Science.gov

Sample records for formation sites n44

  1. A Novel Acidic Matrix Protein, PfN44, Stabilizes Magnesium Calcite to Inhibit the Crystallization of Aragonite*

    PubMed Central

    Pan, Cong; Fang, Dong; Xu, Guangrui; Liang, Jian; Zhang, Guiyou; Wang, Hongzhong; Xie, Liping; Zhang, Rongqing

    2014-01-01

    Magnesium is widely used to control calcium carbonate deposition in the shell of pearl oysters. Matrix proteins in the shell are responsible for nucleation and growth of calcium carbonate crystals. However, there is no direct evidence supporting a connection between matrix proteins and magnesium. Here, we identified a novel acidic matrix protein named PfN44 that affected aragonite formation in the shell of the pearl oyster Pinctada fucata. Using immunogold labeling assays, we found PfN44 in both the nacreous and prismatic layers. In shell repair, PfN44 was repressed, whereas other matrix proteins were up-regulated. Disturbing the function of PfN44 by RNAi led to the deposition of porous nacreous tablets with overgrowth of crystals in the nacreous layer. By in vitro circular dichroism spectra and fluorescence quenching, we found that PfN44 bound to both calcium and magnesium with a stronger affinity for magnesium. During in vitro calcium carbonate crystallization and calcification of amorphous calcium carbonate, PfN44 regulated the magnesium content of crystalline carbonate polymorphs and stabilized magnesium calcite to inhibit aragonite deposition. Taken together, our results suggested that by stabilizing magnesium calcite to inhibit aragonite deposition, PfN44 participated in P. fucata shell formation. These observations extend our understanding of the connections between matrix proteins and magnesium. PMID:24302723

  2. Are oceanic plateaus sites of komatiite formation?

    NASA Astrophysics Data System (ADS)

    Storey, M.; Mahoney, J. J.; Kroenke, L. W.; Saunders, A. D.

    1991-04-01

    During Cretaceous and Tertiary time a series of oceanic terranes were accreted onto the Pacific continental margin of Colombia. The island of Gorgona is thought to represent part of the most recent, early Eocene, terrane-forming event. Gorgona is remarkable for the occurrence of komatiites of middle Cretaceous age, having MgO contents up to 24%. The geochemistry of spatially and temporally associated tholeiites suggests that Gorgona is an obducted fragment of the oceanic Caribbean Plateau, postulated by Duncan and Hargraves (1984) to have formed at 100 to 75 Ma over the Galapagos hotspot. Further examples of high-MgO oceanic lavas that may represent fragments of the Caribbean Plateau occur in allochthonous terranes on the island of Curaçao in the Netherlands Antilles and in the Romeral zone ophiolites in the southwestern Colombian Andes. These and other examples suggest that the formation of high-MgO liquids may be a feature of oceanic-plateau settings. The association of Phanerozoic komatiites with oceanic plateaus, coupled with thermal considerations, provides a plausible analogue for the origin of some komatiite-tholeiite sequences in Archean greenstone belts.

  3. Role of nucleation sites on the formation of nanoporous Ge

    SciTech Connect

    Yates, B. R.; Darby, B. L.; Jones, K. S.; Elliman, R. G.

    2012-09-24

    The role of nucleation sites on the formation of nanoporous Ge was investigated. Three Ge films with different spherical or columnar pore morphologies to act as inherent nucleation sites were sputtered on (001) Ge. Samples were implanted 90 Degree-Sign from incidence at 300 keV with fluences ranging from 3.0 Multiplication-Sign 10{sup 15} to 3.0 Multiplication-Sign 10{sup 16} Ge{sup +}/cm{sup 2}. Electron microscopy investigations revealed varying thresholds for nanoporous Ge formation and exhibited a stark difference in the evolution of the Ge layers based on the microstructure of the initial film. The results suggest that the presence of inherent nucleation sites significantly alters the onset and evolution of nanoporous Ge.

  4. Formation of RNA oligomers on montmorillonite: site of catalysis

    NASA Technical Reports Server (NTRS)

    Ertem, G.; Ferris, J. P.

    1998-01-01

    Certain montmorillonites catalyze the self condensation of the 5'-phosphorimidazolide of nucleosides in pH 8 aqueous electrolyte solutions at ambient temperatures leading to formation of RNA oligomers. In order to establish the nature of the sites on montmorillonite responsible for this catalytic activity, oligomerization reactions were run with montmorillonites which had been selectively modified (I) at the edges by (a) fluoride treatment, (b) silylation, (c) metaphosphate treatment of the anion exchange sites (II) in the interlayer by (a) saturation with quaternary alkylammonium ions of increasing size, (b) aluminum polyoxo cations. High pressure liquid chromatography, HPLC, analysis of condensation products for their chain lengths and yields indicated that modification at the edges did not affect the catalytic activity to a significant extent, while blocking the interlayer strongly inhibited product formation.

  5. Investigation of Gd3N@C2n (40 n 44) family by Raman and inelastic electron tunneling spectroscopy

    SciTech Connect

    Burke, Brian; Chan, Jack; Williams, Keith A; Ge, Jiechao; Shu, Chunying; Fu, Wujun; Dorn, Harry C; Kushmerick, James G; Puretzky, Alexander A; Geohegan, David B

    2010-01-01

    The structure and vibrational spectrum of Gd3N@C80 is studied through Raman and inelastic electron tunneling spectroscopy as well as density-functional theory and universal force eld calculations. Hindered rotations, shown by both theory and experiment, indicate the formation of a Gd3N-C80 bond which reduces the ideal icosahedral symmetry of the C80 cage. The vibrational modes involving the movement of the encapsulated species are a ngerprint of the interaction between the fullerene cage and the core complex. We present Raman data for the Gd3N@C2n 40 n 44 family as well as Y3N@C80, Lu3N@C80, and Y3N@C88 for comparison. Conductance measurements have been performed on Gd3N@C80 and reveal a Kondo effect similar to that observed in C60.

  6. Ftsz Ring Formation at the Chloroplast Division Site in Plants

    PubMed Central

    Vitha, Stanislav; McAndrew, Rosemary S.; Osteryoung, Katherine W.

    2001-01-01

    Among the events that accompanied the evolution of chloroplasts from their endosymbiotic ancestors was the host cell recruitment of the prokaryotic cell division protein FtsZ to function in chloroplast division. FtsZ, a structural homologue of tubulin, mediates cell division in bacteria by assembling into a ring at the midcell division site. In higher plants, two nuclear-encoded forms of FtsZ, FtsZ1 and FtsZ2, play essential and functionally distinct roles in chloroplast division, but whether this involves ring formation at the division site has not been determined previously. Using immunofluorescence microscopy and expression of green fluorescent protein fusion proteins in Arabidopsis thaliana, we demonstrate here that FtsZ1 and FtsZ2 localize to coaligned rings at the chloroplast midpoint. Antibodies specific for recognition of FtsZ1 or FtsZ2 proteins in Arabidopsis also recognize related polypeptides and detect midplastid rings in pea and tobacco, suggesting that midplastid ring formation by FtsZ1 and FtsZ2 is universal among flowering plants. Perturbation in the level of either protein in transgenic plants is accompanied by plastid division defects and assembly of FtsZ1 and FtsZ2 into filaments and filament networks not observed in wild-type, suggesting that previously described FtsZ-containing cytoskeletal-like networks in chloroplasts may be artifacts of FtsZ overexpression. PMID:11285278

  7. Natural new particle formation at the coastal Antarctic site Neumayer

    NASA Astrophysics Data System (ADS)

    Weller, R.; Schmidt, K.; Teinilä, K.; Hillamo, R.

    2015-10-01

    We measured condensation particle (CP) concentrations and particle size distributions at the coastal Antarctic station Neumayer (70°39´ S, 8°15´ W) during two summer campaigns (from 20 January to 26 March 2012 and 1 February to 30 April 2014) and during the polar night between 12 August and 27 September 2014 in the particle diameter (Dp) range from 2.94 to 60.4 nm (2012) and from 6.26 to 212.9 nm (2014). During both summer campaigns we identified all in all 44 new particle formation (NPF) events. From 10 NPF events, particle growth rates could be determined to be around 0.90 ± 0.46 nm h-1 (mean ± SD; range: 0.4-1.9 nm h-1). With the exception of one case, particle growth was generally restricted to the nucleation mode (Dp < 25 nm) and the duration of NPF events was typically around 6.0 ± 1.5 h (mean ± SD; range: 4-9 h). Thus, in the surrounding area of Neumayer, particles did not grow up to sizes required for acting as cloud condensation nuclei. NPF during summer usually occurred in the afternoon in coherence with local photochemistry. During winter, two NPF events could be detected, though showing no ascertainable particle growth. A simple estimation indicated that apart from sulfuric acid, the derived growth rates required other low volatile precursor vapours.

  8. Natural new particle formation at the coastal Antarctic site Neumayer

    NASA Astrophysics Data System (ADS)

    Weller, R.; Schmidt, K.; Teinilä, K.; Hillamo, R.

    2015-06-01

    We measured condensation particle (CP) concentrations and particle size distributions at the coastal Antarctic station Neumayer (70°39' S, 8°15' W) during two summer campaigns (from 20 January to 26 March 2012 and 1 February to 30 April 2014) and during polar night between 12 August and 27 September 2014 in the particle diameter (Dp) range from 2.94 to 60.4 nm (2012) and from 6.26 to 212.9 nm (2014). During both summer campaigns we identified all in all 44 new particle formation (NPF) events. From 10 NPF events, particle growth rates could be determined to be around 0.90 ± 0.46 nm h-1 (mean ± SD; range: 0.4 to 1.9 nm h-1). With the exception of one case, particle growth was generally restricted to the nucleation mode (Dp < 25 nm) and the duration of NPF events was typically around 6.0 ± 1.5 h (mean ± SD; range: 4 to 9 h). Thus in the main, particles did not grow up to sizes required for acting as cloud condensation nuclei. NPF during summer usually occurred in the afternoon in coherence with local photochemistry. During winter, two NPF events could be detected, though showing no ascertainable particle growth. A simple estimation indicated that apart from sulfuric acid, the derived growth rates required other low volatile precursor vapours.

  9. OceanSITES format and Ocean Observatory Output harmonisation: past, present and future

    NASA Astrophysics Data System (ADS)

    Pagnani, Maureen; Galbraith, Nan; Diggs, Stephen; Lankhorst, Matthias; Hidas, Marton; Lampitt, Richard

    2015-04-01

    The Global Ocean Observing System (GOOS) initiative was launched in 1991, and was the first step in creating a global view of ocean observations. In 1999 oceanographers at the OceanObs conference envisioned a 'global system of eulerian observatories' which evolved into the OceanSITES project. OceanSITES has been generously supported by individual oceanographic institutes and agencies across the globe, as well as by the WMO-IOC Joint Technical Commission for Oceanography and Marine Meteorology (under JCOMMOPS). The project is directed by the needs of research scientists, but has a strong data management component, with an international team developing content standards, metadata specifications, and NetCDF templates for many types of in situ oceanographic data. The OceanSITES NetCDF format specification is intended as a robust data exchange and archive format specifically for time-series observatory data from the deep ocean. First released in February 2006, it has evolved to build on and extend internationally recognised standards such as the Climate and Forecast (CF) standard, BODC vocabularies, ISO formats and vocabularies, and in version 1.3, released in 2014, ACDD (Attribute Convention for Dataset Discovery). The success of the OceanSITES format has inspired other observational groups, such as autonomous vehicles and ships of opportunity, to also use the format and today it is fulfilling the original concept of providing a coherent set of data from eurerian observatories. Data in the OceanSITES format is served by 2 Global Data Assembly Centres (GDACs), one at Coriolis, in France, at ftp://ftp.ifremer.fr/ifremer/oceansites/ and one at the US NDBC, at ftp://data.ndbc.noaa.gov/data/oceansites/. These two centres serve over 26,800 OceanSITES format data files from 93 moorings. The use of standardised and controlled features enables the files held at the OceanSITES GDACs to be electronically discoverable and ensures the widest access to the data. The OceanSITES

  10. Methylprednisolone microsphere sustained-release membrane inhibits scar formation at the site of peripheral nerve lesion.

    PubMed

    Li, Qiang; Li, Teng; Cao, Xiang-Chang; Luo, De-Qing; Lian, Ke-Jian

    2016-05-01

    Corticosteroids are widely used for the treatment of acute central nervous system injury. However, their bioactivity is limited by their short half-life. Sustained release of glucocorticoids can prolong their efficacy and inhibit scar formation at the site of nerve injury. In the present study, we wrapped the anastomotic ends of the rat sciatic nerve with a methylprednisolone sustained-release membrane. Compared with methylprednisone alone or methylprednisone microspheres, the methylprednisolone microsphere sustained-release membrane reduced tissue adhesion and inhibited scar tissue formation at the site of anastomosis. It also increased sciatic nerve function index and the thickness of the myelin sheath. Our findings show that the methylprednisolone microsphere sustained-release membrane effectively inhibits scar formation at the site of anastomosis of the peripheral nerve, thereby promoting nerve regeneration. PMID:27335571

  11. Methylprednisolone microsphere sustained-release membrane inhibits scar formation at the site of peripheral nerve lesion

    PubMed Central

    Li, Qiang; Li, Teng; Cao, Xiang-chang; Luo, De-qing; Lian, Ke-jian

    2016-01-01

    Corticosteroids are widely used for the treatment of acute central nervous system injury. However, their bioactivity is limited by their short half-life. Sustained release of glucocorticoids can prolong their efficacy and inhibit scar formation at the site of nerve injury. In the present study, we wrapped the anastomotic ends of the rat sciatic nerve with a methylprednisolone sustained-release membrane. Compared with methylprednisone alone or methylprednisone microspheres, the methylprednisolone microsphere sustained-release membrane reduced tissue adhesion and inhibited scar tissue formation at the site of anastomosis. It also increased sciatic nerve function index and the thickness of the myelin sheath. Our findings show that the methylprednisolone microsphere sustained-release membrane effectively inhibits scar formation at the site of anastomosis of the peripheral nerve, thereby promoting nerve regeneration. PMID:27335571

  12. OceanSITES format and Ocean Observatory Output harmonisation: past, present and future

    NASA Astrophysics Data System (ADS)

    Pagnani, Maureen; Galbraith, Nan; Diggs, Stephen; Lankhorst, Matthias; Hidas, Marton; Lampitt, Richard

    2015-04-01

    The Global Ocean Observing System (GOOS) initiative was launched in 1991, and was the first step in creating a global view of ocean observations. In 1999 oceanographers at the OceanObs conference envisioned a 'global system of eulerian observatories' which evolved into the OceanSITES project. OceanSITES has been generously supported by individual oceanographic institutes and agencies across the globe, as well as by the WMO-IOC Joint Technical Commission for Oceanography and Marine Meteorology (under JCOMMOPS). The project is directed by the needs of research scientists, but has a strong data management component, with an international team developing content standards, metadata specifications, and NetCDF templates for many types of in situ oceanographic data. The OceanSITES NetCDF format specification is intended as a robust data exchange and archive format specifically for time-series observatory data from the deep ocean. First released in February 2006, it has evolved to build on and extend internationally recognised standards such as the Climate and Forecast (CF) standard, BODC vocabularies, ISO formats and vocabularies, and in version 1.3, released in 2014, ACDD (Attribute Convention for Dataset Discovery). The success of the OceanSITES format has inspired other observational groups, such as autonomous vehicles and ships of opportunity, to also use the format and today it is fulfilling the original concept of providing a coherent set of data from eurerian observatories. Data in the OceanSITES format is served by 2 Global Data Assembly Centres (GDACs), one at Coriolis, in France, at ftp://ftp.ifremer.fr/ifremer/oceansites/ and one at the US NDBC, at ftp://data.ndbc.noaa.gov/data/oceansites/. These two centres serve over 26,800 OceanSITES format data files from 93 moorings. The use of standardised and controlled features enables the files held at the OceanSITES GDACs to be electronically discoverable and ensures the widest access to the data. The OceanSITES

  13. Molecular Dynamics Simulations of Solvation and Kink Site Formation at the {001} Barite-Water Interface.

    SciTech Connect

    Stack, Andrew G

    2009-09-01

    Solvation and kink site formation on step edges are known to be controlling parameters in crystal growth and dissolution. However, links from classical crystal growth models to specific reactions at the mineral-water interface have remained elusive. Molecular dynamics is used here to examine the water structure on barium surface sites and kink site formation enthalpies for material adsorbed to and removed from the step parallel to the [120] direction on the {001} barite-water interface. The bariums at the interface are shown to be coordinatively unsaturated with respect to water, and it is suggested that this is due to a steric hindrance from the nature of the interface. Kink site detachment energies that include hydration energies are endothermic for barium and exothermic for sulfate. The implications and problems of using these parameters in a crystal growth model are discussed.

  14. New investigations at Kalambo Falls, Zambia: Luminescence chronology, site formation, and archaeological significance.

    PubMed

    Duller, Geoff A T; Tooth, Stephen; Barham, Lawrence; Tsukamoto, Sumiko

    2015-08-01

    Fluvial deposits can provide excellent archives of early hominin activity but may be complex to interpret, especially without extensive geochronology. The Stone Age site of Kalambo Falls, northern Zambia, has yielded a rich artefact record from dominantly fluvial deposits, but its significance has been restricted by uncertainties over site formation processes and a limited chronology. Our new investigations in the centre of the Kalambo Basin have used luminescence to provide a chronology and have provided key insights into the geomorphological and sedimentological processes involved in site formation. Excavations reveal a complex assemblage of channel and floodplain deposits. Single grain quartz optically stimulated luminescence (OSL) measurements provide the most accurate age estimates for the youngest sediments, but in older deposits the OSL signal from some grains is saturated. A different luminescence signal from quartz, thermally transferred OSL (TT-OSL), can date these older deposits. OSL and TT-OSL results are combined to provide a chronology for the site. Ages indicate four phases of punctuated deposition by the dominantly laterally migrating and vertically aggrading Kalambo River (∼500-300 ka, ∼300-50 ka, ∼50-30 ka, ∼1.5-0.49 ka), followed by deep incision and renewed lateral migration at a lower topographic level. A conceptual model for site formation provides the basis for improved interpretation of the generation, preservation, and visibility of the Kalambo archaeological record. This model highlights the important role of intrinsic meander dynamics in site formation and does not necessarily require complex interpretations that invoke periodic blocking of the Kalambo River, as has previously been suggested. The oldest luminescence ages place the Mode 2/3 transition between ∼500 and 300 ka, consistent with other African and Asian sites where a similar transition can be found. The study approach adopted here can potentially be applied to other

  15. DNA abasic site-directed formation of fluorescent silver nanoclusters for selective nucleobase recognition

    NASA Astrophysics Data System (ADS)

    Ma, Kun; Cui, Qinghua; Liu, Guiying; Wu, Fei; Xu, Shujuan; Shao, Yong

    2011-07-01

    DNA single-nucleotide polymorphism (SNP) detection has attracted much attention due to mutation related diseases. Various methods for SNP detection have been proposed and many are already in use. Here, we find that the abasic site (AP site) in the DNA duplex can be developed as a capping scaffold for the generation of fluorescent silver nanoclusters (Ag NCs). As a proof of concept, the DNA sequences from fragments near codon 177 of cancer supression gene p53 were used as a model for SNP detection by in situ formed Ag NCs. The formation of fluorescent Ag NCs in the AP site-containing DNA duplex is highly selective for cytosine facing the AP site and guanines flanking the site and can be employed in situ as readout for SNP detection. The fluorescent signal-on sensing for SNP based on this inorganic fluorophore is substantially advantageous over the previously reported signal-off responses using low-molecular-weight organic ligands. The strong dependence of fluorescent Ag NC formation on the sequences surrounding the AP site was successfully used to identify mutations in codon 177 of cancer supression gene p53. We anticipate that this approach will be employed to develop a practical SNP detection method by locating an AP site toward the midway cytosine in a target strand containing more than three consecutive cytosines.

  16. Multiethnic Neighbourhoods as Sites of Social Capital Formation: Examining Social to Political "Integration" in Schools

    ERIC Educational Resources Information Center

    Basu, Ranu

    2006-01-01

    In an "ideal" democratic society, publicly funded schools serve many purposes. Aside from its educational mandate, schools are places for neighbourhood integration, social capital formation and the fostering of civil society. For newly arrived immigrants, especially those with young children, schools are important sites of settlement experiences.…

  17. Insertion site and sealing technique affect residual hearing and tissue formation after cochlear implantation.

    PubMed

    Burghard, Alice; Lenarz, Thomas; Kral, Andrej; Paasche, Gerrit

    2014-06-01

    Tissue formation around the electrode array of a cochlear implant has been suggested to influence preservation of residual hearing as well as electrical hearing performance of implanted subjects. Further, inhomogeneity in the electrical properties of the scala tympani shape the electrical field and affect current spread. Intracochlear trauma due to electrode insertion and the insertion site itself are commonly seen as triggers for the tissue formation. The present study investigates whether the insertion site, round window membrane (RWM) vs. cochleostomy (CS), or the sealing material, no seal vs. muscle graft vs. carboxylate cement, have an influence on the amount of fibrous tissue and/or new bone formation after CI implantation in the guinea pig. Hearing thresholds were determined by auditory brainstem response (ABR) measurements prior to implantation and after 28 days. The amount of tissue formation was quantified by evaluation of microscopic images obtained by a grinding/polishing procedure to keep the CI in place during histological processing. An insertion via the round window membrane resulted after 28 days in less tissue formation in the no seal and muscle seal condition compared to the cochleostomy approach. Between these two sealing techniques there was no difference. Sealing the cochlea with carboxylate cement resulted always in a strong new bone formation and almost total loss of residual hearing. The amount of tissue formation and the hearing loss correlated at 1-8 kHz. Consequently, the use of carboxylate cement as a sealing material in cochlear implantation should be avoided even in animal studies, whereas sealing the insertion site with a muscle graft did not induce an additional tissue growth compared to omitting a seal. For hearing preservation the round window approach should be used. PMID:24566091

  18. Preferential sites for intramolecular glucosepane cross-link formation in type I collagen: A thermodynamic study

    PubMed Central

    Collier, Thomas A.; Nash, Anthony; Birch, Helen L.; de Leeuw, Nora H.

    2015-01-01

    The extracellular matrix (ECM) undergoes progressive age-related stiffening and loss of proteolytic digestibility due to an increase in concentration of advanced glycation end products (AGEs). The most abundant AGE, glucosepane, accumulates in collagen with concentrations over 100 times greater than all other AGEs. Detrimental collagen stiffening properties are believed to play a significant role in several age-related diseases such as osteoporosis and cardiovascular disease. Currently little is known of the potential location of covalently cross-linked glucosepane formation within collagen molecules; neither are there reports on how the respective cross-link sites affect the physical and biochemical properties of collagen. Using fully atomistic molecular dynamics simulations (MD) we have identified six sites where the formation of a covalent intra-molecular glucosepane cross-link within a single collagen molecule in a fibrillar environment is energetically favourable. Identification of these favourable sites enables us to align collagen cross-linking with experimentally observed changes to the ECM. For example, formation of glucosepane was found to be energetically favourable within close proximity of the Matrix Metalloproteinase-1 (MMP1) binding site, which could potentially disrupt collagen degradation. PMID:26049074

  19. Preferential sites for intramolecular glucosepane cross-link formation in type I collagen: A thermodynamic study.

    PubMed

    Collier, Thomas A; Nash, Anthony; Birch, Helen L; de Leeuw, Nora H

    2015-10-01

    The extracellular matrix (ECM) undergoes progressive age-related stiffening and loss of proteolytic digestibility due to an increase in concentration of advanced glycation end products (AGEs). The most abundant AGE, glucosepane, accumulates in collagen with concentrations over 100 times greater than all other AGEs. Detrimental collagen stiffening properties are believed to play a significant role in several age-related diseases such as osteoporosis and cardiovascular disease. Currently little is known of the potential location of covalently cross-linked glucosepane formation within collagen molecules; neither are there reports on how the respective cross-link sites affect the physical and biochemical properties of collagen. Using fully atomistic molecular dynamics simulations (MD) we have identified six sites where the formation of a covalent intra-molecular glucosepane cross-link within a single collagen molecule in a fibrillar environment is energetically favourable. Identification of these favourable sites enables us to align collagen cross-linking with experimentally observed changes to the ECM. For example, formation of glucosepane was found to be energetically favourable within close proximity of the Matrix Metalloproteinase-1 (MMP1) binding site, which could potentially disrupt collagen degradation. PMID:26049074

  20. Authigenic Carbonate Formation on the Peru Margin; New Insights from IODP Site 1230

    NASA Astrophysics Data System (ADS)

    Abdullajintakam, S.; Naehr, T. H.

    2015-12-01

    Fluid seepage of reduced organic compounds such as methane impacts the geology and biology of the seabed by inducing complex, microbially mediated biogeochemical processes. Authigenic carbonates serve as one of the few permanent records of these of dynamic biogeochemical interactions that involve methanogenesis, methanotrophy, sulfate reduction and carbonate precipitation. Meister et al. (2007) investigated deep-sea dolomite formation at Sites 1227-1229 on the Peru margin, where dolomite precipitation occurs in association with organic carbon-rich continental margin sediments. Geochemical and petrographic studies indicated episodic dolomite precipitation at a dynamic sulfate methane transition zone (SMTZ). Variations in δ13C values of these dolomites between +15‰ and -15‰ were attributed to non-steady state conditions as a result of the upward and downward migration of the SMTZ. Our study aims to better understand the biogeochemical processes associated with authigenic carbonate precipitation in this dynamic deep-sea setting. We focused our efforts on IODP Site 1230, which is a gas-hydrate-bearing site that shows sulphate consumption within the uppermost 10 m below the seafloor as well as high methane production. Using a multi proxy approach, we combined X-ray diffraction, stable isotope geochemistry, and trace metal analysis of authigenic carbonates to elucidate conditions for authigenic carbonate formation. Results from Site 1230 are compared to Sites 1227 and 1229, which lacks gas hydrates and is characterized by high pore water sulfate and low methane concentrations. This study contributes to a more comprehensive understanding of authigenic carbonate formation and associated biogeochemical processes in continental margin sediments. Meister, P., Mckenzie, J. A., Vasconcelos, C., Bernasconi, S., Frank, M., Gutjhar, M. and SCHRAG, D. P. (2007), Dolomite formation in the dynamic deep biosphere: results from the Peru Margin. Sedimentology, 54: 1007-1032.

  1. Inhibition by alcohols of the localization of radioactive nitrosonornicotine in sites of tumor formation

    SciTech Connect

    Waddell, W.J.; Marlowe, C.

    1983-06-01

    Oral administration of ethanol, n-butanol, or t-butanol to mice 20 minutes before injection of carbon-14-labeled nitrosonornicotine inhibited the localization of radioactivity in bronchial and salivary duct epithelium and in the liver. Localization of radioactivity in the nasal epithelium and esophagus was not significantly reduced. These alcohols therefore may selectively inhibit tumor formation in three of the five sites where this carcinogen typically acts.

  2. Vertical stratification of subsurface microbial community composition across geological formations at the Hanford Site

    SciTech Connect

    Lin, Xueju; Kennedy, David W.; Fredrickson, Jim K.; Bjornstad, Bruce N.; Konopka, Allan

    2011-11-29

    Microbial diversity in subsurface sediments at the Hanford Site 300 Area near Richland, Washington State (USA) was investigated by analyzing samples recovered from depths of 9 to 52 m. Approximately 8000 near full-length 16S rRNA gene sequences were analyzed across geological strata that include a natural redox transition zone. These strata included the oxic coarse-grained Hanford formation, fine-grained oxic and anoxic Ringold Formation sediments, and the weathered basalt group. We detected 1233 and 120 unique bacterial and archaeal OTUs (Operational Taxonomic Units at the 97% identity level), respectively. Microbial community structure and richness varied substantially across the different geological strata. Bacterial OTU richness (Chao1 estimator) was highest (>700) in the upper Hanford formation, and declined to about 120 at the bottom of the Hanford formation. Just above the Ringold oxic-anoxic interface, richness was about 325 and declined to less than 50 in the deeper reduced zones. The deeper Ringold strata were characterized by a preponderance (ca. 90%) of Proteobacteria. The Bacterial community in the oxic sediments contained not only members of 9 well-recognized phyla but also an unusually high proportion of 3 candidate divisions (GAL15, NC10, and SPAM). Additionally, novel phylogenetic orders were identified within the Delta-proteobacteria, a clade rich in microbes that carry out redox transformations of metals that are important contaminants on the Hanford Site.

  3. Vertical stratification of subsurface microbial community composition across geological formations at the Hanford Site.

    PubMed

    Lin, Xueju; Kennedy, David; Fredrickson, Jim; Bjornstad, Bruce; Konopka, Allan

    2012-02-01

    Microbial diversity in subsurface sediments at the Hanford Site 300 Area near Richland, Washington state (USA) was investigated by analysing 21 samples recovered from depths of 9-52 m. Approximately 8000 near full-length 16S rRNA gene sequences were analysed across geological strata that include a natural redox transition zone. These strata included the oxic coarse-grained Hanford formation, fine-grained oxic and anoxic Ringold Formation sediments, and the weathered basalt group. We detected 1233 and 120 unique bacterial and archaeal OTUs (operational taxonomic units at the 97% identity level) respectively. Microbial community structure and richness varied substantially across the different geological strata. Bacterial OTU richness (Chao1 estimator) was highest (> 700) in the upper Hanford formation, and declined to about 120 at the bottom of the Hanford formation. Just above the Ringold oxic-anoxic interface, richness was about 325 and declined to less than 50 in the deeper reduced zones. The deeper Ringold strata were characterized by a preponderance (c. 90%) of Proteobacteria. The bacterial community in the oxic sediments contained not only members of nine well-recognized phyla but also an unusually high proportion of three candidate divisions (GAL15, NC10 and SPAM). Additionally, 13 novel phylogenetic orders were identified within the Deltaproteobacteria, a clade rich in microbes that carry out redox transformations of metals that are important contaminants on the Hanford Site. PMID:22122741

  4. Mineral abundances at the final four curiosity study sites and implications for their formation

    NASA Astrophysics Data System (ADS)

    Poulet, F.; Carter, J.; Bishop, J. L.; Loizeau, D.; Murchie, S. M.

    2014-03-01

    A component of the landing site selection process for the Mars Science Laboratory (MSL) involved the presence of phyllosilicates as the main astrobiological targets. Gale crater was selected as the MSL landing site from among 4 down selected study sites (Gale, Eberswalde and Holden craters, Mawrth Vallis) that addressed the primary scientific goal of assessing the past habitability of Mars. A key constraint on the formation process of these phyllosilicate-bearing deposits is in the precise mineralogical composition. We present a reassessment of the mineralogy of the sites combined with a determination of the modal mineralogy of the major phyllosilicate-bearing deposits of the four final study sites from the modeling of near-infrared spectra using a radiative transfer model. The largest abundance of phyllosilicates (30-70%) is found in Mawrth Vallis, the lowest one in Eberswalde (<25%). Except for Mawrth Vallis, the anhydrous phases (plagioclase, pyroxenes and martian dust) are the dominant phases, suggesting formation conditions with a lower alteration grade and/or a post-formation mixing with anhydrous phases. The composition of Holden layered deposits (mixture of saponite and micas with a total abundance in the range of 25-45%) suggests transport and deposition of altered basalts of the Noachian crust without major chemical transformation. For Eberswalde, the modal mineralogy is also consistent with detrital clays, but the presence of opaline silica indicates that an authigenic formation occurred during the deposition. The overall composition including approximately 20-30% smectite detected by MSL in the rocks of Yellow-knife Bay area interpreted to be material deposited on the floor of Gale crater by channels (http://www.nasa.gov/mission_pages/msl/news/msl20130312.html) is consistent with the compositions modeled for the Eberswalde and Holden deltaic rocks. At Gale, the paucity, the small diversity and the low abundance of nontronite do not favor a complex and

  5. Characteristics of formation and growth of atmospheric nanoparticles observed at four regional background sites in Korea

    NASA Astrophysics Data System (ADS)

    Kim, Yumi; Kim, Sang-Woo; Yoon, Soon-Chang; Park, Jin-Soo; Lim, Jae-Hyun; Hong, Jihyung; Lim, Han-Cheol; Ryu, Jegyu; Lee, Chul-Kyu; Heo, Bok-Haeng

    2016-02-01

    Measurements of the number concentration and size distribution of atmospheric nanoparticles were conducted at four sites on the west coast of the Korean Peninsula by using identical scanning mobility particle sizers (SMPSs) in October 2012. The new particle formation and subsequent growth (NPF) of atmospheric nanoparticles, which were identified by the cyclostationary empirical orthogonal function (CSEOF) analysis technique, was observed on 11 out of 21 days at the Baengnyeong-do Comprehensive Monitoring Observatory (BCMO); and on 10 out of 21 days at the Korea Global Atmosphere Watch Center (KGAWC) from October 9 to 29, 2012. We also observed NPF events for 9 out of 21 days at both the Gosan Climate Observatory (GCO) and the Jeju Comprehensive Monitoring Observatory (JCMO). During the study period, NPF was simultaneously observed for five days at all four sites, which indicates that the NPF event had a spatial extent of at least 540 km. A cold, dry and cloud-free continental air mass originated from northern China, formed favorable environmental conditions (e.g., increasing solar insolation at the surface) on simultaneous NPF at the four sites. These synoptic weather patterns were closely associated with an extraordinary typhoon passing over the south of Japan. The mean values of particle formation rates at BCMO (1.26 cm- 3 s- 1) and KGAWC (1.49 cm- 3 s- 1) were relatively higher than those at GCO (0.39 cm- 3 s- 1) and JCMO (0.74 cm- 3 s- 1), however, the growth rate showed a similar level among four sites. An increase in the spatial homogeneity and inter-site correlation of atmospheric particles among the four sites was apparent for small particles (diameter < 30 nm) on simultaneous NPF event days.

  6. The formation and function of ER-endosome membrane contact sites.

    PubMed

    Eden, Emily R

    2016-08-01

    Recent advances in membrane contact site (MCS) biology have revealed key roles for MCSs in inter-organellar exchange, the importance of which is becoming increasingly apparent. Roles for MCSs in many essential physiological processes including lipid transfer, calcium exchange, receptor tyrosine kinase signalling, lipid droplet formation, autophagosome formation, organelle dynamics and neurite outgrowth have been reported. The ER forms an extensive and dynamic network of MCSs with a diverse range of functionally distinct organelles. MCSs between the ER and endocytic pathway are particularly abundant, suggesting important physiological roles. Here, our current knowledge of the formation and function of ER contact sites with endocytic organelles from studies in mammalian systems is reviewed. Their relatively poorly defined molecular composition and recently identified functions are discussed. In addition, likely, but yet to be established, roles for these contacts in lipid transfer and calcium signalling are considered. This article is part of a Special Issue entitled: The cellular lipid landscape edited by Tim P. Levine and Anant K. Menon. PMID:26898183

  7. Geoarchaeological investigation at Al-Khiday (central Sudan): late Quaternary palaeoenvironment and site formation

    NASA Astrophysics Data System (ADS)

    Zerboni, Andrea; Usai, Donatella; Salvatori, Sandro

    2010-05-01

    The micromorphological investigation on several pluristratified archaeological sites in central Sudan (Al-Khiday, left bank of the White Nile, Khartoum region, Sudan) permitted to elucidate depositional and post-depositional processes playing a role in the formation and preservation of the archaeological record. At Al-Khiday sites are located at the top of small mounds, representing the remains of Pleistocene sandy fluvial bars, and were attended since the beginning of the Holocene. The first occupation of the area corresponds to a pre-Mesolithic cemetery; than Mesolithic groups lived upon the mounds and their occupation is testified by several archaeological features: pits filled by ash and bones and living floors. Preserved Neolithic features are scarce and limited to few graves (V millennium BC). After this phase, a long gap in human attendance is registered, during which wind continued to dismantling the mounds and the sites; at ca. 2000 years BP Meroitic/Post-Meroitic groups built their tombs at the top of the archaeological sequences and altered most of the stratigraphic record. Thanks to micromorphology, it was possible to distinguish between archaeological strata still in situ and those disturbed by natural and anthropic processes; furthermore, this approach allowed to interpret the significance of several archaeological features (living floors, fireplaces, and garbage pits). In this case micromorphology of archaeological deposits was a key tool to reconstruct the depositional and post-depositional processes that contributed to the formation and preservation of the archaeological record.

  8. VOC emissions, evolutions and contributions to SOA formation at a receptor site in eastern China

    NASA Astrophysics Data System (ADS)

    Yuan, B.; Hu, W. W.; Shao, M.; Wang, M.; Chen, W. T.; Lu, S. H.; Zeng, L. M.; Hu, M.

    2013-09-01

    Volatile organic compounds (VOCs) were measured by two online instruments (GC-FID/MS and PTR-MS) at a receptor site on Changdao Island (37.99° N, 120.70° E) in eastern China. Reaction with OH radical dominated chemical losses of most VOC species during the Changdao campaign. A photochemical-age-based parameterization method is used to calculate VOC emission ratios and to quantify the evolution of ambient VOCs. The calculated emission ratios of most hydrocarbons agree well with those obtained from emission inventory data, but determined emission ratios of oxygenated VOCs (OVOCs) are significantly higher than those from emission inventory data. The photochemical-age-based parameterization method is also used to investigate primary emissions and secondary formation of organic aerosol. The primary emission ratio of organic aerosol (OA) to CO is determined to be 14.9 μg m-3 ppm-1, and secondary organic aeorosols (SOA) are produced at an enhancement ratio of 18.8 μg m-3 ppm-1 to CO after 50 h of photochemical processing in the atmosphere. SOA formation is significantly higher than the level determined from VOC oxidation under both high-NOx (2.0 μg m-3 ppm-1 CO) and low-NOx conditions (6.5 μg m-3 ppm-1 CO). Polycyclic aromatic hydrocarbons (PAHs) and higher alkanes (> C10) account for as high as 17.4% of SOA formation, which suggests semi-volatile organic compounds (SVOCs) may be a large contributor to SOA formation during the Changdao campaign. The SOA formation potential of primary VOC emissions determined from field campaigns in Beijing and Pearl River Delta (PRD) is lower than the measured SOA levels reported in the two regions, indicating SOA formation is also beyond explainable by VOC oxidation in the two city clusters.

  9. Vertical stratification of subsurface microbial community composition across geological formations at the Hanford Site

    SciTech Connect

    Lin, Xueju; Kennedy, David W.; Fredrickson, Jim K.; Bjornstad, Bruce N.; Konopka, Allan

    2012-02-01

    The microbial diversity in subsurface sediments at the Hanford Site's 300 Area in southeastern Washington State was investigated by analyzing 21 samples recovered from depths that ranged from 9 to 52 m. Approximately 8000 non-chimeric Bacterial and Archaeal 16S rRNA gene sequences were analyzed across geological strata that contain a natural redox transition zone. These strata included the oxic coarse-grained Hanford formation, fine-grained oxic and anoxic Ringold Formation sediments, and the weathered basalt group. We detected 1233 and 120 unique bacterial and archaeal OTUs (Operational Taxonomic Units, defined at the 97% identity level). Microbial community structure and richness varied substantially across the different geological strata. Bacterial OTU richness (based upon Chao1 estimator) was highest (>700) in the upper Hanford formation, and declined to about 120 at the bottom of the Hanford formation. Just above the Ringold oxic-anoxic transition zone, richness was about 325 and declined to less than 50 in the deeper reduced zones. The Bacterial community in the oxic Hanford and Ringold Formations contained members of 9 major well-recognized phyla as well 30 as unusually high proportions of 3 candidate divisions (GAL15, NC10, and SPAM). The deeper Ringold strata were characterized by low OTU richness and a very high preponderance (ca. 90%) of Proteobacteria. The study has greatly expanded the intralineage phylogenetic diversity within some major divisions. These subsurface sediments have been shown to contain a large number of phylogenetically novel microbes, with substantial heterogeneities between sediment samples from the same geological formation.

  10. Hydraulic Testing of Salado Formation Evaporites at the Waste Isolation Pilot Plant Site: Final Report

    SciTech Connect

    Beauheim, Richard L.; Domski, Paul S.; Roberts, Randall M.

    1999-07-01

    This report presents interpretations of hydraulic tests conducted in bedded evaporates of the Salado Formation from May 1992 through May 1995 at the Waste Isolation Pilot Plant (WIPP) site in southeastern New Mexico. The WIPP is a US Department of Energy research and development facility designed to demonstrate safe disposal of transuranic wastes from the nation's defense programs. The WIPP disposal horizon is located in the lower portion of the Permian Salado Formation. The hydraulic tests discussed in this report were performed in the WIPP underground facility by INTERA inc. (now Duke Engineering and Services, Inc.), Austin, Texas, following the Field Operations Plan and Addendum prepared by Saulnier (1988, 1991 ) under the technical direction of Sandia National Laboratories, Albuquerque, New Mexico.

  11. Soil formation in post mining sites: the role of vegatation soil microflora and fauna interactions

    NASA Astrophysics Data System (ADS)

    Frouz, J.

    2009-04-01

    The role of vegetation and soil micro flora and fauna interaction during soil formation was studied in post mining sites in Czech Republic, Germany and USA. Vegetation and character of substrate substantially effect, micro flora, namely fungal bacterial ration, fauna composition and resulting microstructure of soil. Plants that bring more nitrogen in to the system support larger biomass of soil fauna and namely occurrence of earthworms which yield in larger bioturbation and associated faster production of A horizon in newly developing soil. Manipulation experiment show that presence of fauna have crucial effect of soil formation in these soil and positive effect of many plant species which are assumed to beneficial for reclamation is in fact indirect and caused by its positive effect on soil fauna development.

  12. Prevention of amyloid fibril formation of amyloidogenic chicken cystatin by site-specific glycosylation in yeast

    PubMed Central

    He, Jianwei; Song, Youtao; Ueyama, Nobuhiro; Saito, Akira; Azakami, Hiroyuki; Kato, Akio

    2006-01-01

    To address the role of glycosylation on fibrillogenicity of amyloidogenic chicken cystatin, the consensus sequence for N-linked glycosylation (Asn106-Ile108 → Asn106-Thr108) was introduced by site-directed mutagenesis into the wild-type and amyloidogenic chicken cystatins to construct the glycosylated form of chicken cystatins. Both the glycosylated and unglycosylated forms of wild-type and amyloidogenic mutant I66Q cystatin were expressed and secreted in a culture medium of yeast Pichia pastoris transformants. Comparison of the amount of insoluble aggregate, the secondary structure, and fibrillogenicity has shown that the N-linked glycosylation could prevent amyloid fibril formation of amyloidogenic chicken cystatin secreted in yeast cells without affecting its inhibitory activities. Further study showed this glycosylation could inhibit the formation of cystatin dimers. Therefore, our data strongly suggested that the mechanism causing the prevention of amyloidogenic cystation fibril formation may be realized through suppression of the formation of three-dimensional domain-swapped dimers and oligomers of amyloidogenic cystatin by the glycosylated chains at position 106. PMID:16434741

  13. Lamellipodial actin mechanically links myosin activity with adhesion-site formation.

    PubMed

    Giannone, Grégory; Dubin-Thaler, Benjamin J; Rossier, Olivier; Cai, Yunfei; Chaga, Oleg; Jiang, Guoying; Beaver, William; Döbereiner, Hans-Günther; Freund, Yoav; Borisy, Gary; Sheetz, Michael P

    2007-02-01

    Cell motility proceeds by cycles of edge protrusion, adhesion, and retraction. Whether these functions are coordinated by biochemical or biomechanical processes is unknown. We find that myosin II pulls the rear of the lamellipodial actin network, causing upward bending, edge retraction, and initiation of new adhesion sites. The network then separates from the edge and condenses over the myosin. Protrusion resumes as lamellipodial actin regenerates from the front and extends rearward until it reaches newly assembled myosin, initiating the next cycle. Upward bending, observed by evanescence and electron microscopy, results in ruffle formation when adhesion strength is low. Correlative fluorescence and electron microscopy shows that the regenerating lamellipodium forms a cohesive, separable layer of actin above the lamellum. Thus, actin polymerization periodically builds a mechanical link, the lamellipodium, connecting myosin motors with the initiation of adhesion sites, suggesting that the major functions driving motility are coordinated by a biomechanical process. PMID:17289574

  14. Assessment of the potential for karst in the Rustler Formation at the WIPP site.

    SciTech Connect

    Lorenz, John Clay

    2006-01-01

    This report is an independent assessment of the potential for karst dissolution in evaporitic strata of the Rustler Formation at the Waste Isolation Pilot Plant (WIPP) site. Review of the available data suggests that the Rustler strata thicken and thin across the area in depositional patterns related to lateral variations in sedimentary accommodation space and normal facies changes. Most of the evidence that has been offered for the presence of karst in the subsurface has been used out of context, and the different pieces are not mutually supporting. Outside of Nash Draw, definitive evidence for the development of karst in the Rustler Formation near the WIPP site is limited to the horizon of the Magenta Member in drillhole WIPP-33. Most of the other evidence cited by the proponents of karst is more easily interpreted as primary sedimentary structures and the localized dissolution of evaporitic strata adjacent to the Magenta and Culebra water-bearing units. Some of the cited evidence is invalid, an inherited baggage from studies made prior to the widespread knowledge of modern evaporite depositional environments and prior to the existence of definitive exposures of the Rustler Formation in the WIPP shafts. Some of the evidence is spurious, has been taken out of context, or is misquoted. Lateral lithologic variations from halite to mudstone within the Rustler Formation under the WIPP site have been taken as evidence for the dissolution of halite such as that seen in Nash Draw, but are more rationally explained as sedimentary facies changes. Extrapolation of the known karst features in Nash Draw eastward to the WIPP site, where conditions are and have been significantly different for half a million years, is unwarranted. The volumes of insoluble material that would remain after dissolution of halite would be significantly less than the observed bed thicknesses, thus dissolution is an unlikely explanation for the lateral variations from halite to mudstone and siltstone

  15. BOREAS TE-20 Soils Data Over the NSA-MSA and Tower Sites in Raster Format

    NASA Technical Reports Server (NTRS)

    Hall, Forrest G. (Editor); Veldhuis, Hugo; Knapp, David; Veldhuis, Hugo

    2000-01-01

    The BOREAS TE-20 team collected several data sets for use in developing and testing models of forest ecosystem dynamics. This data set was gridded from vector layers of soil maps that were received from Dr. Hugo Veldhuis, who did the original mapping in the field during 1994. The vector layers were gridded into raster files that cover the NSA-MSA and tower sites. The data are stored in binary, image format files. The data files are available on a CD-ROM (see document number 20010000884), or from the Oak Ridge National Laboratory (ORNL) Distributed Active Center (DAAC).

  16. Geology of the Hanna Formation, Hanna Underground Coal Gasification Site, Hanna, Wyoming

    SciTech Connect

    Oliver, R.L.; Youngberg, A.D.

    1984-01-01

    The Hanna Underground Coal Gasification (UCG) study area consists of the SW1/4 of Section 29 and the E1/2SE1/4 of Section 30 in Township 22 North, Range 81 West, Wyoming. Regionally, this is located in the coal-bearing Hanna Syncline of the Hanna Basin in southeast Wyoming. The structure of the site is characterized by beds dipping gently to the northeast. An east-west fault graben complex interrupts this basic trend in the center of the area. The target coal bed of the UCG experiments was the Hanna No. 1 coal in the Hanna Formation. Sedimentary rocks comprising the Hanna Formation consist of a sequence of nonmarine shales, sandstones, coals and conglomerates. The overburden of the Hanna No. 1 coal bed at the Hanna UCG site was divided into four broad local stratigraphic units. Analytical studies were made on overburden and coal samples taken from cores to determine their mineralogical composition. Textural and mineralogical characteristics of sandstones from local stratigraphic units A, B, and C were analyzed and compared. Petrographic analyses were done on the coal including oxides, forms of sulfur, pyrite types, maceral composition, and coal rank. Semi-quantitative spectrographic and analytic geochemical analyses were done on the overburden and coal and relative element concentrations were compared. Trends within each stratigraphic unit were also presented and related to depositional environments. The spectrographic analysis was also done by lithotype. 34 references, 60 figures, 18 tables.

  17. Site formation and chronology of the new Paleolithic site Sima de Las Palomas de Teba, southern Spain

    NASA Astrophysics Data System (ADS)

    Kehl, Martin; Burow, Christoph; Cantalejo, Pedro; Domínguez-Bella, Salvador; Durán, Juan José; Henselowsky, Felix; Klasen, Nicole; Linstädter, Jörg; Medianero, Javier; Pastoors, Andreas; Ramos, José; Reicherter, Klaus; Schmidt, Christoph; Weniger, Gerd-Christian

    2016-03-01

    The newly identified Paleolithic site Sima de Las Palomas de Teba hosts an almost seven-m-thick sediment profile investigated here to elucidate the rock shelter's chronostratigraphy and formation processes. At its base, the sediment sequence contains rich archeological deposits recording intensive occupation by Neanderthals. Luminescence provides a terminus ante quem of 39.4 ± 2.6 ka or 44.9 ± 4.1 ka (OSL) and 51.4 ± 8.4 ka (TL). This occupation ended with a rockfall event followed by accumulation of archeologically sterile sediments. These were covered by sediments containing few Middle Paleolithic artifacts, which either indicate ephemeral occupation by Neanderthals or reworking as suggested by micromorphological features. Above this unit, scattered lithic artifacts of undiagnostic character may represent undefined Paleolithic occupations. Sediment burial ages between about 23.0 ± 1.5 ka (OSL) and 40.5 ± 3.4 ka (pIRIR) provide an Upper Paleolithic chronology for sediments deposited above the rockfall. Finally, a dung-bearing Holocene layer in the uppermost part of the sequence contains a fragment of a human mandible dated to 4032 ± 39 14C yr BP. Overall, the sequence represents an important new site for studying the end of Neanderthal occupation in southern Spain. Supplementary Figure S2: Preheat-plateau and dose-recovery test results for OSL on fine-grained quartz of samples CP7. Aliquots for the dose-recovery test were administered a dose of 40 Gy after removing the natural signal by blue stimulation for 150 s at 125°C and 80% optical power. Supplementary Figure S3: Dependence of equivalent dose on prior IR stimulation temperature for samples CP1, CP3 and CP7. For each sample and pIRIR protocol six aliquots were used while increasing the first IR stimulation temperature in steps of 30°C from 50°C to 140°C and to 180°C. Data are normalized to the pIRIR De obtained with a first IR stimulation at 50°C. Supplementary Figure S4: Regenerative TL glow

  18. New particle formation at a remote site in the eastern Mediterranean

    NASA Astrophysics Data System (ADS)

    Pikridas, Michael; Riipinen, Ilona; Hildebrandt, Lea; Kostenidou, Evangelia; Manninen, Hanna; Mihalopoulos, Nikos; Kalivitis, Nikos; Burkhart, John F.; Stohl, Andreas; Kulmala, Markku; Pandis, Spyros N.

    2012-06-01

    A year (6-April-2008 to 14-April-2009) of particulate monitoring was conducted at a remote coastal station on the island of Crete, Greece in the eastern Mediterranean. Fifty-eight regional new particle formation events were observed with an Air Ion Spectrometer (AIS), half of which occurred during the coldest months of the year (December-March). Particle formation was favored by air masses arriving from the west that crossed Crete or southern Greece prior to reaching the site and also by lower-than-average condensational sinks (CS). Aerosol composition data, which were acquired during month-long campaigns in the summer and winter, suggest that nucleation events occurred only when particles were neutral. This is consistent with the hypothesis that a lack of NH3, during periods when particles are acidic, may limit nucleation in sulfate-rich environments. Nucleation was not limited by the availability of SO2 alone, as nucleation events often did not take place during periods with high SO2 or H2SO4 concentrations. The above results support the hypothesis that an additional reactant (other than H2SO4) plays an important role in the formation and/or growth of new particles. Our results are consistent with NH3 being this missing reactant.

  19. New Particle Formation Above a Loblolly Pine Forest at a New Tower Site in Central Virginia

    NASA Astrophysics Data System (ADS)

    Joerger, V.; O'Halloran, T. L.; Barr, J. G.

    2014-12-01

    We present initial results investigating the environmental controls on new particle formation events at a new research site in central Virginia. The Sweet Briar College Land-Atmosphere Research Station (SBC-LARS) became operational in July, 2014 and features a 37-meter tower within a ~30 year-old loblolly pine plantation that is surrounded by mixed deciduous forest at the eastern edge of the Blue Ridge Mountains. The tower supports meteorological instruments at three different heights (2, 26, and 37 meters) and two air sampling inlets located above the canopy. The inlets draw air samples into a climate-controlled shed where precursor gas concentrations (ozone, sulfur dioxide, and nitrogen oxides) are determined by gas analyzers. Aerosol size distributions between 10 and 470 nm are measured every 3 minutes by a Scanning Mobility Particle Sizer (SMPS). For this study, aerosol size distributions from July through November 2014 were analyzed along with HYSPLIT backwards trajectories, meteorological measurements, gas concentrations, and the condensational sink, to investigate controls on new particle formation. This station and corresponding dataset will contribute to a better understanding of the contribution of biogenic and anthropogenic emissions to aerosol formation in the southeastern United States.

  20. Greater Bone Formation Induction Occurred in Aged than Young Cancellous Bone Sites

    NASA Technical Reports Server (NTRS)

    Ke, H. Z.; Jee, W. S. S.; Ito, H.; Setterberg, R. B.; Li, M.; Lin, B. Y.; Liang, X. G.; Ma, Y. F.

    1993-01-01

    We have determined the differences in the effects of continual prostaglandin E(sub 2) (PGE(sub 2) treatment in aged (non-growing) and young (growing) cancellous bone sites in 7-month-old Sprague-Dawley rats. The sites involved are the aged distal tibial metaphysis (DTM) with a closed epiphysis and the young proximal tibial metaphysis (PTM) with a slow growing, open epiphysis. The study involved rats treated with 0, 1, 3 or 6 mg PGE(sub 2)/kg/d for 60, 120 and 180 days. Static and dynamic histomorphometry of percent trabecular area, and tissue-referent bone formation rate (BFR/TV) were determined in both DTM and PTM. In pretreatment controls, the secondary spongiosa of the two metaphyses contain the same amount of cancellous bone (11% in DTM vs. 13% in PTM), but markedly less bone formation in DTM (0.6%/y in DTM vs. 41.5%/y in PTM). After 60 days of 6 mg PGE(sub 2)/kg/d treatment, %Tb.Ar was increased 607% in DTM and 199% in PTM, BFR/TV was increased to nearly 14 fold in DTM and only 5 fold in PTM. These results indicated the aged metaphysis of the DTM was much more responsive to PGE(sub 2) treatment than young, growing metaphysis of the PTM. The results of 120 and 180 days treatment did not significantly differ from 60 days treatment in both sites, indicating that the effect of continuous daily PGE2 treatment were in equilibrium after 60 days. We concluded that aged metaphysis was much more responsive to PGE(sub 2) treatment than young growing metaphysis.

  1. The functions of anionic phospholipids during clathrin-mediated endocytosis site initiation and vesicle formation

    PubMed Central

    Sun, Yidi; Drubin, David G.

    2012-01-01

    Summary Anionic phospholipids PI(4,5)P2 and phosphatidylserine (PS) are enriched in the cytosolic leaflet of the plasma membrane where endocytic sites form. In this study, we investigated the roles of PI(4,5)P2 and PS in clathrin-mediated endocytosis (CME) site initiation and vesicle formation in Saccharomyces cerevisiae. Live-cell imaging of endocytic protein dynamics in an mss4ts mutant, which has severely reduced PI(4,5)P2 levels, revealed that PI(4,5)P2 is required for endocytic membrane invagination but is less important for endocytic site initiation. We also demonstrated that, in various deletion mutants of genes encoding components of the Rcy1-Ypt31/32 GTPase pathway, endocytic proteins dynamically assemble not only on the plasma membrane but also on intracellular membrane compartments, which are likely derived from early endosomes. In rcy1Δ cells, fluorescent biosensors indicated that PI(4,5)P2 only localized to the plasma membrane while PS localized to both the plasma membrane and intracellular membranes. Furthermore, we found that polarized endocytic patch establishment is defective in the PS-deficient cho1Δ mutant. We propose that PS is important for directing endocytic proteins to the plasma membrane and that PI(4,5)P2 is required to facilitate endocytic membrane invagination. PMID:23097040

  2. VOC emissions, evolutions and contributions to SOA formation at a receptor site in Eastern China

    NASA Astrophysics Data System (ADS)

    Yuan, B.; Hu, W. W.; Shao, M.; Wang, M.; Chen, W. T.; Lu, S. H.; Zeng, L. M.; Hu, M.

    2013-03-01

    Volatile organic compounds (VOCs) were measured by two online instruments (GC-FID/MS and PTR-MS) at a receptor site on Changdao Island (37.99° N, 120.70° E) in eastern China. Reaction with OH radical dominated the chemical loss of most VOC species during the Changdao campaign. A photochemical age based parameterization method is used to calculate VOC emission ratios and to quantify the evolution of ambient VOCs. The calculated emission ratios of most hydrocarbons agree well with those obtained from emission inventory, but the emission ratios of oxygenated VOCs (OVOCs) are significantly lower than those from emission inventory. The photochemical age based parameterization method is also used to investigate primary emissions and secondary formation of organic aerosol. The primary emission ratio of OA to CO are determined to be 14.9 μg m-3 ppm-1 and SOA are produced at an enhancement ratio of 18.8 μg m-3 ppm-1 to CO after 50 h of photochemical processing in the atmosphere. SOA formation is significantly higher than the level determined from VOC oxidation under both high-NOx (2.0 μg m-3 ppm-1 CO) and low-NOx condition (6.5 μg m-3 ppm-1 CO). Polycyclic aromatic hydrocarbons (PAHs) and higher alkanes (>C10) account for as high as 17.4% of SOA formation, which suggests semi-volatile organic compounds (SVOCs) may be a large contributor to SOA formation during the Changdao campaign. SOA formation potential of primary VOC emissions determined from both field campaigns and emission inventory in China are lower than the measured SOA levels reported in Beijing and Pearl River Delta (PRD), indicating SOA formation cannot be explained by VOC oxidation in this regions. SOA budget in China is estimated to be 5.0-13.7 Tg yr-1, with a fraction of at least 2.7 Tg yr-1 from anthropogenic emissions, which are much higher than the previous estimates from regional models.

  3. Role of Criegee Intermediates in Formation of Sulfuric Acid at BVOCs-rich Cape Corsica Site

    NASA Astrophysics Data System (ADS)

    Kukui, A.; Dusanter, S.; Sauvage, S.; Gros, V.; Bourrianne, T.; Sellegri, K.; Wang, J.; Colomb, A.; Pichon, J. M.; Chen, H.; Kalogridis, C.; Zannoni, N.; Bonsang, B.; Michoud, V.; Locoge, N.; Leonardis, T.

    2015-12-01

    Oxidation of SO2 in reactions with stabilised Criegee Intermediates (sCI) was suggested as an additional source of gaseous sulfuric acid (H2SO4) in the atmosphere, complementary to the conventional H2SO4 formation in reaction of SO2 with OH radicals. Evaluation of the importance of this additional source is complicated due to large uncertainty in the mechanism and rate constants for the reactions of different sCI with SO2, water vapor and other atmospheric species. Here we present an evaluation of the role of sCI in H2SO4 production at remote site on Cape Corsica near the North tip of Corsica Island (Ersa station, Western Mediterranean). In July 2013 comprehensive field observations including gas phase (OH and RO2 radicals, H2SO4, VOCs, NOx, SO2, others) and aerosol measurements were conducted at this site in the frame of ChArMEx project. During the field campaign the site was strongly influenced by local emissions of biogenic volatile compounds (BVOCs), including isoprene and terpenes, forming different sCI in reactions with ozone and, hence, presenting additional source of H2SO4 via sCI+SO2. However, this additional source of H2SO4 at the Ersa site was found to be insignificant. The observed concentrations of H2SO4 were found to be in good agreement with those estimated from the H2SO4 condensation sink and the production of H2SO4 only in the reaction of OH with SO2, without accounting for any additional H2SO4 source. Using the BVOCs observations we present estimation of the upper limit for the rate constants of H2SO4 production via reactions of different sCI with SO2.

  4. Evidence of Conformational Selection Driving the Formation of Ligand Binding Sites in Protein-Protein Interfaces

    PubMed Central

    Bohnuud, Tanggis; Kozakov, Dima; Vajda, Sandor

    2014-01-01

    Many protein-protein interactions (PPIs) are compelling targets for drug discovery, and in a number of cases can be disrupted by small molecules. The main goal of this study is to examine the mechanism of binding site formation in the interface region of proteins that are PPI targets by comparing ligand-free and ligand-bound structures. To avoid any potential bias, we focus on ensembles of ligand-free protein conformations obtained by nuclear magnetic resonance (NMR) techniques and deposited in the Protein Data Bank, rather than on ensembles specifically generated for this study. The measures used for structure comparison are based on detecting binding hot spots, i.e., protein regions that are major contributors to the binding free energy. The main tool of the analysis is computational solvent mapping, which explores the surface of proteins by docking a large number of small “probe” molecules. Although we consider conformational ensembles obtained by NMR techniques, the analysis is independent of the method used for generating the structures. Finding the energetically most important regions, mapping can identify binding site residues using ligand-free models based on NMR data. In addition, the method selects conformations that are similar to some peptide-bound or ligand-bound structure in terms of the properties of the binding site. This agrees with the conformational selection model of molecular recognition, which assumes such pre-existing conformations. The analysis also shows the maximum level of similarity between unbound and bound states that is achieved without any influence from a ligand. Further shift toward the bound structure assumes protein-peptide or protein-ligand interactions, either selecting higher energy conformations that are not part of the NMR ensemble, or leading to induced fit. Thus, forming the sites in protein-protein interfaces that bind peptides and can be targeted by small ligands always includes conformational selection, although

  5. Formation of target-specific binding sites in enzymes: solid-phase molecular imprinting of HRP

    NASA Astrophysics Data System (ADS)

    Czulak, J.; Guerreiro, A.; Metran, K.; Canfarotta, F.; Goddard, A.; Cowan, R. H.; Trochimczuk, A. W.; Piletsky, S.

    2016-05-01

    Here we introduce a new concept for synthesising molecularly imprinted nanoparticles by using proteins as macro-functional monomers. For a proof-of-concept, a model enzyme (HRP) was cross-linked using glutaraldehyde in the presence of glass beads (solid-phase) bearing immobilized templates such as vancomycin and ampicillin. The cross-linking process links together proteins and protein chains, which in the presence of templates leads to the formation of permanent target-specific recognition sites without adverse effects on the enzymatic activity. Unlike complex protein engineering approaches commonly employed to generate affinity proteins, the method proposed can be used to produce protein-based ligands in a short time period using native protein molecules. These affinity materials are potentially useful tools especially for assays since they combine the catalytic properties of enzymes (for signaling) and molecular recognition properties of antibodies. We demonstrate this concept in an ELISA-format assay where HRP imprinted with vancomycin and ampicillin replaced traditional enzyme-antibody conjugates for selective detection of templates at micromolar concentrations. This approach can potentially provide a fast alternative to raising antibodies for targets that do not require high assay sensitivities; it can also find uses as a biochemical research tool, as a possible replacement for immunoperoxidase-conjugates.Here we introduce a new concept for synthesising molecularly imprinted nanoparticles by using proteins as macro-functional monomers. For a proof-of-concept, a model enzyme (HRP) was cross-linked using glutaraldehyde in the presence of glass beads (solid-phase) bearing immobilized templates such as vancomycin and ampicillin. The cross-linking process links together proteins and protein chains, which in the presence of templates leads to the formation of permanent target-specific recognition sites without adverse effects on the enzymatic activity. Unlike

  6. Osterix/Sp7 limits cranial bone initiation sites and is required for formation of sutures.

    PubMed

    Kague, Erika; Roy, Paula; Asselin, Garrett; Hu, Gui; Simonet, Jacqueline; Stanley, Alexandra; Albertson, Craig; Fisher, Shannon

    2016-05-15

    During growth, individual skull bones overlap at sutures, where osteoblast differentiation and bone deposition occur. Mutations causing skull malformations have revealed some required genes, but many aspects of suture regulation remain poorly understood. We describe a zebrafish mutation in osterix/sp7, which causes a generalized delay in osteoblast maturation. While most of the skeleton is patterned normally, mutants have specific defects in the anterior skull and upper jaw, and the top of the skull comprises a random mosaic of bones derived from individual initiation sites. Osteoblasts at the edges of the bones are highly proliferative and fail to differentiate, consistent with global changes in gene expression. We propose that signals from the bone itself are required for orderly recruitment of precursor cells and growth along the edges. The delay in bone maturation caused by loss of Sp7 leads to unregulated bone formation, revealing a new mechanism for patterning the skull and sutures. PMID:26992365

  7. The Conundrum of the High-Affinity NGF Binding Site Formation Unveiled?

    PubMed Central

    Covaceuszach, Sonia; Konarev, Petr V.; Cassetta, Alberto; Paoletti, Francesca; Svergun, Dmitri I.; Lamba, Doriano; Cattaneo, Antonino

    2015-01-01

    The homodimer NGF (nerve growth factor) exerts its neuronal activity upon binding to either or both distinct transmembrane receptors TrkA and p75NTR. Functionally relevant interactions between NGF and these receptors have been proposed, on the basis of binding and signaling experiments. Namely, a ternary TrkA/NGF/p75NTR complex is assumed to be crucial for the formation of the so-called high-affinity NGF binding sites. However, the existence, on the cell surface, of direct extracellular interactions is still a matter of controversy. Here, supported by a small-angle x-ray scattering solution study of human NGF, we propose that it is the oligomerization state of the secreted NGF that may drive the formation of the ternary heterocomplex. Our data demonstrate the occurrence in solution of a concentration-dependent distribution of dimers and dimer of dimers. A head-to-head molecular assembly configuration of the NGF dimer of dimers has been validated. Overall, these findings prompted us to suggest a new, to our knowledge, model for the transient ternary heterocomplex, i.e., a TrkA/NGF/p75NTR ligand/receptors molecular assembly with a (2:4:2) stoichiometry. This model would neatly solve the problem posed by the unconventional orientation of p75NTR with respect to TrkA, as being found in the crystal structures of the TrkA/NGF and p75NTR/NGF complexes. PMID:25650935

  8. Formation of target-specific binding sites in enzymes: solid-phase molecular imprinting of HRP.

    PubMed

    Czulak, J; Guerreiro, A; Metran, K; Canfarotta, F; Goddard, A; Cowan, R H; Trochimczuk, A W; Piletsky, S

    2016-06-01

    Here we introduce a new concept for synthesising molecularly imprinted nanoparticles by using proteins as macro-functional monomers. For a proof-of-concept, a model enzyme (HRP) was cross-linked using glutaraldehyde in the presence of glass beads (solid-phase) bearing immobilized templates such as vancomycin and ampicillin. The cross-linking process links together proteins and protein chains, which in the presence of templates leads to the formation of permanent target-specific recognition sites without adverse effects on the enzymatic activity. Unlike complex protein engineering approaches commonly employed to generate affinity proteins, the method proposed can be used to produce protein-based ligands in a short time period using native protein molecules. These affinity materials are potentially useful tools especially for assays since they combine the catalytic properties of enzymes (for signaling) and molecular recognition properties of antibodies. We demonstrate this concept in an ELISA-format assay where HRP imprinted with vancomycin and ampicillin replaced traditional enzyme-antibody conjugates for selective detection of templates at micromolar concentrations. This approach can potentially provide a fast alternative to raising antibodies for targets that do not require high assay sensitivities; it can also find uses as a biochemical research tool, as a possible replacement for immunoperoxidase-conjugates. PMID:27174700

  9. The effect of drug-DNA interactions on the intercalation site formation

    NASA Astrophysics Data System (ADS)

    Miroshnychenko, K. V.; Shestopalova, A. V.

    The problem of intercalation site formation in the undistorted B-DNA of different length and sequence was considered. Three models of DNA intercalation targets were proposed that accounted for the binding features of intercalators ethidium, daunomycin and 9-amino[N-(2-dimethylamino)ethyl]-acridine-4-carboxamide (9-amino-DACA). The automated docking of ligands into the constructed DNA-targets produced correct structures of complexes for ethidium and daunomycin when asymmetrically unwound DNA was used as target. To obtain the correct structure of 9-amino-DACA-DNA complex, the manual docking was applied. The results of docking of ligands into different DNA-targets indicate that, upon formation of the intercalation target, it is sufficient to take into account only the most significant unwinding in one particular helical step: in the intercalation step (for ethidium and 9-amino-DACA) or in the adjacent helical step (for daunomycin). The unwinding or overwinding of subsequent helical steps could be refined later during the optimization of the obtained intercalation complex. The unwinding of the DNA helical step on the large angle produces the 5‧-North/3‧-South asymmetry of sugar conformations in this step. The value of the total unwinding of the DNA in the intercalation complex was found to be dependent on the sequence and length of the DNA-target.

  10. Ice Lens Formation and Frost Heave at the Phoenix Landing Site

    NASA Technical Reports Server (NTRS)

    Zent, A. P.; Sizemore, H. G.; Remple, A. W.

    2011-01-01

    Several lines of evidence indicate that the volume of shallow ground ice in the martian high latitudes exceeds the pore volume of the host regolith. Boynton et al. found an optimal fit to the Mars Odyssey Gamma Ray Spectrometer (GRS) data at the Phoenix landing site by modeling a buried layer of 50-75% ice by mass (up to 90% ice by volume). Thermal and optical observations of recent impact craters in the northern hemisphere have revealed nearly pure ice. Ice deposits containing only 1-2% soil by volume were excavated by Phoenix. The leading hypothesis for the origin of this excess ice is that it developed in situ by a mechanism analogous to the formation of terrestrial ice lenses and needle ice. Problematically, terrestrial soil-ice segregation is driven by freeze/thaw cycling and the movement of bulk water, neither of which are expected to have occurred in the geologically recent past on Mars. If however ice lens formation is possible at temperatures less than 273 K, there are possible implications for the habitability of Mars permafrost, since the same thin films of unfrozen water that lead to ice segregation are used by terrestrial psychrophiles to metabolize and grow down to temperatures of at least 258 K.

  11. Dynamic formation of single-atom catalytic active sites on ceria-supported gold nanoparticles

    SciTech Connect

    Wang, Yanggang; Mei, Donghai; Glezakou, Vassiliki Alexandra; Li, Jun; Rousseau, Roger J.

    2015-03-04

    Ab initio Molecular Dynamics simulations and static Density Functional Theory calculations have been performed to investigate the reaction mechanism of CO oxidation on Au/CeO2 catalyst. It is found that under reaction condition CO adsorption significantly labializes the surface atoms of the Au cluster and leads to the formation of isolated Au+-CO species that resides on the support in the vicinity of the Au particle. In this context, we identified a dynamic single-atom catalytic mechanism at the interfacial area for CO oxidation on Au/CeO2 catalyst, which is a lower energy pathway than that of CO oxidation at the interface with the metal particle. This results from the ability of the single atom site to strongly couple with the redox properties of the support in a synergistic manner thereby lowering the barrier for redox reactions. We find that the single Au+ ion, which only exists under reaction conditions, breaks away from the Au cluster to catalyze CO oxidation and returns to the Au cluster after the catalytic cycle is completed. Generally, our study highlights the importance of the dynamic creation of active sites under reaction conditions and their essential role in a catalytic process.

  12. Dynamic formation of single-atom catalytic active sites on ceria-supported gold nanoparticles

    DOE PAGESBeta

    Wang, Yanggang; Mei, Donghai; Glezakou, Vassiliki Alexandra; Li, Jun; Rousseau, Roger J.

    2015-03-04

    Ab initio Molecular Dynamics simulations and static Density Functional Theory calculations have been performed to investigate the reaction mechanism of CO oxidation on Au/CeO2 catalyst. It is found that under reaction condition CO adsorption significantly labializes the surface atoms of the Au cluster and leads to the formation of isolated Au+-CO species that resides on the support in the vicinity of the Au particle. In this context, we identified a dynamic single-atom catalytic mechanism at the interfacial area for CO oxidation on Au/CeO2 catalyst, which is a lower energy pathway than that of CO oxidation at the interface with themore » metal particle. This results from the ability of the single atom site to strongly couple with the redox properties of the support in a synergistic manner thereby lowering the barrier for redox reactions. We find that the single Au+ ion, which only exists under reaction conditions, breaks away from the Au cluster to catalyze CO oxidation and returns to the Au cluster after the catalytic cycle is completed. Generally, our study highlights the importance of the dynamic creation of active sites under reaction conditions and their essential role in a catalytic process.« less

  13. Evolutionarily conserved sites in yeast tropomyosin function in cell polarity, transport and contractile ring formation

    PubMed Central

    Cranz-Mileva, Susanne; MacTaggart, Brittany; Russell, Jacquelyn; Hitchcock-DeGregori, Sarah E.

    2015-01-01

    ABSTRACT Tropomyosin is a coiled-coil protein that binds and regulates actin filaments. The tropomyosin gene in Schizosaccharomyces pombe, cdc8, is required for formation of actin cables, contractile rings, and polar localization of actin patches. The roles of conserved residues were investigated in gene replacement mutants. The work validates an evolution-based approach to identify tropomyosin functions in living cells and sites of potential interactions with other proteins. A cdc8 mutant with near-normal actin affinity affects patch polarization and vacuole fusion, possibly by affecting Myo52p, a class V myosin, function. The presence of labile residual cell attachments suggests a delay in completion of cell division and redistribution of cell patches following cytokinesis. Another mutant with a mild phenotype is synthetic negative with GFP-fimbrin, inferring involvement of the mutated tropomyosin sites in interaction between the two proteins. Proteins that assemble in the contractile ring region before actin do so in a mutant cdc8 strain that cannot assemble condensed actin rings, yet some cells can divide. Of general significance, LifeAct-GFP negatively affects the actin cytoskeleton, indicating caution in its use as a biomarker for actin filaments. PMID:26187949

  14. Dynamic formation of single-atom catalytic active sites on ceria-supported gold nanoparticles

    SciTech Connect

    Wang, Yanggang; Mei, Donghai; Glezakou, Vassiliki Alexandra; Li, Jun; Rousseau, Roger J.

    2015-03-04

    Ab initio Molecular Dynamics simulations and static Density Functional Theory calculations have been performed to investigate the reaction mechanism of CO oxidation on Au/CeO2 catalyst. It is found that under reaction condition CO adsorption significantly labializes the surface atoms of the Au cluster and leads to the formation of isolated Au+-CO species that resides on the support in the vicinity of the Au particle. In this context, we identified a dynamic single-atom catalytic mechanism at the interfacial area for CO oxidation on Au/CeO2 catalyst, which is a lower energy pathway than that of CO oxidation at the interface with the metal particle. This results from the ability of the single atom site to strongly couple with the redox properties of the support in a synergistic manner thereby lowering the barrier for redox reactions. We find that the single Au+ ion, which only exists under reaction conditions, breaks away from the Au cluster to catalyze CO oxidation and returns to the Au cluster after the catalytic cycle is completed. Generally, our study highlights the importance of the dynamic creation of active sites under reaction conditions and their essential role in a catalytic process.

  15. L2′ loop is critical for caspase-7 active site formation

    PubMed Central

    Witkowski, Witold A; Hardy, Jeanne A

    2009-01-01

    The active sites of caspases are composed of four mobile loops. A loop (L2) from one half of the dimer interacts with a loop (L2′) from the other half of the dimer to bind substrate. In an inactive form, the two L2′ loops form a cross-dimer hydrogen-bond network over the dimer interface. Although the L2′ loop has been implicated as playing a central role in the formation of the active-site loop bundle, its precise role in catalysis has not been shown. A detailed understanding of the active and inactive conformations is essential to control the caspase function. We have interrogated the contributions of the residues in the L2′ loop to catalytic function and enzyme stability. In wild-type and all mutants, active-site binding results in substantial stabilization of the complex. One mutation, P214A, is significantly destabilized in the ligand-free conformation, but is as stable as wild type when bound to substrate, indicating that caspase-7 rests in different conformations in the absence and presence of substrate. Residues K212 and I213 in the L2′ loop are shown to be essential for substrate-binding and thus proper catalytic function of the caspase. In the crystal structure of I213A, the void created by side-chain deletion is compensated for by rearrangement of tyrosine 211 to fill the void, suggesting that the requirements of substrate-binding are sufficiently strong to induce the active conformation. Thus, although the L2′ loop makes no direct contacts with substrate, it is essential for buttressing the substrate-binding groove and is central to native catalytic efficiency. PMID:19530232

  16. Environmental significance of Upper Miocene phosphorites at hominid sites in the Lukeino Formation (Tugen Hills, Kenya)

    NASA Astrophysics Data System (ADS)

    Dericquebourg, Perrine; Person, Alain; Ségalen, Loïc; Pickford, Martin; Senut, Brigitte; Fagel, Nathalie

    2015-08-01

    The Lukeino Formation contains an important sedimentary and fossiliferous record of the late Miocene (6.09-5.68 Ma), which has in particular yielded the fossil remains of the oldest East African bipedal hominid called Orrorin tugenensis. This fluvio-lacustrine sedimentary succession crops out in the Kenyan part of the East African Rift. It is mainly composed of clay to sandy clay deposits intercalated with volcanic ash horizons, and localized layers of carbonates and diatomites. A detailed sedimentological and mineralogical study of the Lukeino Formation was conducted to throw light on the environmental conditions in which the hominids lived. Several centimetric, relatively continuous and indurated phosphatic horizons, of sedimentary origin, were identified at two sites (Sunbarua and Kapcheberek). Mineralogical (XRD) and geochemical analyses as well as observations by SEM, which was coupled with an energy dispersive spectroscopy (EDS) microprobe, indicate that the autochthonous phosphate layers are composed of a micritic matrix of francolite (38-93%), with incorporation of silicates in variable proportions from one layer to another. The phosphate matrix contains very well preserved and abundant diatom frustules in the basal phosphate layer. These diatoms are identified as Aulacoseira granulata, implying a pH of 7.8-8.2 for freshwaters of the Palaeolake Lukeino. Calcitic tubular structures, linked to a possible bacterial origin, are also observed locally. Phosphate layers occur abruptly within a thick clay-sandy series, associated with an intense runoff phase during the deposition of this interval of the Lukeino Formation. The massive and cyclic input of phosphorus to the lake promoted productivity to the stage where it caused a diatom bloom. The establishment of several phosphate horizons testifies to successive phases of eutrophication of Palaeolake Lukeino. The diatom cells provided some of the organic matter, which was decomposed by bacterial activity at the

  17. Eastern-Mediterranean ventilation variability during sapropel S1 formation, evaluated at two sites influenced by deep-water formation from Adriatic and Aegean Seas

    NASA Astrophysics Data System (ADS)

    Filippidi, A.; Triantaphyllou, M. V.; De Lange, G. J.

    2016-07-01

    Present-day bottom-water ventilation in the Eastern Mediterranean basin occurs through deep-water convection originating from the two marginal basins, i.e. Adriatic and Aegean Seas. In the paleo record, long periods of enhanced deep-water formation have been alternating with shorter periods of reduced deep-water formation. The latter is related mainly to low-latitude humid climate conditions and the enhanced deposition and preservation of organic-rich sediment units (sapropels). This study focuses on sedimentary archives of the most-recent sapropel S1, retrieved from two sites under the direct influence of the two deep-water formation areas. Restricted oxygen conditions have developed rapidly at the beginning of S1 deposition in the Adriatic site, but bottom-water conditions have not persistently remained anoxic during the full interval of sapropel deposition. In fact, the variability in intensity and persistence of sedimentary redox conditions at the two deep-water formation sites is shown to be related to brief episodes of climate cooling. In the Adriatic site, sapropel deposition appears to have been interrupted twice. The 8.2 ka event, only recovered at the Adria site, is characterized by gradually increasing suboxic to possibly intermittently oxic conditions and decreasing Corg fluxes, followed by an abrupt re-establishment of anoxic conditions. Another important event that disrupted sapropel S1 formation, has taken place at ca. 7.4 cal ka BP. The latter event has been recovered at both sites. In the Adriatic site it is followed by a period of sedimentary conditions that gradually change from suboxic to more permanently oxic, as deduced from the Mn/Al pattern. Using the same proxy for suboxic/oxic sedimentary redox conditions, we observe that conditions in the Aegean Sea site shift to more permanently oxic from the 7.4 ka event onwards. However, at both sites the accumulation and preservation of enhanced amounts of organic matter have continued under these

  18. Formation of nanostructured Group IIA metal activated sensors: The transformation of Group IIA metal compound sites

    NASA Astrophysics Data System (ADS)

    Tune, Travis C.; Baker, Caitlin; Hardy, Neil; Lin, Arthur; Widing, Timothy J.; Gole, James L.

    2015-05-01

    Trends in the Group IIA metal oxides and hydroxides of magnesium, calcium, and barium are unique in the periodic table. In this study we find that they display novel trends as decorating nanostructures for extrinsic semiconductor interfaces. The Group IIA metal ions are strong Lewis acids. We form these M2+ ions in aqueous solution and bring these solutions in contact with a porous silicon interface to form interfaces for conductometric measurements. Observed responses are consistent with the formation of MgO whereas the heavier elements display behaviors which suggest the effect of their more basic nature. Mg(OH)2, when formed, represents a weak base whereas the heavier metal hydroxides of Ca, Sr, and Ba are strong bases. However, the hydroxides tend to give up hydrogen and act as Brönsted acids. For the latter elements, the reversible interaction response of nanostructures deposited to the porous silicon (PS) interface is modified, as the formation of more basic sites appears to compete with M2+ Lewis acidity and hydroxide Brönsted acidity. Mg2+ forms an interface whose response to the analytes NH3 and NO is consistent with MgO and well explained by the recently developing Inverse Hard/Soft Acid/Base model. The behavior of the Ca2+ and Ba2+ decorated interfaces as they interact with the hard base NH3 follows a reversal of the model, indicating a decrease in acidic character as the observed conductometric response suggests the interaction with hydroxyl groups. A change from oxide-like to hydroxide-like constituents is supported by XPS studies. The changes in conductometric response is easily monitored in contrast to changes associated with the Group IIA oxides and hydroxides observed in XPS, EDAX, IR, and NMR measurements.

  19. Dipstick format of an improved ELISA for on-site atrazine monitoring in water in Pakistan.

    PubMed

    Maqbool, Uzma; Anwar-ul-Haq; Mahboob, Sadia

    2010-01-01

    A dipstick format was developed for on-site atrazine monitoring in water samples of different origins. It was derived from an in-house-developed ELISA based on polyclonal antibodies that also cross-react with hydroxyatrazine (30%) and terbuthylazine (17%). Test reagents were evaluated for temperature and pH stabilities and rapidity for field applications. Reagents performed well within a temperature range of 20-30 degrees C and were tolerant to alkaline pH (up to 8.5) of the assay buffering system. Tracer incubation time could be reduced to 40 min. Bovine serum albumin addition (1%) in the assay buffer improved assay performance, giving 50% B/B0 (IC50) of 65 ng/L and the lowest LOD of 2 ng/L at 90% B/B0 (IC10). The dipstick ELISA format was standardized on a membrane support. Nylon membrane, positively charged, was superior to PVDF for qualitative or semiquantitative analysis regarding color intensity and stability. Tracer incubation time was further reduced to 30 min with a lowest LOD of 0.1 microg/L. For real sample screening with dipsticks, acceptable results were obtained for water. Significant correlation was found between dipstick and plate ELISA results. Validation using GC with a nitrogen-phosphorus detector and HPLC indicated that dipstick signals in aged water samples, which were mainly due to hydroxyatrazine, were significantly above European Commission regulations of 0.1 microg/L. However, dipsticks were superior, fast, and cost-effective. PMID:20334162

  20. Deciphering site formation processes through soil micromorphology at Contrebandiers Cave, Morocco.

    PubMed

    Aldeias, Vera; Goldberg, Paul; Dibble, Harold L; El-Hajraoui, Mohamed

    2014-04-01

    Contrebandiers Cave preserves a Late Pleistocene sequence containing Middle Stone Age (MSA) so-called Maghrebian Mousterian and Aterian occupations, spanning from ∼126 to 95 ka (thousands of years ago), followed by spatially restricted Iberomaurusian industries. Micromorphological analyses, complemented by instrumental mineralogical identification and fabric orientation, allowed for the reconstruction of the main site formation processes at the site. Initial deposition is characterized by local reworking of marine shelly sands dating to Marine Isotopic Stage 5e (MIS5e). The subsequent stratification reveals sedimentary dynamics predominantly associated with gravity-driven inputs and contributions from weathering of the encasing bedrock, at the same time that anthropogenic sediments were being accumulated. The allochthonous components reflect soil degradation and vegetation changes around the cave during the last interglacial. Human occupations seems to be somewhat ephemeral in nature, with some stratigraphic units apparently lacking archaeological components, while in others the human-associated deposits (e.g., burned bones, charcoal, and ashes) can be substantial. Ephemeral breaks in sedimentation and/or erosion followed by stabilization are mainly discernible microscopically by the presence of phosphatic-rich laminae interpreted as short-lived surfaces, peaks of increased humidity and colonization by plants. More substantial erosion affects the uppermost Aterian layers, presumably due to localized reconfigurations of the cave's roof. The subsequent Iberomaurusian deposits are not in their primary position and are associated with well-sorted silts of aeolian origin. While the effects of chemical diagenesis are limited throughout the whole stratigraphic sequence, physical bioturbation (e.g., by wasps, rodents, and earthworms) is more pervasive and leads to localized movement of the original sedimentary particles. PMID:24650737

  1. Assessment of potential radionuclide transport in site-specific geologic formations

    SciTech Connect

    Dosch, R.G.

    1980-08-01

    Associated with the development of deep, geologic repositories for nuclear waste isolation is a need for safety assessments of the potential for nuclide migration. Frequently used in estimating migration rates is a parameter generally known as a distribution coefficient, K/sub d/, which describes the distribution of a radionuclide between a solid (rock) and a liquid (groundwater) phase. This report is intended to emphasize that the use of K/sub d/ must be coupled with a knowledge of the geology and release scenarios applicable to a repository. Selected K/sub d/ values involving rock samples from groundwater/brine simulants typical of two potential repository sites, WIPP and NTS, are used to illustrate this concern. Experimental parameters used in K/sub d/ measurements including nuclide concentration, site sampling/rock composition, and liquid-to-solid ratios are discussed. The solubility of U(VI) in WIPP brine/groundwater was addressed in order to assess the potential contribution of this phenomena to K/sub d/ values. Understanding mehanisms of sorption of radionuclides on rocks would lead to a better predictive capability. Sorption is attributed to the presence of trace constituents (often unidentified) in rocks. An attempt was made to determine if this applied to WIPP dolomite rocks by comparing sorption behavior of the natural material with that of a synthetic dolomite prepared in the laboratory with reagent grade chemicals. The results were inconclusive. The results of a study of Tc sorption by an argillite sample from the Calico Hills formation at NTS under ambient laboratory conditions were more conclusive. The Tc sorption was found to be associated with elemental carbon. Available evidence points to a reduction mechanism leading to the apparent sorption of Tc on the solid phase.

  2. Micromorphology and site formation at Die Kelders Cave I, South Africa.

    PubMed

    Goldberg, P

    2000-01-01

    The deposits of Die Kelders I were previously described and studied by Tankard & Schweitzer (1974, 1976) from the standpoint of classical granulometric analysis of sand from a coastal cave in order to infer the geological history of the cave and its environs. This paper supplements these earlier works by taking a more holistic approach toward site formation processes by including investigation of the biogenic and anthropogenic influences on the cave deposits and history. The study employs the technique of soil micromorphology, which is the study of resin-impregnated, undisturbed blocks of sediment and petrographic thin sections, in which sediments from all areas of the cave were examined. The study showed that diagenesis of the deposits in the eastern areas of the excavation resulted in decalcification, which in turn brought about slumping and compaction. Equivalent stratigraphic layers exposed in the western and central areas were only mildly decalcified and consequently, these sediments contain limestone rock fall and relatively abundant marine and terrestrial mollusks, the latter not dissimilar to the Late Stone Age (LSA) midden which covers these deposits. Thus, in spite of lowered and more distant shorelines, marine resources were exploited during Middle Stone Age (MSA) times. Observations from these calcareous units also clearly demonstrates that previously recognized "occupational horizons" (e.g. Layers 6, 8 and 10) can be resolved micromorphologically into several ephemeral events, such as burning/fire, redistribution of ashes by wind and water, and non-deposition; the latter is shown by phosphatic alteration of sediments exposed on former surfaces and accumulation of guano, or the presence of millimeter-thick truncation surfaces below which aeolian dust infiltrated. Both field and microscopic observations illustrate that the deposits in caves are highly variable from wall to center, and that excavations should not be localized in just one microenvironment

  3. Nitric oxide-based protein modification: formation and site-specificity of protein S-nitrosylation

    PubMed Central

    Kovacs, Izabella; Lindermayr, Christian

    2013-01-01

    Nitric oxide (NO) is a reactive free radical with pleiotropic functions that participates in diverse biological processes in plants, such as germination, root development, stomatal closing, abiotic stress, and defense responses. It acts mainly through redox-based modification of cysteine residue(s) of target proteins, called protein S-nitrosylation.In this way NO regulates numerous cellular functions and signaling events in plants. Identification of S-nitrosylated substrates and their exact target cysteine residue(s) is very important to reveal the molecular mechanisms and regulatory roles of S-nitrosylation. In addition to the necessity of protein–protein interaction for trans-nitrosylation and denitrosylation reactions, the cellular redox environment and cysteine thiol micro-environment have been proposed important factors for the specificity of protein S-nitrosylation. Several methods have recently been developed for the proteomic identification of target proteins. However, the specificity of NO-based cysteine modification is still less defined. In this review, we discuss formation and specificity of S-nitrosylation. Special focus will be on potential S-nitrosylation motifs, site-specific proteomic analyses, computational predictions using different algorithms, and on structural analysis of cysteine S-nitrosylation. PMID:23717319

  4. Site specific comparison of H2, CH4 and compressed air energy storage in porous formations

    NASA Astrophysics Data System (ADS)

    Tilmann Pfeiffer, Wolf; Wang, Bo; Bauer, Sebastian

    2016-04-01

    The supply of energy from renewable sources like wind or solar power is subject to fluctuations determined by the climatic and weather conditions, and shortage periods can be expected on the order of days to weeks. Energy storage is thus required if renewable energy dominates the total energy production and has to compensate the shortages. Porous formations in the subsurface could provide large storage capacities for various energy carriers, such as hydrogen (H2), synthetic methane (CH4) or compressed air (CAES). All three energy storage options have similar requirements regarding the storage site characteristics and consequently compete for suitable subsurface structures. The aim of this work is to compare the individual storage methods for an individual storage site regarding the storage capacity as well as the achievable delivery rates. This objective is pursued using numerical simulation of the individual storage operations. In a first step, a synthetic anticline with a radius of 4 km, a drop of 900 m and a formation thickness of 20 m is used to compare the individual storage methods. The storage operations are carried out using -depending on the energy carrier- 5 to 13 wells placed in the top of the structure. A homogeneous parameter distribution is assumed with permeability, porosity and residual water saturation being 500 mD, 0.35 and 0.2, respectively. N2 is used as a cushion gas in the H2 storage simulations. In case of compressed air energy storage, a high discharge rate of 400 kg/s equating to 28.8 mio. m³/d at surface conditions is required to produce 320 MW of power. Using 13 wells the storage is capable of supplying the specified gas flow rate for a period of 31 hours. Two cases using 5 and 9 wells were simulated for both the H2 and the CH4 storage operation. The target withdrawal rates of 1 mio. sm³/d are maintained for the whole extraction period of one week in all simulations. However, the power output differs with the 5 well scenario producing

  5. U.S. Department of Energy's site screening, site selection, and initial characterization for storage of CO2 in deep geological formations

    USGS Publications Warehouse

    Rodosta, T.D.; Litynski, J.T.; Plasynski, S.I.; Hickman, S.; Frailey, S.; Myer, L.

    2011-01-01

    The U.S. Department of Energy (DOE) is the lead Federal agency for the development and deployment of carbon sequestration technologies. As part of its mission to facilitate technology transfer and develop guidelines from lessons learned, DOE is developing a series of best practice manuals (BPMs) for carbon capture and storage (CCS). The "Site Screening, Site Selection, and Initial Characterization for Storage of CO2 in Deep Geological Formations" BPM is a compilation of best practices and includes flowchart diagrams illustrating the general decision making process for Site Screening, Site Selection, and Initial Characterization. The BPM integrates the knowledge gained from various programmatic efforts, with particular emphasis on the Characterization Phase through pilot-scale CO2 injection testing of the Validation Phase of the Regional Carbon Sequestration Partnership (RCSP) Initiative. Key geologic and surface elements that suitable candidate storage sites should possess are identified, along with example Site Screening, Site Selection, and Initial Characterization protocols for large-scale geologic storage projects located across diverse geologic and regional settings. This manual has been written as a working document, establishing a framework and methodology for proper site selection for CO2 geologic storage. This will be useful for future CO2 emitters, transporters, and storage providers. It will also be of use in informing local, regional, state, and national governmental agencies of best practices in proper sequestration site selection. Furthermore, it will educate the inquisitive general public on options and processes for geologic CO2 storage. In addition to providing best practices, the manual presents a geologic storage resource and capacity classification system. The system provides a "standard" to communicate storage and capacity estimates, uncertainty and project development risk, data guidelines and analyses for adequate site characterization, and

  6. Disulfide bond formation is a determinant of glycosylation site usage in the hemagglutinin-neuraminidase glycoprotein of Newcastle disease virus.

    PubMed Central

    McGinnes, L W; Morrison, T G

    1997-01-01

    Determinants of glycosylation site usage were explored by using the hemagglutinin-neuraminidase (HN) glycoprotein of the paramyxovirus Newcastle disease virus. The amino acid sequence of the HN protein, a type II glycoprotein, has six N-linked glycosylation addition sites, G1 to G6, two of which, G5 and G6, are not used for the addition of carbohydrate (L. McGinnes and T. Morrison, Virology 212:398-410, 1995). The sequence of this protein also has 13 cysteine residues in the ectodomain (C2 to C14). Mutation of either cysteine 13 or cysteine 14 resulted in the addition of another oligosaccharide chain to the protein. These cysteine residues flank the normally unused G6 glycosylation addition site, and mutation of the G6 site eliminated the extra glycosylation found in the cysteine mutants. These results suggested that failure to form an intramolecular disulfide bond resulted in the usage of a normally unused glycosylation site. This conclusion was confirmed by preventing cotranslational disulfide bond formation in cells by using dithiothreitol. Under these conditions, the wild-type protein acquired extra glycosylation, which was eliminated by mutation of the G6 site. These results suggest that localized folding events on the nascent chain, such as disulfide bond formation, which block access to the oligosaccharyl transferase are a determinant of glycosylation site usage. PMID:9060670

  7. A Study of Geological Formation on Different Sites in Batu Pahat, Malaysia Based On HVSR Method Using Microtremor Measurement

    NASA Astrophysics Data System (ADS)

    Noor, M. A. M.; Madun, A.; Kamarudin, A. F.; Daud, M. E.

    2016-07-01

    Geological formation is a one of information need to know during site reconnaissance. Conventional method like borehole has been known is very accurate to identify the formation of geology of a site. However, the problem of this technique is very expensive and not economical for large area. In the last decade, microtremor measurement has been introduced as an alternative technique and widely used in the geological formation study. Therefore, the aim in this study is to determine the geological formation underneath of surface in Batu Pahat district using microtremor measurement. There are two parameters have been carried out from microtremor measurement in term of natural frequency and HVSR curves images. Microtremor measurements are done conducted at 15 sites surrounding of Batu Pahat. Horizontal to vertical spectral ratio (HVSR) method was used for analyzing microtermor measurement data, to determine the natural frequency and also HVSR curves image. In this study, values of natural frequencies are used to classify the soil types with range in the between 0.93 to 5.35 Hz, meanwhile the pattern of HVSR curve images has been shown exists a few groups of soil types surrounding Batu Pahat district. Hence, microtremor measurement indirectly can be used as a one technique to add value in the site reconnaissance in the future.

  8. Quarries of Culture: An Ethnohistorical and Environmental Account of Sacred Sites and Rock Formations in Southern California's Mission Indian Country

    ERIC Educational Resources Information Center

    Karr, Steven M.

    2005-01-01

    Sacred sites and Rock Formations throughout Southern California's India Country are described by Indians as ancestral markers, origin and place-name locales, areas of deity habitation, and power sources. Early ethnographers were keen to record the traditional stories and meanings related to them by their Native collaborators. Rock formations…

  9. Cooperativity between Al Sites Promotes Hydrogen Transfer and Carbon–Carbon Bond Formation upon Dimethyl Ether Activation on Alumina

    PubMed Central

    2015-01-01

    The methanol-to-olefin (MTO) process allows the conversion of methanol/dimethyl ether into olefins on acidic zeolites via the so-called hydrocarbon pool mechanism. However, the site and mechanism of formation of the first carbon–carbon bond are still a matter of debate. Here, we show that the Lewis acidic Al sites on the 110 facet of γ-Al2O3 can readily activate dimethyl ether to yield CH4, alkenes, and surface formate species according to spectroscopic studies combined with a computational approach. The carbon–carbon forming step as well as the formation of methane and surface formate involves a transient oxonium ion intermediate, generated by a hydrogen transfer between surface methoxy species and coordinated methanol on adjacent Al sites. These results indicate that extra framework Al centers in acidic zeolites, which are associated with alumina, can play a key role in the formation of the first carbon–carbon bond, the initiation step of the industrial MTO process. PMID:27162986

  10. Cooperativity between Al Sites Promotes Hydrogen Transfer and Carbon-Carbon Bond Formation upon Dimethyl Ether Activation on Alumina.

    PubMed

    Comas-Vives, Aleix; Valla, Maxence; Copéret, Christophe; Sautet, Philippe

    2015-09-23

    The methanol-to-olefin (MTO) process allows the conversion of methanol/dimethyl ether into olefins on acidic zeolites via the so-called hydrocarbon pool mechanism. However, the site and mechanism of formation of the first carbon-carbon bond are still a matter of debate. Here, we show that the Lewis acidic Al sites on the 110 facet of γ-Al2O3 can readily activate dimethyl ether to yield CH4, alkenes, and surface formate species according to spectroscopic studies combined with a computational approach. The carbon-carbon forming step as well as the formation of methane and surface formate involves a transient oxonium ion intermediate, generated by a hydrogen transfer between surface methoxy species and coordinated methanol on adjacent Al sites. These results indicate that extra framework Al centers in acidic zeolites, which are associated with alumina, can play a key role in the formation of the first carbon-carbon bond, the initiation step of the industrial MTO process. PMID:27162986

  11. High Fat Diet Enhances β-Site Cleavage of Amyloid Precursor Protein (APP) via Promoting β-Site APP Cleaving Enzyme 1/Adaptor Protein 2/Clathrin Complex Formation.

    PubMed

    Maesako, Masato; Uemura, Maiko; Tashiro, Yoshitaka; Sasaki, Kazuki; Watanabe, Kiwamu; Noda, Yasuha; Ueda, Karin; Asada-Utsugi, Megumi; Kubota, Masakazu; Okawa, Katsuya; Ihara, Masafumi; Shimohama, Shun; Uemura, Kengo; Kinoshita, Ayae

    2015-01-01

    Obesity and type 2 diabetes are risk factors of Alzheimer's disease (AD). We reported that a high fat diet (HFD) promotes amyloid precursor protein (APP) cleavage by β-site APP cleaving enzyme 1 (BACE1) without increasing BACE1 levels in APP transgenic mice. However, the detailed mechanism had remained unclear. Here we demonstrate that HFD promotes BACE1/Adaptor protein-2 (AP-2)/clathrin complex formation by increasing AP-2 levels in APP transgenic mice. In Swedish APP overexpressing Chinese hamster ovary (CHO) cells as well as in SH-SY5Y cells, overexpression of AP-2 promoted the formation of BACE1/AP-2/clathrin complex, increasing the level of the soluble form of APP β (sAPPβ). On the other hand, mutant D495R BACE1, which inhibits formation of this trimeric complex, was shown to decrease the level of sAPPβ. Overexpression of AP-2 promoted the internalization of BACE1 from the cell surface, thus reducing the cell surface BACE1 level. As such, we concluded that HFD may induce the formation of the BACE1/AP-2/clathrin complex, which is followed by its transport of BACE1 from the cell surface to the intracellular compartments. These events might be associated with the enhancement of β-site cleavage of APP in APP transgenic mice. Here we present evidence that HFD, by regulation of subcellular trafficking of BACE1, promotes APP cleavage. PMID:26414661

  12. Urinary bladder matrix promotes site appropriate tissue formation following right ventricle outflow tract repair

    PubMed Central

    Remlinger, Nathaniel T; Gilbert, Thomas W; Yoshida, Masahiro; Guest, Brogan N; Hashizume, Ryotaro; Weaver, Michelle L; Wagner, William R; Brown, Bryan N; Tobita, Kimimasa; Wearden, Peter D

    2013-01-01

    The current prevalence and severity of heart defects requiring functional replacement of cardiac tissue pose a serious clinical challenge. Biologic scaffolds are an attractive tissue engineering approach to cardiac repair because they avoid sensitization associated with homograft materials and theoretically possess the potential for growth in similar patterns as surrounding native tissue. Both urinary bladder matrix (UBM) and cardiac ECM (C-ECM) have been previously investigated as scaffolds for cardiac repair with modest success, but have not been compared directly. In other tissue locations, bone marrow derived cells have been shown to play a role in the remodeling process, but this has not been investigated for UBM in the cardiac location, and has never been studied for C-ECM. The objectives of the present study were to compare the effectiveness of an organ-specific C-ECM patch with a commonly used ECM scaffold for myocardial tissue repair of the right ventricle outflow tract (RVOT), and to examine the role of bone marrow derived cells in the remodeling response. A chimeric rat model in which all bone marrow cells express green fluorescent protein (GFP) was generated and used to show the ability of ECM scaffolds derived from the heart and bladder to support cardiac function and cellular growth in the RVOT. The results from this study suggest that urinary bladder matrix may provide a more appropriate substrate for myocardial repair than cardiac derived matrices, as shown by differences in the remodeling responses following implantation, as well as the presence of site appropriate cells and the formation of immature, myocardial tissue. PMID:23974174

  13. Peroxy radical concentration and ozone formation rate at a rural site in the southeastern United States

    NASA Astrophysics Data System (ADS)

    Kleinman, Lawrence; Lee, Yin-Nan; Springston, Stephen R.; Lee, Jai H.; Nunnermacker, Linda; Weinstein-Lloyd, Judith; Zhou, Xianliang; Newman, Leonard

    1995-04-01

    As part of the Southern Oxidants Study, Brookhaven National Laboratory operated an intensive measurement site near Metter, Georgia, during parts of the summers of 1991 and 1992. Measurements were made of photochemically active trace gases and meteorological parameters relevant to determining causes for elevated ambient ozone concentration. The 1992 data set was used to calculate peroxy radical concentration and ozone formation rate based on determining the departure from the photostationary state (PSS) and based on a radical budget equation, such as applied previously to the 1991 data set. Averaged over the 28-day experimental period, we find maximum radical production occurring near noon at 2.5 ppb h-1, maximum peroxy radical concentration also occurring near noon at 80 ppt, and maximum ozone production of 8 ppb h-1 occurring near 1000 EST. Ozone photolysis accounts for 55% of radical production, HCHO and other carbonyl compounds about 40%. The radical budget and PSS methods depend in different ways on atmospheric photochemistry and a comparison between them affords a test of our understanding of the photochemical production of O3. We find that these methods agree to the extent expected based on uncertainty estimates. For the data set as a whole, the median estimate for fractional error in hourly average peroxy radical concentration determined from the radical budget method is approximately 30% and from the PSS method, 50%. Error estimates for the PSS method are highly variable, becoming infinite as peroxy radical concentration approaches zero. This behavior can be traced back to the difference form of the PSS equations. To conduct a meaningful comparison between the methods, the data set was segregated into subsets based on PSS uncertainty estimates. For the low-uncertainty subset, consisting of a third of the whole data set, we find that the ratio of peroxy radical concentration predicted from the PSS method to that predicted from the radical budget method to be

  14. Sialylation of vitronectin regulates stress fiber formation and cell spreading of dermal fibroblasts via a heparin-binding site.

    PubMed

    Miyamoto, Yasunori; Tanabe, Mio; Date, Kimie; Sakuda, Kanoko; Sano, Kotone; Ogawa, Haruko

    2016-04-01

    Vitronectin (VN) plays an important role in tissue regeneration. We previously reported that VN from partial hepatectomized (PH) rats results in a decrease of sialylation of VN and de-sialylation of VN decreases the cell spreading of hepatic stellate cells. In this study, we analyzed the mechanism how sialylation of VN regulates the properties of mouse primary cultured dermal fibroblasts (MDF) and a dermal fibroblast cell line, Swiss 3T3 cells. At first, we confirmed that VN from PH rats or de-sialylated VN also decreased cell spreading in MDF and Swiss 3T3 cells. The de-sialylation suppressed stress fiber formation in Swiss 3T3 cells. Next, we analyzed the effect of the de-sialylation of VN on stress fiber formation in Swiss 3T3 cells. RGD peptide, an inhibitor for a cell binding site of VN, did not affect the cell attachment of Swiss 3T3 cells on untreated VN but significantly decreased it on de-sialylated VN, suggesting that the de-sialylation attenuates the binding activity of an RGD-independent binding site in VN. To analyze a candidate RGD-independent binding site, an inhibition experiment of stress fiber formation for a heparin binding site was performed. The addition of heparin and treatment of cells with heparinase decreased stress fiber formation in Swiss 3T3 cells. Furthermore, de-sialylation increased the binding activity of VN to heparin, as detected by surface plasmon resonance (SPR). These results demonstrate that sialylation of VN glycans regulates stress fiber formation and cell spreading of dermal fibroblast cells via a heparin binding site. PMID:26979432

  15. Upper Devonian vertebrate taphonomy and sedimentology from the Klunas fossil site, Tervete Formation, Latvia

    NASA Astrophysics Data System (ADS)

    Vasiļkova, J.; Lukševičs, E.; Stinkulis, Ä.¢.; Zupinš, I.

    2012-04-01

    The deposits of the Tervete Formation, Famennian Stage of Latvia, comprising weakly cemented sandstone and sand intercalated with dolomitic marls, siltstone and clay, have been traditionally interpreted as having formed in a shallow, rather restricted sea with lowered salinity. During seven field seasons the excavations took place in the south-western part of Latvia, at the Klunas site, and resulted in extensive palaeontological and sedimentological data. The taphonomical analysis has been performed, having evaluated the size, sorting, orientation of the fossils, articulation and skeletal preservation as well as the degree of fragmentation and abrasion. The sedimentological analysis involved interpretation of sedimentary structures, palaeocurrent direction reconstruction, grain-size analysis and approximate water depth calculations. The vertebrate assemblage of the Klunas site represents all known taxa of the Sparnene Regional Stage of the Baltic Devonian, comprising placoderms Bothriolepis ornata Eichwald, B. jani Lukševičs, Phyllolepis tolli Vasiliauskas, Dunkleosteus sp. and Chelyophorus sp., sarcopterygians Holoptychius nobilissimus Agassiz, Platycephalichthys skuenicus Vorobyeva, Cryptolepis sp., Conchodus sp., Glyptopomus ? sp., "Strunius" ? sp., and Dipterus sp., as well as an undetermined actinopterygian. Placoderms Bothriolepis ornata and B. jani dominate the assemblage. The fossils are represented in the main by fully disarticulated placoderm plates and plate fragments, sarcopterygian scales and teeth, rarely bones of the head and shoulder girdle, and acanthodian spines and scales. The characteristic feature is the great amount of fragmentary remains several times exceeding the number of intact bones. The horizontal distribution of the bones over the studied area is not homogenous, distinct zones of increased or decreased density of fossils can be traced. Zones of the increased density usually contain many elements of various sizes, whereas zones of the

  16. Site-specific glycoproteomics confirms that protein structure dictates formation of N-glycan type, core fucosylation and branching.

    PubMed

    Thaysen-Andersen, Morten; Packer, Nicolle H

    2012-11-01

    Growing evidence indicates that the individualized and highly reproducible N-glycan repertoires on each protein glycosylation site modulate function. Relationships between protein structures and the resulting N-glycoforms have previously been observed, but remain to be quantitatively confirmed and examined in detail to define the responsible mechanisms in the conserved mammalian glycosylation machinery. Here, we investigate this relationship by manually extracting and analyzing quantitative and qualitative site-specific glycoprofiling data from 117 research papers. Specifically, N-glycan structural motifs were correlated with the structure of the protein carriers, focusing on the solvent accessibility of the individual glycosylation sites and the physicochemical properties of the surrounding polypeptide chains. In total, 474 glycosylation sites from 169 mammalian N-glycoproteins originating from different tissues/body fluids were investigated. It was confirmed statistically that the N-glycan type, degree of core fucosylation and branching are strongly influenced by the glycosylation site accessibility. For these three N-glycan features, glycosylation sites carrying highly processed glycans were significantly more solvent-accessible than those carrying less processed counterparts. The glycosylation site accessibilities could be linked to molecular signatures at the primary and secondary protein levels, most notably to the glycoprotein size and the proportion of glycosylation sites located in accessible β-turns. In addition, the subcellular location of the glycoproteins influenced the formation of the N-glycan structures. These data confirm that protein structures dictate site-specific formation of several features of N-glycan structures by affecting the biosynthetic pathway. Mammals have, as such, evolved mechanisms enabling proteins to influence the N-glycans they present to the extracellular environment. PMID:22798492

  17. Role of soil macrofauna in soil formation in post mining sites along climatic and litter quality gradients

    NASA Astrophysics Data System (ADS)

    Frouz, Jan

    2014-05-01

    Soil macrofauna can play important role in soil formation. Here we used thin soil sections to study this process in two environmental gradients, climatic gradient, and liter quality gradient. Climatic gradient consist from four chronosequences of post mining sites in the USA, covering hardwood forest (TN, IN), tallgrass prairie (IL), or shortgrass prairie (WY). Earthworms and other saprophages were absent in such shortgrass sites but were present in the wetter, eastern sites. Absence of saprophagous groups, and especially earthworms, resulted in the absence of bioturbation in shortgrass prairie sites while worm casts and other biogenic structures formed an important part of the soil profile in other chronosequences, in short grass prairie in turn physical processes, such as erosion may play important role in soil mixing. Litter quality gradient consists from set of 28 sites planted with six kind of tree stand (pine, larch, spruce, oak, lime and alder) and unreclaimed sites (covered by willow, birch, aspen dominated forest) on one large heap in Czech Republic. Earthworm density on these sites negatively correlate with CN ratio, the same relationships was shown for proportion of earthworm cast in soil volume. In sites with high earthworm density Oe layer was absent and A layer formed by worm casts was well developed, in the contrary when earthworm were absent Oe layer was thick and A layer absent. Development of A layer correlate with soil carbon storage.

  18. Automated Site-Directed Drug Design: The Formation of Molecular Templates in Primary Structure Generation

    NASA Astrophysics Data System (ADS)

    Lewis, R. A.; Dean, P. M.

    1989-03-01

    In this paper the spacer skeleton concept is used to produce molecular graphs of putative ligands for binding sites. The skeletons are transformed into molecular templates within the constraints of the accessible surface of the ligand-binding site. A distance-matrix method is used to compare ligand points with vertices of the spacer skeleton through a permutation of all possible correspondences. A tolerance parameter is used to screen for poor matches. As a result. a small number of matched vertices and ligand points are produced. These are fitted into the site by a constrained optimization routine using an analytical function. Ligand points fall within the site and are optimally positioned adjacent to the corresponding site points, other vertices of the spacer skeleton lying beneath the accessible surface of the site are clipped off. A molecular template is thereby formed with its vertices linked to the ligand points. The final step is to verify that the bonding integrity of the skeleton remains. The computational methods outlined in this paper have been tested at two binding sites the pteridine binding site in dihydrofolate reductase and the amidinophenylpyruvate site of trypsin. Molecular graphs for both sites were generated automatically, they showed strong similarity to those of the natural ligands.

  19. Tissue-specific factors additively increase the probability of the all-or-none formation of a hypersensitive site.

    PubMed Central

    Boyes, J; Felsenfeld, G

    1996-01-01

    DNase I-hypersensitive sites lack a canonical nucleosome and have binding sites for various transcription factors. To understand how the hypersensitivity is generated and maintained, we studied the chicken erythroid-specific beta(A)/epsilon globin gene enhancer, a region where both tissue-specific and ubiquitous transcription factors can bind. Constructions containing mutations of this enhancer were stably introduced into a chicken erythroid cell line. We found that the hypersensitivity was determined primarily by the erythroid factors and that their binding additively increased the accessibility. The fraction of accessible sites in clonal cell lines was quantitated using restriction endonucleases; these data implied that the formation of each hypersensitive site was an all-or-none phenomenon. Use of DNase I and micrococcal nuclease probes further indicated that the size of the hypersensitive site was influenced by the binding of transcription factors which then determined the length of the nucleosome-free gap. Our data are consistent with a model in which hypersensitive sites are generated stochastically: mutations that reduce the number of bound factors reduce the probability that these factors will prevail over a nucleosome; thus, the fraction of sites in the population that are accessible is also diminished. Images PMID:8665857

  20. Phosphorylation of Atg9 regulates movement to the phagophore assembly site and the rate of autophagosome formation.

    PubMed

    Feng, Yuchen; Backues, Steven K; Baba, Misuzu; Heo, Jin-Mi; Harper, J Wade; Klionsky, Daniel J

    2016-04-01

    Macroautophagy is primarily a degradative process that cells use to break down their own components to recycle macromolecules and provide energy under stress conditions, and defects in macroautophagy lead to a wide range of diseases. Atg9, conserved from yeast to mammals, is the only identified transmembrane protein in the yeast core macroautophagy machinery required for formation of the sequestering compartment termed the autophagosome. This protein undergoes dynamic movement between the phagophore assembly site (PAS), where the autophagosome precursor is nucleated, and peripheral sites that may provide donor membrane for expansion of the phagophore. Atg9 is a phosphoprotein that is regulated by the Atg1 kinase. We used stable isotope labeling by amino acids in cell culture (SILAC) to identify phosphorylation sites on this protein and identified an Atg1-independent phosphorylation site at serine 122. A nonphosphorylatable Atg9 mutant showed decreased autophagy activity, whereas the phosphomimetic mutant enhanced activity. Electron microscopy analysis suggests that the different levels of autophagy activity reflect differences in autophagosome formation, correlating with the delivery of Atg9 to the PAS. Finally, this phosphorylation regulates Atg9 interaction with Atg23 and Atg27. PMID:27050455

  1. Insights into site formation at Rose Cottage Cave, South Africa, based on the analysis of sediment peels

    NASA Astrophysics Data System (ADS)

    Kloos, Peter; Miller, Christopher E.; Kritikakis, Panagiotis; Wadley, Lyn

    2016-04-01

    Rose Cottage Cave (RCC), in South Africa, has been a key site for explaining the origins of modern human behaviour and movement of early modern humans out of Africa. Nine sediment peels were made previously from the profile sections, preserving original materials that provide a record of cultural and environmental change during the late Pleistocene and Holocene. Here, we present the preliminary results of the study of the RCC sediment peels which aims to investigate site formation processes and the implications for site interpretation. Methods used include micromorphology and Fourier Transform Infrared spectroscopy coupled with detailed observations of the peels. The predominance of geogenic processes is demonstrated by the abundance of silt- and sand-sized quartz grains, which entered the site primarily through a crevice at the back of the cave. RCC lacks rich anthropogenic deposits as noted at other Middle Stone Age sites in southern Africa, but anthropogenic input to the sediment is indicated by the presence of charcoal, burnt bone, lithic fragments, fat-derived char and ashes. Clay coating fragments and chaotic microstructures demonstrate that bioturbation and colluvial reworking homogenised much of the deposit and may explain the absence of preserved bedding and rarity of combustion features. Downward movement of water through the sequence, indicated by clay coatings, is the likely cause for poor bone preservation and near lack of ashes at the site, as well as fluctuations in dose rate that have complicated luminescence dating studies. Evidence for diagenesis at the site is in the form of secondary apatite and gypsum. Sedimentary structures such as channel lag deposits and (silt and sand) laminae observed in peels dating between 60 and 35 ka BP suggest a high-energy sedimentary environment, which experienced flooding events that eroded underlying deposits and deposited large volumes of sediment. This explains why some of the post-Howiesons Poort layers contain

  2. The homing of bone marrow MSCs to non-osseous sites for ectopic bone formation induced by osteoinductive calcium phosphate

    PubMed Central

    Song, Guodong; Habibovic, Pamela; Bao, Chongyun; Hu, Jing; van Blitterswijk, Clemens A.; Yuan, Huipin; Chen, Wenchuan; Xu, Hockin H.K.

    2013-01-01

    Osteoinductive biomaterials are promising for bone repair. There is no direct proof that bone marrow mesenchymal stem cells (BMSCs) home to non-osseous sites and participate in ectopic bone formation induced by osteoinductive bioceramics. The objective of this study was to use a sex-mismatched beagle dog model to investigate BMSC homing via blood circulation to participate in ectopic bone formation via osteoinductive biomaterial. BMSCs of male dogs were injected into female femoral marrow cavity. The survival and stable chimerism of donor BMSCs in recipients were confirmed with polymerase chain reaction (PCR) and fluorescence in situ hybridization (FISH). Biphasic calcium phosphate (BCP) granules were implanted in dorsal muscles of female dogs. Y chromosomes were detected in samples harvested from female dogs which had received male BMSCs. At 4 weeks, cells with Y-chromosomes were distributed in the new bone matrix throughout the BCP granule implant. At 6 weeks, cells with Y chromosomes were present in newly mineralized woven bone. TRAP positive osteoclast-like cells were observed in 4-week implants, and the number of such cells decreased from 4 to 6 weeks. These results show that osteoprogenitors were recruited from bone marrow and homed to ectopic site to serve as a cell source for calcium phosphate-induced bone formation. In conclusion, BMSCs were demonstrated to migrate from bone marrow through blood circulation to non-osseous bioceramic implant site to contribute to ectopic bone formation in a canine model. BCP induced new bone in muscles without growth factor delivery, showing excellent osteoinductivity that could be useful for bone tissue engineering. PMID:23298780

  3. Dimer-dimer interaction of the bacterial selenocysteine synthase SelA promotes functional active site formation and catalytic specificity

    PubMed Central

    Itoh, Yuzuru; Bröcker, Markus J.; Sekine, Shun-ichi; Söll, Dieter; Yokoyama, Shigeyuki

    2015-01-01

    The 21st amino acid, selenocysteine (Sec), is incorporated translationally into proteins, and is synthesized on its specific tRNA (tRNASec). In Bacteria, the selenocysteine synthase SelA converts Ser-tRNASec, formed by seryl-tRNA synthetase, to Sec-tRNASec. SelA, a member of the fold-type-I pyridoxal 5′-phosphate (PLP)-dependent enzyme superfamily, has an exceptional homodecameric quaternary structure with a molecular mass of about 500 kDa. Our previously determined crystal structures of Aquifex aeolicus SelA complexed with tRNASec revealed that the ring-shaped decamer is composed of pentamerized SelA dimers, with two SelA dimers arranged to collaboratively interact with one Ser-tRNASec. The SelA catalytic site is close to the dimer-dimer interface, but the significance of the dimer-pentamerization in the catalytic site formation remained elusive. In the present study, we examined the quaternary interactions, and demonstrated their importance for SelA activity by systematic mutagenesis. Furthermore, we determined the crystal structures of “depentamerized” SelA variants with mutations at the dimer-dimer interface that prevent pentamerization. These dimeric SelA variants formed a distorted and inactivated catalytic site, and confirmed that the pentamer interactions are essential for productive catalytic site formation. Intriguingly, the conformation of the non-functional active site of dimeric SelA shares structural features with other fold-type-I PLP-dependent enzymes with native dimer or tetramer (dimer-of-dimers) quaternary structures. PMID:24456689

  4. The use of in vitro DNA adduct formation to estimate the genotoxicity of residues at contaminated sites.

    PubMed

    Shaw, G; Connell, D; Barron, W

    1995-05-01

    Genotoxic carcinogens such as polycyclic aromatic hydrocarbons (PAHs) covalently bind to the bases in DNA to form adducts. The formation of DNA adducts is significant with respect to chemical carcinogenesis. Many contaminated sites contain quantities of carcinogens such as PAHs, and the evaluation of the genotoxicity of these soils has important implications for human risk assessment. DNA adducts can be formed using an in vitro system incorporating extracts from contaminated soils. The 32P-postlabelling assay is a sensitive technique for the detection of DNA adducts from complex mixtures of environmental carcinogens. These techniques have been used to form and detect DNA adducts using soils from a number of coal gasworks sites. The results show that the extent of adduct formation depends partially on the petroleum hydrocarbon content of samples, but also on other undetermined factors related to composition. While environmental weathering has been shown to effect the PAH composition of samples, this is not an important factor in controlling the genotoxicity of samples as estimated by DNA adduct formation. PMID:7780722

  5. Addition of Adipose-Derived Stem Cells to Mesenchymal Stem Cell Sheets Improves Bone Formation at an Ectopic Site

    PubMed Central

    Wang, Zhifa; Li, Zhijin; Dai, Taiqiang; Zong, Chunlin; Liu, Yanpu; Liu, Bin

    2016-01-01

    To determine the effect of adipose-derived stem cells (ADSCs) added to bone marrow-derived mesenchymal stem cell (MSC) sheets on bone formation at an ectopic site. We isolated MSCs and ADSCs from the same rabbits. We then prepared MSC sheets for implantation with or without ADSCs subcutaneously in the backs of severe combined immunodeficiency (SCID) mice. We assessed bone formation at eight weeks after implantation by micro-computed tomography and histological analysis. In osteogenic medium, MSCs grew to form multilayer sheets containing many calcium nodules. MSC sheets without ADSCs formed bone-like tissue; although neo-bone and cartilage-like tissues were sparse and unevenly distributed by eight weeks after implantation. In comparison, MSC sheets with ADSCs promoted better bone regeneration as evidenced by the greater density of bone, increased mineral deposition, obvious formation of blood vessels, large number of interconnected ossified trabeculae and woven bone structures, and greater bone volume/total volume within the composite constructs. Our results indicate that although sheets of only MSCs have the potential to form tissue engineered bone at an ectopic site, the addition of ADSCs can significantly increase the osteogenic potential of MSC sheets. Thus, the combination of MSC sheets with ADSCs may be regarded as a promising therapeutic strategy to stimulate bone regeneration. PMID:26848656

  6. Genetic alterations and cancer formation in a European flatfish at sites of different contaminant burdens.

    PubMed

    Lerebours, Adélaïde; Stentiford, Grant D; Lyons, Brett P; Bignell, John P; Derocles, Stéphane A P; Rotchell, Jeanette M

    2014-09-01

    Fish diseases are an indicator for marine ecosystem health since they provide a biological end-point of historical exposure to stressors. Liver cancer has been used to monitor the effects of exposure to anthropogenic pollution in flatfish for many years. The prevalence of liver cancer can exceed 20%. Despite the high prevalence and the opportunity of using flatfish to study environmentally induced cancer, the genetic and environmental factors driving tumor prevalence across sites are poorly understood. This study aims to define the link between genetic deterioration, liver disease progression, and anthropogenic contaminant exposures in the flatfish dab (Limanda limanda). We assessed genetic changes in a conserved cancer gene, Retinoblastoma (Rb), in association with histological diagnosis of normal, pretumor, and tumor pathologies in the livers of 165 fish from six sites in the North Sea and English Channel. The highest concentrations of metals (especially cadmium) and organic chemicals correlated with the presence of tumor pathology and with defined genetic profiles of the Rb gene, from these sites. Different Rb genetic profiles were found in liver tissue near each tumor phenotype, giving insight into the mechanistic molecular-level cause of the liver pathologies. Different Rb profiles were also found at sampling sites of differing contaminant burdens. Additionally, profiles indicated that histological "normal" fish from Dogger sampling locations possessed Rb profiles associated with pretumor disease. This study highlights an association between Rb and specific contaminants (especially cadmium) in the molecular etiology of dab liver tumorigenesis. PMID:25102285

  7. Impact of Internet Images: Impression-Formation Effects of University Web Site Images

    ERIC Educational Resources Information Center

    Ramasubramanian, Srividya; Gyure, James F.; Mursi, Nasreen M.

    2002-01-01

    Institutions of higher education are increasingly becoming dependent on Web-based marketing to reach out to their target audiences. The current empirical study examines the types of impressions formed by prospective students based on exposure to different university Web site images. A between-subjects experiment was conducted using four identical…

  8. Me and My Environment Formative Evaluation Report 1. Arranging Field Tests: Characteristics of Sites and Students.

    ERIC Educational Resources Information Center

    Steele, Joe M.

    The first in a series of evaluation reports gives characteristics of sites and approximately 500 students in field tests of Me and My Environment, a 3-year life science curriculum for 13- to 16-year-old educable mentally handicapped (EMH) adolescents. Described are the field test design, which involves 14 data gathering approaches, and the…

  9. Formation and growth of atmospheric particles at a forest site in the southeast US

    NASA Astrophysics Data System (ADS)

    Pillai, Priya; Walker, John; Khlystov, Andrey; Aneja, Viney

    2013-05-01

    Atmospheric particle size distribution measurements (10 ≤ aerodynamic diameter, Dp ≤ 250 nm), which took place above a loblolly pine plantation in the Southeast U.S. from November 2005 to September 2007, were made using Scanning Mobility Particle Sizer (SMPS). The size distributions were investigated to identify new particle formation and to classify the new particle formation episodes into different event classes based on the behavior of particle size distribution and particle growth pattern. About 69% of the observation days had nucleation. The event frequency was highest in spring and lowest in winter. The particle growth rate was highest in May (5.0 ± 3.6 nm hr-1) and lowest in February (1.2 ± 2.2 nm hr-1) with an annual average particle growth rate of 2.5 ± 0.3 nm hr-1. Nucleation frequency and event types are examined along with associated meteorological and chemical conditions.

  10. New particle formation at a remote continental site: Assessing the contributions of SO2 and organic precursors

    NASA Astrophysics Data System (ADS)

    Marti, James J.; Weber, Rodney J.; McMurry, Peter H.; Eisele, Fred; Tanner, David; Jefferson, Anne

    1997-03-01

    Ultrafine aerosols, with diameters less than 10 nm, nucleate from gas phase species. The composition of newly formed ultrafine atmospheric aerosols is not known with certainty; new particles have variously been conjectured to be sulfates, organic compounds, and sulfate/organic mixtures. The 1993 Tropospheric OH Photochemistry Experiment at Idaho Hill, Colorado, provided an opportunity to examine the question of which class of compounds, i.e., sulfates or organics, make the major contribution to new particle formation in the unpolluted troposphere. This study compared the production rates of sulfuric acid (from the oxidation of sulfur dioxide) and oxidized organic compounds to gauge their relative contributions to the formation of ultrafine particles. Potential organic precursor species examined in this study were the naturally occurring terpenes α- and β pinene, and the anthropogenic hydrocarbons toluene, m-xylene, ethyl benzene, 1,2,4 trimethyl benzene, and methylcyclohexane. The calculated production of oxidized organics appeared well correlated with total particle surface area and volume, suggesting that at least some of the organic compounds formed in gas phase reactions condensed upon the preexisting aerosol. New particle formation was found to be more highly associated with elevated production of gas phase sulfuric acid (via the SO2-OH reaction) than with production of oxidized organic products, although data from one day, during which sulfuric acid production and total aerosol surface area were both lower than usual, provided evidence for the involvement of terpene species in new particle formation. The results suggest that for this continental site, sulfuric acid was probably responsible for most of the observed new ultrafine particle formation. Low-volatility organic compounds may have caused particle formation under the right conditions, but were more likely to condense upon preexisting particles.

  11. Insights into structural and regulatory roles of Sec16 in COPII vesicle formation at ER exit sites

    PubMed Central

    Yorimitsu, Tomohiro; Sato, Ken

    2012-01-01

    COPII-coated buds are formed at endoplasmic reticulum exit sites (ERES) to mediate ER-to-Golgi transport. Sec16 is an essential factor in ERES formation, as well as in COPII-mediated traffic in vivo. Sec16 interacts with multiple COPII proteins, although the functional significance of these interactions remains unknown. Here we present evidence that full-length Sec16 plays an important role in regulating Sar1 GTPase activity at the late steps of COPII vesicle formation. We show that Sec16 interacts with Sec23 and Sar1 through its C-terminal conserved region and hinders the ability of Sec31 to stimulate Sec23 GAP activity toward Sar1. We also find that purified Sec16 alone can self-assemble into homo-oligomeric complexes on a planar lipid membrane. These features ensure prolonged COPII coat association within a preformed Sec16 cluster, which may lead to the formation of ERES. Our results indicate a mechanistic relationship between COPII coat assembly and ERES formation. PMID:22675024

  12. Dynamic formation of single-atom catalytic active sites on ceria-supported gold nanoparticles

    PubMed Central

    Wang, Yang-Gang; Mei, Donghai; Glezakou, Vassiliki-Alexandra; Li, Jun; Rousseau, Roger

    2015-01-01

    Catalysis by gold supported on reducible oxides has been extensively studied, yet issues such as the nature of the catalytic site and the role of the reducible support remain fiercely debated topics. Here we present ab initio molecular dynamics simulations of an unprecedented dynamic single-atom catalytic mechanism for the oxidation of carbon monoxide by ceria-supported gold clusters. The reported dynamic single-atom catalytic mechanism results from the ability of the gold cation to strongly couple with the redox properties of the ceria in a synergistic manner, thereby lowering the energy of redox reactions. The gold cation can break away from the gold nanoparticle to catalyse carbon monoxide oxidation, adjacent to the metal/oxide interface and subsequently reintegrate back into the nanoparticle after the reaction is completed. Our study highlights the importance of the dynamic creation of active sites under reaction conditions and their essential role in catalysis. PMID:25735407

  13. Formation of NH 4+ at the Brønsted site in SAPO catalysts

    NASA Astrophysics Data System (ADS)

    Limtrakul, Jumras; Yoinuan, Jarungsak

    1994-06-01

    The catalytic properties of ammonia adsorption on silicoaluminophosphate (SAPO) clusters have been investigated within the framework of the ab initio self-consistent field method. Full optimization of strutures has been carried out at the DZ, DZP and TZ2P levels of theory. Two different types of ammonia adsorption on SAPO framework sites are proposed. In one of these the structures H 3SiOHA1(OH) 2OPH 3…NH 3 are stablilized on the bridging OH by a single site binding with an interaction energy of - 17.49 kcal/mol. The others is a type of the structure [H 3SiOA1(OH) 2OPH 3] [NH 4+ ], in which the ammonium cation forms two hydrogen bonds towards the unprotonated framework sites. Other possible structures like a "bifurcated" structure are less stable than the two H-bonded structures by about 0.48 and 0.1 kcal/mol at the DZP and TZ2P basis set levels respectively. This indicates the free rotation of the NH 4+ on the SAPO surface site at room temperature. The interaction energies for the structures [H 3SiOA1(OH) 2OPh 3] [NH 4+ are more stabe than for the structures H 3SiOhA1(OH) 2OPH 3…NH 3 by 0.5-1.36 kcal/mol depending on the basis sets. These calculated energy values are an inversion order from the zeolite/NH 3 complexes. Comparison of the SAPO complexes with hydrogen halides, silanol, and zeolite has demonstrated that the hydrogen-form SAPO is at least as acidic as zeolite.

  14. Barometric pressure transient testing applications at the Nevada Test Site: formation permeability analysis. Final report

    SciTech Connect

    Hanson, J.M.

    1984-12-01

    The report evaluates previous investigations of the gas permeability of the rock surrounding emplacement holes at the Nevada Test Site. The discussion sets the framework from which the present uncertainty in gas permeability can be overcome. The usefulness of the barometric pressure testing method has been established. Flow models were used to evaluate barometric pressure transients taken at NTS holes U2fe, U19ac and U20ai. 31 refs., 103 figs., 18 tabs. (ACR)

  15. Radial Glial Cell–Neuron Interaction Directs Axon Formation at the Opposite Side of the Neuron from the Contact Site

    PubMed Central

    Xu, Chundi; Funahashi, Yasuhiro; Watanabe, Takashi; Takano, Tetsuya; Nakamuta, Shinichi; Namba, Takashi

    2015-01-01

    How extracellular cues direct axon–dendrite polarization in mouse developing neurons is not fully understood. Here, we report that the radial glial cell (RGC)–cortical neuron interaction directs axon formation at the opposite side of the neuron from the contact site. N-cadherin accumulates at the contact site between the RGC and cortical neuron. Inhibition of the N-cadherin-mediated adhesion decreases this oriented axon formation in vitro, and disrupts the axon–dendrite polarization in vivo. Furthermore, the RGC–neuron interaction induces the polarized distribution of active RhoA at the contacting neurite and active Rac1 at the opposite neurite. Inhibition of Rho–Rho-kinase signaling in a neuron impairs the oriented axon formation in vitro, and prevents axon–dendrite polarization in vivo. Collectively, these results suggest that the N-cadherin-mediated radial glia–neuron interaction determines the contacting neurite as the leading process for radial glia-guided neuronal migration and directs axon formation to the opposite side acting through the Rho family GTPases. SIGNIFICANCE STATEMENT Neurons are highly polarized cell lines typically with a single axon and multiple dendrites, which underlies the ability of integrating and transmitting the information in the brain. How is the axon–dendrite polarity of neurons established in the developing neocortex? Here we show that the N-cadherin-mediated radial glial cell–neuron interaction directs axon–dendrite polarization, the radial glial cell–neuron interaction induces polarized distribution of active RhoA and active Rac1 in neurons, and Rho–Rho-kinase signaling is required for axon–dendrite polarization. Our work advances the overall understanding of how extracellular cues direct axon–dendrite polarization in mouse developing neurons. PMID:26511243

  16. Analysis of orientation patterns in Olduvai Bed I assemblages using GIS techniques: implications for site formation processes.

    PubMed

    Benito-Calvo, Alfonso; de la Torre, Ignacio

    2011-07-01

    Mary Leakey's excavations at Olduvai Beds I and II provided an unparalleled wealth of data on the archaeology of the early Pleistocene. We have been able to obtain axial orientations of the Bed I bone and stone tools by applying GIS methods to the site plans contained in the Olduvai Volume 3 monograph (Leakey, 1971). Our analysis indicates that the Bed I assemblages show preferred orientations, probably caused by natural agents such as water disturbance. These results, based on new GIS techniques applied to paleoanthropological studies, have important implications for the understanding of the formative agents of Olduvai sites and the behavioral meaning of the bone and lithic accumulations in Bed I. PMID:21470661

  17. Lipid droplets of neuroepithelial cells are a major calcium storage site during neural tube formation in chick and mouse embryos.

    PubMed

    Bush, K T; Lee, H; Nagele, R G

    1992-05-15

    In situ precipitation of calcium (Ca2+) with fluoride and antimonate shows that Ca(2+)-specific precipitate is localized almost exclusively within lipid droplets of neuroepithelial cells during neural tube formation in chick and mouse embryos. The density of Ca2+ precipitate within lipid droplets is generally greater in the apical ends of cells situated in regions of the neuroepithelium that are actively engaged in bending. These findings suggest that lipid droplets, in addition to providing a source of metabolic fuel for developing neuroepithelial cells, also serve as Ca(2+)-storage and -releasing sites during neurulation. PMID:1601118

  18. Mitochondrial translocation contact sites: separation of dynamic and stabilizing elements in formation of a TOM-TIM-preprotein supercomplex.

    PubMed

    Chacinska, Agnieszka; Rehling, Peter; Guiard, Bernard; Frazier, Ann E; Schulze-Specking, Agnes; Pfanner, Nikolaus; Voos, Wolfgang; Meisinger, Chris

    2003-10-15

    Preproteins with N-terminal presequences are imported into mitochondria at translocation contact sites that include the translocase of the outer membrane (TOM complex) and the presequence translocase of the inner membrane (TIM23 complex). Little is known about the functional cooperation of these translocases. We have characterized translocation contact sites by a productive TOM-TIM-preprotein supercomplex to address the role of three translocase subunits that expose domains to the intermembrane space (IMS). The IMS domain of the receptor Tom22 is required for stabilization of the translocation contact site supercomplex. Surprisingly, the N-terminal segment of the channel Tim23, which tethers the TIM23 complex to the outer membrane, is dispensable for both protein import and generation of the TOM-TIM supercomplex. Tim50, with its large IMS domain, is crucial for generation but not for stabilization of the supercomplex. Thus, Tim50 functions as a dynamic factor and the IMS domain of Tom22 represents a stabilizing element in formation of a productive translocation contact site supercomplex. PMID:14532110

  19. Assessment of Zambales Ophiolite formation as a viable site for CO2 storage

    NASA Astrophysics Data System (ADS)

    Magbitang, Riza; Lamorena-Lim, Rheo

    2015-04-01

    Studies involving carbon dioxide (CO2) storage in geologic formations has been increasing over the years. Even though the developed countries are the ones pioneering the large scale storage studies, third world country such as the Philippines, which is one of the most vulnerable to the effects of elevated CO2 levels in the atmosphere, should also intensify CO2 storage research. In this study the potential of utilizing Ophiolite formations in Zambales province, Philippines, in CO2 storage was evaluated. The kinetics of the carbonation reaction was studied using batch reactor, at various temperature and pressure. The concentration of metals involved in the carbonation reaction was monitored by inductively-coupled plasma mass spectrometry (ICP-MS). Flow-through column reactors were used to simulate and study the gas storage in rock columns, hence leading the evaluation of rock mechanical properties. Moreover, thermo-gravimetric analysis (TGA) was used to characterize carbonated and non-carbonated rock samples, thereby resulting to the experimental determination of the amount of CO2 sequestered.

  20. BOREAS TE-1 Soils Data Over The SSA Tower Sites in Raster Format

    NASA Technical Reports Server (NTRS)

    Hall, Forrest G. (Editor); Anderson, Darwin; Knapp, David E.

    2000-01-01

    The BOREAS TE-1 team collected various data to characterize the soil-plant systems in the BOREAS SSA. This data set was gridded from vector layers of soil maps that were received from Dr. Darwin Anderson (TE-1), who did the original soil mapping in the field during 1994. The vector layers were gridded into raster files that cover approximately 1 square kilometer over each of the tower sites in the SSA. The data files are available on a CD-ROM (see document number 20010000884), or from the Oak Ridge National Laboratory (ORNL) Distributed Active Archive Center (DAAC).

  1. BOREAS TE-20 Soils Data Over the NSA-MSA and Tower Sites in Vector Format

    NASA Technical Reports Server (NTRS)

    Hall, Forrest G. (Editor); Veldhuis, Hugo; Knapp, David

    2000-01-01

    The BOREAS TE-20 team collected several data sets for use in developing and testing models of forest ecosystem dynamics. This data set contains vector layers of soil maps that were received from Dr. Hugo Veldhuis, who did the original mapping in the field during 1994. The vector layers were converted to ARCANFO EXPORT files. These data cover 1-kilometer diameters around each of the NSA tower sites, and another layer covers the NSA-MSA. The data files are available on a CD-ROM (see document number 20010000884), or from the Oak Ridge National Laboratory (ORNL) Distributed Active Center (DAAC).

  2. The Impact of Head Gradient Transients on Transport in Heterogeneous Formations: Application to the Borden Site

    NASA Astrophysics Data System (ADS)

    Bellin, Alberto; Dagan, Gedeon; Rubin, Yoram

    1996-04-01

    A three-dimensional interpretation of the Borden Site experiment is proposed with the aid of a recently developed stochastic model that incorporates transiency of the piezometric head gradient. The behavior of the second-order central transverse plume moments is analyzed with the aim of explaining the underprediction of experimental results by existing steady state models. The model assumes uniformity in space, but time varying mean head gradient, stationary and anisotropic log conductivity, and a first-order approximation in the log conductivity variance. The solution for the trajectory covariances, assumed to be equal to the plume spatial second moments under ergodic conditions, is evaluated with the aid of a few quadratures. An analysis of the parameters and plume spatial moments found in the literature precedes application of the model. It is found that unsteadiness leads to an increase in the transverse, horizontal, second moment compared with the one based on a steady state flow model. Still, application of Borden Site data leads to values lower than the ones inferred from concentration measurements. We conclude that unsteadiness of the mean head gradient does not fully explain the magnitude of observed transverse spreading. However, the impact of transients on spreading is significant in the transverse direction, and the definition of a Fickian transverse dispersion coefficient may not be a simple task for transport occurring under natural flow conditions.

  3. An evaluation of water quality in private drinking water wells near natural gas extraction sites in the Barnett Shale formation.

    PubMed

    Fontenot, Brian E; Hunt, Laura R; Hildenbrand, Zacariah L; Carlton, Doug D; Oka, Hyppolite; Walton, Jayme L; Hopkins, Dan; Osorio, Alexandra; Bjorndal, Bryan; Hu, Qinhong H; Schug, Kevin A

    2013-09-01

    Natural gas has become a leading source of alternative energy with the advent of techniques to economically extract gas reserves from deep shale formations. Here, we present an assessment of private well water quality in aquifers overlying the Barnett Shale formation of North Texas. We evaluated samples from 100 private drinking water wells using analytical chemistry techniques. Analyses revealed that arsenic, selenium, strontium and total dissolved solids (TDS) exceeded the Environmental Protection Agency's Drinking Water Maximum Contaminant Limit (MCL) in some samples from private water wells located within 3 km of active natural gas wells. Lower levels of arsenic, selenium, strontium, and barium were detected at reference sites outside the Barnett Shale region as well as sites within the Barnett Shale region located more than 3 km from active natural gas wells. Methanol and ethanol were also detected in 29% of samples. Samples exceeding MCL levels were randomly distributed within areas of active natural gas extraction, and the spatial patterns in our data suggest that elevated constituent levels could be due to a variety of factors including mobilization of natural constituents, hydrogeochemical changes from lowering of the water table, or industrial accidents such as faulty gas well casings. PMID:23885945

  4. Ground-water flow model of the Boone formation at the Tar Creek superfund site, Oklahoma and Kansas

    USGS Publications Warehouse

    Reed, T.B.; Czarnecki, John B.

    2006-01-01

    Extensive mining activities conducted at the Tar Creek Superfund site, one of the largest Superfund sites in the United States, pose substantial health and safety risks. Mining activities removed a total of about 6,000,000 tons of lead and zinc by 1949. To evaluate the effect of this mining on the ground-water flow, a MODFLOW 2000 digital model has been developed to simulate ground-water flow in the carbonate formations of Mississippian age underlying the Tar Creek Superfund site. The model consists of three layers of variable thickness and a grid of 580 rows by 680 columns of cells 164 feet (50 meters) on a side. Model flux boundary conditions are specified for rivers and general head boundaries along the northern boundary of the Boone Formation. Selected cells in layer 1 are simulated as drain cells. Model calibration has been performed to minimize the difference between simulated and observed water levels in the Boone Formation. Hydraulic conductivity values specified during calibration range from 1.3 to 35 feet per day for the Boone Formation with the larger values occurring along the axis of the Miami Syncline where horizontal anisotropy is specified as 10 to 1. Hydraulic conductivity associated with the mine void is set at 50,000 feet per day and a specific yield of 1.0 is specified to represent that the mine void is filled completely with water. Residuals (the difference between measured and simulated ground-water altitudes) has a root-mean-squared value of 8.53 feet and an absolute mean value of 7.29 feet for 17 observed values of water levels in the Boone Formation. The utility of the model for simulating and evaluating the possible consequences of remediation activities has been demonstrated. The model was used to simulate the emplacement of chat (mine waste consisting of fines and fragments of chert) back into the mine. Scenarios using 1,800,000 and 6,500,000 tons of chat were run. Hydraulic conductivity was reduced from 50,000 feet per day to 35 feet

  5. The Role of Groove Periodicity in the Formation of Site-Controlled Quantum Dot Chains.

    PubMed

    Schramm, Andreas; Hakkarainen, Teemu V; Tommila, Juha; Guina, Mircea

    2015-12-01

    Structural and optical properties of InAs quantum dot (QD) chains formed in etched GaAs grooves having different periods from 200 to 2000 nm in [010] orientation are reported. The site-controlled QDs were fabricated by molecular beam epitaxy on soft UV-nanoimprint lithography-patterned GaAs(001) surfaces. Increasing the groove periods decreases the overall QD density but increases the QD size and the linear density along the groove direction. The effect of the increased QD size with larger periods is reflected in ensemble photoluminescence measurements as redshift of the QD emission. Furthermore, we demonstrate the photoluminescence emission from single QD chains. PMID:26058509

  6. Site characterization of the highest-priority geologic formations for CO2 storage in Wyoming

    SciTech Connect

    Surdam, Ronald C.; Bentley, Ramsey; Campbell-Stone, Erin; Dahl, Shanna; Deiss, Allory; Ganshin, Yuri; Jiao, Zunsheng; Kaszuba, John; Mallick, Subhashis; McLaughlin, Fred; Myers, James; Quillinan, Scott

    2013-12-07

    This study, funded by U.S. Department of Energy National Energy Technology Laboratory award DE-FE0002142 along with the state of Wyoming, uses outcrop and core observations, a diverse electric log suite, a VSP survey, in-bore testing (DST, injection tests, and fluid sampling), a variety of rock/fluid analyses, and a wide range of seismic attributes derived from a 3-D seismic survey to thoroughly characterize the highest-potential storage reservoirs and confining layers at the premier CO2 geological storage site in Wyoming. An accurate site characterization was essential to assessing the following critical aspects of the storage site: (1) more accurately estimate the CO2 reservoir storage capacity (Madison Limestone and Weber Sandstone at the Rock Springs Uplift (RSU)), (2) evaluate the distribution, long-term integrity, and permanence of the confining layers, (3) manage CO2 injection pressures by removing formation fluids (brine production/treatment), and (4) evaluate potential utilization of the stored CO2

  7. Formation of multimers of bacterial collagens through introduction of specific sites for oxidative crosslinking.

    PubMed

    Stoichevska, Violet; An, Bo; Peng, Yong Y; Yigit, Sezin; Vashi, Aditya V; Kaplan, David L; Werkmeister, Jerome A; Dumsday, Geoff J; Ramshaw, John A M

    2016-09-01

    A range of non-animal collagens has been described, derived from bacterial species, which form stable triple-helical structures without the need for secondary modification to include hydroxyproline in the sequence. The non-animal collagens studied to date are typically smaller than animal interstitial collagens, around one quarter the length and do not pack into large fibrillar aggregates like those that are formed by the major animal interstitial collagens. A consequence of this for biomedical products is that fabricated items, such as collagen sponges, are not as mechanically and dimensionally stable as those of animal collagens. In the present study, we examined the production of larger, polymeric forms of non-animal collagens through introduction of tyrosine and cysteine residues that can form selective crosslinks through oxidation. These modifications allow the formation of larger aggregates of the non-animal collagens. When Tyr residues were incorporated, gels were obtained. And with Cys soluble aggregates were formed. These materials can be formed into sponges that are more stable than those formed without these modifications. © 2016 Wiley Periodicals, Inc. J Biomed Mater Res Part A: 104A: 2369-2376, 2016. PMID:27171817

  8. GALFA HI: Candidate Sites for H2 Formation in Cold HI Emission and Other Tracers

    NASA Astrophysics Data System (ADS)

    Newton, Jonathan; Gibson, S. J.; Douglas, K. A.; Koo, B.; Kang, J.; Park, G.; Peek, J. E. G.; Korpela, E. J.; Heiles, C.; Dame, T. M.

    2012-01-01

    Interstellar gas has a variety of temperature phases, but only the coldest clouds are dense enough to collapse gravitationally and form stars. How do such clouds form? A key step in this process is the transition from neutral atomic hydrogen (HI) to molecular hydrogen (H2). To identify candidate sites where this HI-to-H2 transition may be underway, we have developed a method of fitting isolated HI 21cm emission features to constrain their spin temperature and other properties vs. position 21cm-line data cubes. Our method uses the Nelder-Meade `amoeba' method to solve the relevant radiative transfer equation by identifying the absolute chi-squared minimum in the parameter space. As other investigators have noted, this approach requires a very high signal-to-noise ratio, so we are using sensitive Arecibo L-band Feed Array (ALFA) observations, starting with narrow-line HI emission clouds in the inner-Galaxy ALFA (I-GALFA) survey, and we have also tested the reliability of our method with a large suite of model spectra. Cold HI clouds confirmed by the fit will be compared to tracers of molecular gas, including CO lines and FIR dust emission. The I-GALFA survey is part of the Galactic ALFA HI data set obtained with the Arecibo 305m telescope. Arecibo Observatory is part of the National Astronomy and Ionosphere Center, operated sequentially by Cornell University and Stanford Research Institute under Cooperative Agreement with the U.S. National Science Foundation.

  9. A conserved secondary structural motif in 23S rRNA defines the site of interaction of amicetin, a universal inhibitor of peptide bond formation.

    PubMed Central

    Leviev, I G; Rodriguez-Fonseca, C; Phan, H; Garrett, R A; Heilek, G; Noller, H F; Mankin, A S

    1994-01-01

    The binding site and probable site of action have been determined for the universal antibiotic amicetin which inhibits peptide bond formation. Evidence from in vivo mutants, site-directed mutations and chemical footprinting all implicate a highly conserved motif in the secondary structure of the 23S-like rRNA close to the central circle of domain V. We infer that this motif lies at, or close to, the catalytic site in the peptidyl transfer centre. The binding site of amicetin is the first of a group of functionally related hexose-cytosine inhibitors to be localized on the ribosome. Images PMID:8157007

  10. Notch3 Activation Promotes Invasive Glioma Formation in a Tissue Site-Specific Manner

    PubMed Central

    Pierfelice, Tarran J.; Schreck, Karisa C.; Dang, Louis; Asnaghi, Laura; Gaiano, Nicholas; Eberhart, Charles G.

    2010-01-01

    While Notch signaling has been widely implicated in neoplastic growth, direct evidence for in vivo initiation of neoplasia by the pathway in murine models has been limited to tumors of lymphoid, breast, and choroid plexus cells. To examine tumorigenic potential in the eye and brain, we injected retroviruses encoding activated forms of Notch1, Notch2, or Notch3 into embryonic mice. Interestingly, the majority of animals infected with active Notch3 developed proliferative lesions comprised of pigmented ocular choroid cells, retinal and optic nerve glia, and lens epithelium. Notch3-induced lesions in the choroid, retina, and optic nerve were capable of invading adjacent tissues, suggesting that they were malignant tumors. While Notch3 activation induced choroidal tumors in up to 67% of eyes, Notch1 or Notch2 activation never resulted in such tumors. Active forms of Notch1 and Notch2 did generate a few small proliferative glial nodules in the retina and optic nerve, while Notch3 was ten-fold more efficient at generating growths, many of which were large invasive gliomas. Expression of active Notch1/Notch3 chimeric receptors implicated the RAM (RBPjk-association molecule) and transactivation domains (TAD) of Notch3 in generating choroidal and glial tumors, respectively. In contrast to our findings in the optic nerve and retina, introduction of active Notch receptors, including Notch3, into the brain never caused glial tumors. Our results highlight the differential ability of Notch receptor paralogs to initiate malignant tumor formation, and suggest that glial precursors of the optic nerve, but not the brain, are susceptible to transformation by Notch3. PMID:21245095

  11. Dust Seds And Processing Near Sites Of High Mass Star Formation In The LMC

    NASA Astrophysics Data System (ADS)

    Hony, Sacha; Galliano, F.; Madden, S. M.; SAGE Consortium

    2010-01-01

    We present a study into the properties of the dust and complex molecules in and around selected HII regions in the Large Magellanic Cloud. The analysis is based on the Spitzer program SAGE (Surveying the Agents of a Galaxy's Evolution). Because of the lower metallicity environment, dust shielding is reduced and the effects of the ultraviolet radiation carry further than in the Milky way. Because of this these HII regions may better represent star forming regions in the more distant universe. We present the near- to far-IR spectral energy distributions (SEDs) as a function of radial distance to the center of the several clusters. The regions span a wide range in luminosities. We have developed a self consistent spherical clumpy dust radiative transfer model to interpret the observed trends. The model treats the detailed dust optical properties and transient grain heating as well as IR absorption and reprocession. This allows us to interpret the observed variations in SED in terms of the clumpiness, varying incident radiation-field and changing abundances of polycyclic aromatic hydrocarbons (PAHs), transiently heated very small grains (VSG) to submicron-sized grains in thermal equilibrium, i.e. in terms of the varying grain-size distribution. We find that the LMC massive star forming sites are typified by a several parsec sized void and clumpiness and PAH abundance which increases with distance from the central illuminating source. The inner void may be the result of massive star winds. The observed flat mid-IR SEDs require a grain-size distribution skewed to a higher fraction of smaller grains compared to the Milky Way dust.

  12. Climatology and Formation of Tropical Midlevel Clouds at the Darwin ARM Site

    SciTech Connect

    Riihimaki, Laura D.; McFarlane, Sally A.; Comstock, Jennifer M.

    2012-10-01

    A 4-yr climatology of midlevel clouds is presented from vertically pointing cloud lidar and radar measurements at the Atmospheric Radiation Measurement Program (ARM) site at Darwin, Australia. Few studies exist of tropical midlevel clouds using a dataset of this length. Seventy percent of clouds with top heights between 4 and 8 km are less than 2 km thick. These thin layer clouds have a peak in cloud-top temperature around the melting level (0°C) and also a second peak around -12.5°C. The diurnal frequency of thin clouds is highest during the night and reaches a minimum around noon, consistent with variation caused by solar heating. Using a 1.5-yr subset of the observations, the authors found that thin clouds have a high probability of containing supercooled liquid water at low temperatures: ~20% of clouds at -30°C, ~50% of clouds at -20°C, and ~65% of clouds at -10°C contain supercooled liquid water. The authors hypothesize that thin midlevel clouds formed at the melting level are formed differently during active and break monsoon periods and test this over three monsoon seasons. A greater frequency of thin midlevel clouds are likely formed by increased condensation following the latent cooling of melting during active monsoon periods when stratiform precipitation is most frequent. This is supported by the high percentage (65%) of midlevel clouds with preceding stratiform precipitation and the high frequency of stable layers slightly warmer than 0°C. In the break monsoon, a distinct peak in the frequency of stable layers at 0°C matches the peak in thin midlevel cloudiness, consistent with detrainment from convection.

  13. Organic geochemical characterization of reservoir rocks, cap rocks and formation fluids from the CO2 storage site at Ketzin, Germany

    NASA Astrophysics Data System (ADS)

    Scherf, A.-K.; Morozova, D.; Wandrey, M.; Mangelsdorf, K.; Würdemann, H.; Vieth, A.

    2009-04-01

    The European project CO2SINK (CO2 Storage by Injection into a natural saline Aquifer at Ketzin) is the first project on the on-shore underground storage of carbon dioxide in Europe. Near the city Ketzin (north-east Germany) a geological formation of the younger Triassic (Stuttgart Formation) was chosen as reservoir for the long-term storage of the carbon dioxide. Within the scope of the Ketzin project we will analyse the organic matter in core rock and fluid samples to investigate the biogeochemical effects and changes on the geological formation caused by the injection of carbon dioxide. These investigations will help to evaluate the efficiency and reliability of the long-term storage of CO2 in such a geological system. Organic geochemical analyses will be performed on core rock samples drilled in 2007 at the Ketzin CO2 storage site in Germany. In total, three bore holes were constructed: one injection well and two observation wells. In addition to the molecular analysis of the microbial community we will investigate rock samples from different depths for total, dissolved and extractable organic carbon including lipid biomarkers, such as organic acids and intact polar lipids as well as the isotopic analysis of individual organic compounds. With the analysis of intact phospholipids (IPL) we will be able to further characterize the indigenous microbial community. Intact phospholipids are found in all living cells as membrane components (Zelles, 1999). Their interpretation is based on the premise that different microorganisms contain different phospholipids with ester- and/or ether-bound fatty acids (White et al., 1979) and thus, the distribution of IPLs and PLFAs (phospholipids fatty acid) can be applied to characterise and compare microbial communities. The data obtained from these analyses will provide valuable information on the active microorganisms as well as shifts in community composition. The characterization of the organic matter in the reservoir rock

  14. Analysis of solutes in groundwaters from the Rustler Formation at and near the Waste Isolation Pilot Plant site

    SciTech Connect

    Robinson, K.L.

    1997-09-01

    Between 1976 and 1986, groundwater samples from more than 60 locations in the vicinity of the Waste Isolation Pilot Plant site were collected and analyzed for a variety of major, minor, and trace solutes. Most of the samples were from the Rustler Formation (the Culebra Dolomite, the Magenta Dolomite, or the zone at the contact between the Rustler and underlying Salado Formations) or the Dewey Lake Red Beds. The analytical data from the laboratories are presented here with accompanying discussions of sample collection methods, supporting field measurements, and laboratory analytical methods. A comparison of four data sets and a preliminary evaluation of the data for the major solutes (Cl{sup {minus}}, SO{sub 4}{sup {minus}2}, Na, K, Ca, and Mg) shows that the data for samples analyzed by UNC/Bendix for SNL seem to be the most reliable, but that at some locations, samples representative of the native, unperturbed groundwater have not been collected. At other locations, the water chemistry has apparently changed between sampling episodes.

  15. Saharan dust and heterogeneous ice formation: Eleven years of cloud observations at a central European EARLINET site

    NASA Astrophysics Data System (ADS)

    Seifert, P.; Ansmann, A.; Mattis, I.; Wandinger, U.; Tesche, M.; Engelmann, R.; Müller, D.; PéRez, C.; Haustein, K.

    2010-10-01

    More than 2300 observed cloud layers were analyzed to investigate the impact of aged Saharan dust on heterogeneous ice formation. The observations were performed with a polarization/Raman lidar at the European Aerosol Research Lidar Network site of Leipzig, Germany (51.3°N, 12.4°E) from February 1997 to June 2008. The statistical analysis is based on lidar-derived information on cloud phase (liquid water, mixed phase, ice cloud) and cloud top height, cloud top temperature, and vertical profiles of dust mass concentration calculated with the Dust Regional Atmospheric Modeling system. Compared to dust-free air masses, a significantly higher amount of ice-containing clouds (25%-30% more) was observed for cloud top temperatures from -10°C to -20°C in air masses that contained mineral dust. The midlatitude lidar study is compared with our SAMUM lidar study of tropical stratiform clouds at Cape Verde in the winter of 2008. The comparison reveals that heterogeneous ice formation is much stronger over central Europe and starts at higher temperatures than over the tropical station. Possible reasons for the large difference are discussed.

  16. A FEEDBACK-DRIVEN BUBBLE G24.136+00.436: A POSSIBLE SITE OF TRIGGERED STAR FORMATION

    SciTech Connect

    Liu, Hong-Li; Li, JinZeng; Yuan, Jing-Hua; Wu, Yuefang; Dong, Xiaoyi; Liu, Tie E-mail: yfwu.pku@gmail.com

    2015-01-01

    We present a multi-wavelength study of the IR bubble G24.136+00.436. The J = 1-0 observations of {sup 12}CO, {sup 13}CO, and C{sup 18}O were carried out with the Purple Mountain Observatory 13.7 m telescope. Molecular gas with a velocity of 94.8 km s{sup –1} is found prominently in the southeast of the bubble, shaped as a shell with a total mass of ∼2 × 10{sup 4} M {sub ☉}. It was likely assembled during the expansion of the bubble. The expanding shell consists of six dense cores, whose dense (a few of 10{sup 3} cm{sup –3}) and massive (a few of 10{sup 3} M {sub ☉}) characteristics coupled with the broad linewidths (>2.5 km s{sup –1}) suggest that they are promising sites for forming high-mass stars or clusters. This could be further consolidated by the detection of compact H II regions in Cores A and E. We tentatively identified and classified 63 candidate young stellar objects (YSOs) based on the Spitzer and UKIDSS data. They are found to be dominantly distributed in regions with strong molecular gas emission, indicative of active star formation, especially in the shell. The H II region inside the bubble is mainly ionized by a ∼O8V star(s), of the dynamical age of ∼1.6 Myr. The enhanced number of candidate YSOs and secondary star formation in the shell as well as the timescales involved, indicate a possible scenario for triggering star formation, signified by the ''collect and collapse'' process.

  17. MECHANISMS OF PHASE FORMATION IN THE VITRIFICATION OF HIGH-FERROUS SAVANNAH RIVER SITE SB2 HLW SLUDGE SURROGATE - 9300

    SciTech Connect

    Marra, J

    2008-08-27

    Phase formation mechanisms associated with the vitrification of high-ferrous Savannah River Site (SRS) Sludge Batch 2 (SB2) high level waste surrogate were studied by infrared spectroscopy (IRS) and X-ray diffraction (XRD). Two mixtures at 50 wt% waste loading with commercially available Frit 320 (Li{sub 2}O - 8 wt %, B{sub 2}O{sub 3} - 8 wt %, Na{sub 2}O - 12 wt %, SiO{sub 2} - 72 wt %) and batch chemicals (LiOH {center_dot} H{sub 2}O, H{sub 3}BO{sub 3}, NaNO{sub 3}, SiO{sub 2}) to represent the frit formulation were prepared as slurries with a water content of {approx}50 wt%. The mixtures were air-dried at a temperature of 115 C and heat-treated at 500, 700, 900, 1000, 1100, 1200, and 1300 C for 1 hr at each temperature. Infrared spectra and XRD patterns of the products produced at each temperature were recorded. In both mixtures prepared using frit and batch chemicals to represent the frit, phase formation reactions were completed within the temperature range between 900 and 1000 C. However, residual quartz was still present in glass produced from the mixture with batch chemicals even at 1100 C. Although, the phase composition and structure of the glassy products obtained from both mixtures at temperatures over 1000 C were similar, the products obtained from the mixture using actual frit were more homogeneous than those from the mixture with batch chemicals. Thus, the use of frit rather than batch chemicals reduced the temperature range of phase formation and provided for production of higher quality glass.

  18. Quasars as the formation sites of high-redshift ellipticals: a signature in the `associated' absorption-line systems?

    NASA Astrophysics Data System (ADS)

    Franceschini, A.; Gratton, R.

    1997-03-01

    Published data on the average metallicities and abundance ratios for absorption-line systems in high-redshift quasars suggest that a dichotomy may exist between the chemical composition of damped Lyman alpha (Lyalpha) systems (interpreted as intervening galaxies in the QSO line of sight) and the z_abs~=z_em absorption- line systems associated with the quasar. Intervening systems have smaller than solar metallicities, whereas associated absorbers have solar or greater than solar metallicities and small N/C ratios. While these results have to be confirmed by more precise abundance determinations, we argue that they may be explained by an early phase of efficient metal enrichment occurring only in the close environment of high-z QSOs, and characterized by an excess type-II supernova (SNII) activity. This is reminiscent of the SNII phase required to explain the abundance ratios (favouring alpha- over Fe-group elements) observed in the intracluster (IC) medium of local galaxy clusters. We explore the following scenario, to be tested by forthcoming observations of QSO absorption lines using very large optical telescopes. (a) Well-studied damped- Lyalpha, Lyalpha and metal lines in intervening systems trace only part of the history of metal production in the Universe - the one concerning slowly star-forming discs or dwarf irregulars. (b) The complementary class of early-type and bulge-dominated galaxies formed quickly (at z>~4-5) through a huge episode of star formation favouring high-mass stars. (c) The nucleus of the latter is the site of the subsequent formation of a quasar, which partly hides from view the dimmer host galaxy. (d) The products of a galactic wind, following the violent episode of star formation in the host galaxy and metal pollution of the IC medium in the forming cluster, could be directly observable in the z_abs~=z_em associated absorption systems on the QSO line of sight.

  19. Effects of Al(3+) Ions on Formation of Silica Framework and Surface Active Sites for SO4(2-) Ions.

    PubMed

    Sasahara, Shigeo; Ozeki, Sumio

    2016-07-19

    Al(3+) ions were introduced into silica framework at 318 K in order to make active Al sites for SO4(2-) by the addition of aqueous sodium silicate solution to aqueous sulfuric acid solution of Al2(SO4)3. The (27)Al and (29)Si NMR spectra of aluminosilicates were measured at 278 K with reaction time. (29)Si NMR spectra were analyzed by the multivariate curve resolution. The addition of Al(3+) ions to aqueous silicate solution promoted gel formation. Small amounts of Al(3+) ions were incorporated as a four-coordinated complex at early stage of polymerization reaction of silicates and during subsequent reaction six-coordinated Al complex increased, suggesting reversible conversion between 4- and 6-coordinated complexes. SO4(2-) ions interact with positive surfaces of aluminosilicates and are specifically adsorbed on the surface sites of 6-coordinated Al(3+) species, which may be stabilized on silicate surfaces as [Al(H2O)5SO4](+). PMID:27352046

  20. Facile Formation of a DNA Adduct of Semicarbazide on Reaction with Apurinic/Apyrimidinic Sites in DNA.

    PubMed

    Wang, Yinan; Chan, Ho Wai; Chan, Wan

    2016-05-16

    Mutagenic semicarbazide (SEM) is a hydrazine-containing food contaminant found in a wide variety of foods. Despite decades of research, the toxicity of SEM remains incompletely understood. In this study, we demonstrate for the first time that SEM reacts rapidly with apurinic/apyrimidinic sites in an endogenous DNA lesion to form covalently bonded DNA adducts in vitro and in bacteria. Specifically, we performed high-performance liquid chromatography with high accuracy and tandem mass spectrometry to characterize the DNA adduct formed by reacting SEM with 2'-deoxyribose and single- and double-stranded oligonucleotides containing abasic sites under physiologically relevant conditions. By analyzing the reaction mixture at different time points, the reaction kinetics of SEM with DNA was also elucidated. Moreover, by using a highly sensitive and selective liquid chromatography-tandem mass spectrometry method, we show that SEM induces the dose-dependent formation of DNA adducts in Escherichia coli. The results from our studies provide the first direct evidence suggesting that SEM may exert genotoxicity by forming covalently bonded DNA adducts. PMID:27058397

  1. A parasitic nematode releases cytokinin that controls cell division and orchestrates feeding site formation in host plants

    PubMed Central

    Siddique, Shahid; Radakovic, Zoran S.; De La Torre, Carola M.; Chronis, Demosthenis; Novák, Ondřej; Ramireddy, Eswarayya; Holbein, Julia; Matera, Christiane; Hütten, Marion; Gutbrod, Philipp; Anjam, Muhammad Shahzad; Rozanska, Elzbieta; Habash, Samer; Elashry, Abdelnaser; Sobczak, Miroslaw; Kakimoto, Tatsuo; Strnad, Miroslav; Schmülling, Thomas; Mitchum, Melissa G.; Grundler, Florian M. W.

    2015-01-01

    Sedentary plant-parasitic cyst nematodes are biotrophs that cause significant losses in agriculture. Parasitism is based on modifications of host root cells that lead to the formation of a hypermetabolic feeding site (a syncytium) from which nematodes withdraw nutrients. The host cell cycle is activated in an initial cell selected by the nematode for feeding, followed by activation of neighboring cells and subsequent expansion of feeding site through fusion of hundreds of cells. It is generally assumed that nematodes manipulate production and signaling of the plant hormone cytokinin to activate cell division. In fact, nematodes have been shown to produce cytokinin in vitro; however, whether the hormone is secreted into host plants and plays a role in parasitism remained unknown. Here, we analyzed the spatiotemporal activation of cytokinin signaling during interaction between the cyst nematode, Heterodera schachtii, and Arabidopsis using cytokinin-responsive promoter:reporter lines. Our results showed that cytokinin signaling is activated not only in the syncytium but also in neighboring cells to be incorporated into syncytium. An analysis of nematode infection on mutants that are deficient in cytokinin or cytokinin signaling revealed a significant decrease in susceptibility of these plants to nematodes. Further, we identified a cytokinin-synthesizing isopentenyltransferase gene in H. schachtii and show that silencing of this gene in nematodes leads to a significant decrease in virulence due to a reduced expansion of feeding sites. Our findings demonstrate the ability of a plant-parasitic nematode to synthesize a functional plant hormone to manipulate the host system and establish a long-term parasitic interaction. PMID:26417108

  2. Active site formation mechanism of carbon-based oxygen reduction catalysts derived from a hyperbranched iron phthalocyanine polymer

    NASA Astrophysics Data System (ADS)

    Hiraike, Yusuke; Saito, Makoto; Niwa, Hideharu; Kobayashi, Masaki; Harada, Yoshihisa; Oshima, Masaharu; Kim, Jaehong; Nabae, Yuta; Kakimoto, Masa-aki

    2015-04-01

    Carbon-based cathode catalysts derived from a hyperbranched iron phthalocyanine polymer (HB-FePc) were characterized, and their active-site formation mechanism was studied by synchrotron-based spectroscopy. The properties of the HB-FePc catalyst are compared with those of a catalyst with high oxygen reduction reaction (ORR) activity synthesized from a mixture of iron phthalocyanine and phenolic resin (FePc/PhRs). Electrochemical measurements demonstrate that the HB-FePc catalyst does not lose its ORR activity up to 900°C, whereas that of the FePc/PhRs catalyst decreases above 700°C. Hard X-ray photoemission spectra reveal that the HB-FePc catalysts retain more nitrogen components than the FePc/PhRs catalysts between pyrolysis temperatures of 600°C and 800°C. This is because the linked structure of the HB-FePc precursor has high thermostability against nitrogen desorption. Consequently, effective doping of active nitrogen species into the sp 2 carbon network of the HB-FePc catalysts may occur up to 900°C.

  3. An intramembranous ossification model for the in silico analysis of bone tissue formation in tooth extraction sites.

    PubMed

    Corredor-Gómez, Jennifer Paola; Rueda-Ramírez, Andrés Mauricio; Gamboa-Márquez, Miguel Alejandro; Torres-Rodríguez, Carolina; Cortés-Rodríguez, Carlos Julio

    2016-07-21

    The accurate modeling of biological processes allows us to predict the spatiotemporal behavior of living tissues by computer-aided (in silico) testing, a useful tool for the development of medical strategies, avoiding the expenses and potential ethical implications of in vivo experimentation. A model for bone healing in mouth would be useful for selecting proper surgical techniques in dental procedures. In this paper, the formulation and implementation of a model for Intramembranous Ossification is presented aiming to describe the complex process of bone tissue formation in tooth extraction sites. The model consists in a mathematical description of the mechanisms in which different types of cells interact, synthesize and degrade extracellular matrices under the influence of biochemical factors. Special attention is given to angiogenesis, oxygen-dependent effects and growth factor-induced apoptosis of fibroblasts. Furthermore, considering the depth-dependent vascularization of mandibular bone and its influence on bone healing, a functional description of the cell distribution on the severed periodontal ligament (PDL) is proposed. The developed model was implemented using the finite element method (FEM) and successfully validated by simulating an animal in vivo experiment on dogs reported in the literature. A good fit between model outcome and experimental data was obtained with a mean absolute error of 3.04%. The mathematical framework presented here may represent an important tool for the design of future in vitro and in vivo tests, as well as a precedent for future in silico studies on osseointegration and mechanobiology. PMID:27113783

  4. Submicron aerosols at thirteen diversified sites in China: size distribution, new particle formation and corresponding contribution to cloud condensation nuclei production

    NASA Astrophysics Data System (ADS)

    Peng, J. F.; Hu, M.; Wang, Z. B.; Huang, X. F.; Kumar, P.; Wu, Z. J.; Guo, S.; Yue, D. L.; Shang, D. J.; Zheng, Z.; He, L. Y.

    2014-09-01

    Understanding the particle number size distributions in diversified atmospheric environments is important in order to design mitigation strategies related to submicron particles and their effects on regional air quality, haze and human health. In this study, we conducted 15 different field measurement campaigns between 2007 and 2011 at 13 individual sites in China, including five urban sites, four regional sites, three coastal/background sites and one ship cruise measurement along eastern coastline of China. Size resolved particles were measured in the 15-600 nm size range. The median particle number concentrations (PNCs) were found to vary in the range of 1.1-2.2 × 104 cm-3 at urban sites, 0.8-1.5 × 104 cm-3 at regional sites, 0.4-0.6 × 104 cm-3 at coastal/background sites, and 0.5 × 104 cm-3 during cruise measurement. Peak diameters at each of these sites varied greatly from 24 to 115 nm. Particles in the 15-25 nm (nucleation mode), 25-100 nm (Aitken mode) and 100-600 nm (accumulation mode) range showed different characteristics at each sites, indicating the features of primary emissions and secondary formation in these diversified atmospheric environments. Diurnal variations show a build-up of accumulation mode particles belt at regional sites, suggesting the contribution of regional secondary aerosol pollution. Frequencies of new particle formation (NPF) events were much higher at urban and regional sites than at coastal sites and during cruise measurement. The average growth rates (GRs) of nucleation mode particles were 8.0-10.9 nm h-1 at urban sites, 7.4-13.6 nm h-1 at regional sites and 2.8-7.5 nm h-1 at coastal sites and during cruise measurement. The high gaseous precursors and strong oxidation at urban and regional sites not only favored the formation of particles, but also accelerated the growth rate of the nucleation mode particles. No significant difference in condensation sink (CS) during NPF days were observed among different site types

  5. Submicron aerosols at thirteen diversified sites in China: size distribution, new particle formation and corresponding contribution to cloud condensation nuclei production

    NASA Astrophysics Data System (ADS)

    Peng, J. F.; Hu, M.; Wang, Z. B.; Huang, X. F.; Kumar, P.; Wu, Z. J.; Yue, D. L.; Guo, S.; Shang, D. J.; Zheng, Z.; He, L. Y.

    2014-06-01

    Understanding the particle number size distributions in diversified atmospheric environments is important in order to design mitigation strategies related to submicron particles and their effect on regional air quality, haze and human health. In this study, we conducted 15 different field measurement campaigns, each one-month long, between 2007 and 2011 at 13 individual sites in China. These were 5 urban sites, 4 regional sites, 3 coastal/background sites and one ship cruise measurement along eastern coastline of China. Size resolved particles were measured in the 15-600 nm size range. The median particle number concentrations (PNC) were found to vary in the range of 1.1-2.2 × 104 cm-3 at urban sites, 0.8-1.5 × 104 cm-3 at regional sites, 0.4-0.6 × 104 cm-3 at coastal/background sites, and 0.5 × 104 cm-3 during cruise measurements. Peak diameters at each of these sites varied greatly from 24 nm to 115 nm. Particles in the 15-25 nm (nucleation mode), 25-100 nm (Aitken mode) and 100-600 nm (accumulation mode) range showed different characteristics at each of the studied sites, indicating the features of primary emissions and secondary formation in these diversified atmospheric environments. Diurnal variations show a build-up of accumulation mode particles belt at regional sites, suggesting the contribution of regional secondary aerosol pollution. Frequencies of new particle formation (NPF) events were much higher at urban and regional sites than at coastal sites and cruise measurement. The average growth rates (GRs) of nucleation mode particles were 8.0-10.9 nm h-1 at urban sites, 7.4-13.6 nm h-1 at regional sites and 2.8-7.5 nm h-1 at both coastal and cruise measurement sites. The high gaseous precursors and strong oxidation at urban and regional sites not only favored the formation of particles, but also accelerated the growth rate of the nucleation mode particles. No significant difference in condensation sink (CS) during NPF days were observed among different

  6. Numerical studies of gas composition differentiation during gas hydrate formation: An application to the IODP site 1327

    NASA Astrophysics Data System (ADS)

    Yuncheng, C.; Chen, D.

    2014-12-01

    Structure I methane hydrate is the most common type found in nature. Structure I gas hydrate has two types of cages that gas molecules may be hosted. Because the larger cavities filled with ethane would be more stable than those filled by methane (Sloan and Koh, 2008), the larger cavities preferentially enclose ethane during the formation of gas hydrate, which results gas composition differentiation during gas hydrate formation. Based on the principle of gas composition differentiation, we establish a numerical model for the gas composition differentiation between methane and ethane during gas hydrate accumulation and applied the model to IODP site 1327. The simulation shows that the gas composition differentiation only occurs at the interval where gas hydrate presents. The lowest methane/ethane (C1/C2) point indicates the bottom of hydrate zone, and the composition differentiation produces the upward increase of C1/C2 within the gas hydrate zone. The C1/C2 reaches the largest value at the top occurrence of gas hydrate and keeps relative stable above the top occurrence of gas hydrate. The top and bottom occurrence of gas hydrate indicated by the inflection points of the C1/C2 profile are similar to those indicated by the negative anomalies of measured chloride concentrations (Riedel et al., 2006). By comparing with the measured C1/C2, the differentiation coefficient (kh=Xe,h/Xe,w, Xe,h is C1/C2 of the formed gas hydrate, Xe,w [mol/kg] is the concentration of ethane in water ) is calculated to 70 kg/mol. The top occurrence of gas hydrate indicated by the C1/C2 profile also confines the water flux to be 0.4kg/m2-year, similar to that confined by the chloride profile. To best fit the measured C1/C2 profile, the methane flux is calculated to 0.04mol/m2-year. Therefore, the C1/C2 profile could be used to obtain the gas hydrate accumulation information. Acknowledgments:This study was supported by Chinese National Science Foundation (grant 41303044, 91228206 ) References

  7. The Molybdenum Active Site of Formate Dehydrogenase Is Capable of Catalyzing C-H Bond Cleavage and Oxygen Atom Transfer Reactions.

    PubMed

    Hartmann, Tobias; Schrapers, Peer; Utesch, Tillmann; Nimtz, Manfred; Rippers, Yvonne; Dau, Holger; Mroginski, Maria Andrea; Haumann, Michael; Leimkühler, Silke

    2016-04-26

    Formate dehydrogenases (FDHs) are capable of performing the reversible oxidation of formate and are enzymes of great interest for fuel cell applications and for the production of reduced carbon compounds as energy sources from CO2. Metal-containing FDHs in general contain a highly conserved active site, comprising a molybdenum (or tungsten) center coordinated by two molybdopterin guanine dinucleotide molecules, a sulfido and a (seleno-)cysteine ligand, in addition to a histidine and arginine residue in the second coordination sphere. So far, the role of these amino acids in catalysis has not been studied in detail, because of the lack of suitable expression systems and the lability or oxygen sensitivity of the enzymes. Here, the roles of these active site residues is revealed using the Mo-containing FDH from Rhodobacter capsulatus. Our results show that the cysteine ligand at the Mo ion is displaced by the formate substrate during the reaction, the arginine has a direct role in substrate binding and stabilization, and the histidine elevates the pKa of the active site cysteine. We further found that in addition to reversible formate oxidation, the enzyme is further capable of reducing nitrate to nitrite. We propose a mechanistic scheme that combines both functionalities and provides important insights into the distinct mechanisms of C-H bond cleavage and oxygen atom transfer catalyzed by formate dehydrogenase. PMID:27054466

  8. Interpretation of brine-permeability tests of the Salado Formation at the Waste Isolation Pilot Plant site: First interim report

    SciTech Connect

    Beauheim, R.L. ); Saulnier, G.J. Jr.; Avis, J.D. )

    1991-08-01

    Pressure-pulse tests have been performed in bedded evaporites of the Salado Formation at the Waste Isolation Pilot Plant (WIPP) site to evaluate the hydraulic properties controlling brine flow through the Salado. Hydraulic conductivities ranging from about 10{sup {minus}14} to 10{sup {minus}11} m/s (permeabilities of about 10{sup {minus}21} to 10{sup {minus}18} m{sup 2}) have been interpreted from nine tests conducted on five stratigraphic intervals within eleven meters of the WIPP underground excavations. Tests of a pure halite layer showed no measurable permeability. Pore pressures in the stratigraphic intervals range from about 0.5 to 9.3 MPa. An anhydrite interbed (Marker Bed 139) appears to be one or more orders of magnitude more permeable than the surrounding halite. Hydraulic conductivities appear to increase, and pore pressures decrease, with increasing proximity to the excavations. These effects are particularly evident within two to three meters of the excavations. Two tests indicated the presence of apparent zero-flow boundaries about two to three meters from the boreholes. The other tests revealed no apparent boundaries within the radii of influence of the tests, which were calculated to range from about four to thirty-five meters from the test holes. The data are insufficient to determine if brine flow through evaporites results from Darcy-like flow driven by pressure gradients within naturally interconnected porosity or from shear deformation around excavations connecting previously isolated pores, thereby providing pathways for fluids at or near lithostatic pressure to be driven towards the low-pressure excavations. Future testing will be performed at greater distances from the excavations to evaluate hydraulic properties and processes beyond the range of excavation effects.

  9. Evidence for sites of methylmercury formation in a flowing water system: impact of anthropogenic barriers and water management.

    PubMed

    Pizarro-Barraza, Claudia; Gustin, Mae Sexauer; Peacock, Mary; Miller, Matthieu

    2014-04-15

    The Truckee River, California-Nevada, USA is impacted by mercury (Hg) contamination associated with legacy gold mining. In this work, we investigated the potential for hot-spots of methylmercury (MeHg) formation in the river. Mercury concentrations in multiple media were also used to assess the impacts of anthropogenic barriers, restoration, and water management in this flowing water ecosystem. Water samples were collected on a seasonal time step over 3 years, and analyzed for total Hg (THg) and MeHg concentrations, along with a variety of other water quality parameters. In addition, we measured THg and MeHg in sediments, THg in macroinvertebrates, and THg and δ(15)N and δ(13)C concentrations in fish. Differences in stable isotopes and Hg concentrations in fish were applied to understand the mobility of fish in the river. Mercury concentrations of specific macroinvertebrate species were used to identify sites of MeHg production. In general, loads of Hg and nutrients in the river reach above the Reno-Sparks metropolitan area were similar to that reported for pristine systems, while within and below the city, water quality impacts were observed. Fish isotope data showed that in the city reach food resources were different than those upriver and downriver. Based on Hg and isotope data, mobility of the fish in the river is impacted by anthropogenic obstructions and water manipulation. Below the city, particle bound Hg, derived from the legacy mining, continues to be input to the Truckee River. This Hg is deposited in riparian habitats and areas of river restoration, where it is methylated and becomes available to biota. During spring, when flows were highest, MeHg produced and stored in the sediments is mobilized and transported downriver. Fish and macroinvertebrate concentrations increased downriver indicating passive uptake from water. The information presented here could be useful for those doing river restoration and water manipulation in mercury contaminated

  10. Computational study on the roles of amino acid residues in the active site formation mechanism of blue-light photoreceptors

    NASA Astrophysics Data System (ADS)

    Sato, Ryuma; Kitoh-Nishioka, Hirotaka; Ando, Koji; Yamato, Takahisa

    2015-07-01

    To examine the functional roles of the active site methionine (M-site) and glutamic acid (E-site) residues of blue-light photoreceptors, we performed in silico mutation at the M-site in a systematic manner and focused on the hydrogen bonding between the E-site and the substrate: the cyclobutane-pyrimidine dimer (CPD). Fragment molecular orbital calculations with electron correlations demonstrated that substitution of the M-site methionine with either alanine or glutamine always destabilizes the interaction energy between the E-site and the CPD by more than 12.0 kcal/mol, indicating that the methionine and glutamic acid residues cooperatively facilitate the enzymatic reaction in the active site.

  11. The Strength of an Ig Switch Region is Determined by its Ability to Drive R-loop Formation and its Number of WGCW Sites

    PubMed Central

    Zhang, Zheng Z.; Pannunzio, Nicholas R.; Han, Li; Hsieh, Chih-Lin; Yu, Kefei; Lieber, Michael R.

    2014-01-01

    SUMMARY R-loops exist at the murine IgH switch regions and possibly other locations, but their functional importance is unclear. In biochemical systems, R-loop initiation requires DNA sequence regions containing clusters of G nucleotides, but cellular studies have not been done. Here, we vary the G-clustering, total switch region length, and the number of target sites (WGCW sites for the activation-induced deaminase) at synthetic switch regions in a murine B cell line to determine the effect on class switch recombination (CSR). G-clusters increase CSR, regardless of their immediate proximity to the WGCW sites. This increase is accompanied by an increase in R-loop formation. CSR efficiency correlates better with the absolute number of WGCW sites in the switch region rather than the total switch region length or density of WGCW sites. Thus, the overall strength of the switch region depends on G-clusters, which initiate R-loop formation, and on the number of WGCW sites. PMID:25017067

  12. Post burial alteration of the Permian Rustler Formation Evaporites, WIPP (Waste Isolation Pilot Plant) site, New Mexico: Textural, stratigraphic and chemical evidence

    SciTech Connect

    Lowenstein, T.K.

    1987-04-01

    The Rustler Formation is a Late Permian (Ochoan Series) evaporite found in the subsurface and in outcrop in New Mexico and west Texas. The main rock types of the Rustler Formation are anhydrite, gypsum, halite, dolostone and siliciclastic sandstone and mudstone. Across the WIPP site, located in southeastern New Mexico, some of the Rustler rock types and their thicknesses change dramatically over short lateral distances. These lateral variations have mainly been attributed to post-burial dissolution of evaporites. The aim of the present study is to distinguish syndepositional features from post burial alteration features in the Rustler Formation. Four borehole cores of the complete Rustler Formation were examined. Primary sedimentary structures, textures and fabrics were identified, based on comparison with modern evaporite deposits. Vertical and lateral patterns of primary sedimentary features were recorded. From this information, depositional settings have been assembled which best account for the observed types of primary features and their vertical and lateral distribution. With this framework, post-depositional diagenetic overprints were identified in the Rustler Formation. The question of whether subsurface diagenetic alteration is presently active at the WIPP site is addressed.

  13. Directing Group in Decarboxylative Cross-Coupling: Copper-Catalyzed Site-Selective C-N Bond Formation from Nonactivated Aliphatic Carboxylic Acids.

    PubMed

    Liu, Zhao-Jing; Lu, Xi; Wang, Guan; Li, Lei; Jiang, Wei-Tao; Wang, Yu-Dong; Xiao, Bin; Fu, Yao

    2016-08-01

    Copper-catalyzed directed decarboxylative amination of nonactivated aliphatic carboxylic acids is described. This intramolecular C-N bond formation reaction provides efficient access to the synthesis of pyrrolidine and piperidine derivatives as well as the modification of complex natural products. Moreover, this reaction presents excellent site-selectivity in the C-N bond formation step through the use of directing group. Our work can be considered as a big step toward controllable radical decarboxylative carbon-heteroatom cross-coupling. PMID:27439145

  14. Target-controlled formation of silver nanoclusters in abasic site-incorporated duplex DNA for label-free fluorescence detection of theophylline

    NASA Astrophysics Data System (ADS)

    Park, Ki Soo; Oh, Seung Soo; Soh, H. Tom; Park, Hyun Gyu

    2014-08-01

    A novel, label-free, fluorescence based sensor for theophylline has been developed. In the new sensor system, an abasic site-incorporated duplex DNA probe serves as both a pocket for recognition of theophylline and a template for the preparation of fluorescent silver nanoclusters. The strategy relies on theophylline-controlled formation of fluorescent silver nanoclusters from abasic site-incorporated duplex DNA. When theophylline is not present, silver ions interact with the cytosine groups opposite to the abasic site in duplex DNA. This interaction leads to efficient formation of intensely red fluorescent silver nanoclusters. In contrast, when theophylline is bound at the abasic site through pseudo base-pairing with appropriately positioned cytosines, silver ion binding to the cytosine nucleobase is prevented. Consequently, fluorescent silver nanoclusters are not formed causing a significant reduction of the fluorescence signal. By employing this new sensor, theophylline can be highly selectively detected at a concentration as low as 1.8 μM. Finally, the diagnostic capability and practical application of this sensor were demonstrated by its use in detecting theophylline in human blood serum.A novel, label-free, fluorescence based sensor for theophylline has been developed. In the new sensor system, an abasic site-incorporated duplex DNA probe serves as both a pocket for recognition of theophylline and a template for the preparation of fluorescent silver nanoclusters. The strategy relies on theophylline-controlled formation of fluorescent silver nanoclusters from abasic site-incorporated duplex DNA. When theophylline is not present, silver ions interact with the cytosine groups opposite to the abasic site in duplex DNA. This interaction leads to efficient formation of intensely red fluorescent silver nanoclusters. In contrast, when theophylline is bound at the abasic site through pseudo base-pairing with appropriately positioned cytosines, silver ion binding to

  15. [[superscript 3]H]-Flunitrazepam-Labeled Benzodiazepine Binding Sites in the Hippocampal Formation in Autism: A Multiple Concentration Autoradiographic Study

    ERIC Educational Resources Information Center

    Guptill, Jeffrey T.; Booker, Anne B.; Gibbs, Terrell T.; Kemper, Thomas L.; Bauman, Margaret L.; Blatt, Gene J.

    2007-01-01

    Increasing evidence indicates that the GABAergic system in cerebellar and limbic structures is affected in autism. We extended our previous study that found reduced [[superscript 3]H] flunitrazepam-labeled benzodiazepine sites in the autistic hippocampus to determine whether this reduction was due to a decrease in binding site number (B [subscript…

  16. (-)-Rhazinilam and the diphenylpyridazinone NSC 613241: Two compounds inducing the formation of morphologically similar tubulin spirals but binding apparently to two distinct sites on tubulin.

    PubMed

    Bai, Ruoli; Hamel, Ernest

    2016-08-15

    The most potent microtubule assembly inhibitor of newer diphenylpyridazinone derivatives examined was NSC 613241. Because NSC 613241 and (-)-rhazinilam also induce the formation of similar 2-filament spirals, these aberrant reactions were compared. Spiral formation with both compounds was enhanced by GTP and inhibited by GDP and by 15 other inhibitors of microtubule assembly. Similarly, microtubule assembly induced by paclitaxel or laulimalide is enhanced by GTP and inhibited by GDP and assembly inhibitors, but neither [(3)H]NSC 613241 nor [(3)H](-)-rhazinilam bound to microtubules or inhibited the binding of [(3)H]paclitaxel or [(3)H]peloruside A to microtubules. Differences in the pitch of aberrant polymers were found: NSC 613241-induced and (-)-rhazinilam-induced spirals had average repeats of 85 and 79-80 nm, respectively. We found no binding of [(3)H]NSC 613241 or [(3)H](-)-rhazinilam to αβ-tubulin dimer, but both compounds were incorporated into the polymers they induced in substoichiometric reactions, with as little as 0.1-0.2 mol compound/mol of tubulin, and no cross-inhibition by NSC 613241 or (-)-rhazinilam into spirals occurred. Under reaction conditions where neither compound induced spiral formation, both compounds together synergistically induced substantial spiral formation. We conclude that (-)-rhazinilam and NSC 613241 bind to different sites on tubulin that differ from binding sites for other antitubulin agents. PMID:27311615

  17. Mechanism of dehydroxylation of naturally occurring high-silica zeolites involving the formation of Lewis acid sites

    SciTech Connect

    Kazanskii, V.B.

    1987-11-01

    Using low-temperature adsorbed dihydrogen and carbon monoxide as molecular probes, the dehydroxylation of the hydrogen forms of the zeolites Y, and ZSM-5 has been studied. The high stability of the high-silica zeolites to dealumination and their difference from faujasites has been established as being due not only to the strength of their Broensted acid sites but also to the nature of their Lewis acid sites. The chemical properties of the Lewis acid sites and their possible role in catalytic reactions are discussed.

  18. Exploration of the 1891 Foerstner submarine vent site (Pantelleria, Italy): insights into the formation of basaltic balloons

    NASA Astrophysics Data System (ADS)

    Kelly, Joshua T.; Carey, Steven; Pistolesi, Marco; Rosi, Mauro; Croff-Bell, Katherine Lynn; Roman, Chris; Marani, Michael

    2014-07-01

    On October 17, 1891, a submarine eruption started at Foerstner volcano located within the Pantelleria Rift of the Strait of Sicily (Italy). Activity occurred for a period of 1 week from an eruptive vent located 4 km northwest of the island of Pantelleria at a water depth of 250 m. The eruption produced lava balloons that discharged gas at the surface and eventually sank to the seafloor. Remotely operated vehicle (ROV) video footage and high-resolution multi-beam mapping of the Foerstner vent site were used to create a geologic map of the AD 1891 deposits and conduct the first detailed study of the source area associated with this unusual type of submarine volcanism. The main Foerstner vent consists of two overlapping circular mounds with a total volume of 6.3 × 105 m3 and relief of 60 m. It is dominantly constructed of clastic scoriaceous deposits with some interbedded pillow lavas. Petrographic and geochemical analyses of Foerstner samples by X-ray fluorescence and inductively coupled plasma mass spectrometry reveal that the majority of the deposits are vesicular, hypocrystalline basanite scoria that display porphyritic, hyaloophitic, and vitrophyric textures. An intact lava balloon recovered from the seafloor consists of a large interior gas cavity surrounded by a thin lava shell comprising two distinct layers: a thin, oxidized, quenched crust surrounding the exterior of the balloon and a dark gray, tachylite layer lying beneath it. Ostwald ripening is proposed to be the dominant bubble growth mechanism of four representative Foerstner scoria samples as inferred by vesicle size distributions. Characterization of the diversity of deposit facies observed at Foerstner in conjunction with quantitative rock texture analysis indicates that submarine Strombolian-like activity is the most likely mechanism for the formation of lava balloons. The deposit facies observed at the main Foerstner vent are very similar to those produced by other known submarine Strombolian

  19. Target-controlled formation of silver nanoclusters in abasic site-incorporated duplex DNA for label-free fluorescence detection of theophylline.

    PubMed

    Park, Ki Soo; Oh, Seung Soo; Soh, H Tom; Park, Hyun Gyu

    2014-09-01

    A novel, label-free, fluorescence based sensor for theophylline has been developed. In the new sensor system, an abasic site-incorporated duplex DNA probe serves as both a pocket for recognition of theophylline and a template for the preparation of fluorescent silver nanoclusters. The strategy relies on theophylline-controlled formation of fluorescent silver nanoclusters from abasic site-incorporated duplex DNA. When theophylline is not present, silver ions interact with the cytosine groups opposite to the abasic site in duplex DNA. This interaction leads to efficient formation of intensely red fluorescent silver nanoclusters. In contrast, when theophylline is bound at the abasic site through pseudo base-pairing with appropriately positioned cytosines, silver ion binding to the cytosine nucleobase is prevented. Consequently, fluorescent silver nanoclusters are not formed causing a significant reduction of the fluorescence signal. By employing this new sensor, theophylline can be highly selectively detected at a concentration as low as 1.8 μM. Finally, the diagnostic capability and practical application of this sensor were demonstrated by its use in detecting theophylline in human blood serum. PMID:24901073

  20. Geology, coal resources, and chemical analyses of coal from the Fruitland Formation, Kimbeto EMRIA study site, San Juan County, New Mexico

    USGS Publications Warehouse

    Schneider, Gary B.; Hildebrand, Rick T.; Affolter, Ronald H.

    1979-01-01

    The Kimbeto EMRIA study site, an area of about 20 square miles (52 km2), is located on the south margin of the San Juan Basin on the gently northward-dipping strata of the Upper Cretaceous Fruitland Formation and the Kirtland Shale. The coal beds are mainly in the lower 150 feet (45 m) of the Fruitland Format ion. Coal resources--measured, indicated, and inferred--with less than 400 feet (120 m) of overburden in the site are 69,085,000 short tons (62,660,100 metric tons), 369,078,000 short tons (334,754,000 metric tons), and 177,803,000 short tons (161,267,000 metric tons) respectively. About 68 percent of these resources are overlain by 200 feet (60 m) or less of overburden. The apparent rank of the coal ranges from subbituminous B to subbituminous A. The average Btu/lb value of 14 core samples from the site on the as-received basis is 8,240 (4580 Kcal/kg), average ash content is 23.4 percent, and average sulfur content is 0.5 percent. Analyses of coal from the Kimbeto EMRIA study site show significantly higher ash content and significantly lower contents of volatile matter, fixed carbon, carbon, and a significantly lower heat of combustion when compared with other coal analyses from the Rocky Mountain province.

  1. Ionic composition of PM2.5 at urban sites of northern Greece: secondary inorganic aerosol formation.

    PubMed

    Voutsa, D; Samara, C; Manoli, E; Lazarou, D; Tzoumaka, P

    2014-04-01

    This study investigates the water-soluble ionic constituents (Na(+), K(+), NH4 (+), Ca(2+), Mg(2+), Cl(-), NO3 (-), SO4 (2-)) associated to PM2.5 particle fraction at two urban sites in the city of Thessaloniki, northern Greece, an urban traffic site (UT) and urban background site (UB). Ionic constituents represent a significant fraction of PM2.5 mass (29.6 at UT and 41.5 % at UB). The contribution of marine aerosol was low (<1.5 %). Secondary inorganic aerosols (SIA) represent a significant fraction of PM2.5 mass contributing to 26.9 ± 12.4 % and 39.2 ± 13.2 % at UT and UB sites, respectively. Nitrate and sulfate are fully neutralized by ammonium under the existing conditions. The ionic constituents were evaluated in relation to their spatial and temporal variation, their gaseous precursors, meteorological conditions, local and long-range transport. PMID:24363054

  2. NMR structure of the A730 loop of the Neurospora VS ribozyme: insights into the formation of the active site

    PubMed Central

    Bonneau, Eric; Girard, Nicolas; Boisbouvier, Jérôme; Legault, Pascale

    2011-01-01

    The Neurospora VS ribozyme is a small nucleolytic ribozyme with unique primary, secondary and global tertiary structures, which displays mechanistic similarities to the hairpin ribozyme. Here, we determined the high-resolution NMR structure of a stem–loop VI fragment containing the A730 internal loop, which forms part of the active site. In the presence of magnesium ions, the A730 loop adopts a structure that is consistent with existing biochemical data and most likely reflects its conformation in the VS ribozyme prior to docking with the cleavage site internal loop. Interestingly, the A730 loop adopts an S-turn motif that is also present in loop B within the hairpin ribozyme active site. The S-turn appears necessary to expose the Watson–Crick edge of a catalytically important residue (A756) so that it can fulfill its role in catalysis. The A730 loop and the cleavage site loop of the VS ribozyme display structural similarities to internal loops found in the active site of the hairpin ribozyme. These similarities provided a rationale to build a model of the VS ribozyme active site based on the crystal structure of the hairpin ribozyme. PMID:21266483

  3. Enterococcus faecalis from Food, Clinical Specimens, and Oral Sites: Prevalence of Virulence Factors in Association with Biofilm Formation

    PubMed Central

    Anderson, Annette C.; Jonas, Daniel; Huber, Ingrid; Karygianni, Lamprini; Wölber, Johan; Hellwig, Elmar; Arweiler, Nicole; Vach, Kirstin; Wittmer, Annette; Al-Ahmad, Ali

    2016-01-01

    Enterococci have gained significance as the cause of nosocomial infections; they occur as food contaminants and have also been linked to dental diseases. E. faecalis has a great potential to spread virulence as well as antibiotic resistance genes via horizontal gene transfer. The integration of food-borne enterococci into the oral biofilm in-vivo has been observed. Therefore, we investigated the virulence determinants and antibiotic resistance of 97 E. faecalis isolates from the oral cavity, food, and clinical specimens. In addition, phenotypic expression of gelatinase and cytolysin were tested, in-vitro biofilm formation was quantified and isolates were compared for strain relatedness via pulsed field gel electrophoresis (PFGE). Each isolate was found to possess two or more virulence genes, most frequently gelE, efaA, and asa1. Notably, plaque/saliva isolates possessed the highest abundance of virulence genes, the highest levels of phenotypic gelatinase and hemolysin activity and concurrently a high ability to form biofilm. The presence of asa1 was associated with biofilm formation. The biofilm formation capacity of clinical and plaque/saliva isolates was considerably higher than that of food isolates and they also showed similar antibiotic resistance patterns. These results indicate that the oral cavity can constitute a reservoir for virulent E. faecalis strains possessing antibiotic resistance traits and at the same time distinct biofilm formation capabilities facilitating exchange of genetic material. PMID:26793174

  4. Dimer-dimer interaction of the bacterial selenocysteine synthase SelA promotes functional active-site formation and catalytic specificity.

    PubMed

    Itoh, Yuzuru; Bröcker, Markus J; Sekine, Shun-ichi; Söll, Dieter; Yokoyama, Shigeyuki

    2014-04-17

    The 21st amino acid, selenocysteine (Sec), is incorporated translationally into proteins and is synthesized on its specific tRNA (tRNA(Sec)). In Bacteria, the selenocysteine synthase SelA converts Ser-tRNA(Sec), formed by seryl-tRNA synthetase, to Sec-tRNA(Sec). SelA, a member of the fold-type-I pyridoxal 5'-phosphate-dependent enzyme superfamily, has an exceptional homodecameric quaternary structure with a molecular mass of about 500kDa. Our previously determined crystal structures of Aquifex aeolicus SelA complexed with tRNA(Sec) revealed that the ring-shaped decamer is composed of pentamerized SelA dimers, with two SelA dimers arranged to collaboratively interact with one Ser-tRNA(Sec). The SelA catalytic site is close to the dimer-dimer interface, but the significance of the dimer pentamerization in the catalytic site formation remained elusive. In the present study, we examined the quaternary interactions and demonstrated their importance for SelA activity by systematic mutagenesis. Furthermore, we determined the crystal structures of "depentamerized" SelA variants with mutations at the dimer-dimer interface that prevent pentamerization. These dimeric SelA variants formed a distorted and inactivated catalytic site and confirmed that the pentamer interactions are essential for productive catalytic site formation. Intriguingly, the conformation of the non-functional active site of dimeric SelA shares structural features with other fold-type-I pyridoxal 5'-phosphate-dependent enzymes with native dimer or tetramer (dimer-of-dimers) quaternary structures. PMID:24456689

  5. New considerations on the stratigraphy and environmental context of the oldest (2.34 Ma) Lokalalei archaeological site complex of the Nachukui Formation, West Turkana, northern Kenya Rift

    NASA Astrophysics Data System (ADS)

    Tiercelin, Jean-Jacques; Schuster, Mathieu; Roche, Hélène; Brugal, Jean-Philippe; Thuo, Peter; Prat, Sandrine; Harmand, Sonia; Davtian, Gourguen; Barrat, Jean-Alix; Bohn, Marcel

    2010-09-01

    At the northwest end of the Lake Turkana Basin (northern Kenya Rift), intensive fieldwork conducted on the Plio-Pleistocene fluvio-lacustrine Nachukui Formation by the National Museums of Kenya and the West Turkana Archaeological Project (WTAP), led to the discovery of more than 50 archaeological sites aged between 2.4 and 0.7 Ma. Among them is the Lokalalei archaeological site complex, which includes the two oldest archaeological sites (2.34 Ma) found in the Kenyan segment of the East African Rift System. The environmental background of the two sites was described as a succession of ephemeral streams with floodplain palaeosols in which the archaeological sites are situated, bordering the western bank of a large axial meandering river flowing southward. The Lokalalei 1 (LA1) and Lokalalei 2C (LA2C) archaeological sites are of extreme importance in terms of knowledge of hominins' knapping activities. The stratigraphic position of the LA1 and LA2C sites as well as implications on the technical differences between the two sites have been successively discussed by Roche et al. (1999), Brown and Gathogo (2002), and Delagnes and Roche (2005). In terms of stratigraphic position, Lokalalei 2C was estimated to be slightly higher in the section (i.e. younger) than Lokalalei 1. An alternative stratigraphic correlation was proposed by Brown and Gathogo (2002), who suggested that LA2C site should have been approximately 100,000 years younger than LA1. New considerations on the stratigraphy and environmental context of the Lokalalei sites have been developed following controversy on the stratigraphic position and time interval between the LA1 and LA2C sites. High-resolution lithostratigraphic work based on bed-to-bed field correlations, facies sedimentology and tephra geochemistry confirms that the LA2C site is slightly higher in the section than the LA1 site by about 11.20 m. This represents a time interval of ˜74,000 years based on an assumed sedimentation rate of 152 mm

  6. Genetic incorporation of 1,2-aminothiol functionality for site-specific protein modification via thiazolidine formation.

    PubMed

    Bi, Xiaobao; Pasunooti, Kalyan Kumar; Tareq, Ahmad Hussen; Takyi-Williams, John; Liu, Chuan-Fa

    2016-06-21

    Here we report a new site-specific conjugation strategy to modify proteins via thiazolidine ligation. Proteins harbouring a 1,2-aminothiol moiety introduced by amber codon suppression technology could be modified chemoselectively with aldehyde-functionalized reagents, such as a biotin-labeled peptide or ubiquitin, under mild conditions to yield homogeneous biotinylated or ubiquitinated products. PMID:27198059

  7. "Dreams Are Born on Places Like This": The Process of Interpretive Community Formation at the "Field of Dreams" Site.

    ERIC Educational Resources Information Center

    Aden, Roger C.; And Others

    1995-01-01

    Analyzes the narratives of 113 visitors to the site of the film "Field of Dreams." Develops a theory that explains how interpretive communities are formed despite theoretical writings that argue for individualized interpretations of text. Demonstrates that individuals can at once converge and diverge symbolically within the confines of an…

  8. Site-selective multi-porphyrin attachment enables the formation of a next-generation antibody-based photodynamic therapeutic.

    PubMed

    Maruani, Antoine; Savoie, Huguette; Bryden, Francesca; Caddick, Stephen; Boyle, Ross; Chudasama, Vijay

    2015-10-25

    Herein we present a significant step towards next-generation antibody-based photodynamic therapeutics. Site-selective modification of a clinically relevant monoclonal antibody, with a serum-stable linker bearing a strained alkyne, allows for the controlled Cu-free "click" assembly of an in vitro active antibody-based PDT agent using a water soluble azide porpyhrin. PMID:26340593

  9. Co-doping of (Bi0.5Na0.5)TiO3: secondary phase formation and lattice site preference of Co

    NASA Astrophysics Data System (ADS)

    Schmitt, V.; Staab, T. E. M.

    2012-11-01

    Bismuth sodium titanate (Bi0.5Na0.5)TiO3 (BNT) is considered to be one of the most promising lead-free alternatives to piezoelectric lead zirconate titanate (PZT). However, the effect of dopants on the material has so far received little attention from an atomic point of view. In this study we investigated the effects of cobalt-doping on the formation of additional phases and determined the preferred lattice site of cobalt in BNT. The latter was achieved by comparing the measured x-ray absorption near-edge structure (XANES) spectra to numerically calculated spectra of cobalt on various lattice sites in BNT. (Bi0.5Na0.5)TiO3 + x mol% Co (x = 0.0, 0.5, 1.0, 2.6) was synthesized via solid state reaction. As revealed by SEM backscattering images, a secondary phase formed in all doped specimens. Using both XRD and SEM-EDX, it was identified as Co2TiO4 for dopant levels >0.5 mol%. In addition, a certain amount of cobalt was incorporated into BNT, as shown by electron probe microanalysis. This amount increased with increasing dopant levels, suggesting that an equilibrium forms together with the secondary phase. The XANES experiments revealed that cobalt occupies the octahedral B-site in the BNT perovskite lattice, substituting Ti and promoting the formation of oxygen vacancies in the material.

  10. On site measurements of the redox and carbonate system parameters in the low-permeability Opalinus Clay formation at the Mont Terri Rock Laboratory

    NASA Astrophysics Data System (ADS)

    Fernández, A. M. a.; Turrero, M. J.; Sánchez, D. M.; Yllera, A.; Melón, A. M.; Sánchez, M.; Peña, J.; Garralón, A.; Rivas, P.; Bossart, P.; Hernán, P.

    An in situ water sampling experiment was performed in the Opalinus Clay formation (Switzerland), with the aim of obtaining undisturbed pore water samples for its characterization. The study was made from a dedicated borehole, named BDI-B1, drilled in March 2002 in the DI niche of the Mont Terri Rock Laboratory, located at the north-western part of the formation, a few meters away of the underlying Jurensis Marl formation. Five water sampling campaigns have been completed, and on site measurements of the key parameters of the water, such as pH, Eh, Fe(II), S 2- and alkalinity, were performed under controlled conditions inside an anoxic glove box. The chemical composition of the seepage waters obtained from the borehole is Na-Cl type, with an ionic strength of about 0.4 M. The Cl concentrations fit the concentration profile of the Opalinus Clay pore water obtained in previous experiments from boreholes and squeezed water samples. The highest salinity is found in this zone of the Opalinus Clay, with around 12 g/L of chloride. A perturbation of the rock system was produced during the first stages of the experiment due to a packer failure. As a consequence, the borehole was exposed to air during the first phase of the experiment. The main perturbations induced were: (1) pyrite oxidation that caused an increase of sulphate, calcium, magnesium and bicarbonate content in the waters; and (2) the inflow of 3H-bearing water vapour that could penetrate the EDZ. This fresh water infiltration could have mixed with the original formation water, and tritium contents of up to 3.8 TU were measured in the first water sampling campaigns. Nevertheless, after some time the hydrogeochemical conditions of the formation were recovered, and the long-term instrumentation and monitoring of the borehole made possible to obtain different parameters of the formation. Successive water sampling campaigns show a tendency to the stabilization of the main parameters of the water, such as sulphate and

  11. Pre-injection Comparison of Methods for Sampling Formation Water and Associated Gas from a Monitoring Well at a Carbon Dioxide Injection Site, Citronelle Oil Field, Alabama

    NASA Astrophysics Data System (ADS)

    Conaway, C.; Thordsen, J. J.; Manning, M. A.; Cook, P. J.; Abedini, A. A.; Trautz, R. C.; Thomas, B.; Kharaka, Y. K.

    2012-12-01

    The chemical composition of formation water and associated gases from the lower Cretaceous Paluxy Formation was determined using four different sampling methods at a well in the Citronelle Oil Field, Alabama, a site that will be used for a carbon dioxide injection experiment. Prior to each of the two sampling periods, the well was cleaned from the drilling fluids and KCl solutions by producing at least three pore volumes of formation water. Accurate measurements of the chemical composition of groundwater or formation water, including dissolved gasses, and gas samples is essential in understanding subsurface geochemical processes occurring as a result of geologic carbon dioxide injection, which is used for enhanced oil recovery (EOR) and has been proposed as a means of carbon sequestration. In this study, formation water and gas samples for geochemical analyses were obtained from well D-9-8 #2 at Citronelle using nitrogen lift, submersible pump, U-Tube, and a downhole (Kuster) sampler. Field chemical analyses included electrical conductivity, hydrogen sulfide, alkalinity, and pH, and laboratory analyses included major, minor and trace elements by mass spectrometry and ion chromatography, dissolved carbon, organic acid anions, free and dissolved gas species. The formation water obtained from this well is a Na-Ca-Cl brine with a salinity of 160,000 and 200,000 mg/L total dissolved solids (TDS). Differences were evident between sampling methodologies, particularly in pH, Fe and alkalinity measurements. The results of the comparison demonstrate the difficulty and importance of preserving volatile analytes in samples, with the downhole sampler and U-Tube system performing most favorably in this aspect.

  12. CO-0.30-0.07: A Candidate Site of Collision-induced Massive Star Formation in the Milky Way's Central Molecular Zone

    NASA Astrophysics Data System (ADS)

    Tanaka, K.

    2016-05-01

    Cloud-cloud collision has long been claimed to be an efficient trigger of massive star formation. We present interferometric maps of a candidate site of collision-triggered star formation newly discovered at 40 pc projected distance from the Galactic center. The cloud CO- 0.3 has an extremely broad molecular line emission of a 140 km s-1 velocity width despite of absence of any known energy sources nearby and inside the cloud. Recent observations with the Atacama Large Millimeter and Submillimeter Array have unveiled that the cloud is comprised by two distinctive velocity components which appear to contact at a thin, well-defined interface layer on the plane-of-the-sky, suggesting that the extremely broad emissions originate from shocked regions created by cloud-cloud collision.

  13. Formation temperatures of clays from the volcaniclastic series of Site 841 ODP: an oxygen isotopic record of a paleothermal flux into the Tonga forearc

    NASA Astrophysics Data System (ADS)

    Vitali, Frédéric; Blanc, Gérard; Gauthier-Lafaye, François; France-Lanord, Christian

    Oxygen isotopic compositions of clay minerals were determined on representative samples of the volcano-sedimentary series from Site 841 ODP (Tonga forearc). This isotopic study has demonstrated an abnormally high crystallisation temperature of the clay minerals with respect to temperature expected in burial diagenesis. Formation temperatures obtained using 18O reach up to 200°C in a Fe-chlorite-corrensite paragenesis found in the vicinity of basaltic andesite sills intruded into the Miocene tuffs. The paleothermal flux resulting from the cooling of the sills has produced very low grade contact metamorphism in the Miocene Tonga forearc deposits. The consequence of this was the formation of a large amount of hydrous silicates characterised near the sills by a Fe-clays-analcime mineralogical association.

  14. Real-time formation evaluation using a well-site data management system to integrate MWD, surface measurements, and enhanced mud logging data

    SciTech Connect

    Whittaker, A.; Brooks, A.; Dowsett, R.; MacPherson, J.; Nigh, E.

    1986-04-01

    With the advent of measurement while drilling (MWD), a new source of quantitative data became available during the drilling process. The availability of wireline log-type data while drilling has led to a need that traditional mud-logging methods be augmented and enhanced to provide more quantitative correlative data sources and benchmark standards for the lithologic normalization of MWD data. Together these data can be integrated within a single well-site data base to provide effective formation evaluation while the drilling process continues. The data base may be so structured that later available data, such as wireline logs, may be input to provide confirmation and refinement of real-time evaluations. Similarly, the data base may be primed with geophysical and geological pronoses prior to drilling. Case histories show the effective real-time determination of true total and effective porosities, fluid saturations, and estimates of formation characteristics, such as mineralogy and permeability. In each example, when departures between early and late data sets occur (e.g., wireline logs or formation tests), the data variation results from changes in downhole conditions, and the data can be used to enhance formation evaluation by adding a dynamic component.

  15. An active site rearrangement within the Tetrahymena group I ribozyme releases nonproductive interactions and allows formation of catalytic interactions.

    PubMed

    Sengupta, Raghuvir N; Van Schie, Sabine N S; Giambaşu, George; Dai, Qing; Yesselman, Joseph D; York, Darrin; Piccirilli, Joseph A; Herschlag, Daniel

    2016-01-01

    Biological catalysis hinges on the precise structural integrity of an active site that binds and transforms its substrates and meeting this requirement presents a unique challenge for RNA enzymes. Functional RNAs, including ribozymes, fold into their active conformations within rugged energy landscapes that often contain misfolded conformers. Here we uncover and characterize one such "off-pathway" species within an active site after overall folding of the ribozyme is complete. The Tetrahymena group I ribozyme (E) catalyzes cleavage of an oligonucleotide substrate (S) by an exogenous guanosine (G) cofactor. We tested whether specific catalytic interactions with G are present in the preceding E•S•G and E•G ground-state complexes. We monitored interactions with G via the effects of 2'- and 3'-deoxy (-H) and -amino (-NH(2)) substitutions on G binding. These and prior results reveal that G is bound in an inactive configuration within E•G, with the nucleophilic 3'-OH making a nonproductive interaction with an active site metal ion termed MA and with the adjacent 2'-OH making no interaction. Upon S binding, a rearrangement occurs that allows both -OH groups to contact a different active site metal ion, termed M(C), to make what are likely to be their catalytic interactions. The reactive phosphoryl group on S promotes this change, presumably by repositioning the metal ions with respect to G. This conformational transition demonstrates local rearrangements within an otherwise folded RNA, underscoring RNA's difficulty in specifying a unique conformation and highlighting Nature's potential to use local transitions of RNA in complex function. PMID:26567314

  16. Covalent Adduct Formation between the Antihypertensive Drug Hydralazine and Abasic Sites in Double- and Single-Stranded DNA

    PubMed Central

    2015-01-01

    Hydralazine (4) is an antihypertensive agent that displays both mutagenic and epigenetic properties. Here, gel electrophoretic, mass spectroscopic, and chemical kinetics methods were used to provide evidence that medicinally relevant concentrations of 4 rapidly form covalent adducts with abasic sites in double- and single-stranded DNA under physiological conditions. These findings raise the intriguing possibility that the genotoxic properties of this clinically used drug arise via reactions with an endogenous DNA lesion rather than with the canonical structure of DNA. PMID:25405892

  17. Modeling the yield of double-strand breaks due to formation of multiply damaged sites in irradiated plasmid DNA

    SciTech Connect

    Xapsos, M.A.; Pogozelski, W.K.

    1996-12-01

    Although double-strand breaks have long been recognized as an important type of DNa lesion, it is well established that this broad class of damage does not correlate well with indicators of the effectiveness of radiation as the cellular level. Assays of double-strand breaks do not distinguish the degree of complexity or clustering of singly damaged sites produced in a single energy deposition event, which is currently hypothesized to be key to understanding cellular end points. As a step toward this understanding, double-strand breaks that are formed proportionally to dose in plasmid DNA are analyzed from the mechanistic aspect to evaluate the yield that arises from multiply damaged sites as hypothesized by Ward (Prog. Nucleic Acid Res. Mol. Biol. 35, 95-125, 1988) and Goodhead (Int. J. Radiat. Biol. 65, 7-17, 1994) as opposed to the yield that arises form single hydroxyl radicals as hypothesized by Siddiqi and Bothe (Radiat. Res. 112, 449-463, 1987). For low-LET radiation such as {gamma} rays, the importance of multiply damaged sites is shown to increase with the solution`s hydroxyl radical scavenging capacity. For moderately high-LET radiation such as 100 keV/{mu}m helium ions, a much different behavior is observed. In this case, a large fraction of double-strand breaks are formed as a result of multiply damaged sties over a broad range of scavenging conditions. Results also indicate that the RBE for common cellular end points correlates more closely with the RBE for common cellular end points correlates more closely with the RBE for multiply damaged sites than with the RBE for total double-strand breaks over a range of LET up to at least 100 keV/{mu}m. 22 refs., 3 figs., 2 tabs.

  18. Metal-particle-induced, highly localized site-specific etching of Si and formation of single-crystalline Si nanowires in aqueous fluoride solution.

    PubMed

    Peng, Kuiqing; Fang, Hui; Hu, Juejun; Wu, Yin; Zhu, Jing; Yan, Yunjie; Lee, ShuitTong

    2006-10-16

    A straightforward metal-particle-induced, highly localized site-specific corrosion-like mechanism was proposed for the formation of aligned silicon-nanowire arrays on silicon in aqueous HF/AgNO3 solution on the basis of convincing experimental results. The etching process features weak dependence on the doping of the silicon wafers and, thus, provides an efficient method to prepare silicon nanowires with desirable doping characteristics. The novel electrochemical properties between silicon and active noble metals should be useful for preparing novel silicon nanostructures and also new optoelectronic devices. PMID:16871502

  19. Testing short-range migration of microbial methane as a hydrate formation mechanism: Results from Andaman Sea and Kumano Basin drill sites and global implications

    NASA Astrophysics Data System (ADS)

    Malinverno, Alberto; Goldberg, David S.

    2015-07-01

    Methane gas hydrates in marine sediments often concentrate in coarse-grained layers surrounded by fine-grained marine muds that are hydrate-free. Methane in these hydrate deposits is typically microbial, and must have migrated from its source as the coarse-grained sediments contain little or no organic matter. In "long-range" migration, fluid flow through permeable layers transports methane from deeper sources into the gas hydrate stability zone (GHSZ). In "short-range" migration, microbial methane is generated within the GHSZ in fine-grained sediments, where small pore sizes inhibit hydrate formation. Dissolved methane can then diffuse into adjacent sand layers, where pore size does not restrict hydrate formation and hydrates can accumulate. Short-range migration has been used to explain hydrate accumulations in sand layers observed in drill sites on the northern Cascadia margin and in the Gulf of Mexico. Here we test the feasibility of short-range migration in two additional locations, where gas hydrates have been found in coarse-grained volcanic ash layers (Site NGHP-01-17, Andaman Sea, Indian Ocean) and turbidite sand beds (Site IODP-C0002, Kumano forearc basin, Nankai Trough, western Pacific). We apply reaction-transport modeling to calculate dissolved methane concentration and gas hydrate amounts resulting from microbial methane generated within the GHSZ. Model results show that short-range migration of microbial methane can explain the overall amounts of methane hydrate observed at the two sites. Short-range migration has been shown to be feasible in diverse margin environments and is likely to be a widespread methane transport mechanism in gas hydrate systems. It only requires a small amount of organic carbon and sediment sequences consisting of thin coarse-grained layers that can concentrate microbial methane generated within thick fine-grained sediment beds; these conditions are common along continental margins around the globe.

  20. Slow base excision by human alkyladenine DNA glycosylase limits the rate of formation of AP sites and AP endonuclease 1 does not stimulate base excision.

    PubMed

    Maher, Robyn L; Vallur, Aarthy C; Feller, Joyce A; Bloom, Linda B

    2007-01-01

    The base excision repair pathway removes damaged DNA bases and resynthesizes DNA to replace the damage. Human alkyladenine DNA glycosylase (AAG) is one of several damage-specific DNA glycosylases that recognizes and excises damaged DNA bases. AAG removes primarily damaged adenine residues. Human AP endonuclease 1 (APE1) recognizes AP sites produced by DNA glycosylases and incises the phophodiester bond 5' to the damaged site. The repair process is completed by a DNA polymerase and DNA ligase. If not tightly coordinated, base excision repair could generate intermediates that are more deleterious to the cell than the initial DNA damage. The kinetics of AAG-catalyzed excision of two damaged bases, hypoxanthine and 1,N6-ethenoadenine, were measured in the presence and absence of APE1 to investigate the mechanism by which the base excision activity of AAG is coordinated with the AP incision activity of APE1. 1,N6-ethenoadenine is excised significantly slower than hypoxanthine and the rate of excision is not affected by APE1. The excision of hypoxanthine is inhibited to a small degree by accumulated product, and APE1 stimulates multiple turnovers by alleviating product inhibition. These results show that APE1 does not significantly affect the kinetics of base excision by AAG. It is likely that slow excision by AAG limits the rate of AP site formation in vivo such that AP sites are not created faster than can be processed by APE1. PMID:17018265

  1. A functional glucocorticoid-responsive unit composed of two overlapping inactive receptor-binding sites: evidence for formation of a receptor tetramer.

    PubMed Central

    Garlatti, M; Daheshia, M; Slater, E; Bouguet, J; Hanoune, J; Beato, M; Barouki, R

    1994-01-01

    An unusual glucocorticoid-responsive element (called GRE A) was found to mediate the induction of the cytosolic aspartate aminotransferase gene by glucocorticoids and was bound by the glucocorticoid receptor in a DNase I footprinting assay. GRE A consists of two overlapping GREs, each comprising a conserved half-site and an imperfect half-site. The complete unit was able to confer glucocorticoid inducibility to a heterologous promoter (delta MTV-CAT). Mutation of any of the half-sites, including the imperfect ones, abolished inducibility by the hormone, demonstrating that each of the isolated GREs was inactive. In electrophoretic mobility shift assays, purified rat liver glucocorticoid receptor (GR) formed a low-mobility complex with GRE A, presumably containing a GR tetramer. When purified bacterially expressed DBD was used, low-mobility complexes as well as dimer and monomer complexes were formed. In inactive mutated oligonucleotides, no GR tetramer formation was detected. Modification of the imperfect half-sites in order to increase their affinity for GR gave a DNA sequence that bound a GR tetramer in a highly cooperative manner. This activated unit consisting of two overlapping consensus GREs mediated glucocorticoid induction with a higher efficiency than consensus GRE. Images PMID:7969140

  2. Field-based description of rhyolite lava flows of the Calico Hills Formation, Nevada National Security Site, Nevada

    USGS Publications Warehouse

    Sweetkind, Donald S.; Bova, Shiera C.

    2015-01-01

    In the area south of the Rainier Mesa caldera, surface and subsurface geologic data are combined to interpret the overall thickness of the Calico Hills Formation and the proportion of lava flow lithology across the study area. The formation is at least 500 meters (m) thick and contains the greatest proportion of rhyolite lava flow to the northeast of Yucca Mountain in the lower part of Fortymile Canyon. The formation thins to the south and southwest where it is between 50 and 200 m thick beneath Yucca Mountain and contains no rhyolite lavas. Geologic mapping and field-based correlation of individual lava flows allow for the interpretation of the thickness and extent of specific flows and the location of their source areas. The most extensive flows have widths from 2 to 3 kilometers (km) and lengths of at least 5–6 km. Lava flow thickness varies from 150 to 250 m above interpreted source vents to between 30 and 80 m in more distal locations. Rhyolite lavas have length-to-height ratios of 10:1 or greater and, in one instance, a length-to-width ratio of 2:1 or greater, implying a tongue-shaped geometry instead of circular domes or tabular bodies. Although geologic mapping did not identify any physical feature that could be positively identified as a vent, lava flow thickness and the size of clasts in subjacent pyroclastic deposits suggest that primary vent areas for at least some of the flows in the study area are on the east side of Fortymile Canyon, to the northeast of Yucca Mountain.

  3. A dynamic flow simulation code benchmark study addressing the highly heterogeneous properties of the Stuttgart formation at the Ketzin pilot site

    NASA Astrophysics Data System (ADS)

    Kempka, Thomas; Class, Holger; Görke, Uwe-Jens; Norden, Ben; Kolditz, Olaf; Kühn, Michael; Walter, Lena; Wang, Wenqing; Zehner, Björn

    2013-04-01

    CO2 injection at the Ketzin pilot site located in Eastern Germany (Brandenburg) about 25 km west of Berlin is undertaken since June 2008 with a scheduled total amount of about 70,000 t CO2 to be injected into the saline aquifer represented by the Stuttgart Formation at a depth of 630 m to 650 m until the end of August 2013. The Stuttgart Formation is of fluvial origin determined by high-permeablity sandstone channels embedded in a floodplain facies of low permeability indicating a highly heterogeneous distribution of reservoir properties as facies distribution, porosity and permeability relevant for dynamic flow simulations. Following the dynamic modelling activities discussed by Kempka et al. (2010), a revised geological model allowed us to history match CO2 arrival times in the observation wells and reservoir pressure with a good agreement (Martens et al., 2012). Consequently, the validated reservoir model of the Stuttgart Formation at the Ketzin pilot site enabled us to predict the development of reservoir pressure and the CO2 plume migration in the storage formation by dynamic flow simulations. A benchmark study of industrial (ECLIPSE 100 as well as ECLIPSE 300 CO2STORE and GASWAT) and scientific dynamic flow simulations codes (TOUGH2-MP/ECO2N, OpenGeoSys and DuMuX) was initiated to address and compare the simulator capabilities considering a highly complex reservoir model. Hence, our dynamic flow simulations take into account different properties of the geological model such as significant variation of porosity and permeability in the Stuttgart Formation as well as structural geological features implemented in the geological model such as seven major faults located at the top of the Ketzin anticline. Integration of the geological model into reservoir models suitable for the different dynamic flow simulators applied demonstrated that a direct conversion of reservoir model discretization between Finite Volume and Finite Element flow simulators is not feasible

  4. The Evolution of Tissue Stiffness at Radiofrequency Ablation Sites During Lesion Formation and in the Peri‐Ablation Period

    PubMed Central

    EYERLY, STEPHANIE A.; VEJDANI‐JAHROMI, MARYAM; DUMONT, DOUGLAS M.; TRAHEY, GREGG E.

    2015-01-01

    Peri‐Ablation Monitoring of RFA Lesion Stiffness Introduction Elastography imaging can provide radiofrequency ablation (RFA) lesion assessment due to tissue stiffening at the ablation site. An important aspect of assessment is the spatial and temporal stability of the region of stiffness increase in the peri‐ablation period. The aim of this study was to use 2 ultrasound‐based elastography techniques, shear wave elasticity imaging (SWEI) and acoustic radiation force impulse (ARFI) imaging, to monitor the evolution of tissue stiffness at ablation sites in the 30 minutes following lesion creation. Methods and Results In 6 canine subjects, SWEI measurements and 2‐D ARFI images were acquired at 6 ventricular endocardial RFA sites before, during, and for 30 minutes postablation. An immediate increase in tissue stiffness was detected during RFA, and the area of the postablation region of stiffness increase (RoSI) as well as the relative stiffness at the RoSI center was stable approximately 2 minutes after ablation. Of note is the observation that relative stiffness in the region adjacent to the RoSI increased slightly during the first 15 minutes, consistent with local fluid displacement or edema. The magnitude of this increase, ∼0.5‐fold from baseline, was significantly less than the magnitude of the stiffness increase directly inside the RoSI, which was greater than 3‐fold from baseline. Conclusions Ultrasound‐based SWEI and ARFI imaging detected an immediate increase in tissue stiffness during RFA, and the stability and magnitude of the stiffness change suggest that consistent elasticity‐based lesion assessment is possible 2 minutes after and for at least 30 minutes following ablation. PMID:25970142

  5. Rad54B targeting to DNA double-strand break repair sites requires complex formation with S100A11.

    PubMed

    Murzik, Ulrike; Hemmerich, Peter; Weidtkamp-Peters, Stefanie; Ulbricht, Tobias; Bussen, Wendy; Hentschel, Julia; von Eggeling, Ferdinand; Melle, Christian

    2008-07-01

    S100A11 is involved in a variety of intracellular activities such as growth regulation and differentiation. To gain more insight into the physiological role of endogenously expressed S100A11, we used a proteomic approach to detect and identify interacting proteins in vivo. Hereby, we were able to detect a specific interaction between S100A11 and Rad54B, which could be confirmed under in vivo conditions. Rad54B, a DNA-dependent ATPase, is described to be involved in recombinational repair of DNA damage, including DNA double-strand breaks (DSBs). Treatment with bleomycin, which induces DSBs, revealed an increase in the degree of colocalization between S100A11 and Rad54B. Furthermore, S100A11/Rad54B foci are spatially associated with sites of DNA DSB repair. Furthermore, while the expression of p21(WAF1/CIP1) was increased in parallel with DNA damage, its protein level was drastically down-regulated in damaged cells after S100A11 knockdown. Down-regulation of S100A11 by RNA interference also abolished Rad54B targeting to DSBs. Additionally, S100A11 down-regulated HaCaT cells showed a restricted proliferation capacity and an increase of the apoptotic cell fraction. These observations suggest that S100A11 targets Rad54B to sites of DNA DSB repair sites and identify a novel function for S100A11 in p21-based regulation of cell cycle. PMID:18463164

  6. Rad54B Targeting to DNA Double-Strand Break Repair Sites Requires Complex Formation with S100A11

    PubMed Central

    Murzik, Ulrike; Hemmerich, Peter; Weidtkamp-Peters, Stefanie; Ulbricht, Tobias; Bussen, Wendy; Hentschel, Julia; von Eggeling, Ferdinand

    2008-01-01

    S100A11 is involved in a variety of intracellular activities such as growth regulation and differentiation. To gain more insight into the physiological role of endogenously expressed S100A11, we used a proteomic approach to detect and identify interacting proteins in vivo. Hereby, we were able to detect a specific interaction between S100A11 and Rad54B, which could be confirmed under in vivo conditions. Rad54B, a DNA-dependent ATPase, is described to be involved in recombinational repair of DNA damage, including DNA double-strand breaks (DSBs). Treatment with bleomycin, which induces DSBs, revealed an increase in the degree of colocalization between S100A11 and Rad54B. Furthermore, S100A11/Rad54B foci are spatially associated with sites of DNA DSB repair. Furthermore, while the expression of p21WAF1/CIP1 was increased in parallel with DNA damage, its protein level was drastically down-regulated in damaged cells after S100A11 knockdown. Down-regulation of S100A11 by RNA interference also abolished Rad54B targeting to DSBs. Additionally, S100A11 down-regulated HaCaT cells showed a restricted proliferation capacity and an increase of the apoptotic cell fraction. These observations suggest that S100A11 targets Rad54B to sites of DNA DSB repair sites and identify a novel function for S100A11 in p21-based regulation of cell cycle. PMID:18463164

  7. New particle formation and ultrafine charged aerosol climatology at a high altitude site in the Alps (Jungfraujoch, 3580 m a.s.l., Switzerland)

    NASA Astrophysics Data System (ADS)

    Boulon, J.; Sellegri, K.; Venzac, H.; Picard, D.; Weingartner, E.; Wehrle, G.; Baltensperger, U.; Laj, P.

    2010-04-01

    Aerosol nucleation is an important source of atmospheric particles which have an effect both on the climatic system and on human health. The new particle formation (NPF) process is an ubiquitous phenomenon, yet poorly understood despite the many studies performed on this topic using various approaches (observation, experimentation in smog chambers and modeling). In this work, we investigate the formation of secondary charged aerosols and its climatology at Jungfraujoch, a high altitude site in Swiss Alps (3580 m a.s.l.). Charged particles and clusters (0.5-1.8 nm) were measured within the EUCAARI program from April 2008 to April 2009 and allowed the detection of nucleation events. We found that the aerosol concentration, which is dominated by cluster size class, shows a strong diurnal pattern and that the aerosol size distribution and concentration are strongly influenced by the presence of clouds either during daytime or nighttime conditions. New particle formation events have been investigated and it appears that new particle formation occurs 17.5% of measured days and that the nucleation frequency is strongly linked to air mass origin and path and negatively influenced by cloud presence. In fact, we show that NPF events depend on the occurrence of high concentration VOCs air masses which allowed clusters growing by condensation of organic vapors rather than nucleation of new clusters. Furthermore, the contribution of ions to nucleation process was studied and we found that ion-mediated nucleation (IMN) contribute to 26% of the total nucleation so that ions play an important role in the new particle formation and growth at Jungfraujoch.

  8. A Threonine on the Active Site Loop Controls Transition State Formation in Escherichia Coli Respiratory Complex II

    SciTech Connect

    Tomasiak, T.M.; Maklashina, E.; Cecchini, G.; Iverson, T.M.

    2009-05-26

    In Escherichia coli, the complex II superfamily members succinate:ubiquinone oxidoreductase (SQR) and quinol:fumarate reductase (QFR) participate in aerobic and anaerobic respiration, respectively. Complex II enzymes catalyze succinate and fumarate interconversion at the interface of two domains of the soluble flavoprotein subunit, the FAD binding domain and the capping domain. An 11-amino acid loop in the capping domain (Thr-A234 to Thr-A244 in quinol:fumarate reductase) begins at the interdomain hinge and covers the active site. Amino acids of this loop interact with both the substrate and a proton shuttle, potentially coordinating substrate binding and the proton shuttle protonation state. To assess the loop's role in catalysis, two threonine residues were mutated to alanine: QFR Thr-A244 (act-T; Thr-A254 in SQR), which hydrogen-bonds to the substrate at the active site, and QFR Thr-A234 (hinge-T; Thr-A244 in SQR), which is located at the hinge and hydrogen-bonds the proton shuttle. Both mutations impair catalysis and decrease substrate binding. The crystal structure of the hinge-T mutation reveals a reorientation between the FAD-binding and capping domains that accompanies proton shuttle alteration. Taken together, hydrogen bonding from act-T to substrate may coordinate with interdomain motions to twist the double bond of fumarate and introduce the strain important for attaining the transition state.

  9. Surface and subsurface features of the upper Pleistocene Beaumont Formation as studied in a proposed super collider site in Liberty and Hardin counties, southeastern Texas

    SciTech Connect

    Aronow, S.

    1994-12-31

    In 1987 an area in Hardin and Libery Counties in southeastern Texas was a much-studied candidate site for the ill-fated Superconducting Super Collider. The site is on the outcrop of the upper Pleistocene Beaumont Formation, which locally was deposited by a sequence of meandering, avulsing, suspended-load, paleo-Trinity River courses, now preserved as a well-defined to poorly defined depositional topography. Test holes in meanderbelt ridges showed that channel and point-bar silty fine to very fine sands are almost everywhere covered by approximately 10 to 40 ft ({approximately}3 to 12 m) of CH and CL overbank clays. Where completely penetrated, sand bodies are approximately 20 to 50 ft ({approximately}6 to 15 m) thick. Pedogenic calcareous deposits and slickensides at depths well below any influence from present-day surface processes are probably parts of lower horizons of truncated now-buried soils generated during the accumulation of the Beaumont, or on the surface of the underlying Lissie Formation. The relationship of one of the paleo-meanderbelts to the uplifted topographic surface of the Hull salt dome suggests that the rise of the surface postdated deposition of the Beaumont.

  10. Formation of a stable triplex incorporating a CG interrupting site by a new WNA derivative containing 3-aminopyrazole as a nucleobase.

    PubMed

    Uchida, Yuko; Taniguchi, Yosuke; Aoki, Eriko; Togo, Mieko; Sasaki, Shigeki

    2008-01-01

    Triplex-forming oligonucleotides (TFOs) bind within the major groove of duplex DNA in a sequence-specific manner, and have attracted much interest as genomic tools. However, as the triplex DNA is formed by the interaction between the TFOs and homopurine/homopyrimidine sequences of the target duplex DNA, the stable triplex formation is prevented by one pyrimidine base in the homopurine strand. Previously, we developed the nucleoside analogues (WNA: W-shaped nucleoside analogues) that furnish an aromatic ring as a stacking part and a nucleobase as a recognition part onto the bicyclic skeleton. Selective recognition of a TA and a CG interrupting site has been achieved by WNA-beta T and WNA-beta C, respectively. In the subsequent study, it was found that the triplex formation by the WNA analogues depend on its neighbouring bases within the TFO. In this paper, we describe the synthesis and the evaluation of the triplex forming ability of WNA-beta 3AP, having 3-aminopyrazole (3AP) as a nucleobase. It is remarkable that the TFO containing the WNA-beta 3AP recognizes the CG interrupting site with high selectivity in the TFO sequence of 3'-GZG-5', in which the previous WNA-beta C did not show the stabilizing effect. PMID:18776291

  11. The Lindi Formation (upper Albian-Coniacian) and Tanzania Drilling Project Sites 36-40 (Lower Cretaceous to Paleogene): Lithostratigraphy, biostratigraphy and chemostratigraphy

    NASA Astrophysics Data System (ADS)

    Jiménez Berrocoso, Álvaro; Huber, Brian T.; MacLeod, Kenneth G.; Petrizzo, Maria Rose; Lees, Jacqueline A.; Wendler, Ines; Coxall, Helen; Mweneinda, Amina K.; Falzoni, Francesca; Birch, Heather; Haynes, Shannon J.; Bown, Paul R.; Robinson, Stuart A.; Singano, Joyce M.

    2015-01-01

    The 2009 Tanzania Drilling Project (TDP) expedition to southeastern Tanzania cored a total of 572.3 m of sediments at six new mid-Cretaceous to mid-Paleocene boreholes (TDP Sites 36, 37, 38, 39, 40A, 40B). Added to the sites drilled in 2007 and 2008, the new boreholes confirm the common excellent preservation of planktonic and benthic foraminifera and calcareous nannofossils from core samples that will be used for biostratigraphy, evolutionary studies, paleoceanography and climatic reconstructions from the Tanzanian margin, with implications elsewhere. The new sites verify the presence of a relatively expanded Upper Cretaceous succession in the region that has allowed a new stratigraphic unit, named here as the Lindi Formation (Fm), to be formally defined. The Lindi Fm (upper Albian to Coniacian), extending ∼120 km between Kilwa and Lindi, comprises a 335-m-thick, outer-shelf to upper-slope unit, consisting of dark gray claystone and siltstone interbeds, common finely-laminated intervals, minor cm-thick sandstones and up to 2.6% organic carbon in the Turonian. A subsurface, composite stratotype section is proposed for the Lindi Fm, with a gradational top boundary with the overlying Nangurukuru Fm (Santonian to Maastrichtian) and a sharp bottom contact with underlying upper Albian sandstones. The section cored at TDP Sites 36 and 38 belongs to the Lindi Fm and are of lower to middle Turonian age (planktonic foraminifera Whiteinella archaeocretacea to Helvetoglobotruncana helvetica Zones and nannofossils subzones UC6b ± UC7). The lower portion of TDP Site 39 (uppermost part of the Lindi Fm) is assigned to the lower to upper Coniacian (planktonic foraminifera Dicarinella concavata Zone and nannofossils zone UC 10), while the remaining part of this site is attributed to the Coniacian-Santonian transition and younger Santonian (planktonic foraminifera D. asymetrica Zone and upper part of nannofossils zone UC10). TDP Site 37 recovered relatively expanded (150 m thick

  12. Site specific isolated nanostructure array formation on a large area by broad ion beam without any mask and resist

    NASA Astrophysics Data System (ADS)

    Karmakar, Prasanta; Satpati, Biswarup

    2014-06-01

    We report the formation of isolated nanostructure arrays on a large area via broad ion beam implantation without the aid of any mask or resist. Desired ions have been implanted at specific locations of the prefabricated silicon ripple or triangular structures by exploiting the variation of local ion impact angles. We have shown that the implantation of Fe ions on an O+ ions induced pre fabricated triangular shaped patterned Si surface results in a self-organized periodic array of striped magnetic nanostructures having several micron length and about 50 nm width arranged with a spacial separation of ˜200 nm. The morphology, composition, crystalline structure, and magnetic property of these nanopatterns have been analyzed using high-resolution cross-sectional transmission electron microscopy and atomic force microscopy. A geometrical model has been proposed to explain the fundamental features of such ion-induced nanopattern structures.

  13. A first site of galaxy cluster formation: complete spectroscopy of a protocluster at z = 6.01

    SciTech Connect

    Toshikawa, Jun; Kashikawa, Nobunari; Ishikawa, Shogo; Onoue, Masafusa; Overzier, Roderik; Shibuya, Takatoshi; Ota, Kazuaki; Shimasaku, Kazuhiro; Tanaka, Masayuki; Hayashi, Masao; Niino, Yuu

    2014-09-01

    We performed a systematic spectroscopic observation of a protocluster at z = 6.01 in the Subaru Deep Field. We took spectroscopy for all 53 i' dropout galaxies down to z' = 27.09 mag in/around the protocluster region. From these observations, we confirmed that 28 galaxies are at z ∼ 6, 10 of which are clustered in a narrow redshift range of Δz < 0.06. To trace the evolution of this primordial structure, we applied the same i' dropout selection and the same overdensity measurements used in the observations to a semi-analytic model built upon the Millennium Simulation. We obtain a relation between the significance of overdensities observed at z ∼ 6 and the predicted dark matter halo mass at z = 0. This protocluster with 6σ overdensity is expected to grow into a galaxy cluster with a mass of ∼5 × 10{sup 14} M {sub ☉} at z = 0. Ten galaxies within 10 comoving Mpc of the overdense region can, with more than an 80% probability, merge into a single dark matter halo by z = 0. No significant differences appeared in UV and Lyα luminosities between the protocluster and field galaxies, suggesting that this protocluster is still in the early phase of cluster formation before the onset of any obvious environmental effects. However, further observations are required to study other properties, such as stellar mass, dust, and age. We do find that galaxies tend to be in close pairs in this protocluster. These pair-like subgroups will coalesce into a single halo and grow into a more massive structure. We may witness an onset of cluster formation at z ∼ 6 toward a cluster as seen in local universe.

  14. Site-directed Mutagenesis Reveals Regions Implicated in the Stability and Fiber Formation of Human λ3r Light Chains*

    PubMed Central

    Villalba, Miryam I.; Canul-Tec, Juan C.; Luna-Martínez, Oscar D.; Sánchez-Alcalá, Rosalba; Olamendi-Portugal, Timoteo; Rudiño-Piñera, Enrique; Rojas, Sonia; Sánchez-López, Rosana; Fernández-Velasco, Daniel A.; Becerril, Baltazar

    2015-01-01

    Light chain amyloidosis (AL) is a disease that affects vital organs by the fibrillar aggregation of monoclonal light chains. λ3r germ line is significantly implicated in this disease. In this work, we contrasted the thermodynamic stability and aggregation propensity of 3mJL2 (nonamyloidogenic) and 3rJL2 (amyloidogenic) λ3 germ lines. Because of an inherent limitation (extremely low expression), Cys at position 34 of the 3r germ line was replaced by Tyr reaching a good expression yield. A second substitution (W91A) was introduced in 3r to obtain a better template to incorporate additional mutations. Although the single mutant (C34Y) was not fibrillogenic, the second mutation located at CDR3 (W91A) induced fibrillogenesis. We propose, for the first time, that CDR3 (position 91) affects the stability and fiber formation of human λ3r light chains. Using the double mutant (3rJL2/YA) as template, other variants were constructed to evaluate the importance of those substitutions into the stability and aggregation propensity of λ3 light chains. A change in position 7 (P7D) boosted 3rJL2/YA fibrillogenic properties. Modification of position 48 (I48M) partially reverted 3rJL2/YA fibril aggregation. Finally, changes at positions 8 (P8S) or 40 (P40S) completely reverted fibril formation. These results confirm the influential roles of N-terminal region (positions 7 and 8) and the loop 40–60 (positions 40 and 48) on AL. X-ray crystallography revealed that the three-dimensional topology of the single and double λ3r mutants was not significantly altered. This mutagenic approach helped to identify key regions implicated in λ3 AL. PMID:25505244

  15. Comparison of particle number size distributions and new particle formation between the urban and rural sites in the PRD region, China

    NASA Astrophysics Data System (ADS)

    Yue, D. L.; Hu, M.; Wang, Z. B.; Wen, M. T.; Guo, S.; Zhong, L. J.; Wiedensohler, A.; Zhang, Y. H.

    2013-09-01

    Particle number size distributions were simultaneously measured at the Guangzhou (GZ) urban site (23.13°N, 113.26°E) and the Back-garden (BG) rural site (23.5°N, 113.03°E) in the Pearl River Delta (PRD) region in July, 2006. It provided new findings into the evolution of particle number size distribution and new particle formation (NPF) in two different environments. Number concentration of particles (20 nm-10 μm diameter) at GZ was about 70% higher than at BG and significantly affected by traffic emission. However, number concentrations of the regional aerosols (100-660 nm) were (6 ± 3) × 103 cm-3 at both sites. At BG, the diurnal variation of particle number size distributions showed an obvious particle growth process beginning at about 9:00 (LT), probably caused by NPF. In contrast, particle number concentrations in the size rages of 20-45 nm, 45-100 nm, and 100-660 nm showed similar trends with two main peaks at about 12:00 (LT) and 19:00 (LT) at GZ. NPF events were observed at both sites, but the occurrence frequency at GZ was about 50% lower than at BG. Regional NPF events at both sites probably in the same air mass were simultaneously observed with similar growth rates, concentrations and production rates of the condensable vapors, and condensational sinks on July 6. On the whole, deceasing traffic emission will improve air quality efficiently in the aspect of particle number concentration and fine particulate pollution in the summer of PRD should be controlled in a regional scale, especially with stagnant air mass from South China Sea.

  16. Geochemical Controls on Contaminant Uranium in Vadose Hanford Formation Sediments at the 200 Area and 300 Area, Hanford Site, Washington

    SciTech Connect

    McKinley, James P.; Zachara, John M.; Wan, Jiamin; Mccready, David E.; Heald, Steve M.

    2007-11-01

    differences in uranium contributed by contaminated vadose sediments at two locations was investigated. At the BX tank farms, alkaline waste was accidentally released to a thick vadose zone. At the 300 Area, waste of variable acidity was released by unintended infiltration through the base of settling ponds. The waste form at the BX site was devoid of dissolved silica, and reacted with fluids trapped in microfractures to precipitate uranyl silicates. These secondary deposits were isolated physically from the vadose pore space and are not readily leached into pore fluids. At the 300 Area, the aluminum-rich waste precipitated on the surfaces of sediment clasts, forming a microporous reservoir of solid-phase uranium. Interaction of this coating with water in transit through the vadose zone provides a persistent source of dissolved uranium to groundwater.

  17. Analysis of Dose at the Site of Second Tumor Formation After Radiotherapy to the Central Nervous System

    SciTech Connect

    Galloway, Thomas J.; Indelicato, Daniel J.; Amdur, Robert J.; Morris, Christopher G.; Swanson, Erika L.; Marcus, Robert B.

    2012-01-01

    Purpose: Second tumors are an uncommon complication of multimodality treatment of childhood cancer. The present analysis attempted to correlate the dose received as a component of primary treatment and the site of the eventual development of a second tumor. Methods and Materials: We retrospectively identified 16 patients who had received radiotherapy to sites in the craniospinal axis and subsequently developed a second tumor. We compared the historical fields and port films of the primary treatment with the modern imaging of the second tumor locations. We classified the location of the second tumors as follows: in the boost field; marginal to the boost field, but in a whole-brain field; in a whole-brain field; marginal to the whole brain/primary treatment field; and distant to the field. We divided the dose received into 3 broad categories: high dose (>45 Gy), moderate dose (20-36 Gy), and low dose (<20 Gy). Results: The most common location of the second tumor was in the whole brain field (57%) and in the moderate-dose range (81%). Conclusions: Our data contradict previous publications that suggested that most second tumors develop in tissues that receive a low radiation dose. Almost all the second tumors in our series occurred in tissue within a target volume in the cranium that had received a moderate dose (20-36 Gy). These findings suggest that a major decrease in the brain volume that receives a moderate radiation dose is the only way to substantially decrease the second tumor rate after central nervous system radiotherapy.

  18. Correlation of Thermal Stability and Structural Distortion of DNA Interstrand Cross-Links Produced from Oxidized Abasic Sites with Their Selective Formation and Repair.

    PubMed

    Ghosh, Souradyuti; Greenberg, Marc M

    2015-10-13

    C4'-oxidized (C4-AP) and C5'-oxidized abasic sites (DOB) that are produced following abstraction of a hydrogen atom from the DNA backbone reversibly form cross-links selectively with dA opposite a 3'-adjacent nucleotide, despite the comparable proximity of an opposing dA. A previous report on UvrABC incision of DNA substrates containing stabilized analogues of the ICLs derived from C4-AP and DOB also indicated that the latter is repaired more readily by nucleotide excision repair [Ghosh, S., and Greenberg, M. M. (2014) Biochemistry 53, 5958-5965]. The source for selective cross-link formation was probed by comparing the reactivity of ICL analogues of C4-AP and DOB that mimic the preferred and disfavored cross-links with that of reagents that indirectly detect distortion by reacting with the nucleobases. The disfavored C4-AP and DOB analogues were each more reactive than the corresponding preferred cross-link substrates, suggesting that the latter are more stable, which is consistent with selective ICL formation. In addition, the preferred DOB analogue is more reactive than the respective C4-AP ICL, which is consistent with its more efficient incision by UvrABC. The conclusions drawn from the chemical probing experiments are corroborated by UV melting studies. The preferred ICLs exhibit melting temperatures higher than those of the corresponding disfavored isomers. These studies suggest that oxidized abasic sites form reversible interstrand cross-links with dA opposite the 3'-adjacent thymidine because these products are more stable and the thermodynamic preference is reflected in the transition states for their formation. PMID:26426430

  19. Sources of ambient volatile organic compounds and their contributions to photochemical ozone formation at a site in the Pearl River Delta, southern China.

    PubMed

    Ling, Z H; Guo, H; Cheng, H R; Yu, Y F

    2011-10-01

    The Positive Matrix Factorization (PMF) receptor model and the Observation Based Model (OBM) were combined to analyze volatile organic compound (VOC) data collected at a suburban site (WQS) in the PRD region. The purposes are to estimate the VOC source apportionment and investigate the contributions of these sources and species of these sources to the O(3) formation in PRD. Ten VOC sources were identified. We further applied the PMF-extracted concentrations of these 10 sources into the OBM and found "solvent usage 1", "diesel vehicular emissions" and "biomass/biofuel burning" contributed most to the O(3) formation at WQS. Among these three sources, higher Relative Incremental Reactivity (RIR)-weighted values of ethene, toluene and m/p-xylene indicated that they were mainly responsible for local O(3) formation in the region. Sensitivity analysis revealed that the sources of "diesel vehicular emissions", "biomass/biofuel burning" and "solvent usage 1" had low uncertainties whereas "gasoline evaporation" showed the highest uncertainty. PMID:21616570

  20. Geochemistry of two pressurized brines from the Castile Formation in the vicinity of the Waste Isolation Pilot Plant (WIPP) site

    SciTech Connect

    Faith, S.; Spiegler, P.; Rehfeldt, K.R.

    1983-04-01

    The major and minor element data and isotopic data from the ERDA-6 and WIPP-12 testing indicate that the brine reservoirs encountered in the Upper Castile Formation are largely in equilibrium with their surrounding host rock environment. This contention is supported by thermodynamic and stable isotope data. It is not possible to assign an absolute age to the brine based on uranium disequilibrium considerations, but the data do indicate that the brine reequilibrated with a new rock environment at least two million years ago. Information and data evaluated herein indicate the likelihood that the brines encountered are predominantly, if not entirely, derived from a trapped seawater source subsequently modified by diagenesis. Major ion/bromide ratios indicate that halite dissolution has occurred to some extent subsequent to deposition of the Castile anhydrites and entrapment of the seawater brine. Mechanisms for additional halite dissolution are discussed. Based on the degree of present halite saturation, it is concluded that the potential for future dissolution of halite is minimal.

  1. Identification of a structural constituent and one possible site of postembryonic formation of a teleost otolithic membrane

    PubMed Central

    Davis, James G.; Burns, Frank R.; Navaratnam, Dasakumar; Lee, A. Masaji; Ichimiya, Shingo; Oberholtzer, J. Carl; Greene, Mark I.

    1997-01-01

    A gelatinous otolithic membrane (OM) couples a single calcified otolith to the sensory epithelium in the bluegill sunfish (Lepomis macrochirus) saccule, one of the otolithic organs in the inner ear. Though the OM is an integral part of the anatomic network of endorgan structures that result in vestibular function in the inner ear, the identity of the proteins that make up this sensory accessory membrane in teleosts, or in any vertebrate, is not fully known. Previously, we identified a cDNA from the sunfish saccular otolithic organ that encoded a new member of the collagen family of structural proteins. In this study, we examined biochemical features and the localization of the saccular collagen (SC) protein in vivo using polyclonal antisera that recognize the noncollagenous domains of the SC protein. The SC protein, in vivo, was identified as a 95-kDa glycoprotein in sunfish whole-saccule lysate and in homogenates of microdissected saccular OMs. Immunohistochemical analyses demonstrated that the SC protein was localized within one of the two distinct layers of the sunfish saccular OM. The SC protein was also detected within the cytoplasm of supporting cells at the edges of the saccular sensory epithelium, indicating that these cells are a primary site for the synthesis of this structural protein. Further studies of the organization of this matrix molecule in the OM may help clarify the role of this sensory accessory membrane in vestibular sensory function. PMID:9012849

  2. The effect of animal health products on the formation of injection site lesions in subprimals of experimentally injected beef calves.

    PubMed Central

    Van Donkersgoed, J; Dubeski, P L; VanderKop, M; Aalhus, J L; Bygrove, S; Starr, W N

    2000-01-01

    Two hundred and twenty beef calves were used in an experimental study to determine the occurrence of injection site lesions at slaughter (15 to 18 months of age) following subcutaneous and intramuscular injection of various products into the top hip (top butt), thigh (round), and neck or rib of calves at birth, branding, or weaning. Products tested were: 2 different preparations of selenium; a 2-way, a 7-way, and an 8-way clostridial bacterin; 2 combination 7-way clostridial and Haemophilus somnus bacterins; 2 H. somnus bacterins; 2 different 4-way modified-live viral respiratory vaccines; a 4-way killed viral and H. somnus vaccine; and penicillin, florfenicol, ceftiofur, trimethoprim-sulfa, and tilmicosin. The occurrence of lesions, number of steaks affected with lesions, the trim weight of lesions, the histological class of lesions, and the estimated economic losses are described. Generally, products administered subcutaneously in the neck produced minimal tissue damage and economic losses. Images Figure 1. Figure 2. Figure 3. PMID:10945127

  3. Site-1 protease-activated formation of lysosomal targeting motifs is independent of the lipogenic transcription control[S

    PubMed Central

    Klünder, Sarah; Heeren, Jörg; Markmann, Sandra; Santer, René; Braulke, Thomas; Pohl, Sandra

    2015-01-01

    Site-1 protease (S1P) cleaves membrane-bound lipogenic sterol regulatory element-binding proteins (SREBPs) and the α/β-subunit precursor protein of the N-acetylglucosamine-1-phosphotransferase forming mannose 6-phosphate (M6P) targeting markers on lysosomal enzymes. The translocation of SREBPs from the endoplasmic reticulum (ER) to the Golgi-resident S1P depends on the intracellular sterol content, but it is unknown whether the ER exit of the α/β-subunit precursor is regulated. Here, we investigated the effect of cholesterol depletion (atorvastatin treatment) and elevation (LDL overload) on ER-Golgi transport, S1P-mediated cleavage of the α/β-subunit precursor, and the subsequent targeting of lysosomal enzymes along the biosynthetic and endocytic pathway to lysosomes. The data showed that the proteolytic cleavage of the α/β-subunit precursor into mature and enzymatically active subunits does not depend on the cholesterol content. In either treatment, lysosomal enzymes are normally decorated with M6P residues, allowing the proper sorting to lysosomes. In addition, we found that, in fibroblasts of mucolipidosis type II mice and Niemann-Pick type C patients characterized by aberrant cholesterol accumulation, the proteolytic cleavage of the α/β-subunit precursor was not impaired. We conclude that S1P substrate-dependent regulatory mechanisms for lipid synthesis and biogenesis of lysosomes are different. PMID:26108224

  4. Adeno-associated virus (AAV) Rep proteins mediate complex formation between AAV DNA and its integration site in human DNA.

    PubMed Central

    Weitzman, M D; Kyöstiö, S R; Kotin, R M; Owens, R A

    1994-01-01

    AAV is unique among eukaryotic viruses in the ability of its DNA to integrate preferentially into a specific region of the human genome. Understanding AAV integration may aid in developing gene therapy systems with predictable integration sites. Using a gel mobility-shift assay, we have identified a DNA sequence within the AAV integration locus on human chromosome 19 which is specifically bound by the AAV Rep78 and Rep68 proteins. This Rep recognition sequence is a GCTC repeating motif very similar to sequences within the inverted terminal repeats of the AAV genome which are also bound by Rep78 and Rep68. Cloned oligonucleotides containing the recognition sequence can direct specific binding by Rep proteins. Binding assays with mutant Rep proteins show that the amino-terminal portion of Rep78 and Rep68 can direct binding to either the AAV terminal repeat hairpin DNA or chromosome 19. This human genomic DNA can be complexed with AAV DNA by Rep proteins as demonstrated by a dual-label (32P/biotin) assay. These results suggest a role for Rep in targeting viral integration. Images PMID:8016070

  5. Formation of nanostructured porous Cu-Au surfaces: the influence of cationic sites on (electro)-catalysis

    NASA Astrophysics Data System (ADS)

    Najdovski, Ilija; Selvakannan, Pr.; Bhargava, Suresh K.; O'Mullane, Anthony P.

    2012-09-01

    The fabrication of nanostructured bimetallic materials through electrochemical routes offers the ability to control the composition and shape of the final material that can then be effectively applied as (electro)-catalysts. In this work a clean and transitory hydrogen bubble templating method is employed to generate porous Cu-Au materials with a highly anisotropic nanostructured interior. Significantly, the co-electrodeposition of copper and gold promotes the formation of a mixed bimetallic oxide surface which does not occur at the individually electrodeposited materials. Interestingly, the surface is dominated by Au(i) oxide species incorporated within a Cu2O matrix which is extremely effective for the industrially important (electro)-catalytic reduction of 4-nitrophenol. It is proposed that an aurophilic type of interaction takes place between both oxidized gold and copper species which stabilizes the surface against further oxidation and facilitates the binding of 4-nitrophenol to the surface and increases the rate of reaction. An added benefit is that very low gold loadings are required typically less than 2 wt% for a significant enhancement in performance to be observed. Therefore the ability to create a partially oxidized Cu-Au surface through a facile electrochemical route that uses a clean template consisting of only hydrogen bubbles should be of benefit for many more important reactions.The fabrication of nanostructured bimetallic materials through electrochemical routes offers the ability to control the composition and shape of the final material that can then be effectively applied as (electro)-catalysts. In this work a clean and transitory hydrogen bubble templating method is employed to generate porous Cu-Au materials with a highly anisotropic nanostructured interior. Significantly, the co-electrodeposition of copper and gold promotes the formation of a mixed bimetallic oxide surface which does not occur at the individually electrodeposited materials

  6. Remobilization causes site-specific cyst formation in immobilization-induced knee cartilage degeneration in an immobilized rat model.

    PubMed

    Nagai, Momoko; Ito, Akira; Tajino, Junichi; Iijima, Hirotaka; Yamaguchi, Shoki; Zhang, Xiangkai; Aoyama, Tomoki; Kuroki, Hiroshi

    2016-06-01

    An understanding of the articular cartilage degenerative process is necessary for the prevention and treatment of joint disease. The present study aimed to examine how long-term immobilization-induced cartilage degeneration is aggravated by remobilization. Sixty 8-week-old male Wistar rats were used in this study. The unilateral knee joint was immobilized using an external fixator for 8 weeks. The rats were killed at 0 and 3 days, and at 1, 2, 4 and 8 weeks after removing the fixator. After the rats were killed, the maximum knee extension angles were measured. Histological sections at the medial mid-condylar region (non-contact, transitional and contact regions of the femur and tibia) were prepared and scored. The cartilage thickness and number of chondrocytes were measured, and CD44 and Col2-3/4c expression levels were assessed immunohistochemically. The histological assessment revealed progressive aggravation of cartilage degeneration in the transitional region, with a decreased number of chondrocytes and CD44-positive chondrocytes as well as poor scoring over time, particularly in the tibia. Cyst formation was confirmed in the transitional region of the tibia at 8 weeks post-remobilization. The cartilage thickness in the transitional region was thicker than that in the contact region, particularly in the tibia. Col2-3/4c expression was observed in the non-contact and transitional regions, and the knee extension angle was recovered. In conclusion, immobilization-induced cartilage degeneration was aggravated by remobilization over time in the transitional region, followed by observations of a decreased number of chondrocytes and morphological disparity between different cartilage regions. PMID:26989984

  7. Site-specific targeting of aflatoxin adduction directed by triple helix formation in the major groove of oligodeoxyribonucleotides.

    PubMed Central

    Jones, W R; Stone, M P

    1998-01-01

    The targeted adduction of aflatoxin B1- exo -8,9-epoxide (AFB1- exo -8,9-epoxide) to a specific guanine within an oligodeoxyribonucleotide containing multiple guanines was achieved using a DNA triplex to control sequence selectivity. The oligodeoxyribonucleotide d(AGAGAAGATTTTCTTCTCTTTTTTTTCTCTT), designated '3G', spontaneously formed a triplex in which nucleotides C27*G2*C18 and C29*G4*C16 formed base triplets, and nucleotides G7*C13formed a Watson-Crick base pair. The oligodeoxyribonucleotide d(AAGAAATTTTTTCTTTTTTTTTTCTT), designated '1G', also formed a triplex in which nucleotides C24*G3*C24 formed a triplet. Reaction of the two oligodeoxyribonucleotides with AFB1-exo-8,9-epoxide revealed that only the 3G sequence formed an adduct, as determined by UV absorbance and piperidine cleavage of the 5'-labeled adduct, followed by denaturing polyacrylamide gel electrophoresis. This site was identified as G7by comparison to the guanine-specific cleavage pattern. The chemistry was extended to a series of nicked bimolecular triple helices, constructed from d(AAAGGGGGAA) and d(CnTTCTTTTTCCCCCTTTATTTTTTC5-n) (n = 1-5). Each oligomer in the series differed only in the placement of the nick. Reaction of the nicked triplexes with AFB1- exo -8,9-epoxide, piperidine cleavage of the 5'-labeled adduct, followed by denaturing polyacrylamide gel electrophoresis, revealed cleavage corresponding to the guanine closest to the pyrimidine strand nick. By using the appropriate pyrimidine sequence the lesion was positioned within the purine strand. PMID:9461470

  8. Molecular dynamics simulations of apocupredoxins: insights into the formation and stabilization of copper sites under entatic control.

    PubMed

    Abriata, Luciano A; Vila, Alejandro J; Dal Peraro, Matteo

    2014-06-01

    Cupredoxins perform copper-mediated long-range electron transfer (ET) in biological systems. Their copper-binding sites have evolved to force copper ions into ET-competent systems with decreased reorganization energy, increased reduction potential, and a distinct electronic structure compared with those of non-ET-competent copper complexes. The entatic or rack-induced state hypothesis explains these special properties in terms of the strain that the protein matrix exerts on the metal ions. This idea is supported by X-ray structures of apocupredoxins displaying "closed" arrangements of the copper ligands like those observed in the holoproteins; however, it implies completely buried copper-binding atoms, conflicting with the notion that they must be exposed for copper loading. On the other hand, a recent work based on NMR showed that the copper-binding regions of apocupredoxins are flexible in solution. We have explored five cupredoxins in their "closed" apo forms through molecular dynamics simulations. We observed that prearranged ligand conformations are not stable as the X-ray data suggest, although they do form part of the dynamic landscape of the apoproteins. This translates into variable flexibility of the copper-binding regions within a rigid fold, accompanied by fluctuations of the hydrogen bonds around the copper ligands. Major conformations with solvent-exposed copper-binding atoms could allow initial binding of the copper ions. An eventual subsequent incursion to the closed state would result in binding of the remaining ligands, trapping the closed conformation thanks to the additional binding energy and the fastening of noncovalent interactions that make up the rack. PMID:24477946

  9. Crystal Structure of the Nonerythroid [alpha]-Spectrin Tetramerization Site Reveals Differences between Erythroid and Nonerythroid Spectrin Tetramer Formation

    SciTech Connect

    Mehboob, Shahila; Song, Yuanli; Witek, Marta; Long, Fei; Santarsiero, Bernard D.; Johnson, Michael E.; Fung, Leslie W.-M.

    2010-06-21

    We have solved the crystal structure of a segment of nonerythroid {alpha}-spectrin ({alpha}II) consisting of the first 147 residues to a resolution of 2.3 {angstrom}. We find that the structure of this segment is generally similar to a corresponding segment from erythroid {alpha}-spectrin ({alpha}I) but exhibits unique differences with functional significance. Specific features include the following: (i) an irregular and frayed first helix (Helix C{prime}); (ii) a helical conformation in the junction region connecting Helix C{prime} with the first structural domain (D1); (iii) a long A1B1 loop in D1; and (iv) specific inter-helix hydrogen bonds/salt bridges that stabilize D1. Our findings suggest that the hydrogen bond networks contribute to structural domain stability, and thus rigidity, in {alpha}II, and the lack of such hydrogen bond networks in {alpha}I leads to flexibility in {alpha}I. We have previously shown the junction region connecting Helix C{prime} to D1 to be unstructured in {alpha}I (Park, S., Caffrey, M. S., Johnson, M. E., and Fung, L. W. (2003) J. Biol. Chem. 278, 21837-21844) and now find it to be helical in {alpha}II, an important difference for {alpha}-spectrin association with {beta}-spectrin in forming tetramers. Homology modeling and molecular dynamics simulation studies of the structure of the tetramerization site, a triple helical bundle of partial domain helices, show that mutations in {alpha}-spectrin will affect Helix C{prime} structural flexibility and/or the junction region conformation and may alter the equilibrium between spectrin dimers and tetramers in cells. Mutations leading to reduced levels of functional tetramers in cells may potentially lead to abnormal neuronal functions.

  10. On the nature and formation of the active sites in Re[sub 2]O[sub 7] metathesis catalysts supported on borated alumina

    SciTech Connect

    Sibeijn, M.; Bliek, A. ); Veen, J.A.R. van ); Moulijn, J.A. )

    1994-02-01

    Re[sub 2]O[sub 7] catalysts on borated aluminas have been investigated with a view to correlating the structure of the active site and its activity in the metathesis of methyl oleate. Modification of alumina with boria results in much more active metathesis catalysts. Infrared spectroscopy was used for the characterization, pyridine adsorption measurements for determining the Lewis acid and Bronsted acid sites, and temperature-programmed IR measurements to follow the reactions occurring during calcination of the supports and catalysts. Boria binds to the surface via the alumina hydroxyls. Upon Re[sub 2]O[sub 7] loading of nonborated alumina, the ReO[sub 4] groups react first with Lewis acid sites, onto which they are strongly bonded. Above a Re[sub 2]O[sub 7] loading of 3 wt% surface hydroxyls are also substituted by Re[sub 2]O[sub 7] groups, resulting in an increase in catalytic activity. When the borated supports are loaded with Re[sub 2]O[sub 7], the ReO[sub 4] groups are also first bonded to the Lewis acid sites. During calcination these ReO[sub 4] groups substitute surface hydroxyls preferably on alumina hydroxyls. The substitution of the boron hydroxyls only takes place at a calcination time of at least 2 h at 823 K. At high borate loadings (>10 wt%) the reaction of ReO[sub 4] groups with boron hydroxyls competes with the condensation reaction of two neighbouring boron hydroxyls. Taking into account that a ReO[sub 4] group which has substituted in acidic OH group on the support is the precursor of an active site, the increase in activity of Re[sub 2]O[sub 7] catalysts by modification of the alumina support with boria can be ascribed to two effects, namely, the reduction of the bonding strength of Lewis acid sites with ReO[sub 4], making the ReO[sub 4]-OH substitution reaction possible during calcination even at low rhenium loadings, and the formation of acidic surface hydroxyls. 16 refs., 11 figs., 3 tabs.

  11. Site- and Enantioselective Formation of Allene-Bearing Tertiary or Quaternary Carbon Stereogenic Centers through NHC–Cu-Catalyzed Allylic Substitution

    PubMed Central

    Jung, Byunghyuck; Hoveyda, Amir H.

    2012-01-01

    Catalytic enantioselective allylic substitutions that result in exclusive addition of an allenyl group (<2% propargyl addition) and formation of tertiary or quaternary C–C bonds are described. Commercially available allenylboronic acid pinacol ester is used (preparation of a more reactive but less stable boronate derivative not required). Reactions are promoted by 5.0–10 mol % of sulfonate-bearing chiral bidentate N-heterocyclic carbene (NHC) complexes of copper, which exhibit the unique ability to furnish chiral products arising from SN2′ mode of addition. The desired allenyl-containing products are generated in up to 95% yield, >98% SN2′ selectivity and 99:1 enantiomeric ratio (er). Site-selective NHC–Cu-catalyzed hydroboration of enantiomerically enriched allenes and conversion to the corresponding β-vinyl ketones demonstrates utility. PMID:22214185

  12. Formation of lipid bilayer membrane in a poly(dimethylsiloxane) microchip integrated with a stacked polycarbonate membrane support and an on-site nanoinjector.

    PubMed

    Teng, Wei; Ban, Changill; Hahn, Jong Hoon

    2015-03-01

    This paper describes a new and facile approach for the formation of pore-spanning bilayer lipid membranes (BLMs) within a poly(dimethylsiloxane) (PDMS) microfluidic device. Commercially, readily available polycarbonate (PC) membranes are employed for the support of BLMs. PC sheets with 5 μm, 2 μm, and 0.4 μm pore diameters, respectively, are thermally bonded into a multilayer-stack, reducing the pore density of 0.4 μm-pore PC by a factor of 200. The BLMs on this support are considerably stable (a mean lifetime: 17 h). This multilayer-stack PC (MSPC) membrane is integrated into the PDMS chip by an epoxy bonding method developed to secure durable bonding under the use of organic solvents. The microchip has a special channel for guiding a micropipette in the proximity of the MSPC support. With this on-site injection technique, tens to hundreds of nanoliters of solutions can be directly dispensed to the support. Incorporating gramicidin ion channels into BLMs on the MSPC support has confirmed the formation of single BLMs, which is based on the observation from current signals of 20 pS conductance that is typical to single channel opening. Based on the bilayer capacitance (1.4 pF), about 15% of through pores across the MSPC membrane are estimated to be covered with BLMs. PMID:26015832

  13. Formation of lipid bilayer membrane in a poly(dimethylsiloxane) microchip integrated with a stacked polycarbonate membrane support and an on-site nanoinjector

    PubMed Central

    Teng, Wei; Ban, Changill; Hahn, Jong Hoon

    2015-01-01

    This paper describes a new and facile approach for the formation of pore-spanning bilayer lipid membranes (BLMs) within a poly(dimethylsiloxane) (PDMS) microfluidic device. Commercially, readily available polycarbonate (PC) membranes are employed for the support of BLMs. PC sheets with 5 μm, 2 μm, and 0.4 μm pore diameters, respectively, are thermally bonded into a multilayer-stack, reducing the pore density of 0.4 μm-pore PC by a factor of 200. The BLMs on this support are considerably stable (a mean lifetime: 17 h). This multilayer-stack PC (MSPC) membrane is integrated into the PDMS chip by an epoxy bonding method developed to secure durable bonding under the use of organic solvents. The microchip has a special channel for guiding a micropipette in the proximity of the MSPC support. With this on-site injection technique, tens to hundreds of nanoliters of solutions can be directly dispensed to the support. Incorporating gramicidin ion channels into BLMs on the MSPC support has confirmed the formation of single BLMs, which is based on the observation from current signals of 20 pS conductance that is typical to single channel opening. Based on the bilayer capacitance (1.4 pF), about 15% of through pores across the MSPC membrane are estimated to be covered with BLMs. PMID:26015832

  14. EBNA2 Drives Formation of New Chromosome Binding Sites and Target Genes for B-Cell Master Regulatory Transcription Factors RBP-jκ and EBF1.

    PubMed

    Lu, Fang; Chen, Horng-Shen; Kossenkov, Andrew V; DeWispeleare, Karen; Won, Kyoung-Jae; Lieberman, Paul M

    2016-01-01

    Epstein-Barr Virus (EBV) transforms resting B-lymphocytes into proliferating lymphoblasts to establish latent infections that can give rise to malignancies. We show here that EBV-encoded transcriptional regulator EBNA2 drives the cooperative and combinatorial genome-wide binding of two master regulators of B-cell fate, namely EBF1 and RBP-jκ. Previous studies suggest that these B-cell factors are statically bound to target gene promoters. In contrast, we found that EBNA2 induces the formation of new binding for both RBP-jκ and EBF1, many of which are in close physical proximity in the cellular and viral genome. These newly induced binding sites co-occupied by EBNA2-EBF1-RBP-jκ correlate strongly with transcriptional activation of linked genes that are important for B-lymphoblast function. Conditional expression or repression of EBNA2 leads to a rapid alteration in RBP-jκ and EBF1 binding. Biochemical and shRNA depletion studies provide evidence for cooperative assembly at co-occupied sites. These findings reveal that EBNA2 facilitate combinatorial interactions to induce new patterns of transcription factor occupancy and gene programming necessary to drive B-lymphoblast growth and survival. PMID:26752713

  15. EBNA2 Drives Formation of New Chromosome Binding Sites and Target Genes for B-Cell Master Regulatory Transcription Factors RBP-jκ and EBF1

    PubMed Central

    Lu, Fang; Chen, Horng-Shen; Kossenkov, Andrew V.; DeWispeleare, Karen; Won, Kyoung-Jae; Lieberman, Paul M.

    2016-01-01

    Epstein-Barr Virus (EBV) transforms resting B-lymphocytes into proliferating lymphoblasts to establish latent infections that can give rise to malignancies. We show here that EBV-encoded transcriptional regulator EBNA2 drives the cooperative and combinatorial genome-wide binding of two master regulators of B-cell fate, namely EBF1 and RBP-jκ. Previous studies suggest that these B-cell factors are statically bound to target gene promoters. In contrast, we found that EBNA2 induces the formation of new binding for both RBP-jκ and EBF1, many of which are in close physical proximity in the cellular and viral genome. These newly induced binding sites co-occupied by EBNA2-EBF1-RBP-jκ correlate strongly with transcriptional activation of linked genes that are important for B-lymphoblast function. Conditional expression or repression of EBNA2 leads to a rapid alteration in RBP-jκ and EBF1 binding. Biochemical and shRNA depletion studies provide evidence for cooperative assembly at co-occupied sites. These findings reveal that EBNA2 facilitate combinatorial interactions to induce new patterns of transcription factor occupancy and gene programming necessary to drive B-lymphoblast growth and survival. PMID:26752713

  16. The formation of phosphoran olivine and stanfieldite from the pyrometamorphic breakdown of apatite in slags from a prehistoric ritual immolation site (Goldbichl, Igls, Tyrol, Austria)

    NASA Astrophysics Data System (ADS)

    Schneider, Philipp; Tropper, Peter; Kaindl, Reinhard

    2013-04-01

    the M1 2+ and M2 2+ positions and the formation of vacancies on these sites. Since micro-Raman investigations of the TCP phase yielded no conclusive match with a known Raman spectrum of a phosphate mineral so far, therefore it is most likely that the TCP phase is stanfieldite, whose Raman spectrum has not been obtained yet. Schematical Schreinemakers analysis in the system CaO-Al2O3-FeO-SiO2-P2O5-H2O shows that P-rich olivine (fayalite-sarcopside solid solution) can form from mineral reactions involving chlorite, apatite and quartz and show that the occurrence of P-rich Fe-olivines spans a large T-range but is restricted to domains with high aSiO2. The mineral assemblage in the P-rich micro-domains shows that the formation of phosphoran olivine is not only restricted to the interaction between bone material and rocks in slags from ritual immolation sites as suggested by Tropper et al. (Eur J Mineral 16:631-640, 2004) from the immolation site in Oetz but can form locally due to the pyrometamorphic breakdown of a P-rich accessory precursor phase such as apatite.

  17. Mapping of contact sites in complex formation between transducin and light-activated rhodopsin by covalent crosslinking: use of a photoactivatable reagent.

    PubMed

    Cai, K; Itoh, Y; Khorana, H G

    2001-04-24

    Interaction of light-activated rhodopsin with transducin (T) is the first event in visual signal transduction. We use covalent crosslinking approaches to map the contact sites in interaction between the two proteins. Here we use a photoactivatable reagent, N-[(2-pyridyldithio)-ethyl], 4-azido salicylamide. The reagent is attached to the SH group of cytoplasmic monocysteine rhodopsin mutants by a disulfide-exchange reaction with the pyridylthio group, and the derivatized rhodopsin then is complexed with T by illumination at lambda >495 nm. Subsequent irradiation of the complex at lambda310 nm generates covalent crosslinks between the two proteins. Crosslinking was demonstrated between T and a number of single cysteine rhodopsin mutants. However, sites of crosslinks were investigated in detail only between T and the rhodopsin mutant S240C (cytoplasmic loop V-VI). Crosslinking occurred predominantly with T(alpha). For identification of the sites of crosslinks in T(alpha), the strategy used involved: (i) derivatization of all of the free cysteines in the crosslinked proteins with N-ethylmaleimide; (ii) reduction of the disulfide bond linking the two proteins and isolation of all of the T(alpha) species carrying the crosslinked moiety with a free SH group; (iii) adduct formation of the latter with the N-maleimide moiety of the reagent, maleimido-butyryl-biocytin, containing a biotinyl group; (iv) trypsin degradation of the resulting T(alpha) derivatives and isolation of T(alpha) peptides carrying maleimido-butyryl-biocytin by avidin-agarose chromatography; and (v) identification of the isolated peptides by matrix-assisted laser desorption/ionization time-of-flight mass spectrometry. We found that crosslinking occurred mainly to two C-terminal peptides in T(alpha) containing the amino acid sequences 310-313 and 342-345. PMID:11320237

  18. Effect of Siloxane Ring Strain and Cation Charge Density on the Formation of Coordinately Unsaturated Metal Sites on Silica: Insights from DFT Studies

    SciTech Connect

    Das, Ujjal; Zhang, Guanghui; Hu, Bo; Hock, Adam S.; Redfern, Paul C.; Miller, Jeffrey T.; Curtiss, Larry A.

    2015-12-01

    Amorphous silica (SiO2) is commonly used as a support in heterogeneous catalysis. However, due to the structural disorder and temperature induced change of surface morphology, the structures of silica supported metal catalysts are difficult to determine. Most studies are primarily focused on understanding the interactions of different types of surface hydroxyl groups with metal ions. In comparison, the effect of siloxane ring size on the structure of silica supported metal catalysts and how it affects catalytic activity is poorly understood. Here, we have used density functional theory calculations to understand the effect of siloxane ring strain on structure and activity of different monomeric Lewis acid metal sites on silica. In particular, we have found that large siloxane rings favor strong dative bonding interaction between metal ion and surface hydroxyls, leading to the formation of high-coordinate metal sites. In comparison, metal-silanol interaction is weak in small siloxane rings, resulting in low-coordinate metal sites. The physical origin of this size dependence is associated with siloxane ring strain, and, a correlation between metal-silanol interaction energy and ring strain energy has been observed. In addition to ring strain, the strength of the metal-silanol interaction also depends on the positive charge density of the cations. In fact, a correlation also exists between metal-silanol interaction energy and charge density of several first-row transition and post-transition metals. The theoretical results are compared with the EXAFS data of monomeric Zn(II) and Ga(III) ions grafted on silica. The molecular level insights of how metal ion coordination on silica depends on siloxane ring strain and cation charge density will be useful in the synthesis of new catalysts.

  19. Nuclear, chemical and biological characterization of formation histories of ironstones from several sites in Southern California: Dominant role of bacterial activity

    NASA Astrophysics Data System (ADS)

    Lal, D.; Schopf, J. W.; Abbott, P. L.; Vacher, L.; Jull, A. J. T.; McHargue, L.

    2010-08-01

    Pebble-sized sandstone concretions, cemented by iron and manganese oxides, are found in several semi-arid regions in the world. Although recognized for a long time, their formation mechanisms have not yet been constrained from scientific studies. We have made extensive studies of the chemical composition, cosmogenic 10Be and radiogenic U/Th concentrations, and biological fossils in ironstones from six sites in southern California. The ironstones exhibit appreciable enrichments of Mn, Zn, Mg, Ti, Fe, U, Th, and fossil bacteria. In addition to elemental data, we report here first observations of radionuclides, U, Th, K, and concentrations of cosmogenic 10Be which we show are an excellent indicator of precipitation amounts. Our data favor the model that the ironstones formed within sandy beach ridges during wetter climates following dry climates during which aeolian sediment was added to the beach ridges. Iron, Mn, Zn and other trace element-rich leachates from the dust layers nurtured and accelerated bacterial activity in the beach ridges down to depths of a few meters, as first suggested by Abbott (1981). Our observations of trace-element enrichments and bacterial fossils support the model proposed by Abbott and underscore the fact that the ironstones are principally a product of bacterial activity, which concentrates the leachates in a narrow layer within the beach ridges. The extreme alternating dry/wet climatic conditions which existed in the past in southern California led to the formation of ironstone concretions within the ancient beach ridges, which provided suitable host mineralogy for their formation. The time periods represented by the ironstones from the six sites presumably cover the past ˜ 1 my. The recent surface explorations on the surface of Mars by the rovers SPIRIT and OPPORTUNITY (Squyres et al., 2006), showed that similar to southern California, extreme climatic conditions existed on Mars in its early history. It therefore seems that studies of

  20. Repeated occurrences of methanogenic zones, diagenetic dolomite formation and linked silicate alteration in southern Bering Sea sediments (Bowers Ridge, IODP Exp. 323 Site U1341)

    NASA Astrophysics Data System (ADS)

    Wehrmann, L. M.; Ockert, C.; Mix, A. C.; Gussone, N.; Teichert, B. M. A.; Meister, P.

    2016-03-01

    porewater calcium was also influenced by ammonium-calcium exchange on clay minerals and carbonate recrystallization. Our study elucidates the response of porewater element concentrations and isotopic profiles interlinked with the formation of diagenetic carbonates to changes in the deposition of organic carbon in sediments of deeper water sites (>2000 m water depth) over prolonged timescales. It shows that variations in biogeochemical processes in response to changes in oceanographic conditions and a dynamic subseafloor biogeochemical zonation have to also be taken into account at these deep water sites for a global assessment of organic carbon burial fluxes and remineralization.

  1. The mechanism of formation of the seafloor massive sulfide ore body beneath the seafloor at HAKUREI Site in Izena Caldera, Middle Okinawa Trough

    NASA Astrophysics Data System (ADS)

    Yoshizumi, R.; Urabe, T.

    2012-12-01

    dominant at lower of the ore, relatively. The existence of "Black ore (sphalerite-galena ore)" at upper part and "Yellow ore (chalcopyrite-pyrite ore)" at lower part of the Lower ore indicate that the SMS ore beneath the seafloor has already the characteristic mineral assemblage of Kuroko ore deposit at the time of formation. Fe content in Sphalerite is over 6wt% in the Upper ore and under 1wt% in the Lower ore, respectively, which shows that the Lower ore is formed under high Sulfur and Oxygen fugacity than Upper ore if the temperature of formation is not very different each other. Barite occurs not only in the Upper ore, but also in the Lower ore and the crystal size becomes coarser downwards. These lines of evidence imply that the existence of the Lower ore indicates that the mineralization has been repeated in the HAKUREI site. This study is a part of "TAIGA" project funded by Grant-in-Aid program by Monbusho.t; t;

  2. A selective, slow binding inhibitor of factor VIIa binds to a nonstandard active site conformation and attenuates thrombus formation in vivo.

    PubMed

    Olivero, Alan G; Eigenbrot, Charles; Goldsmith, Richard; Robarge, Kirk; Artis, Dean R; Flygare, John; Rawson, Thomas; Sutherlin, Daniel P; Kadkhodayan, Saloumeh; Beresini, Maureen; Elliott, Linda O; DeGuzman, Geralyn G; Banner, David W; Ultsch, Mark; Marzec, Ulla; Hanson, Stephen R; Refino, Canio; Bunting, Stuart; Kirchhofer, Daniel

    2005-03-11

    The serine protease factor VIIa (FVIIa) in complex with its cellular cofactor tissue factor (TF) initiates the blood coagulation reactions. TF.FVIIa is also implicated in thrombosis-related disorders and constitutes an appealing therapeutic target for treatment of cardiovascular diseases. To this end, we generated the FVIIa active site inhibitor G17905, which displayed great potency toward TF.FVIIa (Ki = 0.35 +/- 0.11 nM). G17905 did not appreciably inhibit 12 of the 14 examined trypsin-like serine proteases, consistent with its TF.FVIIa-specific activity in clotting assays. The crystal structure of the FVIIa.G17905 complex provides insight into the molecular basis of the high selectivity. It shows that, compared with other serine proteases, FVIIa is uniquely equipped to accommodate conformational disturbances in the Gln217-Gly219 region caused by the ortho-hydroxy group of the inhibitor's aminobenzamidine moiety located in the S1 recognition pocket. Moreover, the structure revealed a novel, nonstandard conformation of FVIIa active site in the region of the oxyanion hole, a "flipped" Lys192-Gly193 peptide bond. Macromolecular substrate activation assays demonstrated that G17905 is a noncompetitive, slow-binding inhibitor. Nevertheless, G17905 effectively inhibited thrombus formation in a baboon arterio-venous shunt model, reducing platelet and fibrin deposition by approximately 70% at 0.4 mg/kg + 0.1 mg/kg/min infusion. Therefore, the in vitro potency of G17905, characterized by slow binding kinetics, correlated with efficacious antithrombotic activity in vivo. PMID:15632123

  3. Investigation of the Davis Sandstone (Ft. Worth Basin, Texas) as a suitable formation for the GRI Hydraulic Fracture Test Site. Topical report, March 1992

    SciTech Connect

    Collins, E.; Laubach, S.; Dutton, S.; Kukal, G.; Robinson, B.

    1992-03-01

    The concept of the GRI Hydraulic Fracture Test Site (HFTS) was to provide a field laboratory to (1) validate 3-dimensional hydraulic fracture models in tight gas sandstone and (2) develop technology in fracture diagnostics and stimulation. The Davis sandstone in the Ft. Worth Basin, north-central Texas, was initially selected as a viable candidate formation for HFTS research based on the results of a co-op well program initiated with Dallas Production. To gather comprehensive data on a specific site for HFTS research, the S.A. Holditch and Associates Data Well No. 1 was drilled in June 1991. The results of geological, petrophysical and engineering analyses of the co-ops and data well are the basis of the report. These analyses indicate that in northern Parker and southern Wise Counties, Texas, the Davis sediments range from 250 to 350 ft thick. A broadly-continuous, 100-ft thick interval in the upper part of the gross interval comprises the Davis Reservoir. The average permeability of the Davis Reservoir was found to be 0.08 md with an average closure stress of 0.45 psi/ft. The shale barriers above and below the Davis had average closure stress of 0.63 to 0.73 psi/ft and 0.88 to 0.98 psi/ft, respectively. Hydraulic fracture azimuth was found to range from N10 E to N20 E. Drainage area from production analyses was calculated to be 48.7 acres in northwest Parker County. Natural fractures were encountered in the Davis, causing severe drilling problems in Data Well No. 1. Further work in the Davis was therefore suspended.

  4. Characterization of DNA end joining in a mammalian cell nuclear extract: junction formation is accompanied by nucleotide loss, which is limited and uniform but not site specific.

    PubMed Central

    Nicolás, A L; Young, C S

    1994-01-01

    Mammalian cells have a marked capacity to repair double-strand breaks in DNA, but the molecular and biochemical mechanisms underlying this process are largely unknown. A previous report has described an activity from mammalian cell nuclei that is capable of multimerizing blunt-ended DNA substrates (R. Fishel, M.K. Derbyshire, S.P. Moore, and C.S.H. Young, Biochimie 73:257-267, 1991). In this report, we show that nuclear extracts from HeLa cells contain activities which preferentially join linear plasmid substrates in either a head-to-head or tail-to-tail configuration, that the joining reaction is covalent, and that the joining is accompanied by loss of sequence at the junction. Sequencing revealed that there was a loss of a uniform number of nucleotides from junctions formed from any one type of substrate. The loss was not determined by any simple site-specific mechanism, but the number of nucleotides lost was affected by the precise terminal sequence. There was no major effect on the efficiency or outcome of the joining reaction with substrates containing blunt ends or 3' or 5' protruding ends. Using a pair of plasmid molecules with distinguishable restriction enzyme sites, we also observed that blunt-ended DNA substrates could join with those containing protruding 3' ends. As with the junctions formed between molecules with identical ends, there was uniform loss of nucleotides. Taken together, the data are consistent with two models for the joining reaction in which molecules are aligned either throughout most of their length or by using small sequence homologies located toward their ends. Although either model can explain the preferential formation of head-to-head and tail-to-tail products, the latter predicts the precise lossof nucleotides observed. These activities are found in all cell lines examined so far and most likely represent an important repair activity of the mammalian cell. Images PMID:8264584

  5. Evaluation of small-loop transient electromagnetic soundings to locate the Sherwood Sandstone aquifer and confining formations at well sites in the Vale of York, England

    NASA Astrophysics Data System (ADS)

    Meju, M. A.; Fenning, P. J.; Hawkins, T. R. W.

    2000-05-01

    Shallow-depth transient electromagnetic (TEM) soundings have been performed at six borehole locations in an intensively farmed area in northern England to evaluate their usefulness in mapping geological formations under a thick cover of glacial drift deposits. The regionally important Triassic Sherwood Sandstone (SS) Group aquifer is directly overlain by Triassic Mercia Mudstone in the eastern two-thirds of the study area and by drift deposits in the west. Owing to the difficulty of deploying large loops and the overriding need to minimize lateral effects on the depth probes, square transmitter loops of 20, 40 and 50-m side-lengths were deployed in the central-loop configuration with the Geonics EM47 and PROTEM47/57 field equipment. Using a two-stage data interpretation technique, it is found that the effective depth of mapping ranged from about 8 to 150 m at most sounding locations. Comparison of inversion models with borehole data shows that the SS and some overlying sedimentary rocks may be discerned from the TEM soundings; there is a consistent pattern of resistivity distribution within each geological formation at all the borehole sites enabling a realistic identification of the key stratal units. However, a 7-11-m-thick upper layer is found in all the constructed models, which does not correlate with any known formation boundaries, but appears to be justified by comparison with sample dc resistivity soundings at two locations; it would also appear that the earliest time windows (<0.016 ms) are somewhat distorted by the band-limitation operation of the TEM instrumentation. This pilot study demonstrates that the TEM method is a potent tool for stratigraphic mapping in the region, but the upper 5-8 m remains largely inaccessible to the method using state-of-the-art equipment and conventional data processing techniques. It may therefore be necessary to combine TEM and short spread-length ( AB/2≤25 m) dc resistivity depth soundings to accurately map the near

  6. Discriminatory profile of rDNA sites and trend for acrocentric chromosome formation in the genus Trachinotus Lacépède, 1801 (Perciformes, Carangidae).

    PubMed

    Jacobina, Uedson Pereira; Vicari, Marcelo Ricardo; Bertollo, Luiz Antonio Carlos; Molina, Wagner Franco

    2012-01-01

    Chromosomal traits have provided valuable information for phylogeny and taxonomy of several fish groups. Three Atlantic Carangidae species of the genus Trachinotus Lacépède, 1801 (Trachinotus goodei Jordan et Evermann, 1896, Trachinotus carolinus (Linnaeus, 1766)and Trachinotus falcatus (Linnaeus, 1758)) were investigated, having 2n=48 chromosomes but different chromosomal arms (FN number), i.e., 52, 56 and 58, respectively, in view of the different number of two-armed chromosomes found in their karyotypes. Thus, Trachinotus goodei, Trachinotus carolinus and Trachinotus falcatus present a progressive distancefrom the probable basal karyotype proposed for Perciformes (2n=48 acrocentrics, FN=48). At first sight, these findings do not agree with the phylogenetic hypothesis based on mitochondrial sequences, where Trachinotus goodei appear as the most derived species, followed by Trachinotus falcatus and Trachinotus carolinus, respectively. However, the chromosomal mapping of ribosomal DNAs was informative for clarifying this apparent conflict. Indeed, the multiple 5S and 18S rDNA sites found in Trachinotus goodei corroborate the most derived condition for this species. In this sense, the occurrence of the unexpected number of two-armed chromosomes and FN value for this species, as well as for Trachinotus carolinus, must be due to additional rounds of acrocentric formation in these species, modifying the macrostructure of their karyotypes. PMID:24260676

  7. CO 2-rock-brine interactions in Lower Tuscaloosa Formation at Cranfield CO 2 sequestration site, Mississippi, U.S.A.

    USGS Publications Warehouse

    Lu, J.; Kharaka, Y.K.; Thordsen, J.J.; Horita, J.; Karamalidis, A.; Griffith, C.; Hakala, J.A.; Ambats, G.; Cole, D.R.; Phelps, T.J.; Manning, M.A.; Cook, P.J.; Hovorka, S.D.

    2012-01-01

    A highly integrated geochemical program was conducted at the Cranfield CO 2-enhanced oil recovery (EOR) and sequestration site, Mississippi, U.S.A.. The program included extensive field geochemical monitoring, a detailed petrographic study, and an autoclave experiment under in situ reservoir conditions. Results show that mineral reactions in the Lower Tuscaloosa reservoir were minor during CO 2 injection. Brine chemistry remained largely unchanged, which contrasts with significant changes observed in other field tests. Field fluid sampling and laboratory experiments show consistently slow reactions. Carbon isotopic composition and CO 2 content in the gas phase reveal simple two-end-member mixing between injected and original formation gas. We conclude that the reservoir rock, which is composed mainly of minerals with low reactivity (average quartz 79.4%, chlorite 11.8%, kaolinite 3.1%, illite 1.3%, concretionary calcite and dolomite 1.5%, and feldspar 0.2%), is relatively unreactive to CO 2. The significance of low reactivity is both positive, in that the reservoir is not impacted, and negative, in that mineral trapping is insignificant. ?? 2011.

  8. Discriminatory profile of rDNA sites and trend for acrocentric chromosome formation in the genus Trachinotus Lacépède, 1801 (Perciformes, Carangidae)

    PubMed Central

    Jacobina, Uedson Pereira; Vicari, Marcelo Ricardo; Bertollo, Luiz Antonio Carlos; Molina, Wagner Franco

    2012-01-01

    Abstract Chromosomal traits have provided valuable information for phylogeny and taxonomy of several fish groups. Three Atlantic Carangidae species of the genus Trachinotus Lacépède, 1801 (Trachinotus goodei Jordan et Evermann, 1896, Trachinotus carolinus (Linnaeus, 1766)and Trachinotus falcatus (Linnaeus, 1758)) were investigated, having 2n=48 chromosomes but different chromosomal arms (FN number), i.e., 52, 56 and 58, respectively, in view of the different number of two-armed chromosomes found in their karyotypes. Thus, Trachinotus goodei, Trachinotus carolinus and Trachinotus falcatus present a progressive distancefrom the probable basal karyotype proposed for Perciformes (2n=48 acrocentrics, FN=48). At first sight, these findings do not agree with the phylogenetic hypothesis based on mitochondrial sequences, where Trachinotus goodei appear as the most derived species, followed by Trachinotus falcatus and Trachinotus carolinus, respectively. However, the chromosomal mapping of ribosomal DNAs was informative for clarifying this apparent conflict. Indeed, the multiple 5S and 18S rDNA sites found in Trachinotus goodei corroborate the most derived condition for this species. In this sense, the occurrence of the unexpected number of two-armed chromosomes and FN value for this species, as well as for Trachinotus carolinus, must be due to additional rounds of acrocentric formation in these species, modifying the macrostructure of their karyotypes. PMID:24260676

  9. Substitution of glutamine for lysine at the pyridoxal phosphate binding site of bacterial D-amino acid transaminase. Effects of exogenous amines on the slow formation of intermediates.

    PubMed

    Futaki, S; Ueno, H; Martinez del Pozo, A; Pospischil, M A; Manning, J M; Ringe, D; Stoddard, B; Tanizawa, K; Yoshimura, T; Soda, K

    1990-12-25

    In bacterial D-amino acid transaminase, Lys-145, which binds the coenzyme pyridoxal 5'-phosphate in Schiff base linkage, was changed to Gln-145 by site-directed mutagenesis (K145Q). The mutant enzyme had 0.015% the activity of the wild-type enzyme and was capable of forming a Schiff base with D-alanine; this external aldimine was formed over a period of minutes depending upon the D-alanine concentration. The transformation of the pyridoxal-5'-phosphate form of the enzyme to the pyridoxamine-5'-phosphate form (i.e. the half-reaction of transamination) occurred over a period of hours with this mutant enzyme. Thus, information on these two steps in the reaction and on the factors that influence them can readily be obtained with this mutant enzyme. In contrast, these reactions with the wild-type enzyme occur at much faster rates and are not easily studied separately. The mutant enzyme shows distinct preference for D- over L-alanine as substrates but it does so about 50-fold less effectively than the wild-type enzyme. Thus, Lys-145 probably acts in concert with the coenzyme and other functional side chain(s) to lead to efficient and stereochemically precise transamination in the wild-type enzyme. The addition of exogenous amines, ethanolamine or methyl amine, increased the rate of external aldimine formation with D-alanine and the mutant enzyme but the subsequent transformation to the pyridoxamine-5'-phosphate form of the enzyme was unaffected by exogenous amines. The wild-type enzyme displayed a large negative trough in the circular dichroic spectrum at 420 nm, which was practically absent in the mutant enzyme. However, addition of D-alanine to the mutant enzyme generated this negative Cotton effect (due to formation of the external aldimine with D-alanine). This circular dichroism band gradually collapsed in parallel with the transformation to the pyridoxamine-5'-phosphate enzyme. Further studies on this mutant enzyme, which displays the characteristics of the wild

  10. A Model for the Active-Site Formation Process in DMSO Reductase Family Molybdenum Enzymes Involving Oxido-Alcoholato and Oxido-Thiolato Molybdenum(VI) Core Structures.

    PubMed

    Sugimoto, Hideki; Sato, Masanori; Asano, Kaori; Suzuki, Takeyuki; Mieda, Kaoru; Ogura, Takashi; Matsumoto, Takashi; Giles, Logan J; Pokhrel, Amrit; Kirk, Martin L; Itoh, Shinobu

    2016-02-15

    New bis(ene-1,2-dithiolato)-oxido-alcoholato molybdenum(VI) and -oxido-thiolato molybdenum(VI) anionic complexes, denoted as [Mo(VI)O(ER)L2](-) (E = O, S; L = dimethoxycarboxylate-1,2-ethylenedithiolate), were obtained from the reaction of the corresponding dioxido-molybdenum(VI) precursor complex with either an alcohol or a thiol in the presence of an organic acid (e.g., 10-camphorsulfonic acid) at low temperature. The [Mo(VI)O(ER)L2](-) complexes were isolated and characterized, and the structure of [Mo(VI)O(OEt)L2](-) was determined by X-ray crystallography. The Mo(VI) center in [Mo(VI)O(OEt)L2](-) exhibits a distorted octahedral geometry with the two ene-1,2-dithiolate ligands being symmetry inequivalent. The computed structure of [Mo(VI)O(SR)L2](-) is essentially identical to that of [Mo(VI)O(OR)L2](-). The electronic structures of the resulting molybdenum(VI) complexes were evaluated using electronic absorption spectroscopy and bonding calculations. The nature of the distorted O(h) geometry in these [Mo(VI)O(EEt)L2](-) complexes results in a lowest unoccupied molecular orbital wave function that possesses strong π* interactions between the Mo(d(xy)) orbital and the cis S(p(z)) orbital localized on one sulfur donor from a single ene-1,2-dithiolate ligand. The presence of a covalent Mo-S(dithiolene) bonding interaction in these monooxido Mo(VI) compounds contributes to their low-energy ligand-to-metal charge transfer transitions. A second important d-p π bonding interaction derives from the ∼180° O(oxo)-Mo-E-C dihedral angle involving the alcoholate and thiolate donors, and this contributes to ancillary ligand contributions to the electronic structure of these species. The formation of [Mo(VI)O(OEt)L2](-) and [Mo(VI)O(SEt)L2](-) from the dioxidomolybdenum(VI) precursor may be regarded as a model for the active-site formation process that occurs in the dimethyl sulfoxide reductase family of pyranopterin molybdenum enzymes. PMID:26816115

  11. Hydrothermal Alteration of Glass from Underground Nuclear Tests: Formation and Transport of Pu-clay Colloids at the Nevada National Security Site

    SciTech Connect

    Zavarin, M.; Zhao, P.; Joseph, C.; Begg, J.; Boggs, M.; Dai, Z.; Kersting, A. B.

    2015-05-27

    The testing of nuclear weapons at the Nevada National Security Site (NNSS), formerly the Nevada Test Site (NTS), has led to the deposition of substantial quantities of plutonium into the environment. Approximately 2.8 metric tons (3.1×104 TBq) of Pu were deposited in the NNSS subsurface as a result of underground nuclear testing. While 3H is the most abundant anthropogenic radionuclide deposited in the NNSS subsurface (4.7×106 TBq), plutonium is the most abundant from a molar standpoint. The only radioactive elements in greater molar abundance are the naturally occurring K, Th, and U isotopes. 239Pu and 240Pu represent the majority of alpha-emitting Pu isotopes. The extreme temperatures associated with underground nuclear tests and the refractory nature of Pu results in most of the Pu (98%) being sequestered in melted rock, referred to as nuclear melt glass (Iaea, 1998). As a result, Pu release to groundwater is controlled, in large part, by the leaching (or dissolution) of nuclear melt glass over time. The factors affecting glass dissolution rates have been studied extensively. The dissolution of Pu-containing borosilicate nuclear waste glasses at 90ºC has been shown to lead to the formation of dioctahedral smectite colloids. Colloid-facilitated transport of Pu at the NNSS has been observed. Recent groundwater samples collected from a number of contaminated wells have yielded a wide range of Pu concentrations from 0.00022 to 2.0 Bq/L. While Pu concentrations tend to fall below the Maximum Contaminant Level (MCL) established by the Environmental Protection Agency (EPA) for drinking water (0.56 Bq/L), we do not yet understand what factors limit the Pu concentration or its transport behavior. To quantify the upper limit of Pu concentrations produced as a result of melt glass dissolution and determine the nature of colloids and Pu associations, we performed a 3 year nuclear melt glass dissolution experiment

  12. Soil use and hydraulic systems in the Terramara S. Rosa (Poviglio, northern Italy). The role of micromorphology in decrypting site formation processes

    NASA Astrophysics Data System (ADS)

    Cremaschi, Mauro; Chiara, Pizzi

    2010-05-01

    The S. Rosa moated site (Terramara), which dates back to the Middle-Recent Bronze age, is under excavation since 1984, by the Soprintendenza ai Beni Archeologici dell Emilia Romagna, in cooperation with the Università degli Studi di Milano, CNR-IDPA of Milano, and the sponsorship of the Comune di Poviglio and Coopsette. The field seasons of the last ten years were concentrated in the south-western part of the fringe of the site and the adjoining ditch, and unearthed a complex hydraulic system composed of several wells, the moat, a canal converging to it, and minor ditches connecting these structure to the countryside surrounding the Terramara. During the early phase of occupation (late Middle Bronze age), a large number of wells, located at the fringe of the village, in coincidence with the fence were dug to reach the water table. They were kept in use for a long time and the water extracted from them was not directed to the interior of the village but it was carried inside the moat throughout a system of ditches. Outside the moat, a large canal has been recently discovered. Its large size and the sophisticated knowledge in hydraulic engineering that its construction required, make it the first archaeological proof of a large scale water management during the Bronze Age. During the last phase of the village (late Recent Bronze age) the wells of the fence and the canal were deactivated and the flow inside the moat interrupted. Consequently, more wells were excavated in a very short time at the bottom of the moat, as indicated by refitting of the potsherds included in the fill. These wells are surrounded by reservoirs connected by small ditches to make the extracted water available to be used at the outer fringe of the moat. An intensive program of micromorphological studies has been undertaken to reconstruct the formation processes of the excavated deposits. Thin section study led to the differentiation of long lasting phases of use, maintenance and abandonment on

  13. GOLPH3 Is Essential for Contractile Ring Formation and Rab11 Localization to the Cleavage Site during Cytokinesis in Drosophila melanogaster

    PubMed Central

    Sechi, Stefano; Frappaolo, Anna; Raffa, Grazia D.; Fuller, Margaret T.; Giansanti, Maria Grazia

    2014-01-01

    The highly conserved Golgi phosphoprotein 3 (GOLPH3) protein has been described as a Phosphatidylinositol 4-phosphate [PI(4)P] effector at the Golgi. GOLPH3 is also known as a potent oncogene, commonly amplified in several human tumors. However, the molecular pathways through which the oncoprotein GOLPH3 acts in malignant transformation are largely unknown. GOLPH3 has never been involved in cytokinesis. Here, we characterize the Drosophila melanogaster homologue of human GOLPH3 during cell division. We show that GOLPH3 accumulates at the cleavage furrow and is required for successful cytokinesis in Drosophila spermatocytes and larval neuroblasts. In premeiotic spermatocytes GOLPH3 protein is required for maintaining the organization of Golgi stacks. In dividing spermatocytes GOLPH3 is essential for both contractile ring and central spindle formation during cytokinesis. Wild type function of GOLPH3 enables maintenance of centralspindlin and Rho1 at cell equator and stabilization of Myosin II and Septin rings. We demonstrate that the molecular mechanism underlying GOLPH3 function in cytokinesis is strictly dependent on the ability of this protein to interact with PI(4)P. Mutations that abolish PI(4)P binding impair recruitment of GOLPH3 to both the Golgi and the cleavage furrow. Moreover telophase cells from mutants with defective GOLPH3-PI(4)P interaction fail to accumulate PI(4)P-and Rab11-associated secretory organelles at the cleavage site. Finally, we show that GOLPH3 protein interacts with components of both cytokinesis and membrane trafficking machineries in Drosophila cells. Based on these results we propose that GOLPH3 acts as a key molecule to coordinate phosphoinositide signaling with actomyosin dynamics and vesicle trafficking during cytokinesis. Because cytokinesis failures have been associated with premalignant disease and cancer, our studies suggest novel insight into molecular circuits involving the oncogene GOLPH3 in cytokinesis. PMID:24786584

  14. Analysis of Site Formation and Assemblage Integrity Does Not Support Attribution of the Uluzzian to Modern Humans at Grotta del Cavallo.

    PubMed

    Zilhão, João; Banks, William E; d'Errico, Francesco; Gioia, Patrizia

    2015-01-01

    Based on the morphology of two deciduous molars and radiocarbon ages from layers D and E of the Grotta del Cavallo (Lecce, Italy), assigned to the Uluzzian, it has been proposed that modern humans were the makers of this Early Upper Paleolithic culture and that this finding considerably weakens the case for an independent emergence of symbolism among western European Neandertals. Reappraisal of the new dating evidence, of the finds curated in the Taranto Antiquities depot, and of coeval publications detailing the site's 1963-66 excavations shows that (a) Protoaurignacian, Aurignacian and Early Epigravettian lithics exist in the assemblages from layers D and E, (b) even though it contains both inherited and intrusive items, the formation of layer D began during Protoaurignacian times, and (c) the composition of the extant Cavallo assemblages is influenced in a non-negligible manner by the post-hoc assignment of items to stratigraphic units distinct from that of original discovery. In addition, a major disturbance feature affected the 1960s excavation trench down to Mousterian layer F, this feature went unrecognized until 1964, the human remains assigned to the Uluzzian were discovered that year and/or the previous year, and there are contradictions between field reports and the primary anthropological description of the remains as to their morphology and level of provenience. Given these major contextual uncertainties, the Cavallo teeth cannot be used to establish the authorship of the Uluzzian. Since this technocomplex's start date is ca. 45,000 calendar years ago, a number of Neandertal fossils are dated to this period, and the oldest diagnostic European modern human fossil is the <41,400 year-old Oase 1 mandible, Neandertal authorship of the Uluzzian remains the parsimonious reading of the evidence. PMID:26154139

  15. Characterization of Isoprene-Derived Secondary Organic Aerosol Formation at the Look Rock Site during the 2013 Southern Oxidant and Aerosol Study (SOAS)

    NASA Astrophysics Data System (ADS)

    Budisulistiorini, S.; Li, X.; Bairai, S. T.; Hicks, W.; Renfro, J.; Corrigan, A. L.; Guzman, J. M.; Russell, L. M.; Liu, Y.; McKinney, K. A.; Zhang, X.; Cappa, C. D.; Zimmermann, K.; Bertram, T. H.; Canagaratna, M. R.; Croteau, D.; Worsnop, D. R.; Jayne, J. T.; Zhang, Z.; Gold, A.; Surratt, J. D.

    2013-12-01

    Although isoprene is considered as the single largest source of secondary organic aerosol (SOA), the exact manner in which it forms remains unclear. Improving our fundamental understanding of isoprene-derived SOA will be key to improving existing air quality models, especially in the southeastern U.S. where models currently underestimate observations. Reactive epoxides, which include methacrylic acid epoxide (MAE) and isomeric isoprene epoxydiols (IEPOX), produced from the oxidation of isoprene have recently been demonstrated to lead to SOA through heterogeneous chemistry. Anthropogenic pollutants (NOx and SO2) have been shown to enhance isoprene-derived epoxides as a source of SOA. One of the major aims during SOAS was to examine how anthropogenic pollutants impact isoprene SOA formation and its climate-relevant properties. To address this aim, we deployed both an Aerodyne aerosol chemical speciation monitor (ACSM) and a chemical ionization high-resolution time-of-flight mass spectrometer (CI-HR-TOFMS) at the Look Rock (LRK) site in the Great Smoky Mountains National Park, TN, from June 1 to July 15, 2013. In addition, high-volume PM2.5 samplers collected daily (8AM-7AM), day (8AM-7PM), and night (8PM-7AM) samples onto quartz filters. On days that LRK was forecasted to have high isoprene, SO4 (sulfate), and NOx levels, PM2.5 were collected more frequently (8AM-11AM, 12PM-3PM, 4PM-7PM, and 8PM-7AM). Filters were analyzed for known isoprene-derived SOA tracers (2-methyltetrols, 2-methylglyceric acid, C5-alkene triols, 3-methyltetrahydrofuran-3,4-diols, and organosulfates) by gas chromatography/mass spectrometry and ultra performance liquid chromatography coupled to diode array detection and electrospray ionization high-resolution quadrupole time-of-flight mass spectrometry. The average non-refractory PM1 mass measured by the ACSM was 3.87 μg m-3, with organic, sulfate, ammonium, nitrate and chloride contributing 64.4%, 24.1%, 7.6%, 3.8%, and 0.1%, respectively

  16. Gas-particle concentrations of atmospheric polycyclic aromatic hydrocarbons at an urban and a residential site in Osaka, Japan: effect of the formation of atmospherically stable layer on their temporal change.

    PubMed

    Kishida, Masao; Nishikawa, Ayako; Fujimori, Keiichi; Shibutani, Yasuhiko

    2011-09-15

    A comparative study on atmospheric polycyclic aromatic hydrocarbons (PAHs) in particulate matter and the gaseous phase was performed at an urban and a residential site in Osaka, Japan, during 2005-2006. PAH concentrations at the urban site were found to be approximately twice higher than those at the residential site. At both sites, particulate PAH concentrations increased mainly in winter while the trends of temporal change in gaseous PAH concentrations were not clearly observed. The main sources of PAHs were estimated to be local traffic, e.g., diesel engines with catalytic converter. PAH concentrations did not significantly negatively correlate with ozone concentrations and meteorological parameters. Gas-particle partitioning coefficients of representative PAHs with low molecular weight (LMW) significantly negatively correlated with ambient temperature, showing that temporal change in the LMW PAH concentrations in PM could be attributable to the shift of their gas-particle distribution caused by the change in ambient temperature. For the first time, we studied the effect of the formation of atmospherically stable layer following an increase in PAH concentrations in Japan. At the urban site, PAHs showed a significant positive correlation with potential temperature gradients, indicating that temporal variability in PAH concentrations would be dominantly controlled by the formation of atmospherically stable layer in Osaka area. PMID:21752537

  17. Unravelling the secrets of Cs controlled secondary ion formation: Evidence of the dominance of site specific surface chemistry, alloying and ionic bonding

    NASA Astrophysics Data System (ADS)

    Wittmaack, Klaus

    2013-03-01

    implantation can be evaluated as a function of Cs coverage.The summarised results imply that secondary ions are commonly not formed by charge transfer between an escaping atom and the electronic system of the sample but are already emitted as ions. The probability of ion formation appears to be controlled by the local ionic character of the alkali-target atom bonds, i.e., by the difference in electronegativity between the involved elements as well as by the electron affinity and the ionisation potential of the departing atom. This idea is supported by the finding that Si- yields exhibit the same very strong dependence on Cs coverage as Si+ and O- yields on the oxygen fraction in oxygen loaded Si. Most challenging to theoreticians is the finding that the ionisation probability is independent of the emission velocity of sputtered ions. This phenomenon cannot be rationalised along established routes of thinking. Different concepts need to be explored. An old, somewhat exotic idea takes account of the heavy perturbation created for a very short period of time at the site of ion emission (dynamic randomisation). Molecular dynamics simulations are desirable to clarify the issue. Ultimately it may be possible to describe all phenomena of enhanced or suppressed secondary ion formation, produced either by surface loading with alkali atoms or by enforced surface oxidation, on the basis of a single universal model. There is plenty of room for exciting new studies.

  18. Unravelling the secrets of Cs controlled secondary ion formation: Evidence of the dominance of site specific surface chemistry, alloying and ionic bonding

    NASA Astrophysics Data System (ADS)

    Wittmaack, Klaus

    2013-03-01

    implantation can be evaluated as a function of Cs coverage. The summarised results imply that secondary ions are commonly not formed by charge transfer between an escaping atom and the electronic system of the sample but are already emitted as ions. The probability of ion formation appears to be controlled by the local ionic character of the alkali-target atom bonds, i.e., by the difference in electronegativity between the involved elements as well as by the electron affinity and the ionisation potential of the departing atom. This idea is supported by the finding that Si- yields exhibit the same very strong dependence on Cs coverage as Si+ and O- yields on the oxygen fraction in oxygen loaded Si. Most challenging to theoreticians is the finding that the ionisation probability is independent of the emission velocity of sputtered ions. This phenomenon cannot be rationalised along established routes of thinking. Different concepts need to be explored. An old, somewhat exotic idea takes account of the heavy perturbation created for a very short period of time at the site of ion emission (dynamic randomisation). Molecular dynamics simulations are desirable to clarify the issue. Ultimately it may be possible to describe all phenomena of enhanced or suppressed secondary ion formation, produced either by surface loading with alkali atoms or by enforced surface oxidation, on the basis of a single universal model. There is plenty of room for exciting new studies.

  19. Natural heterogeneity and evolving geochemistry of Lower Tuscaloosa Formation brine in response to continuing CO2 injection at Cranfield EOR site, Mississippi, USA

    NASA Astrophysics Data System (ADS)

    Thordsen, J. J.; Kharaka, Y. K.; Thomas, B.; Abedini, A. A.; Conaway, C. H.; Manning, M. A.; Lu, J.

    2012-12-01

    Geochemical monitoring of Lower Tuscaloosa Formation (LTF) brine continues at the Cranfield CO2-enhanced oil recovery (EOR) and sequestration site to investigate the potential for the geologic storage of large volumes of CO2 in saline aquifers and depleted reservoirs. Cranfield oil field is a domal depleted oil and gas reservoir in the Mississippi Interior Salt Basin, with production in heterogeneous fluvial sandstones of the LTF (depth ~3000 m). CO2 flood began in July 2008. Brine samples were collected from selected production wells in March and December 2009, April 2010, and November 2011. Intensive sampling also was conducted for the first 18 days of a CO2 injection experiment below the oil-water contact (December 2009) at the Detailed Area of Study (DAS) 3-well array. The sampling objectives are to define the geochemical composition of the pre-injection brine, and to understand the geochemical changes resulting from interactions between the injected CO2, brine, and reservoir minerals. Results show that Tuscaloosa brine is Na-Ca-Cl type with total salinity ranging from ~140 to 160 g/L TDS (50 samples). Relatively large variations are observed in major divalent cations (Ca ~7,500-14,000 mg/L, Mg ~800-1,250 mg/L, Sr ~475-750 mg/L). Significant positive correlations are noted amongst Ca, Mg, Sr, Ba, and Br, whereas these solutes all trend negatively with Na and Cl. These results may be interpreted as possible binary mixing between two end-member waters: (1) high Na-Cl (51 and 97 g/L, respectively), low Ca, Mg, Sr, and Br (~7500, 800, 475, 280 mg/L, respectively); and (2) low Na-Cl (40 and 86 g/L), high Ca, Mg, Sr, and Br (~14,000, 1250, 750, 480 mg/L). This apparent binary mixing has no obvious correlation to CO2 injection, which suggests that observed variations are due to natural heterogeneities in LTF brine within the Cranfield dome. The variations may indicate vertical and/or lateral proximity to a halite source (i.e. salt dome), with the high Na-Cl, low Br

  20. Interactions between lac repressor protein and site-specific bromodeoxyuridine-substituted operator DNA. Ultraviolet footprinting and protein-DNA cross-link formation

    SciTech Connect

    Wick, K.L.; Matthews, K.S. )

    1991-04-05

    Specific contacts between the lac repressor and operator have been explored using 5-bromodeoxyuridine-substituted DNA. Substitution of BrdU for single thymidine positions in a synthetic 40-base pair operator provides substrate for ultraviolet irradiation; upon irradiation, strand scission occurs at the BrdU residues. When bound, lac repressor protein provides protection against UV-induced breakage depending on the nature of the sites and type of interaction. We have confirmed 13 unique sites of inducer-sensitive protection along the operator sequence using this method compared to complete substitution with BrdU; differences were observed at two positions for singly substituted versus completely substituted DNAs. The ability of these photosensitive DNAs to form short range cross-links to bound protein has been used to determine the efficiency with which cross-linked protein-DNA complexes are generated at each individual site of BrdU substitution. Five sites of high efficiency cross-linking to the repressor protein have been identified. At one site, cross-linking without protection from strand scission was observed; this result suggests an unusual mechanism of strand scission and/or cross-linking at this site. Comparison of the UV protection results and the cross-linking data show that these processes provide complementary tools for identifying and analyzing individual protein-DNA contacts.

  1. Instrumentation used for hydraulic testing of potential water-bearing formations at the Waste Isolation Pilot Plant site in southeastern New Mexico

    USGS Publications Warehouse

    Basler, J.A.

    1983-01-01

    Requirements for testing hydrologic test wells at the proposed Waste Isolation Pilot Plant near Carlsbad, New Mexico, necessitated the use of inflatable formation packers and pressure transducers. Observations during drilling and initial development indicated small formation yields which would require considerable test times by conventional open-casing methods. A pressure-monitoring system was assembled for performance evaluation utilizing commercially available components. Formation pressures were monitored with a down-hole strain-gage transducer. An inflatable packer equipped with a 1/4-inch-diameter steel tube extending through the inflation element permitted sensing formation pressures in isolated test zones. Surface components of the monitoring system provided AC transducer excitation, signal conditioning for recording directly in engineering units, and both analog and digital recording. Continuous surface monitoring of formation pressures provided a means of determining test status and projecting completion times during any phase of testing. Maximum portability was afforded by battery operation with all surface components mounted in a small self-contained trailer. (USGS)

  2. Attenuation of drug-stimulated topoisomerase II-DNA cleavable complex formation in wild-type HL-60 cells treated with an intracellular calcium buffer is correlated with decreased cytotoxicity and site-specific hypophosphorylation of topoisomerase IIalpha.

    PubMed Central

    Aoyama, M; Grabowski, D R; Dubyak, G R; Constantinou, A I; Rybicki, L A; Bukowski, R M; Ganapathi, M K; Hickson, I D; Ganapathi, R

    1998-01-01

    Topoisomerase II (topo II), an essential enzyme for cell viability, is also the target for clinically important anti-neoplastic agents that stimulate topo II-mediated DNA scission. The role of alterations in topo IIalpha phosphorylation and its effect on drug-induced DNA damage and cytotoxicity were investigated. Following loading of HL-60 cells with the calcium buffer 1, 2-bis-(o-aminophenoxy)ethane-N,N,N',N'-tetra-acetic acid tetra(acetoxymethyl) ester (BAPTA-AM), which abrogates intracellular Ca2+ transients, a significant decrease in etoposide (VP-16)- or amsacrine (m-AMSA)-stabilized topo II-DNA cleavable complex formation and a corresponding decrease in cytotoxicity was observed. In a cell-free system, nuclear extracts from BAPTA-AM-treated cells exhibited markedly less activity when assayed for VP-16-stabilized topo II-DNA complex formation, but not decatenation of kinetoplast DNA. In contrast, the loading of HL-60 cells with N,N,N', N'-tetrakis-(2-pyridyl)ethylenediamine (TPEN), which binds heavy metals without disturbing calcium or magnesium concentrations, did not significantly affect VP-16-stimulated topo II-DNA cleavable complex formation or cytotoxicity. In HL-60 cells the accumulation of BAPTA, but not TPEN, also led to the hypophosphorylation of topo IIalpha. Tryptic phosphopeptide mapping of topo IIalpha protein from HL-60 cells revealed: (a) eight major phosphorylation sites in untreated cells; (b) hypophosphorylation of two out of eight sites in BAPTA-AM-treated cells; and (c) hypophosphorylation of between two and four out of eight sites in topo II-poison-resistant HL-60 cells. The two hypophosphorylated sites present following BAPTA-AM treatment of wild-type cells were identical with the hypophosphorylated sites in the resistant cells, but were not the same as the sites that are substrates for casein kinase II [Wells, Addison, Fry, Ganapathi and Hickson (1994) J. Biol. Chem. 269, 29746-29751]. In summary, changes in intracellular Ca2+ transients

  3. Site-Selective Tertiary Alkyl-Fluorine Bond Formation from α-Bromoamides Using a Copper/CsF Catalyst System.

    PubMed

    Nishikata, Takashi; Ishida, Syo; Fujimoto, Ryo

    2016-08-16

    A copper-catalyzed site-selective fluorination of α-bromoamides possessing multiple reaction sites, such as primary and secondary alkyl-Br bonds, using inexpensive CsF is reported. Tertiary alkyl-F bonds, which are very difficult to synthesize, can be formed by this fluorination reaction with the aid of an amide group. Control experiments revealed that in situ generated CuF2 is a key fluorinating reagent that reacts with the tertiary alkyl radicals generated by the reaction between an α-bromocarbonyl compound and a copper(I) salt. PMID:27282558

  4. Mutations in the Fusion Protein Cleavage Site of Avian Paramyxovirus Serotype 4 Confer Increased Replication and Syncytium Formation In Vitro but Not Increased Replication and Pathogenicity in Chickens and Ducks

    PubMed Central

    Kim, Shin-Hee; Xiao, Sa; Shive, Heather; Collins, Peter L.; Samal, Siba K.

    2013-01-01

    To evaluate the role of the F protein cleavage site in the replication and pathogenicity of avian paramyxoviruses (APMVs), we constructed a reverse genetics system for recovery of infectious recombinant APMV-4 from cloned cDNA. The recovered recombinant APMV-4 resembled the biological virus in growth characteristics in vitro and in pathogenicity in vivo. The F cleavage site sequence of APMV-4 (DIQPR↓F) contains a single basic amino acid, at the -1 position. Six mutant APMV-4 viruses were recovered in which the F protein cleavage site was mutated to contain increased numbers of basic amino acids or to mimic the naturally occurring cleavage sites of several paramyxoviruses, including neurovirulent and avirulent strains of NDV. The presence of a glutamine residue at the -3 position was found to be important for mutant virus recovery. In addition, cleavage sites containing the furin protease motif conferred increased replication and syncytium formation in vitro. However, analysis of viral pathogenicity in 9-day-old embryonated chicken eggs, 1-day-old and 2-week-old chickens, and 3-week-old ducks showed that none the F protein cleavage site mutations altered the replication, tropism, and pathogenicity of APMV-4, and no significant differences were observed among the parental and mutant APMV-4 viruses in vivo. Although parental and mutant viruses replicated somewhat better in ducks than in chickens, they all were highly restricted and avirulent in both species. These results suggested that the cleavage site sequence of the F protein is not a limiting determinant of APMV-4 pathogenicity in chickens and ducks. PMID:23341874

  5. Mutations in the fusion protein cleavage site of avian paramyxovirus serotype 4 confer increased replication and syncytium formation in vitro but not increased replication and pathogenicity in chickens and ducks.

    PubMed

    Kim, Shin-Hee; Xiao, Sa; Shive, Heather; Collins, Peter L; Samal, Siba K

    2013-01-01

    To evaluate the role of the F protein cleavage site in the replication and pathogenicity of avian paramyxoviruses (APMVs), we constructed a reverse genetics system for recovery of infectious recombinant APMV-4 from cloned cDNA. The recovered recombinant APMV-4 resembled the biological virus in growth characteristics in vitro and in pathogenicity in vivo. The F cleavage site sequence of APMV-4 (DIQPR↓F) contains a single basic amino acid, at the -1 position. Six mutant APMV-4 viruses were recovered in which the F protein cleavage site was mutated to contain increased numbers of basic amino acids or to mimic the naturally occurring cleavage sites of several paramyxoviruses, including neurovirulent and avirulent strains of NDV. The presence of a glutamine residue at the -3 position was found to be important for mutant virus recovery. In addition, cleavage sites containing the furin protease motif conferred increased replication and syncytium formation in vitro. However, analysis of viral pathogenicity in 9-day-old embryonated chicken eggs, 1-day-old and 2-week-old chickens, and 3-week-old ducks showed that none the F protein cleavage site mutations altered the replication, tropism, and pathogenicity of APMV-4, and no significant differences were observed among the parental and mutant APMV-4 viruses in vivo. Although parental and mutant viruses replicated somewhat better in ducks than in chickens, they all were highly restricted and avirulent in both species. These results suggested that the cleavage site sequence of the F protein is not a limiting determinant of APMV-4 pathogenicity in chickens and ducks. PMID:23341874

  6. Grain-size and grain-shape analyses using digital imaging technology: Application to the fluvial formation of the Ngandong paleoanthropological site in Central Java, Indonesia

    NASA Astrophysics Data System (ADS)

    Sipola, Maija

    2013-04-01

    This study implements grain-size and grain-shape analyses to better understand the fluvial processes responsible for forming the Ngandong paleoanthropological site along the Solo River in Central Java. The site was first discovered and excavated by the Dutch Geological Survey in the early 1930's, during which fourteen Homo erectus fossils and thousands of other macrofaunal remains were uncovered. The Homo erectus fossils discovered at Ngandong are particularly interesting to paleoanthropologists because the morphology of the excavated crania suggests they are from a recently-living variety of the species. The primary scientific focus for many years has been to determine the absolute age of the Ngandong fossils, while the question of exactly how the Ngandong site itself formed has been frequently overlooked. In this study I use Retsch CAMSIZER digital imaging technology to conduct grain-size and grain-shape analyses of sediments from the terrace stratigraphy at the Ngandong site to understand if there are significant differences between sedimentary layers in grain-size and/or grain-shape, and what these differences mean in terms of local paleoflow dynamics over time. Preliminary analyses indicate there are four distinct sedimentary layers present at Ngandong with regard to size sorting, with the fossil-bearing layers proving to be the most poorly-sorted and most similar to debris-flow deposits. These results support hypotheses by geoarchaeologists that the fossil-bearing layers present at Ngandong were deposited during special flow events rather than under normal stream flow conditions.

  7. ALMA OBSERVATIONS OF A HIGH-DENSITY CORE IN TAURUS: DYNAMICAL GAS INTERACTION AT THE POSSIBLE SITE OF A MULTIPLE STAR FORMATION

    SciTech Connect

    Tokuda, Kazuki; Onishi, Toshikazu; Saigo, Kazuya; Kawamura, Akiko; Fukui, Yasuo; Inutsuka, Shu-ichiro; Tachihara, Kengo; Matsumoto, Tomoaki; Machida, Masahiro N.; Tomida, Kengo

    2014-07-01

    Starless dense cores eventually collapse dynamically, forming protostars inside them, and the physical properties of the cores determine the nature of the forming protostars. We report ALMA observations of dust continuum emission and molecular rotational lines toward MC27 or L1521F, which is considered to be very close to the first protostellar core phase. We found a few starless high-density cores, one of which has a very high density of ∼10{sup 7} cm{sup –3}, within a region of several hundred AU around a very low-luminosity protostar detected by Spitzer. A very compact bipolar outflow with a dynamical timescale of a few hundred years was found toward the protostar. The molecular line observation shows several cores with an arc-like structure, possibly due to the dynamical gas interaction. These complex structures revealed in the present observations suggest that the initial condition of star formation is highly dynamical in nature, which is considered to be a key factor in understanding fundamental issues of star formation such as the formation of multiple stars and the origin of the initial mass function of stars.

  8. The formation of DNA single-strand breaks and alkali-labile sites in human blood lymphocytes exposed to 365-nm UVA radiation.

    PubMed

    Osipov, Andreyan N; Smetanina, Nadezhda M; Pustovalova, Margarita V; Arkhangelskaya, Ekaterina; Klokov, Dmitry

    2014-08-01

    The potency of UVA radiation, representing 90% of solar UV light reaching the earth's surface, to induce human skin cancer is the subject of continuing controversy. This study was undertaken to investigate the role of reactive oxygen species in DNA damage produced by the exposure of human cells to UVA radiation. This knowledge is important for better understanding of UV-induced carcinogenesis. We measured DNA single-strand breaks and alkali-labile sites in human lymphocytes exposed ex vivo to various doses of 365-nm UV photons compared to X-rays and hydrogen peroxide using the comet assay. We demonstrated that the UVA-induced DNA damage increased in a linear dose-dependent manner. The rate of DNA single-strand breaks and alkali-labile sites after exposure to 1J/cm(2) was similar to the rate induced by exposure to 1 Gy of X-rays or 25 μM hydrogen peroxide. The presence of either the hydroxyl radical scavenger dimethyl sulfoxide or the singlet oxygen quencher sodium azide resulted in a significant reduction in the UVA-induced DNA damage, suggesting a role for these reactive oxygen species in mediating UVA-induced DNA single-strand breaks and alkali-labile sites. We also showed that chromatin relaxation due to hypertonic conditions resulted in increased damage in both untreated and UVA-treated cells. The effect was the most significant in the presence of 0.5M Na(+), implying a role for histone H1. Our data suggest that the majority of DNA single-strand breaks and alkali-labile sites after exposure of human lymphocytes to UVA are produced by reactive oxygen species (the hydroxyl radical and singlet oxygen) and that the state of chromatin may substantially contribute to the outcome of such exposures. PMID:24816295

  9. Bone taphonomy of the Schöningen "Spear Horizon South" and its implications for site formation and hominin meat provisioning.

    PubMed

    Starkovich, Britt M; Conard, Nicholas J

    2015-12-01

    This paper presents the faunal remains from the new excavation area at the Lower Paleolithic site of Schöningen. The focus of the study is on the southern extension of the main find horizon (Spear Horizon South), which includes the layer that yielded the famous Schöningen spears (13 II-4). Taxonomic data corroborate previous studies, that hominins primarily hunted Equus mosbachensis, a large Pleistocene horse. Equid body part representation at the site suggests that the animals were hunted and butchered locally. There is no evidence for density-mediated attrition in the assemblage. Weathering damage is uncommon, though there is ample evidence that carnivores had access to the bone. Carnivore bite sizes were measured and compared to experimental data provided by previous authors. Based on relationships between bite size and carnivore behavior and body size, we conclude that the primary modifying agents were large carnivores (i.e., wolves or saber-toothed cats). Previous studies show that carnivores often had secondary access to the remains, after hominins. Cut marks are commonly arranged haphazardly on the bones. This may indicate that multiple hominins participated in the butchery of horse skeletons, or that they were butchered over the course of hours or days. Cut marks on axial elements are more "orderly," which probably reflects the physical logistics of orienting one's body in relation to a large carcass. These data differ from sites formed by Middle and Upper Paleolithic hominins, which might suggest that in later times, a system of organized meat provisioning was already in place. Taken together, the faunal evidence from the Spear Horizon South indicates that late Lower Paleolithic hominins using the site understood the behaviors of different prey species, hunted socially to take down large game, and successfully competed with large carnivores on the landscape for primary access to ungulate remains. PMID:26626957

  10. Water-Level Reconstruction and its Implications for Late Pleistocene Paleontological Site Formation in Hoyo Negro, a Submerged Subterranean Pit in Quintana Roo, Mexico

    NASA Astrophysics Data System (ADS)

    Rissolo, D.; Reinhardt, E. G.; Collins, S.; Kovacs, S. E.; Beddows, P. A.; Chatters, J. C.; Nava Blank, A.; Luna Erreguerena, P.

    2014-12-01

    A massive pit deep within the now submerged cave system of Sac Actun, located along the central east coast of the Yucatan Peninsula, contains a diverse fossil assemblage of extinct megafauna as well as a nearly complete human skeleton. The inundated site of Hoyo Negro presents a unique and promising opportunity for interdisciplinary Paleoamerican and paleoenvironmental research in the region. Investigations have thus far revealed a range of associated features and deposits which make possible a multi-proxy approach to identifying and reconstructing the natural and cultural processes that have formed and transformed the site over millennia. Understanding water-level fluctuations (both related to, and independent from, eustatic sea level changes), with respect to cave morphology is central to understanding the movement of humans and animals into and through the cave system. Recent and ongoing studies involve absolute dating of human, faunal, macrobotanical, and geological samples; taphonomic analyses; and a characterization of site hydrogeology and sedimentological facies, including microfossil assemblages and calcite raft deposits.

  11. Quantum-chemical study of the effect of oxygen on the formation of active sites of silver clusters during the selective adsorption of hydrocarbons

    NASA Astrophysics Data System (ADS)

    Lanin, S. N.; Polynskaya, Yu. G.; Pichugina, D. A.; Nguen, V.; Beletskaya, A. V.; Kuz'menko, N. E.; Shestakov, A. F.

    2013-09-01

    Density functional theory (PBE with a modified Dirac-Coulomb-Breit Hamiltonian) is used to simulate the adsorption of hydrocarbons (C2H2, C2H4, C2H6) on the surface of a sorbent containing Ag0, Agδ+, and AgO sites. The dynamics of change in the structural characteristics of Ag n ( n ≤ 10) is analyzed and the adsorption of oxygen on Ag8 and Ag10 is studied to select the adsorption site model. Studying the interaction of hydrocarbons with Ag8, Ag10, Ag{10/+}, Ag10O, and Ag10O2 clusters reveals that the presence of oxygen leads to an increase in the activation of unsaturated hydrocarbons, and the adsorption energy of C2H2 increases tenfold. It is found that the role of adsorbed oxygen is not only to form adsorption sites of hydrocarbons (Agδ+) but also to bind C2H2 and C2H4 directly to the sorbent's surface.

  12. Nuclear localization of mouse Ku70 in interphase cells and focus formation of mouse Ku70 at DNA damage sites immediately after irradiation.

    PubMed

    Koike, Manabu; Yutoku, Yasutomo; Koike, Aki

    2015-09-01

    To elucidate the mechanisms of DNA repair pathway is critical for developing next-generation radiotherapies and chemotherapeutic drugs for cancer. Ionizing radiation and many chemotherapeutic drugs kill tumor cells mainly by inducing DNA double-strand breaks (DSBs). The classical nonhomologous DNA-end joining (NHEJ) (C-NHEJ) pathway repairs a predominant fraction of DSBs in mammalian cells. The C-NHEJ pathway appears to start with the binding of Ku (heterodimer of Ku70 and Ku80) to DNA break ends. Therefore, recruitment of Ku to DSB sites might play a critical role in regulating NHEJ activity. Indeed, human Ku70 and Ku80 localize in the nuclei and accumulate at microirradiated DSB sites. However, the localization and regulation mechanisms of Ku70 and Ku80 homologues in animal models, such as mice and other species, have not been elucidated in detail, particularly in cells immediately after microirradiation. Here, we show that EYFP-tagged mouse Ku70 localizes in the interphase nuclei of mouse fibroblasts and epithelial cells. Furthermore, our findings indicate that EYFP-mouse Ku70 accumulates with its heterodimeric partner Ku80 immediately at laser-microirradiated DSB sites. We also confirmed that the structure of Ku70 nuclear localization signal (NLS) is highly conserved among various rodent species, such as the mouse, rat, degu and ground squirrel, supporting the idea that NLS is important for the regulation of rodent Ku70 function. Collectively, these results suggest that the mechanisms of regulating the localization and accumulation of Ku70 at DSBs might be well conserved between the mouse and human species. PMID:25947323

  13. Formation of uranium-thorium-rich bitumen nodules in the Lockne impact structure, Sweden: A mechanism for carbon concentration at impact sites

    NASA Astrophysics Data System (ADS)

    Lindgren, Paula; Parnell, John; Norman, Craig; Mark, Darren F.; Baron, Martin; Ormö, Jens; Sturkell, Erik; Conliffe, James; Fraser, Wesley

    The Ordovician Lockne impact structure is located in central Sweden. The target lithology consisted of limestone and black unconsolidated shale overlaying a Precambrian crystalline basement. The Precambrian basement is uranium-rich, and the black shale is both uranium- and organic-rich. This circumstance makes Lockne a good candidate for testing the occurrence of U-Th-rich bitumen nodules in an impact structure setting. U-Th-rich bitumen nodules are formed through irradiation; hence the increase in the complexity of organic matter by a radioactive (uranium- and thorium-rich) mineral phase. U-Th-rich bitumen nodules were detected in crystalline impact breccia and resurge deposits from the impact structure, but samples of non-impact-affected rocks from outside the impact structure do not contain any U-Th-rich bitumen nodules. This implies that in the Lockne impact structure, the nodules are associated with impact-related processes. U-Th-rich bitumen nodules occur throughout the geological record and are not restricted to an impact structure setting, but our studies at Lockne show that this process of irradiation can readily occur in impact structures where fracturing of rocks and a post-impact hydrothermal system enhances fluid circulation. The irradiation of organic matter by radioactive minerals has previously been proposed as a process for concentration of carbon on the early Earth. Impact structures are suggested as sites for prebiotic chemistry and primitive evolution, and irradiation by radioactive minerals could be an important mechanism for carbon concentration at impact sites.

  14. ALMA Observations of a High-density Core in Taurus: Dynamical Gas Interaction at the Possible Site of a Multiple Star Formation

    NASA Astrophysics Data System (ADS)

    Tokuda, Kazuki; Onishi, Toshikazu; Saigo, Kazuya; Kawamura, Akiko; Fukui, Yasuo; Matsumoto, Tomoaki; Inutsuka, Shu-ichiro; Machida, Masahiro N.; Tomida, Kengo; Tachihara, Kengo

    2015-08-01

    It is crucially important to observe dense cores in order to investigate the initial condition of star formation since protostars are formed via dynamical collapse of dense cores, inhering the physical properties from their natal dense cores. Here we present the results of ALMA Cycle 0 and Cycle 1 observations of dust continuum emission and molecular rotational lines toward a dense core, MC27 (aka L1521F), which is considered to be very close to the first protostellar core phase.The Cycle 0 observations revealed complex structures at the center. We found a few starless high-density cores, one of which (MMS2) has a very high density of ~107 cm-3, around the very low-luminousity protostar detected by Spitzer. A very compact bipolar outflow with a dynamical timescale of a few hundred years was found toward the protostar. The HCO+ (3-2) observation shows several cores associated with an arc-like structure whose length is ~2000 AU, possibly due to the dynamical gas interaction. These complex structures suggest that the initial condition of star formation is highly dynamical in nature, which is considered to be a key factor in understanding fundamental issues of star formation such as origins of the stellar multiplicity and the initial mass function. These initial Cycle 0 results were published by Tokuda et al. (2014). Matsumoto et al. (2015) investigated the arc-like structures by performing numerical simulations.Detailed column density distribution with the size from ~100 to ~10000 AU scale are revealed by combining the 12m array data with the 7m array data of the ALMA Compact Array as well as with the single dish MAMBO data. Our preliminary analysis shows that the averaged radial column density distribution of the inner part (r < 2000 AU) is N(H2)~r-0.4, clearly flatter than that of the outer part, ~r-1.3. We detected the above-mentioned complex structure inside the inner flatter region, which may reflect the dynamical status of the dense core. The Cycle 1

  15. Contributions of Selected Biogenic and Aromatic Compounds to the Formation of Tropospheric Secondary Organic Aerosol over Several Sites in the United States

    NASA Astrophysics Data System (ADS)

    Jaoui, M.; Kleindienst, T. E.; Lewandowski, M.; Offenberg, J. H.; Corse, E. W.; Gerald, T.; Edney, E.

    2009-12-01

    The National Exposure Research Laboratory of the U.S. Environmental Protection Agency recently undertook an integrated laboratory and field research effort to better understand the contribution of biogenic and aromatic hydrocarbons to the formation of submicron ambient secondary organic aerosol (SOA). In the laboratory, isoprene, α-pinene, β-caryophyllene, 1,3-butadiene, 2-methyl-3-buten-2-ol, benzene, and toluene were individually irradiated under a wide range of conditions in a photochemical reaction chamber in the presence of nitrogen oxide (NOx). These hydrocarbons are thought to contribute to ambient SOA formation. In field studies conducted in Research Triangle Park, NC; Duke Forest in Chapel Hill, NC; Atlanta, GA; Pensacola, FL; Birmingham and Centerville, AL; Riverside, CA; Detroit, MI; Northbrook, East St. Louis and Bondville, IL; and Cincinnati, OH, ambient PM2.5 samples were collected for various periods between 2003 and 2006. The SOA collected from these laboratory experiments and the ambient PM2.5 samples were analyzed for organic carbon (OC) concentration and for organic tracer compounds by GC-MS using BSTFA derivatization for their identification and quantification. An organic tracer-based method was developed for estimating ambient SOA concentrations from individual SOA precursors to allow an assessment of SOA model predictions with ambient data. The results show that several major reaction products detected in SOA formed in the laboratory photooxidations were among the major compounds detected in field samples, effectively connecting laboratory and field results. Using the tracer-based method, the contributions of isoprene and monoterpenes to SOA formation show strong seasonal dependencies. However, no clear seasonal variations were observed for sesquiterpenes and aromatic hydrocarbons. The contribution of 2-methyl-3-buten-2-ol to ambient SOA was found to be not only season dependent but also higher in locations dominated by conifers, which are

  16. Mauna Loa lava accumulation rates at the Hilo drill site: Formation of lava deltas during a period of declining overall volcanic growth

    USGS Publications Warehouse

    Lipman, P.W.; Moore, J.G.

    1996-01-01

    Accumulation rates for lava flows erupted from Mauna Loa, as sampled in the uppermost 280 m of the Hilo drill hole, vary widely for short time intervals (several thousand years), but overall are broadly similar to those documented elsewhere on this volcano since 100 ka. Thickness variations and accumulation rates for Mauna Loa lavas at the Hilo drill site have been strongly affected by local paleotopography, including funneling and ponding between Mauna Kea and Kilauea. In addition, gentle submerged slopes of Mauna Kea in Hilo Bay have permitted large shoreline displacements by Mauna Loa flows. Ages of eruptive intervals have been determined from published isotopic data and from eustatic sea level curves modified to include the isostatic subsidence of the island of Hawaii at 2.2-2.6 mm/yr. Prior to 10 ka, rates of Mauna Loa lava accumulation at the drill site varied from 0.6 to 4.3 mm/yr for dateable intervals, with an overall rate of 1.8 mm/yr. Major eruptive pulses at about 1.3 and 10 ka, each probably representing a single long-lived eruption based on lack of weathering between flow units, increase the overall accumulation rate to 2.4 mm/yr. The higher rate since 10 ka reflects construction of thick near-shoreline lava deltas as postglacial sea levels rose rapidly. Large lava deltas form only along coastal segments where initially subaerial slopes have been submerged by the combined effects of eustatic sea level rise, isostatic subsidence, or spreading of volcano flanks. Overall accumulation of 239 m of lava at the drill site since 100-120 ka closely balances submergence of the Hilo area, suggesting that processes of coastal lava deposition have been modulated by rise in sea level. The Hilo accumulation rate is slightly higher than average rates of 1-2 mm/yr determined elsewhere along the Mauna Loa coast, based on rates of shoreline coverage and dated sea cliff and fault scarp exposures. Low rates of coastal lava accumulation since 100 ka, near or below the rate

  17. Dynamic changes in subcellular localization of cattle XLF during cell cycle, and focus formation of cattle XLF at DNA damage sites immediately after irradiation

    PubMed Central

    KOIKE, Manabu; YUTOKU, Yasutomo; KOIKE, Aki

    2015-01-01

    Clinically, many chemotherapeutics and ionizing radiation (IR) have been applied for the treatment of various types of human and animal malignancies. These treatments kill tumor cells by causing DNA double-strand breaks (DSBs). Core factors of classical nonhomologous DNA-end joining (C-NHEJ) play a vital role in DSB repair. Thus, it is indispensable to clarify the mechanisms of C-NHEJ in order to develop next-generation chemotherapeutics for cancer. The XRCC4-like factor (XLF; also called Cernunnos or NHEJ1) is the lastly identified core NHEJ factor. The localization of core NHEJ factors might play a critical role in regulating NHEJ activity. The localization and function of XLF have not been elucidated in animal species other than mice and humans. Domestic cattle (Bos taurus) are the most common and vital domestic animals in many countries. Here, we show that the localization of cattle XLF changes dynamically during the cell cycle. Furthermore, EYFP-cattle XLF accumulates quickly at microirradiated sites and colocalizes with the DSB marker γH2AX. Moreover, nuclear localization and accumulation of cattle XLF at DSB sites are dependent on 12 amino acids (288–299) of the C-terminal region of XLF (XLF CTR). Furthermore, basic amino acids on the XLF CTR are highly conserved among domestic animals including cattle, goat and horses, suggesting that the CTR is essential for the function of XLF in domestic animals. These findings might be useful to develop the molecular-targeting therapeutic drug taking XLF as a target molecule for human and domestic animals. PMID:25947322

  18. Dynamic changes in subcellular localization of cattle XLF during cell cycle, and focus formation of cattle XLF at DNA damage sites immediately after irradiation.

    PubMed

    Koike, Manabu; Yutoku, Yasutomo; Koike, Aki

    2015-09-01

    Clinically, many chemotherapeutics and ionizing radiation (IR) have been applied for the treatment of various types of human and animal malignancies. These treatments kill tumor cells by causing DNA double-strand breaks (DSBs). Core factors of classical nonhomologous DNA-end joining (C-NHEJ) play a vital role in DSB repair. Thus, it is indispensable to clarify the mechanisms of C-NHEJ in order to develop next-generation chemotherapeutics for cancer. The XRCC4-like factor (XLF; also called Cernunnos or NHEJ1) is the lastly identified core NHEJ factor. The localization of core NHEJ factors might play a critical role in regulating NHEJ activity. The localization and function of XLF have not been elucidated in animal species other than mice and humans. Domestic cattle (Bos taurus) are the most common and vital domestic animals in many countries. Here, we show that the localization of cattle XLF changes dynamically during the cell cycle. Furthermore, EYFP-cattle XLF accumulates quickly at microirradiated sites and colocalizes with the DSB marker γH2AX. Moreover, nuclear localization and accumulation of cattle XLF at DSB sites are dependent on 12 amino acids (288-299) of the C-terminal region of XLF (XLF CTR). Furthermore, basic amino acids on the XLF CTR are highly conserved among domestic animals including cattle, goat and horses, suggesting that the CTR is essential for the function of XLF in domestic animals. These findings might be useful to develop the molecular-targeting therapeutic drug taking XLF as a target molecule for human and domestic animals. PMID:25947322

  19. Habitat change by the formation of alien Crassostrea-reefs in the Wadden Sea and its role as feeding sites for waterbirds

    NASA Astrophysics Data System (ADS)

    Markert, Alexandra; Esser, Wiebke; Frank, Dietrich; Wehrmann, Achim; Exo, Klaus-Michael

    2013-10-01

    Non-indigenous Pacific oysters (Crassostrea gigas) have been invading the central Wadden Sea since 1998, predominantly settling on intertidal blue mussel (Mytilus edulis) beds which are increasingly transformed into Crassostrea-reefs. Pacific oysters are strong ecosystem engineers and the habitat change is considered to be a threat for waterbirds losing important feeding sites in the intertidal of the Wadden Sea. This study has increased our understanding of the use of foraging habitats by birds according to changing food resources. During the spring and autumn migration period in 2007, we recorded bird densities at two reef types varying in Pacific oyster density and at the adjacent sand flat as a reference site. We also recorded feeding behaviour, choice of prey and assessed peck and intake rate of three target species: Eurasian oystercatcher Haematopus ostralegus, Eurasian curlew Numenius arquata and European herring gull Larus argentatus. To evaluate the use of the Crassostrea-reef in the central Wadden Sea, we compared bird densities of the target species at different intertidal feeding habitats in various regions and compared the biomass intake of Eurasian oystercatcher feeding on different prey species. We show that Eurasian oystercatcher and Eurasian curlew have adapted to the new situation and learned to exploit the food supply offered by Crassostrea-reefs. While foraging mainly on Pacific oysters, Eurasian oystercatchers attained sustainable intake rates even though food resource at dense reef during autumn was very poor due to a lack in harvestable oysters. Consolidation of reefs limits the accessibility of prey for Eurasian oystercatchers whereas a successful recruitment of Pacific oysters enhances the suitability of the habitat. Eurasian curlew was promoted by the engineering effects of the Pacific oyster while feeding extensively on shore crabs at the reefs. In contrast, European herring gulls appear hampered in foraging during low tide and hereby

  20. LPS-Induced Formation of Immunoproteasomes: TNF-α and Nitric Oxide Production are Regulated by Altered Composition of Proteasome-Active Sites

    PubMed Central

    Reis, Julia; Guan, Xiu Qin; Kisselev, Alexei F.; Papasian, Christopher J.; Qureshi, Asaf A.; Morrison, David C.; Van Way, Charles W.; Vogel, Stefanie N.

    2011-01-01

    Stimulation of mouse macrophages with LPS leads to tumor necrosis factor (TNF-α) secretion and nitric oxide (NO) release at different times through independent signaling pathways. While the precise regulatory mechanisms responsible for these distinct phenotypic responses have not been fully delineated, results of our recent studies strongly implicate the cellular cytoplasmic ubiquitin–proteasome pathway as a key regulator of LPS-induced macrophage inflammatory responses. Our objective in this study was to define the relative contribution of specific proteasomal active-sites in induction of TNF-α and NO after LPS treatment of RAW 264.7 macrophages using selective inhibitors of these active sites. Our data provide evidence that LPS stimulation of mouse macrophages triggers a selective increase in the levels of gene and protein expression of the immunoproteasomes, resulting in a modulation of specific functional activities of the proteasome and a corresponding increase in NO production as compared to untreated controls. These findings suggest the LPS-dependent induction of immunoproteasome. In contrast, we also demonstrate that TNF-α expression is primarily dependent on both the chymotrypsin- and the trypsin-like activities of X, Y, Z subunits of the proteasome. Proteasome-associated post-acidic activity alone also contributes to LPS-induced expression of TNF-α. Taken together; our results indicate that LPS-induced TNF-α in macrophages is differentially regulated by each of the three proteasome activities. Since addition of proteasome inhibitors to mouse macrophages profoundly affects the degradation of proteins involved in signal transduction, we conclude that proteasome-specific degradation of several signaling proteins is likely involved in differential regulation of LPS-dependent secretion of proinflammatory mediators. PMID:21455682

  1. Studies of the influence of chloro-substituent sites and conformational energy in polychlorinated biphenyls on uroporphyrin formation in chick-embryo liver cell cultures.

    PubMed Central

    Sassa, S; Sugita, O; Ohnuma, N; Imajo, S; Okumura, T; Noguchi, T; Kappas, A

    1986-01-01

    Treatment of cultured chick-embryo liver cells with polychlorinated biphenyls (PCB) results in decreased uroporphyrinogen decarboxylase activity and increased uroporphyrin accumulation. In the present study we examined the effect of the chloro- or bromo-substituent sites in biphenyls (BP) on uroporphyrin accumulation in cultured hepatocytes and the three-dimensional structure of these congeners determined by molecular orbital calculations using a MNDO ('modified neglect of diatomic overlap') method. Among 20 congeners examined, those which were effective in stimulating porphyrin accumulation contained at least two Cl or Br atoms at the lateral adjacent positions in each phenyl ring, e.g. 3,4,3',4'-tetrachloro-, 2,4,3',4'-tetrachloro-, 3,4,5,3',4',5'-hexachloro- and 3,4,5,3',4',5'-hexabromobiphenyl, whereas those which contained less than two halogen atoms or more than three halogen atoms in each phenyl ring or those which contained halogen atoms at 2,2'-positions were not effective. On the basis of the conformational energy (delta E, difference from the most stable conformational energy), which is calculated as a function of the dihedral angle (theta) between the two phenyl rings, biphenyl congeners can be classified into four groups with different conformations. The conformation of active PCB was relatively flexible, whereas inactive species had a rigidly angulated conformation. Furthermore, the calculated probability of the conformation distribution for each congener indicated that the probability of co-planarity was higher for active biphenyls than for inactive congeners. These structural characteristics suggest the significance of both the chloro-substituent sites and the conformational energy reflecting the phenyl-ring twist angles in determining the inhibitory effect of PCB on uroporphyrinogen decarboxylase activity. Images Fig. 4. PMID:3091004

  2. Structural insights into the mechanism of four-coordinate Cob(II)alamin formation in the active site of the Salmonella enterica ATP:Co(I)rrinoid adenosyltransferase enzyme: critical role of residues Phe91 and Trp93.

    PubMed

    Moore, Theodore C; Newmister, Sean A; Rayment, Ivan; Escalante-Semerena, Jorge C

    2012-12-01

    ATP:co(I)rrinoid adenosyltransferases (ACATs) are enzymes that catalyze the formation of adenosylcobalamin (AdoCbl, coenzyme B(12)) from cobalamin and ATP. There are three families of ACATs, namely, CobA, EutT, and PduO. In Salmonella enterica, CobA is the housekeeping enzyme that is required for de novo AdoCbl synthesis and for salvaging incomplete precursors and cobalamin from the environment. Here, we report the crystal structure of CobA in complex with ATP, four-coordinate cobalamin, and five-coordinate cobalamin. This provides the first crystallographic evidence of the existence of cob(II)alamin in the active site of CobA. The structure suggests a mechanism in which the enzyme adopts a closed conformation and two residues, Phe91 and Trp93, displace 5,6-dimethylbenzimidazole, the lower nucleotide ligand base of cobalamin, to generate a transient four-coordinate cobalamin, which is critical in the formation of the AdoCbl Co-C bond. In vivo and in vitro mutational analyses of Phe91 and Trp93 emphasize the important role of bulky hydrophobic side chains in the active site. The proposed manner in which CobA increases the redox potential of the cob(II)alamin/cob(I)alamin couple to facilitate formation of the Co-C bond appears to be analogous to that utilized by the PduO-type ACATs, where in both cases the polar coordination of the lower ligand to the cobalt ion is eliminated by placing that face of the corrin ring adjacent to a cluster of bulky hydrophobic side chains. PMID:23148601

  3. Sulfated Tyrosines Contribute to the Formation of the C5a Docking Site of the Human C5a Anaphylatoxin Receptor

    PubMed Central

    Farzan, Michael; Schnitzler, Christine E.; Vasilieva, Natalya; Leung, Doris; Kuhn, Jens; Gerard, Craig; Gerard, Norma P.; Choe, Hyeryun

    2001-01-01

    The complement anaphylatoxin C5a and its seven-transmembrane segment (7TMS) receptor play an important role in host defense and in a number of inflammation-associated pathologies. The NH2-terminal domain of the C5a receptor (C5aR/CD88) contributes substantially to its ability to bind C5a. Here we show that the tyrosines at positions 11 and 14 of the C5aR are posttranslationally modified by the addition of sulfate groups. The sulfate moieties of each of these tyrosines are critical to the ability of the C5aR to bind C5a and to mobilize calcium. A C5aR variant lacking these sulfate moieties efficiently mobilized calcium in response to a small peptide agonist, but not to C5a, consistent with a two-site model of ligand association in which the tyrosine-sulfated region of the C5aR mediates the initial docking interaction. A peptide based on the NH2 terminus of the C5aR and sulfated at these two tyrosines, but not its unsulfated analogue or a doubly sulfated control peptide, partially inhibited C5a association with its receptor. These observations clarify structural and mutagenic studies of the C5a/C5aR association and suggest that related 7TMS receptors are also modified by functionally important sulfate groups on their NH2-terminal tyrosines. PMID:11342590

  4. Origin of the local structures at the Philae landing site and possible implications on the formation and evolution of 67P/Churyumov-Gerasimenko

    NASA Astrophysics Data System (ADS)

    Poulet, F.; Lucchetti, A.; Bibring, J.-P.; Carter, J.; Gondet, B.; Jorda, L.; Langevin, Y.; Pilorget, C.; Capanna, C.; Cremonese, G.

    2016-08-01

    In situ images of the 67P/Churyumov-Gerasimenko nucleus acquired by the CIVA cameras on-board PHILAE revealed a rough landscape dominated by consolidated materials (Bibring et al. 2015). These data provide a unique view to constrain the past and present conditions prevailing at the surface of the comet. A quantitative analysis of microscopic structures (fractures and pebbles) is derived using a manual extraction from the images. Fractures/cracks are rather ubiquitous at various spatial scales with network and size (from sub-cm to 10 cm) well correlated to the texture of the landscape. The pebble size distributions are derived and compared to the size distribution of other cometary materials. The nature of the landscape is then discussed in relation to endogenic and exogenic processes of surface modification. The block seen in CIVA#1 is interpreted to be close-ups of fractured boulder/cliff belonging to the boulder field identified from the orbit near Abydos, this boulder field being itself the result of gravitational regressive erosion due to sublimation. The observed fractures are best explained by thermal insolation leading to thermal fatigue and/or to loss of volatile materials. This surficial fragmentation (up to > 10 cm length) could generate macroscopic erosion that is also visible at larger scale from the orbit. There is at least an intriguing possibility that the pebbles are remnants of primordial accretion processes. We thus speculate that the Abydos landscape could be in favour of pebble accretion model instead of runaway coagulation model with a formation location in the outer region of the Solar System.

  5. Analysis of Site Formation and Assemblage Integrity Does Not Support Attribution of the Uluzzian to Modern Humans at Grotta del Cavallo

    PubMed Central

    Zilhão, João; Banks, William E.; d’Errico, Francesco; Gioia, Patrizia

    2015-01-01

    Based on the morphology of two deciduous molars and radiocarbon ages from layers D and E of the Grotta del Cavallo (Lecce, Italy), assigned to the Uluzzian, it has been proposed that modern humans were the makers of this Early Upper Paleolithic culture and that this finding considerably weakens the case for an independent emergence of symbolism among western European Neandertals. Reappraisal of the new dating evidence, of the finds curated in the Taranto Antiquities depot, and of coeval publications detailing the site’s 1963–66 excavations shows that (a) Protoaurignacian, Aurignacian and Early Epigravettian lithics exist in the assemblages from layers D and E, (b) even though it contains both inherited and intrusive items, the formation of layer D began during Protoaurignacian times, and (c) the composition of the extant Cavallo assemblages is influenced in a non-negligible manner by the post-hoc assignment of items to stratigraphic units distinct from that of original discovery. In addition, a major disturbance feature affected the 1960s excavation trench down to Mousterian layer F, this feature went unrecognized until 1964, the human remains assigned to the Uluzzian were discovered that year and/or the previous year, and there are contradictions between field reports and the primary anthropological description of the remains as to their morphology and level of provenience. Given these major contextual uncertainties, the Cavallo teeth cannot be used to establish the authorship of the Uluzzian. Since this technocomplex’s start date is ca. 45,000 calendar years ago, a number of Neandertal fossils are dated to this period, and the oldest diagnostic European modern human fossil is the <41,400 year-old Oase 1 mandible, Neandertal authorship of the Uluzzian remains the parsimonious reading of the evidence. PMID:26154139

  6. Isotopic variations within upper oceanic crust at IODP Site 1256: Implications for crustal recycling and the formation of ocean island basalts

    NASA Astrophysics Data System (ADS)

    Duggen, S.; Hoernle, K.; Geldmacher, J.; Hauff, F.

    2007-12-01

    The origin of ocean island basalts (OIBs) is a fundamental question facing Earth scientists. It is commonly agreed that lithospheric material recycled in the mantle is involved in the magma source of OIBs. The relative importance of 1) subducted altered oceanic basaltic crust (AOC), 2) subducted marine sediments and/or 3) delaminated metasomatised subcontinental lithosphere and continental lower crust remains to be resolved. We examine the geochemical composition of a complete in situ section of oceanic crust drilled at Site 1256 during IODP Expeditions 309 and 312. It includes the extrusive layer, sheeted dikes and gabbros of ca. 15 Ma old oceanic crust of the Cocos Plate formed during a period of superfast spreading at the East Pacific Rise. Modeling in the Sr-Nd-Pb-isotope space and comparison with present day radiogenic isotope ratios of OIBs provides constraints on the significance of recycled oceanic crust in the OIB mantle source(s). Our study shows that the generation of sulphides during low- and high-temperature alteration of oceanic crust has a strong influence on U/Pb and Th/Pb ratios and whether an AOC domain evolves relatively low or high Pb-isotope ratios over geological timescales. The model suggests that AOC as the sole precursor material, modified during the subduction process, and after relatively low to moderate recycling ages of ca. 300-800 Ma, is sufficient to explain the Sr-Nd-Pb-isotopic composition of OIBs with Pb-isotopic compositions along or below the Northern Hemisphere Reference Line (NHRL) and relatively high Nd-isotope ratios (e.g. Canaries, Galapagos, Iceland, Madeira). This indicates that additional EM-components, potentially associated with recycled lithospheric material such as subducted sediments, lower continental crust or subcontinental lithosphere, are not required for an array of OIBs, but are only necessary to explain OIBs with Pb-isotope ratios above the NHRL and relatively low Nd- isotope ratios (e.g. Pitcairn, Tristan

  7. The variability of urban aerosol size distributions and optical properties in São Paulo - Brazil: new particle formation events occur at the site

    NASA Astrophysics Data System (ADS)

    Backman, J.; Rizzo, L. V.; Hakala, J.; Nieminen, T.; Manninen, H. E.; Morais, F.; Aalto, P. P.; Siivola, E.; Carbone, S.; Hillamo, R.; Artaxo, P.; Petäjä, T.; Kulmala, M.

    2011-11-01

    The quest to reduce the dependence on fossil fuel has increased the use of bio-ethanol as an additive to gasoline. The metropolitan area of São Paulo (population 20 million) is a unique laboratory to study the ambient aerosol population caused by the use of bio-fuels because 55% of the fuel used is ethanol. The use of ethanol as an additive to fossil fuel is known to increase aldehyde emissions and when photo chemically oxidized, result in smog. In order to characterize this smog problem total particle number concentration, particle number size distribution, light scattering and light absorption measurement equipment were deployed at the University of São Paulo campus area. Here we present the results from three months of measurements from 10 October 2010 to 10 January 2011. The median total particle number concentration for the sub-micron aerosol typically varies between 1×104-3×104 cm-3 frequently exceeding 5×104 cm-3 during the day. Median diurnal values for light absorption and light scattering vary between 12-33 Mm-1 and 21-64 Mm-1, respectively. The hourly median single-scattering albedo varied between 0.63 and 0.85 indicating a net warming effect on a regional scale. A total of ten new particle formation (NPF) events were observed. During these events, growth rates ranged between 9-25 nm h-1. On average, a calculated sulphuric acid vapour abundance of 2.6× 108 cm-3 would have explained the growth with a vapour production rate of 2.8×106 cm-3 s-1 to sustain it. The estimated sulphuric acid concentration, calculated from global irradiance and sulphur dioxide measurements, accounted for only a fraction of the vapour concentration needed to explain the observed growth rates. This indicates that also other condensable vapours participate in the growth process. During the events, the condensation sink was calculated to be 12× 10-3 s-1 on average.

  8. Transport, biomass burning, and in-situ formation contribute to fine particle concentrations at a remote site near Grand Teton National Park

    NASA Astrophysics Data System (ADS)

    Schurman, M. I.; Lee, T.; Desyaterik, Y.; Schichtel, B. A.; Kreidenweis, S. M.; Collett, J. L.

    2015-07-01

    Ecosystem health and visibility degradation due to fine-mode atmospheric particles have been documented in remote areas and motivate particle characterization that can inform mitigation strategies. This study explores submicron (PM1) particle size, composition, and source apportionment at Grand Teton National Park using High-Resolution Time-of-Flight Aerosol Mass Spectrometer data with Positive Matrix Factorization and MODIS fire information. Particulate mass averages 2.08 μg/m3 (max = 21.91 μg/m3) of which 75.0% is organic; PMF-derived Low-Volatility Oxygenated Organic Aerosol (LV-OOA) averages 61.1% of PM1 (or 1.05 μg/m3), with sporadic but higher-concentration biomass burning (BBOA) events contributing another 13.9%. Sulfate (12.5%), ammonium (8.7%), and nitrate (3.8%) are generally low in mass. Ammonium and sulfate have correlated time-series and association with transport from northern Utah and the Snake River Valley. A regionally disperse and/or in situ photochemical LV-OOA source is suggested by 1) afternoon concentration enhancement not correlated with upslope winds, anthropogenic NOx, or ammonium sulfate, 2) smaller particle size, higher polydispersity, and lower levels of oxidation during the day and in comparison to a biomass burning plume inferred to have traveled ∼480 km, and 3) lower degree of oxidation than is usually observed in transported urban plumes and alpine sites with transported anthropogenic OA. CHN fragment spectra suggest organic nitrogen in the form of nitriles and/or pyridines during the day, with the addition of amine fragments at night. Fires near Boise, ID may be the source of a high-concentration biomass-burning event on August 15-16, 2011 associated with SW winds (upslope from the Snake River Valley) and increased sulfate, ammonium, nitrate, and CHN and CHON fragments (nominally, amines and organonitrates). Comparison to limited historical data suggests that the amounts and sources of organics and inorganics presented here

  9. Assessing the impact of anthropogenic pollution on isoprene-derived secondary organic aerosol formation in PM2.5 collected from the Birmingham, Alabama, ground site during the 2013 Southern Oxidant and Aerosol Study

    NASA Astrophysics Data System (ADS)

    Rattanavaraha, Weruka; Chu, Kevin; Hapsari Budisulistiorini, Sri; Riva, Matthieu; Lin, Ying-Hsuan; Edgerton, Eric S.; Baumann, Karsten; Shaw, Stephanie L.; Guo, Hongyu; King, Laura; Weber, Rodney J.; Neff, Miranda E.; Stone, Elizabeth A.; Offenberg, John H.; Zhang, Zhenfa; Gold, Avram; Surratt, Jason D.

    2016-04-01

    In the southeastern US, substantial emissions of isoprene from deciduous trees undergo atmospheric oxidation to form secondary organic aerosol (SOA) that contributes to fine particulate matter (PM2.5). Laboratory studies have revealed that anthropogenic pollutants, such as sulfur dioxide (SO2), oxides of nitrogen (NOx), and aerosol acidity, can enhance SOA formation from the hydroxyl radical (OH)-initiated oxidation of isoprene; however, the mechanisms by which specific pollutants enhance isoprene SOA in ambient PM2.5 remain unclear. As one aspect of an investigation to examine how anthropogenic pollutants influence isoprene-derived SOA formation, high-volume PM2.5 filter samples were collected at the Birmingham, Alabama (BHM), ground site during the 2013 Southern Oxidant and Aerosol Study (SOAS). Sample extracts were analyzed by gas chromatography-electron ionization-mass spectrometry (GC/EI-MS) with prior trimethylsilylation and ultra performance liquid chromatography coupled to electrospray ionization high-resolution quadrupole time-of-flight mass spectrometry (UPLC/ESI-HR-QTOFMS) to identify known isoprene SOA tracers. Tracers quantified using both surrogate and authentic standards were compared with collocated gas- and particle-phase data as well as meteorological data provided by the Southeastern Aerosol Research and Characterization (SEARCH) network to assess the impact of anthropogenic pollution on isoprene-derived SOA formation. Results of this study reveal that isoprene-derived SOA tracers contribute a substantial mass fraction of organic matter (OM) ( ˜ 7 to ˜ 20 %). Isoprene-derived SOA tracers correlated with sulfate (SO42-) (r2 = 0.34, n = 117) but not with NOx. Moderate correlations between methacrylic acid epoxide and hydroxymethyl-methyl-α-lactone (together abbreviated MAE/HMML)-derived SOA tracers with nitrate radical production (P[NO3]) (r2 = 0.57, n = 40) were observed during nighttime, suggesting a potential role of the NO3 radical in

  10. Report on the U.S. Geological Survey's evaluation program for standard reference samples distributed in October 1994 : T-131 (trace constituents), T-133 (trace constituents), M-132 (major constituents), N-43 (nutrients), N-44 (nutrients), P-23 (low ionic strength) and Hg-19 (mercury)

    USGS Publications Warehouse

    Long, H. Keith; Farrar, Jerry W.

    1995-01-01

    This report presents the results of the U.S. Geological Survey's analytical evaluation program for 7 standard reference samples--T-131 (trace constituents), T-133 (trace constituents), M-132 (major constituents), N-43 (nutrients), N-44 (nutrients), P-23 (low ionic strength), and Hg-19 (mercury). The samples were distributed in October 1994 to 131 laboratories registered in the U.S. Geological Survey sponsored interlaboratory testing program. Analytical data that were received from 121 of the laboratories were evaluated with respect to: overall laboratory performance and relative laboratory performance for each analyte in the seven reference samples. Results of these evaluations are presented in tabular form. Also presented are tables and graphs summarizing the analytical data provided by each laboratory for each analyte in the seven standard reference samples. The most probable value for each analyte was determined using nonparametric statistics.