Hospital Audit as a Useful Tool in the Process of Introducing Falsified Medicines Directive (FMD) into Hospital Pharmacy Settings-A Pilot Study.

PubMed

Religioni, Urszula; Swieczkowski, Damian; Gawrońska, Anna; Kowalczuk, Anna; Drozd, Mariola; Zerhau, Mikołaj; Smoliński, Dariusz; Radomiński, Stanisław; Cwalina, Natalia; Brindley, David; Jaguszewski, Miłosz J; Merks, Piotr

2017-11-09

Recently, the European Union has introduced the Falsified Medicines Directive (FMD). Additionally, in early 2016, a Delegated Act (DA) related to the FMD was published. The main objective of this study was to evaluate the usefulness of external audits in the context of implementing new regulations provided by the FMD in the secondary care environment. The external, in-person workflow audits were performed by an authentication company in three Polish hospital pharmacies. Each audit consisted of a combination of supervision (non-participant observation), secondary data analysis, and expert interviews with the use of an independently designed authorial Diagnostic Questionnaire. The questionnaire included information about hospital drug distribution procedures, data concerning drug usage, IT systems, medication order systems, the processes of medication dispensing, and the preparation and administration of hazardous drugs. Data analysis included a thorough examination of hospital documentation in regard to drug management. All data were subjected to qualitative analysis, with the aim of generating meaningful information through inductive inference. Only one dispensing location in the Polish hospitals studied has the potential to be a primary authentication area. In the audited hospitals, an Automated Drug Dispensing System and unit dose were not identified during the study. Hospital wards contained an enclosed place within the department dedicated to drug storage under the direct supervision of senior nursing staff. An electronic order system was not available. In the largest center, unused medications are re-dispensed to different hospital departments, or may be sold to various institutions. Additionally, in one hospital pharmacy, pharmacists prepared parenteral nutrition and chemotherapeutic drugs for patients admitted to the hospital. External audits might prove beneficial in the course of introducing new regulations into everyday settings. However, such action

Hospital Audit as a Useful Tool in the Process of Introducing Falsified Medicines Directive (FMD) into Hospital Pharmacy Settings—A Pilot Study

PubMed Central

Religioni, Urszula; Gawrońska, Anna; Kowalczuk, Anna; Drozd, Mariola; Zerhau, Mikołaj; Smoliński, Dariusz; Radomiński, Stanisław; Cwalina, Natalia; Brindley, David; Jaguszewski, Miłosz J.; Merks, Piotr

2017-01-01

Background: Recently, the European Union has introduced the Falsified Medicines Directive (FMD). Additionally, in early 2016, a Delegated Act (DA) related to the FMD was published. The main objective of this study was to evaluate the usefulness of external audits in the context of implementing new regulations provided by the FMD in the secondary care environment. Methods: The external, in-person workflow audits were performed by an authentication company in three Polish hospital pharmacies. Each audit consisted of a combination of supervision (non-participant observation), secondary data analysis, and expert interviews with the use of an independently designed authorial Diagnostic Questionnaire. The questionnaire included information about hospital drug distribution procedures, data concerning drug usage, IT systems, medication order systems, the processes of medication dispensing, and the preparation and administration of hazardous drugs. Data analysis included a thorough examination of hospital documentation in regard to drug management. All data were subjected to qualitative analysis, with the aim of generating meaningful information through inductive inference. Results: Only one dispensing location in the Polish hospitals studied has the potential to be a primary authentication area. In the audited hospitals, an Automated Drug Dispensing System and unit dose were not identified during the study. Hospital wards contained an enclosed place within the department dedicated to drug storage under the direct supervision of senior nursing staff. An electronic order system was not available. In the largest center, unused medications are re-dispensed to different hospital departments, or may be sold to various institutions. Additionally, in one hospital pharmacy, pharmacists prepared parenteral nutrition and chemotherapeutic drugs for patients admitted to the hospital. Conclusions: External audits might prove beneficial in the course of introducing new regulations into

a Continuous Health Monitoring Guided Wave Fmd System for Retrofit to Existing Offshore Oilrigs

NASA Astrophysics Data System (ADS)

Mijarez, R.; Solis, L.; Martinez, F.

2010-02-01

An automatic health monitoring guided wave flood member detection (FMD) system, for retrofit to existing offshore oilrigs is presented. The system employs a microcontroller piezoelectric (PZT) based transmitter and a receiver instrumentation package composed of a PZT 40 kHz ultrasound transducer and a digital signal processor (DSP) module connected to a PC via USB for monitoring purposes. The transmitter and receiver were attached, non-intrusively, to the external wall of a steel tube; 1 m×27 cm×2 mm. Experiments performed in the laboratory have successfully identified automatically flooded tubes.

Prioritization of Managed Pork Supply Movements during a FMD Outbreak in the US.

PubMed

Patterson, Gilbert R; Mohr, Alicia H; Snider, Tim P; Lindsay, Thomas A; Davies, Peter R; Goldsmith, Tim J; Sampedro, Fernando

2016-01-01

In the event of a foot-and-mouth disease (FMD) outbreak in the United States, local, state, and federal authorities will implement a foreign animal disease emergency response plan restricting the pork supply chain movements and likely disrupting the continuity of the swine industry business. To minimize disruptions of the food supply while providing an effective response in an outbreak, it is necessary to have proactive measures in place to ensure minimal disease spread and maximum continuation of business. Therefore, it is critical to identify candidate movements for proactive risk assessments: those that are both most likely to contribute to disease spread and most necessary for business continuity. To do this, experts from production, harvest, retail, and allied pork industries assessed 30 common pork supply movements for risk of disease spread and industry criticality. The highest priority movements for conducting a risk assessment included the movement of weaned pigs originating from multiple sow farm sources to an off-site nursery or wean to finish facility, the movement of employees or commercial crews, the movement of vaccination crews, the movement of dedicated livestock hauling trucks, and the movement of commercial crews such as manure haulers and feed trucks onto, off, or between sites. These critical movements, along with several others identified in this study, will provide an initial guide for prioritization of risk management efforts and resources to be better prepared in the event of a FMD outbreak in the United States. By specifically and proactively targeting movements that experts agree are likely to spread the disease and are critical to the continuity of business operations, potentially catastrophic consequences in the event of an outbreak can be limited.

Prioritization of Managed Pork Supply Movements during a FMD Outbreak in the US

PubMed Central

Patterson, Gilbert R.; Mohr, Alicia H.; Snider, Tim P.; Lindsay, Thomas A.; Davies, Peter R.; Goldsmith, Tim J.; Sampedro, Fernando

2016-01-01

In the event of a foot-and-mouth disease (FMD) outbreak in the United States, local, state, and federal authorities will implement a foreign animal disease emergency response plan restricting the pork supply chain movements and likely disrupting the continuity of the swine industry business. To minimize disruptions of the food supply while providing an effective response in an outbreak, it is necessary to have proactive measures in place to ensure minimal disease spread and maximum continuation of business. Therefore, it is critical to identify candidate movements for proactive risk assessments: those that are both most likely to contribute to disease spread and most necessary for business continuity. To do this, experts from production, harvest, retail, and allied pork industries assessed 30 common pork supply movements for risk of disease spread and industry criticality. The highest priority movements for conducting a risk assessment included the movement of weaned pigs originating from multiple sow farm sources to an off-site nursery or wean to finish facility, the movement of employees or commercial crews, the movement of vaccination crews, the movement of dedicated livestock hauling trucks, and the movement of commercial crews such as manure haulers and feed trucks onto, off, or between sites. These critical movements, along with several others identified in this study, will provide an initial guide for prioritization of risk management efforts and resources to be better prepared in the event of a FMD outbreak in the United States. By specifically and proactively targeting movements that experts agree are likely to spread the disease and are critical to the continuity of business operations, potentially catastrophic consequences in the event of an outbreak can be limited. PMID:27843934

Finite element analysis using NASTRAN applied to helicopter transmission vibration/noise reduction

NASA Technical Reports Server (NTRS)

Howells, R. W.; Sciarra, J. J.

1975-01-01

A finite element NASTRAN model of the complete forward rotor transmission housing for the Boeing Vertol CH-47 helicopter was developed and applied to reduce transmission vibration/noise at its source. In addition to a description of the model, a technique for vibration/noise prediction and reduction is outlined. Also included are the dynamic response as predicted by NASTRAN, test data, the use of strain energy methods to optimize the housing for minimum vibration/noise, and determination of design modifications which will be manufactured and tested. The techniques presented are not restricted to helicopters but are applicable to any power transmission system. The transmission housing model developed can be used further to evaluate static and dynamic stresses, thermal distortions, deflections and load paths, fail-safety/vulnerability, and composite materials.

Policy and science of FMD control: the stakeholders' contribution to decision making. A call for integrated animal disease management.

PubMed

Marshall, M; Roger, P

Effective control of foot-and-mouth disease (FMD)--prevention, surveillance and response--requires integrated animal disease management as a cooperative effort between stakeholders, scientists and decision makers, at all levels: local, national, regional and international. This paper suggests a process and outlines specific critical issues that need to be addressed in order to best use the science and technology that is available now and to develop new technologies that will lead to significant improvements. The overall objective is not to allow the disease or the disease control measures to damage, violate or destroy public health, the environment, or the economy, or to allow politics to drive disease control policies at the expense of the ethical relationship between man and animals. Critical issues of prevention, surveillance and response policies are examined, and specific recommendations are made to reduce the risk or effect of natural and deliberate introductions. For prevention: a) rapid portable diagnostics and provision of vaccines to control and eradicate the reservoirs of disease. b) alerts, leading to increased controls at borders, animal movement restrictions and biosecurity on farms. For surveillance: a) reporting of unusual symptoms, rapid diagnostics and identification of patterns. b) enhanced role of geographic information systems (GIS) linked to an IT system. c) collection, storage and sharing of disease information. For response policies: a) the role and implementation of stamping out and of vaccination. b) simulation exercises with stakeholder participation. For all aspects of FMD control, consideration should be given to: a) the composition, responsibilities and role of the balanced, permanently operational Expert Group in EU member states as specified in the EU FMD Directive. b) establishment of a balanced, permanently operational European Expert Group. c) establishment of both a European and an International FMD Task Force. Stakeholders need

Association of the expression of Th cytokines with peripheral CD4 and CD8 lymphocyte subsets after vaccination with FMD vaccine in Holstein young sires.

PubMed

Yang, Ling; Liu, Zhichao; Li, Jianbin; He, Kaili; Kong, Lingna; Guo, Runqing; Liu, Wenjiao; Gao, Yundong; Zhong, Jifeng

2018-05-25

High immune response (HIR) cows have a balanced and robust host defense and lower disease incidence, and immune response is more important to consider for selecting young sires than for selecting cows. The protective immune response against foot-and-mouth disease (FMD) virus infection is T-cell-independent in an animal experimental model. However, there is no convenient method to select young sires with a HIR to FMD virus. In this study, 39 healthy Holstein young sires were vaccinated with the trivalent (A, O and Asia 1) FMD vaccine, and T-lymphocyte subsets in peripheral blood lymphocytes (PBLs) were detected using flow cytometric analysis before and after vaccination. The expression of interferon-gamma (IFN-γ), interleukin-2 (IL-2), IL-4, and IL-6 mRNA in PBLs was analyzed after stimulation by lipopolysaccharide (LPS) or Concanavalin A (ConA) after vaccination. According to the percentage of CD4 + lymphocyte and CD4/CD8 ratio after vaccination for selecting the HIR young sires, the results showed that the percentages of CD3 + , CD4 + , CD3 + CD4 + lymphocytes and the CD4/CD8 ratio in the HIR group were higher compared to those in the medium immune response (MIR) and low immune response (LIR) groups before vaccination. Additionally, the percentage of CD4 + lymphocytes and the CD4/CD8 ratio after vaccination were positively associated with the expression level of IFN-γ mRNA in the PBLs after stimulation by LPS. In conclusion, the in vitro expression level of IFN-γ mRNA in the PBLs stimulated by LPS may serve as a parameter for selecting young sires with a HIR to FMD virus. Copyright © 2018 Elsevier Ltd. All rights reserved.

Evaluation of Infectivity, Virulence and Transmission of FDMV Field Strains of Serotypes O and A Isolated In 2010 from Outbreaks in the Republic of Korea

PubMed Central

Pacheco, Juan M.; Lee, Kwang-Nyeong; Eschbaumer, Michael; Bishop, Elizabeth A.; Hartwig, Ethan J.; Pauszek, Steven J.; Smoliga, George R.; Kim, Su-Mi; Park, Jong-Hyeon; Ko, Young-Joon; Lee, Hyang-Sim; Tark, Dongseob; Cho, In-Soo; Kim, Byounghan; Rodriguez, Luis L.; Arzt, Jonathan

2016-01-01

Since the early 2000s outbreaks of foot-and-mouth disease (FMD) have been described in several previously FMD-free Asian nations, including the Republic of Korea (South Korea). One outbreak with FMD virus (FDMV) serotype A and two with serotype O occurred in South Korea in 2010/2011. The causative viruses belonged to lineages that had been spreading in South East Asia, far East and East Asia since 2009 and presented a great threat to the countries in that region. Most FMDV strains infect ruminants and pigs, as it happened during the outbreaks of FMDV serotype O in South Korea. Contrastingly, the strain of serotype A affected only ruminants. Based upon these findings, the intention of the work described in the current report was to characterize and compare the infectivity, virulence and transmission of both strains under laboratory conditions in cattle and pigs, by direct inoculation and contact exposure. As expected, FMDV serotype O was highly virulent in both cattle and swine by contact exposure and direct inoculation. Surprisingly, FMDV serotype A was highly virulent in swine, but was less infectious in cattle by contact exposure to infected swine or cattle. Interestingly, similar quantities of aerosolized FMDV RNA were detected during experiments with viruses of serotypes O and A. Specific virus-host interaction of A/SKR/2010 could affect the transmission of this strain to cattle, and this may explain in part the limited spread of the serotype A epizootic. PMID:26735130

Evaluation of Infectivity, Virulence and Transmission of FDMV Field Strains of Serotypes O and A Isolated In 2010 from Outbreaks in the Republic of Korea

DOE PAGES

Pacheco, Juan M.; Lee, Kwang -Nyeong; Eschbaumer, Michael; ...

2016-01-06

Since the early 2000s outbreaks of foot-and-mouth disease (FMD) have been described in several previously FMD-free Asian nations, including the Republic of Korea (South Korea). One outbreak with FMD virus (FDMV) serotype A and two with serotype O occurred in South Korea in 2010/2011. The causative viruses belonged to lineages that had been spreading in South East Asia, far East and East Asia since 2009 and presented a great threat to the countries in that region. Most FMDV strains infect ruminants and pigs, as it happened during the outbreaks of FMDV serotype O in South Korea. Contrastingly, the strain ofmore » serotype A affected only ruminants. Based upon these findings, the intention of the work described in the current report was to characterize and compare the infectivity, virulence and transmission of both strains under laboratory conditions in cattle and pigs, by direct inoculation and contact exposure. As expected, FMDV serotype O was highly virulent in both cattle and swine by contact exposure and direct inoculation. Surprisingly, FMDV serotype A was highly virulent in swine, but was less infectious in cattle by contact exposure to infected swine or cattle. Interestingly, similar quantities of aerosolized FMDV RNA were detected during experiments with viruses of serotypes O and A. Here, specific virus-host interaction of A/SKR/2010 could affect the transmission of this strain to cattle, and this may explain in part the limited spread of the serotype A epizootic« less

Evaluation of Infectivity, Virulence and Transmission of FDMV Field Strains of Serotypes O and A Isolated In 2010 from Outbreaks in the Republic of Korea

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pacheco, Juan M.; Lee, Kwang -Nyeong; Eschbaumer, Michael

Since the early 2000s outbreaks of foot-and-mouth disease (FMD) have been described in several previously FMD-free Asian nations, including the Republic of Korea (South Korea). One outbreak with FMD virus (FDMV) serotype A and two with serotype O occurred in South Korea in 2010/2011. The causative viruses belonged to lineages that had been spreading in South East Asia, far East and East Asia since 2009 and presented a great threat to the countries in that region. Most FMDV strains infect ruminants and pigs, as it happened during the outbreaks of FMDV serotype O in South Korea. Contrastingly, the strain ofmore » serotype A affected only ruminants. Based upon these findings, the intention of the work described in the current report was to characterize and compare the infectivity, virulence and transmission of both strains under laboratory conditions in cattle and pigs, by direct inoculation and contact exposure. As expected, FMDV serotype O was highly virulent in both cattle and swine by contact exposure and direct inoculation. Surprisingly, FMDV serotype A was highly virulent in swine, but was less infectious in cattle by contact exposure to infected swine or cattle. Interestingly, similar quantities of aerosolized FMDV RNA were detected during experiments with viruses of serotypes O and A. Here, specific virus-host interaction of A/SKR/2010 could affect the transmission of this strain to cattle, and this may explain in part the limited spread of the serotype A epizootic« less

Within-farm transmission dynamics of foot and mouth disease as revealed by the 2001 epidemic in Great Britain.

PubMed

Chis Ster, Irina; Dodd, Peter J; Ferguson, Neil M

2012-08-01

This paper uses statistical and mathematical models to examine the potential impact of within-farm transmission dynamics on the spread of the 2001 foot and mouth disease (FMD) outbreak in Great Britain. We partly parameterize a simple within farm transmission model using data from experimental studies of FMD pathogenesis, embed this model within an existing between-farm transmission model, and then estimate unknown parameters (such as the species-specific within-farm reproduction number) from the 2001 epidemic case data using Markov Chain Monte-Carlo (MCMC) methods. If the probability of detecting an infected premises depends on farm size and species mix then the within-farm species specific basic reproduction ratios for baseline models are estimated to be 21 (16, 25) and 14 (10, 19) for cattle and sheep, respectively. Alternatively, if detection is independent of farm size, then the corresponding estimates are 49 (41, 61) and 10 (1.4, 21). Both model variants predict that the average fraction of total farm infectiousness accumulated prior to detection of infection on an IP is about 30-50% in cattle or mixed farms. The corresponding estimate for sheep farms depended more on the detection model, being 65-80% if detection was linked to the farms' characteristics, but only 25% if not. We highlighted evidence which reinforces the role of within-farm dynamics in contributing to the long tail of the 2001 epidemic. Copyright © 2012 Elsevier B.V. All rights reserved.

Force transmissibility versus displacement transmissibility

NASA Astrophysics Data System (ADS)

Lage, Y. E.; Neves, M. M.; Maia, N. M. M.; Tcherniak, D.

2014-10-01

It is well-known that when a single-degree-of-freedom (sdof) system is excited by a continuous motion of the foundation, the force transmissibility, relating the force transmitted to the foundation to the applied force, equals the displacement transmissibility. Recent developments in the generalization of the transmissibility to multiple-degree-of-freedom (mdof) systems have shown that similar simple and direct relations between both types of transmissibility do not appear naturally from the definitions, as happens in the sdof case. In this paper, the authors present their studies on the conditions under which it is possible to establish a relation between force transmissibility and displacement transmissibility for mdof systems. As far as the authors are aware, such a relation is not currently found in the literature, which is justified by being based on recent developments in the transmissibility concept for mdof systems. Indeed, it does not appear naturally, but the authors observed that the needed link is present when the displacement transmissibility is obtained between the same coordinates where the applied and reaction forces are considered in the force transmissibility case; this implies that the boundary conditions are not exactly the same and instead follow some rules. This work presents a formal derivation of the explicit relation between the force and displacement transmissibilities for mdof systems, and discusses its potential and limitations. The authors show that it is possible to obtain the displacement transmissibility from measured forces, and the force transmissibility from measured displacements, opening new perspectives, for example, in the identification of applied or transmitted forces. With this novel relation, it becomes possible, for example, to estimate the force transmissibility matrix with the structure off its supports, in free boundary conditions, and without measuring the forces. As far as force identification is concerned, this

Foot-and-mouth disease virus-associated abortion and vertical transmission following acute infection in cattle under natural conditions

USDA-ARS?s Scientific Manuscript database

Foot-and-mouth disease (FMD) is a highly contagious and economically important viral disease of cloven-hoofed animals, including domestic as well as more than 70 wild host species. During recent FMD outbreaks in India, spontaneous abortions were reported amongst FMD-affected and asymptomatic cows. T...

Foot-and-Mouth Disease Virus-Associated Abortion and Vertical Transmission following Acute Infection in Cattle under Natural Conditions

DOE PAGES

Ranjan, Rajeev; Biswal, Jitendra K.; Subramaniam, Saravanan; ...

2016-12-15

Foot-and-mouth disease (FMD) is a highly contagious and economically important viral disease of cloven-hoofed animals, including domestic and wild host species. During recent FMD outbreaks in India, spontaneous abortions were reported amongst FMD-affected and asymptomatic cows. The current study was an opportunistic investigation of these naturally occurring bovine abortions to assess causality of abortion and vertical transmission of FMDV from infected cows to fetuses. For this purpose, fetal tissue samples of eight abortuses (heart, liver, kidney, spleen, palatine tonsil, umbilical cord, soft palate, tongue, lungs, and submandibular lymph node) were collected and screened by various detection methods, including viral genomemore » detection, virus isolation, and immunomicroscopy. Amongst these cases, gross pathological changes were observed in 3 abortuses. Gross pathological findings included blood-tinged peritoneal and pleural effusions and myocarditis. Hearts of infected calves had mild to moderate degeneration and necrosis of the myocardium with moderate infiltration by mixed inflammatory cells. Localization of FMDV antigen was demonstrated in lungs and soft palate by immunomicroscopy. FMDV serotype O viral genome was recovered from 7 of 8 cases. Infectious FMDV serotype O was rescued by chemical transfection of the total RNA extracted from three soft palate samples and was sequenced to confirm 100% identity of the VP1 (capsid) coding region with isolates collected from infected cattle during the acute phase of infection. Based upon these findings, it may be concluded that FMDV-associated abortion occurred among the infected pregnant cows included within this study and FMDV was subsequently transmitted vertically to fetuses. This is the first documentation of FMDV-associated abortions in cattle.« less

Foot-and-Mouth Disease Virus-Associated Abortion and Vertical Transmission following Acute Infection in Cattle under Natural Conditions

PubMed Central

Ranjan, Rajeev; Biswal, Jitendra K.; Subramaniam, Saravanan; Singh, Karam Pal; Stenfeldt, Carolina; Rodriguez, Luis L.; Pattnaik, Bramhadev; Arzt, Jonathan

2016-01-01

Foot-and-mouth disease (FMD) is a highly contagious and economically important viral disease of cloven-hoofed animals, including domestic and wild host species. During recent FMD outbreaks in India, spontaneous abortions were reported amongst FMD-affected and asymptomatic cows. The current study was an opportunistic investigation of these naturally occurring bovine abortions to assess causality of abortion and vertical transmission of FMDV from infected cows to fetuses. For this purpose, fetal tissue samples of eight abortuses (heart, liver, kidney, spleen, palatine tonsil, umbilical cord, soft palate, tongue, lungs, and submandibular lymph node) were collected and screened by various detection methods, including viral genome detection, virus isolation, and immunomicroscopy. Amongst these cases, gross pathological changes were observed in 3 abortuses. Gross pathological findings included blood-tinged peritoneal and pleural effusions and myocarditis. Hearts of infected calves had mild to moderate degeneration and necrosis of the myocardium with moderate infiltration by mixed inflammatory cells. Localization of FMDV antigen was demonstrated in lungs and soft palate by immunomicroscopy. FMDV serotype O viral genome was recovered from 7 of 8 cases. Infectious FMDV serotype O was rescued by chemical transfection of the total RNA extracted from three soft palate samples and was sequenced to confirm 100% identity of the VP1 (capsid) coding region with isolates collected from infected cattle during the acute phase of infection. Based upon these findings, it may be concluded that FMDV-associated abortion occurred among the infected pregnant cows included within this study and FMDV was subsequently transmitted vertically to fetuses. This is the first documentation of FMDV-associated abortions in cattle. PMID:27977708

Foot-and-Mouth Disease Virus-Associated Abortion and Vertical Transmission following Acute Infection in Cattle under Natural Conditions

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ranjan, Rajeev; Biswal, Jitendra K.; Subramaniam, Saravanan

Foot-and-mouth disease (FMD) is a highly contagious and economically important viral disease of cloven-hoofed animals, including domestic and wild host species. During recent FMD outbreaks in India, spontaneous abortions were reported amongst FMD-affected and asymptomatic cows. The current study was an opportunistic investigation of these naturally occurring bovine abortions to assess causality of abortion and vertical transmission of FMDV from infected cows to fetuses. For this purpose, fetal tissue samples of eight abortuses (heart, liver, kidney, spleen, palatine tonsil, umbilical cord, soft palate, tongue, lungs, and submandibular lymph node) were collected and screened by various detection methods, including viral genomemore » detection, virus isolation, and immunomicroscopy. Amongst these cases, gross pathological changes were observed in 3 abortuses. Gross pathological findings included blood-tinged peritoneal and pleural effusions and myocarditis. Hearts of infected calves had mild to moderate degeneration and necrosis of the myocardium with moderate infiltration by mixed inflammatory cells. Localization of FMDV antigen was demonstrated in lungs and soft palate by immunomicroscopy. FMDV serotype O viral genome was recovered from 7 of 8 cases. Infectious FMDV serotype O was rescued by chemical transfection of the total RNA extracted from three soft palate samples and was sequenced to confirm 100% identity of the VP1 (capsid) coding region with isolates collected from infected cattle during the acute phase of infection. Based upon these findings, it may be concluded that FMDV-associated abortion occurred among the infected pregnant cows included within this study and FMDV was subsequently transmitted vertically to fetuses. This is the first documentation of FMDV-associated abortions in cattle.« less

Aerosol transmission of foot-and-mouth disease virus Asia-1 under experimental conditions.

PubMed

Colenutt, C; Gonzales, J L; Paton, D J; Gloster, J; Nelson, N; Sanders, C

2016-06-30

Foot-and-mouth disease virus (FMDV) control measures rely on understanding of virus transmission mechanisms. Direct contact between naïve and infected animals or spread by contaminated fomites is prevented by quarantines and rigorous decontamination procedures during outbreaks. Transmission of FMDV by aerosol may not be prevented by these control measures and this route of transmission may allow infection of animals at distance from the infection source. Understanding the potential for aerosol spread of specific FMDV strains is important for informing control strategies in an outbreak. Here, the potential for transmission of an FMDV Asia 1 strain between pigs and cattle by indirect aerosol exposure was evaluated in an experimental setting. Four naïve calves were exposed to aerosols emitted from three infected pigs in an adjacent room for a 10h period. Direct contact between pigs and cattle and fomite transfer between rooms was prevented. Viral titres in aerosols emitted by the infected pigs were measured to estimate the dose that calves were exposed to. One of the calves developed clinical signs of FMD, whilst there was serological evidence for spread to cattle by aerosol transmission in the remaining three calves. This highlights the possibility that this FMDV Asia 1 strain could be spread by aerosol transmission given appropriate environmental conditions should an outbreak occur in pigs. Our estimates suggest the exposure dose required for aerosol transmission was higher than has been previously quantified for other serotypes, implying that aerosols are less likely to play a significant role in transmission and spread of this FMDV strain. Copyright © 2016 Elsevier B.V. All rights reserved.

Reconstructing the origin and transmission dynamics of the 1967–68 foot-and-mouth disease epidemic in the United Kingdom☆

PubMed Central

Wright, Caroline F.; Knowles, Nick J.; Di Nardo, Antonello; Paton, David J.; Haydon, Daniel T.; King, Donald P.

2013-01-01

A large epidemic of foot-and-mouth disease (FMD) occurred in the United Kingdom (UK) over a seven month period in Northwest England from late 1967 to the summer of 1968. This was preceded by a number of smaller FMD outbreaks in the country, two in 1967, in Hampshire and Warwickshire and one in Northumberland during 1966. The causative agent of all four events was identified as FMD virus (FMDV) serotype O and the source of the large epidemic was attributed to infected bone marrow in lamb products imported from Argentina. However, the diagnostic tools available at the time were unable to entirely rule out connections with the earlier UK FMD outbreaks, as well as other potential sources from Europe. The aim of this study was to apply molecular sequencing to investigate the likely source of this epidemic using VP1 region and full genome (FG) sequences determined directly from clinical epithelium samples (n = 13) or cell culture isolates (n = 6), from this and contemporary outbreaks in the UK, Europe and South America. Analysis of the VP1 sequences provided evidence for at least three separate incursions of FMDV into the UK including one independent introduction that was responsible for the main 1967/68 epidemic. Analysis of FG sequences from the main 1967/68 outbreak (n = 10) revealed nucleotide substitutions at 94 genomic sites providing evidence for the linear accumulation of nucleotide substitutions (rate = 2.42 × 10−5 nt substitutions/site/day). However, there were five samples where this linear relationship was absent, indicating evolutional dormancy of the virus, presumably outside a host. These results help define the evolutionary dynamics of FMDV during an epidemic and contribute to the knowledge and understanding from which to base future outbreak control strategies. PMID:24035793

Evaluation of infectivity, virulence and transmission of FDMV field strains of serotypes O and A isolated in 2010 from outbreaks in the Republic of Korea

USDA-ARS?s Scientific Manuscript database

Since the early 2000s outbreaks of foot-and-mouth disease (FMD) have been described in several previously FMD-free Asian nations, including the Republic of Korea (ROK). One outbreak with FMD virus (FDMV) serotype A and two with serotype O occurred in ROK in 2010/2011. The causative viruses belong t...

6D.03: FLOW-MEDIATED DILATATION (FMD) AND ENDOTHELIUM-INDEPENDENT DILATATION (EID) IN PATIENTS WITH MULTIFOCAL FIBROMUSCULAR DYSPLASIA: A CROSS-SECTIONAL STUDY.

PubMed

Khettab, H; Lorthior, A; Niarra, R; Chambon, Y; Jeunemaitre, X; Plouin, P F; Laurent, S; Boutouyrie, P; Azizi, M

2015-06-01

Fibromuscular dysplasia (FD) is a rare idiopathic, segmental, non-atherosclerotic non-inflammatory vascular disease. We previously showed that FD is a general arterial disease with focal exacerbation of the trait. However, whether endothelial dysfunction may be involved in the pathophysiology of FD is unclear. In a cross sectional study, we compared the endothelial function between 50 patients with multifocal FD of renal/carotid arteries confirmed by CT-angiography, 50 essential hypertensive (EH) patients matched for age, sex, ethnicity and BP and 50 healthy subjects (HS) matched for age, sex and ethnicity. Exclusion criteria were: tobacco consumption, hypercholesterolemia, diabetes, aspirin or statin treatment. Brachial artery (BA) FMD after release of hand ischemia and glyceryl trinitrate (GTN)-induced EID was measured using a high-resolution radiofrequency-based echotracking system blind to the diagnosis. FD, EH and HS were well matched (52yrs, 85% women, 80% caucasian). SBP was higher in FD (125 ± 15mmHg) and EH (121 ± 12mmHg) than EH (113 ± 10mmHg) despite antihypertensive treatments. BA external diameter was significantly lower in FD than in both HS and EH before, during and after hand ischemia and after GTN. BA intima media thickness (IMT), internal diameter did not differ between the 3 groups. FMD (%) or EID (%) did not significantly differ between the 3 groups. BA flow velocity did not significantly differ in any experimental condition.(Figure is included in full-text article.) : In conclusion, despite showing similar acute vasodilatory responses to flow and GTN, FD patients differed from EH and HS in terms of arterial morphology with smaller BA diameter associated with similar IMT. This paradoxical remodeling may suggest a chronic defect in the endothelium-dependent pathways involved in arterial remodeling in FD patients.

Applying AI systems in the T and D arena. [Artificial Intelligence, Transmission and Distribution

DOE Office of Scientific and Technical Information (OSTI.GOV)

Venkata, S.S.; Liu, Chenching; Sumic, Z.

1993-04-01

The power engineering community has capitalized on various computer technologies since the early 1960s, with most successful application to solving well-defined problems that are capable of being modeled. Although computing methods have made notable progress in the power engineering arena, there is still a class of problems that is not easy to define or formulate to apply conventional computerized methods. In addition to being difficult to express in a closed mathematical form, these problems are often characterized by the absence of one or both of the following features: a predetermined decision path from the initial state to goal (ill-structured problem);more » a well-defined criteria for whether an obtained solution is acceptable (open-ended problem). Power engineers have been investigating the application of AI-based methodologies to power system problems. Most of the work in the past has been geared towards the development of expert systems as an operator's aid in energy control centers for bulk power transmission systems operating under abnormal conditions. Alarm processing, fault diagnosis, system restoration, and voltage/var control are a few key areas where significant research work has progressed to date. Results of this research have effected more than 100 prototype expert systems for power systems throughout the US, Japan, and Europe. The objectives of this article are to: expose engineers to the benefits of using AI methods for a host of transmission and distribution (T and D) problems that need immediate attention; identify problems that could be solved more effectively by applying AI approaches; summarize recent developments and successful AI applications in T and D.« less

Signal Detection Theory Applied to Helicopter Transmission Diagnostic Thresholds

NASA Technical Reports Server (NTRS)

Dempsey, Paula J.; Keller, Jonathan A.; Wade, Daniel R.

2008-01-01

Helicopter Health Usage Monitoring Systems (HUMS) have potential for providing data to support increasing the service life of a dynamic mechanical component in the transmission of a helicopter. Data collected can demonstrate the HUMS condition indicator responds to a specific component fault with appropriate alert limits and minimal false alarms. Defining thresholds for specific faults requires a tradeoff between the sensitivity of the condition indicator (CI) limit to indicate damage and the number of false alarms. A method using Receiver Operating Characteristic (ROC) curves to assess CI performance was demonstrated using CI data collected from accelerometers installed on several UH60 Black Hawk and AH64 Apache helicopters and an AH64 helicopter component test stand. Results of the analysis indicate ROC curves can be used to reliably assess the performance of commercial HUMS condition indicators to detect damaged gears and bearings in a helicopter transmission.

Signal Detection Theory Applied to Helicopter Transmission Diagnostic Thresholds

NASA Technical Reports Server (NTRS)

Dempsey, Paula J.; Keller, Jonathan A.; Wade, Daniel R.

2009-01-01

Helicopter Health Usage Monitoring Systems (HUMS) have potential for providing data to support increasing the service life of a dynamic mechanical component in the transmission of a helicopter. Data collected can demonstrate the HUMS condition indicator responds to a specific component fault with appropriate alert limits and minimal false alarms. Defining thresholds for specific faults requires a tradeoff between the sensitivity of the condition indicator (CI) limit to indicate damage and the number of false alarms. A method using Receiver Operating Characteristic (ROC) curves to assess CI performance was demonstrated using CI data collected from accelerometers installed on several UH60 Black Hawk and AH64 Apache helicopters and an AH64 helicopter component test stand. Results of the analysis indicate ROC curves can be used to reliably assess the performance of commercial HUMS condition indicators to detect damaged gears and bearings in a helicopter transmission.

Within herd transmission and evaluation of the performance of clinical and serological diagnosis of foot-and-mouth disease in partially immune cattle herds.

PubMed

Gonzales, J L; Barrientos, M A; Quiroga, J L; Ardaya, D; Daza, O; Martinez, C; Orozco, C; Crowther, J; Paton, D J

2014-10-29

The control of foot-and-mouth disease (FMD) in vaccinated populations relies upon surveillance activities such as clinical inspections (CI) and serological monitoring. New evidence to refine current surveillance guidelines has been provided by evaluating (1) the diagnostic performance of CI and serological tests for detection of FMD virus (FMDV) non-structural proteins (NSP), and (2) the within-herd transmission of the virus in partially immune cattle. Data came from 23 affected herds during an epidemic of FMDV type O in Bolivia, in 2007. All cattle (n=957) in these herds were clinically inspected and serum samples were collected one month after the last animal with clinical signs was detected. Samples were tested for the presence of antibodies against NSP using the PANAFTOSA 3ABC-ELISA test and a subset of samples were tested using the enzyme-linked immunoelectrotransfer blot assay (EITB). Data from clinical and serological diagnoses were analysed using a Bayesian model. The sensitivity Se and specificity Sp of the tests, as well as the prevalence and the within-herd reproduction ratio R of FMDV were estimated. In addition, risk factors for infection were identified. The Se of CI, the 3ABC-ELISA and the EITB tests were estimated to be 0.30, 0.88 and 0.96 respectively. The estimated Sp, in the same order, were 0.88, 0.93 and 0.97. The within-herd prevalence of infected animals ranged from 0.04 to 0.91 and R ranged from 1.02 to 2.68. It was observed that cattle coming from areas with high vaccination coverage had a lower risk of becoming infected than home-bred cattle from the affected herds, where vaccination coverage was thought to be low. Although these estimates come from herds kept under specific conditions, they provide a reference for future surveillance design and can inform simulation models for surveillance and control of FMD in similar cattle populations. Copyright © 2014 Elsevier Ltd. All rights reserved.

Value Transmissions between Parents and Children: Gender and Developmental Phase as Transmission Belts

ERIC Educational Resources Information Center

Roest, Annette M. C.; Dubas, Judith Semon; Gerris, Jan R. M.

2010-01-01

This study applied the gender role model of socialization theory, the developmental aging theory, and the topic salience perspective to the investigation of parent-child value transmissions. Specifically, we examined whether the bi-directionality and selectivity of value transmissions differed as a function of parents' and children's gender and…

Continuously Variable Transmission

NASA Technical Reports Server (NTRS)

Grana, D. C.

1985-01-01

Chain slides along two cones, in novel transmission concept. Transmission includes chain drive between two splined shafts. Chain sprockets follow surfaces of two cones. As one chain sprocket moves toward smaller diameter other chain sprocket moves toward larger diameter, thereby changing "gear" ratio. Movement initiated by tension applied to chain by planetary gear mechanism. Device positive, simple, and efficient over wide range of speed ratios.

Genetic and antigenic characterisation of serotype A FMD viruses from East Africa to select new vaccine strains

PubMed Central

Bari, Fufa D.; Parida, Satya; Tekleghiorghis, Tesfaalem; Dekker, Aldo; Sangula, Abraham; Reeve, Richard; Haydon, Daniel T.; Paton, David J.; Mahapatra, Mana

2014-01-01

Vaccine strain selection for emerging foot-and-mouth disease virus (FMDV) outbreaks in enzootic countries can be addressed through antigenic and genetic characterisation of recently circulating viruses. A total of 56 serotype A FMDVs isolated between 1998 and 2012, from Central, East and North African countries were characterised antigenically by virus neutralisation test using antisera to three existing and four candidate vaccine strains and, genetically by characterising the full capsid sequence data. A Bayesian analysis of the capsid sequence data revealed the viruses to be of either African or Asian topotypes with subdivision of the African topotype viruses into four genotypes (Genotypes I, II, IV and VII). The existing vaccine strains were found to be least cross-reactive (good matches observed for only 5.4–46.4% of the sampled viruses). Three bovine antisera, raised against A-EA-2007, A-EA-1981 and A-EA-1984 viruses, exhibited broad cross-neutralisation, towards more than 85% of the circulating viruses. Of the three vaccines, A-EA-2007 was the best showing more than 90% in-vitro cross-protection, as well as being the most recent amongst the vaccine strains used in this study. It therefore appears antigenically suitable as a vaccine strain to be used in the region in FMD control programmes. PMID:25171846

Triangular node for Transmission-Line Modeling (TLM) applied to bio-heat transfer.

PubMed

Milan, Hugo F M; Gebremedhin, Kifle G

2016-12-01

Transmission-Line Modeling (TLM) is a numerical method used to solve complex and time-domain bio-heat transfer problems. In TLM, rectangles are used to discretize two-dimensional problems. The drawback in using rectangular shapes is that instead of refining only the domain of interest, a large additional domain will also be refined in the x and y axes, which results in increased computational time and memory space. In this paper, we developed a triangular node for TLM applied to bio-heat transfer that does not have the drawback associated with the rectangular nodes. The model includes heat source, blood perfusion (advection), boundary conditions and initial conditions. The boundary conditions could be adiabatic, temperature, heat flux, or convection. A matrix equation for TLM, which simplifies the solution of time-domain problems or solves steady-state problems, was also developed. The predicted results were compared against results obtained from the solution of a simplified two-dimensional problem, and they agreed within 1% for a mesh length of triangular faces of 59µm±9µm (mean±standard deviation) and a time step of 1ms. Copyright © 2016 Elsevier Ltd. All rights reserved.

Soil compaction: Evaluation of stress transmission and resulting soil structure

NASA Astrophysics Data System (ADS)

Naveed, Muhammad; Schjønning, Per; Keller, Thomas; Lamande, Mathieu

2016-04-01

Accurate estimation of stress transmission and resultant deformation in soil profiles is a prerequisite for the development of predictive models and decision support tools for preventing soil compaction. Numerous studies have been carried out on the effects of soil compaction, whilst relatively few studies have focused on the cause (mode of stress transmission in the soil). We have coupled both cause and effects together in the present study by carrying out partially confined compression tests on (1) wet aggregates, (2) air dry aggregates, and (3) intact soils to quantify stress transmission and compaction-resulted soil structure at the same time. Stress transmission was quantified using both X-ray CT and Tactilus sensor mat, and soil-pore structure was quantified using X-ray CT. Our results imply that stress transmission through soil highly depends on the magnitude of applied load and aggregate strength. As soon as the applied load is lower than the aggregate strength, the mode of stress transmission is discrete as stresses were mainly transmitted through chain of aggregates. With increasing applied load soil aggregates start deforming that transformed heterogeneous soil into homogenous, as a result stress transmission mode was shifted from discrete towards more like a continuum. Continuum-like stress transmission mode was better simulated with Boussinesq (1885) model based on theory of elasticity compared to discrete. The soil-pore structure was greatly affected by increasing applied stresses. Total porosity was reduced 5-16% and macroporosity 50-85% at 620 kPa applied stress for the intact soils. Similarly, significant changes in the morphological indices of the macropore space were also observed with increasing applied stresses.

Malaria transmission rates estimated from serological data.

PubMed Central

Burattini, M. N.; Massad, E.; Coutinho, F. A.

1993-01-01

A mathematical model was used to estimate malaria transmission rates based on serological data. The model is minimally stochastic and assumes an age-dependent force of infection for malaria. The transmission rates estimated were applied to a simple compartmental model in order to mimic the malaria transmission. The model has shown a good retrieving capacity for serological and parasite prevalence data. PMID:8270011

Value transmissions between parents and children: gender and developmental phase as transmission belts.

PubMed

Roest, Annette M C; Dubas, Judith Semon; Gerris, Jan R M

2010-02-01

This study applied the gender role model of socialization theory, the developmental aging theory, and the topic salience perspective to the investigation of parent-child value transmissions. Specifically, we examined whether the bi-directionality and selectivity of value transmissions differed as a function of parents' and children's gender and children's developmental phase (adolescence versus emerging adulthood). Transmissions between parents and children from 402 Dutch families on the topics of work as duty and hedonism were studied across a 5-year period using structural equation modeling. As expected, we did not find convincing support for the general models of gender socialization and developmental aging. Instead, parent-child value transmissions appeared to be qualified by value salience. Particularly, high salience of work as duty for fathers was related with great paternal involvement in transmissions on this value orientation and high salience of hedonism for sons and adolescents was linked to transmissions from these groups to parents. Copyright (c) 2009 The Association for Professionals in Services for Adolescents. Published by Elsevier Ltd. Published by Elsevier Ltd. All rights reserved.

Foot-and-Mouth Disease Impact on Smallholders - What Do We Know, What Don't We Know and How Can We Find Out More?

PubMed

Knight-Jones, T J D; McLaws, M; Rushton, J

2017-08-01

Foot-and-mouth disease (FMD) endemic regions contain three-quarters of the world's FMD susceptible livestock and most of the world's poor livestock keepers. Yet FMD impact on smallholders in these regions is poorly understood. Diseases of low mortality can exert a large impact if incidence is high. Modelling and field studies commonly find high FMD incidence in endemic countries. Sero-surveys typically find a third of young cattle are sero-positive, however, the proportion of sero-positive animals that developed disease, and resulting impact, are unknown. The few smallholder FMD impact studies that have been performed assessed different aspects of impact, using different approaches. They find that FMD impact can be high (>10% of annual household income). However, impact is highly variable, being a function of FMD incidence and dependency on activities affected by FMD. FMD restricts investment in productive but less FMD-resilient farming methods, however, other barriers to efficient production may exist, reducing the benefits of FMD control. Applying control measures is costly and can have wide-reaching negative impacts; veterinary-cordon-fences may damage wildlife populations, and livestock movement restrictions and trade bans damage farmer profits and the wider economy. When control measures are ineffective, farmers, society and wildlife may experience the burden of control without reducing disease burden. Foot-and-mouth disease control has benefitted smallholders in South America and elsewhere. Success takes decades of regional cooperation with effective veterinary services and widespread farmer participation. However, both the likelihood of success and the full cost of control measures must be considered. Controlling FMD in smallholder systems is challenging, particularly when movement restrictions are hard to enforce. In parts of Africa this is compounded by endemically infected wildlife and limited vaccine performance. This paper reviews FMD impact on

Investigation of smallholder farmer biosecurity and implications for sustainable foot-and-mouth disease control in Cambodia.

PubMed

Young, J R; Suon, S; Olmo, L; Bun, C; Hok, C; Ashley, K; Bush, R D; Windsor, P A

2017-12-01

In Cambodia, the majority of the population is rural and reliant on subsistence agriculture, with cattle raised by smallholder farmers using traditional practices, resulting in low productivity and vulnerability to foot-and-mouth disease (FMD). As FMD causes deleterious impacts on rural livelihoods, known FMD risk factors were reviewed, using knowledge, attitudes and practice (KAP) surveys of smallholders (n = 240) from four regions. The study aimed to understand current biosecurity threats to smallholder livelihoods and investigate the hypothesis that smallholder farmers practising FMD risk management should be associated with higher incomes from cattle. Descriptive data were examined to demonstrate trends in KAP and a multivariable linear regression model developed to identify cattle income predictors. Results showed that baseline mean knowledge scores were low at 28.4% across all regions and basic biosecurity practices, including quarantine of new cattle, isolation of sick cattle and FMD vaccination, were lacking. As farmers purchase and sell cattle from and to various administration levels (including export), there is high risk of FMD transmission into and from smallholder communities. The final multivariable linear regression model identified significant explanatory parameters for annual cattle income, including region, number of calves born, forage plot size (ha), vaccination of cattle and the number of cattle purchased (F pr. < 0.001, R 2  = 29.9). Individual biosecurity practices including FMD vaccination were not significant predictors of income. With the current focus of farmers on treatment of FMD with inappropriate antibiotics leading to potential anti-microbial residue issues, yet receptivity to payment for vaccine in most regions, there is an urgent need for a coordinated national biosecurity and FMD management public awareness campaign. Further, to enhance the association between improved cattle health and rural livelihoods, it is recommended

The performance of approximations of farm contiguity compared to contiguity defined using detailed geographical information in two sample areas in Scotland: implications for foot-and-mouth disease modelling.

PubMed

Flood, Jessica S; Porphyre, Thibaud; Tildesley, Michael J; Woolhouse, Mark E J

2013-10-08

When modelling infectious diseases, accurately capturing the pattern of dissemination through space is key to providing optimal recommendations for control. Mathematical models of disease spread in livestock, such as for foot-and-mouth disease (FMD), have done this by incorporating a transmission kernel which describes the decay in transmission rate with increasing Euclidean distance from an infected premises (IP). However, this assumes a homogenous landscape, and is based on the distance between point locations of farms. Indeed, underlying the spatial pattern of spread are the contact networks involved in transmission. Accordingly, area-weighted tessellation around farm point locations has been used to approximate field-contiguity and simulate the effect of contiguous premises (CP) culling for FMD. Here, geographic data were used to determine contiguity based on distance between premises' fields and presence of landscape features for two sample areas in Scotland. Sensitivity, positive predictive value, and the True Skill Statistic (TSS) were calculated to determine how point distance measures and area-weighted tessellation compared to the 'gold standard' of the map-based measures in identifying CPs. In addition, the mean degree and density of the different contact networks were calculated. Utilising point distances <1 km and <5 km as a measure for contiguity resulted in poor discrimination between map-based CPs/non-CPs (TSS 0.279-0.344 and 0.385-0.400, respectively). Point distance <1 km missed a high proportion of map-based CPs; <5 km point distance picked up a high proportion of map-based non-CPs as CPs. Area-weighted tessellation performed best, with reasonable discrimination between map-based CPs/non-CPs (TSS 0.617-0.737) and comparable mean degree and density. Landscape features altered network properties considerably when taken into account. The farming landscape is not homogeneous. Basing contiguity on geographic locations of field boundaries and including

Tetrahedral node for Transmission-Line Modeling (TLM) applied to Bio-heat Transfer.

PubMed

Milan, Hugo F M; Gebremedhin, Kifle G

2016-12-01

Transmission-Line Modeling (TLM) is a numerical method used to solve complex and time-domain bio-heat transfer problems. In TLM, parallelepipeds are used to discretize three-dimensional problems. The drawback in using parallelepiped shapes is that instead of refining only the domain of interest, a large additional domain would also have to be refined, which results in increased computational time and memory space. In this paper, we developed a tetrahedral node for TLM applied to bio-heat transfer that does not have the drawback associated with the parallelepiped node. The model includes heat source, blood perfusion, boundary conditions and initial conditions. The boundary conditions could be adiabatic, temperature, heat flux, or convection. The predicted temperature and heat flux were compared against results from an analytical solution and the results agreed within 2% for a mesh size of 69,941 nodes and a time step of 5ms. The method was further validated against published results of maximum skin-surface temperature difference in a breast with and without tumor and the results agreed within 6%. The published results were obtained from a model that used parallelepiped TLM node. An open source software, TLMBHT, was written using the theory developed herein and is available for download free-of-charge. Copyright © 2016 Elsevier Ltd. All rights reserved.

Dynamics of Mechanical Signal Transmission through Prestressed Stress Fibers

PubMed Central

Hwang, Yongyun; Barakat, Abdul I.

2012-01-01

Transmission of mechanical stimuli through the actin cytoskeleton has been proposed as a mechanism for rapid long-distance mechanotransduction in cells; however, a quantitative understanding of the dynamics of this transmission and the physical factors governing it remains lacking. Two key features of the actin cytoskeleton are its viscoelastic nature and the presence of prestress due to actomyosin motor activity. We develop a model of mechanical signal transmission through prestressed viscoelastic actin stress fibers that directly connect the cell surface to the nucleus. The analysis considers both temporally stationary and oscillatory mechanical signals and accounts for cytosolic drag on the stress fibers. To elucidate the physical parameters that govern mechanical signal transmission, we initially focus on the highly simplified case of a single stress fiber. The results demonstrate that the dynamics of mechanical signal transmission depend on whether the applied force leads to transverse or axial motion of the stress fiber. For transverse motion, mechanical signal transmission is dominated by prestress while fiber elasticity has a negligible effect. Conversely, signal transmission for axial motion is mediated uniquely by elasticity due to the absence of a prestress restoring force. Mechanical signal transmission is significantly delayed by stress fiber material viscosity, while cytosolic damping becomes important only for longer stress fibers. Only transverse motion yields the rapid and long-distance mechanical signal transmission dynamics observed experimentally. For simple networks of stress fibers, mechanical signals are transmitted rapidly to the nucleus when the fibers are oriented largely orthogonal to the applied force, whereas the presence of fibers parallel to the applied force slows down mechanical signal transmission significantly. The present results suggest that cytoskeletal prestress mediates rapid mechanical signal transmission and allows

Essays on electricity transmission investment and financial transmission rights

NASA Astrophysics Data System (ADS)

Shang, Wenzhuo

The U.S. electric power industry has been going through fundamental restructuring and realignment since the 1990's. Many issues and problems have emerged during the transition, and both economists and engineers have been looking for the solutions fervently. In this dissertation, which consists primarily of three essays, we apply economics theory and techniques to the power industry and address two related issues, transmission investment and financial transmission rights (FTRs). The first essay takes the decentralized perspective and investigates the efficiency attribute of market-based transmission investment under perfect competition. We clarify, for the first time, the nature of the externality created by loop flows that causes transmission investment to be inefficient. Our findings have important implications for better understanding of transmission market design and creating incentives for efficient transmission investment. In the second essay, we define several rules for allocating transmission investment cost within the framework of cooperative game theory. These rules provide fair, stable or efficient cost allocations in theory and are good benchmarks against which the allocation mechanism in practice can be compared and improved upon. In the last essay, we make exploratory efforts in analyzing and assessing empirically the performance of the Midwest independent system operator (MISO) FTR auction market. We reveal some stylized facts about this young market and find that it is not efficient under the risk-neutrality assumption. We also point out and correct the drawbacks in previous related work and suggest about more complete empirical work in future. In all, this dissertation makes both theoretic and empirical analysis of the two hot issues related to the power industry and comes up with findings that have important implications for the development of this industry.

Simultaneous compression and encryption for secure real-time secure transmission of sensitive video transmission

NASA Astrophysics Data System (ADS)

Al-Hayani, Nazar; Al-Jawad, Naseer; Jassim, Sabah A.

2014-05-01

Video compression and encryption became very essential in a secured real time video transmission. Applying both techniques simultaneously is one of the challenges where the size and the quality are important in multimedia transmission. In this paper we proposed a new technique for video compression and encryption. Both encryption and compression are based on edges extracted from the high frequency sub-bands of wavelet decomposition. The compression algorithm based on hybrid of: discrete wavelet transforms, discrete cosine transform, vector quantization, wavelet based edge detection, and phase sensing. The compression encoding algorithm treats the video reference and non-reference frames in two different ways. The encryption algorithm utilized A5 cipher combined with chaotic logistic map to encrypt the significant parameters and wavelet coefficients. Both algorithms can be applied simultaneously after applying the discrete wavelet transform on each individual frame. Experimental results show that the proposed algorithms have the following features: high compression, acceptable quality, and resistance to the statistical and bruteforce attack with low computational processing.

Hybrid powertrain system including smooth shifting automated transmission

DOEpatents

Beaty, Kevin D.; Nellums, Richard A.

2006-10-24

A powertrain system is provided that includes a prime mover and a change-gear transmission having an input, at least two gear ratios, and an output. The powertrain system also includes a power shunt configured to route power applied to the transmission by one of the input and the output to the other one of the input and the output. A transmission system and a method for facilitating shifting of a transmission system are also provided.

SURVIVAL AND TRANSMISSION OF PATHOGENS IN THE ENVIRONMENT

EPA Science Inventory

To provide and apply scientific knowledge regarding the survival and transmission of pathogens in the clinical setting to their potential survival and transmission in the natural environment. Similar to the hospital environment where pathogens reside in organic debris treated wi...

Global Foot-and-Mouth Disease Research Update and Gap Analysis: 2 - Epidemiology, Wildlife and Economics.

PubMed

Knight-Jones, T J D; Robinson, L; Charleston, B; Rodriguez, L L; Gay, C G; Sumption, K J; Vosloo, W

2016-06-01

We assessed knowledge gaps in foot-and-mouth disease (FMD) research, and in this study, we consider (i) epidemiology, (ii) wildlife and (iii) economics. The study took the form of a literature review (2011-2015) combined with research updates collected in 2014 from 33 institutes from across the world. Findings were used to identify priority areas for future FMD research. During 2011-2015, modelling studies were dominant in the broad field of epidemiology; however, continued efforts are required to develop robust models for use during outbreaks in FMD-free countries, linking epidemiologic and economics models. More guidance is needed for both the evaluation and the setting of targets for vaccine coverage, population immunity and vaccine field efficacy. Similarly, methods for seroprevalence studies need to be improved to obtain more meaningful outputs that allow comparison across studies. To inform control programmes in endemic countries, field trials assessing the effectiveness of vaccination in extensive smallholder systems should be performed to determine whether FMD can be controlled with quality vaccines in settings where implementing effective biosecurity is challenging. Studies need to go beyond measuring only vaccine effects and should extend our knowledge of the impact of FMD and increase our understanding of how to maximize farmer participation in disease control. Where wildlife reservoirs of virus exist, particularly African Buffalo, we need to better understand when and under what circumstances transmission to domestic animals occurs in order to manage this risk appropriately, considering the impact of control measures on livelihoods and wildlife. For settings where FMD eradication is unfeasible, further ground testing of commodity-based trade is recommended. A thorough review of global FMD control programmes, covering successes and failures, would be extremely valuable and could be used to guide other control programmes. © 2016 Blackwell Verlag GmbH.

Normalization of flow-mediated dilation to shear stress area under the curve eliminates the impact of variable hyperemic stimulus.

PubMed

Padilla, Jaume; Johnson, Blair D; Newcomer, Sean C; Wilhite, Daniel P; Mickleborough, Timothy D; Fly, Alyce D; Mather, Kieren J; Wallace, Janet P

2008-09-04

Normalization of brachial artery flow-mediated dilation (FMD) to individual shear stress area under the curve (peak FMD:SSAUC ratio) has recently been proposed as an approach to control for the large inter-subject variability in reactive hyperemia-induced shear stress; however, the adoption of this approach among researchers has been slow. The present study was designed to further examine the efficacy of FMD normalization to shear stress in reducing measurement variability. Five different magnitudes of reactive hyperemia-induced shear stress were applied to 20 healthy, physically active young adults (25.3 +/- 0. 6 yrs; 10 men, 10 women) by manipulating forearm cuff occlusion duration: 1, 2, 3, 4, and 5 min, in a randomized order. A venous blood draw was performed for determination of baseline whole blood viscosity and hematocrit. The magnitude of occlusion-induced forearm ischemia was quantified by dual-wavelength near-infrared spectrometry (NIRS). Brachial artery diameters and velocities were obtained via high-resolution ultrasound. The SSAUC was individually calculated for the duration of time-to-peak dilation. One-way repeated measures ANOVA demonstrated distinct magnitudes of occlusion-induced ischemia (volume and peak), hyperemic shear stress, and peak FMD responses (all p < 0.0001) across forearm occlusion durations. Differences in peak FMD were abolished when normalizing FMD to SSAUC (p = 0.785). Our data confirm that normalization of FMD to SSAUC eliminates the influences of variable shear stress and solidifies the utility of FMD:SSAUC ratio as an index of endothelial function.

Challenges and Economic Implications in the Control of Foot and Mouth Disease in Sub-Saharan Africa: Lessons from the Zambian Experience

PubMed Central

Sinkala, Y.; Simuunza, M.; Pfeiffer, D. U.; Munang'andu, H. M.; Mulumba, M.; Kasanga, C. J.; Muma, J. B.; Mweene, A. S.

2014-01-01

Foot and mouth disease is one of the world's most important livestock diseases for trade. FMD infections are complex in nature and there are many epidemiological factors needing clarification. Key questions relate to the control challenges and economic impact of the disease for resource-poor FMD endemic countries like Zambia. A review of the control challenges and economic impact of FMD outbreaks in Zambia was made. Information was collected from peer-reviewed journals articles, conference proceedings, unpublished scientific reports, and personal communication with scientists and personal field experiences. The challenges of controlling FMD using mainly vaccination and movement control are discussed. Impacts include losses in income of over US$ 1.6 billion from exports of beef and sable antelopes and an annual cost of over US$ 2.7 million on preventive measures. Further impacts included unquantified losses in production and low investment in agriculture resulting in slow economic growth. FMD persistence may be a result of inadequate epidemiological understanding of the disease and ineffectiveness of the control measures that are being applied. The identified gaps may be considered in the annual appraisal of the FMD national control strategy in order to advance on the progressive control pathway. PMID:25276472

Challenges and economic implications in the control of foot and mouth disease in sub-saharan Africa: lessons from the zambian experience.

PubMed

Sinkala, Y; Simuunza, M; Pfeiffer, D U; Munang'andu, H M; Mulumba, M; Kasanga, C J; Muma, J B; Mweene, A S

2014-01-01

Foot and mouth disease is one of the world's most important livestock diseases for trade. FMD infections are complex in nature and there are many epidemiological factors needing clarification. Key questions relate to the control challenges and economic impact of the disease for resource-poor FMD endemic countries like Zambia. A review of the control challenges and economic impact of FMD outbreaks in Zambia was made. Information was collected from peer-reviewed journals articles, conference proceedings, unpublished scientific reports, and personal communication with scientists and personal field experiences. The challenges of controlling FMD using mainly vaccination and movement control are discussed. Impacts include losses in income of over US$ 1.6 billion from exports of beef and sable antelopes and an annual cost of over US$ 2.7 million on preventive measures. Further impacts included unquantified losses in production and low investment in agriculture resulting in slow economic growth. FMD persistence may be a result of inadequate epidemiological understanding of the disease and ineffectiveness of the control measures that are being applied. The identified gaps may be considered in the annual appraisal of the FMD national control strategy in order to advance on the progressive control pathway.

Preliminary Evaluation of Commercial Off the Shelf (COTS) Packing Materials for Flight Medication Dispenser (FMD) Technology Development

NASA Technical Reports Server (NTRS)

Du, Brian; Daniels, Vernie; Crady, Camille; Putcha, Lakshmi

2010-01-01

With the advent of longer duration space missions, pharmaceutical use in space has increased. During the first 33 space shuttle missions, crew members took more than 500 individual doses of 31 different medications . Anecdotal reports from crew members described medications as generally "well tolerated" and "effective". However, reported use of increased medication doses and discrepancies in ground vs. flight efficacy may result from reduced potency or altered bioavailability due to changes in chemical and/or physical parameters of pharmaceutical stability. Based on preliminary results from a ground-based irradiation and an inflight study on pharmaceutical stability, three susceptible medications, Amoxicillin/Clavulanate and Sulfamethoxazole/trimethoprim antibiotics tablets and promethazine (PMZ), an antihistamine were selected for testing using two types of Oliver-Tolas bags, TPC-1475(Clear) and TPF-0599B (Foil) for radiation Shielding effectiveness. The material composition of the bags included aluminum coated Mylar sheathing coated with multifunctional nanocomposities based on polyethylene with dispersed boron-rich nanophases. Two bags of each medication were irradiated for different time intervals with 14.6 rad/min to achieve 0.1 Gy, 1 Gy and 10 Gy of cumulative radiation dose. Active pharmaceutical content (API) in each medication was determined and results analyzed. No significant difference in API content was observed between control and irradiated samples for both antibiotic tablets suggesting both types of bags may offer protection against gamma radiation; results with PMZ were inconclusive. These preliminary results suggest that Oliver-Tolas TPL-1475 and TPF-0599B materials may possess characteristics suitable for protection against ionizing radiation and can be considered for designing and further testing of FMD technology.

Role of Semen on Vaginal HIV-1 Transmission and Maraviroc Protection

PubMed Central

Council, Olivia D.; Swanson, Michael D.; Spagnuolo, Rae Ann

2015-01-01

We used bone marrow/liver/thymus (BLT) humanized mice to establish the effect of semen on vaginal HIV infection and on the efficacy of topically applied maraviroc. Our results demonstrate that vaginal transmission of cell-free HIV occurs efficiently in the presence of semen and that topically applied maraviroc efficiently prevents HIV transmission in the presence of semen. We also show that semen has no significant effect on the transmission of transmitted/founder viruses or cell-associated viruses. PMID:26392489

8 CFR 217.7 - Electronic data transmission requirement.

Code of Federal Regulations, 2014 CFR

2014-01-01

... 8 Aliens and Nationality 1 2014-01-01 2014-01-01 false Electronic data transmission requirement... VISA WAIVER PROGRAM § 217.7 Electronic data transmission requirement. (a) An alien who applies for... to submit the required electronic arrival or departure manifests specified in paragraph (a) of this...

8 CFR 217.7 - Electronic data transmission requirement.

Code of Federal Regulations, 2011 CFR

2011-01-01

... 8 Aliens and Nationality 1 2011-01-01 2011-01-01 false Electronic data transmission requirement... VISA WAIVER PROGRAM § 217.7 Electronic data transmission requirement. (a) An alien who applies for... to submit the required electronic arrival or departure manifests specified in paragraph (a) of this...

8 CFR 217.7 - Electronic data transmission requirement.

Code of Federal Regulations, 2012 CFR

2012-01-01

... 8 Aliens and Nationality 1 2012-01-01 2012-01-01 false Electronic data transmission requirement... VISA WAIVER PROGRAM § 217.7 Electronic data transmission requirement. (a) An alien who applies for... to submit the required electronic arrival or departure manifests specified in paragraph (a) of this...

8 CFR 217.7 - Electronic data transmission requirement.

Code of Federal Regulations, 2013 CFR

2013-01-01

... 8 Aliens and Nationality 1 2013-01-01 2013-01-01 false Electronic data transmission requirement... VISA WAIVER PROGRAM § 217.7 Electronic data transmission requirement. (a) An alien who applies for... to submit the required electronic arrival or departure manifests specified in paragraph (a) of this...

Well-posed and stable transmission problems

NASA Astrophysics Data System (ADS)

Nordström, Jan; Linders, Viktor

2018-07-01

We introduce the notion of a transmission problem to describe a general class of problems where different dynamics are coupled in time. Well-posedness and stability are analysed for continuous and discrete problems using both strong and weak formulations, and a general transmission condition is obtained. The theory is applied to the coupling of fluid-acoustic models, multi-grid implementations, adaptive mesh refinements, multi-block formulations and numerical filtering.

Review: Evaluation of Foot-and-Mouth Disease Control Using Fault Tree Analysis.

PubMed

Isoda, N; Kadohira, M; Sekiguchi, S; Schuppers, M; Stärk, K D C

2015-06-01

An outbreak of foot-and-mouth disease (FMD) causes huge economic losses and animal welfare problems. Although much can be learnt from past FMD outbreaks, several countries are not satisfied with their degree of contingency planning and aiming at more assurance that their control measures will be effective. The purpose of the present article was to develop a generic fault tree framework for the control of an FMD outbreak as a basis for systematic improvement and refinement of control activities and general preparedness. Fault trees are typically used in engineering to document pathways that can lead to an undesired event, that is, ineffective FMD control. The fault tree method allows risk managers to identify immature parts of the control system and to analyse the events or steps that will most probably delay rapid and effective disease control during a real outbreak. The present developed fault tree is generic and can be tailored to fit the specific needs of countries. For instance, the specific fault tree for the 2001 FMD outbreak in the UK was refined based on control weaknesses discussed in peer-reviewed articles. Furthermore, the specific fault tree based on the 2001 outbreak was applied to the subsequent FMD outbreak in 2007 to assess the refinement of control measures following the earlier, major outbreak. The FMD fault tree can assist risk managers to develop more refined and adequate control activities against FMD outbreaks and to find optimum strategies for rapid control. Further application using the current tree will be one of the basic measures for FMD control worldwide. © 2013 Blackwell Verlag GmbH.

Characterization of Foot-and-Mouth Disease Viruses Collected in Nigeria Between 2007 and 2014: Evidence for Epidemiological Links Between West and East Africa.

PubMed

Ularamu, H G; Ibu, J O; Wood, B A; Abenga, J N; Lazarus, D D; Wungak, Y S; Knowles, N J; Wadsworth, J; Mioulet, V; King, D P; Shamaki, D; Adah, M I

2017-12-01

This study describes the molecular characterization of 47 foot-and-mouth disease (FMD) viruses recovered from field outbreaks in Nigeria between 2007 and 2014. Antigen ELISA of viral isolates was used to identify FMD virus serotypes O, A and SAT 2. Phylogenetic analyses of VP1 nucleotide sequences provide evidence for the presence of multiple sublineages of serotype SAT 2, and O/EAST AFRICA 3 (EA-3) and O/WEST AFRICA topotypes in the country. In contrast, for serotype A, a single monophyletic cluster of viruses has persisted within Nigeria (2009-2013). These results demonstrate the close genetic relatedness of viruses in Nigeria to those from other African countries, including the first formal characterization of serotype O/EA-3 viruses in Nigeria. The introductions and persistence of certain viral lineages in Nigeria may reflect transmission patterns via nomadic pastoralism and animal trade. Continuous monitoring of field outbreaks is necessary to dissect the complexity of FMD epidemiology in sub-Saharan Africa. © 2016 Blackwell Verlag GmbH.

Review of the transmissions of the Soviet helicopters

NASA Technical Reports Server (NTRS)

Chaiko, Lev I.

1990-01-01

A review of the following aspects of Soviet helicopter transmissions is presented: transmitted power, weight, reduction ratio, RPM, design configuration, comparison of different type of manufacturing methods, and a description of the materials and technologies applied to critical transmission components. Included are mechanical diagrams of the gearboxes of the Soviet helicopters and test stands for testing gearbox and main shaft. The quality of Soviet helicopter transmissions and their Western counterparts are assessed and compared.

Importation of beef from countries infected with foot and mouth disease: a review of risk mitigation measures.

PubMed

Sutmoller, P

2001-12-01

Risk mitigation measures to reduce the risks associated with importing beef from countries affected by foot and mouth disease (FMD) consist of controls at the farm of origin, inspection of slaughterhouses and maturation and deboning of carcasses. This assessment evaluates the effect of these measures on the mitigation of the risks presented by meat from cattle with FMD, for each of the different stages of the disease. The four disease stages considered are the incubation period, the period of clinical signs, convalescence and the carrier stage. Efficient animal health systems, disease surveillance, and ante-mortem and post-mortem inspection of all cattle effectively reduce the risk of FMD transmission from cattle slaughtered during the period of clinical signs or convalescence. These measures fail if the cattle are slaughtered during the incubation period, because of the absence of clinical signs. Cattle in this stage of the infection are likely to be viraemic, with FMD virus present in the skeletal muscles. Maturation of the carcasses of viraemic cattle reduces the risk of virus presence in the beef. In addition, deboning and removal of the principal lymph nodes and large blood vessels eliminate a source of FMD contamination of the beef. However, the slaughter of viraemic cattle creates an additional hazard of gross environmental viral contamination of the slaughterhouse facilities. Therefore, the maturation process may create a false sense of security, and the emphasis should instead be placed on disease surveillance within the infected zone and on the farms of origin, to prevent the slaughter of herds that are incubating FMD. Cattle slaughtered during the carrier stage do not pose a risk for the international beef trade.

PDD applied in the dog transmissible venereal tumor

NASA Astrophysics Data System (ADS)

Hage, Raduan; Duarte, Janaina; Martin, Airton A.; Zangaro, Renato A.; Pacheco, Marcos T. T.

2003-07-01

The Transmissible Venereal Tumor (TVT) is a very common neoplasic disease in a free-roaming dogs which affects the extern genital and presenting resistance to conventional drugs that promote high toxicity. Photodynamic Therapy (PDT) is based in tumor cells irradiation after absorption of photosensitizer substance. At present, the protoporphirin IX (PP IX) has been explored in PDT due to be endogen, then it does not present toxicity effect. This substance can be obtained by exogenous way through aminolevulinic acid (5-ALA) administration in patient. The aim of this work was establish the optimal conditions for PDD (Phodynamic Diagnosis) to irradiate the tumor after ALA administration through fluorescence spectroscopy to improve the results with PDT. In this research was studied the 5-ALA 20% absorption in TVT of vaginal and penial mucous of a female and a male dog, respectivaly. This drug was administrated topically and after 30 minutes the fluorescence spectra were collected in intervals of 15 minutes during 120 minutes. The results showed that the maximum peak of PP IX in the tumor was between 60 and 105 minutes after the ALA application. In conclusion, the optimum effect will be achieved irradiating the tumor tissue into this period.

HVDC power transmission technology assessment

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hauth, R.L.; Tatro, P.J.; Railing, B.D.

1997-04-01

The purpose of this study was to develop an assessment of the national utility system`s needs for electric transmission during the period 1995-2020 that could be met by future reduced-cost HVDC systems. The assessment was to include an economic evaluation of HVDC as a means for meeting those needs as well as a comparison with competing technologies such as ac transmission with and without Flexible AC Transmission System (FACTS) controllers. The role of force commutated dc converters was to be assumed where appropriate. The assessment begins by identifying the general needs for transmission in the U.S. in the context ofmore » a future deregulated power industry. The possible roles for direct current transmission are then postulated in terms of representative scenarios. A few of the scenarios are illustrated with the help of actual U.S. system examples. non-traditional applications as well as traditional applications such as long lines and asynchronous interconnections are discussed. The classical ``break-even distance`` concept for comparing HVDC and ac lines is used to assess the selected scenarios. The impact of reduced-cost converters is reflected in terms of the break-even distance. This report presents a comprehensive review of the functional benefits of HVDC transmission and updated cost data for both ac and dc system components. It also provides some provocative thoughts on how direct current transmission might be applied to better utilize and expand our nation`s increasingly stressed transmission assets.« less

Quantifying Transmission Investment in Malaria Parasites

PubMed Central

Greischar, Megan A.; Mideo, Nicole; Read, Andrew F.; Bjørnstad, Ottar N.

2016-01-01

Many microparasites infect new hosts with specialized life stages, requiring a subset of the parasite population to forgo proliferation and develop into transmission forms. Transmission stage production influences infectivity, host exploitation, and the impact of medical interventions like drug treatment. Predicting how parasites will respond to public health efforts on both epidemiological and evolutionary timescales requires understanding transmission strategies. These strategies can rarely be observed directly and must typically be inferred from infection dynamics. Using malaria as a case study, we test previously described methods for inferring transmission stage investment against simulated data generated with a model of within-host infection dynamics, where the true transmission investment is known. We show that existing methods are inadequate and potentially very misleading. The key difficulty lies in separating transmission stages produced by different generations of parasites. We develop a new approach that performs much better on simulated data. Applying this approach to real data from mice infected with a single Plasmodium chabaudi strain, we estimate that transmission investment varies from zero to 20%, with evidence for variable investment over time in some hosts, but not others. These patterns suggest that, even in experimental infections where host genetics and other environmental factors are controlled, parasites may exhibit remarkably different patterns of transmission investment. PMID:26890485

Bayesian analysis of experimental epidemics of foot-and-mouth disease.

PubMed Central

Streftaris, George; Gibson, Gavin J.

2004-01-01

We investigate the transmission dynamics of a certain type of foot-and-mouth disease (FMD) virus under experimental conditions. Previous analyses of experimental data from FMD outbreaks in non-homogeneously mixing populations of sheep have suggested a decline in viraemic level through serial passage of the virus, but these do not take into account possible variation in the length of the chain of viral transmission for each animal, which is implicit in the non-observed transmission process. We consider a susceptible-exposed-infectious-removed non-Markovian compartmental model for partially observed epidemic processes, and we employ powerful methodology (Markov chain Monte Carlo) for statistical inference, to address epidemiological issues under a Bayesian framework that accounts for all available information and associated uncertainty in a coherent approach. The analysis allows us to investigate the posterior distribution of the hidden transmission history of the epidemic, and thus to determine the effect of the length of the infection chain on the recorded viraemic levels, based on the posterior distribution of a p-value. Parameter estimates of the epidemiological characteristics of the disease are also obtained. The results reveal a possible decline in viraemia in one of the two experimental outbreaks. Our model also suggests that individual infectivity is related to the level of viraemia. PMID:15306359

Serotonergic transmission at Merkel discs: modulation by exogenously applied chemical messengers and involvement of Ih currents.

PubMed

Chang, Weipang; Kanda, Hirosato; Ikeda, Ryo; Ling, Jennifer; Gu, Jianguo G

2017-05-01

The Merkel disc is a main type of tactile end organ consisting of Merkel cells and Aβ-afferent endings that responds to tactile stimulation with slowly adapting type 1 (SA1) afferent impulses. Our recent study has shown that Merkel discs in whisker hair follicles are serotonergic synapses using endogenous serotonin to transmit tactile signals from Merkel cells to Aβ-afferent endings. In this study, we hypothesize that tactile sensitivity of Merkel discs can be modulated by chemical messengers. We tested this hypothesis by determining whether and how SA1 responses of mouse whisker hair follicles may be affected by exogenously applied chemical messengers. We found that SA1 responses were potentiated by serotonin at low concentration (10 μM) but almost completely occluded by serotonin at high concentration (2 mM). In contrast, SA1 responses were not significantly affected by ATP and its metabolically stable analog α,β-methylene-ATP, glutamate, γ-aminobutyric acid (GABA), and histamine. SA1 responses were also not affected by antagonists for P2X receptors, ionotropic glutamate receptors, and ionotropic GABA and glycine receptors. Whole-cell patch-clamp recordings reconfirm the presence of both ionotropic and metabotropic 5-HT receptors on afferent neurons and their terminals innervating whisker hair follicles. All whisker afferent neurons expressed hyperpolarization-activated inward currents (I h ), which are potentiated by serotonin through the activation of metabotropic 5-HT receptors. Taken together, the findings substantiate the serotonergic mechanism of tactile transmission at Merkel discs and identify the involvement of I h currents in postsynaptic excitatory actions of serotonin. In addition, the findings do not favor any significant involvement of ATP, glutamate, histamine, GABA, or glycine in tactile transmission at the Merkel discs of whisker hair follicles. © 2017 International Society for Neurochemistry.

Transmission of vibration through glove materials: effects of contact force.

PubMed

Md Rezali, Khairil Anas; Griffin, Michael J

2018-04-26

This study investigated effects of applied force on the apparent mass of the hand, the dynamic stiffness of glove materials and the transmission of vibration through gloves to the hand. For 10 subjects, 3 glove materials and 3 contact forces, apparent masses and glove transmissibilities were measured at the palm and at a finger at frequencies in the range 5-300 Hz. The dynamic stiffnesses of the materials were also measured. With increasing force, the dynamic stiffnesses of the materials increased, the apparent mass at the palm increased at frequencies greater than the resonance and the apparent mass at the finger increased at low frequencies. The effects of force on transmissibilities therefore differed between materials and depended on vibration frequency, but changes in apparent mass and dynamic stiffness had predictable effects on material transmissibility. Depending on the glove material, the transmission of vibration through a glove can be increased or decreased when increasing the applied force. Practitioner summary: Increasing the contact force (i.e. push force or grip force) can increase or decrease the transmission of vibration through a glove. The vibration transmissibilities of gloves should be assessed with a range of contact forces to understand their likely influence on the exposure of the hand and fingers to vibration.

Foot-and-mouth disease control and eradication in the Bicol Surveillance Buffer Zone of the Philippines.

PubMed

Windsor, P A; Freeman, P G; Abila, R; Benigno, C; Verin, B; Nim, V; Cameron, A

2011-10-01

Following the onset of an epidemic of foot and mouth disease (FMD) commencing in 1994 and affecting mainly pigs in the Philippines, a National Plan for the Control and Eradication of the disease was initiated. A disease surveillance buffer zone in the southern Luzon region of Bicol was established to protect the Visayas and Mindanao from infection and enable eventual elimination of the disease in Luzon. With achievement of Office International Epizooties (OIE)-certified FMD freedom with vaccination in the Philippines now imminent, the four components of the disease control strategy are reviewed, including quarantine and animal movement controls, strategic vaccination, surveillance and disease investigation, and enhanced public awareness with school on the air radio programmes. Although numbers of outbreaks declined following widespread vaccination, evaluation of serological responses in vaccinates suggested low levels of immune protection. The cessation of outbreaks was considered more likely a result of animal movement controls, improved surveillance and emergency response capability, and reduction in FMD-risk behaviours by livestock owners, particularly through efforts to enhance public awareness of biosecurity measures by the training of traders, livestock industry personnel and both commercial and smallholder farmers. A two-stage random sampling serosurveillance strategy enabled identification of residual infection that was not detected through opportunistic sampling and negative incident reporting. Intensive investigations of FMD outbreaks, particularly in Albay province in 1999, enabled improved understanding of the risk factors involved in disease transmission and implementation of appropriate interventions. The findings from this review are offered to assist development of FMD control and eradication programmes in other countries in south-east Asia that are now being encouraged to support the OIE goal of FMD freedom with vaccination by 2020. © 2011

On increasing the spectral efficiency and transmissivity in the data transmission channel on the spacecraft-ground tracking station line

NASA Astrophysics Data System (ADS)

Andrianov, M. N.; Kostenko, V. I.; Likhachev, S. F.

2018-01-01

The algorithms for achieving a practical increase in the rate of data transmission on the space-craft-ground tracking station line has been considered. This increase is achieved by applying spectral-effective modulation techniques, the technology of orthogonal frequency compression of signals using millimeterrange radio waves. The advantages and disadvantages of each of three algorithms have been revealed. A significant advantage of data transmission in the millimeter range has been indicated.

Seasonal forecast of St. Louis encephalitis virus transmission, Florida.

PubMed

Shaman, Jeffrey; Day, Jonathan F; Stieglitz, Marc; Zebiak, Stephen; Cane, Mark

2004-05-01

Disease transmission forecasts can help minimize human and domestic animal health risks by indicating where disease control and prevention efforts should be focused. For disease systems in which weather-related variables affect pathogen proliferation, dispersal, or transmission, the potential for disease forecasting exists. We present a seasonal forecast of St. Louis encephalitis virus transmission in Indian River County, Florida. We derive an empiric relationship between modeled land surface wetness and levels of SLEV transmission in humans. We then use these data to forecast SLEV transmission with a seasonal lead. Forecast skill is demonstrated, and a real-time seasonal forecast of epidemic SLEV transmission is presented. This study demonstrates how weather and climate forecast skill-verification analyses may be applied to test the predictability of an empiric disease forecast model.

Seasonal Forecast of St. Louis Encephalitis Virus Transmission, Florida

PubMed Central

Day, Jonathan F.; Stieglitz, Marc; Zebiak, Stephen; Cane, Mark

2004-01-01

Disease transmission forecasts can help minimize human and domestic animal health risks by indicating where disease control and prevention efforts should be focused. For disease systems in which weather-related variables affect pathogen proliferation, dispersal, or transmission, the potential for disease forecasting exists. We present a seasonal forecast of St. Louis encephalitis virus transmission in Indian River County, Florida. We derive an empirical relationship between modeled land surface wetness and levels of SLEV transmission in humans. We then use these data to forecast SLEV transmission with a seasonal lead. Forecast skill is demonstrated, and a real-time seasonal forecast of epidemic SLEV transmission is presented. This study demonstrates how weather and climate forecast skill verification analyses may be applied to test the predictability of an empirical disease forecast model. PMID:15200812

47 CFR 80.104 - Identification of radar transmissions not authorized.

Code of Federal Regulations, 2011 CFR

2011-10-01

... 47 Telecommunication 5 2011-10-01 2011-10-01 false Identification of radar transmissions not... Procedures-General § 80.104 Identification of radar transmissions not authorized. This section applies to all maritime radar transmitters except radar beacon stations. (a) Radar transmitters must not transmit station...

47 CFR 80.104 - Identification of radar transmissions not authorized.

Code of Federal Regulations, 2010 CFR

2010-10-01

... 47 Telecommunication 5 2010-10-01 2010-10-01 false Identification of radar transmissions not... Procedures-General § 80.104 Identification of radar transmissions not authorized. This section applies to all maritime radar transmitters except radar beacon stations. (a) Radar transmitters must not transmit station...

47 CFR 80.104 - Identification of radar transmissions not authorized.

Code of Federal Regulations, 2012 CFR

2012-10-01

... 47 Telecommunication 5 2012-10-01 2012-10-01 false Identification of radar transmissions not... Procedures-General § 80.104 Identification of radar transmissions not authorized. This section applies to all maritime radar transmitters except radar beacon stations. (a) Radar transmitters must not transmit station...

47 CFR 80.104 - Identification of radar transmissions not authorized.

Code of Federal Regulations, 2014 CFR

2014-10-01

... 47 Telecommunication 5 2014-10-01 2014-10-01 false Identification of radar transmissions not... Procedures-General § 80.104 Identification of radar transmissions not authorized. This section applies to all maritime radar transmitters except radar beacon stations. (a) Radar transmitters must not transmit station...

47 CFR 80.104 - Identification of radar transmissions not authorized.

Code of Federal Regulations, 2013 CFR

2013-10-01

... 47 Telecommunication 5 2013-10-01 2013-10-01 false Identification of radar transmissions not... Procedures-General § 80.104 Identification of radar transmissions not authorized. This section applies to all maritime radar transmitters except radar beacon stations. (a) Radar transmitters must not transmit station...

Hydraulic system for a ratio change transmission

DOEpatents

Kalns, Ilmars

1981-01-01

Disclosed is a drive assembly (10) for an electrically powered vehicle (12). The assembly includes a transaxle (16) having a two-speed transmission (40) and a drive axle differential (46) disposed in a unitary housing assembly (38), an oil-cooled prime mover or electric motor (14) for driving the transmission input shaft (42), an adapter assembly (24) for supporting the prime mover on the transaxle housing assembly, and a hydraulic system (172) providing pressurized oil flow for cooling and lubricating the electric motor and transaxle and for operating a clutch (84) and a brake (86) in the transmission to shift between the two-speed ratios of the transmission. The adapter assembly allows the prime mover to be supported in several positions on the transaxle housing. The brake is spring-applied and locks the transmission in its low-speed ratio should the hydraulic system fail. The hydraulic system pump is driven by an electric motor (212) independent of the prime mover and transaxle.

Sound Transmission through Two Concentric Cylindrical Sandwich Shells

NASA Technical Reports Server (NTRS)

Tang, Yvette Y.; Silcox, Richard J.; Robinson, Jay H.

1996-01-01

This paper solves the problem of sound transmission through a system of two infinite concentric cylindrical sandwich shells. The shells are surrounded by external and internal fluid media and there is fluid (air) in the annular space between them. An oblique plane sound wave is incident upon the surface of the outer shell. A uniform flow is moving with a constant velocity in the external fluid medium. Classical thin shell theory is applied to the inner shell and first-order shear deformation theory is applied to the outer shell. A closed form for transmission loss is derived based on modal analysis. Investigations have been made for the impedance of both shells and the transmission loss through the shells from the exterior into the interior. Results are compared for double sandwich shells and single sandwich shells. This study shows that: (1) the impedance of the inner shell is much smaller than that of the outer shell so that the transmission loss is almost the same in both the annular space and the interior cavity of the shells; (2) the two concentric sandwich shells can produce an appreciable increase of transmission loss over single sandwich shells especially in the high frequency range; and (3) design guidelines may be derived with respect to the noise reduction requirement and the pressure in the annular space at a mid-frequency range.

Transmission overhaul and replacement predictions using Weibull and renewel theory

NASA Technical Reports Server (NTRS)

Savage, M.; Lewicki, D. G.

1989-01-01

A method to estimate the frequency of transmission overhauls is presented. This method is based on the two-parameter Weibull statistical distribution for component life. A second method is presented to estimate the number of replacement components needed to support the transmission overhaul pattern. The second method is based on renewal theory. Confidence statistics are applied with both methods to improve the statistical estimate of sample behavior. A transmission example is also presented to illustrate the use of the methods. Transmission overhaul frequency and component replacement calculations are included in the example.

Voltage dependency of transmission probability of aperiodic DNA molecule

NASA Astrophysics Data System (ADS)

Wiliyanti, V.; Yudiarsah, E.

2017-07-01

Characteristics of electron transports in aperiodic DNA molecules have been studied. Double stranded DNA model with the sequences of bases, GCTAGTACGTGACGTAGCTAGGATATGCCTGA, in one chain and its complements on the other chains has been used. Tight binding Hamiltonian is used to model DNA molecules. In the model, we consider that on-site energy of the basis has a linearly dependency on the applied electric field. Slater-Koster scheme is used to model electron hopping constant between bases. The transmission probability of electron from one electrode to the next electrode is calculated using a transfer matrix technique and scattering matrix method simultaneously. The results show that, generally, higher voltage gives a slightly larger value of the transmission probability. The applied voltage seems to shift extended states to lower energy. Meanwhile, the value of the transmission increases with twisting motion frequency increment.

Applying shot boundary detection for automated crystal growth analysis during in situ transmission electron microscope experiments

DOE Office of Scientific and Technical Information (OSTI.GOV)

Moeglein, W. A.; Griswold, R.; Mehdi, B. L.

In-situ (scanning) transmission electron microscopy (S/TEM) is being developed for numerous applications in the study of nucleation and growth under electrochemical driving forces. For this type of experiment, one of the key parameters is to identify when nucleation initiates. Typically the process of identifying the moment that crystals begin to form is a manual process requiring the user to perform an observation and respond accordingly (adjust focus, magnification, translate the stage etc.). However, as the speed of the cameras being used to perform these observations increases, the ability of a user to “catch” the important initial stage of nucleation decreasesmore » (there is more information that is available in the first few milliseconds of the process). Here we show that video shot boundary detection (SBD) can automatically detect frames where a change in the image occurs. We show that this method can be applied to quickly and accurately identify points of change during crystal growth. This technique allows for automated segmentation of a digital stream for further analysis and the assignment of arbitrary time stamps for the initiation of processes that are independent of the user’s ability to observe and react.« less

System life and reliability modeling for helicopter transmissions

NASA Technical Reports Server (NTRS)

Savage, M.; Brikmanis, C. K.

1986-01-01

A computer program which simulates life and reliability of helicopter transmissions is presented. The helicopter transmissions may be composed of spiral bevel gear units and planetary gear units - alone, in series or in parallel. The spiral bevel gear units may have either single or dual input pinions, which are identical. The planetary gear units may be stepped or unstepped and the number of planet gears carried by the planet arm may be varied. The reliability analysis used in the program is based on the Weibull distribution lives of the transmission components. The computer calculates the system lives and dynamic capacities of the transmission components and the transmission. The system life is defined as the life of the component or transmission at an output torque at which the probability of survival is 90 percent. The dynamic capacity of a component or transmission is defined as the output torque which can be applied for one million output shaft cycles for a probability of survival of 90 percent. A complete summary of the life and dynamic capacity results is produced by the program.

Identifying Nodes of Transmission in Disease Diffusion Through Social Media

NASA Astrophysics Data System (ADS)

Lamb, David Sebastian

The spread of infectious diseases can be described in terms of three interrelated components: interaction, movement, and scale. Transmission between individuals requires some form of interaction, which is dependent on the pathogen, to occur. Diseases spread through the movement of their hosts; they spread across many spatial scales from local neighborhoods to countries, or temporal scales from days to years, or periodic intervals. Prior research into the spread of disease have examined diffusion processes retrospectively at regional or country levels, or developed differential equation or simulation models of the dynamics of disease transmission. While some of the more recent models incorporate all three components, they are limited in the way they understand where interactions occur. The focus has been on home or work, including contact with family or coworkers. The models reflect a lack of knowledge about how transmissions are made at specific locations in time, so-called nodes of transmission. That is, how individuals' intersections in time and space function in disease transmission. This project sought to use the three factors of interaction, movement, and scale to better understand the spread of disease in terms of the place of interaction called the node of transmission. The overarching objective of this research was: how can nodes of transmission be identified through individual activity spaces incorporating the three factors of infectious disease spread: interaction, movement, and scale?. This objective fed into three main sub-objectives: defining nodes of transmission, developing an appropriate methodology to identifying nodes of transmission, and applying it using geotagged social media data from Twitter. To develop an appropriate framework, this research relied on time geography, and traditional disease. This particularly relied on the idea of bundling to create the nodes, and a nesting effect that integrated scale. The data source used to identify nodes

Global Foot-and-Mouth Disease Research Update and Gap Analysis: 3 - Vaccines.

PubMed

Robinson, L; Knight-Jones, T J D; Charleston, B; Rodriguez, L L; Gay, C G; Sumption, K J; Vosloo, W

2016-06-01

This study assessed research knowledge gaps in the field of FMDV (foot-and-mouth disease virus) vaccines. The study took the form of a literature review (2011-15) combined with research updates collected in 2014 from 33 institutes from across the world. Findings were used to identify priority areas for future FMD vaccine research. Vaccines play a vital role in FMD control, used both to limit the spread of the virus during epidemics in FMD-free countries and as the mainstay of disease management in endemic regions, particularly where sanitary controls are difficult to apply. Improvements in the performance or cost-effectiveness of FMD vaccines will allow more widespread and efficient disease control. FMD vaccines have changed little in recent decades, typically produced by inactivation of whole virus, the quantity and stability of the intact viral capsids in the final preparation being key for immunogenicity. However, these are exciting times and several promising novel FMD vaccine candidates have recently been developed. This includes the first FMD vaccine licensed for manufacture and use in the USA; this adenovirus-vectored FMD vaccine causes in vivo expression of viral capsids in vaccinated animals. Another promising vaccine candidate comprises stabilized empty FMDV capsids produced in vitro in a baculovirus expression system. Recombinant technologies are also being developed to improve otherwise conventionally produced inactivated vaccines, for example, by creating a chimeric vaccine virus to increase capsid stability and by inserting sequences into the vaccine virus for desired antigen expression. Other important areas of ongoing research include enhanced adjuvants, vaccine quality control procedures and predicting vaccine protection from immune correlates, thus reducing dependency on animal challenge studies. Globally, the degree of independent vaccine evaluation is highly variable, and this is essential for vaccine quality. Previously neglected, the

A feature selection approach towards progressive vector transmission over the Internet

NASA Astrophysics Data System (ADS)

Miao, Ru; Song, Jia; Feng, Min

2017-09-01

WebGIS has been applied for visualizing and sharing geospatial information popularly over the Internet. In order to improve the efficiency of the client applications, the web-based progressive vector transmission approach is proposed. Important features should be selected and transferred firstly, and the methods for measuring the importance of features should be further considered in the progressive transmission. However, studies on progressive transmission for large-volume vector data have mostly focused on map generalization in the field of cartography, but rarely discussed on the selection of geographic features quantitatively. This paper applies information theory for measuring the feature importance of vector maps. A measurement model for the amount of information of vector features is defined based upon the amount of information for dealing with feature selection issues. The measurement model involves geometry factor, spatial distribution factor and thematic attribute factor. Moreover, a real-time transport protocol (RTP)-based progressive transmission method is then presented to improve the transmission of vector data. To clearly demonstrate the essential methodology and key techniques, a prototype for web-based progressive vector transmission is presented, and an experiment of progressive selection and transmission for vector features is conducted. The experimental results indicate that our approach clearly improves the performance and end-user experience of delivering and manipulating large vector data over the Internet.

Assessing Biosecurity Risks for the Introduction and Spread of Diseases Among Commercial Sheep Properties in New South Wales, Australia, Using Foot-and-Mouth Disease as a Case Study.

PubMed

Fountain, Jake; Woodgate, Robert; Rast, Luzia; Hernández-Jover, Marta

2018-01-01

Sheep production systems are a major industry in Australia, with a gross value of roughly $4.66 billion; 87.3% of which is attributable to export markets. Exotic diseases such as foot-and-mouth disease (FMD) are a potential threat to the viability of Australia's export market. Previous outbreaks of FMD in developed countries, and challenges in the management of onshore biosecurity, signify the importance of on-farm biosecurity in controlling disease transmission. This study aims to investigate the risk of disease introduction and spread among New South Wales (NSW) sheep properties using FMD as a case study and draw recommendation for the industry. Exposure and partial consequence assessments, using scenario trees and Monte Carlo stochastic modeling, were conducted to identify pathways of introduction and spread and calculate the probabilities of these pathways occurring. Input parameters were estimated from the data obtained during qualitative interviews with producers and scientific literature. According to the reported practices of sheep producers and assuming each pathway was carrying the FMD virus, the exposure assessment estimates the median (5-95%) probability of FMD exposure of sheep on a naive property to be 0.619 (0.541-0.698), 0.151 (0.085-0.239), 0.235 (0.153-0.324), and 0.710 (0.619-0.791) for introduction through new stock, wildlife, carriers (humans, dogs, and vehicles), and neighbors, respectively. The spread assessment estimated the median probability of FMD spreading from an infected sheep property to neighboring enterprises to be 0.603 (0.504-0.698). A similar probability was estimated for spread via wildlife (0.523; 0.404-0.638); and a lower spread probability was estimated for carriers (0.315; 0.171-0.527), sheep movement (0.285; 0.161-0.462), and dead stock (0.168; 0.070-0.312). The sensitivity analysis revealed that the introduction of an FMD-infected sheep was more influential for exposure via new stock than isolation practices. Sharing

Assessing Biosecurity Risks for the Introduction and Spread of Diseases Among Commercial Sheep Properties in New South Wales, Australia, Using Foot-and-Mouth Disease as a Case Study

PubMed Central

Fountain, Jake; Woodgate, Robert; Rast, Luzia; Hernández-Jover, Marta

2018-01-01

Sheep production systems are a major industry in Australia, with a gross value of roughly $4.66 billion; 87.3% of which is attributable to export markets. Exotic diseases such as foot-and-mouth disease (FMD) are a potential threat to the viability of Australia’s export market. Previous outbreaks of FMD in developed countries, and challenges in the management of onshore biosecurity, signify the importance of on-farm biosecurity in controlling disease transmission. This study aims to investigate the risk of disease introduction and spread among New South Wales (NSW) sheep properties using FMD as a case study and draw recommendation for the industry. Exposure and partial consequence assessments, using scenario trees and Monte Carlo stochastic modeling, were conducted to identify pathways of introduction and spread and calculate the probabilities of these pathways occurring. Input parameters were estimated from the data obtained during qualitative interviews with producers and scientific literature. According to the reported practices of sheep producers and assuming each pathway was carrying the FMD virus, the exposure assessment estimates the median (5–95%) probability of FMD exposure of sheep on a naive property to be 0.619 (0.541–0.698), 0.151 (0.085–0.239), 0.235 (0.153–0.324), and 0.710 (0.619–0.791) for introduction through new stock, wildlife, carriers (humans, dogs, and vehicles), and neighbors, respectively. The spread assessment estimated the median probability of FMD spreading from an infected sheep property to neighboring enterprises to be 0.603 (0.504–0.698). A similar probability was estimated for spread via wildlife (0.523; 0.404–0.638); and a lower spread probability was estimated for carriers (0.315; 0.171–0.527), sheep movement (0.285; 0.161–0.462), and dead stock (0.168; 0.070–0.312). The sensitivity analysis revealed that the introduction of an FMD-infected sheep was more influential for exposure via new stock than isolation

Prevalence and risk factors for foot and mouth disease infection in small ruminants in Israel.

PubMed

Elnekave, Ehud; van Maanen, Kees; Shilo, Hila; Gelman, Boris; Storm, Nick; Berdenstain, Svetlane; Berke, Olaf; Klement, Eyal

2016-03-01

risk of infection by FMD virus. We conclude that despite the wide distribution of infection among SR farms, low farm level prevalence indicates that in Israel SR pose only limited role in the transmission and dissemination of FMD. This conclusion may be applicable for other endemic countries in which, similar to Israel, all livestock are vaccinated against FMD. Copyright © 2016 Elsevier B.V. All rights reserved.

Economic analysis of transmission line engineering based on industrial engineering

NASA Astrophysics Data System (ADS)

Li, Yixuan

2017-05-01

The modern industrial engineering is applied to the technical analysis and cost analysis of power transmission and transformation engineering. It can effectively reduce the cost of investment. First, the power transmission project is economically analyzed. Based on the feasibility study of power transmission and transformation project investment, the proposal on the company system cost management is put forward through the economic analysis of the effect of the system. The cost management system is optimized. Then, through the cost analysis of power transmission and transformation project, the new situation caused by the cost of construction is found. It is of guiding significance to further improve the cost management of power transmission and transformation project. Finally, according to the present situation of current power transmission project cost management, concrete measures to reduce the cost of power transmission project are given from the two aspects of system optimization and technology optimization.

The global transmission network of HIV-1.

PubMed

Wertheim, Joel O; Leigh Brown, Andrew J; Hepler, N Lance; Mehta, Sanjay R; Richman, Douglas D; Smith, Davey M; Kosakovsky Pond, Sergei L

2014-01-15

Human immunodeficiency virus type 1 (HIV-1) is pandemic, but its contemporary global transmission network has not been characterized. A better understanding of the properties and dynamics of this network is essential for surveillance, prevention, and eventual eradication of HIV. Here, we apply a simple and computationally efficient network-based approach to all publicly available HIV polymerase sequences in the global database, revealing a contemporary picture of the spread of HIV-1 within and between countries. This approach automatically recovered well-characterized transmission clusters and extended other clusters thought to be contained within a single country across international borders. In addition, previously undescribed transmission clusters were discovered. Together, these clusters represent all known modes of HIV transmission. The extent of international linkage revealed by our comprehensive approach demonstrates the need to consider the global diversity of HIV, even when describing local epidemics. Finally, the speed of this method allows for near-real-time surveillance of the pandemic's progression.

Thermal and Structural Analysis of Helicopter Transmission Housings Using NASTRAN

NASA Technical Reports Server (NTRS)

Howells, R. W.; Sciarra, J. J.; Ng, G. S.

1976-01-01

The application of NASTRAN to improve the design of helicopter transmission housings is described. A finite element model of the complete forward rotor transmission housing for the Boeing Vertol CH-47C helicopter was used to study thermal distortion and stress, stress and deflection due to static and dynamic loads, load paths, and design optimization by the control of structural energy distribution. The analytical results are correlated with test data and used to reduce weight and to improve strength, service life, failsafety, and reliability. The techniques presented, although applied herein to helicopter transmissions, are sufficiently general to be applicable to any power transmission system.

The economic impact of foot and mouth disease and its control in South-East Asia: a preliminary assessment with special reference to Thailand.

PubMed

Perry, B D; Kalpravidh, W; Coleman, P G; Horst, H S; McDermott, J J; Randolph, T F; Gleeson, L J

1999-08-01

A pilot study of the economic impact of foot and mouth disease (FMD) in the countries and region of South-East Asia is described. Previous economic impact assessments are reviewed and summarised and a synthesis of these contributions is constructed. A framework for the future economic impact of the disease is then developed, incorporating analyses at the sectoral (production system), national and regional levels. Data requirements for such studies are also identified. Integrated epidemiological and economic models for impact assessment were developed and applied to the case study country of Thailand. The models were used to evaluate the economic viability of FMD control programmes in the country. Scenarios evaluated include the effect of improving vaccination coverage and thus reducing productivity losses, and the effect of eventual eradication of the disease. The results indicate that economic returns to the high expenditures incurred in FMD control could be achieved in the short term if greater international trade in pork products was made possible and export prices higher than those in the domestic market could be attained. If FMD were to be eradicated from Thailand in 2010, the eradication would be economically viable, even without exports, with a predicted benefit-cost ratio of 3.73. With additional exports, the economic justification for control becomes much stronger with a benefit-cost ratio of up to 15:1 being achieved. If eradication is not achieved until 2020, returns remain positive without exports, but at a lower rate. The authors propose that the integrated epidemiological and economic models developed be applied to other countries of the region to gain a more accurate insight into the future benefits of FMD control and eradication in the region.

Performance analysis of a model-sized superconducting DC transmission system based VSC-HVDC transmission technologies using RTDS

NASA Astrophysics Data System (ADS)

Dinh, Minh-Chau; Ju, Chang-Hyeon; Kim, Sung-Kyu; Kim, Jin-Geun; Park, Minwon; Yu, In-Keun

2012-08-01

The combination of a high temperature superconducting DC power cable and a voltage source converter based HVDC (VSC-HVDC) creates a new option for transmitting power with multiple collection and distribution points for long distance and bulk power transmissions. It offers some greater advantages compared with HVAC or conventional HVDC transmission systems, and it is well suited for the grid integration of renewable energy sources in existing distribution or transmission systems. For this reason, a superconducting DC transmission system based HVDC transmission technologies is planned to be set up in the Jeju power system, Korea. Before applying this system to a real power system on Jeju Island, system analysis should be performed through a real time test. In this paper, a model-sized superconducting VSC-HVDC system, which consists of a small model-sized VSC-HVDC connected to a 2 m YBCO HTS DC model cable, is implemented. The authors have performed the real-time simulation method that incorporates the model-sized superconducting VSC-HVDC system into the simulated Jeju power system using Real Time Digital Simulator (RTDS). The performance analysis of the superconducting VSC-HVDC systems has been verified by the proposed test platform and the results were discussed in detail.

The importance of quality assurance/quality control of diagnostics to increase the confidence in global foot-and-mouth disease control.

PubMed

De Clercq, K; Goris, N; Barnett, P V; MacKay, D K

2008-01-01

The last decade international trade in animals and animal products was liberated and confidence in this global trade can increase only if appropriate control measures are applied. As foot-and-mouth disease (FMD) diagnostics will play an essential role in this respect, the Food and Agriculture Organization European Commission for the Control of Foot-and-Mouth Disease (EUFMD) co-ordinates, in collaboration with the European Commission, several programmes to increase the quality of FMD diagnostics. A quality assurance (QA) system is deemed essential for laboratories involved in certifying absence of FMDV or antibodies against the virus. Therefore, laboratories are encouraged to validate their diagnostic tests fully and to install a continuous quality control (QC) monitoring system. Knowledge of performance characteristics of diagnostics is essential to interpret results correctly and to calculate sample rates in regional surveillance campaigns. Different aspects of QA/QC of classical and new FMD virological and serological diagnostics are discussed in respect to the EU FMD directive (2003/85/EC). We recommended accepting trade certificates only from laboratories participating in international proficiency testing on a regular basis.

Apigenin Restricts FMDV Infection and Inhibits Viral IRES Driven Translational Activity

PubMed Central

Qian, Suhong; Fan, Wenchun; Qian, Ping; Zhang, Dong; Wei, Yurong; Chen, Huanchun; Li, Xiangmin

2015-01-01

Foot-and-mouth disease (FMD) is a highly contagious disease of domestic and wild ruminants that is caused by FMD virus (FMDV). FMD outbreaks have occurred in livestock-containing regions worldwide. Apigenin, which is a flavonoid naturally existing in plant, possesses various pharmacological effects, including anti-inflammatory, anticancer, antioxidant and antiviral activities. Results show that apigenin can inhibit FMDV-mediated cytopathogenic effect and FMDV replication in vitro. Further studies demonstrate the following: (i) apigenin inhibits FMDV infection at the viral post-entry stage; (ii) apigenin does not exhibit direct extracellular virucidal activity; and (iii) apigenin interferes with the translational activity of FMDV driven by internal ribosome entry site. Studies on applying apigein in vivo are required for drug development and further identification of potential drug targets against FDMV infection. PMID:25835532

Apigenin restricts FMDV infection and inhibits viral IRES driven translational activity.

PubMed

Qian, Suhong; Fan, Wenchun; Qian, Ping; Zhang, Dong; Wei, Yurong; Chen, Huanchun; Li, Xiangmin

2015-03-31

Foot-and-mouth disease (FMD) is a highly contagious disease of domestic and wild ruminants that is caused by FMD virus (FMDV). FMD outbreaks have occurred in livestock-containing regions worldwide. Apigenin, which is a flavonoid naturally existing in plant, possesses various pharmacological effects, including anti-inflammatory, anticancer, antioxidant and antiviral activities. Results show that apigenin can inhibit FMDV-mediated cytopathogenic effect and FMDV replication in vitro. Further studies demonstrate the following: (i) apigenin inhibits FMDV infection at the viral post-entry stage; (ii) apigenin does not exhibit direct extracellular virucidal activity; and (iii) apigenin interferes with the translational activity of FMDV driven by internal ribosome entry site. Studies on applying apigein in vivo are required for drug development and further identification of potential drug targets against FDMV infection.

Role of the international organisation for animal health (Office International des Epizooties: OIE) in the control of foot and mouth disease.

PubMed

Vallat, B

2002-10-01

The author describes activities conducted by the International Organisation for Animal Health (OIE: Office International des Epizooties) to control foot and mouth disease (FMD) world-wide. These activities fall within the framework of the principal missions of the OIE. The first of these missions is the collection and dissemination of epidemiological information and of scientific knowledge on animal diseases, the socio-economic or disease implications of which can be particularly serious. The implementation of the measures required to control the disease and to protect countries threatened by FMD depends on the quality and rapidity of the transmission of this information. The co-ordination of studies, research and control programmes against FMD is equally important for the OIE. This work is based, in particular, on work conducted by the OlE foot and mouth disease and other epizootics Commission. OIE Member Countries not only have access to the most recent data on the diagnosis, surveillance and control of FMD but also have recourse to the official recognition procedure for disease-free status provided by this Commission. Finally, through the standardisation of health recommendations, diagnostic tests, manufacture protocols and the control of biological products, made available by the OIE International Animal Health Code Commission in regard to the former and by the OIE Standards Commission in regard to the latter, the OIE provides the reference for international trade in animals and animal products, and is recognised in this role by the World Trade Organization.

A method for modeling discontinuities in a microwave coaxial transmission line

NASA Technical Reports Server (NTRS)

Otoshi, T. Y.

1992-01-01

A method for modeling discontinuities in a coaxial transmission line is presented. The methodology involves the use of a nonlinear least-squares fit program to optimize the fit between theoretical data (from the model) and experimental data. When this method was applied to modeling discontinuities in a slightly damaged Galileo spacecraft S-band (2.295-GHz) antenna cable, excellent agreement between theory and experiment was obtained over a frequency range of 1.70-2.85 GHz. The same technique can be applied for diagnostics and locating unknown discontinuities in other types of microwave transmission lines, such as rectangular, circular, and beam waveguides.

A method for modeling discontinuities in a microwave coaxial transmission line

NASA Astrophysics Data System (ADS)

Otoshi, T. Y.

1992-08-01

A method for modeling discontinuities in a coaxial transmission line is presented. The methodology involves the use of a nonlinear least-squares fit program to optimize the fit between theoretical data (from the model) and experimental data. When this method was applied to modeling discontinuities in a slightly damaged Galileo spacecraft S-band (2.295-GHz) antenna cable, excellent agreement between theory and experiment was obtained over a frequency range of 1.70-2.85 GHz. The same technique can be applied for diagnostics and locating unknown discontinuities in other types of microwave transmission lines, such as rectangular, circular, and beam waveguides.

Metasurface with interfering Fano resonance: manipulating transmission wave with high efficiency.

PubMed

Su, Zhaoxian; Song, Kun; Yin, Jianbo; Zhao, Xiaopeng

2017-06-15

We proposed a novel strategy to design a deep subwavelength metasurface with full 2π transmission phase modulation and high transmission efficiency by applying resonators with interfering Fano resonance. Theoretical investigation demonstrates that the transmission efficiency of the resonators depends on the direct transmission coefficient, direct reflection coefficient, and Q factor. When an impedance layer is added in the resonators, the direct transmission and direct reflection coefficients can be facilely manipulated so that the span of the transmission phase around the resonance frequency can be extended to 2π. As a result, we can continuously adjust the transmission phase from 0 to 2π through changing the geometric parameters of the resonators and construct a deep subwavelength metasurface with the resonators to manipulate the transmission wave with high efficiency. We also find that a layer of grating can be used as the impedance layer to change direct transmission and direct reflection in the actual design of the metasurface. The proposed strategy may provide effective guidance to design a deep subwavelength metasurface for controlling a transmitted wave with high efficiency.

Prevention of SHIV transmission by topical IFN-β treatment.

PubMed

Veazey, R S; Pilch-Cooper, H A; Hope, T J; Alter, G; Carias, A M; Sips, M; Wang, X; Rodriguez, B; Sieg, S F; Reich, A; Wilkinson, P; Cameron, M J; Lederman, M M

2016-11-01

Understanding vaginal and rectal HIV transmission and protective cellular and molecular mechanisms is critical for designing new prevention strategies, including those required for an effective vaccine. The determinants of protection against HIV infection are, however, poorly understood. Increasing evidence suggest that innate immune defenses may help protect mucosal surfaces from HIV transmission in highly exposed, uninfected subjects. More recent studies suggest that systemically administered type 1 interferon protects against simian immunodeficiency virus infection of macaques. Here we hypothesized that topically applied type 1 interferons might stimulate vaginal innate responses that could protect against HIV transmission. We therefore applied a recombinant human type 1 interferon (IFN-β) to the vagina of rhesus macaques and vaginally challenged them with pathogenic simian/human immunodeficiency virus (SHIV). Vaginal administration of IFN-β resulted in marked local changes in immune cell phenotype, increasing immune activation and HIV co-receptor expression, yet provided significant protection from SHIV acquisition as interferon response genes were also upregulated. These data suggest that protection from vaginal HIV acquisition may be achieved by activating innate mucosal defenses.

Acoustic Power Transmission Through a Ducted Fan

NASA Technical Reports Server (NTRS)

Envia, Ed

2016-01-01

For high-speed ducted fans, when the rotor flowfield is shock-free, the main contribution to the inlet radiated acoustic power comes from the portion of the rotor stator interaction sound field that is transmitted upstream through the rotor. As such, inclusion of the acoustic transmission is an essential ingredient in the prediction of the fan inlet noise when the fan tip relative speed is subsonic. This paper describes a linearized Euler based approach to computing the acoustic transmission of fan tones through the rotor. The approach is embodied in a code called LINFLUX was applied to a candidate subsonic fan called the Advanced Ducted Propulsor (ADP). The results from this study suggest that it is possible to make such prediction with sufficient fidelity to provide an indication of the acoustic transmission trends with the fan tip speed.

Efficient quantum transmission in multiple-source networks.

PubMed

Luo, Ming-Xing; Xu, Gang; Chen, Xiu-Bo; Yang, Yi-Xian; Wang, Xiaojun

2014-04-02

A difficult problem in quantum network communications is how to efficiently transmit quantum information over large-scale networks with common channels. We propose a solution by developing a quantum encoding approach. Different quantum states are encoded into a coherent superposition state using quantum linear optics. The transmission congestion in the common channel may be avoided by transmitting the superposition state. For further decoding and continued transmission, special phase transformations are applied to incoming quantum states using phase shifters such that decoders can distinguish outgoing quantum states. These phase shifters may be precisely controlled using classical chaos synchronization via additional classical channels. Based on this design and the reduction of multiple-source network under the assumption of restricted maximum-flow, the optimal scheme is proposed for specially quantized multiple-source network. In comparison with previous schemes, our scheme can greatly increase the transmission efficiency.

Foot & Mouth Disease & Ulcerative/Vesicular Rule-outs: Challenges Encountered in Recent Outbreaks

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hullinger, P

2008-01-28

carriers. It has been shown that the African Cape buffalo are the major maintenance host of SAT serotypes. FMDV transmission can occur by either direct or indirect contact. Indirect transmission can occur via contaminated animate vectors (humans, etc.), inanimate vectors (vehicles, implements) or airborne transmission. Indirect disease transmission via animate or inanimate vectors can play a major role in disease transmission. Good biosecurity can significantly reduce this type of transmission. Airborne transmission is often debated and is known to be serotype and species specific as well as require specific environmental conditions to occur. Airborne transmission is favored in temperate zones and has been postulated to occur over distances of up to 60 km overland and 300 km by sea. Foot and mouth disease virus is an unenveloped virus which is preserved by refrigeration and freezing and progressively inactivated by temperatures above 50 C. FMDV is highly sensitive to pH change and is inactivated by pH < 6.0 or > 9.0. There are many disinfectants which are effective against FMDV including sodium hydroxide (2%), sodium carbonate (4%), and citric acid (0.2%). FMDV is resistant to iodophores, quaternary ammonium compounds, hypochlorite and phenol, especially in the presence of organic matter. The virus can survive in lymph nodes and bone marrow at neutral pH, but is destroyed in muscle when is pH < 6.0 i.e. after rigor mortis. FMDV can persist in contaminated feed/commodities and the environment for over to 1 month, depending on the temperature and pH conditions. The incubation period for FMD is 2-14 days. Animals transition through latent (infected but not infectious), subclinically infected (infectious but lacking clinical signs) clinically infected and recovered disease states. In cattle clinical signs include pyrexia, reluctance to eat, bruxism, drooling, lameness, treading or stamping of the feet and decreased milk production. Most clinical signs are related to the

Flux Cloning in Josephson Transmission Lines

NASA Astrophysics Data System (ADS)

Gulevich, D. R.; Kusmartsev, F. V.

2006-07-01

We describe a novel effect related to the controlled birth of a single Josephson vortex. In this phenomenon, the vortex is created in a Josephson transmission line at a T-shaped junction. The “baby” vortex arises at the moment when a “mother” vortex propagating in the adjacent transmission line passes the T-shaped junction. In order to give birth to a new vortex, the mother vortex must have enough kinetic energy. Its motion can also be supported by an externally applied driving current. We determine the critical velocity and the critical driving current for the creation of the baby vortices and briefly discuss the potential applications of the found effect.

Optimal topologies for maximizing network transmission capacity

NASA Astrophysics Data System (ADS)

Chen, Zhenhao; Wu, Jiajing; Rong, Zhihai; Tse, Chi K.

2018-04-01

It has been widely demonstrated that the structure of a network is a major factor that affects its traffic dynamics. In this work, we try to identify the optimal topologies for maximizing the network transmission capacity, as well as to build a clear relationship between structural features of a network and the transmission performance in terms of traffic delivery. We propose an approach for designing optimal network topologies against traffic congestion by link rewiring and apply them on the Barabási-Albert scale-free, static scale-free and Internet Autonomous System-level networks. Furthermore, we analyze the optimized networks using complex network parameters that characterize the structure of networks, and our simulation results suggest that an optimal network for traffic transmission is more likely to have a core-periphery structure. However, assortative mixing and the rich-club phenomenon may have negative impacts on network performance. Based on the observations of the optimized networks, we propose an efficient method to improve the transmission capacity of large-scale networks.

New assessment of endothelial function measured by short time flow-mediated vasodilation: Comparison with conventional flow-mediated vasodilation measurement.

PubMed

Matsui, Shogo; Kajikawa, Masato; Maruhashi, Tatsuya; Hashimoto, Haruki; Kihara, Yasuki; Chayama, Kazuaki; Goto, Chikara; Aibara, Yoshiki; Yusoff, Farina Mohamad; Kishimoto, Shinji; Nakashima, Ayumu; Noma, Kensuke; Kawaguchi, Tomohiro; Matsumoto, Takeo; Higashi, Yukihito

2018-05-04

Measurement of flow-mediated vasodilation (FMD) is an established method for assessing endothelial function. Measurement of FMD is useful for showing the relationship between atherosclerosis and endothelial function, mechanisms of endothelial dysfunction, and clinical implications including effects of interventions and cardiovascular events. To shorten and simplify the measurement of FMD, we have developed a novel technique named short time FMD (stFMD). We investigated the validity of stFMD for assessment of endothelial function compared with conventional FMD. We evaluated stFMD and conventional FMD in 82 subjects including patients with atherosclerotic risk factors and cardiovascular disease (66 men and 16 women, 57 ± 16 years). Both stFMD and conventional FMD were significantly correlated with age, systolic blood pressure, diastolic blood pressure and baseline brachial artery diameter. In addition, stFMD was significantly correlated with conventional FMD (r = 0.76, P < 0.001). Bland-Altman plot analysis showed good agreement between stFMD and conventional FMD. Moreover, stFMD in the at risk group and that in the cardiovascular disease group were significantly lower than that in the no risk group (4.6 ± 2.3% and 4.4 ± 2.2% vs. 7.3 ± 1.9%, P < 0.001, respectively). Optimal cutoff value of stFMD for diagnosing atherosclerosis was 7.0% (sensitivity of 71.0% and specificity of 85.0%). These findings suggest that measurement of stFMD, a novel and simple method, is useful for assessing endothelial function. Measurement of stFMD may be suitable for screening of atherosclerosis when repeated measurements of vascular function are required and when performing a clinical trial using a large population. URL for Clinical Trial: http://UMIN; Registration Number for Clinical Trial: UMIN000025458. Copyright © 2017 Elsevier B.V. All rights reserved.

47 CFR 25.212 - Narrowband analog transmissions, digital transmissions, and video transmissions in the GSO Fixed...

Code of Federal Regulations, 2012 CFR

2012-10-01

... transmissions, and video transmissions in the GSO Fixed-Satellite Service. 25.212 Section 25.212... Technical Standards § 25.212 Narrowband analog transmissions, digital transmissions, and video transmissions... narrowband and/or wideband digital services, including digital video services, if the maximum input spectral...

47 CFR 25.212 - Narrowband analog transmissions, digital transmissions, and video transmissions in the GSO Fixed...

Code of Federal Regulations, 2010 CFR

2010-10-01

... transmissions, and video transmissions in the GSO Fixed-Satellite Service. 25.212 Section 25.212... Technical Standards § 25.212 Narrowband analog transmissions, digital transmissions, and video transmissions... narrowband and/or wideband digital services, including digital video services, if the maximum input spectral...

47 CFR 25.212 - Narrowband analog transmissions, digital transmissions, and video transmissions in the GSO Fixed...

Code of Federal Regulations, 2011 CFR

2011-10-01

... transmissions, and video transmissions in the GSO Fixed-Satellite Service. 25.212 Section 25.212... Technical Standards § 25.212 Narrowband analog transmissions, digital transmissions, and video transmissions... narrowband and/or wideband digital services, including digital video services, if the maximum input spectral...

Cloud Properties Derived from Surface-Based Near-Infrared Spectral Transmission

NASA Technical Reports Server (NTRS)

Pilewskie, Peter; Twomey, S.; Gore, Warren J. Y. (Technical Monitor)

1996-01-01

Surface based near-infrared cloud spectral transmission measurements from a recent precipitation/cloud physics field study are used to determine cloud physical properties and relate them to other remote sensing and in situ measurements. Asymptotic formulae provide an effective means of closely approximating the qualitative and quantitative behavior of transmission computed by more laborious detailed methods. Relationships derived from asymptotic formulae are applied to measured transmission spectra to test objectively the internal consistency of data sets acquired during the field program and they confirmed the quality of the measurements. These relationships appear to be very useful in themselves, not merely as a quality control measure, but also a potentially valuable remote-sensing technique in its own right. Additional benefits from this analysis have been the separation of condensed water (cloud) transmission and water vapor transmission and the development of a method to derive cloud liquid water content.

ACHP | Energy Development, Transmission, and Historic Preservation

Science.gov Websites

review process established in Section 106 of the National Historic Preservation Act (NHPA), when applied review process established in Section 106 of the NHPA. Federal agencies reviewing or approving these regarding Coordination in Federal Agency Review of Electric Transmission Facilities on Federal Land Gateway

Life and reliability models for helicopter transmissions

NASA Technical Reports Server (NTRS)

Savage, M.; Knorr, R. J.; Coy, J. J.

1982-01-01

Computer models of life and reliability are presented for planetary gear trains with a fixed ring gear, input applied to the sun gear, and output taken from the planet arm. For this transmission the input and output shafts are co-axial and the input and output torques are assumed to be coaxial with these shafts. Thrust and side loading are neglected. The reliability model is based on the Weibull distributions of the individual reliabilities of the in transmission components. The system model is also a Weibull distribution. The load versus life model for the system is a power relationship as the models for the individual components. The load-life exponent and basic dynamic capacity are developed as functions of the components capacities. The models are used to compare three and four planet, 150 kW (200 hp), 5:1 reduction transmissions with 1500 rpm input speed to illustrate their use.

Efficient Quantum Transmission in Multiple-Source Networks

PubMed Central

Luo, Ming-Xing; Xu, Gang; Chen, Xiu-Bo; Yang, Yi-Xian; Wang, Xiaojun

2014-01-01

A difficult problem in quantum network communications is how to efficiently transmit quantum information over large-scale networks with common channels. We propose a solution by developing a quantum encoding approach. Different quantum states are encoded into a coherent superposition state using quantum linear optics. The transmission congestion in the common channel may be avoided by transmitting the superposition state. For further decoding and continued transmission, special phase transformations are applied to incoming quantum states using phase shifters such that decoders can distinguish outgoing quantum states. These phase shifters may be precisely controlled using classical chaos synchronization via additional classical channels. Based on this design and the reduction of multiple-source network under the assumption of restricted maximum-flow, the optimal scheme is proposed for specially quantized multiple-source network. In comparison with previous schemes, our scheme can greatly increase the transmission efficiency. PMID:24691590

Real-time transmission of digital video using variable-length coding

NASA Technical Reports Server (NTRS)

Bizon, Thomas P.; Shalkhauser, Mary JO; Whyte, Wayne A., Jr.

1993-01-01

Huffman coding is a variable-length lossless compression technique where data with a high probability of occurrence is represented with short codewords, while 'not-so-likely' data is assigned longer codewords. Compression is achieved when the high-probability levels occur so frequently that their benefit outweighs any penalty paid when a less likely input occurs. One instance where Huffman coding is extremely effective occurs when data is highly predictable and differential coding can be applied (as with a digital video signal). For that reason, it is desirable to apply this compression technique to digital video transmission; however, special care must be taken in order to implement a communication protocol utilizing Huffman coding. This paper addresses several of the issues relating to the real-time transmission of Huffman-coded digital video over a constant-rate serial channel. Topics discussed include data rate conversion (from variable to a fixed rate), efficient data buffering, channel coding, recovery from communication errors, decoder synchronization, and decoder architectures. A description of the hardware developed to execute Huffman coding and serial transmission is also included. Although this paper focuses on matters relating to Huffman-coded digital video, the techniques discussed can easily be generalized for a variety of applications which require transmission of variable-length data.

Design of UAV high resolution image transmission system

NASA Astrophysics Data System (ADS)

Gao, Qiang; Ji, Ming; Pang, Lan; Jiang, Wen-tao; Fan, Pengcheng; Zhang, Xingcheng

2017-02-01

In order to solve the problem of the bandwidth limitation of the image transmission system on UAV, a scheme with image compression technology for mini UAV is proposed, based on the requirements of High-definition image transmission system of UAV. The video codec standard H.264 coding module and key technology was analyzed and studied for UAV area video communication. Based on the research of high-resolution image encoding and decoding technique and wireless transmit method, The high-resolution image transmission system was designed on architecture of Android and video codec chip; the constructed system was confirmed by experimentation in laboratory, the bit-rate could be controlled easily, QoS is stable, the low latency could meets most applied requirement not only for military use but also for industrial applications.

Small passenger car transmission test-Chevrolet 200 transmission

NASA Technical Reports Server (NTRS)

Bujold, M. P.

1980-01-01

The small passenger car transmission was tested to supply electric vehicle manufacturers with technical information regarding the performance of commerically available transmissions which would enable them to design a more energy efficient vehicle. With this information the manufacturers could estimate vehicle driving range as well as speed and torque requirements for specific road load performance characteristics. A 1979 Chevrolet Model 200 automatic transmission was tested per a passenger car automatic transmission test code (SAE J651b) which required drive performance, coast performance, and no load test conditions. The transmission attained maximum efficiencies in the mid-eighty percent range for both drive performance tests and coast performance tests. Torque, speed and efficiency curves map the complete performance characteristics for Chevrolet Model 200 transmission.

Transmissivity testing of multilayer insulation at cryogenic temperatures

NASA Astrophysics Data System (ADS)

Johnson, W. L.; Van Dresar, N. T.; Chato, D. J.; Demers, J. R.

2017-09-01

The problem of degraded emissivity of thin films at low temperatures has been a long observed phenomena. Previous efforts at measuring properties have suggested that transmission of energy through the films may play a key role in the thermal performance of multilayer insulation systems at low temperatures. Similarly, recent testing on tank applied systems has suggested a radiative degradation at low temperatures. Two different approaches were used to attempt to measure the transmission of energy through MLI at low temperatures. A laser based measurement system was set up to directly measure transmittance and a calorimetric based measurement system was used to measure relative emittance of a single layer between aluminum foil and double aluminized Mylar. Minimal transmission at long wavelengths were observed through standard MLI blanket materials at deposition thicknesses of even 35 nm. Where transmission was measured, it was too low to effect the performance of a multilayers system. Similarly, the calorimeter showed similar increases of emissivity for both standard blanket materials and aluminum foils. Multiple different methodologies of measurement have all yielded the same result: that there is no transmission through standard MLI blanket materials at wavelengths associated with temperatures as low as 2 K.

Whole-genome sequencing to determine Neisseria gonorrhoeae transmission: an observational study

PubMed Central

Cole, Kevin; Cole, Michelle J; Cresswell, Fiona; Dean, Gillian; Dave, Jayshree; Thomas, Daniel Rh; Foster, Kirsty; Waldram, Alison; Wilson, Daniel J; Didelot, Xavier; Grad, Yonatan H; Crook, Derrick W; Peto, Tim EA; Walker, A Sarah

2016-01-01

Background New approaches are urgently required to address increasing rates of gonorrhoea and the emergence and global spread of antibiotic-resistant Neisseria gonorrhoeae. Whole genome sequencing (WGS) can be applied to study transmission and track resistance. Methods We performed WGS on 1659 isolates from Brighton, UK, and 217 additional isolates from other UK locations. We included WGS data (n=196) from the USA. Estimated mutation rates, plus diversity observed within patients across anatomical sites and probable transmission pairs, were used to fit a coalescent model to determine the number of single nucleotide polymorphisms (SNPs) expected between sequences related by direct/indirect transmission, depending on the time between samples. Findings We detected extensive local transmission. 281/1061(26%) Brighton cases were indistinguishable (0 SNPs) to ≥1 previous case(s), and 786(74%) had evidence of a sampled direct or indirect Brighton source. There was evidence of sustained transmission of some lineages. We observed multiple related samples across geographic locations. Of 1273 infections in Brighton, 225(18%) were linked to another case from elsewhere in the UK, and 115(9%) to a case from the USA. Four lineages initially identified in Brighton could be linked to 70 USA sequences, including 61 from a lineage carrying the mosaic penA XXXIV associated with reduced cefixime susceptibility. Interpretation We present a WGS-based tool for genomic contact tracing of N. gonorrhoeae and demonstrate local, national and international transmission. WGS can be applied across geographical boundaries to investigate gonorrhoea transmission and to track antimicrobial resistance. Funding Oxford NIHR Health Protection Research Unit and Biomedical Research Centre. PMID:27427203

Cost estimation of HVDC transmission system of Bangka's NPP candidates

NASA Astrophysics Data System (ADS)

Liun, Edwaren; Suparman

2014-09-01

Regarding nuclear power plant development in Bangka Island, it can be estimated that produced power will be oversupply for the Bangka Island and needs to transmit to Sumatra or Java Island. The distance between the regions or islands causing considerable loss of power in transmission by alternating current, and a wide range of technical and economical issues. The objective of this paper addresses to economics analysis of direct current transmission system to overcome those technical problem. Direct current transmission has a stable characteristic, so that the power delivery from Bangka to Sumatra or Java in a large scale efficiently and reliably can be done. HVDC system costs depend on the power capacity applied to the system and length of the transmission line in addition to other variables that may be different.

Bayesian reconstruction of transmission within outbreaks using genomic variants.

PubMed

De Maio, Nicola; Worby, Colin J; Wilson, Daniel J; Stoesser, Nicole

2018-04-01

Pathogen genome sequencing can reveal details of transmission histories and is a powerful tool in the fight against infectious disease. In particular, within-host pathogen genomic variants identified through heterozygous nucleotide base calls are a potential source of information to identify linked cases and infer direction and time of transmission. However, using such data effectively to model disease transmission presents a number of challenges, including differentiating genuine variants from those observed due to sequencing error, as well as the specification of a realistic model for within-host pathogen population dynamics. Here we propose a new Bayesian approach to transmission inference, BadTrIP (BAyesian epiDemiological TRansmission Inference from Polymorphisms), that explicitly models evolution of pathogen populations in an outbreak, transmission (including transmission bottlenecks), and sequencing error. BadTrIP enables the inference of host-to-host transmission from pathogen sequencing data and epidemiological data. By assuming that genomic variants are unlinked, our method does not require the computationally intensive and unreliable reconstruction of individual haplotypes. Using simulations we show that BadTrIP is robust in most scenarios and can accurately infer transmission events by efficiently combining information from genetic and epidemiological sources; thanks to its realistic model of pathogen evolution and the inclusion of epidemiological data, BadTrIP is also more accurate than existing approaches. BadTrIP is distributed as an open source package (https://bitbucket.org/nicofmay/badtrip) for the phylogenetic software BEAST2. We apply our method to reconstruct transmission history at the early stages of the 2014 Ebola outbreak, showcasing the power of within-host genomic variants to reconstruct transmission events.

Phase noise suppression for coherent optical block transmission systems: a unified framework.

PubMed

Yang, Chuanchuan; Yang, Feng; Wang, Ziyu

2011-08-29

A unified framework for phase noise suppression is proposed in this paper, which could be applied in any coherent optical block transmission systems, including coherent optical orthogonal frequency-division multiplexing (CO-OFDM), coherent optical single-carrier frequency-domain equalization block transmission (CO-SCFDE), etc. Based on adaptive modeling of phase noise, unified observation equations for different coherent optical block transmission systems are constructed, which lead to unified phase noise estimation and suppression. Numerical results demonstrate that the proposal is powerful in mitigating laser phase noise.

Reprint of “Performance analysis of a model-sized superconducting DC transmission system based VSC-HVDC transmission technologies using RTDS”

NASA Astrophysics Data System (ADS)

Dinh, Minh-Chau; Ju, Chang-Hyeon; Kim, Sung-Kyu; Kim, Jin-Geun; Park, Minwon; Yu, In-Keun

2013-01-01

The combination of a high temperature superconducting DC power cable and a voltage source converter based HVDC (VSC-HVDC) creates a new option for transmitting power with multiple collection and distribution points for long distance and bulk power transmissions. It offers some greater advantages compared with HVAC or conventional HVDC transmission systems, and it is well suited for the grid integration of renewable energy sources in existing distribution or transmission systems. For this reason, a superconducting DC transmission system based HVDC transmission technologies is planned to be set up in the Jeju power system, Korea. Before applying this system to a real power system on Jeju Island, system analysis should be performed through a real time test. In this paper, a model-sized superconducting VSC-HVDC system, which consists of a small model-sized VSC-HVDC connected to a 2 m YBCO HTS DC model cable, is implemented. The authors have performed the real-time simulation method that incorporates the model-sized superconducting VSC-HVDC system into the simulated Jeju power system using Real Time Digital Simulator (RTDS). The performance analysis of the superconducting VSC-HVDC systems has been verified by the proposed test platform and the results were discussed in detail.

Monolithic high voltage nonlinear transmission line fabrication process

DOEpatents

Cooper, Gregory A.

1994-01-01

A process for fabricating sequential inductors and varactor diodes of a monolithic, high voltage, nonlinear, transmission line in GaAs is disclosed. An epitaxially grown laminate is produced by applying a low doped active n-type GaAs layer to an n-plus type GaAs substrate. A heavily doped p-type GaAs layer is applied to the active n-type layer and a heavily doped n-type GaAs layer is applied to the p-type layer. Ohmic contacts are applied to the heavily doped n-type layer where diodes are desired. Multiple layers are then either etched away or Oxygen ion implanted to isolate individual varactor diodes. An insulator is applied between the diodes and a conductive/inductive layer is thereafter applied on top of the insulator layer to complete the process.

Characteristics of the transmission loss apparatus at NASA Langley Research Center

NASA Technical Reports Server (NTRS)

Grosveld, F. W.

1983-01-01

A description of the Transmission Loss Apparatus at NASA Langley Research Center, which is specifically designed to accommodate general aviation type aircraft structures, is presented. The measurement methodology, referred to as the Plate Reference Method, is discussed and compared with the classical method as described in the Standard of the American Society for Testing and Materials. This measurement procedure enables reliable and accurate noise transmission loss measurements down to the 50 Hz one-third octave band. The transmission loss characteristics of add-on acoustical treatments, applied to the basic structure, can be established by inclusion of appropriate absorption corrections for the treatment.

Biology as population dynamics: heuristics for transmission risk.

PubMed

Keebler, Daniel; Walwyn, David; Welte, Alex

2013-02-01

Population-type models, accounting for phenomena such as population lifetimes, mixing patterns, recruitment patterns, genetic evolution and environmental conditions, can be usefully applied to the biology of HIV infection and viral replication. A simple dynamic model can explore the effect of a vaccine-like stimulus on the mortality and infectiousness, which formally looks like fertility, of invading virions; the mortality of freshly infected cells; and the availability of target cells, all of which impact on the probability of infection. Variations on this model could capture the importance of the timing and duration of different key events in viral transmission, and hence be applied to questions of mucosal immunology. The dynamical insights and assumptions of such models are compatible with the continuum of between- and within-individual risks in sexual violence and may be helpful in making sense of the sparse data available on the association between HIV transmission and sexual violence. © 2012 John Wiley & Sons A/S.

Small passenger car transmission test: Mercury Lynx ATX transmission

NASA Technical Reports Server (NTRS)

Bujold, M. P.

1981-01-01

The testing of a Mercury Lynx automatic transmission is reported. The transmission was tested in accordance with a passenger car automatic transmission test code (SAE J65lb) which required drive performance, coast performance, and no load test conditions. Under these conditions, the transmission attained maximum efficiencies in the mid-ninety percent range both for drive performance test and coast performance tests. The torque, speed, and efficiency curves are presented, which provide the complete performance characteristics for the Mercury Lynx automatic transmission.

Transmission eigenvalues

NASA Astrophysics Data System (ADS)

Cakoni, Fioralba; Haddar, Houssem

2013-10-01

In inverse scattering theory, transmission eigenvalues can be seen as the extension of the notion of resonant frequencies for impenetrable objects to the case of penetrable dielectrics. The transmission eigenvalue problem is a relatively late arrival to the spectral theory of partial differential equations. Its first appearance was in 1986 in a paper by Kirsch who was investigating the denseness of far-field patterns for scattering solutions of the Helmholtz equation or, in more modern terminology, the injectivity of the far-field operator [1]. The paper of Kirsch was soon followed by a more systematic study by Colton and Monk in the context of developing the dual space method for solving the inverse scattering problem for acoustic waves in an inhomogeneous medium [2]. In this paper they showed that for a spherically stratified media transmission eigenvalues existed and formed a discrete set. Numerical examples were also given showing that in principle transmission eigenvalues could be determined from the far-field data. This first period of interest in transmission eigenvalues was concluded with papers by Colton et al in 1989 [3] and Rynne and Sleeman in 1991 [4] showing that for an inhomogeneous medium (not necessarily spherically stratified) transmission eigenvalues, if they existed, formed a discrete set. For the next seventeen years transmission eigenvalues were ignored. This was mainly due to the fact that, with the introduction of various sampling methods to determine the shape of an inhomogeneous medium from far-field data, transmission eigenvalues were something to be avoided and hence the fact that transmission eigenvalues formed at most a discrete set was deemed to be sufficient. In addition, questions related to the existence of transmission eigenvalues or the structure of associated eigenvectors were recognized as being particularly difficult due to the nonlinearity of the eigenvalue problem and the special structure of the associated transmission

Echinococcosis: disease, detection and transmission.

PubMed

Craig, P S; Rogan, M T; Campos-Ponce, M

2003-01-01

Echinococcosis is one of the world's most geographically widespread parasitic zoonoses, with transmission occurring in tropical, temperate and arctic biomes. Most human infections are due to Echinococcus granulosus transmitted between domestic dogs and livestock, but this cosmopolitan species also cycles between wild carnivores (principally canids) and wild ungulates. The other species with significant zoonotic potential is E. multilocularis that occurs naturally in fox definitive hosts and small mammal intermediate hosts. These two species cause human cystic or alveolar echinococcosis respectively, which may be considered serious public health problems in several regions including developed countries. This review provides an introductory overview to the Supplement and summarises the biology and epidemiology of these two related cestodes with an emphasis on applied aspects relating to detection, diagnosis and surveillance in animal and human populations, and includes aspects of transmission ecology, and also considers aspects of community epidemiology and potential for control.

Theory of forward and reverse middle-ear transmission applied to otoacoustic emissions in infant and adult ears

PubMed Central

Keefe, Douglas H.; Abdala, Carolina

2008-01-01

The purpose of this study is to understand why otoacoustic emission (OAE) levels are higher in normal-hearing human infants relative to adults. In a previous study, distortion product (DP) OAE input/output (I/O) functions were shown to differ at f2=6 kHz in adults compared to infants through 6 months of age. These DPOAE I/O functions were used to noninvasively assess immaturities in forward/reverse transmission through the ear canal and middle ear [Abdala, C., and Keefe, D. H., (2006). J. Acoust Soc. Am. 120, 3832–3842]. In the present study, ear-canal reflectance and DPOAEs measured in the same ears were analyzed using a scattering-matrix model of forward and reverse transmission in the ear canal, middle ear, and cochlea. Reflectance measurements were sensitive to frequency-dependent effects of ear-canal and middle-ear transmission that differed across OAE type and subject age. Results indicated that DPOAE levels were larger in infants mainly because the reverse middle-ear transmittance level varied with ear-canal area, which differed by more than a factor of 7 between term infants and adults. The forward middle-ear transmittance level was −16 dB less in infants, so that the conductive efficiency was poorer in infants than adults. PMID:17348521

Transmissible cancers in an evolutionary context.

PubMed

Ujvari, Beata; Papenfuss, Anthony T; Belov, Katherine

2016-07-01

Cancer is an evolutionary and ecological process in which complex interactions between tumour cells and their environment share many similarities with organismal evolution. Tumour cells with highest adaptive potential have a selective advantage over less fit cells. Naturally occurring transmissible cancers provide an ideal model system for investigating the evolutionary arms race between cancer cells and their surrounding micro-environment and macro-environment. However, the evolutionary landscapes in which contagious cancers reside have not been subjected to comprehensive investigation. Here, we provide a multifocal analysis of transmissible tumour progression and discuss the selection forces that shape it. We demonstrate that transmissible cancers adapt to both their micro-environment and macro-environment, and evolutionary theories applied to organisms are also relevant to these unique diseases. The three naturally occurring transmissible cancers, canine transmissible venereal tumour (CTVT) and Tasmanian devil facial tumour disease (DFTD) and the recently discovered clam leukaemia, exhibit different evolutionary phases: (i) CTVT, the oldest naturally occurring cell line is remarkably stable; (ii) DFTD exhibits the signs of stepwise cancer evolution; and (iii) clam leukaemia shows genetic instability. While all three contagious cancers carry the signature of ongoing and fairly recent adaptations to selective forces, CTVT appears to have reached an evolutionary stalemate with its host, while DFTD and the clam leukaemia appear to be still at a more dynamic phase of their evolution. Parallel investigation of contagious cancer genomes and transcriptomes and of their micro-environment and macro-environment could shed light on the selective forces shaping tumour development at different time points: during the progressive phase and at the endpoint. A greater understanding of transmissible cancers from an evolutionary ecology perspective will provide novel avenues for

Interrelationships Among Flow-Mediated Vasodilation, Nitroglycerine-Induced Vasodilation, Baseline Brachial Artery Diameter, Hyperemic Shear Stress, and Cardiovascular Risk Factors.

PubMed

Maruhashi, Tatsuya; Iwamoto, Yumiko; Kajikawa, Masato; Oda, Nozomu; Kishimoto, Shinji; Matsui, Shogo; Hashimoto, Haruki; Aibara, Yoshiki; Yusoff, Farina Mohamad; Hidaka, Takayuki; Kihara, Yasuki; Chayama, Kazuaki; Noma, Kensuke; Nakashima, Ayumu; Goto, Chikara; Hida, Eisuke; Higashi, Yukihito

2017-12-29

Flow-mediated vasodilation (FMD) of the brachial artery has been used for the assessment of endothelial function. Considering the mechanism underlying the vasodilatory response of the brachial artery to reactive hyperemia, hyperemic shear stress (HSS), a stimulus for FMD; nitroglycerine-induced vasodilation (NID), an index of endothelium-independent vasodilation; and baseline brachial artery diameter (BAD) are also involved in vasodilatory response. The purpose of this study was to investigate the interrelationships among FMD, HSS, NID, baseline BAD, and cardiovascular risk factors. We measured FMD, HSS, NID, and baseline BAD simultaneously in 1033 participants (633 men and 400 women; mean age: 58.6±17.0 years). Framingham risk score was negatively correlated with FMD, HSS, and NID and was positively correlated with baseline BAD. HSS and NID were positively correlated with FMD, and baseline BAD was negatively correlated with FMD. In participants with normal NID, FMD was correlated with HSS, NID, and baseline BAD, all of which were independent variables of FMD in multivariate analysis. In participants with impaired NID, FMD was correlated with NID and baseline BAD, both of which were independent variables of FMD in multivariate analysis, but there was no association between FMD and HSS. NID and baseline BAD were independent variables of FMD regardless of the status of endothelium-independent vasodilation, whereas there was a significant association between FMD and HSS in participants with normal NID but not in those with impaired NID. The influence of HSS on FMD seems to be dependent on the status of endothelium-independent vasodilation. © 2017 The Authors. Published on behalf of the American Heart Association, Inc., by Wiley.

Small passenger car transmission test; Chevrolet LUV transmission

NASA Technical Reports Server (NTRS)

Bujold, M. P.

1980-01-01

A 1978 Chevrolet LUV manual transmission tested per the applicable portions of a passenger car automatic transmission test code (SAE J65lb) which required drive performance, coast performance, and no load test conditions. Under these test conditions, the transmission attained maximum efficiencies in the upper ninety percent range for both drive performance tests and coast performance tests. The major results of this test (torque, speed, and efficiency curves) are presented. Graphs map the complete performance characteristics for the Chevrolet LUV transmission.

Continuous variable transmission and regenerative braking devices in bicycles utilizing magnetorheological fluids

NASA Astrophysics Data System (ADS)

Cheung, Wai Ming; Liao, Wei-Hsin

2013-04-01

The use of magnetorheological (MR) fluids in vehicles has been gaining popular recently due to its controllable nature, which gives automotive designers more dimensions of freedom in functional designs. However, not much attention has been paid to apply it to bicycles. This paper is aimed to study the feasibility of applying MR fluids in different dynamic parts of a bicycle such as the transmission and braking systems. MR continuous variable transmission (CVT) and power generator assisted in braking systems were designed and analyzed. Both prototypes were fabricated and tested to evaluate their performances. Experimental results showed that the proposed designs are promising to be used in bicycles.

Extended RF shimming: Sequence‐level parallel transmission optimization applied to steady‐state free precession MRI of the heart

PubMed Central

Price, Anthony N.; Padormo, Francesco; Hajnal, Joseph V.; Malik, Shaihan J.

2017-01-01

Cardiac magnetic resonance imaging (MRI) at high field presents challenges because of the high specific absorption rate and significant transmit field (B 1 +) inhomogeneities. Parallel transmission MRI offers the ability to correct for both issues at the level of individual radiofrequency (RF) pulses, but must operate within strict hardware and safety constraints. The constraints are themselves affected by sequence parameters, such as the RF pulse duration and TR, meaning that an overall optimal operating point exists for a given sequence. This work seeks to obtain optimal performance by performing a ‘sequence‐level’ optimization in which pulse sequence parameters are included as part of an RF shimming calculation. The method is applied to balanced steady‐state free precession cardiac MRI with the objective of minimizing TR, hence reducing the imaging duration. Results are demonstrated using an eight‐channel parallel transmit system operating at 3 T, with an in vivo study carried out on seven male subjects of varying body mass index (BMI). Compared with single‐channel operation, a mean‐squared‐error shimming approach leads to reduced imaging durations of 32 ± 3% with simultaneous improvement in flip angle homogeneity of 32 ± 8% within the myocardium. PMID:28195684

Extended RF shimming: Sequence-level parallel transmission optimization applied to steady-state free precession MRI of the heart.

PubMed

Beqiri, Arian; Price, Anthony N; Padormo, Francesco; Hajnal, Joseph V; Malik, Shaihan J

2017-06-01

Cardiac magnetic resonance imaging (MRI) at high field presents challenges because of the high specific absorption rate and significant transmit field (B 1 + ) inhomogeneities. Parallel transmission MRI offers the ability to correct for both issues at the level of individual radiofrequency (RF) pulses, but must operate within strict hardware and safety constraints. The constraints are themselves affected by sequence parameters, such as the RF pulse duration and TR, meaning that an overall optimal operating point exists for a given sequence. This work seeks to obtain optimal performance by performing a 'sequence-level' optimization in which pulse sequence parameters are included as part of an RF shimming calculation. The method is applied to balanced steady-state free precession cardiac MRI with the objective of minimizing TR, hence reducing the imaging duration. Results are demonstrated using an eight-channel parallel transmit system operating at 3 T, with an in vivo study carried out on seven male subjects of varying body mass index (BMI). Compared with single-channel operation, a mean-squared-error shimming approach leads to reduced imaging durations of 32 ± 3% with simultaneous improvement in flip angle homogeneity of 32 ± 8% within the myocardium. © 2017 The Authors. NMR in Biomedicine published by John Wiley & Sons Ltd.

Monolithic high voltage nonlinear transmission line fabrication process

DOEpatents

Cooper, G.A.

1994-10-04

A process for fabricating sequential inductors and varistor diodes of a monolithic, high voltage, nonlinear, transmission line in GaAs is disclosed. An epitaxially grown laminate is produced by applying a low doped active n-type GaAs layer to an n-plus type GaAs substrate. A heavily doped p-type GaAs layer is applied to the active n-type layer and a heavily doped n-type GaAs layer is applied to the p-type layer. Ohmic contacts are applied to the heavily doped n-type layer where diodes are desired. Multiple layers are then either etched away or Oxygen ion implanted to isolate individual varistor diodes. An insulator is applied between the diodes and a conductive/inductive layer is thereafter applied on top of the insulator layer to complete the process. 6 figs.

HIV Transmission

PubMed Central

Shaw, George M.; Hunter, Eric

2012-01-01

HIV-1 is transmitted by sexual contact across mucosal surfaces, by maternal-infant exposure, and by percutaneous inoculation. For reasons that are still incompletely understood, CCR5-tropic viruses (R5 viruses) are preferentially transmitted by all routes. Transmission is followed by an orderly appearance of viral and host markers of infection in the blood plasma. In the acute phase of infection, HIV-1 replicates exponentially and diversifies randomly, allowing for an unambiguous molecular identification of transmitted/founder virus genomes and a precise characterization of the population bottleneck to virus transmission. Sexual transmission of HIV-1 most often results in productive clinical infection arising from a single virus, highlighting the extreme bottleneck and inherent inefficiency in virus transmission. It remains to be determined if HIV-1 transmission is largely a stochastic process whereby any reasonably fit R5 virus can be transmitted or if there are features of transmitted/founder viruses that facilitate their transmission in a biologically meaningful way. Human tissue explant models of HIV-1 infection and animal models of SIV/SHIV/HIV-1 transmission, coupled with new challenge virus strains that more closely reflect transmitted/founder viruses, have the potential to elucidate fundamental mechanisms in HIV-1 transmission relevant to vaccine design and other prevention strategies. PMID:23043157

High speed data transmission coaxial-cable in the space communication system

NASA Astrophysics Data System (ADS)

Su, Haohang; Huang, Jing

2018-01-01

An effective method is proved based on the scattering parameter of high speed 8-core coaxial-cable measured by vector network analyzer, and the semi-physical simulation is made to receive the eye diagram at different data transmission rate. The result can be apply to analysis decay and distortion of the signal through the coaxial-cable at high frequency, and can extensively design for electromagnetic compatibility of high-speed data transmission system.

8 CFR 217.7 - Electronic data transmission requirement.

Code of Federal Regulations, 2010 CFR

2010-01-01

... VISA WAIVER PROGRAM § 217.7 Electronic data transmission requirement. (a) An alien who applies for... will not be admitted under the Visa Waiver Program unless an appropriate official of the carrier... departure from the United States by sea or air of an alien admitted under the Visa Waiver Program, an...

Efficient Sparse Signal Transmission over a Lossy Link Using Compressive Sensing

PubMed Central

Wu, Liantao; Yu, Kai; Cao, Dongyu; Hu, Yuhen; Wang, Zhi

2015-01-01

Reliable data transmission over lossy communication link is expensive due to overheads for error protection. For signals that have inherent sparse structures, compressive sensing (CS) is applied to facilitate efficient sparse signal transmissions over lossy communication links without data compression or error protection. The natural packet loss in the lossy link is modeled as a random sampling process of the transmitted data, and the original signal will be reconstructed from the lossy transmission results using the CS-based reconstruction method at the receiving end. The impacts of packet lengths on transmission efficiency under different channel conditions have been discussed, and interleaving is incorporated to mitigate the impact of burst data loss. Extensive simulations and experiments have been conducted and compared to the traditional automatic repeat request (ARQ) interpolation technique, and very favorable results have been observed in terms of both accuracy of the reconstructed signals and the transmission energy consumption. Furthermore, the packet length effect provides useful insights for using compressed sensing for efficient sparse signal transmission via lossy links. PMID:26287195

Economic analysis for transmission operation and planning

NASA Astrophysics Data System (ADS)

Zhou, Qun

2011-12-01

Restructuring of the electric power industry has caused dramatic changes in the use of transmission system. The increasing congestion conditions as well as the necessity of integrating renewable energy introduce new challenges and uncertainties to transmission operation and planning. Accurate short-term congestion forecasting facilitates market traders in bidding and trading activities. Cost sharing and recovery issue is a major impediment for long-term transmission investment to integrate renewable energy. In this research, a new short-term forecasting algorithm is proposed for predicting congestion, LMPs, and other power system variables based on the concept of system patterns. The advantage of this algorithm relative to standard statistical forecasting methods is that structural aspects underlying power market operations are exploited to reduce the forecasting error. The advantage relative to previously proposed structural forecasting methods is that data requirements are substantially reduced. Forecasting results based on a NYISO case study demonstrate the feasibility and accuracy of the proposed algorithm. Moreover, a negotiation methodology is developed to guide transmission investment for integrating renewable energy. Built on Nash Bargaining theory, the negotiation of investment plans and payment rate can proceed between renewable generation and transmission companies for cost sharing and recovery. The proposed approach is applied to Garver's six bus system. The numerical results demonstrate fairness and efficiency of the approach, and hence can be used as guidelines for renewable energy investors. The results also shed light on policy-making of renewable energy subsidies.

The economic impacts of foot and mouth disease – What are they, how big are they and where do they occur?

PubMed Central

Knight-Jones, T.J.D.; Rushton, J.

2013-01-01

Although a disease of low mortality, the global impact of foot and mouth disease (FMD) is colossal due to the huge numbers of animals affected. This impact can be separated into two components: (1) direct losses due to reduced production and changes in herd structure; and (2) indirect losses caused by costs of FMD control, poor access to markets and limited use of improved production technologies. This paper estimates that annual impact of FMD in terms of visible production losses and vaccination in endemic regions alone amount to between US$6.5 and 21 billion. In addition, outbreaks in FMD free countries and zones cause losses of >US$1.5 billion a year. FMD impacts are not the same throughout the world:1.FMD production losses have a big impact on the world's poorest where more people are directly dependent on livestock. FMD reduces herd fertility leading to less efficient herd structures and discourages the use of FMD susceptible, high productivity breeds. Overall the direct losses limit livestock productivity affecting food security.2.In countries with ongoing control programmes, FMD control and management creates large costs. These control programmes are often difficult to discontinue due to risks of new FMD incursion.3.The presence, or even threat, of FMD prevents access to lucrative international markets.4.In FMD free countries outbreaks occur periodically and the costs involved in regaining free status have been enormous. FMD is highly contagious and the actions of one farmer affect the risk of FMD occurring on other holdings; thus sizeable externalities are generated. Control therefore requires coordination within and between countries. These externalities imply that FMD control produces a significant amount of public goods, justifying the need for national and international public investment. Equipping poor countries with the tools needed to control FMD will involve the long term development of state veterinary services that in turn will deliver wider

Identification and proposed control of helicopter transmission noise at the source

NASA Technical Reports Server (NTRS)

Coy, John J.; Handschuh, Robert F.; Lewicki, David G.; Huff, Ronald G.; Krejsa, Eugene A.; Karchmer, Allan M.; Coy, John J.

1988-01-01

Helicopter cabin interiors require noise treatment which is expensive and adds weight. The gears inside the main power transmission are major sources of cabin noise. Work conducted by the NASA Lewis Research Center in measuring cabin interior noise and in relating the noise spectrum to the gear vibration of the Army OH-58 helicopter is described. Flight test data indicate that the planetary gear train is a major source of cabin noise and that other low frequency sources are present that could dominate the cabin noise. Companion vibration measurements were made in a transmission test stand, revealing that the single largest contributor to the transmission vibration was the spiral bevel gear mesh. The current understanding of the nature and causes of gear and transmission noise is discussed. It is believed that the kinematical errors of the gear mesh have a strong influence on that noise. The completed NASA/Army sponsored research that applies to transmission noise reduction is summarized. The continuing research program is also reviewed.

Identification and proposed control of helicopter transmission noise at the source

NASA Technical Reports Server (NTRS)

Coy, John J.; Handschuh, Robert F.; Lewicki, David G.; Huff, Ronald G.; Krejsa, Eugene A.; Karchmer, Allan M.

1987-01-01

Helicopter cabin interiors require noise treatment which is expensive and adds weight. The gears inside the main power transmission are major sources of cabin noise. Work conducted by the NASA Lewis Research Center in measuring cabin interior noise and in relating the noise spectrum to the gear vibration of the Army OH-58 helicopter is described. Flight test data indicate that the planetary gear train is a major source of cabin noise and that other low frequency sources are present that could dominate the cabin noise. Companion vibration measurements were made in a transmission test stand, revealing that the single largest contributor to the transmission vibration was the spiral bevel gear mesh. The current understanding of the nature and causes of gear and transmission noise is discussed. It is believed that the kinematical errors of the gear mesh have a strong influence on that noise. The completed NASA/Army sponsored research that applies to transmission noise reduction is summarized. The continuing research program is also reviewed.

The complex relationship between weather and dengue virus transmission in Thailand.

PubMed

Campbell, Karen M; Lin, C D; Iamsirithaworn, Sopon; Scott, Thomas W

2013-12-01

Using a novel analytical approach, weather dynamics and seasonal dengue virus transmission cycles were profiled for each Thailand province, 1983-2001, using monthly assessments of cases, temperature, humidity, and rainfall. We observed systematic differences in the structure of seasonal transmission cycles of different magnitude, the role of weather in regulating seasonal cycles, necessary versus optimal transmission "weather-space," basis of large epidemics, and predictive indicators that estimate risk. Larger epidemics begin earlier, develop faster, and are predicted at Onset change-point when case counts are low. Temperature defines a viable range for transmission; humidity amplifies the potential within that range. This duality is central to transmission. Eighty percent of 1.2 million severe dengue cases occurred when mean temperature was 27-29.5°C and mean humidity was > 75%. Interventions are most effective when applied early. Most cases occur near Peak, yet small reductions at Onset can substantially reduce epidemic magnitude. Monitoring the Quiet-Phase is fundamental in effectively targeting interventions pre-emptively.

Challenges of Generating and Maintaining Protective Vaccine-Induced Immune Responses for Foot-and-Mouth Disease Virus in Pigs

PubMed Central

Lyons, Nicholas A.; Lyoo, Young S.; King, Donald P.; Paton, David J.

2016-01-01

Vaccination can play a central role in the control of outbreaks of foot-and-mouth disease (FMD) by reducing both the impact of clinical disease and the extent of virus transmission between susceptible animals. Recent incursions of exotic FMD virus lineages into several East Asian countries have highlighted the difficulties of generating and maintaining an adequate immune response in vaccinated pigs. Factors that impact vaccine performance include (i) the potency, antigenic payload, and formulation of a vaccine; (ii) the antigenic match between the vaccine and the heterologous circulating field strain; and (iii) the regime (timing, frequency, and herd-level coverage) used to administer the vaccine. This review collates data from studies that have evaluated the performance of foot-and-mouth disease virus vaccines at the individual and population level in pigs and identifies research priorities that could provide new insights to improve vaccination in the future. PMID:27965966

Small passenger car transmission test: Dodge Omni A-404 transmission

NASA Technical Reports Server (NTRS)

Bujold, M. P.

1980-01-01

The small passenger car transmission test was initiated to supply electric vehicle manufacturers with technical information regarding the performance of commercially available transmissions. This transmission was tested in accordance with a passenger car automatic transmission test code (SAE J65lb) which required drive performance, coast performance, and no load test conditions. Under these test conditions, the transmission attained maximum efficiencies in the mid eighty percent range for both drive performance test and coast performance tests.

stochastic estimation of transmissivity fields conditioned to flow connectivity data

NASA Astrophysics Data System (ADS)

Freixas, Genis; Fernàndez-Garcia, Daniel; Sanchez-vila, Xavier

2017-04-01

Most methods for hydraulic parameter interpretation rely on a number of simplifications regarding the homogeneity of the underlying porous media. This way, the actual heterogeneity of any natural parameter, such as transmissivity, is transferred to the estimated in a way heavily dependent on the interpretation method used. An example is a pumping test, in most cases interpreted by means of the Cooper-Jacob method, which implicitly assumes a homogeneous isotropic confined aquifer. It was shown that the estimates obtained from this method when applied to a real site are not local values, but still have a physical meaning; the estimated transmissivity is equal to the effective transmissivity characteristic of the regional scale, while the log-ratio of the estimated storage coefficient with respect to the actual real value (assumed constant), indicated by , is an indicator of flow connectivity, representative of the scale given by the distance between the pumping and the observation wells. In this work we propose a methodology to use together with actual measurements of the log transmissivity at selected points to obtain a map of the best local transmissivity estimates using cokriging. Since the interpolation involves two variables measured at different support scales, a critical point is the estimation of the covariance and crosscovariance matrices, involving some quadratures that are obtained using some simplified approach. The method was applied to a synthetic field displaying statistical anisotropy, showing that the use of connectivity indicators mixed with the local values provide a better representation of the local value map, in particular regarding the enhanced representation of the continuity of structures corresponding to either high or low values.

Financial Impacts of Foot-and-Mouth Disease at Village and National Levels in Lao PDR.

PubMed

Nampanya, S; Khounsy, S; Abila, R; Young, J R; Bush, R D; Windsor, P A

2016-10-01

To assist policies on Foot-and-Mouth Disease (FMD) control in Laos and the Mekong region, the financial impact of recent outbreaks at village and national levels was examined. Village-level impacts were derived from recent research on financial losses due to FMD per smallholder household and number of households with FMD-affected livestock in the village. National-level impacts of FMD were determined from examination of 2011-2013 FMD reported to the Lao Department of Livestock and Fisheries (DLF), with the 2011 epidemic reported separately due to the large number and size of outbreaks of FMD in that year. Estimates of the national financial impact of FMD were based on (i) total FMD financial losses at the village level and (ii) the costs of FMD responses and other related costs at the DLF, provincial and district levels where FMD was reported, but excluding the costs of revenue forgone. A Monte Carlo simulation was utilized to account for likelihood of FMD over- and under-reporting. Foot-and-mouth disease was recorded in four provinces of Phonsaly, Bokeo, Xayyabouli and Champasak in three consecutive years from 2011 to 2013. However, the FMD epidemic in 2011 was more widely distributed and involved 414 villages in 14 provinces, with thousands of cases of morbidity in cattle and buffalo and some mortalities. The estimated financial losses due to FMD in 2011 were USD 30 881(±23 176) at the village level and USD 13 512 291 at the national level based on the number of villages with FMD outbreaks reported. However, when the likelihood of FMD under-reporting was accounted for, the estimated financial losses at the national level could potentially increase to USD 102 094 464 (±52 147 261), being almost 12% of the estimated farm gate value of the national large ruminant herd. These findings confirm that FMD causes substantial financial impacts in villages and to the national economy of Laos, providing justification for sustained investments in FMD control

Computer controllable synchronous shifting of an automatic transmission

DOEpatents

Davis, R.I.; Patil, P.B.

1989-08-08

A multiple forward speed automatic transmission produces its lowest forward speed ratio when a hydraulic clutch and hydraulic brake are disengaged and a one-way clutch connects a ring gear to the transmission casing. Second forward speed ratio results when the hydraulic clutch is engaged to connect the ring gear to the planetary carrier of a second gear set. Reverse drive and regenerative operation result when an hydraulic brake fixes the planetary and the direction of power flow is reversed. Various sensors produce signals representing the torque at the output of the transmission or drive wheels, the speed of the power source, and the hydraulic pressure applied to a clutch and brake. A control algorithm produces input data representing a commanded upshift, a commanded downshift, a commanded transmission output torque, and commanded power source speed. A microprocessor processes the inputs and produces a response to them in accordance with the execution of a control algorithm. Output or response signals cause selective engagement and disengagement of the clutch and brake at a rate that satisfies the requirements for a short gear ratio change and smooth torque transfer between the friction elements. 6 figs.

Computer controlled synchronous shifting of an automatic transmission

DOEpatents

Davis, Roy I.; Patil, Prabhakar B.

1989-01-01

A multiple forward speed automatic transmission produces its lowest forward speed ratio when a hydraulic clutch and hydraulic brake are disengaged and a one-way clutch connects a ring gear to the transmission casing. Second forward speed ratio results when the hydraulic clutch is engaged to connect the ring gear to the planetary carrier of a second gear set. Reverse drive and regenerative operation result when an hydraulic brake fixes the planetary and the direction of power flow is reversed. Various sensors produce signals representing the torque at the output of the transmission or drive wheels, the speed of the power source, and the hydraulic pressure applied to a clutch and brake. A control algorithm produces input data representing a commanded upshift, a commanded downshift, a commanded transmission output torque, and commanded power source speed. A microprocessor processes the inputs and produces a response to them in accordance with the execution of a control algorithm. Output or response signals cause selective engagement and disengagement of the clutch and brake at a rate that satisfies the requirements for a short gear ratio change and smooth torque transfer between the friction elements.

Knowledge transmission model with differing initial transmission and retransmission process

NASA Astrophysics Data System (ADS)

Wang, Haiying; Wang, Jun; Small, Michael

2018-10-01

Knowledge transmission is a cyclic dynamic diffusion process. The rate of acceptance of knowledge differs upon whether or not the recipient has previously held the knowledge. In this paper, the knowledge transmission process is divided into an initial and a retransmission procedure, each with its own transmission and self-learning parameters. Based on epidemic spreading model, we propose a naive-evangelical-agnostic (VEA) knowledge transmission model and derive mean-field equations to describe the dynamics of knowledge transmission in homogeneous networks. Theoretical analysis identifies a criterion for the persistence of knowledge, i.e., the reproduction number R0 depends on the minor effective parameters between the initial and retransmission process. Moreover, the final size of evangelical individuals is only related to retransmission process parameters. Numerical simulations validate the theoretical analysis. Furthermore, the simulations indicate that increasing the initial transmission parameters, including first transmission and self-learning rates of naive individuals, can accelerate the velocity of knowledge transmission efficiently but have no effect on the final size of evangelical individuals. In contrast, the retransmission parameters, including retransmission and self-learning rates of agnostic individuals, have a significant effect on the rate of knowledge transmission, i.e., the larger parameters the greater final density of evangelical individuals.

Identification of foot and mouth disease risk areas using a multi-criteria analysis approach

PubMed Central

Silva, Gustavo Sousa e; Weber, Eliseu José; Hasenack, Heinrich; Groff, Fernando Henrique Sautter; Todeschini, Bernardo; Borba, Mauro Riegert; Medeiros, Antonio Augusto Rosa; Leotti, Vanessa Bielefeldt; Canal, Cláudio Wageck; Corbellini, Luis Gustavo

2017-01-01

Foot and mouth disease (FMD) is a highly infectious disease that affects cloven-hoofed livestock and wildlife. FMD has been a problem for decades, which has led to various measures to control, eradicate and prevent FMD by National Veterinary Services worldwide. Currently, the identification of areas that are at risk of FMD virus incursion and spread is a priority for FMD target surveillance after FMD is eradicated from a given country or region. In our study, a knowledge-driven spatial model was built to identify risk areas for FMD occurrence and to evaluate FMD surveillance performance in Rio Grande do Sul state, Brazil. For this purpose, multi-criteria decision analysis was used as a tool to seek multiple and conflicting criteria to determine a preferred course of action. Thirteen South American experts analyzed 18 variables associated with FMD introduction and dissemination pathways in Rio Grande do Sul. As a result, FMD higher risk areas were identified at international borders and in the central region of the state. The final model was expressed as a raster surface. The predictive ability of the model assessed by comparing, for each cell of the raster surface, the computed model risk scores with a binary variable representing the presence or absence of an FMD outbreak in that cell during the period 1985 to 2015. Current FMD surveillance performance was assessed, and recommendations were made to improve surveillance activities in critical areas. PMID:28552973

Determinants of Rotavirus Transmission: A Lag Nonlinear Time Series Analysis.

PubMed

van Gaalen, Rolina D; van de Kassteele, Jan; Hahné, Susan J M; Bruijning-Verhagen, Patricia; Wallinga, Jacco

2017-07-01

Rotavirus is a common viral infection among young children. As in many countries, the infection dynamics of rotavirus in the Netherlands are characterized by an annual winter peak, which was notably low in 2014. Previous study suggested an association between weather factors and both rotavirus transmission and incidence. From epidemic theory, we know that the proportion of susceptible individuals can affect disease transmission. We investigated how these factors are associated with rotavirus transmission in the Netherlands, and their impact on rotavirus transmission in 2014. We used available data on birth rates and rotavirus laboratory reports to estimate rotavirus transmission and the proportion of individuals susceptible to primary infection. Weather data were directly available from a central meteorological station. We developed an approach for detecting determinants of seasonal rotavirus transmission by assessing nonlinear, delayed associations between each factor and rotavirus transmission. We explored relationships by applying a distributed lag nonlinear regression model with seasonal terms. We corrected for residual serial correlation using autoregressive moving average errors. We inferred the relationship between different factors and the effective reproduction number from the most parsimonious model with low residual autocorrelation. Higher proportions of susceptible individuals and lower temperatures were associated with increases in rotavirus transmission. For 2014, our findings suggest that relatively mild temperatures combined with the low proportion of susceptible individuals contributed to lower rotavirus transmission in the Netherlands. However, our model, which overestimated the magnitude of the peak, suggested that other factors were likely instrumental in reducing the incidence that year.

Small passenger car transmission test; Ford C4 transmission

NASA Technical Reports Server (NTRS)

Bujold, M. P.

1980-01-01

A 1979 Ford C4 automatic transmission was tested per a passenger car automatic transmission test code (SAE J651b) which required drive performance, coast performance, and no load test conditions. Under these test conditions, the transmission attained maximum efficiencies in the mid-eighty percent range for both drive performance tests and coast performance tests. The major results of this test (torque, speed, and efficiency curves) are presented. Graphs map the complete performance characteristics for the Ford C4 transmission.

Self-similar transmission properties of aperiodic Cantor potentials in gapped graphene

NASA Astrophysics Data System (ADS)

Rodríguez-González, Rogelio; Rodríguez-Vargas, Isaac; Díaz-Guerrero, Dan Sidney; Gaggero-Sager, Luis Manuel

2016-01-01

We investigate the transmission properties of quasiperiodic or aperiodic structures based on graphene arranged according to the Cantor sequence. In particular, we have found self-similar behaviour in the transmission spectra, and most importantly, we have calculated the scalability of the spectra. To do this, we implement and propose scaling rules for each one of the fundamental parameters: generation number, height of the barriers and length of the system. With this in mind we have been able to reproduce the reference transmission spectrum, applying the appropriate scaling rule, by means of the scaled transmission spectrum. These scaling rules are valid for both normal and oblique incidence, and as far as we can see the basic ingredients to obtain self-similar characteristics are: relativistic Dirac electrons, a self-similar structure and the non-conservation of the pseudo-spin.

Tea-induced improvement of endothelial function in humans: No role for epigallocatechin gallate (EGCG).

PubMed

Lorenz, Mario; Rauhut, Franziska; Hofer, Christine; Gwosc, Stefanie; Müller, Eda; Praeger, Damaris; Zimmermann, Benno F; Wernecke, Klaus-Dieter; Baumann, Gert; Stangl, Karl; Stangl, Verena

2017-05-23

Consumption of tea is inversely associated with cardiovascular diseases. However, the active compound(s) responsible for the protective effects of tea are unknown. Although many favorable cardiovascular effects in vitro are mediated by epigallocatechin gallate (EGCG), its contribution to the beneficial effects of tea in vivo remains unresolved. In a randomised crossover study, a single dose of 200 mg EGCG was applied in three different formulas (as green tea beverage, green tea extract (GTE), and isolated EGCG) to 50 healthy men. Flow-mediated dilation (FMD) and endothelial-independent nitro-mediated dilation (NMD) was measured before and two hours after ingestion. Plasma levels of tea compounds were determined after each intervention and correlated with FMD. FMD significantly improved after consumption of green tea containing 200 mg EGCG (p < 0.01). However, GTE and EGCG had no significant effect on FMD. NMD did not significantly differ between interventions. EGCG plasma levels were highest after administration of EGCG and lowest after consumption of green tea. Plasma levels of caffeine increased after green tea consumption. The results show that EGCG is most likely not involved in improvement of flow-mediated dilation by green tea. Instead, other tea compounds, metabolites or combinations thereof may play a role.

Microwave transmission measurements through a magnetic photonic crystal

NASA Astrophysics Data System (ADS)

Radwan, Mohamed Zein; Dewar, Graeme

We have measured the 12 - 18 GHz microwave transmission through, and the reflection from, a nickel zinc ferrite penetrated by a wire lattice. The metamaterial efficiently transmitted microwaves under conditions for which the index of refraction was negative. The wires, 0.29 mm in diameter, were threaded through Teflon tubes and centered in holes 1.7 mm in diameter drilled through the ferrite. The holes formed a square array with a lattice constant of 3.0 mm. A ferrite sample containing the wire array filled a length of 3.0 cm inside standard WR-62 waveguide and a static magnetic field between 0.042 and 13.0 kOe was applied parallel to the wires. We measured the transmission relative to an open waveguide and the reflection relative to a reflective metal plate across the waveguide face. We observed transmission modes at combinations of magnetic field and microwave frequency for which both the permeability of the ferrite and permittivity of the wire array were negative.

Improvement in smallholder farmer knowledge of cattle production, health and biosecurity in Southern Cambodia between 2008 and 2010.

PubMed

Nampanya, S; Suon, S; Rast, L; Windsor, P A

2012-04-01

Farmer knowledge surveys were conducted in 2008 and 2010 in Cambodia to evaluate the impact of a research project studying interventions that can improve cattle production and health, including biosecurity and practices relating to risks of transmission of transboundary diseases. The project hypothesis is that by increasing the value of smallholder-owned large ruminants through nutritional interventions and improved marketing, knowledge-based interventions including risk management for infectious diseases such as foot-and-mouth disease (FMD) can be implemented into a more sustainable pathway for rural development. Between 2008 and 2010, significant improvements in farmer knowledge and attitudes were recorded in three villages in three provinces of southern Cambodia. This was achieved through participatory 'applied field research', 'on the job' training plus 'formal' training programmes. No cases of FMD were recorded during the study period in the 'high-intervention' (HI) villages despite the common occurrence of the disease in a nearby 'low-intervention' and many other villages in the three provinces. Whilst it is likely that protection of these villages from FMD infection was from increasing the herd immunity by vaccination, it could also have been partly because of a decrease in risk behaviours by farmers as a result of their increasing knowledge of biosecurity. The research indicates that smallholder farmers are motivated by nutritional interventions that improve the value of their cattle 'bank' and offer better marketing opportunities. This provides a more receptive environment for introduction of disease risk management for infectious and other production limiting diseases, best implemented for smallholder farmers in Cambodia by intensive training programmes. In lieu of a widespread public awareness programme to deliver mass education of smallholder farmers in disease prevention and biosecurity, livestock development projects in South-East Asia should be

Quantifying Transmission.

PubMed

Woolhouse, Mark

2017-07-01

Transmissibility is the defining characteristic of infectious diseases. Quantifying transmission matters for understanding infectious disease epidemiology and designing evidence-based disease control programs. Tracing individual transmission events can be achieved by epidemiological investigation coupled with pathogen typing or genome sequencing. Individual infectiousness can be estimated by measuring pathogen loads, but few studies have directly estimated the ability of infected hosts to transmit to uninfected hosts. Individuals' opportunities to transmit infection are dependent on behavioral and other risk factors relevant given the transmission route of the pathogen concerned. Transmission at the population level can be quantified through knowledge of risk factors in the population or phylogeographic analysis of pathogen sequence data. Mathematical model-based approaches require estimation of the per capita transmission rate and basic reproduction number, obtained by fitting models to case data and/or analysis of pathogen sequence data. Heterogeneities in infectiousness, contact behavior, and susceptibility can have substantial effects on the epidemiology of an infectious disease, so estimates of only mean values may be insufficient. For some pathogens, super-shedders (infected individuals who are highly infectious) and super-spreaders (individuals with more opportunities to transmit infection) may be important. Future work on quantifying transmission should involve integrated analyses of multiple data sources.

Transmission function properties for multi-layered structures: application to super-resolution.

PubMed

Mattiucci, N; D'Aguanno, G; Scalora, M; Bloemer, M J; Sibilia, C

2009-09-28

We discuss the properties of the transmission function in the k-space for a generic multi-layered structure. In particular we analytically demonstrate that a transmission greater than one in the evanescent spectrum (amplification of the evanescent modes) can be directly linked to the guided modes supported by the structure. Moreover we show that the slope of the phase of the transmission function in the propagating spectrum is inversely proportional to the ability of the structure to compensate the diffraction of the propagating modes. We apply these findings to discuss several examples where super-resolution is achieved thanks to the simultaneous availability of the amplification of the evanescent modes and the diffraction compensation of the propagating modes.

Global Transmission Dynamics of Measles in the Measles Elimination Era.

PubMed

Furuse, Yuki; Oshitani, Hitoshi

2017-04-16

Although there have been many epidemiological reports of the inter-country transmission of measles, systematic analysis of the global transmission dynamics of the measles virus (MV) is limited. In this study, we applied phylogeographic analysis to characterize the global transmission dynamics of the MV using large-scale genetic sequence data (obtained for 7456 sequences) from 115 countries between 1954 and 2015. These analyses reveal the spatial and temporal characteristics of global transmission of the virus, especially in Australia, China, India, Japan, the UK, and the USA in the period since 1990. The transmission is frequently observed, not only within the same region but also among distant and frequently visited areas. Frequencies of export from measles-endemic countries, such as China, India, and Japan are high but decreasing, while the frequencies from countries where measles is no longer endemic, such as Australia, the UK, and the USA, are low but slightly increasing. The world is heading toward measles eradication, but the disease is still transmitted regionally and globally. Our analysis reveals that countries wherein measles is endemic and those having eliminated the disease (apart from occasional outbreaks) both remain a source of global transmission in this measles elimination era. It is therefore crucial to maintain vigilance in efforts to monitor and eradicate measles globally.

Transmission clustering among newly diagnosed HIV patients in Chicago, 2008 to 2011: using phylogenetics to expand knowledge of regional HIV transmission patterns

PubMed Central

Lubelchek, Ronald J.; Hoehnen, Sarah C.; Hotton, Anna L.; Kincaid, Stacey L.; Barker, David E.; French, Audrey L.

2014-01-01

Introduction HIV transmission cluster analyses can inform HIV prevention efforts. We describe the first such assessment for transmission clustering among HIV patients in Chicago. Methods We performed transmission cluster analyses using HIV pol sequences from newly diagnosed patients presenting to Chicago’s largest HIV clinic between 2008 and 2011. We compared sequences via progressive pairwise alignment, using neighbor joining to construct an un-rooted phylogenetic tree. We defined clusters as >2 sequences among which each sequence had at least one partner within a genetic distance of ≤ 1.5%. We used multivariable regression to examine factors associated with clustering and used geospatial analysis to assess geographic proximity of phylogenetically clustered patients. Results We compared sequences from 920 patients; median age 35 years; 75% male; 67% Black, 23% Hispanic; 8% had a Rapid Plasma Reagin (RPR) titer ≥ 1:16 concurrent with their HIV diagnosis. We had HIV transmission risk data for 54%; 43% identified as men who have sex with men (MSM). Phylogenetic analysis demonstrated 123 patients (13%) grouped into 26 clusters, the largest having 20 members. In multivariable regression, age < 25, Black race, MSM status, male gender, higher HIV viral load, and RPR ≥ 1:16 associated with clustering. We did not observe geographic grouping of genetically clustered patients. Discussion Our results demonstrate high rates of HIV transmission clustering, without local geographic foci, among young Black MSM in Chicago. Applied prospectively, phylogenetic analyses could guide prevention efforts and help break the cycle of transmission. PMID:25321182

Pre- and post-treatment experiences of fear, anxiety, and pain among chronic periodontitis patients treated by scaling and root planing per quadrant versus one-stage full-mouth disinfection: a 6-month randomized controlled clinical trial.

PubMed

Santuchi, Camila Carvalho; Cortelli, Sheila Cavalca; Cortelli, José Roberto; Cota, Luís Otávio Miranda; Alencar, Camila Oliveira; Costa, Fernando Oliveira

2015-11-01

To relate the clinical effects of two different forms of non-surgical periodontal therapy - scaling and root planing per quadrant (SRP-Q) and one-stage full-mouth disinfection (FMD) - to patient-based outcomes such as fear, anxiety, and pain of moderate chronic periodontitis patients. Dental Fear Survey (DFS) and Dental Anxiety Scale (DAS) questionnaires and Visual Analogue Scale (VAS) were applied to 78 patients randomized into two groups: SRP-Q (n = 37) and FMD (n = 41). Periodontal clinical parameters: probing pocket depth (PD), clinical attachment level (CAL), plaque index (PI), and gingival index (GI) were monitored at baseline and 6 months after treatment. Data were statistically analysed by chi-square, Fisher's exact, Mann-Whitney, Wilcoxon tests, Pearson's correlation, and Cluster analysis. All periodontal clinical parameters improved from baseline to 6 months. Patients with higher fear and anxiety showed a worse clinical periodontal status before and after treatment (mean CAL, PI, and GI). After both types of treatment, fear and anxiety decreased (FMD: p = 0.019; SRP-Q: p = 0.043) with no differences between the groups. Pain did not differ between groups (FMD: 20.6 ± 19.0 and SRP: 20.7 ± 20.0; p = 0.930). In moderate chronic periodontitis patients, SRP-Q and FMD provided periodontal clinical improvements and similar experiences of fear, anxiety, and pain. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

A study of methods of prediction and measurement of the transmission of sound through the walls of light aircraft

NASA Technical Reports Server (NTRS)

Forssen, B.; Wang, Y. S.; Raju, P. K.; Crocker, M. J.

1981-01-01

The acoustic intensity technique was applied to the sound transmission loss of panel structures (single, composite, and stiffened). A theoretical model of sound transmission through a cylindrical shell is presented.

A study of methods of prediction and measurement of the transmission of sound through the walls of light aircraft

NASA Astrophysics Data System (ADS)

Forssen, B.; Wang, Y. S.; Raju, P. K.; Crocker, M. J.

1981-08-01

The acoustic intensity technique was applied to the sound transmission loss of panel structures (single, composite, and stiffened). A theoretical model of sound transmission through a cylindrical shell is presented.

Carotid-bulb atypical fibromuscular dysplasia in young Afro-Caribbean patients with stroke.

PubMed

Joux, Julien; Chausson, Nicolas; Jeannin, Séverine; Saint-Vil, Martine; Mejdoubi, Mehdi; Hennequin, Jean-Luc; Deschamps, Lydia; Smadja, Didier; Olindo, Stéphane

2014-12-01

An atypical form of fibromuscular dysplasia located in the internal carotid-bulb (CaFMD) is thought to be uncommon and is poorly described as a cause of ischemic stroke in the young. This study aimed to obtain a better description of CaFMD in Afro-Caribbean population, who could be particularly affected by it. This study included consecutive patients <55 years consulting at Fort-de-France University Hospital Stroke Center (Martinique, FWI) found to have CaFMD as the only cause after a comprehensive work-up. CaFMD was diagnosed when computed tomographic angiography showed a bulbar spur without calcification. Twenty-five patients with stroke and CaFMD were identified. Computed tomographic angiography showed 2 CaFMD patterns: a thin (n=15) or thick (n=10) spur. Three patients initial computed tomographic angiography images showed a mural thrombus overlying the CaFMD. CaFMD was surgically removed from 7 of 25 and 20 of 25 patients who received antiplatelet therapy; after mean follow-up of 25.3±19.5 months, their respective recurrence rates were 0% and 30%. CaFMD could be a common condition in young Afro-Caribbeans with carotid-territory ischemic stroke. Recurrences were frequent under antiplatelet treatment, while surgical CaFMD removal seemed more effective. © 2014 American Heart Association, Inc.

High-Throughput Assay and Discovery of Small Molecules that Interrupt Malaria Transmission

PubMed Central

Plouffe, David M.; Wree, Melanie; Du, Alan Y.; Meister, Stephan; Li, Fengwu; Patra, Kailash; Lubar, Aristea; Okitsu, Shinji L.; Flannery, Erika L.; Kato, Nobutaka; Tanaseichuk, Olga; Comer, Eamon; Zhou, Bin; Kuhen, Kelli; Zhou, Yingyao; Leroy, Didier; Schreiber, Stuart L.; Scherer, Christina A.; Vinetz, Joseph; Winzeler, Elizabeth A.

2016-01-01

Summary Preventing transmission is an important element of malaria control. However, most of the current available methods to assay for malaria transmission blocking are relatively low throughput and cannot be applied to large chemical libraries. We have developed a high-throughput and cost-effective assay, the Saponin-lysis Sexual Stage Assay (SaLSSA), for identifying small molecules with transmission-blocking capacity. SaLSSA analysis of 13,983 unique compounds uncovered that >90% of well-characterized antimalarials, including endoperoxides and 4-aminoquinolines, as well as compounds active against asexual blood stages, lost most of their killing activity when parasites developed into metabolically quiescent stage V gametocytes. On the other hand, we identified compounds with consistent low nanomolar transmission-blocking activity, some of which showed cross-reactivity against asexual blood and liver stages. The data clearly emphasize substantial physiological differences between sexual and asexual parasites and provide a tool and starting points for the discovery and development of transmission-blocking drugs. PMID:26749441

New discoveries in the transmission biology of sleeping sickness parasites: applying the basics.

PubMed

MacGregor, Paula; Matthews, Keith R

2010-09-01

The sleeping sickness parasite, Trypanosoma brucei, must differentiate in response to the changing environments that it encounters during its complex life cycle. One developmental form, the bloodstream stumpy stage, plays an important role in infection dynamics and transmission of the parasite. Recent advances have shed light on the molecular mechanisms by which these stumpy forms differentiate as they are transmitted from the mammalian host to the insect vector of sleeping sickness, tsetse flies. These molecular advances now provide improved experimental tools for the study of stumpy formation and function within the mammalian bloodstream. They also offer new routes to therapy via high-throughput screens for agents that accelerate parasite development. Here, we shall discuss the recent advances that have been made and the prospects for future research now available.

The Complex Relationship between Weather and Dengue Virus Transmission in Thailand

PubMed Central

Campbell, Karen M.; Lin, C. D.; Iamsirithaworn, Sopon; Scott, Thomas W.

2013-01-01

Using a novel analytical approach, weather dynamics and seasonal dengue virus transmission cycles were profiled for each Thailand province, 1983–2001, using monthly assessments of cases, temperature, humidity, and rainfall. We observed systematic differences in the structure of seasonal transmission cycles of different magnitude, the role of weather in regulating seasonal cycles, necessary versus optimal transmission “weather-space,” basis of large epidemics, and predictive indicators that estimate risk. Larger epidemics begin earlier, develop faster, and are predicted at Onset change-point when case counts are low. Temperature defines a viable range for transmission; humidity amplifies the potential within that range. This duality is central to transmission. Eighty percent of 1.2 million severe dengue cases occurred when mean temperature was 27–29.5°C and mean humidity was > 75%. Interventions are most effective when applied early. Most cases occur near Peak, yet small reductions at Onset can substantially reduce epidemic magnitude. Monitoring the Quiet-Phase is fundamental in effectively targeting interventions pre-emptively. PMID:23958906

Simulation of stochastic wind action on transmission power lines

NASA Astrophysics Data System (ADS)

Wielgos, Piotr; Lipecki, Tomasz; Flaga, Andrzej

2018-01-01

The paper presents FEM analysis of the wind action on overhead transmission power lines. The wind action is based on a stochastic simulation of the wind field in several points of the structure and on the wind tunnel tests on aerodynamic coefficients of the single conductor consisting of three wires. In FEM calculations the section of the transmission power line composed of three spans is considered. Non-linear analysis with deadweight of the structure is performed first to obtain the deformed shape of conductors. Next, time-dependent wind forces are applied to respective points of conductors and non-linear dynamic analysis is carried out.

Transmission dynamics of cholera: Mathematical modeling and control strategies

NASA Astrophysics Data System (ADS)

Sun, Gui-Quan; Xie, Jun-Hui; Huang, Sheng-He; Jin, Zhen; Li, Ming-Tao; Liu, Liqun

2017-04-01

Cholera, as an endemic disease around the world, has generated great threat to human society and caused enormous morbidity and mortality with weak surveillance system. In this paper, we propose a mathematical model to describe the transmission of Cholera. Moreover, basic reproduction number and the global dynamics of the dynamical model are obtained. Then we apply our model to characterize the transmission process of Cholera in China. It was found that, in order to avoid its outbreak in China, it may be better to increase immunization coverage rate and make effort to improve environmental management especially for drinking water. Our results may provide some new insights for elimination of Cholera.

Bordetella pertussis transmission

PubMed Central

Trainor, Elizabeth A.; Nicholson, Tracy L.; Merkel, Tod J.

2015-01-01

Bordetella pertussis and B. bronchiseptica are Gram-negative bacterial respiratory pathogens. Bordetella pertussis is the causative agent of whooping cough and is considered a human-adapted variant of B. bronchiseptica. Bordetella pertussis and B. bronchiseptica share mechanisms of pathogenesis and are genetically closely related. However, despite the close genetic relatedness, these Bordetella species differ in several classic fundamental aspects of bacterial pathogens such as host range, pathologies and persistence. The development of the baboon model for the study of B. pertussis transmission, along with the development of the swine and mouse model for the study of B. bronchiseptica, has enabled the investigation of different aspects of transmission including the route, attack rate, role of bacterial and host factors, and the impact of vaccination on transmission. This review will focus on B. pertussis transmission and how animal models of B. pertussis transmission and transmission models using the closely related B. bronchiseptica have increased our understanding of B. pertussis transmission. PMID:26374235

Evaluation of foot and mouth vaccination for yak (Bos grunniens) in Pakistan.

PubMed

Mortenson, J A; Khan, E H Haq; Ali, I; Manzoor, S; Jamil, A; Abubakar, M; Afzal, M; Hussain, M

2017-04-01

In northern Pakistan, many farming communities rely on domestic yak (Bos grunniens) as a principle source of income. A 2006 participatory disease surveillance report from this region indicated that foot-and-mouth disease (FMD) is the most prevalent annual disease of yak. Our objectives of this study were to determine exposure levels of yak to FMD virus; implement a vaccination program based on current, regional FMD virus serotypes and subtypes; and quantify immune responses following vaccination. Blood samples were used to determine pre-vaccination exposure of animals to FMD virus by antibody presence to non-structural proteins of FMD virus using a 3-ABC trapping indirect ELISA. Vaccine used consisted of FMD serotypes 'O' (PanAsia-2), 'A' (Iran-05), and 'Asia-1' (Shamir), but changed later during the study to match newly circulating viruses in the country ('O'-PanAsia-2; 'A'-Turk-06 and Asia-1-Sindh-08). Three hundred sixty-three blood samples were tested from selected villages to determine pre-vaccination FMD virus exposure in yak with an average of 37.7%. Immune responses from initial vaccination and booster dose 30 days later showed clear protective levels (as mean percent inhibition) of antibodies against structural proteins of serotypes 'O,' 'A,' and 'Asia-1.' These responses remained above threshold positive level even at day 210 following initial vaccination. Results of sero-surveillance and anecdotal information of repeated FMD outbreaks demonstrate the persistence of FMD virus of yak in northern Pakistan. Laboratory results and field observations clearly indicated that yak can be protected against FMD with a good quality vaccine with FMD serotype(s) matching current, regionally circulating FMD virus.

Transmission Electron Microscopy of Minerals and Rocks

NASA Astrophysics Data System (ADS)

McLaren, Alex C.

1991-04-01

Of the many techniques that have been applied to the study of crystal defects, none has contributed more to our understanding of their nature and influence on the physical and chemical properties of crystalline materials than transmission electron microscopy (TEM). TEM is now used extensively by an increasing number of earth scientists for direct observation of defect microstructures in minerals and rocks. Transmission Electron Microscopy of Rocks and Minerals is an introduction to the principles of the technique and is the only book to date on the subject written specifically for geologists and mineralogists. The first part of the book deals with the essential physics of the transmission electron microscope and presents the basic theoretical background required for the interpretation of images and electron diffraction patterns. The final chapters are concerned with specific applications of TEM in mineralogy and deal with such topics as planar defects, intergrowths, radiation-induced defects, dislocations and deformation-induced microstructures. The examples cover a wide range of rock-forming minerals from crustal rocks to those in the lower mantle, and also take into account the role of defects in important mineralogical and geological processes.

NASA transmission research and its probable effects on helicopter transmission design

NASA Technical Reports Server (NTRS)

Zaretsky, E. V.; Coy, J. J.; Townsend, D. P.

1983-01-01

Transmissions studied for application to helicopters in addition to the more conventional geared transmissions include hybrid (traction/gear), bearingless planetary, and split torque transmissions. Research is being performed to establish the validity of analysis and computer codes developed to predict the performance, efficiency, life, and reliability of these transmissions. Results of this research should provide the transmission designer with analytical tools to design for minimum weight and noise with maximum life and efficiency. In addition, the advantages and limitations of drive systems as well as the more conventional systems will be defined.

NASA transmission research and its probable effects on helicopter transmission design

NASA Technical Reports Server (NTRS)

Zaretsky, E. V.; Coy, J. J.; Townsend, D. P.

1984-01-01

Transmissions studied for application to helicopters in addition to the more conventional geared transmissions include hybrid (traction/gear), bearingless planetary, and split torque transmissions. Research is being performed to establish the validity of analysis and computer codes developed to predict the performance, efficiency, life, and reliability of these transmissions. Results of this research should provide the transmission designer with analytical tools to design for minimum weight and noise with maximum life and efficiency. In addition, the advantages and limitations of drive systems as well as the more conventional systems will be defined.

Planning Electric Transmission Lines: A Review of Recent Regional Transmission Plans

DOE Office of Scientific and Technical Information (OSTI.GOV)

Eto, Joseph H.

The first Quadrennial Energy Review (QER) recommends that the U.S. Department of Energy (DOE) conduct a national review of transmission plans and assess the barriers and incentives to their implementation. DOE tasked Lawrence Berkeley National Laboratory (LBNL) to prepare two reports to support the agency’s response to this recommendation. This report reviews regional transmission plans and regional transmission planning processes that have been directed by Federal Energy Regulatory Commission (FERC) Order Nos. 890 and 1000. We focus on the most recent regional transmission plans (those issued in 2015 and through approximately mid-year 2016) and current regional transmission planning processes. Amore » companion report focuses on non-plan-related factors that affect transmission projects.« less

Reconfigurable terahertz grating with enhanced transmission of TE polarized light

NASA Astrophysics Data System (ADS)

He, J. W.; Wang, X. K.; Xie, Z. W.; Xue, Y. Z.; Wang, S.; Zhang, Y.

2017-07-01

We demonstrate an optically reconfigurable grating with enhanced transmission of TE-polarized waves in the terahertz (THz) waveband. This kind of grating is realized by projecting a grating image onto a thin Si wafer with a digital micromirror device (DMD). The enhanced transmission is caused by a resonance of the electromagnetic fields between the photoexcited strips. The position of the transmission peak shifts with the variation of the period and duty cycle of the photoinduced grating, which can be readily controlled by the DMD. Furthermore, a flattened Gaussian model was applied to describe the distribution of the photoexcited free carriers in the Si wafer, and the simulated transmittance spectra are shown to be in good agreement with the experimental results. In future, the photoexcited carriers could also be used to produce THz diffractive elements with reconfigurable functionality.

Mapping influenza transmission in the ferret model to transmission in humans

PubMed Central

Buhnerkempe, Michael G; Gostic, Katelyn; Park, Miran; Ahsan, Prianna; Belser, Jessica A; Lloyd-Smith, James O

2015-01-01

The controversy surrounding 'gain-of-function' experiments on high-consequence avian influenza viruses has highlighted the role of ferret transmission experiments in studying the transmission potential of novel influenza strains. However, the mapping between influenza transmission in ferrets and in humans is unsubstantiated. We address this gap by compiling and analyzing 240 estimates of influenza transmission in ferrets and humans. We demonstrate that estimates of ferret secondary attack rate (SAR) explain 66% of the variation in human SAR estimates at the subtype level. Further analysis shows that ferret transmission experiments have potential to identify influenza viruses of concern for epidemic spread in humans, though small sample sizes and biological uncertainties prevent definitive classification of human transmissibility. Thus, ferret transmission experiments provide valid predictions of pandemic potential of novel influenza strains, though results should continue to be corroborated by targeted virological and epidemiological research. DOI: http://dx.doi.org/10.7554/eLife.07969.001 PMID:26329460

MRI characteristics of carotid bulb atypical fibromuscular dysplasia in black stroke patients.

PubMed

Joux, Julien; Mejdoubi, Mehdi; Quere, Jean-Baptiste; Colombani, Sylvie; Hennequin, Jean-Luc; Deschamps, Lydia; Jeannin, Séverine; Olindo, Stéphane

2016-06-01

In black stroke patients, a particular form of fibromuscular dysplasia (FMD), called atypical FMD (aFMD), is involved in stroke mechanism. The high rate of stroke recurrence under medical treatment leads to propose surgery in such patients. Regarding its location level on the carotid bulb, aFMD is often confused with atherosclerosis or free-floating thrombus. Nowadays, only histology can confirm the diagnosis. MRI of aFMD has never been assessed. The constitution of a black patient's cohort with aFMD-related ischemic stroke is currently in progress in the French West Indies, Martinique. In patients scheduled for surgery, MRI of the carotid bifurcation was analyzed preoperatively, with subsequent histological examination of the excised specimen. The first four black stroke patients with MRI and histological findings are described. On imaging, aFMD lesion was homogeneous with isosignal on T2-weighted sequences and slight hypersignal on T1-weighted sequences with mild gadolinium enhancement of the inner layer. Histological findings confirmed the aFMD mainly located in the intima. aFMD generates a particular MRI pattern in our four patients, which could increase the diagnosis accuracy. Carotid bulb lesion in black stroke patients should suggest aFMD and MRI analysis may contribute to rule out differential diagnoses. Copyright © 2015 Elsevier Masson SAS. All rights reserved.

Video Transmission for Third Generation Wireless Communication Systems

PubMed Central

Gharavi, H.; Alamouti, S. M.

2001-01-01

This paper presents a twin-class unequal protected video transmission system over wireless channels. Video partitioning based on a separation of the Variable Length Coded (VLC) Discrete Cosine Transform (DCT) coefficients within each block is considered for constant bitrate transmission (CBR). In the splitting process the fraction of bits assigned to each of the two partitions is adjusted according to the requirements of the unequal error protection scheme employed. Subsequently, partitioning is applied to the ITU-T H.263 coding standard. As a transport vehicle, we have considered one of the leading third generation cellular radio standards known as WCDMA. A dual-priority transmission system is then invoked on the WCDMA system where the video data, after being broken into two streams, is unequally protected. We use a very simple error correction coding scheme for illustration and then propose more sophisticated forms of unequal protection of the digitized video signals. We show that this strategy results in a significantly higher quality of the reconstructed video data when it is transmitted over time-varying multipath fading channels. PMID:27500033

High mean water vapour pressure promotes the transmission of bacillary dysentery.

PubMed

Li, Guo-Zheng; Shao, Feng-Feng; Zhang, Hao; Zou, Chun-Pu; Li, Hui-Hui; Jin, Jue

2015-01-01

Bacillary dysentery is an infectious disease caused by Shigella dysenteriae, which has a seasonal distribution. External environmental factors, including climate, play a significant role in its transmission. This paper identifies climate-related risk factors and their role in bacillary dysentery transmission. Harbin, in northeast China, with a temperate climate, and Quzhou, in southern China, with a subtropical climate, are chosen as the study locations. The least absolute shrinkage and selectionator operator is applied to select relevant climate factors involved in the transmission of bacillary dysentery. Based on the selected relevant climate factors and incidence rates, an AutoRegressive Integrated Moving Average (ARIMA) model is established successfully as a time series prediction model. The numerical results demonstrate that the mean water vapour pressure over the previous month results in a high relative risk for bacillary dysentery transmission in both cities, and the ARIMA model can successfully perform such a prediction. These results provide better explanations for the relationship between climate factors and bacillary dysentery transmission than those put forth in other studies that use only correlation coefficients or fitting models. The findings in this paper demonstrate that the mean water vapour pressure over the previous month is an important predictor for the transmission of bacillary dysentery.

Bordetella pertussis transmission.

PubMed

Trainor, Elizabeth A; Nicholson, Tracy L; Merkel, Tod J

2015-11-01

Bordetella pertussis and B. bronchiseptica are Gram-negative bacterial respiratory pathogens. Bordetella pertussis is the causative agent of whooping cough and is considered a human-adapted variant of B. bronchiseptica. Bordetella pertussis and B. bronchiseptica share mechanisms of pathogenesis and are genetically closely related. However, despite the close genetic relatedness, these Bordetella species differ in several classic fundamental aspects of bacterial pathogens such as host range, pathologies and persistence. The development of the baboon model for the study of B. pertussis transmission, along with the development of the swine and mouse model for the study of B. bronchiseptica, has enabled the investigation of different aspects of transmission including the route, attack rate, role of bacterial and host factors, and the impact of vaccination on transmission. This review will focus on B. pertussis transmission and how animal models of B. pertussis transmission and transmission models using the closely related B. bronchiseptica have increased our understanding of B. pertussis transmission. © FEMS 2015. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Comparison of two automatic methods for the assessment of brachial artery flow-mediated dilation.

PubMed

Faita, Francesco; Masi, Stefano; Loukogeorgakis, Stavros; Gemignani, Vincenzo; Okorie, Mike; Bianchini, Elisabetta; Charakida, Marietta; Demi, Marcello; Ghiadoni, Lorenzo; Deanfield, John Eric

2011-01-01

Brachial artery flow-mediated dilation (FMD) is associated with risk factors providing information on cardiovascular prognosis. Despite the large effort to standardize the methodology, the FMD examination is still characterized by problems of reproducibility and reliability that can be partially overcome with the use of automatic systems. We developed real-time software for the assessment of brachial FMD (FMD Studio, Institute of Clinical Physiology, Pisa, Italy) from ultrasound images. The aim of this study is to compare our system with another automatic method (Brachial Analyzer, MIA LLC, IA, USA) which is currently considered as a reference method in FMD assessment. The agreement between systems was assessed as follows. Protocol 1: Mean baseline (Basal), maximal (Max) brachial artery diameter after forearm ischemia and FMD, calculated as maximal percentage diameter increase, have been evaluated in 60 recorded FMD sequences. Protocol 2: Values of diameter and FMD have been evaluated in 618 frames extracted from 12 sequences. All biases are negligible and standard deviations of the differences are satisfactory (protocol 1: -0.27 ± 0.59%; protocol 2: -0.26 ± 0.61%) for FMD measurements. Analysis times were reduced (-33%) when FMD Studio is used. Rejected examinations due to the poor quality were 2% with the FMD Studio and 5% with the Brachial Analyzer. In conclusion, the compared systems show a optimal grade of agreement and they can be used interchangeably. Thus, the use of a system characterized by real-time functionalities could represent a referral method for assessing endothelial function in clinical trials.

Current knowledge on Mycobacterium leprae transmission: a systematic literature review.

PubMed

Bratschi, Martin W; Steinmann, Peter; Wickenden, Anna; Gillis, Thomas P

2015-06-01

Summary The transmission pathways of Mycobacterium leprae are not fully understood. Solid evidence exists for an increased risk for individuals living in close contact with leprosy patients but the existence of zoonotic leprosy, environmental reservoirs and trauma-related transmission has also been established. To assess the current state of knowledge on M. leprae transmission, we conducted a systematic review of the peer-reviewed literature pertaining to this topic. Major electronic bibliographic databases were searched for relevant peer-reviewed articles published up to January 2014. No restrictions on study types, participants and location were applied, and all outcomes demonstrated to contribute to the transmission of M. leprae were considered. Included studies were grouped by mode of transmission, namely (i) human-to-human via aerosols or direct contact; (ii) direct inoculation (e.g. injury); and (iii) transmission to humans from environmental or zoonotic reservoirs, and by insects. The importance of the different transmission pathways and the strength of the evidence were assessed considering the number of publications describing similar findings, the consistency of the findings and the methodological quality of the studies. A total of 79 relevant articles were retained out of 3,805 hits resulting from the application of the search strategy. Solid evidence for transmission among contacts exists, and for zoonotic leprosy in the southern States of the USA. Based on the extant evidence, skin-to-skin contact, aerosols/droplets and shedding of bacteria into the environment and subsequent infection, e.g. through dust or small wounds, all remain possible options. No study has unequivocally demonstrated the mechanisms by which M. leprae bacteria travel from one case of leprosy to another.

Circularly-symmetric complex normal ratio distribution for scalar transmissibility functions. Part III: Application to statistical modal analysis

NASA Astrophysics Data System (ADS)

Yan, Wang-Ji; Ren, Wei-Xin

2018-01-01

This study applies the theoretical findings of circularly-symmetric complex normal ratio distribution Yan and Ren (2016) [1,2] to transmissibility-based modal analysis from a statistical viewpoint. A probabilistic model of transmissibility function in the vicinity of the resonant frequency is formulated in modal domain, while some insightful comments are offered. It theoretically reveals that the statistics of transmissibility function around the resonant frequency is solely dependent on 'noise-to-signal' ratio and mode shapes. As a sequel to the development of the probabilistic model of transmissibility function in modal domain, this study poses the process of modal identification in the context of Bayesian framework by borrowing a novel paradigm. Implementation issues unique to the proposed approach are resolved by Lagrange multiplier approach. Also, this study explores the possibility of applying Bayesian analysis in distinguishing harmonic components and structural ones. The approaches are verified through simulated data and experimentally testing data. The uncertainty behavior due to variation of different factors is also discussed in detail.

Implementing AORN recommended practices for prevention of transmissible infections.

PubMed

Patrick, Marcia R; Hicks, Rodney W

2013-12-01

Preventing infection in the perioperative setting is a critical element of patient and health care worker safety. This article reviews the recommendations in the AORN "Recommended practices for prevention of transmissible infections in the perioperative practice setting." The recommended practices are intended to help perioperative nurses implement standard and transmission-based precautions (ie, contact, droplet, airborne), including use of personal protective equipment as well as interventions to prevent surgical site infections and exposure to bloodborne pathogens. Additional recommendations cover vaccination programs and how to manage personnel who require work restrictions. Hospital and ambulatory patient scenarios are included to help perioperative nurses apply the recommendations in daily practice. Copyright © 2013 AORN, Inc. Published by Elsevier Inc. All rights reserved.

Impact of volunteer-related and methodology-related factors on the reproducibility of brachial artery flow-mediated vasodilation: analysis of 672 individual repeated measurements.

PubMed

van Mil, Anke C C M; Greyling, Arno; Zock, Peter L; Geleijnse, Johanna M; Hopman, Maria T; Mensink, Ronald P; Reesink, Koen D; Green, Daniel J; Ghiadoni, Lorenzo; Thijssen, Dick H

2016-09-01

Brachial artery flow-mediated dilation (FMD) is a popular technique to examine endothelial function in humans. Identifying volunteer and methodological factors related to variation in FMD is important to improve measurement accuracy and applicability. Volunteer-related and methodology-related parameters were collected in 672 volunteers from eight affiliated centres worldwide who underwent repeated measures of FMD. All centres adopted contemporary expert-consensus guidelines for FMD assessment. After calculating the coefficient of variation (%) of the FMD for each individual, we constructed quartiles (n = 168 per quartile). Based on two regression models (volunteer-related factors and methodology-related factors), statistically significant components of these two models were added to a final regression model (calculated as β-coefficient and R). This allowed us to identify factors that independently contributed to the variation in FMD%. Median coefficient of variation was 17.5%, with healthy volunteers demonstrating a coefficient of variation 9.3%. Regression models revealed age (β = 0.248, P < 0.001), hypertension (β = 0.104, P < 0.001), dyslipidemia (β = 0.331, P < 0.001), time between measurements (β = 0.318, P < 0.001), lab experience (β = -0.133, P < 0.001) and baseline FMD% (β = 0.082, P < 0.05) as contributors to the coefficient of variation. After including all significant factors in the final model, we found that time between measurements, hypertension, baseline FMD% and lab experience with FMD independently predicted brachial artery variability (total R = 0.202). Although FMD% showed good reproducibility, larger variation was observed in conditions with longer time between measurements, hypertension, less experience and lower baseline FMD%. Accounting for these factors may improve FMD% variability.

Emerging diseases and their impact on animal commerce: the Argentine lesson.

PubMed

Cané, B G; Leanes, L F; Mascitelli, L O

2004-10-01

As a result of the Argentine experience with foot-and-mouth disease (FMD) in 2001, a need was postulated for the establishment of efficient supranational schemes for continuous surveillance of the interrelations between tropical extractives livestock systems and the prairies that are optimal for the feeding of livestock in the southern region of South America. FMD in Argentina and in other countries, new or re-emerging risks from avian influenza with potential risks for public health, the spongiform encephalopathies, porcine reproductive and respiratory syndrome, and classical swine fever, among other animal diseases, have generated a strong reaction and evolution within the veterinary services of the country. These present lessons will influence decision-making within countries and should be accepted by the technical and scientific community. From the perspective of the official animal health sector and with the FMD eradication plan as a basis within the national territory, we have worked not only to achieve international recognition and credibility within animal health systems, but also to realize the formation of a regional block of countries that can be recognized internationally as an area with equivalent animal health status. We emphasize not only that this lesson is useful in FMD, but also that it is possible to apply the valuable conclusions reached for other emerging or re-emerging diseases.

Global Foot-and-Mouth Disease Research Update and Gap Analysis: 5 - Biotherapeutics and Disinfectants.

PubMed

Robinson, L; Knight-Jones, T J D; Charleston, B; Rodriguez, L L; Gay, C G; Sumption, K J; Vosloo, W

2016-06-01

We assessed knowledge gaps in foot-and-mouth disease (FMD) research. Findings are reported in a series of papers, and in this article, we consider biotherapeutics and disinfectants. The study took the form of a literature review (2011-2015) combined with research updates collected in 2014 from 33 institutes from across the world. Findings were used to identify priority areas for future FMD research. While vaccines will remain the key immunological intervention used against FMD virus (FMDV) for the foreseeable future, it takes a few days for the immune system to respond to vaccination. In an outbreak situation, protection could potentially be provided during this period by the application of rapid, short-acting biotherapeutics, aiming either to stimulate a non-specific antiviral state in the animal or to specifically inhibit a part of the viral life cycle. Certain antiviral cytokines have been shown to promote rapid protection against FMD; however, the effects of different immune-modulators appear to vary across species in ways and for reasons that are not yet understood. Major barriers to the effective incorporation of biotherapeutics into control strategies are cost, limited understanding of their effect on subsequent immune responses to vaccines and uncertainty about their potential impact if used for disease containment. Recent research has highlighted the importance of environmental contamination in FMDV transmission. Effective disinfectants for FMDV have long been available, but research is being conducted to further develop methods for quantitatively evaluating their performance under field, or near-field, conditions. During outbreaks in South Korea in 2010 there was public concern about potential environmental contamination after the mass use of disinfectant and mass burial of culled stock; this should be considered during outbreak contingency planning. © 2016 Blackwell Verlag GmbH.

Automated manual transmission controller

DOEpatents

Lawrie, Robert E.; Reed, Jr., Richard G.; Bernier, David R.

1999-12-28

A powertrain system for a hybrid vehicle. The hybrid vehicle includes a heat engine, such as a diesel engine, and an electric machine, which operates as both an electric motor and an alternator, to power the vehicle. The hybrid vehicle also includes a manual-style transmission configured to operate as an automatic transmission from the perspective of the driver. The engine and the electric machine drive an input shaft which in turn drives an output shaft of the transmission. In addition to driving the transmission, the electric machine regulates the speed of the input shaft in order to synchronize the input shaft during either an upshift or downshift of the transmission by either decreasing or increasing the speed of the input shaft. When decreasing the speed of the input shaft, the electric motor functions as an alternator to produce electrical energy which may be stored by a storage device. Operation of the transmission is controlled by a transmission controller which receives input signals and generates output signals to control shift and clutch motors to effect smooth launch, upshift shifts, and downshifts of the transmission, so that the transmission functions substantially as an automatic transmission from the perspective of the driver, while internally substantially functioning as a manual transmission.

Laboratory capacity for diagnosis of foot-and-mouth disease in Eastern Africa: implications for the progressive control pathway.

PubMed

Namatovu, Alice; Wekesa, Sabenzia Nabalayo; Tjørnehøj, Kirsten; Dhikusooka, Moses Tefula; Muwanika, Vincent B; Siegsmund, Hans Redlef; Ayebazibwe, Chrisostom

2013-01-24

Accurate diagnosis is pertinent to any disease control programme. If Eastern Africa is to work towards control of foot-and-mouth disease (FMD) using the Progressive Control Pathway for FMD (PCP-FMD) as a tool, then the capacity of national reference laboratories (NRLs) mandated to diagnose FMD should match this task. This study assessed the laboratory capacity of 14 NRLs of the Eastern Africa Region Laboratory Network member countries using a semi-structured questionnaire and retrospective data from the World Reference Laboratory for FMD annual reports and Genbank® through National Centre for Biotechnology Information for the period 2006-2010. The questionnaire response rate was 13/14 (93%). Twelve out of the 13 countries/regions had experienced at least one outbreak in the relevant five year period. Only two countries (Ethiopia and Kenya) had laboratories at biosecurity level 3 and only three (Ethiopia, Kenya and Sudan) had identified FMD virus serotypes for all reported outbreaks. Based on their own country/region assessment, 12/13 of these countries /regions were below stage 3 of the PCP-FMD. Quarantine (77%) and vaccination (54%) were the major FMD control strategies employed. The majority (12/13) of the NRLs used serological techniques to diagnose FMD, seven used antigen ELISA and three of these (25%) also used molecular techniques which were the tests most frequently requested from collaborating laboratories by the majority (69%) of the NRLs. Only 4/13 (31%) participated in proficiency testing for FMD. Four (31%) laboratories had no quality management systems (QMS) in place and where QMS existed it was still deficient, thus, none of the laboratories had achieved accreditation for FMD diagnosis. This study indicates that FMD diagnostic capacity in Eastern Africa is still inadequate and largely depends on antigen and antibody ELISAs techniques undertaken by the NRLs. Hence, for the region to progress on the PCP-FMD, there is need to: implement regional control

Laboratory capacity for diagnosis of foot-and-mouth disease in Eastern Africa: implications for the progressive control pathway

PubMed Central

2013-01-01

Background Accurate diagnosis is pertinent to any disease control programme. If Eastern Africa is to work towards control of foot-and-mouth disease (FMD) using the Progressive Control Pathway for FMD (PCP-FMD) as a tool, then the capacity of national reference laboratories (NRLs) mandated to diagnose FMD should match this task. This study assessed the laboratory capacity of 14 NRLs of the Eastern Africa Region Laboratory Network member countries using a semi-structured questionnaire and retrospective data from the World Reference Laboratory for FMD annual reports and Genbank® through National Centre for Biotechnology Information for the period 2006–2010. Results The questionnaire response rate was 13/14 (93%). Twelve out of the 13 countries/regions had experienced at least one outbreak in the relevant five year period. Only two countries (Ethiopia and Kenya) had laboratories at biosecurity level 3 and only three (Ethiopia, Kenya and Sudan) had identified FMD virus serotypes for all reported outbreaks. Based on their own country/region assessment, 12/13 of these countries /regions were below stage 3 of the PCP-FMD. Quarantine (77%) and vaccination (54%) were the major FMD control strategies employed. The majority (12/13) of the NRLs used serological techniques to diagnose FMD, seven used antigen ELISA and three of these (25%) also used molecular techniques which were the tests most frequently requested from collaborating laboratories by the majority (69%) of the NRLs. Only 4/13 (31%) participated in proficiency testing for FMD. Four (31%) laboratories had no quality management systems (QMS) in place and where QMS existed it was still deficient, thus, none of the laboratories had achieved accreditation for FMD diagnosis. Conclusions This study indicates that FMD diagnostic capacity in Eastern Africa is still inadequate and largely depends on antigen and antibody ELISAs techniques undertaken by the NRLs. Hence, for the region to progress on the PCP-FMD, there is

Transient analysis for alternating over-current characteristics of HTSC power transmission cable

NASA Astrophysics Data System (ADS)

Lim, S. H.; Hwang, S. D.

2006-10-01

In this paper, the transient analysis for the alternating over-current distribution in case that the over-current was applied for a high-TC superconducting (HTSC) power transmission cable was performed. The transient analysis for the alternating over-current characteristics of HTSC power transmission cable with multi-layer is required to estimate the redistribution of the over-current between its conducting layers and to protect the cable system from the over-current in case that the quench in one or two layers of the HTSC power cable happens. For its transient analysis, the resistance generation of the conducting layers for the alternating over-current was reflected on its equivalent circuit, based on the resistance equation obtained by applying discrete Fourier transform (DFT) for the voltage and the current waveforms of the HTSC tape, which comprises each layer of the HTSC power transmission cable. It was confirmed through the numerical analysis on its equivalent circuit that after the current redistribution from the outermost layer into the inner layers first happened, the fast current redistribution between the inner layers developed as the amplitude of the alternating over-current increased.

Vaccines and companion diagnostic tests for foot-and-mouth disease virus. An overview of the experience in South America.

PubMed

Bergmann, I E; Malirat, V; Neitzert, E; Correa Melo, E

2003-01-01

Vaccination constitutes an important control policy for foot-and-mouth disease (FMD) in affected areas with advanced eradication programmes, as well as in free regions that decide to use immunization as a control measure after a recent introduction of the disease. However, considering that vaccinated animals exposed to FMD virus can establish sub-clinical infection and eventually remain persistently infected, availability of tools to identify sub-clinical infection and its silent transmission within and between herds, regardless of their vaccination state, is of utmost importance. In response to the need for new diagnostic tools to support the eradication campaigns implemented in 1988 in South America, during the past decade we have developed, validated and applied a highly sensitive and specific immuno-enzymatic system for recognition of persistence at a herd level. The system is based on the detection of antibodies against non-capsid proteins required for viral replication. These proteins, in principle, are removed from the viral suspensions destined for production of BEI inactivated vaccines. Within the validation steps, evaluation of potential induction of antibodies to non-capsid proteins caused by traces of these proteins eventually remaining in the vaccines was a major concern. This report presents a review on the experience gathered through the application of the system to various experimental and field immunization conditions. It was concluded that vaccination is not expected to induce antibody responses to non-capsid proteins that could lead to misinterpretation of serological investigations. Progress on the development of approaches towards vaccine certification to guarantee absence of interference will be discussed.

Simultaneous inference of phylogenetic and transmission trees in infectious disease outbreaks

PubMed Central

2017-01-01

Whole-genome sequencing of pathogens from host samples becomes more and more routine during infectious disease outbreaks. These data provide information on possible transmission events which can be used for further epidemiologic analyses, such as identification of risk factors for infectivity and transmission. However, the relationship between transmission events and sequence data is obscured by uncertainty arising from four largely unobserved processes: transmission, case observation, within-host pathogen dynamics and mutation. To properly resolve transmission events, these processes need to be taken into account. Recent years have seen much progress in theory and method development, but existing applications make simplifying assumptions that often break up the dependency between the four processes, or are tailored to specific datasets with matching model assumptions and code. To obtain a method with wider applicability, we have developed a novel approach to reconstruct transmission trees with sequence data. Our approach combines elementary models for transmission, case observation, within-host pathogen dynamics, and mutation, under the assumption that the outbreak is over and all cases have been observed. We use Bayesian inference with MCMC for which we have designed novel proposal steps to efficiently traverse the posterior distribution, taking account of all unobserved processes at once. This allows for efficient sampling of transmission trees from the posterior distribution, and robust estimation of consensus transmission trees. We implemented the proposed method in a new R package phybreak. The method performs well in tests of both new and published simulated data. We apply the model to five datasets on densely sampled infectious disease outbreaks, covering a wide range of epidemiological settings. Using only sampling times and sequences as data, our analyses confirmed the original results or improved on them: the more realistic infection times place more

Simultaneous inference of phylogenetic and transmission trees in infectious disease outbreaks.

PubMed

Klinkenberg, Don; Backer, Jantien A; Didelot, Xavier; Colijn, Caroline; Wallinga, Jacco

2017-05-01

Whole-genome sequencing of pathogens from host samples becomes more and more routine during infectious disease outbreaks. These data provide information on possible transmission events which can be used for further epidemiologic analyses, such as identification of risk factors for infectivity and transmission. However, the relationship between transmission events and sequence data is obscured by uncertainty arising from four largely unobserved processes: transmission, case observation, within-host pathogen dynamics and mutation. To properly resolve transmission events, these processes need to be taken into account. Recent years have seen much progress in theory and method development, but existing applications make simplifying assumptions that often break up the dependency between the four processes, or are tailored to specific datasets with matching model assumptions and code. To obtain a method with wider applicability, we have developed a novel approach to reconstruct transmission trees with sequence data. Our approach combines elementary models for transmission, case observation, within-host pathogen dynamics, and mutation, under the assumption that the outbreak is over and all cases have been observed. We use Bayesian inference with MCMC for which we have designed novel proposal steps to efficiently traverse the posterior distribution, taking account of all unobserved processes at once. This allows for efficient sampling of transmission trees from the posterior distribution, and robust estimation of consensus transmission trees. We implemented the proposed method in a new R package phybreak. The method performs well in tests of both new and published simulated data. We apply the model to five datasets on densely sampled infectious disease outbreaks, covering a wide range of epidemiological settings. Using only sampling times and sequences as data, our analyses confirmed the original results or improved on them: the more realistic infection times place more

Dosage Transmission Disequilibrium Test (dTDT) for Linkage and Association Detection

PubMed Central

Zhang, Zhehao; Wang, Jen-Chyong; Howells, William; Lin, Peng; Agrawal, Arpana; Edenberg, Howard J.; Tischfield, Jay A.; Schuckit, Marc A.; Bierut, Laura J.; Goate, Alison; Rice, John P.

2013-01-01

Both linkage and association studies have been successfully applied to identify disease susceptibility genes with genetic markers such as microsatellites and Single Nucleotide Polymorphisms (SNPs). As one of the traditional family-based studies, the Transmission/Disequilibrium Test (TDT) measures the over-transmission of an allele in a trio from its heterozygous parents to the affected offspring and can be potentially useful to identify genetic determinants for complex disorders. However, there is reduced information when complete trio information is unavailable. In this study, we developed a novel approach to “infer” the transmission of SNPs by combining both the linkage and association data, which uses microsatellite markers from families informative for linkage together with SNP markers from the offspring who are genotyped for both linkage and a Genome-Wide Association Study (GWAS). We generalized the traditional TDT to process these inferred dosage probabilities, which we name as the dosage-TDT (dTDT). For evaluation purpose, we developed a simulation procedure to assess its operating characteristics. We applied the dTDT to the simulated data and documented the power of the dTDT under a number of different realistic scenarios. Finally, we applied our methods to a family study of alcohol dependence (COGA) and performed individual genotyping on complete families for the top signals. One SNP (rs4903712 on chromosome 14) remained significant after correcting for multiple testing Methods developed in this study can be adapted to other platforms and will have widespread applicability in genomic research when case-control GWAS data are collected in families with existing linkage data. PMID:23691058

Flow-mediated dilation: can new approaches provide greater mechanistic insight into vascular dysfunction in preeclampsia and other diseases?

PubMed

Weissgerber, Tracey L

2014-11-01

Endothelial dysfunction is a key feature of preeclampsia and may contribute to increased cardiovascular disease risk years after pregnancy. Flow-mediated dilation (FMD) is a non-invasive endothelial function test that predicts cardiovascular event risk. New protocols allow researchers to measure three components of the FMD response: FMD, low flow-mediated constriction, and shear stimulus. This review encourages researchers to think beyond "low FMD" by examining how these three components may provide additional insights into the mechanisms and location of vascular dysfunction. The review then examines what FMD studies reveal about vascular dysfunction in preeclampsia while highlighting opportunities to gain greater mechanistic insight from new protocols. Studies using traditional protocols show that FMD is low in mid-pregnancy prior to preeclampsia, at diagnosis, and for 3 years post-partum. However, FMD returns to normal by 10 years post-partum. Studies using new protocols are needed to gain more mechanistic insight.

Mapping the Transmission Functions of Single-Molecule Junctions.

PubMed

Capozzi, Brian; Low, Jonathan Z; Xia, Jianlong; Liu, Zhen-Fei; Neaton, Jeffrey B; Campos, Luis M; Venkataraman, Latha

2016-06-08

Charge transport phenomena in single-molecule junctions are often dominated by tunneling, with a transmission function dictating the probability that electrons or holes tunnel through the junction. Here, we present a new and simple technique for measuring the transmission functions of molecular junctions in the coherent tunneling limit, over an energy range of 1.5 eV around the Fermi energy. We create molecular junctions in an ionic environment with electrodes having different exposed areas, which results in the formation of electric double layers of dissimilar density on the two electrodes. This allows us to electrostatically shift the molecular resonance relative to the junction Fermi levels in a manner that depends on the sign of the applied bias, enabling us to map out the junction's transmission function and determine the dominant orbital for charge transport in the molecular junction. We demonstrate this technique using two groups of molecules: one group having molecular resonance energies relatively far from EF and one group having molecular resonance energies within the accessible bias window. Our results compare well with previous electrochemical gating data and with transmission functions computed from first principles. Furthermore, with the second group of molecules, we are able to examine the behavior of a molecular junction as a resonance shifts into the bias window. This work provides a new, experimentally simple route for exploring the fundamentals of charge transport at the nanoscale.

High-performance sub-terahertz transmission imaging system for food inspection

PubMed Central

Ok, Gyeongsik; Park, Kisang; Chun, Hyang Sook; Chang, Hyun-Joo; Lee, Nari; Choi, Sung-Wook

2015-01-01

Unlike X-ray systems, a terahertz imaging system can distinguish low-density materials in a food matrix. For applying this technique to food inspection, imaging resolution and acquisition speed ought to be simultaneously enhanced. Therefore, we have developed the first continuous-wave sub-terahertz transmission imaging system with a polygonal mirror. Using an f-theta lens and a polygonal mirror, beam scanning is performed over a range of 150 mm. For obtaining transmission images, the line-beam is incorporated with sample translation. The imaging system demonstrates that a pattern with 2.83 mm line-width at 210 GHz can be identified with a scanning speed of 80 mm/s. PMID:26137392

Discrimination of bilateral finger photoplethysmogram responses to reactive hyperemia in diabetic and healthy subjects using a differential vascular model framework.

PubMed

Keikhosravi, Adib; Aghajani, Haleh; Zahedi, Edmond

2013-05-01

Endothelial dysfunction assessment has received considerable attention due to its potential in early screening of cardiovascular diseases. Since the seminal work by Celermajer in flow-mediated dilation (FMD) based on B-mode ultrasound measurement of the brachial artery dilation following limb ischemia, many attempts have been made toward applying this method to clinical, non-invasive endothelial dysfunction assessment. One major obstacle toward achieving this objective has been the relative high cost of the required setup and skilled manpower. Such limitations have prompted the investigation of other non-invasively accessible signals such as the photoplethysmogram (PPG) in relation to FMD. It is in the above context that this paper proposes to use a modified version of an existing differential model of the human upper vasculature in order to discriminate between healthy and diabetic subjects. PPG from 46 subjects (23 healthy and 23 diabetic) were utilized to identify the model parameters. Once the model parameters were identified, singular value decomposition was applied to reduce the number of features and increase the separability. Finally, a naive Bayes classifier resulted in an overall accuracy of 93.5% (Spec. 87.0% and Sens. 100%). Taking into account subjects' gender further improved the overall accuracy. It is thought that the application of the proposed method to endothelial dysfunction assessment may positively impact the deployment of FMD in clinical settings.

Experimental infection of giraffe (Giraffa camelopardalis) with SAT-1 and SAT-2 foot-and-mouth disease virus.

PubMed

Vosloo, W; Swanepoel, S P; Bauman, M; Botha, B; Esterhuysen, J J; Boshoff, C I; Keet, D F; Dekker, A

2011-04-01

The potential role of giraffe (Giraffa camelopardalis) in the epidemiology and spread of foot-and-mouth disease (FMD) SAT types was investigated by experimental infection and detection of virus in excretions using virus isolation on primary pig kidney cell cultures. In two experiments separated by a period of 24 months, groups of four animals were needle infected with a SAT-1 or SAT-2 virus, respectively and two in-contact controls were kept with each group. Viraemia was detected 3-9 days post-infection and virus isolated from mouth washes and faeces only occasionally up to day 13. The SAT-1 virus was transmitted to only one in-contact control animal, probably via saliva that contained virus from vesicles in the mouth of a needle-infected animal. None of the animals infected with the SAT-2 virus had any vesicles in the mouth, and there was no evidence of transmission to the in-contact controls. No virus was detected in probang samples for the duration of the experiments (60 days post-infection), indicating that persistent infection probably did not establish with either of these isolates. Giraffe most likely do not play an important role in FMD dissemination. Transmission of infection would possibly occur only during close contact with other animals when mouth vesicles are evident. © 2010 Blackwell Verlag GmbH.

Hybrid digital-analog video transmission in wireless multicast and multiple-input multiple-output system

NASA Astrophysics Data System (ADS)

Liu, Yu; Lin, Xiaocheng; Fan, Nianfei; Zhang, Lin

2016-01-01

Wireless video multicast has become one of the key technologies in wireless applications. But the main challenge of conventional wireless video multicast, i.e., the cliff effect, remains unsolved. To overcome the cliff effect, a hybrid digital-analog (HDA) video transmission framework based on SoftCast, which transmits the digital bitstream with the quantization residuals, is proposed. With an effective power allocation algorithm and appropriate parameter settings, the residual gains can be maximized; meanwhile, the digital bitstream can assure transmission of a basic video to the multicast receiver group. In the multiple-input multiple-output (MIMO) system, since nonuniform noise interference on different antennas can be regarded as the cliff effect problem, ParCast, which is a variation of SoftCast, is also applied to video transmission to solve it. The HDA scheme with corresponding power allocation algorithms is also applied to improve video performance. Simulations show that the proposed HDA scheme can overcome the cliff effect completely with the transmission of residuals. What is more, it outperforms the compared WSVC scheme by more than 2 dB when transmitting under the same bandwidth, and it can further improve performance by nearly 8 dB in MIMO when compared with the ParCast scheme.

Estimation of hepatitis C virus infections resulting from vertical transmission in Egypt.

PubMed

Benova, Lenka; Awad, Susanne F; Miller, F DeWolfe; Abu-Raddad, Laith J

2015-03-01

Despite having the highest hepatitis C virus (HCV) prevalence in the world, the ongoing level of HCV incidence in Egypt and its drivers are poorly understood. Whereas HCV mother-to-child infection is a well-established transmission route, there are no estimates of HCV infections resulting from vertical transmission for any country, including Egypt. The aim of this study was to estimate the absolute number of new HCV infections resulting from vertical transmission in Egypt. We developed a conceptual framework of HCV vertical transmission, expressed in terms of a mathematical model and based on maternal HCV antibody and viremia. The mathematical model estimated the number of HCV vertical infections nationally and for six subnational areas. Applying two vertical transmission risk estimates to the 2008 Egyptian birth cohort, we estimated that between 3,080 and 5,167 HCV infections resulted from vertical transmission among children born in 2008. HCV vertical transmission may account for half of incident cases in the <5-year age group. Disproportionately higher proportions of vertical infections were estimated in Lower Rural and Upper Rural subnational areas. This geographical clustering was a result of higher-area-level HCV prevalence among women and higher fertility rates. Vertical transmission is one of the primary HCV infection routes among children<5 years in Egypt. The absolute number of vertical transmissions and the young age at infection highlight a public health concern. These findings also emphasize the need to quantify the relative contributions of other transmission routes to HCV incidence in Egypt. © 2014 The Authors. Hepatology published by Wiley Periodicals, Inc., on behalf of the American Association for the Study of Liver Diseases.

Cross-layer Energy Optimization Under Image Quality Constraints for Wireless Image Transmissions.

PubMed

Yang, Na; Demirkol, Ilker; Heinzelman, Wendi

2012-01-01

Wireless image transmission is critical in many applications, such as surveillance and environment monitoring. In order to make the best use of the limited energy of the battery-operated cameras, while satisfying the application-level image quality constraints, cross-layer design is critical. In this paper, we develop an image transmission model that allows the application layer (e.g., the user) to specify an image quality constraint, and optimizes the lower layer parameters of transmit power and packet length, to minimize the energy dissipation in image transmission over a given distance. The effectiveness of this approach is evaluated by applying the proposed energy optimization to a reference ZigBee system and a WiFi system, and also by comparing to an energy optimization study that does not consider any image quality constraint. Evaluations show that our scheme outperforms the default settings of the investigated commercial devices and saves a significant amount of energy at middle-to-large transmission distances.

Coupling of an applied field magnetically insulated ion diode to a high power magnetically insulated transmission line system

DOE Office of Scientific and Technical Information (OSTI.GOV)

Maenchen, J.E.

1983-01-01

The coupling of energy from a high power pulsed accelerator through a long triplate magnetically insulated transmission line (MITL) in vacuum to an annular applied magnetic field insulated extraction ion diode is examined. The narrow power transport window and the wave front erosion of the MITL set stringent impedance history conditions on the diode load. A new ion diode design developed to satisfy these criteria with marginal electron insulation is presented. The LION accelerator is used to provide a positive polarity 1.5 MV, 350 kA, 40 ns FWHM pulse with a 30 kA/ns current rate from a triplate MITL source.more » A transition converts the triplate into a cylindrical cross section which flares into the ion diode load. Extensive current and voltage measurements performed along this structure and on the extracted ion beam provide conclusive evidence that the self insulation condition of the MITL is maintained in the transition by current loss alone. The ion diode utilizes a radial magnetic field between a grounded cathode annular emission tip and a disk anode. A 50 cm/sup 2/ dielectric/metal anode area serves as the ion plasma source subject to direct electron bombardment from the opposing cathode tip under marginal magnetic insulation conditions. The ions extracted cross the radial magnetic field and exit the diode volume as an annular cross section beam of peak current about 100 kA. The diode current gradually converts from the initial electron flow to nearly 100% ion current af« less

AUTOMOTIVE DIESEL MAINTENANCE 2. UNIT XXII, MICHIGAN/CLARK TRANSMISSION--CONVERTER/TRANSMISSION.

ERIC Educational Resources Information Center

Minnesota State Dept. of Education, St. Paul. Div. of Vocational and Technical Education.

THIS MODULE OF A 25-MODULE COURSE IS DESIGNED TO DEVELOP A DETAILED UNDERSTANDING OF A SPECIFIC POWER CONVERTER AND TRANSMISSION USED ON DIESEL POWERED EQUIPMENT. TOPICS ARE A CLOSER LOOK AT THE CONVERTER, CONVERTER ASSEMBLY AND INSTALLATION, TRANSMISSION FUNCTION, AND TRANSMISSION SHIFTING. THE MODULE CONSISTS OF A SELF-INSTRUCTIONAL PROGRAMED…

Climate and dengue transmission: evidence and implications.

PubMed

Morin, Cory W; Comrie, Andrew C; Ernst, Kacey

2013-01-01

Climate influences dengue ecology by affecting vector dynamics, agent development, and mosquito/human interactions. Although these relationships are known, the impact climate change will have on transmission is unclear. Climate-driven statistical and process-based models are being used to refine our knowledge of these relationships and predict the effects of projected climate change on dengue fever occurrence, but results have been inconsistent. We sought to identify major climatic influences on dengue virus ecology and to evaluate the ability of climate-based dengue models to describe associations between climate and dengue, simulate outbreaks, and project the impacts of climate change. We reviewed the evidence for direct and indirect relationships between climate and dengue generated from laboratory studies, field studies, and statistical analyses of associations between vectors, dengue fever incidence, and climate conditions. We assessed the potential contribution of climate-driven, process-based dengue models and provide suggestions to improve their performance. Relationships between climate variables and factors that influence dengue transmission are complex. A climate variable may increase dengue transmission potential through one aspect of the system while simultaneously decreasing transmission potential through another. This complexity may at least partly explain inconsistencies in statistical associations between dengue and climate. Process-based models can account for the complex dynamics but often omit important aspects of dengue ecology, notably virus development and host-species interactions. Synthesizing and applying current knowledge of climatic effects on all aspects of dengue virus ecology will help direct future research and enable better projections of climate change effects on dengue incidence.

Applying Mediationist Theory to Communication about Terrorism and War.

ERIC Educational Resources Information Center

Coufal, Kathy L.

2002-01-01

This introductory article to a forum on contemporary issues discusses the importance of communication in the transmission of social values and attitudes and applies mediation theory to the role of parents and teachers in assisting children to understand the images and rhetoric they encounter. (Contains 3 references.) (Author/DB)

A program to calculate pulse transmission responses through transversely isotropic media

NASA Astrophysics Data System (ADS)

Li, Wei; Schmitt, Douglas R.; Zou, Changchun; Chen, Xiwei

2018-05-01

We provide a program (AOTI2D) to model responses of ultrasonic pulse transmission measurements through arbitrarily oriented transversely isotropic rocks. The program is built with the distributed point source method that treats the transducers as a series of point sources. The response of each point source is calculated according to the ray-tracing theory of elastic plane waves. The program could offer basic wave parameters including phase and group velocities, polarization, anisotropic reflection coefficients and directivity patterns, and model the wave fields, static wave beam, and the observed signals for pulse transmission measurements considering the material's elastic stiffnesses and orientations, sample dimensions, and the size and positions of the transmitters and the receivers. The program could be applied to exhibit the ultrasonic beam behaviors in anisotropic media, such as the skew and diffraction of ultrasonic beams, and analyze its effect on pulse transmission measurements. The program would be a useful tool to help design the experimental configuration and interpret the results of ultrasonic pulse transmission measurements through either isotropic or transversely isotropic rock samples.

Sound transmission through a microperforated-panel structure with subdivided air cavities.

PubMed

Toyoda, Masahiro; Takahashi, Daiji

2008-12-01

The absorption characteristics of a microperforated-panel (MPP) absorber have been widely investigated, and MPPs are recognized as a next-generation absorbing material due to their fiber-free nature and attractive appearance. Herein, further possibilities of MPPs are investigated theoretically from a sound transmission viewpoint. Employing an analytical model composed of a typical MPP and a back wall with an infinite extent, transmission loss through the structure is obtained. Although MPP structures generally have great potential for sound absorption, an improvement in the transmission loss at midfrequencies, which is important for architectural sound insulation, is not sufficient when using a backing cavity alone. Hence, to improve transmission loss at midfrequencies, an air-cavity-subdivision technique is applied to MPP structures. By subdividing the air cavity with partitions, each cell can create a local one-dimensional sound field as well as lead to a normal incidence into the apertures, which is the most effective condition for Helmholtz-type resonance absorption. Moreover, by providing the same motion as the back wall to the MPP, the sound-insulation performance can be further improved at midfrequencies.

Magnetically insulated transmission line oscillator

DOEpatents

Bacon, Larry D.; Ballard, William P.; Clark, M. Collins; Marder, Barry M.

1988-01-01

A magnetically insulated transmission line oscillator employs self-generated magnetic fields to generate microwave energy. An anode of the oscillator includes slow-wave structures which are formed of a plurality of thin conductive vanes defining cavities therebetween, and a gap is formed between the anode and a cathode of the oscillator. In response to a pulsed voltage applied to the anode and cathode, self-generated magnetic fields arfe produced in a cross-field orientation with respect to the orientation of the electric field between the anode and the cathode. The cross-field magnetic fields insulate the flow of electrons in the gap and confine the flow of electrons within the gap.

AQUIFER TRANSMISSIVITY

EPA Science Inventory

Evaluation of groundwater resources requires the knowledge of the capacity of aquifers to store and transmit ground water. This requires estimates of key hydraulic parameters, such as the transmissivity, among others. The transmissivity T (m²/sec) is a hydrauli...

The economic impacts of foot and mouth disease - what are they, how big are they and where do they occur?

PubMed

Knight-Jones, T J D; Rushton, J

2013-11-01

Although a disease of low mortality, the global impact of foot and mouth disease (FMD) is colossal due to the huge numbers of animals affected. This impact can be separated into two components: (1) direct losses due to reduced production and changes in herd structure; and (2) indirect losses caused by costs of FMD control, poor access to markets and limited use of improved production technologies. This paper estimates that annual impact of FMD in terms of visible production losses and vaccination in endemic regions alone amount to between US$6.5 and 21 billion. In addition, outbreaks in FMD free countries and zones cause losses of >US$1.5 billion a year. FMD impacts are not the same throughout the world: FMD is highly contagious and the actions of one farmer affect the risk of FMD occurring on other holdings; thus sizeable externalities are generated. Control therefore requires coordination within and between countries. These externalities imply that FMD control produces a significant amount of public goods, justifying the need for national and international public investment. Equipping poor countries with the tools needed to control FMD will involve the long term development of state veterinary services that in turn will deliver wider benefits to a nation including the control of other livestock diseases. Copyright © 2013 Elsevier B.V. All rights reserved.

Multi-band transmission color filters for multi-color white LEDs based visible light communication

NASA Astrophysics Data System (ADS)

Wang, Qixia; Zhu, Zhendong; Gu, Huarong; Chen, Mengzhu; Tan, Qiaofeng

2017-11-01

Light-emitting diodes (LEDs) based visible light communication (VLC) can provide license-free bands, high data rates, and high security levels, which is a promising technique that will be extensively applied in future. Multi-band transmission color filters with enough peak transmittance and suitable bandwidth play a pivotal role for boosting signal-noise-ratio in VLC systems. In this paper, multi-band transmission color filters with bandwidth of dozens nanometers are designed by a simple analytical method. Experiment results of one-dimensional (1D) and two-dimensional (2D) tri-band color filters demonstrate the effectiveness of the multi-band transmission color filters and the corresponding analytical method.

Research on Condition Assessment Method of Transmission Tower Under the Action of Strong Wind

NASA Astrophysics Data System (ADS)

Huang, Ren-mou; An, Li-qiang; Zhang, Rong-lun; Wu, Jiong; Liang, Ya-feng

2018-03-01

Transmission towers are often subjected to the external damage of severe weather like strong wind and so on, which may cause the collapse due to the yield and fracture of the tower material. Aiming this issue, an assessment method was proposed in this paper to assess the operation condition of transmission towers under strong wind. With a reasonable assess index system established firstly, then the internal force of the tower material was solved and its stability was determined through the mechanical analysis of the transmission tower finite element model. Meanwhile, the condition risk level of the tower was finally determined by considering the difference among the influences of other factors like corrosion and loose of members, slope on the transmission tower through the analytic hierarchy process. The assessment method was applied to assess the wind-induced collapse of towers in 110kV Bao Yi II line in Wenchang City, Hainan Province, of which the result proves the method can assess the condition of transmission tower under strong wind and of guiding significance for improving the windproof capability of transmission towers.

Renal hemodynamics and renin-angiotensin system activity in humans with multifocal renal artery fibromuscular dysplasia.

PubMed

van Twist, Daan J L; Houben, Alphons J H M; de Haan, Michiel W; de Leeuw, Peter W; Kroon, Abraham A

2016-06-01

Fibromuscular dysplasia (FMD) is the second most common cause of renovascular hypertension. Nonetheless, knowledge on the renal microvasculature and renin-angiotensin system (RAS) activity in kidneys with FMD is scarce. Given the fairly good results of revascularization, we hypothesized that the renal microvasculature and RAS are relatively spared in kidneys with FMD. In 58 hypertensive patients with multifocal renal artery FMD (off medication) and 116 matched controls with essential hypertension, we measured renal blood flow (Xenon washout method) per kidney and drew blood samples from the aorta and both renal veins to determine renin secretion and glomerular filtration rate per kidney. We found that renal blood flow and glomerular filtration rate in FMD were comparable to those in controls. Although systemic renin levels were somewhat higher in FMD, renal renin secretion was not elevated. Moreover, in patients with unilateral FMD, no differences between the affected and unaffected kidney were observed with regard to renal blood flow, glomerular filtration rate, or renin secretion. In men, renin levels and renin secretion were higher as compared with women. The renal blood flow response to RAS modulation (by intrarenal infusion of angiotensin II, angiotensin-(1-7), an angiotensin II type 1 receptor blocker, or a nitric oxide synthase blocker) was also comparable between FMD and controls. Renal blood flow, glomerular filtration, and the response to vasoactive substances in kidneys with multifocal FMD are comparable to patients with essential hypertension, suggesting that microvascular function is relatively spared. Renin secretion was not increased and the response to RAS modulation was not affected in kidneys with FMD.

The impact of tetrahydrobiopterin administration on endothelial function before and after smoking cessation in chronic smokers.

PubMed

Taylor, Beth A; Zaleski, Amanda L; Dornelas, Ellen A; Thompson, Paul D

2016-03-01

Cardiovascular disease mortality is reduced following smoking cessation but the reversibility of specific atherogenic risk factors such as endothelial dysfunction is less established. We assessed brachial artery flow-mediated dilation (FMD) in 57 chronic smokers and 15 healthy controls, alone and after oral tetrahydrobiopterin (BH4) administration, to assess the extent to which reduced bioactivity of BH4, a cofactor for the endothelial nitric oxide synthase enzyme (eNOS), contributes to smoking-associated reductions in FMD. Thirty-four smokers then ceased cigarette and nicotine use for 1 week, after which FMD (±BH4 administration) was repeated. Brachial artery FMD was calculated as the peak dilatory response observed relative to baseline (%FMD). Endothelium-independent dilation was assessed by measuring the dilatory response to sublingual nitroglycerin (%NTG). Chronic smokers exhibited reduced %FMD relative to controls: (5.6±3.0% vs. 8.1±3.7%; P<0.01) and %NTG was not different between groups (P=0.22). BH4 administration improved FMD in both groups (P=0.03) independent of smoking status (P=0.78) such that FMD was still lower in smokers relative to controls (6.6±3.3% vs. 9.8±3.2%; P<0.01). With smoking cessation, FMD increased significantly (from 5.0±2.9 to 7.8±3.2%;P<0.01); %NTG was not different (P=0.57) and BH4 administration did not further improve FMD (P=0.33). These findings suggest that the blunted FMD observed in chronic smokers, likely due at least in part to reduced BH4 bioactivity and eNOS uncoupling, can be restored with smoking cessation. Post-cessation BH4 administration does not further improve endothelial function in chronic smokers, unlike the effect observed in nonsmokers, indicating a longer-term impact of chronic smoking on vascular function that is not acutely reversible.

Comparison of full-mouth disinfection and quadrant-wise scaling in the treatment of adult chronic periodontitis: a systematic review and meta-analysis.

PubMed

Fang, H; Han, M; Li, Q-L; Cao, C Y; Xia, R; Zhang, Z-H

2016-08-01

Scaling and root planing are widely considered as effective methods for treating chronic periodontitis. A meta-analysis published in 2008 showed no statistically significant differences between full-mouth disinfection (FMD) or full-mouth scaling and root planing (FMS) and quadrant scaling and root planing (Q-SRP). The FMD approach only resulted in modest additional improvements in several indices. Whether differences exist between these two approaches requires further validation. Accordingly, a study was conducted to further validate whether FMD with antiseptics or FMS without the use of antiseptics within 24 h provides greater clinical improvement than Q-SRP in patients with chronic periodontitis. Medline (via OVID), EMBASE (via OVID), PubMed and CENTRAL databases were searched up to 27 January 2015. Randomized controlled trials comparing FMD or FMS with Q-SRP after at least 3 mo were included. Meta-analysis was performed to obtain the weighted mean difference (WMD), together with the corresponding 95% confidence intervals. Thirteen articles were included in the meta-analysis. The WMD of probing pocket depth reduction was 0.25 mm (p < 0.05) for FMD vs. Q-SRP in single-rooted teeth with moderate pockets, and clinical attachment level gain in single- and multirooted teeth with moderate pockets was 0.33 mm (p < 0.05) for FMD vs. Q-SRP. Except for those, no statistically significant differences were found in the other subanalyses of FMD vs. Q-SRP, FMS vs. Q-SRP and FMD vs. FMS. Therefore, the meta-analysis results showed that FMD was better than Q-SRP for achieving probing pocket depth reduction and clinical attachment level gain in moderate pockets. Additionally, regardless of the treatment, no serious complications were observed. FMD, FMS and Q-SRP are all effective for the treatment of adult chronic periodontitis, and they do not lead to any obvious discomfort among patients. Moreover, FMD had modest additional clinical benefits over Q-SRP, so we prefer to

Bayesian estimation of the transmissivity spatial structure from pumping test data

NASA Astrophysics Data System (ADS)

Demir, Mehmet Taner; Copty, Nadim K.; Trinchero, Paolo; Sanchez-Vila, Xavier

2017-06-01

Estimating the statistical parameters (mean, variance, and integral scale) that define the spatial structure of the transmissivity or hydraulic conductivity fields is a fundamental step for the accurate prediction of subsurface flow and contaminant transport. In practice, the determination of the spatial structure is a challenge because of spatial heterogeneity and data scarcity. In this paper, we describe a novel approach that uses time drawdown data from multiple pumping tests to determine the transmissivity statistical spatial structure. The method builds on the pumping test interpretation procedure of Copty et al. (2011) (Continuous Derivation method, CD), which uses the time-drawdown data and its time derivative to estimate apparent transmissivity values as a function of radial distance from the pumping well. A Bayesian approach is then used to infer the statistical parameters of the transmissivity field by combining prior information about the parameters and the likelihood function expressed in terms of radially-dependent apparent transmissivities determined from pumping tests. A major advantage of the proposed Bayesian approach is that the likelihood function is readily determined from randomly generated multiple realizations of the transmissivity field, without the need to solve the groundwater flow equation. Applying the method to synthetically-generated pumping test data, we demonstrate that, through a relatively simple procedure, information on the spatial structure of the transmissivity may be inferred from pumping tests data. It is also shown that the prior parameter distribution has a significant influence on the estimation procedure, given the non-uniqueness of the estimation procedure. Results also indicate that the reliability of the estimated transmissivity statistical parameters increases with the number of available pumping tests.

Reflection and transmission of light at periodic layered metamaterial films

NASA Astrophysics Data System (ADS)

Paul, Thomas; Menzel, Christoph; Śmigaj, Wojciech; Rockstuhl, Carsten; Lalanne, Philippe; Lederer, Falk

2011-09-01

The appropriate description of light scattering (transmission/reflection) at a bulky artificial medium, consisting of a sequence of functional metamaterial and natural material films, represents a major challenge in current theoretical nano-optics. Because in many relevant cases, in particular, in the optical domain, a metamaterial must not be described by an effective permittivity and permeability the usual Fresnel formalism cannot be applied. A reliable alternative consists in using a Bloch mode formalism known, e.g., from the theory of photonic crystals. It permits to split this complex issue into two more elementary ones, namely the study of light propagation in an infinitely extended metamaterial and the analysis of light scattering at interfaces between adjacent meta and natural materials. The first problem is routinely solved by calculating the relevant Bloch modes and their dispersion relations. The second task is more involved and represents the subject of the present study. It consists in using the general Bloch mode orthogonality to derive rigorous expressions for the reflection and transmission coefficients at an interface between two three-dimensional absorptive periodic media for arbitrary incidence. A considerable simplification can be achieved if only the fundamental Bloch modes of both media govern the scattering properties at the interface. If this approximation is valid, which depends on the longitudinal metamaterial period, the periodic metamaterial may be termed homogeneous. Only in this case the disentanglement of the fundamental modes of both media can be performed and the reflection/transmission coefficients can be expressed in terms of two impedances, each depending solely on the properties of the fundamental mode of the respective medium. In order to complement the picture, we apply the present formalism to the quite general problem of reflection/transmission at a metamaterial film sandwiched between a dissimilar metamaterial. This

Does Risk Aversion Affect Transmission and Generation Planning? A Western North America Case Study

DOE Office of Scientific and Technical Information (OSTI.GOV)

Munoz, Francisco; van der Weijde, Adriaan Hendrik; Hobbs, Benjamin F.

Here, we investigate the effects of risk aversion on optimal transmission and generation expansion planning in a competitive and complete market. To do so, we formulate a stochastic model that minimizes a weighted average of expected transmission and generation costs and their conditional value at risk (CVaR). We also show that the solution of this optimization problem is equivalent to the solution of a perfectly competitive risk-averse Stackelberg equilibrium, in which a risk-averse transmission planner maximizes welfare after which risk-averse generators maximize profits. Furthermore, this model is then applied to a 240-bus representation of the Western Electricity Coordinating Council, inmore » which we examine the impact of risk aversion on levels and spatial patterns of generation and transmission investment. Although the impact of risk aversion remains small at an aggregate level, state-level impacts on generation and transmission investment can be significant, which emphasizes the importance of explicit consideration of risk aversion in planning models.« less

Does Risk Aversion Affect Transmission and Generation Planning? A Western North America Case Study

DOE PAGES

Munoz, Francisco; van der Weijde, Adriaan Hendrik; Hobbs, Benjamin F.; ...

2017-04-07

Here, we investigate the effects of risk aversion on optimal transmission and generation expansion planning in a competitive and complete market. To do so, we formulate a stochastic model that minimizes a weighted average of expected transmission and generation costs and their conditional value at risk (CVaR). We also show that the solution of this optimization problem is equivalent to the solution of a perfectly competitive risk-averse Stackelberg equilibrium, in which a risk-averse transmission planner maximizes welfare after which risk-averse generators maximize profits. Furthermore, this model is then applied to a 240-bus representation of the Western Electricity Coordinating Council, inmore » which we examine the impact of risk aversion on levels and spatial patterns of generation and transmission investment. Although the impact of risk aversion remains small at an aggregate level, state-level impacts on generation and transmission investment can be significant, which emphasizes the importance of explicit consideration of risk aversion in planning models.« less

Surface thermodynamics and adhesion forces governing bacterial transmission in contact lens related microbial keratitis.

PubMed

Qu, Wenwen; Busscher, Henk J; Hooymans, Johanna M M; van der Mei, Henny C

2011-06-15

Contact lens induced microbial keratitis results from bacterial transmission from one surface to another. We investigated the adhesion forces of Pseudomonas aeruginosa, Staphylococci and Serratia to different contact lenses, lens cases and corneal surfaces using AFM, and applied a Weibull analysis on these adhesion forces to calculate bacterial transmission probabilities from lens case to corneas with a contact lens as an intermediate. Also a new surface thermodynamic parameter was introduced, the interfacial free energy of transmission, which in essence compares the interfacial free energies of bacterial adhesion, calculated from measured contact angles with liquids on the donating and receiving surfaces in the transmission process. Bacterial adhesion forces were generally strongest among all eight strains for the lens case (-6.5 to -12.0 nN) and corneas (-3.5 to -11.5 nN), while contact lenses (-0.6 to -13.1 nN) exerted slightly smaller adhesion forces. Consequently, bacterial transmission from lens case to contact lens yielded a smaller contribution in the final transmission than from contact lens to cornea. Bacterial transmission probabilities as derived from force analyses were higher when the interfacial free energies of transmission were more negative, which is in line with surface thermodynamic principles. Therewith this parameter could provide useful in analyzing other bacterial transmission phenomena between donating and receiving surfaces as well. Copyright © 2011 Elsevier Inc. All rights reserved.

Identifying multidrug resistant tuberculosis transmission hotspots using routinely collected data12

PubMed Central

Manjourides, Justin; Lin, Hsien-Ho; Shin, Sonya; Jeffery, Caroline; Contreras, Carmen; Cruz, Janeth Santa; Jave, Oswaldo; Yagui, Martin; Asencios, Luis; Pagano, Marcello; Cohen, Ted

2012-01-01

SUMMARY In most countries with large drug resistant tuberculosis epidemics, only those cases that are at highest risk of having MDRTB receive a drug sensitivity test (DST) at the time of diagnosis. Because of this prioritized testing, identification of MDRTB transmission hotspots in communities where TB cases do not receive DST is challenging, as any observed aggregation of MDRTB may reflect systematic differences in how testing is distributed in communities. We introduce a new disease mapping method, which estimates this missing information through probability–weighted locations, to identify geographic areas of increased risk of MDRTB transmission. We apply this method to routinely collected data from two districts in Lima, Peru over three consecutive years. This method identifies an area in the eastern part of Lima where previously untreated cases have increased risk of MDRTB. This may indicate an area of increased transmission of drug resistant disease, a finding that may otherwise have been missed by routine analysis of programmatic data. The risk of MDR among retreatment cases is also highest in these probable transmission hotspots, though a high level of MDR among retreatment cases is present throughout the study area. Identifying potential multidrug resistant tuberculosis (MDRTB) transmission hotspots may allow for targeted investigation and deployment of resources. PMID:22401962

Emerging Infectious Diseases and Blood Safety: Modeling the Transfusion-Transmission Risk.

PubMed

Kiely, Philip; Gambhir, Manoj; Cheng, Allen C; McQuilten, Zoe K; Seed, Clive R; Wood, Erica M

2017-07-01

While the transfusion-transmission (TT) risk associated with the major transfusion-relevant viruses such as HIV is now very low, during the last 20 years there has been a growing awareness of the threat to blood safety from emerging infectious diseases, a number of which are known to be, or are potentially, transfusion transmissible. Two published models for estimating the transfusion-transmission risk from EIDs, referred to as the Biggerstaff-Petersen model and the European Upfront Risk Assessment Tool (EUFRAT), respectively, have been applied to several EIDs in outbreak situations. We describe and compare the methodological principles of both models, highlighting their similarities and differences. We also discuss the appropriateness of comparing results from the two models. Quantitating the TT risk of EIDs can inform decisions about risk mitigation strategies and their cost-effectiveness. Finally, we present a qualitative risk assessment for Zika virus (ZIKV), an EID agent that has caused several outbreaks since 2007. In the latest and largest ever outbreak, several probable cases of transfusion-transmission ZIKV have been reported, indicating that it is transfusion-transmissible and therefore a risk to blood safety. We discuss why quantitative modeling the TT risk of ZIKV is currently problematic. Crown Copyright © 2017. Published by Elsevier Inc. All rights reserved.

Study of Corrosion Resistance Improvement by Metallic Coating for Overhead Transmission Line Conductor

NASA Astrophysics Data System (ADS)

Isozaki, Masanori; Adachi, Kouichi; Hita, Takanori; Asano, Yuji

Applying anti-corrosion grease and aluminum clad steel (AC) wires to ACSR has adopted as general methods to prevent overhead transmission line conductors and/or wires from corrosion. However, there are some cases that ineffectiveness of those means are reported on some transmission lines passing through acid atmosphere in the vicinity of a factory exhausting acid smoke. The feature of the corrosion caused by acid atmosphere is to show a higher speed in its progressing as well known. As means against such acid corrosion, application of high purity aluminum, selective removal of inter-metallic compound in aluminum and plastic coating wires has been reported before, and each has both of advantage and disadvantage actually. In the former letter, we reported the new type of anti-corrosion grease that shows an excellent property against acid atmosphere as well as in a salty circumstance. Here presents a new type of anti-corrosion technology of applying high corrosion resistance aluminum alloy or zinc coatings on each component wires of a conductor that we succeed in developing through a serial study of anti-corrosion methods on overhead transmission lines.

Finite-difference interblock transmissivity for unconfined aquifers and for aquifers having smoothly varying transmissivity

USGS Publications Warehouse

Goode, D.J.; Appel, C.A.

1992-01-01

More accurate alternatives to the widely used harmonic mean interblock transmissivity are proposed for block-centered finite-difference models of ground-water flow in unconfined aquifers and in aquifers having smoothly varying transmissivity. The harmonic mean is the exact interblock transmissivity for steady-state one-dimensional flow with no recharge if the transmissivity is assumed to be spatially uniform over each finite-difference block, changing abruptly at the block interface. However, the harmonic mean may be inferior to other means if transmissivity varies in a continuous or smooth manner between nodes. Alternative interblock transmissivity functions are analytically derived for the case of steady-state one-dimensional flow with no recharge. The second author has previously derived the exact interblock transmissivity, the logarithmic mean, for one-dimensional flow when transmissivity is a linear function of distance in the direction of flow. We show that the logarithmic mean transmissivity is also exact for uniform flow parallel to the direction of changing transmissivity in a two- or three-dimensional model, regardless of grid orientation relative to the flow vector. For the case of horizontal flow in a homogeneous unconfined or water-table aquifer with a horizontal bottom and with areally distributed recharge, the exact interblock transmissivity is the unweighted arithmetic mean of transmissivity at the nodes. This mean also exhibits no grid-orientation effect for unidirectional flow in a two-dimensional model. For horizontal flow in an unconfined aquifer with no recharge where hydraulic conductivity is a linear function of distance in the direction of flow the exact interblock transmissivity is the product of the arithmetic mean saturated thickness and the logarithmic mean hydraulic conductivity. For several hypothetical two- and three-dimensional cases with smoothly varying transmissivity or hydraulic conductivity, the harmonic mean is shown to yield

Elimination of foot-and-mouth disease in South America: lessons and challenges.

PubMed

Naranjo, José; Cosivi, Ottorino

2013-08-05

Foot-and-mouth disease (FMD) is a highly transmissible and economically devastating disease of cloven-hoofed livestock. Although vaccines are available and have been instrumental in eliminating the disease from most of the South American animal population, viral circulation still persists in some countries and areas, posing a threat to the advances of the last 60 years by the official veterinary services with considerable support of the livestock sectors. The importance of the disease for the social and economic development of the American continent led to the establishment in 1951 of the Pan American Centre for Foot-and-Mouth Disease (PANAFTOSA), which has been providing technical cooperation to countries for the elimination of the disease. The first FMD national elimination programmes were established in South America around the 1960s and 1970s. To advance the regional elimination efforts in the 1980s, countries agreed on a Plan of Action 1988-2009 of the Hemispheric Program for the Eradication of Foot-and-Mouth Disease. The Plan of Action 1988-2009 did not reach the goal of elimination from the continent; and a new Plan of Action 2011-2020 was developed in 2010 based on the experience acquired by the countries and PANAFTOSA during the past 60 years. This plan is now being implemented; several challenges are still to be overcome to ensure the elimination of FMD from the Americas by 2020, however, the goal is achievable.

Elimination of foot-and-mouth disease in South America: lessons and challenges

PubMed Central

Naranjo, José; Cosivi, Ottorino

2013-01-01

Foot-and-mouth disease (FMD) is a highly transmissible and economically devastating disease of cloven-hoofed livestock. Although vaccines are available and have been instrumental in eliminating the disease from most of the South American animal population, viral circulation still persists in some countries and areas, posing a threat to the advances of the last 60 years by the official veterinary services with considerable support of the livestock sectors. The importance of the disease for the social and economic development of the American continent led to the establishment in 1951 of the Pan American Centre for Foot-and-Mouth Disease (PANAFTOSA), which has been providing technical cooperation to countries for the elimination of the disease. The first FMD national elimination programmes were established in South America around the 1960s and 1970s. To advance the regional elimination efforts in the 1980s, countries agreed on a Plan of Action 1988–2009 of the Hemispheric Program for the Eradication of Foot-and-Mouth Disease. The Plan of Action 1988–2009 did not reach the goal of elimination from the continent; and a new Plan of Action 2011–2020 was developed in 2010 based on the experience acquired by the countries and PANAFTOSA during the past 60 years. This plan is now being implemented; several challenges are still to be overcome to ensure the elimination of FMD from the Americas by 2020, however, the goal is achievable. PMID:23798699

Mapping the Transmission Functions of Single-Molecule Junctions

DOE PAGES

Capozzi, Brian; Low, Jonathan Z.; Xia, Jianlong; ...

2016-06-08

Charge transport characteristics of single-molecule junctions are often governed by a transmission function that dictates the probability of electrons or holes tunneling across the junction. Here, we present a new and simple technique for measuring the transmission function of molecular junctions in the coherent tunneling limit, over an energy range of 2 eV around the Fermi energy. We create molecular junctions in an ionic environment with electrodes having different areas exposed, which results in the formation of electric double layers of dissimilar density on the two electrodes. This allows us to electrostatically shift the molecular resonance relative to the junctionmore » Fermi levels in a manner that depends on the sign of the applied bias, enabling us to map out the junction’s transmission function and determine the dominant orbital for charge transport in the molecular junction. We demonstrate this technique using two groups of molecules: one group having molecular resonance energies relatively far from EF and one group having molecular resonance energies within the accessible bias window. Our results compare well with previous electrochemical gating data and with transmission functions computed ab initio. Furthermore, with the second group of molecules, we are able to examine the behavior of a molecular junction as a resonance shifts into the bias window. This work provides a new, experimentally simple route for exploring the fundamentals of charge transport at the nanoscale.« less

Mapping the Transmission Functions of Single-Molecule Junctions

DOE Office of Scientific and Technical Information (OSTI.GOV)

Capozzi, Brian; Low, Jonathan Z.; Xia, Jianlong

Charge transport characteristics of single-molecule junctions are often governed by a transmission function that dictates the probability of electrons or holes tunneling across the junction. Here, we present a new and simple technique for measuring the transmission function of molecular junctions in the coherent tunneling limit, over an energy range of 2 eV around the Fermi energy. We create molecular junctions in an ionic environment with electrodes having different areas exposed, which results in the formation of electric double layers of dissimilar density on the two electrodes. This allows us to electrostatically shift the molecular resonance relative to the junctionmore » Fermi levels in a manner that depends on the sign of the applied bias, enabling us to map out the junction’s transmission function and determine the dominant orbital for charge transport in the molecular junction. We demonstrate this technique using two groups of molecules: one group having molecular resonance energies relatively far from EF and one group having molecular resonance energies within the accessible bias window. Our results compare well with previous electrochemical gating data and with transmission functions computed ab initio. Furthermore, with the second group of molecules, we are able to examine the behavior of a molecular junction as a resonance shifts into the bias window. This work provides a new, experimentally simple route for exploring the fundamentals of charge transport at the nanoscale.« less

Pellicle transmission uniformity requirements

NASA Astrophysics Data System (ADS)

Brown, Thomas L.; Ito, Kunihiro

1998-12-01

Controlling critical dimensions of devices is a constant battle for the photolithography engineer. Current DUV lithographic process exposure latitude is typically 12 to 15% of the total dose. A third of this exposure latitude budget may be used up by a variable related to masking that has not previously received much attention. The emphasis on pellicle transmission has been focused on increasing the average transmission. Much less, attention has been paid to transmission uniformity. This paper explores the total demand on the photospeed latitude budget, the causes of pellicle transmission nonuniformity and examines reasonable expectations for pellicle performance. Modeling is used to examine how the two primary errors in pellicle manufacturing contribute to nonuniformity in transmission. World-class pellicle transmission uniformity standards are discussed and a comparison made between specifications of other components in the photolithographic process. Specifications for other materials or parameters are used as benchmarks to develop a proposed industry standard for pellicle transmission uniformity.

Reanalysis of the start of the UK 1967 to 1968 foot-and-mouth disease epidemic to calculate airborne transmission probabilities.

PubMed

Sanson, R L; Gloster, J; Burgin, L

2011-09-24

The aims of this study were to statistically reassess the likelihood that windborne spread of foot-and-mouth disease (FMD) virus (FMDV) occurred at the start of the UK 1967 to 1968 FMD epidemic at Oswestry, Shropshire, and to derive dose-response probability of infection curves for farms exposed to airborne FMDV. To enable this, data on all farms present in 1967 in the parishes near Oswestry were assembled. Cases were infected premises whose date of appearance of first clinical signs was within 14 days of the depopulation of the index farm. Logistic regression was used to evaluate the association between infection status and distance and direction from the index farm. The UK Met Office's NAME atmospheric dispersion model (ADM) was used to generate plumes for each day that FMDV was excreted from the index farm based on actual historical weather records from October 1967. Daily airborne FMDV exposure rates for all farms in the study area were calculated using a geographical information system. Probit analyses were used to calculate dose-response probability of infection curves to FMDV, using relative exposure rates on case and control farms. Both the logistic regression and probit analyses gave strong statistical support to the hypothesis that airborne spread occurred. There was some evidence that incubation period was inversely proportional to the exposure rate.

A wireless power transmission system for an active capsule endoscope for colon inspection.

PubMed

Jia, Zhiwei; Yan, Guozheng; Shi, Yu; Zhu, Bingquan

2012-07-01

Multipurpose active capsule endoscopes (ACE) have drawn considerable attention in recent years, but these devices continue to suffer from energy limitations. In order to deliver stable and sufficient energy safely, a wireless power transmission system based on inductive coupling is presented. The system consists of a double-layer solenoid pair primary coil outside and a multiple secondary coils inside the body. At least 500 mW usable power can be transmitted under the worst geometrical conditions and the safety restraints in a volume of Φ13 × 13 mm. The wireless power transmission system is integrated to an ACE and applied in animal experiments. The designed wireless power transmission is proved to be feasible and potentially safe in a future application.

Estimation of the transmissivity of thin leaky-confined aquifers from single-well pumping tests

NASA Astrophysics Data System (ADS)

Worthington, Paul F.

1981-01-01

Data from the quasi-equilibrium phases of a step-drawdown test are used to evaluate the coefficient of non-linear head losses subject to the assumption of a constant effective well radius. After applying a well-loss correction to the observed drawdowns of the first step, an approximation method is used to estimate a pseudo-transmissivity of the aquifer from a single value of time-variant drawdown. The pseudo-transmissivities computed for each of a sequence of values of time pass through a minimum when there is least manifestation of casing-storage and leakage effects, phenomena to which pumping-test data of this kind are particularly susceptible. This minimum pseudo-transmissivity, adjusted for partial penetration effects where appropriate, constitutes the best possible estimate of aquifer transmissivity. The ease of application of the overall procedure is illustrated by a practical example.

Contributions from the silent majority dominate dengue virus transmission

PubMed Central

Duong, Veasna; Althouse, Benjamin M.; Lloyd, Alun L.; Waller, Lance A.; Morrison, Amy C.; Kitron, Uriel

2018-01-01

Despite estimates that, each year, as many as 300 million dengue virus (DENV) infections result in either no perceptible symptoms (asymptomatic) or symptoms that are sufficiently mild to go undetected by surveillance systems (inapparent), it has been assumed that these infections contribute little to onward transmission. However, recent blood-feeding experiments with Aedes aegypti mosquitoes showed that people with asymptomatic and pre-symptomatic DENV infections are capable of infecting mosquitoes. To place those findings into context, we used models of within-host viral dynamics and human demographic projections to (1) quantify the net infectiousness of individuals across the spectrum of DENV infection severity and (2) estimate the fraction of transmission attributable to people with different severities of disease. Our results indicate that net infectiousness of people with asymptomatic infections is 80% (median) that of people with apparent or inapparent symptomatic infections (95% credible interval (CI): 0–146%). Due to their numerical prominence in the infectious reservoir, clinically inapparent infections in total could account for 84% (CI: 82–86%) of DENV transmission. Of infections that ultimately result in any level of symptoms, we estimate that 24% (95% CI: 0–79%) of onward transmission results from mosquitoes biting individuals during the pre-symptomatic phase of their infection. Only 1% (95% CI: 0.8–1.1%) of DENV transmission is attributable to people with clinically detected infections after they have developed symptoms. These findings emphasize the need to (1) reorient current practices for outbreak response to adoption of pre-emptive strategies that account for contributions of undetected infections and (2) apply methodologies that account for undetected infections in surveillance programs, when assessing intervention impact, and when modeling mosquito-borne virus transmission. PMID:29723307

Overview of foot-and-mouth disease awareness among farmers and veterinarians in France.

PubMed

Raut, Noémie; Rivière, Julie; Hosteing, Soline; Collin, Eric; Philizot, Stéphanie; Debaere, Olivier; Zanella, Gina

2018-06-15

Foot-and-mouth disease (FMD) is of major concern in most countries including Europe, where no outbreaks have occurred since a decade. Indeed, the risk of FMD introduction from infected countries is not negligible and the awareness of field stakeholders (farmers, veterinarians) is essential to ensure an effective detection of the viral circulation. The French veterinary services launched in 2015 a survey to estimate the awareness of farmers and veterinarians and their knowledge about epidemiological and regulatory aspects of FMD. Official health visits were used to collect information from cattle farmers and veterinarians through two separate questionnaires. The results show that not all cattle farmers were aware of the risk of FMD reintroduction in France and of its routes of infection and speed of dissemination. As for the veterinarians, their promptness to report a suspicion was dependent on the occurrence of FMD cases in European countries. These results highlight key aspectsregarding FMD epidemiology which should be regularly reminded to the field stakeholders in FMD-free countries to increase their awareness and thus ensure an effective early detection in case of FMD introduction. © British Veterinary Association (unless otherwise stated in the text of the article) 2018. All rights reserved. No commercial use is permitted unless otherwise expressly granted.

Recovery of viral RNA and infectious foot-and-mouth disease virus from positive lateral-flow devices.

PubMed

Fowler, Veronica L; Bankowski, Bartlomiej M; Armson, Bryony; Di Nardo, Antonello; Valdazo-Gonzalez, Begoña; Reid, Scott M; Barnett, Paul V; Wadsworth, Jemma; Ferris, Nigel P; Mioulet, Valérie; King, Donald P

2014-01-01

Foot-and-mouth disease Virus (FMDV) is an economically important, highly contagious picornavirus that affects both wild and domesticated cloven hooved animals. In developing countries, the effective laboratory diagnosis of foot-and-mouth disease (FMD) is often hindered by inadequate sample preservation due to difficulties in the transportation and storage of clinical material. These factors can compromise the ability to detect and characterise FMD virus in countries where the disease is endemic. Furthermore, the high cost of sending infectious virus material and the biosecurity risk it presents emphasises the need for a thermo-stable, non-infectious mode of transporting diagnostic samples. This paper investigates the potential of using FMDV lateral-flow devices (LFDs) for dry transportation of clinical samples for subsequent nucleic acid amplification, sequencing and recovery of infectious virus by electroporation. FMDV positive samples (epithelial suspensions and cell culture isolates) representing four FMDV serotypes were applied to antigen LFDs: after which it was possible to recover viral RNA that could be detected using real-time RT-PCR. Using this nucleic acid, it was also possible to recover VP1 sequences and also successfully utilise protocols for amplification of complete FMD virus genomes. It was not possible to recover infectious FMDV directly from the LFDs, however following electroporation into BHK-21 cells and subsequent cell passage, infectious virus could be recovered. Therefore, these results support the use of the antigen LFD for the dry, non-hazardous transportation of samples from FMD endemic countries to international reference laboratories.

Downhole transmission system

DOEpatents

Hall, David R [Provo, UT; Fox, Joe [Spanish Fork, UT

2008-01-15

A transmission system in a downhole component comprises a data transmission element in both ends of the downhole component. Each data transmission element houses an electrically conducting coil in a MCEI circular trough. An electrical conductor connects both the transmission elements. The electrical conductor comprises at least three electrically conductive elements insulated from each other. In the preferred embodiment the electrical conductor comprises an electrically conducting outer shield, an electrically conducting inner shield and an electrical conducting core. In some embodiments of the present invention, the electrical conductor comprises an electrically insulating jacket. In other embodiments, the electrical conductor comprises a pair of twisted wires. In some embodiments, the electrical conductor comprises semi-conductive material.

Printed circuit dispersive transmission line

DOEpatents

Ikezi, H.; Lin-Liu, Y.R.; DeGrassie, J.S.

1991-08-27

A printed circuit dispersive transmission line structure is disclosed comprising an insulator, a ground plane formed on one surface of the insulator, a first transmission line formed on a second surface of the insulator, and a second transmission line also formed on the second surface of the insulator and of longer length than the first transmission line and periodically intersecting the first transmission line. In a preferred embodiment, the transmission line structure exhibits highly dispersive characteristics by designing the length of one of the transmission line between two adjacent periodic intersections to be longer than the other. 5 figures.

Printed circuit dispersive transmission line

DOEpatents

Ikezi, Hiroyuki; Lin-Liu, Yuh-Ren; DeGrassie, John S.

1991-01-01

A printed circuit dispersive transmission line structure is disclosed comprising an insulator, a ground plane formed on one surface of the insulator, a first transmission line formed on a second surface of the insulator, and a second transmission line also formed on the second surface of the insulator and of longer length than the first transmission line and periodically intersecting the first transmission line. In a preferred embodiment, the transmission line structure exhibits highly dispersive characteristics by designing the length of one of the transmission line between two adjacent periodic intersections to be longer than the other.

Couples at risk for transmission of alcoholism: protective influences.

PubMed

Bennett, L A; Wolin, S J; Reiss, D; Teitelbaum, M A

1987-03-01

A two-generation, sociocultural model of the transmission of alcoholism in families was operationalized and tested. Sixty-eight married children of alcoholic parents and their spouses were interviewed regarding dinner-time and holiday ritual practices in their families of origin, and heritage and ritual practices in the couples' current generation. Coders rated transcribed interviews along 14 theory-derived predictor variables, nine for the family of origin and five for the current nuclear family. Multiple regression analysis was applied in a two-step hierarchical method, with the dependent variable being transmission of alcoholism to the couple. The 14 predictor variables contributed significantly (p less than .01) to the couple's alcoholism outcome. A general theme of selective disengagement and reengagement for couples in families at risk for alcoholism recurrence is discussed.

Modeling Malaria Transmission in Thailand and Indonesia

NASA Technical Reports Server (NTRS)

Kiang, Richard; Adimi, Farida; Nigro, Joseph

2007-01-01

Malaria Modeling and Surveillance is a project in the NASA Applied Sciences Public Health Applications Program. The main objectives of this project are: 1) identification of the potential breeding sites for major vector species: 2) implementation of a malaria transmission model to identify they key factors that sustain or intensify malaria transmission; and 3) implementation of a risk algorithm to predict the occurrence of malaria and its transmission intensity. Remote sensing and GIs are the essential elements of this project. The NASA Earth science data sets used in this project include AVHRR Pathfinder, TRMM, MODIS, NSIPP and SIESIP. Textural-contextual classifications are used to identify small larval habitats. Neural network methods are used to model malaria cases as a function of precipitation, temperatures, humidity and vegetation. Hindcastings based on these environmental parameters have shown good agreement to epidemiological records. Examples for spatio-temporal modeling of malaria transmissions in Southeast Asia are given. Discrete event simulations were used for modeling the detailed interactions among the vector life cycle, sporogonic cycle and human infection cycle, under the explicit influences of selected extrinsic and intrinsic factors. The output of the model includes the individual infection status and the quantities normally observed in field studies, such as mosquito biting rates, sporozoite infection rates, gametocyte prevalence and incidence. Results are in good agreement with mosquito vector and human malaria data acquired by Coleman et al. over 4.5 years in Kong Mong Tha, a remote village in western Thailand. Application of our models is not restricted to Southeast Asia. The model and techniques are equally applicable to other regions of the world, when appropriate epidemiological and vector ecological parameters are used as input.

Drivers of Tuberculosis Transmission.

PubMed

Mathema, Barun; Andrews, Jason R; Cohen, Ted; Borgdorff, Martien W; Behr, Marcel; Glynn, Judith R; Rustomjee, Roxana; Silk, Benjamin J; Wood, Robin

2017-11-03

Measuring tuberculosis transmission is exceedingly difficult, given the remarkable variability in the timing of clinical disease after Mycobacterium tuberculosis infection; incident disease can result from either a recent (ie, weeks to months) or a remote (ie, several years to decades) infection event. Although we cannot identify with certainty the timing and location of tuberculosis transmission for individuals, approaches for estimating the individual probability of recent transmission and for estimating the fraction of tuberculosis cases due to recent transmission in populations have been developed. Data used to estimate the probable burden of recent transmission include tuberculosis case notifications in young children and trends in tuberculin skin test and interferon γ-release assays. More recently, M. tuberculosis whole-genome sequencing has been used to estimate population levels of recent transmission, identify the distribution of specific strains within communities, and decipher chains of transmission among culture-positive tuberculosis cases. The factors that drive the transmission of tuberculosis in communities depend on the burden of prevalent tuberculosis; the ways in which individuals live, work, and interact (eg, congregate settings); and the capacity of healthcare and public health systems to identify and effectively treat individuals with infectious forms of tuberculosis. Here we provide an overview of these factors, describe tools for measurement of ongoing transmission, and highlight knowledge gaps that must be addressed. © The Author 2017. Published by Oxford University Press for the Infectious Diseases Society of America.

A Method For Modeling Discontinuities In A Microwave Coaxial Transmission Line

NASA Technical Reports Server (NTRS)

Otoshi, Tom Y.

1994-01-01

A methodology for modeling discountinuities in a coaxial transmission line is presented. The method uses a none-linear least squares fit program to optimize the fit between a theoretical model and experimental data. When the method was applied for modeling discontinuites in a damaged S-band antenna cable, excellent agreement was obtained.

The role of virologic and immunologic factors in mother-to-child transmission of HIV-1.

PubMed

Colognesi, C; Halapi, E; Jansson, M; Hodara, V; Steuer, G; Tresoldi, E; Leitner, T; Scarlatti, G

1997-09-01

More than 90% of human immunodeficiency virus type 1 (HIV-1) infection in children is acquired by mother-to-child transmission. However, infection of the child occurs in between 14 and 35% of cases. To understand the mechanisms involved in HIV-1 transmission, we have investigated the antigenic, molecular, and phenotypic characteristics of the virus harbored in infected mothers and their children. A clear correlation was observed between the transmission of the virus and the isolation of viral variants with a rapidly replicating and syncytium-inducing phenotype from the mother. Furthermore, non-transmitting mothers were able to neutralize several primary isolates more frequently than transmitting mothers. The comparison of the viral phenotype and genotype of mother-child pairs showed that the transmitted virus did not have common features, suggesting that transmission is usually not a selective process. This study suggests that transmission is governed by an interaction of both viral and immunological factors. The results obtained indicate that different strategies can be applied for the prevention of transmission.

Magnetically insulated transmission line oscillator

DOEpatents

Bacon, L.D.; Ballard, W.P.; Clark, M.C.; Marder, B.M.

1987-05-19

A magnetically insulated transmission line oscillator employs self-generated magnetic fields to generate microwave energy. An anode of the oscillator includes slow-wave structures which are formed of a plurality of thin conductive vanes defining cavities therebetween, and a gap is formed between the anode and a cathode of the oscillator. In response to a pulsed voltage applied to the anode and cathode, self-generated magnetic fields are produced in a cross-field orientation with respect to the orientation of the electric field between the anode and the cathode. The cross-field magnetic fields insulate the flow of electrons in the gap and confine the flow of electrons within the gap. 11 figs.

An Approach for Transmission Loss and Cost Allocation by Loss Allocation Index and Co-operative Game Theory

NASA Astrophysics Data System (ADS)

Khan, Baseem; Agnihotri, Ganga; Mishra, Anuprita S.

2016-03-01

In the present work authors proposed a novel method for transmission loss and cost allocation to users (generators and loads). In the developed methodology transmission losses are allocated to users based on their usage of the transmission line. After usage allocation, particular loss allocation indices (PLAI) are evaluated for loads and generators. Also Cooperative game theory approach is applied for comparison of results. The proposed method is simple and easy to implement on the practical power system. Sample 6 bus and IEEE 14 bus system is used for showing the effectiveness of proposed method.

Vertical cultural transmission effects on demic front propagation: Theory and application to the Neolithic transition in Europe

NASA Astrophysics Data System (ADS)

Fort, Joaquim

2011-05-01

It is shown that Lotka-Volterra interaction terms are not appropriate to describe vertical cultural transmission. Appropriate interaction terms are derived and used to compute the effect of vertical cultural transmission on demic front propagation. They are also applied to a specific example, the Neolithic transition in Europe. In this example, it is found that the effect of vertical cultural transmission can be important (about 30%). On the other hand, simple models based on differential equations can lead to large errors (above 50%). Further physical, biophysical, and cross-disciplinary applications are outlined.

Automated manual transmission clutch controller

DOEpatents

Lawrie, Robert E.; Reed, Jr., Richard G.; Rausen, David J.

1999-11-30

A powertrain system for a hybrid vehicle. The hybrid vehicle includes a heat engine, such as a diesel engine, and an electric machine, which operates as both an electric motor and an alternator, to power the vehicle. The hybrid vehicle also includes a manual-style transmission configured to operate as an automatic transmission from the perspective of the driver. The engine and the electric machine drive an input shaft which in turn drives an output shaft of the transmission. In addition to driving the transmission, the electric machine regulates the speed of the input shaft in order to synchronize the input shaft during either an upshift or downshift of the transmission by either decreasing or increasing the speed of the input shaft. When decreasing the speed of the input shaft, the electric motor functions as an alternator to produce electrical energy which may be stored by a storage device. Operation of the transmission is controlled by a transmission controller which receives input signals and generates output signals to control shift and clutch motors to effect smooth launch, upshift shifts, and downshifts of the transmission, so that the transmission functions substantially as an automatic transmission from the perspective of the driver, while internally substantially functioning as a manual transmission.

Modeling Post-death Transmission of Ebola: Challenges for Inference and Opportunities for Control

NASA Astrophysics Data System (ADS)

Weitz, Joshua S.; Dushoff, Jonathan

2015-03-01

Multiple epidemiological models have been proposed to predict the spread of Ebola in West Africa. These models include consideration of counter-measures meant to slow and, eventually, stop the spread of the disease. Here, we examine one component of Ebola dynamics that is of ongoing concern - the transmission of Ebola from the dead to the living. We do so by applying the toolkit of mathematical epidemiology to analyze the consequences of post-death transmission. We show that underlying disease parameters cannot be inferred with confidence from early-stage incidence data (that is, they are not ``identifiable'') because different parameter combinations can produce virtually the same epidemic trajectory. Despite this identifiability problem, we find robustly that inferences that don't account for post-death transmission tend to underestimate the basic reproductive number - thus, given the observed rate of epidemic growth, larger amounts of post-death transmission imply larger reproductive numbers. From a control perspective, we explain how improvements in reducing post-death transmission of Ebola may reduce the overall epidemic spread and scope substantially. Increased attention to the proportion of post-death transmission has the potential to aid both in projecting the course of the epidemic and in evaluating a portfolio of control strategies.

Cardiorespiratory fitness modulates the acute flow-mediated dilation response following high-intensity but not moderate-intensity exercise in elderly men.

PubMed

Bailey, Tom G; Perissiou, Maria; Windsor, Mark; Russell, Fraser; Golledge, Jonathan; Green, Daniel J; Askew, Christopher D

2017-05-01

Impaired endothelial function is observed with aging and in those with low cardiorespiratory fitness (V̇o 2peak ). Improvements in endothelial function with exercise training are somewhat dependent on the intensity of exercise. While the acute stimulus for this improvement is not completely understood, it may, in part, be due to the flow-mediated dilation (FMD) response to acute exercise. We examined the hypothesis that exercise intensity alters the brachial (systemic) FMD response in elderly men and is modulated by V̇o 2peak Forty-seven elderly men were stratified into lower (V̇o 2peak = 24.3 ± 2.9 ml·kg -1 ·min -1 ; n = 27) and higher fit groups (V̇o 2peak = 35.4 ± 5.5 ml·kg -1 ·min -1 ; n = 20) after a test of cycling peak power output (PPO). In randomized order, participants undertook moderate-intensity continuous exercise (MICE; 40% PPO) or high-intensity interval cycling exercise (HIIE; 70% PPO) or no-exercise control. Brachial FMD was assessed at rest and 10 and 60 min after exercise. FMD increased after MICE in both groups {increase of 0.86% [95% confidence interval (CI), 0.17-1.56], P = 0.01} and normalized after 60 min. In the lower fit group, FMD was reduced after HIIE [reduction of 0.85% (95% CI, 0.12-1.58), P = 0.02] and remained decreased at 60 min. In the higher fit group, FMD was unchanged immediately after HIIE and increased after 60 min [increase of 1.52% (95% CI, 0.41-2.62), P < 0.01, which was correlated with V̇o 2peak , r = 0.41; P < 0.01]. In the no-exercise control, FMD was reduced in both groups after 60 min ( P = 0.05). Exercise intensity alters the acute FMD response in elderly men and V̇o 2peak modulates the FMD response following HIIE but not MICE. The sustained decrease in FMD in the lower fit group following HIIE may represent a signal for vascular adaptation or endothelial fatigue. NEW & NOTEWORTHY This study is the first to show that moderate-intensity continuous cycling exercise increased flow-mediated dilation (FMD

Re-Active Passive devices for control of noise transmission through a panel

NASA Astrophysics Data System (ADS)

Carneal, James P.; Giovanardi, Marco; Fuller, Chris R.; Palumbo, Dan

2008-01-01

Re-Active Passive devices have been developed to control low-frequency (<1000 Hz) noise transmission through a panel. These devices use a combination of active, re-active, and passive technologies packaged into a single unit to control a broad frequency range utilizing the strength of each technology over its best suited frequency range. The Re-Active Passive device uses passive constrained layer damping to cover relatively high-frequency range (>150 Hz), reactive distributed vibration absorber to cover the medium-frequency range (50-200 Hz), and active control for controlling low frequencies (<150 Hz). The actuator was applied to control noise transmission through a panel mounted in the Transmission Loss Test Facility at Virginia Tech. Experimental results are presented for the bare panel, and combinations of passive treatment, reactive treatment, and active control. Results indicate that three Re-Active Passive devices were able to increase the overall broadband (15-1000 Hz) transmission loss by 9.4 dB. These three devices added a total of 285 g to the panel mass of 6.0 kg, or approximately 5%, not including control electronics.

Theoretical vibro-acoustic modeling of acoustic noise transmission through aircraft windows

NASA Astrophysics Data System (ADS)

Aloufi, Badr; Behdinan, Kamran; Zu, Jean

2016-06-01

In this paper, a fully vibro-acoustic model for sound transmission across a multi-pane aircraft window is developed. The proposed model is efficiently applied for a set of window models to perform extensive theoretical parametric studies. The studied window configurations generally simulate the passenger window designs of modern aircraft classes which have an exterior multi-Plexiglas pane, an interior single acrylic glass pane and a dimmable glass ("smart" glass), all separated by thin air cavities. The sound transmission loss (STL) characteristics of three different models, triple-, quadruple- and quintuple-paned windows identical in size and surface density, are analyzed for improving the acoustic insulation performances. Typical results describing the influence of several system parameters, such as the thicknesses, number and spacing of the window panes, on the transmission loss are then investigated. In addition, a comparison study is carried out to evaluate the acoustic reduction capability of each window model. The STL results show that the higher frequencies sound transmission loss performance can be improved by increasing the number of window panels, however, the low frequency performance is decreased, particularly at the mass-spring resonances.

Optimal estimation of spatially variable recharge and transmissivity fields under steady-state groundwater flow. Part 2. Case study

NASA Astrophysics Data System (ADS)

Graham, Wendy D.; Neff, Christina R.

1994-05-01

The first-order analytical solution of the inverse problem for estimating spatially variable recharge and transmissivity under steady-state groundwater flow, developed in Part 1 is applied to the Upper Floridan Aquifer in NE Florida. Parameters characterizing the statistical structure of the log-transmissivity and head fields are estimated from 152 measurements of transmissivity and 146 measurements of hydraulic head available in the study region. Optimal estimates of the recharge, transmissivity and head fields are produced throughout the study region by conditioning on the nearest 10 available transmissivity measurements and the nearest 10 available head measurements. Head observations are shown to provide valuable information for estimating both the transmissivity and the recharge fields. Accurate numerical groundwater model predictions of the aquifer flow system are obtained using the optimal transmissivity and recharge fields as input parameters, and the optimal head field to define boundary conditions. For this case study, both the transmissivity field and the uncertainty of the transmissivity field prediction are poorly estimated, when the effects of random recharge are neglected.

Identifiability and estimation of multiple transmission pathways in cholera and waterborne disease.

PubMed

Eisenberg, Marisa C; Robertson, Suzanne L; Tien, Joseph H

2013-05-07

Cholera and many waterborne diseases exhibit multiple characteristic timescales or pathways of infection, which can be modeled as direct and indirect transmission. A major public health issue for waterborne diseases involves understanding the modes of transmission in order to improve control and prevention strategies. An important epidemiological question is: given data for an outbreak, can we determine the role and relative importance of direct vs. environmental/waterborne routes of transmission? We examine whether parameters for a differential equation model of waterborne disease transmission dynamics can be identified, both in the ideal setting of noise-free data (structural identifiability) and in the more realistic setting in the presence of noise (practical identifiability). We used a differential algebra approach together with several numerical approaches, with a particular emphasis on identifiability of the transmission rates. To examine these issues in a practical public health context, we apply the model to a recent cholera outbreak in Angola (2006). Our results show that the model parameters-including both water and person-to-person transmission routes-are globally structurally identifiable, although they become unidentifiable when the environmental transmission timescale is fast. Even for water dynamics within the identifiable range, when noisy data are considered, only a combination of the water transmission parameters can practically be estimated. This makes the waterborne transmission parameters difficult to estimate, leading to inaccurate estimates of important epidemiological parameters such as the basic reproduction number (R0). However, measurements of pathogen persistence time in environmental water sources or measurements of pathogen concentration in the water can improve model identifiability and allow for more accurate estimation of waterborne transmission pathway parameters as well as R0. Parameter estimates for the Angola outbreak suggest

Transmission Planning Analysis Tool

DOE Office of Scientific and Technical Information (OSTI.GOV)

2015-06-23

Developed to solve specific problem: Assist transmission planning for regional transfers in interconnected power systems. This work was originated in a study for the U.S. Department of State, to recommend transmission reinforcements for the Central American regional system that interconnects 6 countries. Transmission planning analysis is currently performed by engineers with domainspecific and systemspecific knowledge without a unique methodology. The software codes of this disclosure assists engineers by defining systematic analysis procedures to help identify weak points and make decisions on transmission planning of regional interconnected power systems. Transmission Planning Analysis Tool groups PSS/E results of multiple AC contingency analysismore » and voltage stability analysis and QV analysis of many scenarios of study and arrange them in a systematic way to aid power system planning engineers or transmission operators in effective decision]making process or in the off]line study environment.« less

Nondestructive Testing of Overhead Transmission LINES—NUMERICAL and Experimental Investigation

NASA Astrophysics Data System (ADS)

Kulkarni, S.; Hurlebaus, S.

2009-03-01

Overhead transmission lines are periodically inspected using both on-ground and helicopter-aided visual inspection. Factors including sun glare, cloud cover, close proximity to power lines and the rapidly changing visual circumstances make airborne inspection of power lines a particularly hazardous task. In this study, a finite element model is developed that can be used to create the theoretical dispersion curves of an overhead transmission line. The numerical results are then verified with experimental test using a non-contact and broadband laser detection technique. The methodology developed in this study can be further extended to a continuous monitoring system and be applied to other cable monitoring applications, such as bridge cable monitoring, which would otherwise put human inspectors at risk.

Measurement of the normalized broadband ultrasound attenuation in trabecular bone by using a bidirectional transverse transmission technique

NASA Astrophysics Data System (ADS)

Lee, Kang Il

2015-01-01

A new method for measuring the normalized broadband ultrasound attenuation (nBUA) in trabecular bone by using a bidirectional transverse transmission technique was proposed and validated with measurements obtained by using the conventional transverse transmission technique. There was no significant difference between the nBUA measurements obtained for 14 bovine femoral trabecular bone samples by using the bidirectional and the conventional transverse transmission techniques. The nBUA measured by using the two transverse transmission techniques showed strong positive correlations of r = 0.87 to 0.88 with the apparent bone density, consistent with the behavior in human trabecular bone invitro. We expect that the new method can be usefully applied for improved accuracy and precision in clinical measurements.

Video transmission on ATM networks. Ph.D. Thesis

NASA Technical Reports Server (NTRS)

Chen, Yun-Chung

1993-01-01

The broadband integrated services digital network (B-ISDN) is expected to provide high-speed and flexible multimedia applications. Multimedia includes data, graphics, image, voice, and video. Asynchronous transfer mode (ATM) is the adopted transport techniques for B-ISDN and has the potential for providing a more efficient and integrated environment for multimedia. It is believed that most broadband applications will make heavy use of visual information. The prospect of wide spread use of image and video communication has led to interest in coding algorithms for reducing bandwidth requirements and improving image quality. The major results of a study on the bridging of network transmission performance and video coding are: Using two representative video sequences, several video source models are developed. The fitness of these models are validated through the use of statistical tests and network queuing performance. A dual leaky bucket algorithm is proposed as an effective network policing function. The concept of the dual leaky bucket algorithm can be applied to a prioritized coding approach to achieve transmission efficiency. A mapping of the performance/control parameters at the network level into equivalent parameters at the video coding level is developed. Based on that, a complete set of principles for the design of video codecs for network transmission is proposed.

An integrative analysis of foot-and-mouth disease virus carriers in Vietnam achieved through targeted surveillance and molecular epidemiology

USDA-ARS?s Scientific Manuscript database

A multidisciplinary, molecular and conventional epidemiological approach was applied to an investigation of endemic foot-and-mouth disease in Vietnam. Within the study space, it was found that 22.3 percent of sampled ruminants had previously been infected with FMD virus (FMDV) and that 2.4 percent w...

Global Foot-and-Mouth Disease Research Update and Gap Analysis: 1 - Overview of Global Status and Research Needs.

PubMed

Knight-Jones, T J D; Robinson, L; Charleston, B; Rodriguez, L L; Gay, C G; Sumption, K J; Vosloo, W

2016-06-01

The Global Foot-and-mouth disease (FMD) Research Alliance periodically reviews the state of FMD research to assess progress and to identify new priorities. In this supplement we provide an update of global FMD research, comprising (i) this overview paper, which includes background information with key findings, and papers covering (ii) epidemiology, wildlife and economics, (iii) vaccines, (iv) diagnostics, (v) biotherapeutics and disinfectants, (vi) immunology and (vii) pathogenesis and molecular biology. FMD research publications were reviewed (2011-2015) and activity updates were obtained from 33 FMD research institutes from around the world. Although a continual threat, FMD has been effectively controlled in much of the world using existing tools. However, control remains a challenge in most developing countries, where little has been done to understand the ongoing burden of FMD. More research is needed to support control in endemically infected countries, particularly robust field studies. Traditional FMD vaccines have several limitations including short duration and spectrum of protection, cold chain requirements, and the costs and biosecurity risks associated with vaccine production. Significant progress has been made in the development of novel vaccine candidates, particularly in the use of recombinant vaccines and virus-like particles as an alternative to traditional inactivated whole virus vaccines. Continued investment is needed to turn these developments into improved vaccines produced at scale. Increased knowledge of cellular and mucosal immunity would benefit vaccine development, as would further advances in our ability to enhance vaccine capsid stability. Developments in molecular biology and phylogenetics underlie many of the recent advances in FMD research, including improved vaccines and diagnostics, and improved understanding of FMD epidemiology. Tools for genetic analyses continue to become both more powerful and more affordable enabling them to

Reconstruction of disease transmission rates: Applications to measles, dengue, and influenza.

PubMed

Lange, Alexander

2016-07-07

Transmission rates are key in understanding the spread of infectious diseases. Using the framework of compartmental models, we introduce a simple method to reconstruct time series of transmission rates directly from incidence or disease-related mortality data. The reconstruction employs differential equations, which model the time evolution of infective stages and strains. Being sensitive to initial values, the method produces asymptotically correct solutions. The computations are fast, with time complexity being quadratic. We apply the reconstruction to data of measles (England and Wales, 1948-1967), dengue (Thailand, 1982-1999), and influenza (U.S., 1910-1927). The Measles example offers comparison with earlier work. Here we re-investigate reporting corrections, include and exclude demographic information. The dengue example deals with the failure of vector-control measures in reducing dengue hemorrhagic fever (DHF) in Thailand. Two competing mechanisms have been held responsible: strain interaction and demographic transitions. Our reconstruction reveals that both explanations are possible, showing that the increase in DHF cases is consistent with decreasing transmission rates resulting from reduced vector counts. The flu example focuses on the 1918/1919 pandemic, examining the transmission rate evolution for an invading strain. Our analysis indicates that the pandemic strain could have circulated in the population for many months before the pandemic was initiated by an event of highly increased transmission. Copyright © 2016 Elsevier Ltd. All rights reserved.

Experimental study on an S-band near-field microwave magnetron power transmission system on hundred-watt level

NASA Astrophysics Data System (ADS)

Zhang, Biao; Jiang, Wan; Yang, Yang; Yu, Chengyang; Huang, Kama; Liu, Changjun

2015-11-01

A multi-magnetron microwave source, a metamaterial transmitting antenna, and a large power rectenna array are presented to build a near-field 2.45 GHz microwave power transmission system. The square 1 m2 rectenna array consists of sixteen rectennas with 2048 Schottky diodes for large power microwave rectifying. It receives microwave power and converts them into DC power. The design, structure, and measured performance of a unit rectenna as well as the entail rectenna array are presented in detail. The multi-magnetron microwave power source switches between half and full output power levels, i.e. the half-wave and full-wave modes. The transmission antenna is formed by a double-layer metallic hole array, which is applied to combine the output power of each magnetron. The rectenna array DC output power reaches 67.3 W on a 1.2 Ω DC load at a distance of 5.5 m from the transmission antenna. DC output power is affected by the distance, DC load, and the mode of microwave power source. It shows that conventional low power Schottky diodes can be applied to a microwave power transmission system with simple magnetrons to realise large power microwave rectifying.

Torque Splitting by a Concentric Face Gear Transmission

NASA Technical Reports Server (NTRS)

Filler, Robert R.; Heath, Gregory F.; Slaughter, Stephen C.; Lewicki, David G.

2002-01-01

Tests of a 167 Kilowatt (224 Horsepower) split torque face gearbox were performed by the Boeing Company in Mesa, Arizona, while working under a Defense Advanced Research Projects Agency (DARPA) Technology Reinvestment Program (TRP). This paper provides a summary of these cooperative tests, which were jointly funded by Boeing and DARPA. Design, manufacture and testing of the scaled-power TRP proof-of-concept (POC) split torque gearbox followed preliminary evaluations of the concept performed early in the program. The split torque tests were run using 200 N-m (1767 in-lbs) torque input to each side of the transmission. During tests, two input pinions were slow rolled while in mesh with the two face gears. Two idler gears were also used in the configuration to recombine torque near the output. Resistance was applied at the output face gear to create the required loading conditions in the gear teeth. A system of weights, pulleys and cables were used in the test rig to provide both the input and output loading. Strain gages applied in the tooth root fillets provided strain indication used to determine torque splitting conditions at the input pinions. The final two pinion-two idler tests indicated 52% to 48% average torque split capabilities for the two pinions. During the same tests, a 57% to 43% average distribution of the torque being recombined to the upper face gear from the lower face gear was measured between the two idlers. The POC split torque tests demonstrated that face gears can be applied effectively in split torque rotorcraft transmissions, yielding good potential for significant weight, cost and reliability improvements over existing equipment using spiral bevel gearing.

Is the association between flow-mediated dilation and cardiovascular risk limited to low-risk populations?

PubMed

Witte, Daniel R; Westerink, Jan; de Koning, Eelco J; van der Graaf, Yolanda; Grobbee, Diederick E; Bots, Michiel L

2005-06-21

The aim of this research was to study whether the relation between endothelial function measured by flow-mediated dilation (FMD) of the brachial artery and cardiovascular risk factors is affected by the baseline cardiovascular risk. Flow-mediated dilation of the brachial artery is widely used as a measure of endothelial function. Relations between FMD and most cardiovascular risk factors have been described. We performed a meta-regression analysis of 211 selected articles (399 populations) reporting on FMD and cardiovascular risk factors. Mean values of FMD; age; proportion of men; proportion of smokers; blood pressure; lipids; glucose; and the presence of diabetes mellitus, of hyperlipidemia, and of hypertension were retrieved from the articles. The 10-year risk of coronary heart disease (CHD) for each population was estimated based on the Framingham risk score. The relation between FMD and cardiovascular risk factors was assessed within each risk category by linear regression analysis, adjusting for age and gender, and weighted for the study size. A relation between FMD and cardiovascular risk factors was most clear in the category with lowest baseline risk (below 2.8% per decade). In populations with low baseline risk, for each % increase in Framingham risk, FMD decreased by 1.42% (95% confidence interval: 0.65 to 2.19). In medium- and high-risk populations, FMD was not related to risk (-0.02% [-0.27 to 0.22] and 0.06% [-0.02 to 0.13], respectively). These findings were independent of differences in brachial lumen diameter and technical aspects of the FMD measurement. Only in populations at low risk, endothelial function measured by FMD is related to the principal cardiovascular risk factors, and to the estimated 10-year risk of CHD.

Modal parameter identification based on combining transmissibility functions and blind source separation techniques

NASA Astrophysics Data System (ADS)

Araújo, Iván Gómez; Sánchez, Jesús Antonio García; Andersen, Palle

2018-05-01

Transmissibility-based operational modal analysis is a recent and alternative approach used to identify the modal parameters of structures under operational conditions. This approach is advantageous compared with traditional operational modal analysis because it does not make any assumptions about the excitation spectrum (i.e., white noise with a flat spectrum). However, common methodologies do not include a procedure to extract closely spaced modes with low signal-to-noise ratios. This issue is relevant when considering that engineering structures generally have closely spaced modes and that their measured responses present high levels of noise. Therefore, to overcome these problems, a new combined method for modal parameter identification is proposed in this work. The proposed method combines blind source separation (BSS) techniques and transmissibility-based methods. Here, BSS techniques were used to recover source signals, and transmissibility-based methods were applied to estimate modal information from the recovered source signals. To achieve this combination, a new method to define a transmissibility function was proposed. The suggested transmissibility function is based on the relationship between the power spectral density (PSD) of mixed signals and the PSD of signals from a single source. The numerical responses of a truss structure with high levels of added noise and very closely spaced modes were processed using the proposed combined method to evaluate its ability to identify modal parameters in these conditions. Colored and white noise excitations were used for the numerical example. The proposed combined method was also used to evaluate the modal parameters of an experimental test on a structure containing closely spaced modes. The results showed that the proposed combined method is capable of identifying very closely spaced modes in the presence of noise and, thus, may be potentially applied to improve the identification of damping ratios.

The Reusable Load Cell with Protection Applied for Online Monitoring of Overhead Transmission Lines Based on Fiber Bragg Grating

PubMed Central

Ma, Guoming; Mao, Naiqiang; Li, Yabo; Jiang, Jun; Zhou, Hongyang; Li, Chengrong

2016-01-01

Heavy ice coating of high–voltage overhead transmission lines may lead to conductor breakage and tower collapse causing the unexpected interrupt of power supply. The optical load cell applied in ice monitoring systems is immune to electromagnetic interference and has no need of a power supply on site. Therefore, it has become a hot research topic in China and other countries. In this paper, to solve the problem of eccentric load in measurement, we adopt the shearing structure with additional grooves to improve the strain distribution and acquire good repeatability. Then, the fiber Bragg grating (FBG) with a permanent weldable package are mounted onto the front/rear groove of the elastic element by spot welding, the direction deviation of FBGs is 90° from each other to achieve temperature compensation without an extra FBG. After that, protection parts are designed to guarantee high sensitivity for a light load condition and industrial safety under a heavy load up to 65 kN. The results of tension experiments indicate that the sensitivity and resolution of the load cell is 0.1285 pm/N and 7.782 N in the conventional measuring range (0–10 kN). Heavy load tension experiments prove that the protection structure works and the sensitivity and resolution are not changed after several high load (65 kN) cycles. In addition, the experiment shows that the resolution of the sensor is 87.79 N in the large load range, allowing the parameter to be used in heavy icing monitoring. PMID:27338403

Fitness-valley crossing with generalized parent-offspring transmission.

PubMed

Osmond, Matthew M; Otto, Sarah P

2015-11-01

Simple and ubiquitous gene interactions create rugged fitness landscapes composed of coadapted gene complexes separated by "valleys" of low fitness. Crossing such fitness valleys allows a population to escape suboptimal local fitness peaks to become better adapted. This is the premise of Sewall Wright's shifting balance process. Here we generalize the theory of fitness-valley crossing in the two-locus, bi-allelic case by allowing bias in parent-offspring transmission. This generalization extends the existing mathematical framework to genetic systems with segregation distortion and uniparental inheritance. Our results are also flexible enough to provide insight into shifts between alternate stable states in cultural systems with "transmission valleys". Using a semi-deterministic analysis and a stochastic diffusion approximation, we focus on the limiting step in valley crossing: the first appearance of the genotype on the new fitness peak whose lineage will eventually fix. We then apply our results to specific cases of segregation distortion, uniparental inheritance, and cultural transmission. Segregation distortion favouring mutant alleles facilitates crossing most when recombination and mutation are rare, i.e., scenarios where crossing is otherwise unlikely. Interactions with more mutable genes (e.g., uniparental inherited cytoplasmic elements) substantially reduce crossing times. Despite component traits being passed on poorly in the previous cultural background, small advantages in the transmission of a new combination of cultural traits can greatly facilitate a cultural transition. While peak shifts are unlikely under many of the common assumptions of population genetic theory, relaxing some of these assumptions can promote fitness-valley crossing. Copyright © 2015 Elsevier Inc. All rights reserved.

Numerical study of influence of different dispersed components of crystal cloud on transmission of radiant energy

NASA Astrophysics Data System (ADS)

Shefer, Olga

2017-11-01

The calculated results of the transmission of visible and infrared radiation by an atmosphere layer involving ensembles of large preferentially oriented crystals and spherical particles are presented. To calculate extinction characteristics, the physical optics method and the Mie theory are applied. Among all atmospheric particles, both the small particles that are commensurable with the wavelength of the incident radiation and the large plates and the columns are distinguished by the most pronounced dependence of the transmission on spectra of radiant energy. The work illustrates features of influence of parameters of the particle size distribution, particle aspect ratios, orientation and particle refractive index, also polarization state of the incident radiation on the transmission. The predominant effect of the plates on the wavelength dependence of the transmission is shown. A separated and cooperative contributes of the large plates and the small volume shape particles to the common transmission by medium are considered.

Fire retardancy using applied materials

NASA Technical Reports Server (NTRS)

Feldman, R.

1971-01-01

An example of advanced technology transfer from the Little Joe, Surveyor, Comsat, re-entry and Apollo age to everyday fire protection needs is presented. Utilizing the principle of sublimation cooling for thermostatic temperature control, the material meets a wide range of fire retardancy and heat transmission control requirements. Properties vary from flexible tape for conduits and electrical cables to rigid coatings for column protection, with a broad spectrum of sublimation temperatures available. The material can be applied in the field or in the factory, utilizing mass production techniques, yielding a product that is reliable, effective, widely available and low in cost.

Transmission rights and market power

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bushnell, J.

1999-10-01

Most of the concerns about physical transmission rights relate to the ability to implicitly or explicitly remove that transmission capacity from the market-place. Under a very strict form of physical right, owners could simply choose not to sell it if they don't want to use it. Modifications that require the release of spare capacity back into an open market could potentially alleviate this problem but there is concern that such releases would not occur far enough in advance to be of much use to schedulers. Similarly, the transmission capacity that is made available for use by non-rights holders can alsomore » be manipulated by the owners of transmission rights. The alternative form, financial transmission rights, provide to their owners congestion payments, but physical control of transmission paths. In electricity markets such as California's, even financial transmission rights could potentially be utilized to effectively withhold transmission capacity from the marketplace. However, methods for withholding transmission capacity are somewhat more convoluted, and probably more difficult, for owners of financial rights than for owners of physical rights. In this article, the author discusses some of the potential concerns over transmission rights and their use for the exercise of various forms of market power.« less

Evidence of subclinical foot-and-mouth disease virus infection in young calves born from clinically recovered cow under natural condition

USDA-ARS?s Scientific Manuscript database

Foot-and-mouth disease (FMD) is a highly contagious and economically important, transboundary viral disease of cloven-hoofed animals. It is known that a chronic, asymptomatic FMD syndrome may occur subsequent to acute FMD in adult ruminants. However, neither asymptomatic nor persistent infection has...

Transmission Kikuchi diffraction and transmission electron forescatter imaging of electropolished and FIB manufactured TEM specimens

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zieliński, W., E-mail: wiziel@inmat.pw.edu.pl; Płociński, T.; Kurzydłowski, K.J.

2015-06-15

We present a study of the efficiency of the utility of scanning electron microscope (SEM)-based transmission methods for characterizing grain structure in thinned bulk metals. Foils of type 316 stainless steel were prepared by two methods commonly used for transmission electron microscopy — double-jet electropolishing and focused ion beam milling. A customized holder allowed positioning of the foils in a configuration appropriate for both transmission electron forward scatter diffraction, and for transmission imaging by the use of a forescatter detector with two diodes. We found that both crystallographic orientation maps and dark-field transmitted images could be obtained for specimens preparedmore » by either method. However, for both methods, preparation-induced artifacts may affect the quality or accuracy of transmission SEM data, especially those acquired by the use of transmission Kikuchi diffraction. Generally, the quality of orientation data was better for specimens prepared by electropolishing, due to the absence of ion-induced damage. - Highlights: • The transmission imaging and diffraction techniques are emerging in scanning electron microscopy (SEM) as promising new field of materials characterization. • The manuscript titled: “Transmission Kikuchi Diffraction and Transmission Electron Forescatter Imaging of Electropolished and FIB Manufactured TEM Specimens” documents how different specimen thinning procedures can effect efficiency of transmission Kikuchi diffraction and transmission electron forescatter imaging. • The abilities to make precision crystallographic orientation maps and dark-field images in transmission was studied on electropolished versus focus ion beam manufactured TEM specimens. • Depending on the need, electropolished and focused ion beam technique may produce suitable specimens for transmission imaging and diffraction in SEM.« less

Autophagy pathway induced by a plant virus facilitates viral spread and transmission by its insect vector.

PubMed

Chen, Yong; Chen, Qian; Li, Manman; Mao, Qianzhuo; Chen, Hongyan; Wu, Wei; Jia, Dongsheng; Wei, Taiyun

2017-11-01

Many viral pathogens are persistently transmitted by insect vectors and cause agricultural or health problems. Generally, an insect vector can use autophagy as an intrinsic antiviral defense mechanism against viral infection. Whether viruses can evolve to exploit autophagy to promote their transmission by insect vectors is still unknown. Here, we show that the autophagic process is triggered by the persistent replication of a plant reovirus, rice gall dwarf virus (RGDV) in cultured leafhopper vector cells and in intact insects, as demonstrated by the appearance of obvious virus-containing double-membrane autophagosomes, conversion of ATG8-I to ATG8-II and increased level of autophagic flux. Such virus-containing autophagosomes seem able to mediate nonlytic viral release from cultured cells or facilitate viral spread in the leafhopper intestine. Applying the autophagy inhibitor 3-methyladenine or silencing the expression of Atg5 significantly decrease viral spread in vitro and in vivo, whereas applying the autophagy inducer rapamycin or silencing the expression of Torc1 facilitate such viral spread. Furthermore, we find that activation of autophagy facilitates efficient viral transmission, whereas inhibiting autophagy blocks viral transmission by its insect vector. Together, these results indicate a plant virus can induce the formation of autophagosomes for carrying virions, thus facilitating viral spread and transmission by its insect vector. We believe that such a role for virus-induced autophagy is common for vector-borne persistent viruses during their transmission by insect vectors.

Autophagy pathway induced by a plant virus facilitates viral spread and transmission by its insect vector

PubMed Central

Mao, Qianzhuo; Chen, Hongyan; Wu, Wei

2017-01-01

Many viral pathogens are persistently transmitted by insect vectors and cause agricultural or health problems. Generally, an insect vector can use autophagy as an intrinsic antiviral defense mechanism against viral infection. Whether viruses can evolve to exploit autophagy to promote their transmission by insect vectors is still unknown. Here, we show that the autophagic process is triggered by the persistent replication of a plant reovirus, rice gall dwarf virus (RGDV) in cultured leafhopper vector cells and in intact insects, as demonstrated by the appearance of obvious virus-containing double-membrane autophagosomes, conversion of ATG8-I to ATG8-II and increased level of autophagic flux. Such virus-containing autophagosomes seem able to mediate nonlytic viral release from cultured cells or facilitate viral spread in the leafhopper intestine. Applying the autophagy inhibitor 3-methyladenine or silencing the expression of Atg5 significantly decrease viral spread in vitro and in vivo, whereas applying the autophagy inducer rapamycin or silencing the expression of Torc1 facilitate such viral spread. Furthermore, we find that activation of autophagy facilitates efficient viral transmission, whereas inhibiting autophagy blocks viral transmission by its insect vector. Together, these results indicate a plant virus can induce the formation of autophagosomes for carrying virions, thus facilitating viral spread and transmission by its insect vector. We believe that such a role for virus-induced autophagy is common for vector-borne persistent viruses during their transmission by insect vectors. PMID:29125860

Atmospheric Spread of Foot-and-mouth Disease During The Early Phase of The Uk Epidemic 2001

NASA Astrophysics Data System (ADS)

Sørensen, J. H.; Mikkelsen, T.; Astrup, P.; Alexandersen, S.; Donaldson, A. I.

Foot-and-mouth disease (FMD) is a highly contagious viral disease in cloven-hoofed domesticated and wild animals. The highly contagious nature of FMD is a reflection of the wide range of species which are susceptible, the enormous quantities of virus liberated by infected animals, the range of excretions and secretions which can be infectious, the stability of the virus in the environment, the multiplicity of routes of infection and the very small doses of virus that can initiate infection in susceptible hosts. One of the routes for the spread of the disease is the atmospheric dispersion of virus exhaled by infected animals. Such spread can be rapid and extensive, and it is known in certain circumstances to have occurred over a distance of several hundred kilometres. For the FMD epidemic in UK in 2001, atmospheric dispersion models were applied in real time in order to describe the atmospheric dispersion of virus for the larger outbreaks of the disease. The operational value of such modelling is first of all to identify risk zones, which is helpful to the emergency management. The paper addresses the modelling techniques and presents results related with the epidemic in UK in 2001.

Using exceedance probabilities to detect anomalies in routinely recorded animal health data, with particular reference to foot-and-mouth disease in Viet Nam.

PubMed

Richards, K K; Hazelton, M L; Stevenson, M A; Lockhart, C Y; Pinto, J; Nguyen, L

2014-10-01

The widespread availability of computer hardware and software for recording and storing disease event information means that, in theory, we have the necessary information to carry out detailed analyses of factors influencing the spatial distribution of disease in animal populations. However, the reliability of such analyses depends on data quality, with anomalous records having the potential to introduce significant bias and lead to inappropriate decision making. In this paper we promote the use of exceedance probabilities as a tool for detecting anomalies when applying hierarchical spatio-temporal models to animal health data. We illustrate this methodology through a case study data on outbreaks of foot-and-mouth disease (FMD) in Viet Nam for the period 2006-2008. A flexible binomial logistic regression was employed to model the number of FMD infected communes within each province of the country. Standard analyses of the residuals from this model failed to identify problems, but exceedance probabilities identified provinces in which the number of reported FMD outbreaks was unexpectedly low. This finding is interesting given that these provinces are on major cattle movement pathways through Viet Nam. Copyright © 2014 Elsevier Ltd. All rights reserved.

Farmers’ Intentions to Implement Foot and Mouth Disease Control Measures in Ethiopia

PubMed Central

Jemberu, Wudu T.; Mourits, M. C. M.; Hogeveen, H.

2015-01-01

The objectives of this study were to explore farmers’ intentions to implement foot and mouth disease (FMD) control in Ethiopia, and to identify perceptions about the disease and its control measures that influence these intentions using the Health Belief Model (HBM) framework. Data were collected using questionnaires from 293 farmers in three different production systems. The influence of perceptions on the intentions to implement control measures were analyzed using binary logistic regression. The effect of socio-demographic and husbandry variables on perceptions that were found to significantly influence the intentions were analyzed using ordinal logistic regression. Almost all farmers (99%) intended to implement FMD vaccination free of charge. The majority of farmers in the pastoral (94%) and market oriented (92%) systems also had the intention to implement vaccination with charge but only 42% of the crop-livestock mixed farmers had the intention to do so. Only 2% of pastoral and 18% of crop-livestock mixed farmers had the intention to implement herd isolation and animal movement restriction continuously. These proportions increased to 11% for pastoral and 50% for crop-livestock mixed farmers when the measure is applied only during an outbreak. The majority of farmers in the market oriented system (>80%) had the intention to implement herd isolation and animal movement restriction measure, both continuously and during an outbreak. Among the HBM perception constructs, perceived barrier was found to be the only significant predictor of the intention to implement vaccination. Perceived susceptibility, perceived benefit and perceived barrier were the significant predictors of the intention for herd isolation and animal movement restriction measure. In turn, the predicting perceived barrier on vaccination control varied significantly with the production system and the age of farmers. The significant HBM perception predictors on herd isolation and animal movement

Farmers' Intentions to Implement Foot and Mouth Disease Control Measures in Ethiopia.

PubMed

Jemberu, Wudu T; Mourits, M C M; Hogeveen, H

2015-01-01

The objectives of this study were to explore farmers' intentions to implement foot and mouth disease (FMD) control in Ethiopia, and to identify perceptions about the disease and its control measures that influence these intentions using the Health Belief Model (HBM) framework. Data were collected using questionnaires from 293 farmers in three different production systems. The influence of perceptions on the intentions to implement control measures were analyzed using binary logistic regression. The effect of socio-demographic and husbandry variables on perceptions that were found to significantly influence the intentions were analyzed using ordinal logistic regression. Almost all farmers (99%) intended to implement FMD vaccination free of charge. The majority of farmers in the pastoral (94%) and market oriented (92%) systems also had the intention to implement vaccination with charge but only 42% of the crop-livestock mixed farmers had the intention to do so. Only 2% of pastoral and 18% of crop-livestock mixed farmers had the intention to implement herd isolation and animal movement restriction continuously. These proportions increased to 11% for pastoral and 50% for crop-livestock mixed farmers when the measure is applied only during an outbreak. The majority of farmers in the market oriented system (>80%) had the intention to implement herd isolation and animal movement restriction measure, both continuously and during an outbreak. Among the HBM perception constructs, perceived barrier was found to be the only significant predictor of the intention to implement vaccination. Perceived susceptibility, perceived benefit and perceived barrier were the significant predictors of the intention for herd isolation and animal movement restriction measure. In turn, the predicting perceived barrier on vaccination control varied significantly with the production system and the age of farmers. The significant HBM perception predictors on herd isolation and animal movement

Construction of the influenza A virus transmission tree in a college-based population: co-transmission and interactions between influenza A viruses.

PubMed

Zhang, Xu-Sheng; De Angelis, Daniela

2016-01-29

Co-infection of different influenza A viruses is known to occur but how viruses interact within co-infection remains unknown. An outbreak in a college campus during the 2009 pandemic involved two subtypes of influenza A: persons infected with pandemic A/H1N1; persons infected with seasonal A/H3N2 viruses; and persons infected with both at the same time (co-infection). This provides data to analyse the possible interaction between influenza A viruses within co-infection. We extend a statistical inference method designed for outbreaks caused by one virus to that caused by two viruses. The method uses knowledge of which subtype each case is infected with (and whether they were co-infected), contact information and symptom onset date of each case in the influenza outbreak. We then apply it to construct the most likely transmission tree during the outbreak in the college campus. Analysis of the constructed transmission tree shows that the simultaneous presence of the two influenza viruses increases the infectivity and the transmissibility of A/H1N1 virus but whether it changes the infectivity of A/H3N2 is unclear. The estimation also shows that co-transmission of both subtypes from co-infection is low and therefore co-infection cannot be sustained on its own. This study suggests that influenza A viruses within co-infected patients can interact in some ways rather than transmit independently, and this can enhance the spread of influenza A virus infection.

75 FR 62023 - Transmission Planning and Cost Allocation by Transmission Owning and Operating Public Utilities

Federal Register 2010, 2011, 2012, 2013, 2014

2010-10-07

...] Transmission Planning and Cost Allocation by Transmission Owning and Operating Public Utilities September 29... (75 FR 37884) proposing to amend the transmission planning and cost allocation requirements... transmission needs driven by public policy requirements established by state or federal laws or regulations...

A systematic review of risk of HIV transmission through biting or spitting: implications for policy.

PubMed

Cresswell, F V; Ellis, J; Hartley, J; Sabin, C A; Orkin, C; Churchill, D R

2018-04-23

The perceived threat of HIV transmission through spitting and biting is evidenced by the increasing use of "spit hoods" by Police Forces in the UK. In addition, a draft parliamentary bill has called for increased penalties for assaults on emergency workers, citing the risk of communicable disease transmission as one justification. We aimed to review literature relating to the risk of HIV transmission through biting or spitting. A systematic literature search was conducted using Medline, Embase and Northern Lights databases and conference websites using search terms relating to HIV, AIDS, bite, spit and saliva. Inclusion and exclusion criteria were applied to identified citations. We classified plausibility of HIV transmission as low, medium, high or confirmed based on pre-specified criteria. A total of 742 abstracts were reviewed, yielding 32 articles for full-text review and 13 case reports/series after inclusion and exclusion criteria had been applied. There were no reported cases of HIV transmission related to spitting and nine cases identified following a bite, in which the majority occurred between family (six of nine), in fights involving serious wounds (three of nine), or to untrained first-aiders placing fingers in the mouth of someone having a seizure (two of nine). Only four cases were classified as highly plausible or confirmed transmission. None related to emergency workers and none were in the UK. There is no risk of transmitting HIV through spitting, and the risk through biting is negligible. Post-exposure prophylaxis is not indicated after a bite in all but exceptional circumstances. Policies to protect emergency workers should be developed with this evidence in mind. © 2018 The Authors. HIV Medicine published by John Wiley & Sons Ltd on behalf of British HIV Association.

Integrated self-cleaning window assembly for optical transmission in combustion environments

DOEpatents

Kass, Michael D [Oak Ridge, TN

2007-07-24

An integrated window design for optical transmission in combustion environments is described. The invention consists of an integrated optical window design that prevents and removes the accumulation of carbon-based particulate matter and gaseous hydrocarbons through a combination of heat and catalysis. These windows will enable established optical technologies to be applied to combustion environments and their exhaust systems.

75 FR 37883 - Transmission Planning and Cost Allocation by Transmission Owning and Operating Public Utilities

Federal Register 2010, 2011, 2012, 2013, 2014

2010-06-30

... Planning and Cost Allocation by Transmission Owning and Operating Public Utilities; Proposed Rule #0;#0...] Transmission Planning and Cost Allocation by Transmission Owning and Operating Public Utilities Issued June 17... Transmission Services by Public Utilities; Recovery of Stranded Costs by Public Utilities and Transmitting...

Results of NASA/Army transmission research

NASA Technical Reports Server (NTRS)

Coy, John J.; Townsend, Dennis P.; Coe, Harold H.

1988-01-01

Since 1970 the NASA Lewis Research Center and the U.S. Army Aviation Systems Command have shared an interest in advancing the technology for helicopter propulsion systems. In particular, that portion of the program that applies to the drive train and its various mechanical components are outlined. The major goals of the program were (and continue to be) to increase the life, reliability, and maintainability, reduce the weight, noise, and vibration, and maintain the relatively high mechanical efficiency of the gear train. Major historical milestones are reviewed, significant advances in technology for bearings, gears, and transmissions are discussed, and the outlook for the future is presented. The reference list is comprehensive.

Envelope and phase distribution of a resonance transmission through a complex environment

NASA Astrophysics Data System (ADS)

Savin, Dmitry V.

2018-06-01

A transmission amplitude is considered for quantum or wave transport mediated by a single resonance coupled to the background of many chaotic states. Such a model provides a useful approach to quantify fluctuations in an established signal induced by a complex environment. Applying random matrix theory to the problem, we derive an exact result for the joint distribution of the transmission intensity (envelope) and the transmission phase at arbitrary coupling to the background with finite absorption. The intensity and phase are distributed within a certain region, revealing essential correlations even at strong absorption. In the latter limit, we obtain a simple asymptotic expression that provides a uniformly good approximation of the exact distribution within its whole support, thus going beyond the Rician distribution often used for such purposes. Exact results are also derived for the marginal distribution of the phase, including its limiting forms at weak and strong absorption.

Global foot-and-mouth disease research update and gap analysis: 1 - overview of global status and research needs

USDA-ARS?s Scientific Manuscript database

Few, if any, animal diseases have a greater impact than footand-mouth disease (FMD). It is highly infectious, has enormous control costs and severe impacts on trade. FMD research is performed in numerous institutions around the world. The Global FMD Research alliance (GFRA) is an international conso...

Subclinical Markers of Cardiovascular Disease Among Police Officers: A Longitudinal Assessment of the Cortisol Awakening Response and Flow Mediated Artery Dilation.

PubMed

Violanti, John M; Fekedulegn, Desta; Andrew, Michael E; Charles, Luenda E; Gu, Ja K; Miller, Diane B

2018-05-07

To examine the association of the cortisol awakening response (CAR) with change in brachial artery flow-mediated dilation (FMD%) in police officers over a seven-year period. Baseline CAR was obtained from four saliva samples taken fifteen minutes apart immediately after awakening. Analysis of covariance was used to compare the change in FMD% (FMD%Follow-up-FMD%Baseline) across tertiles of area under the cortisol curve with respect to increase (AUCI). Regression analysis was use to assess trend. Officers (n = 172; 81% men) had a mean ± SD age of 41 ± 7.6 years. Men in the lowest AUCI tertile (i.e., atypical waking cortisol pattern) had a significantly larger seven-year mean decline in FMD% (mean ± SE: -2.56 ± 0.64) compared to men in the highest tertile (-0.89 ± 0.69) (p = 0.0087). An awakening cortisol AUCI predicted worsening of FMD% approximately seven years later among male officers.

Flow-mediated Dilation: Can New Approaches Provide Greater Mechanistic Insight into Vascular Dysfunction in Preeclampsia and Other Diseases?

PubMed Central

Weissgerber, Tracey L.

2015-01-01

Endothelial dysfunction is a key feature of preeclampsia, and may contribute to increased cardiovascular disease risk years after pregnancy. Flow-mediated dilation (FMD) is a non-invasive endothelial function test that predicts cardiovascular event risk. New protocols allow researchers to measure three components of the FMD response: FMD, low flow-mediated constriction and the shear stimulus. This review encourages researchers to think beyond “low FMD” by examining how these three components may provide additional insights into the mechanisms and location of vascular dysfunction. The review then examines what FMD studies reveal about vascular dysfunction in preeclampsia, while highlighting opportunities to gain greater mechanistic insight from new protocols. Studies using traditional protocols show that FMD is low in mid-pregnancy prior to preeclampsia, at diagnosis, and for three years post-partum. However, FMD returns to normal by ten years post-partum. Studies using new protocols are needed to gain more mechanistic insight. PMID:25182159

Design of trials for interrupting the transmission of endemic pathogens.

PubMed

Silkey, Mariabeth; Homan, Tobias; Maire, Nicolas; Hiscox, Alexandra; Mukabana, Richard; Takken, Willem; Smith, Thomas A

2016-06-06

Many interventions against infectious diseases have geographically diffuse effects. This leads to contamination between arms in cluster-randomized trials (CRTs). Pathogen elimination is the goal of many intervention programs against infectious agents, but contamination means that standard CRT designs and analyses do not provide inferences about the potential of interventions to interrupt pathogen transmission at maximum scale-up. A generic model of disease transmission was used to simulate infections in stepped wedge cluster-randomized trials (SWCRTs) of a transmission-reducing intervention, where the intervention has spatially diffuse effects. Simulations of such trials were then used to examine the potential of such designs for providing generalizable causal inferences about the impact of such interventions, including measurements of the contamination effects. The simulations were applied to the geography of Rusinga Island, Lake Victoria, Kenya, the site of the SolarMal trial on the use of odor-baited mosquito traps to eliminate Plasmodium falciparum malaria. These were used to compare variants in the proposed SWCRT designs for the SolarMal trial. Measures of contamination effects were found that could be assessed in the simulated trials. Inspired by analyses of trials of insecticide-treated nets against malaria when applied to the geography of the SolarMal trial, these measures were found to be robust to different variants of SWCRT design. Analyses of the likely extent of contamination effects supported the choice of cluster size for the trial. The SWCRT is an appropriate design for trials that assess the feasibility of local elimination of a pathogen. The effects of incomplete coverage can be estimated by analyzing the extent of contamination between arms in such trials, and the estimates also support inferences about causality. The SolarMal example illustrates how generic transmission models incorporating spatial smoothing can be used to simulate such trials

Vertical cultural transmission effects on demic front propagation: theory and application to the Neolithic transition in Europe.

PubMed

Fort, Joaquim

2011-05-01

It is shown that Lotka-Volterra interaction terms are not appropriate to describe vertical cultural transmission. Appropriate interaction terms are derived and used to compute the effect of vertical cultural transmission on demic front propagation. They are also applied to a specific example, the Neolithic transition in Europe. In this example, it is found that the effect of vertical cultural transmission can be important (about 30%). On the other hand, simple models based on differential equations can lead to large errors (above 50%). Further physical, biophysical, and cross-disciplinary applications are outlined. © 2011 American Physical Society

Transmissibility of Variant Influenza From Swine to Humans: A Modeling Approach

PubMed Central

Wong, Karen K.; Gambhir, Manoj; Finelli, Lyn; Swerdlow, David L.; Ostroff, Stephen; Reed, Carrie

2015-01-01

Background Respiratory illness was reported among humans and swine at an agricultural fair in 2011; 3 human infections with an influenza A(H3N2) variant (H3N2v) virus were confirmed. Using epidemiologic investigation data, we sought to estimate H3N2v transmissibility from swine to humans. Methods We developed a model of H3N2v transmission among swine and humans and fit it to data from a cohort of 100 agricultural club members reporting swine contact to estimate transmissibility. A sensitivity analysis was performed varying H3N2v prevalence in the club cohort. Using the best-fit transmission probability, we simulated the number of swine-acquired infections among all fair attendees. Results We estimated the best-fit probability of swine-to-human H3N2v transmission per minute of swine contact. Applying this probability to 14 910 people with swine contact at the fair, we estimate that there were 80 (95% confidence interval [CI], 40–133) H3N2v infections among persons aged <20 years and 58 (95% CI, 29–96) H3N2v infections among person aged ≥20 years. Conclusions Using early data from investigation of a new virus with unclear transmission properties, we estimated the transmissibility of H3N2v from swine to humans and the burden of H3N2v among fair attendees. Although the risk of H3N2v virus infection is small for fair attendees with minimal swine contact, large populations attend agricultural events each year, and human cases will likely occur when infected swine are present. PMID:23794727

Postinjection single photon transmission tomography with ordered-subset algorithms for whole-body PET imaging

NASA Astrophysics Data System (ADS)

Bai, Chuanyong; Kinahan, P. E.; Brasse, D.; Comtat, C.; Townsend, D. W.

2002-02-01

We have evaluated the penalized ordered-subset transmission reconstruction (OSTR) algorithm for postinjection single photon transmission scanning. The OSTR algorithm of Erdogan and Fessler (1999) uses a more accurate model for transmission tomography than ordered-subsets expectation-maximization (OSEM) when OSEM is applied to the logarithm of the transmission data. The OSTR algorithm is directly applicable to postinjection transmission scanning with a single photon source, as emission contamination from the patient mimics the effect, in the original derivation of OSTR, of random coincidence contamination in a positron source transmission scan. Multiple noise realizations of simulated postinjection transmission data were reconstructed using OSTR, filtered backprojection (FBP), and OSEM algorithms. Due to the nonspecific task performance, or multiple uses, of the transmission image, multiple figures of merit were evaluated, including image noise, contrast, uniformity, and root mean square (rms) error. We show that: 1) the use of a three-dimensional (3-D) regularizing image roughness penalty with OSTR improves the tradeoffs in noise, contrast, and rms error relative to the use of a two-dimensional penalty; 2) OSTR with a 3-D penalty has improved tradeoffs in noise, contrast, and rms error relative to FBP or OSEM; and 3) the use of image standard deviation from a single realization to estimate the true noise can be misleading in the case of OSEM. We conclude that using OSTR with a 3-D penalty potentially allows for shorter postinjection transmission scans in single photon transmission tomography in positron emission tomography (PET) relative to FBP or OSEM reconstructed images with the same noise properties. This combination of singles+OSTR is particularly suitable for whole-body PET oncology imaging.

41 CFR 102-118.35 - What definitions apply to this part?

Code of Federal Regulations, 2012 CFR

2012-01-01

... between computers instead of paper documents. These electronic transmissions must use established and... 41 Public Contracts and Property Management 3 2012-01-01 2012-01-01 false What definitions apply to this part? 102-118.35 Section 102-118.35 Public Contracts and Property Management Federal Property...

41 CFR 102-118.35 - What definitions apply to this part?

Code of Federal Regulations, 2011 CFR

2011-01-01

... between computers instead of paper documents. These electronic transmissions must use established and... 41 Public Contracts and Property Management 3 2011-01-01 2011-01-01 false What definitions apply to this part? 102-118.35 Section 102-118.35 Public Contracts and Property Management Federal Property...

41 CFR 102-118.35 - What definitions apply to this part?

Code of Federal Regulations, 2013 CFR

2013-07-01

... between computers instead of paper documents. These electronic transmissions must use established and... 41 Public Contracts and Property Management 3 2013-07-01 2013-07-01 false What definitions apply to this part? 102-118.35 Section 102-118.35 Public Contracts and Property Management Federal Property...

41 CFR 102-118.35 - What definitions apply to this part?

Code of Federal Regulations, 2014 CFR

2014-01-01

... between computers instead of paper documents. These electronic transmissions must use established and... 41 Public Contracts and Property Management 3 2014-01-01 2014-01-01 false What definitions apply to this part? 102-118.35 Section 102-118.35 Public Contracts and Property Management Federal Property...

Prediction of the diffuse-field transmission loss of interior natural-ventilation openings and silencers.

PubMed

Bibby, Chris; Hodgson, Murray

2017-01-01

The work reported here, part of a study on the performance and optimal design of interior natural-ventilation openings and silencers ("ventilators"), discusses the prediction of the acoustical performance of such ventilators, and the factors that affect it. A wave-based numerical approach-the finite-element method (FEM)-is applied. The development of a FEM technique for the prediction of ventilator diffuse-field transmission loss is presented. Model convergence is studied with respect to mesh, frequency-sampling and diffuse-field convergence. The modeling technique is validated by way of predictions and the comparison of them to analytical and experimental results. The transmission-loss performance of crosstalk silencers of four shapes, and the factors that affect it, are predicted and discussed. Performance increases with flow-path length for all silencer types. Adding elbows significantly increases high-frequency transmission loss, but does not increase overall silencer performance which is controlled by low-to-mid-frequency transmission loss.

HIV transmission law in the age of treatment-as-prevention.

PubMed

Haire, Bridget; Kaldor, John

2015-12-01

Evidence that treating people with HIV early in infection prevents transmission to sexual partners has reframed HIV prevention paradigms. The resulting emphasis on HIV testing as part of prevention strategies has rekindled the debate as to whether laws that criminalise HIV transmission are counterproductive to the human rights-based public health response. It also raises normative questions about what constitutes 'safe(r) sex' if a person with HIV has undetectable viral load, which has significant implications for sexual practice and health promotion. This paper discusses a recent high-profile Australian case where HIV transmission or exposure has been prosecuted, and considers how the interpretation of law in these instances impacts on HIV prevention paradigms. In addition, we consider the implications of an evolving medical understanding of HIV transmission, and particularly the ability to determine infectiousness through viral load tests, for laws that relate to HIV exposure (as distinct from transmission) offences. We conclude that defensible laws must relate to appreciable risk. Given the evidence that the transmissibility of HIV is reduced to negligible level where viral load is suppressed, this needs to be recognised in the framing, implementation and enforcement of the law. In addition, normative concepts of 'safe(r) sex' need to be expanded to include sex that is 'protected' by means of the positive person being virally suppressed. In jurisdictions where use of a condom has previously mitigated the duty of the person with HIV to disclose to a partner, this might logically also apply to sex that is 'protected' by undetectable viral load. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/

How humans transmit language: horizontal transmission matches word frequencies among peers on Twitter.

PubMed

Bryden, John; Wright, Shaun P; Jansen, Vincent A A

2018-02-01

Language transmission, the passing on of language features such as words between people, is the process of inheritance that underlies linguistic evolution. To understand how language transmission works, we need a mechanistic understanding based on empirical evidence of lasting change of language usage. Here, we analysed 200 million online conversations to investigate transmission between individuals. We find that the frequency of word usage is inherited over conversations, rather than only the binary presence or absence of a word in a person's lexicon. We propose a mechanism for transmission whereby for each word someone encounters there is a chance they will use it more often. Using this mechanism, we measure that, for one word in around every hundred a person encounters, they will use that word more frequently. As more commonly used words are encountered more often, this means that it is the frequencies of words which are copied. Beyond this, our measurements indicate that this per-encounter mechanism is neutral and applies without any further distinction as to whether a word encountered in a conversation is commonly used or not. An important consequence of this is that frequencies of many words can be used in concert to observe and measure language transmission, and our results confirm this. These results indicate that our mechanism for transmission can be used to study language patterns and evolution within populations. © 2018 The Author(s).

Foot-and-mouth disease

USDA-ARS?s Scientific Manuscript database

Foot-and-mouth disease (FMD) is a highly contagious viral disease of cloven-hoofed animals. An outbreak of FMD can have a significant economic impact because of the restrictions on international trade of susceptible animals and their products with FMD-free countries. In this chapter we discuss vario...

Springer index of viruses, 2nd edition chapter - Aphthovirus, Picornaviridae

USDA-ARS?s Scientific Manuscript database

Foot-and-mouth disease (FMD) is a highly contagious viral disease of cloven-hoofed animals. An outbreak of FMD can have a significant economic impact because of the restrictions on international trade of susceptible animals and their products with FMD-free countries. The disease is controlled by sla...

Acoustic contributions of a sound absorbing blanket placed in a double panel structure: absorption versus transmission.

PubMed

Doutres, Olivier; Atalla, Noureddine

2010-08-01

The objective of this paper is to propose a simple tool to estimate the absorption vs. transmission loss contributions of a multilayered blanket unbounded in a double panel structure and thus guide its optimization. The normal incidence airborne sound transmission loss of the double panel structure, without structure-borne connections, is written in terms of three main contributions; (i) sound transmission loss of the panels, (ii) sound transmission loss of the blanket and (iii) sound absorption due to multiple reflections inside the cavity. The method is applied to four different blankets frequently used in automotive and aeronautic applications: a non-symmetric multilayer made of a screen in sandwich between two porous layers and three symmetric porous layers having different pore geometries. It is shown that the absorption behavior of the blanket controls the acoustic behavior of the treatment at low and medium frequencies and its transmission loss at high frequencies. Acoustic treatment having poor sound absorption behavior can affect the performance of the double panel structure.

Improving transmission efficiency of large sequence alignment/map (SAM) files.

PubMed

Sakib, Muhammad Nazmus; Tang, Jijun; Zheng, W Jim; Huang, Chin-Tser

2011-01-01

Research in bioinformatics primarily involves collection and analysis of a large volume of genomic data. Naturally, it demands efficient storage and transfer of this huge amount of data. In recent years, some research has been done to find efficient compression algorithms to reduce the size of various sequencing data. One way to improve the transmission time of large files is to apply a maximum lossless compression on them. In this paper, we present SAMZIP, a specialized encoding scheme, for sequence alignment data in SAM (Sequence Alignment/Map) format, which improves the compression ratio of existing compression tools available. In order to achieve this, we exploit the prior knowledge of the file format and specifications. Our experimental results show that our encoding scheme improves compression ratio, thereby reducing overall transmission time significantly.

Broadband enhanced transmission of acoustic waves through serrated metal gratings

NASA Astrophysics Data System (ADS)

Qi, Dong-Xiang; Fan, Ren-Hao; Deng, Yu-Qiang; Peng, Ru-Wen; Wang, Mu; Jiangnan University Collaboration

In this talk, we present our studies on broadband properties of acoustic waves through metal gratings. We have demonstrated that serrated metal gratings, which introduce gradient coatings, can give rise to broadband transmission enhancement of acoustic waves. Here, we have experimentally and theoretically studied the acoustic transmission properties of metal gratings with or without serrated boundaries. The average transmission is obviously enhanced for serrated metal gratings within a wide frequency range, while the Fabry-Perot resonance is significantly suppressed. An effective medium hypothesis with varying acoustic impedance is proposed to analyze the mechanism, which was verified through comparison with finite-element simulation. The serrated boundary supplies gradient mass distribution and gradient normal acoustic impedance, which could efficiently reduce the boundary reflection. Further, by increasing the region of the serrated boundary, we present a broadband high-transmission grating for wide range of incident angle. Our results may have potential applications to broadband acoustic imaging, acoustic sensing and new acoustic devices. References: [1] Dong-Xiang Qi, Yu-Qiang Deng, Di-Hu Xu, Ren-Hao Fan, Ru-Wen Peng, Ze-Guo Chen, Ming-Hui Lu, X. R. Huang and Mu Wang, Appl. Phys. Lett. 106, 011906 (2015); [2] Dong-Xiang Qi, Ren-Hao Fan, Ru-Wen Peng, Xian-Rong Huang, Ming-Hui Lu, Xu Ni, Qing Hu, and Mu Wang, Applied Physics Letters 101, 061912 (2012).

Effect of oral isoflavone supplementation on vascular endothelial function in postmenopausal women: a meta-analysis of randomized placebo-controlled trials.

PubMed

Li, Shao-Hua; Liu, Xu-Xia; Bai, Yong-Yi; Wang, Xiao-Jian; Sun, Kai; Chen, Jing-Zhou; Hui, Ru-Tai

2010-02-01

The effect of isoflavone on endothelial function in postmenopausal women is controversial. The objective of this study was to evaluate the effect of oral isoflavone supplementation on endothelial function, as measured by flow-mediated dilation (FMD), in postmenopausal women. A meta-analysis of randomized placebo-controlled trials was conducted to evaluate the effect of oral isoflavone supplementation on endothelial function in postmenopausal women. Trials were searched in PubMed, Embase, the Cochrane Library database, and reviews and reference lists of relevant articles. Summary estimates of weighted mean differences (WMDs) and 95% CIs were obtained by using random-effects models. Meta-regression and subgroup analyses were performed to identify the source of heterogeneity. A total of 9 trials were reviewed in the present meta-analysis. Overall, the results of the 9 trials showed that isoflavone significantly increased FMD (WMD: 1.75%; 95% CI: 0.83%, 2.67%; P = 0.0002). Meta-regression analysis indicated that the age-adjusted baseline FMD was inversely related to effect size. Subgroup analysis showed that oral supplementation of isoflavone had no influence on FMD if the age-adjusted baseline FMD was > or = 5.2% (4 trials; WMD: 0.24%; 95% CI: -0.94%, 1.42%; P = 0.69). This improvement seemed to be significant when the age-adjusted baseline FMD levels were <5.2% (5 trials; WMD: 2.22%; 95% CI: 1.15%, 3.30%; P < 0.0001), although significant heterogeneity was still detected in this low-baseline-FMD subgroup. Oral isoflavone supplementation does not improve endothelial function in postmenopausal women with high baseline FMD levels but leads to significant improvement in women with low baseline FMD levels.

Comparison of cluster-based and source-attribution methods for estimating transmission risk using large HIV sequence databases.

PubMed

Le Vu, Stéphane; Ratmann, Oliver; Delpech, Valerie; Brown, Alison E; Gill, O Noel; Tostevin, Anna; Fraser, Christophe; Volz, Erik M

2018-06-01

Phylogenetic clustering of HIV sequences from a random sample of patients can reveal epidemiological transmission patterns, but interpretation is hampered by limited theoretical support and statistical properties of clustering analysis remain poorly understood. Alternatively, source attribution methods allow fitting of HIV transmission models and thereby quantify aspects of disease transmission. A simulation study was conducted to assess error rates of clustering methods for detecting transmission risk factors. We modeled HIV epidemics among men having sex with men and generated phylogenies comparable to those that can be obtained from HIV surveillance data in the UK. Clustering and source attribution approaches were applied to evaluate their ability to identify patient attributes as transmission risk factors. We find that commonly used methods show a misleading association between cluster size or odds of clustering and covariates that are correlated with time since infection, regardless of their influence on transmission. Clustering methods usually have higher error rates and lower sensitivity than source attribution method for identifying transmission risk factors. But neither methods provide robust estimates of transmission risk ratios. Source attribution method can alleviate drawbacks from phylogenetic clustering but formal population genetic modeling may be required to estimate quantitative transmission risk factors. Copyright © 2017 The Authors. Published by Elsevier B.V. All rights reserved.

Re-active Passive (RAP) Devices for Control of Noise Transmission through a Panel

NASA Technical Reports Server (NTRS)

Carneal, James P.; Giovanardi, Marco; Fuller, Chris R.; Palumbo, Daniel L.

2008-01-01

Re-Active Passive (RAP) devices have been developed to control low frequency (<1000 Hz) noise transmission through a panel. These devices use a combination of active, re-active, and passive technologies packaged into a single unit to control a broad frequency range utilizing the strength of each technology over its best suited frequency range. The RAP device uses passive constrained layer damping to cover the relatively high frequency range (>200 Hz), reactive distributed vibration absorber) to cover the medium frequency range (75 to 250 Hz), and active control for controlling low frequencies (<200 Hz). The device was applied to control noise transmission through a panel mounted in a transmission loss test facility. Experimental results are presented for the bare panel, and combinations of passive treatment, reactive treatment, and active control. Results indicate that three RAP devices were able to increase the overall broadband (15-1000 Hz) transmission loss by 9.4 dB. These three devices added a total of 285 grams to the panel mass of 6.0 kg, or approximately 5%, not including control electronics.

Applying Transmission Kikuchi Diffraction (TKD) to Understand Nanogranular Fault Rock Materials

NASA Astrophysics Data System (ADS)

Smith, S. A. F.; Demurtas, M.; Prior, D. J.; Di Toro, G.

2017-12-01

Nanoparticles (<< 1 µm) form in the localized slip zones of natural and experimental faults, but their origin (e.g. seismic vs. aseismic slip) and mechanical behaviour is still debated. Understanding the deformation processes that produce nanoparticles in faults requires an understanding of grain sizes, shapes and crystallographic orientations at higher spatial resolution than is currently possible using standard EBSD techniques. Transmission Kikuchi Diffraction (TKD) in the SEM is a technique that allows to overcome this spatial resolution issue by performing orientation mapping in a commercial EBSD system on electron transparent foils with resolutions that can be below 10 nm. Therefore, the potential of TKD to understand deformation processes in nanoparticles is very high. We present results of TKD analysis performed on mixed calcite-dolomite gouges deformed in a rotary-shear apparatus at slip rates ranging from sub-seismic to co-seismic (30 µm/s to 1 m/s). Samples for TKD were prepared by argon ion slicing, a method that yields relatively large (104 µm2) electron transparent areas, as well as standard argon ion milling. Coupled TKD-EDS analysis allows quantification of elemental contents at a scale of tens of nanometers. Preliminary results show that at a slip velocity of 1 m/s, the localized slip zone that forms in the gouges during shearing is composed of recrystallized grains of calcite and Mg-calcite (the latter being a decarbonation product of dolomite) with an average grain size of c. 300 nm. Individual grains are characterized by relatively straight boundaries, and many triple and quadruple grain junctions are present. The nanogranular aggregates show a polygonised texture with absence of clear porosity and shape preferred orientation. Orientation data show a random distribution of the calcite c-axes. Further investigation will help to obtain new insights into the deformation mechanisms active during seismic faulting in carbonate-bearing faults. The

A Safe Foot-and-Mouth Disease Vaccine Platform with Two Negative Markers for Differentiating Infected from Vaccinated Animals

PubMed Central

Uddowla, Sabena; Hollister, Jason; Pacheco, Juan M.; Rodriguez, Luis L.

2012-01-01

Vaccination of domestic animals with chemically inactivated foot-and-mouth disease virus (FMDV) is widely practiced to control FMD. Currently, FMD vaccine manufacturing requires the growth of large volumes of virulent FMDV in biocontainment-level facilities. Here, two marker FMDV vaccine candidates (A24LL3DYR and A24LL3BPVKV3DYR) featuring the deletion of the leader coding region (Lpro) and one of the 3B proteins were constructed and evaluated. These vaccine candidates also contain either one or two sets of mutations to create negative antigenic markers in the 3D polymerase (3Dpol) and 3B nonstructural proteins. Two mutations in 3Dpol, H27Y and N31R, as well as RQKP9-12→PVKV substitutions, in 3B2 abolish reactivity with monoclonal antibodies targeting the respective sequences in 3Dpol and 3B. Infectious cDNA clones encoding the marker viruses also contain unique restriction endonuclease sites flanking the capsid-coding region that allow for easy derivation of custom designed vaccine candidates. In contrast to the parental A24WT virus, single A24LL3DYR and double A24LL3BPVKV3DYR mutant viruses were markedly attenuated upon inoculation of cattle using the natural aerosol or direct tongue inoculation. Likewise, pigs inoculated with live A24LL3DYR virus in the heel bulbs showed no clinical signs of disease, no fever, and no FMD transmission to in-contact animals. Immunization of cattle with chemically inactivated A24LL3DYR and A24LL3BPVKV3DYR vaccines provided 100% protection from challenge with parental wild-type virus. These attenuated, antigenically marked viruses provide a safe alternative to virulent strains for FMD vaccine manufacturing. In addition, a competitive enzyme-linked immunosorbent assay targeted to the negative markers provides a suitable companion test for differentiating infected from vaccinated animals. PMID:22915802

A safe foot-and-mouth disease vaccine platform with two negative markers for differentiating infected from vaccinated animals.

PubMed

Uddowla, Sabena; Hollister, Jason; Pacheco, Juan M; Rodriguez, Luis L; Rieder, Elizabeth

2012-11-01

Vaccination of domestic animals with chemically inactivated foot-and-mouth disease virus (FMDV) is widely practiced to control FMD. Currently, FMD vaccine manufacturing requires the growth of large volumes of virulent FMDV in biocontainment-level facilities. Here, two marker FMDV vaccine candidates (A(24)LL3D(YR) and A(24)LL3B(PVKV)3D(YR)) featuring the deletion of the leader coding region (L(pro)) and one of the 3B proteins were constructed and evaluated. These vaccine candidates also contain either one or two sets of mutations to create negative antigenic markers in the 3D polymerase (3D(pol)) and 3B nonstructural proteins. Two mutations in 3D(pol), H(27)Y and N(31)R, as well as RQKP(9-12)→PVKV substitutions, in 3B(2) abolish reactivity with monoclonal antibodies targeting the respective sequences in 3D(pol) and 3B. Infectious cDNA clones encoding the marker viruses also contain unique restriction endonuclease sites flanking the capsid-coding region that allow for easy derivation of custom designed vaccine candidates. In contrast to the parental A(24)WT virus, single A(24)LL3D(YR) and double A(24)LL3B(PVKV)3D(YR) mutant viruses were markedly attenuated upon inoculation of cattle using the natural aerosol or direct tongue inoculation. Likewise, pigs inoculated with live A(24)LL3D(YR) virus in the heel bulbs showed no clinical signs of disease, no fever, and no FMD transmission to in-contact animals. Immunization of cattle with chemically inactivated A(24)LL3D(YR) and A(24)LL3B(PVKV)3D(YR) vaccines provided 100% protection from challenge with parental wild-type virus. These attenuated, antigenically marked viruses provide a safe alternative to virulent strains for FMD vaccine manufacturing. In addition, a competitive enzyme-linked immunosorbent assay targeted to the negative markers provides a suitable companion test for differentiating infected from vaccinated animals.

Analysis of Optical CDMA Signal Transmission: Capacity Limits and Simulation Results

NASA Astrophysics Data System (ADS)

Garba, Aminata A.; Yim, Raymond M. H.; Bajcsy, Jan; Chen, Lawrence R.

2005-12-01

We present performance limits of the optical code-division multiple-access (OCDMA) networks. In particular, we evaluate the information-theoretical capacity of the OCDMA transmission when single-user detection (SUD) is used by the receiver. First, we model the OCDMA transmission as a discrete memoryless channel, evaluate its capacity when binary modulation is used in the interference-limited (noiseless) case, and extend this analysis to the case when additive white Gaussian noise (AWGN) is corrupting the received signals. Next, we analyze the benefits of using nonbinary signaling for increasing the throughput of optical CDMA transmission. It turns out that up to a fourfold increase in the network throughput can be achieved with practical numbers of modulation levels in comparison to the traditionally considered binary case. Finally, we present BER simulation results for channel coded binary and[InlineEquation not available: see fulltext.]-ary OCDMA transmission systems. In particular, we apply turbo codes concatenated with Reed-Solomon codes so that up to several hundred concurrent optical CDMA users can be supported at low target bit error rates. We observe that unlike conventional OCDMA systems, turbo-empowered OCDMA can allow overloading (more active users than is the length of the spreading sequences) with good bit error rate system performance.

Computing Lives And Reliabilities Of Turboprop Transmissions

NASA Technical Reports Server (NTRS)

Coy, J. J.; Savage, M.; Radil, K. C.; Lewicki, D. G.

1991-01-01

Computer program PSHFT calculates lifetimes of variety of aircraft transmissions. Consists of main program, series of subroutines applying to specific configurations, generic subroutines for analysis of properties of components, subroutines for analysis of system, and common block. Main program selects routines used in analysis and causes them to operate in desired sequence. Series of configuration-specific subroutines put in configuration data, perform force and life analyses for components (with help of generic component-property-analysis subroutines), fill property array, call up system-analysis routines, and finally print out results of analysis for system and components. Written in FORTRAN 77(IV).

Locomotive dynamic performance under traction/braking conditions considering effect of gear transmissions

NASA Astrophysics Data System (ADS)

Chen, Zaigang; Zhai, Wanming; Wang, Kaiyun

2018-07-01

Traction or braking operations are usually applied to trains or locomotives for acceleration, speed adjustment, and stopping. During these operations, gear transmission equipment plays a very significant role in the delivery of traction or electrical braking power. Failures of the gear transmissions are likely to cause power loses and even threaten the operation safety of the train. Its dynamic performance is closely related to the normal operation and service safety of the entire train, especially under some emergency braking conditions. In this paper, a locomotive-track coupled vertical-longitudinal dynamics model is employed with considering the dynamic action from the gear transmissions. This dynamics model enables the detailed analysis and more practical simulation on the characteristics of power transmission path, namely motor-gear transmission-wheelset-longitudinal motion of locomotive, especially for traction or braking conditions. Multi-excitation sources, such as time-varying mesh stiffness and nonlinear wheel-rail contact excitations, are considered in this study. This dynamics model is then validated by comparing the simulated results with the experimental test results under braking conditions. The calculated results indicate that involvement of gear transmission could reveal the load reduction of the wheelset due to transmitted forces. Vibrations of the wheelset and the motor are dominated by variation of the gear dynamic mesh forces in the low speed range and by rail geometric irregularity in the higher speed range. Rail vertical geometric irregularity could also cause wheelset longitudinal vibrations, and do modulations to the gear dynamic mesh forces. Besides, the hauling weight has little effect on the locomotive vibrations and the dynamic mesh forces of the gear transmissions for both traction and braking conditions under the same running speed.

Nitroglycerin-mediated, but not flow-mediated vasodilation, is associated with blunted nocturnal blood pressure fall in patients with resistant hypertension.

PubMed

Fontes-Guerra, Priscila C A; Cardoso, Claudia R L; Muxfeldt, Elizabeth S; Salles, Gil F

2015-08-01

Endothelial function by flow-mediated (FMD) and nitroglycerin-mediated vasodilations (NMD) was scarcely investigated in resistant hypertension. We aimed to assess the independent correlates of FMD and NMD in resistant hypertensive patients, particularly their associations with ambulatory blood pressures (BP) and nocturnal BP fall patterns. In a cross-sectional study, 280 resistant hypertensive patients performed 24-h ambulatory BP monitoring, carotid-femoral pulse wave velocity, polysomnography, and brachial artery FMD and NMD by high-resolution ultrasonography. Independent correlates of FMD, NMD, and brachial artery diameter (BAD) were assessed by multiple linear and logistic regressions. Median (interquartile range) FMD was 0.75% (-0.6 to +4.4%) and NMD was 11.8% (7.1-18.4%). Baseline BAD and diabetes were independently associated with both FMD and NMD. Older age and prior cardiovascular diseases were associated with altered FMD, whereas higher night-time SBP and lower nocturnal SBP fall were associated with impaired NMD. Moreover, there was a significant gradient of impaired NMD according to blunted nocturnal BP decline patterns. BAD was independently associated with age, sex, BMI, albuminuria, and nocturnal SBP fall. Further adjustments to blood flow velocity, aortic stiffness, plasma aldosterone concentration, and sleep apnea did not change these relationships. NMD, but not FMD, is independently associated with unfavorable night-time BP levels and nondipping patterns, and may be a better cardiovascular risk marker in patients with resistant hypertension. BAD also may provide additional prognostic information.

Proposed design procedure for transmission shafting under fatigue loading

NASA Technical Reports Server (NTRS)

Loewenthal, S. H.

1978-01-01

A new standard for the design of transmission shafting is reported. Computed was the diameter of rotating solid steel shafts under combined cyclic bending and steady torsion is presented. The formula is based on an elliptical variation of endurance strength with torque exhibited by combined stress fatigue data. Fatigue factors are cited to correct specimen bending endurance strength data for use in the shaft formula. A design example illustrates how the method is to be applied.

Inference of Transmission Network Structure from HIV Phylogenetic Trees

DOE PAGES

Giardina, Federica; Romero-Severson, Ethan Obie; Albert, Jan; ...

2017-01-13

Phylogenetic inference is an attractive means to reconstruct transmission histories and epidemics. However, there is not a perfect correspondence between transmission history and virus phylogeny. Both node height and topological differences may occur, depending on the interaction between within-host evolutionary dynamics and between-host transmission patterns. To investigate these interactions, we added a within-host evolutionary model in epidemiological simulations and examined if the resulting phylogeny could recover different types of contact networks. To further improve realism, we also introduced patient-specific differences in infectivity across disease stages, and on the epidemic level we considered incomplete sampling and the age of the epidemic.more » Second, we implemented an inference method based on approximate Bayesian computation (ABC) to discriminate among three well-studied network models and jointly estimate both network parameters and key epidemiological quantities such as the infection rate. Our ABC framework used both topological and distance-based tree statistics for comparison between simulated and observed trees. Overall, our simulations showed that a virus time-scaled phylogeny (genealogy) may be substantially different from the between-host transmission tree. This has important implications for the interpretation of what a phylogeny reveals about the underlying epidemic contact network. In particular, we found that while the within-host evolutionary process obscures the transmission tree, the diversification process and infectivity dynamics also add discriminatory power to differentiate between different types of contact networks. We also found that the possibility to differentiate contact networks depends on how far an epidemic has progressed, where distance-based tree statistics have more power early in an epidemic. Finally, we applied our ABC inference on two different outbreaks from the Swedish HIV-1 epidemic.« less

Evaluating the Evidence for Transmission Distortion in Human Pedigrees

PubMed Central

Meyer, Wynn K.; Arbeithuber, Barbara; Ober, Carole; Ebner, Thomas; Tiemann-Boege, Irene; Hudson, Richard R.; Przeworski, Molly

2012-01-01

Children of a heterozygous parent are expected to carry either allele with equal probability. Exceptions can occur, however, due to meiotic drive, competition among gametes, or viability selection, which we collectively term “transmission distortion” (TD). Although there are several well-characterized examples of these phenomena, their existence in humans remains unknown. We therefore performed a genome-wide scan for TD by applying the transmission disequilibrium test (TDT) genome-wide to three large sets of human pedigrees of European descent: the Framingham Heart Study (FHS), a founder population of European origin (HUTT), and a subset of the Autism Genetic Resource Exchange (AGRE). Genotyping error is an important confounder in this type of analysis. In FHS and HUTT, despite extensive quality control, we did not find sufficient evidence to exclude genotyping error in the strongest signals. In AGRE, however, many signals extended across multiple SNPs, a pattern highly unlikely to arise from genotyping error. We identified several candidate regions in this data set, notably a locus in 10q26.13 displaying a genome-wide significant TDT in combined female and male transmissions and a signature of recent positive selection, as well as a paternal TD signal in 6p21.1, the same region in which a significant TD signal was previously observed in 30 European males. Neither region replicated in FHS, however, and the paternal signal was not visible in sperm competition assays or as allelic imbalance in sperm. In maternal transmissions, we detected no strong signals near centromeres or telomeres, the regions predicted to be most susceptible to female-specific meiotic drive, but we found a significant enrichment of top signals among genes involved in cell junctions. These results illustrate both the potential benefits and the challenges of using the TDT to study transmission distortion and provide candidates for investigation in future studies. PMID:22377632

Inference of Transmission Network Structure from HIV Phylogenetic Trees

DOE Office of Scientific and Technical Information (OSTI.GOV)

Giardina, Federica; Romero-Severson, Ethan Obie; Albert, Jan

Phylogenetic inference is an attractive means to reconstruct transmission histories and epidemics. However, there is not a perfect correspondence between transmission history and virus phylogeny. Both node height and topological differences may occur, depending on the interaction between within-host evolutionary dynamics and between-host transmission patterns. To investigate these interactions, we added a within-host evolutionary model in epidemiological simulations and examined if the resulting phylogeny could recover different types of contact networks. To further improve realism, we also introduced patient-specific differences in infectivity across disease stages, and on the epidemic level we considered incomplete sampling and the age of the epidemic.more » Second, we implemented an inference method based on approximate Bayesian computation (ABC) to discriminate among three well-studied network models and jointly estimate both network parameters and key epidemiological quantities such as the infection rate. Our ABC framework used both topological and distance-based tree statistics for comparison between simulated and observed trees. Overall, our simulations showed that a virus time-scaled phylogeny (genealogy) may be substantially different from the between-host transmission tree. This has important implications for the interpretation of what a phylogeny reveals about the underlying epidemic contact network. In particular, we found that while the within-host evolutionary process obscures the transmission tree, the diversification process and infectivity dynamics also add discriminatory power to differentiate between different types of contact networks. We also found that the possibility to differentiate contact networks depends on how far an epidemic has progressed, where distance-based tree statistics have more power early in an epidemic. Finally, we applied our ABC inference on two different outbreaks from the Swedish HIV-1 epidemic.« less

Modeling the effects of weather and climate change on malaria transmission.

PubMed

Parham, Paul Edward; Michael, Edwin

2010-05-01

In recent years, the impact of climate change on human health has attracted considerable attention; the effects on malaria have been of particular interest because of its disease burden and its transmission sensitivity to environmental conditions. We investigated and illustrated the role that dynamic process-based mathematical models can play in providing strategic insights into the effects of climate change on malaria transmission. We evaluated a relatively simple model that permitted valuable and novel insights into the simultaneous effects of rainfall and temperature on mosquito population dynamics, malaria invasion, persistence and local seasonal extinction, and the impact of seasonality on transmission. We illustrated how large-scale climate simulations and infectious disease systems may be modeled and analyzed and how these methods may be applied to predicting changes in the basic reproduction number of malaria across Tanzania. We found extinction to be more strongly dependent on rainfall than on temperature and identified a temperature window of around 32-33 degrees C where endemic transmission and the rate of spread in disease-free regions is optimized. This window was the same for Plasmodium falciparum and P. vivax, but mosquito density played a stronger role in driving the rate of malaria spread than did the Plasmodium species. The results improved our understanding of how temperature shifts affect the global distribution of at-risk regions, as well as how rapidly malaria outbreaks take off within vulnerable populations. Disease emergence, extinction, and transmission all depend strongly on climate. Mathematical models offer powerful tools for understanding geographic shifts in incidence as climate changes. Nonlinear dependences of transmission on climate necessitates consideration of both changing climate trends and variability across time scales of interest.

Association of Multifocal Fibromuscular Dysplasia in Elderly Patients With a More Benign Clinical Phenotype: Data From the US Registry for Fibromuscular Dysplasia.

PubMed

Bagh, Imad; Olin, Jeffrey W; Froehlich, James B; Kline-Rogers, Eva; Gray, Bruce; Kim, Esther S H; Sharma, Aditya; Weinberg, Ido; Wells, Bryan J; Gu, Xiaokui; Gornik, Heather L

2018-06-20

Fibromuscular dysplasia (FMD) is a nonatherosclerotic arterial disease that predominately affects women and is most commonly diagnosed in middle age. The natural history of FMD among patients diagnosed at an older age is not well understood. To examine the differences in clinical presentation, arterial bed involvement, vascular events, and need for vascular procedures between younger and older patients with FMD. Analysis of baseline data for patients enrolled in the US Registry for FMD as of December 15, 2016, at referral centers participating in the US Registry for FMD. Patients 18 years and older at the time of enrollment and those with only confirmed multifocal (string of beads type) FMD were included. Patients were categorized according to age at the time of diagnosis (≥65 years vs <65 years). Prevalence of specific symptoms, vascular events, and prior vascular procedures at the time of enrollment in the registry. A total of 1016 patients were included in the analysis, of whom, 170 (16.7%) were 65 years or older at the time of diagnosis. Older patients with FMD were more likely to be asymptomatic at the time of diagnosis (4.2% vs 1.4%; P = .02). Headache and pulsatile tinnitus, both common manifestations of FMD, were less common in older patients (40.5% vs 69.1%; P < .001 and 30% vs 44.6%; P < .001, respectively). Extracranial carotid arteries were more commonly involved in patients 65 years or older at time of diagnosis (87% vs 79.4%; P = .03). There was no difference in prevalence of renal artery involvement, number of arterial beds involved, or diagnosis of any aneurysm. Patients 65 years or older were less likely to have had a major vascular event (37.1% vs 46.1%; P = .03) and fewer had undergone a therapeutic vascular procedure (18.5% vs 33.1%; P < .001). In the US Registry for FMD, patients 65 years or older at the time of diagnosis of multifocal FMD were more likely to be asymptomatic, had lower prevalence of major vascular

Anisotropic Babinet-Invertible Metasurfaces to Realize Transmission-Reflection Switching for Orthogonal Polarizations of Light

NASA Astrophysics Data System (ADS)

Nakata, Yosuke; Urade, Yoshiro; Okimura, Kunio; Nakanishi, Toshihiro; Miyamaru, Fumiaki; Takeda, Mitsuo Wada; Kitano, Masao

2016-10-01

The electromagnetic properties of an extremely thin metallic checkerboard drastically change from resonant reflection (transmission) to resonant transmission (reflection) when the local electrical conductivity at the interconnection points of the checkerboard is switched. To date, such critical transitions of metasurfaces have been applied only when they have fourfold rotational symmetry, and their application to polarization control, which requires anisotropy, has been unexplored. To overcome this applicability limitation and open up alternative pathways for dynamic deep-subwavelength polarization control by utilizing critical transitions of checkerboardlike metasurfaces, we introduce a universal class of anisotropic Babinet-invertible metasurfaces enabling transmission-reflection switching for each orthogonally polarized wave. As an application of anisotropic Babinet-invertible metasurfaces, we experimentally realize a reconfigurable terahertz polarizer whose transmitting axis can be dynamically rotated by 90°.

SimWIND: A Geospatial Infrastructure Model for Wind Energy Production and Transmission

NASA Astrophysics Data System (ADS)

Middleton, R. S.; Phillips, B. R.; Bielicki, J. M.

2009-12-01

Wind is a clean, enduring energy resource with a capacity to satisfy 20% or more of the electricity needs in the United States. A chief obstacle to realizing this potential is the general paucity of electrical transmission lines between promising wind resources and primary load centers. Successful exploitation of this resource will therefore require carefully planned enhancements to the electric grid. To this end, we present the model SimWIND for self-consistent optimization of the geospatial arrangement and cost of wind energy production and transmission infrastructure. Given a set of wind farm sites that satisfy meteorological viability and stakeholder interest, our model simultaneously determines where and how much electricity to produce, where to build new transmission infrastructure and with what capacity, and where to use existing infrastructure in order to minimize the cost for delivering a given amount of electricity to key markets. Costs and routing of transmission line construction take into account geographic and social factors, as well as connection and delivery expenses (transformers, substations, etc.). We apply our model to Texas and consider how findings complement the 2008 Electric Reliability Council of Texas (ERCOT) Competitive Renewable Energy Zones (CREZ) Transmission Optimization Study. Results suggest that integrated optimization of wind energy infrastructure and cost using SimWIND could play a critical role in wind energy planning efforts.

The design and analysis of single flank transmission error tester for loaded gears

NASA Technical Reports Server (NTRS)

Bassett, Duane E.; Houser, Donald R.

1987-01-01

To strengthen the understanding of gear transmission error and to verify mathematical models which predict them, a test stand that will measure the transmission error of gear pairs under design loads has been investigated. While most transmission error testers have been used to test gear pairs under unloaded conditions, the goal of this report was to design and perform dynamic analysis of a unique tester with the capability of measuring the transmission error of gears under load. This test stand will have the capability to continuously load a gear pair at torques up to 16,000 in-lb at shaft speeds from 0 to 5 rpm. Error measurement will be accomplished with high resolution optical encoders and the accompanying signal processing unit from an existing unloaded transmission error tester. Input power to the test gear box will be supplied by a dc torque motor while the load will be applied with a similar torque motor. A dual input, dual output control system will regulate the speed and torque of the system. This control system's accuracy and dynamic response were analyzed and it was determined that proportional plus derivative speed control is needed in order to provide the precisely constant torque necessary for error-free measurement.

Combining livestock trade patterns with phylogenetics to help understand the spread of foot and mouth disease in sub-Saharan Africa, the Middle East and Southeast Asia.

PubMed

Di Nardo, A; Knowles, N J; Paton, D J

2011-04-01

International trade in animals and their products is recognised as a primary determinant of the global epidemiology of transboundary diseases such as foot and mouth disease (FMD). As well as causing serious production losses, FMD is highly contagious, being transmitted through multiple routes and hosts, which makes it one of the most important diseases affecting trade in livestock. Its occurrence has dramatic consequences for the agricultural economy of a normally disease-free country, as well as for the livelihoods and income generation of developing countries where the disease continues to be endemic. In the dynamic of FMD virus (FMDV) dispersal across the globe, phylogenetic inference from molecular sequences of isolated viruses makes a significant contribution to investigating the evolutionary and spatial pathways underlying the source of FMD epidemics. Matching data on livestock movement with molecular epidemiology can enhance our fundamental understanding when reconstructing the spread of the virus between geographical regions, which is essential for the development of FMD control strategies worldwide. This paper reviews the global situation of FMD in the last ten years, combining phylogenetic insights with information on livestock production systems and international trade to analyse the epidemiological dynamics of FMD and the sources of FMDV introductions at a regional level in sub-Saharan Africa, the Middle East and Southeast Asia.

Evaluation of fiber-modified adenovirus vector-vaccine against foot-and-mouth diseaes in cattle

USDA-ARS?s Scientific Manuscript database

Novel vaccination approaches against foot-and-mouth-disease (FMD) include the use of a replication-defective human adenovirus type 5 vector (Ad5) that contains the capsid encoding regions of FMD virus (FMDV). An Ad5.A24 has proven effective as a vaccine against FMD in swine and cattle. However, ther...

Design parameters of stainless steel plates for maximizing high frequency ultrasound wave transmission.

PubMed

Michaud, Mark; Leong, Thomas; Swiergon, Piotr; Juliano, Pablo; Knoerzer, Kai

2015-09-01

This work validated, in a higher frequency range, the theoretical predictions made by Boyle around 1930, which state that the optimal transmission of sound pressure through a metal plate occurs when the plate thickness equals a multiple of half the wavelength of the sound wave. Several reactor design parameters influencing the transmission of high frequency ultrasonic waves through a stainless steel plate were examined. The transmission properties of steel plates of various thicknesses (1-7 mm) were studied for frequencies ranging from 400 kHz to 2 MHz and at different distances between plates and transducers. It was shown that transmission of sound pressure through a steel plate showed high dependence of the thickness of the plate to the frequency of the sound wave (thickness ratio). Maximum sound pressure transmission of ∼ 60% of the incident pressure was observed when the ratio of the plate thickness to the applied frequency was a multiple of a half wavelength (2 MHz, 6mm stainless steel plate). In contrast, minimal sound pressure transmission (∼ 10-20%) was measured for thickness ratios that were not a multiple of a half wavelength. Furthermore, the attenuation of the sound pressure in the transmission region was also investigated. As expected, it was confirmed that higher frequencies have more pronounced sound pressure attenuation than lower frequencies. The spatial distribution of the sound pressure transmitted through the plate characterized by sonochemiluminescence measurements using luminol emission, supports the validity of the pressure measurements in this study. Copyright © 2015 Elsevier B.V. All rights reserved.

Studying Vertical Microbiome Transmission from Mothers to Infants by Strain-Level Metagenomic Profiling.

PubMed

Asnicar, Francesco; Manara, Serena; Zolfo, Moreno; Truong, Duy Tin; Scholz, Matthias; Armanini, Federica; Ferretti, Pamela; Gorfer, Valentina; Pedrotti, Anna; Tett, Adrian; Segata, Nicola

2017-01-01

The gut microbiome becomes shaped in the first days of life and continues to increase its diversity during the first months. Links between the configuration of the infant gut microbiome and infant health are being shown, but a comprehensive strain-level assessment of microbes vertically transmitted from mother to infant is still missing. We collected fecal and breast milk samples from multiple mother-infant pairs during the first year of life and applied shotgun metagenomic sequencing followed by computational strain-level profiling. We observed that several specific strains, including those of Bifidobacterium bifidum , Coprococcus comes , and Ruminococcus bromii , were present in samples from the same mother-infant pair, while being clearly distinct from those carried by other pairs, which is indicative of vertical transmission. We further applied metatranscriptomics to study the in vivo gene expression of vertically transmitted microbes and found that transmitted strains of Bacteroides and Bifidobacterium species were transcriptionally active in the guts of both adult and infant. By combining longitudinal microbiome sampling and newly developed computational tools for strain-level microbiome analysis, we demonstrated that it is possible to track the vertical transmission of microbial strains from mother to infants and to characterize their transcriptional activity. Our work provides the foundation for larger-scale surveys to identify the routes of vertical microbial transmission and its influence on postinfancy microbiome development. IMPORTANCE Early infant exposure is important in the acquisition and ultimate development of a healthy infant microbiome. There is increasing support for the idea that the maternal microbial reservoir is a key route of microbial transmission, and yet much is inferred from the observation of shared species in mother and infant. The presence of common species, per se , does not necessarily equate to vertical transmission, as species

Studying Vertical Microbiome Transmission from Mothers to Infants by Strain-Level Metagenomic Profiling

PubMed Central

Manara, Serena; Truong, Duy Tin; Armanini, Federica; Ferretti, Pamela; Gorfer, Valentina; Pedrotti, Anna

2017-01-01

ABSTRACT The gut microbiome becomes shaped in the first days of life and continues to increase its diversity during the first months. Links between the configuration of the infant gut microbiome and infant health are being shown, but a comprehensive strain-level assessment of microbes vertically transmitted from mother to infant is still missing. We collected fecal and breast milk samples from multiple mother-infant pairs during the first year of life and applied shotgun metagenomic sequencing followed by computational strain-level profiling. We observed that several specific strains, including those of Bifidobacterium bifidum, Coprococcus comes, and Ruminococcus bromii, were present in samples from the same mother-infant pair, while being clearly distinct from those carried by other pairs, which is indicative of vertical transmission. We further applied metatranscriptomics to study the in vivo gene expression of vertically transmitted microbes and found that transmitted strains of Bacteroides and Bifidobacterium species were transcriptionally active in the guts of both adult and infant. By combining longitudinal microbiome sampling and newly developed computational tools for strain-level microbiome analysis, we demonstrated that it is possible to track the vertical transmission of microbial strains from mother to infants and to characterize their transcriptional activity. Our work provides the foundation for larger-scale surveys to identify the routes of vertical microbial transmission and its influence on postinfancy microbiome development. IMPORTANCE Early infant exposure is important in the acquisition and ultimate development of a healthy infant microbiome. There is increasing support for the idea that the maternal microbial reservoir is a key route of microbial transmission, and yet much is inferred from the observation of shared species in mother and infant. The presence of common species, per se, does not necessarily equate to vertical transmission, as

Interspecific social networks promote information transmission in wild songbirds.

PubMed

Farine, Damien R; Aplin, Lucy M; Sheldon, Ben C; Hoppitt, William

2015-03-22

Understanding the functional links between social structure and population processes is a central aim of evolutionary ecology. Multiple types of interactions can be represented by networks drawn for the same population, such as kinship, dominance or affiliative networks, but the relative importance of alternative networks in modulating population processes may not be clear. We illustrate this problem, and a solution, by developing a framework for testing the importance of different types of association in facilitating the transmission of information. We apply this framework to experimental data from wild songbirds that form mixed-species flocks, recording the arrival (patch discovery) of individuals to novel foraging sites. We tested whether intraspecific and interspecific social networks predicted the spread of information about novel food sites, and found that both contributed to transmission. The likelihood of acquiring information per unit of connection to knowledgeable individuals increased 22-fold for conspecifics, and 12-fold for heterospecifics. We also found that species varied in how much information they produced, suggesting that some species play a keystone role in winter foraging flocks. More generally, these analyses demonstrate that this method provides a powerful approach, using social networks to quantify the relative transmission rates across different social relationships.

Standard and transmission-based precautions: an update for dentistry.

PubMed

Harte, Jennifer A

2010-05-01

Standard Precautions are the foundation of all infection control programs and include infection control practices that apply to all patients and situations regardless of whether the infection status is suspected, confirmed or unknown. The author reviewed Standard Precautions, including two new elements introduced by the Centers for Disease Control and Prevention in 2007: safe injection practices and respiratory hygiene and cough etiquette. Standard Precautions sometimes are referred to as the first tier of precautions because for some diseases and circumstances, transmission cannot be interrupted completely with Standard Precautions alone and it is necessary to use second-tier Transmission-Based Precautions. The author reviewed the three categories of Transmission-Based Precautions--Airborne, Droplet and Contact--with an emphasis on their use in dental health care outpatient settings. Dental health care personnel (DHCP) should update their infection control programs to ensure that safe injection practices and respiratory hygiene and cough etiquette measures are used routinely. In addition, with the emergence of new pathogens, re-emergence of variant organisms and more patients seeking care in ambulatory care facilities, DHCP need to be aware of additional measures to take when treating patients in their offices who are actively infected with certain organisms to protect fully other patients, their staff members and themselves.

Transmission effects in unfolding electronic-vibrational electron-molecule energy-loss spectra

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wang Shiyang; Khakoo, Murtadha A.; Johnson, Paul V.

2006-03-15

The results of an investigation concerning the sensitivity of conventional unfolding methods applied to electronic-vibrational electron-energy-loss spectra to the transmission efficiency of electron spectrometers are presented. This investigation was made in an effort to understand differences in the differential cross sections for excitation of low-lying electronic states determined experimentally by various groups using electronic-vibrational energy-loss spectra of N{sub 2}. In these experiments, very similar spectral unfolding methods were used, which relied on similar Franck-Condon factors. However, the overall analyses of the electron scattering spectra (by the individual groups) resulted in large differences among the differential cross sections determined from thesemore » energy-loss spectra. The transmission response of the experimental apparatus to different-energy scattered electrons has often been discussed as a key factor that caused these disagreements. The present investigation shows in contrast that the effect of transmission is smaller than that required to independently explain such differences, implying that other systematic effects are responsible for the existing differences between measurements.« less

Transmission properties of C60 ions through micro- and nano-capillaries

NASA Astrophysics Data System (ADS)

Tsuchida, Hidetsugu; Majima, Takuya; Tomita, Shigeo; Sasa, Kimikazu; Narumi, Kazumasa; Saitoh, Yuichi; Chiba, Atsuya; Yamada, Keisuke; Hirata, Koichi; Shibata, Hiromi; Itoh, Akio

2013-11-01

We apply the capillary beam-focusing method for the C60 fullerene projectiles in the velocity range between 0.14 and 0.2 a.u. We study the C60 transmission properties through two different types of capillaries: (1) borosilicate glass microcapillary with an outlet diameter of 5.5 μm, and (2) Al2O3 multi-capillary foil with a pore size of about 70 nm and a high aspect ratio of about 750. We measured the transmitted particle composition by using the electrostatic deflection method combined with the microchannel plate imaging technique. For the experiments with the single microcapillary, the main transmission component is found to be primary C60 beams that are focused in the area equal to the capillary outlet diameter. Minor components are charge-exchanged C60 ions and charged or neutral fragments (fullerene-like C60-2m and small Cn particles), and their fractions decrease with decreasing the projectile velocity. It is concluded that the C60 transmission fraction is considerably high for both types of the capillaries in the present velocity range.

Solid-state nanopores of controlled geometry fabricated in a transmission electron microscope

NASA Astrophysics Data System (ADS)

Qian, Hui; Egerton, Ray F.

2017-11-01

Energy-filtered transmission electron microscopy and electron tomography were applied to in situ studies of the formation, shape, and diameter of nanopores formed in a silicon nitride membrane in a transmission electron microscope. The nanopore geometry was observed in three dimensions by electron tomography. Drilling conditions, such as probe current, beam convergence angle, and probe position, affect the formation rate and the geometry of the pores. With a beam convergence semi-angle of α = 22 mrad, a conical shaped nanopore is formed but at α = 45 mrad, double-cone (hourglass-shaped) nanopores were produced. Nanopores with an effective diameter between 10 nm and 1.8 nm were fabricated by controlling the drilling time.

Guaranteed estimation of solutions to Helmholtz transmission problems with uncertain data from their indirect noisy observations

NASA Astrophysics Data System (ADS)

Podlipenko, Yu. K.; Shestopalov, Yu. V.

2017-09-01

We investigate the guaranteed estimation problem of linear functionals from solutions to transmission problems for the Helmholtz equation with inexact data. The right-hand sides of equations entering the statements of transmission problems and the statistical characteristics of observation errors are supposed to be unknown and belonging to certain sets. It is shown that the optimal linear mean square estimates of the above mentioned functionals and estimation errors are expressed via solutions to the systems of transmission problems of the special type. The results and techniques can be applied in the analysis and estimation of solution to forward and inverse electromagnetic and acoustic problems with uncertain data that arise in mathematical models of the wave diffraction on transparent bodies.

Infectious disease transmission and contact networks in wildlife and livestock

PubMed Central

Craft, Meggan E.

2015-01-01

The use of social and contact networks to answer basic and applied questions about infectious disease transmission in wildlife and livestock is receiving increased attention. Through social network analysis, we understand that wild animal and livestock populations, including farmed fish and poultry, often have a heterogeneous contact structure owing to social structure or trade networks. Network modelling is a flexible tool used to capture the heterogeneous contacts of a population in order to test hypotheses about the mechanisms of disease transmission, simulate and predict disease spread, and test disease control strategies. This review highlights how to use animal contact data, including social networks, for network modelling, and emphasizes that researchers should have a pathogen of interest in mind before collecting or using contact data. This paper describes the rising popularity of network approaches for understanding transmission dynamics in wild animal and livestock populations; discusses the common mismatch between contact networks as measured in animal behaviour and relevant parasites to match those networks; and highlights knowledge gaps in how to collect and analyse contact data. Opportunities for the future include increased attention to experiments, pathogen genetic markers and novel computational tools. PMID:25870393

Strain-specific antibodies reduce co-feeding transmission of the Lyme disease pathogen, Borrelia afzelii.

PubMed

Jacquet, Maxime; Durand, Jonas; Rais, Olivier; Voordouw, Maarten J

2016-03-01

Vector-borne pathogens use a diversity of strategies to evade the vertebrate immune system. Co-feeding transmission is a potential immune evasion strategy because the vector-borne pathogen minimizes the time spent in the vertebrate host. We tested whether the Lyme disease pathogen, Borrelia afzelii, can use co-feeding transmission to escape the acquired immune response in the vertebrate host. We induced a strain-specific, protective antibody response by immunizing mice with one of two variants of OspC (A3 and A10), the highly variable outer surface protein C of Borrelia pathogens. Immunized mice were challenged via tick bite with B. afzelii strains A3 or A10 and infested with larval ticks at days 2 and 34 post-infection to measure co-feeding and systemic transmission respectively. Antibodies against a particular OspC variant significantly reduced co-feeding transmission of the targeted (homologous) strain but not the non-targeted (heterologous) strain. Cross-immunity between OspC antigens had no effect in co-feeding ticks but reduced the spirochaete load twofold in ticks infected via systemic transmission. In summary, OspC-specific antibodies reduced co-feeding transmission of a homologous but not a heterologous strain of B. afzelii. Co-feeding transmission allowed B. afzelii to evade the negative consequences of cross-immunity on the tick spirochaete load. © 2015 Society for Applied Microbiology and John Wiley & Sons Ltd.

Automated manual transmission shift sequence controller

DOEpatents

Lawrie, Robert E.; Reed, Richard G.; Rausen, David J.

2000-02-01

A powertrain system for a hybrid vehicle. The hybrid vehicle includes a heat engine, such as a diesel engine, and an electric machine, which operates as both, an electric motor and an alternator, to power the vehicle. The hybrid vehicle also includes a manual-style transmission configured to operate as an automatic transmission from the perspective of the driver. The engine and the electric machine drive an input shaft which in turn drives an output shaft of the transmission. In addition to driving the transmission, the electric machine regulates the speed of the input shaft in order to synchronize the input shaft during either an upshift or downshift of the transmission by either decreasing or increasing the speed of the input shaft. When decreasing the speed of the input shaft, the electric motor functions as an alternator to produce electrical energy which may be stored by a storage device. Operation of the transmission is controlled by a transmission controller which receives input signals and generates output signals to control shift and clutch motors to effect smooth launch, upshift shifts, and downshifts of the transmission, so that the transmission functions substantially as an automatic transmission from the perspective of the driver, while internally substantially functioning as a manual transmission.

Automated manual transmission mode selection controller

DOEpatents

Lawrie, Robert E.

1999-11-09

A powertrain system for a hybrid vehicle. The hybrid vehicle includes a heat engine, such as a diesel engine, and an electric machine, which operates as both an electric motor and an alternator, to power the vehicle. The hybrid vehicle also includes a manual-style transmission configured to operate as an automatic transmission from the perspective of the driver. The engine and the electric machine drive an input shaft which in turn drives an output shaft of the transmission. In addition to driving the transmission, the electric machine regulates the speed of the input shaft in order to synchronize the input shaft during either an upshift or downshift of the transmission by either decreasing or increasing the speed of the input shaft. When decreasing the speed of the input shaft, the electric motor functions as an alternator to produce electrical energy which may be stored by a storage device. Operation of the transmission is controlled by a transmission controller which receives input signals and generates output signals to control shift and clutch motors to effect smooth launch, upshift shifts, and downshifts of the transmission, so that the transmission functions substantially as an automatic transmission from the perspective of the driver, while internally substantially functioning as a manual transmission.

Auctionable fixed transmission rights for congestion management

NASA Astrophysics Data System (ADS)

Alomoush, Muwaffaq Irsheid

Electric power deregulation has proposed a major change to the regulated utility monopoly. The change manifests the main part of engineers' efforts to reshape three components of today's regulated monopoly: generation, distribution and transmission. In this open access deregulated power market, transmission network plays a major role, and transmission congestion is a major problem that requires further consideration especially when inter-zonal/intra-zonal scheme is implemented. Declaring that engineering studies and experience are the criteria to define zonal boundaries or defining a zone based on the fact that a zone is a densely interconnected area (lake) and paths connecting these densely interconnected areas are inter-zonal lines will render insufficient and fuzzy definitions. Moreover, a congestion problem formulation should take into consideration interactions between intra-zonal and inter-zonal flows and their effects on power systems. In this thesis, we introduce a procedure for minimizing the number of adjustments of preferred schedules to alleviate congestion and apply control schemes to minimize interactions between zones. In addition, we give the zone definition a certain criterion based on the Locational Marginal Price (LMP). This concept will be used to define congestion zonal boundaries and to decide whether any zone should be merged with another zone or split into new zones. The thesis presents a unified scheme that combines zonal and FTR schemes to manage congestion. This combined scheme is utilized with LMPs to define zonal boundaries more appropriately. The presented scheme gains the best features of the FTR scheme, which are providing financial certainty, maximizing the efficient use of the system and making users pay for the actual use of congested paths. LMPs may give an indication of the impact of wheeling transactions, and calculations of and comparisons of LMPs with and without wheeling transactions should be adequate criteria to approve

Clinical Features and Endovascular Management of Iliac Artery Fibromuscular Dysplasia

PubMed Central

Ketha, Siva S.; Bjarnason, Haraldur; Oderich, Gustavo S.; Misra, Sanjay

2014-01-01

Purpose To identify the spectrum of clinical presentation of iliac artery fibromuscular dysplasia (FMD) and to evaluate the outcomes of endovascular management of iliac FMD for claudication. Methods and materials All patients in our institution with a diagnosis of FMD between January 1980 and December 2010 were identified. 14 patients were found to have FMD of the iliac arteries. Associated risk factors included hypertension (79%), hyperlipidemia (64%), smoking history (36%), coronary artery disease (21%), diabetes (0 %), and obesity (36%). Results Eight (57%) patients were incidentally found to have iliac FMD on imaging. 6 (43%) patients had life style limiting claudication involving one or both extremities. All 6 patients were reported as mild peripheral arterial disease (PAD) based on ankle brachial index (ABI) measurements (0.7 to 0.9). These six patients underwent 10 endovascular procedures for claudication including angioplasty (n=8) and self-expanding stent placement (n=2). Mean symptom free survival was 56.3 months. Conclusion Iliac FMD may be found incidentally or may present with disabling claudication that is amenable to endovascular treatment. PMID:24768236

New fully automated software for assessment of brachial artery flow- mediated dilation with advantages of continuous measurement.

PubMed

Ercan, Ertuğrul; Kırılmaz, Bahadır; Kahraman, İsmail; Bayram, Vildan; Doğan, Hüseyin

2012-11-01

Flow-mediated dilation (FMD) is used to evaluate endothelial functions. Computer-assisted analysis utilizing edge detection permits continuous measurements along the vessel wall. We have developed a new fully automated software program to allow accurate and reproducible measurement. FMD has been measured and analyzed in 18 coronary artery disease (CAD) patients and 17 controls both by manually and by the software developed (computer supported) methods. The agreement between methods was assessed by Bland-Altman analysis. The mean age, body mass index and cardiovascular risk factors were higher in CAD group. Automated FMD% measurement for the control subjects was 18.3±8.5 and 6.8±6.5 for the CAD group (p=0.0001). The intraobserver and interobserver correlation for automated measurement was high (r=0.974, r=0.981, r=0.937, r=0.918, respectively). Manual FMD% at 60th second was correlated with automated FMD % (r=0.471, p=0.004). The new fully automated software© can be used to precise measurement of FMD with low intra- and interobserver variability than manual assessment.

Reciprocity relations in transmission electron microscopy: A rigorous derivation.

PubMed

Krause, Florian F; Rosenauer, Andreas

2017-01-01

A concise derivation of the principle of reciprocity applied to realistic transmission electron microscopy setups is presented making use of the multislice formalism. The equivalence of images acquired in conventional and scanning mode is thereby rigorously shown. The conditions for the applicability of the found reciprocity relations is discussed. Furthermore the positions of apertures in relation to the corresponding lenses are considered, a subject which scarcely has been addressed in previous publications. Copyright © 2016 Elsevier Ltd. All rights reserved.

Energy transmission using recyclable quantum entanglement

PubMed Central

Ye, Ming-Yong; Lin, Xiu-Min

2016-01-01

It is known that faster-than-light (FTL) transmission of energy could be achieved if the transmission were considered in the framework of non-relativistic classical mechanics. Here we show that FTL transmission of energy could also be achieved if the transmission were considered in the framework of non-relativistic quantum mechanics. In our transmission protocol a two-spin Heisenberg model is considered and the energy is transmitted by two successive local unitary operations on the initially entangled spins. Our protocol does not mean that FTL transmission can be achieved in reality when the theory of relativity is considered, but it shows that quantum entanglement can be used in a recyclable way in energy transmission. PMID:27465431

L2-LBMT: A Layered Load Balance Routing Protocol for underwater multimedia data transmission

NASA Astrophysics Data System (ADS)

Lv, Ze; Tang, Ruichun; Tao, Ye; Sun, Xin; Xu, Xiaowei

2017-12-01

Providing highly efficient underwater transmission of mass multimedia data is challenging due to the particularities of the underwater environment. Although there are many schemes proposed to optimize the underwater acoustic network communication protocols, from physical layer, data link layer, network layer to transport layer, the existing routing protocols for underwater wireless sensor network (UWSN) still cannot well deal with the problems in transmitting multimedia data because of the difficulties involved in high energy consumption, low transmission reliability or high transmission delay. It prevents us from applying underwater multimedia data to real-time monitoring of marine environment in practical application, especially in emergency search, rescue operation and military field. Therefore, the inefficient transmission of marine multimedia data has become a serious problem that needs to be solved urgently. In this paper, A Layered Load Balance Routing Protocol (L2-LBMT) is proposed for underwater multimedia data transmission. In L2-LBMT, we use layered and load-balance Ad Hoc Network to transmit data, and adopt segmented data reliable transfer (SDRT) protocol to improve the data transport reliability. And a 3-node variant of tornado (3-VT) code is also combined with the Ad Hoc Network to transmit little emergency data more quickly. The simulation results show that the proposed protocol can balance energy consumption of each node, effectively prolong the network lifetime and reduce transmission delay of marine multimedia data.

Transmission dynamics: critical questions and challenges

PubMed Central

2017-01-01

This article overviews the dynamics of disease transmission in one-host–one-parasite systems. Transmission is the result of interacting host and pathogen processes, encapsulated with the environment in a ‘transmission triangle’. Multiple transmission modes and their epidemiological consequences are often not understood because the direct measurement of transmission is difficult. However, its different components can be analysed using nonlinear transmission functions, contact matrices and networks. A particular challenge is to develop such functions for spatially extended systems. This is illustrated for vector transmission where a ‘perception kernel’ approach is developed that incorporates vector behaviour in response to host spacing. A major challenge is understanding the relative merits of the large number of approaches to quantifying transmission. The evolution of transmission mode itself has been a rather neglected topic, but is important in the context of understanding disease emergence and genetic variation in pathogens. Disease impacts many biological processes such as community stability, the evolution of sex and speciation, yet the importance of different transmission modes in these processes is not understood. Broader approaches and ideas to disease transmission are important in the public health realm for combating newly emerging infections. This article is part of the themed issue ‘Opening the black box: re-examining the ecology and evolution of parasite transmission’. PMID:28289255

Flow-mediated dilation in athletes: influence of aging.

PubMed

Montero, David; Padilla, Jaume; Diaz-Cañestro, Candela; Muris, Dennis M J; Pyke, Kyra E; Obert, Philippe; Walther, Guillaume

2014-11-01

Controversy exists on whether endothelial function is enhanced in athletes. We sought to systematically review the literature and determine whether endothelial function, as assessed by flow-mediated dilation (FMD), is greater in athletes across all ages relative to that in their age-matched counterparts. We conducted a systematic search on MEDLINE, Cochrane, Scopus, and Web of Science since their inceptions until July 2013 for articles evaluating FMD in athletes. A meta-analysis was performed to compare the standardized mean difference (SMD) in FMD of the brachial artery between athletes and age-matched control subjects. Subgroup analyses and meta-regression were used to identify sources of heterogeneity. Twenty-one articles were included in this analysis, comprising 530 athletes (452 endurance trained, 49 strength trained, and 29 endurance and strength trained) and 376 control subjects. After data pooling, FMD was higher in athletes than that in control groups (SMD, 0.48; P = 0.008). In subgroup analyses, young athletes (<40 yr) presented increased baseline brachial artery diameter (mean difference, 0.40 mm; P < 0.00001) and similar FMD (SMD, 0.27; P = 0.22) compared with those in controls. In contrast, master athletes (>;50 yr) showed similar baseline brachial artery diameter (mean difference, 0.04 mm; P = 0.69) and increased FMD (SMD, 0.99; P = 0.0005) compared with those in controls. The current meta-analysis provides evidence that master athletes but not young athletes exhibit greater FMD compared with that in age-matched healthy controls, thus suggesting that the association between high levels of exercise training and increased FMD is age dependent.

The network and transmission of based on the principle of laser multipoint communication

NASA Astrophysics Data System (ADS)

Fu, Qiang; Liu, Xianzhu; Jiang, Huilin; Hu, Yuan; Jiang, Lun

2014-11-01

Space laser communication is the perfectly choose to the earth integrated information backbone network in the future. This paper introduces the structure of the earth integrated information network that is a large capacity integrated high-speed broadband information network, a variety of communications platforms were densely interconnected together, such as the land, sea, air and deep air users or aircraft, the technologies of the intelligent high-speed processing, switching and routing were adopt. According to the principle of maximum effective comprehensive utilization of information resources, get accurately information, fast processing and efficient transmission through inter-satellite, satellite earth, sky and ground station and other links. Namely it will be a space-based, air-based and ground-based integrated information network. It will be started from the trends of laser communication. The current situation of laser multi-point communications were expounded, the transmission scheme of the dynamic multi-point between wireless laser communication n network has been carefully studied, a variety of laser communication network transmission schemes the corresponding characteristics and scope described in detail , described the optical multiplexer machine that based on the multiport form of communication is applied to relay backbone link; the optical multiplexer-based on the form of the segmentation receiver field of view is applied to small angle link, the optical multiplexer-based form of three concentric spheres structure is applied to short distances, motorized occasions, and the multi-point stitching structure based on the rotation paraboloid is applied to inter-satellite communications in detail. The multi-point laser communication terminal apparatus consist of the transmitting and receiving antenna, a relay optical system, the spectroscopic system, communication system and communication receiver transmitter system. The communication forms of optical

Tick salivary compounds: their role in modulation of host defences and pathogen transmission

PubMed Central

Kazimírová, Mária; Štibrániová, Iveta

2013-01-01

Ticks require blood meal to complete development and reproduction. Multifunctional tick salivary glands play a pivotal role in tick feeding and transmission of pathogens. Tick salivary molecules injected into the host modulate host defence responses to the benefit of the feeding ticks. To colonize tick organs, tick-borne microorganisms must overcome several barriers, i.e., tick gut membrane, tick immunity, and moulting. Tick-borne pathogens co-evolved with their vectors and hosts and developed molecular adaptations to avoid adverse effects of tick and host defences. Large gaps exist in the knowledge of survival strategies of tick-borne microorganisms and on the molecular mechanisms of tick-host-pathogen interactions. Prior to transmission to a host, the microorganisms penetrate and multiply in tick salivary glands. As soon as the tick is attached to a host, gene expression and production of salivary molecules is upregulated, primarily to facilitate feeding and avoid tick rejection by the host. Pathogens exploit tick salivary molecules for their survival and multiplication in the vector and transmission to and establishment in the hosts. Promotion of pathogen transmission by bioactive molecules in tick saliva was described as saliva-assisted transmission (SAT). SAT candidates comprise compounds with anti-haemostatic, anti-inflammatory and immunomodulatory functions, but the molecular mechanisms by which they mediate pathogen transmission are largely unknown. To date only a few tick salivary molecules associated with specific pathogen transmission have been identified and their functions partially elucidated. Advanced molecular techniques are applied in studying tick-host-pathogen interactions and provide information on expression of vector and pathogen genes during pathogen acquisition, establishment and transmission. Understanding the molecular events on the tick-host-pathogen interface may lead to development of new strategies to control tick-borne diseases. PMID

Household transmission of influenza virus

PubMed Central

Tsang, Tim K.; Lau, Lincoln L. H.; Cauchemez, Simon; Cowling, Benjamin J.

2015-01-01

Human influenza viruses cause regular epidemics and occasional pandemics with a substantial public health burden. Household transmission studies have provided valuable information on the dynamics of influenza transmission. We reviewed published studies and found that once one household member is infected with influenza, the risk of infection in a household contact can be up to 38%, and the delay between onset in index and secondary cases is around 3 days. Younger age was associated with higher susceptibility. In the future, household transmission studies will provide information on transmission dynamics including the correlation of virus shedding and symptoms with transmission, and the correlation of new measures of immunity with protection against infection. PMID:26612500

On Maximizing the Throughput of Packet Transmission under Energy Constraints.

PubMed

Wu, Weiwei; Dai, Guangli; Li, Yan; Shan, Feng

2018-06-23

More and more Internet of Things (IoT) wireless devices have been providing ubiquitous services over the recent years. Since most of these devices are powered by batteries, a fundamental trade-off to be addressed is the depleted energy and the achieved data throughput in wireless data transmission. By exploiting the rate-adaptive capacities of wireless devices, most existing works on energy-efficient data transmission try to design rate-adaptive transmission policies to maximize the amount of transmitted data bits under the energy constraints of devices. Such solutions, however, cannot apply to scenarios where data packets have respective deadlines and only integrally transmitted data packets contribute. Thus, this paper introduces a notion of weighted throughput, which measures how much total value of data packets are successfully and integrally transmitted before their own deadlines. By designing efficient rate-adaptive transmission policies, this paper aims to make the best use of the energy and maximize the weighted throughput. What is more challenging but with practical significance, we consider the fading effect of wireless channels in both offline and online scenarios. In the offline scenario, we develop an optimal algorithm that computes the optimal solution in pseudo-polynomial time, which is the best possible solution as the problem undertaken is NP-hard. In the online scenario, we propose an efficient heuristic algorithm based on optimal properties derived for the optimal offline solution. Simulation results validate the efficiency of the proposed algorithm.

Series Transmission Line Transformer

DOEpatents

Buckles, Robert A.; Booth, Rex; Yen, Boris T.

2004-06-29

A series transmission line transformer is set forth which includes two or more of impedance matched sets of at least two transmissions lines such as shielded cables, connected in parallel at one end ans series at the other in a cascading fashion. The cables are wound about a magnetic core. The series transmission line transformer (STLT) which can provide for higher impedance ratios and bandwidths, which is scalable, and which is of simpler design and construction.

Transmission Bottleneck Size Estimation from Pathogen Deep-Sequencing Data, with an Application to Human Influenza A Virus.

PubMed

Sobel Leonard, Ashley; Weissman, Daniel B; Greenbaum, Benjamin; Ghedin, Elodie; Koelle, Katia

2017-07-15

The bottleneck governing infectious disease transmission describes the size of the pathogen population transferred from the donor to the recipient host. Accurate quantification of the bottleneck size is particularly important for rapidly evolving pathogens such as influenza virus, as narrow bottlenecks reduce the amount of transferred viral genetic diversity and, thus, may decrease the rate of viral adaptation. Previous studies have estimated bottleneck sizes governing viral transmission by using statistical analyses of variants identified in pathogen sequencing data. These analyses, however, did not account for variant calling thresholds and stochastic viral replication dynamics within recipient hosts. Because these factors can skew bottleneck size estimates, we introduce a new method for inferring bottleneck sizes that accounts for these factors. Through the use of a simulated data set, we first show that our method, based on beta-binomial sampling, accurately recovers transmission bottleneck sizes, whereas other methods fail to do so. We then apply our method to a data set of influenza A virus (IAV) infections for which viral deep-sequencing data from transmission pairs are available. We find that the IAV transmission bottleneck size estimates in this study are highly variable across transmission pairs, while the mean bottleneck size of 196 virions is consistent with a previous estimate for this data set. Furthermore, regression analysis shows a positive association between estimated bottleneck size and donor infection severity, as measured by temperature. These results support findings from experimental transmission studies showing that bottleneck sizes across transmission events can be variable and influenced in part by epidemiological factors. IMPORTANCE The transmission bottleneck size describes the size of the pathogen population transferred from the donor to the recipient host and may affect the rate of pathogen adaptation within host populations. Recent

Fibromuscular Dysplasia Presenting with Bilateral Renal Infarction

DOE Office of Scientific and Technical Information (OSTI.GOV)

Doody, O., E-mail: orla_doody@hotmail.co; Adam, W. R.; Foley, P. T.

2009-03-15

Fibromuscular dysplasia (FMD) describes a group of conditions which cause nonatheromatous arterial stenoses, most commonly of the renal and carotid arteries, typically in young women. We report a rare case of bilateral segmental renal infarction secondary to FMD in a young male patient. His initial presentation with loin pain and pyrexia resulted in a delay in the definitive diagnosis of FMD. He was successfully treated with bilateral balloon angioplasty. The delayed diagnosis in this patient until the condition had progressed to bilateral renal infarcts highlights the need for prompt investigation and diagnosis of suspected cases of FMD.

Multiplayer games and HIV transmission via casual encounters.

PubMed

Tully, Stephen; Cojocaru, Monica-Gabriela; Bauch, Chris T

2017-04-01

Population transmission models have been helpful in studying the spread of HIV. They assess changes made at the population level for different intervention strategies. To further understand how individual changes affect the population as a whole, game-theoretical models are used to quantify the decision-making process. Investigating multiplayer nonlinear games that model HIV transmission represents a unique approach in epidemiological research. We present here 2-player and multiplayer noncooperative games where players are defined by HIV status and age and may engage in casual (sexual) encounters. The games are modelled as generalized Nash games with shared constraints, which is completely novel in the context of our applied problem. Each player's HIV status is known to potential partners, and players have personal preferences ranked via utility values of unprotected and protected sex outcomes. We model a player's strategy as their probability of being engaged in a casual unprotected sex encounter (USE), which may lead to HIV transmission; however, we do not incorporate a transmission model here. We study the sensitivity of Nash strategies with respect to varying preference rankings, and the impact of a prophylactic vaccine introduced in players of youngest age groups. We also study the effect of these changes on the overall increase in infection level, as well as the effects that a potential prophylactic treatment may have on age-stratified groups of players. We conclude that the biggest impacts on increasing the infection levels in the overall population are given by the variation in the utilities assigned to individuals for unprotected sex with others of opposite HIV status, while the introduction of a prophylactic vaccine in youngest age group (15-20 yr olds) slows down the increase in HIV infection.

Comparison of three blood transfusion guidelines applied to 31 feline donors to minimise the risk of transfusion-transmissible infections.

PubMed

Marenzoni, Maria Luisa; Lauzi, Stefania; Miglio, Arianna; Coletti, Mauro; Arbia, Andrea; Paltrinieri, Saverio; Antognoni, Maria Teresa

2017-08-01

Objectives The increased demand for animal blood transfusions creates the need for an adequate number of donors. At the same time, a high level of blood safety must be guaranteed and different guidelines (GLs) deal with this topic. The aim of this study was to evaluate the appropriateness of different GLs in preventing transfusion-transmissible infections (TTI) in Italian feline blood donors. Methods Blood samples were collected from 31 cats enrolled as blood donors by the owners' voluntary choice over a period of approximately 1 year. Possible risk factors for TTI were recorded. Based on Italian, European and American GLs, specific TTI, including haemoplasmas, feline leukaemia virus (FeLV), feline immunodeficiency virus (FIV), Anaplasma phagocytophilum, Ehrlichia species, Bartonella species, Babesia species, Theileria species, Cytauxzoon species, Leishmania donovani sensu lato and feline coronavirus (FCoV) were screened. Rapid antigen and serological tests and biomolecular investigations (PCR) were used. Several PCR protocols for haemoplasma and FeLV DNA were compared. Results The presence of at least one recognised risk factor for TTI was reported in all cats. Results for FIV and FeLV infections were negative using rapid tests, whereas five (16.1%) cats were positive for FCoV antibodies. Four (12.9%) cats were PCR positive for haemoplasma DNA and one (3.2%) for FeLV provirus, the latter being positive only using the most sensitive PCR protocol applied. Other TTI were not detected using PCR. Conclusions and relevance Blood safety increases by combining the recommendations of different GLs. To reduce the risk of TTI, sensitive tests are needed and the choice of the best protocol is a critical step in improving blood safety. The cost and time of the screening procedures may be reduced if appropriate tests are selected. To this end, the GLs should include appropriate recruitment protocols and questionnaire-based risk profiles to identify suitable donors.

Multiwavelet packet entropy and its application in transmission line fault recognition and classification.

PubMed

Liu, Zhigang; Han, Zhiwei; Zhang, Yang; Zhang, Qiaoge

2014-11-01

Multiwavelets possess better properties than traditional wavelets. Multiwavelet packet transformation has more high-frequency information. Spectral entropy can be applied as an analysis index to the complexity or uncertainty of a signal. This paper tries to define four multiwavelet packet entropies to extract the features of different transmission line faults, and uses a radial basis function (RBF) neural network to recognize and classify 10 fault types of power transmission lines. First, the preprocessing and postprocessing problems of multiwavelets are presented. Shannon entropy and Tsallis entropy are introduced, and their difference is discussed. Second, multiwavelet packet energy entropy, time entropy, Shannon singular entropy, and Tsallis singular entropy are defined as the feature extraction methods of transmission line fault signals. Third, the plan of transmission line fault recognition using multiwavelet packet entropies and an RBF neural network is proposed. Finally, the experimental results show that the plan with the four multiwavelet packet energy entropies defined in this paper achieves better performance in fault recognition. The performance with SA4 (symmetric antisymmetric) multiwavelet packet Tsallis singular entropy is the best among the combinations of different multiwavelet packets and the four multiwavelet packet entropies.

General analytical approach for sound transmission loss analysis through a thick metamaterial plate

DOE Office of Scientific and Technical Information (OSTI.GOV)

Oudich, Mourad; Zhou, Xiaoming; Badreddine Assouar, M., E-mail: Badreddine.Assouar@univ-lorraine.fr

We report theoretically and numerically on the sound transmission loss performance through a thick plate-type acoustic metamaterial made of spring-mass resonators attached to the surface of a homogeneous elastic plate. Two general analytical approaches based on plane wave expansion were developed to calculate both the sound transmission loss through the metamaterial plate (thick and thin) and its band structure. The first one can be applied to thick plate systems to study the sound transmission for any normal or oblique incident sound pressure. The second approach gives the metamaterial dispersion behavior to describe the vibrational motions of the plate, which helpsmore » to understand the physics behind sound radiation through air by the structure. Computed results show that high sound transmission loss up to 72 dB at 2 kHz is reached with a thick metamaterial plate while only 23 dB can be obtained for a simple homogeneous plate with the same thickness. Such plate-type acoustic metamaterial can be a very effective solution for high performance sound insulation and structural vibration shielding in the very low-frequency range.« less

Inhibition of infectious bursal disease virus transmission using bioceramic derived from chicken feces.

PubMed

Thammakarn, Chanathip; Ishida, Yuki; Suguro, Atsushi; Hakim, Hakimullah; Nakajima, Katsuhiro; Kitazawa, Minori; Takehara, Kazuaki

2015-06-02

Bioceramic powder (BCX), at pH 13.0, derived from chicken feces, was evaluated for its efficacy to inactivate virus and inhibit virus horizontal transmission by fecal-oral route, using infectious bursal disease virus (IBDV) vaccine strain D78 as a challenge virus. Three 1-week-old SPF chicks were vaccinated per os and used as seeder birds. Six hours later, 3 sentinel 1-week-old SPF chicks were introduced into the same cage. Results revealed that BCX had excellent efficacy to inactivate IBDV within 3 min. Treating IBDV contaminated litter in the cage with BCX could prevent transmission of IBDV to new sensitive chicks completely. Further, transmission of IBDV to the sentinel chicks was significantly inhibited by adding BCX to litter and chicken feed. These data suggest that BCX at pH 13, derived from chicken feces, has excellent efficacy to inactivate IBDV, which can be applied in bedding materials for preventing viral transmission during production round. It is a good material that can effectively be used for enhancing biosecurity system in poultry farms. Copyright © 2015 Elsevier B.V. All rights reserved.

Design for a broad non-transmission band gap of three-color filters using photonic heterostructures

NASA Astrophysics Data System (ADS)

Li, Hongfei; Guan, Huihuan; Han, Peide; Li, Yuping; Zhang, Caili

2013-01-01

The bandgap characteristics of one-dimensional (1D) photonic crystal (PC) heterostructures containing defects are studied using the transfer matrix method. The key is to search for the best combination style for different 1D PCs to form heterostructures containing Si/MgF2 multilayer films. The non-transmission range over the entire visible range can be enlarged substantially, and the phenomenon of three-color PC filters in blue-green-red light can be realized by adjusting the repeat cycle counts of various PCs. With perfect omnidirectional and high peak transmission three-color filters for the electric magnetic (TE) mode, this optimization design opens a promising way to fabricate three-color PC filters with a wide non-transmission range in the visible range, which can be applied to white LEDs.

77 FR 32183 - Transmission Planning and Cost Allocation by Transmission Owning and Operating Public Utilities

Federal Register 2010, 2011, 2012, 2013, 2014

2012-05-31

... it would not wait for systemic problems to undermine transmission planning before action is taken... that the development of transmission facilities can involve long lead times and complex problems... rather than allowing the problems in transmission planning and cost allocation to continue or to increase...

Understanding Ebola Virus Transmission

PubMed Central

Judson, Seth; Prescott, Joseph; Munster, Vincent

2015-01-01

An unprecedented number of Ebola virus infections among healthcare workers and patients have raised questions about our understanding of Ebola virus transmission. Here, we explore different routes of Ebola virus transmission between people, summarizing the known epidemiological and experimental data. From this data, we expose important gaps in Ebola virus research pertinent to outbreak situations. We further propose experiments and methods of data collection that will enable scientists to fill these voids in our knowledge about the transmission of Ebola virus. PMID:25654239

Analysis of the transmission of Trypanosoma cruzi infection through hosts and vectors.

PubMed

Fabrizio, María C; Schweigmann, Nicolás J; Bartoloni, Norberto J

2016-08-01

Calculating epidemiological measures of infection by Trypanosoma cruzi, the causative agent of Chagas disease, is complex, because it involves several species, different stages of infection in humans and multiple transmission routes. Using the next-generation matrix method, we analysed a model which considers the three stages of human infection, triatomines and dogs (the main domestic reservoirs of T. cruzi when triatomines are present) and the main transmission routes. We derived R 0 and type-reproduction numbers T. We deduced formulas for the number of new infections generated through each transmission route by each infected individual. We applied our findings in Argentine Gran Chaco. The expressions achieved allowed quantifying the high infectivity of dogs and emphasizing the epidemiological importance of the long and asymptomatic chronic indeterminate stage in humans in the spread of the infection. According to the model, it is expected that one infected human infects 21 triatomines, that 100 infected triatomines are necessary to infect one human and 34 to infect a dog, and that each dog infects on average one triatomine per day. Our results may allow quantifying the effect of control measures on infected humans, triatomines and dogs (or other highly infected vertebrate) or on a specific route of transmission, in other scenarios.

Progressive transmission of secured images with authentication using decompositions into monovariate functions

NASA Astrophysics Data System (ADS)

Leni, Pierre-Emmanuel; Fougerolle, Yohan D.; Truchetet, Frédéric

2014-05-01

We propose a progressive transmission approach of an image authenticated using an overlapping subimage that can be removed to restore the original image. Our approach is different from most visible watermarking approaches that allow one to later remove the watermark, because the mark is not directly introduced in the two-dimensional image space. Instead, it is rather applied to an equivalent monovariate representation of the image. Precisely, the approach is based on our progressive transmission approach that relies on a modified Kolmogorov spline network, and therefore inherits its advantages: resilience to packet losses during transmission and support of heterogeneous display environments. The marked image can be accessed at any intermediate resolution, and a key is needed to remove the mark to fully recover the original image without loss. Moreover, the key can be different for every resolution, and the images can be globally restored in case of packet losses during the transmission. Our contributions lie in the proposition of decomposing a mark (an overlapping image) and an image into monovariate functions following the Kolmogorov superposition theorem; and in the combination of these monovariate functions to provide a removable visible "watermarking" of images with the ability to restore the original image using a key.

Effect of cocoa/chocolate ingestion on brachial artery flow-mediated dilation and its relevance to cardiovascular health and disease in humans.

PubMed

Monahan, Kevin D

2012-11-15

Prospective studies indicate that high intake of dietary flavanols, such as those contained in cocoa/chocolate, are associated with reduced rates of cardiovascular-related morbidity and mortality in humans. Numerous mechanisms may underlie these associations such as favorable effects of flavanols on blood pressure, platelet aggregation, thrombosis, inflammation, and the vascular endothelium. The brachial artery flow-mediated dilation (FMD) technique has emerged as a robust method to quantify endothelial function in humans. Collectively, the preponderance of evidence indicates that FMD is a powerful surrogate measure for firm cardiovascular endpoints, such as cardiovascular-related mortality, in humans. Thus, literally thousands of studies have utilized this technique to document group differences in FMD, as well as to assess the effects of various interventions on FMD. In regards to the latter, numerous studies indicate that both acute and chronic ingestion of cocoa/chocolate increases FMD in humans. Increases in FMD after cocoa/chocolate ingestion appear to be dose-dependent such that greater increases in FMD are observed after ingestion of larger quantities. The mechanisms underlying these responses are likely diverse, however most data suggest an effect of increased nitric oxide bioavailability. Thus, positive vascular effects of cocoa/chocolate on the endothelium may underlie (i.e., be linked mechanistically to) reductions in cardiovascular risk in humans. Copyright © 2012 Elsevier Inc. All rights reserved.

Optical modeling of fiber organic photovoltaic structures using a transmission line method.

PubMed

Moshonas, N; Stathopoulos, N A; O'Connor, B T; Bedeloglu, A Celik; Savaidis, S P; Vasiliadis, S

2017-12-01

An optical model has been developed and evaluated for the calculation of the external quantum efficiency of cylindrical fiber photovoltaic structures. The model is based on the transmission line theory and has been applied on single and bulk heterojunction fiber-photovoltaic cells. Using this model, optimum design characteristics have been proposed for both configurations, and comparison with experimental results has been assessed.

Testing of Two-Speed Transmission Configurations for Use in Rotorcraft

NASA Technical Reports Server (NTRS)

Lewicki, David G.; Stevens, Mark A.

2015-01-01

Large civil tiltrotors have been identified to replace regional airliners over medium ranges to alleviate next-generation air traffic. Variable rotor speed for these vehicles is required for efficient high-speed operation. Two-speed drive system research has been performed to support these advanced rotorcraft applications. Experimental tests were performed on two promising two-speed transmission configurations. The offset compound gear (OCG) transmission and the dual star/idler (DSI) planetary transmission were tested in the NASA Glenn Research Center variable-speed transmission test facility. Both configurations were inline devices with concentric input and output shafts and designed to provide 1:1 and 2:1 output speed reduction ratios. Both were designed for 200 hp and 15,000 rpm input speed and had a dry shift clutch configuration. Shift tests were performed on the transmissions at input speeds of 5,000, 8,000, 10,000, 12,500, and 15,000 rpm. Both the OCG and DSI configurations successfully perform speed shifts at full rated 15,000 rpm input speed. The transient shifting behavior of the OCG and DSI configurations were very similar. The shift clutch had more of an effect on shifting dynamics than the reduction gearing configuration itself since the same shift clutch was used in both configurations. For both OCG and DSI configurations, low-to-high speed shifts were limited in applied torque levels in order to prevent overloads on the transmission due to transient torque spikes. It is believed that the relative lack of appreciable slippage of the dry shifting clutch at operating conditions and pressure profiles tested was a major cause of the transient torque spikes. For the low-to-high speed shifts, the output speed ramp-up time slightly decreased and the peak out torque slightly increased as the clutch pressure ramp-down rate increased. This was caused by slightly less clutch slippage as the clutch pressure ramp-down rate increased.

The re-design at the transformer portion of transcutaneous energy transmission system for all implantable devices.

PubMed

Watada, Masaya; Saisho, Ryohei; Kim, Yong-Jae; Ohuchi, Katsuhiro; Takatani, Setsuo; Um, Yong-Su

2007-01-01

All implantable devices, such as an artificial heart, an artificial lung, a pacemaker, a defibrillator, need electric power. So the electric power supply through the skin is requested. Then, it is transcutaneous energy transmission system (TETS) that has been studied and used a lot. TETS is the system which performs an electric power supply by non-contact transcutaneously using the electromagnetic induction phenomenon of an external primary side coil and a secondary side coil in human body. In this research, we are developing the core type TETS which applied for the implantable devices. In this paper, corresponding to various conditions, such as a difference in required electric power and transmission distance change, the core type transformer which can hold high transmission efficiency is designed.

The Impact of Ventilation and Early Diagnosis on Tuberculosis Transmission in Brazilian Prisons

PubMed Central

Urrego, Juliana; Ko, Albert I.; da Silva Santos Carbone, Andrea; Paião, Dayse Sanchez Guimarães; Sgarbi, Renata Viebrantz Enne; Yeckel, Catherine W.; Andrews, Jason R.; Croda, Julio

2015-01-01

Prisoners have among the highest incidence of tuberculosis (TB) globally. However, the contribution of the prison environment on transmission is not well understood and structural characteristics have received little attention as effective epidemiological interventions in TB control. We evaluated architectural characteristics and estimated ventilation rates in 141 cells in three prisons in central west Brazil using steady-state exhaled carbon dioxide (CO2) levels. We used a modified Wells–Riley equation to estimate the probability of infection for inmates sharing a cell with an infectious case and projected the impact of interventions, including early diagnosis and improved ventilation. Overall, prison cells were densely populated (mean 2.1 m2 per occupant) and poorly ventilated, with only three cells meeting World Health Organization (WHO) standards for per-person ventilation (60 L/s) applied in infection control settings. In the absence of interventions, projected mean risk of infection was 78.0% during a 6-month period. Decreasing time-to-diagnosis by 25% reduced transmission risk by 8.3%. Improving ventilation to WHO standards decreased transmission by 38.2%, whereas optimizing cross-ventilation reduced transmission by 64.4%. Prison environments promote high infection risk over short-time intervals. In this context, enhanced diagnostics have a limited impact on reducing transmission. Improving natural ventilation may be required to effectively control TB in prisons. PMID:26195459

The Impact of Ventilation and Early Diagnosis on Tuberculosis Transmission in Brazilian Prisons.

PubMed

Urrego, Juliana; Ko, Albert I; da Silva Santos Carbone, Andrea; Paião, Dayse Sanchez Guimarães; Sgarbi, Renata Viebrantz Enne; Yeckel, Catherine W; Andrews, Jason R; Croda, Julio

2015-10-01

Prisoners have among the highest incidence of tuberculosis (TB) globally. However, the contribution of the prison environment on transmission is not well understood and structural characteristics have received little attention as effective epidemiological interventions in TB control. We evaluated architectural characteristics and estimated ventilation rates in 141 cells in three prisons in central west Brazil using steady-state exhaled carbon dioxide (CO2) levels. We used a modified Wells-Riley equation to estimate the probability of infection for inmates sharing a cell with an infectious case and projected the impact of interventions, including early diagnosis and improved ventilation. Overall, prison cells were densely populated (mean 2.1 m(2) per occupant) and poorly ventilated, with only three cells meeting World Health Organization (WHO) standards for per-person ventilation (60 L/s) applied in infection control settings. In the absence of interventions, projected mean risk of infection was 78.0% during a 6-month period. Decreasing time-to-diagnosis by 25% reduced transmission risk by 8.3%. Improving ventilation to WHO standards decreased transmission by 38.2%, whereas optimizing cross-ventilation reduced transmission by 64.4%. Prison environments promote high infection risk over short-time intervals. In this context, enhanced diagnostics have a limited impact on reducing transmission. Improving natural ventilation may be required to effectively control TB in prisons. © The American Society of Tropical Medicine and Hygiene.

Quantifying the Value of Perfect Information in Emergency Vaccination Campaigns.

PubMed

Bradbury, Naomi V; Probert, William J M; Shea, Katriona; Runge, Michael C; Fonnesbeck, Christopher J; Keeling, Matt J; Ferrari, Matthew J; Tildesley, Michael J

2017-02-01

Foot-and-mouth disease outbreaks in non-endemic countries can lead to large economic costs and livestock losses but the use of vaccination has been contentious, partly due to uncertainty about emergency FMD vaccination. Value of information methods can be applied to disease outbreak problems such as FMD in order to investigate the performance improvement from resolving uncertainties. Here we calculate the expected value of resolving uncertainty about vaccine efficacy, time delay to immunity after vaccination and daily vaccination capacity for a hypothetical FMD outbreak in the UK. If it were possible to resolve all uncertainty prior to the introduction of control, we could expect savings of £55 million in outbreak cost, 221,900 livestock culled and 4.3 days of outbreak duration. All vaccination strategies were found to be preferable to a culling only strategy. However, the optimal vaccination radius was found to be highly dependent upon vaccination capacity for all management objectives. We calculate that by resolving the uncertainty surrounding vaccination capacity we would expect to return over 85% of the above savings, regardless of management objective. It may be possible to resolve uncertainty about daily vaccination capacity before an outbreak, and this would enable decision makers to select the optimal control action via careful contingency planning.

Quantifying the Value of Perfect Information in Emergency Vaccination Campaigns

PubMed Central

Probert, William J. M.; Shea, Katriona; Fonnesbeck, Christopher J.; Ferrari, Matthew J.; Tildesley, Michael J.

2017-01-01

Foot-and-mouth disease outbreaks in non-endemic countries can lead to large economic costs and livestock losses but the use of vaccination has been contentious, partly due to uncertainty about emergency FMD vaccination. Value of information methods can be applied to disease outbreak problems such as FMD in order to investigate the performance improvement from resolving uncertainties. Here we calculate the expected value of resolving uncertainty about vaccine efficacy, time delay to immunity after vaccination and daily vaccination capacity for a hypothetical FMD outbreak in the UK. If it were possible to resolve all uncertainty prior to the introduction of control, we could expect savings of £55 million in outbreak cost, 221,900 livestock culled and 4.3 days of outbreak duration. All vaccination strategies were found to be preferable to a culling only strategy. However, the optimal vaccination radius was found to be highly dependent upon vaccination capacity for all management objectives. We calculate that by resolving the uncertainty surrounding vaccination capacity we would expect to return over 85% of the above savings, regardless of management objective. It may be possible to resolve uncertainty about daily vaccination capacity before an outbreak, and this would enable decision makers to select the optimal control action via careful contingency planning. PMID:28207777

The evolution of plant virus transmission pathways.

PubMed

Hamelin, Frédéric M; Allen, Linda J S; Prendeville, Holly R; Hajimorad, M Reza; Jeger, Michael J

2016-05-07

The evolution of plant virus transmission pathways is studied through transmission via seed, pollen, or a vector. We address the questions: under what circumstances does vector transmission make pollen transmission redundant? Can evolution lead to the coexistence of multiple virus transmission pathways? We restrict the analysis to an annual plant population in which reproduction through seed is obligatory. A semi-discrete model with pollen, seed, and vector transmission is formulated to investigate these questions. We assume vector and pollen transmission rates are frequency-dependent and density-dependent, respectively. An ecological stability analysis is performed for the semi-discrete model and used to inform an evolutionary study of trade-offs between pollen and seed versus vector transmission. Evolutionary dynamics critically depend on the shape of the trade-off functions. Assuming a trade-off between pollen and vector transmission, evolution either leads to an evolutionarily stable mix of pollen and vector transmission (concave trade-off) or there is evolutionary bi-stability (convex trade-off); the presence of pollen transmission may prevent evolution of vector transmission. Considering a trade-off between seed and vector transmission, evolutionary branching and the subsequent coexistence of pollen-borne and vector-borne strains is possible. This study contributes to the theory behind the diversity of plant-virus transmission patterns observed in nature. Copyright © 2016 Elsevier Ltd. All rights reserved.

Fibromuscular Dysplasia-Related Renal Artery Stenosis Associated with Aneurysm: Successive Endovascular Therapy

DOE Office of Scientific and Technical Information (OSTI.GOV)

Serter, Selim; Oran, Ismail; Parildar, Mustafa

2007-04-15

Fibromuscular dysplasia (FMD) is a nonatherosclerotic, noninflammatory vascular disease. FMD of the renal arteries is one of the leading causes of curable hypertension. The simultaneous occurrence of FMD and renal artery aneurysm has been described previously. In this case, we present a fibrodysplastic lesion and an aneurysm in a renal artery treated with a percutanous transluminal angioplasty and coil embolization.

"Narrowing the transmission gap: A synthesis of three decades of research on intergenerational transmission of attachment": Correction.

PubMed

2018-04-01

Reports an error in "Narrowing the transmission gap: A synthesis of three decades of research on intergenerational transmission of attachment" by Marije L. Verhage, Carlo Schuengel, Sheri Madigan, R. M. Pasco Fearon, Mirjam Oosterman, Rosalinda Cassibba, Marian J. Bakermans-Kranenburg and Marinus H. van IJzendoorn ( Psychological Bulletin , 2016[Apr], Vol 142[4], 337-366). In the article, there are errors in Table 7. The percentages of the attachment classifications do not add up to 100%. The corrected version of Table 7 is provided in the erratum. (The following abstract of the original article appeared in record 2015-55801-001.) Twenty years ago, meta-analytic results (k = 19) confirmed the association between caregiver attachment representations and child-caregiver attachment (Van IJzendoorn, 1995). A test of caregiver sensitivity as the mechanism behind this intergenerational transmission showed an intriguing "transmission gap." Since then, the intergenerational transmission of attachment and the transmission gap have been studied extensively, and now extend to diverse populations from all over the globe. Two decades later, the current review revisited the effect sizes of intergenerational transmission, the heterogeneity of the transmission effects, and the size of the transmission gap. Analyses were carried out with a total of 95 samples (total N = 4,819). All analyses confirmed intergenerational transmission of attachment, with larger effect sizes for secure-autonomous transmission (r = .31) than for unresolved transmission (r = .21), albeit with significantly smaller effect sizes than 2 decades earlier (r = .47 and r = .31, respectively). Effect sizes were moderated by risk status of the sample, biological relatedness of child-caregiver dyads, and age of the children. Multivariate moderator analyses showed that unpublished and more recent studies had smaller effect sizes than published and older studies. Path analyses showed that the transmission could not

Universal filtered multi-carrier system for asynchronous uplink transmission in optical access network

NASA Astrophysics Data System (ADS)

Kang, Soo-Min; Kim, Chang-Hun; Han, Sang-Kook

2016-02-01

In passive optical network (PON), orthogonal frequency division multiplexing (OFDM) has been studied actively due to its advantages such as high spectra efficiency (SE), dynamic resource allocation in time or frequency domain, and dispersion robustness. However, orthogonal frequency division multiple access (OFDMA)-PON requires tight synchronization among multiple access signals. If not, frequency orthogonality could not be maintained. Also its sidelobe causes inter-channel interference (ICI) to adjacent channel. To prevent ICI caused by high sidelobes, guard band (GB) is usually used which degrades SE. Thus, OFDMA-PON is not suitable for asynchronous uplink transmission in optical access network. In this paper, we propose intensity modulation/direct detection (IM/DD) based universal filtered multi-carrier (UFMC) PON for asynchronous multiple access. The UFMC uses subband filtering to subsets of subcarriers. Since it reduces sidelobe of each subband by applying subband filtering, it could achieve better performance compared to OFDM. For the experimental demonstration, different sample delay was applied to subbands to implement asynchronous transmission condition. As a result, time synchronization robustness of UFMC was verified in asynchronous multiple access system.

Refractive Effects in Remote Sensing of the Atmosphere with Infrared Transmission Spectroscopy

DTIC Science & Technology

1975-06-01

J(0O^-H)D HNm*ji^ fta )(j𔃺,ff,ffooooo^HH-i^fyN<Mi\\fv(flmrt^flj;*^^^ ss 2» — < (M O* (T1 0» ff. O’OOO^O’lMM^^NHN^iniOiMHCOhHOOh- O W B ’C ^ O H...8217*O«DN^ *-* rg m ^ tr> fMD ^tr(?,croo’)0:i,H^-<H^’V|M^|M’M^’n^w^ •*• •* *t *t >r ii^ m IT 63 ooooooooooOO(^(7*0’-«mu>«>^4^0t-*(7’f*-^mo^’^ gf f- tr...JOOOUOUOOOU4«NOmiM^ff(DNNHI -« in oooooouuoooagoiv)Loiiiri.irniwKi<«o«iN’«rtOo ooooooooooooo~o-r-rrta.tartoOrt3f^O’»---o»i7’«f-, fta -<*o

Simple, quick and cost-efficient: A universal RT-PCR and sequencing strategy for genomic characterisation of foot-and-mouth disease viruses.

PubMed

Dill, V; Beer, M; Hoffmann, B

2017-08-01

Foot-and-mouth disease (FMD) is a major contributor to poverty and food insecurity in Africa and Asia, and it is one of the biggest threats to agriculture in highly developed countries. As FMD is extremely contagious, strategies for its prevention, early detection, and the immediate characterisation of outbreak strains are of great importance. The generation of whole-genome sequences enables phylogenetic characterisation, the epidemiological tracing of virus transmission pathways and is supportive in disease control strategies. This study describes the development and validation of a rapid, universal and cost-efficient RT-PCR system to generate genome sequences of FMDV, reaching from the IRES to the end of the open reading frame. The method was evaluated using twelve different virus strains covering all seven serotypes of FMDV. Additionally, samples from experimentally infected animals were tested to mimic diagnostic field samples. All primer pairs showed a robust amplification with a high sensitivity for all serotypes. In summary, the described assay is suitable for the generation of FMDV sequences from all serotypes to allow immediate phylogenetic analysis, detailed genotyping and molecular epidemiology. Copyright © 2017 Elsevier B.V. All rights reserved.

Electronic transport in Thue-Morse gapped graphene superlattice under applied bias

NASA Astrophysics Data System (ADS)

Wang, Mingjing; Zhang, Hongmei; Liu, De

2018-04-01

We investigate theoretically the electronic transport properties of Thue-Morse gapped graphene superlattice under an applied electric field. The results indicate that the combined effect of the band gap and the applied bias breaks the angular symmetry of the transmission coefficient. The zero-averaged wave-number gap can be greatly modulated by the band gap and the applied bias, but its position is robust against change of the band gap. Moreover, the conductance and the Fano factor are strongly dependent not only on the Fermi energy but also on the band gap and the applied bias. In the vicinity of the new Dirac point, the minimum value of the conductance obviously decreases and the Fano factor gradually forms a Poissonian value plateau with increasing of the band gap.

76 FR 179 - GMPT Warren Transmission, GM Powertrain Division, a Subsidiary of General Motors Company...

Federal Register 2010, 2011, 2012, 2013, 2014

2011-01-03

... Knight Facilities Management, Warren, MI; Amended Certification Regarding Eligibility To Apply for Worker... Knight Facilities Management were employed on-site at the Warren, Michigan location of the subject firm... Knight Facilities Management working on-site at the Warren, Michigan location of GMPT Warren Transmission...

Deciphering the Landauer-Büttiker Transmission Function from Single Molecule Break Junction Experiments

NASA Astrophysics Data System (ADS)

Reuter, Matthew; Tschudi, Stephen

When investigating the electrical response properties of molecules, experiments often measure conductance whereas computation predicts transmission probabilities. Although the Landauer-Büttiker theory relates the two in the limit of coherent scattering through the molecule, a direct comparison between experiment and computation can still be difficult. Experimental data (specifically that from break junctions) is statistical and computational results are deterministic. Many studies compare the most probable experimental conductance with computation, but such an analysis discards almost all of the experimental statistics. In this work we develop tools to decipher the Landauer-Büttiker transmission function directly from experimental statistics and then apply them to enable a fairer comparison between experimental and computational results.

Down hole transmission system

DOEpatents

Hall, David R [Provo, UT; Hall, Jr., H. Tracy

2007-07-24

A transmission system in a downhole component comprises a data transmission element in both ends of the downhole component. Each data transmission element houses an electrically conducting coil in a MCEI circular trough. The electrically conducting coil comprises at least two generally fractional loops. In the preferred embodiment, the transmission elements are connected by an electrical conductor. Preferably, the electrical conductor is a coaxial cable. Preferably, the MCEI trough comprises ferrite. In the preferred embodiment, the fractional loops are connected by a connecting cable. In one aspect of the present invention, the connecting cable is a pair of twisted wires. In one embodiment the connecting cable is a shielded pair of twisted wires. In another aspect of the present invention, the connecting cable is a coaxial cable. The connecting cable may be disposed outside of the MCEI circular trough.

Correlations between brachial endothelial function and cardiovascular risk factors: a survey of 2,511 Chinese subjects

PubMed Central

Yang, Ping-Ting; Yuan, Hong; Wang, Ya-Qin; Cao, Xia; Wu, Liu-Xin

2014-01-01

Objective We examined the relationship of several cardiovascular risk factors (CVRF) to brachial artery flow-mediated dilatation (FMD) in Chinese subjects. Methods This was a cross-sectional study. In 2,511 Chinese adults (age 46.86±9.52 years, 1,891 men and 620 women) recruited from people who underwent health screening at The Third Xiangya Hospital, patients’ CVRF [age, body mass index (BMI), waist circumference (WC), blood pressure (BP), cholesterol parameters, creatinine (Cr), uric acid (UA), glucose level and smoking] and prevalence of present disease (hypertension, diabetes mellitus, coronary heart disease and hyperlipidemia) were investigated. Results Multivariate analysis revealed that FMD negative correlated with age (β=–0.29, P<0.001), gender (β=–0.12, P<0.001), BMI (β=–0.12, P=0.001), WC (β=–0.10, P=0.011), systolic BP (SBP) (β=–0.12, P<0.001), fasting glucose (β=–0.04, P=0.009), total cholesterol (TC) (β=–0.04, P=0.014), smoking (β=–0.05, P=0.003), and baseline brachial artery diameter (β=–0.35, P<0.001). FMD decreased with increasing age in both genders. In women, FMD was higher than men and age-related decline in FMD was steepest after age 40; FMD was similar in men above 55 years old. Conclusions In Chinese subjects, FMD may be a usefully marker of CVRF. Age, gender, BMI, WC, SBP, fasting glucose, TC, smoking, and baseline brachial artery diameter were independent variables related to the impairment of FMD. The influence of CVRF on endothelial function is more in women than men. PMID:25364521

Systemic Connective Tissue Features in Women with Fibromuscular Dysplasia

PubMed Central

O’Connor, Sarah; Kim, Esther S. H.; Brinza, Ellen; Moran, Rocio; Fendrikova-Mahlay, Natalia; Wolski, Kathy; Gornik, Heather L.

2016-01-01

Background Fibromuscular Dysplasia (FMD) is an non-atherosclerotic disease associated with hypertension, headache, dissection, stroke, and aneurysm. The etiology is unknown but hypothesized to involve genetic and environmental components. Previous studies suggest a possible overlap of FMD with other connective tissue diseases that present with dissections and aneurysms. The aim of this study was to investigate the prevalence of connective tissue physical features in FMD. Methods and Results 142 FMD patients were consecutively enrolled at a single referral center (97.9% female, 92.3% had multifocal FMD). Data are reported for 139 female patients. Moderately severe myopia (29.1%), high palate (33.1%), dental crowding (29.7%), and early onset arthritis (15.6%) were prevalent features. Classic connective features such as hypertelorism, cleft palate, and hypermobility were uncommon. Frequency of systemic connective tissue features was compared between FMD patients with a high vascular risk profile (having had ≥1 dissection and/or ≥2 aneurysms) and those with a standard vascular risk profile. History of spontaneous pneumothorax (5.9% high risk vs. 0% standard risk) and atrophic scarring (17.3% high risk vs. 6.8% standard risk) were significantly more prevalent in the high risk group, p<0.05. High palate was observed in 43.1% of the high risk group vs. 27.3% in the standard risk group, p=0.055. Conclusions In a cohort of women with FMD, there was a prevalence of moderately severe myopia, high palate, dental crowding, and early onset osteoarthritis. However, a characteristic phenotype was not discovered. Several connective tissue features such as high palate and pneumothorax were more prominent among FMD patients with a high vascular risk profile. PMID:26156071

Is triglyceride/HDL ratio a reliable screening test for assessment of atherosclerotic risk in patients with chronic inflammatory disease?

PubMed

Keles, Nursen; Aksu, Feyza; Aciksari, Gonul; Yilmaz, Yusuf; Demircioglu, Kenan; Kostek, Osman; Cekin, Muhammed Esad; Kalcik, Macit; Caliskan, Mustafa

2016-01-01

The term chronic inflammatory disease (CID) refers to a category of inflammatory diseases that includes Ankylosing spondylitis (AS) and familial Mediterranean fever (FMF). The incidence of adverse cardiovascular events is greater among patients with CID, though they may not have conventional atherosclerotic risk factors. Endothelial dysfunction is one of the underlying fundamental mechanisms that trigger development of atherosclerotic alterations in arteries, and flow-mediated dilatation (FMD) is a noninvasive method to determine endothelial dysfunction. Recent studies have shown a relationship between high triglyceride high-density lipoprotein cholesterol (TG/HDL-C) ratio and coronary atherosclerosis. Many studies have demonstrated that patients with CID have lower FMD values compared to healthy population, indicating endothelial dysfunction. However TG/HDL ratio and its relationship to FMD in patients with CID has not been investigated. The present study investigated whether TG/HDL ratio in CID patients differs from that of healthy population, and its relationship to FMD in patients with CID. A total of 58 patients with CID and a group of 58 healthy volunteer individuals were enrolled in the study. FMD measurements were taken with high resolution ultrasound (US), and TG/HDL ratios were calculated. Patients with CID had significantly higher TG/HDL-C ratio (2.5 [2.2-2.8] vs 2.3 [2.1-2.5]; p=0.03) and lower FMD values (5.2 [4.2-6.3] vs 6.7 [6.3-9.7]; p<0.001), compared to healthy group, and a negative correlation was found between FMD levels and TG/HDL ratio of the study population. Higher TG/HDL ratio and lower FMD values found in CID patients may reflect increased atherosclerotic risk.

An economic assessment of foot and mouth disease in Japan.

PubMed

Hayama, Y; Osada, Y; Oushiki, D; Tsutsui, T

2017-04-01

A large-scale foot and mouth disease (FMD) epidemic in Japan in 2010 caused severe economic losses for livestock and related industries. In this paper, the authors develop a clear and usable framework to estimate the economic impact of this FMD outbreak. An economic analysis is then conducted by combining this framework with an epidemiological model. The framework estimates the direct and indirect costs to livestock and related industries by applying an input-output model, as well as by addressing expenditure on disease control. The direct cost to the livestock industry was estimated at 51.2 billion Japanese yen (JPY), engendering an indirect cost to related industries of JPY 25.5 billion. The expenditure for disease control activities was estimated at JPY 8.2 billion. The total impact of the 2010 FMD epidemic was estimated at almost JPY 85 billion. Within the economic analysis, the authors evaluate several control measure scenarios: a baseline scenario, which assumes that the rapid disease spread observed in the early phase of the 2010 FMD epidemic would continue; prompt culling within 24 hours; early detection of the first case; and emergency vaccination within a radius of 10 km around the affected farms in either seven or 28 days. Prompt culling and early detection were superior from an economic point of view, reducing the total economic impact to 30% and 2% of that in the baseline scenario, respectively. Compared with these scenarios, vaccination was less cost effective. However, vaccination suppressed the speed of disease spread and shortened the duration of the epidemic, suggesting its potential effectiveness in curbing rapid disease spread in a densely populated area.

Roles of neuronal NK1 and NK3 receptors in synaptic transmission during motility reflexes in the guinea-pig ileum

PubMed Central

Johnson, P J; Bornstein, J C; Burcher, E

1998-01-01

The role of NK1 and NK3 receptors in synaptic transmission between myenteric neurons during motility reflexes in the guinea-pig ileum was investigated by recording intracellularly the reflex responses of the circular muscle to distension or compression of the mucosal villi. Experiments were performed in a three-chambered organ bath that enabled drugs to be selectively applied to different sites along the reflex pathways.When applied in the recording chamber, an NK1 receptor antagonist, SR140333 (100 nM), reduced by 40–50% the amplitudes of inhibitory junction potentials (i.j.ps) evoked in the circular muscle by activation of descending reflex pathways. This effect was abolished when synaptic transmission in the stimulus region was blocked with physiological saline containing 0.1 mM Ca2+ plus 10 mM Mg2+, leaving only the component of the descending reflex pathway conducted via long anally directed collaterals of intrinsic sensory neurons.SR140333 (100 nM) had no effect on descending reflex i.j.ps when applied to the stimulus region. Ascending reflexes were also unaffected by SR140333 in the stimulus region or between the stimulus and recording sites.Septide (10 nM), an NK1 receptor agonist, enhanced descending reflexes by 30–60% when in the recording chamber. [Sar9,Met(O2)11]substance P had no effect at 10 nM, but potentiated distension-evoked reflexes at 100 nM.A selective NK3 receptor antagonist, SR142801 (100 nM), when applied to the stimulus region, reduced the amplitude of descending reflex responses to compression by 40%, but had no effect on responses to distension. SR142801 (100 nM) had no effect when applied to other regions of the descending reflex pathways.SR142801 (100 nM) only inhibited ascending reflexes when applied at the recording site. However, after nicotinic transmission in the stimulus region was blocked, SR142801 (100 nM) at this site reduced responses to compression.Contractions of the circular muscle of isolated

Medical cost and frequent mental distress among the non-elderly US adult population.

PubMed

Bruning, John; Arif, Ahmed A; Rohrer, James E

2014-03-01

Frequent mental distress (FMD) is an important measure of perceived poor mental health. With the rising cost of health care, it is not uncommon for working adults to delay seeking care. The objective of this study was to determine the relationship between avoidance of medical care due to cost and FMD among the non-elderly US population. We analyzed data from 282 044 non-elderly US population from a 2008 Behavioral Risk Factor Surveillance System survey. Multivariable logistic regression models were used to assess the association between avoidance of medical care due to cost and FMD adjusted for covariates. The overall prevalence of FMD in the non-elderly population was 11.1%; whereas it was 24.2% for those reporting avoiding medical care due to cost. Approximately 18% of the population had no health insurance coverage and the prevalence of FMD was significantly greater in this group. The odds of FMD were >2-fold elevated for respondents who were unable to see a doctor because of cost (adjusted odds ratio: 2.40, 99% confidence interval: 2.19, 2.63). These findings highlight the need for affordable medical care for reducing mental distress and improving population health.

Brief Exposure to Secondhand Smoke Reversibly Impairs Endothelial Vasodilatory Function

PubMed Central

2014-01-01

Introduction: We sought to determine the effects of brief exposures to low concentrations of tobacco secondhand smoke (SHS) on arterial flow-mediated dilation (FMD, a nitric oxide-dependent measure of vascular endothelial function), in a controlled animal model never before exposed to smoke. In humans, SHS exposure for 30min impairs FMD. It is important to gain a better understanding of the acute effects of exposure to SHS at low concentrations and for brief periods of time. Methods: We measured changes in FMD in rats exposed to a range of real-world levels of SHS for durations of 30min, 10min, 1min, and 4 breaths (roughly 15 s). Results: We observed a dose-response relationship between SHS particle concentration over 30min and post-exposure impairment of FMD, which was linear through the range typically encountered in smoky restaurants and then saturated at higher concentrations. One min of exposure to SHS at moderate concentrations was sufficient to impair FMD. Conclusions: Brief SHS exposure at real-world levels reversibly impairs FMD. Even 1min of SHS exposure can cause reduction of endothelial function. PMID:24302638

The transmission process: A combinatorial stochastic process for the evolution of transmission trees over networks.

PubMed

Sainudiin, Raazesh; Welch, David

2016-12-07

We derive a combinatorial stochastic process for the evolution of the transmission tree over the infected vertices of a host contact network in a susceptible-infected (SI) model of an epidemic. Models of transmission trees are crucial to understanding the evolution of pathogen populations. We provide an explicit description of the transmission process on the product state space of (rooted planar ranked labelled) binary transmission trees and labelled host contact networks with SI-tags as a discrete-state continuous-time Markov chain. We give the exact probability of any transmission tree when the host contact network is a complete, star or path network - three illustrative examples. We then develop a biparametric Beta-splitting model that directly generates transmission trees with exact probabilities as a function of the model parameters, but without explicitly modelling the underlying contact network, and show that for specific values of the parameters we can recover the exact probabilities for our three example networks through the Markov chain construction that explicitly models the underlying contact network. We use the maximum likelihood estimator (MLE) to consistently infer the two parameters driving the transmission process based on observations of the transmission trees and use the exact MLE to characterize equivalence classes over the space of contact networks with a single initial infection. An exploratory simulation study of the MLEs from transmission trees sampled from three other deterministic and four random families of classical contact networks is conducted to shed light on the relation between the MLEs of these families with some implications for statistical inference along with pointers to further extensions of our models. The insights developed here are also applicable to the simplest models of "meme" evolution in online social media networks through transmission events that can be distilled from observable actions such as "likes", "mentions

Lithium chloride inhibits early stages of foot-and-mouth disease virus (FMDV) replication in vitro.

PubMed

Zhao, Fu-Rong; Xie, Yin-Li; Liu, Ze-Zhong; Shao, Jun-Jun; Li, Shi-Fang; Zhang, Yong-Guang; Chang, Hui-Yun

2017-11-01

Foot-and-mouth disease virus (FMDV) causes an economically important and highly contagious disease of cloven-hoofed animals such as cattle, swine, and sheep. FMD vaccine is the traditional way to protect against the disease, which can greatly reduce its occurrence. However, the use of FMD vaccines to protect early infection is limited. Therefore, the alternative strategy of applying antiviral agents is required to control the spread of FMDV in outbreak situations. As previously reported, LiCl has obviously inhibition effects on a variety of viruses such as transmissible gastroenteritis virus (TGEV), infectious bronchitis coronavirus (IBV), and pseudorabies herpesvirus and EV-A71 virus. In this study, our findings were the first to demonstrate that LiCl inhibition of the FMDV replication. In this study, BHK-21 cell was dose-dependent with LiCl at various stages of FMDV. Virus titration assay was calculated by the 50% tissue culture infected dose (TCID 50 ) with the Reed and Muench method. The cytotoxicity assay of LiCl was performed by the CCK8 kit. The expression level of viral mRNA was measured by RT-qPCR. The results revealed LiCl can inhibit FMDV replication, but it cannot affect FMDV attachment stage and entry stage in the course of FMDV life cycle. Further studies confirmed that the LiCl affect the replication stage of FMDV, especially the early stages of FMDV replication. So LiCl has potential as an effective anti-FMDV drug. Therefore, LiCl may be an effective drug for the control of FMDV. Based on that, the mechanism of the antiviral effect of LiCl on FMDV infection is need to in-depth research in vivo. © 2017 Wiley Periodicals, Inc.

Voluntary or involuntary? A neurophysiologic approach to functional movement disorders.

PubMed

Stenner, M-P; Haggard, P

2016-01-01

Patients with functional movement disorders (FMD) experience movements as involuntary that share fundamental characteristics with voluntary actions. This apparent paradox raises questions regarding the possible sources of a subjective experience of action. In addition, it poses a yet unresolved diagnostic challenge, namely how to describe or even quantify this experience in a scientifically and clinically useful way. Here, we describe recent experimental approaches that have shed light on the phenomenology of action in FMD. We first outline the sources and content of a subjective experience of action in healthy humans and discuss how this experience may be created in the brain. Turning to FMD, we describe implicit, behavioral measures that have revealed specific abnormalities in the awareness of action in FMD. Based on these abnormalities, we propose a potential, new solution to the paradox of volition in FMD. © 2016 Elsevier B.V. All rights reserved.

Infectious disease transmission and contact networks in wildlife and livestock.

PubMed

Craft, Meggan E

2015-05-26

The use of social and contact networks to answer basic and applied questions about infectious disease transmission in wildlife and livestock is receiving increased attention. Through social network analysis, we understand that wild animal and livestock populations, including farmed fish and poultry, often have a heterogeneous contact structure owing to social structure or trade networks. Network modelling is a flexible tool used to capture the heterogeneous contacts of a population in order to test hypotheses about the mechanisms of disease transmission, simulate and predict disease spread, and test disease control strategies. This review highlights how to use animal contact data, including social networks, for network modelling, and emphasizes that researchers should have a pathogen of interest in mind before collecting or using contact data. This paper describes the rising popularity of network approaches for understanding transmission dynamics in wild animal and livestock populations; discusses the common mismatch between contact networks as measured in animal behaviour and relevant parasites to match those networks; and highlights knowledge gaps in how to collect and analyse contact data. Opportunities for the future include increased attention to experiments, pathogen genetic markers and novel computational tools. © 2015 The Author(s) Published by the Royal Society. All rights reserved.

A Review of Transmission Diagnostics Research at NASA Lewis Research Center

NASA Technical Reports Server (NTRS)

Zakajsek, James J.

1994-01-01

This paper presents a summary of the transmission diagnostics research work conducted at NASA Lewis Research Center over the last four years. In 1990, the Transmission Health and Usage Monitoring Research Team at NASA Lewis conducted a survey to determine the critical needs of the diagnostics community. Survey results indicated that experimental verification of gear and bearing fault detection methods, improved fault detection in planetary systems, and damage magnitude assessment and prognostics research were all critical to a highly reliable health and usage monitoring system. In response to this, a variety of transmission fault detection methods were applied to experimentally obtained fatigue data. Failure modes of the fatigue data include a variety of gear pitting failures, tooth wear, tooth fracture, and bearing spalling failures. Overall results indicate that, of the gear fault detection techniques, no one method can successfully detect all possible failure modes. The more successful methods need to be integrated into a single more reliable detection technique. A recently developed method, NA4, in addition to being one of the more successful gear fault detection methods, was also found to exhibit damage magnitude estimation capabilities.

Revisiting adoption of high transmission PSM: pros, cons and path forward

NASA Astrophysics Data System (ADS)

Ma, Z. Mark; McDonald, Steve; Progler, Chris

2009-12-01

High transmission attenuated phase shift masks (Hi-T PSM) have been successfully applied in volume manufacturing for certain memory devices. Moreover, numerous studies have shown the potential benefits of Hi-T PSM for specific lithography applications. In this paper, the potential for extending Hi-T PSM to logic devices, is revisited with an emphasis on understanding layout, transmission, and manufacturing of Hi-T PSM versus traditional 6% embedded attenuated phase shift mask (EAPSM). Simulations on various layouts show Hi-T PSM has advantage over EAPSM in low duty cycle line patterns and high duty cycle space patterns. The overall process window can be enhanced when Hi- T PSM is combined with optimized optical proximity correction (OPC), sub-resolution assist features (SRAF), and source illumination. Therefore, Hi-T PSM may be a viable and lower cost alternative to other complex resolution enhancement technology (RET) approaches. Aerial image measurement system (AIMS) results on test masks, based on an inverse lithography technology (ILT) generated layout, confirm the simulation results. New advancement in high transmission blanks also make low topography Hi-T PSM a reality, which can minimize scattering effects in high NA lithography.

Mixture model to assess the extent of cross-transmission of multidrug-resistant pathogens in hospitals.

PubMed

Mikolajczyk, Rafael T; Kauermann, Göran; Sagel, Ulrich; Kretzschmar, Mirjam

2009-08-01

Creation of a mixture model based on Poisson processes for assessment of the extent of cross-transmission of multidrug-resistant pathogens in the hospital. We propose a 2-component mixture of Poisson processes to describe the time series of detected cases of colonization. The first component describes the admission process of patients with colonization, and the second describes the cross-transmission. The data set used to illustrate the method consists of the routinely collected records for methicillin-resistant Staphylococcus aureus (MRSA), imipenem-resistant Pseudomonas aeruginosa, and multidrug-resistant Acinetobacter baumannii over a period of 3 years in a German tertiary care hospital. For MRSA and multidrug-resistant A. baumannii, cross-transmission was estimated to be responsible for more than 80% of cases; for imipenem-resistant P. aeruginosa, cross-transmission was estimated to be responsible for 59% of cases. For new cases observed within a window of less than 28 days for MRSA and multidrug-resistant A. baumannii or 40 days for imipenem-resistant P. aeruginosa, there was a 50% or greater probability that the cause was cross-transmission. The proposed method offers a solution to assessing of the extent of cross-transmission, which can be of clinical use. The method can be applied using freely available software (the package FlexMix in R) and it requires relatively little data.

Optimal estimation of spatially variable recharge and transmissivity fields under steady-state groundwater flow. Part 1. Theory

NASA Astrophysics Data System (ADS)

Graham, Wendy D.; Tankersley, Claude D.

1994-05-01

Stochastic methods are used to analyze two-dimensional steady groundwater flow subject to spatially variable recharge and transmissivity. Approximate partial differential equations are developed for the covariances and cross-covariances between the random head, transmissivity and recharge fields. Closed-form solutions of these equations are obtained using Fourier transform techniques. The resulting covariances and cross-covariances can be incorporated into a Bayesian conditioning procedure which provides optimal estimates of the recharge, transmissivity and head fields given available measurements of any or all of these random fields. Results show that head measurements contain valuable information for estimating the random recharge field. However, when recharge is treated as a spatially variable random field, the value of head measurements for estimating the transmissivity field can be reduced considerably. In a companion paper, the method is applied to a case study of the Upper Floridan Aquifer in NE Florida.

The evolution of plant virus transmission pathways

Treesearch

Frédéric M. Hamelin; Linda J.S. Allen; Holly R. Prendeville; M. Reza Hajimorad; Michael J. Jeger

2016-01-01

The evolution of plant virus transmission pathways is studied through transmission via seed, pollen, oravector. We address the questions: under what circumstances does vector transmission make pollen transmission redundant? Can evolution lead to the coexistence of multiple virus transmission pathways? We restrict the analysis to an annual plant population in which...

Household transmission of SARS, 2003

PubMed Central

Wilson-Clark, Samantha D.; Deeks, Shelley L.; Gournis, Effie; Hay, Karen; Bondy, Susan; Kennedy, Erin; Johnson, Ian; Rea, Elizabeth; Kuschak, Theodore; Green, Diane; Abbas, Zahid; Guarda, Brenda

2006-01-01

Background In the 2003 outbreak in Toronto (in Ontario, Canada) of severe acute respiratory syndrome (SARS), about 20% of cases resulted from household transmission. The purpose of our study was to determine characteristics associated with the transmission of SARS within households. Methods A retrospective cohort of SARS-affected households was studied to determine risk factors for household transmission. Questionnaires addressed characteristics of the index case, the household and behaviours among household members. Potential risk factors for secondary transmission of infection were assessed in regression models appropriate to the outcome (secondary cases) and nonindependence of household members. Results The 74 households that participated included 18 secondary cases and 158 uninfected household members in addition to the 74 index cases. The household secondary attack rate was 10.2% (95% confidence interval [CI] 6.7%–23.5%). There was a linear association between the time the index patient spent at home after symptom onset and the secondary attack rate. Infected health care workers who were index cases had lower rates of household transmission. Interpretation SARS transmission in households is complex and increases with the length of time an ill person spends at home. Risk of transmission was lower when the index case was a health care worker. Rapid case identification is the public health measure most useful in minimizing exposure in the home. PMID:17098951

The qualitative f-ratio method applied to electron channelling-induced x-ray imaging with an annular silicon drift detector in a scanning electron microscope in the transmission mode.

PubMed

Brodusch, Nicolas; Gauvin, Raynald

2017-09-01

Electron channelling is known to affect the x-ray production when an accelerated electron beam is applied to a crystalline material and is highly dependent on the local crystal orientation. This effect, unless very long counting time are used, is barely noticeable on x-ray energy spectra recorded with conventional silicon drift detectors (SDD) located at a small elevation angle. However, the very high count rates provided by the new commercially available annular SDDs permit now to observe this effect routinely and may, in some circumstances, hide the true elemental x-ray variations due to the local true specimen composition. To circumvent this issue, the recently developed f-ratio method was applied to display qualitatively the true net intensity x-ray variations in a thin specimen of a Ti-6Al-4V alloy in a scanning electron microscope in transmission mode. The diffraction contrast observed in the x-ray images was successfully cancelled through the use of f-ratios and the true composition variations at the grain boundaries could be observed in relation to the dislocation alignment prior to the β-phase nucleation. The qualitative effectiveness in removing channelling effects demonstrated in this work makes the f-ratio, in its quantitative form, a possible alternative to the ZAF method in channelling conditions. © 2017 The Authors Journal of Microscopy © 2017 Royal Microscopical Society.

Automated Transmission Loss Measurement in the Structural Acoustic Loads and Transmission Facility at NASA Langley Research Center

NASA Technical Reports Server (NTRS)

Klos, J.; Brown, S. A.

2002-01-01

A technique to measure the radiated acoustic intensity and transmission loss of panels is documented in this paper. This facility has been upgraded to include a test fixture that scans the acoustic intensity radiated from a panel on the anechoic receiving room side of the transmission loss window. The acoustic intensity incident on the panel from the reverberant side of the transmission loss window is estimated from measurements made using six stationary microphones in the reverberant source room. From the measured incident and radiated intensity, the sound power transmission loss is calculated. The setup of the facility and data acquisition system are documented. A transmission loss estimate of a typical panel is shown. The measurement-to-measurement and setup-to-setup repeatability of the transmission loss estimate are assessed. Conclusions are drawn about the ability to measure changes in transmission loss due to changes in panel construction.

Proposed design procedure for transmission shafting under fatigue loading

NASA Technical Reports Server (NTRS)

Loewenthal, S. H.

1978-01-01

The B106 American National Standards Committee is currently preparing a new standard for the design of transmission shafting. A design procedure, proposed for use in the new standard, for computing the diameter of rotating solid steel shafts under combined cyclic bending and steady torsion is presented. The formula is based on an elliptical variation of endurance strength with torque exhibited by combined stress fatigue data. Fatigue factors are cited to correct specimen bending endurance strength data for use in the shaft formula. A design example illustrates how the method is to be applied.

Cell-to-cell Transmission of Polyglutamine Aggregates in C. elegans

PubMed Central

Kim, Dong-Kyu; Cho, Kyu-Won; Ahn, Woo Jung; Perez-Acuña, Dayana; Jeong, Hyunsu; Lee, He-Jin

2017-01-01

Huntington disease (HD) is an inherited neurodegenerative disorder characterized by motor and cognitive dysfunction caused by expansion of polyglutamine (polyQ) repeat in exon 1 of huntingtin (HTT). In patients, the number of glutamine residues in polyQ tracts are over 35, and it is correlated with age of onset, severity, and disease progression. Expansion of polyQ increases the propensity for HTT protein aggregation, process known to be implicated in neurodegeneration. These pathological aggregates can be transmitted from neuron to another neuron, and this process may explain the pathological spreading of polyQ aggregates. Here, we developed an in vivo model for studying transmission of polyQ aggregates in a highly quantitative manner in real time. HTT exon 1 with expanded polyQ was fused with either N-terminal or C-terminal fragments of Venus fluorescence protein and expressed in pharyngeal muscles and associated neurons, respectively, of C. elegans. Transmission of polyQ proteins was detected using bimolecular fluorescence complementation (BiFC). Mutant polyQ (Q97) was transmitted much more efficiently than wild type polyQ (Q25) and forms numerous inclusion bodies as well. The transmission of Q97 was gradually increased with aging of animal. The animals with polyQ transmission exhibited degenerative phenotypes, such as nerve degeneration, impaired pharyngeal pumping behavior, and reduced life span. The C. elegans model presented here would be a useful in vivo model system for the study of polyQ aggregate propagation and might be applied to the screening of genetic and chemical modifiers of the propagation. PMID:29302199

Sound transmission through triple-panel structures lined with poroelastic materials

NASA Astrophysics Data System (ADS)

Liu, Yu

2015-03-01

In this paper, previous theories on the prediction of sound transmission loss for a double-panel structure lined with poroelastic materials are extended to address the problem of a triple-panel structure. Six typical configurations are considered for a triple-panel structure based on the method of coupling the porous layers to the facing panels which determines critically the sound insulation performance of the system. The transfer matrix method is employed to solve the system by applying appropriate types of boundary conditions for these configurations. The transmission loss of the triple-panel structures in a diffuse sound field is calculated as a function of frequency and compared with that of corresponding double-panel structures. Generally, the triple-panel structure with poroelastic linings has superior acoustic performance to the double-panel counterpart, remarkably in the mid-high frequency range and possibly at low frequencies, by selecting appropriate configurations in which those with two air gaps in the structure exhibit the best overall performance over the entire frequency range. The poroelastic lining significantly lowers the cut-on frequency above which the triple-panel structure exhibits noticeably higher transmission loss. Compared with a double-panel structure, the wider range of system parameters for a triple-panel structure due to the additional partition provides more design space for tuning the sound insulation performance. Despite the increased structural complexity, the triple-panel structure lined with poroelastic materials has the obvious advantages in sound transmission loss while without the penalties in weight and volume, and is hence a promising replacement for the widely used double-panel sandwich structure.

The spatial coherence function in scanning transmission electron microscopy and spectroscopy.

PubMed

Nguyen, D T; Findlay, S D; Etheridge, J

2014-11-01

We investigate the implications of the form of the spatial coherence function, also referred to as the effective source distribution, for quantitative analysis in scanning transmission electron microscopy, and in particular for interpreting the spatial origin of imaging and spectroscopy signals. These questions are explored using three different source distribution models applied to a GaAs crystal case study. The shape of the effective source distribution was found to have a strong influence not only on the scanning transmission electron microscopy (STEM) image contrast, but also on the distribution of the scattered electron wavefield and hence on the spatial origin of the detected electron intensities. The implications this has for measuring structure, composition and bonding at atomic resolution via annular dark field, X-ray and electron energy loss STEM imaging are discussed. Copyright © 2014 Elsevier B.V. All rights reserved.

Optimal Control of Malaria Transmission using Insecticide Treated Nets and Spraying

NASA Astrophysics Data System (ADS)

Athina, D.; Bakhtiar, T.; Jaharuddin

2017-03-01

In this paper, we consider a model of the transmission of malaria which was developed by Silva and Torres equipped with two control variables, namely the use of insecticide treated nets (ITN) to reduce the number of human beings infected and spraying to reduce the number of mosquitoes. Pontryagin maximum principle was applied to derive the differential equation system as optimality conditions which must be satisfied by optimal control variables. The Mangasarian sufficiency theorem shows that Pontryagin maximum principle is necessary as well as sufficient conditions for optimization problem. The 4th-order Runge Kutta method was then performed to solve the differential equations system. The numerical results show that both controls given at once can reduce the number of infected individuals as well as the number of mosquitoes which reduce the impact of malaria transmission.

Household Financial Status and Gender Perspectives in Determining the Financial Impact of Foot and Mouth Disease in Lao PDR.

PubMed

Nampanya, S; Khounsy, S; Abila, R; Dy, C; Windsor, P A

2016-08-01

The socioeconomic impacts of foot and mouth disease (FMD) during 2011-12 outbreaks on large ruminant smallholders in Laos were investigated, including examination of data on gender, household financial status and farmer husbandry practices. A mix of participatory tools and survey questionnaires at the village and household level, respectively, were conducted, involving individual farmer interviews (n = 124) and group meetings with village elders to establish criteria for classification of household financial status as being 'poor, medium or well off' according to rice sufficiency, assets and household incomes. FMD-attributable financial losses were determined by inclusion of losses due to: mortality, morbidity and costs of treatments. The estimated mean financial losses due to FMD were USD 436 (±92) in the 'poor' and USD 949 (±76) in the 'well off' household categories (P < 0.001), being 128% and 49% of income from the sale of large ruminants, respectively. Variation in financial losses reflected differences in morbidity, farmer husbandry practices including frequency of observation of animals and thus recognition of FMD and choice of treatments. Of concern were adverse financial impacts of treatment especially where antibiotics were used; delays in reporting of FMD cases after observation of signs (mean of 2 days); admission that 10% of farmers had sold FMD-affected livestock; and that 22% of respondents claimed their large ruminants were cared for by females. The findings confirm that FMD has the most severe financial impact on poorer households and that females have a significant role in large ruminant production. It is recommended that livestock extension activities promote the benefits of prevention rather than treatment for FMD and encourage participation of women in biosecurity and disease risk management interventions including rapid reporting and regulatory compliance, particularly with animal movement controls and other biosecurity practices that

Impact of Disease Duration on Vascular Surrogates of Early Atherosclerosis in Childhood-Onset Systemic Lupus Erythematosus.

PubMed

Barsalou, Julie; Bradley, Timothy J; Tyrrell, Pascal N; Slorach, Cameron; Ng, Lawrence W K; Levy, Deborah M; Silverman, Earl D

2016-01-01

To determine whether longer disease duration negatively impacts carotid intima-media thickness (CIMT), flow-mediated dilation (FMD), and pulse wave velocity (PWV) in a cohort of patients with childhood-onset systemic lupus erythematosus (SLE), and to compare CIMT, FMD, and PWV in patients with childhood-onset SLE with those in healthy children and explore determinants of vascular test results in childhood-onset SLE. Cross-sectional analysis was performed in a prospective longitudinal cohort of patients with childhood-onset SLE at the latest followup visit. Clinical and laboratory data were collected for patients with childhood-onset SLE. CIMT, FMD, and PWV were measured using standardized protocols in patients with childhood-onset SLE and healthy children. Correlations between disease duration and results of the 3 vascular tests were performed. Vascular data in patients with childhood-onset SLE were compared with those in healthy children. Multivariable linear regression was used to identify determinants of CIMT, FMD, and PWV in childhood-onset SLE. Patients with childhood-onset SLE (n = 149) and healthy controls (n = 178) were enrolled. The median age of the patients was 17.2 years (interquartile range [IQR] 15.7-17.9 years), and their median disease duration was 3.2 years (IQR 1.8-4.9 years). The median age of the healthy children was 14.7 years (IQR 13.1-15.9 years). Longer disease duration correlated with worse FMD (r = -0.2, P = 0.031) in patients with childhood-onset SLE. Patients with childhood-onset SLE had smaller (better) CIMT, higher (better) FMD, and similar PWV compared with healthy controls. Linear regression analysis explained <24% of the variation in vascular test results in patients with childhood-onset SLE, suggesting that other variables should be explored as important determinants of CIMT, FMD, and PWV. In this cohort of 149 patients with childhood-onset SLE, patients did not have worse CIMT, FMD, or PWV than did healthy controls

Sex impacts the flow-mediated dilation response to acute aerobic exercise in older adults.

PubMed

Yoo, Jeung-Ki; Pinto, Michelle M; Kim, Han-Kyul; Hwang, Chueh-Lung; Lim, Jisok; Handberg, Eileen M; Christou, Demetra D

2017-05-01

There is growing evidence of sex differences in the chronic effect of aerobic exercise on endothelial function (flow-mediated dilation; FMD) in older adults, but whether there are sex differences also in the acute effect of aerobic exercise on FMD in older adults is unknown. The purpose of this study was to test the hypothesis that sex modulates the FMD response to acute aerobic exercise in older adults. Thirteen older men and fifteen postmenopausal women (67±1 vs. 65±2years, means±SE, P=0.6), non-smokers, free of major clinical disease, participated in this randomized crossover study. Brachial artery FMD was measured: 1) prior to exercise; 2) 20min after a single bout of high-intensity interval training (HIIT; 40min; 4×4 intervals 90% peak heart rate (HRpeak)), moderate-intensity continuous training (MICT; 47min 70% HRpeak) and low-intensity continuous training (LICT; 47min 50% HRpeak) on treadmill; and 3) following 60-min recovery from exercise. In older men, FMD was attenuated by 45% following HIIT (5.95±0.85 vs. 3.27±0.52%, P=0.003) and by 37% following MICT (5.97±0.87 vs. 3.73±0.47%, P=0.03; P=0.9 for FMD response to HIIT vs. MICT) and was normalized following 60-min recovery (P=0.99). In postmenopausal women, FMD did not significantly change in response to HIIT (4.93±0.55 vs. 6.31±0.57%, P=0.14) and MICT (5.32±0.62 vs. 5.60±0.68%, P=0.99). In response to LICT, FMD did not change in postmenopausal women nor older men (5.21±0.64 vs. 6.02±0.73%, P=0.7 and 5.70±0.80 vs. 5.55±0.67%, P=0.99). In conclusion, sex and exercise intensity influence the FMD response to acute aerobic exercise in older adults. Copyright © 2017 Elsevier Inc. All rights reserved.

Reactivity to low-flow as a potential determinant for brachial artery flow-mediated vasodilatation.

PubMed

Aizawa, Kunihiko; Elyas, Salim; Adingupu, Damilola D; Casanova, Francesco; Gooding, Kim M; Strain, W David; Shore, Angela C; Gates, Phillip E

2016-06-01

Previous studies have reported a vasoconstrictor response in the radial artery during a cuff-induced low-flow condition, but a similar low-flow condition in the brachial artery results in nonuniform reactivity. This variable reactivity to low-flow influences the subsequent flow-mediated dilatation (FMD) response following cuff-release. However, it is uncertain whether reactivity to low-flow is important in data interpretation in clinical populations and older adults. This study aimed to determine the influence of reactivity to low-flow on the magnitude of brachial artery FMD response in middle-aged and older individuals with diverse cardiovascular risk profiles. Data were analyzed from 165 individuals, divided into increased cardiovascular risk (CVR: n = 115, 85M, 67.0 ± 8.8 years) and healthy control (CTRL: n = 50, 30M, 63.2 ± 7.2 years) groups. Brachial artery diameter and blood velocity data obtained from Doppler ultrasound were used to calculate FMD, reactivity to low-flow and estimated shear rate (SR) using semiautomated edge-detection software. There was a significant association between reactivity to low-flow and FMD in overall (r = 0.261), CTRL (r = 0.410) and CVR (r = 0.189, all P < 0.05) groups. Multivariate regression analysis found that reactivity to low-flow, peak SR, and baseline diameter independently contributed to FMD along with sex, the presence of diabetes, and smoking (total R(2) = 0.450). There was a significant association between reactivity to low-flow and the subsequent FMD response in the overall dataset, and reactivity to low-flow independently contributed to FMD These findings suggest that reactivity to low-flow plays a key role in the subsequent brachial artery FMD response and is important in the interpretation of FMD data. © 2016 The Authors. Physiological Reports published by Wiley Periodicals, Inc. on behalf of the American Physiological Society and The Physiological Society.

Epoetin beta pegol ameliorates flow-mediated dilation with improving endothelial nitric oxide synthase coupling state in nonobese diabetic rats.

PubMed

Serizawa, Kenichi; Yogo, Kenji; Tashiro, Yoshihito; Kawasaki, Ryohei; Endo, Koichi; Shimonaka, Yasushi; Hirata, Michinori

2017-04-01

Patients with diabetic nephropathy have a high cardiovascular mortality. Epoetin beta pegol (continuous erythropoietin receptor activator, C.E.R.A.) is a drug for the treatment of renal anemia. In this study, we investigated the effect of C.E.R.A. on vascular endothelial function as evaluated by flow-mediated dilation (FMD) and the relationship between hematopoiesis and FMD in diabetic nephropathy rats. Male Spontaneously Diabetic Torii rats (SDT, 22 weeks old) were used. C.E.R.A. (0.6, 1.2 μg/kg) was administered subcutaneously once every 2 weeks for 8 weeks. At 1 week after last administration (31 weeks old), we assessed FMD in the femoral arteries of anesthetized rats using a high-resolution ultrasound system. FMD was also measured 1 week after single C.E.R.A. treatment (5.0 μg/kg) to examine the influence of hematopoiesis. Flow-mediated dilation was significantly decreased in SDT rats before the start of C.E.R.A. treatment (22 weeks old). Repeated administration of C.E.R.A. dose-dependently improved FMD in SDT rats (31 weeks old) without changing blood glucose, nitroglycerin-induced vasodilation, or kidney function. Long-term administration of C.E.R.A. improved the state of endothelial nitric oxide synthase uncoupling in the femoral arteries of SDT rats, which showed a positive correlation with FMD. On the other hand, there was no correlation between FMD and Hb or Hct in SDT rats. Furthermore, at 1 week after single administration of C.E.R.A., FMD was not significantly improved although hemoglobin levels were comparable with levels following long-term C.E.R.A. Long-term treatment with C.E.R.A. improved FMD in SDT rats even after onset of endothelial dysfunction. © 2017 The Authors. Cardiovascular Therapeutics Published by John Wiley & Sons Ltd.

Impact of foot-and-mouth disease on pork and chicken prices in Central Luzon, Philippines.

PubMed

Abao, Lary Nel B; Kono, Hiroichi; Gunarathne, Anoma; Promentilla, Rolando R; Gaerlan, Manolita Z

2014-03-01

Central Luzon is the number one pig-producing region in the Philippines and was affected by Foot-and-Mouth disease (FMD) in 1995. In this paper, the impact of FMD on the Central Luzon meat market from 1995 to 1999 was examined. Employing the error correction model (ECM) and historical decomposition, the impact of FMD on the Central Luzon pork and chicken meat market was quantified. The following findings were observed: (a) pig farm and pork wholesale prices dropped 11.8% and 15.7%, respectively, after the initial FMD outbreaks in January, 1995; (b) in February, 1995, chicken farm and wholesale prices declined by 21.1% and 14.2%, respectively (while chicken retail prices also went down by 10.5%); (c) the margins of pig and chicken traders were also adversely affected at some point; and (d) FMD caused changes of dynamic interdependence among prices by meat type at different levels of the meat supply chain. This study makes several contributions to the literature on the impact of FMD outbreaks. This study is the first that simultaneously investigates the impact of FMD outbreaks on meat prices, price margins along the supply chain, and price interdependence in the meat system in Central Luzon, Philippines. Also, the Philippine pork industry is dominated by backyard farmers rather than the predominantly large commercial pig farmers existing in developed countries. Secondly, it yielded the novel finding of price decline in both pig and chicken prices as a result of the FMD outbreaks. And lastly, the study showed that the profit margins of the pig traders, pork traders, chicken traders and chicken meat traders were also negatively affected by the FMD outbreaks in January 1995. However, over the long term, the price margins of pork traders were more severely affected in contrast to that of the other traders' profits. Copyright © 2013 Elsevier B.V. All rights reserved.

An Insight on Right of Way and its Cost for Power Transmission Cable and Conventional Overhead Transmission Lines

NASA Astrophysics Data System (ADS)

Khandelwal, P.; Pachori, A.; Khandelwal, T.

2013-12-01

This paper provides the complete information related to Right of Way (RoW) for the construction of new power transmission line (TL) in terms of present cost for overhead transmission line and underground XLPE transmission cable. The former part of the paper describes the general procedure and rules for acquisition of land for RoW by transmission asset owner (TAO) while in the later part the cost associated to acquire RoW and its impact on the cost of adjacent land have been detailed. It also discusses the actual dismantling cost including the cost of waste metal what TAO get after completion of lifecycle of TL due to increase in metal prices. In this paper cost of RoW after completion of lifecycle of TL is also highlighted. This paper compares the cost of RoW for overhead transmission line and underground XLPE transmission cable for construction of new TL. Also for old transmission infrastructure cost of RoW for change from overhead transmission line to underground XLPE transmission cable is detailed by application of replacement model.

Transmission line design for the lunar environment

NASA Technical Reports Server (NTRS)

Gaustad, Krista L.; Gordon, Lloyd B.

1990-01-01

How the mass, operating temperature, and efficiency of a transmission line operating on the moon are affected by its operating parameters, the lunar environment, and the choice of materials is examined. The key transmission line parameters which have an effect on mass, operating temperature, and efficiency are voltage, power loss, and waveform. The choice of waveform for transmission will be influenced by the waveform of the source and load, and therefore an analysis of both DC and AC transmission is necessary for a complete understanding of lunar power transmission. The data presented are for the DC case only; however, the discussion of the environmental effects and of material selection is pertinent to both AC and DC transmission. The operating voltage is shown to be a key parameter in transmission line design. The role efficiency plays in transmission line design is also examined. The analyses include above- and below-the-surface operation for both a vacuum-insulated, two-wire, transmission line, and a solid-dielectric-insulated, coaxial, transmission line.

Floating marine debris in fjords, gulfs and channels of southern Chile.

PubMed

Hinojosa, Iván A; Thiel, Martin

2009-08-01

Floating marine debris (FMD) is reported from all oceans. The bulk of FMD are plastics, which due to their longevity cause multiple negative impacts on wildlife and environment. Identifying the origins of FMD (land- or sea-based) is important to take the necessary steps to diminish their abundance. Using ship surveys we examined the abundance, composition and distribution of FMD during the years 2002-2005 in the fjords, gulfs and channels of southern Chile. Abundances of FMD were relatively high compared with other studies, ranging from 1 to 250 items km(-2). The majority (approximately 80%) of FMD was composed of styrofoam (expanded polystyrene), plastic bags and plastic fragments. Styrofoam, which is intensively used as flotation device by mussel farms, was very abundant in the northern region but rarely occurred in the southern region of the study area. Food sacks from salmon farms were also most common in the northern region, where approximately 85% of the total Chilean mussel and salmon harvest is produced. Plastic bags, which could be from land- or sea-based sources, were found throughout the entire study area. Our results indicate that sea-based activities (mussel farming and salmon aquaculture) are responsible for most FMD in the study area. In order to reduce FMDs in the environment, in addition to stronger legislation and identification of potential sources, we suggest environmental education programs and we encourage public participation (e.g. in beach surveys and clean-ups).

Molecular characterization of foot-and-mouth disease virus: implications for disease control in Bangladesh.

PubMed

Loth, L; Osmani, M G; Kalam, M A; Chakraborty, R K; Wadsworth, J; Knowles, N J; Hammond, J M; Benigno, C

2011-06-01

Foot-and-mouth disease (FMD) is endemic in Bangladesh, and to implement an effective FMD control programme, it is essential to understand the complex epidemiology of the disease. Here, we report on the characterization of FMD virus (FMDV) recovered from FMD outbreaks in Bangladesh in late 2009. All isolated viruses belonged to the FMDV serotype O. The phylogenetic reconstruction showed that all isolates belonged to the Middle East-South Asia (ME-SA) topotype, but fell into two distinct sublineages, one named Ind-2001 (the other has not been named). Within both sublineages, the 2009 Bangladesh isolates were most closely related to viruses from Nepal collected during 2008 and 2009. Additionally, both sublineages contained older viruses from India collected in 2000 and 2001. In South Asia, there is extensive cross-border cattle movement from Nepal and India to Bangladesh. Both these findings have implications for the control of FMD in Bangladesh. Because of the porous borders, a regional FMD control strategy should be developed. Further, animal identification and monitoring animal movements are necessary to identify the cross-border movements and market chain interactions of ruminants, leading to improved border and movement controls. Additionally, a vaccination strategy should be developed with the initial objective of protecting small-scale dairy herds from disease. For any successful FMD control programme, long-term Government commitment and adequate resources are necessary. A sustainable programme will also need farmer education, commitment and financial contributions. © 2011 Blackwell Verlag GmbH.

Autonomic nervous functions in fetal type Minamata disease patients: assessment of heart rate variability.

PubMed

Oka, Tomoko; Matsukura, Makoto; Okamoto, Miwako; Harada, Noriaki; Kitano, Takao; Miike, Teruhisa; Futatsuka, Makoto

2002-12-01

In order to assess the cardiovascular autonomic nervous functions in patients with fetal type Minamata disease (FMD), we investigated blood pressure (BP), and conducted time and frequency domain analysis of heart rate variability (HRV). Subjects were 9 patients in Meisuien recognized as FMD, and 13 healthy age matched control subjects. HRV and BP were assessed after subjects rested in a supine position for 10 minutes. Electrocardiographic (ECG) data were collected for 3 minutes during natural breathing. Time domain analysis (the average of R-R intervals [Mean RR], standard deviation of R-R intervals [SD RR], coefficient of variation [CV]), and frequency domain analysis by fast Fourier transformation (FFT) (power of low frequency [LF] and high frequency [HF] component, expressed in normalized units[nu]) were then conducted. In the time domain analysis, the mean RR of the FMD group was significantly lower than that of the control group. Neither SD RR nor CV showed significant differences between the two groups, but both tended to be lower in the FMD group. In the frequency domain analysis, the HF component of the FMD group was significantly lower than that of the control group. Pulse pressure (PP) was significantly lower in the FMD subjects. These findings suggest that parasympathetic nervous dysfunction might exist in FMD patients, who were exposed to high doses of methylmercury (MeHg) during the prenatal period. Decrease of PP might be due to degenerative changes of blood vessels driven by exposure to high doses of MeHg.

49 CFR 191.13 - Distribution systems reporting transmission pipelines; transmission or gathering systems...

Code of Federal Regulations, 2010 CFR

2010-10-01

... 49 Transportation 3 2010-10-01 2010-10-01 false Distribution systems reporting transmission pipelines; transmission or gathering systems reporting distribution pipelines. 191.13 Section 191.13 Transportation Other Regulations Relating to Transportation (Continued) PIPELINE AND HAZARDOUS MATERIALS SAFETY ADMINISTRATION, DEPARTMENT OF...

Modelling of Rail Vehicles and Track for Calculation of Ground-Vibration Transmission Into Buildings

NASA Astrophysics Data System (ADS)

Hunt, H. E. M.

1996-05-01

A methodology for the calculation of vibration transmission from railways into buildings is presented. The method permits existing models of railway vehicles and track to be incorporated and it has application to any model of vibration transmission through the ground. Special attention is paid to the relative phasing between adjacent axle-force inputs to the rail, so that vibration transmission may be calculated as a random process. The vehicle-track model is used in conjunction with a building model of infinite length. The tracking and building are infinite and parallel to each other and forces applied are statistically stationary in space so that vibration levels at any two points along the building are the same. The methodology is two-dimensional for the purpose of application of random process theory, but fully three-dimensional for calculation of vibration transmission from the track and through the ground into the foundations of the building. The computational efficiency of the method will interest engineers faced with the task of reducing vibration levels in buildings. It is possible to assess the relative merits of using rail pads, under-sleeper pads, ballast mats, floating-slab track or base isolation for particular applications.

Weather Regulates Location, Timing, and Intensity of Dengue Virus Transmission between Humans and Mosquitoes

PubMed Central

Campbell, Karen M.; Haldeman, Kristin; Lehnig, Chris; Munayco, Cesar V.; Halsey, Eric S.; Laguna-Torres, V. Alberto; Yagui, Martín; Morrison, Amy C.; Lin, Chii-Dean; Scott, Thomas W.

2015-01-01

Background Dengue is one of the most aggressively expanding mosquito-transmitted viruses. The human burden approaches 400 million infections annually. Complex transmission dynamics pose challenges for predicting location, timing, and magnitude of risk; thus, models are needed to guide prevention strategies and policy development locally and globally. Weather regulates transmission-potential via its effects on vector dynamics. An important gap in understanding risk and roadblock in model development is an empirical perspective clarifying how weather impacts transmission in diverse ecological settings. We sought to determine if location, timing, and potential-intensity of transmission are systematically defined by weather. Methodology/Principal Findings We developed a high-resolution empirical profile of the local weather-disease connection across Peru, a country with considerable ecological diversity. Applying 2-dimensional weather-space that pairs temperature versus humidity, we mapped local transmission-potential in weather-space by week during 1994-2012. A binary classification-tree was developed to test whether weather data could classify 1828 Peruvian districts as positive/negative for transmission and into ranks of transmission-potential with respect to observed disease. We show that transmission-potential is regulated by temperature-humidity coupling, enabling epidemics in a limited area of weather-space. Duration within a specific temperature range defines transmission-potential that is amplified exponentially in higher humidity. Dengue-positive districts were identified by mean temperature >22°C for 7+ weeks and minimum temperature >14°C for 33+ weeks annually with 95% sensitivity and specificity. In elevated-risk locations, seasonal peak-incidence occurred when mean temperature was 26-29°C, coincident with humidity at its local maximum; highest incidence when humidity >80%. We profile transmission-potential in weather-space for temperature

Weather Regulates Location, Timing, and Intensity of Dengue Virus Transmission between Humans and Mosquitoes.

PubMed

Campbell, Karen M; Haldeman, Kristin; Lehnig, Chris; Munayco, Cesar V; Halsey, Eric S; Laguna-Torres, V Alberto; Yagui, Martín; Morrison, Amy C; Lin, Chii-Dean; Scott, Thomas W

2015-01-01

Dengue is one of the most aggressively expanding mosquito-transmitted viruses. The human burden approaches 400 million infections annually. Complex transmission dynamics pose challenges for predicting location, timing, and magnitude of risk; thus, models are needed to guide prevention strategies and policy development locally and globally. Weather regulates transmission-potential via its effects on vector dynamics. An important gap in understanding risk and roadblock in model development is an empirical perspective clarifying how weather impacts transmission in diverse ecological settings. We sought to determine if location, timing, and potential-intensity of transmission are systematically defined by weather. We developed a high-resolution empirical profile of the local weather-disease connection across Peru, a country with considerable ecological diversity. Applying 2-dimensional weather-space that pairs temperature versus humidity, we mapped local transmission-potential in weather-space by week during 1994-2012. A binary classification-tree was developed to test whether weather data could classify 1828 Peruvian districts as positive/negative for transmission and into ranks of transmission-potential with respect to observed disease. We show that transmission-potential is regulated by temperature-humidity coupling, enabling epidemics in a limited area of weather-space. Duration within a specific temperature range defines transmission-potential that is amplified exponentially in higher humidity. Dengue-positive districts were identified by mean temperature >22°C for 7+ weeks and minimum temperature >14°C for 33+ weeks annually with 95% sensitivity and specificity. In elevated-risk locations, seasonal peak-incidence occurred when mean temperature was 26-29°C, coincident with humidity at its local maximum; highest incidence when humidity >80%. We profile transmission-potential in weather-space for temperature-humidity ranging 0-38°C and 5-100% at 1°C x 2

Scanning transmission ion micro-tomography (STIM-T) of biological specimens.

PubMed

Schwertner, Micheal; Sakellariou, Arthur; Reinert, Tilo; Butz, Tilman

2006-05-01

Computed tomography (CT) was applied to sets of Scanning Transmission Ion Microscopy (STIM) projections recorded at the LIPSION ion beam laboratory (Leipzig) in order to visualize the 3D-mass distribution in several specimens. Examples for a test structure (copper grid) and for biological specimens (cartilage cells, cygospore) are shown. Scanning Transmission Micro-Tomography (STIM-T) at a resolution of 260 nm was demonstrated for the first time. Sub-micron features of the Cu-grid specimen were verified by scanning electron microscopy. The ion energy loss measured during a STIM-T experiment is related to the mass density of the specimen. Typically, biological specimens can be analysed without staining. Only shock freezing and freeze-drying is required to preserve the ultra-structure of the specimen. The radiation damage to the specimen during the experiment can be neglected. This is an advantage compared to other techniques like X-ray micro-tomography. At present, the spatial resolution is limited by beam position fluctuations and specimen vibrations.

Analysis of longitudinal multivariate outcome data from couples cohort studies: application to HPV transmission dynamics

PubMed Central

Kong, Xiangrong; Wang, Mei-Cheng; Gray, Ronald

2014-01-01

We consider a specific situation of correlated data where multiple outcomes are repeatedly measured on each member of a couple. Such multivariate longitudinal data from couples may exhibit multi-faceted correlations which can be further complicated if there are polygamous partnerships. An example is data from cohort studies on human papillomavirus (HPV) transmission dynamics in heterosexual couples. HPV is a common sexually transmitted disease with 14 known oncogenic types causing anogenital cancers. The binary outcomes on the multiple types measured in couples over time may introduce inter-type, intra-couple, and temporal correlations. Simple analysis using generalized estimating equations or random effects models lacks interpretability and cannot fully utilize the available information. We developed a hybrid modeling strategy using Markov transition models together with pairwise composite likelihood for analyzing such data. The method can be used to identify risk factors associated with HPV transmission and persistence, estimate difference in risks between male-to-female and female-to-male HPV transmission, compare type-specific transmission risks within couples, and characterize the inter-type and intra-couple associations. Applying the method to HPV couple data collected in a Ugandan male circumcision (MC) trial, we assessed the effect of MC and the role of gender on risks of HPV transmission and persistence. PMID:26195849

Data Understanding Applied to Optimization

NASA Technical Reports Server (NTRS)

Buntine, Wray; Shilman, Michael

1998-01-01

The goal of this research is to explore and develop software for supporting visualization and data analysis of search and optimization. Optimization is an ever-present problem in science. The theory of NP-completeness implies that the problems can only be resolved by increasingly smarter problem specific knowledge, possibly for use in some general purpose algorithms. Visualization and data analysis offers an opportunity to accelerate our understanding of key computational bottlenecks in optimization and to automatically tune aspects of the computation for specific problems. We will prototype systems to demonstrate how data understanding can be successfully applied to problems characteristic of NASA's key science optimization tasks, such as central tasks for parallel processing, spacecraft scheduling, and data transmission from a remote satellite.

Probability of introducing foot and mouth disease into the United States via live animal importation.

PubMed

Miller, G Y; Ming, J; Williams, I; Gorvett, R

2012-12-01

Foot and mouth disease (FMD) continues to be a disease of major concern for the United States Department of Agriculture (USDA) and livestock industries. Foot and mouth disease virus is a high-consequence pathogen for the United States (USA). Live animal trade is a major risk factor for introduction of FMD into a country. This research estimates the probability of FMD being introduced into the USA via the legal importation of livestock. This probability is calculated by considering the potential introduction of FMD from each country from which the USA imports live animals. The total probability of introduction into the USA of FMD from imported livestock is estimated to be 0.415% per year, which is equivalent to one introduction every 241 years. In addition, to provide a basis for evaluating the significance of risk management techniques and expenditures, the sensitivity of the above result to changes in various risk parameter assumptions is determined.

Floating marine debris in coastal waters of the SE-Pacific (Chile).

PubMed

Thiel, M; Hinojosa, I; Vásquez, N; Macaya, E

2003-02-01

Herein we report on the abundance and composition of floating marine debris (FMD) in coastal waters of the SE-Pacific (off the Chilean coast) during the austral summer 2002. The observed FMD consisted mainly of plastic material (86.9%). Densities of FMD were highest between 20 degrees S and 40 degrees S, corresponding to the main concentrations of human population and activities. Low densities of FMD were found in the south between 40 degrees S and 50 degrees S (<1 item km(-2)). Generally, the highest densities were recorded in nearshore waters of major port cities (>20 items km(-2)), but occasionally high concentrations of debris were also found 50 km offshore. Densities of FMD in coastal waters of the SE-Pacific are of similar magnitudes as those found in coastal waters or inland seas of highly populated regions in the northern hemisphere, indicating the need for improved regulation and legislation in the countries of the SE-Pacific.

Associations of Work Hours, Job Strain, and Occupation with Endothelial Function: The Multi-Ethnic Study of Atherosclerosis (MESA)

PubMed Central

Charles, Luenda E.; Fekedulegn, Desta; Landsbergis, Paul; Burchfiel, Cecil M.; Baron, Sherry; Kaufman, Joel D.; Stukovsky, Karen Hinckley; Fujishiro, Kaori; Foy, Capri G.; Andrew, Michael E.; Roux, Ana V. Diez

2014-01-01

Objective To investigate associations of work hours, job control, job demands, job strain, and occupational category with brachial artery flow-mediated dilation (FMD) in 1,499 MESA participants. Methods FMD was obtained using high-resolution ultrasound. Mean values of FMD were examined across categories of occupation, work hours, and the other exposures using regression analyses. Results Occupational category was significantly associated with FMD overall, with blue-collar workers showing the lowest mean values: Management/professional=4.97±0.22%; sales/office=5.19±0.28%; services=4.73 ± 0.29%; and blue-collar workers=4.01±0.26% (adjusted P <0.001). There was evidence of effect modification by gender (interaction P=0.031): significant associations were observed among women (adjusted P =0.002) and nearly significant results among men (adjusted P=0.087). Other exposures were not significantly associated with FMD. Conclusions Differences in endothelial function may account for some of the variation in cardiovascular disease across occupational groups. PMID:25376409

Individual differences in boldness influence patterns of social interactions and the transmission of cuticular bacteria among group-mates

PubMed Central

Keiser, Carl N.; Pinter-Wollman, Noa; Augustine, David A.; Ziemba, Michael J.; Hao, Lingran; Lawrence, Jeffrey G.; Pruitt, Jonathan N.

2016-01-01

Despite the importance of host attributes for the likelihood of associated microbial transmission, individual variation is seldom considered in studies of wildlife disease. Here, we test the influence of host phenotypes on social network structure and the likelihood of cuticular bacterial transmission from exposed individuals to susceptible group-mates using female social spiders (Stegodyphus dumicola). Based on the interactions of resting individuals of known behavioural types, we assessed whether individuals assorted according to their behavioural traits. We found that individuals preferentially interacted with individuals of unlike behavioural phenotypes. We next applied a green fluorescent protein-transformed cuticular bacterium, Pantoea sp., to individuals and allowed them to interact with an unexposed colony-mate for 24 h. We found evidence for transmission of bacteria in 55% of cases. The likelihood of transmission was influenced jointly by the behavioural phenotypes of both the exposed and susceptible individuals: transmission was more likely when exposed spiders exhibited higher ‘boldness’ relative to their colony-mate, and when unexposed individuals were in better body condition. Indirect transmission via shared silk took place in only 15% of cases. Thus, bodily contact appears key to transmission in this system. These data represent a fundamental step towards understanding how individual traits influence larger-scale social and epidemiological dynamics. PMID:27097926

Individual differences in boldness influence patterns of social interactions and the transmission of cuticular bacteria among group-mates.

PubMed

Keiser, Carl N; Pinter-Wollman, Noa; Augustine, David A; Ziemba, Michael J; Hao, Lingran; Lawrence, Jeffrey G; Pruitt, Jonathan N

2016-04-27

Despite the importance of host attributes for the likelihood of associated microbial transmission, individual variation is seldom considered in studies of wildlife disease. Here, we test the influence of host phenotypes on social network structure and the likelihood of cuticular bacterial transmission from exposed individuals to susceptible group-mates using female social spiders (Stegodyphus dumicola). Based on the interactions of resting individuals of known behavioural types, we assessed whether individuals assorted according to their behavioural traits. We found that individuals preferentially interacted with individuals of unlike behavioural phenotypes. We next applied a green fluorescent protein-transformed cuticular bacterium,Pantoeasp., to individuals and allowed them to interact with an unexposed colony-mate for 24 h. We found evidence for transmission of bacteria in 55% of cases. The likelihood of transmission was influenced jointly by the behavioural phenotypes of both the exposed and susceptible individuals: transmission was more likely when exposed spiders exhibited higher 'boldness' relative to their colony-mate, and when unexposed individuals were in better body condition. Indirect transmission via shared silk took place in only 15% of cases. Thus, bodily contact appears key to transmission in this system. These data represent a fundamental step towards understanding how individual traits influence larger-scale social and epidemiological dynamics. © 2016 The Author(s).

Active transmission isolation/rotor loads measurement system

NASA Technical Reports Server (NTRS)

Kenigsberg, I. J.; Defelice, J. J.

1973-01-01

Modifications were incorporated into a helicopter active transmission isolation system to provide the capability of utilizing the system as a rotor force measuring device. These included; (1) isolator redesign to improve operation and minimize friction, (2) installation of pressure transducers in each isolator, and (3) load cells in series with each torque restraint link. Full scale vibration tests performed during this study on a CH-53A helicopter airframe verified that these modifications do not degrade the systems wide band isolation characteristics. Bench tests performed on each isolator unit indicated that steady and transient loads can be measured to within 1 percent of applied load. Individual isolator vibratory load measurement accuracy was determined to be 4 percent. Load measurement accuracy was found to be independent of variations in all basic isolator operating characteristics. Full scale system load calibration tests on the CH-53A airframe established the feasibility of simultaneously providing wide band vibration isolation and accurate measurement of rotor loads. Principal rotor loads (lift, propulsive force, and torque) were measured to within 2 percent of applied load.

Systemic connective tissue features in women with fibromuscular dysplasia.

PubMed

O'Connor, Sarah; Kim, Esther Sh; Brinza, Ellen; Moran, Rocio; Fendrikova-Mahlay, Natalia; Wolski, Kathy; Gornik, Heather L

2015-10-01

Fibromuscular dysplasia (FMD) is a non-atherosclerotic disease associated with hypertension, headache, dissection, stroke, and aneurysm. The etiology is unknown but hypothesized to involve genetic and environmental components. Previous studies suggest a possible overlap of FMD with other connective tissue diseases that present with dissections and aneurysms. The aim of this study was to investigate the prevalence of connective tissue physical features in FMD. A total of 142 FMD patients were consecutively enrolled at a single referral center (97.9% female, 92.1% of whom had multifocal FMD). Data are reported for 139 female patients. Moderately severe myopia (29.1%), high palate (33.1%), dental crowding (29.7%), and early-onset arthritis (15.6%) were prevalent features. Classic connective features such as hypertelorism, cleft palate, and hypermobility were uncommon. The frequency of systemic connective tissue features was compared between FMD patients with a high vascular risk profile (having had ⩾1 dissection and/or ⩾2 aneurysms) and those with a standard vascular risk profile. A history of spontaneous pneumothorax (5.9% high risk vs 0% standard risk) and atrophic scarring (17.6% high risk vs 6.8% standard risk) were significantly more prevalent in the high risk group, p<0.05. High palate was observed in 43.1% of the high risk group versus 27.3% in the standard risk group, p=0.055. In conclusion, in a cohort of women with FMD, there was a prevalence of moderately severe myopia, high palate, dental crowding, and early-onset osteoarthritis. However, a characteristic phenotype was not discovered. Several connective tissue features such as high palate and pneumothorax were more prominent among FMD patients with a high vascular risk profile. © The Author(s) 2015.

Is triglyceride/HDL ratio a reliable screening test for assessment of atherosclerotic risk in patients with chronic inflammatory disease?

PubMed Central

Keles, Nursen; Aksu, Feyza; Aciksari, Gonul; Yilmaz, Yusuf; Demircioglu, Kenan; Kostek, Osman; Cekin, Muhammed Esad; Kalcik, Macit; Caliskan, Mustafa

2016-01-01

OBJECTIVE: The term chronic inflammatory disease (CID) refers to a category of inflammatory diseases that includes Ankylosing spondylitis (AS) and familial Mediterranean fever (FMF). The incidence of adverse cardiovascular events is greater among patients with CID, though they may not have conventional atherosclerotic risk factors. Endothelial dysfunction is one of the underlying fundamental mechanisms that trigger development of atherosclerotic alterations in arteries, and flow-mediated dilatation (FMD) is a noninvasive method to determine endothelial dysfunction. Recent studies have shown a relationship between high triglyceride high-density lipoprotein cholesterol (TG/HDL-C) ratio and coronary atherosclerosis. Many studies have demonstrated that patients with CID have lower FMD values compared to healthy population, indicating endothelial dysfunction. However TG/HDL ratio and its relationship to FMD in patients with CID has not been investigated. The present study investigated whether TG/HDL ratio in CID patients differs from that of healthy population, and its relationship to FMD in patients with CID. METHODS: A total of 58 patients with CID and a group of 58 healthy volunteer individuals were enrolled in the study. FMD measurements were taken with high resolution ultrasound (US), and TG/HDL ratios were calculated. RESULTS: Patients with CID had significantly higher TG/HDL-C ratio (2.5 [2.2–2.8] vs 2.3 [2.1–2.5]; p=0.03) and lower FMD values (5.2 [4.2–6.3] vs 6.7 [6.3–9.7]; p<0.001), compared to healthy group, and a negative correlation was found between FMD levels and TG/HDL ratio of the study population. CONCLUSION: Higher TG/HDL ratio and lower FMD values found in CID patients may reflect increased atherosclerotic risk. PMID:28058384

Assessment of premature atherosclerosis in systemic lupus erythematosus patients with and without nephritis.

PubMed

Sharma, S K; Rathi, M; Sahoo, S; Prakash, M; Dhir, V; Singh, S

2016-04-01

Risk of subclinical atherosclerosis is increased in patients with systemic lupus erythematosus (SLE). We correlated carotid intima media thickness (CIMT) and endothelial dysfunction through flow-mediated dilation (FMD) in SLE patients with the SLE Disease Activity Index (SLEDAI). This single-centre cross-sectional study recruited 100 consenting SLE outpatients (ACR 1997 criteria) out of which 50 had nephritis, with disease duration of ≥2 years for SLE and ≥6 months for lupus nephritis. We measured baseline laboratory levels, CIMT and FMD (after brachial BP cuff inflation up to 200 mmHg for five minutes), and calculated SLEDAI. Mean age was 29.88 ± 6.53 years; 95/100 were female. CIMT showed positive correlation (p = 0.037; rho = 0.209), and FMD showed inverse correlation with patient's age (p = 0.011; rho = -0.252). CIMT and FMD were more deranged in patients aged ≥25 years (p < 0.05). CIMT was not significantly different between SLE patients with and without nephritis (p > 0.05), whereas SLEDAI and FMD were more deranged in nephritis patients (p < 0.05). In patients without nephritis, FMD showed significant inverse correlation with disease duration (p = 0.043; rho = -0.288) and urine albumin (p = 0.045; rho = -0.285). In nephritis patients, the correlation between age of the patient was significantly positive with CIMT (p = 0.001; rho = 0.441) and significantly inverse with FMD (p = 0.028; rho = -0.312). SLE patients with nephritis are at a higher risk to develop arterial stiffening, leading to early end-organ damage. Early aggressive treatment may prevent endothelial dysfunction. FMD using vascular ultrasonography on the brachial artery represents a non-invasive, repeatable and useful method for the assessment of endothelial dysfunction. © The Author(s) 2015.

Transmission Line Security Monitor

ScienceCinema