoroughly investigates the impact of the winding layer number and the choice of magnet type on the performance characteristics of surface permanent magnet (SPM) machines with fractional-slot concentrated windings designed for wide speed ranges of constant-power operation. This is accomplished by carefully examining the performance characteristics of three different SPM machines designed for the same set of performance

  7. Impact of Winding Layer Number and Magnet Type on Synchronous Surface PM Machines Designed for Wide Constant-Power Speed Range Operation

    Microsoft Academic Search

    Ayman M. El-Refaie; Thomas M. Jahns

    2008-01-01

    This paper thoroughly investigates the impact of the winding layer number and the choice of magnet type on the performance characteristics of surface permanent magnet (SPM) machines with fractional slot concentrated windings designed for wide speed ranges of constant-power operation. This is accomplished by carefully examining the performance characteristics of three different SPM machines designed for the same set of

  8. Steady-State Calculation and Online Monitoring of Interturn Short Circuit of Field Windings in Synchronous Machines

    Microsoft Academic Search

    Liangliang Hao; Yuguang Sun; Arui Qiu; Xiangheng Wang

    2012-01-01

    The interturn short circuit of field windings in synchronous machines will cause the field current increasing, reactive power output decreasing as well as the aggravation of vibration. In this paper, by using the multiloop theory and analyzing the steady-state characteristics of stator and rotor fault currents, the steady-state expression of each loop current is obtained, and then differential equations in

  9. A helical tow model and numerical simulation of on-line thermal curing of thermoset composites in filament winding

    Microsoft Academic Search

    Xuefeng Wang; David Y. S. Lou; Nengli Zhang

    2004-01-01

    A helical tow model of on-line curing of thermoset composites in winding is developed and solved numerically. Actual shape of tow in winding process is considered, and consequently, the modeling of the on-line curing process is more realistic. A numerical grid generation method is developed for the complicated geometry. Transformations of three-dimensional energy equation and its boundary conditions from physical

  10. Experimental Method for Determining Magnetically Nonlinear Characteristics of Electric Machines With Magnetically Nonlinear and Anisotropic Iron Core, Damping Windings, and Permanent Magnets

    Microsoft Academic Search

    Gorazd Stumberger; Tine Marcic; Bojan Stumberger; Drago Dolinar

    2008-01-01

    This work presents an experimental method appropriate for determining magnetically nonlinear characteristics of electric machines which contain magnetically nonlinear and anisotropic iron core, damping windings, and permanent magnets. The method is based on the two-axis dynamic model of a three-phase machine with wye-connected three-phase stator winding. The d-axis is defined with the magnetic axis of permanent magnets (ldquoflux linkage vectorrdquo

  11. Broken Bar Detection in Synchronous Machines Based Wind Energy Conversion System

    E-print Network

    Rahimian, Mina Mashhadi

    2012-10-19

    current spectrum of the synchronous machine during steady state asynchronous operation is not similar to that of the induction machine with broken bars. As a result, the motor current signature analysis (MCSA) for detection rotor failures in the induction...

  12. Effects of Aerospace Contaminants on EPIKOTE(TM) 862 / EPIKURE(TM)-W Filament Winding Resin System: An Experimental Study

    NASA Astrophysics Data System (ADS)

    Moffet, Mitchell Lee

    This thesis presents the findings of extensive experiments to determine the effects of various common aerospace chemicals on EPIKOTE(TM) 862 (resin) and EPIKURE(TM) W (curing agent), a resin system utilized in filament wound carbon fiber reinforced polymer (CRP) structures. Test specimens of the neat resin system were fabricated and exposed for up to 6 months at room temperature to 11 fluids representing typical aerospace chemicals found on the flight line, and to 74°C tap water. Post exposure the samples were tested in torsion using a rheometer, which performed strain sweeps and frequency sweeps on all the samples. In addition, a subset of the samples received a temperatures sweep. The rheology test parameters represented the nominal stress levels CRP structures would expect to see in operation. In addition to the rheological tests, dimensional and mass measurements were made of the samples both pre and post exposure to study the physical changes due to the chemical interactions. Based on the results, a common detergent, MEK on structures manufactured with the 862W resin system should be prevented or severely limited. It had a significant impact on the performance of the resin system within 3 months, with no visible indications of the degradation. The resins system had good chemical resistance to all the other chemicals used in this study including hot water.

  13. Crossing Filaments

    E-print Network

    Filippov, Boris

    2011-01-01

    Solar filaments show the position of large scale polarity inversion lines and are used for the reconstruction of large-scale solar magnetic field structure on the basis of H{\\alpha} synoptic charts for the periods when magnetographic measurements were not available. Sometimes crossing filaments are seen in H{\\alpha} filtergrams. We analyze daily H{\\alpha} filtergrams from the archive of Big Bear Solar Observatory for the period of 1999-2003 to find crossing and interacting filaments. A number of examples are presented and filament patterns are compared with photospheric magnetic field distributions. We have found that all crossing filaments reveal quadrupolar magnetic configurations of the photospheric field and presume the presence of null points in the corona.

  14. Development of a stationary partial discharge monitoring system for high-voltage rotating machine stator windings

    Microsoft Academic Search

    R. C. Arbour; B. Milano

    1989-01-01

    The stationary partial discharge detector developed by the Bureau of Reclamation provides an economical method of monitoring partial discharge activity in high-voltage motor\\/generator stator windings. No physical connection to the stator coil or winding is required for this monitoring system; therefore, the integrity of the winding insulation is not compromised. The system can be used to monitor partial discharge during

  15. Machinability of glass fibre reinforced plastic (GFRP) composite using alumina-based ceramic cutting tools

    Microsoft Academic Search

    M. Adam Khan; A. Senthil Kumar

    2011-01-01

    This paper deals with the machining of glass fibre reinforced plastic (GFRP) composite material. GFRP composite material was fabricated in our laboratory using E-glass fibre with unsaturated polyester resin. GFRP composite specimens were prepared using a filament winding process. Machining studies were carried out using two different alumina cutting tools: namely, a Ti[C, N] mixed alumina cutting tool (CC650) and

  16. Making Crystal Filaments From Extruded Ceramic Rods

    NASA Technical Reports Server (NTRS)

    Westfall, Leonard J.

    1992-01-01

    New process produces single-crystal fibers of ceramic or metal at lower cost. Single-crystal filament drawn from tip of extruded polycrystalline rod. Extrusion produces longer rods from which longer fibers drawn. Potentially feeds single fiber drawing process directly. Continuous filaments made, and material not subjected to contamination from storage and transfer to drawing machine. Filaments used as reinforcing fibers in composite materials.

  17. Helical filaments

    SciTech Connect

    Barbieri, Nicholas; Lim, Khan; Durand, Magali; Baudelet, Matthieu; Richardson, Martin [Townes Laser Institute, CREOL—The College of Optics and Photonics, University of Central Florida, Orlando, Florida 32816 (United States); Hosseinimakarem, Zahra; Johnson, Eric [Micro-Photonics Laboratory – Center for Optical Material Science, Clemson, Anderson, South Carolina 29634 (United States)

    2014-06-30

    The shaping of laser-induced filamenting plasma channels into helical structures by guiding the process with a non-diffracting beam is demonstrated. This was achieved using a Bessel beam superposition to control the phase of an ultrafast laser beam possessing intensities sufficient to induce Kerr effect driven non-linear self-focusing. Several experimental methods were used to characterize the resulting beams and confirm the observed structures are laser air filaments.

  18. Magnetically driven filament probe

    SciTech Connect

    Schmid, A.; Herrmann, A.; Rohde, V.; Maraschek, M.; Mueller, H. W. [Max-Planck-Institut fuer Plasmaphysik, EURATOM Association, Boltzmannstr. 2, D-85748 Garching (Germany)

    2007-05-15

    A radially movable probe has been developed for studies of filamentary transport in ASDEX Upgrade during edge localized modes (ELMs) by means of Langmuir tips and magnetic pickup coils. The probe is permanently installed at the low field side in the ASDEX Upgrade vacuum vessel and is not subject to limitations in probe size, as, for example, probes on a shared manipulator are. The probe is moved by a magnetic drive, which allows for easy installation in the vessel, and has moderate machine requirements, as it will only require an electric feedthrough and an external power supply. The drive gives a linear motion with a radial range of 5 cm within 50 ms, where range and velocity can be largely scaled according to experimental requirements. The probe has been installed in the outer midplane of the ASDEX Upgrade vessel, where ELM filaments are expected to have their maximum amplitude. Filaments are coherent substructures within an ELM, carrying a fraction of the ELM released energy towards the wall. The new probe allows to measure the structure of these filaments, in particular, parameters such as filament rotation (by time delay measurements) and size (by peak width analysis). Activating the drive moves the probe from a safe position behind the limiter to a position in front of the limiters, i.e., exposes the Langmuir pins to the scrape-off layer plasma.

  19. Understanding Power Electronics and Electrical Machines in Multidisciplinary Wind Energy Conversion System Courses

    ERIC Educational Resources Information Center

    Duran, M. J.; Barrero, F.; Pozo-Ruz, A.; Guzman, F.; Fernandez, J.; Guzman, H.

    2013-01-01

    Wind energy conversion systems (WECS) nowadays offer an extremely wide range of topologies, including various different types of electrical generators and power converters. Wind energy is also an application of great interest to students and with a huge potential for engineering employment. Making WECS the main center of interest when teaching…

  20. SBC: Filamentality

    NSDL National Science Digital Library

    Filamentality is a tool offered by SBC (that's right, the phone company) as part of its education program and the Knowledge Network Explorer (KNE) website. The tool is meant to help educators (classroom teachers, trainers, students, or librarians) create Web-based activities. Basically, Filamentality is "a fill-in-the-blank tool that guides you through picking a topic, searching the Web, gathering good Internet links, and turning them into learning activities." The idea is to "combine the 'filament' of the Web with a learner's 'mentality.'" Setting up your own website is free and the process is explained so that you can get started with little or no knowledge of HTML or how the Web works. The Search Filamentality section lets visitors find some websites already created using Filamentality (i.e.: a search for "mathematics" brought up 1396 different websites), as well as related resources offered through the Knowledge Network Explorer. The Activity Formats section provides some suggestions and examples for ways to organize your educational website.

  1. Control strategies for enhanced power smoothing in wind energy systems using a flywheel driven by a vector-controlled induction machine

    Microsoft Academic Search

    Roberto Cárdenas; Rubén Peña; Greg Asher; Jon Clare

    2001-01-01

    This paper presents a novel control strategy for power smoothing in wind energy applications, especially those feeding a stand-alone load. The system is based on a vector-controlled induction machine driving a flywheel and addresses the problem of regulating the DC-link system voltage against both input power surges\\/sags from a wind turbine or sudden changes in load demand. The control is

  2. Control of an Open Winding Machine in a Grid-Connected Distributed Generation System

    Microsoft Academic Search

    Mu-Shin Kwak; Seung-Ki Sul

    2006-01-01

    A grid-connected distributed generation system which consists of engine generator, dc link with multiple energy sources and inverter is proposed. All six of the stator leads of the generator, which is a surface mount permanent magnet machine, are brought out to the terminal of the generator. Three leads are connected to the inverter and the others are connected to the

  3. FINAL REPORT ON CONTROL ALGORITHM TO IMPROVE THE PARTIAL-LOAD EFFICIENCY OFSURFACE PM MACHINES WITH FRACTIONAL-SLOT CONCENTRATED WINDINGS

    SciTech Connect

    Reddy, P.B.; Jahns, T.M.

    2007-04-30

    Surface permanent magnet (SPM) synchronous machines using fractional-slot concentrated windings are being investigated as candidates for high-performance traction machines for automotive electric propulsion systems. It has been shown analytically and experimentally that such designs can achieve very wide constant-power speed ratios (CPSR) [1,2]. This work has shown that machines of this type are capable of achieving very low cogging torque amplitudes as well as significantly increasing the machine power density [3-5] compared to SPM machines using conventional distributed windings. High efficiency can be achieved in this class of SPM machine by making special efforts to suppress the eddy-current losses in the magnets [6-8], accompanied by efforts to minimize the iron losses in the rotor and stator cores. Considerable attention has traditionally been devoted to maximizing the full-load efficiency of traction machines at their rated operating points and along their maximum-power vs. speed envelopes for higher speeds [9,10]. For example, on-line control approaches have been presented for maximizing the full-load efficiency of PM synchronous machines, including the use of negative d-axis stator current to reduce the core losses [11,12]. However, another important performance specification for electric traction applications is the machine's efficiency at partial loads. Partial-load efficiency is particularly important if the target traction application requires long periods of cruising operation at light loads that are significantly lower than the maximum drive capabilities. While the design of the machine itself is clearly important, investigation has shown that this is a case where the choice of the control algorithm plays a critical role in determining the maximum partial-load efficiency that the machine actually achieves in the traction drive system. There is no evidence that this important topic has been addressed for this type of SPM machine by any other authors. This topic takes on even greater significance for fractional-slot concentrated-winding SPM machine designs. In particular, maximizing the torque/power density of this class of SPM machines typically leads to machine designs with high numbers of poles. The resulting high electrical frequencies can easily result in high stator core losses unless special care is taken during the machine design process. The purpose of this report is to discuss a modified vector control algorithm for a fractional-slot concentrated winding SPM machine that has been developed to maximize the machine's partial-load efficiency over a wide range of operating conditions. For purposes of this discussion, a 55 kW (peak) SPM machine designed to meet requirements established in the US FreedomCar program [13] is used as the basis for demonstrating the proposed technique. A combination of closed-form analysis [14] and finite element analysis (FEA) is used during this investigation.

  4. Final Report on Control Algorithm to Improve the Partial-Load Efficiency of Surface PM Machines with Fractional-Slot Concentrated Windings

    SciTech Connect

    McKeever, John W [ORNL; Reddy, Patel [University of Wisconsin; Jahns, Thomas M [ORNL

    2007-05-01

    Surface permanent magnet (SPM) synchronous machines using fractional-slot concentrated windings are being investigated as candidates for high-performance traction machines for automotive electric propulsion systems. It has been shown analytically and experimentally that such designs can achieve very wide constant-power speed ratios (CPSR) [1,2]. This work has shown that machines of this type are capable of achieving very low cogging torque amplitudes as well as significantly increasing the machine power density [3-5] compared to SPM machines using conventional distributed windings. High efficiency can be achieved in this class of SPM machine by making special efforts to suppress the eddy-current losses in the magnets [6-8], accompanied by efforts to minimize the iron losses in the rotor and stator cores. Considerable attention has traditionally been devoted to maximizing the full-load efficiency of traction machines at their rated operating points and along their maximum-power vs. speed envelopes for higher speeds [9,10]. For example, on-line control approaches have been presented for maximizing the full-load efficiency of PM synchronous machines, including the use of negative d-axis stator current to reduce the core losses [11,12]. However, another important performance specification for electric traction applications is the machine's efficiency at partial loads. Partial-load efficiency is particularly important if the target traction application requires long periods of cruising operation at light loads that are significantly lower than the maximum drive capabilities. While the design of the machine itself is clearly important, investigation has shown that this is a case where the choice of the control algorithm plays a critical role in determining the maximum partial-load efficiency that the machine actually achieves in the traction drive system. There is no evidence that this important topic has been addressed for this type of SPM machine by any other authors. This topic takes on even greater significance for fractional-slot concentrated-winding SPM machine designs. In particular, maximizing the torque/power density of this class of SPM machines typically leads to machine designs with high numbers of poles. The resulting high electrical frequencies can easily result in high stator core losses unless special care is taken during the machine design process. The purpose of this report is to discuss a modified vector control algorithm for a fractional-slot concentrated winding SPM machine that has been developed to maximize the machine's partial-load efficiency over a wide range of operating conditions. For purposes of this discussion, a 55 kW (peak) SPM machine designed to meet requirements established in the US FreedomCar program [13] is used as the basis for demonstrating the proposed technique. A combination of closed-form analysis [14] and finite element analysis (FEA) is used during this investigation.

  5. Sensorless vector control of induction machines for variable-speed wind energy applications

    Microsoft Academic Search

    Roberto Cárdenas; Rubén Peña

    2004-01-01

    A sensorless vector-control strategy for an induction generator in a grid-connected wind energy conversion system is presented. The sensorless control system is based on a model reference adaptive system (MRAS) observer to estimate the rotational speed. In order to tune the MRAS observer and compensate for the parameter variation and uncertainties, a separate estimation of the speed is obtained from

  6. Vector controlled induction machines for stand-alone wind energy applications

    Microsoft Academic Search

    R. S. Pena; R. J. Cardenas; G. M. Asher; J. C. Clare

    2000-01-01

    This paper describes the system and control structures for vector controlled induction generators used for variable speed, wind energy conversion (WEC) systems. The paper focuses on WEC systems feeding an isolated load or weak grid since for such systems the generated voltage and power flow must be regulated by the WEC system itself and the control structures are not trivial.

  7. Fuzzy logic based intelligent control of a variable speed cage machine wind generation system

    Microsoft Academic Search

    M. G. Simoes; B. K. Bose; R. J. Spiegel

    1997-01-01

    The paper describes a variable speed wind generation system where fuzzy logic principles are used for efficiency optimization and performance enhancement control. A squirrel cage induction generator feeds the power to a double-sided pulse width modulated converter system which pumps power to a utility grid or can supply to an autonomous system. The generation system has fuzzy logic control with

  8. FUZZY LOGIC BASED INTELLIGENT CONTROL OF A VARIABLE SPEED CAGE MACHINE WIND GENERATION SYSTEM

    EPA Science Inventory

    The paper describes a variable-speed wind generation system where fuzzy logic principles are used to optimize efficiency and enhance performance control. A squirrel cage induction generator feeds the power to a double-sided pulse width modulated converter system which either pump...

  9. FUZZY LOGIC BASED INTELLIGENT CONTROL OF A VARIABLE SPEED CAGE MACHINE WIND GENERATION SYSTEM

    EPA Science Inventory

    The report gives results of a demonstration of the successful application of fuzzy logic to enhance the performance and control of a variable-speed wind generation system. A squirrel cage induction generator feeds the power to either a double-sided pulse-width modulation converte...

  10. Control of an Open-Winding Machine in a Grid-Connected Distributed Generation System

    Microsoft Academic Search

    Mu-Shin Kwak; Seung-Ki Sul

    2008-01-01

    In this paper, a grid-connected distributed generation system, which consists of engine-generator, DC link with multiple energy sources, and inverter, is proposed. All six of the stator leads of the generator, which is the surface-mount permanent-magnet machine, are brought out to the terminal of the generator. Three leads are connected to the inverter, and the others are connected to the

  11. Graphite filament wound pressure vessels

    NASA Technical Reports Server (NTRS)

    Feldman, A.; Damico, J. J.

    1972-01-01

    Filament wound NOL rings, 4-inch and 8-inch diameter closed-end vessels involving three epoxy resin systems and three graphite fibers were tested to develop property data and fabrication technology for filament wound graphite/epoxy pressure vessels. Vessels were subjected to single-cycle burst tests at room temperature. Manufacturing parameters were established for tooling, winding, and curing that resulted in the development of a pressure/vessel performance factor (pressure x volume/weight) or more than 900,000 in. for an oblate spheroid specimen.

  12. Novel actin-like filament structure from Clostridium tetani.

    PubMed

    Popp, David; Narita, Akihiro; Lee, Lin Jie; Ghoshdastider, Umesh; Xue, Bo; Srinivasan, Ramanujam; Balasubramanian, Mohan K; Tanaka, Toshitsugu; Robinson, Robert C

    2012-06-15

    Eukaryotic F-actin is constructed from two protofilaments that gently wind around each other to form a helical polymer. Several bacterial actin-like proteins (Alps) are also known to form F-actin-like helical arrangements from two protofilaments, yet with varied helical geometries. Here, we report a unique filament architecture of Alp12 from Clostridium tetani that is constructed from four protofilaments. Through fitting of an Alp12 monomer homology model into the electron microscopy data, the filament was determined to be constructed from two antiparallel strands, each composed of two parallel protofilaments. These four protofilaments form an open helical cylinder separated by a wide cleft. The molecular interactions within single protofilaments are similar to F-actin, yet interactions between protofilaments differ from those in F-actin. The filament structure and assembly and disassembly kinetics suggest Alp12 to be a dynamically unstable force-generating motor involved in segregating the pE88 plasmid, which encodes the lethal tetanus toxin, and thus a potential target for drug design. Alp12 can be repeatedly cycled between states of polymerization and dissociation, making it a novel candidate for incorporation into fuel-propelled nanobiopolymer machines. PMID:22514279

  13. Wind

    NSDL National Science Digital Library

    Iowa Public Television. Explore More Project

    2004-01-01

    What part does the wind play in satisfying energy demands? This informational piece, part of a series about the future of energy, introduces students to wind as an energy source. Here students read about the history, uses, and efficiency of wind power. Information is also provided about benefits, limitations, and geographical considerations of wind power in the United States. Thought-provoking questions afford students chances to reflect on what they've read about the uses of wind power. Supplemental articles and information are available from a sidebar. Three energy-related web links are also provided. Copyright 2005 Eisenhower National Clearinghouse

  14. Characteristic analysis and comparison of axial flux machines according to magnetization pattern for 500 W-class wind power generator application

    NASA Astrophysics Data System (ADS)

    Park, Yu-Seop; Jang, Seok-Myeong; Ko, Kyoung-Jin; Choi, Jang-Young; Sung, So-Young

    2012-04-01

    This paper presents the electromagnetic characteristic analysis of axial flux machines applied to 500(W) class wind power generators. For the dramatic analysis time reduction, analytical method is applied, and comparative analysis is performed according to magnetization patterns of permanent magnets. Due to their structural features, quasi 3-dimensional analysis is employed, and correction function is introduced to consider the flux leakage of the machines. The analysis results are compared with the results by finite element method and experiment to validate the suggested method performed in this paper showing high reliability.

  15. Filament turbulence

    NASA Astrophysics Data System (ADS)

    Davidsen, Joern

    2010-03-01

    How much information do you need to distinguish between different mechanisms for spatiotemporal chaos in three-dimensions? In this talk, I will show that the observation of the dynamics on the surface of a medium can be sufficient. Studying mechanisms for filament turbulence in the context of reaction-diffusion media, we found numerically that two major classes of instabilities leave a very different signature on what can be observed on the surface of a three-dimensional medium. These results are of direct relevance in the context of ventricular fibrillation - a turbulent electrical wave activity that destroys the coherent contraction of the ventricular muscle and its main pumping function leading to sudden cardiac death. While it has been proposed that the three-dimensional structure of the heart plays an important role in this type of filament turbulence, only the surface of the heart is currently accessible to experimental observation preventing the study of the full dynamics. Our results suggest that such observations might be sufficient.

  16. Mars vertical axis wind machines. The design of a Darreus and a Giromill for use on Mars

    NASA Astrophysics Data System (ADS)

    Brach, David; Dube, John; Kelly, Jon; Peterson, Joanna; Bollig, John; Gohr, Lisa; Mahoney, Kamin; Polidori, Dave

    1992-05-01

    This report contains the design of both a Darrieus and a Giromill for use on Mars. The report has been organized so that the interested reader may read only about one machine without having to read the entire report. Where components for the two machines differ greatly, separate sections have been allotted for each machine. Each section is complete; therefore, no relevant information is missed by reading only the section for the machine of interest. Also, when components for both machines are similar, both machines have been combined into one section. This is done so that the reader interested in both machines need not read the same information twice.

  17. Mars vertical axis wind machines. The design of a Darreus and a Giromill for use on Mars

    NASA Technical Reports Server (NTRS)

    Brach, David; Dube, John; Kelly, Jon; Peterson, Joanna; Bollig, John; Gohr, Lisa; Mahoney, Kamin; Polidori, Dave

    1992-01-01

    This report contains the design of both a Darrieus and a Giromill for use on Mars. The report has been organized so that the interested reader may read only about one machine without having to read the entire report. Where components for the two machines differ greatly, separate sections have been allotted for each machine. Each section is complete; therefore, no relevant information is missed by reading only the section for the machine of interest. Also, when components for both machines are similar, both machines have been combined into one section. This is done so that the reader interested in both machines need not read the same information twice.

  18. Factors affecting filamentous growth of Sphaerotilus natans.

    PubMed

    GAUDY, E; WOLFE, R S

    1961-11-01

    Filamentous growth in cultures of Sphaerotilus natans can be measured and compared with total growth by a standardized procedure of winding filaments around an inoculating needle. Filaments and residual growth are then separately washed on Millipore filters, dried, and weighed. This method has been used to study changes in the growth habit of S. natans elicited by changes in the concentration of nutrients in the medium. The concentration of peptone, in a medium containing a sugar, phosphate buffer, and inorganic salts, has a much greater effect on the proportion of filamentous growth than does the nature or concentration of the carbon source or the concentration of phosphate buffer. Filament formation is significantly inhibited by concentrations of peptone greater than 0.25%; further increases in peptone concentration stimulate the production of large amounts of capsular material. Increasing the concentration of phosphate buffer to 0.05 M almost completely inhibits growth of S. natans. PMID:13897283

  19. A Comparative Evaluation of Automated Solar Filament Detection

    NASA Astrophysics Data System (ADS)

    Schuh, M. A.; Banda, J. M.; Bernasconi, P. N.; Angryk, R. A.; Martens, P. C. H.

    2014-07-01

    We present a comparative evaluation for automated filament detection in H? solar images. By using metadata produced by the Advanced Automated Filament Detection and Characterization Code (AAFDCC) module, we adapted our trainable feature recognition (TFR) module to accurately detect regions in solar images containing filaments. We first analyze the AAFDCC module's metadata and then transform it into labeled datasets for machine-learning classification. Visualizations of data transformations and classification results are presented and accompanied by statistical findings. Our results confirm the reliable event reporting of the AAFDCC module and establishes our TFR module's ability to effectively detect solar filaments in H? solar images.

  20. Filament Eruption Onset

    NASA Technical Reports Server (NTRS)

    Sterling, Alphonse C.; Moore, Ronald L.

    2011-01-01

    We have been investigating filament eruptions in recent years. Use filament eruptions as markers of the coronal field evolution. Data from SoHO, Yohkoh, TRACE, Hinode, and other sources. We and others have observed: (1)Filaments often show slow rise, followed by fast rise, (2) Brightenings, preflares, microflares during slow rise (3) Magnetic evolution in hours prior to eruption onset. We investigated What do Hinode and SDO show for filament eruptions?

  1. SRM filament wound case resin characterization studies

    NASA Technical Reports Server (NTRS)

    Chou, L. W.

    1985-01-01

    The amine cured epoxy wet winding resin used in fabrication of the SRM filament wound case is analyzed. High pressure liquid chromatography (HPSC) is utilized extensively to study lot-to-lot variation in both resin and curing agent. The validity of quantitative hplc methodology currently under development in-process resin/catalyst assay is assessed.

  2. Filaments from L5

    NASA Technical Reports Server (NTRS)

    Sterling, Alphonse C.

    2011-01-01

    We've been investigating filament eruptions in recent years. Why do eruptions occur? Basic mechanism is magnetic, and can often include coronal mass ejections (CMEs), flares, and filament eruptions. Use filament eruptions as markers of the more-general eruption. From our studies, we can identify directions for future work to help predict when eruptions might occur.

  3. Millikelvin Lab Machine Shop

    E-print Network

    McQuade, D. Tyler

    Millikelvin Lab OP105­112 Machine Shop OP132 Resistive Magnet Shop CICC Winding Area Transformers This building is home to the Millikelvin lab, the control room, the resistive magnet and machine shops, the CICC@magnet.fsu.edu (850) 644-4378 (850) 644-0534 2 MACHINE SHOP OP132 Vaughan Williams (A114*) williams

  4. Influence of bottom topography on an upwelling current : generation of long trapped filaments

    E-print Network

    Paris-Sud XI, Université de

    between the lay- ers, has only a weak influence on the dynamics of topographic eddies and on filament for filaments. Key words: Eastern boundary, Mesoscale dynamics, Upwelling/Downwelling, Topographic flows filaments. They use a 2-layer shallow water model on the f-plane. A wind forced along- shore current

  5. Winds

    NSDL National Science Digital Library

    2012-08-03

    In this problem-based learning (PBL) scenario, students prepare a presentation for investors showing how their fishing company has a significant advantage because it locates upwelling zones and fishing areas using TRMM (Tropical Rainfall Measuring Mission) and other satellite data. Prior to launching the PBL, students learn about wind: the topics of air pressure, coriolis effect, upwelling and the role of differential heating on the atmosphere are explored in classroom demonstrations. Materials required include a beaker, coffee grounds, drinking straw, balloon, flashlight, and turntable. The resource includes teacher background information, glossary, assessment rubric, and an appendix introducing problem-based learning.

  6. Comparison of 5th order and 3rd order machine models for doubly fed induction generator (DFIG) wind turbines

    Microsoft Academic Search

    J. B. Ekanayake; L. Holdsworth; N. Jenkins

    2003-01-01

    With increasing concern over climate change, a number of countries have implemented new renewable energy targets, which require significant amounts of wind generation. It is now recognized that much of this new wind generation plant will be variable speed type using doubly fed induction generators (DFIG). In order to investigate the impacts of these DFIG installations on the operation and

  7. Proceedings of the 2008 International Conference on Electrical Machines Paper ID 1434 DFIG-Based Wind Turbine Fault Diagnosis

    E-print Network

    Boyer, Edmond

    Pitch Drive Brake Induction Generator Frequency Converter Wind Turbine Control Main Circuit Breaker Medium Voltage Switchgear Line Coupling Transformer © Nordex: N80 ­ 2.5 MW (Norway) Gear Pitch Drive Brake Induction Generator Frequency Converter Wind Turbine Control Main Circuit Breaker Medium Voltage

  8. Simulation study of permanent magnet synchronous machine direct drive wind power generator using three level NPC converter system

    Microsoft Academic Search

    Ranjan K. Behera; Wenzhong Gao; Olorunfemi Ojo

    2009-01-01

    In this paper, two three-phase three-level neutral point clamped (NPC) converters connected back-to-back are used for a direct drive wind power generator. A permanent magnet synchronous generator (PMSG) is used as the generator, which is driven by the wind turbine. Main problem of voltage unbalance in each electrolyte capacitor is controlled by using a simple chopper control circuit. A simple

  9. Processing and thermal properties of filament wound carbon-carbon composites for impact shell application

    NASA Astrophysics Data System (ADS)

    Zee, Ralph; Romanoski, Glenn; Gale, H. Shyam; Wang, Hsin

    2001-02-01

    The performance and safety of the radioisotope power source depend in part on the thermal and impact properties of the materials used in the general purpose heat source (GPHS) through the use of an impact shell, thermal insulation and an aeroshell. Results from an earlier study indicate the importance of circumferential fibers to the mechanical properties of cylindrical filament wound carbon-carbon composites for the impact shell application. Based on this study, an investigation was initiated to determine the processing characteristics and the mechanical and thermal response of three filament wound configurations with different percentages of circumferential fibers: 50%, 66% and 80%. The performs were fabricated using a 3-D filament winding machine followed by five cycles of resin impregnation and carbonization. In this paper, the processing sequence and the resulting microstructures of the composites will be described. The thermal conductivity values of the composites as a function of fiber configuration and density will be discussed. These results will be compared with the fine-weave pierced-fabric (FWPF) material and carbon-bonded carbon-fiber insulation. Finally, the relevance of the new configurations for applications in the general purpose heat source (GPHS) will also be inferred. .

  10. Externally refuelled optical filaments

    NASA Astrophysics Data System (ADS)

    Scheller, Maik; Mills, Matthew S.; Miri, Mohammad-Ali; Cheng, Weibo; Moloney, Jerome V.; Kolesik, Miroslav; Polynkin, Pavel; Christodoulides, Demetrios N.

    2014-04-01

    Plasma channels produced in air through femtosecond laser filamentation hold great promise for a number of applications, including remote sensing, attosecond physics and spectroscopy, channelling microwaves and lightning protection. In such settings, extended filaments are desirable, yet their longitudinal span is limited by dissipative processes. Although various techniques aiming to prolong this process have been explored, the substantial extension of optical filaments remains a challenge. Here, we experimentally demonstrate that the natural range of a plasma column can be enhanced by at least an order of magnitude when the filament is prudently accompanied by an auxiliary beam. In this arrangement, the secondary low-intensity `dressing' beam propagates linearly and acts as a distributed energy reservoir, continuously refuelling the optical filament. Our approach offers an efficient and viable route towards the generation of extended light strings in air without inducing premature wave collapse or an undesirable beam break-up into multiple filaments.

  11. Micromechanical Modeling of Filament Wound Cement-Based Composites

    E-print Network

    Mobasher, Barzin

    Based Composites Laboratory at ASU include: pul- trusion, filament winding, extrusion, compression winding Mobasher et al. 1997; Pivacek and Mobasher 1997 . Various continuous fiber cement-based composites consisting of unidirec- tional lamina, 0/90/0 , and 0, 45n , 90n are manufactured with up to 15% continuous

  12. Evaluation of magnetic forces in an induction machine with dual stator winding taking into account hysteresis model

    Microsoft Academic Search

    Dounia Sedira; Mohamed Rachid Mékidèche; Afef Kedous-Lebouc; Siham Laissaoui

    2011-01-01

    Purpose – Designers of electrical machines need a clear understanding of the mechanism of noise generation, in order to be able to reduce the noises which are produced under the influence of forces due to the magnetic field. The purpose of this paper is to develop a new approach to give a best estimation of these forces. Design\\/methodology\\/approach – A

  13. Filament proteins/A0292

    NSDL National Science Digital Library

    2009-04-14

    Cytoplasmic intermediate filaments (IF), also known as A0292, can be divided into 5 subclasses based on their biochemical properties, immunologic specificity and tissue distribution: keratin filaments in epithelial cells, vimentin filaments in cells ...

  14. Parametric evaluation of wind turbine noise

    Microsoft Academic Search

    G. C. Tocci; E. N. Marcus

    1982-01-01

    In lieu of large single wind turbine installations, US Windpower, Burlington, Massachusetts is promoting the wind farm concept for wind power generation. A wind farm is an array of several small machines which are used to produce the equipment power of a single, large wind turbine. The smaller 50 KW machines manufactured by US Windpower, when used in an array

  15. Preliminary study on the applicability of semi-geodesic winding in the design and manufacturing of composite towers

    NASA Astrophysics Data System (ADS)

    Kayran, A.; ?brahimo?lu, C. S.

    2014-12-01

    During last twenty years, wind turbine manufacturers took the path of building larger machines to generate more electricity. However, the bigger the size became, the more material was required to support the loads, leading to great weight increases. Larger turbines and higher hub heights also resulted in larger tower base diameters which are limited considering their logistics. In many countries, the limit for transports with special permits maximizes the diameter to 4.5 metres. Considering this fact, the wind turbine market dominated by welded steel shell towers is looking for new structural solutions for their future turbines. Although, composite materials are not used as the structural material in the towers of today's turbines, the demand for larger wind turbines forces engineers to seek for alternative material systems with high specific strength and stiffness ratios to be used in towers. Inspired by the applicability of filament winding in tower production, in the present article we investigated the effect of semi-geodesic winding on the winding angle, thickness, stiffness coefficients and vibration characteristics of filament wound composite conical shells of revolution which simulate wind turbine towers at the structural level. Present study showed that the preset friction applied during semi-geodesic winding is an important design parameter which can be controlled to obtain gradually increasing thickness from tower top to the base of the tower, and favourably alter the dynamic characteristics of the composite towers.

  16. Compressive testing of filament-wound cylinders

    NASA Technical Reports Server (NTRS)

    Jensen, David W.; Hipp, Patrick A.

    1991-01-01

    An experimental investigation has been conducted on the compressive buckling and failure of filament-wound circular cylinders. This investigation identifies one of the relationships between structural performance and scale, as well as some of the causes of reduced structural performance in large-scale structures. It is hypothesized that this effect is related to two conditions: first, the number of fiber tow undulations; and second, the percentage of weak interfaces within the structure. The effect of winding pattern and the resulting location of the fiber undulations were studied by varying the winding parameters. Three types of cylinders were manufactured from Amoco T650-35/1908 graphite/epoxy preimpregnated tow with different winding sequences (0/+/-60)s, (+/-30/90)s, and (90/+/-30)s. The (90/+/-30)s cylinders were manufactured with two different winding patterns (distributed and classical) and radius-to-thickness ratios (15 and 55). All cylinders were loaded in compression to failure. Comparisons of the compressive strength and failure modes demonstrate the relationship between the winding parameters, scale, and structural performance of filament-wound composite cylinders.

  17. Wind at Work.

    ERIC Educational Resources Information Center

    Adams, Stephen

    1998-01-01

    Describes a project in which students create wind machines to harness the wind's power and do mechanical work. Demonstrates kinetic and potential energy conversions and makes work and power calculations meaningful. Students conduct hands-on investigations with their machines. (DDR)

  18. Lightning Protection for Rotating Machines

    Microsoft Academic Search

    G. D. McCann; E. Beck; L. A. Finzi

    1944-01-01

    The high monetary value and low insulation levels of rotating machines make it necessary to employ special protection. A rotating machine can be conceived as a transmission line with distributed constants, the essential difference being that the machine winding is wound back on itself in the form of turns, which may permit high voltage across the turn-to-turn insulation. The installation

  19. Power from the Wind

    ERIC Educational Resources Information Center

    Roman, Harry T.

    2004-01-01

    Wind energy is the fastest-growing renewable energy source in the world. Over the last 20 years, the wind industry has done a very good job of engineering machines, improving materials, and economies of production, and making this energy source a reality. Like all renewable energy forms, wind energy's successful application is site specific. Also,…

  20. Wind Power Now!

    ERIC Educational Resources Information Center

    Inglis, David Rittenhouse

    1975-01-01

    The government promotes and heavily subsidizes research in nuclear power plants. Federal development of wind power is slow in comparison even though much research with large wind-electric machines has already been conducted. Unless wind power programs are accelerated it will not become a major energy alternative to nuclear power. (MR)

  1. Simple Fatigue Machine for Wires and Foils

    Microsoft Academic Search

    R. L. Benedetti; D. L. Creighton

    1970-01-01

    A simple fatigue machine suitable for testing wires, filaments, foils, and other specimens of small cross section has been designed and built. The axial-load machine applies an alternating stress about a tensile mean stress and is of the constant amplitude of force type utilizing electromagnetic loading. One data curve for commercially pure titanium wire is presented to demonstrate the performance

  2. Aerogel-supported filament

    DOEpatents

    Wuest, C.R.; Tillotson, T.M.; Johnson, C.V. III

    1995-05-16

    The present invention is a thin filament embedded in a low density aerogel for use in radiation detection instruments and incandescent lamps. The aerogel provides a supportive matrix that is thermally and electrically nonconductive, mechanically strong, highly porous, gas-permeable, and transparent to ionizing radiation over short distances. A low density, open-cell aerogel is cast around a fine filament or wire, which allows the wire to be positioned with little or no tension and keeps the wire in place in the event of breakage. The aerogel support reduces the stresses on the wire caused by vibrational, gravitational, electrical, and mechanical forces. 6 Figs.

  3. Aerogel-supported filament

    DOEpatents

    Wuest, Craig R. (Danville, CA); Tillotson, Thomas M. (Tracy, CA); Johnson, III, Coleman V. (Dallas, TX)

    1995-01-01

    The present invention is a thin filament embedded in a low density aerogel for use in radiation detection instruments and incandescent lamps. The aerogel provides a supportive matrix that is thermally and electrically nonconductive, mechanically strong, highly porous, gas-permeable, and transparent to ionizing radiation over short distances. A low density, open-cell aerogel is cast around a fine filament or wire, which allows the wire to be positioned with little or no tension and keeps the wire in place in the event of breakage. The aerogel support reduces the stresses on the wire caused by vibrational, gravitational, electrical, and mechanical forces.

  4. Method for preparing metallated filament-wound structures

    DOEpatents

    Peterson, George R. (Knoxville, TN)

    1979-01-01

    Metallated graphite filament-wound structures are prepared by coating a continuous multi-filament carbon yarn with a metal carbide, impregnating the carbide coated yarn with a polymerizable carbon precursor, winding the resulting filament about a mandrel, partially curing the impregnation in air, subjecting the wound composite to heat and pressure to cure the carbon precursor, and thereafter heating the composite in a sizing die at a pressure loading of at least 1000 psi for graphitizing the carbonaceous material in the composite. The carbide in the composite coalesces into rod-like shapes which are disposed in an end-to-end relationship parallel with the filaments to provide resistance to erosion in abrasive laden atmospheres.

  5. Origin of the Dense Core Mass Function in Contracting Filaments

    NASA Astrophysics Data System (ADS)

    Myers, Philip C.

    2013-02-01

    Mass functions of starless dense cores (CMFs) may arise from contraction and dispersal of core-forming filaments. In an illustrative model, a filament contracts radially by self-gravity, increasing the mass of its cores. During this contraction, FUV photoevaporation and ablation by shocks and winds disperse filament gas and limit core growth. The stopping times of core growth are described by a waiting-time distribution. The initial filament column density profile and the resulting CMF each match recent Herschel observations in detail. Then low-mass cores have short growth ages and arise from the innermost filament gas, while massive cores have long growth ages and draw from more extended filament gas. The model fits the initial density profile and CMF best for mean core density 2 × 104 cm-3 and filament dispersal timescale 0.5 Myr. Then the typical core mass, radius, mean column density, and contraction speed are respectively 0.8 solar masses, 0.06 pc, 6 × 1021 cm-2, and 0.07 km s-1, also in accord with observed values.

  6. Evolving Photospheric Flux Concentrations and Filament Dynamic Changes

    NASA Astrophysics Data System (ADS)

    Schmieder, B.; Aulanier, G.; Mein, P.; López Ariste, A.

    2006-11-01

    We analyze the role of weak photospheric flux concentrations that evolve in a filament channel, in the triggering of dynamic changes in the shape of a filament. The high polarimetric sensitivity of THEMIS allowed us to detect weak flux concentrations (few Gauss) associated with the filament development. The synoptic instruments (MDI, SOLIS) even if their sensitivity is much less than THEMIS were useful to follow any subsequent strengthening of these flux concentrations after their identification in the THEMIS magnetograms. We found that (1) the northern part of the filament develops an H? barb at the same time that weak minority polarity elements develop near a plage; (2) a section in the southern part of the H? filament gradually disappears and later reforms at the same time that several mixed-polarity magnetic elements appear, then subsequently cancel or spread away from each other. These changes correspond to increases in EUV emission, as observed by TRACE, EIT, and CDS. This suggests that the plasma is temporarily heated along the filament spine. An idealized sequence of force-free models of this filament channel, based on plasma-supporting magnetic dips occurring in the windings of a very weakly twisted flux tube, naturally explains the evolution of its southern part as being due to changes in the topology of the coronal magnetic field as the photospheric flux concentrations evolve.

  7. Hygrothermomechanical evaluation of transverse filament tape epoxy/polyester fiberglass composites

    NASA Technical Reports Server (NTRS)

    Lark, R. F.; Chamis, C. C.

    1984-01-01

    Transverse filament tape (TFT) fiberglass/epoxy and TFT polyester composites intended for low cost wind turbine blade fabrication have been subjected to static and cyclic load behavior tests whose results are presently evaluated on the basis of an integrated hygrothermomechanical response theory. Laminate testing employed simulated filament winding procedures. The results obtained show that the predicted hygrothermomechanical environmental effects on TFT composites are in good agreement with measured data for various properties, including fatigue at different R-ratio values.

  8. Design optimization of small wind turbines for low wind regimes

    Microsoft Academic Search

    D. E. Cromack; Debbie Oscar

    1984-01-01

    Attention is given to two examples illustrating the design optimization process for small wind turbines, which is concerned with machine parameters and the wind characteristics and electrical loads of the intended operating environment. The optimization process emphasizes the importance of rated wind speed, rotor rpm, generator size, and rotor blade characteristics. Wind turbines are noted to have been designed for

  9. Wind energy utilization: A bibliography

    NASA Technical Reports Server (NTRS)

    1975-01-01

    Bibliography cites documents published to and including 1974 with abstracts and references, and is indexed by topic, author, organization, title, and keywords. Topics include: Wind Energy Potential and Economic Feasibility, Utilization, Wind Power Plants and Generators, Wind Machines, Wind Data and Properties, Energy Storage, and related topics.

  10. Solid friction between soft filaments

    E-print Network

    Ward, Andrew; Schwenger, Walter; Welch, David; Lau, A W C; Vitelli, Vincenzo; Mahadevan, L; Dogic, Zvonimir

    2015-01-01

    Any macroscopic deformation of a filamentous bundle is necessarily accompanied by local sliding and/or stretching of the constituent filaments. Yet the nature of the sliding friction between two aligned filaments interacting through multiple contacts remains largely unexplored. Here, by directly measuring the sliding forces between two bundled F-actin filaments, we show that these frictional forces are unexpectedly large, scale logarithmically with sliding velocity as in solid-like friction, and exhibit complex dependence on the filaments' overlap length. We also show that a reduction of the frictional force by orders of magnitude, associated with a transition from solid-like friction to Stokes' drag, can be induced by coating F-actin with polymeric brushes. Furthermore, we observe similar transitions in filamentous microtubules and bacterial flagella. Our findings demonstrate how altering a filament's elasticity, structure and interactions can be used to engineer interfilament friction and thus tune the prop...

  11. Solid friction between soft filaments

    E-print Network

    Andrew Ward; Feodor Hilitski; Walter Schwenger; David Welch; A. W. C. Lau; Vincenzo Vitelli; L. Mahadevan; Zvonimir Dogic

    2015-03-04

    Any macroscopic deformation of a filamentous bundle is necessarily accompanied by local sliding and/or stretching of the constituent filaments. Yet the nature of the sliding friction between two aligned filaments interacting through multiple contacts remains largely unexplored. Here, by directly measuring the sliding forces between two bundled F-actin filaments, we show that these frictional forces are unexpectedly large, scale logarithmically with sliding velocity as in solid-like friction, and exhibit complex dependence on the filaments' overlap length. We also show that a reduction of the frictional force by orders of magnitude, associated with a transition from solid-like friction to Stokes' drag, can be induced by coating F-actin with polymeric brushes. Furthermore, we observe similar transitions in filamentous microtubules and bacterial flagella. Our findings demonstrate how altering a filament's elasticity, structure and interactions can be used to engineer interfilament friction and thus tune the properties of fibrous composite materials.

  12. Mean Machines.

    ERIC Educational Resources Information Center

    Flores, Alfinio

    1998-01-01

    Suggests scales as alternative representations of numerical concepts and operations that can be used as arithmetic-mean machines, adding machines, multiplication machines, and geometric-mean machines. (ASK)

  13. Protein machines and self assembly in muscle organization

    NASA Technical Reports Server (NTRS)

    Barral, J. M.; Epstein, H. F.

    1999-01-01

    The remarkable order of striated muscle is the result of a complex series of protein interactions at different levels of organization. Within muscle, the thick filament and its major protein myosin are classical examples of functioning protein machines. Our understanding of the structure and assembly of thick filaments and their organization into the regular arrays of the A-band has recently been enhanced by the application of biochemical, genetic, and structural approaches. Detailed studies of the thick filament backbone have shown that the myosins are organized into a tubular structure. Additional protein machines and specific myosin rod sequences have been identified that play significant roles in thick filament structure, assembly, and organization. These include intrinsic filament components, cross-linking molecules of the M-band and constituents of the membrane-cytoskeleton system. Muscle organization is directed by the multistep actions of protein machines that take advantage of well-established self-assembly relationships. Copyright 1999 John Wiley & Sons, Inc.

  14. Breakup of Liquid Filaments

    E-print Network

    Castrejon-Pita, Alfonso A.; Castrejon-Pita, J.R.; Hutchings, I.M.

    2012-01-01

    is the Weber number defined as We= ?v2R0/? and v the speed of the filament [16, 17]. This critical ra- dius is Inertial influences from the air would become... compared with the typical time scale on which initial disturbances will attenuate, [11]. In contrast, for low Oh, the sur- face pinch off occurs fast and disturbances will have not enough time to grow. Surface defects will be more evi- dent for long...

  15. The Filament Feeding Mechanism

    Microsoft Academic Search

    Patrick Hood-Daniel; James Floyd Kelly

    \\u000a Now that your Extruder is complete, it’s time to bolt it onto your 3D printer frame. Your 3D printer works by feeding a plastic\\u000a filament into the heater core of the Extruder. The plastic melts and is then forced through the Extruder’s nozzle and applied\\u000a to the worktable to print three dimensional objects.

  16. Simple Machines

    NSDL National Science Digital Library

    Mr. Oldroyd

    2007-09-26

    Online Simple Machines Assignment OBJECTIVES: Student\\'s will be able to name and describe all seven simple machines. Students will be able to identify simple machines that they use everyday. Example: Clock = Gear INSTRUCTIONS: 1. Click on the Simple Machines Glossary page and familiarize yourself with the seven simple machines. Simple Machines Glossary Page 2. Students are to click on ...

  17. Complex Flare Dynamics Initiated by a Filament-Filament Interaction

    NASA Astrophysics Data System (ADS)

    Zhu, Chunming; Liu, Rui; Alexander, David; Sun, Xudong; McAteer, James

    2015-04-01

    We report on a filament eruption that led to a relatively rare filament-filament interaction event. The filaments were located at different heights above the same segment of a circular polarity inversion line (PIL) around a condensed leading sunspot. The onset of the eruption of the lower of the two filaments was accompanied by a simultaneous descent of the upper filament resulting in a convergence and direct interaction of the two filaments. The interaction led to the subsequent merger of the filaments into a single magnetically complex structure that erupted to create a large solar flare and an array of complex dynamical activity. A hard X-ray coronal source and an associated enhancement of hot plasma are observed at the interface between the two interacting filaments. These phenomena are related to the production of a small C flare and the subsequent development of a much stronger M flare. Magnetic loop shrinkage and descending dark voids were observed at different locations as part of the large flare energy release giving us a unique insight into these dynamic flare phenomena.

  18. Analytical expressions for maximum wind turbine average power in a Rayleigh wind regime

    SciTech Connect

    Carlin, P.W.

    1996-12-01

    Average or expectation values for annual power of a wind turbine in a Rayleigh wind regime are calculated and plotted as a function of cut-out wind speed. This wind speed is expressed in multiples of the annual average wind speed at the turbine installation site. To provide a common basis for comparison of all real and imagined turbines, the Rayleigh-Betz wind machine is postulated. This machine is an ideal wind machine operating with the ideal Betz power coefficient of 0.593 in a Rayleigh probability wind regime. All other average annual powers are expressed in fractions of that power. Cases considered include: (1) an ideal machine with finite power and finite cutout speed, (2) real machines operating in variable speed mode at their maximum power coefficient, and (3) real machines operating at constant speed.

  19. Wind energy : energy from moving air

    NSDL National Science Digital Library

    US Department of Energy (DOE). Energy Information Administration (EIA)

    2003-01-01

    This resource focuses on the renewable resource of wind energy. This brief overview of wind energy explores how moving air is managed when it is formed. This resource will address such topics as (1) What is Wind?, (2) The History of Wind, (3) Windmill Mechanics, (4) Wind Machines Today, (5) Types of Windmills, (6) Wind Power Plants, (7) Wind Resources, (8) Wind Production, (9) Wind Energy Economics, (10) Wind and the Environment, and (11) the Future of Wind. Copyright 2005 International Technology Education Association

  20. Simple Machines

    NSDL National Science Digital Library

    AWOL

    2006-11-15

    This activity is designed to learn about simple machines and to have fun doing so! First, use this website to learn backround information on the basics of simple machines. Try the quiz! Simple Machines Learning Site Next, play a game that tests your ability to identify simple machines.... Edheads: Simple Machines Finally, view this video to see how students your age used applied simple machines to do a cool task... Building Simple Machines: A Glass of Milk, Please ...

  1. Chaperonin filaments: The archael cytoskeleton

    SciTech Connect

    Trent, J.D.; Kagawa, H.K.; Yaoi, Takuro; Olle, E.; Zaluzec, N.J.

    1997-08-01

    Chaperonins are multi-subunit double-ring complexed composed of 60-kDa proteins that are believed to mediate protein folding in vivo. The chaperonins in the hyperthermophilic archaeon Sulfolobus shibatae are composed of the organism`s two most abundant proteins, which represent 4% of its total protein and have an intracellular concentration of {ge} 3.0 mg/ml. At concentrations of 1.0 mg/ml, purified chaperonin proteins aggregate to form ordered filaments. Filament formation, which requires Mg{sup ++} and nucleotide binding (not hydrolysis), occurs at physiological temperatures under conditions suggesting filaments may exist in vivo. If the estimated 4,600 chaperonins per cell, formed filaments in vivo, they could create a matrix of filaments that would span the diameter of an average S. shibatae cell 100 times. Direct observations of unfixed, minimally treated cells by intermediate voltage electron microscopy (300 kV) revealed an intracellular network of filaments that resembles chaperonin filaments produced in vitro. The hypothesis that the intracellular network contains chaperonins is supported by immunogold analyses. The authors propose that chaperonin activity may be regulated in vivo by filament formation and that chaperonin filaments may serve a cytoskeleton-like function in archaea and perhaps in other prokaryotes.

  2. Intermediate Filament Diseases: Desminopathy

    PubMed Central

    Goldfarb, Lev G.; Olivé, Montse; Vicart, Patrick; Goebel, Hans H.

    2009-01-01

    Desminopathy is one of the most common intermediate filament human disorders associated with mutations in closely interacting proteins, desmin and alphaB-crystallin. The inheritance pattern in familial desminopathy is characterized as autosomal dominant or autosomal recessive, but many cases have no family history. At least some and likely most sporadic desminopathy cases are associated with de novo DES mutations. The age of disease onset and rate of progression may vary depending on the type of inheritance and location of the causative mutation. Typically, the illness presents with lower and later upper limb muscle weakness slowly spreading to involve truncal, neck-flexor, facial and bulbar muscles. Skeletal myopathy is often combined with cardiomyopathy manifested by conduction blocks, arrhythmias and chronic heart failure resulting in premature sudden death. Respiratory muscle weakness is a major complication in some patients. Sections of the affected skeletal and cardiac muscles show abnormal fibre areas containing chimeric aggregates consisting of desmin and other cytoskeletal proteins. Various DES gene mutations: point mutations, an insertion, small in-frame deletions and a larger exon-skipping deletion, have been identified in desminopathy patients. The majority of these mutations are located in conserved alpha-helical segments, but additional mutations have recently been identified in the tail domain. Filament and network assembly studies indicate that most but not all disease-causing mutations make desmin assembly-incompetent and able to disrupt a pre-existing filamentous network in dominant-negative fashion. AlphaB-crystallin serves as a chaperone for desmin preventing its aggregation under various forms of stress; mutant CRYAB causes cardiac and skeletal myopathies identical to those resulting from DES mutations. PMID:19181099

  3. The bearingless electrical machine

    NASA Astrophysics Data System (ADS)

    Bichsel, J.

    1992-05-01

    Electromagnetic bearings allow the suspension of solids. For rotary applications, the most important physical effect is the force of a magnetic circuit to a high permeable armature, called the MAXWELL force. Contrary to the commonly used MAXWELL bearings, the bearingless electrical machine will take advantage of the reaction force of a conductor carrying a current in a magnetic field. This kind of force, called Lorentz force, generates the torque in direct current, asynchronous and synchronous machines. The magnetic field, which already exists in electrical machines and helps to build up the torque, can also be used for the suspension of the rotor. Besides the normal winding of the stator, a special winding was added, which generates forces for levitation. So a radial bearing, which is integrated directly in the active part of the machine, and the motor use the laminated core simultaneously. The winding was constructed for the levitating forces in a special way so that commercially available standard ac inverters for drives can be used. Besides wholly magnetic suspended machines, there is a wide range of applications for normal drives with ball bearings. Resonances of the rotor, especially critical speeds, can be damped actively.

  4. The Bearingless Electrical Machine

    NASA Technical Reports Server (NTRS)

    Bichsel, J.

    1992-01-01

    Electromagnetic bearings allow the suspension of solids. For rotary applications, the most important physical effect is the force of a magnetic circuit to a high permeable armature, called the MAXWELL force. Contrary to the commonly used MAXWELL bearings, the bearingless electrical machine will take advantage of the reaction force of a conductor carrying a current in a magnetic field. This kind of force, called Lorentz force, generates the torque in direct current, asynchronous and synchronous machines. The magnetic field, which already exists in electrical machines and helps to build up the torque, can also be used for the suspension of the rotor. Besides the normal winding of the stator, a special winding was added, which generates forces for levitation. So a radial bearing, which is integrated directly in the active part of the machine, and the motor use the laminated core simultaneously. The winding was constructed for the levitating forces in a special way so that commercially available standard ac inverters for drives can be used. Besides wholly magnetic suspended machines, there is a wide range of applications for normal drives with ball bearings. Resonances of the rotor, especially critical speeds, can be damped actively.

  5. Wind Energy Systems.

    ERIC Educational Resources Information Center

    Conservation and Renewable Energy Inquiry and Referral Service (DOE), Silver Spring, MD.

    During the 1920s and 1930s, millions of wind energy systems were used on farms and other locations far from utility lines. However, with passage of the Rural Electrification Act in 1939, cheap electricity was brought to rural areas. After that, the use of wind machines dramatically declined. Recently, the rapid rise in fuel prices has led to a…

  6. Filament Eruptions, Jets, and Space Weather

    NASA Technical Reports Server (NTRS)

    Moore, Ronald; Sterling, Alphonse; Robe, Nick; Falconer, David; Cirtain, Jonathan

    2013-01-01

    Previously, from chromospheric H alpha and coronal X-ray movies of the Sun's polar coronal holes, it was found that nearly all coronal jets (greater than 90%) are one or the other of two roughly equally common different kinds, different in how they erupt: standard jets and blowout jets (Yamauchi et al 2004, Apl, 605, 5ll: Moore et all 2010, Apj, 720, 757). Here, from inspection of SDO/AIA He II 304 A movies of 54 polar x-ray jets observed in Hinode/XRT movies, we report, as Moore et al (2010) anticipated, that (1) most standard x-ray jets (greater than 80%) show no ejected plasma that is cool enough (T is less than or approximately 10(exp 5K) to be seen in the He II 304 A movies; (2) nearly all blownout X-ray jets (greater than 90%) show obvious ejection of such cool plasma; (3) whereas when cool plasma is ejected in standard X-ray jets, it shows no lateral expansion, the cool plasma ejected in blowout X-ray jets shows strong lateral expansion; and (4) in many blowout X-ray jets, the cool plasma ejection displays the erupting-magnetic-rope form of clasic filament eruptions and is thereby seen to be a miniature filament eruption. The XRT movies also showed most blowout X-ray jets to be larger and brighter, and hence to apparently have more energy, than most standard X-ray jets. These observations (1) confirm the dichotomy of coronal jets, (2) agree with the Shibata model for standard jets, and (3) support the conclusion of Moore et al (2010) that in blowout jets the magnetic-arch base of the jet erupts in the manner of the much larger magnetic arcades in which the core field, the field rooted along the arcade's polarity inversion line, is sheared and twisted (sigmoid), often carries a cool-plasma filament, and erupts to blowout the arcade, producing a CME. From Hinode/SOT Ca II movies of the polar limb, Sterling et al (2010, ApJ, 714, L1) found that chromospheric Type-II spicules show a dichotomy of eruption dynamics similar to that found here for the cool-plasma component of coronal X-ray jets. This favors the idea that Type-II spicules are miniature counterparts of coronal X-ray jets. In Moore et al (2011, ApJ, 731, L18), we pointed out that if Type-II spicules are magnetic eruptions that work like coronal X-ray jets, they carry an area-averaged mechanical energy flux of approximately 7x10)(exp 5) erg cm(exp -2) s(exp-1) into the corona in the form of MHD waves and jet outflow, enough to power the heating of the global corona and solar wind. On this basis, from our observations of mini-filament eruptions in blowout X-ray jets, we infer that magnetic explosions of the type that have erupting filaments in them are the main engines of both (1) the steady solar wind and (2) the CMEs that produce the most severe space weather by blasting out through the corona and solar wind, making solar energetic particle storms, and bashing the Earth's magnetosphere. We conclude that in focusing on prominences and filament eruptions, Einar had his eye on the main bet for understanding what powers all space weather, both the extreme and the normal.

  7. Predicting Noise From Wind Turbines

    NASA Technical Reports Server (NTRS)

    Grosveld, Ferdinand W.

    1990-01-01

    Computer program WINDY predicts broadband noise spectra of horizontal-axis wind-turbine generators. Enables adequate assessment of impact of broadband wind-turbine noise. Effects of turbulence, trailing-edge wakes, and bluntness taken into account. Program has practical application in design and siting of wind-turbine machines acceptable to community. Written in GW-Basic.

  8. A model of filament-wound thin cylinders

    NASA Technical Reports Server (NTRS)

    Calius, Emilio P.; Springer, George S.

    1990-01-01

    A model was developed for simulating he manufacturing process of filament-wound cylinders made of a thermoset matrix composite. The model relates the process variables (winding speed, fiber tension, applied temperature) to the parameters characterizing the composite cylinder and the mandrel. The model is applicable to cylinders for which the diameter is large compared to the wall thickness. The model was implemented by a user-friendly computer code suitable for generating numerical results.

  9. Quiet-Region Filament Eruptions

    NASA Technical Reports Server (NTRS)

    Choudhary, Debi Prasad; Moore, Ronald L.

    2004-01-01

    We report characteristics of quiescent filament eruptions that did not produce coronal mass ejections (CMEs). It is known that there is a dichotomy of quiescent filament eruptions: those that produce CMEs and those that do not. We examined the quiescent filament eruptions, each of which was located far from disk center (greater than or equal to 0.7 R(sub Sun)) in diffuse remnant magnetic fields of decayed active regions, was well observed in Ha observations and Fe XII, and had good coronagraph coverage. We present the similarity and differences of two classes of filament eruptions. From their lack of CME production and the appearance of their eruptive motion in Fe XII movies, we conclude that the non-CME-producing filament eruptions are confined eruptions like the confined filament eruptions in active regions. We take the similarity of the confined and eruptive quiescent filament eruptions with their active-region counterparts to favor runaway tether-cutting connection for unleashing the magnetic explosion in all these eruptions.

  10. Dynamics of solar eruptive filaments

    NASA Astrophysics Data System (ADS)

    Liu, Rui

    The solar filament is one of the most important structures that lead to the destabilization of the solar corona, thereby driving the space weather in t= he Earth space. The dynamics of solar eruptive filaments is crucial for us to understand the physics governing the initiation of coronal mass ejections (CMEs). In this thesis we concentrate on kinking filaments and asymmetric eruptive filaments, which feature unique dynamic evolutions with implicatio= n of distinct initiation mechanisms. Kinking filaments with their warped axes are generally regarded as the `fingerprint' of the MHD helical kink instability. Theoretical/numerical modelings of the kink instability in the solar context have raised a number of interesting issues which can only be fully addressed with detailed observational inputs. Our study on the kink evolution in a number of filame nt eruptions with a wide range of different natures provide a complete picture of how the kink instability works in the interactions of the filament with its magnetic environment. Our work has shown evidence supporting the writhing motion of the filament spine as a precursor of eruptive phenomena in the solar corona, and as a key component in regulating the nature of the eruption, in terms of full, partial or failed eruptions. The dynamic evolution of both kinking and asymmetric eruptive filaments has significant impacts on the production of hard X-ray emission. We have identified two types of asymmetric eruptive filaments: whipping-like and zipping-like, which are associated with the shifting of hard X-ray sources in different ways. Both can be understood in terms of how the highly sheared filament channel field responds to an external asymmetric magnetic confinement. In kinking filaments, our study suggests that two distinct processes take place during the kink evolution, leading to two types of HXR emission with different morphological connections to the overall magnetic configuration. Self- consistent, qualitative models are constructed in both studies. These results improve our understanding of the physical processes leading to the destabilization and eruption of solar filaments, and have significant impact on the modeling of the CME initiation and evolution.

  11. The Electron Emission from Thoriated Tungsten Filaments

    Microsoft Academic Search

    Irving Langmuir

    1923-01-01

    Electron emission from tungsten filaments containing thoria.-Ten years ago the erratic behavior of some tungsten filaments was traced to the thoria present and it was discovered that by suitable treatment the filaments, containing 1 to 2 per cent of thoria, could be activated so as to give an electron emission many thousand times that of a pure tungsten filament at

  12. Plasticity of Intermediate Filament Subunits

    E-print Network

    Kirmse, Robert

    Intermediate filaments (IFs) assembled in vitro from recombinantly expressed proteins have a diameter of 8–12 nm and can reach several micrometers in length. IFs assemble from a soluble pool of subunits, tetramers in the ...

  13. Collisions of Vortex Filament Pairs

    NASA Astrophysics Data System (ADS)

    Banica, Valeria; Faou, Erwan; Miot, Evelyne

    2014-12-01

    We consider the problem of collisions of vortex filaments for a model introduced by Klein et al. (J Fluid Mech 288:201-248, 1995) and Zakharov (Sov Phys Usp 31(7):672-674, 1988, Lect. Notes Phys 536:369-385, 1999) to describe the interaction of almost parallel vortex filaments in three-dimensional fluids. Since the results of Crow (AIAA J 8:2172-2179, 1970) examples of collisions are searched as perturbations of antiparallel translating pairs of filaments, with initial perturbations related to the unstable mode of the linearized problem; most results are numerical calculations. In this article, we first consider a related model for the evolution of pairs of filaments, and we display another type of initial perturbation leading to collision in finite time. Moreover, we give numerical evidence that it also leads to collision through the initial model. We finally study the self-similar solutions of the model.

  14. Wind energy conversion system

    DOEpatents

    Longrigg, Paul (Golden, CO)

    1987-01-01

    The wind energy conversion system includes a wind machine having a propeller connected to a generator of electric power, the propeller rotating the generator in response to force of an incident wind. The generator converts the power of the wind to electric power for use by an electric load. Circuitry for varying the duty factor of the generator output power is connected between the generator and the load to thereby alter a loading of the generator and the propeller by the electric load. Wind speed is sensed electro-optically to provide data of wind speed upwind of the propeller, to thereby permit tip speed ratio circuitry to operate the power control circuitry and thereby optimize the tip speed ratio by varying the loading of the propeller. Accordingly, the efficiency of the wind energy conversion system is maximized.

  15. Electron emitting filaments for electron discharge devices

    DOEpatents

    Leung, Ka-Ngo (Hercules, CA); Pincosy, Philip A. (Oakland, CA); Ehlers, Kenneth W. (Alamo, CA)

    1988-01-01

    Electrons are copiously emitted by a device comprising a loop-shaped filament made of lanthanum hexaboride. The filament is directly heated by an electrical current produced along the filament by a power supply connected to the terminal legs of the filament. To produce a filament, a diamond saw or the like is used to cut a slice from a bar made of lanthanum hexaboride. The diamond saw is then used to cut the slice into the shape of a loop which may be generally rectangular, U-shaped, hairpin-shaped, zigzag-shaped, or generally circular. The filaments provide high electron emission at a relatively low operating temperature, such as 1600.degree. C. To achieve uniform heating, the filament is formed with a cross section which is tapered between the opposite ends of the filament to compensate for non-uniform current distribution along the filament due to the emission of electrons from the filament.

  16. Electron emitting filaments for electron discharge devices

    DOEpatents

    Leung, K.N.; Pincosy, P.A.; Ehlers, K.W.

    1983-06-10

    Electrons are copiously emitted by a device comprising a loop-shaped filament made of lanthanum hexaboride. The filament is directly heated by an electrical current produced along the filament by a power supply connected to the terminal legs of the filament. To produce a filament, a diamond saw or the like is used to cut a slice from a bar made of lanthanum hexaboride. The diamond saw is then used to cut the slice into the shape of a loop which may be generally rectangular, U-shaped, hairpin-shaped, zigzag-shaped, or generally circular. The filaments provide high electron emission at a relatively low operating temperature, such as 1600/sup 0/C. To achieve uniform heating, the filament is formed with a cross section which is tapered between the opposite ends of the filament to compensate for nonuniform current distribution along the filament due to the emission of electrons from the filament.

  17. Intermediate filaments in nervous tissues

    Microsoft Academic Search

    RONALD K. H. LIEM; SHU-HUI YEN; GARY D. SALOMON; MICHAEL L. SHELANSKI

    1978-01-01

    Intermediate filaments have been isolated from rabbit intradural spinal nerve roots by the axonal flotation method. This method was modified to avoid exposure of axons to low ionic strength medium. The purified filaments are morphologically 75-80% pure. The gel electrophoretogr am shows four major bands migrating at 200,000, 145,000, 68,000, and 60,000 daltons, respectively. A similar preparation from rabbit brain

  18. MACHINE CONTEST MACHINE VOLUME WORKSHEET

    E-print Network

    Yener, Aylin

    MACHINE CONTEST® MACHINE VOLUME WORKSHEET Note: Each square is 1' x 1' (0.3 m x 0.3 m) (Official the footprint of your machine NOTE: If any part of the machine falls within a square, you must count the entire: _______________ (choose one: ft2 or m2 ) STEP 3: Measure the height of your machine. NOTE: The maximum height is 8' (2.4 m

  19. Galaxy filaments as pearl necklaces

    NASA Astrophysics Data System (ADS)

    Tempel, E.; Kipper, R.; Saar, E.; Bussov, M.; Hektor, A.; Pelt, J.

    2014-12-01

    Context. Galaxies in the Universe form chains (filaments) that connect groups and clusters of galaxies. The filamentary network includes nearly half of the galaxies and is visually the most striking feature in cosmological maps. Aims: We study the distribution of galaxies along the filamentary network, trying to find specific patterns and regularities. Methods: Galaxy filaments are defined by the Bisous model, a marked point process with interactions. We use the two-point correlation function and the Rayleigh Z-squared statistic to study how galaxies and galaxy groups are distributed along the filaments. Results: We show that galaxies and groups are not uniformly distributed along filaments, but tend to form a regular pattern. The characteristic length of the pattern is around 7 h-1 Mpc. A slightly smaller characteristic length 4 h-1 Mpc can also be found, using the Z-squared statistic. Conclusions: We find that galaxy filaments in the Universe are like pearl necklaces, where the pearls are galaxy groups distributed more or less regularly along the filaments. We propose that this well-defined characteristic scale could be used to test various cosmological models and to probe environmental effects on the formation and evolution of galaxies. Appendices are available in electronic form at http://www.aanda.org

  20. Simple Machines

    NSDL National Science Digital Library

    At this website, EdHeads, a nonprofit, offers five interactive, animated modules to educate second- through sixth-graders about simple machines. By identifying the many machines located throughout a house, students can learn about fulcrums, wheel and axles, levers, pulleys, inclined planes, and much more. The website is equipped with simple animations to help children understand how the machines work. After students have a handle on simple machines, they can begin to see how they work together to create compound machines. The website also provides a brief glossary summarizing nine types of simple machines. This site is also reviewed in the February 18, 2005_NSDL Physical Sciences Report_.

  1. Fatigue testing of low-cost fiberglass composite wind turbine blade materials

    NASA Technical Reports Server (NTRS)

    Hofer, K. E.; Bennett, L. C.

    1981-01-01

    The static and fatigue behavior of transverse filament tape (TFT) fiberglass/epoxy and TFT/polyester composites was established by the testing of specimens cut from panels fabricated by a filament winding process used for the construction of large experimental wind turbine blades.

  2. Kid Machine

    NSDL National Science Digital Library

    2012-06-26

    This activity is on page 3 (continued on page 2) of the pdf, part of the Simple Machines Discovery Box. In this fun activity, learners "create" a complex machine by simulating the parts in action. Learners move their bodies and make sounds as if they are individual parts of a moving machine. Then learners discover what happens when part of a machine is broken and problem solve ways to fix it.

  3. SIMPLE MACHINES

    NSDL National Science Digital Library

    Mrs. MacHose

    2007-03-10

    You will be learning about several types of simple machines. Have fun!! Review the first website (which is right here!! Simple machines) . It has information about simple machines. DON\\"T click until you read all directions!!! Prepare to discuss each type in class. You will need to take some basic notes about each machine, using a bubble-map format. Don\\'t forget ...

  4. Sewing Machines!!

    NSDL National Science Digital Library

    Miss. Walker

    2008-10-20

    Learn the Parts of a Sewing Machine This should help you understand the history of sewing machines and how they work. For this assignment, answer these questions on a sheet of paper and bring it to class. Click on this link to go to a site which will briefly explain the history of the sewing machine: wikipedia Was ...

  5. Electrostatic Machines

    NSDL National Science Digital Library

    De Queiroz, Antonio Carlos M.

    This website from Antonio Carlos M. De Queiroz, an associate professor at the Federal University of Rio de Janeiro, illustrates a number of different electrostatic machines. The site includes details and images of machines built by the professor as well as many other historical machines of this type. Some information is also available in Portugese.

  6. Simple Machines

    NSDL National Science Digital Library

    2012-08-03

    This is a lesson about simple machines and how they relate to robots. Learners will gain an understanding of simple machines and how they may be used in our everyday lives. Students will also have an opportunity to design a Rube Goldberg Machine of their own. This is lesson 10 of 16 in the MarsBots learning module.

  7. Simple Machines

    NSDL National Science Digital Library

    COSI

    2000-01-01

    This is an online activity about simple machines. Learners will try their hand at putting these amazing devices to work. They will use several simple machines to help "build" a tree house. This is an excellent activity to demonstrate how science - in particular, simple machines - are at work in our everyday lives.

  8. Visualization of dynamic simulations of muscle thin filaments.

    PubMed

    Zou, G; Gorry, G A; Phillips, G N

    1995-04-01

    Following a novel computational formalism, the thin filament of muscle can be modeled by a computational machine containing a large number of finite automata that have one-to-one correspondence with the constituent protein molecules. Computer graphics can be used to visualize the correspondence between the states of finite automata and the configurations of protein molecules according to the structural data. The dynamic simulation of the muscle filament that corresponds to the concurrent state transitions of finite automata can be represented as a sequence of video images. The kinetic and structural knowledge of individual protein molecules is, therefore, integrated into a coherent and functional system. This type of computation and visualization can also be useful for the investigation of molecular structure, function, and interaction in various complex biological systems. PMID:7619786

  9. Quantification of biopolymer filament structure.

    PubMed

    Shah, Samir A; Santago, Pete; Rubin, Bruce K

    2005-10-01

    The quantitative analysis of a polymer network is important for understanding its role in biological function. We developed a Matlab program to recognize and segment filaments in a 2-D image, and measure and describe the structure. Our algorithm improved the speed of the Lichtenstein Fiberscore segmentation algorithm by using matrix convolutions, compared filament length by the algorithms of Kulpa, Lichtenstein, and Kimura, and measured the number of branchpoints and Euler number. A user interface was added to easily manipulate algorithm parameters, select images, and visualize results. We used the program to compare the DNA biopolymer network of cystic fibrosis (CF) sputum with mucus from patients without respiratory problems. We also examined an image of fibrin. The images were taken with a laser scanning confocal microscope after staining the specimens with Yo-Yo-1. Computation using matrix convolutions reduced the execution time (Pentium III) of a 512 x 512 TIF image from 18 min to 15s. The Kimura length estimation appeared best at describing filament length because it varied least with filament orientation. The image of CF sputum showed increased filament length, more branchpoints, and more negative Euler number compared to the normal sample. These quantitative descriptions of the network can be correlated to material, mechanical, diffusion, or flow properties, physiological processes, or therapy. PMID:15961231

  10. Mapping a nearby galaxy filament

    NASA Astrophysics Data System (ADS)

    Wakker, Bart

    2010-09-01

    Most of the baryons {90%} are in the intergalactic medium {IGM}. Observationally, about 1/3rd of the IGM consists of photoionized hydrogen, which produces narrow Ly-alpha absorption lines. The remainder is predicted to be at temperatures >10^5 K, forming the WHIM; some of that gas produces broad Ly-alpha and OVI absorption. About half of the Ly-alpha lines originate within 400 kpc of galaxies {Wakker & Savage 2009}. The relationship of the more isolated absorbers to galaxies and galaxy filaments is still unclear. We have identified a 10 Mpc long galaxy filament, toward which 4 QSOs have already been observed, showing evidence for broad Ly-alpha and OVI lines in the galaxy environments. We propose to observe an additional 23 AGNs projected on and next to this filament to study {1} the extent of the Ly-alpha producing gas, {2} whether broad lines {some of which trace the WHIM} are only seen inside the filament or also outside, and {3} the relative velocities of the intergalactic gas and the galaxies in the filament.

  11. An experimental 100 kilowatt wind turbine generator

    NASA Technical Reports Server (NTRS)

    Thomas, R. L.; Puthoff, R. L.; Savino, J. M.; Johnson, W. R.

    1975-01-01

    Experimental generator consists of two blades mounted on 100 foot tower, driving transmission train and electric generator mounted on top of tower. Machine generates 100 kW of electricity at wind speeds from 18 to 60 miles per hour. Yaw control mechanism automatically orients machine into wind.

  12. Development of Nylon Based FDM Filament for Rapid Tooling Application

    NASA Astrophysics Data System (ADS)

    Singh, R.; Singh, S.

    2014-04-01

    There has been critical need for development of cost effective nylon based wire to be used as feed stock filament for fused deposition modelling (FDM) machine. But hitherto, very less work has been reported for development of alternate solution of acrylonitrile butadiene styrene (ABS) based wire which is presently used in most of FDM machines. The present research work is focused on development of nylon based wire as an alternative of ABS wire (which is to be used as feedstock filament on FDM) without changing any hardware or software of machine. For the present study aluminium oxide (Al2O3) as additive in different proportion has been used with nylon fibre. Single screw extruder was used for wire preparation and wire thus produced was tested on FDM. Mechanical properties i.e. tensile strength and percentage elongation of finally developed wire have been optimized by Taguchi L9 technique. The work represented major development in reducing cost and time in rapid tooling applications.

  13. Lighting the Universe with filaments

    E-print Network

    Liang Gao; Tom Theuns

    2007-09-13

    The first stars in the Universe form when chemically pristine gas heats as it falls into dark matter potential wells, cools radiatively due to the formation of molecular hydrogen, and becomes self-gravitating. We demonstrate with super-computer simulations that their properties depend critically on the currently unknown nature of the dark matter. If the dark matter particles have intrinsic velocities that wipe-out small-scale structure, then the first stars form in filaments with lengths of order the free-streaming scale, which can be about 10^20m (~3kpc, baryonic masses 10^7 solar masses) for realistic "warm dark matter" candidates. Fragmentation of the filaments forms stars with a range of masses which may explain the observed peculiar element abundance pattern of extremely metal-poor stars, while coalescence of fragments and stars during the filament's ultimate collapse may seed the super massive black holes that lurk in the centres of most massive galaxies.

  14. Coiling of a viscous filament

    NASA Astrophysics Data System (ADS)

    Samuel, A. D. T.; Ryu, W. S.; Mahadevan, L.

    1997-11-01

    A classic demonstration of fluid buckling is a daily occurence at the breakfast table, where a continuous stream of viscous fluid (honey) is often poured onto a flat surface (toast) from a sufficient height. The thin fluid filament quickly settles into a steady state; near the surface it bends into a helical shape while simultaneously rotating about the vertical and is laid out in a regular coil. This behavior is reminiscent of the coiling of a falling flexible rope. We derive a simple scaling law that predicts the coiling frequency in terms of the filament radius and the flow rate. We also verify this scaling law with the results of experiments.

  15. Nonequilibrium transport in superconducting filaments

    SciTech Connect

    Arutyunov, K.YU.; Danilova, N.P.; Nikolaeva, A.A. [Academy of Sciences of the Moldavian SSR, Kishinev (Russian Federation)

    1995-04-01

    The step-like current-voltage characteristics of highly homogeneous single-crystalline tin and indium thin filaments has been measured. The length of the samples L approximately 1 cm was much greater than the nonequilibrium quasiparticle relaxation length Lambda. It was found that the activation of a successive i-th voltage step occurs at current significantly greater than the one derived with the assumption that the phase slip centers are weakly interacting on a scale L much greater than Lambda. The observation of `subharmonic` fine structure on the voltage-current characteristics of tin filaments confirms the hypothesis of the long-range phase slip centers interaction.

  16. Nonequilibrium transport in superconducting filaments

    NASA Technical Reports Server (NTRS)

    Arutyunov, K. YU.; Danilova, N. P.; Nikolaeva, A. A.

    1995-01-01

    The step-like current-voltage characteristics of highly homogeneous single-crystalline tin and indium thin filaments has been measured. The length of the samples L approximately 1 cm was much greater than the nonequilibrium quasiparticle relaxation length Lambda. It was found that the activation of a successive i-th voltage step occurs at current significantly greater than the one derived with the assumption that the phase slip centers are weakly interacting on a scale L much greater than Lambda. The observation of 'subharmonic' fine structure on the voltage-current characteristics of tin filaments confirms the hypothesis of the long-range phase slip centers interaction.

  17. Wind Fins: Novel Lower-Cost Wind Power System

    SciTech Connect

    David C. Morris; Dr. Will D. Swearingen

    2007-10-08

    This project evaluated the technical feasibility of converting energy from the wind with a novel “wind fin” approach. This patent-pending technology has three major components: (1) a mast, (2) a vertical, hinged wind structure or fin, and (3) a power takeoff system. The wing structure responds to the wind with an oscillating motion, generating power. The overall project goal was to determine the basic technical feasibility of the wind fin technology. Specific objectives were the following: (1) to determine the wind energy-conversion performance of the wind fin and the degree to which its performance could be enhanced through basic design improvements; (2) to determine how best to design the wind fin system to survive extreme winds; (3) to determine the cost-effectiveness of the best wind fin designs compared to state-of-the-art wind turbines; and (4) to develop conclusions about the overall technical feasibility of the wind fin system. Project work involved extensive computer modeling, wind-tunnel testing with small models, and testing of bench-scale models in a wind tunnel and outdoors in the wind. This project determined that the wind fin approach is technically feasible and likely to be commercially viable. Project results suggest that this new technology has the potential to harvest wind energy at approximately half the system cost of wind turbines in the 10kW range. Overall, the project demonstrated that the wind fin technology has the potential to increase the economic viability of small wind-power generation. In addition, it has the potential to eliminate lethality to birds and bats, overcome public objections to the aesthetics of wind-power machines, and significantly expand wind-power’s contribution to the national energy supply.

  18. Wind Energy Conversion Using a Self-Excited Induction Generator

    Microsoft Academic Search

    G. Raina; O. P. Malik

    1983-01-01

    A wind energy conversion scheme using an induction machine driven by a variable speed wind turbine is described. Excitation control has been obtained by employing a single value capacitor and thyristor controlled inductor. Wind speed cube law is proposed to be followed in loading the induction machine for maximising energy conversion. Performance characteristics of the generation scheme have been evaluated

  19. Low cost composite blades for large wind turbines

    Microsoft Academic Search

    O. Weingart

    1980-01-01

    The TFT process developed to fabricate a filament-wound spar for a composite wind turbine blade is discussed, as well as the preliminary design review for the rotor blade and plans for a 4 kW small wind energy conversion system. The TFT process utilizes a low cost E-glass fabric called transverse-filament tape, in which the major reinforcing fibers are transverse to

  20. Studies on the dynamics of limited filaments

    E-print Network

    Bonde, Jeffrey David

    2010-01-01

    A study on the dynamics of filaments in the presence of a diagnostic, conductive limiter is presented. Plasma filaments are coherent structures present in many fusion devices and transport a significant amount of particles ...

  1. The Fluid Foil: The Seventh Simple Machine

    ERIC Educational Resources Information Center

    Mitts, Charles R.

    2012-01-01

    A simple machine does one of two things: create a mechanical advantage (lever) or change the direction of an applied force (pulley). Fluid foils are unique among simple machines because they not only change the direction of an applied force (wheel and axle); they convert fluid energy into mechanical energy (wind and Kaplan turbines) or vice versa,…

  2. Enertech 2kW high-reliability wind system. Phase II. Fabrication and testing

    Microsoft Academic Search

    J. A. Cordes; B. A. Johnson

    1981-01-01

    A high-reliability wind machine rated for 2 kW in a 9 m\\/s wind has been developed. Activities are summarized that are centered on the fabrication and testing of prototypes of the wind machine. The test results verified that the wind machine met the power output specification and that the variable-pitch rotor effectively controlled the rotor speed for wind speeds up

  3. Compressor Case Made With Filaments Wound With V-CAP Resin

    NASA Technical Reports Server (NTRS)

    Vannucci, Raymond; Sutter, James; Humphrey, W. Donald; Ayorinde, A. John; Eaton, Jeremy; Westerman, Ted; Allred, Ron

    1996-01-01

    Laminated cylindrical composite-material compressor case fabricated in process that includes winding of filaments wetted with matrix resins. Prototype of light-weight composite compressor cases required to withstand internal temperatures as high as 700 degrees F. Candidates for replacing titanium compressor cases in high-temperature turbines. Weights and costs reduced.

  4. The Length of the Filamentous Pseudomonas aeruginosa

    Microsoft Academic Search

    Bacteriophage Pf

    1973-01-01

    SUMMARY The length of the Pseudomonas aeruginosa filamentous bacteriophage Pf was found to be 1915 +77 nm, as measured in the electron microscope using the Kleinschmidt spreading technique. Pf is thus the longest filamentous phage so far isolated. Coliphage If, the I-specific filamentous phage, is nearest to it with a length of I3OO nm. Bacteriophage Pf, which is the only

  5. Vapor-grown atomic filaments of graphite

    Microsoft Academic Search

    F. Okuyama; T. Hayashi; M. Kawasaki; K. Ibe

    2000-01-01

    Field emission transmission electron microscopy has revealed the presence of atomic filaments extending from the open edge of a graphite cage formed in a glow-discharge plasma. The filaments are vapor grown, presenting complicated deformations such as curling, waving, and looping in the free space. The filaments correspond well to one carbon atom in diameter, strongly indicating that they are linear

  6. : Helmholtz machine estimation .

    E-print Network

    : Helmholtz machine density estimation . . : . . . (supervised learning) , (active learning) (query learning) [1, 3]. . (unsupervised learning), . , [5]. . Helmholtz machine , . Helmholtz machine : Helmholtz machine [2] . Helmholtz machine (generative network) (recognition network) . , , . Helmholtz machine (self

  7. Rotating electric machine with fluid supported parts

    DOEpatents

    Smith, Jr., Joseph L. (Concord, MA); Kirtley, Jr., James L. (Brookline, MA)

    1981-01-01

    A rotating electric machine in which the armature winding thereof and other parts are supported by a liquid to withstand the mechanical stresses applied during transient overloads and the like. In particular, a narrow gap is provided between the armature winding and the stator which supports it and this gap is filled with an externally pressurized viscous liquid. The liquid is externally pressurized sufficiently to balance the static loads on the armature winding. Transient mechanical loads which deform the armature winding alter the gap dimensions and thereby additionally pressurize the viscous liquid to oppose the armature winding deformation and more nearly uniformly to distribute the resulting mechanical stresses.

  8. Precision Machining

    NSDL National Science Digital Library

    Leske, Cavin.

    Basic machining processes are introduced on a Web site that is devoted to engineering fundamentals (1). Descriptions and illustrations of drilling, turning, grinding, and other common processes are provided for people with little to no prior machining knowledge. A waterjet is a non-traditional machining technology that uses high pressure streams of water with abrasive additives rather than solid cutting instruments to slice through metal and other materials. An in-depth discussion of waterjet operation and applications is available from Southern Methodist University (2). Waterjets are often cited as being much more precise than traditional machining techniques. The Waterjet Video Vault (3) contains clips of waterjet machines in action. The video of the foam cutting procedure is especially interesting, as it shows how quick and accurate the machining process can be. An online guide to cross process machining, which incorporates elements from various conventional and unconventional techniques, is provided by the Mechanical Engineering Department at Columbia University (4). Some remarkable and innovative techniques that have surfaced over the past few years are outlined, including underwater laser machining and plasma-assisted machining. Entirely different and exotic machining techniques are required for creating microelectromechanical systems (MEMS) and other extremely small devices. The Caltech Micromachining Laboratory (5) maintains an archive of research highlights and papers on its homepage, including a paper on a MEMS-driven flapping wing for a palm-sized aerial vehicle. An online article from Modern Machine Shop (6) outlines some new technologies and research in the area of high speed machining. A particularly interesting section of the article describes a system developed at the University of Florida that aims to enable micromachining to achieve rotational speeds of standard machining processes, specifically up to a half million rotations per minute. Cutting edge waterjet innovations are the subject of a February 2003 feature from a publication of the Society of Manufacturing Engineers (7). Extremely high pressure nozzles are being developed to improve cutting speed, and enhanced software for controlling machine movements is also a focus of study. This news article (8) from June 20, 2003 describes an electrochemical machining process that is being used to fabricate complex nanostructures. The work, produced by German and U.S. researchers, has the potential to compete with current lithographic processes.

  9. Design, fabrication, and test of a composite material wind turbine rotor blade

    NASA Technical Reports Server (NTRS)

    Griffee, D. G., Jr.; Gustafson, R. E.; More, E. R.

    1977-01-01

    The aerodynamic design, structural design, fabrication, and structural testing is described for a 60 foot long filament wound, fiberglass/epoxy resin matrix wind turbine rotor blade for a 125 foot diameter, 100 kW wind energy conversion system. One blade was fabricated which met all aerodynamic shape requirements and was structurally capable of operating under all specified design conditions. The feasibility of filament winding large rotor blades was demonstrated.

  10. Machine intelligence

    Microsoft Academic Search

    Alex S. Taylor

    2009-01-01

    Under certain conditions, we appear willing to see and interact with computing machines as though they exhibited intelligence, at least an intelligence of sorts. Using exam- ples from AI and robotics research, as well as a selection of relevant art installations and anthropological fieldwork, this paper reflects on some of our interactions with the kinds of machines we seem ready

  11. Simple Machines

    NSDL National Science Digital Library

    Integrated Teaching and Learning Program,

    Through a five-lesson series with five activities, students are introduced to six simple machines—inclined plane, wedge, screw, lever, pulley, wheel-and-axle—as well as compound machines, which are combinations of two or more simple machines. Once students understand about work (work = force x distance), they become familiar with the machines' mechanical advantages, and see how they make work easier. Through an introduction to compound machines, students begin to think critically about machine inventions and their pervasive roles in our lives. After learning about Rube Goldberg contraptions—absurd inventions that complete simple tasks in complicated ways—they evaluate the importance and usefulness of the many machines around them. Through the hands-on activities, students draw designs for contraptions that could move a circus elephant into a rail car, create a construction site ramp design by measuring different inclined planes and calculating the ideal vs. actual mechanical advantage of each, compare the theoretical and actual mechanical advantages of different pulley systems conceived to save a whale, build and test grape catapults made with popsicle sticks and rubber bands, and follow the steps of the engineering design process to design and build Rube Goldberg machines.

  12. Simple Machines

    NSDL National Science Digital Library

    KET

    2010-11-16

    How do you get a glove and a ball up to your tree house? One answer is to use a pulley. A pulley is a simple machine. In this original KET interactive, children learn about the basic workings of three simple machines.

  13. Electric machine

    DOEpatents

    El-Refaie, Ayman Mohamed Fawzi (Niskayuna, NY); Reddy, Patel Bhageerath (Madison, WI)

    2012-07-17

    An interior permanent magnet electric machine is disclosed. The interior permanent magnet electric machine comprises a rotor comprising a plurality of radially placed magnets each having a proximal end and a distal end, wherein each magnet comprises a plurality of magnetic segments and at least one magnetic segment towards the distal end comprises a high resistivity magnetic material.

  14. Galaxy pairs align with Galactic filaments

    NASA Astrophysics Data System (ADS)

    Tempel, E.; Tamm, A.

    2015-04-01

    Context. Gravitational collapse theory and numerical simulations suggest that the velocity field within large-scale galaxy filaments is dominated by motions along the filaments. Aims: Our aim is to check whether observational data reveal any preferred orientation of galaxy pairs with respect to the underlying filaments as a result of the expectedly anisotropic velocity field. Methods: We use galaxy pairs and galaxy filaments identified from Sloan Digital Sky Survey data. For filament extraction, we use the Bisous model that is based on the marked point process technique. During the filament detection, we use the centre point of each pair instead of the positions of galaxies to avoid a built-in influence of pair orientation on the filament construction. For pairs lying within filaments (3012 cases), we calculate the angle between the line connecting the galaxies of each pair and their host filaments. To avoid redshift-space distortions, the angle is measured in the plane of the sky. Results: The alignment analysis shows that the orientation of galaxy pairs correlates strongly with their host filaments. The alignment signal is stronger for loose pairs, with at least 25% excess of aligned pairs compared to a random distribution. The alignment of galaxy pairs and filaments measured from the observational data is in good agreement with the alignment in the Millennium simulation and thus provides support to the ?CDM formalism.

  15. Stator-permanent magnet brushless machines: Concepts, developments and applications

    Microsoft Academic Search

    Ming Cheng; Wei Hua; Xiaoyong Zhu; Xiangxin Kong; Jianzhong Zhang; Wenxiang Zhao

    2008-01-01

    This paper reviews the concepts, developments and applications of the novel permanent magnet brushless machines having magnets and windings in the stator with particular emphasis on operation principles, electromagnetic performance, design and control aspects. The key features of the machines are summarized. Moreover, the recent development and emerging research directions of the machines are also discussed.

  16. Calculating machines

    NSDL National Science Digital Library

    This website created by Erez Kaplan "deals mainly with the mechanical calculating machines from a collector's point of view." Included here is an historical review of calculating machines, along with Kaplan's attempt to classify the machines, a collection of old advertisements for the machines, and a brief history of calculating. The latest feature is a Java applet that lets you operate an 1885 Felt adding machine to give you a sense of the way it was used. The photos and descriptions provide insight on other gadgets such as the Pocket Cash Registers used by "the sophisticated man or woman of 1900 who had everything." The Reference section provides some resources for further reading, including numerous other personal calculator collectors sites and museums.

  17. UNUSUAL FILAMENTS INSIDE THE UMBRA

    SciTech Connect

    Kleint, L. [High Altitude Observatory/NCAR, P.O. Box 3000, Boulder, CO 80307 (United States); Sainz Dalda, A., E-mail: kleintl@ucar.edu [Stanford-Lockheed Institute for Space Research, Stanford University, HEPL, 466 Via Ortega, Stanford, CA 94305 (United States)

    2013-06-10

    We analyze several unusual filamentary structures which appeared in the umbra of one of the sunspots in AR 11302. They do not resemble typical light bridges in morphology or in evolution. We analyze data from SDO/HMI to investigate their temporal evolution, Hinode/SP for photospheric inversions, IBIS for chromospheric imaging, and SDO/AIA for the overlying corona. Photospheric inversions reveal a horizontal, inverse Evershed flow along these structures, which we call umbral filaments. Chromospheric images show brightenings and energy dissipation, while coronal images indicate that bright coronal loops seem to end in these umbral filaments. These rapidly evolving features do not seem to be common, and are possibly related to the high flare-productivity of the active region. Their analysis could help to understand the complex evolution of active regions.

  18. Filament wound rocket motor chambers

    NASA Technical Reports Server (NTRS)

    1976-01-01

    The design, analysis, fabrication and testing of a Kevlar-49/HBRF-55A filament wound chamber is reported. The chamber was fabricated and successfully tested to 80% of the design burst pressure. Results of the data reduction and analysis from the hydrotest indicate that the chamber design and fabrication techniques used for the chamber were adequate and the chamber should perform adequately in a static test.

  19. Mechanics of vimentin intermediate filaments

    NASA Technical Reports Server (NTRS)

    Wang, Ning; Stamenovic, Dimitrijie

    2002-01-01

    It is increasingly evident that the cytoskeleton of living cells plays important roles in mechanical and biological functions of the cells. Here we focus on the contribution of intermediate filaments (IFs) to the mechanical behaviors of living cells. Vimentin, a major structural component of IFs in many cell types, is shown to play an important role in vital mechanical and biological functions such as cell contractility, migration, stiffness, stiffening, and proliferation.

  20. The Geography of Wind Energy: Problem Solving Activities.

    ERIC Educational Resources Information Center

    Lahart, David E.; Allen, Rodney F.

    1985-01-01

    Today there are many attempts to use wind machines to confront the increasing costs of electricity. Described are activities to help secondary students understand wind energy, its distribution, applications, and limitations. (RM)

  1. An Unusual System of HI Filaments near WR 5 and HD 17603

    E-print Network

    Lewis B. G. Knee; Bradley J. Wallace; Magdalen Normandeau

    2005-05-18

    We report the discovery of a system of unusual HI filaments which appear to be associated with molecular clouds in the Perseus spiral arm of our Galaxy. We investigate the hypothesis that this system is the result of a directed flow of dissociated gas from clouds trapped within an extended wind flow from massive stars. The Wolf-Rayet star WR 5 and the OIb(f) star HD 17603 are identified as candidate driving sources. However, an examination of this hypothesis within the context of the theory of mass-loaded winds shows that these two stars alone cannot account for the energetics and kinematics of the required spherically symmetric wind flow. Unless the apparent association between HI, molecular gas, and stars is an accidental one, we suggest that other as-yet unidentified stars must have contributed to driving the filaments.

  2. Generalization of Filament Braiding Model for Amyloid Fibril Assembly

    NASA Astrophysics Data System (ADS)

    Pope, Maighdlin; Ionescu-Zanetti, Cristian; Khurana, Ritu; Carter, Sue

    2001-03-01

    Research into the formation of amyloid fibrils is motivated by their association with several prominent diseases, among these Alzheimer's Disease, Parkinson's Disease and amyloidosis. Previous work in monitering the aggregation of immunoglobulin light chains to form amyloid fibrils suggests a braided structure where filaments and protofibrils wind together to form Type I and Type II fibrils. Non-contact atomic force microscopy is used to image and explore the kinetics of several other amyloid fibril forming proteins in an effort to generalize the filament braiding model. Included in this study are insulin and the B1 domain of G. Both of these have been shown to form fibrils in vitro. Alpha-synuclein is also included in this study. It is involved in the formation of Lewy bodies in Parkinson's Disease. The fourth protein used in this comparitive study is human amylin that is the cause of a systemic amyloidosis. Results from these four proteins and their associated fibrils are compared to the Ig light chain fibril structure in an effort to show the universality of the filament braiding model.

  3. Design optimization of small wind turbines for low wind regimes

    NASA Astrophysics Data System (ADS)

    Cromack, D. E.; Oscar, D.

    1984-08-01

    Attention is given to two examples illustrating the design optimization process for small wind turbines, which is concerned with machine parameters and the wind characteristics and electrical loads of the intended operating environment. The optimization process emphasizes the importance of rated wind speed, rotor rpm, generator size, and rotor blade characteristics. Wind turbines are noted to have been designed for excessively high wind speeds and generator capacities in the past; machines intended for residential use should instead be scaled to closely match the expected load and should be rated at a windspeed close to the value of the greatest energy contribution. Simplicity of design is noted to yield reduced costs and lower maintenance requirements while increasing reliability.

  4. Diagnosis of femtosecond plasma filament by channeling microwaves along the filament

    NASA Astrophysics Data System (ADS)

    Alshershby, Mostafa; Ren, Yu; Qin, Jiang; Hao, Zuoqiang; Lin, Jingquan

    2013-05-01

    We introduce a simple, fast, and non-intrusive experimental method to obtain the basic parameters of femtosecond laser-generated plasma filament. The method is based on the channeling of microwaves along both a plasma filament and a well-defined conducting wire. By comparing the detected microwaves that propagate along the plasma filament and a copper wire with known conductivity and spatial dimension, the basic parameters of the plasma filament can be easily obtained. As a result of the possibility of channeling microwave radiation along the plasma filament, we were then able to obtain the plasma density distribution along the filament length.

  5. Scribbling Machines

    NSDL National Science Digital Library

    Exploratorium

    2013-01-30

    In this activity, learners explore electronics and motion by making a Scribbling Machine, a motorized contraption that moves in unusual ways and leaves a mark to trace its path. It’s made from simple materials and is based on the idea of motion created by an offset motor. Try using harvested motors and switches from discarded toys and electronics to make your Scribbling Machine - this not only keeps costs down, but is a playful and inventive way to explore how everyday objects work. To take the activity further, you can also incorporate PicoCrickets to make your Scribbling Machine more intelligent and to explore computers.

  6. Response of a flexible filament in a flowing soap film subject to a forced vibration

    NASA Astrophysics Data System (ADS)

    Jia, Laibing; Xiao, Qing; Wu, Haijun; Wu, Yanfeng; Yin, Xiezhen

    2015-01-01

    The interactions between flexible plates and fluids are important physical phenomena. A flag in wind is one of the most simplified and classical models for studying the problem. In this paper, we investigated the response of a flag in flow with an externally forced vibration by using flexible filaments and soap film. Experiments show that for a filament that is either in oscillation or stationary, the external forced vibration leads to its oscillation. A synchronization phenomenon occurs in the experiments. A small perturbation leads to a large response of flapping amplitude in response. The insight provided here is helpful to the applications in the flow control, energy harvesting, and bionic propulsion areas.

  7. Math Machines

    NSDL National Science Digital Library

    The mission of the Math Machines organization is to "improve the quality of mathematical education, enhance the transfer of mathematical thinking into other classes, and increase students' ability to apply rigorous mathematics outside the classroom." Their website supports a National Science Foundation ATE grant-supported project designed to improve teaching in the areas of Mathematics, Science, and Technology at the high school and college levels. This improved learning results from using math, science, and technology principles to build and control various machines such as pointers and robots or "math machines", which are simple devices that provide an immediate, physical, dynamic expression to abstract mathematical equations. The website provides information links on Educational Theory, Classroom Activities, Project Workshops, Calculators & Programs, and Machine Construction Instructions for Building: Closed Circuits, Servo Motors, Controllers, Robot Boards and more. There is also contact information, an FAQ section, as well as upcoming events.

  8. Simple Machines

    NSDL National Science Digital Library

    This series of three interactive, multimedia activities introduce and demonstrate the properties of six simple machines. Specifically, the lessons show how levers, pulleys, inclined planes, screws, wheels and axles, and wedges can reduce the amount of work done by humans. After learning about the characteristics of each classification, users can try to find the simple machines that make up a lawn mower. By inspecting the mower from different angles, several simple machines are revealed and must be identified. The final activity lets users test their knowledge of the mechanics of simple machines. Following a builder through each stage of constructing a tree house, users can apply equations to determine the mechanical advantage supplied by using the tools.

  9. Machine therapy

    E-print Network

    Dobson, Kelly E. (Kelly Elizabeth), 1970-

    2007-01-01

    Machine Therapy is a new practice combining art, design, psychoanalysis, and engineering work in ways that access and reveal the vital, though often unnoticed, relevance of people's interactions and relationships with ...

  10. Design of the Wind Eagle Turbine

    SciTech Connect

    Carter, J. Sr. [Wind Eagle Corporation, Wichita Falls, TX (United States).

    1995-09-01

    The Wind Eagle Turbine has many design features that contribute to a simple, lightweight, low cost and rugged wind machine. It is a down wind, two bladed, rigid hub, free yaw and free pitch machine with full span blade pitch control. Most of the wind community are unaware of the advantages that are inherent in the Wind Eagle concept. It is the intent of this oral presentation to point out and discuss the features of this design so there is a better understanding of this very cost effective machine. Some parts of the Wind Eagle Turbine to be covered include: main spar, spar and blade connection, fiberglass blade, yaw bearing, tower, low speed shaft and shut down.

  11. Prominence Seismology: Wavelet Analysis of Filament Oscillations

    NASA Astrophysics Data System (ADS)

    Pintér, Balázs; Jain, Rekha; Tripathi, Durgesh; Isobe, Hiroaki

    2008-06-01

    The temporal and spatial behavior of a large-amplitude filament oscillation is investigated using wavelet analysis. The extreme-ultraviolet (EUV) images of the phenomenon, which occurred on 2002 October 15, were taken from the EUV Imaging Telescope on board the Solar and Heliospheric Observatory (SOHO). The wavelet spectra, extracted from the intensity data, show that the filament oscillates as a rigid body, with a period of about 2.5-2.6 hr which is almost constant along the filament. The period slowly decreases with time until the filament erupts. No clear sign of the eruption is found in the wavelet spectrum prior to the eruption, that followed the filament oscillation. The axial component of the magnetic field is estimated between 1 and 5 G, which is believed to be reasonable for a polar crown filament of this kind.

  12. Femtosecond Laser Filamentation for Atmospheric Sensing

    PubMed Central

    Xu, Huai Liang; Chin, See Leang

    2011-01-01

    Powerful femtosecond laser pulses propagating in transparent materials result in the formation of self-guided structures called filaments. Such filamentation in air can be controlled to occur at a distance as far as a few kilometers, making it ideally suited for remote sensing of pollutants in the atmosphere. On the one hand, the high intensity inside the filaments can induce the fragmentation of all matters in the path of filaments, resulting in the emission of characteristic fluorescence spectra (fingerprints) from the excited fragments, which can be used for the identification of various substances including chemical and biological species. On the other hand, along with the femtosecond laser filamentation, white-light supercontinuum emission in the infrared to UV range is generated, which can be used as an ideal light source for absorption Lidar. In this paper, we present an overview of recent progress concerning remote sensing of the atmosphere using femtosecond laser filamentation. PMID:22346566

  13. Harnessing Wind

    NSDL National Science Digital Library

    2014-09-18

    Students are introduced to the ways that engineers study and harness the wind. They learn about the different kinds of winds and how to measure wind direction. In addition, they learn how air pressure creates winds and how engineers design and test wind turbines to harness renewable wind energy.

  14. Motion, decay and merging of vortex filaments

    NASA Technical Reports Server (NTRS)

    Liu, C. H.; Ting, L.

    1988-01-01

    The asymptotic solutions of Navier-Stokes equations for vortex filaments of finite strength with small effective vortical cores are summarized. Emphases are placed on the physical meaning and the practical limit to the applicability of the asymptotic solution. Finite-difference solutions of Navier-Stokes equations for the merging of the filament(s) are described. It is focused on the development of the approximate boundary conditions for the computational domain.

  15. Molecular rotovibrational dynamics excited in optical filamentation.

    PubMed

    Calegari, F; Vozzi, C; De Silvestri, S; Stagira, S

    2008-12-15

    The rotovibrational dynamics excited by optical filamentation in molecular gases is studied in the temporal domain. Two time-delayed replicas of the same laser pulse have been used to generate a first filament, for the rotovibrational excitation of the sample, and a second collinear filament probing the Raman dynamics. The Fermi doublet structure in CO(2) as well as the very fast stretching mode of H(2) were clearly resolved. PMID:19079493

  16. Machine Vision

    NSDL National Science Digital Library

    Leske, Cavin.

    An overview of a generic image-based machine vision system is provided on this Web site (1). The tutorial describes the main components of such a system, how its accuracy is measured, and what scientific and industrial applications benefit from machine vision. A more technical perspective of machine vision technology is given in an online publication of the Automated Imaging Association (2). Monthly feature articles discuss breaking issues related to machine vision, and several technical papers can be downloaded, which are sorted into categories such as three dimensional imaging and nanotechnology. Researchers from the MIT's Artificial Intelligence Laboratory (3) are investigating how to enable a computer to interpret visual and audio signals from its human user. By using machine perception systems to track the user's gaze, for example, the computer could ascertain the focus of the user's attention, thereby facilitating interaction between the human and the computer. The project's homepage includes numerous research papers, as well as video demonstrations of some of its systems. Machine vision is also finding its way into vehicles. A March 2003 news article (4) highlights a field test in Michigan of a collision avoidance system that uses, among other things, machine vision to warn drivers that they are approaching a slower or stopped object too quickly. The 3D Computer Vision Group at Carnegie Mellon University (5) is involved in several projects, including three dimensional object recognition and humanoid robot vision. Many of the group's recent publications are available for download. NASA's Mars Exploration Rovers, the second of which was launched in July 2003, have vision systems that will let them safely navigate rough terrain. These systems are described in this conference paper (6), including specifics of the stereo vision algorithm and insights into future missions. A new implementation of machine vision comes from a former researcher from Cambridge University. His shape recognition system, which is detailed in this news article (7), is reportedly much more related to human visual processes than existing techniques. For additional developments related to this evolving technology, Machine Vision News (8) has information about worldwide research and new applications of machine vision systems.

  17. Measurement of birefringence inside a filament

    SciTech Connect

    Yuan Shuai [Centre d'Optique, Photonique et Laser (COPL) et Departement de physique, de genie physique et d'optique, Universite Laval, Quebec, Quebec G1V 0A6 (Canada); State Key Laboratory of Precision Spectroscopy, East China Normal University, Shanghai 200062 (China); Wang, Tie-Jun; Chin, See Leang [Centre d'Optique, Photonique et Laser (COPL) et Departement de physique, de genie physique et d'optique, Universite Laval, Quebec, Quebec G1V 0A6 (Canada); Kosareva, Olga; Panov, Nikolay; Makarov, Vladimir [International Laser Center and Faculty of Physics, Lomonosov Moscow State University, Moscow (Russian Federation); Zeng Heping [State Key Laboratory of Precision Spectroscopy, East China Normal University, Shanghai 200062 (China)

    2011-07-15

    We quantified the ultrafast birefringence induced in the filament in an atomic gas by measuring the filament-induced polarization rotation of a probe pulse. Based on the dephasing of the probe's orthogonal polarization components in argon, the experiment was done at 1 atm by copropagating a linearly polarized 400-nm probe pulse with an 800-nm pump pulse which generated the filament. The probe's elliptical polarization states were shown under various initial pump-probe polarization schemes. These states were verified by comparing the filament-induced probe polarization rotation angle and the ellipticity of the probe polarization.

  18. The Regulation of Filamentous Growth in Yeast

    PubMed Central

    Cullen, Paul J.; Sprague, George F.

    2012-01-01

    Filamentous growth is a nutrient-regulated growth response that occurs in many fungal species. In pathogens, filamentous growth is critical for host–cell attachment, invasion into tissues, and virulence. The budding yeast Saccharomyces cerevisiae undergoes filamentous growth, which provides a genetically tractable system to study the molecular basis of the response. Filamentous growth is regulated by evolutionarily conserved signaling pathways. One of these pathways is a mitogen activated protein kinase (MAPK) pathway. A remarkable feature of the filamentous growth MAPK pathway is that it is composed of factors that also function in other pathways. An intriguing challenge therefore has been to understand how pathways that share components establish and maintain their identity. Other canonical signaling pathways—rat sarcoma/protein kinase A (RAS/PKA), sucrose nonfermentable (SNF), and target of rapamycin (TOR)—also regulate filamentous growth, which raises the question of how signals from multiple pathways become integrated into a coordinated response. Together, these pathways regulate cell differentiation to the filamentous type, which is characterized by changes in cell adhesion, cell polarity, and cell shape. How these changes are accomplished is also discussed. High-throughput genomics approaches have recently uncovered new connections to filamentous growth regulation. These connections suggest that filamentous growth is a more complex and globally regulated behavior than is currently appreciated, which may help to pave the way for future investigations into this eukaryotic cell differentiation behavior. PMID:22219507

  19. Methods for modeling cytoskeletal and DNA filaments.

    PubMed

    Andrews, Steven S

    2014-02-01

    This review summarizes the models that researchers use to represent the conformations and dynamics of cytoskeletal and DNA filaments. It focuses on models that address individual filaments in continuous space. Conformation models include the freely jointed, Gaussian, angle-biased chain (ABC), and wormlike chain (WLC) models, of which the first three bend at discrete joints and the last bends continuously. Predictions from the WLC model generally agree well with experiment. Dynamics models include the Rouse, Zimm, stiff rod, dynamic WLC, and reptation models, of which the first four apply to isolated filaments and the last to entangled filaments. Experiments show that the dynamic WLC and reptation models are most accurate. They also show that biological filaments typically experience strong hydrodynamic coupling and/or constrained motion. Computer simulation methods that address filament dynamics typically compute filament segment velocities from local forces using the Langevin equation and then integrate these velocities with explicit or implicit methods; the former are more versatile and the latter are more efficient. Much remains to be discovered in biological filament modeling. In particular, filament dynamics in living cells are not well understood, and current computational methods are too slow and not sufficiently versatile. Although primarily a review, this paper also presents new statistical calculations for the ABC and WLC models. Additionally, it corrects several discrepancies in the literature about bending and torsional persistence length definitions, and their relations to flexural and torsional rigidities. PMID:24476634

  20. Deep coronal hole associated with quiescent filament

    NASA Astrophysics Data System (ADS)

    Kesumaningrum, Rasdewita; Herdiwidjaya, Dhani

    2014-03-01

    We present a study of the morphology of quiescent filament observed by H-alpha Solar Telescope at Bosscha Observatory in association with coronal hole observed by Atmospheric Imaging Assembly (AIA) instrument in 193 Å from Solar Dynamics Observatory. H-alpha images were processed by imaging softwares, namely Iris 5.59 and ImageJ, to enhance the signal to noise ratio and to identify the filament features associated with coronal hole. For images observed on October 12, 2011, November 14, 2011 and January 2, 2012, we identified distinct features of coronal holes above the quiescent filaments. This associated coronal holes have filament-like morphology with a thick long thread as it's `spine', defined as Deep Coronal Hole. Because of strong magnetic field of sunspot, these filaments and coronal holes emerged far from active region and lasted for several days. It is interesting as for segmented filament, deep coronal holes above the filaments lasted for a quite long period of time and merged. This association between filament and deep coronal hole can be explained by filament magnetic loop.

  1. Viscoelastic properties of vimentin compared with other filamentous biopolymer networks

    Microsoft Academic Search

    Paul A. Janmey; Ursula Euteneuer; Peter Traub; Manfred Schliwa

    1991-01-01

    The cytoplasm of vertebrate cells contains three distinct filamentous biopolymers, the microtu- bules, microfilaments, and intermediate filaments. The basic structural elements of these three filaments are linear polymers of the proteins tubulin, actin, and vimentin or another related intermediate filament pro- tein, respectively. The viscoelastic properties of cyto- plasmic filaments are likely to be relevant to their biologic function, because

  2. Midterm periods of solar filaments

    NASA Astrophysics Data System (ADS)

    Zou, Peng; Li, Qixiu

    2014-12-01

    On the basis of the Carte Synoptique catalogue of solar filaments from March 1919 to December 1989, we measure power spectra of detrended full-disk (FSFNs, latitudinal bands: 0?-90?), low-latitude (LSFNs, latitudinal bands: <50?), and high-latitude (HSFNs, latitudinal bands: ?50?) solar filament numbers by Maximum Entropy Method (MEM) and Continuous wavelet transform to detect midterm periods. It is found as the following: (1) FSFNs and LSFNs have the same midterm periodicity, while HSFNs show a different midrange periodicity. Some periods frequently mentioned in other solar indices are also detected from the solar filament numbers, such as 2-3 year period (quasi-biennial oscillation—QBO), ˜1.7 year, ˜1.3 year, ˜1 year, 150-157 day period (Rieger period), and 6.0-6.4 months (Rieger-type period). These periods are intermittent during considered time span. Some of them are missing in some solar cycles. (2) QBO is detected from total data and most solar cycles of FSFNs, LSFNs, and HSFNs. It may be related to oscillation of magnetic field of solar surface. (3) Approximately 1.3 year period occasionally appears, but ˜1.7 year period is hardly seen. These two periods probably are seasonal effects. (4) Approximately 1 year period is detected from both total data and every solar cycle of FSFNs and LSFNs but hardly detected from HSFNs. It is perhaps connected with sunspot activity. (5) Rieger period of 5.0-5.2 months is detected in total data and even solar cycles of HSFNs. Rieger-type period of 6.0-6.4 months is found in total data and most solar cycles, except cycle 18 of LSFNs and FSFNs. These periods seem to be subharmonics of ˜11 year period.

  3. Analysis of electromechanical interactions in a flywheel system with a doubly fed induction machine

    E-print Network

    Ran, Li

    This paper analyzes the electromechanical inter-action in a flywheel system with a doubly fed induction machine, used for wind farm power smoothing or grid frequency response control. The grid-connected electrical machine ...

  4. Wind Turbine Acoustics

    NASA Technical Reports Server (NTRS)

    Hubbard, Harvey H.; Shepherd, Kevin P.

    2009-01-01

    Wind turbine generators, ranging in size from a few kilowatts to several megawatts, are producing electricity both singly and in wind power stations that encompass hundreds of machines. Many installations are in uninhabited areas far from established residences, and therefore there are no apparent environmental impacts in terms of noise. There is, however, the potential for situations in which the radiated noise can be heard by residents of adjacent neighborhoods, particularly those neighborhoods with low ambient noise levels. A widely publicized incident of this nature occurred with the operation of the experimental Mod-1 2-MW wind turbine, which is described in detail elsewhere. Pioneering studies which were conducted at the Mod-1 site on the causes and remedies of noise from wind turbines form the foundation of much of the technology described in this chapter.

  5. Influence of local fiber undulations on the global buckling behavior of filament-wound cylinders

    NASA Technical Reports Server (NTRS)

    Jensen, D. W.; Pai, S. P.

    1993-01-01

    The predicted compressive stiffness and buckling strength of filament-wound cylinders using classical lamination theory is significantly higher than those observed experimentally. This discrepancy is partially influenced by the variation of mechanical properties in the region of fiber undulations. These regions are localized geometric defects intrinsic to the filament-winding, weaving, and braiding processes. In the present work, the average mechanical properties of the fiber undulation region are quantified using modified models of woven-fabric composites to account for the 3-dimensional effects. The mechanical properties thus determined can be incorporated as local element properties into global finite-element models. Preliminary results from large-displacement analyses of filament-wound cylinders are relatively more accurate when fiber undulations are accounted for.

  6. Extensible Wind Towers

    NASA Astrophysics Data System (ADS)

    Sinagra, Marco; Tucciarelli, Tullio

    The diffusion of wind energy generators is restricted by their strong landscape impact. The PERIMA project is about the development of an extensible wind tower able to support a wind machine for several hundred kW at its optimal working height, up to more than 50 m. The wind tower has a telescopic structure, made by several tubes located inside each other with their axis in vertical direction. The lifting force is given by a jack-up system confined inside a shaft, drilled below the ground level. In the retracted tower configuration, at rest, tower tubes are hidden in the foundation of the telescopic structure, located below the ground surface, and the wind machine is the only emerging part of the system. The lifting system is based on a couple of oleodynamic cylinders that jack-up a central tube connected to the top of the tower by a spring, with a diameter smaller than the minimum tower diameter and with a length a bit greater than the length of the extended telescopic structure. The central tube works as plunger and lifts all telescopic elements. The constraint between the telescopic elements is ensured by special parts, which are kept in traction by the force of the spring and provide the resisting moment. The most evident benefit of the proposed system is attained with the use of a two-blade propeller, which can be kept horizontal in the retracted tower configuration.

  7. On the Fatigue Analysis of Wind Turbines

    SciTech Connect

    Sutherland, Herbert J.

    1999-06-01

    Modern wind turbines are fatigue critical machines that are typically used to produce electrical power from the wind. Operational experiences with these large rotating machines indicated that their components (primarily blades and blade joints) were failing at unexpectedly high rates, which led the wind turbine community to develop fatigue analysis capabilities for wind turbines. Our ability to analyze the fatigue behavior of wind turbine components has matured to the point that the prediction of service lifetime is becoming an essential part of the design process. In this review paper, I summarize the technology and describe the ''best practices'' for the fatigue analysis of a wind turbine component. The paper focuses on U.S. technology, but cites European references that provide important insights into the fatigue analysis of wind turbines.

  8. Wind driven gas generator

    SciTech Connect

    Crehore, R.

    1980-01-15

    A means is provided to convert wind energy into electrical energy which, through electrolysis, forms gases to be stored under pressure, giving a form of stored energy for use at some future time by the use of a high torque, low speed vertical axis wind machine connected by direct drive to homopolar direct current generators so as to create direct current for the electrolysis of water, resulting in the breakdown of water into its basic components of hydrogen and oxygen, which are then stored under pressure until necessary for use as a source of energy.

  9. Culture Machine

    NSDL National Science Digital Library

    Culture Machine is a new, refereed, electronic journal encompassing cultural studies and cultural theory. The international editorial board of the interactive journal aims to "generat[e] research in culture and theory" by promoting and publishing "the most provocative of new work." The theme of the inaugural issue is Taking Risks with the Future. Content includes articles such as Life After Death of the Text by Johan Fornas, Cultural Studies in the Clouds: Mourning for Detail by Tadeusz Slawek, and The Future States of Politics by Kenneth Surin. Culture Machine is hosted by the University of Teesside, England.

  10. Workout Machine

    NASA Technical Reports Server (NTRS)

    1995-01-01

    The Orbotron is a tri-axle exercise machine patterned after a NASA training simulator for astronaut orientation in the microgravity of space. It has three orbiting rings corresponding to roll, pitch and yaw. The user is in the middle of the inner ring with the stomach remaining in the center of all axes, eliminating dizziness. Human power starts the rings spinning, unlike the NASA air-powered system. Marketed by Fantasy Factory (formerly Orbotron, Inc.), the machine can improve aerobic capacity, strength and endurance in five to seven minute workouts.

  11. The physical structure of cold filaments near Point Arena, California, during June 1987

    NASA Astrophysics Data System (ADS)

    Ramp, Steven R.; Jessen, Paul F.; Brink, Kenneth H.; Niiler, Pearn P.; Daggett, Francis L.; Best, Jeffrey S.

    1991-08-01

    Shipboard conductivity-temperature-depth, acoustic Doppler current profiler, and continuous temperature and salinity observations were made in the coastal transition zone off Point Arena, California (39°N, 124°W), during June 15-28, 1987, to describe the hydrographic structure and velocity fields associated with the cold filaments found there. An adaptive sampling plan was used to measure the properties of these filaments, guided in real time by satellite Advanced Very High Resolution Radiometer sea surface temperature imagery and feedback from the in situ sensors. The primary feature observed was a large, cool (12.0°-13.5°C), salty (32.7-33.0 psu) filament which extended over 200 km offshore from Point Arena and exceeded 500 m depth. This feature was bounded in the offshore direction by a continuous equatorward meander, with offshore velocities (60-87 cm s-1) on the northern edge of the cool filament and onshore velocities (69-92 cm s-1) along the southern edge, and persisted for at least 3 weeks. A second feature was advected into the study area from the north by an anticyclonic eddy offshore and later merged with the Point Arena filament. Smaller (30 km wide by 50-100 km long by 50-100 m deep) very cold (10.0°-12.0°C) high salinity (>33.0 practical salinity units (psu)) features were observed within the Point Arena filament, but persisted for only 6-10 days. The net volume transport of the larger feature was offshore at ˜3 × 106 m3 s-1 and suggests it was fed by an inflow to the region from the north. The smaller features were correlated with bursts of equatorward wind stress on an event by event basis but not with times of large-scale wind stress convergence. Surface drifters deployed during the experiment closely followed the surface dynamic topography. Some of the drifters followed the path of the offshore meander, while others moved south inshore.

  12. Prominence Seismology: Wavelet Analysis of Filament Oscillations

    Microsoft Academic Search

    Balázs Pintér; Rekha Jain; Durgesh Tripathi; Hiroaki Isobe

    2008-01-01

    The temporal and spatial behavior of a large-amplitude filament oscillation is investigated using wavelet analysis. The extreme-ultraviolet (EUV) images of the phenomenon, which occurred on 2002 October 15, were taken from the EUV Imaging Telescope on board the Solar and Heliospheric Observatory (SOHO). The wavelet spectra, extracted from the intensity data, show that the filament oscillates as a rigid body,

  13. Infrared multimillijoule single-filament supercontinuum generation

    Microsoft Academic Search

    O. D. Mucke; A. J. Verhoef; A. Pugzlys; A. Baltuska; S. Alisauskas; V. Smilgevicius; J. Pocius; L. Giniunas; R. Danielius; N. Forget

    2009-01-01

    Single 4-mJ supercontinuum filaments supporting 8-fs pulses are generated by focusing ultrashort pulses from a four-stage KTP-OPCPA into a noble-gas cell. The use of a 1.6-mum wavelength permits efficient energy scaling in the single-filament regime.

  14. Fall and rise of a viscoelastic filament

    Microsoft Academic Search

    Anshuman Roy; L. Mahadevan; Jean-Luc Thiffeault

    2006-01-01

    When a viscoelastic fluid blob is stretched out into a thin horizontal filament, it sags and falls gradually under its own weight, forming a catenary-like structure that evolves dynamically. If the ends are brought together rapidly after stretching, the falling filament tends to straighten by rising. These two effects are strongly influenced by the elasticity of the fluid and yield

  15. Process for making silver metal filaments

    SciTech Connect

    Bamberger, C.E.

    1998-04-01

    This invention relates to a process for making filaments of metal compounds and more particularly to a process for making silver metal filaments. The United States Government has rights to this invention pursuant to Contract No. DE-AC05-8421400 with Lockheed Martin Energy Systems, Inc. awarded by the US Department of Energy.

  16. Comparison of hand laid-up tape and filament wound composite cylinders and panels with and without impact damage

    NASA Technical Reports Server (NTRS)

    Jegley, Dawn C.; Lopez, Osvaldo F.

    1991-01-01

    Experimentally determined axial compressive failure loads, strains and failure modes of composite flat panels and cylinders are presented. A comparison of two types of filament wound flat graphite-epoxy panels indicates that the winding pattern can influence structural response. A comparison of hand laid-up tape and filament wound composite cylinders indicates that fabrication method may not significantly influence the failure mode or average failure strain of thick-walled (radius-to-thickness ratio less than 15) graphite-epoxy cylinders. The interaction of manufacturing-induced features (fiber cross-overs) and low-speed impact damage for graphite-epoxy specimens is also presented. Filament would flat panels with many fiber cross-overs exhibited lower failure strains than filament wound panels without fiber cross-overs for all impact speeds examined. Graphite-thermoplastic cylinders exhibited a significantly different failure mode from the graphite-epoxy cylinders.

  17. Enigmatic reticulated filaments in subsurface granite.

    PubMed

    Miller, A Z; Hernández-Mariné, M; Jurado, V; Dionísio, A; Barquinha, P; Fortunato, E; Afonso, M J; Chaminé, H I; Saiz-Jimenez, C

    2012-12-01

    In the last few years, geomicrobiologists have focused their researches on the nature and origin of enigmatic reticulated filaments reported in modern and fossil samples from limestone caves and basalt lava tubes. Researchers have posed questions on these filaments concerning their nature, origin, chemistry, morphology, mode of formation and growth. A tentative microbial origin has been elusive since these filaments are found as hollow tubular sheaths and could not be affiliated to any known microorganism. We describe the presence of similar structures in a 16th century granite tunnel in Porto, Northwest Portugal. The reticulated filaments we identify exhibit fine geometry surface ornamentation formed by cross-linked Mn-rich nanofibres, surrounded by a large amount of extracellular polymeric substances. Within these Mn-rich filaments we report for the first time the occurrence of microbial cells. PMID:23760930

  18. Quantifying protein diffusion and capture on filaments.

    PubMed

    Reithmann, Emanuel; Reese, Louis; Frey, Erwin

    2015-02-17

    The functional relevance of regulating proteins is often limited to specific binding sites such as the ends of microtubules or actin-filaments. A localization of proteins on these functional sites is of great importance. We present a quantitative theory for a diffusion and capture process, where proteins diffuse on a filament and stop diffusing when reaching the filament's end. It is found that end-association after one-dimensional diffusion is the main source for tip-localization of such proteins. As a consequence, diffusion and capture is highly efficient in enhancing the reaction velocity of enzymatic reactions, where proteins and filament ends are to each other as enzyme and substrate. We show that the reaction velocity can effectively be described within a Michaelis-Menten framework. Together, one-dimensional diffusion and capture beats the (three-dimensional) Smoluchowski diffusion limit for the rate of protein association to filament ends. PMID:25692582

  19. Quantifying protein diffusion and capture on filaments

    E-print Network

    Reithmann, Emanuel; Frey, Erwin

    2015-01-01

    The functional relevance of regulating proteins is often limited to specific binding sites such as the ends of microtubules or actin-filaments. A localization of proteins on these functional sites is of great importance. We present a quantitative theory for a diffusion and capture process, where proteins diffuse on a filament and stop diffusing when reaching the filament's end. It is found that end-association after one-dimensional diffusion is the main source for tip-localization of such proteins. As a consequence, diffusion and capture is highly efficient in enhancing the reaction velocity of enzymatic reactions, where proteins and filament ends are to each other as enzyme and substrate. We show that the reaction velocity can effectively be described within a Michaelis-Menten framework. Together one-dimensional diffusion and capture beats the (three-dimensional) Smoluchowski diffusion limit for the rate of protein association to filament ends.

  20. Quantifying protein diffusion and capture on filaments

    E-print Network

    Emanuel Reithmann; Louis Reese; Erwin Frey

    2015-03-03

    The functional relevance of regulating proteins is often limited to specific binding sites such as the ends of microtubules or actin-filaments. A localization of proteins on these functional sites is of great importance. We present a quantitative theory for a diffusion and capture process, where proteins diffuse on a filament and stop diffusing when reaching the filament's end. It is found that end-association after one-dimensional diffusion is the main source for tip-localization of such proteins. As a consequence, diffusion and capture is highly efficient in enhancing the reaction velocity of enzymatic reactions, where proteins and filament ends are to each other as enzyme and substrate. We show that the reaction velocity can effectively be described within a Michaelis-Menten framework. Together one-dimensional diffusion and capture beats the (three-dimensional) Smoluchowski diffusion limit for the rate of protein association to filament ends.

  1. DOE/NASA Lewis large wind turbine program

    NASA Technical Reports Server (NTRS)

    Thomas, R. L.

    1982-01-01

    An overview of the large wind turbine activities managed by NASA is given. These activities include resuls from the first and second generation field machines (Mod-0A, -1, and -2), the status of the Department of Interior WTS-4 machine for which NASA is responsible for technical management, and the design phase of the third generation wind turbines (Mod-5).

  2. WIND ENERGY RESEARCH AT UNIVERSITY AND FEDERAL LEVELS

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Modern wind energy research began not long after the 1973 oil embargo. The Federal government established programs for large machines, small machines, wind resources, and applications in rural and remote areas. The research for the applications in rural and remote areas was conducted by the USDA-Ag...

  3. innovati nWind Turbine Design Innovations Drive Industry Transformation

    E-print Network

    innovati nWind Turbine Design Innovations Drive Industry Transformation For more than 20 years expense in those early wind machines was for repair and maintenance of gearboxes, along with supporting gearbox failures related to wear and stress on the machines. However, there was no way to definitively

  4. Decoding Machine

    NSDL National Science Digital Library

    Utah LessonPlans

    2012-10-22

    In this math lesson, learners explore variables and their uses. Learners pretend to be FBI agents and make a TOP SECRET tool that enables them to decode and find the values of hidden messages and words. Learners make their simple "decoding machines" out of paper and tape.

  5. Function Machine

    NSDL National Science Digital Library

    2011-01-01

    This Java applet allows learners to explore simple linear functions. Students determine the algebraic form of a linear equation by entering inputs into the machine and by looking for patterns in the outputs. The function rules available are: integers from -10 to 10 are either added to, subtracted from, or multiplied by the input x to yield the output y.

  6. Wacky Machines

    ERIC Educational Resources Information Center

    Fendrich, Jean

    2002-01-01

    Collectors everywhere know that local antique shops and flea markets are treasure troves just waiting to be plundered. Science teachers might take a hint from these hobbyists, for the next community yard sale might be a repository of old, quirky items that are just the things to get students thinking about simple machines. By introducing some…

  7. Leonardo's Machines

    NSDL National Science Digital Library

    Science Netlinks

    2003-03-05

    This Science NetLinks lesson will highlight some of Leonardo da Vinci's futuristic inventions, introducing the elements of machines. Through the use of student interactives, this lesson provides an interesting context in which students can begin to develop their ideas about the uniqueness of humans in the natural world.

  8. Performance of filament-wound vessels from an organic fiber in several epoxy matrices

    NASA Technical Reports Server (NTRS)

    Chiao, T. T.; Jessop, E. S.; Hamstad, M. A.

    1975-01-01

    A study was carried out to select a state-of-the-art epoxy for wet filament winding. Ten epoxy systems were used to filament wind pressure vessels with a high-modulus, high-strength organic fiber. Data are reported on vessel performance, fiber strand strengths, and shear strengths for the different systems. Using our criteria (processibility, neat resin properties, and vessel performance), we find that an epoxy system based on the rubber-modified bis-phenol-F resin, diluted with vinyl cyclohexane dioxide and cured with mixed aromatic amines, can easily replace bis-phenol-A epoxies diluted with bis-(2, 3-epoxycyclopentyl) ether (such as ERL 2256 epoxy of Union Carbide) with comparable overall performance.

  9. Ultrasonic analysis of Kevlar-epoxy filament wound spherical test specimens

    SciTech Connect

    Brosey, W.D.

    1984-12-06

    Increased use of composite materials in enclosed geometries such as cylindrical, spherical, or conical shapes has led to the desire to transfer and further develop the most promising nondestructive evaluation (NDE) techniques used on nonenclosed geometries to enclosed geometries. Known defects were placed within spherical Kevlar-epoxy filament wound test specimens to determine the extent to which they could be detected. These defects included Teflon shim-simulated delaminations, macrosphere-simulated voids, dry-band sets, variable tension, Kevlar 29 fiber, and an alternate high void content winding pattern. Ultrasonic C-scan analysis of Kevlar-epoxy filament wound spheres was performed to determine detectability of normal winding patterns and implanted flaw conditions in the composite using this technique. Ultrasonic waveform analysis was performed in both the time and frequency domains to determine the detectability and locatability of structural flaws within the composite.

  10. Apparatus for cooling an electric machine

    DOEpatents

    Palafox, Pepe; Gerstler, William Dwight; Shen, Xiaochun; El-Refaie, Ayman Mohamed Fawzi; Lokhandwalla, Murtuza; Salasoo, Lembit

    2013-07-16

    Provided is an apparatus, for example, for use with a rotating electric machine, that includes a housing. The housing can include a housing main portion and a housing end portion. The housing main portion can be configured to be disposed proximal to a body portion of a stator section of an electric machine. The housing main portion can define a main fluid channel that is configured to conduct fluid therethrough. The housing end portion can receive fluid from said main fluid channel and direct fluid into contact with a winding end portion of a conductive winding of the stator section.

  11. Automatic Detect and Trace of Solar Filaments

    NASA Astrophysics Data System (ADS)

    Fang, Cheng; Chen, P. F.; Tang, Yu-hua; Hao, Qi; Guo, Yang

    We developed a series of methods to automatically detect and trace solar filaments in solar H? images. The programs are able to not only recognize filaments and determine their properties, such as the position, the area and other relevant parameters, but also to trace the daily evolution of the filaments. For solar full disk H? images, the method consists of three parts: first, preprocessing is applied to correct the original images; second, the Canny edge-detection method is used to detect the filaments; third, filament properties are recognized through the morphological operators. For each H? filament and its barb features, we introduced the unweighted undirected graph concept and adopted Dijkstra shortest-path algorithm to recognize the filament spine; then, using polarity inversion line shift method for measuring the polarities in both sides of the filament to determine the filament axis chirality; finally, employing connected components labeling method to identify the barbs and calculating the angle between each barb and spine to indicate the barb chirality. Our algorithms are applied to the observations from varied observatories, including the Optical & Near Infrared Solar Eruption Tracer (ONSET) in Nanjing University, Mauna Loa Solar Observatory (MLSO) and Big Bear Solar Observatory (BBSO). The programs are demonstrated to be effective and efficient. We used our method to automatically process and analyze 3470 images obtained by MLSO from January 1998 to December 2009, and a butterfly diagram of filaments is obtained. It shows that the latitudinal migration of solar filaments has three trends in the Solar Cycle 23: The drift velocity was fast from 1998 to the solar maximum; after the solar maximum, it became relatively slow and after 2006, the migration became divergent, signifying the solar minimum. About 60% filaments with the latitudes larger than 50 degree migrate towards the Polar Regions with relatively high velocities, and the latitudinal migrating speeds in the northern and the southern hemispheres do not differ significantly in the Solar Cycle 23. We also processed a number of relatively high-resolution H? images obtained by BBSO. It is found that in some cases, the filament axis has single chirality and the associated magnetic field also has single helicity, while its barbs in different parts of it have opposite barb chirality.

  12. Performance Analysis of Small Wind Turbine Connected to a Grid through Modelling and Simulation

    Microsoft Academic Search

    Rajesh Saiju; Abdel Tamzarti; Siegfried Heier

    2007-01-01

    This paper focuses on the modelling and performance analysis of small Wind Turbine Generator (WTG). A specially developed pole changeable induction machine, which is directly connected into a grid, is considered for simulation. The mathematical equations of the induction machine, wind turbine, grid are simulated in powerful software tool Matlab\\/Simulink. The dynamic analysis has been carried out by changing wind

  13. A Generalized Deletion Machine

    E-print Network

    Indranil Chakrabarty; Satyabrata Adhikari

    2005-11-22

    In this work we prescribe a more generalized quantum-deleting machine (input state dependent). The fidelity of deletion is dependent on some machine parameters such that on alteration of machine parameters we get back to standard deleting machines. We also carried out a various comparative study of various kinds of quantum deleting machines. We also plotted graphs, making a comparative study of fidelity of deletion of the deletion machines, obtained as particular cases on changing the machine parameters of our machine.

  14. Drilling Machines: Vocational Machine Shop.

    ERIC Educational Resources Information Center

    Thomas, John C.

    The lessons and supportive information in this field tested instructional block provide a guide for teachers in developing a machine shop course of study in drilling. The document is comprised of operation sheets, information sheets, and transparency masters for 23 lessons. Each lesson plan includes a performance objective, material and tools,…

  15. Performance analysis of synchronous machines under dynamic eccentricity

    E-print Network

    Al-Nuaim, Nabil Abdulaziz

    1996-01-01

    The performance of salient pole synchronous machines under eccentric rotors is studied. Relationships between stator and rotor current induced harmonics and dynamic eccentricity are investigated. The winding function theory has been modified...

  16. State-Machine Replication

    E-print Network

    Venkataramani, Arun

    State-Machine Replication #12;The Problem Clients Server #12;The Problem Clients Server #12;The (state machine) #12;The Solution 1. Make server deterministic (state machine) State machine #12;The Solution 1. Make server deterministic (state machine) 2. Replicate server State machines #12;The Solution 1

  17. Prediction of the far field noise from wind energy farms

    NASA Technical Reports Server (NTRS)

    Shepherd, K. P.; Hubbard, H. H.

    1986-01-01

    The basic physical factors involved in making predictions of wind turbine noise and an approach which allows for differences in the machines, the wind energy farm configurations and propagation conditions are reviewed. Example calculations to illustrate the sensitivity of the radiated noise to such variables as machine size, spacing and numbers, and such atmosphere variables as absorption and wind direction are presented. It is found that calculated far field distances to particular sound level contours are greater for lower values of atmospheric absorption, for a larger total number of machines, for additional rows of machines and for more powerful machines. At short and intermediate distances, higher sound pressure levels are calculated for closer machine spacings, for more powerful machines, for longer row lengths and for closer row spacings.

  18. Filaments in Simulations of Molecular Cloud Formation

    NASA Astrophysics Data System (ADS)

    Gómez, Gilberto C.; Vázquez-Semadeni, Enrique

    2014-08-01

    We report on the filaments that develop self-consistently in a new numerical simulation of cloud formation by colliding flows. As in previous studies, the forming cloud begins to undergo gravitational collapse because it rapidly acquires a mass much larger than the average Jeans mass. Thus, the collapse soon becomes nearly pressureless, proceeding along its shortest dimension first. This naturally produces filaments in the cloud and clumps within the filaments. The filaments are not in equilibrium at any time, but instead are long-lived flow features through which the gas flows from the cloud to the clumps. The filaments are long-lived because they accrete from their environment while simultaneously accreting onto the clumps within them; they are essentially the locus where the flow changes from accreting in two dimensions to accreting in one dimension. Moreover, the clumps also exhibit a hierarchical nature: the gas in a filament flows onto a main, central clump but other, smaller-scale clumps form along the infalling gas. Correspondingly, the velocity along the filament exhibits a hierarchy of jumps at the locations of the clumps. Two prominent filaments in the simulation have lengths ~15 pc and masses ~600 M ? above density n ~ 103 cm-3 (~2 × 103 M ? at n > 50 cm-3). The density profile exhibits a central flattened core of size ~0.3 pc and an envelope that decays as r -2.5 in reasonable agreement with observations. Accretion onto the filament reaches a maximum linear density rate of ~30 M ? Myr-1 pc-1.

  19. THERMAL AND CHEMICAL EVOLUTION OF COLLAPSING FILAMENTS

    SciTech Connect

    Gray, William J. [Lawrence Livermore National Laboratory, P.O. Box 808, L-038, Livermore, CA 94550 (United States); Scannapieco, Evan [School of Earth and Space Exploration, Arizona State University, P.O. Box 871404, Tempe, AZ 85287-1494 (United States)

    2013-05-10

    Intergalactic filaments form the foundation of the cosmic web that connect galaxies together, and provide an important reservoir of gas for galaxy growth and accretion. Here we present very high resolution two-dimensional simulations of the thermal and chemical evolution of such filaments, making use of a 32 species chemistry network that tracks the evolution of key molecules formed from hydrogen, oxygen, and carbon. We study the evolution of filaments over a wide range of parameters including the initial density, initial temperature, strength of the dissociating UV background, and metallicity. In low-redshift, Z Almost-Equal-To 0.1 Z{sub Sun} filaments, the evolution is determined completely by the initial cooling time. If this is sufficiently short, the center of the filament always collapses to form a dense, cold core containing a substantial fraction of molecules. In high-redshift, Z = 10{sup -3} Z{sub Sun} filaments, the collapse proceeds much more slowly. This is mostly due to the lower initial temperatures, which lead to a much more modest increase in density before the atomic cooling limit is reached, making subsequent molecular cooling much less efficient. Finally, we study how the gravitational potential from a nearby dwarf galaxy affects the collapse of the filament and compare this to NGC 5253, a nearby starbursting dwarf galaxy thought to be fueled by the accretion of filament gas. In contrast to our fiducial case, a substantial density peak forms at the center of the potential. This peak evolves faster than the rest of the filament due to the increased rate at which chemical species form and cooling occurs. We find that we achieve similar accretion rates as NGC 5253 but our two-dimensional simulations do not recover the formation of the giant molecular clouds that are seen in radio observations.

  20. Iogenic Ion Loss via Magnetic Filaments in Jupiter's Magnetotail

    NASA Astrophysics Data System (ADS)

    Hill, Matthew; Haggerty, Dennis; McNutt, Ralph L., Jr.; Paranicas, Chris

    We show that energetic ions with Iogenic (sulfur-rich) composition are recurrently injected at 150 ±30RJ (RJ = 71,492 km) anti-sunward of Jupiter and funnelled down the magnetotail. The particle events show velocity dispersion and were observed during the first half of 2007 by the PEPSSI (Pluto Energetic Particle Spectrometer Science Investigation) instrument on the Pluto-bound New Horizons (NH) spacecraft. Our survey to 2562 RJ down the magnetotail characterizes the behavior of ˜few-keV—1 MeV particles and their environment, yielding an estimate of the injection site location. A case study of one of the most interesting of the many sulfur-rich events, beginning on day-of-year 118, 28 April 2007, contributes to the determination that the ˜400 RJ-wide > 9000RJ -long magnetotail is actually composed of narrow ˜1 RJ -diameter filaments stretching down the tail. Reconciling this with the large (˜500 RJ ) plasmoid interpretation supported by the NH/SWAP (Solar Wind Around Pluto) observations is an opportunity to greatly expand our understanding of the Jovian magnetotail and its particle dynamics. The impact of Io's vulcanism is clear as far down the tail as we observed, but between events the abundance of the solar wind tracer helium grows as the spacecraft recedes from the planet, possibly due to solar wind flux tubes mixing with the Jovian flux tubes liberating material trapped in the Io taurus and inner magnetosphere into interplanetary space.

  1. Acoustic emission produced during burst tests of filament-wound bottles.

    NASA Technical Reports Server (NTRS)

    Hamstad, M. A.; Chiao, T. T.

    1973-01-01

    Acoustic emission was recorded during burst tests of filament-wound, composite pressure vessels. Organic and graphite fibers were tested, and two different epoxy resin systems were used: one with a low and another with a relatively high cure temperature. Acoustic emission was studied for the effects of different winding patterns, artificial flaws, winding-induced fiber fraying, different resins, and different fibers. Small effects produced in the vessels by changes in these variables were greatly magnified when they appeared as changes in acoustic emission. They would, in fact, be difficult or impossible to detect by other test means.

  2. Hybrid Wound Filaments for Greater Resistance to Impacts

    NASA Technical Reports Server (NTRS)

    DeLay, Thomas K.; Patterson, James E.; Olson, Michael A.

    2008-01-01

    A hybrid material containing wound filaments made of a hybrid of high-strength carbon fibers and poly(phenylene benzobisoxazole) [PBO] fibers is discussed. This hybrid material is chosen in an effort to increase the ability of the pressure vessel to resist damage by low-speed impacts (e.g., dropping of tools on the vessel or bumping of the vessel against hard objects during installation and use) without significantly increasing the weight of the vessel. While the basic concept of hybridizing fibers in filament-wound structures is not new, the use of hybridization to increase resistance to impacts is an innovation, and can be expected to be of interest in the composite-pressure-vessel industry. The precise types and the proportions of the high-strength carbon fibers and the PBO fibers in the hybrid are chosen, along with the filament-winding pattern, to maximize the advantageous effects and minimize the disadvantageous effects of each material. In particular, one seeks to (1) take advantage of the ability of the carbon fibers to resist stress rupture while minimizing their contribution to vulnerability of the vessel to impact damage and (2) take advantage of the toughness of the PBO fibers while minimizing their contribution to vulnerability of the vessel to stress rupture. Experiments on prototype vessels fabricated according to this concept have shown promising results. At the time of reporting the information for this article, research toward understanding and optimizing the performances of PBO fibers so as to minimize their contribution to vulnerability of the pressure vessel to stress rupture had yet to be performed.

  3. Simple Machines

    NSDL National Science Digital Library

    Wakild, Terri

    The goals for this introduction activity to Simple Machines are.: - Generate scientific questions about the world based on observation - Design and conduct scientific investigations - Use tools and equipment appropriate to scientific investigations - Use sources of information in support of scientific investigation - Write and follow procedures in the form of step-by-step instructions, formulas, flow diagram, and sketches - Show how common themes of science, mathematics, and technology apply in real-world contexts - Recognize the contributions made in science by cultures and individuals of diverse backgrounds - Design strategies for moving objects by application of forces, including the use of simple machines MERC Online Reviewer Comments: Good computer activities for under-represented students who want to pursue manufacturing education. Distance Learning is a plus.

  4. Modeling stochastic wind loads on vertical axis wind turbines

    NASA Astrophysics Data System (ADS)

    Veers, P. S.

    The Vertical Axis Wind Turbine (VAWT) is a machine which extracts energy from the wind. Since random turbulence is always present, the effect of this turbulence on the wind turbine fatigue life must be evaluated. This problem is approached by numerically simulating the turbulence and calculating, in the time domain, the aerodynamic loads on the turbine blades. These loads are reduced to the form of power and cross spectral densities which can be used in standard linear structural analysis codes. The relative importance of the turbulence on blade loads is determined.

  5. Living Machines

    Microsoft Academic Search

    Yung-Tse Hung; Joseph F. Hawumba; Lawrence K. Wang

    \\u000a Ecological studies have revealed that nature has an in-built system to restore itself, thereby sustaining its continuity.\\u000a In other words, natural ecosystems can act as “Living Machines” in keeping the ecosystems habitable. The biological communities\\u000a – microbes, plants, and animals – serve as the driving force of several living technological innovations – constructed wetlands,\\u000a Lake Restores, Eco-Restorers, and Reedbeds. These

  6. How really transverse is the filamentation instability?

    NASA Astrophysics Data System (ADS)

    Bret, A.; Gremillet, L.; Bellido, J. C.

    2007-03-01

    It is generally considered that the linear filamentation instability encountered when two counter streaming electron beams interpenetrate is purely transverse. Exact and approximated results are derived in the relativistic fluid approximation showing that within some parameter range, filamentation can be indeed almost longitudinal with cos (k ,Ê)?1-3.1/?b, where ?b is the relativistic factor of the beam. Temperature effects are then evaluated through relativistic kinetic theory and yield even fewer transverse filamentation modes. In the cold case, the transverse approximation overestimates the growth rate by a factor ???b .

  7. Nonlinear control of wind power generation systems

    Microsoft Academic Search

    Yi Guo; John N. Jiang; Choon Yik Tang

    2009-01-01

    This paper proposes a nonlinear control design technique for wind generation systems that deals with both active power and reactive power at the same time in consideration of the fact that the wind generation system is a high order nonlinear dynamical system. Unlike the existing controller designs, the proposed technique is developed based on original nonlinear models of electric machine

  8. High performance filament wound composites for pressure vessel applications.

    NASA Technical Reports Server (NTRS)

    Hoggatt, J. T.

    1971-01-01

    A new high modulus fiber was evaluated as a reinforcement for filament wound pressure vessels. Based on preliminary data it offers significant specific strength and modulus improvements over an S-glass reinforcement. Winding parameters and design data were established for the fiber with two different epoxy resin systems. NOL composite rings were evaluated for tensile strength, modulus and interlaminar shear strength at +70 F, -320 F and -423 F. Results showed that the fiber reinforced composite exhibited a specific strength of 4,100,000 inches and a specific modulus of 290,000,000 inches compared to 3,260,000 inches and 110,000,000 inches respectively for S-glass. Utilizing this data to design small filament wound pressure vessels, a performance factor of 806,000 inches was obtained experimentally with PRD 49-1 fiber compared to values of 632,000 inches and 501,000 inches for S-glass and high modulus graphite vessels, respectively.

  9. Wild Wind

    NSDL National Science Digital Library

    2014-09-18

    Students learn the difference between global, prevailing and local winds. They make wind vanes out of paper, straws and soda bottles and use them to measure wind direction over time. They analyze their data to draw conclusions about the local prevailing winds.

  10. Meteorology (Wind)

    Atmospheric Science Data Center

    2014-09-25

    Wind speed at 50 m (m/s) The average and percent difference minimum and ... are given.   Percent of time for ranges of wind speed at 50 m (percent) Percentage [frequency] of time that wind ... be adjusted to heights from 10 to 300 meters using the Gipe power law. Wind speeds may be adjusted for different terrain by selecting from ...

  11. Snake Filament Eruption - Duration: 0:05.

    NASA Video Gallery

    A very long solar filament that had been snaking around the Sun erupted on Dec. 6, 2010 with a flourish. NASA's Solar Dynamics Observatory (SDO) caught the action in dramatic detail in extreme ultr...

  12. Actin Filament Segmentation Using Dynamic Programming

    PubMed Central

    Li, Hongsheng; Shen, Tian; Huang, Xiaolei

    2011-01-01

    We introduce a novel algorithm for actin filament segmentation in 2D TIRFM image sequences. This problem is difficult because actin filaments dynamically change shapes during their growth, and the TIRFM images are usually noisy. We ask a user to specify the two tips of a filament of interest in the first frame. We then model the segmentation problem in an image sequence as a temporal chain, where its states are tip locations; given candidate tip locations, actin filaments' body points are inferred by a dynamic programming method, which adaptively generates candidate solutions. Combining candidate tip locations and their inferred body points, the temporal chain model is efficiently optimized using another dynamic programming method. Evaluation on noisy TIRFM image sequences demonstrates the accuracy and robustness of this approach. PMID:21761674

  13. Actin filament segmentation using dynamic programming.

    PubMed

    Li, Hongsheng; Shen, Tian; Huang, Xiaolei

    2011-01-01

    We introduce a novel algorithm for actin filament segmentation in 2D TIRFM image sequences. This problem is difficult because actin filaments dynamically change shapes during their growth, and the TIRFM images are usually noisy. We ask a user to specify the two tips of a filament of interest in the first frame. We then model the segmentation problem in an image sequence as a temporal chain, where its states are tip locations; given candidate tip locations, actin filaments' body points are inferred by a dynamic programming method, which adaptively generates candidate solutions. Combining candidate tip locations and their inferred body points, the temporal chain model is efficiently optimized using another dynamic programming method. Evaluation on noisy TIRFM image sequences demonstrates the accuracy and robustness of this approach. PMID:21761674

  14. Tension of freely suspended fluid filaments.

    PubMed

    Morys, M; Trittel, T; Eremin, A; Murphy, P; Stannarius, R

    2012-10-01

    Stable fluid filaments with diameters of several micrometers and slenderness ratios well above 1000 are unique objects formed by some liquid crystalline phases of bent-core mesogens. We present a technique to determine filament tensions from their deflection under defined loads. A strong temperature dependence is observed, with a minimum near the clearing temperature. Both the nonlinear relation between filament tension and diameter and the substantial increase of the tension with lower temperatures indicate contributions of volume terms, in addition to surface capillary forces. We discuss a model that relates these bulk terms to elastic forces, originating from the undulated smectic layer structure. This model can explain the origin of the filament stability. PMID:23214519

  15. Filamentous bacteria existence in aerobic granular reactors.

    PubMed

    Figueroa, M; Val Del Río, A; Campos, J L; Méndez, R; Mosquera-Corral, A

    2015-05-01

    Filamentous bacteria are associated to biomass settling problems in wastewater treatment plants. In systems based on aerobic granular biomass they have been proposed to contribute to the initial biomass aggregation process. However, their development on mature aerobic granular systems has not been sufficiently studied. In the present research work, filamentous bacteria were studied for the first time after long-term operation (up to 300 days) of aerobic granular systems. Chloroflexi and Sphaerotilus natans have been observed in a reactor fed with synthetic wastewater. These filamentous bacteria could only come from the inoculated sludge. Thiothrix and Chloroflexi bacteria were observed in aerobic granular biomass treating wastewater from a fish canning industry. Meganema perideroedes was detected in a reactor treating wastewater from a plant processing marine products. As a conclusion, the source of filamentous bacteria in these mature aerobic granular systems fed with industrial effluents was the incoming wastewater. PMID:25533039

  16. Thioredoxin is required for filamentous phage assembly.

    PubMed Central

    Russel, M; Model, P

    1985-01-01

    Sequence comparisons show that the fip gene product of Escherichia coli, which is required for filamentous phage assembly, is thioredoxin. Thioredoxin serves as a cofactor for reductive processes in many cell types and is a constituent of phage T7 DNA polymerase. The fip-1 mutation makes filamentous phage and T7 growth temperature sensitive in cells that carry it. The lesion lies within a highly conserved thioredoxin active site. Thioredoxin reductase (NADPH), as well as thioredoxin, is required for efficient filamentous phage production. Mutant phages defective in phage gene I are particularly sensitive to perturbations in the fip-thioredoxin system. A speculative model is presented in which thioredoxin reductase, thioredoxin, and the gene I protein interact to drive an engine for filamentous phage assembly. Images PMID:3881756

  17. Do filaments cross core "boundaries"?

    NASA Astrophysics Data System (ADS)

    Goodman, Alyssa A.; Chen, Hope; Pineda, Jaime E.; Offner, Stella

    2015-01-01

    Thanks to extensive observations of the Perseus star-forming region, and the Barnard 5 (B5) star-forming core within it, we can study filamentary structure at scales from tens of pc down to to hundredths of pc using a wide variety of gas and dust tracers. Recently, in compositing Herschel dust emission maps of Perseus with GBT and JVLA maps of ammonia in B5, we noticed that the large scale (>1 pc) filaments that lead to the B5 core appear to continue across the "coherent core" boundary, right down into the sub 0.1 pc scales traced by ammonia. We find this result very surprising, since it suggests that the "core" is not as distinct from its filamentary surroundings as we--and current conventional wisdom--would have predicted. Numerical simulations on 1-10 pc scales typically create "sink" particles on scales small enough to correspond to our JVLA measurements. The new B5 results presented here should inspire new simulations which offer enough dynamic range to trace the morphology of self-gravitating, non-isothermal turbulence continuously from 10 to 0.01 pc scales, in order to see how, why, and how long filamentary structure is maintained across these scales.

  18. Filament overwrapped motor case technology

    NASA Astrophysics Data System (ADS)

    Compton, Joel P.

    1993-11-01

    Atlantic Research Corporation (ARC) joined with the French Societe Europeenne de Propulsion (SEP) to develop and deliver to the U.S. Navy a small quantity of composite filament wound rocket motors to demonstrate a manufacturing technique that was being applied at the two companies. It was perceived that the manufacturing technique could produce motors that would be light in weight, inexpensive to produce, and that had a good chance of meeting insensitive munitions (IM) requirements that were being formulated by the Navy in the early 1980s. Under subcontract to ARC, SEP designed, tested, and delivered 2.75-inch rocket motors to the U.S. Navy for IM tests that were conducted in 1989 at China Lake, California. The program was one of the first to be founded by Nunn Amendment money. The Government-to-Government program was sponsored by the Naval Air Systems Command and was monitored by the Naval Surface Warfare Center, Indian Head (NSWC-IH), Maryland. The motor propellant that was employed was a new, extruded composite formulation that was under development at the Naval Surface Warfare Center. The following paper describes the highlights of the program and gives the results of structural and ballistic static tests and insensitive munitions tests that were conducted on demonstration motors.

  19. Counterstreaming in a Large Polar Crown Filament

    Microsoft Academic Search

    Yong Lin; Oddbjø Rn Engvold; Jun Elin Wiik

    2003-01-01

    The motion of small-scale structures is well resolved in high-resolution filament images that were observed on 19 June 1998 with the Swedish Vacuum Solar Telescope, La Palma. The filament was between 80 000 and 100 000 km high. The study is based on two hours of narrow-band observations at three wavelength positions in Halpha. Velocities along the line of sight

  20. Counterstreaming in a Large Polar Crown Filament

    Microsoft Academic Search

    Yong Lin; OddbjØ rn Engvold; Jun Elin Wiik

    2003-01-01

    The motion of small-scale structures is well resolved in high-resolution filament images that were observed on 19 June 1998\\u000a with the Swedish Vacuum Solar Telescope, La Palma. The filament was between 80?000 and 100?000 km high. The study is based\\u000a on two hours of narrow-band observations at three wavelength positions in H?. Velocities along the line of sight and in the

  1. Study of filamentation threshold in zinc selenide.

    PubMed

    Durand, Magali; Houard, Aurélien; Lim, Khan; Durécu, Anne; Vasseur, Olivier; Richardson, Martin

    2014-03-10

    The possibility of creating filaments with laser wavelengths ranging from 800 nm to 2.4 µm was investigated using an OPA laser system. Zinc Selenide's (ZnSe) unique characteristics - small band gap E(gZnSe)=2.67eV and positive dispersion for this wavelength range - are well suited for filamentation study where multi-photon absorption can be achieved with two to six photons. PMID:24663922

  2. Atomic model of the actin filament

    Microsoft Academic Search

    Kenneth C. Holmes; David Popp; Werner Gebhard; Wolfgang Kabsch

    1990-01-01

    The F-actin filament has been constructed from the atomic structure of the actin monomer to fit the observed X-ray fibre diagram from oriented gels of F-actin. A unique orientation of the monomer with respect to the actin helix has been found. The main interactions are along the two-start helix with a contribution from a loop extending across the filament axis

  3. Optically Directed Assembly of Continuous Mesoscale Filaments

    NASA Astrophysics Data System (ADS)

    Bahns, J. T.; Sankaranarayanan, S. K. R. S.; Gray, S. K.; Chen, L.

    2011-03-01

    We demonstrate irreversible continuous filament formation when a weak laser focus is positioned near the edge of an evaporating colloidal droplet containing carbon and gold nanoparticles. Optical trapping, hydrothermal, and chemical interactions lead to controlled colloidal synthesis of stable, irreversible mesoscale filaments of arbitrary shape and size. Mechanisms for this optically directed assembly are discussed with fluid dynamics, molecular dynamics, and lattice kinetic Monte Carlo calculations.

  4. Filament-wound, fiberglass cryogenic tank supports

    NASA Technical Reports Server (NTRS)

    Carter, J. S.; Timberlake, T. E.

    1971-01-01

    The design, fabrication, and testing of filament-wound, fiberglass cryogenic tank supports for a LH2 tank, a LF2/FLOX tank and a CH4 tank. These supports consist of filament-wound fiberglass tubes with titanium end fittings. These units were satisfactorily tested at cryogenic temperatures, thereby offering a design that can be reliably and economically produced in large or small quantities. The basic design concept is applicable to any situation where strong, lightweight axial load members are desired.

  5. The exo-metabolome in filamentous fungi

    Microsoft Academic Search

    Ulf Thrane; Birgitte Anderson; Jens C. Frisvad; Jørn Smedsgaard

    Filamentous fungi are a diverse group of eukaryotic microorganisms that have a significant impact\\u000a on human life as spoilers of food and feed by degradation and toxin production. They are also most\\u000a useful as a source of bulk and fine chemicals and pharmaceuticals. This chapter focuses on the exo-metabolome\\u000a in filamentous fungi, which comprises more than 30,000 known secondary metabolites.

  6. Wind Power: A Turning Point. Worldwatch Paper 45.

    ERIC Educational Resources Information Center

    Flavin, Christopher

    Recent studies have shown wind power to be an eminently practical and potentially substantial source of electricity and direct mechanical power. Wind machines range from simple water-pumping devices made of wood and cloth to large electricity producing turbines with fiberglass blades nearly 300 feet long. Wind is in effect a form of solar…

  7. Learning about Simple Machines

    NSDL National Science Digital Library

    Mrs. Keller

    2010-01-17

    This activity is designed to learn about simple machines and to have fun doing so! First, use this website to learn backround information on the basics of simple machines. Try the quiz! Simple Machines Learning Site Next, play a game that tests your ability to identify simple machines.... Edheads: Simple Machines Finally, view this video to see how students your age used applied simple machines to do a cool task... Building Simple Machines: A Glass of Milk, Please ...

  8. Modeling and control of a wind turbine driven doubly fed induction generator

    Microsoft Academic Search

    Arantxa Tapia; Gerardo Tapia; J. Xabier Ostolaza; José Ramón Sáenz

    2003-01-01

    This paper presents the simulation results of a grid-connected wind driven doubly fed induction machine (DFIM) together with some real machine performance results. The modeling of the machine considers operating conditions below and above synchronous speed, which are actually achieved by means of a double-sided PWM converter joining the machine rotor to the grid. In order to decouple the active

  9. Filament Eruption without Coronal Mass Ejection

    NASA Technical Reports Server (NTRS)

    Choudhary, Debi Prasad; Moore, Ronald L.

    2003-01-01

    We report characteristics of quiescent filament eruptions that did not produce coronal mass ejections (CMEs). We examined 12 quiescent filament eruptions, each of which was located far from disk center (greater than or equal to 0.7 R (sub sun)) in diffuse remnant magnetic fields of decayed active regions, was well observed in full-disk movies in H alpha and Fe XII, and had good coronagraph coverage. Of the 12 eruptions, 7 produced CMEs and 5 did not. Even though the two kinds of eruption were indistinguishable in their magnetic setting and in the eruptive motion of the filament in the H alpha movies, each of the CME-producing eruptions produced a two-ribbon flare in H alpha and a flare arcade in Fe XII, and each of the non-CME-producing eruptions did not. From this result, and the appearance of the eruptive motion in the Fe XII movies, we conclude that the non-CME-producing filament eruptions are confined eruptions like the confined filament eruptions in active regions. We take the similarity of the confined and eruptive quiescent filament eruptions with their active-region counterparts to favor runaway tether-cutting reconnection for unleashing the magnetic explosion in all these eruptions.

  10. Wind turbine optimal control during storms

    NASA Astrophysics Data System (ADS)

    Petrovi?, V.; Bottasso, C. L.

    2014-06-01

    This paper proposes a control algorithm that enables wind turbine operation in high winds. With this objective, an online optimization procedure is formulated that, based on the wind turbine state, estimates those extremal wind speed variations that would produce maximal allowable wind turbine loads. Optimization results are compared to the actual wind speed and, if there is a danger of excessive loading, the wind turbine power reference is adjusted to ensure that loads stay within allowed limits. This way, the machine can operate safely even above the cut-out wind speed, thereby realizing a soft envelope-protecting cut-out. The proposed control strategy is tested and verified using a high-fidelity aeroservoelastic simulation model.

  11. Machine Design

    NSDL National Science Digital Library

    This website, the homepage of Machine Design.com, contains resources on a variety of information for engineers and technicians related to devices, components, design applications, products, and systems in the manufacturing technology sector. The site also features a CAD library, eBooks, audiovisual aids, webinars, whitepapers and a reference center. Some of the resources require a free login. The page offers an RSS feed to keep users up to date on new resources. A free login may be required to access some of these items.

  12. Function Machine

    NSDL National Science Digital Library

    2012-07-19

    This Java activity for the interactive white board (free access with registration) provides learners an opportunity to explore number functions and to predict outcomes. Teachers set the desired function from the drop-down list (double it, halve it, add 1, subtract 1, add 10, or subtract 10) and choose the start number from 1-20. Students are asked to predict the outcome before asking the machine to go. There is an option to hide the function so the teacher can ask students to work out what operation is being used to get from the starting number to the number generated.

  13. Solar filament impact on 21 January 2005: Geospace consequences

    NASA Astrophysics Data System (ADS)

    Kozyra, J. U.; Liemohn, M. W.; Cattell, C.; De Zeeuw, D.; Escoubet, C. P.; Evans, D. S.; Fang, X.; Fok, M.-C.; Frey, H. U.; Gonzalez, W. D.; Hairston, M.; Heelis, R.; Lu, G.; Manchester, W. B.; Mende, S.; Paxton, L. J.; Rastaetter, L.; Ridley, A.; Sandanger, M.; Soraas, F.; Sotirelis, T.; Thomsen, M. W.; Tsurutani, B. T.; Verkhoglyadova, O.

    2014-07-01

    On 21 January 2005, a moderate magnetic storm produced a number of anomalous features, some seen more typically during superstorms. The aim of this study is to establish the differences in the space environment from what we expect (and normally observe) for a storm of this intensity, which make it behave in some ways like a superstorm. The storm was driven by one of the fastest interplanetary coronal mass ejections in solar cycle 23, containing a piece of the dense erupting solar filament material. The momentum of the massive solar filament caused it to push its way through the flux rope as the interplanetary coronal mass ejection decelerated moving toward 1 AU creating the appearance of an eroded flux rope (see companion paper by Manchester et al. (2014)) and, in this case, limiting the intensity of the resulting geomagnetic storm. On impact, the solar filament further disrupted the partial ring current shielding in existence at the time, creating a brief superfountain in the equatorial ionosphere—an unusual occurrence for a moderate storm. Within 1 h after impact, a cold dense plasma sheet (CDPS) formed out of the filament material. As the interplanetary magnetic field (IMF) rotated from obliquely to more purely northward, the magnetotail transformed from an open to a closed configuration and the CDPS evolved from warmer to cooler temperatures. Plasma sheet densities reached tens per cubic centimeter along the flanks—high enough to inflate the magnetotail in the simulation under northward IMF conditions despite the cool temperatures. Observational evidence for this stretching was provided by a corresponding expansion and intensification of both the auroral oval and ring current precipitation zones linked to magnetotail stretching by field line curvature scattering. Strong Joule heating in the cusps, a by-product of the CDPS formation process, contributed to an equatorward neutral wind surge that reached low latitudes within 1-2 h and intensified the equatorial ionization anomaly. Understanding the geospace consequences of extremes in density and pressure is important because some of the largest and most damaging space weather events ever observed contained similar intervals of dense solar material.

  14. PROPER MOTIONS AND BRIGHTNESS VARIATIONS OF NONTHERMAL X-RAY FILAMENTS IN THE CASSIOPEIA A SUPERNOVA REMNANT

    SciTech Connect

    Patnaude, Daniel J. [Smithsonian Astrophysical Observatory, Cambridge, MA 02138 (United States); Fesen, Robert A. [Department of Physics and Astronomy, 6127 Wilder Lab, Dartmouth College, Hanover, NH 03755 (United States)

    2009-05-20

    We present Chandra ACIS X-ray observations of the Galactic supernova remnant Cassiopeia A taken in 2007 December. Combining these data with previous archival Chandra observations taken in 2000, 2002, and 2004, we estimate the remnant's forward shock velocity at various points around the outermost shell to range between 4200 and 5200 {+-} 500 km s{sup -1}. Using these results together with previous analyses of Cas A's X-ray emission, we present a model for the evolution of Cas A and find that it's expansion is well fit by a {rho}{sub ej} {proportional_to} r {sup -(7-9)} ejecta profile running into a circumstellar wind. We further find that while the position of the reverse shock in this model is consistent with that measured in the X-rays, in order to match the forward shock velocity and radius we had to assume that {approx} 30% of the explosion energy has gone into accelerating cosmic rays at the forward shock. The new X-ray images also show that brightness variations can occur for some forward shock filaments like that seen for several nonthermal filaments seen projected in the interior of the remnant. Spectral fits to exterior forward shock filaments and interior nonthermal filaments show that they exhibit similar spectra. This together with similar flux variations suggests that interior nonthermal filaments might be simply forward shock filaments seen in projection and not located at the reverse shock as has been recently proposed.

  15. Wind turbine powered heat generator. Final report

    SciTech Connect

    Not Available

    1981-09-15

    The preliminary design was conducted for a wind machine capable of handling the heating loads in an average 2000 square foot home. The wind machine is rated at 4.5 kW in a wind of 18 mph and should be operational in winds of 4 to 18 mph. Model testing preceded the design and indicated the form function of the nozzle to be y = 0.25x/sup 2/ where y is the locus of the nozzle wall and x is the distance from the throat in inches. The machine has a 20 foot equivalent entrance diameter, a 10:1 constriction ratio and a 2 foot wheel radius.

  16. Synchronous Machines 1.0 Introduction

    E-print Network

    McCalley, James D.

    of energy (steam, water, wind) into mechanical energy, as illustrated in Fig. 1 [1]. Fig. 1 [1] PDF created that, when p=2, we get one electric cycle for every one mechanical cycle. When p=4, we get two electrical cycles for every one mechanical cycle. If we consider that e must be constant from one machine

  17. Monitoring the integrity of filament-wound structures using built-in sensor networks

    NASA Astrophysics Data System (ADS)

    Lin, Mark; Kumar, Amrita; Qing, Xinlin; Beard, Shawn J.; Russell, Samuel S.; Walker, James L.; Delay, Thomas K.

    2003-08-01

    Monitoring the integrity of filament wound composite structures such as solid rocket motors and liquid fuel bottles is important in order to prevent catastrophic failures and to prolong the service life of these structures. To ensure the safety and reliability of rocket components, they require frequent inspection for structural damages that might have occurred during manufacturing, transportation, and storage. The timely and accurate detection, characterization and monitoring of structural cracking, delamination, debonding and other types of damage is a major concern in the operational environment. Utilization of a sensor network system integrated with the structure itself can greatly reduce this inspection burden through fast in-situ data collection and processing. Acellent Technologies, Inc. is currently developing integrated structural monitoring tools for continuous monitoring of composite and metal structures on aircraft and spacecraft. Acellent's integrated structural monitoring system consists of a flexible sensor/actuator network layer called the SMART Layer, supporting diagnostic hardware, and data processing/analysis software. Recently, Acellent has been working with NASA Marshall Space Flight Center to develop ways of embedding the SMART Layer inside filament wound composite bottles. SMART Layers were designed and manufactured for the filament wound bottles and embedded in them during the filament winding process. Acellent has been working on developing a complete structural health monitoring system for the filament wound bottles including data processing tools to interpret the changes in sensor signal caused by changes in the structural condition or material property. A prototype of a filament wound composite bottle with an embedded sensor network has been fabricated and preliminary data analysis tools have been developed.

  18. Course info Machine Learning

    E-print Network

    Shi, Qinfeng "Javen"

    Course info Machine Learning Real life problems Lecture 1: Machine Learning Problem Qinfeng (Javen) Shi 28 July 2014 Intro. to Stats. Machine Learning COMP SCI 4401/7401 Qinfeng (Javen) Shi Lecture 1: Machine Learning Problem #12;Course info Machine Learning Real life problems Table of Contents I 1 Course

  19. Relationship of Species-Specific Filament Levels to Filamentous Bulking in Activated Sludge

    PubMed Central

    Liao, Jiangying; Lou, Inchio; de los Reyes, Francis L.

    2004-01-01

    To examine the relationship between activated-sludge bulking and levels of specific filamentous bacteria, we developed a statistics-based quantification method for estimating the biomass levels of specific filaments using 16S rRNA-targeted fluorescent in situ hybridization (FISH) probes. The results of quantitative FISH for the filament Sphaerotilus natans were similar to the results of quantitative membrane hybridization in a sample from a full-scale wastewater treatment plant. Laboratory-scale reactors were operated under different flow conditions to develop bulking and nonbulking sludge and were bioaugmented with S. natans cells to stimulate bulking. Instead of S. natans, the filament Eikelboom type 1851 became dominant in the reactors. Levels of type 1851 filaments extending out of the flocs correlated strongly with the sludge volume index, and extended filament lengths of approximately 6 × 108 ?m ml?1 resulted in bulking in laboratory-scale and full-scale activated-sludge samples. Quantitative FISH showed that high levels of filaments occurred inside the flocs in nonbulking sludge, supporting the “substrate diffusion limitation” hypothesis for bulking. The approach will allow the monitoring of incremental improvements in bulking control methods and the delineation of the operational conditions that lead to bulking due to specific filaments. PMID:15066840

  20. Relationship of species-specific filament levels to filamentous bulking in activated sludge.

    PubMed

    Liao, Jiangying; Lou, Inchio; de los Reyes, Francis L

    2004-04-01

    To examine the relationship between activated-sludge bulking and levels of specific filamentous bacteria, we developed a statistics-based quantification method for estimating the biomass levels of specific filaments using 16S rRNA-targeted fluorescent in situ hybridization (FISH) probes. The results of quantitative FISH for the filament Sphaerotilus natans were similar to the results of quantitative membrane hybridization in a sample from a full-scale wastewater treatment plant. Laboratory-scale reactors were operated under different flow conditions to develop bulking and nonbulking sludge and were bioaugmented with S. natans cells to stimulate bulking. Instead of S. natans, the filament Eikelboom type 1851 became dominant in the reactors. Levels of type 1851 filaments extending out of the flocs correlated strongly with the sludge volume index, and extended filament lengths of approximately 6 x 10(8) micro m ml(-1) resulted in bulking in laboratory-scale and full-scale activated-sludge samples. Quantitative FISH showed that high levels of filaments occurred inside the flocs in nonbulking sludge, supporting the "substrate diffusion limitation" hypothesis for bulking. The approach will allow the monitoring of incremental improvements in bulking control methods and the delineation of the operational conditions that lead to bulking due to specific filaments. PMID:15066840

  1. Enertech 2-kW high-reliability wind system. Phase II. Fabrication and testing

    SciTech Connect

    Cordes, J A; Johnson, B A

    1981-06-01

    A high-reliability wind machine rated for 2 kW in a 9 m/s wind has been developed. Activities are summarized that are centered on the fabrication and testing of prototypes of the wind machine. The test results verified that the wind machine met the power output specification and that the variable-pitch rotor effectively controlled the rotor speed for wind speeds up to 50 mph. Three prototypes of the wind machine were shipped to the Rocky Flats test center in September through November of 1979. Work was also performed to reduce the start-up wind speed. The start-up wind speed to the Enertech facility has been reduced to 4.5 m/s.

  2. Development of single crystal filaments. Final report

    SciTech Connect

    Milewski, J.V.; Shoultz, R.A.; Bourque-McConnell, M.M.

    1995-04-01

    The program just completed addresses a route to a more efficient longer-lasting electric light bulb filament. All current filaments for light bulbs are metallic in nature. They are subject to embrittlement with age (large grain growth) and relatively high vapor pressures which limits their operating temperature. There is evidence which suggests advantages to using high temperature refractory single crystal fibers as a filament for a light bulb. These refractory materials may include materials such as hafnium or tantalum carbide which have melting points about 500{degrees}C higher than tungsten. Another advantage is that single crystal fibers have a very high degree of crystalline perfection with very few voids and dislocations. Without these imperfections, the atomic mobility at high temperatures is highly restricted. Thus single crystal fibers are very stable at high temperature and will last longer. The efficiencies result from running these single crystal ceramic fiber filaments at higher temperatures and the higher emissivity of the carbide filaments compared to tungsten. The amount of visible light is proportional to the 4the power of the temperature thus a 500{degrees}C higher operating give about a 3-fold increase in radiation in the visible range. The program accomplishments can be summarized as follows: (1) Single crystal fibers of JfC sufficient crystal quality for light bulb filament applications were made. (2) The HfC fiber furnace growth chamber, power control and data collection system was developed for the laboratory scale plant. (3) method for mounting and apparatuses for testing the single crystal fiber filaments were developed and built.

  3. Hybrid-secondary uncluttered induction machine

    DOEpatents

    Hsu, John S. (Oak Ridge, TN)

    2001-01-01

    An uncluttered secondary induction machine (100) includes an uncluttered rotating transformer (66) which is mounted on the same shaft as the rotor (73) of the induction machine. Current in the rotor (73) is electrically connected to current in the rotor winding (67) of the transformer, which is not electrically connected to, but is magnetically coupled to, a stator secondary winding (40). The stator secondary winding (40) is alternately connected to an effective resistance (41), an AC source inverter (42) or a magnetic switch (43) to provide a cost effective slip-energy-controlled, adjustable speed, induction motor that operates over a wide speed range from below synchronous speed to above synchronous speed based on the AC line frequency fed to the stator.

  4. Dual-rotor, radial-flux, toroidally-wound, permanent-magnet machine

    DOEpatents

    Qu, Ronghai; Lipo, Thomas A.

    2005-08-02

    The present invention provides a novel dual-rotor, radial-flux, toroidally-wound, permanent-magnet machine. The present invention improves electrical machine torque density and efficiency. At least one concentric surface-mounted permanent magnet dual-rotor is located inside and outside of a torus-shaped stator with back-to-back windings, respectively. The machine substantially improves machine efficiency by reducing the end windings and boosts the torque density by at least doubling the air gap and optimizing the machine aspect ratio.

  5. Mind & Machine

    NSDL National Science Digital Library

    Dunn, Ashley.

    Mind & Machine is a weekly column provided by Ashley Dunn for the New York Times Cybertimes that discusses topics related to computing, technology, and the Internet. Recent columns have addressed the topics of the development of Internet telephony, possible futures of user interfaces, the history of technology and standards, and the Internet as a vehicle for community. Articles are well written, opinionated, and thought provoking. Mr. Dunn is a free lance writer who has written for such papers as the New York Times, the Los Angeles Times, the Seattle Post-Intelligencer, and the South China Morning Post. Note that the site is available only upon registration and is free of charge only in the US.

  6. Actin filament severing by cofilin dismantles actin patches and produces mother filaments for new patches

    PubMed Central

    Chen, Qian; Pollard, Thomas

    2014-01-01

    Summary Background Yeast cells depend on Arp2/3 complex to assemble actin filaments at sites of endocytosis, but the source of the initial filaments required to activate Arp2/3 complex is not known. Results We tested the proposal that cofilin severs actin filaments during endocytosis in fission yeast cells using a mutant cofilin defective in severing. We used quantitative fluorescence microscopy to track mGFP-tagged proteins, including early endocytic adaptor proteins, activators of Arp2/3 complex and actin filaments. Consistent with the hypothesis, actin patches disassembled far slower in cells depending on severing-deficient cofilin than wild type cells. Even more interesting, actin patches assembled slowly in these cofilin mutant cells. Adaptor proteins End4p and Pan1p accumulated and persisted at endocytic sites more than 10 times longer than in wild type cells, followed by slow put persistent recruitment of activators of Arp2/3 complex, including WASP and myosin-I. Mutations revealed that actin filament binding sites on adaptor proteins Pan1p and End4p contribute to initiating actin polymerization in actin patches. Conclusions We propose a “sever, diffuse and trigger” model for the nucleation of actin filaments at sites of endocytosis whereby cofilin generates actin filament fragments that diffuse through the cytoplasm, bind adapter proteins at nascent sites of endocytosis and serve as mother filaments to initiate the autocatalytic assembly of the branched actin filament network of each new patch. This hypothesis explains the source of the “mother filaments” that are absolutely required for Arp2/3 complex to nucleate polymerization. PMID:23727096

  7. On the nature of star-forming filaments - I. Filament morphologies

    NASA Astrophysics Data System (ADS)

    Smith, Rowan J.; Glover, Simon C. O.; Klessen, Ralf. S.

    2014-12-01

    We use a suite of high-resolution molecular cloud simulations carried out with the moving mesh code AREPO to explore the nature of star-forming filaments. The simulated filaments are identified and categorized from column density maps in the same manner as for recent Herschel observations. When fitted with a Plummer-like profile, the filaments are in excellent agreement with observations, and have shallow power-law profiles of p ˜ 2.2 without the need for magnetic support. When data within 1 pc of the filament centre are fitted with a Gaussian function, the average full width at half-maximum (FWHM) is ˜0.3 pc, in agreement with predictions for accreting filaments. However, if the fit is constructed using only the inner regions, as in Herschel observations, the resulting FWHM is only ˜0.2 pc. This value is larger than that measured in IC 5146 and Taurus, but is similar to that found in the Planck Galactic cold cores and in Cygnus X. The simulated filaments have a range of widths rather than a constant value. When the column density maps are compared to the 3D gas densities, the filaments seen in column density do not belong to a single structure. Instead, they are made up of a network of short ribbon-like sub-filaments reminiscent of those seen in Taurus. The sub-filaments are pre-existing within the simulated clouds, have radii similar to their Jeans radius, and are not primarily formed through fragmentation of the larger filament seen in column density. Instead, small filamentary clumps are swept together into a single column density structure by the large-scale collapse of the cloud.

  8. Socially guided machine learning

    E-print Network

    Thomaz, Andrea Lockerd

    2006-01-01

    Social interaction will be key to enabling robots and machines in general to learn new tasks from ordinary people (not experts in robotics or machine learning). Everyday people who need to teach their machines new things ...

  9. Nebulin binding impedes mutant desmin filament assembly

    PubMed Central

    Baker, Laura K.; Gillis, David C.; Sharma, Sarika; Ambrus, Andy; Herrmann, Harald; Conover, Gloria M.

    2013-01-01

    Desmin intermediate filaments (DIFs) form an intricate meshwork that organizes myofibers within striated muscle cells. The mechanisms that regulate the association of desmin to sarcomeres and their role in desminopathy are incompletely understood. Here we compare the effect nebulin binding has on the assembly kinetics of desmin and three desminopathy-causing mutant desmin variants carrying mutations in the head, rod, or tail domains of desmin (S46F, E245D, and T453I). These mutants were chosen because the mutated residues are located within the nebulin-binding regions of desmin. We discovered that, although nebulin M160–164 bound to both desmin tetrameric complexes and mature filaments, all three mutants exhibited significantly delayed filament assembly kinetics when bound to nebulin. Correspondingly, all three mutants displayed enhanced binding affinities and capacities for nebulin relative to wild-type desmin. Electron micrographs showed that nebulin associates with elongated normal and mutant DIFs assembled in vitro. Moreover, we measured significantly delayed dynamics for the mutant desmin E245D relative to wild-type desmin in fluorescence recovery after photobleaching in live-cell imaging experiments. We propose a mechanism by which mutant desmin slows desmin remodeling in myocytes by retaining nebulin near the Z-discs. On the basis of these data, we suggest that for some filament-forming desmin mutants, the molecular etiology of desminopathy results from subtle deficiencies in their association with nebulin, a major actin-binding filament protein of striated muscle. PMID:23615443

  10. Filament Eruption without Coronal Mass Ejection

    NASA Technical Reports Server (NTRS)

    Choudhary, Debi Prasad; Moore, Ronald L.

    2003-01-01

    We report characteristics of quiescent filament eruptions that were not associated with coronal mass ejections (CMEs). We examined 12 quiescent filament eruptions, each of which was located far from disk center (20.7 R(sub sun)) in diffuse remnant magnetic fields of decayed active regions, was well observed in full-disk movies in Ha and Fe XI, and had good coronagraph coverage. Of the 12 events, 9 were associated with CMEs and 3 were not. Even though the two kinds of eruption were indistinguishable in their magnetic setting and in the eruptive motion of the filament in the Ha movies, each of the CME-producing eruptions produced a two-ribbon flare in Ha and a coronal arcade and/or two-ribbon flare in Fe XII, and each of the non-CME-producing eruptions did not. From this result, and the appearance of the eruptive motion in the Fe XII movies, we conclude that the non-CME-associated filament eruptions are confined eruptions like the confined filament eruptions in active regions.

  11. Wind Turbine

    USGS Multimedia Gallery

    The species of bats that are most susceptible to wind turbines all roost in trees throughout the year, leading some scientists to speculate that they may be visually mistaking wind turbines for trees in which to roost....

  12. Wind Energy

    NSDL National Science Digital Library

    2014-09-18

    Students learn about wind energy by making a pinwheel to model a wind turbine. Just like engineers, they decide where and how their turbine works best by testing it in different areas of the playground.

  13. Performance of a 3 kW wind turbine generator with variable pitch control system

    Microsoft Academic Search

    Baku M. Nagai; Kazumasa Ameku; Jitendro Nath Roy

    2009-01-01

    A prototype 3kW horizontal upwind type wind turbine generator of 4m in diameter has been designed and examined under real wind conditions. The machine was designed based on the concept that even small wind turbines should have a variable pitch control system just as large wind turbines, especially in Japan where typhoons occur at least once a year. A characteristic

  14. Pinson C2E wind turbine generator failure analysis and corrective design modification

    Microsoft Academic Search

    M. J. Carr; V. K. Grotsky; J. H. Sexton

    1980-01-01

    On December 4, 1978 wind speeds at the Rocky Flats Small Wind Systems Test Center reached 42 m\\/s. Two failures were observed on the Pinson C2E wind turbine generator during a routine inspection of all wind machines following this windstorm. One failure was fatigue cracks which formed on plates welded to the rotor shaft. The second failure was a number

  15. A Novel Internal Fault Analysis of a Brushless DC Motor Using Winding Function Theory

    Microsoft Academic Search

    Hyung-Woo Lee; Tae-Hyung Kim; Changho Choi

    2005-01-01

    This paper presents a winding function-based method to analyze the inter-turn fault in stator windings of a brushless DC (BLDC) motor. It is essential to analyze the behavior of the machine under internal faults and design appropriate protection systems to avoid expensive failures. The winding functions and inductance of stator windings are explained in detail and the informative simulation results

  16. Ris-PhD-Report Accounting for the speed shear in wind

    E-print Network

    Risø-PhD-Report Accounting for the speed shear in wind turbine power performance measurement Rozenn for the speed shear in wind turbine power performance measurement Division: Wind Energy Division Abstract: The power curve of a wind turbine is the primary char- acteristic of the machine as it is the basis

  17. Simple Machines - Mechanical Advantage

    NSDL National Science Digital Library

    2007-01-01

    This video uses working simple machines to demonstrate how to calculate mechanical advantage. Suitable for any school program involving simple machines. Demonstrates pulley systems including a chain block.

  18. A Double-Sided Linear Primary Permanent Magnet Vernier Machine

    PubMed Central

    2015-01-01

    The purpose of this paper is to present a new double-sided linear primary permanent magnet (PM) vernier (DSLPPMV) machine, which can offer high thrust force, low detent force, and improved power factor. Both PMs and windings of the proposed machine are on the short translator, while the long stator is designed as a double-sided simple iron core with salient teeth so that it is very robust to transmit high thrust force. The key of this new machine is the introduction of double stator and the elimination of translator yoke, so that the inductance and the volume of the machine can be reduced. Hence, the proposed machine offers improved power factor and thrust force density. The electromagnetic performances of the proposed machine are analyzed including flux, no-load EMF, thrust force density, and inductance. Based on using the finite element analysis, the characteristics and performances of the proposed machine are assessed.

  19. Toasty Wind

    NSDL National Science Digital Library

    National Weather Service

    2012-07-24

    In this quick activity, learners use a toaster to investigate the source for the Earth's wind. Learners hold a pinwheel above a toaster to discover that rising heat causes wind. Use this activity to introduce learners to the process of convection as a source for wind. This resource also explains how convection causes thunderstorms and lists important thunderstorm safety tips.

  20. Wind Whispers

    NSDL National Science Digital Library

    The Advanced Technology Environmental and Energy Center (ATEEC) provides this presentation on the career and technical aspects of wind energy. In addition to discussing careers in wind, the presentation covers the siting of wind turbines and some electricity basics. Users must download this resource for viewing, which requires a free log-in. There is no cost to download the item.

  1. Parallel-machine rescheduling with machine disruptions

    Microsoft Academic Search

    Meral Azizoglu; Oguzhan Alagöz

    2005-01-01

    In this study we consider a rescheduling problem on identical parallel machines. The rescheduling is undertaken because of a period of unavailability on one of the machines. We consider the total flow time as an efficiency measure and stability is gauged in terms of the number of jobs processed on different machines in the original and new schedules. We show

  2. Classifying Structures in the ISM with Machine Learning Techniques

    NASA Astrophysics Data System (ADS)

    Beaumont, Christopher; Goodman, A. A.; Williams, J. P.

    2011-01-01

    The processes which govern molecular cloud evolution and star formation often sculpt structures in the ISM: filaments, pillars, shells, outflows, etc. Because of their morphological complexity, these objects are often identified manually. Manual classification has several disadvantages; the process is subjective, not easily reproducible, and does not scale well to handle increasingly large datasets. We have explored to what extent machine learning algorithms can be trained to autonomously identify specific morphological features in molecular cloud datasets. We show that the Support Vector Machine algorithm can successfully locate filaments and outflows blended with other emission structures. When the objects of interest are morphologically distinct from the surrounding emission, this autonomous classification achieves >90% accuracy. We have developed a set of IDL-based tools to apply this technique to other datasets.

  3. SOLAR MAGNETIZED 'TORNADOES': RELATION TO FILAMENTS

    SciTech Connect

    Su Yang; Veronig, Astrid; Temmer, Manuela [IGAM-Kanzelhoehe Observatory, Institute of Physics, University of Graz, Universitaetsplatz 5, A-8010 Graz (Austria); Wang Tongjiang [Department of Physics, Catholic University of America, Washington, DC 20064 (United States); Gan Weiqun, E-mail: yang.su@uni-graz.at [Key Laboratory of Dark Matter and Space Astronomy, Purple Mountain Observatory, Chinese Academy of Sciences, Nanjing 210008 (China)

    2012-09-10

    Solar magnetized 'tornadoes', a phenomenon discovered in the solar atmosphere, appear as tornado-like structures in the corona but are rooted in the photosphere. Like other solar phenomena, solar tornadoes are a feature of magnetized plasma and therefore differ distinctly from terrestrial tornadoes. Here we report the first analysis of solar 'tornadoes' (two papers which focused on different aspects of solar tornadoes were published in the Astrophysical Journal Letters and Nature, respectively, during the revision of this Letter). A detailed case study of two events indicates that they are rotating vertical magnetic structures probably driven by underlying vortex flows in the photosphere. They usually exist as a group and are related to filaments/prominences, another important solar phenomenon whose formation and eruption are still mysteries. Solar tornadoes may play a distinct role in the supply of mass and twists to filaments. These findings could lead to a new explanation of filament formation and eruption.

  4. Filament Twist in F-Actin Bundles

    NASA Astrophysics Data System (ADS)

    Angelini, Tommy; Sanders, Lori; Wong, Gerard

    2003-03-01

    The twist state of F-actin can modify specific binding sites and influence the hierarchy of interactions in cytoskeletal regulation. F-actin in the cytoskeleton is often organized into bundles, using a wide variety of cationic molecules and actin-linking proteins. The native helical symmetry of uncondensed f-actin filaments is not necessarily the preferred symmetry of bundled filaments, which will depend on the particular bundling mechanism and the kind of condensing agent used. In order to explore the role of filament distortion in the process of bundle formation, we have carried out a series of synchrotron x-ray measurements on systems of bundled f-actin, using multivalent cations, cationic globular proteins, and actin binding proteins. Preliminary results will be presented. This work was supported by NSF DMR-0071761, DOE, DEFG02-91ER45439, the Beckman Young Investigator Program, and the Cystic Fibrosis Foundation.

  5. Filament velocity scaling laws for warm ions

    SciTech Connect

    Manz, P. [Physik-Department E28, Technische Universität München, James-Franck-Str. 1, 85748 Garching (Germany) [Physik-Department E28, Technische Universität München, James-Franck-Str. 1, 85748 Garching (Germany); Max-Planck-Institut für Plasmaphysik, EURATOM Assoziation, Boltzmannstr. 2, 85748 Garching (Germany); Carralero, D.; Birkenmeier, G.; Müller, H. W.; Scott, B. D. [Max-Planck-Institut für Plasmaphysik, EURATOM Assoziation, Boltzmannstr. 2, 85748 Garching (Germany)] [Max-Planck-Institut für Plasmaphysik, EURATOM Assoziation, Boltzmannstr. 2, 85748 Garching (Germany); Müller, S. H. [Center for Momentum Transport and Flow Organization, University of California at San Diego, San Diego 92093 (United States)] [Center for Momentum Transport and Flow Organization, University of California at San Diego, San Diego 92093 (United States); Fuchert, G. [Insitut für Grenzflächenverfahrenstechnik und Plasmatechnologie, Universität Stuttgart, 70569 Stuttgart (Germany)] [Insitut für Grenzflächenverfahrenstechnik und Plasmatechnologie, Universität Stuttgart, 70569 Stuttgart (Germany); Stroth, U. [Max-Planck-Institut für Plasmaphysik, EURATOM Assoziation, Boltzmannstr. 2, 85748 Garching (Germany) [Max-Planck-Institut für Plasmaphysik, EURATOM Assoziation, Boltzmannstr. 2, 85748 Garching (Germany); Physik-Department E28, Technische Universität München, James-Franck-Str. 1, 85748 Garching (Germany)

    2013-10-15

    The dynamics of filaments or blobs in the scrape-off layer of magnetic fusion devices are studied by magnitude estimates of a comprehensive drift-interchange-Alfvén fluid model. The standard blob models are reproduced in the cold ion case. Even though usually neglected, in the scrape-off layer, the ion temperature can exceed the electron temperature by an order of magnitude. The ion pressure affects the dynamics of filaments amongst others by adding up to the interchange drive and the polarisation current. It is shown how both effects modify the scaling laws for filament velocity in dependence of its size. Simplifications for experimentally relevant limit regimes are given. These are the sheath dissipation, collisional, and electromagnetic regime.

  6. Solar Magnetized "Tornadoes:" Relation to Filaments

    NASA Astrophysics Data System (ADS)

    Su, Yang; Wang, Tongjiang; Veronig, Astrid; Temmer, Manuela; Gan, Weiqun

    2012-09-01

    Solar magnetized "tornadoes," a phenomenon discovered in the solar atmosphere, appear as tornado-like structures in the corona but are rooted in the photosphere. Like other solar phenomena, solar tornadoes are a feature of magnetized plasma and therefore differ distinctly from terrestrial tornadoes. Here we report the first analysis of solar "tornadoes" (two papers which focused on different aspects of solar tornadoes were published in the Astrophysical Journal Letters and Nature, respectively, during the revision of this Letter). A detailed case study of two events indicates that they are rotating vertical magnetic structures probably driven by underlying vortex flows in the photosphere. They usually exist as a group and are related to filaments/prominences, another important solar phenomenon whose formation and eruption are still mysteries. Solar tornadoes may play a distinct role in the supply of mass and twists to filaments. These findings could lead to a new explanation of filament formation and eruption.

  7. U. radio emission from quiescent filaments

    NASA Technical Reports Server (NTRS)

    Lang, Kenneth R.

    1989-01-01

    Full-disk Very Large Array (VLA) synthesis maps of the quiet Sun indicate that filaments can be seen in emission at 91.6 cm wavelength; they are detected in absorption at shorter microwave wavelengths. The 91.6 cm emission has a brightness temperature of T sub B = 3 x 10(exp 5) K. It is hotter, wider and longer than the underlying filament detected at H alpha wavelengths, but the similarity between the shape, position, elongation and orientation of the radio and optical features suggests their close association. The 91.6 cm emission is attributed to the thermal-bremsstrahlung of a hot transition sheath that envelopes the H alpha filament and acts as an interface between the cool, dense H alpha filament and the hotter, rarefied corona. The transition sheath is seen in emission because of the lower optical depth of the corona at 90 cm wavelength, and the width of this sheet is 10(exp 9) cm. A power law gradient in pressure provides a better match to the observations than a constant pressure model; definitive tests of theoretical models await simultaneous multi-wavelength studies of filaments at different observing angles. When the thermal bremsstrahlung is optically thin, the magnetic field strength in the transition sheath can be inferred from the observed circular polarization. Variable physical parameters of the sheath, such as width, electron density, and electron temperature, can explain controversial reports of the detection of, or the failure to detect, the meter-wavelength counterpart of H alpha filaments.

  8. Filamentary structures in dense plasma focus: Current filaments or vortex filaments?

    SciTech Connect

    Soto, Leopoldo, E-mail: lsoto@cchen.cl; Pavez, Cristian; Moreno, José [Comisión Chilena de Energía Nuclear, CCHEN, Casilla 188-D, Santiago (Chile); Center for Research and Applications in Plasma Physics and Pulsed Power, P4, Departamento de Ciencias Físicas, Facultad de Ciencias Exactas, Universidad Andrés Bello, República 220, Santiago (Chile); Castillo, Fermin [Universidad Nacional Autónoma de México, Cuernavaca, México (Mexico); Veloso, Felipe [Instituto de Física, Pontificia Universidad Católica de Chile, 7820436 Santiago (Chile); Auluck, S. K. H. [Bhabha Atomic Research Center, Mumbai 400 085 (India)

    2014-07-15

    Recent observations of an azimuthally distributed array of sub-millimeter size sources of fusion protons and correlation between extreme ultraviolet (XUV) images of filaments with neutron yield in PF-1000 plasma focus have re-kindled interest in their significance. These filaments have been described variously in literature as current filaments and vortex filaments, with very little experimental evidence in support of either nomenclature. This paper provides, for the first time, experimental observations of filaments on a table-top plasma focus device using three techniques: framing photography of visible self-luminosity from the plasma, schlieren photography, and interferometry. Quantitative evaluation of density profile of filaments from interferometry reveals that their radius closely agrees with the collision-less ion skin depth. This is a signature of relaxed state of a Hall fluid, which has significant mass flow with equipartition between kinetic and magnetic energy, supporting the “vortex filament” description. This interpretation is consistent with empirical evidence of an efficient energy concentration mechanism inferred from nuclear reaction yields.

  9. Filamentary structures in dense plasma focus: Current filaments or vortex filaments?

    NASA Astrophysics Data System (ADS)

    Soto, Leopoldo; Pavez, Cristian; Castillo, Fermin; Veloso, Felipe; Moreno, José; Auluck, S. K. H.

    2014-07-01

    Recent observations of an azimuthally distributed array of sub-millimeter size sources of fusion protons and correlation between extreme ultraviolet (XUV) images of filaments with neutron yield in PF-1000 plasma focus have re-kindled interest in their significance. These filaments have been described variously in literature as current filaments and vortex filaments, with very little experimental evidence in support of either nomenclature. This paper provides, for the first time, experimental observations of filaments on a table-top plasma focus device using three techniques: framing photography of visible self-luminosity from the plasma, schlieren photography, and interferometry. Quantitative evaluation of density profile of filaments from interferometry reveals that their radius closely agrees with the collision-less ion skin depth. This is a signature of relaxed state of a Hall fluid, which has significant mass flow with equipartition between kinetic and magnetic energy, supporting the "vortex filament" description. This interpretation is consistent with empirical evidence of an efficient energy concentration mechanism inferred from nuclear reaction yields.

  10. Current filamentation instability in laser wakefield accelerators.

    PubMed

    Huntington, C M; Thomas, A G R; McGuffey, C; Matsuoka, T; Chvykov, V; Kalintchenko, G; Kneip, S; Najmudin, Z; Palmer, C; Yanovsky, V; Maksimchuk, A; Drake, R P; Katsouleas, T; Krushelnick, K

    2011-03-11

    Experiments using an electron beam produced by laser-wakefield acceleration have shown that varying the overall beam-plasma interaction length results in current filamentation at lengths that exceed the laser depletion length in the plasma. Three-dimensional simulations show this to be a combination of hosing, beam erosion, and filamentation of the decelerated beam. This work suggests the ability to perform scaled experiments of astrophysical instabilities. Additionally, understanding the processes involved with electron beam propagation is essential to the development of wakefield accelerator applications. PMID:21469796

  11. Generation of stable overlaps between antiparallel filaments

    E-print Network

    D. Johann; D. Goswami; K. Kruse

    2015-03-26

    During cell division, sister chromatids are segregated by the mitotic spindle, a bipolar assembly of interdigitating antiparallel polar filaments called microtubules. Establishing a stable overlap region is essential for maintenance of bipolarity, but the underlying mechanisms are poorly understood. Using a particle-based stochastic model, we find that the interplay of motors and passive cross linkers can robustly generate partial overlaps between antiparallel filaments. Our analysis shows that motors reduce the overlap in a length-dependent manner, whereas passive cross linkers increase it independently of the length. In addition to maintaining structural integrity, passive cross linkers can thus also have a dynamic role for size regulation.

  12. Nuclear flow in a filamentous fungus

    E-print Network

    Hickey, Patrick C; Read, Nick; Glass, N Louise; Roper, Marcus

    2012-01-01

    The syncytial cells of a filamentous fungus consist of a mass of growing, tube-like hyphae. Each extending tip is fed by a continuous flow of nuclei from the colony interior, pushed by a gradient in turgor pressure. The myco-fluidic flows of nuclei are complex and multidirectional, like traffic in a city. We map out the flows in a strain of the model filamentous fungus {\\it N. crassa} that has been transformed so that nuclei express either hH1-dsRed (a red fluorescent nuclear protein) or hH1-GFP (a green-fluorescent protein) and report our results in a fluid dynamics video.

  13. Infrared Radiation Filament And Metnod Of Manufacture

    DOEpatents

    Johnson, Edward A. (Bedford, MA)

    1998-11-17

    An improved IR radiation source is provided by the invention. A radiation filament has a textured surface produced by seeded ion bombardment of a metal foil which is cut to a serpentine shape and mounted in a windowed housing. Specific ion bombardment texturing techniques tune the surface to maximize emissions in the desired wavelength range and to limit emissions outside that narrow range, particularly at longer wavelengths. A combination of filament surface texture, thickness, material, shape and power circuit feedback control produce wavelength controlled and efficient radiation at much lower power requirements than devices of the prior art.

  14. Myosin binding protein-C activates thin filaments and inhibits thick filaments in heart muscle cells

    PubMed Central

    Kampourakis, Thomas; Yan, Ziqian; Gautel, Mathias; Sun, Yin-Biao; Irving, Malcolm

    2014-01-01

    Myosin binding protein-C (MyBP-C) is a key regulatory protein in heart muscle, and mutations in the MYBPC3 gene are frequently associated with cardiomyopathy. However, the mechanism of action of MyBP-C remains poorly understood, and both activating and inhibitory effects of MyBP-C on contractility have been reported. To clarify the function of the regulatory N-terminal domains of MyBP-C, we determined their effects on the structure of thick (myosin-containing) and thin (actin-containing) filaments in intact sarcomeres of heart muscle. We used fluorescent probes on troponin C in the thin filaments and on myosin regulatory light chain in the thick filaments to monitor structural changes associated with activation of demembranated trabeculae from rat ventricle by the C1mC2 region of rat MyBP-C. C1mC2 induced larger structural changes in thin filaments than calcium activation, and these were still present when active force was blocked with blebbistatin, showing that C1mC2 directly activates the thin filaments. In contrast, structural changes in thick filaments induced by C1mC2 were smaller than those associated with calcium activation and were abolished or reversed by blebbistatin. Low concentrations of C1mC2 did not affect resting force but increased calcium sensitivity and reduced cooperativity of force and structural changes in both thin and thick filaments. These results show that the N-terminal region of MyBP-C stabilizes the ON state of thin filaments and the OFF state of thick filaments and lead to a novel hypothesis for the physiological role of MyBP-C in the regulation of cardiac contractility. PMID:25512492

  15. Cores, Filaments, and Bundles: Hierarchical core formation in the B213 filament in Taurus

    NASA Astrophysics Data System (ADS)

    Hacar, Alvaro; Tafalla, Mario; Kauffmann, Jens; Kovacs, Attila

    2013-07-01

    Characterizing the dense core formation in filaments is a critical step for our understanding of the star formation process within molecular clouds. Using different molecular tracers to study the gas kinematics at different scales and density regimes, we have investigated the dense core formation in the B213/L1495 filament in Taurus, one of the most prominent structures identified in nearby clouds (see Hacar et al 2013, A&A, 554, A55). Our analysis of its internal kinematics demonstrates that this filament is actually a bundle of 35 velocity-coherent filaments, typically with lengths of ˜ 0.5 pc and oscillatory-like and sonic velocity field, each of them exhibiting linear masses close to the expected mass for a filament in hydrostatic equilibrium. Among them, only a small fraction of these filaments (˜1/4) are "fertile" and efficiently fragment forming all the cores identified within this region, while most of them (˜3/4) do not form cores and remain "sterile". Our observations then suggest that core formation in Taurus occurs in two steps. First, 0.5 pc-long velocity-coherent filaments condense out of the cloud gas, probably as a result of the turbulent cascade. After that, the dense cores condense quasi-statically in only those "fertile" filaments that have accumulated enough mass to became gravitational unstable, inheriting their kinematic properties. The formation of these velocity-coherent filaments appears therefore as a critical step on the star formation process being the first subsonic structures formed out of the turbulent regime that dominates the cloud dynamics at large scales.

  16. Six-phase induction machine operating as a stand-alone self-excited induction generator

    E-print Network

    Brest, Université de

    generators are particularly used in small and isolated power plants based on wind turbine or hydroelectric of multiphase induction machines in renewable energy applications such as wind and hydropower. Thus, some exploitation conditions as in wind and hydro energy conversion. The main criteria are simple and rigid

  17. DC Machine

    NSDL National Science Digital Library

    Riaz, Mahmoud

    The effect of the commutator is to produce a fixed spatial distribution of current directions in the armature conductors (shown as blue & green circles) independent of shaft rotation. The field created by these currents (armature reaction) is vertically directed along the quadrature axis. The field established by the excitation of the stator poles is directed along the horizontal direct axis. This package presents computer models of electric machines based on the space vector formulation leading to the assessment of the dynamic performance of open- and closed-loopac and dc drive systems. The Simulink/Matlab implementation is adopted because of its inherent integration of vectorized system representations in block diagram form, of numerical analysis methods, of graphical portrayal of time evolutions of signals combined with the simple realization of the functionality of controllers and power electronic excitations. The development of Simulink models of drive assemblies is a relatively simple task consisting of combining input-output block representation of the various components making up the system; these blocks can readily be reused (utilizing standard copy-and-paste techniques) to modify the system components or the configuration of the system. This approach provides a powerful design tool because of the ease of observing the effects of parameters modifications and of differing system configurations and control strategies.

  18. Ultrasonic evaluation of mechanical properties of thick, multilayered, filament-wound composites

    NASA Technical Reports Server (NTRS)

    Kautz, H. E.

    1987-01-01

    A preliminary investigation is conducted to define capabilities and limitations of ultrasonic and acousto-ultrasonic measurements related to mechanical properties of filament wound graphite/epoxy composite structures. The structures studied are segments of filament wound cylinders formed of multiple layers of hoop and helical windings. The segments consist of 24 to 35 layers and range from 3.02 to 3.34 cm in wall thickness. The resultant structures are anisotropic, heterogeneous, porous, and highly attenuating to ultrasonic frequencies greater than 1 MHz. The segments represent structures to be used for Space Shuttle booster cases.Ultrasonic velocity and acousto-ultrasonic stress wave factor measurement approaches are discussed. Correlations among velocity, density, and porosity, and between the acousto-ultrasonic stress wave factor and interlaminar shear strength are presented.

  19. Variabilities detected by acoustic emission from filament-wound Aramid fiber/epoxy composite pressure vessels

    NASA Technical Reports Server (NTRS)

    Hamstad, M. A.

    1978-01-01

    Two hundred and fifty Aramid fiber/epoxy pressure vessels were filament-wound over spherical aluminum mandrels under controlled conditions typical for advanced filament-winding. A random set of 30 vessels was proof-tested to 74% of the expected burst pressure; acoustic emission data were obtained during the proof test. A specially designed fixture was used to permit in situ calibration of the acoustic emission system for each vessel by the fracture of a 4-mm length of pencil lead (0.3 mm in diameter) which was in contact with the vessel. Acoustic emission signatures obtained during testing showed larger than expected variabilities in the mechanical damage done during the proof tests. To date, identification of the cause of these variabilities has not been determined.

  20. Ultrasonic evaluation of mechanical properties of thick, multilayered, filament wound composites

    NASA Technical Reports Server (NTRS)

    Kautz, H. E.

    1985-01-01

    A preliminary investigation is conducted to define capabilities and limitations of ultrasonic and acousto-ultrasonic measurements related to mechanical properties of filament wound graphite/epoxy composite structures. The structures studied are segments of filament wound cylinders formed of multiple layers of hoop and helical windings. The segments consist of 24 to 35 layers and range from 3.02 to 3.34 cm in wall thickness. The resultant structures are anisotropic, heterogeneous, porous, and highly attenuating to ultrasonic frequencies greater than 1 MHz. The segments represent structures to be used for space shuttle booster cases. Ultrasonic velocity and acousto-ultrasonic stress wave factor measurement approaches are discussed. Correlations among velocity, density, and porosity, and between the acousto-ultrasonic stress wave factor and interlaminar shear strength are presented.

  1. Residual stress analysis in forming process of filament wound thick-walled CFRP pipes

    SciTech Connect

    Kondo, Toshimi [Nagaoka College of Technology (Japan). Dept. of Mechanical Engineering; Sekine, Hideki [Tohoku Univ., Sendai (Japan). Dept. of Aeronautics and Space Engineering; Nakano, Kunio [Japan Space Utilization Center, Tokyo (Japan)

    1995-11-01

    Residual stress analysis for the cracking phenomenon of filament would thick-walled CFRP pipes, which frequently occurs in the forming process of curing and thermal cycling through the course of the wet filament winding, was made from both the experimental and theoretical points of view. A simple analytical model to study the cracking in the CFRP pipes was proposed. The pipes are multilayered and reinforced in the axial and circumferential directions alternatively by carbon fibers. Taking account of the anisotropy of mechanical and thermal properties including the shrinkage strain, which depend considerably on the temperature, the residual stresses in the CFRP pipes were elucidated in the forming process, particularly, in cooling of the cure process.

  2. One Half Million Mile Solar Filament - Duration: 0:19.

    NASA Video Gallery

    NASAâ??s Solar Dynamics Observatory (SDO) captures a very long, whip-like solar filament extending over half a million miles in a long arc above the sunâ??s surface. Filaments are cooler clouds of ...

  3. SDO Watches Giant Filament on the Sun - Duration: 13 seconds.

    NASA Video Gallery

    A snaking, extended filament of solar material currently lies on the front of the sun-- some 1 million miles across from end to end. Filaments are clouds of solar material suspended above the sun b...

  4. GRAVITATIONAL INFALL ONTO MOLECULAR FILAMENTS. II. EXTERNALLY PRESSURIZED CYLINDERS

    SciTech Connect

    Heitsch, Fabian, E-mail: fheitsch@unc.edu [Department of Physics and Astronomy, University of North Carolina Chapel Hill, Chapel Hill, NC 27599-3255 (United States)

    2013-10-10

    Two aspects of the evolution of externally pressurized, hydrostatic filaments are discussed. (1) The free-fall accretion of gas onto such a filament will lead to filament parameters (specifically, FWHM-column-density relations) inconsistent with the observations of Arzoumanian et al., except for two cases: for low-mass, isothermal filaments, agreement is found as in the analysis by Fischera and Martin. Magnetized cases, for which the field scales weakly with the density as B?n {sup 1/2}, also reproduce observed parameters. (2) Realistically, the filaments will be embedded not only in gas of non-zero pressure, but also of non-zero density. Thus, the appearance of sheet-embedded filaments is explored. Generating a grid of filament models and comparing the resulting column density ratios and profile shapes with observations suggests that the three-dimensional filament profiles are intrinsically flatter than isothermal, beyond projection and evolution effects.

  5. Dynamics of filament formation in a Kerr medium

    SciTech Connect

    Centurion, Martin [Physics Department, California Institute of Technology, Pasadena, California 91125 (United States); Pu Ye; Tsang, Mankei; Psaltis, Demetri [Department of Electrical Engineering, California Institute of Technology, Pasadena, California 91125 (United States)

    2005-06-15

    We have studied the large-scale beam breakup and filamentation of femtosecond pulses in a Kerr medium. We have experimentally monitored the formation of stable light filaments, conical emission, and interactions between filaments. Three major stages lead to the formation of stable light filaments: First the beam breaks up into a pattern of connected lines (constellation), then filaments form on the constellations, and finally the filaments release a fraction of their energy through conical emission. We observed a phase transition to a faster filamentation rate at the onset of conical emission. We attribute this to the interaction of conical emissions with the constellation which creates additional filaments. Numerical simulations show good agreement with the experimental results.

  6. The genome sequence of the filamentous fungus Neurospora crassa

    E-print Network

    Kellis, Manolis

    The genome sequence of the filamentous fungus Neurospora crassa James E. Galagan1 , Sarah E. Calvo1 is a multicellular filamentous fungus, it has also provided a system to study cellular differentiation

  7. Questions Concerning the Disconnection and Eruption of Filaments and CMEs

    NASA Technical Reports Server (NTRS)

    Kucera, Theresa

    2007-01-01

    Reviews examples of eruptions and failed eruptions of filaments and CMEs and review questions concerning the processes and mechanisms involved. Where and how does disconnection occur? What can we learn (if anything!) about CME eruptions by observing related filament eruptions?

  8. DRILLING MACHINES GENERAL INFORMATION

    E-print Network

    Gellman, Andrew J.

    or angled drilled. The base of the drilling machine supports the entire machine and when bolted to the floor parts. Follow the manufacturer's manual for proper lubrication methods. Clean each machine after useTC 9-524 Chapter 4 DRILLING MACHINES GENERAL INFORMATION PURPOSE This chapter contains basic

  9. Wind turbine generator rotor blade concepts with low cost potential

    NASA Technical Reports Server (NTRS)

    Sullivan, T. L.; Cahill, T. P.; Griffee, D. G., Jr.; Gewehr, H. W.

    1977-01-01

    Four processed for producing blades are examined. Two use filament winding techniques and two involve filling a mold or form to produce all or part of a blade. The processes are described and a comparison is made of cost, material properties, design and free vibration characteristics. Conclusions are made regarding the feasibility of each process to produce low cost, structurally adequate blades.

  10. SMART Observation of Magnetic Helicity in Solar Filaments

    NASA Astrophysics Data System (ADS)

    Hagino, M.; Kitai, R.; Shibata, K.

    2006-08-01

    We examined the magnetic helicity of solar filaments from their structure in the chromosphere and corona. The H-alpha telescope of the Solar Magnetic Activity Research Telescope (SMART) observed 239 intermediate filaments from 2005 July 1 to 2006 May 15. The intermediate filament usually locates between two active regions. Using these images, we identified the filament spine and its barbs, and determined the chromospheric filament helicity from the mean angle between each barbs and a spine. We found that 71% (78 of 110) of intermediate filaments in the northern hemisphere are negative helicity and 67% (87 of 129) of filaments in the southern hemisphere are positive, which agreed with the well-known hemispheric tendency of the magnetic helicity. Additionally, we studied the coronal helicity of intermediate filaments. The coronal filament helicity is defined as the crossing angle of threads formed a filament. The helicity pattern of coronal filaments obtained with EIT/SOHO 171A also shows the helicity hemispheric tendency. Namely, 65% (71 of 110) of coronal filaments in the northern hemisphere exhibit negative helicity and the 65% (84 of 129) of filaments in the southern hemisphere show negative helicity. These data were observed in the same day with the SMART H-alpha data. Moreover, we found 12 filament eruptions in our data. The 7 of 12 filaments show the clear opposite sign of the hemispheric tendency of the magnetic helicity. The helicity seems to be change during temporal evolution. This results suggest that filament instability may be driven by the opposite sign helicity injection from the foot point of the barb.

  11. A new wind energy conversion system

    NASA Technical Reports Server (NTRS)

    Smetana, F. O.

    1975-01-01

    It is presupposed that vertical axis wind energy machines will be superior to horizontal axis machines on a power output/cost basis and the design of a new wind energy machine is presented. The design employs conical cones with sharp lips and smooth surfaces to promote maximum drag and minimize skin friction. The cones are mounted on a vertical axis in such a way as to assist torque development. Storing wind energy as compressed air is thought to be optimal and reasons are: (1) the efficiency of compression is fairly high compared to the conversion of mechanical energy to electrical energy in storage batteries; (2) the release of stored energy through an air motor has high efficiency; and (3) design, construction, and maintenance of an all-mechanical system is usually simpler than for a mechanical to electrical conversion system.

  12. Filament eruption with apparent reshuffle of endpoints

    E-print Network

    Filippov, Boris

    2014-01-01

    Filament eruption on 30 April - 1 May 2010, which shows the reconnection of one filament leg with a region far away from its initial position, is analyzed. Observations from three viewpoints are used for as precise as possible measurements of endpoint coordinates. The northern leg of the erupting prominence loop 'jumps' laterally to the latitude lower than the latitude of the originally southern endpoint. Thus, the endpoints reshuffled their positions in the limb view. Although this behaviour could be interpreted as the asymmetric zipping-like eruption, it does not look very likely. It seems more likely to be reconnection of the flux-rope field lines in its northern leg with ambient coronal magnetic field lines rooted in a quiet region far from the filament. From calculations of coronal potential magnetic field, we found that the filament before the eruption was stable for vertical displacements, but was liable to violation of the horizontal equilibrium. This is unusual initiation of an eruption with combinat...

  13. Filament-wound composite vessel materials technology

    NASA Technical Reports Server (NTRS)

    Lark, R. F.

    1973-01-01

    Review of recent developments in advanced filament-wound fiber/resin composite vessel technology for cryogen and high-pressure gas containment applications. Design and fabrication procedures have been developed for small-diameter closed-end vessels equipped with thin elastomeric or thin metallic liners. Specific results are discussed.

  14. SECONDARY METABOLIC GENE CLUSTERS IN FILAMENTOUS FUNGI

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Filamentous fungi produce a number of secondary metabolic compounds that have been shown to be both of great value (i.e. antibiotics and anti-hypercholesterolemics) and great harm (i.e. aflatoxins and trichothecenes). The genes responsible for producing the secondary metabolite are often clustered ...

  15. Magnetic field strength of active region filaments

    NASA Astrophysics Data System (ADS)

    Kuckein, C.; Centeno, R.; Martínez Pillet, V.; Casini, R.; Manso Sainz, R.; Shimizu, T.

    2009-07-01

    Aims: We study the vector magnetic field of a filament observed over a compact active region neutral line. Methods: Spectropolarimetric data acquired with TIP-II (VTT, Tenerife, Spain) of the 10 830 Å spectral region provide full Stokes vectors that were analyzed using three different methods: magnetograph analysis, Milne-Eddington inversions, and PCA-based atomic polarization inversions. Results: The inferred magnetic field strengths in the filament are around 600-700 G by all these three methods. Longitudinal fields are found in the range of 100-200 G whereas the transverse components become dominant, with fields as high as 500-600 G. We find strong transverse fields near the neutral line also at photospheric levels. Conclusions: Our analysis indicates that strong (higher than 500 G, but below kG) transverse magnetic fields are present in active region filaments. This corresponds to the highest field strengths reliably measured in these structures. The profiles of the helium 10 830 Å lines observed in this active region filament are dominated by the Zeeman effect.

  16. Light sources based on semiconductor current filaments

    DOEpatents

    Zutavern, Fred J. (Albuquerque, NM); Loubriel, Guillermo M. (Albuquerque, NM); Buttram, Malcolm T. (Sandia Park, NM); Mar, Alan (Albuquerque, NM); Helgeson, Wesley D. (Albuquerque, NM); O'Malley, Martin W. (Edgewood, NM); Hjalmarson, Harold P. (Albuquerque, NM); Baca, Albert G. (Albuquerque, NM); Chow, Weng W. (Cedar Crest, NM); Vawter, G. Allen (Albuquerque, NM)

    2003-01-01

    The present invention provides a new type of semiconductor light source that can produce a high peak power output and is not injection, e-beam, or optically pumped. The present invention is capable of producing high quality coherent or incoherent optical emission. The present invention is based on current filaments, unlike conventional semiconductor lasers that are based on p-n junctions. The present invention provides a light source formed by an electron-hole plasma inside a current filament. The electron-hole plasma can be several hundred microns in diameter and several centimeters long. A current filament can be initiated optically or with an e-beam, but can be pumped electrically across a large insulating region. A current filament can be produced in high gain photoconductive semiconductor switches. The light source provided by the present invention has a potentially large volume and therefore a potentially large energy per pulse or peak power available from a single (coherent) semiconductor laser. Like other semiconductor lasers, these light sources will emit radiation at the wavelength near the bandgap energy (for GaAs 875 nm or near infra red). Immediate potential applications of the present invention include high energy, short pulse, compact, low cost lasers and other incoherent light sources.

  17. Drebrin-induced Stabilization of Actin Filaments*

    PubMed Central

    Mikati, Mouna A.; Grintsevich, Elena E.; Reisler, Emil

    2013-01-01

    Drebrin is a mammalian neuronal protein that binds to and organizes filamentous actin (F-actin) in dendritic spines, the receptive regions of most excitatory synapses that play a crucial role in higher brain functions. Here, the structural effects of drebrin on F-actin were examined in solution. Depolymerization and differential scanning calorimetry assays show that F-actin is stabilized by the binding of drebrin. Drebrin inhibits depolymerization mainly at the barbed end of F-actin. Full-length drebrin and its C-terminal truncated constructs were used to clarify the domain requirements for these effects. The actin binding domain of drebrin decreases the intrastrand disulfide cross-linking of Cys-41 (in the DNase I binding loop) to Cys-374 (C-terminal) but increases the interstrand disulfide cross-linking of Cys-265 (hydrophobic loop) to Cys-374 in the yeast mutants Q41C and S265C, respectively. We also demonstrate, using solution biochemistry methods and EM, the rescue of filament formation by drebrin in different cases of longitudinal interprotomer contact perturbation: the T203C/C374S yeast actin mutant and grimelysin-cleaved skeletal actin (between Gly-42 and Val-43). Additionally, we show that drebrin rescues the polymerization of V266G/L267G, a hydrophobic loop yeast actin mutant with an impaired lateral interface formation between the two filament strands. Overall, our data suggest that drebrin stabilizes actin filaments through its effect on their interstrand and intrastrand contacts. PMID:23696644

  18. Radial interchange motions of plasma filaments

    SciTech Connect

    Garcia, O. E.; Bian, N. H.; Fundamenski, W. [Association EURATOM-Risoe National Laboratory, P.O. Box 49, OPL-128 Risoe, DK-4000 Roskilde (Denmark); School of Physics and Astronomy, University of Manchester, Manchester M60 1QD (United Kingdom); EURATOM/UKAEA Fusion Association, Culham Science Centre, Abingdon OX14 3DB (United Kingdom)

    2006-08-15

    Radial convection of isolated filamentary structures due to interchange motions in magnetized plasmas is investigated. Following a basic discussion of vorticity generation, ballooning, and the role of sheaths, a two-field interchange model is studied by means of numerical simulations on a biperiodic domain perpendicular to the magnetic field. It is demonstrated that a blob-like plasma structure develops dipolar vorticity and electrostatic potential fields, resulting in rapid radial acceleration and formation of a steep front and a trailing wake. While the dynamical evolution strongly depends on the amount of collisional diffusion and viscosity, the structure travels a radial distance many times its initial size in all parameter regimes in the absence of sheath dissipation. In the ideal limit, there is an inertial scaling for the maximum radial velocity of isolated filaments. This velocity scales as the acoustic speed times the square root of the structure size relative to the length scale of the magnetic field. The plasma filament eventually decelerates due to mixing and collisional dissipation. Finally, the role of sheath dissipation is investigated. When included in the simulations, it significantly reduces the radial velocity of isolated filaments. The results are discussed in the context of convective transport in scrape-off layer plasmas, comprising both blob-like structures in low confinement modes and edge localized mode filaments in unstable high confinement regimes.

  19. Membrane-induced bundling of actin filaments

    E-print Network

    Geissler, Phillip

    actin networks containing actin, neural-Wiscott Aldrich Syndrome Protein (N-WASP), and the seven.1038/nphys1071 Dynamic interplay between the plasma membrane and underlying cytoskeleton is essential­protein interactions that branch, crosslink and bundle filaments into networks that interact with the membrane

  20. Giant molecular filaments in the Milky Way

    NASA Astrophysics Data System (ADS)

    Ragan, S. E.; Henning, Th.; Tackenberg, J.; Beuther, H.; Johnston, K. G.; Kainulainen, J.; Linz, H.

    2014-08-01

    Throughout the Milky Way, molecular clouds typically appear filamentary, and mounting evidence indicates that this morphology plays an important role in star formation. What is not known is to what extent the dense filaments most closely associated with star formation are connected to the surrounding diffuse clouds up to arbitrarily large scales. How are these cradles of star formation linked to the Milky Way's spiral structure? Using archival Galactic plane survey data, we have used multiple datasets in search of large-scale, velocity-coherent filaments in the Galactic plane. In this paper, we present our methods employed to identify coherent filamentary structures first in extinction and confirmed using Galactic Ring Survey data. We present a sample of seven giant molecular filaments (GMFs) that have lengths on the order of ~100 pc, total masses of 104-105 M?, and exhibit velocity coherence over their full length. The GMFs we study appear to be inter-arm clouds and may be the Milky Way analogs to spurs observed in nearby spiral galaxies. We find that between 2 and 12% of the total mass (above ~1020 cm-2) is "dense" (above 1022 cm-2), where filaments near spiral arms in the Galactic midplane tend to have higher dense gas mass fractions than those further from the arms. Appendix A is available in electronic form at http://www.aanda.org

  1. Optical Analysis of Plasma Ball Filaments

    NASA Astrophysics Data System (ADS)

    Vasquez, Scott; Campanell, Michael; Zweben, Stewart J.

    2009-11-01

    Optical methods were used to study the properties of a commercial plasma ball. Using spectrometry, the gas composition of the plasma ball was analyzed. Spectra of known gases were compared with the plasma ball spectrum, confirming the presence of Neon and Xenon. The spectra indicate that faint amounts of Nitrogen may also be present. Photomultiplier tubes were used to measure the radial velocity of filaments in the plasma ball. Digital oscilloscope traces produced with the photomultiplier tubes show that the filaments propagate radially at an average velocity on the order of 10,000 m/s. Furthermore, these traces suggest that that the radial velocity decreases with increasing distance from the electrode. A hotwired commercial plasma ball, with connections for a pulse generator and Variac has been built, allowing for the study of filament velocity at different operating voltages and frequencies. A custom plasma ball whose parameters, such as gas mixture, pressure, electrode configuration, and applied voltage waveform can be varied, has also been constructed. Analysis of the custom plasma ball will give further insight to how such parameters affect the plasma ball's filament formation and behavior. Initial results will be presented. Ultimately, this custom plasma ball, along with the methods used to measure its properties, will be incorporated into an undergraduate physics lab.

  2. Stable limited filamentous bulking through keeping the competition between floc-formers and filaments in balance.

    PubMed

    Guo, Jianhua; Peng, Yongzhen; Wang, Shuying; Yang, Xiong; Wang, Zhongwei; Zhu, Ao

    2012-01-01

    Limited filamentous bulking (LFB) was proposed to save aeration energy consumption and enhance the capacity of filaments to degrade substrates with low concentrations in activated sludge systems. Operational parameters favorable for maintaining the LFB state were investigated in an anoxic-oxic reactor treating domestic wastewater. The experiments showed that the LFB state would deteriorate with sharply decreasing temperature, reducing substrate gradients or removing anoxic zones. The balance between filaments and floc-formers could be achieved by controlling dissolved oxygen and sludge loading rates to be in optimal ranges. Eikelboom Type 0041 and CandidatusMicrothrix parvicella were the filamentous bacteria responsible for the LFB state. However, the excess growth of Eikelboom Type 021N and Sphaerotilus natans were observed when serious bulking occurred under low substrate gradients. It was demonstrated that stable maintenance of LFB for energy saving was feasible by process control and optimization. PMID:22029958

  3. Factors affecting filamentation in Candida albicans: changes in respiratory activity of Candida albicans during filamentation.

    PubMed Central

    Land, G A; McDonald, W C; Stjernholm, R L; Friedman, L

    1975-01-01

    Glucose metabolism and respiration of Candida albicans were compared under conditions which permitted either maximal filamentous or maximal yeast growth. Changes in metabolism were monitored by comparing the quantities of ethanol produced, CO2 evolved, and oxygen consumed. Filamenting cultures produced more ethanol and less CO2 than yeasts, with oxygen consumption in the former concomitantly slower than that of the latter. Studies involving cofactors and inhibitors associated with electron transport imply that a transfer of electrons away from flavoprotein is required for maintenance of yeast morphology. Conditions consistent with a buildup of reduced flavoprotein, however, favored filament formation. These changes were expressed metabolically as a shift from an aerobic to a fermentative metabolism. The results presented are consistent with hypotheses correlating filament production with changes in carbohydrate metabolism and an interruption of electron transfer within the cell. PMID:1095490

  4. Smoke Sheets and Vortex Filaments with Flexible Reconnection

    E-print Network

    ). Fluid motion is simulated using vortex filaments (center) and the smoke surface is tracked usingSmoke Sheets and Vortex Filaments with Flexible Reconnection Alfred Barnat CMU-CS-11-123 July 2011, Smoke, Vorticity, Vortex Filaments #12;Abstract Smoke is one of the core phenomena which fluid

  5. Multiple tail domain interactions stabilize nonmuscle myosin II bipolar filaments

    E-print Network

    Prehoda, Ken

    Multiple tail domain interactions stabilize nonmuscle myosin II bipolar filaments Derek Ricketson derives from its assembly into bipolar filaments. The coiled-coil tail domain of the myosin II heavy chain and assembly domain in stabilizing myosin bipolar filaments. contraction cytokinesis macromolecular assembly

  6. Rotational model for actin filament alignment by myosin.

    PubMed

    Miller, Callie J; Bard Ermentrout, G; Davidson, Lance A

    2012-05-01

    Dynamics of the actomyosin cytoskeleton regulate cellular processes such as secretion, cell division, cell motility, and shape change. Actomyosin dynamics are themselves regulated by proteins that control actin filament polymerization and depolymerization, and myosin motor contractility. Previous theoretical work has focused on translational movement of actin filaments but has not considered the role of filament rotation. Since filament rotational movements are likely sources of forces that direct cell shape change and movement we explicitly model the dynamics of actin filament rotation as myosin II motors traverse filament pairs, drawing them into alignment. Using Monte Carlo simulations we find an optimal motor velocity for alignment of actin filaments. In addition, when we introduce polymerization and depolymerization of actin filaments, we find that alignment is reduced and the filament arrays exist in a stable, asynchronous state. Further analysis with continuum models allows us to investigate factors contributing to the stability of filament arrays and their ability to generate force. Interestingly, we find that two different morphologies of F-actin arrays generate the same amount of force. We also identify a phase transition to alignment which occurs when either polymerization rates are reduced or motor velocities are optimized. We have extended our analysis to include a maximum allowed stretch of the myosin motors, and a non-uniform length for filaments leading to little change in the qualitative results. Through the integration of simulations and continuum analysis, we are able to approach the problem of understanding rotational alignment of actin filaments by myosin II motors. PMID:22326473

  7. Motility and Chemotaxis of Filamentous Cells of Escherichia coli

    PubMed Central

    Maki, Nazli; Gestwicki, Jason E.; Lake, Ellen M.; Kiessling, Laura L.; Adler, Julius

    2000-01-01

    Filamentous cells of Escherichia coli can be produced by treatment with the antibiotic cephalexin, which blocks cell division but allows cell growth. To explore the effect of cell size on chemotactic activity, we studied the motility and chemotaxis of filamentous cells. The filaments, up to 50 times the length of normal E. coli organisms, were motile and had flagella along their entire lengths. Despite their increased size, the motility and chemotaxis of filaments were very similar to those properties of normal-sized cells. Unstimulated filaments of chemotactically normal bacteria ran and stopped repeatedly (while normal-sized bacteria run and tumble repeatedly). Filaments responded to attractants by prolonged running (like normal-sized bacteria) and to repellents by prolonged stopping (unlike normal-sized bacteria, which tumble), until adaptation restored unstimulated behavior (as occurs with normal-sized cells). Chemotaxis mutants that always ran when they were normal sized always ran when they were filament sized, and those mutants that always tumbled when they were normal sized always stopped when they were filament sized. Chemoreceptors in filaments were localized to regions both at the poles and at intervals along the filament. We suggest that the location of the chemoreceptors enables the chemotactic responses observed in filaments. The implications of this work with regard to the cytoplasmic diffusion of chemotaxis components in normal-sized and filamentous E. coli are discussed. PMID:10894745

  8. Calibration and Temperature Profile of a Tungsten Filament Lamp

    ERIC Educational Resources Information Center

    de Izarra, Charles; Gitton, Jean-Michel

    2010-01-01

    The goal of this work proposed for undergraduate students and teachers is the calibration of a tungsten filament lamp from electric measurements that are both simple and precise, allowing to determine the temperature of tungsten filament as a function of the current intensity. This calibration procedure was first applied to a conventional filament

  9. Direct observation of subunit exchange along mature vimentin intermediate filaments.

    PubMed

    Nöding, Bernd; Herrmann, Harald; Köster, Sarah

    2014-12-16

    Actin filaments, microtubules, and intermediate filaments (IFs) are central elements of the metazoan cytoskeleton. At the molecular level, the assembly mechanism for actin filaments and microtubules is fundamentally different from that of IFs. The former two types of filaments assemble from globular proteins. By contrast, IFs assemble from tetrameric complexes of extended, half-staggered, and antiparallel oriented coiled-coils. These tetramers laterally associate into unit-length filaments; subsequent longitudinal annealing of unit-length filaments yields mature IFs. In vitro, IFs form open structures without a fixed number of tetramers per cross-section along the filament. Therefore, a central question for the structural biology of IFs is whether individual subunits can dissociate from assembled filaments and rebind at other sites. Using the fluorescently labeled IF-protein vimentin for assembly, we directly observe and quantitatively determine subunit exchange events between filaments as well as with soluble vimentin pools. Thereby we demonstrate that the cross-sectional polymorphism of donor and acceptor filaments plays an important role. We propose that in segments of donor filaments with more than the standard 32 molecules per cross-section, subunits are not as tightly bound and are predisposed to be released from the filament. PMID:25517157

  10. Superconducting generators for large off shore wind turbines 

    E-print Network

    Keysan, Ozan

    2014-06-30

    This thesis describes four novel superconducting machine concepts, in the pursuit of finding a suitable design for large offshore wind turbines. The designs should be reliable, modular and light-weight. The main novelty ...

  11. Large Wind Turbine Design Characteristics and R and D Requirements

    NASA Technical Reports Server (NTRS)

    Lieblein, S. (editor)

    1979-01-01

    Detailed technical presentations on large wind turbine research and development activities sponsored by public and private organizations are presented. Both horizontal and vertical axis machines are considered with emphasis on their structural design.

  12. Wind Generator

    NSDL National Science Digital Library

    The Concord Consortium

    2012-05-21

    Windmills have been used for hundreds of years to collect energy from the wind in order to pump water, grind grain, and more recently generate electricity. There are many possible designs for the blades of a wind generator and engineers are always trying new ones. Design and test your own wind generator, then try to improve it by running a small electric motor connected to a voltage sensor.

  13. Modeling and simulation of an induction drive with application to a small wind turbine generator

    Microsoft Academic Search

    L. Tamas; Z. Szekely

    2008-01-01

    Among renewable energies the solution of utilizing wind energy conversion systems is now in a growing trend. A valid choice for operation of such systems may be the use of the induction machine. This study presents modeling and simulation of a stand-alone induction drive with application to a small wind turbine generator system. The model of the induction machine is

  14. A new monitoring system for wind turbines with doubly-fed induction generators

    Microsoft Academic Search

    A. Yazidi; G. A. Capolino; F. Filippetti; D. Casadei

    2006-01-01

    For modern large wind farms, it is interesting to design an efficient diagnosis system oriented to wind turbine generators based on doubly-fed induction machine (DFIM). Intensive research efforts have been focused on the signature analysis to predict or to detect electrical and mechanical faults in induction machines. Different signals can be used such as voltages, currents or stray flux. In

  15. DOE large horizontal axis wind turbine development at NASA Lewis Research Center

    NASA Technical Reports Server (NTRS)

    Linscott, B. S.

    1982-01-01

    Large wind turbine activities managed by NASA Lewis are reviewed. These activities include results from the first and second generation field machines (Mod-OA, -1, and -2), the status of the Department of Interior WTS-4 machine for which NASA is responsible for technical management, and the design phase of the third generation wind turbines (Mod-5).

  16. The Internal Fault Analysis of Brushless DC Motors Based on the Winding Function Theory

    Microsoft Academic Search

    Taehyung Kim; Hyung-Woo Lee; Sangshin Kwak

    2009-01-01

    This paper presents a new approach to analyze the stator inter-turn fault of a brushless dc motor. It is essential to analyze the behavior of the machine under internal faults and design appropriate protection systems to avoid expensive failures that might occur to the machine in the near future. The winding functions and inductance change of stator windings under internal

  17. Metallic wear debris sensors: promising developments in failure prevention for wind turbine gearsets and similar components

    Microsoft Academic Search

    Jack Poley; Michael Dines

    2011-01-01

    Wind turbines are frequently located in remote, hard-to-reach locations, making it difficult to apply traditional oil analysis sampling of the machine's critical gearset at timely intervals. Metal detection sensors are excellent candidates for sensors designed to monitor machine condition in vivo. Remotely sited components, such as wind turbines, therefore, can be comfortably monitored from a distance. Online sensor technology has

  18. Synthesis of high performance PM motors with concentrated windings

    Microsoft Academic Search

    Jéröme Cros; Philippe Viarouge

    2002-01-01

    The windings concentrated around the teeth offer obvious advantages for the electrical machines with radial air-gap, because the volume of copper used in the end-windings can be reduced. The Joule losses are decreased, and the efficiency is improved. These machines are still limited to applications of sub-fractional power and they generally present a reduced number of phases. In the three-phase

  19. Spontaneous Symmetry Breaking of a Hinged Flapping Filament Generates Lift

    NASA Astrophysics Data System (ADS)

    Bagheri, Shervin; Mazzino, Andrea; Bottaro, Alessandro

    2012-10-01

    Elastic filamentous structures found on swimming and flying organisms are versatile in function, rendering their precise contribution to locomotion difficult to assess. We show in this Letter that a single passive filament hinged on the rear of a bluff body placed in a stream can generate a net lift force without increasing the mean drag force on the body. This is a consequence of spontaneous symmetry breaking in the filament’s flapping dynamics. The phenomenon is related to a resonance between the frequency associated with the von Kármán vortex street developing behind the bluff body and the natural frequency of the free bending vibrations of the filament.

  20. Transition from linear- to nonlinear-focusing regime in filamentation

    PubMed Central

    Lim, Khan; Durand, Magali; Baudelet, Matthieu; Richardson, Martin

    2014-01-01

    Laser filamentation in gases is often carried out in the laboratory with focusing optics to better stabilize the filament, whereas real-world applications of filaments frequently involve collimated or near-collimated beams. It is well documented that geometrical focusing can alter the properties of laser filaments and, consequently, a transition between a collimated and a strongly focused filament is expected. Nevertheless, this transition point has not been identified. Here, we propose an analytical method to determine the transition, and show that it corresponds to an actual shift in the balance of physical mechanisms governing filamentation. In high-NA conditions, filamentation is primarily governed by geometrical focusing and plasma effects, while the Kerr nonlinearity plays a more significant role as NA decreases. We find the transition between the two regimes to be relatively insensitive to the intrinsic laser parameters, and our analysis agrees well with a wide range of parameters found in published literature. PMID:25434678

  1. Ultraminiature broadband light source with spiral shaped filament

    NASA Technical Reports Server (NTRS)

    Tuma, Margaret L. (Inventor); Collura, Joseph S. (Inventor); Helvajian, Henry (Inventor); Pocha, Michael D. (Inventor); Meyer, Glenn A. (Inventor); McConaghy, Charles F. (Inventor); Olsen, Barry L. (Inventor); Hansen, William W (Inventor)

    2012-01-01

    An ultraminiature light source using a double-spiral shaped tungsten filament includes end contact portions which are separated to allow for radial and length-wise unwinding of the spiral. The double-spiral filament is spaced relatively far apart at the end portions thereof so that contact between portions of the filament upon expansion is avoided. The light source is made by fabricating a double-spiral ultraminiature tungsten filament from tungsten foil and housing the filament in a ceramic package having a reflective bottom and a well wherein the filament is suspended. A vacuum furnace brazing process attaches the filament to contacts of the ceramic package. Finally, a cover with a transparent window is attached onto the top of the ceramic package by solder reflow in a second vacuum furnace process to form a complete hermetically sealed package.

  2. Extreme Kicking Machine

    NSDL National Science Digital Library

    2012-08-20

    In this design challenge activity follow up to "Kicking Machine", learners add a hands-free feature to their Kicking Machine. Learners modify their kicking machine to have it either release the pendulum or rubber band while standing three feet away or have it automatically feed balls into the kicking machine, one after another. They must figure out how to integrate the new feature into the existing structure and use the design process to make sure the modified kicking machine works properly. Educators can use this activity to demonstrate simple machines and kinetic/potential energy.

  3. Wind Engineering

    NASA Technical Reports Server (NTRS)

    1983-01-01

    Dr. Jack Cermak, Director of Fluid Dynamics and Diffusion Laboratory, developed the first wind tunnel to simulate the changing temperatures, directions and velocities of natural winds. In this work, Cermak benefited from NASA technology related to what is known as the atmospheric boundary layer (ABL).

  4. Wind energy.

    PubMed

    Leithead, W E

    2007-04-15

    From its rebirth in the early 1980s, the rate of development of wind energy has been dramatic. Today, other than hydropower, it is the most important of the renewable sources of power. The UK Government and the EU Commission have adopted targets for renewable energy generation of 10 and 12% of consumption, respectively. Much of this, by necessity, must be met by wind energy. The US Department of Energy has set a goal of 6% of electricity supply from wind energy by 2020. For this potential to be fully realized, several aspects, related to public acceptance, and technical issues, related to the expected increase in penetration on the electricity network and the current drive towards larger wind turbines, need to be resolved. Nevertheless, these challenges will be met and wind energy will, very likely, become increasingly important over the next two decades. An overview of the technology is presented. PMID:17272245

  5. A neutral-point clamped converter system for direct-drive variable-speed wind power unit

    Microsoft Academic Search

    Amirnaser Yazdani; Reza Iravani

    2006-01-01

    Recent and ongoing developments in wind turbine technology indicate a trend towards utilization of high capacity (e.g., up to 5 MW) wind power units in large wind farms. Higher capacity of the wind turbine necessitates operation of the corresponding electric machine and the static converter system at higher voltages. This paper presents a neutral point diode clamped (NPC) converter system

  6. Experiments on the propagation of plasma filaments.

    PubMed

    Katz, Noam; Egedal, Jan; Fox, Will; Le, Ari; Porkolab, Miklos

    2008-07-01

    We investigate experimentally the motion and structure of isolated plasma filaments propagating through neutral gas. Plasma filaments, or "blobs," arise from turbulent fluctuations in a range of plasmas. Our experimental geometry is toroidally symmetric, and the blobs expand to a larger major radius under the influence of a vertical electric field. The electric field, which is caused by nabla B and curvature drifts in a 1/R magnetic field, is limited by collisional damping on the neutral gas. The blob's electrostatic potential structure and the resulting E x B flow field give rise to a vortex pair and a mushroom shape, which are consistent with nonlinear plasma simulations. We observe experimentally this characteristic mushroom shape for the first time. We also find that the blob propagation velocity is inversely proportional to the neutral density and decreases with time as the blob cools. PMID:18764120

  7. Filament-wound composite vessels material technology

    NASA Technical Reports Server (NTRS)

    Lark, R. F.

    1973-01-01

    Programs are reviewed that were conducted to establish a technology base for applying advanced fibers or resins to high performance filament-wound pressure vessels for containment of cryogens and high pressure gases. Materials evaluated included boron, graphite, PRD 49-1 and 3/epoxy and S-glass/polyimide composites. Closed-end cylindrical, and oblate spheroid-shaped vessels were fabricated in 4- and 8-inch diameter sizes. Vessels were subjected to single-cycle burst, low-cycle fatigue, and sustained loading tests over a -423 F to room temperature range for epoxy composites and a -423 to 500 F temperature range for the polyimide composites. Vessels tested at cryogenic and/or 500 F had thin (3 to 20 mils) metallic liners whereas vessels tested at room temperature had elastomeric liners. Correlations between acoustic emissions and burst and cyclic properties of PRD 49-1 filament-wound vessels are discussed.

  8. Three Dimension Filamentous Human Cardiac Tissue Model

    PubMed Central

    Ma, Zhen; Koo, Sangmo; Finnegan, Micaela A.; Loskill, Peter; Huebsch, Nathaniel; Marks, Natalie C.; Conklin, Bruce R.; Grigoropoulos, Costas P.; Healy, Kevin E.

    2013-01-01

    A human in vitro cardiac tissue model would be a significant advancement for understanding, studying, and developing new strategies for treating cardiac arrhythmias and related cardiovascular diseases. We developed an in vitro model of three-dimensional (3D) human cardiac tissue by populating synthetic filamentous matrices with cardiomyocytes derived from healthy wild-type volunteer (WT) and patient-specific long QT syndrome type 3 (LQT3) induced pluripotent stem cells (iPS-CMs) to mimic the condensed and aligned human ventricular myocardium. Using such a highly controllable cardiac model, we studied the contractility malfunctions associated with the electrophysiological consequences of LQT3 and their response to a panel of drugs. By varying the stiffness of filamentous matrices, LQT3 iPS-CMs exhibited different level of contractility abnormality and susceptibility to drug-induced cardiotoxicity. PMID:24268663

  9. Trapped slender vortex filaments in statistical equilibrium

    E-print Network

    Timothy D. Andersen; Chjan C. Lim

    2007-02-08

    The statistical mechanics of nearly parallel vortex filaments confined in the unbounded plane by angular momentum, first studied by Lions and Majda (2000), is investigated using a mean-field approximation to interaction and a spherical constraint to develop an explicit formula for the mean square vortex position or length scale of the system, $R$, verified with Path Integral Monte Carlo simulations. We confirm that 3D filaments resist confinement in a different way than 2D point vortices and that this results in a profound shift at high-densities for the length scale of quasi-2D versus strictly-2D models of vorticity fields in which angular momentum is conserved. Our analytical results correspond well with those of the Monte Carlo simulations and show a 3D effects contributing significantly to determination of the length scale.

  10. Morphogenesis of filaments growing in flexible confinements

    E-print Network

    Roman Vetter; Falk K. Wittel; Hans J. Herrmann

    2014-07-17

    Space-saving design is a requirement that is encountered in biological systems and the development of modern technological devices alike. Many living organisms dynamically pack their polymer chains, filaments or membranes inside of deformable vesicles or soft tissue like cell walls, chorions, and buds. Surprisingly little is known about morphogenesis due to growth in flexible confinements - perhaps owing to the daunting complexity lying in the nonlinear feedback between packed material and expandable cavity. Here we show by experiments and simulations how geometric and material properties lead to a plethora of morphologies when elastic filaments are growing far beyond the equilibrium size of a flexible thin sheet they are confined in. Depending on friction, sheet flexibility and thickness, we identify four distinct morphological phases emerging from bifurcation and present the corresponding phase diagram. Four order parameters quantifying the transitions between these phases are proposed.

  11. Viscoelastic response of contractile filament bundles

    E-print Network

    Achim Besser; Julien Colombelli; Ernst H. K. Stelzer; Ulrich S. Schwarz

    2011-02-25

    The actin cytoskeleton of adherent tissue cells often condenses into filament bundles contracted by myosin motors, so-called stress fibers, which play a crucial role in the mechanical interaction of cells with their environment. Stress fibers are usually attached to their environment at the endpoints, but possibly also along their whole length. We introduce a theoretical model for such contractile filament bundles which combines passive viscoelasticity with active contractility. The model equations are solved analytically for two different types of boundary conditions. A free boundary corresponds to stress fiber contraction dynamics after laser surgery and results in good agreement with experimental data. Imposing cyclic varying boundary forces allows us to calculate the complex modulus of a single stress fiber.

  12. Morphogenesis of filaments growing in flexible confinements

    NASA Astrophysics Data System (ADS)

    Vetter, R.; Wittel, F. K.; Herrmann, H. J.

    2014-07-01

    Space-saving design is a requirement that is encountered in biological systems and the development of modern technological devices alike. Many living organisms dynamically pack their polymer chains, filaments or membranes inside deformable vesicles or soft tissue-like cell walls, chorions and buds. Surprisingly little is known about morphogenesis due to growth in flexible confinements—perhaps owing to the daunting complexity lying in the nonlinear feedback between packed material and expandable cavity. Here we show by experiments and simulations how geometric and material properties lead to a plethora of morphologies when elastic filaments are growing far beyond the equilibrium size of a flexible thin sheet they are confined in. Depending on friction, sheet flexibility and thickness, we identify four distinct morphological phases emerging from bifurcation and present the corresponding phase diagram. Four order parameters quantifying the transitions between these phases are proposed.

  13. Ionic wave propagation along actin filaments.

    PubMed

    Tuszy?ski, J A; Portet, S; Dixon, J M; Luxford, C; Cantiello, H F

    2004-04-01

    We investigate the conditions enabling actin filaments to act as electrical transmission lines for ion flows along their lengths. We propose a model in which each actin monomer is an electric element with a capacitive, inductive, and resistive property due to the molecular structure of the actin filament and viscosity of the solution. Based on Kirchhoff's laws taken in the continuum limit, a nonlinear partial differential equation is derived for the propagation of ionic waves. We solve this equation in two different regimes. In the first, the maximum propagation velocity wave is found in terms of Jacobi elliptic functions. In the general case, we analyze the equation in terms of Fisher-Kolmogoroff modes with both localized and extended wave characteristics. We propose a new signaling mechanism in the cell, especially in neurons. PMID:15041636

  14. Cluster Substructure and Large Scales Filaments

    NASA Technical Reports Server (NTRS)

    Foreman, William

    1997-01-01

    New results from ASCA and ROSAT will be presented showing evidence for large scale structure from X-ray observations. The talk will present observations of the Coma cluster showing the interaction between an infalling group and the ambient cluster medium. For Abell 85, large scale structure is seen, consistent with the overall supercluster in which Abell 85 resides. Both X-ray temperature and X-ray surface brightness maps show evidence for merging along a supercluster filament. The filament orientation is well defined from optical observations of the overall galaxy distribution as well as the ellipticity of the central cD galaxy. The overall optical galaxy distribution shows a very complex region of sheets both behind and in front of A85. Finally, a progress report on a cluster survey using archival ROSAT PSPC and ROSAT HRI data will be presented.

  15. Helicity and Filament Channels? The Straight Twist!

    NASA Technical Reports Server (NTRS)

    Antiochos, Spiro K.

    2010-01-01

    One of the most important and most puzzling features of the coronal magnetic field is that it appears to have smooth magnetic structure with little evidence for non-potentiality except at special locations, photospheric polarity inversions lines where the non-potentiality is observed as a filament channel. This characteristic feature of the closed-field corona is highly unexpected given that photospheric motions continuously tangle its magnetic field. Although reconnection can eliminate some of the injected structure, it cannot destroy the helicity, which should build up to produce observable complexity. We propose that an inverse cascade process transports the injected helicity from the interior of closed flux regions to their boundaries, polarity inversion lines, creating filament channels. We describe how the helicity is injected and transported and calculate the relevant rates. We argue that one process, helicity transport, can explain both the observed lack and presence of structure in the coronal magnetic field.

  16. Low cost composite materials for wind energy conversion systems

    NASA Technical Reports Server (NTRS)

    Weingart, O.

    1980-01-01

    A winding process utilizing a low-cost E-glass fabric called transverse-filament tape for low-cost production of wind turbine generators (WTG) is described. The process can be carried out continuously at high speed to produce large one-piece parts with tapered wall thicknesses on a tapered mandrel. It is being used to manufacture blades for the NASA/DOE 200-ft-diameter MOD-1 WTG and Rockwell/DOE 40-kW small wind energy conversion system (SWECS).

  17. Continuous-Filament Isogrid Composite Panel

    NASA Technical Reports Server (NTRS)

    Williams, J. G.; Palmer, R. J.; Tucci, A. T.

    1985-01-01

    Damaged panels do not fail catastrophically when fabricated this way. Isogrid stiffener formed in slotted silicon-rubber tool. At grid intersections, slots offset to prevent excessive buildup of composite material and widened to give room for overlapping filaments to spread when compressed. Following total failure of skin, isogrid stiffener still carries 350 kN/m (2,000 1b/in.) and remains intact.

  18. Molecular Phylogeny of Metazoan Intermediate Filament Proteins

    Microsoft Academic Search

    Andreas Erber; Dieter Riemer; Marc Bovenschulte; Klaus Weber

    1998-01-01

    .   We have cloned cytoplasmic intermediate filament (IF) proteins from a large number of invertebrate phyla using cDNA probes,\\u000a the monoclonal antibody IFA, peptide sequence information, and various RT-PCR procedures. Novel IF protein sequences reported\\u000a here include the urochordata and nine protostomic phyla, i.e., Annelida, Brachiopoda, Chaetognatha, Echiura, Nematomorpha,\\u000a Nemertea, Platyhelminthes, Phoronida, and Sipuncula. Taken together with the wealth of

  19. [Elimination of microscopic filamentous fungi with disinfectants].

    PubMed

    Laciaková, A; Laciak, V

    1994-01-01

    The antifungal effectivity of three single-component (Persteril, Septonex, Glutaraldehyd) and of three combined (Persteril+Septonex, Pesteril+Glutaraldehyd, Glutaraldehyd+Septonex) commercially available disinfectants was monitored by the diffuse method on five fen of the microscopic filamentous fungi Aspergillus alternata, Aspergillus niger, Mucor fragillis, Fusarium moniliforme, Penicillium glabrum. The highest antifungal activity was observed in 2% Persteril while 2% Persteril + 1% Septonex were the most effective among the combined disinfectants. M. fragilis was the most resistant strain. PMID:7863573

  20. Differential Geometry of the Vortex Filament Equation

    E-print Network

    Yukinori Yasui; Norihito Sasaki

    1996-11-11

    Differential calculus on the space of asymptotically linear curves is developed. The calculus is applied to the vortex filament equation in its Hamiltonian description. The recursion operator generating the infinite sequence of commuting flows is shown to be hereditary. The system is shown to have a description with a Hamiltonian pair. Master symmetries are found and are applied to deriving an expression of the constants of motion in involution. The expression agrees with the inspection of Langer and Perline.

  1. Sodium transport in filamentous nitrogen fixing cyanobacteria

    Microsoft Academic Search

    Shree Kumar Apte; Joseph Thomas

    1983-01-01

    Two filamentous, nitrogen fixing cyanobacteria were examined for their salt tolerance and sodium (Na+) transport.Anabaena torulosa, a saline form, grew efficiently and fixed nitrogen even at 150 mM salt (NaCl) concentration while,Anabaena L-31, a fresh water cyanobacterium, failed to grow beyond 35 mM NaCl.Anabaena torulosa showed a rapidly saturating kinetics of Na+ transport with a high affinity for Na+\\u000a (K

  2. Viral detection using DNA functionalized gold filaments

    PubMed Central

    Perez, Jonas W.; Haselton, Frederick R.

    2010-01-01

    Early detection of pediatric viruses is critical to effective intervention. A successful clinical tool must have a low detection limit, be simple to use and report results quickly. No current method meets all three of these criteria. In this report, we describe an approach that combines simple, rapid processing and label free detection. The method detects viral RNA using DNA hairpin structures covalently attached to a gold filament. In this design, the gold filament serves both to simplify processing and enable fluorescence detection. The approach was evaluated by assaying for the presence of respiratory syncytial virus (RSV) using the DNA hairpin probe 5? [C6Thiol]TTTTTTTTTTCGACGAAAAATGGGGCAAATACGTCG[CAL] 3? covalently attached to a 5 cm length of a 100 ?m diameter gold-clad filament. This sequence was designed to target a portion of the gene end-intergenic gene start signals which is repeated multiple times within the negative-sense genome giving multiple targets for each strand of genomic viral RNA present. The filament functionalized with probes was immersed in a 200 ?m capillary tube containing viral RNA, moved to subsequent capillary tubes for rinsing and then scanned for fluorescence. The response curve had a typical sigmoidal shape and plateaued at about 300 plaque forming units (PFU) of viral RNA in 20 ?L. The lower limit of detection was determined to be 11.9 PFU. This lower limit of detection was ~200 times better than a standard comparison ELISA. The simplicity of the core assay makes this approach attractive for further development as a viral detection platform in a clinical setting. PMID:20448919

  3. Impact damage in filament wound composite bottles

    NASA Technical Reports Server (NTRS)

    Highsmith, Alton L.

    1993-01-01

    Increasingly, composite materials are being used in advanced structural applications because of the significant weight savings they offer when compared to more traditional engineering materials. The higher cost of composites must be offset by the increased performance that results from reduced structural weight if these new materials are to be used effectively. At present, there is considerable interest in fabricating solid rocket motor cases out of composite materials, and capitalizing on the reduced structural weight to increase rocket performance. However, one of the difficulties that arises when composite materials are used is that composites can develop significant amounts of internal damage during low velocity impacts. Such low velocity impacts may be encountered in routine handling of a structural component like a rocket motor case. The ability to assess the reduction in structural integrity of composite motor cases that experience accidental impacts is essential if composite rocket motor cases are to be certified for manned flight. While experimental studies of the post-impact performance of filament wound composite motor cases haven been proven performed (2,3), scaling impact data from small specimens to full scale structures has proven difficult. If such a scaling methodology is to be achieved, an increased understanding of the damage processes which influence residual strength is required. The study described herein was part of an ongoing investigation of damage development and reduction of tensile strength in filament wound composites subjected to low velocity impacts. The present study, which focused on documenting the damage that develops in filament wound composites as a result of such impacts, included two distinct tasks. The first task was to experimentally assess impact damage in small, filament wound pressure bottles using x-ray radiography. The second task was to study the feasibility of using digital image processing techniques to assist in determining the 3-D distribution of damage from stereo x-ray pairs.

  4. Energetic particle evidence for magnetic filaments in Jupiter's magnetotail

    NASA Astrophysics Data System (ADS)

    Hill, Matthew E.; Haggerty, Dennis K.; McNutt, Ralph L.; Paranicas, Christopher P.

    2009-11-01

    Jupiter's immense magnetotail was uniquely traversed and observed in situ to 2562 Jovian radii (RJ = 71,492 km) for the first time by the Pluto-bound New Horizons spacecraft during the first half of 2007. We show evidence that energetic ions with sulfur-rich composition traceable to Io's volcanism originated 150 ± 40 RJ antisunward of the planet and were recurrently released and funneled by the magnetic field down the magnetotail. Ions detected at New Horizons by the Pluto Energetic Particle Spectrometer Science Investigation (PEPSSI) instrument showed unmistakable signatures of velocity dispersion. We performed a survey of the unambiguous dispersion events observed by PEPSSI and provide a quantitative description of each event's dispersion characteristics. Energetic ions are sensitive probes of the magnetic field structure in the magnetotail; so, for a case study of one of the most interesting events, beginning on day of year 118, 28 April 2007, we are also able to estimate small-scale features of the magnetotail. Our observations (which include energies above ˜2 keV/nuc and total energies below ˜1 MeV), combined with straightforward simulations of particle flow, are consistent with narrow spatial structures, or filaments, on the order of 5 RJ wide in the ˜400 RJ wide > 9000 RJ long magnetotail; the Solar Wind Around Pluto plasma instrument measurements show coherent structures on a much larger scale (˜500 RJ) in the same region.

  5. Counterstreaming in a Large Polar Crown Filament

    NASA Astrophysics Data System (ADS)

    Lin, Yong; Engvold, Oddbjø Rn; Wiik, Jun Elin

    2003-09-01

    The motion of small-scale structures is well resolved in high-resolution filament images that were observed on 19 June 1998 with the Swedish Vacuum Solar Telescope, La Palma. The filament was between 80 000 and 100 000 km high. The study is based on two hours of narrow-band observations at three wavelength positions in H?. Velocities along the line of sight and in the transverse direction, respectively, V los and V tr, were measured for a large number of individual small-scale filament structures. Small features are all moving along nearly parallel threads, some in one direction along the threads and the remainder in the other direction, a pattern of motion known as counterstreaming. The net flow velocities in the two directions are about 8 km s-1 and both are tilted by an angle ??16° relative to the plane of the sky. This angle is less than expected, by factors between 2.0 and 2.5, relative to the local horizontal plane. We believe that V los is underestimated by these factors due to a line-shift reducing effect by the underlying H? absorption line of the chromosphere.

  6. Reconnection of vortex filaments and Kolmogorov spectrum

    E-print Network

    Sergey K. Nemirovskii

    2014-04-19

    The energy spectrum of the 3D velocity field, induced by collapsing vortex filaments is studied. One of the aims of this work is to clarify the appearance of the Kolmogorov type energy spectrum $E(k)\\varpropto k^{-5/3}$, observed in many numerical works on discrete vortex tubes (quantized vortex filaments in quantum fluids). Usually, explaining classical turbulent properties of quantum turbulence, the model of vortex bundles, is used. This model is necessary to mimic the vortex stretching, which is responsible for the energy transfer in classical turbulence. In our consideration we do not appeal to the possible "bundle arrangement" but explore alternative idea that the turbulent spectra appear from singular solution, which describe the collapsing line at moments of reconnection. One more aim is related to an important and intensively discussed topic - a role of hydrodynamic collapse in the formation of turbulent spectra. We demonstrated that the specific vortex filament configuration generated the spectrum $E(k)$ close to the Kolmogorov dependence and discussed the reason for this as well as the reason for deviation. We also discuss the obtained results from point of view of the both classical and quantum turbulence.

  7. Hot filament CVD of boron nitride films

    DOEpatents

    Rye, Robert R. (Albuquerque, NM)

    1992-01-01

    Using a hot filament (.apprxeq.1400.degree. C.) to activate borazine (B.sub.3 N.sub.3 H.sub.6) molecules for subsequent reaction with a direct line-of-sight substrate, transparent boron ntiride films as thick as 25,000 angstroms are grown for a substrate temperature as low as 100.degree. C. The minimum temperature is determined by radiative heating from the adjacent hot filament. The low temperature BN films show no indication of crystallinity with X-ray diffraction (XRD). X-ray photoelectron spectra (XPS) show the films to have a B:N ratio of 0.97:1 with no other XPS detectable impurities above the 0.5% level. Both Raman and infrared (IR) spectroscopy are characteristic of h-BN with small amounts of hydrogen detected as N-H and B-H bands in the IR spectrum. An important feature of this method is the separation and localization of the thermal activation step at the hot filament from the surface reaction and film growth steps at the substrate surface. This allows both higher temperature thermal activation and lower temperature film growth.

  8. Filament Channel Formation Via Magnetic Helicity Condensation

    NASA Astrophysics Data System (ADS)

    Knizhnik, Kalman Joshua; Antiochos, Spiro K.; DeVore, C. Richard

    2015-04-01

    A major unexplained feature of the solar atmosphere is the accumulation of magnetic shear, in the form of filament channels, at photospheric polarity inversion lines (PILs). In addition to free energy, this shear also represents magnetic helicity, which is conserved under reconnection. In this work, we address the problem of filament channel formation and show how they acquire their shear and magnetic helicity. The results of 3D simulations using the Adaptively Refined Magnetohydrodynamics Solver (ARMS) are presented that support the model of filament channel formation by magnetic helicity condensation developed by Antiochos (2013). We consider the convective twisting of a quasi-potential flux system that is bounded by a PIL and contains a coronal hole (CH). The magnetic helicity injected by the small-scale photospheric motions is shown to inverse-cascade up to the largest allowable scales that defined the closed flux system: the PIL and the CH. This process produces field lines that are both sheared and smooth, and are sheared in opposite senses at the PIL and the CH. The accumulated helicity and shear flux are shown to be in excellent quantitative agreement with the helicity-condensation model. We present a detailed analysis of the simulations, including comparisons of our analytical and numerical results, and discuss their implications for observations. Our research was supported by NASA's Earth and Space Science Fellowship (K.J.K.) and Heliophysics Supporting Research (S.K.A. and C.R.D.) programs.

  9. Experimental Study of the Current Filamentation Instability

    NASA Astrophysics Data System (ADS)

    Allen, Brian; Muggli, Patric; Silva, Luis O.; Martins, Joana; Yakimenko, Vitaly; Fedurin, Mikhail; Kusche, Karl; Babzien, Marcus; Huang, Chengkun; Mori, Warren

    2012-10-01

    The Current Filamentation Instability (CFI) is of central importance for the propagation of relativistic electron beams in plasmas. CFI has potential relevance to astrophysics, afterglow of gamma ray bursts, inertial confinement fusion, energy transport in the fast-igniter concept, and places an upper limit on the plasma density and accelerating gradient in PWFA's. An experimental study at the Accelerator Test Facility at Brookhaven National Laboratory with the 60MeV e^- beam and cm length plasma. The experiment included the systematic study and characterization of the instability as a function of the beam charge and plasma density. The transverse beam profile is measured directly at the plasma exit using OTR. Experimental results show the transition from plasma focusing to CFI near kp?r=1 characterized by the appearance of multiple (1-5) beam filaments and scaling of the transverse filament size with the plasma skin depth. Suppression of the instability is seen by lowering the growth rate of the instability by reducing the beam charge. The experimental results are in excellent agreement with theory and simulations and we present and discuss simulation and experimental results.

  10. Stirling machine operating experience

    NASA Technical Reports Server (NTRS)

    Ross, Brad; Dudenhoefer, James E.

    1991-01-01

    Numerous Stirling machines have been built and operated, but the operating experience of these machines is not well known. It is important to examine this operating experience in detail, because it largely substantiates the claim that Stirling machines are capable of reliable and lengthy lives. The amount of data that exists is impressive, considering that many of the machines that have been built are developmental machines intended to show proof of concept, and were not expected to operate for any lengthy period of time. Some Stirling machines (typically free-piston machines) achieve long life through non-contact bearings, while other Stirling machines (typically kinematic) have achieved long operating lives through regular seal and bearing replacements. In addition to engine and system testing, life testing of critical components is also considered.

  11. Women, Men, and Machines.

    ERIC Educational Resources Information Center

    Form, William; McMillen, David Byron

    1983-01-01

    Data from the first national study of technological change show that proportionately more women than men operate machines, are more exposed to machines that have alienating effects, and suffer more from the negative effects of technological change. (Author/SSH)

  12. Filaments of Forming Star Cluster Complexes in the Heart of NGC~1808

    NASA Astrophysics Data System (ADS)

    Galliano, E.; Kissler-Patig, M.; Tacconi-Garmann, L.; Alloin, D.

    2014-09-01

    We present new ESO/VLT/SINFONI data of the central starburst region of NGC~1808. We highlight the detection of chaplets of embedded clusters forming along filaments of gas circling around the nucleus. The embedded clusters are detected as Br_gamma sources and have no K-band counterpart. The kinematic maps reveal an inward radial velocity component for the gas, which is more pronounced than that for the stars. This suggests a scenario in which clusters are formed in inward spiraling filaments of gas which are locally illuminated by the young massive clusters. After 4-8 Myr, the clusters, following the stellar kinematic pattern, drift away from the gas filaments and become detectable in the K-band. This mechanism may complement gas expulsion by winds and supernovae for explaining the transition from embedded to non-embedded state, and may be especially important in dense environments such as those observed in the central starburst region of barred spiral galaxies.

  13. A filament of energetic particles near the high-latitude dawn magnetopause

    NASA Technical Reports Server (NTRS)

    Lui, A. T. Y.; Williams, D. J.; Mcentire, R. W.; Christon, S. P.; Jacquey, C.; Angelopoulos, V.; Yamamoto, T.; Kokubun, S.; Frank, L. A.; Ackerson, K. L.

    1994-01-01

    The Geotail satelite detected a filament of tailward-streaming energetic particles spatially separated from the boundary layer of energetic particles at the high-latitude dawn magnetopause at a downstream distance of approximately 80 R(sub E) on October 27, 1992. During this event, the composition and charge states of energetic ions at energies above approximately 10 keV show significant intermix of ions from solar wind and ionospheric sources. Detailed analysis leads to the deduction that the filament was moving southward towards the neutral sheet at an average speed of approximately 80 km/s, implying an average duskward electric field of approximately 1 mV/m. Its north-south dimension was approximately 1 R(sub E) and it was associated with an earthward directed field-aligned current of approximately 5 mA/m. The filament was separated from the energetic particle boundary layer straddling the magnetopause by approximately 0.8 R(sub E) and was inferred to be detached from the boundary layer at downstream distance beyond approximately 70 R(sub E) in the distant tail.

  14. Machine protection systems

    E-print Network

    Macpherson, A L

    2010-01-01

    A summary of the Machine Protection System of the LHC is given, with particular attention given to the outstanding issues to be addressed, rather than the successes of the machine protection system from the 2009 run. In particular, the issues of Safe Machine Parameter system, collimation and beam cleaning, the beam dump system and abort gap cleaning, injection and dump protection, and the overall machine protection program for the upcoming run are summarised.

  15. A collaborative programme of field measurements on wind turbines

    Microsoft Academic Search

    D. T. Swift-Hook

    1979-01-01

    Field measurements are needed on the largest available wind turbine machines in order to complement theoretical and small scale experimental (wind-tunnel) studies. A collaborative program is described which involves field measurements for five different windmills varying from 5 m to 17 m diameter in size and covering a range of important design features such as vertical and horizontal axes with

  16. IMPLEMENTATION OF WIND TURBINE CONTROLLERS W.E.Leithead

    E-print Network

    Duffy, Ken

    -speed wind turbines are considered, namely, (1) accommodation of the strongly nonlinear rotor aerodynamics of around 1 MW. The rotor usually has two or three blades, and in pitch regulated machines the pitch angle-speed wind turbines, are investigated, namely, 1. Compensation of the strongly nonlinear rotor aerodynamics

  17. Filamentous structures in skeletal muscle: anchors for the subsarcolemmal space.

    PubMed

    Khairani, Astrid Feinisa; Tajika, Yuki; Takahashi, Maiko; Ueno, Hitoshi; Murakami, Tohru; Soenggono, Arifin; Yorifuji, Hiroshi

    2015-03-01

    In skeletal muscle fibers, intermediate filaments and actin filaments provide structural support to the myofibrils and the sarcolemma. For many years, it was poorly understood from ultrastructural observations that how these filamentous structures were kept anchored. The present study was conducted to determine the architecture of filamentous anchoring structures in the subsarcolemmal space and the intermyofibrils. The diaphragms (Dp) of adult wild type and mdx mice (mdx is a model for Duchenne muscular dystrophy) were subjected to tension applied perpendicular to the long axis of the muscle fibers, with or without treatment with 1 % Triton X-100 or 0.03 % saponin. These experiments were conducted to confirm the presence and integrity of the filamentous anchoring structures. Transmission electron microscopy revealed that these structures provide firm transverse connections between the sarcolemma and peripheral myofibrils. Most of the filamentous structures appeared to be inserted into subsarcolemmal densities, forming anchoring connections between the sarcolemma and peripheral myofibrils. In some cases, actin filaments were found to run longitudinally in the subsarcolemmal space to connect to the sarcolemma or in some cases to connect to the intermyofibrils as elongated thin filaments. These filamentous anchoring structures were less common in the mdx Dp. Our data suggest that the transverse and longitudinal filamentous structures form an anchoring system in the subsarcolemmal space and the intermyofibrils. PMID:24519712

  18. The Filament-Moreton Wave Interaction of 2006 December 6

    NASA Astrophysics Data System (ADS)

    Gilbert, Holly R.; Daou, Antoun G.; Young, Daniel; Tripathi, Durgesh; Alexander, David

    2008-09-01

    We utilize chromospheric observations obtained at MLSO of the 2006 December 6 Moreton wave, which exhibits two distinct fronts, and subsequent filament activation to conduct a comprehensive analysis of the wave-filament interaction. By determining the period, amplitude, and evolution of the oscillations in the activated filament, we make certain inferences regarding the physical properties of both the wave and the filament. The large-amplitude oscillations induced in the filament by the wave passage last on the order of 180 minutes and demonstrate a complicated mixture of transverse and perpendicular motion with respect to the filament spine. These oscillations are predominantly along the filament axis, with a period of ~29 minutes and maximum line-of-sight velocity amplitude of ~41 km s-1. A careful examination of the complex oscillatory response of the filament elucidates some of the fundamental characteristics of the related Moreton wave. Specifically, we infer the maximum total kinetic energy involved in the interaction, the structure and topology of the passing wave, and discuss implications for the topology of the responding magnetic structure supporting the filament. The results of this observational study equip us with a better understanding of how filaments become activated and the nature of their responses to large propagating disturbances.

  19. Wind Energy Leasing Handbook

    E-print Network

    Balasundaram, Balabhaskar "Baski"

    Wind Energy Leasing Handbook Wind Energy Leasing Handbook E-1033 Oklahoma Cooperative Extension?..................................................................................................................... 31 What do wind developers consider in locating wind energy projects?............................................................................................ 37 How do companies and individuals invest in wind energy projects?....................................................................

  20. The Advantage of Machines

    NSDL National Science Digital Library

    Integrated Teaching and Learning Program,

    In this lesson, students learn about work as defined by physical science and see that work is made easier through the use of simple machines. Already encountering simple machines everyday, students will be learn about their widespread uses in improving everyday life. This lesson serves as the starting point for the Simple Machines Unit.

  1. Drilling mud cleaning machine

    Microsoft Academic Search

    W. L. Spruiell; J. L. Spruiell

    1987-01-01

    This patent describes a multiple-function cleaning, desilting and desanding machine for cleaning drilling muds which contain unwanted solid waste materials entrained during drilling processes. The machine comprises: supportive frame means adapted to be disposed upon a supportive surface for securely positioning the machine at a selected drilling site; a cyclone chamber having means for receiving dirty drilling mud from a

  2. Review on ultrasonic machining

    Microsoft Academic Search

    T. B. Thoe; D. K. Aspinwall; M. L. H. Wise

    1998-01-01

    Ultrasonic machining is of particular interest for the cutting of non-conductive, brittle workpiece materials such as engineering ceramics. Unlike other non-traditional processes such as laser beam, and electrical discharge machining, etc., ultrasonic machining does not thermally damage the workpiece or appear to introduce significant levels of residual stress, which is important for the survival of brittle materials in service. The

  3. Your Sewing Machine.

    ERIC Educational Resources Information Center

    Peacock, Marion E.

    The programed instruction manual is designed to aid the student in learning the parts, uses, and operation of the sewing machine. Drawings of sewing machine parts are presented, and space is provided for the student's written responses. Following an introductory section identifying sewing machine parts, the manual deals with each part and its…

  4. Find the Simple Machines

    NSDL National Science Digital Library

    COSI

    2000-01-01

    This is a web activity about simple machines. Learners will explore a lawn mower and identify six different simple machines which work together to help make our lives easier. This is an excellent activity for exploring how simple machines, and science in general, apply to learners' everyday lives.

  5. Apprentice Machine Theory Outline.

    ERIC Educational Resources Information Center

    Connecticut State Dept. of Education, Hartford. Div. of Vocational-Technical Schools.

    This volume contains outlines for 16 courses in machine theory that are designed for machine tool apprentices. Addressed in the individual course outlines are the following topics: basic concepts; lathes; milling machines; drills, saws, and shapers; heat treatment and metallurgy; grinders; quality control; hydraulics and pneumatics;…

  6. Geometry of flexible filament cohesion: Better contact through twist?

    NASA Astrophysics Data System (ADS)

    Cajamarca, Luis; Grason, Gregory M.

    2014-11-01

    Cohesive interactions between filamentous molecules have broad implications for a range of biological and synthetic materials. While long-standing theoretical approaches have addressed the problem of inter-filament forces from the limit of infinitely rigid rods, the ability of flexible filaments to deform intra-filament shape in response to changes in inter-filament geometry has a profound affect on the nature of cohesive interactions. In this paper, we study two theoretical models of inter-filament cohesion in the opposite limit, in which filaments are sufficiently flexible to maintain cohesive contact along their contours, and address, in particular, the role played by helical-interfilament geometry in defining interactions. Specifically, we study models of featureless, tubular filaments interacting via: (1) pair-wise Lennard-Jones (LJ) interactions between surface elements and (2) depletion-induced filament binding stabilized by electrostatic surface repulsion. Analysis of these models reveals a universal preference for cohesive filament interactions for non-zero helical skew, and further, that in the asymptotic limit of vanishing interaction range relative to filament diameter, the skew-dependence of cohesion approaches a geometrically defined limit described purely by the close-packing geometry of twisted tubular filaments. We further analyze non-universal features of the skew-dependence of cohesion at small-twist for both potentials, and argue that in the LJ model the pair-wise surface attraction generically destabilizes parallel filaments, while in the second model, pair-wise electrostatic repulsion in combination with non-pairwise additivity of depletion leads to a meta-stable parallel state.

  7. Global Winds

    NSDL National Science Digital Library

    2012-08-03

    On this worksheet, students examine a diagram of global winds and learn the position of the prevailing westerlies, the polar easterlies, the trade winds, the horse latitudes and the doldrums, and that together, the uneven heating of the planet by the Sun and the Coriolis Effect are responsible for the global wind belts. The resource is part of the teacher's guide accompanying the video, NASA Why Files: The Case of the Mysterious Red Light. Lesson objectives supported by the video, additional resources, teaching tips and an answer sheet are included in the teacher's guide.

  8. Stellar Winds

    NASA Astrophysics Data System (ADS)

    Owocki, Stan

    A "stellar wind" is the continuous, supersonic outflow of matter from the surface layers of a star. Our sun has a solar wind, driven by the gas-pressure expansion of the hot (T > 106 K) solar corona. It can be studied through direct in situ measurement by interplanetary spacecraft; but analogous coronal winds in more distant solar-type stars are so tenuous and transparent that that they are difficult to detect directly. Many more luminous stars have winds that are dense enough to be opaque at certain wavelengths of the star's radiation, making it possible to study their wind outflows remotely through careful interpretation of the observed stellar spectra. Red giant stars show slow, dense winds that may be driven by the pressure from magnetohydrodyanmic waves. As stars with initial mass up to 8 M ? evolve toward the Asymptotic Giant Branch (AGB), a combination of stellar pulsations and radiative scattering off dust can culminate in "superwinds" that strip away the entire stellar envelope, leaving behind a hot white dwarf stellar core with less than the Chandrasekhar mass of ˜ ?? 1. 4M ?. The winds of hot, luminous, massive stars are driven by line-scattering of stellar radiation, but such massive stars can also exhibit superwind episodes, either as Red Supergiants or Luminous Blue Variable stars. The combined wind and superwind mass loss can strip the star's hydrogen envelope, leaving behind a Wolf-Rayet star composed of the products of earlier nuclear burning via the CNO cycle. In addition to such direct effects on a star's own evolution, stellar winds can be a substantial source of mass, momentum, and energy to the interstellar medium, blowing open large cavities or "bubbles" in this ISM, seeding it with nuclear processed material, and even helping trigger the formation of new stars, and influencing their eventual fate as white dwarves or core-collapse supernovae. This chapter reviews the properties of such stellar winds, with an emphasis on the various dynamical driving processes and what they imply for key wind parameters like the wind flow speed and mass loss rate.

  9. Wind Tunnel

    NSDL National Science Digital Library

    Lawrence Hall of Science

    2009-01-01

    Scientists use enormous wind tunnels to test the design of planes, helicopters, even the Space Shuttle. In this simulation activity, learners create a miniature wind tunnel test by blowing air with a fan or blow dryer through a large tube, then flying paper airplanes, helicopters and other folded paper models in the "wind." Unless the source of the air is a fan that stands on its own, for example, more than one person will be needed to do the activity.This activity can be combined with the Helicopter Twirl, Parachute Drop and Boomerang activities, also found on the Lawrence Hall of Science Kids Site.

  10. Quadraphonic Wind

    NSDL National Science Digital Library

    National Weather Service

    2012-12-18

    In this activity, learners discover how the extent of various wind speeds changes in each of the four quadrants around a hurricane. Learners use data from the 'present' location of Hurricane Bill (2009) to plot the distance of various wind speeds that extend from the center of the storm. This resource includes brief background information about hurricanes and forecasting as well as an explanation of the Hurricane Bill data used in this activity and how small increases in wind speed can cause increased potential for damage.

  11. A 34-meter VAWT (Vertical Axis Wind Turbine) point design

    NASA Astrophysics Data System (ADS)

    Ashwill, T. D.; Berg, D. E.; Dodd, H. M.; Rumsey, M. A.; Sutherland, H. J.; Veers, P. S.

    The Wind Energy Division at Sandia National Laboratories recently completed a point design based on the 34-m Vertical Axis Wind Turbine (VAWT) Test Bed. The 34-m Test Bed research machine incorporates several innovations that improve Darrieus technology, including increased energy production, over previous machines. The point design differs minimally from the Test Bed; but by removing research-related items, its estimated cost is substantially reduced. The point design is a first step towards a Test-Bed-based commercial machine that would be competitive with conventional sources of power in the mid-1990s.

  12. Dynamics of solar filaments. IV - Structure and mass flow of an active region filament

    NASA Technical Reports Server (NTRS)

    Schmieder, B.; Malherbe, J. M.; Simon, G.; Poland, A. I.

    1985-01-01

    An active region filament near the center of the solar disk was observed on September 29-30, 1980, with the Multichannel Subtractive Double Pass Spectrograph of the Meudon solar tower and the UV Spectrograph and Polarimeter aboard the SMM satellite. H-alpha and C IV measurements are presently used to study brightness and material velocity in the 10,000 and 100,000 K temperature ranges, and photospheric magnetograms are used to investigate the underlying magnetic field. Attention is given to the constraints imposed on possible filament structures by observations, as well as the expected MHD relationships.

  13. Harmonic control of multiple-stator induction machines for voltage regulation

    E-print Network

    Holloway, Jack Wade, 1980-

    2004-01-01

    Small, one to a few horsepower, three-phase induction machines with three sets of electrically-isolated, magnetically-coupled stator winding circuits are described. A voltage inverter is developed and used to drive one set ...

  14. Lebost wind turbine: laboratory tests and data analysis

    Microsoft Academic Search

    M. I. Hoffert; B. A. Rugg

    1978-01-01

    Preliminary aerodynamic torque and power measurements and data analysis are presented for the Lebost Wind Turbine--a recently patented vertical-axis wind energy machine incorporating flow-focusing inlets fixed to a housing shroud surrounding blades rotating normal to the flow. Two laboratory-scale models were constructed, instrumented, and tested in a specially modified section of the NYU 30-m wind tunnel at freestream velocities (U\\/sub

  15. Electronically commutated serial-parallel switching for motor windings

    DOEpatents

    Hsu, John S. (Oak Ridge, TN)

    2012-03-27

    A method and a circuit for controlling an ac machine comprises controlling a full bridge network of commutation switches which are connected between a multiphase voltage source and the phase windings to switch the phase windings between a parallel connection and a series connection while providing commutation discharge paths for electrical current resulting from inductance in the phase windings. This provides extra torque for starting a vehicle from lower battery current.

  16. Wind energy research at the Solar Energy Research Institute

    Microsoft Academic Search

    R. J. Noun; D. M. Dodge

    1988-01-01

    As world interest in wind energy research and development (RandD) emerged in the mid-1970s, the path to the commercialization of wind power seemed clear, straightforward, and relatively short. In the United States, a fledgling industry foresaw small, 10-kW wind machines spinning in suburban and rural backyards, providing a fully dispersed new power source that would provide low-cost electricity to thousands

  17. Wind Story

    NSDL National Science Digital Library

    WPSU (Penn State University broadcast station)

    This animation presents the characteristics of wind power as a source of clean energy. The force of moving air generates electricity, by rotating blades around a rotor. The motion of the rotor turns a driveshaft that drives an electric generator.

  18. Wind Surge

    NSDL National Science Digital Library

    Robert A. Dalrymple

    This site features an interactive applet from the University of Delaware. The applet illustrates the way water can pile up against the downwind side (of a basin) due to stresses exerted on the surface by strong wind.

  19. Wind Landforms

    NSDL National Science Digital Library

    Lisa Tranel

    In this assignment, students evaluate depositional and erosional landforms created by wind processes. This exercise looks at sand dune and yardang features using satellite images and topographic maps in an online GIS.

  20. Momentbased Probability Models for Wind Engineering Applications

    E-print Network

    Sweetman, Bert

    on limited data from a prototype machine; and (2) dynamic structural response to wind drag loads, including + b 2 X 2 + b 3 X 3 ; ff 4X ! ff 4U (2) #12; These transformations seek to preserve not only the mean

  1. Superconductivity for Large Scale Wind Turbines

    SciTech Connect

    R. Fair; W. Stautner; M. Douglass; R. Rajput-Ghoshal; M. Moscinski; P. Riley; D. Wagner; J. Kim; S. Hou; F. Lopez; K. Haran; J. Bray; T. Laskaris; J. Rochford; R. Duckworth

    2012-10-12

    A conceptual design has been completed for a 10MW superconducting direct drive wind turbine generator employing low temperature superconductors for the field winding. Key technology building blocks from the GE Wind and GE Healthcare businesses have been transferred across to the design of this concept machine. Wherever possible, conventional technology and production techniques have been used in order to support the case for commercialization of such a machine. Appendices A and B provide further details of the layout of the machine and the complete specification table for the concept design. Phase 1 of the program has allowed us to understand the trade-offs between the various sub-systems of such a generator and its integration with a wind turbine. A Failure Modes and Effects Analysis (FMEA) and a Technology Readiness Level (TRL) analysis have been completed resulting in the identification of high risk components within the design. The design has been analyzed from a commercial and economic point of view and Cost of Energy (COE) calculations have been carried out with the potential to reduce COE by up to 18% when compared with a permanent magnet direct drive 5MW baseline machine, resulting in a potential COE of 0.075 $/kWh. Finally, a top-level commercialization plan has been proposed to enable this technology to be transitioned to full volume production. The main body of this report will present the design processes employed and the main findings and conclusions.

  2. Microwave guiding in air along single femtosecond laser filament

    SciTech Connect

    Ren Yu; Alshershby, Mostafa; Qin Jiang; Hao Zuoqiang; Lin Jingquan [School of Science, Changchun University of Science and Technology, Changchun 130022 (China)

    2013-03-07

    Microwave guiding along single plasma filament generated through the propagation of femtosecond (fs) laser pulses in air has been demonstrated over a distance of about 6.5 cm, corresponding to a microwave signal intensity enhancement of more than 3-fold over free space propagation. The current propagation distance along the fs laser filament is in agreement with the calculations and limited by the relatively high resistance of the single plasma filament. Using a single fs laser filament to channel microwave radiation considerably alleviate requirements to the power of fs laser pulses compared to the case of the circular filaments waveguide. In addition, it can be used as a simple and non-intrusive method to obtain the basic parameters of laser-generated plasma filament.

  3. Adhesive micropatterns to study intermediate filament function in nuclear positioning.

    PubMed

    Dupin, Isabelle; Elric, Julien; Etienne-Manneville, Sandrine

    2015-01-01

    The nucleus is generally found near the cell center; however its position can vary in response to extracellular or intracellular signals, leading to a polarized intracellular organization. Nuclear movement is mediated by the cytoskeleton and its associated motors. While the role of actin and microtubule cytoskeletons in nuclear positioning has been assessed in various systems, the contribution of intermediate filaments is less established due in part to the lack of tools to study intermediate filament functions. The methods described here use micropatterned substrates to impose reproducible cell shape and nucleus position. Intermediate filament organization can be perturbed using gene downregulation or upregulation; intermediate filaments can also be visualized using fluorescent intermediate filament proteins. This protocol is valuable for characterizing the role of intermediate filaments in a variety of live or fixed adherent cells. © 2015 by John Wiley & Sons, Inc. PMID:25727329

  4. The 100 kW experimental wind turbine generator project

    NASA Technical Reports Server (NTRS)

    Puthoff, R. L.; Sirocky, P.

    1975-01-01

    The Energy Research and Development Administration and the NASA Lewis Research Center engaged jointly in a Wind Energy Program which included the design and erection of a 100 kW wind turbine generator. This test machine consists of a rotor turbine, transmission, shaft, alternator, and tower. The rotor, measuring 125 feet in diameter and consisting of two variable pitch blades, operates at 40 rpm and generates 100 kW of electrical power at a wind velocity of 18 mph. The entire assembly is placed on top of a tower 100 feet above ground level. The machine was scheduled to be ready for operation in August, 1975.

  5. Can Wind Turbines be Bad for You? Alec N. Salt, Ph.D.

    E-print Network

    Salt, Alec N.

    Can Wind Turbines be Bad for You? Alec N. Salt, Ph.D. Department of Otolaryngology always been Industrial Machines. Some are beautiful and remind us of days gone by. #12;Modern wind farmsModern wind farms are equally industrialare equally industrial but not so quaintbut not so quaint (unless

  6. Improved Crowbar Control Strategy of DFIG Based Wind Turbines for Grid Fault Ride-Through

    Microsoft Academic Search

    Ling Peng; Bruno Francois; Yongdong Li

    2009-01-01

    Nowadays, the most widely used variable speed machine for wind turbine above 1 MW is the doubly fed induction generator (DFIG). As the wind power penetration continues to increase, wind turbines are required to provide Low Voltage Ride-Through (LVRT) capability. Crowbars are commonly used to protect the power converters during voltage dips. Its main drawback is that the DFIG absorbs

  7. Resistance of the insulation of the stator winding of water-filled submersible electric motor

    Microsoft Academic Search

    V. F. Fedorov; O. N. Nikiforova; V. T. Kolesnikova

    1987-01-01

    The authors analyzed the data on the resistance of the insulation of the stator winding of water-filled electric motors obtained in tests of 560 series produced machines in the course of ten years. The stator windings were made of conductors PEVVP and PVDP. The authors conclude that the resistance of the insulation of the stator windings of series produced electric

  8. A Comprehensive Overview on Reactive Power Compensation Technologies for Wind Power Applications

    Microsoft Academic Search

    Ahmed Faheem Zobaa; Milutin Jovanovic

    2006-01-01

    The size and number of wind farms contributing to the energy production is continuously growing. The rating of wind turbines has increased from less than 1 MW a few years ago to 2- to 3-MW being installed today with 5-MW machines under development. The interaction of the wind farm, reactive power compensators, and the associated power network is being investigated.

  9. Wire electric-discharge machining and other fabrication techniques

    NASA Technical Reports Server (NTRS)

    Morgan, W. H.

    1983-01-01

    Wire electric discharge machining and extrude honing were used to fabricate a two dimensional wing for cryogenic wind tunnel testing. Electric-discharge cutting is done with a moving wire electrode. The cut track is controlled by means of a punched-tape program and the cutting feed is regulated according to the progress of the work. Electric-discharge machining involves no contact with the work piece, and no mechanical force is exerted. Extrude hone is a process for honing finish-machined surfaces by the extrusion of an abrasive material (silly putty), which is forced through a restrictive fixture. The fabrication steps are described and production times are given.

  10. On the dynamics of magnetically driven elastic filaments

    Microsoft Academic Search

    Marcus Roper; Rémi Dreyfus; Jean Baudry; M. Fermigier; J. Bibette; H. A. Stone

    2006-01-01

    Following a novel realization of low-Reynolds-number swimming (Dreyfus et al., Nature, vol. 436, 2005, p. 862), in which self-assembled filaments of paramagnetic micron-sized beads are tethered to red blood cells and then induced to swim under crossed uniform and oscillating magnetic fields, the dynamics of magnetoelastic filaments is studied. The filament is modelled as a slender elastica driven by a

  11. Tailoring femtosecond laser pulse filamentation using plasma photonic lattices

    SciTech Connect

    Suntsov, Sergiy; Abdollahpour, Daryoush; Panagiotopoulos, Paris [Institute of Electronic Structure and Laser, Foundation for Research and Technology Hellas, P.O. Box 1527, 71110 Heraklion (Greece); Papazoglou, Dimitrios G.; Tzortzakis, Stelios [Institute of Electronic Structure and Laser, Foundation for Research and Technology Hellas, P.O. Box 1527, 71110 Heraklion (Greece); Materials Science and Technology Department, University of Crete, P.O. Box 2208, 71003 Heraklion (Greece); Couairon, Arnaud [Centre de Physique Theorique, CNRS, Ecole Polytechnique, F-91128 Palaiseau (France)

    2013-07-08

    We demonstrate experimentally that by using transient plasma photonic lattices, the attributes of intense femtosecond laser filaments, such as peak intensity and length, can be dynamically controlled. The extended plasma lattice structure is generated using two co-propagating non-diffracting intense Bessel beams in water. The use of such transient lattice structures to control the competition between linear and nonlinear effects involved in filamentation opens the way for extensive control of the filamentation process.

  12. Rotational Model for Actin Filament Alignment by Myosin

    PubMed Central

    Miller, Callie J; Ermentrout, G Bard; Davidson, Lance A

    2012-01-01

    Dynamics of the actomyosin cytoskeleton regulate cellular processes such as secretion, cell division, cell motility, and shape change. Actomyosin dynamics are themselves regulated by proteins that control actin filament polymerization and depolymerization, and myosin motor contractility. Previous theoretical work has focused on translational movement of actin filaments but has not considered the role of filament rotation. Since filament rotational movements are likely sources of forces that direct cell shape change and movement we explicitly model the dynamics of actin filament rotation as myosin II motors traverse filament pairs, drawing them into alignment. Using Monte Carlo simulations we find an optimal motor velocity for alignment of actin filaments. In addition, when we introduce polymerization and depolymerization of actin filaments, we find that alignment is reduced and the filament arrays exist in a stable, asynchronous state. Further analysis with continuum models allow us to investigate factors contributing to the stability of filament arrays and their ability to generate force. Interestingly, we find that two different morphologies of F-actin arrays generate the same amount of force. We also identify a phase transition to alignment occurs when either polymerization rates are reduced or motor velocities are optimized. We have extended our analysis to include a maximum allowed stretch of the myosin motors, and a non-uniform length for filaments leading to little change in the qualitative results. Through the integration of simulations and continuum analysis, we are able to approach the problem of understanding rotational alignment of actin filaments by myosin II motors in a truly unique way. PMID:22326473

  13. Electrical machines and assemblies including a yokeless stator with modular lamination stacks

    DOEpatents

    Qu, Ronghai; Jansen, Patrick Lee; Bagepalli, Bharat Sampathkumar; Carl Jr., Ralph James; Gadre, Aniruddha Dattatraya; Lopez, Fulton Jose

    2010-04-06

    An electrical machine includes a rotor with an inner rotor portion and an outer rotor portion, and a double-sided yokeless stator. The yokeless stator includes modular lamination stacks and is configured for radial magnetic flux flow. The double-sided yokeless stator is concentrically disposed between the inner rotor portion and the outer rotor portion of the electrical machine. Examples of particularly useful embodiments for the electrical machine include wind turbine generators, ship propulsion motors, switch reluctance machines and double-sided synchronous machines.

  14. The two types of flare associated filament eruptions

    NASA Technical Reports Server (NTRS)

    Tang, F.

    1986-01-01

    Using years of high resolution solar footage obtained at Big Bear Solar Observatory flare associated filament eruptions were studied. In addition to the classical type eruption consisting of expansion and breakup, evidence was found of another type where a layer is shed from the filament and erupts while the inversion line filament below (or, what is left of it) remains in place. Both types of eruptions are presented. It is hoped that the new evidence will shed new light on the understanding of the role of filaments in flares.

  15. Improving the electrochemical performance of carbon filaments by solvent cleansing

    SciTech Connect

    Shui, X.; Chung, D.D.L. [State Univ. of New York, Buffalo, NY (United States). Composite Materials Research Lab.; Frysz, C.A. [Wilson Greatbatch, Ltd., Clarence, NY (United States)

    1995-12-31

    Found inherent in the submicron-diameter vapor-grown carbon filament fabrication process was a tarry residue, which comprised polyaromatic hydrocarbons. Cyclic voltammetry conducted using carbon working electrodes and an iron cyanide electrolyte showed that the residue harmed the electrochemical performance. Removal of the residue from the filaments using a solvent resulted in increases in the electron transfer rate (to values as high as 0.2 cm/s) and reversibility of the iron cyanide redox species, increase in the packing density and decrease in the filament-filament contact electrical resistivity.

  16. Hollow cylindrical plasma filament waveguide with discontinuous finite thickness cladding

    NASA Astrophysics Data System (ADS)

    Alshershby, Mostafa; Hao, Zuoqiang; Lin, Jingquan

    2013-01-01

    We have explored here a hollow cylindrical laser plasma multifilament waveguide with discontinuous finite thickness cladding, in which the separation between individual filaments is in the range of several millimeters and the waveguide cladding thickness is in the order of the microwave penetration depth. Such parameters give a closer representation of a realistic laser filament waveguide sustained by a long stable propagation of femtosecond (fs) laser pulses. We report how the waveguide losses depend on structural parameters like normalized plasma filament spacing, filament to filament distance or pitch, normal spatial frequency, and radius of the plasma filament. We found that for typical plasma parameters, the proposed waveguide can support guided modes of microwaves in extremely high frequency even with a cladding consisting of only one ring of plasma filaments. The loss of the microwave radiation is mainly caused by tunneling through the discontinuous finite cladding, i.e., confinement loss, and is weakly dependent on the plasma absorption. In addition, the analysis indicates that the propagation loss is fairly large compared with the loss of a plasma waveguide with a continuous infinite thickness cladding, while they are comparable when using a cladding contains more than one ring. Compared to free space propagation, this waveguide still presents a superior microwave transmission to some distance in the order of the filamentation length; thus, the laser plasma filaments waveguide may be a potential channel for transporting pulsed-modulated microwaves if ensuring a long and stable propagation of fs laser pulses.

  17. Hollow cylindrical plasma filament waveguide with discontinuous finite thickness cladding

    SciTech Connect

    Alshershby, Mostafa; Hao Zuoqiang; Lin Jingquan [School of Science, Changchun University of Science and Technology, Changchun 130022 (China)

    2013-01-15

    We have explored here a hollow cylindrical laser plasma multifilament waveguide with discontinuous finite thickness cladding, in which the separation between individual filaments is in the range of several millimeters and the waveguide cladding thickness is in the order of the microwave penetration depth. Such parameters give a closer representation of a realistic laser filament waveguide sustained by a long stable propagation of femtosecond (fs) laser pulses. We report how the waveguide losses depend on structural parameters like normalized plasma filament spacing, filament to filament distance or pitch, normal spatial frequency, and radius of the plasma filament. We found that for typical plasma parameters, the proposed waveguide can support guided modes of microwaves in extremely high frequency even with a cladding consisting of only one ring of plasma filaments. The loss of the microwave radiation is mainly caused by tunneling through the discontinuous finite cladding, i.e., confinement loss, and is weakly dependent on the plasma absorption. In addition, the analysis indicates that the propagation loss is fairly large compared with the loss of a plasma waveguide with a continuous infinite thickness cladding, while they are comparable when using a cladding contains more than one ring. Compared to free space propagation, this waveguide still presents a superior microwave transmission to some distance in the order of the filamentation length; thus, the laser plasma filaments waveguide may be a potential channel for transporting pulsed-modulated microwaves if ensuring a long and stable propagation of fs laser pulses.

  18. Advances in intense femtosecond laser filamentation in air

    NASA Astrophysics Data System (ADS)

    Chin, S. L.; Wang, T.-J.; Marceau, C.; Wu, J.; Liu, J. S.; Kosareva, O.; Panov, N.; Chen, Y. P.; Daigle, J.-F.; Yuan, S.; Azarm, A.; Liu, W. W.; Seideman, T.; Zeng, H. P.; Richardson, M.; Li, R.; Xu, Z. Z.

    2011-09-01

    This is a review of some recent development in femtosecond filamentation science with emphasis on our collective work. Previously reviewed work in the field will not be discussed. We thus start with a very brief description of the fundamental physics of single filamentation of powerful femtosecond laser pulses in air. Intensity clamping is emphasized. One consequence is that the peak intensity inside one or more filaments would not increase significantly even if one focuses the pulse at very high peak power even up to the peta-watt level. Another is that the clamped intensity is independent of pressure. One interesting outcome of the high intensity inside a filament is filament fusion which comes from the nonlinear change of index of refraction inside the filament leading to cross beam focusing. Because of the high intensity inside the filament, one can envisage nonlinear phenomena taking place inside a filament such as a new type of Raman red shift and the generation of very broad band supercontinuum into the infrared through four-wave-mixing. This is what we call by filamentation nonlinear optics. It includes also terahertz generation from inside the filament. The latter is discussed separately because of its special importance to those working in the field of safety and security in recent years. When the filamenting pulse is linearly polarized, the isotropic nature of air becomes birefringent both electronically (instantaneous) and through molecular wave packet rotation and revival (delayed). Such birefringence is discussed in detailed. Because, in principle, a filament can be projected to a long distance in air, applications to pollution measurement as well as other atmospheric science could be earned out. We call this filamentation atmospheric science. Thus, the following subjects are discussed briefly, namely, lightning control, rain making, remote measurement of electric field, microwave guidance and remote sensing of pollutants. A discussion on the higher order Kerr effect on the physics of filamentation is also given. This is a new hot subject of current debate. This review ends on giving our view of the prospect of progress of this field of filamentation in the future. We believe it hinges upon the development of the laser technology based upon the physical understanding of filamentation and on the reduction in price of the laser system.

  19. History and phylogeny of intermediate filaments: now in insects.

    PubMed

    Herrmann, Harald; Strelkov, Sergei V

    2011-01-01

    Intermediate filaments include the nuclear lamins, which are universal in metazoans, and the cytoplasmic intermediate filaments, which are much more varied and form cell type-specific networks in animal cells. Until now, it has been thought that insects harbor lamins only. This view is fundamentally challenged by the discovery, reported in BMC Biology, of an intermediate filament-like cytoplasmic protein, isomin, in the hexapod Isotomurus maculatus. Here we briefly review the history of research on intermediate filaments, and discuss the implications of this latest finding in the context of what is known of their structure and functions. PMID:21356127

  20. Helical deformation of the filament of a scroll wave

    NASA Astrophysics Data System (ADS)

    Kupitz, Dennis; Hauser, Marcus J. B.

    2012-12-01

    In three-dimensional excitable systems scroll waves may lose their originally straight shape through different instabilities. In experiments, the formation of zigzag-shaped or helical filaments is often observed. Such a deformation may be due to either a twist-induced instability or a 3D meandering instability. We performed a systematic study using a Belousov-Zhabotinsky (BZ) system with a vertical gradient of excitability and determined the necessary twist for the onset of undulation in the filament. Thus, we demonstrate that in the case of a BZ system with a gradient parallel to the filament, the deformation of the filament is induced by a twist-induced instability.

  1. Etude et simulation des groupes convertisseurs-machines synchrones a six phases

    NASA Astrophysics Data System (ADS)

    Doyon, Jean-Francois

    Since many years, multiphase (n > 3) machines represent a growing research interest in the electrical machines domain. This type of machine can be used for many systems like automotive electrical traction, electric ship propulsion, wind farms or high-power industrial applications. Above all multiphase machines, the six phases wounded rotor synchronous machine brings a huge interest. Subsequently, using that kind of machine in any application requires a good understanding of the machine model and its respective converters. Hence, simulation represents a great way to study the behaviour and design of such applications that uses six phases wounded rotor synchronous machines. The present research concerns the study and simulation of six phase synchronous machinesconverters systems. From this project resulted the implementation of the six phases wound rotor salient pole synchronous machine in the Demos library of Matlab SimPowerSytems. In terms of study, a six phase machine electric drive is designed as well as a six phase machine implementation in a type 4 wind farm. The modeling of the six phase synchronous machine is fully detailed for the electrical part and the mechanical part. Then, the voltage source inverter electric drive with hysteresis control is conceived. Simulations of torque control, speed control and degraded mode of the machine are executed. The results illustrate the electric drive efficiency. This is followed by the type 4 wind turbine application of the machine. The wind farm is connected to a 120 kV grid, where a voltage drop fault appears at the 120 kV bar for a duration of six 60 Hz cycles. The results show a good operation of the regulators during the fault. This application is also subjected to a degraded mode, where results illustrate once again a good system regulation. Also, for the electric drive and the wind farm applications, a comparative study is made for the use of an asymmetrical versus symmetrical winding configuration of the machine. It is shown that for these two configurations, the total harmonic distortion seen from the source are similar. Finally, detailed model and average model of the converters are made for the electric drive and the wind turbine. The results show great similarity between the models.

  2. Wind energy utilization: A bibliography with abstracts - Cumulative volume 1944/1974

    NASA Technical Reports Server (NTRS)

    1975-01-01

    Bibliography, up to 1974 inclusive, of articles and books on utilization of wind power in energy generation. Worldwide literature is surveyed, and short abstracts are provided in many cases. The citations are grouped by subject: (1) general; (2) utilization; (3) wind power plants; (4) wind power generators (rural, synchronous, remote station); (5) wind machines (motors, pumps, turbines, windmills, home-built); (6) wind data and properties; (7) energy storage; and (8) related topics (control and regulation devices, wind measuring devices, blade design and rotors, wind tunnel simulation, aerodynamics). Gross-referencing is aided by indexes of authors, corporate sources, titles, and keywords.

  3. Mechanism of Actin Filament Bundling by Fascin

    SciTech Connect

    Jansen, Silvia; Collins, Agnieszka; Yang, Changsong; Rebowski, Grzegorz; Svitkina, Tatyana; Dominguez, Roberto (UPENN); (UPENN-MED)

    2013-03-07

    Fascin is the main actin filament bundling protein in filopodia. Because of the important role filopodia play in cell migration, fascin is emerging as a major target for cancer drug discovery. However, an understanding of the mechanism of bundle formation by fascin is critically lacking. Fascin consists of four {beta}-trefoil domains. Here, we show that fascin contains two major actin-binding sites, coinciding with regions of high sequence conservation in {beta}-trefoil domains 1 and 3. The site in {beta}-trefoil-1 is located near the binding site of the fascin inhibitor macroketone and comprises residue Ser-39, whose phosphorylation by protein kinase C down-regulates actin bundling and formation of filopodia. The site in {beta}-trefoil-3 is related by pseudo-2-fold symmetry to that in {beta}-trefoil-1. The two sites are {approx}5 nm apart, resulting in a distance between actin filaments in the bundle of {approx}8.1 nm. Residue mutations in both sites disrupt bundle formation in vitro as assessed by co-sedimentation with actin and electron microscopy and severely impair formation of filopodia in cells as determined by rescue experiments in fascin-depleted cells. Mutations of other areas of the fascin surface also affect actin bundling and formation of filopodia albeit to a lesser extent, suggesting that, in addition to the two major actin-binding sites, fascin makes secondary contacts with other filaments in the bundle. In a high resolution crystal structure of fascin, molecules of glycerol and polyethylene glycol are bound in pockets located within the two major actin-binding sites. These molecules could guide the rational design of new anticancer fascin inhibitors.

  4. Mechanism of Actin Filament Bundling by Fascin*

    PubMed Central

    Jansen, Silvia; Collins, Agnieszka; Yang, Changsong; Rebowski, Grzegorz; Svitkina, Tatyana; Dominguez, Roberto

    2011-01-01

    Fascin is the main actin filament bundling protein in filopodia. Because of the important role filopodia play in cell migration, fascin is emerging as a major target for cancer drug discovery. However, an understanding of the mechanism of bundle formation by fascin is critically lacking. Fascin consists of four ?-trefoil domains. Here, we show that fascin contains two major actin-binding sites, coinciding with regions of high sequence conservation in ?-trefoil domains 1 and 3. The site in ?-trefoil-1 is located near the binding site of the fascin inhibitor macroketone and comprises residue Ser-39, whose phosphorylation by protein kinase C down-regulates actin bundling and formation of filopodia. The site in ?-trefoil-3 is related by pseudo-2-fold symmetry to that in ?-trefoil-1. The two sites are ?5 nm apart, resulting in a distance between actin filaments in the bundle of ?8.1 nm. Residue mutations in both sites disrupt bundle formation in vitro as assessed by co-sedimentation with actin and electron microscopy and severely impair formation of filopodia in cells as determined by rescue experiments in fascin-depleted cells. Mutations of other areas of the fascin surface also affect actin bundling and formation of filopodia albeit to a lesser extent, suggesting that, in addition to the two major actin-binding sites, fascin makes secondary contacts with other filaments in the bundle. In a high resolution crystal structure of fascin, molecules of glycerol and polyethylene glycol are bound in pockets located within the two major actin-binding sites. These molecules could guide the rational design of new anticancer fascin inhibitors. PMID:21685497

  5. Wind for Schools (Poster)

    Microsoft Academic Search

    Baring-Gould

    2010-01-01

    As the United States dramatically expands wind energy deployment, the industry is challenged with developing a skilled workforce and addressing public resistance. Wind Powering America's Wind for Schools project addresses these issues by developing Wind Application Centers (WACs) at universities; WAC students assist in implementing school wind turbines and participate in wind courses, by installing small wind turbines at community

  6. Plasma planar filament instability and Alfven waves

    E-print Network

    Garcia de Andrade

    2007-03-05

    Inhomogeneous plasmas filaments instabilities are investigated by using the techniques of classical differential geometry of curves where Frenet torsion and curvature describe completely the motion of curves. In our case the Frenet frame changes in time and also depends upon the other coordinates taking into account the inhomogeneity of the plasma. The exponential perturbation method so commonly used to describe cosmological perturbatons is applied to magnetohydrodynamic (MHD) plasma equations to find longitudinal modes describing Alfven waves propagation modes describing plasma waves in the medium. Stability is investigated in the imaginary axis of the spectra of complex frequencies ${\\omega}$ or $Im(\\omega)\

  7. The bacterial cytoskeleton: more than twisted filaments

    PubMed Central

    Pilhofer, Martin; Jensen, Grant J.

    2012-01-01

    Far from being simple “bags” of enzymes, bacteria are richly endowed with ultrastructures that challenge and expand standard definitions of the cytoskeleton. Here we review rods, rings, twisted pairs, tubes, sheets, spirals, moving patches, meshes and composites, and suggest defining the term “bacterial cytoskeleton” as all cytoplasmic protein filaments and their superstructures that move or scaffold (stabilize/position/recruit) other cellular materials. The evolution of each superstructure has been driven by specific functional requirements. As a result, while homologous proteins with different functions have evolved to form surprisingly divergent superstructures, those of unrelated proteins with similar functions have converged. PMID:23183140

  8. Vortex filament equation for a regular polygon

    NASA Astrophysics Data System (ADS)

    de la Hoz, Francisco; Vega, Luis

    2014-12-01

    In this paper, we study the evolution of the vortex filament equation, with X(s, 0) being a regular planar polygon. Using algebraic techniques, supported by full numerical simulations, we give strong evidence that X(s, t) is also a polygon at any rational time; moreover, it can be fully characterized, up to a rigid movement, by a generalized quadratic Gauß sum. We also study the fractal behaviour of X(0, t), relating it with the so-called Riemann's non-differentiable function, that was proved by Jaffard to be a multifractal.

  9. Phytoplankton pigment patterns and wind forcing off central California

    NASA Technical Reports Server (NTRS)

    Abbott, Mark R.; Barksdale, Brett

    1991-01-01

    Mesoscale variability in phytoplankton pigment distributions of central California during the spring-summer upwelling season are studied via a 4-yr time series of high-resolution coastal zone color scanner imagery. Empirical orthogonal functions are used to decompose the time series of spatial images into its dominant modes of variability. The coupling between wind forcing of the upper ocean and phytoplankton distribution on mesoscales is investigated. Wind forcing, in particular the curl of the wind stress, was found to play an important role in the distribution of phytoplankton pigment in the California Current. The spring transition varies in timing and intensity from year to year but appears to be a recurrent feature associated with the rapid onset of the upwelling-favorable winds. Although the underlying dynamics may be dominated by processes other than forcing by wind stress curl, it appears that curl may force the variability of the filaments and hence the pigment patterns.

  10. Finite element analyses of continuous filament ties for masonry applications:final report for the Arquin Corporation.

    SciTech Connect

    Quinones, Armando (Arquin Corporation, La Luz, NM); Bibeau, Tiffany A.; Ho, Clifford Kuofei

    2006-06-01

    Finite-element analyses were performed to simulate the response of a hypothetical masonry shear wall with and without continuous filament ties to various lateral loads. The loads represented three different scenarios: (1) 100 mph wind, (2) explosive attack, and (3) an earthquake. In addition, a static loading analysis and cost comparison were performed to evaluate optimal materials and designs for the spacers affixed to the filaments. Results showed that polypropylene, ABS, and polyethylene (high density) were suitable materials for the spacers based on performance and cost, and the short T-spacer design was optimal based on its performance and functionality. Results of the shear-wall loading simulations revealed that simulated walls with the continuous filament ties yielded factors of safety that were at least ten times greater than those without the ties. In the explosive attack simulation (100 psi), the simulated wall without the ties failed (minimum factor of safety was less than one), but the simulated wall with the ties yielded a minimum factor of safety greater than one. Simulations of the walls subject to lateral loads caused by 100 mph winds (0.2 psi) and seismic events with a peak ground acceleration of 1 ''g'' (0.66 psi) yielded no failures with or without the ties. Simulations of wall displacement during the seismic scenarios showed that the wall with the ties resulted in a maximum displacement that was 20% less than the wall without the ties.

  11. The Mod-2 wind turbine development project

    NASA Technical Reports Server (NTRS)

    Linscott, B. S.; Dennett, J. T.; Gordon, L. H.

    1981-01-01

    A major phase of the Federal Wind Energy Program, the Mod-2 wind turbine, a second-generation machine developed by the Boeing Engineering and Construction Co. for the U.S. Department of Energy and the Lewis Research Center of the National Aeronautics and Space Administration, is described. The Mod-2 is a large (2.5-MW power rating) horizontal-axis wind turbine designed for the generation of electrical power on utility networks. Three machines were built and are located in a cluster at Goodnoe Hills, Washington. All technical aspects of the project are described: design approach, significant innovation features, the mechanical system, the electrical power system, the control system, and the safety system.

  12. Finite element analysis of filament-wound composite pressure vessel under internal pressure

    NASA Astrophysics Data System (ADS)

    Sulaiman, S.; Borazjani, S.; Tang, S. H.

    2013-12-01

    In this study, finite element analysis (FEA) of composite overwrapped pressure vessel (COPV), using commercial software ABAQUS 6.12 was performed. The study deals with the simulation of aluminum pressure vessel overwrapping by Carbon/Epoxy fiber reinforced polymer (CFRP). Finite element method (FEM) was utilized to investigate the effects of winding angle on filament-wound pressure vessel. Burst pressure, maximum shell displacement and the optimum winding angle of the composite vessel under pure internal pressure were determined. The Laminae were oriented asymmetrically for [00,00]s, [150,-150]s, [300,-300]s, [450,-450]s, [550,-550]s, [600,-600]s, [750,-750]s, [900,-900]s orientations. An exact elastic solution along with the Tsai-Wu, Tsai-Hill and maximum stress failure criteria were employed for analyzing data. Investigations exposed that the optimum winding angle happens at 550 winding angle. Results were compared with the experimental ones and there was a good agreement between them.

  13. Variable Structure Control of a Wind Energy Conversion System Based on a Brushless Doubly Fed Reluctance Generator

    Microsoft Academic Search

    Fernando Valenciaga; Paul F. Puleston

    2007-01-01

    This paper introduces a variable structure robust controller for wind energy conversion systems based on brushless doubly fed reluctance machine. Two simultaneous control goals are tackled: maximization of the wind energy conversion efficiency and minimization of the machine copper losses. The proposed multiple-input multiple-output (MIMO) robust controller is systematically synthesized following a general design method for MIMO nonlinear affine systems.

  14. Review of position-sensorless operation of brushless permanent-magnet machines

    Microsoft Academic Search

    Paul P. Acarnley; John F. Watson

    2006-01-01

    The operation of a brushless permanent-magnet machine requires rotor-position information, which is used to control the frequency and phase angle of the machine's winding currents. Sensorless techniques for estimating rotor position from measurements of voltage and current have been the subject of intensive research. This paper reviews the state of the art in these sensorless techniques, which are broadly classified

  15. Analysis of Electromechanical Interactions in a Flywheel System With a Doubly Fed Induction Machine

    Microsoft Academic Search

    Li Ran; Dawei Xiang; James L. Kirtley

    2011-01-01

    This paper analyzes the electromechanical interac- tion in a flywheel system with a doubly fed induction machine, used for wind farm power smoothing or grid frequency response control. The grid-connected electrical machine is subject to power control, and this can cause it to produce negative damping to the shaft torsional vibration. Resonance must be prevented, and this paper proposes a

  16. Analytical prediction of eddy-current loss in modular tubular permanent-magnet machines

    Microsoft Academic Search

    Yacine Amara; Jiabin Wang; David Howe

    2005-01-01

    The paper describes an analytical technique for predicting the eddy-current loss in the moving armature of a tubular permanent magnet machine. This loss component is usually neglected in conventional tubular permanent magnet machines since high-order time harmonics in the stator current waveform and space harmonics in the winding magnetomotive force (MMF) distribution are generally considered to be insignificant. However, a

  17. Influence of slot and pole number combinations on unbalanced magnetic force in permanent magnet machines

    Microsoft Academic Search

    Z. Q. Zhu; M. L. Mohd Jamil; L. J. Wu

    2011-01-01

    Unbalanced magnetic forces (UMF) exist in permanent magnet machines having pole and slot numbers differed by one and two, even when there is no rotor eccentricity. In machines having pole and slot numbers differed by two, the on-load UMF results only when the single layer winding is employed and the number of coils is odd. This paper investigates the influence

  18. Wind, pumps, and desalination

    SciTech Connect

    Theyse, F.H.

    1980-12-01

    Worldwide there exists an increasing need for waterpumping. Functions to be served include control of waterlevel, irrigation, reclamation of soil, control of a watertable in general. Specifically in the developing countries with their still underdeveloped infrastructure this need increases rapidly. For this pumping energy is needed, energy of high exergy to drive the pumps. With the increasing costs of fossil fuels and electricity, there is ample reason to investigate the potential of wind anew. A two-bladed fixed-rotor WECS, driving screwpumps via an automotive geartrain proves to offer a very reliable, fail-safe and self-optimizing solution for up to about 200 kW power, providing water at a cost of 4 to 6 dollarcents per kWh of water pumped. This is very favorable, compared to other means. Using the same concept to drive an adapted water-brake, it proves that desalination via the multiple-flash evaporisation route also becomes a self-optimizing, fail-safe, cheap and reliable operation, providing fresh water at less than 3 dollars per m/sup 3/, under the worst conditions. This is not only of importance to the developing countries with their sparse water supply, but even more for the industrialised countries, where lack of adequate water is an increasing problem. Costs can get substantially below the level indicated. It proves, that for this type of operations at acceptable costs, vertical axis windmills are basically unsuited. Although the horizontal axis machines need provisions to follow the wind, such provisions prove far cheaper in their effect on energy costs, then the controls and/or loss in power coefficient of vertical axis machines.

  19. Apparatus For Laminating Segmented Core For Electric Machine

    DOEpatents

    Lawrence, Robert Anthony (Kokomo, IN); Stabel, Gerald R (Swartz Creek, MI)

    2003-06-17

    A segmented core for an electric machine includes segments stamped from coated electric steel. The segments each have a first end, a second end, and winding openings. A predetermined number of segments are placed end-to-end to form layers. The layers are stacked such that each of the layers is staggered from adjacent layers by a predetermined rotation angle. The winding openings of each of the layers are in vertical alignment with the winding openings of the adjacent layers. The stack of layers is secured to form the segmented core.

  20. Proper horizontal photospheric flows in a filament channel

    NASA Astrophysics Data System (ADS)

    Schmieder, B.; Roudier, T.; Mein, N.; Mein, P.; Malherbe, J. M.; Chandra, R.

    2014-04-01

    Context. An extended filament in the central part of the active region NOAA 11106 crossed the central meridian on Sept. 17, 2010 in the southern hemisphere. It has been observed in H? with the THEMIS telescope in the Canary Islands and in 304 Å with the EUV imager (AIA) onboard the Solar Dynamic Observatory (SDO). Counterstreaming along the H? threads and bright moving blobs (jets) along the 304 Å filament channel were observed during 10 h before the filament erupted at 17:03 UT. Aims: The aim of the paper is to understand the coupling between magnetic field and convection in filament channels and relate the horizontal photospheric motions to the activity of the filament. Methods: An analysis of the proper photospheric motions using SDO/HMI continuum images with the new version of the coherent structure tracking (CST) algorithm developed to track granules, as well as the large scale photospheric flows, was performed for three hours. Using corks, we derived the passive scalar points and produced a map of the cork distribution in the filament channel. Averaging the velocity vectors in the southern hemisphere in each latitude in steps of 3.5 arcsec, we defined a profile of the differential rotation. Results: Supergranules are clearly identified in the filament channel. Diverging flows inside the supergranules are similar in and out of the filament channel. Converging flows corresponding to the accumulation of corks are identified well around the H? filament feet and at the edges of the EUV filament channel. At these convergence points, the horizontal photospheric velocity may reach 1 km s-1, but with a mean velocity of 0.35 km s-1. In some locations, horizontal flows crossing the channel are detected, indicating eventually large scale vorticity. Conclusions: The coupling between convection and magnetic field in the photosphere is relatively strong. The filament experienced the convection motions through its anchorage points with the photosphere, which are magnetized areas (ends, feet, lateral extensions of the EUV filament channel). From a large scale point-of-view, the differential rotation induced a shear of 0.1 km s-1 in the filament. From a small scale point-of-view, any convective motions favored the interaction of the parasitic polarities responsible for the anchorages of the filament to the photosphere with the surrounding network and may explain the activity of the filament. Two movies are available in electronic form at http://www.aanda.org

  1. A Correlative Analysis of Actin Filament Assembly, Structure, and Dynamics

    PubMed Central

    Steinmetz, Michel O.; Goldie, Kenneth N.; Aebi, Ueli

    1997-01-01

    The effect of the type of metal ion (i.e., Ca2+, Mg2+, or none) bound to the high-affinity divalent cation binding site (HAS) of actin on filament assembly, structure, and dynamics was investigated in the absence and presence of the mushroom toxin phalloidin. In agreement with earlier reports, we found the polymerization reaction of G-actin into F-actin filaments to be tightly controlled by the type of divalent cation residing in its HAS. Moreover, novel polymerization data are presented indicating that LD, a dimer unproductive by itself, does incorporate into growing F-actin filaments. This observation suggests that during actin filament formation, in addition to the obligatory nucleation– condensation pathway involving UD, a productive filament dimer, a facultative, LD-based pathway is implicated whose abundance strongly depends on the exact polymerization conditions chosen. The “ragged” and “branched” filaments observed during the early stages of assembly represent a hallmark of LD incorporation and might be key to producing an actin meshwork capable of rapidly assembling and disassembling in highly motile cells. Hence, LD incorporation into growing actin filaments might provide an additional level of regulation of actin cytoskeleton dynamics. Regarding the structure and mechanical properties of the F-actin filament at steady state, no significant correlation with the divalent cation residing in its HAS was found. However, compared to native filaments, phalloidin-stabilized filaments were stiffer and yielded subtle but significant structural changes. Together, our data indicate that whereas the G-actin conformation is tightly controlled by the divalent cation in its HAS, the F-actin conformation appears more robust than this variation. Hence, we conclude that the structure and dynamics of the Mg–F-actin moiety within the thin filament are not significantly modulated by the cyclic Ca2+ release as it occurs in muscle contraction to regulate the actomyosin interaction via troponin. PMID:9245786

  2. Supercoiling of f-actin filaments.

    PubMed

    Lednev, V V; Popp, D

    1990-05-01

    In the X-ray diffraction pattern from oriented gels of actin-containing filaments sampling of layer lines indicating the development of a well-ordered pseudo-hexagonal lattice within the gels at interfilament spacings as large as 13 nm is observed. This value exceeds by 3 nm the largest estimate of an external diameter of pure f-actin. The development of layer line sampling is always accompanied by: (i) the appearance of strong forbidden meridional reflections on the 5.9- and 5.1-nm layer lines; (ii) a drastic intensification of the first (expected) 2.75-nm meridional reflection by a factor of about 4; (iii) the appearance of streaks, connecting near-meridional reflections on the 5.9-, 5.1-, and 37-nm layer lines; and (iv) a slight decrease in the number of subunits per turn of the basic f-actin helix. All these features strongly indicate that f-actin filaments are supercoiled and make regular local contacts between themselves, which may lead to periodic distortions of the mobile external domain in the actin subunits. PMID:2261308

  3. The Filamentous Fungal Gene Expression Database (FFGED)

    PubMed Central

    Zhang, Zhang; Townsend, Jeffrey P.

    2010-01-01

    Filamentous fungal gene expression assays provide essential information for understanding systemic cellular regulation. To aid research on fungal gene expression, we constructed a novel, comprehensive, free database, the Filamentous Fungal Gene Expression Database (FFGED), available at http://bioinfo.townsend.yale.edu. FFGED features user-friendly management of gene expression data, which are assorted into experimental metadata, experimental design, raw data, normalized details, and analysis results. Data may be submitted in the process of an experiment, and any user can submit multiple experiments, thus classifying the FFGED as an “active experiment” database. Most importantly, FFGED functions as a collective and collaborative platform, by connecting each experiment with similar related experiments made public by other users, maximizing data sharing among different users, and correlating diverse gene expression levels under multiple experimental designs within different experiments. A clear and efficient web interface is provided with enhancement by AJAX (Asynchronous JavaScript and XML) and through a collection of tools to effectively facilitate data submission, sharing, retrieval and visualization. PMID:20025988

  4. Machine tool locator

    DOEpatents

    Hanlon, John A. (Los Alamos, NM); Gill, Timothy J. (Stanley, NM)

    2001-01-01

    Machine tools can be accurately measured and positioned on manufacturing machines within very small tolerances by use of an autocollimator on a 3-axis mount on a manufacturing machine and positioned so as to focus on a reference tooling ball or a machine tool, a digital camera connected to the viewing end of the autocollimator, and a marker and measure generator for receiving digital images from the camera, then displaying or measuring distances between the projection reticle and the reference reticle on the monitoring screen, and relating the distances to the actual position of the autocollimator relative to the reference tooling ball. The images and measurements are used to set the position of the machine tool and to measure the size and shape of the machine tool tip, and examine cutting edge wear. patent

  5. Post-Assembly Magnetization of Rare-Earth Fractional-Slot Surface Permanent-Magnet Machines Using a Two-Shot Method

    Microsoft Academic Search

    Min-Fu Hsieh; Yao-Min Lien; David G. Dorrell

    2011-01-01

    This paper studies the post-assembly magnetization of a fractional-slot, concentrated winding brushless rare-earth surface permanent-magnet machine with six rotor poles and nine stator slots. In the paper, the simulation method is discussed, and it is illustrated that it is possible to fully magnetize the machine after assembly using two pulses of the winding (\\

  6. Present status and future trends of R&D for HTS rotational machines in Japan

    NASA Astrophysics Data System (ADS)

    Tsukamoto, Osami

    2014-09-01

    Various HTS rotating machines, from multiple MW class to several 10 kW class, are being developed in Japan. R&D statuses of those machines are reviewed. Design studies of various types of HTS wind power generators are also conducted in Japan and their merits and demerits are discussed. Based on the present R&D statuses, future technical trends of HTS machines are discussed.

  7. Development and Validation of a Comprehensive Synchronous Machine Model for a Real-Time Environment

    Microsoft Academic Search

    A. B. Dehkordi; Prabhakar Neti; A. M. Gole; T. L. Maguire

    2010-01-01

    A comprehensive model of a salient-pole synchronous machine is developed for a real-time environment. By obtaining the effective specific permeance of the machine from simple experimental measurements and the exact geometry of the rotor pole arc, a model is developed that includes the exact distribution of windings and operating-point-dependent saturation. This model offers a superior simulated response of the machine

  8. Wind turbine

    DOEpatents

    Cheney, Jr., Marvin C. (Glastonbury, CT)

    1982-01-01

    A wind turbine of the type having an airfoil blade (15) mounted on a flexible beam (20) and a pitch governor (55) which selectively, torsionally twists the flexible beam in response to wind turbine speed thereby setting blade pitch, is provided with a limiter (85) which restricts unwanted pitch change at operating speeds due to torsional creep of the flexible beam. The limiter allows twisting of the beam by the governor under excessive wind velocity conditions to orient the blades in stall pitch positions, thereby preventing overspeed operation of the turbine. In the preferred embodiment, the pitch governor comprises a pendulum (65,70) which responds to changing rotor speed by pivotal movement, the limiter comprising a resilient member (90) which engages an end of the pendulum to restrict further movement thereof, and in turn restrict beam creep and unwanted blade pitch misadjustment.

  9. Machining: An Introduction

    NSDL National Science Digital Library

    Basic machining processes are introduced on this site that is devoted to engineering fundamentals. Descriptions and illustrations of drilling, turning, grinding, and other common processes are provided for people with little to no prior machining knowledge. A waterjet is a non-traditional machining technology that uses high pressure streams of water with abrasive additives rather than solid cutting instruments to slice through metal and other materials.

  10. Quantum Learning Machine

    E-print Network

    Jeongho Bang; James Lim; M. S. Kim; Jinhyoung Lee

    2008-03-31

    We propose a novel notion of a quantum learning machine for automatically controlling quantum coherence and for developing quantum algorithms. A quantum learning machine can be trained to learn a certain task with no a priori knowledge on its algorithm. As an example, it is demonstrated that the quantum learning machine learns Deutsch's task and finds itself a quantum algorithm, that is different from but equivalent to the original one.

  11. Chaotic Boltzmann machines

    PubMed Central

    Suzuki, Hideyuki; Imura, Jun-ichi; Horio, Yoshihiko; Aihara, Kazuyuki

    2013-01-01

    The chaotic Boltzmann machine proposed in this paper is a chaotic pseudo-billiard system that works as a Boltzmann machine. Chaotic Boltzmann machines are shown numerically to have computing abilities comparable to conventional (stochastic) Boltzmann machines. Since no randomness is required, efficient hardware implementation is expected. Moreover, the ferromagnetic phase transition of the Ising model is shown to be characterised by the largest Lyapunov exponent of the proposed system. In general, a method to relate probabilistic models to nonlinear dynamics by derandomising Gibbs sampling is presented. PMID:23558425

  12. Chaotic Boltzmann machines.

    PubMed

    Suzuki, Hideyuki; Imura, Jun-ichi; Horio, Yoshihiko; Aihara, Kazuyuki

    2013-01-01

    The chaotic Boltzmann machine proposed in this paper is a chaotic pseudo-billiard system that works as a Boltzmann machine. Chaotic Boltzmann machines are shown numerically to have computing abilities comparable to conventional (stochastic) Boltzmann machines. Since no randomness is required, efficient hardware implementation is expected. Moreover, the ferromagnetic phase transition of the Ising model is shown to be characterised by the largest Lyapunov exponent of the proposed system. In general, a method to relate probabilistic models to nonlinear dynamics by derandomising Gibbs sampling is presented. PMID:23558425

  13. Wind Tubes

    NSDL National Science Digital Library

    Exploratorium

    2012-12-14

    In this activity, learners create and experiment with wind tubes. These tubes are a playful and inventive way to explore the effect that moving air has on objects. Construction uses everyday materials such as a fan and embroidery hoops. It’s fun to make things fly out of or float in the tubes, and to adjust the tubes to change the way the objects fly. The activity requires a significant amount of time and resources to build and may require adult help in construction. Experimentation with the wind tubes is engaging for a wide age range of learners.

  14. Eddy current losses in permanent magnets of the BLDC machine

    Microsoft Academic Search

    Damijan Miljavec; Bogomir Zidari?

    2007-01-01

    Purpose – This study aims to calculate eddy current losses in permanent magnets of BLDC machine in the generator mode of operation with no-load. Design\\/methodology\\/approach – Stator slot openings and special design of the stator poles cause changes in the magnetic flux density changes in permanent magnets. The stator windings are not connected to an outer source and no currents

  15. Characterizing pivot sprinklers using an experimental irrigation machine

    Microsoft Academic Search

    E. Playán; S. Garrido; J. M. Faci; A. Galán

    2004-01-01

    In this work, a Fixed Spray Plate Sprinkler (FSPS) and two Rotating Spray Plate Sprinklers (RSPS) were compared in terms of wetted diameter, wind drift and evaporation losses (WDEL), static water precipitation pattern and dynamic water application profile. An experimental irrigation machine reproducing a pivot section was constructed and used to perform experiments in static and dynamic (linear displacement) modes.

  16. Thin phytoplankton layer formation at eddies, filaments, and fronts in a coastal upwelling zone

    NASA Astrophysics Data System (ADS)

    Johnston, T. M. Shaun; Cheriton, Olivia M.; Pennington, J. Timothy; Chavez, Francisco P.

    2009-02-01

    On two cruises in August and September 2003 (hereafter cruises 2 and 3) during wind relaxations and transitions to upwelling conditions, thin layers of phytoplankton were observed in or a few meters below the stratified transition layer at the mixed layer base and in regions of sheared flow on the flanks of eddies, filaments, and fronts near Monterey Bay, California. On an earlier cruise in August (cruise 1), no thin layers were found after a prolonged wind relaxation. Chlorophyll concentrations and shear were both an order of magnitude less than on cruises 2 and 3. Our vertical profiles were made using a fluorometer mounted on a conductivity-temperature-depth package, which was lowered from the ship as slowly as 0.25ms-1 every 10 km on five ˜80-km cross-shore transects. Remotely sensed sea-surface temperature, chlorophyll, and currents are required to understand the temporal and spatial evolution of the circulation and to interpret the quasi-synoptic in situ data. Decorrelation scales are ˜20km from lagged temperature and salinity covariances. Objectively mapped sections of the in situ data indicate the waters containing thin layers were recently upwelled at either the Point Sur or Point Año Nuevo upwelling centers. Spatially limited distributions of phytoplankton at the coastal upwelling centers ( ˜40km alongshore, 20 km cross-shore, and 30 m thick) were transformed into thin layers by current shear and isolated from wind-driven vertical mixing by the stratification maximum of the transition layer. Vertically sheared horizontal currents on the flanks of the eddies, filaments, and fronts horizontally stretched and vertically thinned phytoplankton distributions. These thin, elongated structures were then observed as thin layers of phytoplankton in vertical fluorescence profiles at four stations on cruise 2 and eight stations on cruise 3. Light winds during relaxations did not mix away these thin layers. On cruise 2, thin layers were found at eddies at the inshore and offshore ends of a 100-km-long filament, while broader subsurface chlorophyll maxima were found along the filament. This result suggests that higher-resolution sampling along and across a filament may find thin layers forming and dissipating along its length. On cruise 3, thin layers were found at three adjacent stations across an upwelling front and may have extended continuously for >20km, but neither species composition nor bio-optical data are available to confirm this conjecture. The thin layers were 1-5 m thick in the vertical at full width half maximum and had peak fluorescence values from 7-30mgm-3. (Bottle chlorophyll samples showed fluorometer chlorophyll readings may have been 1.3-1.5×too large, but the scatter in this relation was considerable especially at the larger fluorescence values detected in thin layers.) While sheared currents thinned an initially thick subsurface chlorophyll maximum into thin layers, the peak values in these thin layers exceeded concentrations in the upwelled source waters and were unexplained by our data.

  17. The art and design of genetic screens: filamentous fungi

    Microsoft Academic Search

    Miriam Zolan; Lorna Casselton

    2002-01-01

    In the 1940s, screens for metabolic mutants of the filamentous fungus Neurospora crassa established the fundamental, one-to-one relationship between a gene and a specific protein, and also established fungi as important genetic organisms. Today, a wide range of filamentous species, which represents a billion years of evolutionary divergence, is used for experimental studies. The developmental complexity of these fungi sets

  18. Unlined Reuseable Filament Wound Composite Cryogenic Tank Testing

    NASA Technical Reports Server (NTRS)

    Murphy, A. W.; Lake, R. E.; Wilkerson, C.

    1999-01-01

    An unlined reusable filament wound composite cryogenic tank was tested at the Marshall Space Flight Center using LH2 cryogen and pressurization to 320 psig. The tank was fabricated by Phillips Laboratory and Wilson Composite Group, Inc., using an EnTec five-axis filament winder and sand mandrels. The material used was IM7/977-2 (graphite/epoxy).

  19. Filament-wound spar shell graphite/epoxy fan blades

    NASA Technical Reports Server (NTRS)

    Yao, S.

    1976-01-01

    The methodology for fabrication of wet filament wound spar shell fan blades is presented. All principal structural elements were filament wound, assembled, formed, bonded and co-cured in a female mold. A pair of blades were fabricated as one integral unit and parted into two after curing.

  20. Verifying Stiffness Parameters Of Filament-Wound Cylinders

    NASA Technical Reports Server (NTRS)

    Verderaime, V.; Rheinfurth, M.

    1994-01-01

    Predicted engineering stiffness parameters of filament-wound composite-material cylinders verified with respect to experimental data, by use of equations developed straightforwardly from applicable formulation of Hooke's law. Equations derived in engineering study of filament-wound rocket-motor cases, also applicable to other cylindrical pressure vessels made of orthotropic materials.