Science.gov

Sample records for formation sites n44

  1. A Novel Acidic Matrix Protein, PfN44, Stabilizes Magnesium Calcite to Inhibit the Crystallization of Aragonite*

    PubMed Central

    Pan, Cong; Fang, Dong; Xu, Guangrui; Liang, Jian; Zhang, Guiyou; Wang, Hongzhong; Xie, Liping; Zhang, Rongqing

    2014-01-01

    Magnesium is widely used to control calcium carbonate deposition in the shell of pearl oysters. Matrix proteins in the shell are responsible for nucleation and growth of calcium carbonate crystals. However, there is no direct evidence supporting a connection between matrix proteins and magnesium. Here, we identified a novel acidic matrix protein named PfN44 that affected aragonite formation in the shell of the pearl oyster Pinctada fucata. Using immunogold labeling assays, we found PfN44 in both the nacreous and prismatic layers. In shell repair, PfN44 was repressed, whereas other matrix proteins were up-regulated. Disturbing the function of PfN44 by RNAi led to the deposition of porous nacreous tablets with overgrowth of crystals in the nacreous layer. By in vitro circular dichroism spectra and fluorescence quenching, we found that PfN44 bound to both calcium and magnesium with a stronger affinity for magnesium. During in vitro calcium carbonate crystallization and calcification of amorphous calcium carbonate, PfN44 regulated the magnesium content of crystalline carbonate polymorphs and stabilized magnesium calcite to inhibit aragonite deposition. Taken together, our results suggested that by stabilizing magnesium calcite to inhibit aragonite deposition, PfN44 participated in P. fucata shell formation. These observations extend our understanding of the connections between matrix proteins and magnesium. PMID:24302723

  2. Are oceanic plateaus sites of komatiite formation?

    NASA Astrophysics Data System (ADS)

    Storey, M.; Mahoney, J. J.; Kroenke, L. W.; Saunders, A. D.

    1991-04-01

    During Cretaceous and Tertiary time a series of oceanic terranes were accreted onto the Pacific continental margin of Colombia. The island of Gorgona is thought to represent part of the most recent, early Eocene, terrane-forming event. Gorgona is remarkable for the occurrence of komatiites of middle Cretaceous age, having MgO contents up to 24%. The geochemistry of spatially and temporally associated tholeiites suggests that Gorgona is an obducted fragment of the oceanic Caribbean Plateau, postulated by Duncan and Hargraves (1984) to have formed at 100 to 75 Ma over the Galapagos hotspot. Further examples of high-MgO oceanic lavas that may represent fragments of the Caribbean Plateau occur in allochthonous terranes on the island of Curaçao in the Netherlands Antilles and in the Romeral zone ophiolites in the southwestern Colombian Andes. These and other examples suggest that the formation of high-MgO liquids may be a feature of oceanic-plateau settings. The association of Phanerozoic komatiites with oceanic plateaus, coupled with thermal considerations, provides a plausible analogue for the origin of some komatiite-tholeiite sequences in Archean greenstone belts.

  3. Role of nucleation sites on the formation of nanoporous Ge

    SciTech Connect

    Yates, B. R.; Darby, B. L.; Jones, K. S.; Elliman, R. G.

    2012-09-24

    The role of nucleation sites on the formation of nanoporous Ge was investigated. Three Ge films with different spherical or columnar pore morphologies to act as inherent nucleation sites were sputtered on (001) Ge. Samples were implanted 90 Degree-Sign from incidence at 300 keV with fluences ranging from 3.0 Multiplication-Sign 10{sup 15} to 3.0 Multiplication-Sign 10{sup 16} Ge{sup +}/cm{sup 2}. Electron microscopy investigations revealed varying thresholds for nanoporous Ge formation and exhibited a stark difference in the evolution of the Ge layers based on the microstructure of the initial film. The results suggest that the presence of inherent nucleation sites significantly alters the onset and evolution of nanoporous Ge.

  4. Formation of RNA oligomers on montmorillonite: site of catalysis

    NASA Technical Reports Server (NTRS)

    Ertem, G.; Ferris, J. P.

    1998-01-01

    Certain montmorillonites catalyze the self condensation of the 5'-phosphorimidazolide of nucleosides in pH 8 aqueous electrolyte solutions at ambient temperatures leading to formation of RNA oligomers. In order to establish the nature of the sites on montmorillonite responsible for this catalytic activity, oligomerization reactions were run with montmorillonites which had been selectively modified (I) at the edges by (a) fluoride treatment, (b) silylation, (c) metaphosphate treatment of the anion exchange sites (II) in the interlayer by (a) saturation with quaternary alkylammonium ions of increasing size, (b) aluminum polyoxo cations. High pressure liquid chromatography, HPLC, analysis of condensation products for their chain lengths and yields indicated that modification at the edges did not affect the catalytic activity to a significant extent, while blocking the interlayer strongly inhibited product formation.

  5. Investigation of Gd3N@C2n (40 n 44) family by Raman and inelastic electron tunneling spectroscopy

    SciTech Connect

    Burke, Brian; Chan, Jack; Williams, Keith A; Ge, Jiechao; Shu, Chunying; Fu, Wujun; Dorn, Harry C; Kushmerick, James G; Puretzky, Alexander A; Geohegan, David B

    2010-01-01

    The structure and vibrational spectrum of Gd3N@C80 is studied through Raman and inelastic electron tunneling spectroscopy as well as density-functional theory and universal force eld calculations. Hindered rotations, shown by both theory and experiment, indicate the formation of a Gd3N-C80 bond which reduces the ideal icosahedral symmetry of the C80 cage. The vibrational modes involving the movement of the encapsulated species are a ngerprint of the interaction between the fullerene cage and the core complex. We present Raman data for the Gd3N@C2n 40 n 44 family as well as Y3N@C80, Lu3N@C80, and Y3N@C88 for comparison. Conductance measurements have been performed on Gd3N@C80 and reveal a Kondo effect similar to that observed in C60.

  6. Ftsz Ring Formation at the Chloroplast Division Site in Plants

    PubMed Central

    Vitha, Stanislav; McAndrew, Rosemary S.; Osteryoung, Katherine W.

    2001-01-01

    Among the events that accompanied the evolution of chloroplasts from their endosymbiotic ancestors was the host cell recruitment of the prokaryotic cell division protein FtsZ to function in chloroplast division. FtsZ, a structural homologue of tubulin, mediates cell division in bacteria by assembling into a ring at the midcell division site. In higher plants, two nuclear-encoded forms of FtsZ, FtsZ1 and FtsZ2, play essential and functionally distinct roles in chloroplast division, but whether this involves ring formation at the division site has not been determined previously. Using immunofluorescence microscopy and expression of green fluorescent protein fusion proteins in Arabidopsis thaliana, we demonstrate here that FtsZ1 and FtsZ2 localize to coaligned rings at the chloroplast midpoint. Antibodies specific for recognition of FtsZ1 or FtsZ2 proteins in Arabidopsis also recognize related polypeptides and detect midplastid rings in pea and tobacco, suggesting that midplastid ring formation by FtsZ1 and FtsZ2 is universal among flowering plants. Perturbation in the level of either protein in transgenic plants is accompanied by plastid division defects and assembly of FtsZ1 and FtsZ2 into filaments and filament networks not observed in wild-type, suggesting that previously described FtsZ-containing cytoskeletal-like networks in chloroplasts may be artifacts of FtsZ overexpression. PMID:11285278

  7. Natural new particle formation at the coastal Antarctic site Neumayer

    NASA Astrophysics Data System (ADS)

    Weller, R.; Schmidt, K.; Teinilä, K.; Hillamo, R.

    2015-10-01

    We measured condensation particle (CP) concentrations and particle size distributions at the coastal Antarctic station Neumayer (70°39´ S, 8°15´ W) during two summer campaigns (from 20 January to 26 March 2012 and 1 February to 30 April 2014) and during the polar night between 12 August and 27 September 2014 in the particle diameter (Dp) range from 2.94 to 60.4 nm (2012) and from 6.26 to 212.9 nm (2014). During both summer campaigns we identified all in all 44 new particle formation (NPF) events. From 10 NPF events, particle growth rates could be determined to be around 0.90 ± 0.46 nm h-1 (mean ± SD; range: 0.4-1.9 nm h-1). With the exception of one case, particle growth was generally restricted to the nucleation mode (Dp < 25 nm) and the duration of NPF events was typically around 6.0 ± 1.5 h (mean ± SD; range: 4-9 h). Thus, in the surrounding area of Neumayer, particles did not grow up to sizes required for acting as cloud condensation nuclei. NPF during summer usually occurred in the afternoon in coherence with local photochemistry. During winter, two NPF events could be detected, though showing no ascertainable particle growth. A simple estimation indicated that apart from sulfuric acid, the derived growth rates required other low volatile precursor vapours.

  8. Natural new particle formation at the coastal Antarctic site Neumayer

    NASA Astrophysics Data System (ADS)

    Weller, R.; Schmidt, K.; Teinilä, K.; Hillamo, R.

    2015-06-01

    We measured condensation particle (CP) concentrations and particle size distributions at the coastal Antarctic station Neumayer (70°39' S, 8°15' W) during two summer campaigns (from 20 January to 26 March 2012 and 1 February to 30 April 2014) and during polar night between 12 August and 27 September 2014 in the particle diameter (Dp) range from 2.94 to 60.4 nm (2012) and from 6.26 to 212.9 nm (2014). During both summer campaigns we identified all in all 44 new particle formation (NPF) events. From 10 NPF events, particle growth rates could be determined to be around 0.90 ± 0.46 nm h-1 (mean ± SD; range: 0.4 to 1.9 nm h-1). With the exception of one case, particle growth was generally restricted to the nucleation mode (Dp < 25 nm) and the duration of NPF events was typically around 6.0 ± 1.5 h (mean ± SD; range: 4 to 9 h). Thus in the main, particles did not grow up to sizes required for acting as cloud condensation nuclei. NPF during summer usually occurred in the afternoon in coherence with local photochemistry. During winter, two NPF events could be detected, though showing no ascertainable particle growth. A simple estimation indicated that apart from sulfuric acid, the derived growth rates required other low volatile precursor vapours.

  9. OceanSITES format and Ocean Observatory Output harmonisation: past, present and future

    NASA Astrophysics Data System (ADS)

    Pagnani, Maureen; Galbraith, Nan; Diggs, Stephen; Lankhorst, Matthias; Hidas, Marton; Lampitt, Richard

    2015-04-01

    The Global Ocean Observing System (GOOS) initiative was launched in 1991, and was the first step in creating a global view of ocean observations. In 1999 oceanographers at the OceanObs conference envisioned a 'global system of eulerian observatories' which evolved into the OceanSITES project. OceanSITES has been generously supported by individual oceanographic institutes and agencies across the globe, as well as by the WMO-IOC Joint Technical Commission for Oceanography and Marine Meteorology (under JCOMMOPS). The project is directed by the needs of research scientists, but has a strong data management component, with an international team developing content standards, metadata specifications, and NetCDF templates for many types of in situ oceanographic data. The OceanSITES NetCDF format specification is intended as a robust data exchange and archive format specifically for time-series observatory data from the deep ocean. First released in February 2006, it has evolved to build on and extend internationally recognised standards such as the Climate and Forecast (CF) standard, BODC vocabularies, ISO formats and vocabularies, and in version 1.3, released in 2014, ACDD (Attribute Convention for Dataset Discovery). The success of the OceanSITES format has inspired other observational groups, such as autonomous vehicles and ships of opportunity, to also use the format and today it is fulfilling the original concept of providing a coherent set of data from eurerian observatories. Data in the OceanSITES format is served by 2 Global Data Assembly Centres (GDACs), one at Coriolis, in France, at ftp://ftp.ifremer.fr/ifremer/oceansites/ and one at the US NDBC, at ftp://data.ndbc.noaa.gov/data/oceansites/. These two centres serve over 26,800 OceanSITES format data files from 93 moorings. The use of standardised and controlled features enables the files held at the OceanSITES GDACs to be electronically discoverable and ensures the widest access to the data. The OceanSITES

  10. Methylprednisolone microsphere sustained-release membrane inhibits scar formation at the site of peripheral nerve lesion.

    PubMed

    Li, Qiang; Li, Teng; Cao, Xiang-Chang; Luo, De-Qing; Lian, Ke-Jian

    2016-05-01

    Corticosteroids are widely used for the treatment of acute central nervous system injury. However, their bioactivity is limited by their short half-life. Sustained release of glucocorticoids can prolong their efficacy and inhibit scar formation at the site of nerve injury. In the present study, we wrapped the anastomotic ends of the rat sciatic nerve with a methylprednisolone sustained-release membrane. Compared with methylprednisone alone or methylprednisone microspheres, the methylprednisolone microsphere sustained-release membrane reduced tissue adhesion and inhibited scar tissue formation at the site of anastomosis. It also increased sciatic nerve function index and the thickness of the myelin sheath. Our findings show that the methylprednisolone microsphere sustained-release membrane effectively inhibits scar formation at the site of anastomosis of the peripheral nerve, thereby promoting nerve regeneration. PMID:27335571

  11. Methylprednisolone microsphere sustained-release membrane inhibits scar formation at the site of peripheral nerve lesion

    PubMed Central

    Li, Qiang; Li, Teng; Cao, Xiang-chang; Luo, De-qing; Lian, Ke-jian

    2016-01-01

    Corticosteroids are widely used for the treatment of acute central nervous system injury. However, their bioactivity is limited by their short half-life. Sustained release of glucocorticoids can prolong their efficacy and inhibit scar formation at the site of nerve injury. In the present study, we wrapped the anastomotic ends of the rat sciatic nerve with a methylprednisolone sustained-release membrane. Compared with methylprednisone alone or methylprednisone microspheres, the methylprednisolone microsphere sustained-release membrane reduced tissue adhesion and inhibited scar tissue formation at the site of anastomosis. It also increased sciatic nerve function index and the thickness of the myelin sheath. Our findings show that the methylprednisolone microsphere sustained-release membrane effectively inhibits scar formation at the site of anastomosis of the peripheral nerve, thereby promoting nerve regeneration. PMID:27335571

  12. OceanSITES format and Ocean Observatory Output harmonisation: past, present and future

    NASA Astrophysics Data System (ADS)

    Pagnani, Maureen; Galbraith, Nan; Diggs, Stephen; Lankhorst, Matthias; Hidas, Marton; Lampitt, Richard

    2015-04-01

    The Global Ocean Observing System (GOOS) initiative was launched in 1991, and was the first step in creating a global view of ocean observations. In 1999 oceanographers at the OceanObs conference envisioned a 'global system of eulerian observatories' which evolved into the OceanSITES project. OceanSITES has been generously supported by individual oceanographic institutes and agencies across the globe, as well as by the WMO-IOC Joint Technical Commission for Oceanography and Marine Meteorology (under JCOMMOPS). The project is directed by the needs of research scientists, but has a strong data management component, with an international team developing content standards, metadata specifications, and NetCDF templates for many types of in situ oceanographic data. The OceanSITES NetCDF format specification is intended as a robust data exchange and archive format specifically for time-series observatory data from the deep ocean. First released in February 2006, it has evolved to build on and extend internationally recognised standards such as the Climate and Forecast (CF) standard, BODC vocabularies, ISO formats and vocabularies, and in version 1.3, released in 2014, ACDD (Attribute Convention for Dataset Discovery). The success of the OceanSITES format has inspired other observational groups, such as autonomous vehicles and ships of opportunity, to also use the format and today it is fulfilling the original concept of providing a coherent set of data from eurerian observatories. Data in the OceanSITES format is served by 2 Global Data Assembly Centres (GDACs), one at Coriolis, in France, at ftp://ftp.ifremer.fr/ifremer/oceansites/ and one at the US NDBC, at ftp://data.ndbc.noaa.gov/data/oceansites/. These two centres serve over 26,800 OceanSITES format data files from 93 moorings. The use of standardised and controlled features enables the files held at the OceanSITES GDACs to be electronically discoverable and ensures the widest access to the data. The OceanSITES

  13. Molecular Dynamics Simulations of Solvation and Kink Site Formation at the {001} Barite-Water Interface.

    SciTech Connect

    Stack, Andrew G

    2009-09-01

    Solvation and kink site formation on step edges are known to be controlling parameters in crystal growth and dissolution. However, links from classical crystal growth models to specific reactions at the mineral-water interface have remained elusive. Molecular dynamics is used here to examine the water structure on barium surface sites and kink site formation enthalpies for material adsorbed to and removed from the step parallel to the [120] direction on the {001} barite-water interface. The bariums at the interface are shown to be coordinatively unsaturated with respect to water, and it is suggested that this is due to a steric hindrance from the nature of the interface. Kink site detachment energies that include hydration energies are endothermic for barium and exothermic for sulfate. The implications and problems of using these parameters in a crystal growth model are discussed.

  14. New investigations at Kalambo Falls, Zambia: Luminescence chronology, site formation, and archaeological significance.

    PubMed

    Duller, Geoff A T; Tooth, Stephen; Barham, Lawrence; Tsukamoto, Sumiko

    2015-08-01

    Fluvial deposits can provide excellent archives of early hominin activity but may be complex to interpret, especially without extensive geochronology. The Stone Age site of Kalambo Falls, northern Zambia, has yielded a rich artefact record from dominantly fluvial deposits, but its significance has been restricted by uncertainties over site formation processes and a limited chronology. Our new investigations in the centre of the Kalambo Basin have used luminescence to provide a chronology and have provided key insights into the geomorphological and sedimentological processes involved in site formation. Excavations reveal a complex assemblage of channel and floodplain deposits. Single grain quartz optically stimulated luminescence (OSL) measurements provide the most accurate age estimates for the youngest sediments, but in older deposits the OSL signal from some grains is saturated. A different luminescence signal from quartz, thermally transferred OSL (TT-OSL), can date these older deposits. OSL and TT-OSL results are combined to provide a chronology for the site. Ages indicate four phases of punctuated deposition by the dominantly laterally migrating and vertically aggrading Kalambo River (∼500-300 ka, ∼300-50 ka, ∼50-30 ka, ∼1.5-0.49 ka), followed by deep incision and renewed lateral migration at a lower topographic level. A conceptual model for site formation provides the basis for improved interpretation of the generation, preservation, and visibility of the Kalambo archaeological record. This model highlights the important role of intrinsic meander dynamics in site formation and does not necessarily require complex interpretations that invoke periodic blocking of the Kalambo River, as has previously been suggested. The oldest luminescence ages place the Mode 2/3 transition between ∼500 and 300 ka, consistent with other African and Asian sites where a similar transition can be found. The study approach adopted here can potentially be applied to other

  15. DNA abasic site-directed formation of fluorescent silver nanoclusters for selective nucleobase recognition

    NASA Astrophysics Data System (ADS)

    Ma, Kun; Cui, Qinghua; Liu, Guiying; Wu, Fei; Xu, Shujuan; Shao, Yong

    2011-07-01

    DNA single-nucleotide polymorphism (SNP) detection has attracted much attention due to mutation related diseases. Various methods for SNP detection have been proposed and many are already in use. Here, we find that the abasic site (AP site) in the DNA duplex can be developed as a capping scaffold for the generation of fluorescent silver nanoclusters (Ag NCs). As a proof of concept, the DNA sequences from fragments near codon 177 of cancer supression gene p53 were used as a model for SNP detection by in situ formed Ag NCs. The formation of fluorescent Ag NCs in the AP site-containing DNA duplex is highly selective for cytosine facing the AP site and guanines flanking the site and can be employed in situ as readout for SNP detection. The fluorescent signal-on sensing for SNP based on this inorganic fluorophore is substantially advantageous over the previously reported signal-off responses using low-molecular-weight organic ligands. The strong dependence of fluorescent Ag NC formation on the sequences surrounding the AP site was successfully used to identify mutations in codon 177 of cancer supression gene p53. We anticipate that this approach will be employed to develop a practical SNP detection method by locating an AP site toward the midway cytosine in a target strand containing more than three consecutive cytosines.

  16. Multiethnic Neighbourhoods as Sites of Social Capital Formation: Examining Social to Political "Integration" in Schools

    ERIC Educational Resources Information Center

    Basu, Ranu

    2006-01-01

    In an "ideal" democratic society, publicly funded schools serve many purposes. Aside from its educational mandate, schools are places for neighbourhood integration, social capital formation and the fostering of civil society. For newly arrived immigrants, especially those with young children, schools are important sites of settlement experiences.…

  17. Insertion site and sealing technique affect residual hearing and tissue formation after cochlear implantation.

    PubMed

    Burghard, Alice; Lenarz, Thomas; Kral, Andrej; Paasche, Gerrit

    2014-06-01

    Tissue formation around the electrode array of a cochlear implant has been suggested to influence preservation of residual hearing as well as electrical hearing performance of implanted subjects. Further, inhomogeneity in the electrical properties of the scala tympani shape the electrical field and affect current spread. Intracochlear trauma due to electrode insertion and the insertion site itself are commonly seen as triggers for the tissue formation. The present study investigates whether the insertion site, round window membrane (RWM) vs. cochleostomy (CS), or the sealing material, no seal vs. muscle graft vs. carboxylate cement, have an influence on the amount of fibrous tissue and/or new bone formation after CI implantation in the guinea pig. Hearing thresholds were determined by auditory brainstem response (ABR) measurements prior to implantation and after 28 days. The amount of tissue formation was quantified by evaluation of microscopic images obtained by a grinding/polishing procedure to keep the CI in place during histological processing. An insertion via the round window membrane resulted after 28 days in less tissue formation in the no seal and muscle seal condition compared to the cochleostomy approach. Between these two sealing techniques there was no difference. Sealing the cochlea with carboxylate cement resulted always in a strong new bone formation and almost total loss of residual hearing. The amount of tissue formation and the hearing loss correlated at 1-8 kHz. Consequently, the use of carboxylate cement as a sealing material in cochlear implantation should be avoided even in animal studies, whereas sealing the insertion site with a muscle graft did not induce an additional tissue growth compared to omitting a seal. For hearing preservation the round window approach should be used. PMID:24566091

  18. Preferential sites for intramolecular glucosepane cross-link formation in type I collagen: A thermodynamic study.

    PubMed

    Collier, Thomas A; Nash, Anthony; Birch, Helen L; de Leeuw, Nora H

    2015-10-01

    The extracellular matrix (ECM) undergoes progressive age-related stiffening and loss of proteolytic digestibility due to an increase in concentration of advanced glycation end products (AGEs). The most abundant AGE, glucosepane, accumulates in collagen with concentrations over 100 times greater than all other AGEs. Detrimental collagen stiffening properties are believed to play a significant role in several age-related diseases such as osteoporosis and cardiovascular disease. Currently little is known of the potential location of covalently cross-linked glucosepane formation within collagen molecules; neither are there reports on how the respective cross-link sites affect the physical and biochemical properties of collagen. Using fully atomistic molecular dynamics simulations (MD) we have identified six sites where the formation of a covalent intra-molecular glucosepane cross-link within a single collagen molecule in a fibrillar environment is energetically favourable. Identification of these favourable sites enables us to align collagen cross-linking with experimentally observed changes to the ECM. For example, formation of glucosepane was found to be energetically favourable within close proximity of the Matrix Metalloproteinase-1 (MMP1) binding site, which could potentially disrupt collagen degradation. PMID:26049074

  19. Preferential sites for intramolecular glucosepane cross-link formation in type I collagen: A thermodynamic study

    PubMed Central

    Collier, Thomas A.; Nash, Anthony; Birch, Helen L.; de Leeuw, Nora H.

    2015-01-01

    The extracellular matrix (ECM) undergoes progressive age-related stiffening and loss of proteolytic digestibility due to an increase in concentration of advanced glycation end products (AGEs). The most abundant AGE, glucosepane, accumulates in collagen with concentrations over 100 times greater than all other AGEs. Detrimental collagen stiffening properties are believed to play a significant role in several age-related diseases such as osteoporosis and cardiovascular disease. Currently little is known of the potential location of covalently cross-linked glucosepane formation within collagen molecules; neither are there reports on how the respective cross-link sites affect the physical and biochemical properties of collagen. Using fully atomistic molecular dynamics simulations (MD) we have identified six sites where the formation of a covalent intra-molecular glucosepane cross-link within a single collagen molecule in a fibrillar environment is energetically favourable. Identification of these favourable sites enables us to align collagen cross-linking with experimentally observed changes to the ECM. For example, formation of glucosepane was found to be energetically favourable within close proximity of the Matrix Metalloproteinase-1 (MMP1) binding site, which could potentially disrupt collagen degradation. PMID:26049074

  20. Authigenic Carbonate Formation on the Peru Margin; New Insights from IODP Site 1230

    NASA Astrophysics Data System (ADS)

    Abdullajintakam, S.; Naehr, T. H.

    2015-12-01

    Fluid seepage of reduced organic compounds such as methane impacts the geology and biology of the seabed by inducing complex, microbially mediated biogeochemical processes. Authigenic carbonates serve as one of the few permanent records of these of dynamic biogeochemical interactions that involve methanogenesis, methanotrophy, sulfate reduction and carbonate precipitation. Meister et al. (2007) investigated deep-sea dolomite formation at Sites 1227-1229 on the Peru margin, where dolomite precipitation occurs in association with organic carbon-rich continental margin sediments. Geochemical and petrographic studies indicated episodic dolomite precipitation at a dynamic sulfate methane transition zone (SMTZ). Variations in δ13C values of these dolomites between +15‰ and -15‰ were attributed to non-steady state conditions as a result of the upward and downward migration of the SMTZ. Our study aims to better understand the biogeochemical processes associated with authigenic carbonate precipitation in this dynamic deep-sea setting. We focused our efforts on IODP Site 1230, which is a gas-hydrate-bearing site that shows sulphate consumption within the uppermost 10 m below the seafloor as well as high methane production. Using a multi proxy approach, we combined X-ray diffraction, stable isotope geochemistry, and trace metal analysis of authigenic carbonates to elucidate conditions for authigenic carbonate formation. Results from Site 1230 are compared to Sites 1227 and 1229, which lacks gas hydrates and is characterized by high pore water sulfate and low methane concentrations. This study contributes to a more comprehensive understanding of authigenic carbonate formation and associated biogeochemical processes in continental margin sediments. Meister, P., Mckenzie, J. A., Vasconcelos, C., Bernasconi, S., Frank, M., Gutjhar, M. and SCHRAG, D. P. (2007), Dolomite formation in the dynamic deep biosphere: results from the Peru Margin. Sedimentology, 54: 1007-1032.

  1. Inhibition by alcohols of the localization of radioactive nitrosonornicotine in sites of tumor formation

    SciTech Connect

    Waddell, W.J.; Marlowe, C.

    1983-06-01

    Oral administration of ethanol, n-butanol, or t-butanol to mice 20 minutes before injection of carbon-14-labeled nitrosonornicotine inhibited the localization of radioactivity in bronchial and salivary duct epithelium and in the liver. Localization of radioactivity in the nasal epithelium and esophagus was not significantly reduced. These alcohols therefore may selectively inhibit tumor formation in three of the five sites where this carcinogen typically acts.

  2. Vertical stratification of subsurface microbial community composition across geological formations at the Hanford Site

    SciTech Connect

    Lin, Xueju; Kennedy, David W.; Fredrickson, Jim K.; Bjornstad, Bruce N.; Konopka, Allan

    2011-11-29

    Microbial diversity in subsurface sediments at the Hanford Site 300 Area near Richland, Washington State (USA) was investigated by analyzing samples recovered from depths of 9 to 52 m. Approximately 8000 near full-length 16S rRNA gene sequences were analyzed across geological strata that include a natural redox transition zone. These strata included the oxic coarse-grained Hanford formation, fine-grained oxic and anoxic Ringold Formation sediments, and the weathered basalt group. We detected 1233 and 120 unique bacterial and archaeal OTUs (Operational Taxonomic Units at the 97% identity level), respectively. Microbial community structure and richness varied substantially across the different geological strata. Bacterial OTU richness (Chao1 estimator) was highest (>700) in the upper Hanford formation, and declined to about 120 at the bottom of the Hanford formation. Just above the Ringold oxic-anoxic interface, richness was about 325 and declined to less than 50 in the deeper reduced zones. The deeper Ringold strata were characterized by a preponderance (ca. 90%) of Proteobacteria. The Bacterial community in the oxic sediments contained not only members of 9 well-recognized phyla but also an unusually high proportion of 3 candidate divisions (GAL15, NC10, and SPAM). Additionally, novel phylogenetic orders were identified within the Delta-proteobacteria, a clade rich in microbes that carry out redox transformations of metals that are important contaminants on the Hanford Site.

  3. Vertical stratification of subsurface microbial community composition across geological formations at the Hanford Site.

    PubMed

    Lin, Xueju; Kennedy, David; Fredrickson, Jim; Bjornstad, Bruce; Konopka, Allan

    2012-02-01

    Microbial diversity in subsurface sediments at the Hanford Site 300 Area near Richland, Washington state (USA) was investigated by analysing 21 samples recovered from depths of 9-52 m. Approximately 8000 near full-length 16S rRNA gene sequences were analysed across geological strata that include a natural redox transition zone. These strata included the oxic coarse-grained Hanford formation, fine-grained oxic and anoxic Ringold Formation sediments, and the weathered basalt group. We detected 1233 and 120 unique bacterial and archaeal OTUs (operational taxonomic units at the 97% identity level) respectively. Microbial community structure and richness varied substantially across the different geological strata. Bacterial OTU richness (Chao1 estimator) was highest (> 700) in the upper Hanford formation, and declined to about 120 at the bottom of the Hanford formation. Just above the Ringold oxic-anoxic interface, richness was about 325 and declined to less than 50 in the deeper reduced zones. The deeper Ringold strata were characterized by a preponderance (c. 90%) of Proteobacteria. The bacterial community in the oxic sediments contained not only members of nine well-recognized phyla but also an unusually high proportion of three candidate divisions (GAL15, NC10 and SPAM). Additionally, 13 novel phylogenetic orders were identified within the Deltaproteobacteria, a clade rich in microbes that carry out redox transformations of metals that are important contaminants on the Hanford Site. PMID:22122741

  4. Characteristics of formation and growth of atmospheric nanoparticles observed at four regional background sites in Korea

    NASA Astrophysics Data System (ADS)

    Kim, Yumi; Kim, Sang-Woo; Yoon, Soon-Chang; Park, Jin-Soo; Lim, Jae-Hyun; Hong, Jihyung; Lim, Han-Cheol; Ryu, Jegyu; Lee, Chul-Kyu; Heo, Bok-Haeng

    2016-02-01

    Measurements of the number concentration and size distribution of atmospheric nanoparticles were conducted at four sites on the west coast of the Korean Peninsula by using identical scanning mobility particle sizers (SMPSs) in October 2012. The new particle formation and subsequent growth (NPF) of atmospheric nanoparticles, which were identified by the cyclostationary empirical orthogonal function (CSEOF) analysis technique, was observed on 11 out of 21 days at the Baengnyeong-do Comprehensive Monitoring Observatory (BCMO); and on 10 out of 21 days at the Korea Global Atmosphere Watch Center (KGAWC) from October 9 to 29, 2012. We also observed NPF events for 9 out of 21 days at both the Gosan Climate Observatory (GCO) and the Jeju Comprehensive Monitoring Observatory (JCMO). During the study period, NPF was simultaneously observed for five days at all four sites, which indicates that the NPF event had a spatial extent of at least 540 km. A cold, dry and cloud-free continental air mass originated from northern China, formed favorable environmental conditions (e.g., increasing solar insolation at the surface) on simultaneous NPF at the four sites. These synoptic weather patterns were closely associated with an extraordinary typhoon passing over the south of Japan. The mean values of particle formation rates at BCMO (1.26 cm- 3 s- 1) and KGAWC (1.49 cm- 3 s- 1) were relatively higher than those at GCO (0.39 cm- 3 s- 1) and JCMO (0.74 cm- 3 s- 1), however, the growth rate showed a similar level among four sites. An increase in the spatial homogeneity and inter-site correlation of atmospheric particles among the four sites was apparent for small particles (diameter < 30 nm) on simultaneous NPF event days.

  5. Mineral abundances at the final four curiosity study sites and implications for their formation

    NASA Astrophysics Data System (ADS)

    Poulet, F.; Carter, J.; Bishop, J. L.; Loizeau, D.; Murchie, S. M.

    2014-03-01

    A component of the landing site selection process for the Mars Science Laboratory (MSL) involved the presence of phyllosilicates as the main astrobiological targets. Gale crater was selected as the MSL landing site from among 4 down selected study sites (Gale, Eberswalde and Holden craters, Mawrth Vallis) that addressed the primary scientific goal of assessing the past habitability of Mars. A key constraint on the formation process of these phyllosilicate-bearing deposits is in the precise mineralogical composition. We present a reassessment of the mineralogy of the sites combined with a determination of the modal mineralogy of the major phyllosilicate-bearing deposits of the four final study sites from the modeling of near-infrared spectra using a radiative transfer model. The largest abundance of phyllosilicates (30-70%) is found in Mawrth Vallis, the lowest one in Eberswalde (<25%). Except for Mawrth Vallis, the anhydrous phases (plagioclase, pyroxenes and martian dust) are the dominant phases, suggesting formation conditions with a lower alteration grade and/or a post-formation mixing with anhydrous phases. The composition of Holden layered deposits (mixture of saponite and micas with a total abundance in the range of 25-45%) suggests transport and deposition of altered basalts of the Noachian crust without major chemical transformation. For Eberswalde, the modal mineralogy is also consistent with detrital clays, but the presence of opaline silica indicates that an authigenic formation occurred during the deposition. The overall composition including approximately 20-30% smectite detected by MSL in the rocks of Yellow-knife Bay area interpreted to be material deposited on the floor of Gale crater by channels (http://www.nasa.gov/mission_pages/msl/news/msl20130312.html) is consistent with the compositions modeled for the Eberswalde and Holden deltaic rocks. At Gale, the paucity, the small diversity and the low abundance of nontronite do not favor a complex and

  6. The formation and function of ER-endosome membrane contact sites.

    PubMed

    Eden, Emily R

    2016-08-01

    Recent advances in membrane contact site (MCS) biology have revealed key roles for MCSs in inter-organellar exchange, the importance of which is becoming increasingly apparent. Roles for MCSs in many essential physiological processes including lipid transfer, calcium exchange, receptor tyrosine kinase signalling, lipid droplet formation, autophagosome formation, organelle dynamics and neurite outgrowth have been reported. The ER forms an extensive and dynamic network of MCSs with a diverse range of functionally distinct organelles. MCSs between the ER and endocytic pathway are particularly abundant, suggesting important physiological roles. Here, our current knowledge of the formation and function of ER contact sites with endocytic organelles from studies in mammalian systems is reviewed. Their relatively poorly defined molecular composition and recently identified functions are discussed. In addition, likely, but yet to be established, roles for these contacts in lipid transfer and calcium signalling are considered. This article is part of a Special Issue entitled: The cellular lipid landscape edited by Tim P. Levine and Anant K. Menon. PMID:26898183

  7. Geoarchaeological investigation at Al-Khiday (central Sudan): late Quaternary palaeoenvironment and site formation

    NASA Astrophysics Data System (ADS)

    Zerboni, Andrea; Usai, Donatella; Salvatori, Sandro

    2010-05-01

    The micromorphological investigation on several pluristratified archaeological sites in central Sudan (Al-Khiday, left bank of the White Nile, Khartoum region, Sudan) permitted to elucidate depositional and post-depositional processes playing a role in the formation and preservation of the archaeological record. At Al-Khiday sites are located at the top of small mounds, representing the remains of Pleistocene sandy fluvial bars, and were attended since the beginning of the Holocene. The first occupation of the area corresponds to a pre-Mesolithic cemetery; than Mesolithic groups lived upon the mounds and their occupation is testified by several archaeological features: pits filled by ash and bones and living floors. Preserved Neolithic features are scarce and limited to few graves (V millennium BC). After this phase, a long gap in human attendance is registered, during which wind continued to dismantling the mounds and the sites; at ca. 2000 years BP Meroitic/Post-Meroitic groups built their tombs at the top of the archaeological sequences and altered most of the stratigraphic record. Thanks to micromorphology, it was possible to distinguish between archaeological strata still in situ and those disturbed by natural and anthropic processes; furthermore, this approach allowed to interpret the significance of several archaeological features (living floors, fireplaces, and garbage pits). In this case micromorphology of archaeological deposits was a key tool to reconstruct the depositional and post-depositional processes that contributed to the formation and preservation of the archaeological record.

  8. VOC emissions, evolutions and contributions to SOA formation at a receptor site in eastern China

    NASA Astrophysics Data System (ADS)

    Yuan, B.; Hu, W. W.; Shao, M.; Wang, M.; Chen, W. T.; Lu, S. H.; Zeng, L. M.; Hu, M.

    2013-09-01

    Volatile organic compounds (VOCs) were measured by two online instruments (GC-FID/MS and PTR-MS) at a receptor site on Changdao Island (37.99° N, 120.70° E) in eastern China. Reaction with OH radical dominated chemical losses of most VOC species during the Changdao campaign. A photochemical-age-based parameterization method is used to calculate VOC emission ratios and to quantify the evolution of ambient VOCs. The calculated emission ratios of most hydrocarbons agree well with those obtained from emission inventory data, but determined emission ratios of oxygenated VOCs (OVOCs) are significantly higher than those from emission inventory data. The photochemical-age-based parameterization method is also used to investigate primary emissions and secondary formation of organic aerosol. The primary emission ratio of organic aerosol (OA) to CO is determined to be 14.9 μg m-3 ppm-1, and secondary organic aeorosols (SOA) are produced at an enhancement ratio of 18.8 μg m-3 ppm-1 to CO after 50 h of photochemical processing in the atmosphere. SOA formation is significantly higher than the level determined from VOC oxidation under both high-NOx (2.0 μg m-3 ppm-1 CO) and low-NOx conditions (6.5 μg m-3 ppm-1 CO). Polycyclic aromatic hydrocarbons (PAHs) and higher alkanes (> C10) account for as high as 17.4% of SOA formation, which suggests semi-volatile organic compounds (SVOCs) may be a large contributor to SOA formation during the Changdao campaign. The SOA formation potential of primary VOC emissions determined from field campaigns in Beijing and Pearl River Delta (PRD) is lower than the measured SOA levels reported in the two regions, indicating SOA formation is also beyond explainable by VOC oxidation in the two city clusters.

  9. Vertical stratification of subsurface microbial community composition across geological formations at the Hanford Site

    SciTech Connect

    Lin, Xueju; Kennedy, David W.; Fredrickson, Jim K.; Bjornstad, Bruce N.; Konopka, Allan

    2012-02-01

    The microbial diversity in subsurface sediments at the Hanford Site's 300 Area in southeastern Washington State was investigated by analyzing 21 samples recovered from depths that ranged from 9 to 52 m. Approximately 8000 non-chimeric Bacterial and Archaeal 16S rRNA gene sequences were analyzed across geological strata that contain a natural redox transition zone. These strata included the oxic coarse-grained Hanford formation, fine-grained oxic and anoxic Ringold Formation sediments, and the weathered basalt group. We detected 1233 and 120 unique bacterial and archaeal OTUs (Operational Taxonomic Units, defined at the 97% identity level). Microbial community structure and richness varied substantially across the different geological strata. Bacterial OTU richness (based upon Chao1 estimator) was highest (>700) in the upper Hanford formation, and declined to about 120 at the bottom of the Hanford formation. Just above the Ringold oxic-anoxic transition zone, richness was about 325 and declined to less than 50 in the deeper reduced zones. The Bacterial community in the oxic Hanford and Ringold Formations contained members of 9 major well-recognized phyla as well 30 as unusually high proportions of 3 candidate divisions (GAL15, NC10, and SPAM). The deeper Ringold strata were characterized by low OTU richness and a very high preponderance (ca. 90%) of Proteobacteria. The study has greatly expanded the intralineage phylogenetic diversity within some major divisions. These subsurface sediments have been shown to contain a large number of phylogenetically novel microbes, with substantial heterogeneities between sediment samples from the same geological formation.

  10. Hydraulic Testing of Salado Formation Evaporites at the Waste Isolation Pilot Plant Site: Final Report

    SciTech Connect

    Beauheim, Richard L.; Domski, Paul S.; Roberts, Randall M.

    1999-07-01

    This report presents interpretations of hydraulic tests conducted in bedded evaporates of the Salado Formation from May 1992 through May 1995 at the Waste Isolation Pilot Plant (WIPP) site in southeastern New Mexico. The WIPP is a US Department of Energy research and development facility designed to demonstrate safe disposal of transuranic wastes from the nation's defense programs. The WIPP disposal horizon is located in the lower portion of the Permian Salado Formation. The hydraulic tests discussed in this report were performed in the WIPP underground facility by INTERA inc. (now Duke Engineering and Services, Inc.), Austin, Texas, following the Field Operations Plan and Addendum prepared by Saulnier (1988, 1991 ) under the technical direction of Sandia National Laboratories, Albuquerque, New Mexico.

  11. Soil formation in post mining sites: the role of vegatation soil microflora and fauna interactions

    NASA Astrophysics Data System (ADS)

    Frouz, J.

    2009-04-01

    The role of vegetation and soil micro flora and fauna interaction during soil formation was studied in post mining sites in Czech Republic, Germany and USA. Vegetation and character of substrate substantially effect, micro flora, namely fungal bacterial ration, fauna composition and resulting microstructure of soil. Plants that bring more nitrogen in to the system support larger biomass of soil fauna and namely occurrence of earthworms which yield in larger bioturbation and associated faster production of A horizon in newly developing soil. Manipulation experiment show that presence of fauna have crucial effect of soil formation in these soil and positive effect of many plant species which are assumed to beneficial for reclamation is in fact indirect and caused by its positive effect on soil fauna development.

  12. Prevention of amyloid fibril formation of amyloidogenic chicken cystatin by site-specific glycosylation in yeast

    PubMed Central

    He, Jianwei; Song, Youtao; Ueyama, Nobuhiro; Saito, Akira; Azakami, Hiroyuki; Kato, Akio

    2006-01-01

    To address the role of glycosylation on fibrillogenicity of amyloidogenic chicken cystatin, the consensus sequence for N-linked glycosylation (Asn106-Ile108 → Asn106-Thr108) was introduced by site-directed mutagenesis into the wild-type and amyloidogenic chicken cystatins to construct the glycosylated form of chicken cystatins. Both the glycosylated and unglycosylated forms of wild-type and amyloidogenic mutant I66Q cystatin were expressed and secreted in a culture medium of yeast Pichia pastoris transformants. Comparison of the amount of insoluble aggregate, the secondary structure, and fibrillogenicity has shown that the N-linked glycosylation could prevent amyloid fibril formation of amyloidogenic chicken cystatin secreted in yeast cells without affecting its inhibitory activities. Further study showed this glycosylation could inhibit the formation of cystatin dimers. Therefore, our data strongly suggested that the mechanism causing the prevention of amyloidogenic cystation fibril formation may be realized through suppression of the formation of three-dimensional domain-swapped dimers and oligomers of amyloidogenic cystatin by the glycosylated chains at position 106. PMID:16434741

  13. Lamellipodial actin mechanically links myosin activity with adhesion-site formation.

    PubMed

    Giannone, Grégory; Dubin-Thaler, Benjamin J; Rossier, Olivier; Cai, Yunfei; Chaga, Oleg; Jiang, Guoying; Beaver, William; Döbereiner, Hans-Günther; Freund, Yoav; Borisy, Gary; Sheetz, Michael P

    2007-02-01

    Cell motility proceeds by cycles of edge protrusion, adhesion, and retraction. Whether these functions are coordinated by biochemical or biomechanical processes is unknown. We find that myosin II pulls the rear of the lamellipodial actin network, causing upward bending, edge retraction, and initiation of new adhesion sites. The network then separates from the edge and condenses over the myosin. Protrusion resumes as lamellipodial actin regenerates from the front and extends rearward until it reaches newly assembled myosin, initiating the next cycle. Upward bending, observed by evanescence and electron microscopy, results in ruffle formation when adhesion strength is low. Correlative fluorescence and electron microscopy shows that the regenerating lamellipodium forms a cohesive, separable layer of actin above the lamellum. Thus, actin polymerization periodically builds a mechanical link, the lamellipodium, connecting myosin motors with the initiation of adhesion sites, suggesting that the major functions driving motility are coordinated by a biomechanical process. PMID:17289574

  14. Assessment of the potential for karst in the Rustler Formation at the WIPP site.

    SciTech Connect

    Lorenz, John Clay

    2006-01-01

    This report is an independent assessment of the potential for karst dissolution in evaporitic strata of the Rustler Formation at the Waste Isolation Pilot Plant (WIPP) site. Review of the available data suggests that the Rustler strata thicken and thin across the area in depositional patterns related to lateral variations in sedimentary accommodation space and normal facies changes. Most of the evidence that has been offered for the presence of karst in the subsurface has been used out of context, and the different pieces are not mutually supporting. Outside of Nash Draw, definitive evidence for the development of karst in the Rustler Formation near the WIPP site is limited to the horizon of the Magenta Member in drillhole WIPP-33. Most of the other evidence cited by the proponents of karst is more easily interpreted as primary sedimentary structures and the localized dissolution of evaporitic strata adjacent to the Magenta and Culebra water-bearing units. Some of the cited evidence is invalid, an inherited baggage from studies made prior to the widespread knowledge of modern evaporite depositional environments and prior to the existence of definitive exposures of the Rustler Formation in the WIPP shafts. Some of the evidence is spurious, has been taken out of context, or is misquoted. Lateral lithologic variations from halite to mudstone within the Rustler Formation under the WIPP site have been taken as evidence for the dissolution of halite such as that seen in Nash Draw, but are more rationally explained as sedimentary facies changes. Extrapolation of the known karst features in Nash Draw eastward to the WIPP site, where conditions are and have been significantly different for half a million years, is unwarranted. The volumes of insoluble material that would remain after dissolution of halite would be significantly less than the observed bed thicknesses, thus dissolution is an unlikely explanation for the lateral variations from halite to mudstone and siltstone

  15. BOREAS TE-20 Soils Data Over the NSA-MSA and Tower Sites in Raster Format

    NASA Technical Reports Server (NTRS)

    Hall, Forrest G. (Editor); Veldhuis, Hugo; Knapp, David; Veldhuis, Hugo

    2000-01-01

    The BOREAS TE-20 team collected several data sets for use in developing and testing models of forest ecosystem dynamics. This data set was gridded from vector layers of soil maps that were received from Dr. Hugo Veldhuis, who did the original mapping in the field during 1994. The vector layers were gridded into raster files that cover the NSA-MSA and tower sites. The data are stored in binary, image format files. The data files are available on a CD-ROM (see document number 20010000884), or from the Oak Ridge National Laboratory (ORNL) Distributed Active Center (DAAC).

  16. Geology of the Hanna Formation, Hanna Underground Coal Gasification Site, Hanna, Wyoming

    SciTech Connect

    Oliver, R.L.; Youngberg, A.D.

    1984-01-01

    The Hanna Underground Coal Gasification (UCG) study area consists of the SW1/4 of Section 29 and the E1/2SE1/4 of Section 30 in Township 22 North, Range 81 West, Wyoming. Regionally, this is located in the coal-bearing Hanna Syncline of the Hanna Basin in southeast Wyoming. The structure of the site is characterized by beds dipping gently to the northeast. An east-west fault graben complex interrupts this basic trend in the center of the area. The target coal bed of the UCG experiments was the Hanna No. 1 coal in the Hanna Formation. Sedimentary rocks comprising the Hanna Formation consist of a sequence of nonmarine shales, sandstones, coals and conglomerates. The overburden of the Hanna No. 1 coal bed at the Hanna UCG site was divided into four broad local stratigraphic units. Analytical studies were made on overburden and coal samples taken from cores to determine their mineralogical composition. Textural and mineralogical characteristics of sandstones from local stratigraphic units A, B, and C were analyzed and compared. Petrographic analyses were done on the coal including oxides, forms of sulfur, pyrite types, maceral composition, and coal rank. Semi-quantitative spectrographic and analytic geochemical analyses were done on the overburden and coal and relative element concentrations were compared. Trends within each stratigraphic unit were also presented and related to depositional environments. The spectrographic analysis was also done by lithotype. 34 references, 60 figures, 18 tables.

  17. Site formation and chronology of the new Paleolithic site Sima de Las Palomas de Teba, southern Spain

    NASA Astrophysics Data System (ADS)

    Kehl, Martin; Burow, Christoph; Cantalejo, Pedro; Domínguez-Bella, Salvador; Durán, Juan José; Henselowsky, Felix; Klasen, Nicole; Linstädter, Jörg; Medianero, Javier; Pastoors, Andreas; Ramos, José; Reicherter, Klaus; Schmidt, Christoph; Weniger, Gerd-Christian

    2016-03-01

    The newly identified Paleolithic site Sima de Las Palomas de Teba hosts an almost seven-m-thick sediment profile investigated here to elucidate the rock shelter's chronostratigraphy and formation processes. At its base, the sediment sequence contains rich archeological deposits recording intensive occupation by Neanderthals. Luminescence provides a terminus ante quem of 39.4 ± 2.6 ka or 44.9 ± 4.1 ka (OSL) and 51.4 ± 8.4 ka (TL). This occupation ended with a rockfall event followed by accumulation of archeologically sterile sediments. These were covered by sediments containing few Middle Paleolithic artifacts, which either indicate ephemeral occupation by Neanderthals or reworking as suggested by micromorphological features. Above this unit, scattered lithic artifacts of undiagnostic character may represent undefined Paleolithic occupations. Sediment burial ages between about 23.0 ± 1.5 ka (OSL) and 40.5 ± 3.4 ka (pIRIR) provide an Upper Paleolithic chronology for sediments deposited above the rockfall. Finally, a dung-bearing Holocene layer in the uppermost part of the sequence contains a fragment of a human mandible dated to 4032 ± 39 14C yr BP. Overall, the sequence represents an important new site for studying the end of Neanderthal occupation in southern Spain. Supplementary Figure S2: Preheat-plateau and dose-recovery test results for OSL on fine-grained quartz of samples CP7. Aliquots for the dose-recovery test were administered a dose of 40 Gy after removing the natural signal by blue stimulation for 150 s at 125°C and 80% optical power. Supplementary Figure S3: Dependence of equivalent dose on prior IR stimulation temperature for samples CP1, CP3 and CP7. For each sample and pIRIR protocol six aliquots were used while increasing the first IR stimulation temperature in steps of 30°C from 50°C to 140°C and to 180°C. Data are normalized to the pIRIR De obtained with a first IR stimulation at 50°C. Supplementary Figure S4: Regenerative TL glow

  18. New particle formation at a remote site in the eastern Mediterranean

    NASA Astrophysics Data System (ADS)

    Pikridas, Michael; Riipinen, Ilona; Hildebrandt, Lea; Kostenidou, Evangelia; Manninen, Hanna; Mihalopoulos, Nikos; Kalivitis, Nikos; Burkhart, John F.; Stohl, Andreas; Kulmala, Markku; Pandis, Spyros N.

    2012-06-01

    A year (6-April-2008 to 14-April-2009) of particulate monitoring was conducted at a remote coastal station on the island of Crete, Greece in the eastern Mediterranean. Fifty-eight regional new particle formation events were observed with an Air Ion Spectrometer (AIS), half of which occurred during the coldest months of the year (December-March). Particle formation was favored by air masses arriving from the west that crossed Crete or southern Greece prior to reaching the site and also by lower-than-average condensational sinks (CS). Aerosol composition data, which were acquired during month-long campaigns in the summer and winter, suggest that nucleation events occurred only when particles were neutral. This is consistent with the hypothesis that a lack of NH3, during periods when particles are acidic, may limit nucleation in sulfate-rich environments. Nucleation was not limited by the availability of SO2 alone, as nucleation events often did not take place during periods with high SO2 or H2SO4 concentrations. The above results support the hypothesis that an additional reactant (other than H2SO4) plays an important role in the formation and/or growth of new particles. Our results are consistent with NH3 being this missing reactant.

  19. New Particle Formation Above a Loblolly Pine Forest at a New Tower Site in Central Virginia

    NASA Astrophysics Data System (ADS)

    Joerger, V.; O'Halloran, T. L.; Barr, J. G.

    2014-12-01

    We present initial results investigating the environmental controls on new particle formation events at a new research site in central Virginia. The Sweet Briar College Land-Atmosphere Research Station (SBC-LARS) became operational in July, 2014 and features a 37-meter tower within a ~30 year-old loblolly pine plantation that is surrounded by mixed deciduous forest at the eastern edge of the Blue Ridge Mountains. The tower supports meteorological instruments at three different heights (2, 26, and 37 meters) and two air sampling inlets located above the canopy. The inlets draw air samples into a climate-controlled shed where precursor gas concentrations (ozone, sulfur dioxide, and nitrogen oxides) are determined by gas analyzers. Aerosol size distributions between 10 and 470 nm are measured every 3 minutes by a Scanning Mobility Particle Sizer (SMPS). For this study, aerosol size distributions from July through November 2014 were analyzed along with HYSPLIT backwards trajectories, meteorological measurements, gas concentrations, and the condensational sink, to investigate controls on new particle formation. This station and corresponding dataset will contribute to a better understanding of the contribution of biogenic and anthropogenic emissions to aerosol formation in the southeastern United States.

  20. Greater Bone Formation Induction Occurred in Aged than Young Cancellous Bone Sites

    NASA Technical Reports Server (NTRS)

    Ke, H. Z.; Jee, W. S. S.; Ito, H.; Setterberg, R. B.; Li, M.; Lin, B. Y.; Liang, X. G.; Ma, Y. F.

    1993-01-01

    We have determined the differences in the effects of continual prostaglandin E(sub 2) (PGE(sub 2) treatment in aged (non-growing) and young (growing) cancellous bone sites in 7-month-old Sprague-Dawley rats. The sites involved are the aged distal tibial metaphysis (DTM) with a closed epiphysis and the young proximal tibial metaphysis (PTM) with a slow growing, open epiphysis. The study involved rats treated with 0, 1, 3 or 6 mg PGE(sub 2)/kg/d for 60, 120 and 180 days. Static and dynamic histomorphometry of percent trabecular area, and tissue-referent bone formation rate (BFR/TV) were determined in both DTM and PTM. In pretreatment controls, the secondary spongiosa of the two metaphyses contain the same amount of cancellous bone (11% in DTM vs. 13% in PTM), but markedly less bone formation in DTM (0.6%/y in DTM vs. 41.5%/y in PTM). After 60 days of 6 mg PGE(sub 2)/kg/d treatment, %Tb.Ar was increased 607% in DTM and 199% in PTM, BFR/TV was increased to nearly 14 fold in DTM and only 5 fold in PTM. These results indicated the aged metaphysis of the DTM was much more responsive to PGE(sub 2) treatment than young, growing metaphysis of the PTM. The results of 120 and 180 days treatment did not significantly differ from 60 days treatment in both sites, indicating that the effect of continuous daily PGE2 treatment were in equilibrium after 60 days. We concluded that aged metaphysis was much more responsive to PGE(sub 2) treatment than young growing metaphysis.

  1. The functions of anionic phospholipids during clathrin-mediated endocytosis site initiation and vesicle formation

    PubMed Central

    Sun, Yidi; Drubin, David G.

    2012-01-01

    Summary Anionic phospholipids PI(4,5)P2 and phosphatidylserine (PS) are enriched in the cytosolic leaflet of the plasma membrane where endocytic sites form. In this study, we investigated the roles of PI(4,5)P2 and PS in clathrin-mediated endocytosis (CME) site initiation and vesicle formation in Saccharomyces cerevisiae. Live-cell imaging of endocytic protein dynamics in an mss4ts mutant, which has severely reduced PI(4,5)P2 levels, revealed that PI(4,5)P2 is required for endocytic membrane invagination but is less important for endocytic site initiation. We also demonstrated that, in various deletion mutants of genes encoding components of the Rcy1-Ypt31/32 GTPase pathway, endocytic proteins dynamically assemble not only on the plasma membrane but also on intracellular membrane compartments, which are likely derived from early endosomes. In rcy1Δ cells, fluorescent biosensors indicated that PI(4,5)P2 only localized to the plasma membrane while PS localized to both the plasma membrane and intracellular membranes. Furthermore, we found that polarized endocytic patch establishment is defective in the PS-deficient cho1Δ mutant. We propose that PS is important for directing endocytic proteins to the plasma membrane and that PI(4,5)P2 is required to facilitate endocytic membrane invagination. PMID:23097040

  2. VOC emissions, evolutions and contributions to SOA formation at a receptor site in Eastern China

    NASA Astrophysics Data System (ADS)

    Yuan, B.; Hu, W. W.; Shao, M.; Wang, M.; Chen, W. T.; Lu, S. H.; Zeng, L. M.; Hu, M.

    2013-03-01

    Volatile organic compounds (VOCs) were measured by two online instruments (GC-FID/MS and PTR-MS) at a receptor site on Changdao Island (37.99° N, 120.70° E) in eastern China. Reaction with OH radical dominated the chemical loss of most VOC species during the Changdao campaign. A photochemical age based parameterization method is used to calculate VOC emission ratios and to quantify the evolution of ambient VOCs. The calculated emission ratios of most hydrocarbons agree well with those obtained from emission inventory, but the emission ratios of oxygenated VOCs (OVOCs) are significantly lower than those from emission inventory. The photochemical age based parameterization method is also used to investigate primary emissions and secondary formation of organic aerosol. The primary emission ratio of OA to CO are determined to be 14.9 μg m-3 ppm-1 and SOA are produced at an enhancement ratio of 18.8 μg m-3 ppm-1 to CO after 50 h of photochemical processing in the atmosphere. SOA formation is significantly higher than the level determined from VOC oxidation under both high-NOx (2.0 μg m-3 ppm-1 CO) and low-NOx condition (6.5 μg m-3 ppm-1 CO). Polycyclic aromatic hydrocarbons (PAHs) and higher alkanes (>C10) account for as high as 17.4% of SOA formation, which suggests semi-volatile organic compounds (SVOCs) may be a large contributor to SOA formation during the Changdao campaign. SOA formation potential of primary VOC emissions determined from both field campaigns and emission inventory in China are lower than the measured SOA levels reported in Beijing and Pearl River Delta (PRD), indicating SOA formation cannot be explained by VOC oxidation in this regions. SOA budget in China is estimated to be 5.0-13.7 Tg yr-1, with a fraction of at least 2.7 Tg yr-1 from anthropogenic emissions, which are much higher than the previous estimates from regional models.

  3. Role of Criegee Intermediates in Formation of Sulfuric Acid at BVOCs-rich Cape Corsica Site

    NASA Astrophysics Data System (ADS)

    Kukui, A.; Dusanter, S.; Sauvage, S.; Gros, V.; Bourrianne, T.; Sellegri, K.; Wang, J.; Colomb, A.; Pichon, J. M.; Chen, H.; Kalogridis, C.; Zannoni, N.; Bonsang, B.; Michoud, V.; Locoge, N.; Leonardis, T.

    2015-12-01

    Oxidation of SO2 in reactions with stabilised Criegee Intermediates (sCI) was suggested as an additional source of gaseous sulfuric acid (H2SO4) in the atmosphere, complementary to the conventional H2SO4 formation in reaction of SO2 with OH radicals. Evaluation of the importance of this additional source is complicated due to large uncertainty in the mechanism and rate constants for the reactions of different sCI with SO2, water vapor and other atmospheric species. Here we present an evaluation of the role of sCI in H2SO4 production at remote site on Cape Corsica near the North tip of Corsica Island (Ersa station, Western Mediterranean). In July 2013 comprehensive field observations including gas phase (OH and RO2 radicals, H2SO4, VOCs, NOx, SO2, others) and aerosol measurements were conducted at this site in the frame of ChArMEx project. During the field campaign the site was strongly influenced by local emissions of biogenic volatile compounds (BVOCs), including isoprene and terpenes, forming different sCI in reactions with ozone and, hence, presenting additional source of H2SO4 via sCI+SO2. However, this additional source of H2SO4 at the Ersa site was found to be insignificant. The observed concentrations of H2SO4 were found to be in good agreement with those estimated from the H2SO4 condensation sink and the production of H2SO4 only in the reaction of OH with SO2, without accounting for any additional H2SO4 source. Using the BVOCs observations we present estimation of the upper limit for the rate constants of H2SO4 production via reactions of different sCI with SO2.

  4. Evidence of Conformational Selection Driving the Formation of Ligand Binding Sites in Protein-Protein Interfaces

    PubMed Central

    Bohnuud, Tanggis; Kozakov, Dima; Vajda, Sandor

    2014-01-01

    Many protein-protein interactions (PPIs) are compelling targets for drug discovery, and in a number of cases can be disrupted by small molecules. The main goal of this study is to examine the mechanism of binding site formation in the interface region of proteins that are PPI targets by comparing ligand-free and ligand-bound structures. To avoid any potential bias, we focus on ensembles of ligand-free protein conformations obtained by nuclear magnetic resonance (NMR) techniques and deposited in the Protein Data Bank, rather than on ensembles specifically generated for this study. The measures used for structure comparison are based on detecting binding hot spots, i.e., protein regions that are major contributors to the binding free energy. The main tool of the analysis is computational solvent mapping, which explores the surface of proteins by docking a large number of small “probe” molecules. Although we consider conformational ensembles obtained by NMR techniques, the analysis is independent of the method used for generating the structures. Finding the energetically most important regions, mapping can identify binding site residues using ligand-free models based on NMR data. In addition, the method selects conformations that are similar to some peptide-bound or ligand-bound structure in terms of the properties of the binding site. This agrees with the conformational selection model of molecular recognition, which assumes such pre-existing conformations. The analysis also shows the maximum level of similarity between unbound and bound states that is achieved without any influence from a ligand. Further shift toward the bound structure assumes protein-peptide or protein-ligand interactions, either selecting higher energy conformations that are not part of the NMR ensemble, or leading to induced fit. Thus, forming the sites in protein-protein interfaces that bind peptides and can be targeted by small ligands always includes conformational selection, although

  5. Formation of target-specific binding sites in enzymes: solid-phase molecular imprinting of HRP

    NASA Astrophysics Data System (ADS)

    Czulak, J.; Guerreiro, A.; Metran, K.; Canfarotta, F.; Goddard, A.; Cowan, R. H.; Trochimczuk, A. W.; Piletsky, S.

    2016-05-01

    Here we introduce a new concept for synthesising molecularly imprinted nanoparticles by using proteins as macro-functional monomers. For a proof-of-concept, a model enzyme (HRP) was cross-linked using glutaraldehyde in the presence of glass beads (solid-phase) bearing immobilized templates such as vancomycin and ampicillin. The cross-linking process links together proteins and protein chains, which in the presence of templates leads to the formation of permanent target-specific recognition sites without adverse effects on the enzymatic activity. Unlike complex protein engineering approaches commonly employed to generate affinity proteins, the method proposed can be used to produce protein-based ligands in a short time period using native protein molecules. These affinity materials are potentially useful tools especially for assays since they combine the catalytic properties of enzymes (for signaling) and molecular recognition properties of antibodies. We demonstrate this concept in an ELISA-format assay where HRP imprinted with vancomycin and ampicillin replaced traditional enzyme-antibody conjugates for selective detection of templates at micromolar concentrations. This approach can potentially provide a fast alternative to raising antibodies for targets that do not require high assay sensitivities; it can also find uses as a biochemical research tool, as a possible replacement for immunoperoxidase-conjugates.Here we introduce a new concept for synthesising molecularly imprinted nanoparticles by using proteins as macro-functional monomers. For a proof-of-concept, a model enzyme (HRP) was cross-linked using glutaraldehyde in the presence of glass beads (solid-phase) bearing immobilized templates such as vancomycin and ampicillin. The cross-linking process links together proteins and protein chains, which in the presence of templates leads to the formation of permanent target-specific recognition sites without adverse effects on the enzymatic activity. Unlike

  6. Osterix/Sp7 limits cranial bone initiation sites and is required for formation of sutures.

    PubMed

    Kague, Erika; Roy, Paula; Asselin, Garrett; Hu, Gui; Simonet, Jacqueline; Stanley, Alexandra; Albertson, Craig; Fisher, Shannon

    2016-05-15

    During growth, individual skull bones overlap at sutures, where osteoblast differentiation and bone deposition occur. Mutations causing skull malformations have revealed some required genes, but many aspects of suture regulation remain poorly understood. We describe a zebrafish mutation in osterix/sp7, which causes a generalized delay in osteoblast maturation. While most of the skeleton is patterned normally, mutants have specific defects in the anterior skull and upper jaw, and the top of the skull comprises a random mosaic of bones derived from individual initiation sites. Osteoblasts at the edges of the bones are highly proliferative and fail to differentiate, consistent with global changes in gene expression. We propose that signals from the bone itself are required for orderly recruitment of precursor cells and growth along the edges. The delay in bone maturation caused by loss of Sp7 leads to unregulated bone formation, revealing a new mechanism for patterning the skull and sutures. PMID:26992365

  7. Formation of target-specific binding sites in enzymes: solid-phase molecular imprinting of HRP.

    PubMed

    Czulak, J; Guerreiro, A; Metran, K; Canfarotta, F; Goddard, A; Cowan, R H; Trochimczuk, A W; Piletsky, S

    2016-06-01

    Here we introduce a new concept for synthesising molecularly imprinted nanoparticles by using proteins as macro-functional monomers. For a proof-of-concept, a model enzyme (HRP) was cross-linked using glutaraldehyde in the presence of glass beads (solid-phase) bearing immobilized templates such as vancomycin and ampicillin. The cross-linking process links together proteins and protein chains, which in the presence of templates leads to the formation of permanent target-specific recognition sites without adverse effects on the enzymatic activity. Unlike complex protein engineering approaches commonly employed to generate affinity proteins, the method proposed can be used to produce protein-based ligands in a short time period using native protein molecules. These affinity materials are potentially useful tools especially for assays since they combine the catalytic properties of enzymes (for signaling) and molecular recognition properties of antibodies. We demonstrate this concept in an ELISA-format assay where HRP imprinted with vancomycin and ampicillin replaced traditional enzyme-antibody conjugates for selective detection of templates at micromolar concentrations. This approach can potentially provide a fast alternative to raising antibodies for targets that do not require high assay sensitivities; it can also find uses as a biochemical research tool, as a possible replacement for immunoperoxidase-conjugates. PMID:27174700

  8. Ice Lens Formation and Frost Heave at the Phoenix Landing Site

    NASA Technical Reports Server (NTRS)

    Zent, A. P.; Sizemore, H. G.; Remple, A. W.

    2011-01-01

    Several lines of evidence indicate that the volume of shallow ground ice in the martian high latitudes exceeds the pore volume of the host regolith. Boynton et al. found an optimal fit to the Mars Odyssey Gamma Ray Spectrometer (GRS) data at the Phoenix landing site by modeling a buried layer of 50-75% ice by mass (up to 90% ice by volume). Thermal and optical observations of recent impact craters in the northern hemisphere have revealed nearly pure ice. Ice deposits containing only 1-2% soil by volume were excavated by Phoenix. The leading hypothesis for the origin of this excess ice is that it developed in situ by a mechanism analogous to the formation of terrestrial ice lenses and needle ice. Problematically, terrestrial soil-ice segregation is driven by freeze/thaw cycling and the movement of bulk water, neither of which are expected to have occurred in the geologically recent past on Mars. If however ice lens formation is possible at temperatures less than 273 K, there are possible implications for the habitability of Mars permafrost, since the same thin films of unfrozen water that lead to ice segregation are used by terrestrial psychrophiles to metabolize and grow down to temperatures of at least 258 K.

  9. The Conundrum of the High-Affinity NGF Binding Site Formation Unveiled?

    PubMed Central

    Covaceuszach, Sonia; Konarev, Petr V.; Cassetta, Alberto; Paoletti, Francesca; Svergun, Dmitri I.; Lamba, Doriano; Cattaneo, Antonino

    2015-01-01

    The homodimer NGF (nerve growth factor) exerts its neuronal activity upon binding to either or both distinct transmembrane receptors TrkA and p75NTR. Functionally relevant interactions between NGF and these receptors have been proposed, on the basis of binding and signaling experiments. Namely, a ternary TrkA/NGF/p75NTR complex is assumed to be crucial for the formation of the so-called high-affinity NGF binding sites. However, the existence, on the cell surface, of direct extracellular interactions is still a matter of controversy. Here, supported by a small-angle x-ray scattering solution study of human NGF, we propose that it is the oligomerization state of the secreted NGF that may drive the formation of the ternary heterocomplex. Our data demonstrate the occurrence in solution of a concentration-dependent distribution of dimers and dimer of dimers. A head-to-head molecular assembly configuration of the NGF dimer of dimers has been validated. Overall, these findings prompted us to suggest a new, to our knowledge, model for the transient ternary heterocomplex, i.e., a TrkA/NGF/p75NTR ligand/receptors molecular assembly with a (2:4:2) stoichiometry. This model would neatly solve the problem posed by the unconventional orientation of p75NTR with respect to TrkA, as being found in the crystal structures of the TrkA/NGF and p75NTR/NGF complexes. PMID:25650935

  10. The effect of drug-DNA interactions on the intercalation site formation

    NASA Astrophysics Data System (ADS)

    Miroshnychenko, K. V.; Shestopalova, A. V.

    The problem of intercalation site formation in the undistorted B-DNA of different length and sequence was considered. Three models of DNA intercalation targets were proposed that accounted for the binding features of intercalators ethidium, daunomycin and 9-amino[N-(2-dimethylamino)ethyl]-acridine-4-carboxamide (9-amino-DACA). The automated docking of ligands into the constructed DNA-targets produced correct structures of complexes for ethidium and daunomycin when asymmetrically unwound DNA was used as target. To obtain the correct structure of 9-amino-DACA-DNA complex, the manual docking was applied. The results of docking of ligands into different DNA-targets indicate that, upon formation of the intercalation target, it is sufficient to take into account only the most significant unwinding in one particular helical step: in the intercalation step (for ethidium and 9-amino-DACA) or in the adjacent helical step (for daunomycin). The unwinding or overwinding of subsequent helical steps could be refined later during the optimization of the obtained intercalation complex. The unwinding of the DNA helical step on the large angle produces the 5‧-North/3‧-South asymmetry of sugar conformations in this step. The value of the total unwinding of the DNA in the intercalation complex was found to be dependent on the sequence and length of the DNA-target.

  11. Dynamic formation of single-atom catalytic active sites on ceria-supported gold nanoparticles

    DOE PAGESBeta

    Wang, Yanggang; Mei, Donghai; Glezakou, Vassiliki Alexandra; Li, Jun; Rousseau, Roger J.

    2015-03-04

    Ab initio Molecular Dynamics simulations and static Density Functional Theory calculations have been performed to investigate the reaction mechanism of CO oxidation on Au/CeO2 catalyst. It is found that under reaction condition CO adsorption significantly labializes the surface atoms of the Au cluster and leads to the formation of isolated Au+-CO species that resides on the support in the vicinity of the Au particle. In this context, we identified a dynamic single-atom catalytic mechanism at the interfacial area for CO oxidation on Au/CeO2 catalyst, which is a lower energy pathway than that of CO oxidation at the interface with themore » metal particle. This results from the ability of the single atom site to strongly couple with the redox properties of the support in a synergistic manner thereby lowering the barrier for redox reactions. We find that the single Au+ ion, which only exists under reaction conditions, breaks away from the Au cluster to catalyze CO oxidation and returns to the Au cluster after the catalytic cycle is completed. Generally, our study highlights the importance of the dynamic creation of active sites under reaction conditions and their essential role in a catalytic process.« less

  12. Evolutionarily conserved sites in yeast tropomyosin function in cell polarity, transport and contractile ring formation

    PubMed Central

    Cranz-Mileva, Susanne; MacTaggart, Brittany; Russell, Jacquelyn; Hitchcock-DeGregori, Sarah E.

    2015-01-01

    ABSTRACT Tropomyosin is a coiled-coil protein that binds and regulates actin filaments. The tropomyosin gene in Schizosaccharomyces pombe, cdc8, is required for formation of actin cables, contractile rings, and polar localization of actin patches. The roles of conserved residues were investigated in gene replacement mutants. The work validates an evolution-based approach to identify tropomyosin functions in living cells and sites of potential interactions with other proteins. A cdc8 mutant with near-normal actin affinity affects patch polarization and vacuole fusion, possibly by affecting Myo52p, a class V myosin, function. The presence of labile residual cell attachments suggests a delay in completion of cell division and redistribution of cell patches following cytokinesis. Another mutant with a mild phenotype is synthetic negative with GFP-fimbrin, inferring involvement of the mutated tropomyosin sites in interaction between the two proteins. Proteins that assemble in the contractile ring region before actin do so in a mutant cdc8 strain that cannot assemble condensed actin rings, yet some cells can divide. Of general significance, LifeAct-GFP negatively affects the actin cytoskeleton, indicating caution in its use as a biomarker for actin filaments. PMID:26187949

  13. Dynamic formation of single-atom catalytic active sites on ceria-supported gold nanoparticles

    SciTech Connect

    Wang, Yanggang; Mei, Donghai; Glezakou, Vassiliki Alexandra; Li, Jun; Rousseau, Roger J.

    2015-03-04

    Ab initio Molecular Dynamics simulations and static Density Functional Theory calculations have been performed to investigate the reaction mechanism of CO oxidation on Au/CeO2 catalyst. It is found that under reaction condition CO adsorption significantly labializes the surface atoms of the Au cluster and leads to the formation of isolated Au+-CO species that resides on the support in the vicinity of the Au particle. In this context, we identified a dynamic single-atom catalytic mechanism at the interfacial area for CO oxidation on Au/CeO2 catalyst, which is a lower energy pathway than that of CO oxidation at the interface with the metal particle. This results from the ability of the single atom site to strongly couple with the redox properties of the support in a synergistic manner thereby lowering the barrier for redox reactions. We find that the single Au+ ion, which only exists under reaction conditions, breaks away from the Au cluster to catalyze CO oxidation and returns to the Au cluster after the catalytic cycle is completed. Generally, our study highlights the importance of the dynamic creation of active sites under reaction conditions and their essential role in a catalytic process.

  14. Dynamic formation of single-atom catalytic active sites on ceria-supported gold nanoparticles

    SciTech Connect

    Wang, Yanggang; Mei, Donghai; Glezakou, Vassiliki Alexandra; Li, Jun; Rousseau, Roger J.

    2015-03-04

    Ab initio Molecular Dynamics simulations and static Density Functional Theory calculations have been performed to investigate the reaction mechanism of CO oxidation on Au/CeO2 catalyst. It is found that under reaction condition CO adsorption significantly labializes the surface atoms of the Au cluster and leads to the formation of isolated Au+-CO species that resides on the support in the vicinity of the Au particle. In this context, we identified a dynamic single-atom catalytic mechanism at the interfacial area for CO oxidation on Au/CeO2 catalyst, which is a lower energy pathway than that of CO oxidation at the interface with the metal particle. This results from the ability of the single atom site to strongly couple with the redox properties of the support in a synergistic manner thereby lowering the barrier for redox reactions. We find that the single Au+ ion, which only exists under reaction conditions, breaks away from the Au cluster to catalyze CO oxidation and returns to the Au cluster after the catalytic cycle is completed. Generally, our study highlights the importance of the dynamic creation of active sites under reaction conditions and their essential role in a catalytic process.

  15. L2′ loop is critical for caspase-7 active site formation

    PubMed Central

    Witkowski, Witold A; Hardy, Jeanne A

    2009-01-01

    The active sites of caspases are composed of four mobile loops. A loop (L2) from one half of the dimer interacts with a loop (L2′) from the other half of the dimer to bind substrate. In an inactive form, the two L2′ loops form a cross-dimer hydrogen-bond network over the dimer interface. Although the L2′ loop has been implicated as playing a central role in the formation of the active-site loop bundle, its precise role in catalysis has not been shown. A detailed understanding of the active and inactive conformations is essential to control the caspase function. We have interrogated the contributions of the residues in the L2′ loop to catalytic function and enzyme stability. In wild-type and all mutants, active-site binding results in substantial stabilization of the complex. One mutation, P214A, is significantly destabilized in the ligand-free conformation, but is as stable as wild type when bound to substrate, indicating that caspase-7 rests in different conformations in the absence and presence of substrate. Residues K212 and I213 in the L2′ loop are shown to be essential for substrate-binding and thus proper catalytic function of the caspase. In the crystal structure of I213A, the void created by side-chain deletion is compensated for by rearrangement of tyrosine 211 to fill the void, suggesting that the requirements of substrate-binding are sufficiently strong to induce the active conformation. Thus, although the L2′ loop makes no direct contacts with substrate, it is essential for buttressing the substrate-binding groove and is central to native catalytic efficiency. PMID:19530232

  16. Environmental significance of Upper Miocene phosphorites at hominid sites in the Lukeino Formation (Tugen Hills, Kenya)

    NASA Astrophysics Data System (ADS)

    Dericquebourg, Perrine; Person, Alain; Ségalen, Loïc; Pickford, Martin; Senut, Brigitte; Fagel, Nathalie

    2015-08-01

    The Lukeino Formation contains an important sedimentary and fossiliferous record of the late Miocene (6.09-5.68 Ma), which has in particular yielded the fossil remains of the oldest East African bipedal hominid called Orrorin tugenensis. This fluvio-lacustrine sedimentary succession crops out in the Kenyan part of the East African Rift. It is mainly composed of clay to sandy clay deposits intercalated with volcanic ash horizons, and localized layers of carbonates and diatomites. A detailed sedimentological and mineralogical study of the Lukeino Formation was conducted to throw light on the environmental conditions in which the hominids lived. Several centimetric, relatively continuous and indurated phosphatic horizons, of sedimentary origin, were identified at two sites (Sunbarua and Kapcheberek). Mineralogical (XRD) and geochemical analyses as well as observations by SEM, which was coupled with an energy dispersive spectroscopy (EDS) microprobe, indicate that the autochthonous phosphate layers are composed of a micritic matrix of francolite (38-93%), with incorporation of silicates in variable proportions from one layer to another. The phosphate matrix contains very well preserved and abundant diatom frustules in the basal phosphate layer. These diatoms are identified as Aulacoseira granulata, implying a pH of 7.8-8.2 for freshwaters of the Palaeolake Lukeino. Calcitic tubular structures, linked to a possible bacterial origin, are also observed locally. Phosphate layers occur abruptly within a thick clay-sandy series, associated with an intense runoff phase during the deposition of this interval of the Lukeino Formation. The massive and cyclic input of phosphorus to the lake promoted productivity to the stage where it caused a diatom bloom. The establishment of several phosphate horizons testifies to successive phases of eutrophication of Palaeolake Lukeino. The diatom cells provided some of the organic matter, which was decomposed by bacterial activity at the

  17. Eastern-Mediterranean ventilation variability during sapropel S1 formation, evaluated at two sites influenced by deep-water formation from Adriatic and Aegean Seas

    NASA Astrophysics Data System (ADS)

    Filippidi, A.; Triantaphyllou, M. V.; De Lange, G. J.

    2016-07-01

    Present-day bottom-water ventilation in the Eastern Mediterranean basin occurs through deep-water convection originating from the two marginal basins, i.e. Adriatic and Aegean Seas. In the paleo record, long periods of enhanced deep-water formation have been alternating with shorter periods of reduced deep-water formation. The latter is related mainly to low-latitude humid climate conditions and the enhanced deposition and preservation of organic-rich sediment units (sapropels). This study focuses on sedimentary archives of the most-recent sapropel S1, retrieved from two sites under the direct influence of the two deep-water formation areas. Restricted oxygen conditions have developed rapidly at the beginning of S1 deposition in the Adriatic site, but bottom-water conditions have not persistently remained anoxic during the full interval of sapropel deposition. In fact, the variability in intensity and persistence of sedimentary redox conditions at the two deep-water formation sites is shown to be related to brief episodes of climate cooling. In the Adriatic site, sapropel deposition appears to have been interrupted twice. The 8.2 ka event, only recovered at the Adria site, is characterized by gradually increasing suboxic to possibly intermittently oxic conditions and decreasing Corg fluxes, followed by an abrupt re-establishment of anoxic conditions. Another important event that disrupted sapropel S1 formation, has taken place at ca. 7.4 cal ka BP. The latter event has been recovered at both sites. In the Adriatic site it is followed by a period of sedimentary conditions that gradually change from suboxic to more permanently oxic, as deduced from the Mn/Al pattern. Using the same proxy for suboxic/oxic sedimentary redox conditions, we observe that conditions in the Aegean Sea site shift to more permanently oxic from the 7.4 ka event onwards. However, at both sites the accumulation and preservation of enhanced amounts of organic matter have continued under these

  18. Formation of nanostructured Group IIA metal activated sensors: The transformation of Group IIA metal compound sites

    NASA Astrophysics Data System (ADS)

    Tune, Travis C.; Baker, Caitlin; Hardy, Neil; Lin, Arthur; Widing, Timothy J.; Gole, James L.

    2015-05-01

    Trends in the Group IIA metal oxides and hydroxides of magnesium, calcium, and barium are unique in the periodic table. In this study we find that they display novel trends as decorating nanostructures for extrinsic semiconductor interfaces. The Group IIA metal ions are strong Lewis acids. We form these M2+ ions in aqueous solution and bring these solutions in contact with a porous silicon interface to form interfaces for conductometric measurements. Observed responses are consistent with the formation of MgO whereas the heavier elements display behaviors which suggest the effect of their more basic nature. Mg(OH)2, when formed, represents a weak base whereas the heavier metal hydroxides of Ca, Sr, and Ba are strong bases. However, the hydroxides tend to give up hydrogen and act as Brönsted acids. For the latter elements, the reversible interaction response of nanostructures deposited to the porous silicon (PS) interface is modified, as the formation of more basic sites appears to compete with M2+ Lewis acidity and hydroxide Brönsted acidity. Mg2+ forms an interface whose response to the analytes NH3 and NO is consistent with MgO and well explained by the recently developing Inverse Hard/Soft Acid/Base model. The behavior of the Ca2+ and Ba2+ decorated interfaces as they interact with the hard base NH3 follows a reversal of the model, indicating a decrease in acidic character as the observed conductometric response suggests the interaction with hydroxyl groups. A change from oxide-like to hydroxide-like constituents is supported by XPS studies. The changes in conductometric response is easily monitored in contrast to changes associated with the Group IIA oxides and hydroxides observed in XPS, EDAX, IR, and NMR measurements.

  19. Dipstick format of an improved ELISA for on-site atrazine monitoring in water in Pakistan.

    PubMed

    Maqbool, Uzma; Anwar-ul-Haq; Mahboob, Sadia

    2010-01-01

    A dipstick format was developed for on-site atrazine monitoring in water samples of different origins. It was derived from an in-house-developed ELISA based on polyclonal antibodies that also cross-react with hydroxyatrazine (30%) and terbuthylazine (17%). Test reagents were evaluated for temperature and pH stabilities and rapidity for field applications. Reagents performed well within a temperature range of 20-30 degrees C and were tolerant to alkaline pH (up to 8.5) of the assay buffering system. Tracer incubation time could be reduced to 40 min. Bovine serum albumin addition (1%) in the assay buffer improved assay performance, giving 50% B/B0 (IC50) of 65 ng/L and the lowest LOD of 2 ng/L at 90% B/B0 (IC10). The dipstick ELISA format was standardized on a membrane support. Nylon membrane, positively charged, was superior to PVDF for qualitative or semiquantitative analysis regarding color intensity and stability. Tracer incubation time was further reduced to 30 min with a lowest LOD of 0.1 microg/L. For real sample screening with dipsticks, acceptable results were obtained for water. Significant correlation was found between dipstick and plate ELISA results. Validation using GC with a nitrogen-phosphorus detector and HPLC indicated that dipstick signals in aged water samples, which were mainly due to hydroxyatrazine, were significantly above European Commission regulations of 0.1 microg/L. However, dipsticks were superior, fast, and cost-effective. PMID:20334162

  20. Deciphering site formation processes through soil micromorphology at Contrebandiers Cave, Morocco.

    PubMed

    Aldeias, Vera; Goldberg, Paul; Dibble, Harold L; El-Hajraoui, Mohamed

    2014-04-01

    Contrebandiers Cave preserves a Late Pleistocene sequence containing Middle Stone Age (MSA) so-called Maghrebian Mousterian and Aterian occupations, spanning from ∼126 to 95 ka (thousands of years ago), followed by spatially restricted Iberomaurusian industries. Micromorphological analyses, complemented by instrumental mineralogical identification and fabric orientation, allowed for the reconstruction of the main site formation processes at the site. Initial deposition is characterized by local reworking of marine shelly sands dating to Marine Isotopic Stage 5e (MIS5e). The subsequent stratification reveals sedimentary dynamics predominantly associated with gravity-driven inputs and contributions from weathering of the encasing bedrock, at the same time that anthropogenic sediments were being accumulated. The allochthonous components reflect soil degradation and vegetation changes around the cave during the last interglacial. Human occupations seems to be somewhat ephemeral in nature, with some stratigraphic units apparently lacking archaeological components, while in others the human-associated deposits (e.g., burned bones, charcoal, and ashes) can be substantial. Ephemeral breaks in sedimentation and/or erosion followed by stabilization are mainly discernible microscopically by the presence of phosphatic-rich laminae interpreted as short-lived surfaces, peaks of increased humidity and colonization by plants. More substantial erosion affects the uppermost Aterian layers, presumably due to localized reconfigurations of the cave's roof. The subsequent Iberomaurusian deposits are not in their primary position and are associated with well-sorted silts of aeolian origin. While the effects of chemical diagenesis are limited throughout the whole stratigraphic sequence, physical bioturbation (e.g., by wasps, rodents, and earthworms) is more pervasive and leads to localized movement of the original sedimentary particles. PMID:24650737

  1. Assessment of potential radionuclide transport in site-specific geologic formations

    SciTech Connect

    Dosch, R.G.

    1980-08-01

    Associated with the development of deep, geologic repositories for nuclear waste isolation is a need for safety assessments of the potential for nuclide migration. Frequently used in estimating migration rates is a parameter generally known as a distribution coefficient, K/sub d/, which describes the distribution of a radionuclide between a solid (rock) and a liquid (groundwater) phase. This report is intended to emphasize that the use of K/sub d/ must be coupled with a knowledge of the geology and release scenarios applicable to a repository. Selected K/sub d/ values involving rock samples from groundwater/brine simulants typical of two potential repository sites, WIPP and NTS, are used to illustrate this concern. Experimental parameters used in K/sub d/ measurements including nuclide concentration, site sampling/rock composition, and liquid-to-solid ratios are discussed. The solubility of U(VI) in WIPP brine/groundwater was addressed in order to assess the potential contribution of this phenomena to K/sub d/ values. Understanding mehanisms of sorption of radionuclides on rocks would lead to a better predictive capability. Sorption is attributed to the presence of trace constituents (often unidentified) in rocks. An attempt was made to determine if this applied to WIPP dolomite rocks by comparing sorption behavior of the natural material with that of a synthetic dolomite prepared in the laboratory with reagent grade chemicals. The results were inconclusive. The results of a study of Tc sorption by an argillite sample from the Calico Hills formation at NTS under ambient laboratory conditions were more conclusive. The Tc sorption was found to be associated with elemental carbon. Available evidence points to a reduction mechanism leading to the apparent sorption of Tc on the solid phase.

  2. Micromorphology and site formation at Die Kelders Cave I, South Africa.

    PubMed

    Goldberg, P

    2000-01-01

    The deposits of Die Kelders I were previously described and studied by Tankard & Schweitzer (1974, 1976) from the standpoint of classical granulometric analysis of sand from a coastal cave in order to infer the geological history of the cave and its environs. This paper supplements these earlier works by taking a more holistic approach toward site formation processes by including investigation of the biogenic and anthropogenic influences on the cave deposits and history. The study employs the technique of soil micromorphology, which is the study of resin-impregnated, undisturbed blocks of sediment and petrographic thin sections, in which sediments from all areas of the cave were examined. The study showed that diagenesis of the deposits in the eastern areas of the excavation resulted in decalcification, which in turn brought about slumping and compaction. Equivalent stratigraphic layers exposed in the western and central areas were only mildly decalcified and consequently, these sediments contain limestone rock fall and relatively abundant marine and terrestrial mollusks, the latter not dissimilar to the Late Stone Age (LSA) midden which covers these deposits. Thus, in spite of lowered and more distant shorelines, marine resources were exploited during Middle Stone Age (MSA) times. Observations from these calcareous units also clearly demonstrates that previously recognized "occupational horizons" (e.g. Layers 6, 8 and 10) can be resolved micromorphologically into several ephemeral events, such as burning/fire, redistribution of ashes by wind and water, and non-deposition; the latter is shown by phosphatic alteration of sediments exposed on former surfaces and accumulation of guano, or the presence of millimeter-thick truncation surfaces below which aeolian dust infiltrated. Both field and microscopic observations illustrate that the deposits in caves are highly variable from wall to center, and that excavations should not be localized in just one microenvironment

  3. Nitric oxide-based protein modification: formation and site-specificity of protein S-nitrosylation

    PubMed Central

    Kovacs, Izabella; Lindermayr, Christian

    2013-01-01

    Nitric oxide (NO) is a reactive free radical with pleiotropic functions that participates in diverse biological processes in plants, such as germination, root development, stomatal closing, abiotic stress, and defense responses. It acts mainly through redox-based modification of cysteine residue(s) of target proteins, called protein S-nitrosylation.In this way NO regulates numerous cellular functions and signaling events in plants. Identification of S-nitrosylated substrates and their exact target cysteine residue(s) is very important to reveal the molecular mechanisms and regulatory roles of S-nitrosylation. In addition to the necessity of protein–protein interaction for trans-nitrosylation and denitrosylation reactions, the cellular redox environment and cysteine thiol micro-environment have been proposed important factors for the specificity of protein S-nitrosylation. Several methods have recently been developed for the proteomic identification of target proteins. However, the specificity of NO-based cysteine modification is still less defined. In this review, we discuss formation and specificity of S-nitrosylation. Special focus will be on potential S-nitrosylation motifs, site-specific proteomic analyses, computational predictions using different algorithms, and on structural analysis of cysteine S-nitrosylation. PMID:23717319

  4. Site specific comparison of H2, CH4 and compressed air energy storage in porous formations

    NASA Astrophysics Data System (ADS)

    Tilmann Pfeiffer, Wolf; Wang, Bo; Bauer, Sebastian

    2016-04-01

    The supply of energy from renewable sources like wind or solar power is subject to fluctuations determined by the climatic and weather conditions, and shortage periods can be expected on the order of days to weeks. Energy storage is thus required if renewable energy dominates the total energy production and has to compensate the shortages. Porous formations in the subsurface could provide large storage capacities for various energy carriers, such as hydrogen (H2), synthetic methane (CH4) or compressed air (CAES). All three energy storage options have similar requirements regarding the storage site characteristics and consequently compete for suitable subsurface structures. The aim of this work is to compare the individual storage methods for an individual storage site regarding the storage capacity as well as the achievable delivery rates. This objective is pursued using numerical simulation of the individual storage operations. In a first step, a synthetic anticline with a radius of 4 km, a drop of 900 m and a formation thickness of 20 m is used to compare the individual storage methods. The storage operations are carried out using -depending on the energy carrier- 5 to 13 wells placed in the top of the structure. A homogeneous parameter distribution is assumed with permeability, porosity and residual water saturation being 500 mD, 0.35 and 0.2, respectively. N2 is used as a cushion gas in the H2 storage simulations. In case of compressed air energy storage, a high discharge rate of 400 kg/s equating to 28.8 mio. m³/d at surface conditions is required to produce 320 MW of power. Using 13 wells the storage is capable of supplying the specified gas flow rate for a period of 31 hours. Two cases using 5 and 9 wells were simulated for both the H2 and the CH4 storage operation. The target withdrawal rates of 1 mio. sm³/d are maintained for the whole extraction period of one week in all simulations. However, the power output differs with the 5 well scenario producing

  5. U.S. Department of Energy's site screening, site selection, and initial characterization for storage of CO2 in deep geological formations

    USGS Publications Warehouse

    Rodosta, T.D.; Litynski, J.T.; Plasynski, S.I.; Hickman, S.; Frailey, S.; Myer, L.

    2011-01-01

    The U.S. Department of Energy (DOE) is the lead Federal agency for the development and deployment of carbon sequestration technologies. As part of its mission to facilitate technology transfer and develop guidelines from lessons learned, DOE is developing a series of best practice manuals (BPMs) for carbon capture and storage (CCS). The "Site Screening, Site Selection, and Initial Characterization for Storage of CO2 in Deep Geological Formations" BPM is a compilation of best practices and includes flowchart diagrams illustrating the general decision making process for Site Screening, Site Selection, and Initial Characterization. The BPM integrates the knowledge gained from various programmatic efforts, with particular emphasis on the Characterization Phase through pilot-scale CO2 injection testing of the Validation Phase of the Regional Carbon Sequestration Partnership (RCSP) Initiative. Key geologic and surface elements that suitable candidate storage sites should possess are identified, along with example Site Screening, Site Selection, and Initial Characterization protocols for large-scale geologic storage projects located across diverse geologic and regional settings. This manual has been written as a working document, establishing a framework and methodology for proper site selection for CO2 geologic storage. This will be useful for future CO2 emitters, transporters, and storage providers. It will also be of use in informing local, regional, state, and national governmental agencies of best practices in proper sequestration site selection. Furthermore, it will educate the inquisitive general public on options and processes for geologic CO2 storage. In addition to providing best practices, the manual presents a geologic storage resource and capacity classification system. The system provides a "standard" to communicate storage and capacity estimates, uncertainty and project development risk, data guidelines and analyses for adequate site characterization, and

  6. Disulfide bond formation is a determinant of glycosylation site usage in the hemagglutinin-neuraminidase glycoprotein of Newcastle disease virus.

    PubMed Central

    McGinnes, L W; Morrison, T G

    1997-01-01

    Determinants of glycosylation site usage were explored by using the hemagglutinin-neuraminidase (HN) glycoprotein of the paramyxovirus Newcastle disease virus. The amino acid sequence of the HN protein, a type II glycoprotein, has six N-linked glycosylation addition sites, G1 to G6, two of which, G5 and G6, are not used for the addition of carbohydrate (L. McGinnes and T. Morrison, Virology 212:398-410, 1995). The sequence of this protein also has 13 cysteine residues in the ectodomain (C2 to C14). Mutation of either cysteine 13 or cysteine 14 resulted in the addition of another oligosaccharide chain to the protein. These cysteine residues flank the normally unused G6 glycosylation addition site, and mutation of the G6 site eliminated the extra glycosylation found in the cysteine mutants. These results suggested that failure to form an intramolecular disulfide bond resulted in the usage of a normally unused glycosylation site. This conclusion was confirmed by preventing cotranslational disulfide bond formation in cells by using dithiothreitol. Under these conditions, the wild-type protein acquired extra glycosylation, which was eliminated by mutation of the G6 site. These results suggest that localized folding events on the nascent chain, such as disulfide bond formation, which block access to the oligosaccharyl transferase are a determinant of glycosylation site usage. PMID:9060670

  7. Quarries of Culture: An Ethnohistorical and Environmental Account of Sacred Sites and Rock Formations in Southern California's Mission Indian Country

    ERIC Educational Resources Information Center

    Karr, Steven M.

    2005-01-01

    Sacred sites and Rock Formations throughout Southern California's India Country are described by Indians as ancestral markers, origin and place-name locales, areas of deity habitation, and power sources. Early ethnographers were keen to record the traditional stories and meanings related to them by their Native collaborators. Rock formations…

  8. A Study of Geological Formation on Different Sites in Batu Pahat, Malaysia Based On HVSR Method Using Microtremor Measurement

    NASA Astrophysics Data System (ADS)

    Noor, M. A. M.; Madun, A.; Kamarudin, A. F.; Daud, M. E.

    2016-07-01

    Geological formation is a one of information need to know during site reconnaissance. Conventional method like borehole has been known is very accurate to identify the formation of geology of a site. However, the problem of this technique is very expensive and not economical for large area. In the last decade, microtremor measurement has been introduced as an alternative technique and widely used in the geological formation study. Therefore, the aim in this study is to determine the geological formation underneath of surface in Batu Pahat district using microtremor measurement. There are two parameters have been carried out from microtremor measurement in term of natural frequency and HVSR curves images. Microtremor measurements are done conducted at 15 sites surrounding of Batu Pahat. Horizontal to vertical spectral ratio (HVSR) method was used for analyzing microtermor measurement data, to determine the natural frequency and also HVSR curves image. In this study, values of natural frequencies are used to classify the soil types with range in the between 0.93 to 5.35 Hz, meanwhile the pattern of HVSR curve images has been shown exists a few groups of soil types surrounding Batu Pahat district. Hence, microtremor measurement indirectly can be used as a one technique to add value in the site reconnaissance in the future.

  9. Cooperativity between Al Sites Promotes Hydrogen Transfer and Carbon–Carbon Bond Formation upon Dimethyl Ether Activation on Alumina

    PubMed Central

    2015-01-01

    The methanol-to-olefin (MTO) process allows the conversion of methanol/dimethyl ether into olefins on acidic zeolites via the so-called hydrocarbon pool mechanism. However, the site and mechanism of formation of the first carbon–carbon bond are still a matter of debate. Here, we show that the Lewis acidic Al sites on the 110 facet of γ-Al2O3 can readily activate dimethyl ether to yield CH4, alkenes, and surface formate species according to spectroscopic studies combined with a computational approach. The carbon–carbon forming step as well as the formation of methane and surface formate involves a transient oxonium ion intermediate, generated by a hydrogen transfer between surface methoxy species and coordinated methanol on adjacent Al sites. These results indicate that extra framework Al centers in acidic zeolites, which are associated with alumina, can play a key role in the formation of the first carbon–carbon bond, the initiation step of the industrial MTO process. PMID:27162986

  10. Cooperativity between Al Sites Promotes Hydrogen Transfer and Carbon-Carbon Bond Formation upon Dimethyl Ether Activation on Alumina.

    PubMed

    Comas-Vives, Aleix; Valla, Maxence; Copéret, Christophe; Sautet, Philippe

    2015-09-23

    The methanol-to-olefin (MTO) process allows the conversion of methanol/dimethyl ether into olefins on acidic zeolites via the so-called hydrocarbon pool mechanism. However, the site and mechanism of formation of the first carbon-carbon bond are still a matter of debate. Here, we show that the Lewis acidic Al sites on the 110 facet of γ-Al2O3 can readily activate dimethyl ether to yield CH4, alkenes, and surface formate species according to spectroscopic studies combined with a computational approach. The carbon-carbon forming step as well as the formation of methane and surface formate involves a transient oxonium ion intermediate, generated by a hydrogen transfer between surface methoxy species and coordinated methanol on adjacent Al sites. These results indicate that extra framework Al centers in acidic zeolites, which are associated with alumina, can play a key role in the formation of the first carbon-carbon bond, the initiation step of the industrial MTO process. PMID:27162986

  11. High Fat Diet Enhances β-Site Cleavage of Amyloid Precursor Protein (APP) via Promoting β-Site APP Cleaving Enzyme 1/Adaptor Protein 2/Clathrin Complex Formation.

    PubMed

    Maesako, Masato; Uemura, Maiko; Tashiro, Yoshitaka; Sasaki, Kazuki; Watanabe, Kiwamu; Noda, Yasuha; Ueda, Karin; Asada-Utsugi, Megumi; Kubota, Masakazu; Okawa, Katsuya; Ihara, Masafumi; Shimohama, Shun; Uemura, Kengo; Kinoshita, Ayae

    2015-01-01

    Obesity and type 2 diabetes are risk factors of Alzheimer's disease (AD). We reported that a high fat diet (HFD) promotes amyloid precursor protein (APP) cleavage by β-site APP cleaving enzyme 1 (BACE1) without increasing BACE1 levels in APP transgenic mice. However, the detailed mechanism had remained unclear. Here we demonstrate that HFD promotes BACE1/Adaptor protein-2 (AP-2)/clathrin complex formation by increasing AP-2 levels in APP transgenic mice. In Swedish APP overexpressing Chinese hamster ovary (CHO) cells as well as in SH-SY5Y cells, overexpression of AP-2 promoted the formation of BACE1/AP-2/clathrin complex, increasing the level of the soluble form of APP β (sAPPβ). On the other hand, mutant D495R BACE1, which inhibits formation of this trimeric complex, was shown to decrease the level of sAPPβ. Overexpression of AP-2 promoted the internalization of BACE1 from the cell surface, thus reducing the cell surface BACE1 level. As such, we concluded that HFD may induce the formation of the BACE1/AP-2/clathrin complex, which is followed by its transport of BACE1 from the cell surface to the intracellular compartments. These events might be associated with the enhancement of β-site cleavage of APP in APP transgenic mice. Here we present evidence that HFD, by regulation of subcellular trafficking of BACE1, promotes APP cleavage. PMID:26414661

  12. Urinary bladder matrix promotes site appropriate tissue formation following right ventricle outflow tract repair

    PubMed Central

    Remlinger, Nathaniel T; Gilbert, Thomas W; Yoshida, Masahiro; Guest, Brogan N; Hashizume, Ryotaro; Weaver, Michelle L; Wagner, William R; Brown, Bryan N; Tobita, Kimimasa; Wearden, Peter D

    2013-01-01

    The current prevalence and severity of heart defects requiring functional replacement of cardiac tissue pose a serious clinical challenge. Biologic scaffolds are an attractive tissue engineering approach to cardiac repair because they avoid sensitization associated with homograft materials and theoretically possess the potential for growth in similar patterns as surrounding native tissue. Both urinary bladder matrix (UBM) and cardiac ECM (C-ECM) have been previously investigated as scaffolds for cardiac repair with modest success, but have not been compared directly. In other tissue locations, bone marrow derived cells have been shown to play a role in the remodeling process, but this has not been investigated for UBM in the cardiac location, and has never been studied for C-ECM. The objectives of the present study were to compare the effectiveness of an organ-specific C-ECM patch with a commonly used ECM scaffold for myocardial tissue repair of the right ventricle outflow tract (RVOT), and to examine the role of bone marrow derived cells in the remodeling response. A chimeric rat model in which all bone marrow cells express green fluorescent protein (GFP) was generated and used to show the ability of ECM scaffolds derived from the heart and bladder to support cardiac function and cellular growth in the RVOT. The results from this study suggest that urinary bladder matrix may provide a more appropriate substrate for myocardial repair than cardiac derived matrices, as shown by differences in the remodeling responses following implantation, as well as the presence of site appropriate cells and the formation of immature, myocardial tissue. PMID:23974174

  13. Peroxy radical concentration and ozone formation rate at a rural site in the southeastern United States

    NASA Astrophysics Data System (ADS)

    Kleinman, Lawrence; Lee, Yin-Nan; Springston, Stephen R.; Lee, Jai H.; Nunnermacker, Linda; Weinstein-Lloyd, Judith; Zhou, Xianliang; Newman, Leonard

    1995-04-01

    As part of the Southern Oxidants Study, Brookhaven National Laboratory operated an intensive measurement site near Metter, Georgia, during parts of the summers of 1991 and 1992. Measurements were made of photochemically active trace gases and meteorological parameters relevant to determining causes for elevated ambient ozone concentration. The 1992 data set was used to calculate peroxy radical concentration and ozone formation rate based on determining the departure from the photostationary state (PSS) and based on a radical budget equation, such as applied previously to the 1991 data set. Averaged over the 28-day experimental period, we find maximum radical production occurring near noon at 2.5 ppb h-1, maximum peroxy radical concentration also occurring near noon at 80 ppt, and maximum ozone production of 8 ppb h-1 occurring near 1000 EST. Ozone photolysis accounts for 55% of radical production, HCHO and other carbonyl compounds about 40%. The radical budget and PSS methods depend in different ways on atmospheric photochemistry and a comparison between them affords a test of our understanding of the photochemical production of O3. We find that these methods agree to the extent expected based on uncertainty estimates. For the data set as a whole, the median estimate for fractional error in hourly average peroxy radical concentration determined from the radical budget method is approximately 30% and from the PSS method, 50%. Error estimates for the PSS method are highly variable, becoming infinite as peroxy radical concentration approaches zero. This behavior can be traced back to the difference form of the PSS equations. To conduct a meaningful comparison between the methods, the data set was segregated into subsets based on PSS uncertainty estimates. For the low-uncertainty subset, consisting of a third of the whole data set, we find that the ratio of peroxy radical concentration predicted from the PSS method to that predicted from the radical budget method to be

  14. Sialylation of vitronectin regulates stress fiber formation and cell spreading of dermal fibroblasts via a heparin-binding site.

    PubMed

    Miyamoto, Yasunori; Tanabe, Mio; Date, Kimie; Sakuda, Kanoko; Sano, Kotone; Ogawa, Haruko

    2016-04-01

    Vitronectin (VN) plays an important role in tissue regeneration. We previously reported that VN from partial hepatectomized (PH) rats results in a decrease of sialylation of VN and de-sialylation of VN decreases the cell spreading of hepatic stellate cells. In this study, we analyzed the mechanism how sialylation of VN regulates the properties of mouse primary cultured dermal fibroblasts (MDF) and a dermal fibroblast cell line, Swiss 3T3 cells. At first, we confirmed that VN from PH rats or de-sialylated VN also decreased cell spreading in MDF and Swiss 3T3 cells. The de-sialylation suppressed stress fiber formation in Swiss 3T3 cells. Next, we analyzed the effect of the de-sialylation of VN on stress fiber formation in Swiss 3T3 cells. RGD peptide, an inhibitor for a cell binding site of VN, did not affect the cell attachment of Swiss 3T3 cells on untreated VN but significantly decreased it on de-sialylated VN, suggesting that the de-sialylation attenuates the binding activity of an RGD-independent binding site in VN. To analyze a candidate RGD-independent binding site, an inhibition experiment of stress fiber formation for a heparin binding site was performed. The addition of heparin and treatment of cells with heparinase decreased stress fiber formation in Swiss 3T3 cells. Furthermore, de-sialylation increased the binding activity of VN to heparin, as detected by surface plasmon resonance (SPR). These results demonstrate that sialylation of VN glycans regulates stress fiber formation and cell spreading of dermal fibroblast cells via a heparin binding site. PMID:26979432

  15. Upper Devonian vertebrate taphonomy and sedimentology from the Klunas fossil site, Tervete Formation, Latvia

    NASA Astrophysics Data System (ADS)

    Vasiļkova, J.; Lukševičs, E.; Stinkulis, Ä.¢.; Zupinš, I.

    2012-04-01

    The deposits of the Tervete Formation, Famennian Stage of Latvia, comprising weakly cemented sandstone and sand intercalated with dolomitic marls, siltstone and clay, have been traditionally interpreted as having formed in a shallow, rather restricted sea with lowered salinity. During seven field seasons the excavations took place in the south-western part of Latvia, at the Klunas site, and resulted in extensive palaeontological and sedimentological data. The taphonomical analysis has been performed, having evaluated the size, sorting, orientation of the fossils, articulation and skeletal preservation as well as the degree of fragmentation and abrasion. The sedimentological analysis involved interpretation of sedimentary structures, palaeocurrent direction reconstruction, grain-size analysis and approximate water depth calculations. The vertebrate assemblage of the Klunas site represents all known taxa of the Sparnene Regional Stage of the Baltic Devonian, comprising placoderms Bothriolepis ornata Eichwald, B. jani Lukševičs, Phyllolepis tolli Vasiliauskas, Dunkleosteus sp. and Chelyophorus sp., sarcopterygians Holoptychius nobilissimus Agassiz, Platycephalichthys skuenicus Vorobyeva, Cryptolepis sp., Conchodus sp., Glyptopomus ? sp., "Strunius" ? sp., and Dipterus sp., as well as an undetermined actinopterygian. Placoderms Bothriolepis ornata and B. jani dominate the assemblage. The fossils are represented in the main by fully disarticulated placoderm plates and plate fragments, sarcopterygian scales and teeth, rarely bones of the head and shoulder girdle, and acanthodian spines and scales. The characteristic feature is the great amount of fragmentary remains several times exceeding the number of intact bones. The horizontal distribution of the bones over the studied area is not homogenous, distinct zones of increased or decreased density of fossils can be traced. Zones of the increased density usually contain many elements of various sizes, whereas zones of the

  16. Site-specific glycoproteomics confirms that protein structure dictates formation of N-glycan type, core fucosylation and branching.

    PubMed

    Thaysen-Andersen, Morten; Packer, Nicolle H

    2012-11-01

    Growing evidence indicates that the individualized and highly reproducible N-glycan repertoires on each protein glycosylation site modulate function. Relationships between protein structures and the resulting N-glycoforms have previously been observed, but remain to be quantitatively confirmed and examined in detail to define the responsible mechanisms in the conserved mammalian glycosylation machinery. Here, we investigate this relationship by manually extracting and analyzing quantitative and qualitative site-specific glycoprofiling data from 117 research papers. Specifically, N-glycan structural motifs were correlated with the structure of the protein carriers, focusing on the solvent accessibility of the individual glycosylation sites and the physicochemical properties of the surrounding polypeptide chains. In total, 474 glycosylation sites from 169 mammalian N-glycoproteins originating from different tissues/body fluids were investigated. It was confirmed statistically that the N-glycan type, degree of core fucosylation and branching are strongly influenced by the glycosylation site accessibility. For these three N-glycan features, glycosylation sites carrying highly processed glycans were significantly more solvent-accessible than those carrying less processed counterparts. The glycosylation site accessibilities could be linked to molecular signatures at the primary and secondary protein levels, most notably to the glycoprotein size and the proportion of glycosylation sites located in accessible β-turns. In addition, the subcellular location of the glycoproteins influenced the formation of the N-glycan structures. These data confirm that protein structures dictate site-specific formation of several features of N-glycan structures by affecting the biosynthetic pathway. Mammals have, as such, evolved mechanisms enabling proteins to influence the N-glycans they present to the extracellular environment. PMID:22798492

  17. Role of soil macrofauna in soil formation in post mining sites along climatic and litter quality gradients

    NASA Astrophysics Data System (ADS)

    Frouz, Jan

    2014-05-01

    Soil macrofauna can play important role in soil formation. Here we used thin soil sections to study this process in two environmental gradients, climatic gradient, and liter quality gradient. Climatic gradient consist from four chronosequences of post mining sites in the USA, covering hardwood forest (TN, IN), tallgrass prairie (IL), or shortgrass prairie (WY). Earthworms and other saprophages were absent in such shortgrass sites but were present in the wetter, eastern sites. Absence of saprophagous groups, and especially earthworms, resulted in the absence of bioturbation in shortgrass prairie sites while worm casts and other biogenic structures formed an important part of the soil profile in other chronosequences, in short grass prairie in turn physical processes, such as erosion may play important role in soil mixing. Litter quality gradient consists from set of 28 sites planted with six kind of tree stand (pine, larch, spruce, oak, lime and alder) and unreclaimed sites (covered by willow, birch, aspen dominated forest) on one large heap in Czech Republic. Earthworm density on these sites negatively correlate with CN ratio, the same relationships was shown for proportion of earthworm cast in soil volume. In sites with high earthworm density Oe layer was absent and A layer formed by worm casts was well developed, in the contrary when earthworm were absent Oe layer was thick and A layer absent. Development of A layer correlate with soil carbon storage.

  18. Automated Site-Directed Drug Design: The Formation of Molecular Templates in Primary Structure Generation

    NASA Astrophysics Data System (ADS)

    Lewis, R. A.; Dean, P. M.

    1989-03-01

    In this paper the spacer skeleton concept is used to produce molecular graphs of putative ligands for binding sites. The skeletons are transformed into molecular templates within the constraints of the accessible surface of the ligand-binding site. A distance-matrix method is used to compare ligand points with vertices of the spacer skeleton through a permutation of all possible correspondences. A tolerance parameter is used to screen for poor matches. As a result. a small number of matched vertices and ligand points are produced. These are fitted into the site by a constrained optimization routine using an analytical function. Ligand points fall within the site and are optimally positioned adjacent to the corresponding site points, other vertices of the spacer skeleton lying beneath the accessible surface of the site are clipped off. A molecular template is thereby formed with its vertices linked to the ligand points. The final step is to verify that the bonding integrity of the skeleton remains. The computational methods outlined in this paper have been tested at two binding sites the pteridine binding site in dihydrofolate reductase and the amidinophenylpyruvate site of trypsin. Molecular graphs for both sites were generated automatically, they showed strong similarity to those of the natural ligands.

  19. Tissue-specific factors additively increase the probability of the all-or-none formation of a hypersensitive site.

    PubMed Central

    Boyes, J; Felsenfeld, G

    1996-01-01

    DNase I-hypersensitive sites lack a canonical nucleosome and have binding sites for various transcription factors. To understand how the hypersensitivity is generated and maintained, we studied the chicken erythroid-specific beta(A)/epsilon globin gene enhancer, a region where both tissue-specific and ubiquitous transcription factors can bind. Constructions containing mutations of this enhancer were stably introduced into a chicken erythroid cell line. We found that the hypersensitivity was determined primarily by the erythroid factors and that their binding additively increased the accessibility. The fraction of accessible sites in clonal cell lines was quantitated using restriction endonucleases; these data implied that the formation of each hypersensitive site was an all-or-none phenomenon. Use of DNase I and micrococcal nuclease probes further indicated that the size of the hypersensitive site was influenced by the binding of transcription factors which then determined the length of the nucleosome-free gap. Our data are consistent with a model in which hypersensitive sites are generated stochastically: mutations that reduce the number of bound factors reduce the probability that these factors will prevail over a nucleosome; thus, the fraction of sites in the population that are accessible is also diminished. Images PMID:8665857

  20. Phosphorylation of Atg9 regulates movement to the phagophore assembly site and the rate of autophagosome formation.

    PubMed

    Feng, Yuchen; Backues, Steven K; Baba, Misuzu; Heo, Jin-Mi; Harper, J Wade; Klionsky, Daniel J

    2016-04-01

    Macroautophagy is primarily a degradative process that cells use to break down their own components to recycle macromolecules and provide energy under stress conditions, and defects in macroautophagy lead to a wide range of diseases. Atg9, conserved from yeast to mammals, is the only identified transmembrane protein in the yeast core macroautophagy machinery required for formation of the sequestering compartment termed the autophagosome. This protein undergoes dynamic movement between the phagophore assembly site (PAS), where the autophagosome precursor is nucleated, and peripheral sites that may provide donor membrane for expansion of the phagophore. Atg9 is a phosphoprotein that is regulated by the Atg1 kinase. We used stable isotope labeling by amino acids in cell culture (SILAC) to identify phosphorylation sites on this protein and identified an Atg1-independent phosphorylation site at serine 122. A nonphosphorylatable Atg9 mutant showed decreased autophagy activity, whereas the phosphomimetic mutant enhanced activity. Electron microscopy analysis suggests that the different levels of autophagy activity reflect differences in autophagosome formation, correlating with the delivery of Atg9 to the PAS. Finally, this phosphorylation regulates Atg9 interaction with Atg23 and Atg27. PMID:27050455

  1. Insights into site formation at Rose Cottage Cave, South Africa, based on the analysis of sediment peels

    NASA Astrophysics Data System (ADS)

    Kloos, Peter; Miller, Christopher E.; Kritikakis, Panagiotis; Wadley, Lyn

    2016-04-01

    Rose Cottage Cave (RCC), in South Africa, has been a key site for explaining the origins of modern human behaviour and movement of early modern humans out of Africa. Nine sediment peels were made previously from the profile sections, preserving original materials that provide a record of cultural and environmental change during the late Pleistocene and Holocene. Here, we present the preliminary results of the study of the RCC sediment peels which aims to investigate site formation processes and the implications for site interpretation. Methods used include micromorphology and Fourier Transform Infrared spectroscopy coupled with detailed observations of the peels. The predominance of geogenic processes is demonstrated by the abundance of silt- and sand-sized quartz grains, which entered the site primarily through a crevice at the back of the cave. RCC lacks rich anthropogenic deposits as noted at other Middle Stone Age sites in southern Africa, but anthropogenic input to the sediment is indicated by the presence of charcoal, burnt bone, lithic fragments, fat-derived char and ashes. Clay coating fragments and chaotic microstructures demonstrate that bioturbation and colluvial reworking homogenised much of the deposit and may explain the absence of preserved bedding and rarity of combustion features. Downward movement of water through the sequence, indicated by clay coatings, is the likely cause for poor bone preservation and near lack of ashes at the site, as well as fluctuations in dose rate that have complicated luminescence dating studies. Evidence for diagenesis at the site is in the form of secondary apatite and gypsum. Sedimentary structures such as channel lag deposits and (silt and sand) laminae observed in peels dating between 60 and 35 ka BP suggest a high-energy sedimentary environment, which experienced flooding events that eroded underlying deposits and deposited large volumes of sediment. This explains why some of the post-Howiesons Poort layers contain

  2. The homing of bone marrow MSCs to non-osseous sites for ectopic bone formation induced by osteoinductive calcium phosphate

    PubMed Central

    Song, Guodong; Habibovic, Pamela; Bao, Chongyun; Hu, Jing; van Blitterswijk, Clemens A.; Yuan, Huipin; Chen, Wenchuan; Xu, Hockin H.K.

    2013-01-01

    Osteoinductive biomaterials are promising for bone repair. There is no direct proof that bone marrow mesenchymal stem cells (BMSCs) home to non-osseous sites and participate in ectopic bone formation induced by osteoinductive bioceramics. The objective of this study was to use a sex-mismatched beagle dog model to investigate BMSC homing via blood circulation to participate in ectopic bone formation via osteoinductive biomaterial. BMSCs of male dogs were injected into female femoral marrow cavity. The survival and stable chimerism of donor BMSCs in recipients were confirmed with polymerase chain reaction (PCR) and fluorescence in situ hybridization (FISH). Biphasic calcium phosphate (BCP) granules were implanted in dorsal muscles of female dogs. Y chromosomes were detected in samples harvested from female dogs which had received male BMSCs. At 4 weeks, cells with Y-chromosomes were distributed in the new bone matrix throughout the BCP granule implant. At 6 weeks, cells with Y chromosomes were present in newly mineralized woven bone. TRAP positive osteoclast-like cells were observed in 4-week implants, and the number of such cells decreased from 4 to 6 weeks. These results show that osteoprogenitors were recruited from bone marrow and homed to ectopic site to serve as a cell source for calcium phosphate-induced bone formation. In conclusion, BMSCs were demonstrated to migrate from bone marrow through blood circulation to non-osseous bioceramic implant site to contribute to ectopic bone formation in a canine model. BCP induced new bone in muscles without growth factor delivery, showing excellent osteoinductivity that could be useful for bone tissue engineering. PMID:23298780

  3. Dimer-dimer interaction of the bacterial selenocysteine synthase SelA promotes functional active site formation and catalytic specificity

    PubMed Central

    Itoh, Yuzuru; Bröcker, Markus J.; Sekine, Shun-ichi; Söll, Dieter; Yokoyama, Shigeyuki

    2015-01-01

    The 21st amino acid, selenocysteine (Sec), is incorporated translationally into proteins, and is synthesized on its specific tRNA (tRNASec). In Bacteria, the selenocysteine synthase SelA converts Ser-tRNASec, formed by seryl-tRNA synthetase, to Sec-tRNASec. SelA, a member of the fold-type-I pyridoxal 5′-phosphate (PLP)-dependent enzyme superfamily, has an exceptional homodecameric quaternary structure with a molecular mass of about 500 kDa. Our previously determined crystal structures of Aquifex aeolicus SelA complexed with tRNASec revealed that the ring-shaped decamer is composed of pentamerized SelA dimers, with two SelA dimers arranged to collaboratively interact with one Ser-tRNASec. The SelA catalytic site is close to the dimer-dimer interface, but the significance of the dimer-pentamerization in the catalytic site formation remained elusive. In the present study, we examined the quaternary interactions, and demonstrated their importance for SelA activity by systematic mutagenesis. Furthermore, we determined the crystal structures of “depentamerized” SelA variants with mutations at the dimer-dimer interface that prevent pentamerization. These dimeric SelA variants formed a distorted and inactivated catalytic site, and confirmed that the pentamer interactions are essential for productive catalytic site formation. Intriguingly, the conformation of the non-functional active site of dimeric SelA shares structural features with other fold-type-I PLP-dependent enzymes with native dimer or tetramer (dimer-of-dimers) quaternary structures. PMID:24456689

  4. The use of in vitro DNA adduct formation to estimate the genotoxicity of residues at contaminated sites.

    PubMed

    Shaw, G; Connell, D; Barron, W

    1995-05-01

    Genotoxic carcinogens such as polycyclic aromatic hydrocarbons (PAHs) covalently bind to the bases in DNA to form adducts. The formation of DNA adducts is significant with respect to chemical carcinogenesis. Many contaminated sites contain quantities of carcinogens such as PAHs, and the evaluation of the genotoxicity of these soils has important implications for human risk assessment. DNA adducts can be formed using an in vitro system incorporating extracts from contaminated soils. The 32P-postlabelling assay is a sensitive technique for the detection of DNA adducts from complex mixtures of environmental carcinogens. These techniques have been used to form and detect DNA adducts using soils from a number of coal gasworks sites. The results show that the extent of adduct formation depends partially on the petroleum hydrocarbon content of samples, but also on other undetermined factors related to composition. While environmental weathering has been shown to effect the PAH composition of samples, this is not an important factor in controlling the genotoxicity of samples as estimated by DNA adduct formation. PMID:7780722

  5. Addition of Adipose-Derived Stem Cells to Mesenchymal Stem Cell Sheets Improves Bone Formation at an Ectopic Site

    PubMed Central

    Wang, Zhifa; Li, Zhijin; Dai, Taiqiang; Zong, Chunlin; Liu, Yanpu; Liu, Bin

    2016-01-01

    To determine the effect of adipose-derived stem cells (ADSCs) added to bone marrow-derived mesenchymal stem cell (MSC) sheets on bone formation at an ectopic site. We isolated MSCs and ADSCs from the same rabbits. We then prepared MSC sheets for implantation with or without ADSCs subcutaneously in the backs of severe combined immunodeficiency (SCID) mice. We assessed bone formation at eight weeks after implantation by micro-computed tomography and histological analysis. In osteogenic medium, MSCs grew to form multilayer sheets containing many calcium nodules. MSC sheets without ADSCs formed bone-like tissue; although neo-bone and cartilage-like tissues were sparse and unevenly distributed by eight weeks after implantation. In comparison, MSC sheets with ADSCs promoted better bone regeneration as evidenced by the greater density of bone, increased mineral deposition, obvious formation of blood vessels, large number of interconnected ossified trabeculae and woven bone structures, and greater bone volume/total volume within the composite constructs. Our results indicate that although sheets of only MSCs have the potential to form tissue engineered bone at an ectopic site, the addition of ADSCs can significantly increase the osteogenic potential of MSC sheets. Thus, the combination of MSC sheets with ADSCs may be regarded as a promising therapeutic strategy to stimulate bone regeneration. PMID:26848656

  6. Genetic alterations and cancer formation in a European flatfish at sites of different contaminant burdens.

    PubMed

    Lerebours, Adélaïde; Stentiford, Grant D; Lyons, Brett P; Bignell, John P; Derocles, Stéphane A P; Rotchell, Jeanette M

    2014-09-01

    Fish diseases are an indicator for marine ecosystem health since they provide a biological end-point of historical exposure to stressors. Liver cancer has been used to monitor the effects of exposure to anthropogenic pollution in flatfish for many years. The prevalence of liver cancer can exceed 20%. Despite the high prevalence and the opportunity of using flatfish to study environmentally induced cancer, the genetic and environmental factors driving tumor prevalence across sites are poorly understood. This study aims to define the link between genetic deterioration, liver disease progression, and anthropogenic contaminant exposures in the flatfish dab (Limanda limanda). We assessed genetic changes in a conserved cancer gene, Retinoblastoma (Rb), in association with histological diagnosis of normal, pretumor, and tumor pathologies in the livers of 165 fish from six sites in the North Sea and English Channel. The highest concentrations of metals (especially cadmium) and organic chemicals correlated with the presence of tumor pathology and with defined genetic profiles of the Rb gene, from these sites. Different Rb genetic profiles were found in liver tissue near each tumor phenotype, giving insight into the mechanistic molecular-level cause of the liver pathologies. Different Rb profiles were also found at sampling sites of differing contaminant burdens. Additionally, profiles indicated that histological "normal" fish from Dogger sampling locations possessed Rb profiles associated with pretumor disease. This study highlights an association between Rb and specific contaminants (especially cadmium) in the molecular etiology of dab liver tumorigenesis. PMID:25102285

  7. Impact of Internet Images: Impression-Formation Effects of University Web Site Images

    ERIC Educational Resources Information Center

    Ramasubramanian, Srividya; Gyure, James F.; Mursi, Nasreen M.

    2002-01-01

    Institutions of higher education are increasingly becoming dependent on Web-based marketing to reach out to their target audiences. The current empirical study examines the types of impressions formed by prospective students based on exposure to different university Web site images. A between-subjects experiment was conducted using four identical…

  8. Me and My Environment Formative Evaluation Report 1. Arranging Field Tests: Characteristics of Sites and Students.

    ERIC Educational Resources Information Center

    Steele, Joe M.

    The first in a series of evaluation reports gives characteristics of sites and approximately 500 students in field tests of Me and My Environment, a 3-year life science curriculum for 13- to 16-year-old educable mentally handicapped (EMH) adolescents. Described are the field test design, which involves 14 data gathering approaches, and the…

  9. Formation and growth of atmospheric particles at a forest site in the southeast US

    NASA Astrophysics Data System (ADS)

    Pillai, Priya; Walker, John; Khlystov, Andrey; Aneja, Viney

    2013-05-01

    Atmospheric particle size distribution measurements (10 ≤ aerodynamic diameter, Dp ≤ 250 nm), which took place above a loblolly pine plantation in the Southeast U.S. from November 2005 to September 2007, were made using Scanning Mobility Particle Sizer (SMPS). The size distributions were investigated to identify new particle formation and to classify the new particle formation episodes into different event classes based on the behavior of particle size distribution and particle growth pattern. About 69% of the observation days had nucleation. The event frequency was highest in spring and lowest in winter. The particle growth rate was highest in May (5.0 ± 3.6 nm hr-1) and lowest in February (1.2 ± 2.2 nm hr-1) with an annual average particle growth rate of 2.5 ± 0.3 nm hr-1. Nucleation frequency and event types are examined along with associated meteorological and chemical conditions.

  10. New particle formation at a remote continental site: Assessing the contributions of SO2 and organic precursors

    NASA Astrophysics Data System (ADS)

    Marti, James J.; Weber, Rodney J.; McMurry, Peter H.; Eisele, Fred; Tanner, David; Jefferson, Anne

    1997-03-01

    Ultrafine aerosols, with diameters less than 10 nm, nucleate from gas phase species. The composition of newly formed ultrafine atmospheric aerosols is not known with certainty; new particles have variously been conjectured to be sulfates, organic compounds, and sulfate/organic mixtures. The 1993 Tropospheric OH Photochemistry Experiment at Idaho Hill, Colorado, provided an opportunity to examine the question of which class of compounds, i.e., sulfates or organics, make the major contribution to new particle formation in the unpolluted troposphere. This study compared the production rates of sulfuric acid (from the oxidation of sulfur dioxide) and oxidized organic compounds to gauge their relative contributions to the formation of ultrafine particles. Potential organic precursor species examined in this study were the naturally occurring terpenes α- and β pinene, and the anthropogenic hydrocarbons toluene, m-xylene, ethyl benzene, 1,2,4 trimethyl benzene, and methylcyclohexane. The calculated production of oxidized organics appeared well correlated with total particle surface area and volume, suggesting that at least some of the organic compounds formed in gas phase reactions condensed upon the preexisting aerosol. New particle formation was found to be more highly associated with elevated production of gas phase sulfuric acid (via the SO2-OH reaction) than with production of oxidized organic products, although data from one day, during which sulfuric acid production and total aerosol surface area were both lower than usual, provided evidence for the involvement of terpene species in new particle formation. The results suggest that for this continental site, sulfuric acid was probably responsible for most of the observed new ultrafine particle formation. Low-volatility organic compounds may have caused particle formation under the right conditions, but were more likely to condense upon preexisting particles.

  11. Dynamic formation of single-atom catalytic active sites on ceria-supported gold nanoparticles

    PubMed Central

    Wang, Yang-Gang; Mei, Donghai; Glezakou, Vassiliki-Alexandra; Li, Jun; Rousseau, Roger

    2015-01-01

    Catalysis by gold supported on reducible oxides has been extensively studied, yet issues such as the nature of the catalytic site and the role of the reducible support remain fiercely debated topics. Here we present ab initio molecular dynamics simulations of an unprecedented dynamic single-atom catalytic mechanism for the oxidation of carbon monoxide by ceria-supported gold clusters. The reported dynamic single-atom catalytic mechanism results from the ability of the gold cation to strongly couple with the redox properties of the ceria in a synergistic manner, thereby lowering the energy of redox reactions. The gold cation can break away from the gold nanoparticle to catalyse carbon monoxide oxidation, adjacent to the metal/oxide interface and subsequently reintegrate back into the nanoparticle after the reaction is completed. Our study highlights the importance of the dynamic creation of active sites under reaction conditions and their essential role in catalysis. PMID:25735407

  12. Insights into structural and regulatory roles of Sec16 in COPII vesicle formation at ER exit sites

    PubMed Central

    Yorimitsu, Tomohiro; Sato, Ken

    2012-01-01

    COPII-coated buds are formed at endoplasmic reticulum exit sites (ERES) to mediate ER-to-Golgi transport. Sec16 is an essential factor in ERES formation, as well as in COPII-mediated traffic in vivo. Sec16 interacts with multiple COPII proteins, although the functional significance of these interactions remains unknown. Here we present evidence that full-length Sec16 plays an important role in regulating Sar1 GTPase activity at the late steps of COPII vesicle formation. We show that Sec16 interacts with Sec23 and Sar1 through its C-terminal conserved region and hinders the ability of Sec31 to stimulate Sec23 GAP activity toward Sar1. We also find that purified Sec16 alone can self-assemble into homo-oligomeric complexes on a planar lipid membrane. These features ensure prolonged COPII coat association within a preformed Sec16 cluster, which may lead to the formation of ERES. Our results indicate a mechanistic relationship between COPII coat assembly and ERES formation. PMID:22675024

  13. Barometric pressure transient testing applications at the Nevada Test Site: formation permeability analysis. Final report

    SciTech Connect

    Hanson, J.M.

    1984-12-01

    The report evaluates previous investigations of the gas permeability of the rock surrounding emplacement holes at the Nevada Test Site. The discussion sets the framework from which the present uncertainty in gas permeability can be overcome. The usefulness of the barometric pressure testing method has been established. Flow models were used to evaluate barometric pressure transients taken at NTS holes U2fe, U19ac and U20ai. 31 refs., 103 figs., 18 tabs. (ACR)

  14. Formation of NH 4+ at the Brønsted site in SAPO catalysts

    NASA Astrophysics Data System (ADS)

    Limtrakul, Jumras; Yoinuan, Jarungsak

    1994-06-01

    The catalytic properties of ammonia adsorption on silicoaluminophosphate (SAPO) clusters have been investigated within the framework of the ab initio self-consistent field method. Full optimization of strutures has been carried out at the DZ, DZP and TZ2P levels of theory. Two different types of ammonia adsorption on SAPO framework sites are proposed. In one of these the structures H 3SiOHA1(OH) 2OPH 3…NH 3 are stablilized on the bridging OH by a single site binding with an interaction energy of - 17.49 kcal/mol. The others is a type of the structure [H 3SiOA1(OH) 2OPH 3] [NH 4+ ], in which the ammonium cation forms two hydrogen bonds towards the unprotonated framework sites. Other possible structures like a "bifurcated" structure are less stable than the two H-bonded structures by about 0.48 and 0.1 kcal/mol at the DZP and TZ2P basis set levels respectively. This indicates the free rotation of the NH 4+ on the SAPO surface site at room temperature. The interaction energies for the structures [H 3SiOA1(OH) 2OPh 3] [NH 4+ are more stabe than for the structures H 3SiOhA1(OH) 2OPH 3…NH 3 by 0.5-1.36 kcal/mol depending on the basis sets. These calculated energy values are an inversion order from the zeolite/NH 3 complexes. Comparison of the SAPO complexes with hydrogen halides, silanol, and zeolite has demonstrated that the hydrogen-form SAPO is at least as acidic as zeolite.

  15. Analysis of orientation patterns in Olduvai Bed I assemblages using GIS techniques: implications for site formation processes.

    PubMed

    Benito-Calvo, Alfonso; de la Torre, Ignacio

    2011-07-01

    Mary Leakey's excavations at Olduvai Beds I and II provided an unparalleled wealth of data on the archaeology of the early Pleistocene. We have been able to obtain axial orientations of the Bed I bone and stone tools by applying GIS methods to the site plans contained in the Olduvai Volume 3 monograph (Leakey, 1971). Our analysis indicates that the Bed I assemblages show preferred orientations, probably caused by natural agents such as water disturbance. These results, based on new GIS techniques applied to paleoanthropological studies, have important implications for the understanding of the formative agents of Olduvai sites and the behavioral meaning of the bone and lithic accumulations in Bed I. PMID:21470661

  16. Radial Glial Cell–Neuron Interaction Directs Axon Formation at the Opposite Side of the Neuron from the Contact Site

    PubMed Central

    Xu, Chundi; Funahashi, Yasuhiro; Watanabe, Takashi; Takano, Tetsuya; Nakamuta, Shinichi; Namba, Takashi

    2015-01-01

    How extracellular cues direct axon–dendrite polarization in mouse developing neurons is not fully understood. Here, we report that the radial glial cell (RGC)–cortical neuron interaction directs axon formation at the opposite side of the neuron from the contact site. N-cadherin accumulates at the contact site between the RGC and cortical neuron. Inhibition of the N-cadherin-mediated adhesion decreases this oriented axon formation in vitro, and disrupts the axon–dendrite polarization in vivo. Furthermore, the RGC–neuron interaction induces the polarized distribution of active RhoA at the contacting neurite and active Rac1 at the opposite neurite. Inhibition of Rho–Rho-kinase signaling in a neuron impairs the oriented axon formation in vitro, and prevents axon–dendrite polarization in vivo. Collectively, these results suggest that the N-cadherin-mediated radial glia–neuron interaction determines the contacting neurite as the leading process for radial glia-guided neuronal migration and directs axon formation to the opposite side acting through the Rho family GTPases. SIGNIFICANCE STATEMENT Neurons are highly polarized cell lines typically with a single axon and multiple dendrites, which underlies the ability of integrating and transmitting the information in the brain. How is the axon–dendrite polarity of neurons established in the developing neocortex? Here we show that the N-cadherin-mediated radial glial cell–neuron interaction directs axon–dendrite polarization, the radial glial cell–neuron interaction induces polarized distribution of active RhoA and active Rac1 in neurons, and Rho–Rho-kinase signaling is required for axon–dendrite polarization. Our work advances the overall understanding of how extracellular cues direct axon–dendrite polarization in mouse developing neurons. PMID:26511243

  17. Lipid droplets of neuroepithelial cells are a major calcium storage site during neural tube formation in chick and mouse embryos.

    PubMed

    Bush, K T; Lee, H; Nagele, R G

    1992-05-15

    In situ precipitation of calcium (Ca2+) with fluoride and antimonate shows that Ca(2+)-specific precipitate is localized almost exclusively within lipid droplets of neuroepithelial cells during neural tube formation in chick and mouse embryos. The density of Ca2+ precipitate within lipid droplets is generally greater in the apical ends of cells situated in regions of the neuroepithelium that are actively engaged in bending. These findings suggest that lipid droplets, in addition to providing a source of metabolic fuel for developing neuroepithelial cells, also serve as Ca(2+)-storage and -releasing sites during neurulation. PMID:1601118

  18. Mitochondrial translocation contact sites: separation of dynamic and stabilizing elements in formation of a TOM-TIM-preprotein supercomplex.

    PubMed

    Chacinska, Agnieszka; Rehling, Peter; Guiard, Bernard; Frazier, Ann E; Schulze-Specking, Agnes; Pfanner, Nikolaus; Voos, Wolfgang; Meisinger, Chris

    2003-10-15

    Preproteins with N-terminal presequences are imported into mitochondria at translocation contact sites that include the translocase of the outer membrane (TOM complex) and the presequence translocase of the inner membrane (TIM23 complex). Little is known about the functional cooperation of these translocases. We have characterized translocation contact sites by a productive TOM-TIM-preprotein supercomplex to address the role of three translocase subunits that expose domains to the intermembrane space (IMS). The IMS domain of the receptor Tom22 is required for stabilization of the translocation contact site supercomplex. Surprisingly, the N-terminal segment of the channel Tim23, which tethers the TIM23 complex to the outer membrane, is dispensable for both protein import and generation of the TOM-TIM supercomplex. Tim50, with its large IMS domain, is crucial for generation but not for stabilization of the supercomplex. Thus, Tim50 functions as a dynamic factor and the IMS domain of Tom22 represents a stabilizing element in formation of a productive translocation contact site supercomplex. PMID:14532110

  19. BOREAS TE-1 Soils Data Over The SSA Tower Sites in Raster Format

    NASA Technical Reports Server (NTRS)

    Hall, Forrest G. (Editor); Anderson, Darwin; Knapp, David E.

    2000-01-01

    The BOREAS TE-1 team collected various data to characterize the soil-plant systems in the BOREAS SSA. This data set was gridded from vector layers of soil maps that were received from Dr. Darwin Anderson (TE-1), who did the original soil mapping in the field during 1994. The vector layers were gridded into raster files that cover approximately 1 square kilometer over each of the tower sites in the SSA. The data files are available on a CD-ROM (see document number 20010000884), or from the Oak Ridge National Laboratory (ORNL) Distributed Active Archive Center (DAAC).

  20. BOREAS TE-20 Soils Data Over the NSA-MSA and Tower Sites in Vector Format

    NASA Technical Reports Server (NTRS)

    Hall, Forrest G. (Editor); Veldhuis, Hugo; Knapp, David

    2000-01-01

    The BOREAS TE-20 team collected several data sets for use in developing and testing models of forest ecosystem dynamics. This data set contains vector layers of soil maps that were received from Dr. Hugo Veldhuis, who did the original mapping in the field during 1994. The vector layers were converted to ARCANFO EXPORT files. These data cover 1-kilometer diameters around each of the NSA tower sites, and another layer covers the NSA-MSA. The data files are available on a CD-ROM (see document number 20010000884), or from the Oak Ridge National Laboratory (ORNL) Distributed Active Center (DAAC).

  1. Assessment of Zambales Ophiolite formation as a viable site for CO2 storage

    NASA Astrophysics Data System (ADS)

    Magbitang, Riza; Lamorena-Lim, Rheo

    2015-04-01

    Studies involving carbon dioxide (CO2) storage in geologic formations has been increasing over the years. Even though the developed countries are the ones pioneering the large scale storage studies, third world country such as the Philippines, which is one of the most vulnerable to the effects of elevated CO2 levels in the atmosphere, should also intensify CO2 storage research. In this study the potential of utilizing Ophiolite formations in Zambales province, Philippines, in CO2 storage was evaluated. The kinetics of the carbonation reaction was studied using batch reactor, at various temperature and pressure. The concentration of metals involved in the carbonation reaction was monitored by inductively-coupled plasma mass spectrometry (ICP-MS). Flow-through column reactors were used to simulate and study the gas storage in rock columns, hence leading the evaluation of rock mechanical properties. Moreover, thermo-gravimetric analysis (TGA) was used to characterize carbonated and non-carbonated rock samples, thereby resulting to the experimental determination of the amount of CO2 sequestered.

  2. The Impact of Head Gradient Transients on Transport in Heterogeneous Formations: Application to the Borden Site

    NASA Astrophysics Data System (ADS)

    Bellin, Alberto; Dagan, Gedeon; Rubin, Yoram

    1996-04-01

    A three-dimensional interpretation of the Borden Site experiment is proposed with the aid of a recently developed stochastic model that incorporates transiency of the piezometric head gradient. The behavior of the second-order central transverse plume moments is analyzed with the aim of explaining the underprediction of experimental results by existing steady state models. The model assumes uniformity in space, but time varying mean head gradient, stationary and anisotropic log conductivity, and a first-order approximation in the log conductivity variance. The solution for the trajectory covariances, assumed to be equal to the plume spatial second moments under ergodic conditions, is evaluated with the aid of a few quadratures. An analysis of the parameters and plume spatial moments found in the literature precedes application of the model. It is found that unsteadiness leads to an increase in the transverse, horizontal, second moment compared with the one based on a steady state flow model. Still, application of Borden Site data leads to values lower than the ones inferred from concentration measurements. We conclude that unsteadiness of the mean head gradient does not fully explain the magnitude of observed transverse spreading. However, the impact of transients on spreading is significant in the transverse direction, and the definition of a Fickian transverse dispersion coefficient may not be a simple task for transport occurring under natural flow conditions.

  3. An evaluation of water quality in private drinking water wells near natural gas extraction sites in the Barnett Shale formation.

    PubMed

    Fontenot, Brian E; Hunt, Laura R; Hildenbrand, Zacariah L; Carlton, Doug D; Oka, Hyppolite; Walton, Jayme L; Hopkins, Dan; Osorio, Alexandra; Bjorndal, Bryan; Hu, Qinhong H; Schug, Kevin A

    2013-09-01

    Natural gas has become a leading source of alternative energy with the advent of techniques to economically extract gas reserves from deep shale formations. Here, we present an assessment of private well water quality in aquifers overlying the Barnett Shale formation of North Texas. We evaluated samples from 100 private drinking water wells using analytical chemistry techniques. Analyses revealed that arsenic, selenium, strontium and total dissolved solids (TDS) exceeded the Environmental Protection Agency's Drinking Water Maximum Contaminant Limit (MCL) in some samples from private water wells located within 3 km of active natural gas wells. Lower levels of arsenic, selenium, strontium, and barium were detected at reference sites outside the Barnett Shale region as well as sites within the Barnett Shale region located more than 3 km from active natural gas wells. Methanol and ethanol were also detected in 29% of samples. Samples exceeding MCL levels were randomly distributed within areas of active natural gas extraction, and the spatial patterns in our data suggest that elevated constituent levels could be due to a variety of factors including mobilization of natural constituents, hydrogeochemical changes from lowering of the water table, or industrial accidents such as faulty gas well casings. PMID:23885945

  4. Ground-water flow model of the Boone formation at the Tar Creek superfund site, Oklahoma and Kansas

    USGS Publications Warehouse

    Reed, T.B.; Czarnecki, John B.

    2006-01-01

    Extensive mining activities conducted at the Tar Creek Superfund site, one of the largest Superfund sites in the United States, pose substantial health and safety risks. Mining activities removed a total of about 6,000,000 tons of lead and zinc by 1949. To evaluate the effect of this mining on the ground-water flow, a MODFLOW 2000 digital model has been developed to simulate ground-water flow in the carbonate formations of Mississippian age underlying the Tar Creek Superfund site. The model consists of three layers of variable thickness and a grid of 580 rows by 680 columns of cells 164 feet (50 meters) on a side. Model flux boundary conditions are specified for rivers and general head boundaries along the northern boundary of the Boone Formation. Selected cells in layer 1 are simulated as drain cells. Model calibration has been performed to minimize the difference between simulated and observed water levels in the Boone Formation. Hydraulic conductivity values specified during calibration range from 1.3 to 35 feet per day for the Boone Formation with the larger values occurring along the axis of the Miami Syncline where horizontal anisotropy is specified as 10 to 1. Hydraulic conductivity associated with the mine void is set at 50,000 feet per day and a specific yield of 1.0 is specified to represent that the mine void is filled completely with water. Residuals (the difference between measured and simulated ground-water altitudes) has a root-mean-squared value of 8.53 feet and an absolute mean value of 7.29 feet for 17 observed values of water levels in the Boone Formation. The utility of the model for simulating and evaluating the possible consequences of remediation activities has been demonstrated. The model was used to simulate the emplacement of chat (mine waste consisting of fines and fragments of chert) back into the mine. Scenarios using 1,800,000 and 6,500,000 tons of chat were run. Hydraulic conductivity was reduced from 50,000 feet per day to 35 feet

  5. The Role of Groove Periodicity in the Formation of Site-Controlled Quantum Dot Chains.

    PubMed

    Schramm, Andreas; Hakkarainen, Teemu V; Tommila, Juha; Guina, Mircea

    2015-12-01

    Structural and optical properties of InAs quantum dot (QD) chains formed in etched GaAs grooves having different periods from 200 to 2000 nm in [010] orientation are reported. The site-controlled QDs were fabricated by molecular beam epitaxy on soft UV-nanoimprint lithography-patterned GaAs(001) surfaces. Increasing the groove periods decreases the overall QD density but increases the QD size and the linear density along the groove direction. The effect of the increased QD size with larger periods is reflected in ensemble photoluminescence measurements as redshift of the QD emission. Furthermore, we demonstrate the photoluminescence emission from single QD chains. PMID:26058509

  6. Site characterization of the highest-priority geologic formations for CO2 storage in Wyoming

    SciTech Connect

    Surdam, Ronald C.; Bentley, Ramsey; Campbell-Stone, Erin; Dahl, Shanna; Deiss, Allory; Ganshin, Yuri; Jiao, Zunsheng; Kaszuba, John; Mallick, Subhashis; McLaughlin, Fred; Myers, James; Quillinan, Scott

    2013-12-07

    This study, funded by U.S. Department of Energy National Energy Technology Laboratory award DE-FE0002142 along with the state of Wyoming, uses outcrop and core observations, a diverse electric log suite, a VSP survey, in-bore testing (DST, injection tests, and fluid sampling), a variety of rock/fluid analyses, and a wide range of seismic attributes derived from a 3-D seismic survey to thoroughly characterize the highest-potential storage reservoirs and confining layers at the premier CO2 geological storage site in Wyoming. An accurate site characterization was essential to assessing the following critical aspects of the storage site: (1) more accurately estimate the CO2 reservoir storage capacity (Madison Limestone and Weber Sandstone at the Rock Springs Uplift (RSU)), (2) evaluate the distribution, long-term integrity, and permanence of the confining layers, (3) manage CO2 injection pressures by removing formation fluids (brine production/treatment), and (4) evaluate potential utilization of the stored CO2

  7. Formation of multimers of bacterial collagens through introduction of specific sites for oxidative crosslinking.

    PubMed

    Stoichevska, Violet; An, Bo; Peng, Yong Y; Yigit, Sezin; Vashi, Aditya V; Kaplan, David L; Werkmeister, Jerome A; Dumsday, Geoff J; Ramshaw, John A M

    2016-09-01

    A range of non-animal collagens has been described, derived from bacterial species, which form stable triple-helical structures without the need for secondary modification to include hydroxyproline in the sequence. The non-animal collagens studied to date are typically smaller than animal interstitial collagens, around one quarter the length and do not pack into large fibrillar aggregates like those that are formed by the major animal interstitial collagens. A consequence of this for biomedical products is that fabricated items, such as collagen sponges, are not as mechanically and dimensionally stable as those of animal collagens. In the present study, we examined the production of larger, polymeric forms of non-animal collagens through introduction of tyrosine and cysteine residues that can form selective crosslinks through oxidation. These modifications allow the formation of larger aggregates of the non-animal collagens. When Tyr residues were incorporated, gels were obtained. And with Cys soluble aggregates were formed. These materials can be formed into sponges that are more stable than those formed without these modifications. © 2016 Wiley Periodicals, Inc. J Biomed Mater Res Part A: 104A: 2369-2376, 2016. PMID:27171817

  8. GALFA HI: Candidate Sites for H2 Formation in Cold HI Emission and Other Tracers

    NASA Astrophysics Data System (ADS)

    Newton, Jonathan; Gibson, S. J.; Douglas, K. A.; Koo, B.; Kang, J.; Park, G.; Peek, J. E. G.; Korpela, E. J.; Heiles, C.; Dame, T. M.

    2012-01-01

    Interstellar gas has a variety of temperature phases, but only the coldest clouds are dense enough to collapse gravitationally and form stars. How do such clouds form? A key step in this process is the transition from neutral atomic hydrogen (HI) to molecular hydrogen (H2). To identify candidate sites where this HI-to-H2 transition may be underway, we have developed a method of fitting isolated HI 21cm emission features to constrain their spin temperature and other properties vs. position 21cm-line data cubes. Our method uses the Nelder-Meade `amoeba' method to solve the relevant radiative transfer equation by identifying the absolute chi-squared minimum in the parameter space. As other investigators have noted, this approach requires a very high signal-to-noise ratio, so we are using sensitive Arecibo L-band Feed Array (ALFA) observations, starting with narrow-line HI emission clouds in the inner-Galaxy ALFA (I-GALFA) survey, and we have also tested the reliability of our method with a large suite of model spectra. Cold HI clouds confirmed by the fit will be compared to tracers of molecular gas, including CO lines and FIR dust emission. The I-GALFA survey is part of the Galactic ALFA HI data set obtained with the Arecibo 305m telescope. Arecibo Observatory is part of the National Astronomy and Ionosphere Center, operated sequentially by Cornell University and Stanford Research Institute under Cooperative Agreement with the U.S. National Science Foundation.

  9. A conserved secondary structural motif in 23S rRNA defines the site of interaction of amicetin, a universal inhibitor of peptide bond formation.

    PubMed Central

    Leviev, I G; Rodriguez-Fonseca, C; Phan, H; Garrett, R A; Heilek, G; Noller, H F; Mankin, A S

    1994-01-01

    The binding site and probable site of action have been determined for the universal antibiotic amicetin which inhibits peptide bond formation. Evidence from in vivo mutants, site-directed mutations and chemical footprinting all implicate a highly conserved motif in the secondary structure of the 23S-like rRNA close to the central circle of domain V. We infer that this motif lies at, or close to, the catalytic site in the peptidyl transfer centre. The binding site of amicetin is the first of a group of functionally related hexose-cytosine inhibitors to be localized on the ribosome. Images PMID:8157007

  10. Notch3 Activation Promotes Invasive Glioma Formation in a Tissue Site-Specific Manner

    PubMed Central

    Pierfelice, Tarran J.; Schreck, Karisa C.; Dang, Louis; Asnaghi, Laura; Gaiano, Nicholas; Eberhart, Charles G.

    2010-01-01

    While Notch signaling has been widely implicated in neoplastic growth, direct evidence for in vivo initiation of neoplasia by the pathway in murine models has been limited to tumors of lymphoid, breast, and choroid plexus cells. To examine tumorigenic potential in the eye and brain, we injected retroviruses encoding activated forms of Notch1, Notch2, or Notch3 into embryonic mice. Interestingly, the majority of animals infected with active Notch3 developed proliferative lesions comprised of pigmented ocular choroid cells, retinal and optic nerve glia, and lens epithelium. Notch3-induced lesions in the choroid, retina, and optic nerve were capable of invading adjacent tissues, suggesting that they were malignant tumors. While Notch3 activation induced choroidal tumors in up to 67% of eyes, Notch1 or Notch2 activation never resulted in such tumors. Active forms of Notch1 and Notch2 did generate a few small proliferative glial nodules in the retina and optic nerve, while Notch3 was ten-fold more efficient at generating growths, many of which were large invasive gliomas. Expression of active Notch1/Notch3 chimeric receptors implicated the RAM (RBPjk-association molecule) and transactivation domains (TAD) of Notch3 in generating choroidal and glial tumors, respectively. In contrast to our findings in the optic nerve and retina, introduction of active Notch receptors, including Notch3, into the brain never caused glial tumors. Our results highlight the differential ability of Notch receptor paralogs to initiate malignant tumor formation, and suggest that glial precursors of the optic nerve, but not the brain, are susceptible to transformation by Notch3. PMID:21245095

  11. Climatology and Formation of Tropical Midlevel Clouds at the Darwin ARM Site

    SciTech Connect

    Riihimaki, Laura D.; McFarlane, Sally A.; Comstock, Jennifer M.

    2012-10-01

    A 4-yr climatology of midlevel clouds is presented from vertically pointing cloud lidar and radar measurements at the Atmospheric Radiation Measurement Program (ARM) site at Darwin, Australia. Few studies exist of tropical midlevel clouds using a dataset of this length. Seventy percent of clouds with top heights between 4 and 8 km are less than 2 km thick. These thin layer clouds have a peak in cloud-top temperature around the melting level (0°C) and also a second peak around -12.5°C. The diurnal frequency of thin clouds is highest during the night and reaches a minimum around noon, consistent with variation caused by solar heating. Using a 1.5-yr subset of the observations, the authors found that thin clouds have a high probability of containing supercooled liquid water at low temperatures: ~20% of clouds at -30°C, ~50% of clouds at -20°C, and ~65% of clouds at -10°C contain supercooled liquid water. The authors hypothesize that thin midlevel clouds formed at the melting level are formed differently during active and break monsoon periods and test this over three monsoon seasons. A greater frequency of thin midlevel clouds are likely formed by increased condensation following the latent cooling of melting during active monsoon periods when stratiform precipitation is most frequent. This is supported by the high percentage (65%) of midlevel clouds with preceding stratiform precipitation and the high frequency of stable layers slightly warmer than 0°C. In the break monsoon, a distinct peak in the frequency of stable layers at 0°C matches the peak in thin midlevel cloudiness, consistent with detrainment from convection.

  12. Dust Seds And Processing Near Sites Of High Mass Star Formation In The LMC

    NASA Astrophysics Data System (ADS)

    Hony, Sacha; Galliano, F.; Madden, S. M.; SAGE Consortium

    2010-01-01

    We present a study into the properties of the dust and complex molecules in and around selected HII regions in the Large Magellanic Cloud. The analysis is based on the Spitzer program SAGE (Surveying the Agents of a Galaxy's Evolution). Because of the lower metallicity environment, dust shielding is reduced and the effects of the ultraviolet radiation carry further than in the Milky way. Because of this these HII regions may better represent star forming regions in the more distant universe. We present the near- to far-IR spectral energy distributions (SEDs) as a function of radial distance to the center of the several clusters. The regions span a wide range in luminosities. We have developed a self consistent spherical clumpy dust radiative transfer model to interpret the observed trends. The model treats the detailed dust optical properties and transient grain heating as well as IR absorption and reprocession. This allows us to interpret the observed variations in SED in terms of the clumpiness, varying incident radiation-field and changing abundances of polycyclic aromatic hydrocarbons (PAHs), transiently heated very small grains (VSG) to submicron-sized grains in thermal equilibrium, i.e. in terms of the varying grain-size distribution. We find that the LMC massive star forming sites are typified by a several parsec sized void and clumpiness and PAH abundance which increases with distance from the central illuminating source. The inner void may be the result of massive star winds. The observed flat mid-IR SEDs require a grain-size distribution skewed to a higher fraction of smaller grains compared to the Milky Way dust.

  13. Analysis of solutes in groundwaters from the Rustler Formation at and near the Waste Isolation Pilot Plant site

    SciTech Connect

    Robinson, K.L.

    1997-09-01

    Between 1976 and 1986, groundwater samples from more than 60 locations in the vicinity of the Waste Isolation Pilot Plant site were collected and analyzed for a variety of major, minor, and trace solutes. Most of the samples were from the Rustler Formation (the Culebra Dolomite, the Magenta Dolomite, or the zone at the contact between the Rustler and underlying Salado Formations) or the Dewey Lake Red Beds. The analytical data from the laboratories are presented here with accompanying discussions of sample collection methods, supporting field measurements, and laboratory analytical methods. A comparison of four data sets and a preliminary evaluation of the data for the major solutes (Cl{sup {minus}}, SO{sub 4}{sup {minus}2}, Na, K, Ca, and Mg) shows that the data for samples analyzed by UNC/Bendix for SNL seem to be the most reliable, but that at some locations, samples representative of the native, unperturbed groundwater have not been collected. At other locations, the water chemistry has apparently changed between sampling episodes.

  14. Saharan dust and heterogeneous ice formation: Eleven years of cloud observations at a central European EARLINET site

    NASA Astrophysics Data System (ADS)

    Seifert, P.; Ansmann, A.; Mattis, I.; Wandinger, U.; Tesche, M.; Engelmann, R.; Müller, D.; PéRez, C.; Haustein, K.

    2010-10-01

    More than 2300 observed cloud layers were analyzed to investigate the impact of aged Saharan dust on heterogeneous ice formation. The observations were performed with a polarization/Raman lidar at the European Aerosol Research Lidar Network site of Leipzig, Germany (51.3°N, 12.4°E) from February 1997 to June 2008. The statistical analysis is based on lidar-derived information on cloud phase (liquid water, mixed phase, ice cloud) and cloud top height, cloud top temperature, and vertical profiles of dust mass concentration calculated with the Dust Regional Atmospheric Modeling system. Compared to dust-free air masses, a significantly higher amount of ice-containing clouds (25%-30% more) was observed for cloud top temperatures from -10°C to -20°C in air masses that contained mineral dust. The midlatitude lidar study is compared with our SAMUM lidar study of tropical stratiform clouds at Cape Verde in the winter of 2008. The comparison reveals that heterogeneous ice formation is much stronger over central Europe and starts at higher temperatures than over the tropical station. Possible reasons for the large difference are discussed.

  15. Organic geochemical characterization of reservoir rocks, cap rocks and formation fluids from the CO2 storage site at Ketzin, Germany

    NASA Astrophysics Data System (ADS)

    Scherf, A.-K.; Morozova, D.; Wandrey, M.; Mangelsdorf, K.; Würdemann, H.; Vieth, A.

    2009-04-01

    The European project CO2SINK (CO2 Storage by Injection into a natural saline Aquifer at Ketzin) is the first project on the on-shore underground storage of carbon dioxide in Europe. Near the city Ketzin (north-east Germany) a geological formation of the younger Triassic (Stuttgart Formation) was chosen as reservoir for the long-term storage of the carbon dioxide. Within the scope of the Ketzin project we will analyse the organic matter in core rock and fluid samples to investigate the biogeochemical effects and changes on the geological formation caused by the injection of carbon dioxide. These investigations will help to evaluate the efficiency and reliability of the long-term storage of CO2 in such a geological system. Organic geochemical analyses will be performed on core rock samples drilled in 2007 at the Ketzin CO2 storage site in Germany. In total, three bore holes were constructed: one injection well and two observation wells. In addition to the molecular analysis of the microbial community we will investigate rock samples from different depths for total, dissolved and extractable organic carbon including lipid biomarkers, such as organic acids and intact polar lipids as well as the isotopic analysis of individual organic compounds. With the analysis of intact phospholipids (IPL) we will be able to further characterize the indigenous microbial community. Intact phospholipids are found in all living cells as membrane components (Zelles, 1999). Their interpretation is based on the premise that different microorganisms contain different phospholipids with ester- and/or ether-bound fatty acids (White et al., 1979) and thus, the distribution of IPLs and PLFAs (phospholipids fatty acid) can be applied to characterise and compare microbial communities. The data obtained from these analyses will provide valuable information on the active microorganisms as well as shifts in community composition. The characterization of the organic matter in the reservoir rock

  16. MECHANISMS OF PHASE FORMATION IN THE VITRIFICATION OF HIGH-FERROUS SAVANNAH RIVER SITE SB2 HLW SLUDGE SURROGATE - 9300

    SciTech Connect

    Marra, J

    2008-08-27

    Phase formation mechanisms associated with the vitrification of high-ferrous Savannah River Site (SRS) Sludge Batch 2 (SB2) high level waste surrogate were studied by infrared spectroscopy (IRS) and X-ray diffraction (XRD). Two mixtures at 50 wt% waste loading with commercially available Frit 320 (Li{sub 2}O - 8 wt %, B{sub 2}O{sub 3} - 8 wt %, Na{sub 2}O - 12 wt %, SiO{sub 2} - 72 wt %) and batch chemicals (LiOH {center_dot} H{sub 2}O, H{sub 3}BO{sub 3}, NaNO{sub 3}, SiO{sub 2}) to represent the frit formulation were prepared as slurries with a water content of {approx}50 wt%. The mixtures were air-dried at a temperature of 115 C and heat-treated at 500, 700, 900, 1000, 1100, 1200, and 1300 C for 1 hr at each temperature. Infrared spectra and XRD patterns of the products produced at each temperature were recorded. In both mixtures prepared using frit and batch chemicals to represent the frit, phase formation reactions were completed within the temperature range between 900 and 1000 C. However, residual quartz was still present in glass produced from the mixture with batch chemicals even at 1100 C. Although, the phase composition and structure of the glassy products obtained from both mixtures at temperatures over 1000 C were similar, the products obtained from the mixture using actual frit were more homogeneous than those from the mixture with batch chemicals. Thus, the use of frit rather than batch chemicals reduced the temperature range of phase formation and provided for production of higher quality glass.

  17. A FEEDBACK-DRIVEN BUBBLE G24.136+00.436: A POSSIBLE SITE OF TRIGGERED STAR FORMATION

    SciTech Connect

    Liu, Hong-Li; Li, JinZeng; Yuan, Jing-Hua; Wu, Yuefang; Dong, Xiaoyi; Liu, Tie E-mail: yfwu.pku@gmail.com

    2015-01-01

    We present a multi-wavelength study of the IR bubble G24.136+00.436. The J = 1-0 observations of {sup 12}CO, {sup 13}CO, and C{sup 18}O were carried out with the Purple Mountain Observatory 13.7 m telescope. Molecular gas with a velocity of 94.8 km s{sup –1} is found prominently in the southeast of the bubble, shaped as a shell with a total mass of ∼2 × 10{sup 4} M {sub ☉}. It was likely assembled during the expansion of the bubble. The expanding shell consists of six dense cores, whose dense (a few of 10{sup 3} cm{sup –3}) and massive (a few of 10{sup 3} M {sub ☉}) characteristics coupled with the broad linewidths (>2.5 km s{sup –1}) suggest that they are promising sites for forming high-mass stars or clusters. This could be further consolidated by the detection of compact H II regions in Cores A and E. We tentatively identified and classified 63 candidate young stellar objects (YSOs) based on the Spitzer and UKIDSS data. They are found to be dominantly distributed in regions with strong molecular gas emission, indicative of active star formation, especially in the shell. The H II region inside the bubble is mainly ionized by a ∼O8V star(s), of the dynamical age of ∼1.6 Myr. The enhanced number of candidate YSOs and secondary star formation in the shell as well as the timescales involved, indicate a possible scenario for triggering star formation, signified by the ''collect and collapse'' process.

  18. Quasars as the formation sites of high-redshift ellipticals: a signature in the `associated' absorption-line systems?

    NASA Astrophysics Data System (ADS)

    Franceschini, A.; Gratton, R.

    1997-03-01

    Published data on the average metallicities and abundance ratios for absorption-line systems in high-redshift quasars suggest that a dichotomy may exist between the chemical composition of damped Lyman alpha (Lyalpha) systems (interpreted as intervening galaxies in the QSO line of sight) and the z_abs~=z_em absorption- line systems associated with the quasar. Intervening systems have smaller than solar metallicities, whereas associated absorbers have solar or greater than solar metallicities and small N/C ratios. While these results have to be confirmed by more precise abundance determinations, we argue that they may be explained by an early phase of efficient metal enrichment occurring only in the close environment of high-z QSOs, and characterized by an excess type-II supernova (SNII) activity. This is reminiscent of the SNII phase required to explain the abundance ratios (favouring alpha- over Fe-group elements) observed in the intracluster (IC) medium of local galaxy clusters. We explore the following scenario, to be tested by forthcoming observations of QSO absorption lines using very large optical telescopes. (a) Well-studied damped- Lyalpha, Lyalpha and metal lines in intervening systems trace only part of the history of metal production in the Universe - the one concerning slowly star-forming discs or dwarf irregulars. (b) The complementary class of early-type and bulge-dominated galaxies formed quickly (at z>~4-5) through a huge episode of star formation favouring high-mass stars. (c) The nucleus of the latter is the site of the subsequent formation of a quasar, which partly hides from view the dimmer host galaxy. (d) The products of a galactic wind, following the violent episode of star formation in the host galaxy and metal pollution of the IC medium in the forming cluster, could be directly observable in the z_abs~=z_em associated absorption systems on the QSO line of sight.

  19. Effects of Al(3+) Ions on Formation of Silica Framework and Surface Active Sites for SO4(2-) Ions.

    PubMed

    Sasahara, Shigeo; Ozeki, Sumio

    2016-07-19

    Al(3+) ions were introduced into silica framework at 318 K in order to make active Al sites for SO4(2-) by the addition of aqueous sodium silicate solution to aqueous sulfuric acid solution of Al2(SO4)3. The (27)Al and (29)Si NMR spectra of aluminosilicates were measured at 278 K with reaction time. (29)Si NMR spectra were analyzed by the multivariate curve resolution. The addition of Al(3+) ions to aqueous silicate solution promoted gel formation. Small amounts of Al(3+) ions were incorporated as a four-coordinated complex at early stage of polymerization reaction of silicates and during subsequent reaction six-coordinated Al complex increased, suggesting reversible conversion between 4- and 6-coordinated complexes. SO4(2-) ions interact with positive surfaces of aluminosilicates and are specifically adsorbed on the surface sites of 6-coordinated Al(3+) species, which may be stabilized on silicate surfaces as [Al(H2O)5SO4](+). PMID:27352046

  20. Facile Formation of a DNA Adduct of Semicarbazide on Reaction with Apurinic/Apyrimidinic Sites in DNA.

    PubMed

    Wang, Yinan; Chan, Ho Wai; Chan, Wan

    2016-05-16

    Mutagenic semicarbazide (SEM) is a hydrazine-containing food contaminant found in a wide variety of foods. Despite decades of research, the toxicity of SEM remains incompletely understood. In this study, we demonstrate for the first time that SEM reacts rapidly with apurinic/apyrimidinic sites in an endogenous DNA lesion to form covalently bonded DNA adducts in vitro and in bacteria. Specifically, we performed high-performance liquid chromatography with high accuracy and tandem mass spectrometry to characterize the DNA adduct formed by reacting SEM with 2'-deoxyribose and single- and double-stranded oligonucleotides containing abasic sites under physiologically relevant conditions. By analyzing the reaction mixture at different time points, the reaction kinetics of SEM with DNA was also elucidated. Moreover, by using a highly sensitive and selective liquid chromatography-tandem mass spectrometry method, we show that SEM induces the dose-dependent formation of DNA adducts in Escherichia coli. The results from our studies provide the first direct evidence suggesting that SEM may exert genotoxicity by forming covalently bonded DNA adducts. PMID:27058397

  1. A parasitic nematode releases cytokinin that controls cell division and orchestrates feeding site formation in host plants

    PubMed Central

    Siddique, Shahid; Radakovic, Zoran S.; De La Torre, Carola M.; Chronis, Demosthenis; Novák, Ondřej; Ramireddy, Eswarayya; Holbein, Julia; Matera, Christiane; Hütten, Marion; Gutbrod, Philipp; Anjam, Muhammad Shahzad; Rozanska, Elzbieta; Habash, Samer; Elashry, Abdelnaser; Sobczak, Miroslaw; Kakimoto, Tatsuo; Strnad, Miroslav; Schmülling, Thomas; Mitchum, Melissa G.; Grundler, Florian M. W.

    2015-01-01

    Sedentary plant-parasitic cyst nematodes are biotrophs that cause significant losses in agriculture. Parasitism is based on modifications of host root cells that lead to the formation of a hypermetabolic feeding site (a syncytium) from which nematodes withdraw nutrients. The host cell cycle is activated in an initial cell selected by the nematode for feeding, followed by activation of neighboring cells and subsequent expansion of feeding site through fusion of hundreds of cells. It is generally assumed that nematodes manipulate production and signaling of the plant hormone cytokinin to activate cell division. In fact, nematodes have been shown to produce cytokinin in vitro; however, whether the hormone is secreted into host plants and plays a role in parasitism remained unknown. Here, we analyzed the spatiotemporal activation of cytokinin signaling during interaction between the cyst nematode, Heterodera schachtii, and Arabidopsis using cytokinin-responsive promoter:reporter lines. Our results showed that cytokinin signaling is activated not only in the syncytium but also in neighboring cells to be incorporated into syncytium. An analysis of nematode infection on mutants that are deficient in cytokinin or cytokinin signaling revealed a significant decrease in susceptibility of these plants to nematodes. Further, we identified a cytokinin-synthesizing isopentenyltransferase gene in H. schachtii and show that silencing of this gene in nematodes leads to a significant decrease in virulence due to a reduced expansion of feeding sites. Our findings demonstrate the ability of a plant-parasitic nematode to synthesize a functional plant hormone to manipulate the host system and establish a long-term parasitic interaction. PMID:26417108

  2. Active site formation mechanism of carbon-based oxygen reduction catalysts derived from a hyperbranched iron phthalocyanine polymer

    NASA Astrophysics Data System (ADS)

    Hiraike, Yusuke; Saito, Makoto; Niwa, Hideharu; Kobayashi, Masaki; Harada, Yoshihisa; Oshima, Masaharu; Kim, Jaehong; Nabae, Yuta; Kakimoto, Masa-aki

    2015-04-01

    Carbon-based cathode catalysts derived from a hyperbranched iron phthalocyanine polymer (HB-FePc) were characterized, and their active-site formation mechanism was studied by synchrotron-based spectroscopy. The properties of the HB-FePc catalyst are compared with those of a catalyst with high oxygen reduction reaction (ORR) activity synthesized from a mixture of iron phthalocyanine and phenolic resin (FePc/PhRs). Electrochemical measurements demonstrate that the HB-FePc catalyst does not lose its ORR activity up to 900°C, whereas that of the FePc/PhRs catalyst decreases above 700°C. Hard X-ray photoemission spectra reveal that the HB-FePc catalysts retain more nitrogen components than the FePc/PhRs catalysts between pyrolysis temperatures of 600°C and 800°C. This is because the linked structure of the HB-FePc precursor has high thermostability against nitrogen desorption. Consequently, effective doping of active nitrogen species into the sp 2 carbon network of the HB-FePc catalysts may occur up to 900°C.

  3. An intramembranous ossification model for the in silico analysis of bone tissue formation in tooth extraction sites.

    PubMed

    Corredor-Gómez, Jennifer Paola; Rueda-Ramírez, Andrés Mauricio; Gamboa-Márquez, Miguel Alejandro; Torres-Rodríguez, Carolina; Cortés-Rodríguez, Carlos Julio

    2016-07-21

    The accurate modeling of biological processes allows us to predict the spatiotemporal behavior of living tissues by computer-aided (in silico) testing, a useful tool for the development of medical strategies, avoiding the expenses and potential ethical implications of in vivo experimentation. A model for bone healing in mouth would be useful for selecting proper surgical techniques in dental procedures. In this paper, the formulation and implementation of a model for Intramembranous Ossification is presented aiming to describe the complex process of bone tissue formation in tooth extraction sites. The model consists in a mathematical description of the mechanisms in which different types of cells interact, synthesize and degrade extracellular matrices under the influence of biochemical factors. Special attention is given to angiogenesis, oxygen-dependent effects and growth factor-induced apoptosis of fibroblasts. Furthermore, considering the depth-dependent vascularization of mandibular bone and its influence on bone healing, a functional description of the cell distribution on the severed periodontal ligament (PDL) is proposed. The developed model was implemented using the finite element method (FEM) and successfully validated by simulating an animal in vivo experiment on dogs reported in the literature. A good fit between model outcome and experimental data was obtained with a mean absolute error of 3.04%. The mathematical framework presented here may represent an important tool for the design of future in vitro and in vivo tests, as well as a precedent for future in silico studies on osseointegration and mechanobiology. PMID:27113783

  4. Submicron aerosols at thirteen diversified sites in China: size distribution, new particle formation and corresponding contribution to cloud condensation nuclei production

    NASA Astrophysics Data System (ADS)

    Peng, J. F.; Hu, M.; Wang, Z. B.; Huang, X. F.; Kumar, P.; Wu, Z. J.; Guo, S.; Yue, D. L.; Shang, D. J.; Zheng, Z.; He, L. Y.

    2014-09-01

    Understanding the particle number size distributions in diversified atmospheric environments is important in order to design mitigation strategies related to submicron particles and their effects on regional air quality, haze and human health. In this study, we conducted 15 different field measurement campaigns between 2007 and 2011 at 13 individual sites in China, including five urban sites, four regional sites, three coastal/background sites and one ship cruise measurement along eastern coastline of China. Size resolved particles were measured in the 15-600 nm size range. The median particle number concentrations (PNCs) were found to vary in the range of 1.1-2.2 × 104 cm-3 at urban sites, 0.8-1.5 × 104 cm-3 at regional sites, 0.4-0.6 × 104 cm-3 at coastal/background sites, and 0.5 × 104 cm-3 during cruise measurement. Peak diameters at each of these sites varied greatly from 24 to 115 nm. Particles in the 15-25 nm (nucleation mode), 25-100 nm (Aitken mode) and 100-600 nm (accumulation mode) range showed different characteristics at each sites, indicating the features of primary emissions and secondary formation in these diversified atmospheric environments. Diurnal variations show a build-up of accumulation mode particles belt at regional sites, suggesting the contribution of regional secondary aerosol pollution. Frequencies of new particle formation (NPF) events were much higher at urban and regional sites than at coastal sites and during cruise measurement. The average growth rates (GRs) of nucleation mode particles were 8.0-10.9 nm h-1 at urban sites, 7.4-13.6 nm h-1 at regional sites and 2.8-7.5 nm h-1 at coastal sites and during cruise measurement. The high gaseous precursors and strong oxidation at urban and regional sites not only favored the formation of particles, but also accelerated the growth rate of the nucleation mode particles. No significant difference in condensation sink (CS) during NPF days were observed among different site types

  5. Submicron aerosols at thirteen diversified sites in China: size distribution, new particle formation and corresponding contribution to cloud condensation nuclei production

    NASA Astrophysics Data System (ADS)

    Peng, J. F.; Hu, M.; Wang, Z. B.; Huang, X. F.; Kumar, P.; Wu, Z. J.; Yue, D. L.; Guo, S.; Shang, D. J.; Zheng, Z.; He, L. Y.

    2014-06-01

    Understanding the particle number size distributions in diversified atmospheric environments is important in order to design mitigation strategies related to submicron particles and their effect on regional air quality, haze and human health. In this study, we conducted 15 different field measurement campaigns, each one-month long, between 2007 and 2011 at 13 individual sites in China. These were 5 urban sites, 4 regional sites, 3 coastal/background sites and one ship cruise measurement along eastern coastline of China. Size resolved particles were measured in the 15-600 nm size range. The median particle number concentrations (PNC) were found to vary in the range of 1.1-2.2 × 104 cm-3 at urban sites, 0.8-1.5 × 104 cm-3 at regional sites, 0.4-0.6 × 104 cm-3 at coastal/background sites, and 0.5 × 104 cm-3 during cruise measurements. Peak diameters at each of these sites varied greatly from 24 nm to 115 nm. Particles in the 15-25 nm (nucleation mode), 25-100 nm (Aitken mode) and 100-600 nm (accumulation mode) range showed different characteristics at each of the studied sites, indicating the features of primary emissions and secondary formation in these diversified atmospheric environments. Diurnal variations show a build-up of accumulation mode particles belt at regional sites, suggesting the contribution of regional secondary aerosol pollution. Frequencies of new particle formation (NPF) events were much higher at urban and regional sites than at coastal sites and cruise measurement. The average growth rates (GRs) of nucleation mode particles were 8.0-10.9 nm h-1 at urban sites, 7.4-13.6 nm h-1 at regional sites and 2.8-7.5 nm h-1 at both coastal and cruise measurement sites. The high gaseous precursors and strong oxidation at urban and regional sites not only favored the formation of particles, but also accelerated the growth rate of the nucleation mode particles. No significant difference in condensation sink (CS) during NPF days were observed among different

  6. Numerical studies of gas composition differentiation during gas hydrate formation: An application to the IODP site 1327

    NASA Astrophysics Data System (ADS)

    Yuncheng, C.; Chen, D.

    2014-12-01

    Structure I methane hydrate is the most common type found in nature. Structure I gas hydrate has two types of cages that gas molecules may be hosted. Because the larger cavities filled with ethane would be more stable than those filled by methane (Sloan and Koh, 2008), the larger cavities preferentially enclose ethane during the formation of gas hydrate, which results gas composition differentiation during gas hydrate formation. Based on the principle of gas composition differentiation, we establish a numerical model for the gas composition differentiation between methane and ethane during gas hydrate accumulation and applied the model to IODP site 1327. The simulation shows that the gas composition differentiation only occurs at the interval where gas hydrate presents. The lowest methane/ethane (C1/C2) point indicates the bottom of hydrate zone, and the composition differentiation produces the upward increase of C1/C2 within the gas hydrate zone. The C1/C2 reaches the largest value at the top occurrence of gas hydrate and keeps relative stable above the top occurrence of gas hydrate. The top and bottom occurrence of gas hydrate indicated by the inflection points of the C1/C2 profile are similar to those indicated by the negative anomalies of measured chloride concentrations (Riedel et al., 2006). By comparing with the measured C1/C2, the differentiation coefficient (kh=Xe,h/Xe,w, Xe,h is C1/C2 of the formed gas hydrate, Xe,w [mol/kg] is the concentration of ethane in water ) is calculated to 70 kg/mol. The top occurrence of gas hydrate indicated by the C1/C2 profile also confines the water flux to be 0.4kg/m2-year, similar to that confined by the chloride profile. To best fit the measured C1/C2 profile, the methane flux is calculated to 0.04mol/m2-year. Therefore, the C1/C2 profile could be used to obtain the gas hydrate accumulation information. Acknowledgments:This study was supported by Chinese National Science Foundation (grant 41303044, 91228206 ) References

  7. The Molybdenum Active Site of Formate Dehydrogenase Is Capable of Catalyzing C-H Bond Cleavage and Oxygen Atom Transfer Reactions.

    PubMed

    Hartmann, Tobias; Schrapers, Peer; Utesch, Tillmann; Nimtz, Manfred; Rippers, Yvonne; Dau, Holger; Mroginski, Maria Andrea; Haumann, Michael; Leimkühler, Silke

    2016-04-26

    Formate dehydrogenases (FDHs) are capable of performing the reversible oxidation of formate and are enzymes of great interest for fuel cell applications and for the production of reduced carbon compounds as energy sources from CO2. Metal-containing FDHs in general contain a highly conserved active site, comprising a molybdenum (or tungsten) center coordinated by two molybdopterin guanine dinucleotide molecules, a sulfido and a (seleno-)cysteine ligand, in addition to a histidine and arginine residue in the second coordination sphere. So far, the role of these amino acids in catalysis has not been studied in detail, because of the lack of suitable expression systems and the lability or oxygen sensitivity of the enzymes. Here, the roles of these active site residues is revealed using the Mo-containing FDH from Rhodobacter capsulatus. Our results show that the cysteine ligand at the Mo ion is displaced by the formate substrate during the reaction, the arginine has a direct role in substrate binding and stabilization, and the histidine elevates the pKa of the active site cysteine. We further found that in addition to reversible formate oxidation, the enzyme is further capable of reducing nitrate to nitrite. We propose a mechanistic scheme that combines both functionalities and provides important insights into the distinct mechanisms of C-H bond cleavage and oxygen atom transfer catalyzed by formate dehydrogenase. PMID:27054466

  8. Interpretation of brine-permeability tests of the Salado Formation at the Waste Isolation Pilot Plant site: First interim report

    SciTech Connect

    Beauheim, R.L. ); Saulnier, G.J. Jr.; Avis, J.D. )

    1991-08-01

    Pressure-pulse tests have been performed in bedded evaporites of the Salado Formation at the Waste Isolation Pilot Plant (WIPP) site to evaluate the hydraulic properties controlling brine flow through the Salado. Hydraulic conductivities ranging from about 10{sup {minus}14} to 10{sup {minus}11} m/s (permeabilities of about 10{sup {minus}21} to 10{sup {minus}18} m{sup 2}) have been interpreted from nine tests conducted on five stratigraphic intervals within eleven meters of the WIPP underground excavations. Tests of a pure halite layer showed no measurable permeability. Pore pressures in the stratigraphic intervals range from about 0.5 to 9.3 MPa. An anhydrite interbed (Marker Bed 139) appears to be one or more orders of magnitude more permeable than the surrounding halite. Hydraulic conductivities appear to increase, and pore pressures decrease, with increasing proximity to the excavations. These effects are particularly evident within two to three meters of the excavations. Two tests indicated the presence of apparent zero-flow boundaries about two to three meters from the boreholes. The other tests revealed no apparent boundaries within the radii of influence of the tests, which were calculated to range from about four to thirty-five meters from the test holes. The data are insufficient to determine if brine flow through evaporites results from Darcy-like flow driven by pressure gradients within naturally interconnected porosity or from shear deformation around excavations connecting previously isolated pores, thereby providing pathways for fluids at or near lithostatic pressure to be driven towards the low-pressure excavations. Future testing will be performed at greater distances from the excavations to evaluate hydraulic properties and processes beyond the range of excavation effects.

  9. Evidence for sites of methylmercury formation in a flowing water system: impact of anthropogenic barriers and water management.

    PubMed

    Pizarro-Barraza, Claudia; Gustin, Mae Sexauer; Peacock, Mary; Miller, Matthieu

    2014-04-15

    The Truckee River, California-Nevada, USA is impacted by mercury (Hg) contamination associated with legacy gold mining. In this work, we investigated the potential for hot-spots of methylmercury (MeHg) formation in the river. Mercury concentrations in multiple media were also used to assess the impacts of anthropogenic barriers, restoration, and water management in this flowing water ecosystem. Water samples were collected on a seasonal time step over 3 years, and analyzed for total Hg (THg) and MeHg concentrations, along with a variety of other water quality parameters. In addition, we measured THg and MeHg in sediments, THg in macroinvertebrates, and THg and δ(15)N and δ(13)C concentrations in fish. Differences in stable isotopes and Hg concentrations in fish were applied to understand the mobility of fish in the river. Mercury concentrations of specific macroinvertebrate species were used to identify sites of MeHg production. In general, loads of Hg and nutrients in the river reach above the Reno-Sparks metropolitan area were similar to that reported for pristine systems, while within and below the city, water quality impacts were observed. Fish isotope data showed that in the city reach food resources were different than those upriver and downriver. Based on Hg and isotope data, mobility of the fish in the river is impacted by anthropogenic obstructions and water manipulation. Below the city, particle bound Hg, derived from the legacy mining, continues to be input to the Truckee River. This Hg is deposited in riparian habitats and areas of river restoration, where it is methylated and becomes available to biota. During spring, when flows were highest, MeHg produced and stored in the sediments is mobilized and transported downriver. Fish and macroinvertebrate concentrations increased downriver indicating passive uptake from water. The information presented here could be useful for those doing river restoration and water manipulation in mercury contaminated

  10. Computational study on the roles of amino acid residues in the active site formation mechanism of blue-light photoreceptors

    NASA Astrophysics Data System (ADS)

    Sato, Ryuma; Kitoh-Nishioka, Hirotaka; Ando, Koji; Yamato, Takahisa

    2015-07-01

    To examine the functional roles of the active site methionine (M-site) and glutamic acid (E-site) residues of blue-light photoreceptors, we performed in silico mutation at the M-site in a systematic manner and focused on the hydrogen bonding between the E-site and the substrate: the cyclobutane-pyrimidine dimer (CPD). Fragment molecular orbital calculations with electron correlations demonstrated that substitution of the M-site methionine with either alanine or glutamine always destabilizes the interaction energy between the E-site and the CPD by more than 12.0 kcal/mol, indicating that the methionine and glutamic acid residues cooperatively facilitate the enzymatic reaction in the active site.

  11. The Strength of an Ig Switch Region is Determined by its Ability to Drive R-loop Formation and its Number of WGCW Sites

    PubMed Central

    Zhang, Zheng Z.; Pannunzio, Nicholas R.; Han, Li; Hsieh, Chih-Lin; Yu, Kefei; Lieber, Michael R.

    2014-01-01

    SUMMARY R-loops exist at the murine IgH switch regions and possibly other locations, but their functional importance is unclear. In biochemical systems, R-loop initiation requires DNA sequence regions containing clusters of G nucleotides, but cellular studies have not been done. Here, we vary the G-clustering, total switch region length, and the number of target sites (WGCW sites for the activation-induced deaminase) at synthetic switch regions in a murine B cell line to determine the effect on class switch recombination (CSR). G-clusters increase CSR, regardless of their immediate proximity to the WGCW sites. This increase is accompanied by an increase in R-loop formation. CSR efficiency correlates better with the absolute number of WGCW sites in the switch region rather than the total switch region length or density of WGCW sites. Thus, the overall strength of the switch region depends on G-clusters, which initiate R-loop formation, and on the number of WGCW sites. PMID:25017067

  12. Post burial alteration of the Permian Rustler Formation Evaporites, WIPP (Waste Isolation Pilot Plant) site, New Mexico: Textural, stratigraphic and chemical evidence

    SciTech Connect

    Lowenstein, T.K.

    1987-04-01

    The Rustler Formation is a Late Permian (Ochoan Series) evaporite found in the subsurface and in outcrop in New Mexico and west Texas. The main rock types of the Rustler Formation are anhydrite, gypsum, halite, dolostone and siliciclastic sandstone and mudstone. Across the WIPP site, located in southeastern New Mexico, some of the Rustler rock types and their thicknesses change dramatically over short lateral distances. These lateral variations have mainly been attributed to post-burial dissolution of evaporites. The aim of the present study is to distinguish syndepositional features from post burial alteration features in the Rustler Formation. Four borehole cores of the complete Rustler Formation were examined. Primary sedimentary structures, textures and fabrics were identified, based on comparison with modern evaporite deposits. Vertical and lateral patterns of primary sedimentary features were recorded. From this information, depositional settings have been assembled which best account for the observed types of primary features and their vertical and lateral distribution. With this framework, post-depositional diagenetic overprints were identified in the Rustler Formation. The question of whether subsurface diagenetic alteration is presently active at the WIPP site is addressed.

  13. Directing Group in Decarboxylative Cross-Coupling: Copper-Catalyzed Site-Selective C-N Bond Formation from Nonactivated Aliphatic Carboxylic Acids.

    PubMed

    Liu, Zhao-Jing; Lu, Xi; Wang, Guan; Li, Lei; Jiang, Wei-Tao; Wang, Yu-Dong; Xiao, Bin; Fu, Yao

    2016-08-01

    Copper-catalyzed directed decarboxylative amination of nonactivated aliphatic carboxylic acids is described. This intramolecular C-N bond formation reaction provides efficient access to the synthesis of pyrrolidine and piperidine derivatives as well as the modification of complex natural products. Moreover, this reaction presents excellent site-selectivity in the C-N bond formation step through the use of directing group. Our work can be considered as a big step toward controllable radical decarboxylative carbon-heteroatom cross-coupling. PMID:27439145

  14. Target-controlled formation of silver nanoclusters in abasic site-incorporated duplex DNA for label-free fluorescence detection of theophylline

    NASA Astrophysics Data System (ADS)

    Park, Ki Soo; Oh, Seung Soo; Soh, H. Tom; Park, Hyun Gyu

    2014-08-01

    A novel, label-free, fluorescence based sensor for theophylline has been developed. In the new sensor system, an abasic site-incorporated duplex DNA probe serves as both a pocket for recognition of theophylline and a template for the preparation of fluorescent silver nanoclusters. The strategy relies on theophylline-controlled formation of fluorescent silver nanoclusters from abasic site-incorporated duplex DNA. When theophylline is not present, silver ions interact with the cytosine groups opposite to the abasic site in duplex DNA. This interaction leads to efficient formation of intensely red fluorescent silver nanoclusters. In contrast, when theophylline is bound at the abasic site through pseudo base-pairing with appropriately positioned cytosines, silver ion binding to the cytosine nucleobase is prevented. Consequently, fluorescent silver nanoclusters are not formed causing a significant reduction of the fluorescence signal. By employing this new sensor, theophylline can be highly selectively detected at a concentration as low as 1.8 μM. Finally, the diagnostic capability and practical application of this sensor were demonstrated by its use in detecting theophylline in human blood serum.A novel, label-free, fluorescence based sensor for theophylline has been developed. In the new sensor system, an abasic site-incorporated duplex DNA probe serves as both a pocket for recognition of theophylline and a template for the preparation of fluorescent silver nanoclusters. The strategy relies on theophylline-controlled formation of fluorescent silver nanoclusters from abasic site-incorporated duplex DNA. When theophylline is not present, silver ions interact with the cytosine groups opposite to the abasic site in duplex DNA. This interaction leads to efficient formation of intensely red fluorescent silver nanoclusters. In contrast, when theophylline is bound at the abasic site through pseudo base-pairing with appropriately positioned cytosines, silver ion binding to

  15. [[superscript 3]H]-Flunitrazepam-Labeled Benzodiazepine Binding Sites in the Hippocampal Formation in Autism: A Multiple Concentration Autoradiographic Study

    ERIC Educational Resources Information Center

    Guptill, Jeffrey T.; Booker, Anne B.; Gibbs, Terrell T.; Kemper, Thomas L.; Bauman, Margaret L.; Blatt, Gene J.

    2007-01-01

    Increasing evidence indicates that the GABAergic system in cerebellar and limbic structures is affected in autism. We extended our previous study that found reduced [[superscript 3]H] flunitrazepam-labeled benzodiazepine sites in the autistic hippocampus to determine whether this reduction was due to a decrease in binding site number (B [subscript…

  16. Mechanism of dehydroxylation of naturally occurring high-silica zeolites involving the formation of Lewis acid sites

    SciTech Connect

    Kazanskii, V.B.

    1987-11-01

    Using low-temperature adsorbed dihydrogen and carbon monoxide as molecular probes, the dehydroxylation of the hydrogen forms of the zeolites Y, and ZSM-5 has been studied. The high stability of the high-silica zeolites to dealumination and their difference from faujasites has been established as being due not only to the strength of their Broensted acid sites but also to the nature of their Lewis acid sites. The chemical properties of the Lewis acid sites and their possible role in catalytic reactions are discussed.

  17. (-)-Rhazinilam and the diphenylpyridazinone NSC 613241: Two compounds inducing the formation of morphologically similar tubulin spirals but binding apparently to two distinct sites on tubulin.

    PubMed

    Bai, Ruoli; Hamel, Ernest

    2016-08-15

    The most potent microtubule assembly inhibitor of newer diphenylpyridazinone derivatives examined was NSC 613241. Because NSC 613241 and (-)-rhazinilam also induce the formation of similar 2-filament spirals, these aberrant reactions were compared. Spiral formation with both compounds was enhanced by GTP and inhibited by GDP and by 15 other inhibitors of microtubule assembly. Similarly, microtubule assembly induced by paclitaxel or laulimalide is enhanced by GTP and inhibited by GDP and assembly inhibitors, but neither [(3)H]NSC 613241 nor [(3)H](-)-rhazinilam bound to microtubules or inhibited the binding of [(3)H]paclitaxel or [(3)H]peloruside A to microtubules. Differences in the pitch of aberrant polymers were found: NSC 613241-induced and (-)-rhazinilam-induced spirals had average repeats of 85 and 79-80 nm, respectively. We found no binding of [(3)H]NSC 613241 or [(3)H](-)-rhazinilam to αβ-tubulin dimer, but both compounds were incorporated into the polymers they induced in substoichiometric reactions, with as little as 0.1-0.2 mol compound/mol of tubulin, and no cross-inhibition by NSC 613241 or (-)-rhazinilam into spirals occurred. Under reaction conditions where neither compound induced spiral formation, both compounds together synergistically induced substantial spiral formation. We conclude that (-)-rhazinilam and NSC 613241 bind to different sites on tubulin that differ from binding sites for other antitubulin agents. PMID:27311615

  18. Exploration of the 1891 Foerstner submarine vent site (Pantelleria, Italy): insights into the formation of basaltic balloons

    NASA Astrophysics Data System (ADS)

    Kelly, Joshua T.; Carey, Steven; Pistolesi, Marco; Rosi, Mauro; Croff-Bell, Katherine Lynn; Roman, Chris; Marani, Michael

    2014-07-01

    On October 17, 1891, a submarine eruption started at Foerstner volcano located within the Pantelleria Rift of the Strait of Sicily (Italy). Activity occurred for a period of 1 week from an eruptive vent located 4 km northwest of the island of Pantelleria at a water depth of 250 m. The eruption produced lava balloons that discharged gas at the surface and eventually sank to the seafloor. Remotely operated vehicle (ROV) video footage and high-resolution multi-beam mapping of the Foerstner vent site were used to create a geologic map of the AD 1891 deposits and conduct the first detailed study of the source area associated with this unusual type of submarine volcanism. The main Foerstner vent consists of two overlapping circular mounds with a total volume of 6.3 × 105 m3 and relief of 60 m. It is dominantly constructed of clastic scoriaceous deposits with some interbedded pillow lavas. Petrographic and geochemical analyses of Foerstner samples by X-ray fluorescence and inductively coupled plasma mass spectrometry reveal that the majority of the deposits are vesicular, hypocrystalline basanite scoria that display porphyritic, hyaloophitic, and vitrophyric textures. An intact lava balloon recovered from the seafloor consists of a large interior gas cavity surrounded by a thin lava shell comprising two distinct layers: a thin, oxidized, quenched crust surrounding the exterior of the balloon and a dark gray, tachylite layer lying beneath it. Ostwald ripening is proposed to be the dominant bubble growth mechanism of four representative Foerstner scoria samples as inferred by vesicle size distributions. Characterization of the diversity of deposit facies observed at Foerstner in conjunction with quantitative rock texture analysis indicates that submarine Strombolian-like activity is the most likely mechanism for the formation of lava balloons. The deposit facies observed at the main Foerstner vent are very similar to those produced by other known submarine Strombolian

  19. Geology, coal resources, and chemical analyses of coal from the Fruitland Formation, Kimbeto EMRIA study site, San Juan County, New Mexico

    USGS Publications Warehouse

    Schneider, Gary B.; Hildebrand, Rick T.; Affolter, Ronald H.

    1979-01-01

    The Kimbeto EMRIA study site, an area of about 20 square miles (52 km2), is located on the south margin of the San Juan Basin on the gently northward-dipping strata of the Upper Cretaceous Fruitland Formation and the Kirtland Shale. The coal beds are mainly in the lower 150 feet (45 m) of the Fruitland Format ion. Coal resources--measured, indicated, and inferred--with less than 400 feet (120 m) of overburden in the site are 69,085,000 short tons (62,660,100 metric tons), 369,078,000 short tons (334,754,000 metric tons), and 177,803,000 short tons (161,267,000 metric tons) respectively. About 68 percent of these resources are overlain by 200 feet (60 m) or less of overburden. The apparent rank of the coal ranges from subbituminous B to subbituminous A. The average Btu/lb value of 14 core samples from the site on the as-received basis is 8,240 (4580 Kcal/kg), average ash content is 23.4 percent, and average sulfur content is 0.5 percent. Analyses of coal from the Kimbeto EMRIA study site show significantly higher ash content and significantly lower contents of volatile matter, fixed carbon, carbon, and a significantly lower heat of combustion when compared with other coal analyses from the Rocky Mountain province.

  20. Target-controlled formation of silver nanoclusters in abasic site-incorporated duplex DNA for label-free fluorescence detection of theophylline.

    PubMed

    Park, Ki Soo; Oh, Seung Soo; Soh, H Tom; Park, Hyun Gyu

    2014-09-01

    A novel, label-free, fluorescence based sensor for theophylline has been developed. In the new sensor system, an abasic site-incorporated duplex DNA probe serves as both a pocket for recognition of theophylline and a template for the preparation of fluorescent silver nanoclusters. The strategy relies on theophylline-controlled formation of fluorescent silver nanoclusters from abasic site-incorporated duplex DNA. When theophylline is not present, silver ions interact with the cytosine groups opposite to the abasic site in duplex DNA. This interaction leads to efficient formation of intensely red fluorescent silver nanoclusters. In contrast, when theophylline is bound at the abasic site through pseudo base-pairing with appropriately positioned cytosines, silver ion binding to the cytosine nucleobase is prevented. Consequently, fluorescent silver nanoclusters are not formed causing a significant reduction of the fluorescence signal. By employing this new sensor, theophylline can be highly selectively detected at a concentration as low as 1.8 μM. Finally, the diagnostic capability and practical application of this sensor were demonstrated by its use in detecting theophylline in human blood serum. PMID:24901073

  1. Ionic composition of PM2.5 at urban sites of northern Greece: secondary inorganic aerosol formation.

    PubMed

    Voutsa, D; Samara, C; Manoli, E; Lazarou, D; Tzoumaka, P

    2014-04-01

    This study investigates the water-soluble ionic constituents (Na(+), K(+), NH4 (+), Ca(2+), Mg(2+), Cl(-), NO3 (-), SO4 (2-)) associated to PM2.5 particle fraction at two urban sites in the city of Thessaloniki, northern Greece, an urban traffic site (UT) and urban background site (UB). Ionic constituents represent a significant fraction of PM2.5 mass (29.6 at UT and 41.5 % at UB). The contribution of marine aerosol was low (<1.5 %). Secondary inorganic aerosols (SIA) represent a significant fraction of PM2.5 mass contributing to 26.9 ± 12.4 % and 39.2 ± 13.2 % at UT and UB sites, respectively. Nitrate and sulfate are fully neutralized by ammonium under the existing conditions. The ionic constituents were evaluated in relation to their spatial and temporal variation, their gaseous precursors, meteorological conditions, local and long-range transport. PMID:24363054

  2. NMR structure of the A730 loop of the Neurospora VS ribozyme: insights into the formation of the active site

    PubMed Central

    Bonneau, Eric; Girard, Nicolas; Boisbouvier, Jérôme; Legault, Pascale

    2011-01-01

    The Neurospora VS ribozyme is a small nucleolytic ribozyme with unique primary, secondary and global tertiary structures, which displays mechanistic similarities to the hairpin ribozyme. Here, we determined the high-resolution NMR structure of a stem–loop VI fragment containing the A730 internal loop, which forms part of the active site. In the presence of magnesium ions, the A730 loop adopts a structure that is consistent with existing biochemical data and most likely reflects its conformation in the VS ribozyme prior to docking with the cleavage site internal loop. Interestingly, the A730 loop adopts an S-turn motif that is also present in loop B within the hairpin ribozyme active site. The S-turn appears necessary to expose the Watson–Crick edge of a catalytically important residue (A756) so that it can fulfill its role in catalysis. The A730 loop and the cleavage site loop of the VS ribozyme display structural similarities to internal loops found in the active site of the hairpin ribozyme. These similarities provided a rationale to build a model of the VS ribozyme active site based on the crystal structure of the hairpin ribozyme. PMID:21266483

  3. Enterococcus faecalis from Food, Clinical Specimens, and Oral Sites: Prevalence of Virulence Factors in Association with Biofilm Formation

    PubMed Central

    Anderson, Annette C.; Jonas, Daniel; Huber, Ingrid; Karygianni, Lamprini; Wölber, Johan; Hellwig, Elmar; Arweiler, Nicole; Vach, Kirstin; Wittmer, Annette; Al-Ahmad, Ali

    2016-01-01

    Enterococci have gained significance as the cause of nosocomial infections; they occur as food contaminants and have also been linked to dental diseases. E. faecalis has a great potential to spread virulence as well as antibiotic resistance genes via horizontal gene transfer. The integration of food-borne enterococci into the oral biofilm in-vivo has been observed. Therefore, we investigated the virulence determinants and antibiotic resistance of 97 E. faecalis isolates from the oral cavity, food, and clinical specimens. In addition, phenotypic expression of gelatinase and cytolysin were tested, in-vitro biofilm formation was quantified and isolates were compared for strain relatedness via pulsed field gel electrophoresis (PFGE). Each isolate was found to possess two or more virulence genes, most frequently gelE, efaA, and asa1. Notably, plaque/saliva isolates possessed the highest abundance of virulence genes, the highest levels of phenotypic gelatinase and hemolysin activity and concurrently a high ability to form biofilm. The presence of asa1 was associated with biofilm formation. The biofilm formation capacity of clinical and plaque/saliva isolates was considerably higher than that of food isolates and they also showed similar antibiotic resistance patterns. These results indicate that the oral cavity can constitute a reservoir for virulent E. faecalis strains possessing antibiotic resistance traits and at the same time distinct biofilm formation capabilities facilitating exchange of genetic material. PMID:26793174

  4. Dimer-dimer interaction of the bacterial selenocysteine synthase SelA promotes functional active-site formation and catalytic specificity.

    PubMed

    Itoh, Yuzuru; Bröcker, Markus J; Sekine, Shun-ichi; Söll, Dieter; Yokoyama, Shigeyuki

    2014-04-17

    The 21st amino acid, selenocysteine (Sec), is incorporated translationally into proteins and is synthesized on its specific tRNA (tRNA(Sec)). In Bacteria, the selenocysteine synthase SelA converts Ser-tRNA(Sec), formed by seryl-tRNA synthetase, to Sec-tRNA(Sec). SelA, a member of the fold-type-I pyridoxal 5'-phosphate-dependent enzyme superfamily, has an exceptional homodecameric quaternary structure with a molecular mass of about 500kDa. Our previously determined crystal structures of Aquifex aeolicus SelA complexed with tRNA(Sec) revealed that the ring-shaped decamer is composed of pentamerized SelA dimers, with two SelA dimers arranged to collaboratively interact with one Ser-tRNA(Sec). The SelA catalytic site is close to the dimer-dimer interface, but the significance of the dimer pentamerization in the catalytic site formation remained elusive. In the present study, we examined the quaternary interactions and demonstrated their importance for SelA activity by systematic mutagenesis. Furthermore, we determined the crystal structures of "depentamerized" SelA variants with mutations at the dimer-dimer interface that prevent pentamerization. These dimeric SelA variants formed a distorted and inactivated catalytic site and confirmed that the pentamer interactions are essential for productive catalytic site formation. Intriguingly, the conformation of the non-functional active site of dimeric SelA shares structural features with other fold-type-I pyridoxal 5'-phosphate-dependent enzymes with native dimer or tetramer (dimer-of-dimers) quaternary structures. PMID:24456689

  5. New considerations on the stratigraphy and environmental context of the oldest (2.34 Ma) Lokalalei archaeological site complex of the Nachukui Formation, West Turkana, northern Kenya Rift

    NASA Astrophysics Data System (ADS)

    Tiercelin, Jean-Jacques; Schuster, Mathieu; Roche, Hélène; Brugal, Jean-Philippe; Thuo, Peter; Prat, Sandrine; Harmand, Sonia; Davtian, Gourguen; Barrat, Jean-Alix; Bohn, Marcel

    2010-09-01

    At the northwest end of the Lake Turkana Basin (northern Kenya Rift), intensive fieldwork conducted on the Plio-Pleistocene fluvio-lacustrine Nachukui Formation by the National Museums of Kenya and the West Turkana Archaeological Project (WTAP), led to the discovery of more than 50 archaeological sites aged between 2.4 and 0.7 Ma. Among them is the Lokalalei archaeological site complex, which includes the two oldest archaeological sites (2.34 Ma) found in the Kenyan segment of the East African Rift System. The environmental background of the two sites was described as a succession of ephemeral streams with floodplain palaeosols in which the archaeological sites are situated, bordering the western bank of a large axial meandering river flowing southward. The Lokalalei 1 (LA1) and Lokalalei 2C (LA2C) archaeological sites are of extreme importance in terms of knowledge of hominins' knapping activities. The stratigraphic position of the LA1 and LA2C sites as well as implications on the technical differences between the two sites have been successively discussed by Roche et al. (1999), Brown and Gathogo (2002), and Delagnes and Roche (2005). In terms of stratigraphic position, Lokalalei 2C was estimated to be slightly higher in the section (i.e. younger) than Lokalalei 1. An alternative stratigraphic correlation was proposed by Brown and Gathogo (2002), who suggested that LA2C site should have been approximately 100,000 years younger than LA1. New considerations on the stratigraphy and environmental context of the Lokalalei sites have been developed following controversy on the stratigraphic position and time interval between the LA1 and LA2C sites. High-resolution lithostratigraphic work based on bed-to-bed field correlations, facies sedimentology and tephra geochemistry confirms that the LA2C site is slightly higher in the section than the LA1 site by about 11.20 m. This represents a time interval of ˜74,000 years based on an assumed sedimentation rate of 152 mm

  6. Genetic incorporation of 1,2-aminothiol functionality for site-specific protein modification via thiazolidine formation.

    PubMed

    Bi, Xiaobao; Pasunooti, Kalyan Kumar; Tareq, Ahmad Hussen; Takyi-Williams, John; Liu, Chuan-Fa

    2016-06-21

    Here we report a new site-specific conjugation strategy to modify proteins via thiazolidine ligation. Proteins harbouring a 1,2-aminothiol moiety introduced by amber codon suppression technology could be modified chemoselectively with aldehyde-functionalized reagents, such as a biotin-labeled peptide or ubiquitin, under mild conditions to yield homogeneous biotinylated or ubiquitinated products. PMID:27198059

  7. Site-selective multi-porphyrin attachment enables the formation of a next-generation antibody-based photodynamic therapeutic.

    PubMed

    Maruani, Antoine; Savoie, Huguette; Bryden, Francesca; Caddick, Stephen; Boyle, Ross; Chudasama, Vijay

    2015-10-25

    Herein we present a significant step towards next-generation antibody-based photodynamic therapeutics. Site-selective modification of a clinically relevant monoclonal antibody, with a serum-stable linker bearing a strained alkyne, allows for the controlled Cu-free "click" assembly of an in vitro active antibody-based PDT agent using a water soluble azide porpyhrin. PMID:26340593

  8. "Dreams Are Born on Places Like This": The Process of Interpretive Community Formation at the "Field of Dreams" Site.

    ERIC Educational Resources Information Center

    Aden, Roger C.; And Others

    1995-01-01

    Analyzes the narratives of 113 visitors to the site of the film "Field of Dreams." Develops a theory that explains how interpretive communities are formed despite theoretical writings that argue for individualized interpretations of text. Demonstrates that individuals can at once converge and diverge symbolically within the confines of an…

  9. Co-doping of (Bi0.5Na0.5)TiO3: secondary phase formation and lattice site preference of Co

    NASA Astrophysics Data System (ADS)

    Schmitt, V.; Staab, T. E. M.

    2012-11-01

    Bismuth sodium titanate (Bi0.5Na0.5)TiO3 (BNT) is considered to be one of the most promising lead-free alternatives to piezoelectric lead zirconate titanate (PZT). However, the effect of dopants on the material has so far received little attention from an atomic point of view. In this study we investigated the effects of cobalt-doping on the formation of additional phases and determined the preferred lattice site of cobalt in BNT. The latter was achieved by comparing the measured x-ray absorption near-edge structure (XANES) spectra to numerically calculated spectra of cobalt on various lattice sites in BNT. (Bi0.5Na0.5)TiO3 + x mol% Co (x = 0.0, 0.5, 1.0, 2.6) was synthesized via solid state reaction. As revealed by SEM backscattering images, a secondary phase formed in all doped specimens. Using both XRD and SEM-EDX, it was identified as Co2TiO4 for dopant levels >0.5 mol%. In addition, a certain amount of cobalt was incorporated into BNT, as shown by electron probe microanalysis. This amount increased with increasing dopant levels, suggesting that an equilibrium forms together with the secondary phase. The XANES experiments revealed that cobalt occupies the octahedral B-site in the BNT perovskite lattice, substituting Ti and promoting the formation of oxygen vacancies in the material.

  10. On site measurements of the redox and carbonate system parameters in the low-permeability Opalinus Clay formation at the Mont Terri Rock Laboratory

    NASA Astrophysics Data System (ADS)

    Fernández, A. M. a.; Turrero, M. J.; Sánchez, D. M.; Yllera, A.; Melón, A. M.; Sánchez, M.; Peña, J.; Garralón, A.; Rivas, P.; Bossart, P.; Hernán, P.

    An in situ water sampling experiment was performed in the Opalinus Clay formation (Switzerland), with the aim of obtaining undisturbed pore water samples for its characterization. The study was made from a dedicated borehole, named BDI-B1, drilled in March 2002 in the DI niche of the Mont Terri Rock Laboratory, located at the north-western part of the formation, a few meters away of the underlying Jurensis Marl formation. Five water sampling campaigns have been completed, and on site measurements of the key parameters of the water, such as pH, Eh, Fe(II), S 2- and alkalinity, were performed under controlled conditions inside an anoxic glove box. The chemical composition of the seepage waters obtained from the borehole is Na-Cl type, with an ionic strength of about 0.4 M. The Cl concentrations fit the concentration profile of the Opalinus Clay pore water obtained in previous experiments from boreholes and squeezed water samples. The highest salinity is found in this zone of the Opalinus Clay, with around 12 g/L of chloride. A perturbation of the rock system was produced during the first stages of the experiment due to a packer failure. As a consequence, the borehole was exposed to air during the first phase of the experiment. The main perturbations induced were: (1) pyrite oxidation that caused an increase of sulphate, calcium, magnesium and bicarbonate content in the waters; and (2) the inflow of 3H-bearing water vapour that could penetrate the EDZ. This fresh water infiltration could have mixed with the original formation water, and tritium contents of up to 3.8 TU were measured in the first water sampling campaigns. Nevertheless, after some time the hydrogeochemical conditions of the formation were recovered, and the long-term instrumentation and monitoring of the borehole made possible to obtain different parameters of the formation. Successive water sampling campaigns show a tendency to the stabilization of the main parameters of the water, such as sulphate and

  11. Pre-injection Comparison of Methods for Sampling Formation Water and Associated Gas from a Monitoring Well at a Carbon Dioxide Injection Site, Citronelle Oil Field, Alabama

    NASA Astrophysics Data System (ADS)

    Conaway, C.; Thordsen, J. J.; Manning, M. A.; Cook, P. J.; Abedini, A. A.; Trautz, R. C.; Thomas, B.; Kharaka, Y. K.

    2012-12-01

    The chemical composition of formation water and associated gases from the lower Cretaceous Paluxy Formation was determined using four different sampling methods at a well in the Citronelle Oil Field, Alabama, a site that will be used for a carbon dioxide injection experiment. Prior to each of the two sampling periods, the well was cleaned from the drilling fluids and KCl solutions by producing at least three pore volumes of formation water. Accurate measurements of the chemical composition of groundwater or formation water, including dissolved gasses, and gas samples is essential in understanding subsurface geochemical processes occurring as a result of geologic carbon dioxide injection, which is used for enhanced oil recovery (EOR) and has been proposed as a means of carbon sequestration. In this study, formation water and gas samples for geochemical analyses were obtained from well D-9-8 #2 at Citronelle using nitrogen lift, submersible pump, U-Tube, and a downhole (Kuster) sampler. Field chemical analyses included electrical conductivity, hydrogen sulfide, alkalinity, and pH, and laboratory analyses included major, minor and trace elements by mass spectrometry and ion chromatography, dissolved carbon, organic acid anions, free and dissolved gas species. The formation water obtained from this well is a Na-Ca-Cl brine with a salinity of 160,000 and 200,000 mg/L total dissolved solids (TDS). Differences were evident between sampling methodologies, particularly in pH, Fe and alkalinity measurements. The results of the comparison demonstrate the difficulty and importance of preserving volatile analytes in samples, with the downhole sampler and U-Tube system performing most favorably in this aspect.

  12. Formation temperatures of clays from the volcaniclastic series of Site 841 ODP: an oxygen isotopic record of a paleothermal flux into the Tonga forearc

    NASA Astrophysics Data System (ADS)

    Vitali, Frédéric; Blanc, Gérard; Gauthier-Lafaye, François; France-Lanord, Christian

    Oxygen isotopic compositions of clay minerals were determined on representative samples of the volcano-sedimentary series from Site 841 ODP (Tonga forearc). This isotopic study has demonstrated an abnormally high crystallisation temperature of the clay minerals with respect to temperature expected in burial diagenesis. Formation temperatures obtained using 18O reach up to 200°C in a Fe-chlorite-corrensite paragenesis found in the vicinity of basaltic andesite sills intruded into the Miocene tuffs. The paleothermal flux resulting from the cooling of the sills has produced very low grade contact metamorphism in the Miocene Tonga forearc deposits. The consequence of this was the formation of a large amount of hydrous silicates characterised near the sills by a Fe-clays-analcime mineralogical association.

  13. CO-0.30-0.07: A Candidate Site of Collision-induced Massive Star Formation in the Milky Way's Central Molecular Zone

    NASA Astrophysics Data System (ADS)

    Tanaka, K.

    2016-05-01

    Cloud-cloud collision has long been claimed to be an efficient trigger of massive star formation. We present interferometric maps of a candidate site of collision-triggered star formation newly discovered at 40 pc projected distance from the Galactic center. The cloud CO- 0.3 has an extremely broad molecular line emission of a 140 km s-1 velocity width despite of absence of any known energy sources nearby and inside the cloud. Recent observations with the Atacama Large Millimeter and Submillimeter Array have unveiled that the cloud is comprised by two distinctive velocity components which appear to contact at a thin, well-defined interface layer on the plane-of-the-sky, suggesting that the extremely broad emissions originate from shocked regions created by cloud-cloud collision.

  14. Real-time formation evaluation using a well-site data management system to integrate MWD, surface measurements, and enhanced mud logging data

    SciTech Connect

    Whittaker, A.; Brooks, A.; Dowsett, R.; MacPherson, J.; Nigh, E.

    1986-04-01

    With the advent of measurement while drilling (MWD), a new source of quantitative data became available during the drilling process. The availability of wireline log-type data while drilling has led to a need that traditional mud-logging methods be augmented and enhanced to provide more quantitative correlative data sources and benchmark standards for the lithologic normalization of MWD data. Together these data can be integrated within a single well-site data base to provide effective formation evaluation while the drilling process continues. The data base may be so structured that later available data, such as wireline logs, may be input to provide confirmation and refinement of real-time evaluations. Similarly, the data base may be primed with geophysical and geological pronoses prior to drilling. Case histories show the effective real-time determination of true total and effective porosities, fluid saturations, and estimates of formation characteristics, such as mineralogy and permeability. In each example, when departures between early and late data sets occur (e.g., wireline logs or formation tests), the data variation results from changes in downhole conditions, and the data can be used to enhance formation evaluation by adding a dynamic component.

  15. Covalent Adduct Formation between the Antihypertensive Drug Hydralazine and Abasic Sites in Double- and Single-Stranded DNA

    PubMed Central

    2015-01-01

    Hydralazine (4) is an antihypertensive agent that displays both mutagenic and epigenetic properties. Here, gel electrophoretic, mass spectroscopic, and chemical kinetics methods were used to provide evidence that medicinally relevant concentrations of 4 rapidly form covalent adducts with abasic sites in double- and single-stranded DNA under physiological conditions. These findings raise the intriguing possibility that the genotoxic properties of this clinically used drug arise via reactions with an endogenous DNA lesion rather than with the canonical structure of DNA. PMID:25405892

  16. Modeling the yield of double-strand breaks due to formation of multiply damaged sites in irradiated plasmid DNA

    SciTech Connect

    Xapsos, M.A.; Pogozelski, W.K.

    1996-12-01

    Although double-strand breaks have long been recognized as an important type of DNa lesion, it is well established that this broad class of damage does not correlate well with indicators of the effectiveness of radiation as the cellular level. Assays of double-strand breaks do not distinguish the degree of complexity or clustering of singly damaged sites produced in a single energy deposition event, which is currently hypothesized to be key to understanding cellular end points. As a step toward this understanding, double-strand breaks that are formed proportionally to dose in plasmid DNA are analyzed from the mechanistic aspect to evaluate the yield that arises from multiply damaged sites as hypothesized by Ward (Prog. Nucleic Acid Res. Mol. Biol. 35, 95-125, 1988) and Goodhead (Int. J. Radiat. Biol. 65, 7-17, 1994) as opposed to the yield that arises form single hydroxyl radicals as hypothesized by Siddiqi and Bothe (Radiat. Res. 112, 449-463, 1987). For low-LET radiation such as {gamma} rays, the importance of multiply damaged sites is shown to increase with the solution`s hydroxyl radical scavenging capacity. For moderately high-LET radiation such as 100 keV/{mu}m helium ions, a much different behavior is observed. In this case, a large fraction of double-strand breaks are formed as a result of multiply damaged sties over a broad range of scavenging conditions. Results also indicate that the RBE for common cellular end points correlates more closely with the RBE for common cellular end points correlates more closely with the RBE for multiply damaged sites than with the RBE for total double-strand breaks over a range of LET up to at least 100 keV/{mu}m. 22 refs., 3 figs., 2 tabs.

  17. An active site rearrangement within the Tetrahymena group I ribozyme releases nonproductive interactions and allows formation of catalytic interactions.

    PubMed

    Sengupta, Raghuvir N; Van Schie, Sabine N S; Giambaşu, George; Dai, Qing; Yesselman, Joseph D; York, Darrin; Piccirilli, Joseph A; Herschlag, Daniel

    2016-01-01

    Biological catalysis hinges on the precise structural integrity of an active site that binds and transforms its substrates and meeting this requirement presents a unique challenge for RNA enzymes. Functional RNAs, including ribozymes, fold into their active conformations within rugged energy landscapes that often contain misfolded conformers. Here we uncover and characterize one such "off-pathway" species within an active site after overall folding of the ribozyme is complete. The Tetrahymena group I ribozyme (E) catalyzes cleavage of an oligonucleotide substrate (S) by an exogenous guanosine (G) cofactor. We tested whether specific catalytic interactions with G are present in the preceding E•S•G and E•G ground-state complexes. We monitored interactions with G via the effects of 2'- and 3'-deoxy (-H) and -amino (-NH(2)) substitutions on G binding. These and prior results reveal that G is bound in an inactive configuration within E•G, with the nucleophilic 3'-OH making a nonproductive interaction with an active site metal ion termed MA and with the adjacent 2'-OH making no interaction. Upon S binding, a rearrangement occurs that allows both -OH groups to contact a different active site metal ion, termed M(C), to make what are likely to be their catalytic interactions. The reactive phosphoryl group on S promotes this change, presumably by repositioning the metal ions with respect to G. This conformational transition demonstrates local rearrangements within an otherwise folded RNA, underscoring RNA's difficulty in specifying a unique conformation and highlighting Nature's potential to use local transitions of RNA in complex function. PMID:26567314

  18. Metal-particle-induced, highly localized site-specific etching of Si and formation of single-crystalline Si nanowires in aqueous fluoride solution.

    PubMed

    Peng, Kuiqing; Fang, Hui; Hu, Juejun; Wu, Yin; Zhu, Jing; Yan, Yunjie; Lee, ShuitTong

    2006-10-16

    A straightforward metal-particle-induced, highly localized site-specific corrosion-like mechanism was proposed for the formation of aligned silicon-nanowire arrays on silicon in aqueous HF/AgNO3 solution on the basis of convincing experimental results. The etching process features weak dependence on the doping of the silicon wafers and, thus, provides an efficient method to prepare silicon nanowires with desirable doping characteristics. The novel electrochemical properties between silicon and active noble metals should be useful for preparing novel silicon nanostructures and also new optoelectronic devices. PMID:16871502

  19. Testing short-range migration of microbial methane as a hydrate formation mechanism: Results from Andaman Sea and Kumano Basin drill sites and global implications

    NASA Astrophysics Data System (ADS)

    Malinverno, Alberto; Goldberg, David S.

    2015-07-01

    Methane gas hydrates in marine sediments often concentrate in coarse-grained layers surrounded by fine-grained marine muds that are hydrate-free. Methane in these hydrate deposits is typically microbial, and must have migrated from its source as the coarse-grained sediments contain little or no organic matter. In "long-range" migration, fluid flow through permeable layers transports methane from deeper sources into the gas hydrate stability zone (GHSZ). In "short-range" migration, microbial methane is generated within the GHSZ in fine-grained sediments, where small pore sizes inhibit hydrate formation. Dissolved methane can then diffuse into adjacent sand layers, where pore size does not restrict hydrate formation and hydrates can accumulate. Short-range migration has been used to explain hydrate accumulations in sand layers observed in drill sites on the northern Cascadia margin and in the Gulf of Mexico. Here we test the feasibility of short-range migration in two additional locations, where gas hydrates have been found in coarse-grained volcanic ash layers (Site NGHP-01-17, Andaman Sea, Indian Ocean) and turbidite sand beds (Site IODP-C0002, Kumano forearc basin, Nankai Trough, western Pacific). We apply reaction-transport modeling to calculate dissolved methane concentration and gas hydrate amounts resulting from microbial methane generated within the GHSZ. Model results show that short-range migration of microbial methane can explain the overall amounts of methane hydrate observed at the two sites. Short-range migration has been shown to be feasible in diverse margin environments and is likely to be a widespread methane transport mechanism in gas hydrate systems. It only requires a small amount of organic carbon and sediment sequences consisting of thin coarse-grained layers that can concentrate microbial methane generated within thick fine-grained sediment beds; these conditions are common along continental margins around the globe.

  20. A functional glucocorticoid-responsive unit composed of two overlapping inactive receptor-binding sites: evidence for formation of a receptor tetramer.

    PubMed Central

    Garlatti, M; Daheshia, M; Slater, E; Bouguet, J; Hanoune, J; Beato, M; Barouki, R

    1994-01-01

    An unusual glucocorticoid-responsive element (called GRE A) was found to mediate the induction of the cytosolic aspartate aminotransferase gene by glucocorticoids and was bound by the glucocorticoid receptor in a DNase I footprinting assay. GRE A consists of two overlapping GREs, each comprising a conserved half-site and an imperfect half-site. The complete unit was able to confer glucocorticoid inducibility to a heterologous promoter (delta MTV-CAT). Mutation of any of the half-sites, including the imperfect ones, abolished inducibility by the hormone, demonstrating that each of the isolated GREs was inactive. In electrophoretic mobility shift assays, purified rat liver glucocorticoid receptor (GR) formed a low-mobility complex with GRE A, presumably containing a GR tetramer. When purified bacterially expressed DBD was used, low-mobility complexes as well as dimer and monomer complexes were formed. In inactive mutated oligonucleotides, no GR tetramer formation was detected. Modification of the imperfect half-sites in order to increase their affinity for GR gave a DNA sequence that bound a GR tetramer in a highly cooperative manner. This activated unit consisting of two overlapping consensus GREs mediated glucocorticoid induction with a higher efficiency than consensus GRE. Images PMID:7969140

  1. Slow base excision by human alkyladenine DNA glycosylase limits the rate of formation of AP sites and AP endonuclease 1 does not stimulate base excision.

    PubMed

    Maher, Robyn L; Vallur, Aarthy C; Feller, Joyce A; Bloom, Linda B

    2007-01-01

    The base excision repair pathway removes damaged DNA bases and resynthesizes DNA to replace the damage. Human alkyladenine DNA glycosylase (AAG) is one of several damage-specific DNA glycosylases that recognizes and excises damaged DNA bases. AAG removes primarily damaged adenine residues. Human AP endonuclease 1 (APE1) recognizes AP sites produced by DNA glycosylases and incises the phophodiester bond 5' to the damaged site. The repair process is completed by a DNA polymerase and DNA ligase. If not tightly coordinated, base excision repair could generate intermediates that are more deleterious to the cell than the initial DNA damage. The kinetics of AAG-catalyzed excision of two damaged bases, hypoxanthine and 1,N6-ethenoadenine, were measured in the presence and absence of APE1 to investigate the mechanism by which the base excision activity of AAG is coordinated with the AP incision activity of APE1. 1,N6-ethenoadenine is excised significantly slower than hypoxanthine and the rate of excision is not affected by APE1. The excision of hypoxanthine is inhibited to a small degree by accumulated product, and APE1 stimulates multiple turnovers by alleviating product inhibition. These results show that APE1 does not significantly affect the kinetics of base excision by AAG. It is likely that slow excision by AAG limits the rate of AP site formation in vivo such that AP sites are not created faster than can be processed by APE1. PMID:17018265

  2. Field-based description of rhyolite lava flows of the Calico Hills Formation, Nevada National Security Site, Nevada

    USGS Publications Warehouse

    Sweetkind, Donald S.; Bova, Shiera C.

    2015-01-01

    In the area south of the Rainier Mesa caldera, surface and subsurface geologic data are combined to interpret the overall thickness of the Calico Hills Formation and the proportion of lava flow lithology across the study area. The formation is at least 500 meters (m) thick and contains the greatest proportion of rhyolite lava flow to the northeast of Yucca Mountain in the lower part of Fortymile Canyon. The formation thins to the south and southwest where it is between 50 and 200 m thick beneath Yucca Mountain and contains no rhyolite lavas. Geologic mapping and field-based correlation of individual lava flows allow for the interpretation of the thickness and extent of specific flows and the location of their source areas. The most extensive flows have widths from 2 to 3 kilometers (km) and lengths of at least 5–6 km. Lava flow thickness varies from 150 to 250 m above interpreted source vents to between 30 and 80 m in more distal locations. Rhyolite lavas have length-to-height ratios of 10:1 or greater and, in one instance, a length-to-width ratio of 2:1 or greater, implying a tongue-shaped geometry instead of circular domes or tabular bodies. Although geologic mapping did not identify any physical feature that could be positively identified as a vent, lava flow thickness and the size of clasts in subjacent pyroclastic deposits suggest that primary vent areas for at least some of the flows in the study area are on the east side of Fortymile Canyon, to the northeast of Yucca Mountain.

  3. A dynamic flow simulation code benchmark study addressing the highly heterogeneous properties of the Stuttgart formation at the Ketzin pilot site

    NASA Astrophysics Data System (ADS)

    Kempka, Thomas; Class, Holger; Görke, Uwe-Jens; Norden, Ben; Kolditz, Olaf; Kühn, Michael; Walter, Lena; Wang, Wenqing; Zehner, Björn

    2013-04-01

    CO2 injection at the Ketzin pilot site located in Eastern Germany (Brandenburg) about 25 km west of Berlin is undertaken since June 2008 with a scheduled total amount of about 70,000 t CO2 to be injected into the saline aquifer represented by the Stuttgart Formation at a depth of 630 m to 650 m until the end of August 2013. The Stuttgart Formation is of fluvial origin determined by high-permeablity sandstone channels embedded in a floodplain facies of low permeability indicating a highly heterogeneous distribution of reservoir properties as facies distribution, porosity and permeability relevant for dynamic flow simulations. Following the dynamic modelling activities discussed by Kempka et al. (2010), a revised geological model allowed us to history match CO2 arrival times in the observation wells and reservoir pressure with a good agreement (Martens et al., 2012). Consequently, the validated reservoir model of the Stuttgart Formation at the Ketzin pilot site enabled us to predict the development of reservoir pressure and the CO2 plume migration in the storage formation by dynamic flow simulations. A benchmark study of industrial (ECLIPSE 100 as well as ECLIPSE 300 CO2STORE and GASWAT) and scientific dynamic flow simulations codes (TOUGH2-MP/ECO2N, OpenGeoSys and DuMuX) was initiated to address and compare the simulator capabilities considering a highly complex reservoir model. Hence, our dynamic flow simulations take into account different properties of the geological model such as significant variation of porosity and permeability in the Stuttgart Formation as well as structural geological features implemented in the geological model such as seven major faults located at the top of the Ketzin anticline. Integration of the geological model into reservoir models suitable for the different dynamic flow simulators applied demonstrated that a direct conversion of reservoir model discretization between Finite Volume and Finite Element flow simulators is not feasible

  4. The Evolution of Tissue Stiffness at Radiofrequency Ablation Sites During Lesion Formation and in the Peri‐Ablation Period

    PubMed Central

    EYERLY, STEPHANIE A.; VEJDANI‐JAHROMI, MARYAM; DUMONT, DOUGLAS M.; TRAHEY, GREGG E.

    2015-01-01

    Peri‐Ablation Monitoring of RFA Lesion Stiffness Introduction Elastography imaging can provide radiofrequency ablation (RFA) lesion assessment due to tissue stiffening at the ablation site. An important aspect of assessment is the spatial and temporal stability of the region of stiffness increase in the peri‐ablation period. The aim of this study was to use 2 ultrasound‐based elastography techniques, shear wave elasticity imaging (SWEI) and acoustic radiation force impulse (ARFI) imaging, to monitor the evolution of tissue stiffness at ablation sites in the 30 minutes following lesion creation. Methods and Results In 6 canine subjects, SWEI measurements and 2‐D ARFI images were acquired at 6 ventricular endocardial RFA sites before, during, and for 30 minutes postablation. An immediate increase in tissue stiffness was detected during RFA, and the area of the postablation region of stiffness increase (RoSI) as well as the relative stiffness at the RoSI center was stable approximately 2 minutes after ablation. Of note is the observation that relative stiffness in the region adjacent to the RoSI increased slightly during the first 15 minutes, consistent with local fluid displacement or edema. The magnitude of this increase, ∼0.5‐fold from baseline, was significantly less than the magnitude of the stiffness increase directly inside the RoSI, which was greater than 3‐fold from baseline. Conclusions Ultrasound‐based SWEI and ARFI imaging detected an immediate increase in tissue stiffness during RFA, and the stability and magnitude of the stiffness change suggest that consistent elasticity‐based lesion assessment is possible 2 minutes after and for at least 30 minutes following ablation. PMID:25970142

  5. Rad54B targeting to DNA double-strand break repair sites requires complex formation with S100A11.

    PubMed

    Murzik, Ulrike; Hemmerich, Peter; Weidtkamp-Peters, Stefanie; Ulbricht, Tobias; Bussen, Wendy; Hentschel, Julia; von Eggeling, Ferdinand; Melle, Christian

    2008-07-01

    S100A11 is involved in a variety of intracellular activities such as growth regulation and differentiation. To gain more insight into the physiological role of endogenously expressed S100A11, we used a proteomic approach to detect and identify interacting proteins in vivo. Hereby, we were able to detect a specific interaction between S100A11 and Rad54B, which could be confirmed under in vivo conditions. Rad54B, a DNA-dependent ATPase, is described to be involved in recombinational repair of DNA damage, including DNA double-strand breaks (DSBs). Treatment with bleomycin, which induces DSBs, revealed an increase in the degree of colocalization between S100A11 and Rad54B. Furthermore, S100A11/Rad54B foci are spatially associated with sites of DNA DSB repair. Furthermore, while the expression of p21(WAF1/CIP1) was increased in parallel with DNA damage, its protein level was drastically down-regulated in damaged cells after S100A11 knockdown. Down-regulation of S100A11 by RNA interference also abolished Rad54B targeting to DSBs. Additionally, S100A11 down-regulated HaCaT cells showed a restricted proliferation capacity and an increase of the apoptotic cell fraction. These observations suggest that S100A11 targets Rad54B to sites of DNA DSB repair sites and identify a novel function for S100A11 in p21-based regulation of cell cycle. PMID:18463164

  6. Rad54B Targeting to DNA Double-Strand Break Repair Sites Requires Complex Formation with S100A11

    PubMed Central

    Murzik, Ulrike; Hemmerich, Peter; Weidtkamp-Peters, Stefanie; Ulbricht, Tobias; Bussen, Wendy; Hentschel, Julia; von Eggeling, Ferdinand

    2008-01-01

    S100A11 is involved in a variety of intracellular activities such as growth regulation and differentiation. To gain more insight into the physiological role of endogenously expressed S100A11, we used a proteomic approach to detect and identify interacting proteins in vivo. Hereby, we were able to detect a specific interaction between S100A11 and Rad54B, which could be confirmed under in vivo conditions. Rad54B, a DNA-dependent ATPase, is described to be involved in recombinational repair of DNA damage, including DNA double-strand breaks (DSBs). Treatment with bleomycin, which induces DSBs, revealed an increase in the degree of colocalization between S100A11 and Rad54B. Furthermore, S100A11/Rad54B foci are spatially associated with sites of DNA DSB repair. Furthermore, while the expression of p21WAF1/CIP1 was increased in parallel with DNA damage, its protein level was drastically down-regulated in damaged cells after S100A11 knockdown. Down-regulation of S100A11 by RNA interference also abolished Rad54B targeting to DSBs. Additionally, S100A11 down-regulated HaCaT cells showed a restricted proliferation capacity and an increase of the apoptotic cell fraction. These observations suggest that S100A11 targets Rad54B to sites of DNA DSB repair sites and identify a novel function for S100A11 in p21-based regulation of cell cycle. PMID:18463164

  7. New particle formation and ultrafine charged aerosol climatology at a high altitude site in the Alps (Jungfraujoch, 3580 m a.s.l., Switzerland)

    NASA Astrophysics Data System (ADS)

    Boulon, J.; Sellegri, K.; Venzac, H.; Picard, D.; Weingartner, E.; Wehrle, G.; Baltensperger, U.; Laj, P.

    2010-04-01

    Aerosol nucleation is an important source of atmospheric particles which have an effect both on the climatic system and on human health. The new particle formation (NPF) process is an ubiquitous phenomenon, yet poorly understood despite the many studies performed on this topic using various approaches (observation, experimentation in smog chambers and modeling). In this work, we investigate the formation of secondary charged aerosols and its climatology at Jungfraujoch, a high altitude site in Swiss Alps (3580 m a.s.l.). Charged particles and clusters (0.5-1.8 nm) were measured within the EUCAARI program from April 2008 to April 2009 and allowed the detection of nucleation events. We found that the aerosol concentration, which is dominated by cluster size class, shows a strong diurnal pattern and that the aerosol size distribution and concentration are strongly influenced by the presence of clouds either during daytime or nighttime conditions. New particle formation events have been investigated and it appears that new particle formation occurs 17.5% of measured days and that the nucleation frequency is strongly linked to air mass origin and path and negatively influenced by cloud presence. In fact, we show that NPF events depend on the occurrence of high concentration VOCs air masses which allowed clusters growing by condensation of organic vapors rather than nucleation of new clusters. Furthermore, the contribution of ions to nucleation process was studied and we found that ion-mediated nucleation (IMN) contribute to 26% of the total nucleation so that ions play an important role in the new particle formation and growth at Jungfraujoch.

  8. A Threonine on the Active Site Loop Controls Transition State Formation in Escherichia Coli Respiratory Complex II

    SciTech Connect

    Tomasiak, T.M.; Maklashina, E.; Cecchini, G.; Iverson, T.M.

    2009-05-26

    In Escherichia coli, the complex II superfamily members succinate:ubiquinone oxidoreductase (SQR) and quinol:fumarate reductase (QFR) participate in aerobic and anaerobic respiration, respectively. Complex II enzymes catalyze succinate and fumarate interconversion at the interface of two domains of the soluble flavoprotein subunit, the FAD binding domain and the capping domain. An 11-amino acid loop in the capping domain (Thr-A234 to Thr-A244 in quinol:fumarate reductase) begins at the interdomain hinge and covers the active site. Amino acids of this loop interact with both the substrate and a proton shuttle, potentially coordinating substrate binding and the proton shuttle protonation state. To assess the loop's role in catalysis, two threonine residues were mutated to alanine: QFR Thr-A244 (act-T; Thr-A254 in SQR), which hydrogen-bonds to the substrate at the active site, and QFR Thr-A234 (hinge-T; Thr-A244 in SQR), which is located at the hinge and hydrogen-bonds the proton shuttle. Both mutations impair catalysis and decrease substrate binding. The crystal structure of the hinge-T mutation reveals a reorientation between the FAD-binding and capping domains that accompanies proton shuttle alteration. Taken together, hydrogen bonding from act-T to substrate may coordinate with interdomain motions to twist the double bond of fumarate and introduce the strain important for attaining the transition state.

  9. The Lindi Formation (upper Albian-Coniacian) and Tanzania Drilling Project Sites 36-40 (Lower Cretaceous to Paleogene): Lithostratigraphy, biostratigraphy and chemostratigraphy

    NASA Astrophysics Data System (ADS)

    Jiménez Berrocoso, Álvaro; Huber, Brian T.; MacLeod, Kenneth G.; Petrizzo, Maria Rose; Lees, Jacqueline A.; Wendler, Ines; Coxall, Helen; Mweneinda, Amina K.; Falzoni, Francesca; Birch, Heather; Haynes, Shannon J.; Bown, Paul R.; Robinson, Stuart A.; Singano, Joyce M.

    2015-01-01

    The 2009 Tanzania Drilling Project (TDP) expedition to southeastern Tanzania cored a total of 572.3 m of sediments at six new mid-Cretaceous to mid-Paleocene boreholes (TDP Sites 36, 37, 38, 39, 40A, 40B). Added to the sites drilled in 2007 and 2008, the new boreholes confirm the common excellent preservation of planktonic and benthic foraminifera and calcareous nannofossils from core samples that will be used for biostratigraphy, evolutionary studies, paleoceanography and climatic reconstructions from the Tanzanian margin, with implications elsewhere. The new sites verify the presence of a relatively expanded Upper Cretaceous succession in the region that has allowed a new stratigraphic unit, named here as the Lindi Formation (Fm), to be formally defined. The Lindi Fm (upper Albian to Coniacian), extending ∼120 km between Kilwa and Lindi, comprises a 335-m-thick, outer-shelf to upper-slope unit, consisting of dark gray claystone and siltstone interbeds, common finely-laminated intervals, minor cm-thick sandstones and up to 2.6% organic carbon in the Turonian. A subsurface, composite stratotype section is proposed for the Lindi Fm, with a gradational top boundary with the overlying Nangurukuru Fm (Santonian to Maastrichtian) and a sharp bottom contact with underlying upper Albian sandstones. The section cored at TDP Sites 36 and 38 belongs to the Lindi Fm and are of lower to middle Turonian age (planktonic foraminifera Whiteinella archaeocretacea to Helvetoglobotruncana helvetica Zones and nannofossils subzones UC6b ± UC7). The lower portion of TDP Site 39 (uppermost part of the Lindi Fm) is assigned to the lower to upper Coniacian (planktonic foraminifera Dicarinella concavata Zone and nannofossils zone UC 10), while the remaining part of this site is attributed to the Coniacian-Santonian transition and younger Santonian (planktonic foraminifera D. asymetrica Zone and upper part of nannofossils zone UC10). TDP Site 37 recovered relatively expanded (150 m thick

  10. Formation of a stable triplex incorporating a CG interrupting site by a new WNA derivative containing 3-aminopyrazole as a nucleobase.

    PubMed

    Uchida, Yuko; Taniguchi, Yosuke; Aoki, Eriko; Togo, Mieko; Sasaki, Shigeki

    2008-01-01

    Triplex-forming oligonucleotides (TFOs) bind within the major groove of duplex DNA in a sequence-specific manner, and have attracted much interest as genomic tools. However, as the triplex DNA is formed by the interaction between the TFOs and homopurine/homopyrimidine sequences of the target duplex DNA, the stable triplex formation is prevented by one pyrimidine base in the homopurine strand. Previously, we developed the nucleoside analogues (WNA: W-shaped nucleoside analogues) that furnish an aromatic ring as a stacking part and a nucleobase as a recognition part onto the bicyclic skeleton. Selective recognition of a TA and a CG interrupting site has been achieved by WNA-beta T and WNA-beta C, respectively. In the subsequent study, it was found that the triplex formation by the WNA analogues depend on its neighbouring bases within the TFO. In this paper, we describe the synthesis and the evaluation of the triplex forming ability of WNA-beta 3AP, having 3-aminopyrazole (3AP) as a nucleobase. It is remarkable that the TFO containing the WNA-beta 3AP recognizes the CG interrupting site with high selectivity in the TFO sequence of 3'-GZG-5', in which the previous WNA-beta C did not show the stabilizing effect. PMID:18776291

  11. Surface and subsurface features of the upper Pleistocene Beaumont Formation as studied in a proposed super collider site in Liberty and Hardin counties, southeastern Texas

    SciTech Connect

    Aronow, S.

    1994-12-31

    In 1987 an area in Hardin and Libery Counties in southeastern Texas was a much-studied candidate site for the ill-fated Superconducting Super Collider. The site is on the outcrop of the upper Pleistocene Beaumont Formation, which locally was deposited by a sequence of meandering, avulsing, suspended-load, paleo-Trinity River courses, now preserved as a well-defined to poorly defined depositional topography. Test holes in meanderbelt ridges showed that channel and point-bar silty fine to very fine sands are almost everywhere covered by approximately 10 to 40 ft ({approximately}3 to 12 m) of CH and CL overbank clays. Where completely penetrated, sand bodies are approximately 20 to 50 ft ({approximately}6 to 15 m) thick. Pedogenic calcareous deposits and slickensides at depths well below any influence from present-day surface processes are probably parts of lower horizons of truncated now-buried soils generated during the accumulation of the Beaumont, or on the surface of the underlying Lissie Formation. The relationship of one of the paleo-meanderbelts to the uplifted topographic surface of the Hull salt dome suggests that the rise of the surface postdated deposition of the Beaumont.

  12. Site specific isolated nanostructure array formation on a large area by broad ion beam without any mask and resist

    NASA Astrophysics Data System (ADS)

    Karmakar, Prasanta; Satpati, Biswarup

    2014-06-01

    We report the formation of isolated nanostructure arrays on a large area via broad ion beam implantation without the aid of any mask or resist. Desired ions have been implanted at specific locations of the prefabricated silicon ripple or triangular structures by exploiting the variation of local ion impact angles. We have shown that the implantation of Fe ions on an O+ ions induced pre fabricated triangular shaped patterned Si surface results in a self-organized periodic array of striped magnetic nanostructures having several micron length and about 50 nm width arranged with a spacial separation of ˜200 nm. The morphology, composition, crystalline structure, and magnetic property of these nanopatterns have been analyzed using high-resolution cross-sectional transmission electron microscopy and atomic force microscopy. A geometrical model has been proposed to explain the fundamental features of such ion-induced nanopattern structures.

  13. Site-directed Mutagenesis Reveals Regions Implicated in the Stability and Fiber Formation of Human λ3r Light Chains*

    PubMed Central

    Villalba, Miryam I.; Canul-Tec, Juan C.; Luna-Martínez, Oscar D.; Sánchez-Alcalá, Rosalba; Olamendi-Portugal, Timoteo; Rudiño-Piñera, Enrique; Rojas, Sonia; Sánchez-López, Rosana; Fernández-Velasco, Daniel A.; Becerril, Baltazar

    2015-01-01

    Light chain amyloidosis (AL) is a disease that affects vital organs by the fibrillar aggregation of monoclonal light chains. λ3r germ line is significantly implicated in this disease. In this work, we contrasted the thermodynamic stability and aggregation propensity of 3mJL2 (nonamyloidogenic) and 3rJL2 (amyloidogenic) λ3 germ lines. Because of an inherent limitation (extremely low expression), Cys at position 34 of the 3r germ line was replaced by Tyr reaching a good expression yield. A second substitution (W91A) was introduced in 3r to obtain a better template to incorporate additional mutations. Although the single mutant (C34Y) was not fibrillogenic, the second mutation located at CDR3 (W91A) induced fibrillogenesis. We propose, for the first time, that CDR3 (position 91) affects the stability and fiber formation of human λ3r light chains. Using the double mutant (3rJL2/YA) as template, other variants were constructed to evaluate the importance of those substitutions into the stability and aggregation propensity of λ3 light chains. A change in position 7 (P7D) boosted 3rJL2/YA fibrillogenic properties. Modification of position 48 (I48M) partially reverted 3rJL2/YA fibril aggregation. Finally, changes at positions 8 (P8S) or 40 (P40S) completely reverted fibril formation. These results confirm the influential roles of N-terminal region (positions 7 and 8) and the loop 40–60 (positions 40 and 48) on AL. X-ray crystallography revealed that the three-dimensional topology of the single and double λ3r mutants was not significantly altered. This mutagenic approach helped to identify key regions implicated in λ3 AL. PMID:25505244

  14. A first site of galaxy cluster formation: complete spectroscopy of a protocluster at z = 6.01

    SciTech Connect

    Toshikawa, Jun; Kashikawa, Nobunari; Ishikawa, Shogo; Onoue, Masafusa; Overzier, Roderik; Shibuya, Takatoshi; Ota, Kazuaki; Shimasaku, Kazuhiro; Tanaka, Masayuki; Hayashi, Masao; Niino, Yuu

    2014-09-01

    We performed a systematic spectroscopic observation of a protocluster at z = 6.01 in the Subaru Deep Field. We took spectroscopy for all 53 i' dropout galaxies down to z' = 27.09 mag in/around the protocluster region. From these observations, we confirmed that 28 galaxies are at z ∼ 6, 10 of which are clustered in a narrow redshift range of Δz < 0.06. To trace the evolution of this primordial structure, we applied the same i' dropout selection and the same overdensity measurements used in the observations to a semi-analytic model built upon the Millennium Simulation. We obtain a relation between the significance of overdensities observed at z ∼ 6 and the predicted dark matter halo mass at z = 0. This protocluster with 6σ overdensity is expected to grow into a galaxy cluster with a mass of ∼5 × 10{sup 14} M {sub ☉} at z = 0. Ten galaxies within 10 comoving Mpc of the overdense region can, with more than an 80% probability, merge into a single dark matter halo by z = 0. No significant differences appeared in UV and Lyα luminosities between the protocluster and field galaxies, suggesting that this protocluster is still in the early phase of cluster formation before the onset of any obvious environmental effects. However, further observations are required to study other properties, such as stellar mass, dust, and age. We do find that galaxies tend to be in close pairs in this protocluster. These pair-like subgroups will coalesce into a single halo and grow into a more massive structure. We may witness an onset of cluster formation at z ∼ 6 toward a cluster as seen in local universe.

  15. Comparison of particle number size distributions and new particle formation between the urban and rural sites in the PRD region, China

    NASA Astrophysics Data System (ADS)

    Yue, D. L.; Hu, M.; Wang, Z. B.; Wen, M. T.; Guo, S.; Zhong, L. J.; Wiedensohler, A.; Zhang, Y. H.

    2013-09-01

    Particle number size distributions were simultaneously measured at the Guangzhou (GZ) urban site (23.13°N, 113.26°E) and the Back-garden (BG) rural site (23.5°N, 113.03°E) in the Pearl River Delta (PRD) region in July, 2006. It provided new findings into the evolution of particle number size distribution and new particle formation (NPF) in two different environments. Number concentration of particles (20 nm-10 μm diameter) at GZ was about 70% higher than at BG and significantly affected by traffic emission. However, number concentrations of the regional aerosols (100-660 nm) were (6 ± 3) × 103 cm-3 at both sites. At BG, the diurnal variation of particle number size distributions showed an obvious particle growth process beginning at about 9:00 (LT), probably caused by NPF. In contrast, particle number concentrations in the size rages of 20-45 nm, 45-100 nm, and 100-660 nm showed similar trends with two main peaks at about 12:00 (LT) and 19:00 (LT) at GZ. NPF events were observed at both sites, but the occurrence frequency at GZ was about 50% lower than at BG. Regional NPF events at both sites probably in the same air mass were simultaneously observed with similar growth rates, concentrations and production rates of the condensable vapors, and condensational sinks on July 6. On the whole, deceasing traffic emission will improve air quality efficiently in the aspect of particle number concentration and fine particulate pollution in the summer of PRD should be controlled in a regional scale, especially with stagnant air mass from South China Sea.

  16. Geochemical Controls on Contaminant Uranium in Vadose Hanford Formation Sediments at the 200 Area and 300 Area, Hanford Site, Washington

    SciTech Connect

    McKinley, James P.; Zachara, John M.; Wan, Jiamin; Mccready, David E.; Heald, Steve M.

    2007-11-01

    differences in uranium contributed by contaminated vadose sediments at two locations was investigated. At the BX tank farms, alkaline waste was accidentally released to a thick vadose zone. At the 300 Area, waste of variable acidity was released by unintended infiltration through the base of settling ponds. The waste form at the BX site was devoid of dissolved silica, and reacted with fluids trapped in microfractures to precipitate uranyl silicates. These secondary deposits were isolated physically from the vadose pore space and are not readily leached into pore fluids. At the 300 Area, the aluminum-rich waste precipitated on the surfaces of sediment clasts, forming a microporous reservoir of solid-phase uranium. Interaction of this coating with water in transit through the vadose zone provides a persistent source of dissolved uranium to groundwater.

  17. Analysis of Dose at the Site of Second Tumor Formation After Radiotherapy to the Central Nervous System

    SciTech Connect

    Galloway, Thomas J.; Indelicato, Daniel J.; Amdur, Robert J.; Morris, Christopher G.; Swanson, Erika L.; Marcus, Robert B.

    2012-01-01

    Purpose: Second tumors are an uncommon complication of multimodality treatment of childhood cancer. The present analysis attempted to correlate the dose received as a component of primary treatment and the site of the eventual development of a second tumor. Methods and Materials: We retrospectively identified 16 patients who had received radiotherapy to sites in the craniospinal axis and subsequently developed a second tumor. We compared the historical fields and port films of the primary treatment with the modern imaging of the second tumor locations. We classified the location of the second tumors as follows: in the boost field; marginal to the boost field, but in a whole-brain field; in a whole-brain field; marginal to the whole brain/primary treatment field; and distant to the field. We divided the dose received into 3 broad categories: high dose (>45 Gy), moderate dose (20-36 Gy), and low dose (<20 Gy). Results: The most common location of the second tumor was in the whole brain field (57%) and in the moderate-dose range (81%). Conclusions: Our data contradict previous publications that suggested that most second tumors develop in tissues that receive a low radiation dose. Almost all the second tumors in our series occurred in tissue within a target volume in the cranium that had received a moderate dose (20-36 Gy). These findings suggest that a major decrease in the brain volume that receives a moderate radiation dose is the only way to substantially decrease the second tumor rate after central nervous system radiotherapy.

  18. Correlation of Thermal Stability and Structural Distortion of DNA Interstrand Cross-Links Produced from Oxidized Abasic Sites with Their Selective Formation and Repair.

    PubMed

    Ghosh, Souradyuti; Greenberg, Marc M

    2015-10-13

    C4'-oxidized (C4-AP) and C5'-oxidized abasic sites (DOB) that are produced following abstraction of a hydrogen atom from the DNA backbone reversibly form cross-links selectively with dA opposite a 3'-adjacent nucleotide, despite the comparable proximity of an opposing dA. A previous report on UvrABC incision of DNA substrates containing stabilized analogues of the ICLs derived from C4-AP and DOB also indicated that the latter is repaired more readily by nucleotide excision repair [Ghosh, S., and Greenberg, M. M. (2014) Biochemistry 53, 5958-5965]. The source for selective cross-link formation was probed by comparing the reactivity of ICL analogues of C4-AP and DOB that mimic the preferred and disfavored cross-links with that of reagents that indirectly detect distortion by reacting with the nucleobases. The disfavored C4-AP and DOB analogues were each more reactive than the corresponding preferred cross-link substrates, suggesting that the latter are more stable, which is consistent with selective ICL formation. In addition, the preferred DOB analogue is more reactive than the respective C4-AP ICL, which is consistent with its more efficient incision by UvrABC. The conclusions drawn from the chemical probing experiments are corroborated by UV melting studies. The preferred ICLs exhibit melting temperatures higher than those of the corresponding disfavored isomers. These studies suggest that oxidized abasic sites form reversible interstrand cross-links with dA opposite the 3'-adjacent thymidine because these products are more stable and the thermodynamic preference is reflected in the transition states for their formation. PMID:26426430

  19. Sources of ambient volatile organic compounds and their contributions to photochemical ozone formation at a site in the Pearl River Delta, southern China.

    PubMed

    Ling, Z H; Guo, H; Cheng, H R; Yu, Y F

    2011-10-01

    The Positive Matrix Factorization (PMF) receptor model and the Observation Based Model (OBM) were combined to analyze volatile organic compound (VOC) data collected at a suburban site (WQS) in the PRD region. The purposes are to estimate the VOC source apportionment and investigate the contributions of these sources and species of these sources to the O(3) formation in PRD. Ten VOC sources were identified. We further applied the PMF-extracted concentrations of these 10 sources into the OBM and found "solvent usage 1", "diesel vehicular emissions" and "biomass/biofuel burning" contributed most to the O(3) formation at WQS. Among these three sources, higher Relative Incremental Reactivity (RIR)-weighted values of ethene, toluene and m/p-xylene indicated that they were mainly responsible for local O(3) formation in the region. Sensitivity analysis revealed that the sources of "diesel vehicular emissions", "biomass/biofuel burning" and "solvent usage 1" had low uncertainties whereas "gasoline evaporation" showed the highest uncertainty. PMID:21616570

  20. Geochemistry of two pressurized brines from the Castile Formation in the vicinity of the Waste Isolation Pilot Plant (WIPP) site

    SciTech Connect

    Faith, S.; Spiegler, P.; Rehfeldt, K.R.

    1983-04-01

    The major and minor element data and isotopic data from the ERDA-6 and WIPP-12 testing indicate that the brine reservoirs encountered in the Upper Castile Formation are largely in equilibrium with their surrounding host rock environment. This contention is supported by thermodynamic and stable isotope data. It is not possible to assign an absolute age to the brine based on uranium disequilibrium considerations, but the data do indicate that the brine reequilibrated with a new rock environment at least two million years ago. Information and data evaluated herein indicate the likelihood that the brines encountered are predominantly, if not entirely, derived from a trapped seawater source subsequently modified by diagenesis. Major ion/bromide ratios indicate that halite dissolution has occurred to some extent subsequent to deposition of the Castile anhydrites and entrapment of the seawater brine. Mechanisms for additional halite dissolution are discussed. Based on the degree of present halite saturation, it is concluded that the potential for future dissolution of halite is minimal.

  1. The effect of animal health products on the formation of injection site lesions in subprimals of experimentally injected beef calves.

    PubMed Central

    Van Donkersgoed, J; Dubeski, P L; VanderKop, M; Aalhus, J L; Bygrove, S; Starr, W N

    2000-01-01

    Two hundred and twenty beef calves were used in an experimental study to determine the occurrence of injection site lesions at slaughter (15 to 18 months of age) following subcutaneous and intramuscular injection of various products into the top hip (top butt), thigh (round), and neck or rib of calves at birth, branding, or weaning. Products tested were: 2 different preparations of selenium; a 2-way, a 7-way, and an 8-way clostridial bacterin; 2 combination 7-way clostridial and Haemophilus somnus bacterins; 2 H. somnus bacterins; 2 different 4-way modified-live viral respiratory vaccines; a 4-way killed viral and H. somnus vaccine; and penicillin, florfenicol, ceftiofur, trimethoprim-sulfa, and tilmicosin. The occurrence of lesions, number of steaks affected with lesions, the trim weight of lesions, the histological class of lesions, and the estimated economic losses are described. Generally, products administered subcutaneously in the neck produced minimal tissue damage and economic losses. Images Figure 1. Figure 2. Figure 3. PMID:10945127

  2. Identification of a structural constituent and one possible site of postembryonic formation of a teleost otolithic membrane

    PubMed Central

    Davis, James G.; Burns, Frank R.; Navaratnam, Dasakumar; Lee, A. Masaji; Ichimiya, Shingo; Oberholtzer, J. Carl; Greene, Mark I.

    1997-01-01

    A gelatinous otolithic membrane (OM) couples a single calcified otolith to the sensory epithelium in the bluegill sunfish (Lepomis macrochirus) saccule, one of the otolithic organs in the inner ear. Though the OM is an integral part of the anatomic network of endorgan structures that result in vestibular function in the inner ear, the identity of the proteins that make up this sensory accessory membrane in teleosts, or in any vertebrate, is not fully known. Previously, we identified a cDNA from the sunfish saccular otolithic organ that encoded a new member of the collagen family of structural proteins. In this study, we examined biochemical features and the localization of the saccular collagen (SC) protein in vivo using polyclonal antisera that recognize the noncollagenous domains of the SC protein. The SC protein, in vivo, was identified as a 95-kDa glycoprotein in sunfish whole-saccule lysate and in homogenates of microdissected saccular OMs. Immunohistochemical analyses demonstrated that the SC protein was localized within one of the two distinct layers of the sunfish saccular OM. The SC protein was also detected within the cytoplasm of supporting cells at the edges of the saccular sensory epithelium, indicating that these cells are a primary site for the synthesis of this structural protein. Further studies of the organization of this matrix molecule in the OM may help clarify the role of this sensory accessory membrane in vestibular sensory function. PMID:9012849

  3. Adeno-associated virus (AAV) Rep proteins mediate complex formation between AAV DNA and its integration site in human DNA.

    PubMed Central

    Weitzman, M D; Kyöstiö, S R; Kotin, R M; Owens, R A

    1994-01-01

    AAV is unique among eukaryotic viruses in the ability of its DNA to integrate preferentially into a specific region of the human genome. Understanding AAV integration may aid in developing gene therapy systems with predictable integration sites. Using a gel mobility-shift assay, we have identified a DNA sequence within the AAV integration locus on human chromosome 19 which is specifically bound by the AAV Rep78 and Rep68 proteins. This Rep recognition sequence is a GCTC repeating motif very similar to sequences within the inverted terminal repeats of the AAV genome which are also bound by Rep78 and Rep68. Cloned oligonucleotides containing the recognition sequence can direct specific binding by Rep proteins. Binding assays with mutant Rep proteins show that the amino-terminal portion of Rep78 and Rep68 can direct binding to either the AAV terminal repeat hairpin DNA or chromosome 19. This human genomic DNA can be complexed with AAV DNA by Rep proteins as demonstrated by a dual-label (32P/biotin) assay. These results suggest a role for Rep in targeting viral integration. Images PMID:8016070

  4. Site-1 protease-activated formation of lysosomal targeting motifs is independent of the lipogenic transcription control[S

    PubMed Central

    Klünder, Sarah; Heeren, Jörg; Markmann, Sandra; Santer, René; Braulke, Thomas; Pohl, Sandra

    2015-01-01

    Site-1 protease (S1P) cleaves membrane-bound lipogenic sterol regulatory element-binding proteins (SREBPs) and the α/β-subunit precursor protein of the N-acetylglucosamine-1-phosphotransferase forming mannose 6-phosphate (M6P) targeting markers on lysosomal enzymes. The translocation of SREBPs from the endoplasmic reticulum (ER) to the Golgi-resident S1P depends on the intracellular sterol content, but it is unknown whether the ER exit of the α/β-subunit precursor is regulated. Here, we investigated the effect of cholesterol depletion (atorvastatin treatment) and elevation (LDL overload) on ER-Golgi transport, S1P-mediated cleavage of the α/β-subunit precursor, and the subsequent targeting of lysosomal enzymes along the biosynthetic and endocytic pathway to lysosomes. The data showed that the proteolytic cleavage of the α/β-subunit precursor into mature and enzymatically active subunits does not depend on the cholesterol content. In either treatment, lysosomal enzymes are normally decorated with M6P residues, allowing the proper sorting to lysosomes. In addition, we found that, in fibroblasts of mucolipidosis type II mice and Niemann-Pick type C patients characterized by aberrant cholesterol accumulation, the proteolytic cleavage of the α/β-subunit precursor was not impaired. We conclude that S1P substrate-dependent regulatory mechanisms for lipid synthesis and biogenesis of lysosomes are different. PMID:26108224

  5. Formation of nanostructured porous Cu-Au surfaces: the influence of cationic sites on (electro)-catalysis

    NASA Astrophysics Data System (ADS)

    Najdovski, Ilija; Selvakannan, Pr.; Bhargava, Suresh K.; O'Mullane, Anthony P.

    2012-09-01

    The fabrication of nanostructured bimetallic materials through electrochemical routes offers the ability to control the composition and shape of the final material that can then be effectively applied as (electro)-catalysts. In this work a clean and transitory hydrogen bubble templating method is employed to generate porous Cu-Au materials with a highly anisotropic nanostructured interior. Significantly, the co-electrodeposition of copper and gold promotes the formation of a mixed bimetallic oxide surface which does not occur at the individually electrodeposited materials. Interestingly, the surface is dominated by Au(i) oxide species incorporated within a Cu2O matrix which is extremely effective for the industrially important (electro)-catalytic reduction of 4-nitrophenol. It is proposed that an aurophilic type of interaction takes place between both oxidized gold and copper species which stabilizes the surface against further oxidation and facilitates the binding of 4-nitrophenol to the surface and increases the rate of reaction. An added benefit is that very low gold loadings are required typically less than 2 wt% for a significant enhancement in performance to be observed. Therefore the ability to create a partially oxidized Cu-Au surface through a facile electrochemical route that uses a clean template consisting of only hydrogen bubbles should be of benefit for many more important reactions.The fabrication of nanostructured bimetallic materials through electrochemical routes offers the ability to control the composition and shape of the final material that can then be effectively applied as (electro)-catalysts. In this work a clean and transitory hydrogen bubble templating method is employed to generate porous Cu-Au materials with a highly anisotropic nanostructured interior. Significantly, the co-electrodeposition of copper and gold promotes the formation of a mixed bimetallic oxide surface which does not occur at the individually electrodeposited materials

  6. Remobilization causes site-specific cyst formation in immobilization-induced knee cartilage degeneration in an immobilized rat model.

    PubMed

    Nagai, Momoko; Ito, Akira; Tajino, Junichi; Iijima, Hirotaka; Yamaguchi, Shoki; Zhang, Xiangkai; Aoyama, Tomoki; Kuroki, Hiroshi

    2016-06-01

    An understanding of the articular cartilage degenerative process is necessary for the prevention and treatment of joint disease. The present study aimed to examine how long-term immobilization-induced cartilage degeneration is aggravated by remobilization. Sixty 8-week-old male Wistar rats were used in this study. The unilateral knee joint was immobilized using an external fixator for 8 weeks. The rats were killed at 0 and 3 days, and at 1, 2, 4 and 8 weeks after removing the fixator. After the rats were killed, the maximum knee extension angles were measured. Histological sections at the medial mid-condylar region (non-contact, transitional and contact regions of the femur and tibia) were prepared and scored. The cartilage thickness and number of chondrocytes were measured, and CD44 and Col2-3/4c expression levels were assessed immunohistochemically. The histological assessment revealed progressive aggravation of cartilage degeneration in the transitional region, with a decreased number of chondrocytes and CD44-positive chondrocytes as well as poor scoring over time, particularly in the tibia. Cyst formation was confirmed in the transitional region of the tibia at 8 weeks post-remobilization. The cartilage thickness in the transitional region was thicker than that in the contact region, particularly in the tibia. Col2-3/4c expression was observed in the non-contact and transitional regions, and the knee extension angle was recovered. In conclusion, immobilization-induced cartilage degeneration was aggravated by remobilization over time in the transitional region, followed by observations of a decreased number of chondrocytes and morphological disparity between different cartilage regions. PMID:26989984

  7. Crystal Structure of the Nonerythroid [alpha]-Spectrin Tetramerization Site Reveals Differences between Erythroid and Nonerythroid Spectrin Tetramer Formation

    SciTech Connect

    Mehboob, Shahila; Song, Yuanli; Witek, Marta; Long, Fei; Santarsiero, Bernard D.; Johnson, Michael E.; Fung, Leslie W.-M.

    2010-06-21

    We have solved the crystal structure of a segment of nonerythroid {alpha}-spectrin ({alpha}II) consisting of the first 147 residues to a resolution of 2.3 {angstrom}. We find that the structure of this segment is generally similar to a corresponding segment from erythroid {alpha}-spectrin ({alpha}I) but exhibits unique differences with functional significance. Specific features include the following: (i) an irregular and frayed first helix (Helix C{prime}); (ii) a helical conformation in the junction region connecting Helix C{prime} with the first structural domain (D1); (iii) a long A1B1 loop in D1; and (iv) specific inter-helix hydrogen bonds/salt bridges that stabilize D1. Our findings suggest that the hydrogen bond networks contribute to structural domain stability, and thus rigidity, in {alpha}II, and the lack of such hydrogen bond networks in {alpha}I leads to flexibility in {alpha}I. We have previously shown the junction region connecting Helix C{prime} to D1 to be unstructured in {alpha}I (Park, S., Caffrey, M. S., Johnson, M. E., and Fung, L. W. (2003) J. Biol. Chem. 278, 21837-21844) and now find it to be helical in {alpha}II, an important difference for {alpha}-spectrin association with {beta}-spectrin in forming tetramers. Homology modeling and molecular dynamics simulation studies of the structure of the tetramerization site, a triple helical bundle of partial domain helices, show that mutations in {alpha}-spectrin will affect Helix C{prime} structural flexibility and/or the junction region conformation and may alter the equilibrium between spectrin dimers and tetramers in cells. Mutations leading to reduced levels of functional tetramers in cells may potentially lead to abnormal neuronal functions.

  8. Site-specific targeting of aflatoxin adduction directed by triple helix formation in the major groove of oligodeoxyribonucleotides.

    PubMed Central

    Jones, W R; Stone, M P

    1998-01-01

    The targeted adduction of aflatoxin B1- exo -8,9-epoxide (AFB1- exo -8,9-epoxide) to a specific guanine within an oligodeoxyribonucleotide containing multiple guanines was achieved using a DNA triplex to control sequence selectivity. The oligodeoxyribonucleotide d(AGAGAAGATTTTCTTCTCTTTTTTTTCTCTT), designated '3G', spontaneously formed a triplex in which nucleotides C27*G2*C18 and C29*G4*C16 formed base triplets, and nucleotides G7*C13formed a Watson-Crick base pair. The oligodeoxyribonucleotide d(AAGAAATTTTTTCTTTTTTTTTTCTT), designated '1G', also formed a triplex in which nucleotides C24*G3*C24 formed a triplet. Reaction of the two oligodeoxyribonucleotides with AFB1-exo-8,9-epoxide revealed that only the 3G sequence formed an adduct, as determined by UV absorbance and piperidine cleavage of the 5'-labeled adduct, followed by denaturing polyacrylamide gel electrophoresis. This site was identified as G7by comparison to the guanine-specific cleavage pattern. The chemistry was extended to a series of nicked bimolecular triple helices, constructed from d(AAAGGGGGAA) and d(CnTTCTTTTTCCCCCTTTATTTTTTC5-n) (n = 1-5). Each oligomer in the series differed only in the placement of the nick. Reaction of the nicked triplexes with AFB1- exo -8,9-epoxide, piperidine cleavage of the 5'-labeled adduct, followed by denaturing polyacrylamide gel electrophoresis, revealed cleavage corresponding to the guanine closest to the pyrimidine strand nick. By using the appropriate pyrimidine sequence the lesion was positioned within the purine strand. PMID:9461470

  9. Molecular dynamics simulations of apocupredoxins: insights into the formation and stabilization of copper sites under entatic control.

    PubMed

    Abriata, Luciano A; Vila, Alejandro J; Dal Peraro, Matteo

    2014-06-01

    Cupredoxins perform copper-mediated long-range electron transfer (ET) in biological systems. Their copper-binding sites have evolved to force copper ions into ET-competent systems with decreased reorganization energy, increased reduction potential, and a distinct electronic structure compared with those of non-ET-competent copper complexes. The entatic or rack-induced state hypothesis explains these special properties in terms of the strain that the protein matrix exerts on the metal ions. This idea is supported by X-ray structures of apocupredoxins displaying "closed" arrangements of the copper ligands like those observed in the holoproteins; however, it implies completely buried copper-binding atoms, conflicting with the notion that they must be exposed for copper loading. On the other hand, a recent work based on NMR showed that the copper-binding regions of apocupredoxins are flexible in solution. We have explored five cupredoxins in their "closed" apo forms through molecular dynamics simulations. We observed that prearranged ligand conformations are not stable as the X-ray data suggest, although they do form part of the dynamic landscape of the apoproteins. This translates into variable flexibility of the copper-binding regions within a rigid fold, accompanied by fluctuations of the hydrogen bonds around the copper ligands. Major conformations with solvent-exposed copper-binding atoms could allow initial binding of the copper ions. An eventual subsequent incursion to the closed state would result in binding of the remaining ligands, trapping the closed conformation thanks to the additional binding energy and the fastening of noncovalent interactions that make up the rack. PMID:24477946

  10. On the nature and formation of the active sites in Re[sub 2]O[sub 7] metathesis catalysts supported on borated alumina

    SciTech Connect

    Sibeijn, M.; Bliek, A. ); Veen, J.A.R. van ); Moulijn, J.A. )

    1994-02-01

    Re[sub 2]O[sub 7] catalysts on borated aluminas have been investigated with a view to correlating the structure of the active site and its activity in the metathesis of methyl oleate. Modification of alumina with boria results in much more active metathesis catalysts. Infrared spectroscopy was used for the characterization, pyridine adsorption measurements for determining the Lewis acid and Bronsted acid sites, and temperature-programmed IR measurements to follow the reactions occurring during calcination of the supports and catalysts. Boria binds to the surface via the alumina hydroxyls. Upon Re[sub 2]O[sub 7] loading of nonborated alumina, the ReO[sub 4] groups react first with Lewis acid sites, onto which they are strongly bonded. Above a Re[sub 2]O[sub 7] loading of 3 wt% surface hydroxyls are also substituted by Re[sub 2]O[sub 7] groups, resulting in an increase in catalytic activity. When the borated supports are loaded with Re[sub 2]O[sub 7], the ReO[sub 4] groups are also first bonded to the Lewis acid sites. During calcination these ReO[sub 4] groups substitute surface hydroxyls preferably on alumina hydroxyls. The substitution of the boron hydroxyls only takes place at a calcination time of at least 2 h at 823 K. At high borate loadings (>10 wt%) the reaction of ReO[sub 4] groups with boron hydroxyls competes with the condensation reaction of two neighbouring boron hydroxyls. Taking into account that a ReO[sub 4] group which has substituted in acidic OH group on the support is the precursor of an active site, the increase in activity of Re[sub 2]O[sub 7] catalysts by modification of the alumina support with boria can be ascribed to two effects, namely, the reduction of the bonding strength of Lewis acid sites with ReO[sub 4], making the ReO[sub 4]-OH substitution reaction possible during calcination even at low rhenium loadings, and the formation of acidic surface hydroxyls. 16 refs., 11 figs., 3 tabs.

  11. Site- and Enantioselective Formation of Allene-Bearing Tertiary or Quaternary Carbon Stereogenic Centers through NHC–Cu-Catalyzed Allylic Substitution

    PubMed Central

    Jung, Byunghyuck; Hoveyda, Amir H.

    2012-01-01

    Catalytic enantioselective allylic substitutions that result in exclusive addition of an allenyl group (<2% propargyl addition) and formation of tertiary or quaternary C–C bonds are described. Commercially available allenylboronic acid pinacol ester is used (preparation of a more reactive but less stable boronate derivative not required). Reactions are promoted by 5.0–10 mol % of sulfonate-bearing chiral bidentate N-heterocyclic carbene (NHC) complexes of copper, which exhibit the unique ability to furnish chiral products arising from SN2′ mode of addition. The desired allenyl-containing products are generated in up to 95% yield, >98% SN2′ selectivity and 99:1 enantiomeric ratio (er). Site-selective NHC–Cu-catalyzed hydroboration of enantiomerically enriched allenes and conversion to the corresponding β-vinyl ketones demonstrates utility. PMID:22214185

  12. Formation of lipid bilayer membrane in a poly(dimethylsiloxane) microchip integrated with a stacked polycarbonate membrane support and an on-site nanoinjector.

    PubMed

    Teng, Wei; Ban, Changill; Hahn, Jong Hoon

    2015-03-01

    This paper describes a new and facile approach for the formation of pore-spanning bilayer lipid membranes (BLMs) within a poly(dimethylsiloxane) (PDMS) microfluidic device. Commercially, readily available polycarbonate (PC) membranes are employed for the support of BLMs. PC sheets with 5 μm, 2 μm, and 0.4 μm pore diameters, respectively, are thermally bonded into a multilayer-stack, reducing the pore density of 0.4 μm-pore PC by a factor of 200. The BLMs on this support are considerably stable (a mean lifetime: 17 h). This multilayer-stack PC (MSPC) membrane is integrated into the PDMS chip by an epoxy bonding method developed to secure durable bonding under the use of organic solvents. The microchip has a special channel for guiding a micropipette in the proximity of the MSPC support. With this on-site injection technique, tens to hundreds of nanoliters of solutions can be directly dispensed to the support. Incorporating gramicidin ion channels into BLMs on the MSPC support has confirmed the formation of single BLMs, which is based on the observation from current signals of 20 pS conductance that is typical to single channel opening. Based on the bilayer capacitance (1.4 pF), about 15% of through pores across the MSPC membrane are estimated to be covered with BLMs. PMID:26015832

  13. Formation of lipid bilayer membrane in a poly(dimethylsiloxane) microchip integrated with a stacked polycarbonate membrane support and an on-site nanoinjector

    PubMed Central

    Teng, Wei; Ban, Changill; Hahn, Jong Hoon

    2015-01-01

    This paper describes a new and facile approach for the formation of pore-spanning bilayer lipid membranes (BLMs) within a poly(dimethylsiloxane) (PDMS) microfluidic device. Commercially, readily available polycarbonate (PC) membranes are employed for the support of BLMs. PC sheets with 5 μm, 2 μm, and 0.4 μm pore diameters, respectively, are thermally bonded into a multilayer-stack, reducing the pore density of 0.4 μm-pore PC by a factor of 200. The BLMs on this support are considerably stable (a mean lifetime: 17 h). This multilayer-stack PC (MSPC) membrane is integrated into the PDMS chip by an epoxy bonding method developed to secure durable bonding under the use of organic solvents. The microchip has a special channel for guiding a micropipette in the proximity of the MSPC support. With this on-site injection technique, tens to hundreds of nanoliters of solutions can be directly dispensed to the support. Incorporating gramicidin ion channels into BLMs on the MSPC support has confirmed the formation of single BLMs, which is based on the observation from current signals of 20 pS conductance that is typical to single channel opening. Based on the bilayer capacitance (1.4 pF), about 15% of through pores across the MSPC membrane are estimated to be covered with BLMs. PMID:26015832

  14. EBNA2 Drives Formation of New Chromosome Binding Sites and Target Genes for B-Cell Master Regulatory Transcription Factors RBP-jκ and EBF1

    PubMed Central

    Lu, Fang; Chen, Horng-Shen; Kossenkov, Andrew V.; DeWispeleare, Karen; Won, Kyoung-Jae; Lieberman, Paul M.

    2016-01-01

    Epstein-Barr Virus (EBV) transforms resting B-lymphocytes into proliferating lymphoblasts to establish latent infections that can give rise to malignancies. We show here that EBV-encoded transcriptional regulator EBNA2 drives the cooperative and combinatorial genome-wide binding of two master regulators of B-cell fate, namely EBF1 and RBP-jκ. Previous studies suggest that these B-cell factors are statically bound to target gene promoters. In contrast, we found that EBNA2 induces the formation of new binding for both RBP-jκ and EBF1, many of which are in close physical proximity in the cellular and viral genome. These newly induced binding sites co-occupied by EBNA2-EBF1-RBP-jκ correlate strongly with transcriptional activation of linked genes that are important for B-lymphoblast function. Conditional expression or repression of EBNA2 leads to a rapid alteration in RBP-jκ and EBF1 binding. Biochemical and shRNA depletion studies provide evidence for cooperative assembly at co-occupied sites. These findings reveal that EBNA2 facilitate combinatorial interactions to induce new patterns of transcription factor occupancy and gene programming necessary to drive B-lymphoblast growth and survival. PMID:26752713

  15. EBNA2 Drives Formation of New Chromosome Binding Sites and Target Genes for B-Cell Master Regulatory Transcription Factors RBP-jκ and EBF1.

    PubMed

    Lu, Fang; Chen, Horng-Shen; Kossenkov, Andrew V; DeWispeleare, Karen; Won, Kyoung-Jae; Lieberman, Paul M

    2016-01-01

    Epstein-Barr Virus (EBV) transforms resting B-lymphocytes into proliferating lymphoblasts to establish latent infections that can give rise to malignancies. We show here that EBV-encoded transcriptional regulator EBNA2 drives the cooperative and combinatorial genome-wide binding of two master regulators of B-cell fate, namely EBF1 and RBP-jκ. Previous studies suggest that these B-cell factors are statically bound to target gene promoters. In contrast, we found that EBNA2 induces the formation of new binding for both RBP-jκ and EBF1, many of which are in close physical proximity in the cellular and viral genome. These newly induced binding sites co-occupied by EBNA2-EBF1-RBP-jκ correlate strongly with transcriptional activation of linked genes that are important for B-lymphoblast function. Conditional expression or repression of EBNA2 leads to a rapid alteration in RBP-jκ and EBF1 binding. Biochemical and shRNA depletion studies provide evidence for cooperative assembly at co-occupied sites. These findings reveal that EBNA2 facilitate combinatorial interactions to induce new patterns of transcription factor occupancy and gene programming necessary to drive B-lymphoblast growth and survival. PMID:26752713

  16. The formation of phosphoran olivine and stanfieldite from the pyrometamorphic breakdown of apatite in slags from a prehistoric ritual immolation site (Goldbichl, Igls, Tyrol, Austria)

    NASA Astrophysics Data System (ADS)

    Schneider, Philipp; Tropper, Peter; Kaindl, Reinhard

    2013-04-01

    the M1 2+ and M2 2+ positions and the formation of vacancies on these sites. Since micro-Raman investigations of the TCP phase yielded no conclusive match with a known Raman spectrum of a phosphate mineral so far, therefore it is most likely that the TCP phase is stanfieldite, whose Raman spectrum has not been obtained yet. Schematical Schreinemakers analysis in the system CaO-Al2O3-FeO-SiO2-P2O5-H2O shows that P-rich olivine (fayalite-sarcopside solid solution) can form from mineral reactions involving chlorite, apatite and quartz and show that the occurrence of P-rich Fe-olivines spans a large T-range but is restricted to domains with high aSiO2. The mineral assemblage in the P-rich micro-domains shows that the formation of phosphoran olivine is not only restricted to the interaction between bone material and rocks in slags from ritual immolation sites as suggested by Tropper et al. (Eur J Mineral 16:631-640, 2004) from the immolation site in Oetz but can form locally due to the pyrometamorphic breakdown of a P-rich accessory precursor phase such as apatite.

  17. Mapping of contact sites in complex formation between transducin and light-activated rhodopsin by covalent crosslinking: use of a photoactivatable reagent.

    PubMed

    Cai, K; Itoh, Y; Khorana, H G

    2001-04-24

    Interaction of light-activated rhodopsin with transducin (T) is the first event in visual signal transduction. We use covalent crosslinking approaches to map the contact sites in interaction between the two proteins. Here we use a photoactivatable reagent, N-[(2-pyridyldithio)-ethyl], 4-azido salicylamide. The reagent is attached to the SH group of cytoplasmic monocysteine rhodopsin mutants by a disulfide-exchange reaction with the pyridylthio group, and the derivatized rhodopsin then is complexed with T by illumination at lambda >495 nm. Subsequent irradiation of the complex at lambda310 nm generates covalent crosslinks between the two proteins. Crosslinking was demonstrated between T and a number of single cysteine rhodopsin mutants. However, sites of crosslinks were investigated in detail only between T and the rhodopsin mutant S240C (cytoplasmic loop V-VI). Crosslinking occurred predominantly with T(alpha). For identification of the sites of crosslinks in T(alpha), the strategy used involved: (i) derivatization of all of the free cysteines in the crosslinked proteins with N-ethylmaleimide; (ii) reduction of the disulfide bond linking the two proteins and isolation of all of the T(alpha) species carrying the crosslinked moiety with a free SH group; (iii) adduct formation of the latter with the N-maleimide moiety of the reagent, maleimido-butyryl-biocytin, containing a biotinyl group; (iv) trypsin degradation of the resulting T(alpha) derivatives and isolation of T(alpha) peptides carrying maleimido-butyryl-biocytin by avidin-agarose chromatography; and (v) identification of the isolated peptides by matrix-assisted laser desorption/ionization time-of-flight mass spectrometry. We found that crosslinking occurred mainly to two C-terminal peptides in T(alpha) containing the amino acid sequences 310-313 and 342-345. PMID:11320237

  18. Effect of Siloxane Ring Strain and Cation Charge Density on the Formation of Coordinately Unsaturated Metal Sites on Silica: Insights from DFT Studies

    SciTech Connect

    Das, Ujjal; Zhang, Guanghui; Hu, Bo; Hock, Adam S.; Redfern, Paul C.; Miller, Jeffrey T.; Curtiss, Larry A.

    2015-12-01

    Amorphous silica (SiO2) is commonly used as a support in heterogeneous catalysis. However, due to the structural disorder and temperature induced change of surface morphology, the structures of silica supported metal catalysts are difficult to determine. Most studies are primarily focused on understanding the interactions of different types of surface hydroxyl groups with metal ions. In comparison, the effect of siloxane ring size on the structure of silica supported metal catalysts and how it affects catalytic activity is poorly understood. Here, we have used density functional theory calculations to understand the effect of siloxane ring strain on structure and activity of different monomeric Lewis acid metal sites on silica. In particular, we have found that large siloxane rings favor strong dative bonding interaction between metal ion and surface hydroxyls, leading to the formation of high-coordinate metal sites. In comparison, metal-silanol interaction is weak in small siloxane rings, resulting in low-coordinate metal sites. The physical origin of this size dependence is associated with siloxane ring strain, and, a correlation between metal-silanol interaction energy and ring strain energy has been observed. In addition to ring strain, the strength of the metal-silanol interaction also depends on the positive charge density of the cations. In fact, a correlation also exists between metal-silanol interaction energy and charge density of several first-row transition and post-transition metals. The theoretical results are compared with the EXAFS data of monomeric Zn(II) and Ga(III) ions grafted on silica. The molecular level insights of how metal ion coordination on silica depends on siloxane ring strain and cation charge density will be useful in the synthesis of new catalysts.

  19. Nuclear, chemical and biological characterization of formation histories of ironstones from several sites in Southern California: Dominant role of bacterial activity

    NASA Astrophysics Data System (ADS)

    Lal, D.; Schopf, J. W.; Abbott, P. L.; Vacher, L.; Jull, A. J. T.; McHargue, L.

    2010-08-01

    Pebble-sized sandstone concretions, cemented by iron and manganese oxides, are found in several semi-arid regions in the world. Although recognized for a long time, their formation mechanisms have not yet been constrained from scientific studies. We have made extensive studies of the chemical composition, cosmogenic 10Be and radiogenic U/Th concentrations, and biological fossils in ironstones from six sites in southern California. The ironstones exhibit appreciable enrichments of Mn, Zn, Mg, Ti, Fe, U, Th, and fossil bacteria. In addition to elemental data, we report here first observations of radionuclides, U, Th, K, and concentrations of cosmogenic 10Be which we show are an excellent indicator of precipitation amounts. Our data favor the model that the ironstones formed within sandy beach ridges during wetter climates following dry climates during which aeolian sediment was added to the beach ridges. Iron, Mn, Zn and other trace element-rich leachates from the dust layers nurtured and accelerated bacterial activity in the beach ridges down to depths of a few meters, as first suggested by Abbott (1981). Our observations of trace-element enrichments and bacterial fossils support the model proposed by Abbott and underscore the fact that the ironstones are principally a product of bacterial activity, which concentrates the leachates in a narrow layer within the beach ridges. The extreme alternating dry/wet climatic conditions which existed in the past in southern California led to the formation of ironstone concretions within the ancient beach ridges, which provided suitable host mineralogy for their formation. The time periods represented by the ironstones from the six sites presumably cover the past ˜ 1 my. The recent surface explorations on the surface of Mars by the rovers SPIRIT and OPPORTUNITY (Squyres et al., 2006), showed that similar to southern California, extreme climatic conditions existed on Mars in its early history. It therefore seems that studies of

  20. Repeated occurrences of methanogenic zones, diagenetic dolomite formation and linked silicate alteration in southern Bering Sea sediments (Bowers Ridge, IODP Exp. 323 Site U1341)

    NASA Astrophysics Data System (ADS)

    Wehrmann, L. M.; Ockert, C.; Mix, A. C.; Gussone, N.; Teichert, B. M. A.; Meister, P.

    2016-03-01

    porewater calcium was also influenced by ammonium-calcium exchange on clay minerals and carbonate recrystallization. Our study elucidates the response of porewater element concentrations and isotopic profiles interlinked with the formation of diagenetic carbonates to changes in the deposition of organic carbon in sediments of deeper water sites (>2000 m water depth) over prolonged timescales. It shows that variations in biogeochemical processes in response to changes in oceanographic conditions and a dynamic subseafloor biogeochemical zonation have to also be taken into account at these deep water sites for a global assessment of organic carbon burial fluxes and remineralization.

  1. The mechanism of formation of the seafloor massive sulfide ore body beneath the seafloor at HAKUREI Site in Izena Caldera, Middle Okinawa Trough

    NASA Astrophysics Data System (ADS)

    Yoshizumi, R.; Urabe, T.

    2012-12-01

    dominant at lower of the ore, relatively. The existence of "Black ore (sphalerite-galena ore)" at upper part and "Yellow ore (chalcopyrite-pyrite ore)" at lower part of the Lower ore indicate that the SMS ore beneath the seafloor has already the characteristic mineral assemblage of Kuroko ore deposit at the time of formation. Fe content in Sphalerite is over 6wt% in the Upper ore and under 1wt% in the Lower ore, respectively, which shows that the Lower ore is formed under high Sulfur and Oxygen fugacity than Upper ore if the temperature of formation is not very different each other. Barite occurs not only in the Upper ore, but also in the Lower ore and the crystal size becomes coarser downwards. These lines of evidence imply that the existence of the Lower ore indicates that the mineralization has been repeated in the HAKUREI site. This study is a part of "TAIGA" project funded by Grant-in-Aid program by Monbusho.t; t;

  2. A selective, slow binding inhibitor of factor VIIa binds to a nonstandard active site conformation and attenuates thrombus formation in vivo.

    PubMed

    Olivero, Alan G; Eigenbrot, Charles; Goldsmith, Richard; Robarge, Kirk; Artis, Dean R; Flygare, John; Rawson, Thomas; Sutherlin, Daniel P; Kadkhodayan, Saloumeh; Beresini, Maureen; Elliott, Linda O; DeGuzman, Geralyn G; Banner, David W; Ultsch, Mark; Marzec, Ulla; Hanson, Stephen R; Refino, Canio; Bunting, Stuart; Kirchhofer, Daniel

    2005-03-11

    The serine protease factor VIIa (FVIIa) in complex with its cellular cofactor tissue factor (TF) initiates the blood coagulation reactions. TF.FVIIa is also implicated in thrombosis-related disorders and constitutes an appealing therapeutic target for treatment of cardiovascular diseases. To this end, we generated the FVIIa active site inhibitor G17905, which displayed great potency toward TF.FVIIa (Ki = 0.35 +/- 0.11 nM). G17905 did not appreciably inhibit 12 of the 14 examined trypsin-like serine proteases, consistent with its TF.FVIIa-specific activity in clotting assays. The crystal structure of the FVIIa.G17905 complex provides insight into the molecular basis of the high selectivity. It shows that, compared with other serine proteases, FVIIa is uniquely equipped to accommodate conformational disturbances in the Gln217-Gly219 region caused by the ortho-hydroxy group of the inhibitor's aminobenzamidine moiety located in the S1 recognition pocket. Moreover, the structure revealed a novel, nonstandard conformation of FVIIa active site in the region of the oxyanion hole, a "flipped" Lys192-Gly193 peptide bond. Macromolecular substrate activation assays demonstrated that G17905 is a noncompetitive, slow-binding inhibitor. Nevertheless, G17905 effectively inhibited thrombus formation in a baboon arterio-venous shunt model, reducing platelet and fibrin deposition by approximately 70% at 0.4 mg/kg + 0.1 mg/kg/min infusion. Therefore, the in vitro potency of G17905, characterized by slow binding kinetics, correlated with efficacious antithrombotic activity in vivo. PMID:15632123

  3. Characterization of DNA end joining in a mammalian cell nuclear extract: junction formation is accompanied by nucleotide loss, which is limited and uniform but not site specific.

    PubMed Central

    Nicolás, A L; Young, C S

    1994-01-01

    Mammalian cells have a marked capacity to repair double-strand breaks in DNA, but the molecular and biochemical mechanisms underlying this process are largely unknown. A previous report has described an activity from mammalian cell nuclei that is capable of multimerizing blunt-ended DNA substrates (R. Fishel, M.K. Derbyshire, S.P. Moore, and C.S.H. Young, Biochimie 73:257-267, 1991). In this report, we show that nuclear extracts from HeLa cells contain activities which preferentially join linear plasmid substrates in either a head-to-head or tail-to-tail configuration, that the joining reaction is covalent, and that the joining is accompanied by loss of sequence at the junction. Sequencing revealed that there was a loss of a uniform number of nucleotides from junctions formed from any one type of substrate. The loss was not determined by any simple site-specific mechanism, but the number of nucleotides lost was affected by the precise terminal sequence. There was no major effect on the efficiency or outcome of the joining reaction with substrates containing blunt ends or 3' or 5' protruding ends. Using a pair of plasmid molecules with distinguishable restriction enzyme sites, we also observed that blunt-ended DNA substrates could join with those containing protruding 3' ends. As with the junctions formed between molecules with identical ends, there was uniform loss of nucleotides. Taken together, the data are consistent with two models for the joining reaction in which molecules are aligned either throughout most of their length or by using small sequence homologies located toward their ends. Although either model can explain the preferential formation of head-to-head and tail-to-tail products, the latter predicts the precise lossof nucleotides observed. These activities are found in all cell lines examined so far and most likely represent an important repair activity of the mammalian cell. Images PMID:8264584

  4. Investigation of the Davis Sandstone (Ft. Worth Basin, Texas) as a suitable formation for the GRI Hydraulic Fracture Test Site. Topical report, March 1992

    SciTech Connect

    Collins, E.; Laubach, S.; Dutton, S.; Kukal, G.; Robinson, B.

    1992-03-01

    The concept of the GRI Hydraulic Fracture Test Site (HFTS) was to provide a field laboratory to (1) validate 3-dimensional hydraulic fracture models in tight gas sandstone and (2) develop technology in fracture diagnostics and stimulation. The Davis sandstone in the Ft. Worth Basin, north-central Texas, was initially selected as a viable candidate formation for HFTS research based on the results of a co-op well program initiated with Dallas Production. To gather comprehensive data on a specific site for HFTS research, the S.A. Holditch and Associates Data Well No. 1 was drilled in June 1991. The results of geological, petrophysical and engineering analyses of the co-ops and data well are the basis of the report. These analyses indicate that in northern Parker and southern Wise Counties, Texas, the Davis sediments range from 250 to 350 ft thick. A broadly-continuous, 100-ft thick interval in the upper part of the gross interval comprises the Davis Reservoir. The average permeability of the Davis Reservoir was found to be 0.08 md with an average closure stress of 0.45 psi/ft. The shale barriers above and below the Davis had average closure stress of 0.63 to 0.73 psi/ft and 0.88 to 0.98 psi/ft, respectively. Hydraulic fracture azimuth was found to range from N10 E to N20 E. Drainage area from production analyses was calculated to be 48.7 acres in northwest Parker County. Natural fractures were encountered in the Davis, causing severe drilling problems in Data Well No. 1. Further work in the Davis was therefore suspended.

  5. Evaluation of small-loop transient electromagnetic soundings to locate the Sherwood Sandstone aquifer and confining formations at well sites in the Vale of York, England

    NASA Astrophysics Data System (ADS)

    Meju, M. A.; Fenning, P. J.; Hawkins, T. R. W.

    2000-05-01

    Shallow-depth transient electromagnetic (TEM) soundings have been performed at six borehole locations in an intensively farmed area in northern England to evaluate their usefulness in mapping geological formations under a thick cover of glacial drift deposits. The regionally important Triassic Sherwood Sandstone (SS) Group aquifer is directly overlain by Triassic Mercia Mudstone in the eastern two-thirds of the study area and by drift deposits in the west. Owing to the difficulty of deploying large loops and the overriding need to minimize lateral effects on the depth probes, square transmitter loops of 20, 40 and 50-m side-lengths were deployed in the central-loop configuration with the Geonics EM47 and PROTEM47/57 field equipment. Using a two-stage data interpretation technique, it is found that the effective depth of mapping ranged from about 8 to 150 m at most sounding locations. Comparison of inversion models with borehole data shows that the SS and some overlying sedimentary rocks may be discerned from the TEM soundings; there is a consistent pattern of resistivity distribution within each geological formation at all the borehole sites enabling a realistic identification of the key stratal units. However, a 7-11-m-thick upper layer is found in all the constructed models, which does not correlate with any known formation boundaries, but appears to be justified by comparison with sample dc resistivity soundings at two locations; it would also appear that the earliest time windows (<0.016 ms) are somewhat distorted by the band-limitation operation of the TEM instrumentation. This pilot study demonstrates that the TEM method is a potent tool for stratigraphic mapping in the region, but the upper 5-8 m remains largely inaccessible to the method using state-of-the-art equipment and conventional data processing techniques. It may therefore be necessary to combine TEM and short spread-length ( AB/2≤25 m) dc resistivity depth soundings to accurately map the near

  6. Discriminatory profile of rDNA sites and trend for acrocentric chromosome formation in the genus Trachinotus Lacépède, 1801 (Perciformes, Carangidae).

    PubMed

    Jacobina, Uedson Pereira; Vicari, Marcelo Ricardo; Bertollo, Luiz Antonio Carlos; Molina, Wagner Franco

    2012-01-01

    Chromosomal traits have provided valuable information for phylogeny and taxonomy of several fish groups. Three Atlantic Carangidae species of the genus Trachinotus Lacépède, 1801 (Trachinotus goodei Jordan et Evermann, 1896, Trachinotus carolinus (Linnaeus, 1766)and Trachinotus falcatus (Linnaeus, 1758)) were investigated, having 2n=48 chromosomes but different chromosomal arms (FN number), i.e., 52, 56 and 58, respectively, in view of the different number of two-armed chromosomes found in their karyotypes. Thus, Trachinotus goodei, Trachinotus carolinus and Trachinotus falcatus present a progressive distancefrom the probable basal karyotype proposed for Perciformes (2n=48 acrocentrics, FN=48). At first sight, these findings do not agree with the phylogenetic hypothesis based on mitochondrial sequences, where Trachinotus goodei appear as the most derived species, followed by Trachinotus falcatus and Trachinotus carolinus, respectively. However, the chromosomal mapping of ribosomal DNAs was informative for clarifying this apparent conflict. Indeed, the multiple 5S and 18S rDNA sites found in Trachinotus goodei corroborate the most derived condition for this species. In this sense, the occurrence of the unexpected number of two-armed chromosomes and FN value for this species, as well as for Trachinotus carolinus, must be due to additional rounds of acrocentric formation in these species, modifying the macrostructure of their karyotypes. PMID:24260676

  7. CO 2-rock-brine interactions in Lower Tuscaloosa Formation at Cranfield CO 2 sequestration site, Mississippi, U.S.A.

    USGS Publications Warehouse

    Lu, J.; Kharaka, Y.K.; Thordsen, J.J.; Horita, J.; Karamalidis, A.; Griffith, C.; Hakala, J.A.; Ambats, G.; Cole, D.R.; Phelps, T.J.; Manning, M.A.; Cook, P.J.; Hovorka, S.D.

    2012-01-01

    A highly integrated geochemical program was conducted at the Cranfield CO 2-enhanced oil recovery (EOR) and sequestration site, Mississippi, U.S.A.. The program included extensive field geochemical monitoring, a detailed petrographic study, and an autoclave experiment under in situ reservoir conditions. Results show that mineral reactions in the Lower Tuscaloosa reservoir were minor during CO 2 injection. Brine chemistry remained largely unchanged, which contrasts with significant changes observed in other field tests. Field fluid sampling and laboratory experiments show consistently slow reactions. Carbon isotopic composition and CO 2 content in the gas phase reveal simple two-end-member mixing between injected and original formation gas. We conclude that the reservoir rock, which is composed mainly of minerals with low reactivity (average quartz 79.4%, chlorite 11.8%, kaolinite 3.1%, illite 1.3%, concretionary calcite and dolomite 1.5%, and feldspar 0.2%), is relatively unreactive to CO 2. The significance of low reactivity is both positive, in that the reservoir is not impacted, and negative, in that mineral trapping is insignificant. ?? 2011.

  8. Discriminatory profile of rDNA sites and trend for acrocentric chromosome formation in the genus Trachinotus Lacépède, 1801 (Perciformes, Carangidae)

    PubMed Central

    Jacobina, Uedson Pereira; Vicari, Marcelo Ricardo; Bertollo, Luiz Antonio Carlos; Molina, Wagner Franco

    2012-01-01

    Abstract Chromosomal traits have provided valuable information for phylogeny and taxonomy of several fish groups. Three Atlantic Carangidae species of the genus Trachinotus Lacépède, 1801 (Trachinotus goodei Jordan et Evermann, 1896, Trachinotus carolinus (Linnaeus, 1766)and Trachinotus falcatus (Linnaeus, 1758)) were investigated, having 2n=48 chromosomes but different chromosomal arms (FN number), i.e., 52, 56 and 58, respectively, in view of the different number of two-armed chromosomes found in their karyotypes. Thus, Trachinotus goodei, Trachinotus carolinus and Trachinotus falcatus present a progressive distancefrom the probable basal karyotype proposed for Perciformes (2n=48 acrocentrics, FN=48). At first sight, these findings do not agree with the phylogenetic hypothesis based on mitochondrial sequences, where Trachinotus goodei appear as the most derived species, followed by Trachinotus falcatus and Trachinotus carolinus, respectively. However, the chromosomal mapping of ribosomal DNAs was informative for clarifying this apparent conflict. Indeed, the multiple 5S and 18S rDNA sites found in Trachinotus goodei corroborate the most derived condition for this species. In this sense, the occurrence of the unexpected number of two-armed chromosomes and FN value for this species, as well as for Trachinotus carolinus, must be due to additional rounds of acrocentric formation in these species, modifying the macrostructure of their karyotypes. PMID:24260676

  9. Substitution of glutamine for lysine at the pyridoxal phosphate binding site of bacterial D-amino acid transaminase. Effects of exogenous amines on the slow formation of intermediates.

    PubMed

    Futaki, S; Ueno, H; Martinez del Pozo, A; Pospischil, M A; Manning, J M; Ringe, D; Stoddard, B; Tanizawa, K; Yoshimura, T; Soda, K

    1990-12-25

    In bacterial D-amino acid transaminase, Lys-145, which binds the coenzyme pyridoxal 5'-phosphate in Schiff base linkage, was changed to Gln-145 by site-directed mutagenesis (K145Q). The mutant enzyme had 0.015% the activity of the wild-type enzyme and was capable of forming a Schiff base with D-alanine; this external aldimine was formed over a period of minutes depending upon the D-alanine concentration. The transformation of the pyridoxal-5'-phosphate form of the enzyme to the pyridoxamine-5'-phosphate form (i.e. the half-reaction of transamination) occurred over a period of hours with this mutant enzyme. Thus, information on these two steps in the reaction and on the factors that influence them can readily be obtained with this mutant enzyme. In contrast, these reactions with the wild-type enzyme occur at much faster rates and are not easily studied separately. The mutant enzyme shows distinct preference for D- over L-alanine as substrates but it does so about 50-fold less effectively than the wild-type enzyme. Thus, Lys-145 probably acts in concert with the coenzyme and other functional side chain(s) to lead to efficient and stereochemically precise transamination in the wild-type enzyme. The addition of exogenous amines, ethanolamine or methyl amine, increased the rate of external aldimine formation with D-alanine and the mutant enzyme but the subsequent transformation to the pyridoxamine-5'-phosphate form of the enzyme was unaffected by exogenous amines. The wild-type enzyme displayed a large negative trough in the circular dichroic spectrum at 420 nm, which was practically absent in the mutant enzyme. However, addition of D-alanine to the mutant enzyme generated this negative Cotton effect (due to formation of the external aldimine with D-alanine). This circular dichroism band gradually collapsed in parallel with the transformation to the pyridoxamine-5'-phosphate enzyme. Further studies on this mutant enzyme, which displays the characteristics of the wild

  10. A Model for the Active-Site Formation Process in DMSO Reductase Family Molybdenum Enzymes Involving Oxido-Alcoholato and Oxido-Thiolato Molybdenum(VI) Core Structures.

    PubMed

    Sugimoto, Hideki; Sato, Masanori; Asano, Kaori; Suzuki, Takeyuki; Mieda, Kaoru; Ogura, Takashi; Matsumoto, Takashi; Giles, Logan J; Pokhrel, Amrit; Kirk, Martin L; Itoh, Shinobu

    2016-02-15

    New bis(ene-1,2-dithiolato)-oxido-alcoholato molybdenum(VI) and -oxido-thiolato molybdenum(VI) anionic complexes, denoted as [Mo(VI)O(ER)L2](-) (E = O, S; L = dimethoxycarboxylate-1,2-ethylenedithiolate), were obtained from the reaction of the corresponding dioxido-molybdenum(VI) precursor complex with either an alcohol or a thiol in the presence of an organic acid (e.g., 10-camphorsulfonic acid) at low temperature. The [Mo(VI)O(ER)L2](-) complexes were isolated and characterized, and the structure of [Mo(VI)O(OEt)L2](-) was determined by X-ray crystallography. The Mo(VI) center in [Mo(VI)O(OEt)L2](-) exhibits a distorted octahedral geometry with the two ene-1,2-dithiolate ligands being symmetry inequivalent. The computed structure of [Mo(VI)O(SR)L2](-) is essentially identical to that of [Mo(VI)O(OR)L2](-). The electronic structures of the resulting molybdenum(VI) complexes were evaluated using electronic absorption spectroscopy and bonding calculations. The nature of the distorted O(h) geometry in these [Mo(VI)O(EEt)L2](-) complexes results in a lowest unoccupied molecular orbital wave function that possesses strong π* interactions between the Mo(d(xy)) orbital and the cis S(p(z)) orbital localized on one sulfur donor from a single ene-1,2-dithiolate ligand. The presence of a covalent Mo-S(dithiolene) bonding interaction in these monooxido Mo(VI) compounds contributes to their low-energy ligand-to-metal charge transfer transitions. A second important d-p π bonding interaction derives from the ∼180° O(oxo)-Mo-E-C dihedral angle involving the alcoholate and thiolate donors, and this contributes to ancillary ligand contributions to the electronic structure of these species. The formation of [Mo(VI)O(OEt)L2](-) and [Mo(VI)O(SEt)L2](-) from the dioxidomolybdenum(VI) precursor may be regarded as a model for the active-site formation process that occurs in the dimethyl sulfoxide reductase family of pyranopterin molybdenum enzymes. PMID:26816115

  11. Hydrothermal Alteration of Glass from Underground Nuclear Tests: Formation and Transport of Pu-clay Colloids at the Nevada National Security Site

    SciTech Connect

    Zavarin, M.; Zhao, P.; Joseph, C.; Begg, J.; Boggs, M.; Dai, Z.; Kersting, A. B.

    2015-05-27

    The testing of nuclear weapons at the Nevada National Security Site (NNSS), formerly the Nevada Test Site (NTS), has led to the deposition of substantial quantities of plutonium into the environment. Approximately 2.8 metric tons (3.1×104 TBq) of Pu were deposited in the NNSS subsurface as a result of underground nuclear testing. While 3H is the most abundant anthropogenic radionuclide deposited in the NNSS subsurface (4.7×106 TBq), plutonium is the most abundant from a molar standpoint. The only radioactive elements in greater molar abundance are the naturally occurring K, Th, and U isotopes. 239Pu and 240Pu represent the majority of alpha-emitting Pu isotopes. The extreme temperatures associated with underground nuclear tests and the refractory nature of Pu results in most of the Pu (98%) being sequestered in melted rock, referred to as nuclear melt glass (Iaea, 1998). As a result, Pu release to groundwater is controlled, in large part, by the leaching (or dissolution) of nuclear melt glass over time. The factors affecting glass dissolution rates have been studied extensively. The dissolution of Pu-containing borosilicate nuclear waste glasses at 90ºC has been shown to lead to the formation of dioctahedral smectite colloids. Colloid-facilitated transport of Pu at the NNSS has been observed. Recent groundwater samples collected from a number of contaminated wells have yielded a wide range of Pu concentrations from 0.00022 to 2.0 Bq/L. While Pu concentrations tend to fall below the Maximum Contaminant Level (MCL) established by the Environmental Protection Agency (EPA) for drinking water (0.56 Bq/L), we do not yet understand what factors limit the Pu concentration or its transport behavior. To quantify the upper limit of Pu concentrations produced as a result of melt glass dissolution and determine the nature of colloids and Pu associations, we performed a 3 year nuclear melt glass dissolution experiment

  12. Soil use and hydraulic systems in the Terramara S. Rosa (Poviglio, northern Italy). The role of micromorphology in decrypting site formation processes

    NASA Astrophysics Data System (ADS)

    Cremaschi, Mauro; Chiara, Pizzi

    2010-05-01

    The S. Rosa moated site (Terramara), which dates back to the Middle-Recent Bronze age, is under excavation since 1984, by the Soprintendenza ai Beni Archeologici dell Emilia Romagna, in cooperation with the Università degli Studi di Milano, CNR-IDPA of Milano, and the sponsorship of the Comune di Poviglio and Coopsette. The field seasons of the last ten years were concentrated in the south-western part of the fringe of the site and the adjoining ditch, and unearthed a complex hydraulic system composed of several wells, the moat, a canal converging to it, and minor ditches connecting these structure to the countryside surrounding the Terramara. During the early phase of occupation (late Middle Bronze age), a large number of wells, located at the fringe of the village, in coincidence with the fence were dug to reach the water table. They were kept in use for a long time and the water extracted from them was not directed to the interior of the village but it was carried inside the moat throughout a system of ditches. Outside the moat, a large canal has been recently discovered. Its large size and the sophisticated knowledge in hydraulic engineering that its construction required, make it the first archaeological proof of a large scale water management during the Bronze Age. During the last phase of the village (late Recent Bronze age) the wells of the fence and the canal were deactivated and the flow inside the moat interrupted. Consequently, more wells were excavated in a very short time at the bottom of the moat, as indicated by refitting of the potsherds included in the fill. These wells are surrounded by reservoirs connected by small ditches to make the extracted water available to be used at the outer fringe of the moat. An intensive program of micromorphological studies has been undertaken to reconstruct the formation processes of the excavated deposits. Thin section study led to the differentiation of long lasting phases of use, maintenance and abandonment on

  13. GOLPH3 Is Essential for Contractile Ring Formation and Rab11 Localization to the Cleavage Site during Cytokinesis in Drosophila melanogaster

    PubMed Central

    Sechi, Stefano; Frappaolo, Anna; Raffa, Grazia D.; Fuller, Margaret T.; Giansanti, Maria Grazia

    2014-01-01

    The highly conserved Golgi phosphoprotein 3 (GOLPH3) protein has been described as a Phosphatidylinositol 4-phosphate [PI(4)P] effector at the Golgi. GOLPH3 is also known as a potent oncogene, commonly amplified in several human tumors. However, the molecular pathways through which the oncoprotein GOLPH3 acts in malignant transformation are largely unknown. GOLPH3 has never been involved in cytokinesis. Here, we characterize the Drosophila melanogaster homologue of human GOLPH3 during cell division. We show that GOLPH3 accumulates at the cleavage furrow and is required for successful cytokinesis in Drosophila spermatocytes and larval neuroblasts. In premeiotic spermatocytes GOLPH3 protein is required for maintaining the organization of Golgi stacks. In dividing spermatocytes GOLPH3 is essential for both contractile ring and central spindle formation during cytokinesis. Wild type function of GOLPH3 enables maintenance of centralspindlin and Rho1 at cell equator and stabilization of Myosin II and Septin rings. We demonstrate that the molecular mechanism underlying GOLPH3 function in cytokinesis is strictly dependent on the ability of this protein to interact with PI(4)P. Mutations that abolish PI(4)P binding impair recruitment of GOLPH3 to both the Golgi and the cleavage furrow. Moreover telophase cells from mutants with defective GOLPH3-PI(4)P interaction fail to accumulate PI(4)P-and Rab11-associated secretory organelles at the cleavage site. Finally, we show that GOLPH3 protein interacts with components of both cytokinesis and membrane trafficking machineries in Drosophila cells. Based on these results we propose that GOLPH3 acts as a key molecule to coordinate phosphoinositide signaling with actomyosin dynamics and vesicle trafficking during cytokinesis. Because cytokinesis failures have been associated with premalignant disease and cancer, our studies suggest novel insight into molecular circuits involving the oncogene GOLPH3 in cytokinesis. PMID:24786584

  14. Analysis of Site Formation and Assemblage Integrity Does Not Support Attribution of the Uluzzian to Modern Humans at Grotta del Cavallo.

    PubMed

    Zilhão, João; Banks, William E; d'Errico, Francesco; Gioia, Patrizia

    2015-01-01

    Based on the morphology of two deciduous molars and radiocarbon ages from layers D and E of the Grotta del Cavallo (Lecce, Italy), assigned to the Uluzzian, it has been proposed that modern humans were the makers of this Early Upper Paleolithic culture and that this finding considerably weakens the case for an independent emergence of symbolism among western European Neandertals. Reappraisal of the new dating evidence, of the finds curated in the Taranto Antiquities depot, and of coeval publications detailing the site's 1963-66 excavations shows that (a) Protoaurignacian, Aurignacian and Early Epigravettian lithics exist in the assemblages from layers D and E, (b) even though it contains both inherited and intrusive items, the formation of layer D began during Protoaurignacian times, and (c) the composition of the extant Cavallo assemblages is influenced in a non-negligible manner by the post-hoc assignment of items to stratigraphic units distinct from that of original discovery. In addition, a major disturbance feature affected the 1960s excavation trench down to Mousterian layer F, this feature went unrecognized until 1964, the human remains assigned to the Uluzzian were discovered that year and/or the previous year, and there are contradictions between field reports and the primary anthropological description of the remains as to their morphology and level of provenience. Given these major contextual uncertainties, the Cavallo teeth cannot be used to establish the authorship of the Uluzzian. Since this technocomplex's start date is ca. 45,000 calendar years ago, a number of Neandertal fossils are dated to this period, and the oldest diagnostic European modern human fossil is the <41,400 year-old Oase 1 mandible, Neandertal authorship of the Uluzzian remains the parsimonious reading of the evidence. PMID:26154139

  15. Characterization of Isoprene-Derived Secondary Organic Aerosol Formation at the Look Rock Site during the 2013 Southern Oxidant and Aerosol Study (SOAS)

    NASA Astrophysics Data System (ADS)

    Budisulistiorini, S.; Li, X.; Bairai, S. T.; Hicks, W.; Renfro, J.; Corrigan, A. L.; Guzman, J. M.; Russell, L. M.; Liu, Y.; McKinney, K. A.; Zhang, X.; Cappa, C. D.; Zimmermann, K.; Bertram, T. H.; Canagaratna, M. R.; Croteau, D.; Worsnop, D. R.; Jayne, J. T.; Zhang, Z.; Gold, A.; Surratt, J. D.

    2013-12-01

    Although isoprene is considered as the single largest source of secondary organic aerosol (SOA), the exact manner in which it forms remains unclear. Improving our fundamental understanding of isoprene-derived SOA will be key to improving existing air quality models, especially in the southeastern U.S. where models currently underestimate observations. Reactive epoxides, which include methacrylic acid epoxide (MAE) and isomeric isoprene epoxydiols (IEPOX), produced from the oxidation of isoprene have recently been demonstrated to lead to SOA through heterogeneous chemistry. Anthropogenic pollutants (NOx and SO2) have been shown to enhance isoprene-derived epoxides as a source of SOA. One of the major aims during SOAS was to examine how anthropogenic pollutants impact isoprene SOA formation and its climate-relevant properties. To address this aim, we deployed both an Aerodyne aerosol chemical speciation monitor (ACSM) and a chemical ionization high-resolution time-of-flight mass spectrometer (CI-HR-TOFMS) at the Look Rock (LRK) site in the Great Smoky Mountains National Park, TN, from June 1 to July 15, 2013. In addition, high-volume PM2.5 samplers collected daily (8AM-7AM), day (8AM-7PM), and night (8PM-7AM) samples onto quartz filters. On days that LRK was forecasted to have high isoprene, SO4 (sulfate), and NOx levels, PM2.5 were collected more frequently (8AM-11AM, 12PM-3PM, 4PM-7PM, and 8PM-7AM). Filters were analyzed for known isoprene-derived SOA tracers (2-methyltetrols, 2-methylglyceric acid, C5-alkene triols, 3-methyltetrahydrofuran-3,4-diols, and organosulfates) by gas chromatography/mass spectrometry and ultra performance liquid chromatography coupled to diode array detection and electrospray ionization high-resolution quadrupole time-of-flight mass spectrometry. The average non-refractory PM1 mass measured by the ACSM was 3.87 μg m-3, with organic, sulfate, ammonium, nitrate and chloride contributing 64.4%, 24.1%, 7.6%, 3.8%, and 0.1%, respectively

  16. Gas-particle concentrations of atmospheric polycyclic aromatic hydrocarbons at an urban and a residential site in Osaka, Japan: effect of the formation of atmospherically stable layer on their temporal change.

    PubMed

    Kishida, Masao; Nishikawa, Ayako; Fujimori, Keiichi; Shibutani, Yasuhiko

    2011-09-15

    A comparative study on atmospheric polycyclic aromatic hydrocarbons (PAHs) in particulate matter and the gaseous phase was performed at an urban and a residential site in Osaka, Japan, during 2005-2006. PAH concentrations at the urban site were found to be approximately twice higher than those at the residential site. At both sites, particulate PAH concentrations increased mainly in winter while the trends of temporal change in gaseous PAH concentrations were not clearly observed. The main sources of PAHs were estimated to be local traffic, e.g., diesel engines with catalytic converter. PAH concentrations did not significantly negatively correlate with ozone concentrations and meteorological parameters. Gas-particle partitioning coefficients of representative PAHs with low molecular weight (LMW) significantly negatively correlated with ambient temperature, showing that temporal change in the LMW PAH concentrations in PM could be attributable to the shift of their gas-particle distribution caused by the change in ambient temperature. For the first time, we studied the effect of the formation of atmospherically stable layer following an increase in PAH concentrations in Japan. At the urban site, PAHs showed a significant positive correlation with potential temperature gradients, indicating that temporal variability in PAH concentrations would be dominantly controlled by the formation of atmospherically stable layer in Osaka area. PMID:21752537

  17. Unravelling the secrets of Cs controlled secondary ion formation: Evidence of the dominance of site specific surface chemistry, alloying and ionic bonding

    NASA Astrophysics Data System (ADS)

    Wittmaack, Klaus

    2013-03-01

    implantation can be evaluated as a function of Cs coverage.The summarised results imply that secondary ions are commonly not formed by charge transfer between an escaping atom and the electronic system of the sample but are already emitted as ions. The probability of ion formation appears to be controlled by the local ionic character of the alkali-target atom bonds, i.e., by the difference in electronegativity between the involved elements as well as by the electron affinity and the ionisation potential of the departing atom. This idea is supported by the finding that Si- yields exhibit the same very strong dependence on Cs coverage as Si+ and O- yields on the oxygen fraction in oxygen loaded Si. Most challenging to theoreticians is the finding that the ionisation probability is independent of the emission velocity of sputtered ions. This phenomenon cannot be rationalised along established routes of thinking. Different concepts need to be explored. An old, somewhat exotic idea takes account of the heavy perturbation created for a very short period of time at the site of ion emission (dynamic randomisation). Molecular dynamics simulations are desirable to clarify the issue. Ultimately it may be possible to describe all phenomena of enhanced or suppressed secondary ion formation, produced either by surface loading with alkali atoms or by enforced surface oxidation, on the basis of a single universal model. There is plenty of room for exciting new studies.

  18. Unravelling the secrets of Cs controlled secondary ion formation: Evidence of the dominance of site specific surface chemistry, alloying and ionic bonding

    NASA Astrophysics Data System (ADS)

    Wittmaack, Klaus

    2013-03-01

    implantation can be evaluated as a function of Cs coverage. The summarised results imply that secondary ions are commonly not formed by charge transfer between an escaping atom and the electronic system of the sample but are already emitted as ions. The probability of ion formation appears to be controlled by the local ionic character of the alkali-target atom bonds, i.e., by the difference in electronegativity between the involved elements as well as by the electron affinity and the ionisation potential of the departing atom. This idea is supported by the finding that Si- yields exhibit the same very strong dependence on Cs coverage as Si+ and O- yields on the oxygen fraction in oxygen loaded Si. Most challenging to theoreticians is the finding that the ionisation probability is independent of the emission velocity of sputtered ions. This phenomenon cannot be rationalised along established routes of thinking. Different concepts need to be explored. An old, somewhat exotic idea takes account of the heavy perturbation created for a very short period of time at the site of ion emission (dynamic randomisation). Molecular dynamics simulations are desirable to clarify the issue. Ultimately it may be possible to describe all phenomena of enhanced or suppressed secondary ion formation, produced either by surface loading with alkali atoms or by enforced surface oxidation, on the basis of a single universal model. There is plenty of room for exciting new studies.

  19. Natural heterogeneity and evolving geochemistry of Lower Tuscaloosa Formation brine in response to continuing CO2 injection at Cranfield EOR site, Mississippi, USA

    NASA Astrophysics Data System (ADS)

    Thordsen, J. J.; Kharaka, Y. K.; Thomas, B.; Abedini, A. A.; Conaway, C. H.; Manning, M. A.; Lu, J.

    2012-12-01

    Geochemical monitoring of Lower Tuscaloosa Formation (LTF) brine continues at the Cranfield CO2-enhanced oil recovery (EOR) and sequestration site to investigate the potential for the geologic storage of large volumes of CO2 in saline aquifers and depleted reservoirs. Cranfield oil field is a domal depleted oil and gas reservoir in the Mississippi Interior Salt Basin, with production in heterogeneous fluvial sandstones of the LTF (depth ~3000 m). CO2 flood began in July 2008. Brine samples were collected from selected production wells in March and December 2009, April 2010, and November 2011. Intensive sampling also was conducted for the first 18 days of a CO2 injection experiment below the oil-water contact (December 2009) at the Detailed Area of Study (DAS) 3-well array. The sampling objectives are to define the geochemical composition of the pre-injection brine, and to understand the geochemical changes resulting from interactions between the injected CO2, brine, and reservoir minerals. Results show that Tuscaloosa brine is Na-Ca-Cl type with total salinity ranging from ~140 to 160 g/L TDS (50 samples). Relatively large variations are observed in major divalent cations (Ca ~7,500-14,000 mg/L, Mg ~800-1,250 mg/L, Sr ~475-750 mg/L). Significant positive correlations are noted amongst Ca, Mg, Sr, Ba, and Br, whereas these solutes all trend negatively with Na and Cl. These results may be interpreted as possible binary mixing between two end-member waters: (1) high Na-Cl (51 and 97 g/L, respectively), low Ca, Mg, Sr, and Br (~7500, 800, 475, 280 mg/L, respectively); and (2) low Na-Cl (40 and 86 g/L), high Ca, Mg, Sr, and Br (~14,000, 1250, 750, 480 mg/L). This apparent binary mixing has no obvious correlation to CO2 injection, which suggests that observed variations are due to natural heterogeneities in LTF brine within the Cranfield dome. The variations may indicate vertical and/or lateral proximity to a halite source (i.e. salt dome), with the high Na-Cl, low Br

  20. Interactions between lac repressor protein and site-specific bromodeoxyuridine-substituted operator DNA. Ultraviolet footprinting and protein-DNA cross-link formation

    SciTech Connect

    Wick, K.L.; Matthews, K.S. )

    1991-04-05

    Specific contacts between the lac repressor and operator have been explored using 5-bromodeoxyuridine-substituted DNA. Substitution of BrdU for single thymidine positions in a synthetic 40-base pair operator provides substrate for ultraviolet irradiation; upon irradiation, strand scission occurs at the BrdU residues. When bound, lac repressor protein provides protection against UV-induced breakage depending on the nature of the sites and type of interaction. We have confirmed 13 unique sites of inducer-sensitive protection along the operator sequence using this method compared to complete substitution with BrdU; differences were observed at two positions for singly substituted versus completely substituted DNAs. The ability of these photosensitive DNAs to form short range cross-links to bound protein has been used to determine the efficiency with which cross-linked protein-DNA complexes are generated at each individual site of BrdU substitution. Five sites of high efficiency cross-linking to the repressor protein have been identified. At one site, cross-linking without protection from strand scission was observed; this result suggests an unusual mechanism of strand scission and/or cross-linking at this site. Comparison of the UV protection results and the cross-linking data show that these processes provide complementary tools for identifying and analyzing individual protein-DNA contacts.

  1. Instrumentation used for hydraulic testing of potential water-bearing formations at the Waste Isolation Pilot Plant site in southeastern New Mexico

    USGS Publications Warehouse

    Basler, J.A.

    1983-01-01

    Requirements for testing hydrologic test wells at the proposed Waste Isolation Pilot Plant near Carlsbad, New Mexico, necessitated the use of inflatable formation packers and pressure transducers. Observations during drilling and initial development indicated small formation yields which would require considerable test times by conventional open-casing methods. A pressure-monitoring system was assembled for performance evaluation utilizing commercially available components. Formation pressures were monitored with a down-hole strain-gage transducer. An inflatable packer equipped with a 1/4-inch-diameter steel tube extending through the inflation element permitted sensing formation pressures in isolated test zones. Surface components of the monitoring system provided AC transducer excitation, signal conditioning for recording directly in engineering units, and both analog and digital recording. Continuous surface monitoring of formation pressures provided a means of determining test status and projecting completion times during any phase of testing. Maximum portability was afforded by battery operation with all surface components mounted in a small self-contained trailer. (USGS)

  2. Attenuation of drug-stimulated topoisomerase II-DNA cleavable complex formation in wild-type HL-60 cells treated with an intracellular calcium buffer is correlated with decreased cytotoxicity and site-specific hypophosphorylation of topoisomerase IIalpha.

    PubMed Central

    Aoyama, M; Grabowski, D R; Dubyak, G R; Constantinou, A I; Rybicki, L A; Bukowski, R M; Ganapathi, M K; Hickson, I D; Ganapathi, R

    1998-01-01

    Topoisomerase II (topo II), an essential enzyme for cell viability, is also the target for clinically important anti-neoplastic agents that stimulate topo II-mediated DNA scission. The role of alterations in topo IIalpha phosphorylation and its effect on drug-induced DNA damage and cytotoxicity were investigated. Following loading of HL-60 cells with the calcium buffer 1, 2-bis-(o-aminophenoxy)ethane-N,N,N',N'-tetra-acetic acid tetra(acetoxymethyl) ester (BAPTA-AM), which abrogates intracellular Ca2+ transients, a significant decrease in etoposide (VP-16)- or amsacrine (m-AMSA)-stabilized topo II-DNA cleavable complex formation and a corresponding decrease in cytotoxicity was observed. In a cell-free system, nuclear extracts from BAPTA-AM-treated cells exhibited markedly less activity when assayed for VP-16-stabilized topo II-DNA complex formation, but not decatenation of kinetoplast DNA. In contrast, the loading of HL-60 cells with N,N,N', N'-tetrakis-(2-pyridyl)ethylenediamine (TPEN), which binds heavy metals without disturbing calcium or magnesium concentrations, did not significantly affect VP-16-stimulated topo II-DNA cleavable complex formation or cytotoxicity. In HL-60 cells the accumulation of BAPTA, but not TPEN, also led to the hypophosphorylation of topo IIalpha. Tryptic phosphopeptide mapping of topo IIalpha protein from HL-60 cells revealed: (a) eight major phosphorylation sites in untreated cells; (b) hypophosphorylation of two out of eight sites in BAPTA-AM-treated cells; and (c) hypophosphorylation of between two and four out of eight sites in topo II-poison-resistant HL-60 cells. The two hypophosphorylated sites present following BAPTA-AM treatment of wild-type cells were identical with the hypophosphorylated sites in the resistant cells, but were not the same as the sites that are substrates for casein kinase II [Wells, Addison, Fry, Ganapathi and Hickson (1994) J. Biol. Chem. 269, 29746-29751]. In summary, changes in intracellular Ca2+ transients

  3. Site-Selective Tertiary Alkyl-Fluorine Bond Formation from α-Bromoamides Using a Copper/CsF Catalyst System.

    PubMed

    Nishikata, Takashi; Ishida, Syo; Fujimoto, Ryo

    2016-08-16

    A copper-catalyzed site-selective fluorination of α-bromoamides possessing multiple reaction sites, such as primary and secondary alkyl-Br bonds, using inexpensive CsF is reported. Tertiary alkyl-F bonds, which are very difficult to synthesize, can be formed by this fluorination reaction with the aid of an amide group. Control experiments revealed that in situ generated CuF2 is a key fluorinating reagent that reacts with the tertiary alkyl radicals generated by the reaction between an α-bromocarbonyl compound and a copper(I) salt. PMID:27282558

  4. Mutations in the fusion protein cleavage site of avian paramyxovirus serotype 4 confer increased replication and syncytium formation in vitro but not increased replication and pathogenicity in chickens and ducks.

    PubMed

    Kim, Shin-Hee; Xiao, Sa; Shive, Heather; Collins, Peter L; Samal, Siba K

    2013-01-01

    To evaluate the role of the F protein cleavage site in the replication and pathogenicity of avian paramyxoviruses (APMVs), we constructed a reverse genetics system for recovery of infectious recombinant APMV-4 from cloned cDNA. The recovered recombinant APMV-4 resembled the biological virus in growth characteristics in vitro and in pathogenicity in vivo. The F cleavage site sequence of APMV-4 (DIQPR↓F) contains a single basic amino acid, at the -1 position. Six mutant APMV-4 viruses were recovered in which the F protein cleavage site was mutated to contain increased numbers of basic amino acids or to mimic the naturally occurring cleavage sites of several paramyxoviruses, including neurovirulent and avirulent strains of NDV. The presence of a glutamine residue at the -3 position was found to be important for mutant virus recovery. In addition, cleavage sites containing the furin protease motif conferred increased replication and syncytium formation in vitro. However, analysis of viral pathogenicity in 9-day-old embryonated chicken eggs, 1-day-old and 2-week-old chickens, and 3-week-old ducks showed that none the F protein cleavage site mutations altered the replication, tropism, and pathogenicity of APMV-4, and no significant differences were observed among the parental and mutant APMV-4 viruses in vivo. Although parental and mutant viruses replicated somewhat better in ducks than in chickens, they all were highly restricted and avirulent in both species. These results suggested that the cleavage site sequence of the F protein is not a limiting determinant of APMV-4 pathogenicity in chickens and ducks. PMID:23341874

  5. Mutations in the Fusion Protein Cleavage Site of Avian Paramyxovirus Serotype 4 Confer Increased Replication and Syncytium Formation In Vitro but Not Increased Replication and Pathogenicity in Chickens and Ducks

    PubMed Central

    Kim, Shin-Hee; Xiao, Sa; Shive, Heather; Collins, Peter L.; Samal, Siba K.

    2013-01-01

    To evaluate the role of the F protein cleavage site in the replication and pathogenicity of avian paramyxoviruses (APMVs), we constructed a reverse genetics system for recovery of infectious recombinant APMV-4 from cloned cDNA. The recovered recombinant APMV-4 resembled the biological virus in growth characteristics in vitro and in pathogenicity in vivo. The F cleavage site sequence of APMV-4 (DIQPR↓F) contains a single basic amino acid, at the -1 position. Six mutant APMV-4 viruses were recovered in which the F protein cleavage site was mutated to contain increased numbers of basic amino acids or to mimic the naturally occurring cleavage sites of several paramyxoviruses, including neurovirulent and avirulent strains of NDV. The presence of a glutamine residue at the -3 position was found to be important for mutant virus recovery. In addition, cleavage sites containing the furin protease motif conferred increased replication and syncytium formation in vitro. However, analysis of viral pathogenicity in 9-day-old embryonated chicken eggs, 1-day-old and 2-week-old chickens, and 3-week-old ducks showed that none the F protein cleavage site mutations altered the replication, tropism, and pathogenicity of APMV-4, and no significant differences were observed among the parental and mutant APMV-4 viruses in vivo. Although parental and mutant viruses replicated somewhat better in ducks than in chickens, they all were highly restricted and avirulent in both species. These results suggested that the cleavage site sequence of the F protein is not a limiting determinant of APMV-4 pathogenicity in chickens and ducks. PMID:23341874

  6. Grain-size and grain-shape analyses using digital imaging technology: Application to the fluvial formation of the Ngandong paleoanthropological site in Central Java, Indonesia

    NASA Astrophysics Data System (ADS)

    Sipola, Maija

    2013-04-01

    This study implements grain-size and grain-shape analyses to better understand the fluvial processes responsible for forming the Ngandong paleoanthropological site along the Solo River in Central Java. The site was first discovered and excavated by the Dutch Geological Survey in the early 1930's, during which fourteen Homo erectus fossils and thousands of other macrofaunal remains were uncovered. The Homo erectus fossils discovered at Ngandong are particularly interesting to paleoanthropologists because the morphology of the excavated crania suggests they are from a recently-living variety of the species. The primary scientific focus for many years has been to determine the absolute age of the Ngandong fossils, while the question of exactly how the Ngandong site itself formed has been frequently overlooked. In this study I use Retsch CAMSIZER digital imaging technology to conduct grain-size and grain-shape analyses of sediments from the terrace stratigraphy at the Ngandong site to understand if there are significant differences between sedimentary layers in grain-size and/or grain-shape, and what these differences mean in terms of local paleoflow dynamics over time. Preliminary analyses indicate there are four distinct sedimentary layers present at Ngandong with regard to size sorting, with the fossil-bearing layers proving to be the most poorly-sorted and most similar to debris-flow deposits. These results support hypotheses by geoarchaeologists that the fossil-bearing layers present at Ngandong were deposited during special flow events rather than under normal stream flow conditions.

  7. ALMA OBSERVATIONS OF A HIGH-DENSITY CORE IN TAURUS: DYNAMICAL GAS INTERACTION AT THE POSSIBLE SITE OF A MULTIPLE STAR FORMATION

    SciTech Connect

    Tokuda, Kazuki; Onishi, Toshikazu; Saigo, Kazuya; Kawamura, Akiko; Fukui, Yasuo; Inutsuka, Shu-ichiro; Tachihara, Kengo; Matsumoto, Tomoaki; Machida, Masahiro N.; Tomida, Kengo

    2014-07-01

    Starless dense cores eventually collapse dynamically, forming protostars inside them, and the physical properties of the cores determine the nature of the forming protostars. We report ALMA observations of dust continuum emission and molecular rotational lines toward MC27 or L1521F, which is considered to be very close to the first protostellar core phase. We found a few starless high-density cores, one of which has a very high density of ∼10{sup 7} cm{sup –3}, within a region of several hundred AU around a very low-luminosity protostar detected by Spitzer. A very compact bipolar outflow with a dynamical timescale of a few hundred years was found toward the protostar. The molecular line observation shows several cores with an arc-like structure, possibly due to the dynamical gas interaction. These complex structures revealed in the present observations suggest that the initial condition of star formation is highly dynamical in nature, which is considered to be a key factor in understanding fundamental issues of star formation such as the formation of multiple stars and the origin of the initial mass function of stars.

  8. The formation of DNA single-strand breaks and alkali-labile sites in human blood lymphocytes exposed to 365-nm UVA radiation.

    PubMed

    Osipov, Andreyan N; Smetanina, Nadezhda M; Pustovalova, Margarita V; Arkhangelskaya, Ekaterina; Klokov, Dmitry

    2014-08-01

    The potency of UVA radiation, representing 90% of solar UV light reaching the earth's surface, to induce human skin cancer is the subject of continuing controversy. This study was undertaken to investigate the role of reactive oxygen species in DNA damage produced by the exposure of human cells to UVA radiation. This knowledge is important for better understanding of UV-induced carcinogenesis. We measured DNA single-strand breaks and alkali-labile sites in human lymphocytes exposed ex vivo to various doses of 365-nm UV photons compared to X-rays and hydrogen peroxide using the comet assay. We demonstrated that the UVA-induced DNA damage increased in a linear dose-dependent manner. The rate of DNA single-strand breaks and alkali-labile sites after exposure to 1J/cm(2) was similar to the rate induced by exposure to 1 Gy of X-rays or 25 μM hydrogen peroxide. The presence of either the hydroxyl radical scavenger dimethyl sulfoxide or the singlet oxygen quencher sodium azide resulted in a significant reduction in the UVA-induced DNA damage, suggesting a role for these reactive oxygen species in mediating UVA-induced DNA single-strand breaks and alkali-labile sites. We also showed that chromatin relaxation due to hypertonic conditions resulted in increased damage in both untreated and UVA-treated cells. The effect was the most significant in the presence of 0.5M Na(+), implying a role for histone H1. Our data suggest that the majority of DNA single-strand breaks and alkali-labile sites after exposure of human lymphocytes to UVA are produced by reactive oxygen species (the hydroxyl radical and singlet oxygen) and that the state of chromatin may substantially contribute to the outcome of such exposures. PMID:24816295

  9. Bone taphonomy of the Schöningen "Spear Horizon South" and its implications for site formation and hominin meat provisioning.

    PubMed

    Starkovich, Britt M; Conard, Nicholas J

    2015-12-01

    This paper presents the faunal remains from the new excavation area at the Lower Paleolithic site of Schöningen. The focus of the study is on the southern extension of the main find horizon (Spear Horizon South), which includes the layer that yielded the famous Schöningen spears (13 II-4). Taxonomic data corroborate previous studies, that hominins primarily hunted Equus mosbachensis, a large Pleistocene horse. Equid body part representation at the site suggests that the animals were hunted and butchered locally. There is no evidence for density-mediated attrition in the assemblage. Weathering damage is uncommon, though there is ample evidence that carnivores had access to the bone. Carnivore bite sizes were measured and compared to experimental data provided by previous authors. Based on relationships between bite size and carnivore behavior and body size, we conclude that the primary modifying agents were large carnivores (i.e., wolves or saber-toothed cats). Previous studies show that carnivores often had secondary access to the remains, after hominins. Cut marks are commonly arranged haphazardly on the bones. This may indicate that multiple hominins participated in the butchery of horse skeletons, or that they were butchered over the course of hours or days. Cut marks on axial elements are more "orderly," which probably reflects the physical logistics of orienting one's body in relation to a large carcass. These data differ from sites formed by Middle and Upper Paleolithic hominins, which might suggest that in later times, a system of organized meat provisioning was already in place. Taken together, the faunal evidence from the Spear Horizon South indicates that late Lower Paleolithic hominins using the site understood the behaviors of different prey species, hunted socially to take down large game, and successfully competed with large carnivores on the landscape for primary access to ungulate remains. PMID:26626957

  10. Water-Level Reconstruction and its Implications for Late Pleistocene Paleontological Site Formation in Hoyo Negro, a Submerged Subterranean Pit in Quintana Roo, Mexico

    NASA Astrophysics Data System (ADS)

    Rissolo, D.; Reinhardt, E. G.; Collins, S.; Kovacs, S. E.; Beddows, P. A.; Chatters, J. C.; Nava Blank, A.; Luna Erreguerena, P.

    2014-12-01

    A massive pit deep within the now submerged cave system of Sac Actun, located along the central east coast of the Yucatan Peninsula, contains a diverse fossil assemblage of extinct megafauna as well as a nearly complete human skeleton. The inundated site of Hoyo Negro presents a unique and promising opportunity for interdisciplinary Paleoamerican and paleoenvironmental research in the region. Investigations have thus far revealed a range of associated features and deposits which make possible a multi-proxy approach to identifying and reconstructing the natural and cultural processes that have formed and transformed the site over millennia. Understanding water-level fluctuations (both related to, and independent from, eustatic sea level changes), with respect to cave morphology is central to understanding the movement of humans and animals into and through the cave system. Recent and ongoing studies involve absolute dating of human, faunal, macrobotanical, and geological samples; taphonomic analyses; and a characterization of site hydrogeology and sedimentological facies, including microfossil assemblages and calcite raft deposits.

  11. Quantum-chemical study of the effect of oxygen on the formation of active sites of silver clusters during the selective adsorption of hydrocarbons

    NASA Astrophysics Data System (ADS)

    Lanin, S. N.; Polynskaya, Yu. G.; Pichugina, D. A.; Nguen, V.; Beletskaya, A. V.; Kuz'menko, N. E.; Shestakov, A. F.

    2013-09-01

    Density functional theory (PBE with a modified Dirac-Coulomb-Breit Hamiltonian) is used to simulate the adsorption of hydrocarbons (C2H2, C2H4, C2H6) on the surface of a sorbent containing Ag0, Agδ+, and AgO sites. The dynamics of change in the structural characteristics of Ag n ( n ≤ 10) is analyzed and the adsorption of oxygen on Ag8 and Ag10 is studied to select the adsorption site model. Studying the interaction of hydrocarbons with Ag8, Ag10, Ag{10/+}, Ag10O, and Ag10O2 clusters reveals that the presence of oxygen leads to an increase in the activation of unsaturated hydrocarbons, and the adsorption energy of C2H2 increases tenfold. It is found that the role of adsorbed oxygen is not only to form adsorption sites of hydrocarbons (Agδ+) but also to bind C2H2 and C2H4 directly to the sorbent's surface.

  12. Nuclear localization of mouse Ku70 in interphase cells and focus formation of mouse Ku70 at DNA damage sites immediately after irradiation.

    PubMed

    Koike, Manabu; Yutoku, Yasutomo; Koike, Aki

    2015-09-01

    To elucidate the mechanisms of DNA repair pathway is critical for developing next-generation radiotherapies and chemotherapeutic drugs for cancer. Ionizing radiation and many chemotherapeutic drugs kill tumor cells mainly by inducing DNA double-strand breaks (DSBs). The classical nonhomologous DNA-end joining (NHEJ) (C-NHEJ) pathway repairs a predominant fraction of DSBs in mammalian cells. The C-NHEJ pathway appears to start with the binding of Ku (heterodimer of Ku70 and Ku80) to DNA break ends. Therefore, recruitment of Ku to DSB sites might play a critical role in regulating NHEJ activity. Indeed, human Ku70 and Ku80 localize in the nuclei and accumulate at microirradiated DSB sites. However, the localization and regulation mechanisms of Ku70 and Ku80 homologues in animal models, such as mice and other species, have not been elucidated in detail, particularly in cells immediately after microirradiation. Here, we show that EYFP-tagged mouse Ku70 localizes in the interphase nuclei of mouse fibroblasts and epithelial cells. Furthermore, our findings indicate that EYFP-mouse Ku70 accumulates with its heterodimeric partner Ku80 immediately at laser-microirradiated DSB sites. We also confirmed that the structure of Ku70 nuclear localization signal (NLS) is highly conserved among various rodent species, such as the mouse, rat, degu and ground squirrel, supporting the idea that NLS is important for the regulation of rodent Ku70 function. Collectively, these results suggest that the mechanisms of regulating the localization and accumulation of Ku70 at DSBs might be well conserved between the mouse and human species. PMID:25947323

  13. Formation of uranium-thorium-rich bitumen nodules in the Lockne impact structure, Sweden: A mechanism for carbon concentration at impact sites

    NASA Astrophysics Data System (ADS)

    Lindgren, Paula; Parnell, John; Norman, Craig; Mark, Darren F.; Baron, Martin; Ormö, Jens; Sturkell, Erik; Conliffe, James; Fraser, Wesley

    The Ordovician Lockne impact structure is located in central Sweden. The target lithology consisted of limestone and black unconsolidated shale overlaying a Precambrian crystalline basement. The Precambrian basement is uranium-rich, and the black shale is both uranium- and organic-rich. This circumstance makes Lockne a good candidate for testing the occurrence of U-Th-rich bitumen nodules in an impact structure setting. U-Th-rich bitumen nodules are formed through irradiation; hence the increase in the complexity of organic matter by a radioactive (uranium- and thorium-rich) mineral phase. U-Th-rich bitumen nodules were detected in crystalline impact breccia and resurge deposits from the impact structure, but samples of non-impact-affected rocks from outside the impact structure do not contain any U-Th-rich bitumen nodules. This implies that in the Lockne impact structure, the nodules are associated with impact-related processes. U-Th-rich bitumen nodules occur throughout the geological record and are not restricted to an impact structure setting, but our studies at Lockne show that this process of irradiation can readily occur in impact structures where fracturing of rocks and a post-impact hydrothermal system enhances fluid circulation. The irradiation of organic matter by radioactive minerals has previously been proposed as a process for concentration of carbon on the early Earth. Impact structures are suggested as sites for prebiotic chemistry and primitive evolution, and irradiation by radioactive minerals could be an important mechanism for carbon concentration at impact sites.

  14. ALMA Observations of a High-density Core in Taurus: Dynamical Gas Interaction at the Possible Site of a Multiple Star Formation

    NASA Astrophysics Data System (ADS)

    Tokuda, Kazuki; Onishi, Toshikazu; Saigo, Kazuya; Kawamura, Akiko; Fukui, Yasuo; Matsumoto, Tomoaki; Inutsuka, Shu-ichiro; Machida, Masahiro N.; Tomida, Kengo; Tachihara, Kengo

    2015-08-01

    It is crucially important to observe dense cores in order to investigate the initial condition of star formation since protostars are formed via dynamical collapse of dense cores, inhering the physical properties from their natal dense cores. Here we present the results of ALMA Cycle 0 and Cycle 1 observations of dust continuum emission and molecular rotational lines toward a dense core, MC27 (aka L1521F), which is considered to be very close to the first protostellar core phase.The Cycle 0 observations revealed complex structures at the center. We found a few starless high-density cores, one of which (MMS2) has a very high density of ~107 cm-3, around the very low-luminousity protostar detected by Spitzer. A very compact bipolar outflow with a dynamical timescale of a few hundred years was found toward the protostar. The HCO+ (3-2) observation shows several cores associated with an arc-like structure whose length is ~2000 AU, possibly due to the dynamical gas interaction. These complex structures suggest that the initial condition of star formation is highly dynamical in nature, which is considered to be a key factor in understanding fundamental issues of star formation such as origins of the stellar multiplicity and the initial mass function. These initial Cycle 0 results were published by Tokuda et al. (2014). Matsumoto et al. (2015) investigated the arc-like structures by performing numerical simulations.Detailed column density distribution with the size from ~100 to ~10000 AU scale are revealed by combining the 12m array data with the 7m array data of the ALMA Compact Array as well as with the single dish MAMBO data. Our preliminary analysis shows that the averaged radial column density distribution of the inner part (r < 2000 AU) is N(H2)~r-0.4, clearly flatter than that of the outer part, ~r-1.3. We detected the above-mentioned complex structure inside the inner flatter region, which may reflect the dynamical status of the dense core. The Cycle 1

  15. Contributions of Selected Biogenic and Aromatic Compounds to the Formation of Tropospheric Secondary Organic Aerosol over Several Sites in the United States

    NASA Astrophysics Data System (ADS)

    Jaoui, M.; Kleindienst, T. E.; Lewandowski, M.; Offenberg, J. H.; Corse, E. W.; Gerald, T.; Edney, E.

    2009-12-01

    The National Exposure Research Laboratory of the U.S. Environmental Protection Agency recently undertook an integrated laboratory and field research effort to better understand the contribution of biogenic and aromatic hydrocarbons to the formation of submicron ambient secondary organic aerosol (SOA). In the laboratory, isoprene, α-pinene, β-caryophyllene, 1,3-butadiene, 2-methyl-3-buten-2-ol, benzene, and toluene were individually irradiated under a wide range of conditions in a photochemical reaction chamber in the presence of nitrogen oxide (NOx). These hydrocarbons are thought to contribute to ambient SOA formation. In field studies conducted in Research Triangle Park, NC; Duke Forest in Chapel Hill, NC; Atlanta, GA; Pensacola, FL; Birmingham and Centerville, AL; Riverside, CA; Detroit, MI; Northbrook, East St. Louis and Bondville, IL; and Cincinnati, OH, ambient PM2.5 samples were collected for various periods between 2003 and 2006. The SOA collected from these laboratory experiments and the ambient PM2.5 samples were analyzed for organic carbon (OC) concentration and for organic tracer compounds by GC-MS using BSTFA derivatization for their identification and quantification. An organic tracer-based method was developed for estimating ambient SOA concentrations from individual SOA precursors to allow an assessment of SOA model predictions with ambient data. The results show that several major reaction products detected in SOA formed in the laboratory photooxidations were among the major compounds detected in field samples, effectively connecting laboratory and field results. Using the tracer-based method, the contributions of isoprene and monoterpenes to SOA formation show strong seasonal dependencies. However, no clear seasonal variations were observed for sesquiterpenes and aromatic hydrocarbons. The contribution of 2-methyl-3-buten-2-ol to ambient SOA was found to be not only season dependent but also higher in locations dominated by conifers, which are

  16. Mauna Loa lava accumulation rates at the Hilo drill site: Formation of lava deltas during a period of declining overall volcanic growth

    USGS Publications Warehouse

    Lipman, P.W.; Moore, J.G.

    1996-01-01

    Accumulation rates for lava flows erupted from Mauna Loa, as sampled in the uppermost 280 m of the Hilo drill hole, vary widely for short time intervals (several thousand years), but overall are broadly similar to those documented elsewhere on this volcano since 100 ka. Thickness variations and accumulation rates for Mauna Loa lavas at the Hilo drill site have been strongly affected by local paleotopography, including funneling and ponding between Mauna Kea and Kilauea. In addition, gentle submerged slopes of Mauna Kea in Hilo Bay have permitted large shoreline displacements by Mauna Loa flows. Ages of eruptive intervals have been determined from published isotopic data and from eustatic sea level curves modified to include the isostatic subsidence of the island of Hawaii at 2.2-2.6 mm/yr. Prior to 10 ka, rates of Mauna Loa lava accumulation at the drill site varied from 0.6 to 4.3 mm/yr for dateable intervals, with an overall rate of 1.8 mm/yr. Major eruptive pulses at about 1.3 and 10 ka, each probably representing a single long-lived eruption based on lack of weathering between flow units, increase the overall accumulation rate to 2.4 mm/yr. The higher rate since 10 ka reflects construction of thick near-shoreline lava deltas as postglacial sea levels rose rapidly. Large lava deltas form only along coastal segments where initially subaerial slopes have been submerged by the combined effects of eustatic sea level rise, isostatic subsidence, or spreading of volcano flanks. Overall accumulation of 239 m of lava at the drill site since 100-120 ka closely balances submergence of the Hilo area, suggesting that processes of coastal lava deposition have been modulated by rise in sea level. The Hilo accumulation rate is slightly higher than average rates of 1-2 mm/yr determined elsewhere along the Mauna Loa coast, based on rates of shoreline coverage and dated sea cliff and fault scarp exposures. Low rates of coastal lava accumulation since 100 ka, near or below the rate

  17. Dynamic changes in subcellular localization of cattle XLF during cell cycle, and focus formation of cattle XLF at DNA damage sites immediately after irradiation

    PubMed Central

    KOIKE, Manabu; YUTOKU, Yasutomo; KOIKE, Aki

    2015-01-01

    Clinically, many chemotherapeutics and ionizing radiation (IR) have been applied for the treatment of various types of human and animal malignancies. These treatments kill tumor cells by causing DNA double-strand breaks (DSBs). Core factors of classical nonhomologous DNA-end joining (C-NHEJ) play a vital role in DSB repair. Thus, it is indispensable to clarify the mechanisms of C-NHEJ in order to develop next-generation chemotherapeutics for cancer. The XRCC4-like factor (XLF; also called Cernunnos or NHEJ1) is the lastly identified core NHEJ factor. The localization of core NHEJ factors might play a critical role in regulating NHEJ activity. The localization and function of XLF have not been elucidated in animal species other than mice and humans. Domestic cattle (Bos taurus) are the most common and vital domestic animals in many countries. Here, we show that the localization of cattle XLF changes dynamically during the cell cycle. Furthermore, EYFP-cattle XLF accumulates quickly at microirradiated sites and colocalizes with the DSB marker γH2AX. Moreover, nuclear localization and accumulation of cattle XLF at DSB sites are dependent on 12 amino acids (288–299) of the C-terminal region of XLF (XLF CTR). Furthermore, basic amino acids on the XLF CTR are highly conserved among domestic animals including cattle, goat and horses, suggesting that the CTR is essential for the function of XLF in domestic animals. These findings might be useful to develop the molecular-targeting therapeutic drug taking XLF as a target molecule for human and domestic animals. PMID:25947322

  18. Dynamic changes in subcellular localization of cattle XLF during cell cycle, and focus formation of cattle XLF at DNA damage sites immediately after irradiation.

    PubMed

    Koike, Manabu; Yutoku, Yasutomo; Koike, Aki

    2015-09-01

    Clinically, many chemotherapeutics and ionizing radiation (IR) have been applied for the treatment of various types of human and animal malignancies. These treatments kill tumor cells by causing DNA double-strand breaks (DSBs). Core factors of classical nonhomologous DNA-end joining (C-NHEJ) play a vital role in DSB repair. Thus, it is indispensable to clarify the mechanisms of C-NHEJ in order to develop next-generation chemotherapeutics for cancer. The XRCC4-like factor (XLF; also called Cernunnos or NHEJ1) is the lastly identified core NHEJ factor. The localization of core NHEJ factors might play a critical role in regulating NHEJ activity. The localization and function of XLF have not been elucidated in animal species other than mice and humans. Domestic cattle (Bos taurus) are the most common and vital domestic animals in many countries. Here, we show that the localization of cattle XLF changes dynamically during the cell cycle. Furthermore, EYFP-cattle XLF accumulates quickly at microirradiated sites and colocalizes with the DSB marker γH2AX. Moreover, nuclear localization and accumulation of cattle XLF at DSB sites are dependent on 12 amino acids (288-299) of the C-terminal region of XLF (XLF CTR). Furthermore, basic amino acids on the XLF CTR are highly conserved among domestic animals including cattle, goat and horses, suggesting that the CTR is essential for the function of XLF in domestic animals. These findings might be useful to develop the molecular-targeting therapeutic drug taking XLF as a target molecule for human and domestic animals. PMID:25947322

  19. Habitat change by the formation of alien Crassostrea-reefs in the Wadden Sea and its role as feeding sites for waterbirds

    NASA Astrophysics Data System (ADS)

    Markert, Alexandra; Esser, Wiebke; Frank, Dietrich; Wehrmann, Achim; Exo, Klaus-Michael

    2013-10-01

    Non-indigenous Pacific oysters (Crassostrea gigas) have been invading the central Wadden Sea since 1998, predominantly settling on intertidal blue mussel (Mytilus edulis) beds which are increasingly transformed into Crassostrea-reefs. Pacific oysters are strong ecosystem engineers and the habitat change is considered to be a threat for waterbirds losing important feeding sites in the intertidal of the Wadden Sea. This study has increased our understanding of the use of foraging habitats by birds according to changing food resources. During the spring and autumn migration period in 2007, we recorded bird densities at two reef types varying in Pacific oyster density and at the adjacent sand flat as a reference site. We also recorded feeding behaviour, choice of prey and assessed peck and intake rate of three target species: Eurasian oystercatcher Haematopus ostralegus, Eurasian curlew Numenius arquata and European herring gull Larus argentatus. To evaluate the use of the Crassostrea-reef in the central Wadden Sea, we compared bird densities of the target species at different intertidal feeding habitats in various regions and compared the biomass intake of Eurasian oystercatcher feeding on different prey species. We show that Eurasian oystercatcher and Eurasian curlew have adapted to the new situation and learned to exploit the food supply offered by Crassostrea-reefs. While foraging mainly on Pacific oysters, Eurasian oystercatchers attained sustainable intake rates even though food resource at dense reef during autumn was very poor due to a lack in harvestable oysters. Consolidation of reefs limits the accessibility of prey for Eurasian oystercatchers whereas a successful recruitment of Pacific oysters enhances the suitability of the habitat. Eurasian curlew was promoted by the engineering effects of the Pacific oyster while feeding extensively on shore crabs at the reefs. In contrast, European herring gulls appear hampered in foraging during low tide and hereby

  20. Studies of the influence of chloro-substituent sites and conformational energy in polychlorinated biphenyls on uroporphyrin formation in chick-embryo liver cell cultures.

    PubMed Central

    Sassa, S; Sugita, O; Ohnuma, N; Imajo, S; Okumura, T; Noguchi, T; Kappas, A

    1986-01-01

    Treatment of cultured chick-embryo liver cells with polychlorinated biphenyls (PCB) results in decreased uroporphyrinogen decarboxylase activity and increased uroporphyrin accumulation. In the present study we examined the effect of the chloro- or bromo-substituent sites in biphenyls (BP) on uroporphyrin accumulation in cultured hepatocytes and the three-dimensional structure of these congeners determined by molecular orbital calculations using a MNDO ('modified neglect of diatomic overlap') method. Among 20 congeners examined, those which were effective in stimulating porphyrin accumulation contained at least two Cl or Br atoms at the lateral adjacent positions in each phenyl ring, e.g. 3,4,3',4'-tetrachloro-, 2,4,3',4'-tetrachloro-, 3,4,5,3',4',5'-hexachloro- and 3,4,5,3',4',5'-hexabromobiphenyl, whereas those which contained less than two halogen atoms or more than three halogen atoms in each phenyl ring or those which contained halogen atoms at 2,2'-positions were not effective. On the basis of the conformational energy (delta E, difference from the most stable conformational energy), which is calculated as a function of the dihedral angle (theta) between the two phenyl rings, biphenyl congeners can be classified into four groups with different conformations. The conformation of active PCB was relatively flexible, whereas inactive species had a rigidly angulated conformation. Furthermore, the calculated probability of the conformation distribution for each congener indicated that the probability of co-planarity was higher for active biphenyls than for inactive congeners. These structural characteristics suggest the significance of both the chloro-substituent sites and the conformational energy reflecting the phenyl-ring twist angles in determining the inhibitory effect of PCB on uroporphyrinogen decarboxylase activity. Images Fig. 4. PMID:3091004

  1. LPS-Induced Formation of Immunoproteasomes: TNF-α and Nitric Oxide Production are Regulated by Altered Composition of Proteasome-Active Sites

    PubMed Central

    Reis, Julia; Guan, Xiu Qin; Kisselev, Alexei F.; Papasian, Christopher J.; Qureshi, Asaf A.; Morrison, David C.; Van Way, Charles W.; Vogel, Stefanie N.

    2011-01-01

    Stimulation of mouse macrophages with LPS leads to tumor necrosis factor (TNF-α) secretion and nitric oxide (NO) release at different times through independent signaling pathways. While the precise regulatory mechanisms responsible for these distinct phenotypic responses have not been fully delineated, results of our recent studies strongly implicate the cellular cytoplasmic ubiquitin–proteasome pathway as a key regulator of LPS-induced macrophage inflammatory responses. Our objective in this study was to define the relative contribution of specific proteasomal active-sites in induction of TNF-α and NO after LPS treatment of RAW 264.7 macrophages using selective inhibitors of these active sites. Our data provide evidence that LPS stimulation of mouse macrophages triggers a selective increase in the levels of gene and protein expression of the immunoproteasomes, resulting in a modulation of specific functional activities of the proteasome and a corresponding increase in NO production as compared to untreated controls. These findings suggest the LPS-dependent induction of immunoproteasome. In contrast, we also demonstrate that TNF-α expression is primarily dependent on both the chymotrypsin- and the trypsin-like activities of X, Y, Z subunits of the proteasome. Proteasome-associated post-acidic activity alone also contributes to LPS-induced expression of TNF-α. Taken together; our results indicate that LPS-induced TNF-α in macrophages is differentially regulated by each of the three proteasome activities. Since addition of proteasome inhibitors to mouse macrophages profoundly affects the degradation of proteins involved in signal transduction, we conclude that proteasome-specific degradation of several signaling proteins is likely involved in differential regulation of LPS-dependent secretion of proinflammatory mediators. PMID:21455682

  2. Structural insights into the mechanism of four-coordinate Cob(II)alamin formation in the active site of the Salmonella enterica ATP:Co(I)rrinoid adenosyltransferase enzyme: critical role of residues Phe91 and Trp93.

    PubMed

    Moore, Theodore C; Newmister, Sean A; Rayment, Ivan; Escalante-Semerena, Jorge C

    2012-12-01

    ATP:co(I)rrinoid adenosyltransferases (ACATs) are enzymes that catalyze the formation of adenosylcobalamin (AdoCbl, coenzyme B(12)) from cobalamin and ATP. There are three families of ACATs, namely, CobA, EutT, and PduO. In Salmonella enterica, CobA is the housekeeping enzyme that is required for de novo AdoCbl synthesis and for salvaging incomplete precursors and cobalamin from the environment. Here, we report the crystal structure of CobA in complex with ATP, four-coordinate cobalamin, and five-coordinate cobalamin. This provides the first crystallographic evidence of the existence of cob(II)alamin in the active site of CobA. The structure suggests a mechanism in which the enzyme adopts a closed conformation and two residues, Phe91 and Trp93, displace 5,6-dimethylbenzimidazole, the lower nucleotide ligand base of cobalamin, to generate a transient four-coordinate cobalamin, which is critical in the formation of the AdoCbl Co-C bond. In vivo and in vitro mutational analyses of Phe91 and Trp93 emphasize the important role of bulky hydrophobic side chains in the active site. The proposed manner in which CobA increases the redox potential of the cob(II)alamin/cob(I)alamin couple to facilitate formation of the Co-C bond appears to be analogous to that utilized by the PduO-type ACATs, where in both cases the polar coordination of the lower ligand to the cobalt ion is eliminated by placing that face of the corrin ring adjacent to a cluster of bulky hydrophobic side chains. PMID:23148601

  3. Sulfated Tyrosines Contribute to the Formation of the C5a Docking Site of the Human C5a Anaphylatoxin Receptor

    PubMed Central

    Farzan, Michael; Schnitzler, Christine E.; Vasilieva, Natalya; Leung, Doris; Kuhn, Jens; Gerard, Craig; Gerard, Norma P.; Choe, Hyeryun

    2001-01-01

    The complement anaphylatoxin C5a and its seven-transmembrane segment (7TMS) receptor play an important role in host defense and in a number of inflammation-associated pathologies. The NH2-terminal domain of the C5a receptor (C5aR/CD88) contributes substantially to its ability to bind C5a. Here we show that the tyrosines at positions 11 and 14 of the C5aR are posttranslationally modified by the addition of sulfate groups. The sulfate moieties of each of these tyrosines are critical to the ability of the C5aR to bind C5a and to mobilize calcium. A C5aR variant lacking these sulfate moieties efficiently mobilized calcium in response to a small peptide agonist, but not to C5a, consistent with a two-site model of ligand association in which the tyrosine-sulfated region of the C5aR mediates the initial docking interaction. A peptide based on the NH2 terminus of the C5aR and sulfated at these two tyrosines, but not its unsulfated analogue or a doubly sulfated control peptide, partially inhibited C5a association with its receptor. These observations clarify structural and mutagenic studies of the C5a/C5aR association and suggest that related 7TMS receptors are also modified by functionally important sulfate groups on their NH2-terminal tyrosines. PMID:11342590

  4. Origin of the local structures at the Philae landing site and possible implications on the formation and evolution of 67P/Churyumov-Gerasimenko

    NASA Astrophysics Data System (ADS)

    Poulet, F.; Lucchetti, A.; Bibring, J.-P.; Carter, J.; Gondet, B.; Jorda, L.; Langevin, Y.; Pilorget, C.; Capanna, C.; Cremonese, G.

    2016-08-01

    In situ images of the 67P/Churyumov-Gerasimenko nucleus acquired by the CIVA cameras on-board PHILAE revealed a rough landscape dominated by consolidated materials (Bibring et al. 2015). These data provide a unique view to constrain the past and present conditions prevailing at the surface of the comet. A quantitative analysis of microscopic structures (fractures and pebbles) is derived using a manual extraction from the images. Fractures/cracks are rather ubiquitous at various spatial scales with network and size (from sub-cm to 10 cm) well correlated to the texture of the landscape. The pebble size distributions are derived and compared to the size distribution of other cometary materials. The nature of the landscape is then discussed in relation to endogenic and exogenic processes of surface modification. The block seen in CIVA#1 is interpreted to be close-ups of fractured boulder/cliff belonging to the boulder field identified from the orbit near Abydos, this boulder field being itself the result of gravitational regressive erosion due to sublimation. The observed fractures are best explained by thermal insolation leading to thermal fatigue and/or to loss of volatile materials. This surficial fragmentation (up to > 10 cm length) could generate macroscopic erosion that is also visible at larger scale from the orbit. There is at least an intriguing possibility that the pebbles are remnants of primordial accretion processes. We thus speculate that the Abydos landscape could be in favour of pebble accretion model instead of runaway coagulation model with a formation location in the outer region of the Solar System.

  5. Analysis of Site Formation and Assemblage Integrity Does Not Support Attribution of the Uluzzian to Modern Humans at Grotta del Cavallo

    PubMed Central

    Zilhão, João; Banks, William E.; d’Errico, Francesco; Gioia, Patrizia

    2015-01-01

    Based on the morphology of two deciduous molars and radiocarbon ages from layers D and E of the Grotta del Cavallo (Lecce, Italy), assigned to the Uluzzian, it has been proposed that modern humans were the makers of this Early Upper Paleolithic culture and that this finding considerably weakens the case for an independent emergence of symbolism among western European Neandertals. Reappraisal of the new dating evidence, of the finds curated in the Taranto Antiquities depot, and of coeval publications detailing the site’s 1963–66 excavations shows that (a) Protoaurignacian, Aurignacian and Early Epigravettian lithics exist in the assemblages from layers D and E, (b) even though it contains both inherited and intrusive items, the formation of layer D began during Protoaurignacian times, and (c) the composition of the extant Cavallo assemblages is influenced in a non-negligible manner by the post-hoc assignment of items to stratigraphic units distinct from that of original discovery. In addition, a major disturbance feature affected the 1960s excavation trench down to Mousterian layer F, this feature went unrecognized until 1964, the human remains assigned to the Uluzzian were discovered that year and/or the previous year, and there are contradictions between field reports and the primary anthropological description of the remains as to their morphology and level of provenience. Given these major contextual uncertainties, the Cavallo teeth cannot be used to establish the authorship of the Uluzzian. Since this technocomplex’s start date is ca. 45,000 calendar years ago, a number of Neandertal fossils are dated to this period, and the oldest diagnostic European modern human fossil is the <41,400 year-old Oase 1 mandible, Neandertal authorship of the Uluzzian remains the parsimonious reading of the evidence. PMID:26154139

  6. Isotopic variations within upper oceanic crust at IODP Site 1256: Implications for crustal recycling and the formation of ocean island basalts

    NASA Astrophysics Data System (ADS)

    Duggen, S.; Hoernle, K.; Geldmacher, J.; Hauff, F.

    2007-12-01

    The origin of ocean island basalts (OIBs) is a fundamental question facing Earth scientists. It is commonly agreed that lithospheric material recycled in the mantle is involved in the magma source of OIBs. The relative importance of 1) subducted altered oceanic basaltic crust (AOC), 2) subducted marine sediments and/or 3) delaminated metasomatised subcontinental lithosphere and continental lower crust remains to be resolved. We examine the geochemical composition of a complete in situ section of oceanic crust drilled at Site 1256 during IODP Expeditions 309 and 312. It includes the extrusive layer, sheeted dikes and gabbros of ca. 15 Ma old oceanic crust of the Cocos Plate formed during a period of superfast spreading at the East Pacific Rise. Modeling in the Sr-Nd-Pb-isotope space and comparison with present day radiogenic isotope ratios of OIBs provides constraints on the significance of recycled oceanic crust in the OIB mantle source(s). Our study shows that the generation of sulphides during low- and high-temperature alteration of oceanic crust has a strong influence on U/Pb and Th/Pb ratios and whether an AOC domain evolves relatively low or high Pb-isotope ratios over geological timescales. The model suggests that AOC as the sole precursor material, modified during the subduction process, and after relatively low to moderate recycling ages of ca. 300-800 Ma, is sufficient to explain the Sr-Nd-Pb-isotopic composition of OIBs with Pb-isotopic compositions along or below the Northern Hemisphere Reference Line (NHRL) and relatively high Nd-isotope ratios (e.g. Canaries, Galapagos, Iceland, Madeira). This indicates that additional EM-components, potentially associated with recycled lithospheric material such as subducted sediments, lower continental crust or subcontinental lithosphere, are not required for an array of OIBs, but are only necessary to explain OIBs with Pb-isotope ratios above the NHRL and relatively low Nd- isotope ratios (e.g. Pitcairn, Tristan

  7. The variability of urban aerosol size distributions and optical properties in São Paulo - Brazil: new particle formation events occur at the site

    NASA Astrophysics Data System (ADS)

    Backman, J.; Rizzo, L. V.; Hakala, J.; Nieminen, T.; Manninen, H. E.; Morais, F.; Aalto, P. P.; Siivola, E.; Carbone, S.; Hillamo, R.; Artaxo, P.; Petäjä, T.; Kulmala, M.

    2011-11-01

    The quest to reduce the dependence on fossil fuel has increased the use of bio-ethanol as an additive to gasoline. The metropolitan area of São Paulo (population 20 million) is a unique laboratory to study the ambient aerosol population caused by the use of bio-fuels because 55% of the fuel used is ethanol. The use of ethanol as an additive to fossil fuel is known to increase aldehyde emissions and when photo chemically oxidized, result in smog. In order to characterize this smog problem total particle number concentration, particle number size distribution, light scattering and light absorption measurement equipment were deployed at the University of São Paulo campus area. Here we present the results from three months of measurements from 10 October 2010 to 10 January 2011. The median total particle number concentration for the sub-micron aerosol typically varies between 1×104-3×104 cm-3 frequently exceeding 5×104 cm-3 during the day. Median diurnal values for light absorption and light scattering vary between 12-33 Mm-1 and 21-64 Mm-1, respectively. The hourly median single-scattering albedo varied between 0.63 and 0.85 indicating a net warming effect on a regional scale. A total of ten new particle formation (NPF) events were observed. During these events, growth rates ranged between 9-25 nm h-1. On average, a calculated sulphuric acid vapour abundance of 2.6× 108 cm-3 would have explained the growth with a vapour production rate of 2.8×106 cm-3 s-1 to sustain it. The estimated sulphuric acid concentration, calculated from global irradiance and sulphur dioxide measurements, accounted for only a fraction of the vapour concentration needed to explain the observed growth rates. This indicates that also other condensable vapours participate in the growth process. During the events, the condensation sink was calculated to be 12× 10-3 s-1 on average.

  8. Transport, biomass burning, and in-situ formation contribute to fine particle concentrations at a remote site near Grand Teton National Park

    NASA Astrophysics Data System (ADS)

    Schurman, M. I.; Lee, T.; Desyaterik, Y.; Schichtel, B. A.; Kreidenweis, S. M.; Collett, J. L.

    2015-07-01

    Ecosystem health and visibility degradation due to fine-mode atmospheric particles have been documented in remote areas and motivate particle characterization that can inform mitigation strategies. This study explores submicron (PM1) particle size, composition, and source apportionment at Grand Teton National Park using High-Resolution Time-of-Flight Aerosol Mass Spectrometer data with Positive Matrix Factorization and MODIS fire information. Particulate mass averages 2.08 μg/m3 (max = 21.91 μg/m3) of which 75.0% is organic; PMF-derived Low-Volatility Oxygenated Organic Aerosol (LV-OOA) averages 61.1% of PM1 (or 1.05 μg/m3), with sporadic but higher-concentration biomass burning (BBOA) events contributing another 13.9%. Sulfate (12.5%), ammonium (8.7%), and nitrate (3.8%) are generally low in mass. Ammonium and sulfate have correlated time-series and association with transport from northern Utah and the Snake River Valley. A regionally disperse and/or in situ photochemical LV-OOA source is suggested by 1) afternoon concentration enhancement not correlated with upslope winds, anthropogenic NOx, or ammonium sulfate, 2) smaller particle size, higher polydispersity, and lower levels of oxidation during the day and in comparison to a biomass burning plume inferred to have traveled ∼480 km, and 3) lower degree of oxidation than is usually observed in transported urban plumes and alpine sites with transported anthropogenic OA. CHN fragment spectra suggest organic nitrogen in the form of nitriles and/or pyridines during the day, with the addition of amine fragments at night. Fires near Boise, ID may be the source of a high-concentration biomass-burning event on August 15-16, 2011 associated with SW winds (upslope from the Snake River Valley) and increased sulfate, ammonium, nitrate, and CHN and CHON fragments (nominally, amines and organonitrates). Comparison to limited historical data suggests that the amounts and sources of organics and inorganics presented here

  9. Assessing the impact of anthropogenic pollution on isoprene-derived secondary organic aerosol formation in PM2.5 collected from the Birmingham, Alabama, ground site during the 2013 Southern Oxidant and Aerosol Study

    NASA Astrophysics Data System (ADS)

    Rattanavaraha, Weruka; Chu, Kevin; Hapsari Budisulistiorini, Sri; Riva, Matthieu; Lin, Ying-Hsuan; Edgerton, Eric S.; Baumann, Karsten; Shaw, Stephanie L.; Guo, Hongyu; King, Laura; Weber, Rodney J.; Neff, Miranda E.; Stone, Elizabeth A.; Offenberg, John H.; Zhang, Zhenfa; Gold, Avram; Surratt, Jason D.

    2016-04-01

    In the southeastern US, substantial emissions of isoprene from deciduous trees undergo atmospheric oxidation to form secondary organic aerosol (SOA) that contributes to fine particulate matter (PM2.5). Laboratory studies have revealed that anthropogenic pollutants, such as sulfur dioxide (SO2), oxides of nitrogen (NOx), and aerosol acidity, can enhance SOA formation from the hydroxyl radical (OH)-initiated oxidation of isoprene; however, the mechanisms by which specific pollutants enhance isoprene SOA in ambient PM2.5 remain unclear. As one aspect of an investigation to examine how anthropogenic pollutants influence isoprene-derived SOA formation, high-volume PM2.5 filter samples were collected at the Birmingham, Alabama (BHM), ground site during the 2013 Southern Oxidant and Aerosol Study (SOAS). Sample extracts were analyzed by gas chromatography-electron ionization-mass spectrometry (GC/EI-MS) with prior trimethylsilylation and ultra performance liquid chromatography coupled to electrospray ionization high-resolution quadrupole time-of-flight mass spectrometry (UPLC/ESI-HR-QTOFMS) to identify known isoprene SOA tracers. Tracers quantified using both surrogate and authentic standards were compared with collocated gas- and particle-phase data as well as meteorological data provided by the Southeastern Aerosol Research and Characterization (SEARCH) network to assess the impact of anthropogenic pollution on isoprene-derived SOA formation. Results of this study reveal that isoprene-derived SOA tracers contribute a substantial mass fraction of organic matter (OM) ( ˜ 7 to ˜ 20 %). Isoprene-derived SOA tracers correlated with sulfate (SO42-) (r2 = 0.34, n = 117) but not with NOx. Moderate correlations between methacrylic acid epoxide and hydroxymethyl-methyl-α-lactone (together abbreviated MAE/HMML)-derived SOA tracers with nitrate radical production (P[NO3]) (r2 = 0.57, n = 40) were observed during nighttime, suggesting a potential role of the NO3 radical in

  10. Report on the U.S. Geological Survey's evaluation program for standard reference samples distributed in October 1994 : T-131 (trace constituents), T-133 (trace constituents), M-132 (major constituents), N-43 (nutrients), N-44 (nutrients), P-23 (low ionic strength) and Hg-19 (mercury)

    USGS Publications Warehouse

    Long, H. Keith; Farrar, Jerry W.

    1995-01-01

    This report presents the results of the U.S. Geological Survey's analytical evaluation program for 7 standard reference samples--T-131 (trace constituents), T-133 (trace constituents), M-132 (major constituents), N-43 (nutrients), N-44 (nutrients), P-23 (low ionic strength), and Hg-19 (mercury). The samples were distributed in October 1994 to 131 laboratories registered in the U.S. Geological Survey sponsored interlaboratory testing program. Analytical data that were received from 121 of the laboratories were evaluated with respect to: overall laboratory performance and relative laboratory performance for each analyte in the seven reference samples. Results of these evaluations are presented in tabular form. Also presented are tables and graphs summarizing the analytical data provided by each laboratory for each analyte in the seven standard reference samples. The most probable value for each analyte was determined using nonparametric statistics.

  11. Formation of on-site normal points

    NASA Technical Reports Server (NTRS)

    Appleby, G. M.; Sinclair, Andrew T.

    1993-01-01

    We describe our methods of fitting a smoothing function to observational range differences from a predicted orbit, by deducing corrections to the orbit in the radial and along-track directions. The method has been used on observations of a variety of satellites, and using predicted orbits computed both by numerical integration using IRV's as starting values and analytically from orbital elements. The along-track corrections to the predicted orbit have been successfully used in the form of time biases to improve subsequent predictions, and a statistical test has been devised to ensure that the range residuals may be used to form unbiased quick look normal points.

  12. Site-specific quantitative evaluation of the protein glycation product N6-(2,3-dihydroxy-5,6-dioxohexyl)-L-lysinate by LC-(ESI)MS peptide mapping: evidence for its key role in AGE formation.

    PubMed

    Biemel, Klaus M; Lederer, Markus O

    2003-01-01

    Advanced glycation end products (AGEs) contribute to various pathologies associated with the general aging process and long-term complications of diabetes. Involvement of alpha-dicarbonyl intermediates in the formation of such compounds is firmly established. We now report on the first unequivocal identification of the dideoxyosone N(6)-(2,3-dihydroxy-5,6-dioxohexyl)-l-lysinate (4) on lysozyme via its quinoxaline derivative N(6)-(2,3-dihydroxy-4-quinoxalin-2-ylbutyl)-l-lysinate (6), formed by reaction of 4 with o-phenylenediamine (OPD). For accurate quantification of the total content of 6 as well as of glucosepane 5 by LC-(ESI)MS, (13)C(6)-labeled reference compounds were independently synthesized; 5 so far is the only established follow-up product of 4. With an overall lysine derivatization quota of 5%, compound 4 is shown to be a quantitatively important Maillard intermediate of which only about 8 per thousand are transformed into the cross-link 5. Hence, the major follow-up products of the highly reactive intermediate 4 are yet unknown. The site-specific quantitative evaluation of aminoketose 1 and quinoxaline 6 by LC-(ESI)MS peptide mapping shows that all lysine moieties in lysozyme are in fact modified by these compounds. If an arginine side chain is adjacent to the lysine moiety, transformation of 1 into 4 seems to be favored. The efficient formation and high reactivity of 4 clearly points to its potential as exogenous or endogenous glycotoxin. PMID:12757388

  13. Concept Formation.

    ERIC Educational Resources Information Center

    Vaidya, Narendera

    This document, published in India by the Regional College of Education, deals with 13 subjects: the tough context (thinking), definitions of concept, functions of concept, the process of concept formation, discriminant learning, mediation process, second signalling system, factors affecting concept formation, studies in concept formation, the…

  14. SITE RANK

    EPA Science Inventory

    Site rank is formulated for ranking the relative hazard of contamination sources and vulnerability of drinking water wells. Site rank can be used with a variety of groundwater flow and transport models.

  15. Expression of recombinant human serum amyloid A in mammalian cells and demonstration of the region necessary for high-density lipoprotein binding and amyloid fibril formation by site-directed mutagenesis.

    PubMed Central

    Patel, H; Bramall, J; Waters, H; De Beer, M C; Woo, P

    1996-01-01

    Site-directed mutagenesis of the acute-phase human serum amyloid A (SAA1 alpha) protein was used to evaluate the importance of the N-terminal amino acid residues, namely RSFFSFLGEAF The full-length cDNA clone of SAA1 alpha (pA1.mod.) was used to create two mutations, namely Gly-8 to Asp-8 and an 11 amino acid truncation between Arg-1 and Phe-11 respectively. Wild-type and mutant cDNAs were expressed in Chinese hamster ovary (CHO) cells under the control of the human cytomegalovirus promoter, which resulted in the secretion of the processed proteins into the culture media. Wild-type recombinant human SAA (rSAA) protein was shown to have pI values of 6.0 and 6.4, similar to the human SAA isoform SAA1 alpha and SAA1 alpha desArg found in acute-phase plasma. N-terminal sequencing of 56 residues confirmed its identity with human SAA1 alpha. The total yield of wild-type rSAA measured by ELISA was between 3.5 and 30 mg/l. The two mutations resulted in reduced expression levels of the mutant SAA proteins (3-10 mg/l). Further measurements of rSAA concentration in lipid fractions of culture medium collected at a density of 1.21 g/ml (high-density liporotein; HDL) and 1.063-1.18 g/ml (very-low-density lipoprotein/low-density lipoprotein; VLDL/LDL) showed that 76% of the wild-type protein was found in the HDL fraction and the remaining 24% in the infranatant non-lipid fraction. In contrast the relative concentration of mutant rSAA in HDL and infranatant fractions was reversed. This is consistent with the previously proposed involvement of the 11 amino acid peptide in anchoring. SAA protein on to HDL3 [Turnell, Sarra, Glover, Baum, Caspi, Baltz and Pepys (1986) Mol. Biol. Med. 3, 387-407]. Wild-type rSAA protein was shown to from amyloid fibrils in vitro under acidic conditions as shown by electron microscopy, and stained positive with Congo Red and exhibited apple-green birefringence when viewed under polarized light. Under the same conditions mutSAA(G8D) and mutSAA delta 1

  16. Gaussian entanglement of formation

    SciTech Connect

    Wolf, M.M.; Giedke, G.; Krueger, O.; Werner, R. F.; Cirac, J.I.

    2004-05-01

    We introduce a Gaussian version of the entanglement of formation adapted to bipartite Gaussian states by considering decompositions into pure Gaussian states only. We show that this quantity is an entanglement monotone under Gaussian operations and provide a simplified computation for states of arbitrary many modes. For the case of one mode per site the remaining variational problem can be solved analytically. If the considered state is in addition symmetric with respect to interchanging the two modes, we prove additivity of the considered entanglement measure. Moreover, in this case and considering only a single copy, our entanglement measure coincides with the true entanglement of formation.

  17. Formative Assessment

    ERIC Educational Resources Information Center

    Technology & Learning, 2005

    2005-01-01

    In today's climate of high-stakes testing and accountability, educators are challenged to continuously monitor student progress to ensure achievement. This article details how formative assessment helps educators meet this challenge and to ensure achievement. Formative assessment can influence learning and support achievement, allowing teachers…

  18. Evaluation of Cavity Collapse and Surface Crater Formation at the Norbo Underground Nuclear Test in U8c, Nevada Nuclear Security Site, and the Impact on Stability of the Ground Surface

    SciTech Connect

    Pawloski, G A

    2012-06-18

    Lawrence Livermore National Laboratory (LLNL) Containment Program performed a review of nuclear test-related data for the Norbo underground nuclear test in U8c to assist in evaluating this legacy site as a test bed for application technologies for use in On-Site Inspections (OSI) under the Comprehensive Nuclear Test Ban Treaty. This request is similar to one made for the Salut site in U8c (Pawloski, 2012b). Review of the Norbo site is complicated because the test first exhibited subsurface collapse, which was not unusual, but it then collapsed to the surface over one year later, which was unusual. Of particular interest is the stability of the ground surface above the Norbo detonation point. Proposed methods for on-site verification include radiological signatures, artifacts from nuclear testing activities, and imaging to identify alteration to the subsurface hydrogeology due to the nuclear detonation. Aviva Sussman from the Los Alamos National Laboratory (LANL) has also proposed work at this site. Both proposals require physical access at or near the ground surface of specific underground nuclear test locations at the Nevada Nuclear Security Site (NNSS), formerly the Nevada Test Site (NTS), and focus on possible activities such as visual observation, multispectral measurements, and shallow and deep geophysical surveys.

  19. Value siting

    SciTech Connect

    Ferrar, T.A.; Howes, J.A.

    1995-02-01

    Finding an appropriate site is becoming an increasing challenge in building new power projects. One of the first orders of business in project development is identifying a site that offers the maximum spread between the cost of fuel and net power price. The collection of sites that exhibit an adequate spread - presenting a first-order, acceptable economic expectation - must now be subjected to an ever increasing number of political, societal, technical, and economic exclusion screens. The barriers can include cooling water constraints, community resistance, visual incompatibility, archaeological concerns and endangered species preservation issues. Most power siting difficulties can be substantially mitigated by gaining access to developed, but under-used sites, whose current owners are bound by circumstances - political or financial - that prevent them from using such locations. There are two such categories of sites: Utilities that have sites on which depreciated power production assets rest; and, The federal government, with numerous sites throughout the country, particularly military bases subject to closure under the Base Realignment and Closure (BRAC) proceedings. It is in the interests of developers, as well as consumers, investors and taxpayers, ti undertake a thorough examination of these overlooked pearls of opportunities and develop their potential.

  20. Interpretation of single-well push-pull spikings conducted in deep crystalline formations (Soultz-s.-F. in the Upper Rhine Graben, and KTB-VB at the German site of ICDP)

    NASA Astrophysics Data System (ADS)

    Ghergut, J.; Sauter, M.; Behrens, H.; (Steffen) Fischer, S.; (Steffi) Fischer, S.; Licha, T.; Nottebohm, M.

    2009-04-01

    Two somewhat contrasting model approaches are presented, both aimed at interpreting long-term return signals from tracer push-pull tests conducted at single wells penetrating increased-permeability features in crystalline rock, about 4 km deep. The general idea is that single-well tracer push-pull tests, owing to the flow-field reversal, should provide privileged access to advection-independent parameters of solute transport, like the density of fluid-rock contact surface areas (Sauter et al., 2002). The latter is equivalent to the heat exchange area for a liquid-based geothermal system. At the geothermal site of Soultz-sous-Forêts in the Upper Rhine Graben, the French BRGM, in cooperation with EGI Utah and other partners, conducted a comprehensive tracer testing programme, whose results were presented in detail by Sanjuan et al. (2004, 2006), Rose et al. (2006). Of these results, we pick the tracer return signals detected during post-stimulation backflow periods at borehole GPK-2 between 2000 and 2002 (as published by Sanjuan et al., 2004) and attempt to interpret them in terms of a single-well injection-withdrawal sequence. Two chemically dissimilar organic tracers have been used by BRGM; however the difference between their return signals seems not significant enough to allow quantifying fluid-rock contact surfaces from this difference alone (additional / a priori information on coefficients of solute exchange across these surfaces would be required). Instead, the tracer return signals enable characterizing the nature of solute exchange processes within the spiked volume of the assumed fractured-porous formation (highly altered crystalline rock). At least one rapid-exchange (E-7 / d), slightly dispersive (Pe~12) component and one moderate-exchange (2E-8 / d), less dispersive (Pe~20) component appear to act within few hundred metres and, respectively, within at least 1 km radial distance from the borehole. - An alternative component of extremely fast exchange

  1. Evaluation of Cavity Collapse and Surface Crater Formation at the Salut Underground Nuclear Test in U20ak, Nevada National Security Site, and the Impact of Stability of the Ground Surface

    SciTech Connect

    Pawloski, G A

    2012-04-25

    At the request of Jerry Sweeney, the LLNL Containment Program performed a review of nuclear test-related data for the Salut underground nuclear test in U20ak to assist in evaluating this legacy site as a test bed for application technologies for use in On-Site Inspections (OSI) under the Comprehensive Nuclear Test Ban Treaty. Review of the Salut site is complicated because the test experienced a subsurface, rather than surface, collapse. Of particular interest is the stability of the ground surface above the Salut detonation point. Proposed methods for on-site verification include radiological signatures, artifacts from nuclear testing activities, and imaging to identify alteration to the subsurface hydrogeologogy due to the nuclear detonation. Sweeney's proposal requires physical access at or near the ground surface of specific underground nuclear test locations at the Nevada Nuclear Test Site (NNSS, formerly the Nevada Test Site), and focuses on possible activities such as visual observation, multispectral measurements, and shallow, and deep geophysical surveys.

  2. Galaxy formation

    SciTech Connect

    Silk, J.

    1984-11-01

    Implications of the isotropy of the cosmic microwave background on large and small angular scales for galaxy formation are reviewed. In primeval adiabatic fluctuations, a universe dominated by cold, weakly interacting nonbaryonic matter, e.g., the massive photino is postulated. A possible signature of photino annihilation in our galactic halo involves production of cosmic ray antiprotons. If the density is near its closure value, it is necessary to invoke a biasing mechanism for suppressing galaxy formation throughout most of the universe in order to reconcile the dark matter density with the lower astronomical determinations of the mean cosmological density. A mechanism utilizing the onset of primordial massive star formation to strip gaseous protogalaxies is described. Only the densest, early collapsing systems form luminous galaxies. (ESA)

  3. Comet formation

    NASA Astrophysics Data System (ADS)

    Blum, J.

    2014-07-01

    There has been vast progress in our understanding of planetesimal formation over the past decades, owing to a number of laboratory experiments as well as to refined models of dust and ice agglomeration in protoplanetary disks. Coagulation rapidly forms cm-sized ''pebbles'' by direct sticking in collisions at low velocities (Güttler et al. 2010; Zsom et al. 2010). For the further growth, two model approaches are currently being discussed: (1) Local concentration of pebbles in nebular instabilities until gravitational instability occurs (Johansen et al. 2007). (2) A competition between fragmentation and mass transfer in collisions among the dusty bodies, in which a few ''lucky winners'' make it to planetesimal sizes (Windmark et al. 2012a,b; Garaud et al. 2013). Predictions of the physical properties of the resulting bodies in both models allow a distinction of the two formation scenarios of planetesimals. In particular, the tensile strength (i.e, the inner cohesion) of the planetesimals differ widely between the two models (Skorov & Blum 2012; Blum et al. 2014). While model (1) predicts tensile strengths on the order of ˜ 1 Pa, model (2) results in rather compactified dusty bodies with tensile strengths in the kPa regime. If comets are km-sized survivors of the planetesimal-formation era, they should in principle hold the secret of their formation process. Water ice is the prime volatile responsible for the activity of comets. Thermophysical models of the heat and mass transport close to the comet-nucleus surface predict water-ice sublimation temperatures that relate to maximum sublimation pressures well below the kPa regime predicted for formation scenario (2). Model (1), however, is in agreement with the observed dust and gas activity of comets. Thus, a formation scenario for cometesimals involving gravitational instability is favored (Blum et al. 2014).

  4. Planet Formation

    NASA Astrophysics Data System (ADS)

    Klahr, Hubert; Brandner, Wolfgang

    2011-02-01

    1. Historical notes on planet formation Bodenheimer; 2. The formation and evolution of planetary systems Bouwman et al.; 3. Destruction of protoplanetary disks by photoevaporation Richling, Hollenbach and Yorke; 4. Turbulence in protoplanetary accretion disks Klahr, Rozyczka, Dziourkevitch, Wunsch and Johansen; 5. The origin of solids in the early solar system Trieloff and Palme; 6. Experiments on planetesimal formation Wurm and Blum; 7. Dust coagulation in protoplanetary disks Henning, Dullemond, Wolf and Dominik; 8. The accretion of giant planet cores Thommes and Duncan; 9. Planetary transits: direct vision of extrasolar planets Lecavelier des Etangs and Vidal-Madjar; 10. The core accretion - gas capture model Hubickyj; 11. Properties of exoplanets Marcy, Fischer, Butler and Vogt; 12. Giant planet formation: theories meet observations Boss; 13. From hot Jupiters to hot Neptures … and below Lovis, Mayor and Udry; 14. Disk-planet interaction and migration Masset and Kley; 15. The Brown Dwarf - planet relation Bate; 16. From astronomy to astrobiology Brandner; 17. Overview and prospective Lin.

  5. Site Construction.

    ERIC Educational Resources Information Center

    Richardson, Eric C.

    1996-01-01

    Presents a guide to planning and building a Web site, with an emphasis on setting up a Web server. Discussion includes hiring a consultant, contracts and payment, assembly of teams, training, development of a business plan, registration of domain name, purchase of hardware and software, local area networks, and types of Internet connection. (JKP)

  6. Characterization of Archaeological Sediments Using Fourier Transform Infrared (FT-IR) and Portable X-ray Fluorescence (pXRF): An Application to Formative Period Pyro-Industrial Sites in Pacific Coastal Southern Chiapas, Mexico.

    PubMed

    Neff, Hector; Bigney, Scott J; Sakai, Sachiko; Burger, Paul R; Garfin, Timothy; George, Richard G; Culleton, Brendan J; Kennett, Douglas J

    2016-01-01

    Archaeological sediments from mounds within the mangrove zone of far-southern Pacific coastal Chiapas, Mexico, are characterized in order to test the hypothesis that specialized pyro-technological activities of the region's prehistoric inhabitants (salt and ceramic production) created the accumulations visible today. Fourier transform infrared spectroscopy (FT-IR) is used to characterize sediment mineralogy, while portable X-ray fluorescence (pXRF) is used to determine elemental concentrations. Elemental characterization of natural sediments by both instrumental neutron activation analysis (INAA) and pXRF also contribute to understanding of processes that created the archaeological deposits. Radiocarbon dates combined with typological analysis of ceramics indicate that pyro-industrial activity in the mangrove zone peaked during the Late Formative and Terminal Formative periods, when population and monumental activity on the coastal plain and piedmont were also at their peaks. PMID:26767637

  7. Formation testers

    SciTech Connect

    Brieger, E.

    1980-07-01

    A description is given of a method for use in obtaining multiple pressure tests of an earth formation traversed by a well bore by use of a sidewall fluid sampler well tool which has a fluid pressure sampling chamber in the well tool in open fluid communication with a pad sealing means, comprising the steps of: for one selected level in a well bore, moving a pad sealing means on the well tool into engagement with the wall of a well bore and isolating a wall segment of the earth formation; after the pad sealing means engges the wall segment of the earth formation, generating a hydraulic pressure in the well tool and applying said hydraulic pressure to said fluid pressure sampling chamber for increasing the volume of said fluid pressure sampling chamber thereby to dray a fluid sample from the earth formation engaged by the pad sealing means into the fluid pressure sampling chamber, sensing the pressure of said fluid sample as it is drawn into the fluid pressure sampling chamber while the volume of the sampling chamber is being increased, relieving the hydraulic pressure in the well tool with respect to said fluid pressur sampling chamber for decreasing the volume of said fluid pressure sampling chamber thereby to contact the sampling chamber to dischrge the fluid sample through the pad sealing means; retracting the sealing pad means and, after retrction of sealing pad means from engagement from the wall of the well bore, moving the well tool to a second location at another level in the well bore and, at the second location, repeating the steps of the method performed at the one selected level for obtaining another fluid sample and pressure sensing at said second location.

  8. Nitric oxide-based protein modification: formation and site-specificity of protein S-nitrosylation: Could protein S-nitrosylation be the unifying oxidative modification to explain the cellular signaling activity of superoxide and hydrogen peroxide?

    PubMed

    Clement, Marie-Veronique

    2014-10-01

    Accumulating evidence indicates that reactive oxygen species (ROS) and reactive nitrogen species (RNS) function as signaling molecules in physiological settings by acting as second messengers in response to external stimuli such as growth factors, cytokines and hormones. The nature of the ROS involved in cell signaling as well as the underlying mechanisms by which ROS modify protein function to influence cellular processes have been unfolding over the past decade. ROS and RNS influence various cellular processes by altering the function of critical proteins via reversible oxidation of "reactive cysteine" residues. Protein S-nitrosylation is a mechanism of nitric oxide-based signaling, however, while the presence of NO is sufficient and may be a prerequisite for the formation of cysteine-SNO, we reasoned that if protein-SNO formation is a critical cystein modification for redox driven signal transduction, an increase in intracellular ROS such as H2O2 and O2(-), shown to be independently involved in cell signaling, might both promote the formation of protein-SNO. In this respect, the present study shows that an increase in protein-SNO was detected not only upon an increase in the intracellular level of nitric oxide (NO), but also following exposure to low concentration of exogenous hydrogen peroxide (H2O2) or upon inhibition of the Cu/Zn superoxide dismutase that results in increased intracellular O2(-). PMID:26461291

  9. 1994 Site Environmental Report

    SciTech Connect

    1995-05-01

    The 1994 Site Environmental Report summarizes environmental activities at Lawrence Berkeley Laboratory (LBL) for the calendar year (CY) 1994. The report strives to present environmental data in a manner that characterizes the performance and compliance status of the Laboratory`s environmental management programs when measured against regulatory standards and DOE requirements. The report also discusses significant highlight and planning efforts of these programs. The format and content of the report are consistent with the requirements of the US Department of Energy (DOE) Order 5400.1, General Environmental Protection Program.

  10. Amphiplex Formation

    NASA Astrophysics Data System (ADS)

    Petersen, Shannon; Laaser, Jennifer; Lodge, Timothy

    2015-03-01

    Polymer-micelle complexes are currently under heavy investigation due to their potential applications in targeted drug delivery and gene therapy, yet the dynamics of the complex formation is still relatively unstudied. By varying the ratios of poly(styrene sulfonate) chains and cationic poly(dimethylaminoethyl methacrylate)-b-poly(styrene) micelles and the ionic strength of the system, we created a variety of complex configurations of different sizes and charges. The complexes were characterized dynamic light scattering and zeta potential measurements which provided information regarding the hydrodynamic radius, distribution of sizes, and effective charge.

  11. 48 CFR 307.7103 - Format.

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... for preparing an AP. The template for the AP is available on the ASFR/OGAPA/DA Internet Web site. (b) OPDIVs may use the prescribed format without modification or use it as a guideline, as long as the...

  12. 48 CFR 307.7103 - Format.

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... for preparing an AP. The template for the AP is available on the ASFR/OGAPA/DA Internet Web site. (b) OPDIVs may use the prescribed format without modification or use it as a guideline, as long as the...

  13. 48 CFR 307.7103 - Format.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... for preparing an AP. The template for the AP is available on the ASFR/OGAPA/DA Internet Web site. (b) OPDIVs may use the prescribed format without modification or use it as a guideline, as long as the...

  14. 48 CFR 307.7103 - Format.

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... for preparing an AP. The template for the AP is available on the ASFR/OGAPA/DA Internet Web site. (b) OPDIVs may use the prescribed format without modification or use it as a guideline, as long as the...

  15. Habit formation.

    PubMed

    Smith, Kyle S; Graybiel, Ann M

    2016-03-01

    Habits, both good ones and bad ones, are pervasive in animal behavior. Important frameworks have been developed to understand habits through psychological and neurobiological studies. This work has given us a rich understanding of brain networks that promote habits, and has also helped us to understand what constitutes a habitual behavior as opposed to a behavior that is more flexible and prospective. Mounting evidence from studies using neural recording methods suggests that habit formation is not a simple process. We review this evidence and take the position that habits could be sculpted from multiple dissociable changes in neural activity. These changes occur across multiple brain regions and even within single brain regions. This strategy of classifying components of a habit based on different brain signals provides a potentially useful new way to conceive of disorders that involve overly fixed behaviors as arising from different potential dysfunctions within the brain's habit network. PMID:27069378

  16. Habit formation

    PubMed Central

    Smith, Kyle S.; Graybiel, Ann M.

    2016-01-01

    Habits, both good ones and bad ones, are pervasive in animal behavior. Important frameworks have been developed to understand habits through psychological and neurobiological studies. This work has given us a rich understanding of brain networks that promote habits, and has also helped us to understand what constitutes a habitual behavior as opposed to a behavior that is more flexible and prospective. Mounting evidence from studies using neural recording methods suggests that habit formation is not a simple process. We review this evidence and take the position that habits could be sculpted from multiple dissociable changes in neural activity. These changes occur across multiple brain regions and even within single brain regions. This strategy of classifying components of a habit based on different brain signals provides a potentially useful new way to conceive of disorders that involve overly fixed behaviors as arising from different potential dysfunctions within the brain's habit network. PMID:27069378

  17. Examining the effects of anthropogenic emissions on isoprene-derived secondary organic aerosol formation during the 2013 Southern Oxidant and Aerosol Study (SOAS) at the Look Rock, Tennessee, ground site

    NASA Astrophysics Data System (ADS)

    Budisulistiorini, S. H.; Li, X.; Bairai, S. T.; Renfro, J.; Liu, Y.; Liu, Y. J.; McKinney, K. A.; Martin, S. T.; McNeill, V. F.; Pye, H. O. T.; Nenes, A.; Neff, M. E.; Stone, E. A.; Mueller, S.; Knote, C.; Shaw, S. L.; Zhang, Z.; Gold, A.; Surratt, J. D.

    2015-03-01

    A suite of offline and real-time gas- and particle-phase measurements was deployed at Look Rock, Tennessee (TN), during the 2013 Southern Oxidant and Aerosol Study (SOAS) to examine the effects of anthropogenic emissions on isoprene-derived secondary organic aerosol (SOA) formation. High- and low-time resolution PM2.5 samples were collected for analysis of known tracer compounds in isoprene-derived SOA by gas chromatography/electron ionization-mass spectrometry (GC/EI-MS) and ultra performance liquid chromatography/diode array detection-electrospray ionization-high-resolution quadrupole time-of-flight mass spectrometry (UPLC/DAD-ESI-HR-QTOFMS). Source apportionment of the organic aerosol (OA) was determined by positive matrix factorization (PMF) analysis of mass spectrometric data acquired on an Aerodyne Aerosol Chemical Speciation Monitor (ACSM). Campaign average mass concentrations of the sum of quantified isoprene-derived SOA tracers contributed to ~9% (up to 26%) of the total OA mass, with isoprene-epoxydiol (IEPOX) chemistry accounting for ~97% of the quantified tracers. PMF analysis resolved a factor with a profile similar to the IEPOX-OA factor resolved in an Atlanta study and was therefore designated IEPOX-OA. This factor was strongly correlated (r2>0.7) with 2-methyltetrols, C5-alkene triols, IEPOX-derived organosulfates, and dimers of organosulfates, confirming the role of IEPOX chemistry as the source. On average, IEPOX-derived SOA tracer mass was ~25% (up to 47%) of the IEPOX-OA factor mass, which accounted for 32% of the total OA. A low-volatility oxygenated organic aerosol (LV-OOA) and an oxidized factor with a profile similar to 91Fac observed in areas where emissions are biogenic-dominated were also resolved by PMF analysis, whereas no primary organic aerosol (POA) sources could be resolved. These findings were consistent with low levels of primary pollutants, such as nitric oxide (NO~0.03ppb), carbon monoxide (CO~116 ppb), and black carbon (BC~0

  18. Examining the effects of anthropogenic emissions on isoprene-derived secondary organic aerosol formation during the 2013 Southern Oxidant and Aerosol Study (SOAS) at the Look Rock, Tennessee ground site

    NASA Astrophysics Data System (ADS)

    Budisulistiorini, S. H.; Li, X.; Bairai, S. T.; Renfro, J.; Liu, Y.; Liu, Y. J.; McKinney, K. A.; Martin, S. T.; McNeill, V. F.; Pye, H. O. T.; Nenes, A.; Neff, M. E.; Stone, E. A.; Mueller, S.; Knote, C.; Shaw, S. L.; Zhang, Z.; Gold, A.; Surratt, J. D.

    2015-08-01

    A suite of offline and real-time gas- and particle-phase measurements was deployed at Look Rock, Tennessee (TN), during the 2013 Southern Oxidant and Aerosol Study (SOAS) to examine the effects of anthropogenic emissions on isoprene-derived secondary organic aerosol (SOA) formation. High- and low-time-resolution PM2.5 samples were collected for analysis of known tracer compounds in isoprene-derived SOA by gas chromatography/electron ionization-mass spectrometry (GC/EI-MS) and ultra performance liquid chromatography/diode array detection-electrospray ionization-high-resolution quadrupole time-of-flight mass spectrometry (UPLC/DAD-ESI-HR-QTOFMS). Source apportionment of the organic aerosol (OA) was determined by positive matrix factorization (PMF) analysis of mass spectrometric data acquired on an Aerodyne Aerosol Chemical Speciation Monitor (ACSM). Campaign average mass concentrations of the sum of quantified isoprene-derived SOA tracers contributed to ~ 9 % (up to 28 %) of the total OA mass, with isoprene-epoxydiol (IEPOX) chemistry accounting for ~ 97 % of the quantified tracers. PMF analysis resolved a factor with a profile similar to the IEPOX-OA factor resolved in an Atlanta study and was therefore designated IEPOX-OA. This factor was strongly correlated (r2 > 0.7) with 2-methyltetrols, C5-alkene triols, IEPOX-derived organosulfates, and dimers of organosulfates, confirming the role of IEPOX chemistry as the source. On average, IEPOX-derived SOA tracer mass was ~ 26 % (up to 49 %) of the IEPOX-OA factor mass, which accounted for 32 % of the total OA. A low-volatility oxygenated organic aerosol (LV-OOA) and an oxidized factor with a profile similar to 91Fac observed in areas where emissions are biogenic-dominated were also resolved by PMF analysis, whereas no primary organic aerosol (POA) sources could be resolved. These findings were consistent with low levels of primary pollutants, such as nitric oxide (NO ~ 0.03 ppb), carbon monoxide (CO ~ 116 ppb), and black

  19. Barrier Formation

    PubMed Central

    Lyaruu, D.M.; Medina, J.F.; Sarvide, S.; Bervoets, T.J.M.; Everts, V.; DenBesten, P.; Smith, C.E.; Bronckers, A.L.J.J.

    2014-01-01

    Enamel fluorosis is an irreversible structural enamel defect following exposure to supraoptimal levels of fluoride during amelogenesis. We hypothesized that fluorosis is associated with excess release of protons during formation of hypermineralized lines in the mineralizing enamel matrix. We tested this concept by analyzing fluorotic enamel defects in wild-type mice and mice deficient in anion exchanger-2a,b (Ae2a,b), a transmembrane protein in maturation ameloblasts that exchanges extracellular Cl− for bicarbonate. Defects were more pronounced in fluorotic Ae2a,b−/− mice than in fluorotic heterozygous or wild-type mice. Phenotypes included a hypermineralized surface, extensive subsurface hypomineralization, and multiple hypermineralized lines in deeper enamel. Mineral content decreased in all fluoride-exposed and Ae2a,b−/− mice and was strongly correlated with Cl−. Exposure of enamel surfaces underlying maturation-stage ameloblasts to pH indicator dyes suggested the presence of diffusion barriers in fluorotic enamel. These results support the concept that fluoride stimulates hypermineralization at the mineralization front. This causes increased release of protons, which ameloblasts respond to by secreting more bicarbonates at the expense of Cl− levels in enamel. The fluoride-induced hypermineralized lines may form barriers that impede diffusion of proteins and mineral ions into the subsurface layers, thereby delaying biomineralization and causing retention of enamel matrix proteins. PMID:24170372

  20. Pattern Formation

    NASA Astrophysics Data System (ADS)

    Hoyle, Rebecca

    2006-03-01

    From the stripes of a zebra and the spots on a leopard's back to the ripples on a sandy beach or desert dune, regular patterns arise everywhere in nature. The appearance and evolution of these phenomena has been a focus of recent research activity across several disciplines. This book provides an introduction to the range of mathematical theory and methods used to analyse and explain these often intricate and beautiful patterns. Bringing together several different approaches, from group theoretic methods to envelope equations and theory of patterns in large-aspect ratio-systems, the book also provides insight behind the selection of one pattern over another. Suitable as an upper-undergraduate textbook for mathematics students or as a fascinating, engaging, and fully illustrated resource for readers in physics and biology, Rebecca Hoyle's book, using a non-partisan approach, unifies a range of techniques used by active researchers in this growing field. Accessible description of the mathematical theory behind fascinating pattern formation in areas such as biology, physics and materials science Collects recent research for the first time in an upper level textbook Features a number of exercises - with solutions online - and worked examples

  1. An allolactose trapped at the lacZ β-galactosidase active site with its galactosyl moiety in a (4)H3 conformation provides insights into the formation, conformation, and stabilization of the transition state.

    PubMed

    Wheatley, Robert W; Huber, Reuben E

    2015-12-01

    When lactose was incubated with G794A-β-galactosidase (a variant with a "closed" active site loop that binds transition state analogs well) an allolactose was trapped with its Gal moiety in a (4)H3 conformation, similar to the oxocarbenium ion-like conformation expected of the transition state. The numerous interactions formed between the (4)H3 structure and β-galactosidase indicate that this structure is representative of the transition state. This conformation is also very similar to that of d-galactono-1,5-lactone, a good transition state analog. Evidence indicates that substrates take up the (4)H3 conformation during migration from the shallow to the deep mode. Steric forces utilizing His418 and other residues are important for positioning the O1 leaving group into a quasi-axial position. An electrostatic interaction between the O5 of the distorted Gal and Tyr503 as well as C-H-π bonds with Trp568 are also significant. Computational studies of the energy of sugar ring distortion show that the β-galactosidase reaction itinerary is driven by energetic considerations in utilization of a (4)H3 transition state with a novel (4)C1-(4)H3-(4)C1 conformation itinerary. To our knowledge, this is the first X-ray crystallographic structural demonstration that the transition state of a natural substrate of a glycosidase has a (4)H3 conformation. PMID:26291713

  2. 92-kD gelatinase is produced by eosinophils at the site of blister formation in bullous pemphigoid and cleaves the extracellular domain of recombinant 180-kD bullous pemphigoid autoantigen.

    PubMed Central

    Ståhle-Bäckdahl, M; Inoue, M; Guidice, G J; Parks, W C

    1994-01-01

    Eosinophils are prominent in bullous pemphigoid (BP), and proteases secreted from these and other inflammatory cells may induce disruption of the basement membrane. We used in situ hybridization and immunohistochemistry to localize the sites of 92-kD gelatinase expression in BP lesions. In all samples (20/20), a strong signal for gelatinase mRNA was detected only in eosinophils and was most pronounced where these cells accumulated at the floor of forming blisters. No other cells were positive for enzyme mRNA. Both eosinophils and neutrophils, however, contained immunoreactive 92-kD gelatinase indicating that active expression occurred only in eosinophils. Degranulated eosinophils were also seen near blisters, and as demonstrated by gelatin zymography, immunoblotting, and ELISA, 92-kD gelatinase protein was prominent in BP blister fluid. No other gelatinolytic activity was specifically detected in BP fluid, and only small amounts of 92-kD gelatinase were present in suction blister fluids. As demonstrated in vitro, 92-kD gelatinase cleaved the extracellular, collagenous domain of recombinant 180-kD BP autoantigen (BP180, BPAG2, HD4, type XVII collagen), a transmembrane molecule of the epidermal hemidesmosome. Our results suggest that production and release 92-kD gelatinase by eosinophils contributes significantly to tissue damage in BP. Images PMID:8182134

  3. Late Pleistocene ice margin fluctuations in the Nahanni National Park-UNESCO World Heritage Site and their impact on glacial lake formation and architecture of drainage systems across the Yukon-NWT continental divide

    NASA Astrophysics Data System (ADS)

    Duk-Rodkin, A.; Barendregt, R. W.

    2009-12-01

    In the late Pleistocene the southern Mackenzie region was glaciated by ice masses from a Cordilleran and continental source (Laurentide). Stratigraphic and geomorphologic evidence indicate that the two glaciers occupied this region at different times during the Late Pleistocene. The continental ice sheet advanced over the foothills and up major valleys reaching its maximum extent, ca. 30 ka. B. P. This took place when Cordilleran glaciers were in their initial stages of development. The Laurentide Ice Sheet blocked the drainage of the South Nahanni River near Virginia Falls, forming a glacial lake which inundated an area of approximately 900 km2 at its maximum stand, and had an outlet to the southwest, across the continental divide into the Yukon Territory and eventually into the Pacific Ocean. Lacustrine sediments at various sites reach thicknesses ranging from 110 to 120 metres, at an elevation of around 700 m. Cordilleran glaciers advanced eastward and approximately 5000 years later blocked this southwestward drainage, rerouting it to the east and north along the Mackenzie Mountain front. The drainage was confined between the mountains and continental ice margin where it incised major canyons into the limestone bedrock, and produced a spectacular karst landscape, which today forms part of the Nahanni National Park. During the retreat of the Laurentide and advance of Cordilleran glaciers, glacial Lake Nahanni cut an outlet to the east at First Canyon. This outlet drained into a continuous northbound network of marginal meltwater channels joining the north-flowing drainage that eventually reached the Arctic Ocean, and during further retreat of the ice sheet established the Mackenzie River in its modern location. The presence of Laurentide ice in this region is evidenced by large granite boulders carried from the Canadian Shield. Erratics are found up to 100 km west of the mountain front. Neotectonic activity in the area is interpreted from exposures such as those

  4. DUST FORMATION IN MACRONOVAE

    SciTech Connect

    Takami, Hajime; Ioka, Kunihito; Nozawa, Takaya E-mail: kunihito.ioka@kek.jp

    2014-07-01

    We examine dust formation in macronovae (as known as kilonovae), which are the bright ejecta of neutron star binary mergers and one of the leading sites of r-process nucleosynthesis. In light of information about the first macronova candidate associated with GRB 130603B, we find that dust grains of r-process elements have difficulty forming because of the low number density of the r-process atoms, while carbon or elements lighter than iron can condense into dust if they are abundant. Dust grains absorb emission from ejecta with an opacity even greater than that of the r-process elements, and re-emit photons at infrared wavelengths. Such dust emission can potentially account for macronovae without r-process nucleosynthesis as an alternative model. This dust scenario predicts a spectrum with fewer features than the r-process model and day-scale optical-to-ultraviolet emission.

  5. Target sites of anthelmintics.

    PubMed

    Martin, R J; Robertson, A P; Bjorn, H

    1997-01-01

    This paper reviews sites of action of anthelmintic drugs including: (1) levamisole and pyrantel, which act as agonists at nicotinic acetylcholine receptors of nematodes; (2) the avermectins, which potentiate or gate the opening of glutamategated chloride channels found only in invertebrates; (3) piperazine, which acts as an agonist at GABA gated chloride channels on nematode muscle; (4) praziquantel, which increases the permeability of trematode tegument to calcium and results in contraction of the parasite muscle; (5) the benzimidazoles, like thiabendazole, which bind selectively to parasite beta-tubulin and prevents microtubule formation; (6) the proton ionophores, like closantel, which uncouple oxidative phosphorylation; (7) diamphenethide and clorsulon, which selectively inhibit glucose metabolism of Fasciola and; (8) diethylcarbamazine, which appears to interfere with arachidonic acid metabolism of filarial parasites and host. The review concludes with brief comments on the development of anthelmintics in the future. PMID:9309773

  6. Supershells and propagating star formation

    NASA Technical Reports Server (NTRS)

    Maclow, M. M.; Mccray, R.; Kafatos, M.

    1986-01-01

    Correlated supernovae from an OB association can carve large cavities (greater than 100 pc) in the interstellar medium (ISM), and can punch holes completely through the disk of a spiral galaxy. Supernova remnant energy within such a cavity is thermalized before the shock reaches the supershell. Thus stellar wind theory may be used to model these superbubbles. We describe how the evolution of the superbubble depends on the density distribution of the galactic disk gas and the rate of supernovae in the OB association. At a radius of 100 to 300 pc, the supershell becomes gravitationally unstable, forming giant molecular clouds which are the sites for new star formation. This gravitational instability of the supershells provides a physical mechanism for propagating star formation and may account for the observation of bursts of star formation in galaxies.

  7. Implementation: Preparing the Site.

    ERIC Educational Resources Information Center

    Epstein, Susan Baerg

    1983-01-01

    Considers site requirements that should be specified by the library and the vendor for a library automated system located at a central site away from the library, including size of site, the environment, cleanliness, electrical power, security/safety (fire, restricted access), site certification, telecommunications, and terminal sites. (EJS)

  8. The ASCD Healthy School Communities Project: Formative Evaluation Results

    ERIC Educational Resources Information Center

    Valois, Robert F.; Lewallen, Theresa C.; Slade, Sean; Tasco, Adriane N.

    2015-01-01

    Purpose: The purpose of this paper is to report the formative evaluation results from the Association for Supervision and Curriculum Development Healthy School Communities (HSC) pilot project. Design/methodology/approach: This study utilized 11 HSC pilot sites in the USA (eight sites) and Canada (three sites). The evaluation question was…

  9. Low Abundant N-linked Glycosylation in Hen Egg White Lysozyme Is Localized at Nonconsensus Sites.

    PubMed

    Asperger, Arndt; Marx, Kristina; Albers, Christian; Molin, Laura; Pinato, Odra

    2015-06-01

    Although wild-type hen egg white lysozyme (HEL) is lacking the consensus sequence motif NX(S/T), in 1995 Trudel et al. (Biochem. Cell Biol. 1995, 73, 307-309) proposed the existence of a low abundant N-glycosylated form of HEL; however, the identity of active glycosylation sites in HEL remained a matter of speculation. For the first time since Trudel's initial work, we report here a comprehensive characterization by means of mass spectrometry of N-glycosylation in wild-type HEL. Our analytical approach comprised ZIC-HILIC enrichment of N-glycopeptides from HEL trypsin digest, deglycosylation by (18)O/PNGase F as well as by various endoglycosidases, and LC-MS/MS analysis of both intact and deglycosylated N-glycopeptides engaging multiple techniques of ionization and fragmentation. A novel data interpretation workflow based on MS/MS spectra classification and glycan database searching enabled the straightforward identification of the asparagine-rich N-glycopeptide [34-45] FESNFNTQATNR and allowed for compositional profiling of its modifying N-glycans. The overall heterogeneity profile of N-glycans in HEL comprised at least 26 different compositions. Results obtained from deglycosylation experiments provided clear evidence of asparagine residues N44 and N39 representing active glycosylation sites in HEL. Both of these sites do not fall into any known N-glycosylation-specific sequence motif but are localized in rarely observed nonconsensus sequons (NXN, NXQ). PMID:25964011

  10. Promoting Your Web Site.

    ERIC Educational Resources Information Center

    Raeder, Aggi

    1997-01-01

    Discussion of ways to promote sites on the World Wide Web focuses on how search engines work and how they retrieve and identify sites. Appropriate Web links for submitting new sites and for Internet marketing are included. (LRW)

  11. Cyclic Imide Dioxime: Formation and Hydrolytic Stability

    SciTech Connect

    Kang, S.O.; Vukovic, Sinisa; Custelcean, Radu; Hay, Benjamin

    2012-01-01

    Poly(acrylamidoximes) play an important role in the uranium extraction from seawater. The present work reports solution studies of simple analogs to address the formation and stability of two binding sites present in these polymers, open-chain amidoximes and cyclic imide dioximes, including: 1) conditions that maximize the formation of the cyclic form, 2) existence of a base-induced conversion from open-chain to cyclic form, and 3) degradation under acid and base conditions.

  12. Hanford Site Development Plan

    SciTech Connect

    Rinne, C.A.; Curry, R.H.; Hagan, J.W.; Seiler, S.W.; Sommer, D.J. ); Yancey, E.F. )

    1990-01-01

    The Hanford Site Development Plan (Site Development Plan) is intended to guide the short- and long-range development and use of the Hanford Site. All acquisition, development, and permanent facility use at the Hanford Site will conform to the approved plan. The Site Development Plan also serves as the base document for all subsequent studies that involve use of facilities at the Site. This revision is an update of a previous plan. The executive summary presents the highlights of the five major topics covered in the Site Development Plan: general site information, existing conditions, planning analysis, Master Plan, and Five-Year Plan. 56 refs., 67 figs., 31 tabs.

  13. Lawrence Berkeley Laboratory 1993 Site Environmental Report

    SciTech Connect

    Not Available

    1994-05-01

    This annual Site Environmental Report summarizes Lawrence Berkeley Laboratory`s (LBL`s) environmental activities in calendar year (CY) 1993. The purpose of this report is to characterize site environmental management performance, confirm compliance status with environmental standards and requirements, and highlight significant programs and efforts. Its format and content are consistent with the requirements of the US Department of Energy (DOE) Order 5400.1, General Environmental Protection Program.

  14. Star formation - An overview

    NASA Technical Reports Server (NTRS)

    Evans, N. J., II

    1985-01-01

    Methods for studying star formation are reviewed. Stellar clusters and associations, as well as field stars, provide a fossil record of the star formation process. Regions of current star formation provide a series of snapshots of different epochs of star formation. A simplified picture of individual star formation as it was envisioned in the late 1970s is contrasted with the results of recent observations, in particular the outflow phenomenon.

  15. Formate Formation and Formate Conversion in Biological Fuels Production

    PubMed Central

    Crable, Bryan R.; Plugge, Caroline M.; McInerney, Michael J.; Stams, Alfons J. M.

    2011-01-01

    Biomethanation is a mature technology for fuel production. Fourth generation biofuels research will focus on sequestering CO2 and providing carbon-neutral or carbon-negative strategies to cope with dwindling fossil fuel supplies and environmental impact. Formate is an important intermediate in the methanogenic breakdown of complex organic material and serves as an important precursor for biological fuels production in the form of methane, hydrogen, and potentially methanol. Formate is produced by either CoA-dependent cleavage of pyruvate or enzymatic reduction of CO2 in an NADH- or ferredoxin-dependent manner. Formate is consumed through oxidation to CO2 and H2 or can be further reduced via the Wood-Ljungdahl pathway for carbon fixation or industrially for the production of methanol. Here, we review the enzymes involved in the interconversion of formate and discuss potential applications for biofuels production. PMID:21687599

  16. Remedial Action Plan and Site Design for stabilization of the inactive Uranium Mill Tailings sites at Slick Rock, Colorado: Appendix C to Attachment 3, Calculations. Final

    SciTech Connect

    1995-09-01

    This volume contains calculations for: Slick Rock processing sites background ground water quality; Slick Rock processing sites lysimeter water quality; Slick Rock processing sites on-site and downgradient ground water quality; Slick Rock disposal site background water quality; Burro Canyon disposal site, Slick Rock, Colorado, average hydraulic gradients and average liner ground water velocities in the upper, middle, and lower sandstone units of the Burro Canyon formation; Slick Rock--Burro Canyon disposal site, Burro Canyon pumping and slug tests--analyses; water balance and surface contours--Burro Canyon disposal cell; and analytical calculation of drawdown in a hypothetical well completed in the upper sandstone unit of the Burro Canyon formation.

  17. Hanford Site Development Plan

    SciTech Connect

    Hathaway, H.B.; Daly, K.S.; Rinne, C.A.; Seiler, S.W.

    1993-05-01

    The Hanford Site Development Plan (HSDP) provides an overview of land use, infrastructure, and facility requirements to support US Department of Energy (DOE) programs at the Hanford Site. The HSDP`s primary purpose is to inform senior managers and interested parties of development activities and issues that require a commitment of resources to support the Hanford Site. The HSDP provides an existing and future land use plan for the Hanford Site. The HSDP is updated annually in accordance with DOE Order 4320.1B, Site Development Planning, to reflect the mission and overall site development process. Further details about Hanford Site development are defined in individual area development plans.

  18. Is occupationally induced exposure to radiation a risk factor for thyroid nodule formation?

    SciTech Connect

    Antonelli, A.; Silvano, G.; Gambuzza, C.; Bianchi, F.; Tana, L.; Baschieri, L.

    1996-05-01

    The prevalance of thyroid nodules was studied with ultrasonography in a group of male hospital workers (n = 44) who had been exposed occupationally to x-rays. This group was compared with a group of nonexposed workers (n = 88) who were age- and sex-matched with the exposed workers. Thyroid nodules were detected in 18 (41%) of the exposed workers, compared with 11 (13%) of the nonexposed controls. Both groups were subdivided with respect to age (i.e., 30-39 y, 40-49 y, 50-59 y), and there was a higher and significant relative risk for thyroid nodule formation in the exposed group. We also divided the groups into subgroups according to levels of exposure (i.e., nonexposed, exposed for {le} 20 y, and exposed for {ge} 20 y), and a significant result was obtained with the linear-trend chi-square test. The preliminary results of our study suggest that occupationally induced exposure to radiation may be a risk factor for thyroid nodule formation. 9 refs., 2 tabs.

  19. Development of a Learning Progression for the Formation of the Solar System

    NASA Astrophysics Data System (ADS)

    Plummer, Julia D.; Palma, Christopher; Flarend, Alice; Rubin, KeriAnn; Shiou Ong, Yann; Botzer, Brandon; McDonald, Scott; Furman, Tanya

    2015-06-01

    This study describes the process of defining a hypothetical learning progression (LP) for astronomy around the big idea of Solar System formation. At the most sophisticated level, students can explain how the formation process led to the current Solar System by considering how the planets formed from the collapse of a rotating cloud of gas and dust. Development of this LP was conducted in 2 phases. First, we interviewed middle school, high school, and college students (N = 44), asking them to describe properties of the current Solar System and to explain how the Solar System was formed. Second, we interviewed 6th-grade students (N = 24) before and after a 15-week astronomy curriculum designed around the big idea. Our analysis provides evidence for potential levels of sophistication within the hypothetical LP, while also revealing common alternative conceptions or areas of limited understanding that could form barriers to progress if not addressed by instruction. For example, many students' understanding of Solar System phenomena was limited by either alternative ideas about gravity or limited application of momentum in their explanations. Few students approached a scientific-level explanation, but their responses revealed possible stepping stones that could be built upon with appropriate instruction.

  20. SCHOOL SITE STANDARDS AND SITE SELECTION.

    ERIC Educational Resources Information Center

    New York State Education Dept., Albany.

    THIS REPORT PRESENTS ELEMENTARY AND SECONDARY SCHOOL SITE DEVELOPMENT DATA COMPILED BY THE DIVISION OF EDUCATIONAL FACILITIES PLANNING, NEW YORK STATE EDUCATION DEPARTMENT. ENROLLMENT FIGURES USED REPRESENT THE ULTIMATE SIZE OF THE SCHOOLS. THE STANDARDS ARE MINIMUM FOR THE STATE OF NEW YORK WITH ELEMENTARY SCHOOL SITES BASED ON THREE ACRES PLUS…

  1. Structure Formation in Astrophysics

    NASA Astrophysics Data System (ADS)

    Chabrier, Gilles

    2009-01-01

    Part I. Physical Processes and Numerical Methods Common to Structure Formations in Astrophysics: 1. The physics of turbulence E. Levêque; 2. The numerical simulation of turbulence W. Schmidt; 3. Numerical methods for radiation magnetohydrodynamics in astrophysics R. Klein and J. Stone; 4. The role of jets in the formation of planets, stars, and galaxies R. Banerjee, R. Pudritz and R. Ouyed; 5. Advanced numerical methods in astrophysical fluid dynamics A. Hujeirat and F. Heitsch; Part II. Structure and Star Formation in the Primordial Universe: 6. New frontiers in cosmology and galaxy formation challenges for the future R. Ellis and J. Silk; 7. Galaxy formation physics T. Abel, G. Bryan and R. Teyssier; 8. First stars formation, evolution, feedback effects V. Bromm, A. Ferrara and A. Heger; Part III. Contemporary Star and Brown Dwarf Formation: a) Cloud Formation and Fragmentation: 9. Diffuse interstellar medium and the formation of molecular clouds P. Hennebelle, M. Mac Low and E. Vazquez-Semadeni; 10. The formation of distributed and clustered stars in molecular clouds T. Megeath, Z. -Y. Li and A. Nordlund; b) Core Fragmentation and Star Formation: 11. The formation and evolution of prestellar cores P. André, S. Basu and S. Inutsuka; 12. Models for the formation of massive stars; Part IV. Protoplanetary Disks and Planet Formation M. Krumholz and I. Bonnell: 13. Observational properties of disks and young stellar objects G. Duchêne, F. Ménard, J. Muzzerolle and S. Mohanty; 14. Structure and dynamics of protoplanetary disks C. Dullemond, R. Durisen and J. Papaloizou; 15. Planet formation and evolution theory and observation Y. Alibert, I. Baraffe, W. Benz, G. Laughlin and S. Udry; 16. Planet formation assembling the puzzle G. Wurm and T. Guillot; Part V. Summary: 17. Open issues in small- and large-scale structure formation R. Klessen and M. Mac Low; 18. Final word E. Salpeter.

  2. Structure Formation in Astrophysics

    NASA Astrophysics Data System (ADS)

    Chabrier, Gilles

    2011-02-01

    Part I. Physical Processes and Numerical Methods Common to Structure Formations in Astrophysics: 1. The physics of turbulence E. Levêque; 2. The numerical simulation of turbulence W. Schmidt; 3. Numerical methods for radiation magnetohydrodynamics in astrophysics R. Klein and J. Stone; 4. The role of jets in the formation of planets, stars, and galaxies R. Banerjee, R. Pudritz and R. Ouyed; 5. Advanced numerical methods in astrophysical fluid dynamics A. Hujeirat and F. Heitsch; Part II. Structure and Star Formation in the Primordial Universe: 6. New frontiers in cosmology and galaxy formation challenges for the future R. Ellis and J. Silk; 7. Galaxy formation physics T. Abel, G. Bryan and R. Teyssier; 8. First stars formation, evolution, feedback effects V. Bromm, A. Ferrara and A. Heger; Part III. Contemporary Star and Brown Dwarf Formation: a) Cloud Formation and Fragmentation: 9. Diffuse interstellar medium and the formation of molecular clouds P. Hennebelle, M. Mac Low and E. Vazquez-Semadeni; 10. The formation of distributed and clustered stars in molecular clouds T. Megeath, Z. -Y. Li and A. Nordlund; b) Core Fragmentation and Star Formation: 11. The formation and evolution of prestellar cores P. André, S. Basu and S. Inutsuka; 12. Models for the formation of massive stars; Part IV. Protoplanetary Disks and Planet Formation M. Krumholz and I. Bonnell: 13. Observational properties of disks and young stellar objects G. Duchêne, F. Ménard, J. Muzzerolle and S. Mohanty; 14. Structure and dynamics of protoplanetary disks C. Dullemond, R. Durisen and J. Papaloizou; 15. Planet formation and evolution theory and observation Y. Alibert, I. Baraffe, W. Benz, G. Laughlin and S. Udry; 16. Planet formation assembling the puzzle G. Wurm and T. Guillot; Part V. Summary: 17. Open issues in small- and large-scale structure formation R. Klessen and M. Mac Low; 18. Final word E. Salpeter.

  3. Dispersal of smallmouth bass from a simulated tournament weigh-in site

    USGS Publications Warehouse

    Kaintz, Melissa A.; Bettoli, Phillip William

    2010-01-01

    Simulated smallmouth bass Micropterus dolomieu fishing tournaments were staged in Dale Hollow Lake, a 12,400-ha reservoir in Tennessee, between March 2004 and February 2005 to investigate posttournament dispersal. Smallmouth bass (n = 54) were captured with conventional hook-and-line tackle and artificial lures, placed in live wells, and subjected to a weigh-in procedure before being externally tagged with an ultrasonic transmitter and released. Water temperatures ranged from 7.4°C to 29.3°C (mean [SE] = 17.6°C [2.5]), fish ranged in total length from 330 to 572 mm (mean = 452 [8.3]), and no fish were dead at the weigh-ins. Smallmouth bass dispersed rapidly away from the release site, which was located at the head of a 68-ha embayment. After 3-5d, survivors (n = 44) traversed an average distance of 1,475 m [213]. Most (72%) fish swam uplake and out of the 385-ha study area after 6 d. The rapid dispersal of smallmouth bass may be relevant in systems that experience heavy tournament activity. The smallmouth bass caught and subjected to simulated tournament conditions on Dale Hollow Lake did not stockpile near the release site.

  4. Effect of venous injection site on accuracy of fast computed tomography (CT) estimation of myocardial perfusion

    SciTech Connect

    Bell, M.R.; Rumberger, J.A.; Lerman, L.O.; Behrenbeck, T.; Sheedy, P.F.; Ritman, E.L. )

    1990-02-26

    Measurement of myocardial perfusion with fast CT, using venous injections of contrast, underestimates high flow rates. Accounting for intramyocardial blood volume improves the accuracy of such measurements but the additional influence of different contrast injection sites is unknown. To examine this, eight closed chest anesthetized dogs (18-24 kg) underwent fast CT studies of regional myocardial perfusion which were compared to microspheres (M). Dilute iohexol (0.5 mL/kg) was injected over 2.5 seconds, via, in turn, the pulmonary artery (PA), proximal inferior vena cava (IVC) and femoral vein (FV) during CT scans performed at rest and after vasodilation with adenosine (M flow range: 52-399 mL/100 g/minute). Correlations made with M were not significantly different for PA vs IVC (n = 24), PA vs FV (n = 22) and IVC vs FV (n = 44). To determine the relative influence of injection site on accuracy of measurements above normal flow rates (> 150mL/100g/minute), CT flow (mL/100g/minute; mean {+-}SD) was compared to M. Thus, at normal flow, some CT overestimation of myocardial perfusion occurred with PA injections but FV or IVC injections provided for accurate measurements. At higher flow rates only PA and IVC injections enabled accurate CT measurements of perfusion. This may be related to differing transit kinetics of the input bolus of contrast.

  5. Star Formation in Galaxies

    NASA Technical Reports Server (NTRS)

    1987-01-01

    Topics addressed include: star formation; galactic infrared emission; molecular clouds; OB star luminosity; dust grains; IRAS observations; galactic disks; stellar formation in Magellanic clouds; irregular galaxies; spiral galaxies; starbursts; morphology of galactic centers; and far-infrared observations.

  6. The Format Dilemma.

    ERIC Educational Resources Information Center

    Oder, Norman

    2002-01-01

    Reports results of a survey of public libraries that investigated trends in audiovisual materials. Highlights include format issues; audiobooks; media budgets for various formats; video collections; DVDs; circulation; collection sizes; music CDs; and future possibilities. (LRW)

  7. The reconnaissance and siting of field hospitals.

    PubMed

    Boreham, A; Bricknell, M C M

    2002-03-01

    This paper describes the reconnaissance function for the siting of deployable field hospitals. It reports two levels of reconnaissance, theatre/operational and tactical. The paper describes the factors to be considered when conducting the reconnaissance and the format of the reconnaissance report. PMID:12024890

  8. Educational Computing Course. [SITE 2001 Section].

    ERIC Educational Resources Information Center

    Bump, Wren, Ed.

    This document contains the following papers on the educational computing course from the SITE (Society for Information Technology & Teacher Education) 2001 conference: "Using a Flexible Format To Create a Constructivist Learning Environment in the Educational Computing Course" (Wren M. Bump); "Technological Diversity: Managing Differing Technology…

  9. The role of fanatics in consensus formation

    NASA Astrophysics Data System (ADS)

    Gündüç, Semra

    2015-08-01

    A model of opinion dynamics with two types of agents as social actors are presented, using the Ising thermodynamic model as the dynamics template. The agents are considered as opportunists which live at sites and interact with the neighbors, or fanatics/missionaries which move from site to site randomly in persuasion of converting agents of opposite opinion with the help of opportunists. Here, the moving agents act as an external influence on the opportunists to convert them to the opposite opinion. It is shown by numerical simulations that such dynamics of opinion formation may explain some details of consensus formation even when one of the opinions are held by a minority. Regardless the distribution of the opinion, different size societies exhibit different opinion formation behavior and time scales. In order to understand general behavior, the scaling relations obtained by comparing opinion formation processes observed in societies with varying population and number of randomly moving agents are studied. For the proposed model two types of scaling relations are observed. In fixed size societies, increasing the number of randomly moving agents give a scaling relation for the time scale of the opinion formation process. The second type of scaling relation is due to the size dependent information propagation in finite but large systems, namely finite-size scaling.

  10. Simple Ontology Format (SOFT)

    SciTech Connect

    Sorokine, Alexandre

    2011-10-01

    Simple Ontology Format (SOFT) library and file format specification provides a set of simple tools for developing and maintaining ontologies. The library, implemented as a perl module, supports parsing and verification of the files in SOFt format, operations with ontologies (adding, removing, or filtering of entities), and converting of ontologies into other formats. SOFT allows users to quickly create ontologies using only a basic text editor, verify it, and portray it in a graph layout system using customized styles.

  11. Formation of crustal magma chambers in Iceland

    SciTech Connect

    Gudmundsson, A.

    1986-02-01

    Formation of crustal magma chambers in Iceland may be facilitated by the occurrence of stress barriers that lead to formation of thick sills. Such sills absorb the magma of all dikes that enter them and may evolve into magma chambers. Ideal sites for stress barriers, and hence for magma chambers, are rock formations where individual layers have different elastic properties. The rocks formed during the Pleistocene have notably different elastic properties, and when buried in the volcanic zones, they form more promising sites for magma chambers than the Tertiary rocks. This may explain why the number of magma chambers, indicated by the number of corresponding central volcanoes, during the late Pleistocene (i.e., during the past 0.7 m.y.) appears to be proportionally greater than the number of chambers (i.e., central volcanoes) active during Tertiary time.

  12. Generalized trends in the formation energies of perovskite oxides.

    PubMed

    Zeng, ZhenHua; Calle-Vallejo, Federico; Mogensen, Mogens B; Rossmeisl, Jan

    2013-05-28

    Generalized trends in the formation energies of several families of perovskite oxides (ABO3) and plausible explanations to their existence are provided in this study through a combination of DFT calculations, solid-state physics analyses and simple physical/chemical descriptors. The studied elements at the A site of perovskites comprise rare-earth, alkaline-earth and alkaline metals, whereas 3d and 5d metals were studied at the B site. We also include ReO3-type compounds, which have the same crystal structure of cubic ABO3 perovskites except without A-site elements. From the observations we extract the following four conclusions for the perovskites studied in the present paper: for a given cation at the B site, (I) perovskites with cations of identical oxidation state at the A site possess close formation energies; and (II) perovskites with cations of different oxidation states at the A site usually have quite different but ordered formation energies. On the other hand, for a given A-site cation, (III) the formation energies of perovskites vary linearly with respect to the atomic number of the elements at the B site within the same period of the periodic table, and the slopes depend systematically on the oxidation state of the A-site cation; and (IV) the trends in formation energies of perovskites with elements from different periods at the B site depend on the oxidation state of A-site cations. Since the energetics of perovskites is shown to be the superposition of the individual contributions of their constituent oxides, the trends can be rationalized in terms of A-O and B-O interactions in the ionic crystal. These findings reveal the existence of general systematic trends in the formation energies of perovskites and provide further insight into the role of ion-ion interactions in the properties of ternary compounds. PMID:23579382

  13. Formation of polarity convergences underlying shoot outgrowths.

    PubMed

    Abley, Katie; Sauret-Güeto, Susanna; Marée, Athanasius Fm; Coen, Enrico

    2016-01-01

    The development of outgrowths from plant shoots depends on formation of epidermal sites of cell polarity convergence with high intracellular auxin at their centre. A parsimonious model for generation of convergence sites is that cell polarity for the auxin transporter PIN1 orients up auxin gradients, as this spontaneously generates convergent alignments. Here we test predictions of this and other models for the patterns of auxin biosynthesis and import. Live imaging of outgrowths from kanadi1 kanadi2 Arabidopsis mutant leaves shows that they arise by formation of PIN1 convergence sites within a proximodistal polarity field. PIN1 polarities are oriented away from regions of high auxin biosynthesis enzyme expression, and towards regions of high auxin importer expression. Both expression patterns are required for normal outgrowth emergence, and may form part of a common module underlying shoot outgrowths. These findings are more consistent with models that spontaneously generate tandem rather than convergent alignments. PMID:27478985

  14. Possible mechanisms of macrolayer formation

    SciTech Connect

    Sadasivan, P.; Chappidi, P.R.; Unal, C.; Nelson, R.A.

    1992-01-01

    The high heat flux nucleate boiling region, also called the vapor mushroom region, has been shown to have a thin liquid layer on the heater surface under the large mushroom-shaped vapor bubbles that grow from the heater surface. The name given to this liquid layer is the macrolayer to differentiate it from the microlayer that exists under the discrete bubbles found at lower heat fluxes in the nucleate boiling region. Typical thicknesses of this macrolayer range from 50 to 500 {mu}m for water on a flat horizontal boiling surface and depend upon the heat flux. Thus, the macrolayer is thicker than the wedge-shaped microlayers, found under discrete bubbles, which range in thickness from 1 to 10 {mu}m. Although the mechanism of microlayer formation and its evaporation is conceptually simple that of the macrolayer is still not understood. This paper critically compares the potential mechanisms proposed for macrolayer formation. These mechanisms include the Helmholtz instability applied to the vapor stem above active nucleation sites, liquid trapped by lateral coalescence of discrete bubbles that initially form during the mushroom bubble's waiting period, and the limitation of liquid resupply at mushroom departure as a result of vapor flow from the active nucleation sites.

  15. Possible mechanisms of macrolayer formation

    SciTech Connect

    Sadasivan, P.; Chappidi, P.R.; Unal, C.; Nelson, R.A.

    1992-05-01

    The high heat flux nucleate boiling region, also called the vapor mushroom region, has been shown to have a thin liquid layer on the heater surface under the large mushroom-shaped vapor bubbles that grow from the heater surface. The name given to this liquid layer is the macrolayer to differentiate it from the microlayer that exists under the discrete bubbles found at lower heat fluxes in the nucleate boiling region. Typical thicknesses of this macrolayer range from 50 to 500 {mu}m for water on a flat horizontal boiling surface and depend upon the heat flux. Thus, the macrolayer is thicker than the wedge-shaped microlayers, found under discrete bubbles, which range in thickness from 1 to 10 {mu}m. Although the mechanism of microlayer formation and its evaporation is conceptually simple that of the macrolayer is still not understood. This paper critically compares the potential mechanisms proposed for macrolayer formation. These mechanisms include the Helmholtz instability applied to the vapor stem above active nucleation sites, liquid trapped by lateral coalescence of discrete bubbles that initially form during the mushroom bubble`s waiting period, and the limitation of liquid resupply at mushroom departure as a result of vapor flow from the active nucleation sites.

  16. Beaver assisted river valley formation

    USGS Publications Warehouse

    Westbrook, C.J.; Cooper, D.J.; Baker, B.W.

    2011-01-01

    We examined how beaver dams affect key ecosystem processes, including pattern and process of sediment deposition, the composition and spatial pattern of vegetation, and nutrient loading and processing. We provide new evidence for the formation of heterogeneous beaver meadows on riverine system floodplains and terraces where dynamic flows are capable of breaching in-channel beaver dams. Our data show a 1.7-m high beaver dam triggered overbank flooding that drowned vegetation in areas deeply flooded, deposited nutrient-rich sediment in a spatially heterogeneous pattern on the floodplain and terrace, and scoured soils in other areas. The site quickly de-watered following the dam breach by high stream flows, protecting the deposited sediment from future re-mobilization by overbank floods. Bare sediment either exposed by scouring or deposited by the beaver flood was quickly colonized by a spatially heterogeneous plant community, forming a beaver meadow. Many willow and some aspen seedlings established in the more heavily disturbed areas, suggesting the site may succeed to a willow carr plant community suitable for future beaver re-occupation. We expand existing theory beyond the beaver pond to include terraces within valleys. This more fully explains how beavers can help drive the formation of alluvial valleys and their complex vegetation patterns as was first postulated by Ruedemann and Schoonmaker in 1938. ?? 2010 John Wiley & Sons, Ltd.

  17. Medical image file formats.

    PubMed

    Larobina, Michele; Murino, Loredana

    2014-04-01

    Image file format is often a confusing aspect for someone wishing to process medical images. This article presents a demystifying overview of the major file formats currently used in medical imaging: Analyze, Neuroimaging Informatics Technology Initiative (Nifti), Minc, and Digital Imaging and Communications in Medicine (Dicom). Concepts common to all file formats, such as pixel depth, photometric interpretation, metadata, and pixel data, are first presented. Then, the characteristics and strengths of the various formats are discussed. The review concludes with some predictive considerations about the future trends in medical image file formats. PMID:24338090

  18. The Nifty Assignments Site.

    ERIC Educational Resources Information Center

    Parlante, Nick

    2001-01-01

    Describes a Web site called Nifty Assignments that offers assignments for computer science education. Topics include programming assignments; student appeal; appropriateness for high school classes; and links to other related Web sites. (LRW)

  19. Field site selection

    NASA Technical Reports Server (NTRS)

    Schwarz, D. E.; Ellefsen, R. E.

    1981-01-01

    Several general guidelines should be kept in mind when considering the selection of field sites for teaching remote sensing fundamentals. Proximity and vantage point are two very practical considerations. Only through viewing a broad enough area to place the site in context can one make efficient use of a site. The effects of inclement weather when selecting sites should be considered. If field work is to be an effective tool to illustrate remote sensing principles, the following criteria are critical: (1) the site must represent the range of class interest; (2) the site must have a theme or add something no other site offers; (3) there should be intrasite variation within the theme; (4) ground resolution and spectral signature distinction should be illustrated; and (5) the sites should not be ordered sequentially.

  20. Interplay between electron-phonon interaction and Hubbard repulsion: Bipolaron formation

    SciTech Connect

    Nath, S.; Mondal, N. S.; Ghosh, N. K.

    2015-06-24

    In the weak coupling limit, the 2D Hubbard model extended by on-site (local) and inter-site (long range) electron-phonon (EP) interaction has been investigated within Lanczos method of exact diagonalization (ED). On-site (S0) bipolaron formation has been favored by on-site EP interaction induced effective attraction between electrons. But, inter-site phonon mediated interaction between electrons helps to form both S0 and neighboring site (S1) bipolaron. It is further observed that both types of bipolaron formation are suppressed by on-site Hubbard repulsion.

  1. Memory Formation Shaped by Astroglia.

    PubMed

    Zorec, Robert; Horvat, Anemari; Vardjan, Nina; Verkhratsky, Alexei

    2015-01-01

    Astrocytes, the most heterogeneous glial cells in the central nervous system (CNS), execute a multitude of homeostatic functions and contribute to memory formation. Consolidation of synaptic and systemic memory is a prolonged process and hours are required to form long-term memory. In the past, neurons or their parts have been considered to be the exclusive cellular sites of these processes, however, it has now become evident that astrocytes provide an important and essential contribution to memory formation. Astrocytes participate in the morphological remodeling associated with synaptic plasticity, an energy-demanding process that requires mobilization of glycogen, which, in the CNS, is almost exclusively stored in astrocytes. Synaptic remodeling also involves bidirectional astroglial-neuronal communication supported by astroglial receptors and release of gliosignaling molecules. Astroglia exhibit cytoplasmic excitability that engages second messengers, such as Ca(2+), for phasic, and cyclic adenosine monophosphate (cAMP), for tonic signal coordination with neuronal processes. The detection of signals by astrocytes and the release of gliosignaling molecules, in particular by vesicle-based mechanisms, occurs with a significant delay after stimulation, orders of magnitude longer than that present in stimulus-secretion coupling in neurons. These particular arrangements position astrocytes as integrators ideally tuned to support time-dependent memory formation. PMID:26635551

  2. Star Formation for Predictive Primordial Galaxy Formation

    NASA Astrophysics Data System (ADS)

    Milosavljević, Miloš; Safranek-Shrader, Chalence

    The elegance of inflationary cosmology and cosmological perturbation theory ends with the formation of the first stars and galaxies, the initial sources of light that launched the phenomenologically rich process of cosmic reionization. Here we review the current understanding of early star formation, emphasizing unsolved problems and technical challenges. We begin with the first generation of stars to form after the Big Bang and trace how they influenced subsequent star formation. The onset of chemical enrichment coincided with a sharp increase in the overall physical complexity of star forming systems. Ab-initio computational treatments are just now entering the domain of the predictive and are establishing contact with local observations of the relics of this ancient epoch.

  3. Site Environmental Report, 1993

    SciTech Connect

    Not Available

    1994-06-01

    The Site Environmental Report (SER) is prepared annually in accordance with DOE Order 5400.1, ``General Environmental Protection Program.`` This 1993 SER provides the general public as well as scientists and engineers with the results from the site`s ongoing Environmental Monitoring Program. Also included in this report is information concerning the site`s progress toward achieving full compliance with requirements set forth by DOE, US Environmental Protection Agency (USEPA), and Ohio EPA (OEPA). For some readers, the highlights provided in the Executive Summary may provide sufficient information. Many readers, however, may wish to read more detailed descriptions of the information than those which are presented here.

  4. Rulison Site corrective action report

    SciTech Connect

    1996-09-01

    Project Rulison was a joint US Atomic Energy Commission (AEC) and Austral Oil Company (Austral) experiment, conducted under the AEC`s Plowshare Program, to evaluate the feasibility of using a nuclear device to stimulate natural gas production in low-permeability gas-producing geologic formations. The experiment was conducted on September 10, 1969, and consisted of detonating a 40-kiloton nuclear device at a depth of 2,568 m below ground surface (BGS). This Corrective Action Report describes the cleanup of petroleum hydrocarbon- and heavy-metal-contaminated sediments from an old drilling effluent pond and characterization of the mud pits used during drilling of the R-EX well at the Rulison Site. The Rulison Site is located approximately 65 kilometers (40 miles) northeast of Grand Junction, Colorado. The effluent pond was used for the storage of drilling mud during drilling of the emplacement hole for the 1969 gas stimulation test conducted by the AEC. This report also describes the activities performed to determine whether contamination is present in mud pits used during the drilling of well R-EX, the gas production well drilled at the site to evaluate the effectiveness of the detonation in stimulating gas production. The investigation activities described in this report were conducted during the autumn of 1995, concurrent with the cleanup of the drilling effluent pond. This report describes the activities performed during the soil investigation and provides the analytical results for the samples collected during that investigation.

  5. Evidence for arrested bone formation during spaceflight

    NASA Technical Reports Server (NTRS)

    Turner, R. T.; Bobyn, J. D.; Duvall, P.; Morey, E. R.; Baylink, D. J.; Spector, M.

    1982-01-01

    Addressing the question of whether the bone formed in space is unusual, the morphology of bone made at the tibial diaphysis of rats before, during, and after spaceflight is studied. Evidence of arrest lines in the bone formed in space is reported suggesting that bone formation ceases along portions of the periosteum during spaceflight. Visualized by microradiography, the arrest lines are shown to be less mineralized than the surrounding bone matrix. When viewed by scanning electron microscopy, it is seen that bone fractures more readily at the site of an arrest line. These observations are seen as suggesting that arrest lines are a zone of weakness and that their formation may result in decreased bone strength in spite of normalization of bone formation after flight. The occurrence, location, and morphology of arrest lines are seen as suggesting that they are a visible result of the phenomenon of arrested bone formation.

  6. Site Development Planning Handbook

    SciTech Connect

    1981-01-01

    The Handbook provides facility managers and site planners at DOE organizations responsible for planning site developments and facilities utilization a step-by-step planning checklist to ensure that planners at each site are focusing on Department-wide goals and objectives. It begins with a brief discussion of a site development-by-objectives program design to promote, recognize, and implement opportunities for improvements in site utilization through planning. Additional information is included on: assembling existing data, plans, programs, and procedures; establishing realistic objectives; identifying site problems, opportunities; and development needs; determining priorities among development needs; developing short and long-range plans; choosing the right development solutions and meeting minimum legal site restrictions; presenting the plan; implementing elements of the plan; monitoring and reporting plan status; and modifying development program plans. (MCW)

  7. Tropical cyclone formation

    SciTech Connect

    Montgomery, M.T.; Farrell, B.F. )

    1993-01-15

    The physics of tropical cyclone formation is not well understood, and more is known about the mature hurricane than the formative mechanisms that produce it. It is believed part of the reason for this can be traced to insufficient upper-level atmospheric data. Recent observations suggest that tropical cyclones are initiated by asymmetric interactions associated with migratory upper-level potential vorticity disturbances and low-level disturbances. Favored theories of cyclones formation, however, focus on internal processes associated with cumulus convection and/or air-sea interaction. This work focuses on external mechanisms of cyclone formation and, using both a two- and three-dimensional moist geostrophic momentum model, investigates the role of upper-level potential vorticity disturbances on the formation process. A conceptual model of tropical cyclone formation is proposed, and implications of the theory are discussed. 71 refs., 5 figs., 1 tab.

  8. Hanford Site Comprehensive site Compliance Evaluation Report

    SciTech Connect

    Tollefson, K.S.

    1997-08-05

    This document is the second annual submittal by WHC, ICF/KH, PNL and BHI and contains the results of inspections of the stormwater outfalls listed in the Hanford Site Storm Water Pollution Prevention Plan (SWPPP) (WHC 1993a) as required by General Permit No. WA-R-00-000F (WA-R-00-A17F): This report also describes the methods used to conduct the Storm Water Comprehensive Site Compliance Evaluation, as required in Part IV, Section D, {ampersand} C of the General Permit, summarizes the results of the compliance evaluation, and documents significant leaks and spills.

  9. Hanford Site comprehensive site compliance evaluation report

    SciTech Connect

    Tollefson, K.S.

    1995-09-01

    This document is the second annual submittal by WHC, ICF/KH, PNL and BHI and contains the results of inspections of the storm water outfalls listed in the Hanford Site Storm Water Pollution Prevention Plan (SWPPP) (WHC 1993a) as required by General Permit No. WA-R-00- 000F (WA-R-00-A17F): This report also describes the methods used to conduct the Storm Water Comprehensive Site Compliance Evaluation, as required in Part IV, Section D. $. C. of the General Permit, summarizes the results of the compliance evaluation, and documents significant leaks and spills.

  10. Data format translation routines

    SciTech Connect

    Burris, R.D.

    1981-02-01

    To enable the effective connection of several dissimilar computers into a network, modification of the data being passed from one computer to another may become necessary. This document describes a package of routines which permit the translation of data in PDP-8 formats to PDP-11 or DECsystem-10 formats or from PDP-11 format to DECsystem-10 format. Additional routines are described which permit the effective use of the translation routines in the environment of the Fusion Energy Division (FED) network and the Elmo Bumpy Torus (EBT) data base.

  11. Simple Ontology Format (SOFT)

    Energy Science and Technology Software Center (ESTSC)

    2011-10-01

    Simple Ontology Format (SOFT) library and file format specification provides a set of simple tools for developing and maintaining ontologies. The library, implemented as a perl module, supports parsing and verification of the files in SOFt format, operations with ontologies (adding, removing, or filtering of entities), and converting of ontologies into other formats. SOFT allows users to quickly create ontologies using only a basic text editor, verify it, and portray it in a graph layoutmore » system using customized styles.« less

  12. MARINE SEDIMENT DATA - CERCLA NPL SITES - USEPA REGION 10

    EPA Science Inventory

    The following information has been compiled for a subgroup of the National Priority List (NPL) Superfund sites located in Region 10. A description of each NPL Site marine sediment data file is available here as well as a link to the compressed (Pkzip) DBF format data file. The da...

  13. Site characteristics report: UE11 (Yacht Hole)

    SciTech Connect

    Sweeney, J.J.

    1986-12-01

    This is a compilation of data pertaining to nuclear test containment at the UE11 borehole site at the Nevada Test Site. Most of the data presented here on the physical properties of rocks at the site come from previous investigations, but a resistivity survey to locate the subsurface expression of a fault, and determinations of grain density and CO/sub 2/ content were carried out for the purposes of this study. Details of the lithologic and geophysical characteristics of the Eleana Formation rocks are presented. A geologic map, including locations of faults in the vicinity of the borehole, and pertinent geologic cross-sections of the area are also included to illustrate the character of the subsurface around the UE11 site.

  14. Nevada Test Site Environmental Report 2003

    SciTech Connect

    Bechtel Nevada

    2004-10-01

    The Nevada Test Site Environmental Report 2003 was prepared by Bechtel Nevada to meet the requirements and guidelines of the U.S. Department of Energy and the information needs of the public. This report is meant to be useful to members of the public, public officials, regulators, and Nevada Test Site contractors. The Executive Summary strives to present in a concise format the purpose of the document, the NTS mission and major programs, a summary of radiological releases and doses to the public resulting from site operations, a summary of non-radiological releases, and an overview of the Nevada Test Site Environmental Management System. The Executive Summary, combined with the following Compliance Summary, are written to meet all the objectives of the report and to be stand-alone sections for those who choose not to read the entire document.

  15. GLOBAL STAR FORMATION REVISITED

    SciTech Connect

    Silk, Joseph; Norman, Colin E-mail: norman@stsci.edu

    2009-07-20

    A general treatment of disk star formation is developed from a dissipative multiphase model, with the dominant dissipation due to cloud collisions. The Schmidt-Kennicutt (SK) law emerges naturally for star-forming disks and starbursts. We predict that there should be an inverse correlation between Tully-Fisher law and SK law residuals. The model is extended to include a multiphase treatment of supernova feedback that leads to a turbulent pressure-regulated generalization of the star formation law and is applicable to gas-rich starbursts. Enhanced pressure, as expected in merger-induced star formation, enhances star formation efficiency. An upper limit is derived for the disk star formation rate in starbursts that depends on the ratio of global ISM to cloud pressures. We extend these considerations to the case where the interstellar gas pressure in the inner galaxy is dominated by outflows from a central active galactic nucleus (AGN). During massive spheroid formation, AGN-driven winds trigger star formation, resulting in enhanced supernova feedback and outflows. The outflows are comparable to the AGN-boosted star formation rate and saturate in the super-Eddington limit. Downsizing of both SMBH and spheroids is a consequence of AGN-driven positive feedback. Bondi accretion feeds the central black hole with a specific accretion rate that is proportional to the black hole mass. AGN-enhanced star formation is mediated by turbulent pressure and relates spheroid star formation rate to black hole accretion rate. The relation between black hole mass and spheroid velocity dispersion has a coefficient (Salpeter time to gas consumption time ratio) that provides an arrow of time. Highly efficient, AGN-boosted star formation can occur at high redshift.

  16. TOPOGRAPHIC SITE RESPONSE AT HARD ROCK SITES

    NASA Astrophysics Data System (ADS)

    Yong, A. K.; Hough, S. E.

    2009-12-01

    Site (material impedance) and topographic (geometric form) effects are known to be key factors that influence seismic ground motions. To characterize site effects, Yong et al. (2009) developed a terrain-based Vs30 prediction model using an automated classification method (Iwahashi and Pike, 2007) that relied on taxonomic criteria (slope gradient, local convexity and surface texture) developed from geomorphometry to identify 16 terrain types from a 1-km spatial resolution (SRTM30 data) digital elevation model of California. On the basis that the underlying framework for this model contains parameters (esp., local convexity) which aptly describe the geometry (i.e., base to height ratio) of relief features that are known to also control the behavior of ground motions (Bouchon, 1973), we extend our investigation to study topographic effects. Focusing on sites that would generally be considered “hard rock,” the classification scheme distinguishes 7 separate terrain types ranging from “moderately eroded mountains” to “well dissected alpine summits.” Observed 1-Hz amplification factors at Southern California Seismographic Network sites reveal a weak but systematic correlation with these 7 terrain types. Significant scatter is also found within each terrain type; typical standard deviations of logarithmic amplification factors are 0.2-0.3. Considering stations that have high amplification factors, we find some that have apparently been misclassified due to data resolution limitations. Many of the remaining stations with higher than expected amplifications are located on or near topographic peaks or ridges. The unusually high amplification factors at hard-rock sites, typically factors of 1.5-2, can most plausibly be explained as a topographic effect.

  17. Site environmental report summary

    SciTech Connect

    Not Available

    1992-12-31

    In this summary of the Fernald 1992 Site Environmental Report the authors will describe the impact of the Fernald site on man and the environment and provide results from the ongoing Environmental Monitoring Program. Also included is a summary of the data obtained from sampling conducted to determine if the site complies with DOE, US Environmental Protection Agency (USEPA), and Ohio EPA (OEPA) requirements. These requirements are set to protect both man and the environment.

  18. Site environmental programs

    SciTech Connect

    Schmidt, J.W.; Hanf, R.W.

    1995-06-01

    This section of the 1994 Hanford Site Environmental Report summarizes the site environmental programs. Effluent monitoring and environmental surveillance programs monitor for impacts from operations in several areas. The first area consists of the point of possible release into the environment. The second area consists of possible contamination adjacent to DOE facilities, and the third area is the general environment both on and off the site.

  19. Viking landing sites

    NASA Technical Reports Server (NTRS)

    Panagakos, N.

    1973-01-01

    A valley near the mouth of the 20,000-foot-deep Martian Grand Canyon has been chosen by NASA as the site of its first automated landing on the planet Mars. The landing site for the second mission of the 1975-76 Viking spacecraft will probably be an area about 1,000 miles northeast of the first site, where the likelihood of water increases the chances of finding evidence of life.

  20. Ice Formation on Wings

    NASA Technical Reports Server (NTRS)

    Ritz, L

    1939-01-01

    This report makes use of the results obtained in the Gottingen ice tunnel in which the atmospheric conditions are simulated and the process of ice formation photographed. The effect of ice formation is threefold: 1) added weight to the airplane; 2) a change in the lift and drag forces; 3) a change in the stability characteristics.

  1. Formative Assessment Probes

    ERIC Educational Resources Information Center

    Eberle, Francis; Keeley, Page

    2008-01-01

    Formative assessment probes can be effective tools to help teachers build a bridge between students' initial ideas and scientific ones. In this article, the authors describe how using two formative assessment probes can help teachers determine the extent to which students make similar connections between developing a concept of matter and a…

  2. Formative Assessment in Context

    ERIC Educational Resources Information Center

    Oxenford-O'Brian, Julie

    2013-01-01

    This dissertation responds to critical gaps in current research on formative assessment practice which could limit successful implementation of this practice within the K-12 classroom context. The study applies a socio cultural perspective of learning to interpret a cross-case analysis of formative assessment practice occurring during one…

  3. School Formative Feedback Systems

    ERIC Educational Resources Information Center

    Halverson, Richard

    2010-01-01

    Data-driven instructional improvement relies on developing coherent systems that allow school staff to generate, interpret, and act upon quality formative information on students and school programs. This article offers a formative feedback system model that captures how school leaders and teachers structure artifacts and practices to create…

  4. 1994 Site environmental report

    SciTech Connect

    1995-07-01

    The Fernald site is a Department of Energy (DOE)-owned facility that produced high-quality uranium metals for military defense for nearly 40 years. DOE suspended production at the site in 1989 and formally ended production in 1991. Although production activities have ceased, the site continues to examine the air and liquid pathways as possible routes through which pollutants from past operations and current remedial activities may leave the site. The Site Environmental Report (SER) is prepared annually in accordance with DOE Order 5400.1, General Environmental Protection Program. This 1994 SER provides the general public as well as scientists and engineers with the results from the site`s ongoing Environmental Monitoring Program. Also included in this report is information concerning the site`s progress toward achieving full compliance with requirements set forth by DOE, U.S. Environmental Protection Agency (USEPA), and Ohio EPA (OEPA). For some readers, the highlights provided in this Executive Summary may provide sufficient information. Many readers, however, may wish to read more detailed descriptions of the information than those which are presented here. All information presented in this summary is discussed more fully in the main body of this report.

  5. SITE QUARTERLY REPORT HIGHLIGHTS (SUPERFUND INNOVATIVE TECHNOLOGY EVALUATION (SITE) PROGRAM)

    EPA Science Inventory

    The SITE Quarterly Report Highlights were designed to keep readers and stakeholders informed of recent developments in the SITE program. Pertinent items listed in the Highlights include (1) schedules for planned SITE Demonstrations, (2) SITE solicitation updates, (3) new developm...

  6. State of Nevada comments on the US Department of Energy site characterization plan, Yucca Mountain site, Nevada; Volume 3

    SciTech Connect

    1989-09-01

    In December 1988, the US Department of Energy issued a Site Characterization Plan (SCP) for the Yucca Mountain site, as required by Section 113 of the Nuclear Waste Policy Act of 1982 (NWPA). The purpose of site characterization is to develop sufficient information to support a determination of the suitability, or lack of suitability of the site to safely isolate high-level radioactive waste with reasonable certainty for thousands of years. The purpose of the Site Characterization Plan is to describe plans for obtaining sufficient information about the site, plans for mitigation of any adverse impacts occurring from site characterization activities, and plans for decontamination and decommissioning of the site if it is determined not to be suitable for a repository. Part I presents an overview of the State`s comments. The overview takes the form of general concerns and comments organized by specific areas of concern. The overview does not follow the format of the SCP.

  7. Biomineralization: mineral formation by organisms

    NASA Astrophysics Data System (ADS)

    Addadi, Lia; Weiner, Steve

    2014-09-01

    Organisms form many different types of minerals, with diverse shapes and sizes. These minerals fulfill a variety of functions. Inspired by the late H A Lowenstam, Steve Weiner and Lia Addadi have addressed many questions that relate to the mechanisms by which biological organisms produce these mineral phases and how their structures relate to their functions. Addadi and Weiner have explored the manner in which macromolecules extracted from mineralized tissues can interact with some crystal planes and not others, how these macromolecules can be occluded inside the forming crystals residing preferentially on specific crystal planes, and how they can induce one polymorph of calcium carbonate and not another to nucleate. Addadi and Weiner have also identified a novel strategy used by the sea urchin to form its smooth and convoluted mineralized skeletal elements. The strategy involves the initial production by cells of a highly disordered mineral precursor phase in vesicles, and then the export of this so-called amorphous phase to the site of skeletal formation, where it crystallizes. This strategy is now known to be used by many different invertebrate phyla, as well as by vertebrates to build bones and teeth. One of the major current research aims of the Weiner--Addadi group is to understand the biomineralization pathways whereby ions are extracted from the environment, are transported and deposited inside cells within vesicles, how these disordered phases are then transferred to the site of skeletal formation, and finally how the so-called amorphous phase crystallizes. Biology has clearly evolved unique strategies for forming crystalline minerals. Despite more than 300 years of research in this field, many challenging questions still remain unanswered.

  8. Savannah River Site's Site Specific Plan

    SciTech Connect

    Not Available

    1991-08-01

    This Site Specific Plan (SSP) has been prepared by the Savannah River Site (SRS) in order to show the Environmental Restoration and Waste Management activities that were identified during the preparation of the Department of Energy-Headquarters (DOE-HQ) Environmental Restoration and Waste Management Five-Year Plan (FYP) for FY 1992--1996. The SSP has been prepared in accordance with guidance received from DOE-HQ. DOE-SR is accountable to DOE-HQ for the implementation of this plan. The purpose of the SSP is to develop a baseline for policy, budget, and schedules for the DOE Environmental Restoration and Waste Management activities. The plan explains accomplishments since the Fiscal Year (FY) 1990 plan, demonstrates how present and future activities are prioritized, identifies currently funded activities and activities that are planned to be funded in the upcoming fiscal year, and describes future activities that SRS is considering.

  9. Plugged-in SITE.

    ERIC Educational Resources Information Center

    Phillips, Rhys

    2003-01-01

    Examines form, color, and technology at the University of Ottawa's School of Information Technology and Engineering (SITE) building, focusing on systems (e.g., SITE is a data wired building, but with no expensive raised floors or cheap dropped ceilings); assembly rather than construction (replacing standard notions of construction with the process…

  10. Site characterization handbook

    SciTech Connect

    Not Available

    1988-06-01

    This Handbook discusses both management and technical elements that should be considered in developing a comprehensive site characterization program. Management elements typical of any project of a comparable magnitude and complexity are combined with a discussion of strategies specific to site characterization. Information specific to the technical elements involved in site characterization is based on guidance published by the Nuclear Regulatory Commission (NRC) with respect to licensing requirements for LLW disposal facilities. The objective of this Handbook is to provide a reference for both NRC Agreement States and non-Agreement States for use in developing a comprehensive site characterization program that meets the specific objectives of the State and/or site developer/licensee. Each site characterization program will vary depending on the objectives, licensing requirements, schedules/budgets, physical characteristics of the site, proposed facility design, and the specific concerns raised by government agencies and the public. Therefore, the Handbook is not a prescriptive guide to site characterization. 18 refs., 6 figs.

  11. Sites of the Holocaust.

    ERIC Educational Resources Information Center

    McCleary, George F., Jr.

    1995-01-01

    Presents a map of Europe identifying the location of major concentration camps, extermination camps, and massacre sites during World War II. Maintains that only a few of the over 400 sites in the former Soviet Union where entire Jewish villages were exterminated are shown. (CFR)

  12. SAMPLING OF CONTAMINATED SITES

    EPA Science Inventory

    A critical aspect of characterization of the amount and species of contamination of a hazardous waste site is the sampling plan developed for that site. f the sampling plan is not thoroughly conceptualized before sampling takes place, then certain critical aspects of the limits o...

  13. Improving Web Site Usability

    ERIC Educational Resources Information Center

    Watts, Chris

    2004-01-01

    Over the last 10 years the Internet has become an essential part of the way companies do business. These days, it is as important to have a Web site as it is to have a phone book listing. Unfortunately, many Web sites are riddled with perplexing navigation and unclear priorities that leave many users confused and frustrated. This article presents…

  14. The Iowa Validation Site

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Remote sensing can be used to observe the land surface hydrologic cycle, but the quantitative aspects of these observations are not well known. We present a small (1 km^2) experimental validation site, the Iowa Validation Site. Initially we have focused on validating remotely-sensed observations of ...

  15. WWW: Neuroscience Web Sites

    ERIC Educational Resources Information Center

    Liu, Dennis

    2006-01-01

    The human brain contains an estimated 100 billion neurons, and browsing the Web, one might be led to believe that there's a Web site for every one of those cells. It's no surprise that there are lots of Web sites concerning the nervous system. After all, the human brain is toward the top of nearly everyone's list of favorite organs and of…

  16. Commercial Web Site Links.

    ERIC Educational Resources Information Center

    Thelwall, Mike

    2001-01-01

    Discusses business use of the Web and related search engine design issues as well as research on general and academic links before reporting on a survey of the links published by a collection of business Web sites. Results indicate around 66% of Web sites do carry external links, most of which are targeted at a specific purpose, but about 17%…

  17. Preliminary Site Characterization Report, Rulsion Site, Colorado

    SciTech Connect

    1996-08-01

    This report is a summary of environmental information gathered during a review of the documents pertaining to Project Rulison and interviews with personnel who worked on the project. Project Rulison was part of Operation Plowshare (a program designed to explore peaceful uses for nuclear devices). The project consisted of detonating a 43-kiloton nuclear device on September 10, 1969, in western Colorado to stimulate natural gas production. Following the detonation, a reentry well was drilled and several gas production tests were conducted. The reentry well was shut-in after the last gas production test and was held in standby condition until the general cleanup was undertaken in 1972. A final cleanup was conducted after the emplacement and testing wells were plugged in 1976. However, some surface radiologic contamination resulted from decontamination of the drilling equipment and fallout from the gas flaring during drilling operations. With the exception of the drilling effluent pond, all surface contamination at the Rulison Site was removed during the cleanup operations. All mudpits and other excavations were backfilled, and both upper and lower drilling pads were leveled and dressed. This report provides information regarding known or suspected areas of contamination, previous cleanup activities, analytical results, a review of the regulatory status, the site`s physical environment, and future recommendations for Project Ruhson. Based on this research, several potential areas of contamination have been identified. These include the drilling effluent pond and mudpits used during drilling operations. In addition, contamination could migrate in the gas horizon.

  18. Academic Enhancement site.

    PubMed

    DeJong, Judith A; Holder, Stanley R

    2006-01-01

    This off-reservation boarding school serves over 600 students in grades 4-12; approximately 85% of the students reside in campus dormitories. After having documented significant improvement on a number of outcomes during a previous High Risk Youth Prevention demonstration grant, the site submitted a Therapeutic Residential Model proposal, requesting funding to continue successful elements developed under the demonstration grant and to expand mental health services. The site received Therapeutic Residential Model funding for school year 2001-2002. Once funds were received, the site chose to shift Therapeutic Residential Model funds to an intensive academic enhancement effort. While not in compliance with the Therapeutic Residential Model initiative and therefore not funded in subsequent years, this site created the opportunity to enhance the research design by providing a naturally occurring placebo condition at a site with extensive cross-sectional data baselines that addressed issues related to current federal educational policies. PMID:17602403

  19. Site directed recombination

    DOEpatents

    Jurka, Jerzy W.

    1997-01-01

    Enhanced homologous recombination is obtained by employing a consensus sequence which has been found to be associated with integration of repeat sequences, such as Alu and ID. The consensus sequence or sequence having a single transition mutation determines one site of a double break which allows for high efficiency of integration at the site. By introducing single or double stranded DNA having the consensus sequence flanking region joined to a sequence of interest, one can reproducibly direct integration of the sequence of interest at one or a limited number of sites. In this way, specific sites can be identified and homologous recombination achieved at the site by employing a second flanking sequence associated with a sequence proximal to the 3'-nick.

  20. Site-specific photochemistry

    NASA Astrophysics Data System (ADS)

    Koplitz, Brent D.; Brum, Jeffrey L.; Deshmukh, Subhash; Xu, Xiaodong; Wang, Zhongrui; Yen, Yu-Fong

    1992-04-01

    We present results on `site-specific' H-atom production in photolysis experiments conducted under collisionless conditions. H and D atoms are used as labels to investigate the site(s) at which C-H (or C-D) bond cleavage occurs in a variety of haloalkane systems. Experiments using two photolysis lasers clearly indicate that photon absorption by an intermediate, presumably an alkyl radical, is important in many of the systems studied. The site(s) (e.g., (alpha) , (beta) , or (gamma) ) at which C-H (or C-D) bond cleavage occurs is dependent not only on the nature of the molecule, but also on the photolysis wavelength. As a diagnostic tool, H- and D-atom Doppler spectroscopy allows us to gain insight into the energetics associated with the various dissociation processes. Our overall aim is to gain a further understanding of the photolysis properties of a variety of simple molecules and their associated radicals.

  1. Site decommissioning management plan

    SciTech Connect

    Fauver, D.N.; Austin, J.H.; Johnson, T.C.; Weber, M.F.; Cardile, F.P.; Martin, D.E.; Caniano, R.J.; Kinneman, J.D.

    1993-10-01

    The Nuclear Regulatory Commission (NRC) staff has identified 48 sites contaminated with radioactive material that require special attention to ensure timely decommissioning. While none of these sites represent an immediate threat to public health and safety they have contamination that exceeds existing NRC criteria for unrestricted use. All of these sites require some degree of remediation, and several involve regulatory issues that must be addressed by the Commission before they can be released for unrestricted use and the applicable licenses terminated. This report contains the NRC staff`s strategy for addressing the technical, legal, and policy issues affecting the timely decommissioning of the 48 sites and describes the status of decommissioning activities at the sites.

  2. Sparse Image Format

    Energy Science and Technology Software Center (ESTSC)

    2007-04-12

    The Sparse Image Format (SIF) is a file format for storing spare raster images. It works by breaking an image down into tiles. Space is savid by only storing non-uniform tiles, i.e. tiles with at least two different pixel values. If a tile is completely uniform, its common pixel value is stored instead of the complete tile raster. The software is a library in the C language used for manipulating files in SIF format. Itmore » supports large files (> 2GB) and is designed to build in Windows and Linux environments.« less

  3. Sparse Image Format

    SciTech Connect

    Eads, Damian Ryan

    2007-04-12

    The Sparse Image Format (SIF) is a file format for storing spare raster images. It works by breaking an image down into tiles. Space is savid by only storing non-uniform tiles, i.e. tiles with at least two different pixel values. If a tile is completely uniform, its common pixel value is stored instead of the complete tile raster. The software is a library in the C language used for manipulating files in SIF format. It supports large files (> 2GB) and is designed to build in Windows and Linux environments.

  4. Probabilistic Modeling of Rosette Formation

    PubMed Central

    Long, Mian; Chen, Juan; Jiang, Ning; Selvaraj, Periasamy; McEver, Rodger P.; Zhu, Cheng

    2006-01-01

    Rosetting, or forming a cell aggregate between a single target nucleated cell and a number of red blood cells (RBCs), is a simple assay for cell adhesion mediated by specific receptor-ligand interaction. For example, rosette formation between sheep RBC and human lymphocytes has been used to differentiate T cells from B cells. Rosetting assay is commonly used to determine the interaction of Fc γ-receptors (FcγR) expressed on inflammatory cells and IgG coated on RBCs. Despite its wide use in measuring cell adhesion, the biophysical parameters of rosette formation have not been well characterized. Here we developed a probabilistic model to describe the distribution of rosette sizes, which is Poissonian. The average rosette size is predicted to be proportional to the apparent two-dimensional binding affinity of the interacting receptor-ligand pair and their site densities. The model has been supported by experiments of rosettes mediated by four molecular interactions: FcγRIII interacting with IgG, T cell receptor and coreceptor CD8 interacting with antigen peptide presented by major histocompatibility molecule, P-selectin interacting with P-selectin glycoprotein ligand 1 (PSGL-1), and L-selectin interacting with PSGL-1. The latter two are structurally similar and are different from the former two. Fitting the model to data enabled us to evaluate the apparent effective two-dimensional binding affinity of the interacting molecular pairs: 7.19 × 10−5 μm4 for FcγRIII-IgG interaction, 4.66 × 10−3 μm4 for P-selectin-PSGL-1 interaction, and 0.94 × 10−3 μm4 for L-selectin-PSGL-1 interaction. These results elucidate the biophysical mechanism of rosette formation and enable it to become a semiquantitative assay that relates the rosette size to the effective affinity for receptor-ligand binding. PMID:16603493

  5. Lunar Polar Landing Sites

    NASA Astrophysics Data System (ADS)

    Kamps, Oscar; Foing, Bernard H.; Flahaut, Jessica

    2016-07-01

    An important step for a scientific mission is to assess on where the mission should be conducted. This study on landing site selection focuses on a mission to the poles of the Moon where an in-situ mission should be conducted to answer the questions with respect to volatiles and ices. The European interest for a mission to the poles of the Moon is presented in the mission concept called Heracles. This mission would be a tele-operated, sample return mission where astronauts will controlling a rover from an Orion capsule in cislunar orbit. The primary selection of landing sites was based on the scientific interest of areas near the poles. The maximum temperature map from Diviner was used to select sites where CO^2¬ should always be stable. This means that the maximum temperature is lower than 54K which is the sublimation temperature for CO^2¬ in lunar atmospheric pressure. Around these areas 14 potential regions of interest were selected. Further selection was based on the epoch of the surface in these regions of interest. It was thought that it would be of high scientific value if sites are sampled which have another epoch than already sampled by one of the Apollo or Luna missions. Only 6 sites on both North as South Pole could contain stable CO^2 ¬and were older than (Pre-)Necterian. Before a landing site and rover traverse was planned these six sites were compared on their accessibility of the areas which could contain stable CO^2. It was assumed that slope lower than 20^o is doable to rove. Eventually Amundsen and Rozhdestvenskiy West were selected as regions of interest. Assumptions for selecting landing sites was that area should have a slope lower than 5^o, a diameter of 1km, in partial illuminated area, and should not be isolated but inside an area which is in previous steps marked as accessible area to rove. By using multiple tools in ArcGIS it is possible to present the area's which were marked as potential landing sites. The closest potential landing

  6. Teaching Letter Formation.

    ERIC Educational Resources Information Center

    Graham, Steve; Madan, Avi J.

    1981-01-01

    The authors describe a remedial technique for teaching letter formation to students with handwriting difficulties. The approach blends traditional procedures (modeling, physical prompts, tracing, self correction, etc.) with cognitive behavior modification principles. (CL)

  7. Circumstellar grain formation

    NASA Technical Reports Server (NTRS)

    Draine, B. T.

    1986-01-01

    Dust formation around cool giant and supergiant stars is examined in terms of grain formulation. Optical properties of small clusters, molecular physics of cluster nucleation and growth, circumstellar mass flows, and their application to alpha Ori are discussed.

  8. Potential MER Landing Site in Melas Chasma

    NASA Technical Reports Server (NTRS)

    Weitz, C. M.; Parker, Timothy J.; Anderson, F. Scott

    2001-01-01

    We have selected one area in Valles Marineris as a potential landing site for the Mars Exploration Rover (MER) mission. After 30 years of analyses, the formation of the Valles Marineris system of troughs and its associated deposits still remains an enigma. Understanding all aspects of the Valles Marineris would significantly contribute to deciphering the internal and external history of Mars. A landing site within Melas Chasma could provide insight into both the formation of Valles Marineris and the composition and origin of the interior layered deposits (ILDs). The ILDs have been proposed as: (1) sedimentary deposits formed in lakes mass wasted material from the walls; (3) remnants of the wall rock; (4) carbonate deposits; (5) aeolian deposits; and (6) volcanic. More recently, Malin and Edgett suggest that the fine-scale, rhythmic layering seen in the interior deposits, as well as other layered deposits in craters, supports a sedimentary origin. Because an understanding of the formation of Valles Marineris and its interior deposits is so important to deciphering the history of Mars, we have proposed a landing site for the MER mission on an exposure of interior deposits in western Melas Chasma. Either MER-A and MER-B could land at this same location.

  9. Master Plans for Park Sites.

    ERIC Educational Resources Information Center

    Van Meter, Jerry R.

    This booklet is a general guide to park site planning. The four basic steps involved in developing a park site are a) determination of the uses of the site, b) analysis of the site potential for these uses, c) identification of the functional relationship among the uses, and d) coordination of the uses to the park sites. Uses of park sites are…

  10. Display formats manual

    NASA Technical Reports Server (NTRS)

    Runnels, R. L.

    1973-01-01

    The standards and procedures for the generation of operational display formats to be used in the Mission Control Center (MCC) display control system are presented. The required effort, forms, and fundamentals for the design, specifications, and production of display formats are identified. The principles of display design and system constraints controlling the creation of optimum operational displays for mission control are explained. The basic two types of MCC display systems for presenting information are described.

  11. Plant Formate Dehydrogenase

    SciTech Connect

    John Markwell

    2005-01-10

    The research in this study identified formate dehydrogenase, an enzyme that plays a metabolic role on the periphery of one-carbon metabolism, has an unusual localization in Arabidopsis thaliana and that the enzyme has an unusual kinetic plasticity. These properties make it possible that this enzyme could be engineered to attempt to engineer plants with an improved photosynthetic efficiency. We have produced transgenic Arabidopsis and tobacco plants with increased expression of the formate dehydrogenase enzyme to initiate further studies.

  12. Expedited site characterization

    SciTech Connect

    McCreary, I.; Booth, S.R.

    1997-03-01

    Expedited Site Characterization (ESC) is being offered as a new, more cost-effective way to perform DOE environmental site characterizations. Site characterization of environmental cleanup sites can be costly and time consuming. {open_quotes}Traditional techniques,{close_quotes} though effective, are the outgrowth of cautious and often restrictive regulatory control. At some sites up to 40% of the funds and 70% of the time spent on cleanup operations have been devoted to characterization. More realistically, the DOE`s Ten Year Plan (TYP) Cost Rollup by Category (high budgetary version) budgets $1.34 billion to remedial action assessments out of a total of $9.7 billion in remedial actions - about 14% of the total TYP expenditures for this type of cleanup work. The expenditure percentage for characterization drops to a much lower 3% of total expenditures during outyears, after 2006, as most of the assessments will have been completed during the early TYP years. (The sampling and monitoring costs, however, rise from 7% of the budget during the TYP to 30% during the outyears as this activity continues and others decline. Improved characterizations could have the potential to reduce the need for some of these ongoing monitoring costs.) Fortunately, regulatory agencies have begun to relax many of the constraints on site characterization allowing more efficient and innovative approaches to be applied. Argonne National Laboratory`s Expedited Site Characterization is perhaps the best defined of these new approaches. ESC is founded on the premise that it is cheaper, faster, and more efficient to develop and test a conceptual model (or {open_quotes}hypothesis{close_quotes}) of contamination at a site than it is to collect data on a statistical basis and then attempt to model a site from those data. The difference between these two approaches has been described as a {open_quotes}scientific versus an engineering approach{close_quotes}.

  13. Autonomous Formation Flight

    NASA Technical Reports Server (NTRS)

    Schkolnik, Gerard S.; Cobleigh, Brent

    2004-01-01

    NASA's Strategic Plan for the Aerospace Technology Enterprise includes ambitious objectives focused on affordable air travel, reduced emissions, and expanded aviation-system capacity. NASA Dryden Flight Research Center, in cooperation with NASA Ames Research Center, the Boeing Company, and the University of California, Los Angeles, has embarked on an autonomous-formation-flight project that promises to make significant strides towards these goals. For millions of years, birds have taken advantage of the aerodynamic benefit of flying in formation. The traditional "V" formation flown by many species of birds (including gulls, pelicans, and geese) enables each of the trailing birds to fly in the upwash flow field that exists just outboard of the bird immediately ahead in the formation. The result for each trailing bird is a decrease in induced drag and thus a reduction in the energy needed to maintain a given speed. Hence, for migratory birds, formation flight extends the range of the system of birds over the range of birds flying solo. The Autonomous Formation Flight (AFF) Project is seeking to extend this symbiotic relationship to aircraft.

  14. Mapping Recombination Initiation Sites Using Chromatin Immunoprecipitation.

    PubMed

    He, Yan; Wang, Minghui; Sun, Qi; Pawlowski, Wojciech P

    2016-01-01

    Genome-wide maps of recombination sites provide valuable information not only on the recombination pathway itself but also facilitate the understanding of genome dynamics and evolution. Here, we describe a chromatin immunoprecipitation (ChIP) protocol to map the sites of recombination initiation in plants with maize used as an example. ChIP is a method that allows identification of chromosomal sites occupied by specific proteins. Our protocol utilizes RAD51, a protein involved in repair of double-strand breaks (DSBs) that initiate meiotic recombination, to identify DSB formation hotspots. Chromatin is extracted from meiotic flowers, sheared and enriched in fragments bound to RAD51. Genomic location of the protein is then identified by next-generation sequencing. This protocol can also be used in other species of plants, animals, and fungi. PMID:27511175

  15. Comprehensive, integrated, remote sensing at DOE sites

    SciTech Connect

    Lackey, J.G.; Burson, Z.G.

    1984-01-01

    The Department of Energy has established a program called Comprehensive, Integrated Remote Sensing (CIRS). The overall objective is to provide a state-of-the-art data base of remotely sensed data for all users of such information at large DOE sites. The primary types of remote sensing provided consist of the following: (1) large format aerial photography; (2) video from aerial platforms; (3) multispectral scanning; and (4) airborne nuclear radiometric surveys. Implementation of the CIRS Program began with field operations at the Savannah River Plant in 1982 and is continuing at that DOE site at a level of effort of about $1.5 m per year. Integrated remote sensing studies were subsequently extended to the West Valley Demonstration Project in the summer and fall of 1984. It is expected that the Program will eventually be extended to cover all large DOE sites on a continuing basis. 2 figures.

  16. Solar site test module

    NASA Technical Reports Server (NTRS)

    Kissel, R. R.; Scott, D. R.

    1980-01-01

    A solar site test module using the Rockwell AIM 65microcomputer is described. The module is designed to work at any site where an IBM site data acquisition system (SDAS) is installed and is intended primarily as a troubleshooting tool. It collects sensor information (temperatures, flow rates, etc.) and displays or prints it immediately in calibrated engineering units. It will read one sensor on demand, periodically read up to 10sensors or periodically read all sensors. Performance calculations can also be included with sensor data. Unattended operation is possible to, e.g., monitor a group of sensors once per hour. Work is underway to add a data acquisition system to the test module so that it can be used at sites which have no SDAS.

  17. Slipcovering a superfund site

    SciTech Connect

    Gascoyne, S.

    1993-09-01

    The Rocky Mountain Arsenal is both a Superfund cleanup site (one of the most contaminated in the United States) and a recently named provisional wildlife refuge. In this article, the history of the Rocky Mountain arsenal is reviewed. The decontamination program for the arsenal and the probable effects of cleanup on the ecology of the site are described. Some of the diverse responses to the program are included in the discussion.

  18. USGIN Lab site

    Energy Science and Technology Software Center (ESTSC)

    2009-08-01

    This web site provides information related to service profiles and implementation in development for the US Geoscience information network (USGIN). It is meant to be a site where developers can learn about the standard in use, the objectives of the application profiles being developed, software being used or tested for implementation of services, and details about particular implementations. Forums are provided for asking questions about the services, profiles, and implemenation issues.

  19. GSM Cell Site Porensics

    NASA Astrophysics Data System (ADS)

    Swenson, Christopher; Moore, Tyler; Shenoi, Sujeet

    Cell site forensics is a new and growing area of digital forensics, enabling investigators to verify a mobile phone subscriber's location at specific times. This paper focuses on cell site forensics in GSM networks. In particular, it discusses current methods utilizing call detail records generated from telephone switches that provide information about cellular calls and text messages, and the cellular towers on which calls/messages were placed and received.

  20. Bacterial start site prediction.

    PubMed

    Hannenhalli, S S; Hayes, W S; Hatzigeorgiou, A G; Fickett, J W

    1999-09-01

    With the growing number of completely sequenced bacterial genes, accurate gene prediction in bacterial genomes remains an important problem. Although the existing tools predict genes in bacterial genomes with high overall accuracy, their ability to pinpoint the translation start site remains unsatisfactory. In this paper, we present a novel approach to bacterial start site prediction that takes into account multiple features of a potential start site, viz., ribosome binding site (RBS) binding energy, distance of the RBS from the start codon, distance from the beginning of the maximal ORF to the start codon, the start codon itself and the coding/non-coding potential around the start site. Mixed integer programing was used to optimize the discriminatory system. The accuracy of this approach is up to 90%, compared to 70%, using the most common tools in fully automated mode (that is, without expert human post-processing of results). The approach is evaluated using Bacillus subtilis, Escherichia coli and Pyrococcus furiosus. These three genomes cover a broad spectrum of bacterial genomes, since B.subtilis is a Gram-positive bacterium, E.coli is a Gram-negative bacterium and P. furiosus is an archaebacterium. A significant problem is generating a set of 'true' start sites for algorithm training, in the absence of experimental work. We found that sequence conservation between P. furiosus and the related Pyrococcus horikoshii clearly delimited the gene start in many cases, providing a sufficient training set. PMID:10446249

  1. Development of clinical sites.

    PubMed

    O'Brien, Mary

    2015-02-01

    Clinical experiences are vital to all types of healthcare educational programs. Supervised clinical experiences provide the opportunity for the learner to apply didactic knowledge and theory to real world situations and hone skills necessary for entry into practice. Nurse anesthesia programs utilize a wide variety of clinical sites to expose student registered nurse anesthetists to experiences that will prepare them clinically, academically and professionally to enter practice as a Certified Registered Nurse Anesthetist. This article describes the process of developing a clinical site. A thorough evaluation will determine the types of experiences meant to be offered at the site, the resources available to house and educate the students, and how to evaluate the effectiveness of the clinical site. Open communication between the clinical coordinator and the program director or designee is essential to ensure success of the clinical site. The Council on Accreditation of Nurse Anesthesia Educational Programs has resources available to guide those interested in becoming a clinical site, as well as for program administrators who seek to add new experiences to their programs. PMID:25842629

  2. Positronium Formation in Muscle

    PubMed Central

    Gustafson, D. R.

    1970-01-01

    Positronium formation in muscle at +4°C and -4°C was examined by the measurement of the angular correlation of positron annihilation radiation. Since the positronium formation rate in ice is considerably higher than it is in water, there should be a comparable increase in the positronium formation rate in muscle tissue if recent speculation that cellular water is ordered in a semicrystalline icelike state is correct. Comparison of the angular correlation from muscle at +4°C with that from water at +4°C shows no enhancement of the positronium formation rate. Frozen muscle at -4°C shows an enhancement of the positronium formation rate of approximately half that found in ice at -4°C, indicating that most cellular water undergoes a normal water-ice transition when frozen. It is concluded therefore that cell water in muscle is not ordered in a hexagonal icelike structure. While the results are consistent with the hypothesis that cell water is in the liquid state, the hypothesis that cell water is ordered in an undetermined close packed structure which transforms to the hexagonal ice structure at or near 0°C cannot be ruled out. PMID:5436881

  3. Formation of the earth

    NASA Technical Reports Server (NTRS)

    Wetherill, George W.

    1990-01-01

    The origin of the earth is discussed in the context of the formation of the sun and the planets, and a standard model for such a formation assuming gravitational instability in a dense interstellar molecular cloud is outlined, along with the most significant variant of the model in which the loss of the nebular gas occurred after the formation of the earth. The formation of the sun and solar nebulae is addressed, and the coagulation of grains and the formation of small planetesimals are covered, along with the gravitational accumulation of planetesimals into planetary embryos and final stages of accumulation - embryos of planets. It is pointed out that the final stage of accumulation consists of the collision of these embryos; because of their large size, particularly after their further growth, these collisions represent giant impacts. It is concluded that the earth was initially an extremely hot and melted planet, surrounded by a fragile atmosphere and subject to violent impacts by bodies of the size of Ceres and even the moon.

  4. RAPID DUST FORMATION IN NOVAE: THE SPEED CLASS—FORMATION TIMESCALE CORRELATION EXPLAINED

    SciTech Connect

    Williams, S. C.; Bode, M. F.; Darnley, M. J.; Evans, A.; Zubko, V.; Shafter, A. W.

    2013-11-10

    Observations show that the time of onset of dust formation in classical novae depends strongly on their speed class, with dust typically taking longer to form in slower novae. Using empirical relationships between speed class, luminosity and ejection velocity, it can be shown that dust formation timescale is expected to be essentially independent of speed class. However, following a nova outburst the spectrum of the central hot source evolves, with an increasing proportion of the radiation being emitted short-ward of the Lyman limit. The rate at which the spectrum evolves also depends on the speed class. We have therefore refined the simple model by assuming photons at energies higher than the Lyman limit are absorbed by neutral hydrogen gas internal to the dust formation sites, therefore preventing these photons reaching the nucleation sites. With this refinement the dust formation timescale is theoretically dependent on speed class and the results of our theoretical modification agree well with the observational data. We consider two types of carbon-based dust, graphite and amorphous carbon, with both types producing similar relationships. Our results can be used to predict when dust will form in a nova of a given speed class and hence when observations should optimally be taken to detect the onset of dust formation.

  5. Spectral imaging microscopy web sites and data.

    PubMed

    McNamara, George; Gupta, Amit; Reynaert, James; Coates, Thomas D; Boswell, Carl

    2006-08-01

    The Internet is enabling greater access to spectral imaging publications, spectral graphs, and data than that was available a generation ago. The spectral imaging systems discussed in this issue of Cytometry work because reagent and hardware spectra are reproducible, reusable, and provide input to spectral unmixing and spectral components recognition algorithms. These spectra need to be readily available in order to determine what to purchase, how to use it, and what the output means. We refer to several commercially sponsored and academic spectral web sites and discuss our spectral graphing and data sites. Sites include fluorescent dye graph servers from Invitrogen/Molecular Probes, BD Biosciences, Zeiss/Bio-Rad Cell Sciences, and filter set servers from Chroma Technology and Omega Optical. Several of these sites include data download capabilities. Recently, two microscope manufacturers have published on their web sites transmission curves for select objective lenses-crucial data for anyone doing multiphoton excitation microscopy. Notable among the academic sites, PhotoChemCAD 2.0 has over 200 dyes and a downloadable database/graphing program, and the USC-A Chemistry UV-vis Database displays absorption spectra of many dyes and indicators used in clinical histology and pathology. Our Fluorescent Spectra graphing/calculator site presents dyes, filters, and illumination data from many of these and additional sources. PubSpectra is our free download site which uses Microsoft Excel files as standardized human/machine readable format with over 2,000 biomedical spectra. The principle that data is not subject to copyright provides a framework in which all scientific data should be made freely accessible. PMID:16969821

  6. Site study plan for exploratory shaft monitoring wells, Deaf Smith County Site, Texas: Preliminary Draft

    SciTech Connect

    Not Available

    1988-01-01

    As part of site characterization studies, two exploratory shafts will be constructed at the Deaf Smith County site, Texas. Twelve wells at five locations have been proposed to monitor potential impacts of shaft construction on water-bearing zones in the Ogallala Formation and the Dockum Group. In addition, tests have been proposed to determine the hydraulic properties of the water-bearing zones for use in design and construction of the shafts. Samples of the Blackwater Draw Formation, Ogallala Formation, and Dockum Group will be obtained during construction of these wells. Visual indentification, laboratory testing, and in situ testing will yield data necessary for Exploratory Shaft Facility design and construction. This activity provides the earliest data on the Blackwater Drew Formation, Ogallala Formation, and Dockum Group near the exploratory shaft locations. Drilling and hydrologic testing are scheduled prior to other subsurface activity at the Exploratory Shaft Facility to establish ground-water baseline conditions. The Technical Field Services Contractor is responsible for conducting the field program of drilling and testing. Samples and data will be handled and reported in accordance with established Salt Repository Project procedures. A quality assurance program will be utilized to assure that activities affecting quality are performed correctly and that the appropriate documentation is maintained. 45 refs., 11 figs., 4 tabs.

  7. Molecules in star formation.

    NASA Astrophysics Data System (ADS)

    Shu, F. H.

    The author reviews current ideas and models in the problem of star formation from molecular cloud cores that are relatively isolated from the influences of other forming stars. He discusses the time scales, flow dynamics, and density and temperature structures applicable to each of the four stages of the entire process: (1) formation of a magnetized cloud core by ambipolar diffusion and evolution to a pivotal state of gravomagneto catastrophe; (2) self-similar collapse of the pivotal configuration and the formation of protostars, disks, and pseudo-disks; (3) onset of a magnetocentrifugally driven, lightly ionized wind from the interaction of an accretion disk and the magnetosphere of the central star, and the driving of bipolar molecular outflows; (4) evolution of pre-main-sequence stars surrounded by dusty accretion disks. For each of these stages and processes, he considers the characteristics of the molecular diagnostics needed to investigate the crucial aspects of the observational problem.

  8. Site clearance working group

    SciTech Connect

    1997-03-01

    The Gulf of Mexico and Louisiana continue to be areas with a high level of facility removal, and the pace of removal is projected to increase. Regulations were promulgated for the Gulf of Mexico and Louisiana requiring that abandoned sites be cleared of debris that could interfere with fishing and shrimping activities. The site clearance regulations also required verification that the sites were clear. Additionally, government programs were established to compensate fishermen for losses associated with snagging their equipment on oil and gas related objects that remained on the water bottoms in areas other than active producing sites and sites that had been verified as clear of obstructions and snags. The oil and gas industry funds the compensation programs. This paper reviews the regulations and evolving operating practices in the Gulf of Mexico and Louisiana where site clearance and fisherman`s gear compensation regulations have been in place for a number of years. Although regulations and guidelines may be in place elsewhere in the world, this paper focuses on the Gulf of Mexico and Louisiana. Workshop participants are encouraged to bring up international issues during the course of the workshop. Additionally, this paper raises questions and focuses on issues that are of concern to the various Gulf of Mexico and Louisiana water surface and water bottom stakeholders. This paper does not have answers to the questions or issues. During the workshop participants will debate the questions and issues in an attempt to develop consensus opinions and/or make suggestions that can be provided to the appropriate organizations, both private and government, for possible future research or policy adjustments. Site clearance and facility removal are different activities. Facility removal deals with removal of the structures used to produce oil and gas including platforms, wells, casing, piles, pipelines, well protection structures, etc.

  9. Lunar base siting

    NASA Technical Reports Server (NTRS)

    Staehle, Robert L.; Dowling, Richard

    1991-01-01

    As with any planetary body, the lunar surface is quite heterogeneous. There are widely dispersed sites of particular interest for known and potential resource availability, selenology, and lunar observatories. Discriminating characteristics include solar illumination, view of earth, local topography, engineering properties of the regolith and certain geological features, and local mineralogy and petrology. Space vehicle arrival and departure trajectories constitute a minor consideration. Over time, a variety of base sites will be developed serving different purposes. Resource-driven sites may see the fastest growth during the first decades of lunar development, but selection of the most favorable sites is likely to be driven by suitability for a combination of activities. As on earth, later development may be driven by geographical advantages of surface transportation routes. With the availability of near-constant sunlight for power generation, as well as permanently shadowed areas at cryogenic temperatures, polar sites are attractive because they require substantially less earth-launched mass and lower equipment complexity for an initial permanent base. Discovery of accessible volatiles reservoirs, either in the form of polar permafrost or gas reservoirs at other locations, would dramatically increase the attractiveness of any site from a logistical support and selenological point of view. Amid such speculation, no reliable evidence of such volatiles exist. More reliable evidence exists for areas of certain mineral concentrations, such as ilmenite, which could form a feedstock for some proposed resource extraction schemes. While tentative selections of advantageous base sites are made, new data from lunar polar orbiters and the Galileo polar flybys would be very helpful.

  10. Thrombus formation in vivo

    PubMed Central

    Furie, Bruce; Furie, Barbara C.

    2005-01-01

    To examine thrombus formation in a living mouse, new technologies involving intravital videomicroscopy have been applied to the analysis of vascular windows to directly visualize arterioles and venules. After vessel wall injury in the microcirculation, thrombus development can be imaged in real time. These systems have been used to explore the role of platelets, blood coagulation proteins, endothelium, and the vessel wall during thrombus formation. The study of biochemistry and cell biology in a living animal offers new understanding of physiology and pathology in complex biologic systems. PMID:16322780

  11. Crystal Formation in Inflammation.

    PubMed

    Franklin, Bernardo S; Mangan, Matthew S; Latz, Eicke

    2016-05-20

    The formation and accumulation of crystalline material in tissues is a hallmark of many metabolic and inflammatory conditions. The discovery that the phase transition of physiologically soluble substances to their crystalline forms can be detected by the immune system and activate innate immune pathways has revolutionized our understanding of how crystals cause inflammation. It is now appreciated that crystals are part of the pathogenesis of numerous diseases, including gout, silicosis, asbestosis, and atherosclerosis. In this review we discuss current knowledge of the complex mechanisms of crystal formation in diseased tissues and their interplay with the nutrients, metabolites, and immune cells that account for crystal-induced inflammation. PMID:26772211

  12. Isolating Triggered Star Formation

    SciTech Connect

    Barton, Elizabeth J.; Arnold, Jacob A.; Zentner, Andrew R.; Bullock, James S.; Wechsler, Risa H.; /KIPAC, Menlo Park /SLAC

    2007-09-12

    Galaxy pairs provide a potentially powerful means of studying triggered star formation from galaxy interactions. We use a large cosmological N-body simulation coupled with a well-tested semi-analytic substructure model to demonstrate that the majority of galaxies in close pairs reside within cluster or group-size halos and therefore represent a biased population, poorly suited for direct comparison to 'field' galaxies. Thus, the frequent observation that some types of galaxies in pairs have redder colors than 'field' galaxies is primarily a selection effect. We use our simulations to devise a means to select galaxy pairs that are isolated in their dark matter halos with respect to other massive subhalos (N= 2 halos) and to select a control sample of isolated galaxies (N= 1 halos) for comparison. We then apply these selection criteria to a volume-limited subset of the 2dF Galaxy Redshift Survey with M{sub B,j} {le} -19 and obtain the first clean measure of the typical fraction of galaxies affected by triggered star formation and the average elevation in the star formation rate. We find that 24% (30.5 %) of these L* and sub-L* galaxies in isolated 50 (30) h{sup -1} kpc pairs exhibit star formation that is boosted by a factor of {approx}> 5 above their average past value, while only 10% of isolated galaxies in the control sample show this level of enhancement. Thus, 14% (20 %) of the galaxies in these close pairs show clear triggered star formation. Our orbit models suggest that 12% (16%) of 50 (30) h{sup -1} kpc close pairs that are isolated according to our definition have had a close ({le} 30 h{sup -1} kpc) pass within the last Gyr. Thus, the data are broadly consistent with a scenario in which most or all close passes of isolated pairs result in triggered star formation. The isolation criteria we develop provide a means to constrain star formation and feedback prescriptions in hydrodynamic simulations and a very general method of understanding the importance of

  13. Sand dollar sites orogenesis

    NASA Astrophysics Data System (ADS)

    Amos, Dee

    2013-04-01

    The determinology of the humble sand dollars habitat changing from inception to the drastic evolution of the zone to that of present day. Into the cauldron along the southern Californian 'ring of fire' lithosphere are evidence of geosynclinals areas, metasedimentary rock formations and hydrothermal activity. The explanation begins with 'Theia' and the Moon's formation, battles with cometary impacts, glacial ages, epochs with evolutionary bottlenecks and plate tectonics. Fully illustrated the lecture includes localised diagrams and figures with actual subject photographic examples of plutonic, granitic, jade and peridodite. Finally, the origins of the materials used in the lecture are revealed for prosecution by future students and the enjoyment of interested parties in general.

  14. Closure Plan for the Area 5 Radioactive Waste Management Site at the Nevada Test Site

    SciTech Connect

    NSTec Environmental Management

    2008-09-01

    The Area 5 Radioactive Waste Management Site (RMWS) at the Nevada Test Site (NTS) is managed and operated by National Security Technologies, LLC (NSTec), for the U.S. Department of Energy (DOE), National Nuclear Security Administration Nevada Site Office (NNSA/NSO). This document is the first update of the preliminary closure plan for the Area 5 RWMS at the NTS that was presented in the Integrated Closure and Monitoring Plan (DOE, 2005a). The major updates to the plan include a new closure schedule, updated closure inventory, updated site and facility characterization data, the Title II engineering cover design, and the closure process for the 92-Acre Area of the RWMS. The format and content of this site-specific plan follows the Format and Content Guide for U.S. Department of Energy Low-Level Waste Disposal Facility Closure Plans (DOE, 1999a). This interim closure plan meets closure and post-closure monitoring requirements of the order DOE O 435.1, manual DOE M 435.1-1, Title 40 Code of Federal Regulations (CFR) Part 191, 40 CFR 265, Nevada Administrative Code (NAC) 444.743, and Resource Conservation and Recovery Act (RCRA) requirements as incorporated into NAC 444.8632. The Area 5 RWMS accepts primarily packaged low-level waste (LLW), low-level mixed waste (LLMW), and asbestiform low-level waste (ALLW) for disposal in excavated disposal cells.

  15. Site investigation for Magnus

    SciTech Connect

    Semple, R.M.; Rigden, W.J.

    1983-05-01

    In April 1982, BP's Magnus structure was installed about 150 km northeast of the Shetland Islands. The most northerly, deepest water platform in the North Sea, the steel tower is supported on groups of 2 m diameter piles that were driven, in good accordance with predictions, to an average penetration of 85 m in strong cohesive soils. The paper describes investigations performed at the platform site, and documents soil characteristics for conventional and state of the art pile analyses. Reference is made to several innovative techniques first used at the Magnus site that have since been incorporated into the larger North Sea investigations. Information is given about the geological history of the site. Test results are presented on soil strength and stiffness, including critical state soil mechanics parameters, on residual pore pressures after sampling, and on the effect of sample size on strength characteristics.

  16. SLAC site design aesthetics

    SciTech Connect

    Hall, F.F.

    1985-10-01

    Stanford Linear Accelerator Center (SLAC) is a single mission laboratory dedicated to basic research in high energy particle physics. SLAC site also houses Stanford Synchrotron Radiation Laboratory (SSRL) which is a multi-mission laboratory for research using beams of ultraviolet light and low energy photons as emitted tangentially from SLAC colliding beam facilities. This paper discusses various aspects of SLAC site design aesthetics under the following headings: (1) imposed footprint of SLAC, (2) description of selected site, (3) use of earth cover for radiation and sight screens, (4) use of landscaping for cosmetic purposes, (5) use of exterior paint colors to soften SLAC impact on neighbors, (6) relocation of SLAC main entrance, (7) relocation of SLAC collider arcs and experimental hall, (8) parking lots and storage yards, and (9) land use zoning at SLAC.

  17. statement of significance, location map, site plan, landscape plan, site ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    statement of significance, location map, site plan, landscape plan, site sections, evolution of cemetery landscape. - San Francisco National Cemetery, 1 Lincoln Boulevard, San Francisco, San Francisco County, CA

  18. YUCCA MOUNTAIN SITE DESCRIPTION

    SciTech Connect

    A.M. Simmons

    2004-04-16

    The ''Yucca Mountain Site Description'' summarizes, in a single document, the current state of knowledge and understanding of the natural system at Yucca Mountain. It describes the geology; geochemistry; past, present, and projected future climate; regional hydrologic system; and flow and transport within the unsaturated and saturated zones at the site. In addition, it discusses factors affecting radionuclide transport, the effect of thermal loading on the natural system, and tectonic hazards. The ''Yucca Mountain Site Description'' is broad in nature. It summarizes investigations carried out as part of the Yucca Mountain Project since 1988, but it also includes work done at the site in earlier years, as well as studies performed by others. The document has been prepared under the Office of Civilian Radioactive Waste Management quality assurance program for the Yucca Mountain Project. Yucca Mountain is located in Nye County in southern Nevada. The site lies in the north-central part of the Basin and Range physiographic province, within the northernmost subprovince commonly referred to as the Great Basin. The basin and range physiography reflects the extensional tectonic regime that has affected the region during the middle and late Cenozoic Era. Yucca Mountain was initially selected for characterization, in part, because of its thick unsaturated zone, its arid to semiarid climate, and the existence of a rock type that would support excavation of stable openings. In 1987, the United States Congress directed that Yucca Mountain be the only site characterized to evaluate its suitability for development of a geologic repository for high-level radioactive waste and spent nuclear fuel.

  19. BISAC Variable Format.

    ERIC Educational Resources Information Center

    Information Technology and Libraries, 1983

    1983-01-01

    Presents revision of Book Industry Systems Advisory Committee (BISAC) format designed specifically for electronic transmission of purchase orders for monograph or series titles combining fixed and variable length data fields which was approved in January 1983. Special characters, sample address descriptions, summary of fixed records, glossary, and…

  20. The Formation of Trihalomethanes.

    ERIC Educational Resources Information Center

    Trussell, R. Rhodes; Umphres, Mark D.

    1978-01-01

    Reviewed are a number of factors important in the formation of trihalomethanes (THM) including the nature of aquatic humus and the influences of preozonation, bromide, pH, and chlorine. A brief investigation is also conducted into the kinetics of the THM reaction. Several major research needs are represented. (CS)

  1. Reconsidering Formative Measurement

    ERIC Educational Resources Information Center

    Howell, Roy D.; Breivik, Einar; Wilcox, James B.

    2007-01-01

    The relationship between observable responses and the latent constructs they are purported to measure has received considerable attention recently, with particular focus on what has become known as formative measurement. This alternative to reflective measurement in the area of theory-testing research is examined in the context of the potential…

  2. Formation of Freirian Facilitators.

    ERIC Educational Resources Information Center

    Noble, Phyllis

    This paper is written for people who are already familiar with the philosophy and methodology of Paulo Freire's liberatory education and are interested in creating a formation program for adult education facilitators using his ideas. The author describes the paper as "a collection of thoughts, of things to consider," when organizing such a…

  3. Formation of planetesimals

    NASA Technical Reports Server (NTRS)

    Weidenschilling, Stuart J.

    1991-01-01

    Formation of planetesimals is discussed. The following subject areas are covered: (1) nebular structure; (2) aerodynamics of the solid bodies in the nebula; (3) problems with gravitational instability; (4) particle growth by coagulation; properties of fractal aggregates; and (5) coagulation and settling of fractal aggregates.

  4. Technobabble: File Formats.

    ERIC Educational Resources Information Center

    Wilson, Bradley

    1999-01-01

    Considers the confusion of over 20 different kinds of graphics programs. Briefly distinguishes between some of the more popular graphics formats (Photoshop, TIFF, JPEG, GIF, PICT, and EPS), and describes the benefits and disadvantages of each in the context of journalism education. (SC)

  5. FORMATION OF PHOTOCHEMICAL AEROSOLS

    EPA Science Inventory

    The objective was to develop a better understanding of smog aerosol formation with particular reference to haze in the Southern California area. This study combined laboratory work with ambient air studies. Counting of particles by light scattering was the principle physical tech...

  6. Common file formats.

    PubMed

    Leonard, Shonda A; Littlejohn, Timothy G; Baxevanis, Andreas D

    2007-01-01

    This appendix discusses a few of the file formats frequently encountered in bioinformatics. Specifically, it reviews the rules for generating FASTA files and provides guidance for interpreting NCBI descriptor lines, commonly found in FASTA files. In addition, it reviews the construction of GenBank, Phylip, MSF and Nexus files. PMID:18428774

  7. Bacterial formate hydrogenlyase complex

    PubMed Central

    McDowall, Jennifer S.; Murphy, Bonnie J.; Haumann, Michael; Palmer, Tracy; Armstrong, Fraser A.; Sargent, Frank

    2014-01-01

    Under anaerobic conditions, Escherichia coli can carry out a mixed-acid fermentation that ultimately produces molecular hydrogen. The enzyme directly responsible for hydrogen production is the membrane-bound formate hydrogenlyase (FHL) complex, which links formate oxidation to proton reduction and has evolutionary links to Complex I, the NADH:quinone oxidoreductase. Although the genetics, maturation, and some biochemistry of FHL are understood, the protein complex has never been isolated in an intact form to allow biochemical analysis. In this work, genetic tools are reported that allow the facile isolation of FHL in a single chromatographic step. The core complex is shown to comprise HycE (a [NiFe] hydrogenase component termed Hyd-3), FdhF (the molybdenum-dependent formate dehydrogenase-H), and three iron-sulfur proteins: HycB, HycF, and HycG. A proportion of this core complex remains associated with HycC and HycD, which are polytopic integral membrane proteins believed to anchor the core complex to the cytoplasmic side of the membrane. As isolated, the FHL complex retains formate hydrogenlyase activity in vitro. Protein film electrochemistry experiments on Hyd-3 demonstrate that it has a unique ability among [NiFe] hydrogenases to catalyze production of H2 even at high partial pressures of H2. Understanding and harnessing the activity of the FHL complex is critical to advancing future biohydrogen research efforts. PMID:25157147

  8. Kepler Planet Formation

    NASA Technical Reports Server (NTRS)

    Lissauer, Jack J.

    2015-01-01

    Kepler has vastly increased our knowledge of planets and planetary systems located close to stars. The new data shows surprising results for planetary abundances, planetary spacings and the distribution of planets on a mass-radius diagram. The implications of these results for theories of planet formation will be discussed.

  9. 500+ Writing Formats.

    ERIC Educational Resources Information Center

    McIntosh, Margaret E.

    1997-01-01

    Suggests a multitude of ideas for students to communicate their ideas in writing using the language of mathematics. Includes a sampling of 500+ writing formats, 67 abbreviated writing assignments, and three complete assignments along with a sample student response to each. Sample assignments include advice column, biographical sketch, commercial,…

  10. Formation in the Classroom

    ERIC Educational Resources Information Center

    Glennon, Fred; Jacobsen, Douglas; Jacobsen, Rhonda Hustedt; Thatamanil, John J.; Porterfield, Amanda; Moore, Mary Elizabeth

    2011-01-01

    What is the relationship between the academic knowledge of the guild and the formation of students in the classroom? This Forum gathers four essays originally presented at a Special Topics Session at the 2009 conference of the American Academy of Religion (Atlanta, Georgia), with a brief introductory essay by Fred Glennon explaining the genesis of…

  11. Amino acid sequence prerequisites for the formation of cn ions.

    PubMed

    Downard, K M; Biemann, K

    1993-11-01

    Ammo acid sequence prerequisites are described for the formation of c, ions observed in high-energy collision-induced decomposition spectra of peptides. It is shown that the formation of cn ions is promoted by the nature of the amino acid C-terminal to the cleavage site. A propensity for cn cleavage preceding threonine, and to a lesser extent tryptophan, lysine, and serine, is demonstrated where fragmentation is directed N-terminally at these residues. In addition, the nature of the residue N-terminal to the cleavage site is shown to have little effect on cn ion formation. A mechanism for cn ion formation is proposed and its applicability to the results observed is discussed. PMID:24227531

  12. PPPL Site Environmental Report

    SciTech Connect

    Virginia Finley; Sheneman, Robert S.; Levine, Jerry D.

    2012-12-01

    Contained in the following report are data for radioactivity in the environment collected and analyzed by Princeton Plasma Physics Laboratory’s Princeton Environmental, Analytical, and Radiological Laboratory (PEARL). The PEARL is located on-site and is certified for analyzing radiological and non-radiological parameters through the New Jersey Department of Environmental Protection’s Laboratory Certification Program, Certification Number 12471. Non-radiological surface and ground water samples are analyzed by NJDEP certified subcontractor laboratories – QC, Inc. and Accutest Laboratory. To the best of our knowledge, these data, as contained in the “Annual Site Environmental Report for 2011,” are documented and certified to be correct.

  13. Phoenix Site Panorama

    NASA Technical Reports Server (NTRS)

    2008-01-01

    [figure removed for brevity, see original site] Click on image for animation

    This movie is compiled of images from Phoenix's Stereo Surface Imager (SSI) camera that were taken on sols 1 and 3. The top images, highlighted in yellow at the beginning of the movie, have been stretched eight times to show details of features in the background. Phoenix's parachute, backshell, heatshield, and impact site can also be seen.

    The Phoenix Mission is led by the University of Arizona, Tucson, on behalf of NASA. Project management of the mission is by NASA's Jet Propulsion Laboratory, Pasadena, Calif. Spacecraft development is by Lockheed Martin Space Systems, Denver.

  14. Waste Site Mapping

    NASA Technical Reports Server (NTRS)

    1994-01-01

    Old aircraft considered not restorable are melted down in on-site furnaces to reclaim the aluminum in their airframes. The process produces aluminum ingots and leaves a residue known as "dross." Because dross contains contaminants like lead silver cadmium and copper, Pima County, the dross dumping site, wanted to locate areas where dross had been dumped. Dr. Larry Lepley and Sandra L. Perry used the Landsat Thematic Mapper to screen for dross. A special two-step procedure was developed to separate the dross dumps (typically no larger than 50 meters across) from the desert background. The project has opened the door for similar applications.

  15. Developing a perioperative educational video web site.

    PubMed

    O'Dowd Bell, Lynn

    2012-04-01

    Nurses frequently have to adjust to changes in technology, particularly in the OR, but cataloging the wealth of resources commonly used in the OR (eg, equipment, supplies, how to use them) has not kept pace. To address this, I worked with the information systems administrative coordinator at the University of Texas Medical Branch, Galveston, to design and implement a perioperative intranet site that includes videos and fact sheets about equipment and supplies and that can be accessed by all perioperative staff members. This required promoting the idea and getting stakeholder sign-on, soliciting videotapes and DVDs and screening all submissions for appropriateness, choosing and formatting applicable resources for use on the site, working with members of the information systems department to create a web site after the video library was assembled, and helping staff members use and accept the site as a valuable educational resource. This intranet web site has been available to staff members for two years, and data from a recent survey of staff members and from mandatory intranet inservice compliance programs show evidence of its effectiveness. PMID:22464619

  16. Soils and geomorphology of the East Chestnut Ridge site

    SciTech Connect

    Lietzke, D.A.; Ketelle, R.H.; Lee, R.R. , Rutledge, TN; Oak Ridge National Lab., TN )

    1989-10-01

    Soil mapping of the East Chestnut Ridge site in conjunction with subsurface soil and rock coring provides an in-depth evaluation of the site and its suitability for disposal of wastes. Landforms and surface and subsurface hydrology, the natural, undisturbed, soil-saprolite-geohydrology system beneath the zone of engineering modifications provides for the ultimate containment of wastes and a means for the filtration and purification of any leachate before it reaches the aquifer. The surface location and extent of each geologic formation on the site were mapped. These locations correlated well with projections of subsurface contacts to the surface even through the criteria used by the pedologist and geologist to identify soil and rock from the same formation may be different. Soil thickness over bedrock of the Copper Ridge, Chepultepec, Longview, and Kingsport Formations is sufficient to provide considerable buffering between trench bottoms and groundwater or rock. Soil thickness over the Mascot Formation is comparatively thin, and pinnacles and ledges exposed on steeper sideslopes are common. Soil underlain by the Mascot Formation is not suited for a trench landfill. According to soil coring and active borrow pit observations, chert beds in the soil and saprolite are preferred zones of water flow. Construction of adequate clay liners beneath disposal units sited on the Longview dolomite may require placement and compaction of other native soils to achieve sufficiently low soil permeabilities. Karst geomorphic processes that initiated the formation of dolines evidently started several million years ago. Doline formation and enlargement is episodic, with short periods of activity followed by long periods of stability. Analysis of doline soil stratigraphy suggests that most of the large dolines on the site have been stable for most of the past 10,000 to 1000,000 years. 8 refs., 9 figs.

  17. Insights on galaxy formation

    NASA Astrophysics Data System (ADS)

    Bullock, James Steven

    1999-12-01

    Recent advances in theoretical modeling coupled with a wealth of new observational data, provide a unique opportunity for gaining insight into process of galaxy formation. I present results which test and develop current theories. The analysis utilizes state of the art theoretical modeling and makes predictions aimed at comparisons with some of the latest and upcoming observational data sets. In part I, I discuss an analysis of the structure and properties of dark matter halos (believed to govern the dynamical evolution of galaxies). The results make use of very high-resolution N-body simulations, and are derived from a new hierarchical halo finder, designed especially for these projects and to complement advancements in simulation technology. I present information on the dark matter halo substructure, density profiles, angular momentum structure, and collision rates. In part II, I discuss some aspects of galaxy formation theory in light of new observational data. The discussion includes an investigation of the nature of high-redshift galaxies, the local velocity function of galaxies, and the use of gamma ray telescopes to probe the extra-galactic background light-the latter analysis is done in the context of semi-analytic modeling of galaxy formation. The most important conclusions of this thesis are as follows. (1)Dark matter halos at high redshift are much less concentrated than previously believed. implying that quiescently star-forming galaxies at high redshift are larger and dimmer than expected. (2)The observed bright. abundant. and highly clustered high- redshift (Lyman-break) galaxies are likely starbursts driven by collisions between relatively small galaxies at z ~ 3. And (3)there is a real possibility of using the growing advances in γ-ray astronomy to probe many poorly constrained processes of galaxy formation, including the stellar initial mass function and the star formation history of the universe.

  18. Pattern formation today

    PubMed Central

    Chuong, Cheng-Ming; Richardson, Michael K.

    2010-01-01

    Patterns are orders embedded in randomness. They may appear as spatial arrangements or temporal series, and the elements may appear identical or with variations. Patterns exist in the physical world as well as in living systems. In the biological world, patterns can range from simple to complex, forming the basic building blocks of life. The process which generates this ordering in the biological world was termed pattern formation. Since Wolpert promoted this concept four decades ago, scientists from molecular biology, developmental biology, stem cell biology, tissue engineering, theoretical modeling and other disciplines have made remarkable progress towards understanding its mechanisms. It is time to review and re-integrate our understanding. Here, we explore the origin of pattern formation, how the genetic code is translated into biological form, and how complex phenotypes are selected over evolutionary time. We present four topics: Principles, Evolution, Development, and Stem Cells and Regeneration. We have interviewed several leaders in the field to gain insight into how their research and the field of pattern formation have shaped each other. We have learned that both molecular process and physico-chemical principles are important for biological pattern formation. New understanding will emerge through integration of the analytical approach of molecular-genetic manipulation and the systemic approach of model simulation. We regret that we could not include every major investigator in the field, but hope that this Special Issue of the Int. J. Dev. Biol. represents a sample of our knowledge of pattern formation today, which will help to stimulate more research on this fundamental process. PMID:19557673

  19. Time Dependent Models of Grain Formation Around Carbon Stars

    NASA Technical Reports Server (NTRS)

    Egan, M. P.; Shipman, R. F.

    1996-01-01

    Carbon-rich Asymptotic Giant Branch stars are sites of dust formation and undergo mass loss at rates ranging from 10(exp -7) to 10(exp -4) solar mass/yr. The state-of-the-art in modeling these processes is time-dependent models which simultaneously solve the grain formation and gas dynamics problem. We present results from such a model, which also includes an exact solution of the radiative transfer within the system.

  20. Small Wind Site Assessment Guidelines

    SciTech Connect

    Olsen, Tim; Preus, Robert

    2015-09-01

    Site assessment for small wind energy systems is one of the key factors in the successful installation, operation, and performance of a small wind turbine. A proper site assessment is a difficult process that includes wind resource assessment and the evaluation of site characteristics. These guidelines address many of the relevant parts of a site assessment with an emphasis on wind resource assessment, using methods other than on-site data collection and creating a small wind site assessment report.

  1. Hypoxic adipocytes pattern early heterotopic bone formation.

    PubMed

    Olmsted-Davis, Elizabeth; Gannon, Francis H; Ozen, Mustafa; Ittmann, Michael M; Gugala, Zbigniew; Hipp, John A; Moran, Kevin M; Fouletier-Dilling, Christine M; Schumara-Martin, Shannon; Lindsey, Ronald W; Heggeness, Michael H; Brenner, Malcolm K; Davis, Alan R

    2007-02-01

    The factors contributing to heterotopic ossification, the formation of bone in abnormal soft-tissue locations, are beginning to emerge, but little is known about microenvironmental conditions promoting this often devastating disease. Using a murine model in which endochondral bone formation is triggered in muscle by bone morphogenetic protein 2 (BMP2), we studied changes near the site of injection of BMP2-expressing cells. As early as 24 hours later, brown adipocytes began accumulating in the lesional area. These cells stained positively for pimonidazole and therefore generated hypoxic stress within the target tissue, a prerequisite for the differentiation of stem cells to chondrocytes and subsequent heterotopic bone formation. We propose that aberrant expression of BMPs in soft tissue stimulates production of brown adipocytes, which drive the early steps of heterotopic endochondral ossification by lowering oxygen tension in adjacent tissue, creating the correct environment for chondrogenesis. Results in misty gray lean mutant mice not producing brown fat suggest that white adipocytes convert into fat-oxidizing cells when brown adipocytes are unavailable, providing a compensatory mechanism for generation of a hypoxic microenvironment. Manipulation of the transcriptional control of adipocyte fate in local soft-tissue environments may offer a means to prevent or treat development of bone in extraskeletal sites. PMID:17255330

  2. DNA Instability at Chromosomal Fragile Sites in Cancer

    PubMed Central

    Dillon, Laura W; Burrow, Allison A; Wang, Yuh-Hwa

    2010-01-01

    Human chromosomal fragile sites are specific genomic regions which exhibit gaps or breaks on metaphase chromosomes following conditions of partial replication stress. Fragile sites often coincide with genes that are frequently rearranged or deleted in human cancers, with over half of cancer-specific translocations containing breakpoints within fragile sites. But until recently, little direct evidence existed linking fragile site breakage to the formation of cancer-causing chromosomal aberrations. Studies have revealed that DNA breakage at fragile sites can induce formation of RET/PTC rearrangements, and deletions within the FHIT gene, resembling those observed in human tumors. These findings demonstrate the important role of fragile sites in cancer development, suggesting that a better understanding of the molecular basis of fragile site instability is crucial to insights in carcinogenesis. It is hypothesized that under conditions of replication stress, stable secondary structures form at fragile sites and stall replication fork progress, ultimately resulting in DNA breaks. A recent study examining an FRA16B fragment confirmed the formation of secondary structure and DNA polymerase stalling within this sequence in vitro, as well as reduced replication efficiency and increased instability in human cells. Polymerase stalling during synthesis of FRA16D has also been demonstrated. The ATR DNA damage checkpoint pathway plays a critical role in maintaining stability at fragile sites. Recent findings have confirmed binding of the ATR protein to three regions of FRA3B under conditions of mild replication stress. This review will discuss recent advances made in understanding the role and mechanism of fragile sites in cancer development. PMID:21286310

  3. International Symposium on Site Characterization for CO2Geological Storage

    SciTech Connect

    Tsang, Chin-Fu

    2006-02-23

    Several technological options have been proposed to stabilize atmospheric concentrations of CO{sub 2}. One proposed remedy is to separate and capture CO{sub 2} from fossil-fuel power plants and other stationary industrial sources and to inject the CO{sub 2} into deep subsurface formations for long-term storage and sequestration. Characterization of geologic formations for sequestration of large quantities of CO{sub 2} needs to be carefully considered to ensure that sites are suitable for long-term storage and that there will be no adverse impacts to human health or the environment. The Intergovernmental Panel on Climate Change (IPCC) Special Report on Carbon Dioxide Capture and Storage (Final Draft, October 2005) states that ''Site characterization, selection and performance prediction are crucial for successful geological storage. Before selecting a site, the geological setting must be characterized to determine if the overlying cap rock will provide an effective seal, if there is a sufficiently voluminous and permeable storage formation, and whether any abandoned or active wells will compromise the integrity of the seal. Moreover, the availability of good site characterization data is critical for the reliability of models''. This International Symposium on Site Characterization for CO{sub 2} Geological Storage (CO2SC) addresses the particular issue of site characterization and site selection related to the geologic storage of carbon dioxide. Presentations and discussions cover the various aspects associated with characterization and selection of potential CO{sub 2} storage sites, with emphasis on advances in process understanding, development of measurement methods, identification of key site features and parameters, site characterization strategies, and case studies.

  4. Star Formation through the Chemical Lens

    NASA Astrophysics Data System (ADS)

    Tassis, K.

    2013-09-01

    Star formation is the process that connects the physical and the observable universe, that lights up the stars and creates planets. Yet to this day our understanding of it remains highly uncertain: the mechanism that is responsible for the fragmentation of star-forming clouds and that regulates the contraction of interstellar gas to form pre-stellar objects and protostars remains the subject of intense debate. At the heart of the problem lies the difficulty in observing star-forming sites and obtaining directly the initial conditions of star formation: molecular hydrogen, the raw material of star formation and the dominant constituent of interstellar clouds that act as stellar nurseries, does not have any transitions that are excitable and thus observable at the chillingly low temperatures of molecular clouds. For this reason, observations of star-forming sites rely heavily on the use of molecular tracers? chemical compounds present in molecular clouds. However, the abundance of these tracers is not constant: it is a result of a complex network of chemical reactions, and it depends on the age, density, and dynamical history of the star-forming site. In this talk, I will discuss how the coupling between chemistry and dynamics can help us probe the initial conditions of star formation and the origin of protostars. To this end, we have studied a variety of dynamical models describing the evolution of prestellar molecular cloud cores that cover the entire spectrum of proposed mechanisms, including pure hydrodynamical collapse and magnetically mediated collapse at various levels of importance of the magnetic field in the cloud dynamics. These models have been coupled to a network of chemical reactions that follow the relative abundances for ~100 molecular species, by solving the nonequilibrium chemical reactions for the first time simultaneously with the dynamical equations. I will present highlights from the results of this work, including newly proposed observables

  5. Formation of polarity convergences underlying shoot outgrowths

    PubMed Central

    Abley, Katie; Sauret-Güeto, Susanna; Marée, Athanasius FM; Coen, Enrico

    2016-01-01

    The development of outgrowths from plant shoots depends on formation of epidermal sites of cell polarity convergence with high intracellular auxin at their centre. A parsimonious model for generation of convergence sites is that cell polarity for the auxin transporter PIN1 orients up auxin gradients, as this spontaneously generates convergent alignments. Here we test predictions of this and other models for the patterns of auxin biosynthesis and import. Live imaging of outgrowths from kanadi1 kanadi2 Arabidopsis mutant leaves shows that they arise by formation of PIN1 convergence sites within a proximodistal polarity field. PIN1 polarities are oriented away from regions of high auxin biosynthesis enzyme expression, and towards regions of high auxin importer expression. Both expression patterns are required for normal outgrowth emergence, and may form part of a common module underlying shoot outgrowths. These findings are more consistent with models that spontaneously generate tandem rather than convergent alignments. DOI: http://dx.doi.org/10.7554/eLife.18165.001 PMID:27478985

  6. Science. [SITE 2001 Section].

    ERIC Educational Resources Information Center

    Roach, Linda E., Ed.

    This document contains the following papers on science from the SITE (Society for Information Technology & Teacher Education) 2001 conference: (1) "Using a Computer Simulation before Dissection To Help Students Learn Anatomy" (Joseph Paul Akpan and Thomas Andre); (2) "EARTH2CLASS: A Unique Workshop/On-Line/Distance-Learning Teacher Training…

  7. Site characterization rover missions

    NASA Technical Reports Server (NTRS)

    Pivirotto, Donna Shirley

    1990-01-01

    Concepts for site characterization rovers capable of efficient operation on Mars with human supervision from earth are discussed. In particular, attention is given to strategies for developing and evaluating the necessary technology for implementing the roving vehicles and process technologies required for a systematic and integrated implementation of technologically advanced rovers. A vehicle testbed program is also described.

  8. Research. [SITE 2002 Section].

    ERIC Educational Resources Information Center

    Curtis, Reagan, Ed.

    This document contains papers on instructional technology research from the SITE (Society for Information Technology & Teacher Education) 2002 conference. Topics covered include: professors share their thoughts and feelings with their students; faculty reflections on teaching online; integrating technology into preservice teacher education;…

  9. Mathematics. [SITE 2001 Section].

    ERIC Educational Resources Information Center

    Connell, Michael L., Ed.; Lowery, Norene Vail, Ed.; Harnisch, Delwyn L., Ed.

    This document contains the following papers on mathematics from the SITE (Society for Information Technology & Teacher Education) 2001 conference: "Secondary Mathematics Methods Course with Technology Units: Encouraging Pre-Service Teachers To Use Technology" (Rajee Amarasinghe); "Competency Exams in College Mathematics" (Kathy R. Autrey and Leigh…

  10. International. [SITE 2002 Section].

    ERIC Educational Resources Information Center

    Willis, Dee Anna, Ed.

    This document contains the following papers on international issues from the SITE (Society for Information Technology & Teacher Education) 2002 conference: (1) "The Management of Technological Change within Faculties in International American Schools" (Martine Audeoud); (2) "Going Global: Using a Website Development Project To Teach Technology…

  11. Mathematics. [SITE 2002 Section].

    ERIC Educational Resources Information Center

    Connell, Michael L., Ed.; Lowery, Norene Vail, Ed.; Harnisch, Delwyn L., Ed.

    This document contains the following papers on mathematics from the SITE (Society for Information Technology & Teacher Education) 2002 conference: (1) "Teachers' Learning of Mathematics in the Presence of Technology: Participatory Cognitive Apprenticeship" (Mara Alagic); (2) "A Fractal Is a Pattern in Your Neighborhood" (Craig N. Bach); (3)…

  12. Academic Enhancement Site

    ERIC Educational Resources Information Center

    DeJong, Judith A.; Holder, Stanley R.

    2006-01-01

    This off-reservation boarding school serves over 600 students in grades 4-12; approximately 85% of the students reside in campus dormitories. After having documented significant improvement on a number of outcomes during a previous High Risk Youth Prevention demonstration grant, the site submitted a Therapeutic Residential Model proposal,…

  13. International. [SITE 2001 Section].

    ERIC Educational Resources Information Center

    Willis, Dee Anna, Ed.

    This document contains the following papers on international issues from the SITE (Society for Information Technology & Teacher Education) 2001 conference: (1) "Attitudes of Malaysian Vocational Trainee Teachers towards the Integration of Computer in Teaching" (Ab. Rahim Bakar and Shamsiah Mohamed); (2) "Views from an Asian Bridge: How…

  14. Site authorization service (SAZ)

    SciTech Connect

    Dane Skow; Igor Mandrichenko; Vijay Sehkri

    2003-10-01

    In this paper the authors present a methodology to provide an additional level of centralized control for the grid resources. This centralized control is applied to site-wide distribution of various grids and thus provides an upper hand in the maintenance.

  15. Ignitor Siting Evaluations

    NASA Astrophysics Data System (ADS)

    Zucchetti, Massimo; Zunino, Cristina

    2002-11-01

    Ignitor is a compact high-magnetic field experiment aimed at studying plasma burning conditions in Deuterium-Tritium plasmas up to ignition. The ENEL-TERNA center in Rondissone (Italy) has been selected for its localisation. The main positive features of this site are the presence of electrical facilities because of the distribution node of Rondissone, the availability of the main office building and of the space for the construction of the Ignitor machine. Available data concerning the nearby nuclear site of Saluggia, only five kilometers away, are in fact used. The non-site dependent accidental analysis of Ignitor has been recently reviewed. New design of the Tritium Handling System has reduced tritium inventory in Ignitor to about 3 g. Then, many of the environmental source terms considered in previous accidental analyses are reduced. Design Basis Accidents (DBA) bring to maximum doses for the public below 1 mSv, and collective doses cause negligible health effects. All the assessments show that Ignitor can be effectively located in the ENEL-TERNA site, satisfying environmental and safety requirements.

  16. Research. [SITE 2001 Section].

    ERIC Educational Resources Information Center

    McAlister, Kim, Ed.; Curtis, Reagan, Ed.

    This document contains the papers on research from the SITE (Society for Information Technology & Teacher Education) 2001 conference. Topics covered include: concerns of administrators and teachers in the diffusion of information technology; preservice elementary mathematics teachers' computer self efficacy, attitudes, and perceptions; information…

  17. Savannah River Site Robotics

    ScienceCinema

    None

    2012-06-14

    Meet Sandmantis and Frankie, two advanced robotic devices that are key to cleanup at Savannah River Site. Sandmantis cleans hard, residual waste off huge underground storage tanks. Frankie is equipped with unique satellite capabilities and sensing abilties that can determine what chemicals still reside in the tanks in a cost effective manner.

  18. Proposed Drill Sites

    DOE Data Explorer

    Lane, Michael

    2013-06-28

    Proposed drill sites for intermediate depth temperature gradient holes and/or deep resource confirmation wells. Temperature gradient contours based on shallow TG program and faults interpreted from seismic reflection survey are shown, as are two faults interpreted by seismic contractor Optim but not by Oski Energy, LLC.

  19. RADIATION SITES TECHNICAL WORKGROUP

    EPA Science Inventory

    Much of the radiation expertise in EPA is located in the Region Offices. The EPA Radiation Sites Technical Workgroup is an interoffice technical workgroup within EPA which provides a focal point for radiation expertise. The Workgroup has members from each region, as well as the...

  20. Library Web Site Innovations.

    ERIC Educational Resources Information Center

    Falk, Howard

    1999-01-01

    Reports on some of the new ways public library sites are presenting themselves to their patrons and to the broader World Wide Web audience. Discusses library virtual tours; calendar display; audio-visual materials; resource listings; book clubs; money-raising activities; fugitive fact files; hot item advisors; periodicals; FAQs (frequently asked…

  1. Elementary Classroom Web Sites

    ERIC Educational Resources Information Center

    Baker, Elizabeth A.

    2007-01-01

    The purpose of this study was to understand how elementary classroom Web sites support children's literacy. From a sociocultural perspective of literacy and a transformative stance toward the integration of literacy and technology, and building on explorations of new literacies, I discuss opportunities provided by the Internet that can support…

  2. Science. [SITE 2002 Section].

    ERIC Educational Resources Information Center

    Roach, Linda Easley, Ed.

    This document contains the following papers on science from the SITE (Society for Information Technology & Teacher Education) 2002 conference: (1) "Color & Light: Design and Evaluation of a Multimedia-Case for Elementary Teacher-Education" (Peter Blijleven and Ellen van den Berg); (2) "Standards-Based Design of Technology-Integrated Science…

  3. Simulation. [SITE 2001 Section].

    ERIC Educational Resources Information Center

    Seymour, Cathy R., Ed.

    This document contains three papers on simulation from the SITE (Society for Information Technology & Teacher Education) 2001 conference. "Simulations in the Learning Cycle: A Case Study Involving 'Exploring the Nardoo'" (William M. Dwyer and Valesca E. Lopez) presents a study of middle school students using a CD-based simulation program,…

  4. Pecan site evaluations

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Guidance is provided to help pecan growers obtain copies of their County Soil Survey Reports and interpret information concerning climatic, topographic and edaphic variables of pecan orchard sites. As media for plant growth, soils must provide anchorage, water, air, and nutrients. Their ability to...

  5. Theory. [SITE 2002 Section].

    ERIC Educational Resources Information Center

    Christensen, Paula, Ed.

    This document contains the following papers on theory from the SITE (Society for Information Technology & Teacher Education) 2002 conference: (1) "The Emerging Ecological Contribution of Online Resources and Tools to K-12 Classrooms" (Therese Laferriere, Robert Bracewell, Alain Breuleux); (2) "Pedagogical Ethnotechnography: A Bifocal Lens To…

  6. Theory. [SITE 2001 Section].

    ERIC Educational Resources Information Center

    Christensen, Paula, Ed.

    This document contains the following papers on theory from the SITE (Society for Information Technology & Teacher Education) 2001 Conference: (1) "IT with Integrity" (Savilla Banister); (2) "Applications of Knowledge Based Evaluation in Educational Technology" (Michael Connell); (3) "A Tutor's Advice Trains a Student's Self-Regulation Skill"…

  7. 2014 Site Environmental Report

    SciTech Connect

    Paquette, Douglas; Remien, Jason; Foley, Brian; Burke, John; Dorsch, William; Ratel, Karen; Howe, Robert; Welty, Tim; Williams, Jeffrey; Pohlpt, Peter; Lagattolla, Richard; Metz, Robert; Milligan, James; Lettieri, Lawrence

    2015-10-01

    BNL prepares an annual Site Environmental Report (SER) in accordance with DOE Order 231.1B, Environment, Safety and Health Reporting. The report is written to inform the public, regulators, employees, and other stakeholders of the Laboratory’s environmental performance during the calendar year in review.

  8. Savannah River Site Robotics

    SciTech Connect

    2010-01-01

    Meet Sandmantis and Frankie, two advanced robotic devices that are key to cleanup at Savannah River Site. Sandmantis cleans hard, residual waste off huge underground storage tanks. Frankie is equipped with unique satellite capabilities and sensing abilties that can determine what chemicals still reside in the tanks in a cost effective manner.

  9. Development of CEOP Reference Site Data Sets

    NASA Astrophysics Data System (ADS)

    Loehrer, S. M.; Cully, L. E.; Williams, S. F.

    2004-05-01

    This presentation will discuss the development of a series of specialized observational data sets for the World Climate Research Programme (WCRP) Coordinated Enhanced Observing Period. CEOP is composed of a number of global WCRP research programmes [i.e. Global Energy and Water Cycle Experiment (GEWEX), Climate Variability and Predictability (CLIVAR), and Climate and Cryosphere (CliC)]. Each one of the GEWEX Continental Scale Experiments selected a number of well instrumented reference sites in various climatic regions of the world (36 in total) to support CEOP research activities. These reference sites provide observations of surface meteorology, radiation, fluxes, soils, and atmospheric profiles in a variety of spatial and temporal resolutions in different formats. The University Corporation for Atmospheric Research/Joint Office for Science Support (UCAR/JOSS) takes these disparate data and conducts a consistent processing and quality assurance methodology leading to the development of a data set in a consistent format and temporal resolution. This presentation will discuss the current status of the CEOP EOP-3 (1 October 2002 to 30 September 2003) data processing, quality assurance, and data archival and distribution as well as plans for the remaining CEOP reference site data sets.

  10. Medusae Fossae Formation

    NASA Technical Reports Server (NTRS)

    2002-01-01

    (Released 10 April 2002) The Science This THEMIS visible image was acquired near 7o S, 172o W (188o E) and shows a remarkable martian geologic deposit known as the Medusae Fossae Formation. This Formation, seen here as the raised plateau in the upper two-thirds of the image, is a soft, easily eroded deposit that extends for nearly 1,000 km along the equator of Mars. In this region the deposit has been heavily eroded by the wind to produce a series of linear ridges called yardangs. These parallel ridges point in direction of the prevailing winds that carved them, and demonstrate the power of martian winds to sculpt the dry landscape of Mars. The Medusae Fossae Formation has been completely stripped from the surface in the lower third of the image, revealing a harder layer below that is more resistant to wind erosion. The easily eroded nature of the Medusae Fossae Formation suggests that it is composed of weakly cemented particles, and was most likely formed by the deposition of wind-blown dust or volcanic ash. Several ancient craters that were once completely buried by this deposit are being exposed, or exhumed, as the overlying Medusae Formation is removed. Very few impact craters are visible on this Formation, indicating that the surface seen today is relatively young, and that the processes of erosion are likely to be actively occurring. The Story Medusa of Greek mythology fame, the name-giver to this region, had snaky locks of hair that could turn a person to stone. Wild and unruly, this monster of the underworld could certainly wreak havoc on the world of the human imagination. As scary as she was, Medusa would have no advantage over the fierce, masterful winds blowing across Mars, which once carved the streaky, terrain at the top of this image. Wild and whipping, these winds have slowly eroded away the 'topsoil,' revealing ancient craters and other surface features they once covered. The loosely cemented particles of this 'topsoil' are likely made up of dust

  11. Site-specific magnetization reversal studies of magnetite

    SciTech Connect

    Cady, A.; Haskel, D.; Lang, J. C.; Islam, Z.; Srajer, G.; Ankudinov, A.; Subias, G.; Garcia, J.

    2006-04-01

    The mechanism of magnetization reversal in magnetite (Fe{sub 3}O{sub 4}) single crystals was studied using site-specific magnetic sensitive diffraction anomalous near-edge structure. By exploiting the angular dependence of the cross section, we are able to show that the mechanism of reversal involves a mixture of coherent rotation and domain formation. The results reveal additional details to that provided by XMCD measurements, which average over nonequivalent sites.

  12. The Oak Ridge Reservation Annual Site Environmental Report Summary, 2007

    SciTech Connect

    None, None

    2009-02-28

    The Oak Ridge Reservation Annual Site Environmental Report is prepared and published each year to inform the public of the environmental activities that take place on the reservation and in the surrounding areas. It is written to comply with DOE Order 231.1A, Environment, Safety, and Health Reporting. This document has been prepared to present the highlights of the Oak Ridge Reservation Annual Site Environmental Report 2007 in an easy-to-read, summary format.

  13. Reservoir High's TE Site Wins Web Site of the Month

    ERIC Educational Resources Information Center

    Tech Directions, 2008

    2008-01-01

    This article features "Mr. Rhine's Technology Education Web Site," a winner of the Web Site of the Month. This Web site was designed by Luke Rhine, a teacher at the Reservoir High School in Fulton, Maryland. Rhine's Web site offers course descriptions and syllabuses, class calendars, lectures and presentations, design briefs and other course…

  14. Format( )MEDIC( )Input

    NASA Astrophysics Data System (ADS)

    Foster, K.

    1994-09-01

    This document is a description of a computer program called Format( )MEDIC( )Input. The purpose of this program is to allow the user to quickly reformat wind velocity data in the Model Evaluation Database (MEDb) into a reasonable 'first cut' set of MEDIC input files (MEDIC.nml, StnLoc.Met, and Observ.Met). The user is cautioned that these resulting input files must be reviewed for correctness and completeness. This program will not format MEDb data into a Problem Station Library or Problem Metdata File. A description of how the program reformats the data is provided, along with a description of the required and optional user input and a description of the resulting output files. A description of the MEDb is not provided here but can be found in the RAS Division Model Evaluation Database Description document.

  15. Pattern formation during vasculogenesis.

    PubMed

    Czirok, Andras; Little, Charles D

    2012-06-01

    Vasculogenesis, the assembly of the first vascular network, is an intriguing developmental process that yields the first functional organ system of the embryo. In addition to being a fundamental part of embryonic development, vasculogenic processes also have medical importance. To explain the organizational principles behind vascular patterning, we must understand how morphogenesis of tissue level structures can be controlled through cell behavior patterns that, in turn, are determined by biochemical signal transduction processes. Mathematical analyses and computer simulations can help conceptualize how to bridge organizational levels and thus help in evaluating hypotheses regarding the formation of vascular networks. Here, we discuss the ideas that have been proposed to explain the formation of the first vascular pattern: cell motility guided by extracellular matrix alignment (contact guidance), chemotaxis guided by paracrine and autocrine morphogens, and sprouting guided by cell-cell contacts. PMID:22692888

  16. Cosmological structure formation

    NASA Technical Reports Server (NTRS)

    Schramm, David N.

    1991-01-01

    A summary of the current forefront problem of physical cosmology, the formation of structures (galaxies, clusters, great walls, etc.) in the universe is presented. Solutions require two key ingredients: (1) matter; and (2) seeds. Regarding the matter, it now seems clear that both baryonic and non-baryonic matter are required. Whether the non-baryonic matter is hot or cold depends on the choice of seeds. Regarding the seeds, both density fluctuations and topological defects are discussed. The combination of isotropy of the microwave background and the recent observations indicating more power on large scales have severly constrained, if not eliminated, Gaussian fluctuations with equal power on all scales, regardless of the eventual resolution of both the matter and seed questions. It is important to note that all current structure formation ideas require new physics beyond SU(3) x SU(2) x U(1).

  17. Emptiness Formation Probability

    NASA Astrophysics Data System (ADS)

    Crawford, Nicholas; Ng, Stephen; Starr, Shannon

    2016-08-01

    We present rigorous upper and lower bounds on the emptiness formation probability for the ground state of a spin-1/2 Heisenberg XXZ quantum spin system. For a d-dimensional system we find a rate of decay of the order {exp(-c L^{d+1})} where L is the sidelength of the box in which we ask for the emptiness formation event to occur. In the {d=1} case this confirms previous predictions made in the integrable systems community, though our bounds do not achieve the precision predicted by Bethe ansatz calculations. On the other hand, our bounds in the case {d ≥ 2} are new. The main tools we use are reflection positivity and a rigorous path integral expansion, which is a variation on those previously introduced by Toth, Aizenman-Nachtergaele and Ueltschi.

  18. Formation of bacterial nanocells

    NASA Astrophysics Data System (ADS)

    Vainshtein, Mikhail; Kudryashova, Ekaterina; Suzina, Natalia; Ariskina, Elena; Voronkov, Vadim

    1998-07-01

    Existence of nanobacteria received increasing attention both in environmental microbiology/geomicro-biology and in medical microbiology. In order to study a production of nanoforms by typical bacterial cells. Effects of different physical factors were investigated. Treatment of bacterial cultures with microwave radiation, or culturing in field of electric current resulted in formation a few types of nanocells. The number and type of nanoforms were determined with type and dose of the treatment. The produced nanoforms were: i) globules, ii) clusters of the globules--probably produced by liaison, iii) nanocells coated with membrane. The viability of the globules is an object opened for doubts. The nanocells discovered multiplication and growth on solidified nutrient media. The authors suggest that formation of nanocells is a common response of bacteria to stress-actions produced by different agents.

  19. Prominence Formation Processes

    NASA Astrophysics Data System (ADS)

    Welsch, B. T.; DeVore, C. R.; Antiochos, S. K.

    2005-01-01

    Martens and Zwaan (ApJ v. 558 872) have proposed a prominence/ filament formation model in which differential rotation drives reconnection between two initially unconnected active regions to form helical field lines that support mass and are held down by overlying field. Using an MHD solver with adaptive refinement we simulated this process by imposing a shear flow meant to mimic differential rotation on two bipolar flux distributions meant to mimic distinct active regions. In some runs the flux systems are initially potential while in others they have been twisted by footpoint rotation to inject helicity prior to imposing the shear flow. The resulting structures are studied to understand the role of helicity in the formation of prominence-like structures.

  20. Format-Preserving Encryption

    NASA Astrophysics Data System (ADS)

    Bellare, Mihir; Ristenpart, Thomas; Rogaway, Phillip; Stegers, Till

    Format-preserving encryption (FPE) encrypts a plaintext of some specified format into a ciphertext of identical format—for example, encrypting a valid credit-card number into a valid credit-card number. The problem has been known for some time, but it has lacked a fully general and rigorous treatment. We provide one, starting off by formally defining FPE and security goals for it. We investigate the natural approach for achieving FPE on complex domains, the “rank-then-encipher” approach, and explore what it can and cannot do. We describe two flavors of unbalanced Feistel networks that can be used for achieving FPE, and we prove new security results for each. We revisit the cycle-walking approach for enciphering on a non-sparse subset of an encipherable domain, showing that the timing information that may be divulged by cycle walking is not a damaging thing to leak.

  1. Formate-assisted pyrolysis

    SciTech Connect

    DeSisto, William Joseph; Wheeler, Marshall Clayton; van Heiningen, Adriaan R. P.

    2015-03-17

    The present invention provides, among other thing, methods for creating significantly deoxygenated bio-oils form biomass including the steps of providing a feedstock, associating the feedstock with an alkali formate to form a treated feedstock, dewatering the treated feedstock, heating the dewatered treated feedstock to form a vapor product, and condensing the vapor product to form a pyrolysis oil, wherein the pyrolysis oil contains less than 30% oxygen by weight.

  2. Hail Formation in Florida

    NASA Astrophysics Data System (ADS)

    Stanley, Matthew

    Hail poses a substantial threat to life and property in the state of Florida. These losses could be minimized through better understanding of the relationships between atmospheric variables that impact hail formation in Florida. Improving hail forecasting in Florida requires analyzing a number of meteorological parameters and synoptic data related to hail formation. NOAA archive data was retrieved to create a database that was used to categorize text files of hail days. The text files were entered into the National Oceanic and Atmospheric Administration Earth System Research Laboratory website to create National Centers for Environmental Prediction/National Center for Atmospheric Research Reanalysis maps of atmospheric variables for Florida hail days as well as days leading to the hail event. These data were then analyzed to determine the relationship between variables that affect hail formation, in general, across different regions and seasons in Florida using Statistical Product and Service Solutions. The reasoning for the differing factors affecting hail formation between regions, seasons and hail sizes were discussed, as well as forecasting suggestions relating to region and month in Florida. The study found that the majority of all hail that occurs in Florida is during the wet season. A low Lifted Index, high Precipitable Water and lower than average Sea Level Pressure, in most cases, is present during hail days in Florida. Furthermore, results show that Vector Wind magnitude increases as hail size increases. Additionally, several atmospheric variables useful to studying hail events, such as Lifted Index, Precipitable Water, Sea Level Pressure, Vector Wind and Temperature have significant correlations with each other depending on the region and season being observed. Strong correlations between low Lifted Index, high Precipitable Water values and the occurrence of hail events are discussed, as well as the relationship between temperature anomalies at various

  3. Galaxy Formation and Evolution

    NASA Astrophysics Data System (ADS)

    Nagamine, Kentaro; Reddy, Naveen; Daddi, Emanuele; Sargent, Mark T.

    2016-07-01

    In this chapter, we discuss the current status of observational and computational studies on galaxy formation and evolution. In particular, a joint analysis of star-formation rates (SFRs), stellar masses, and metallicities of galaxies throughout cosmic time can shed light on the processes by which galaxies build up their stellar mass and enrich the environment with heavy elements. Comparison of such observations and the results of numerical simulations can give us insights on the physical importance of various feedback effects by supernovae and active galactic nuclei. In Sect. 1, we first discuss the primary methods used to deduce the SFRs, stellar masses, and (primarily) gas-phase metallicities in high-redshift galaxies. Then, we show how these quantities are related to each other and evolve with time. In Sect. 2, we further examine the distribution of SFRs in galaxies following the `Main Sequence' paradigm. We show how the so-called `starbursts' display higher specific SFRs and SF efficiencies by an order of magnitude. We use this to devise a simple description of the evolution of the star-forming galaxy population since z ˜3 that can successfully reproduce some of the observed statistics in the infrared (IR) wavelength. We also discuss the properties of molecular gas. In Sect. 3, we highlight some of the recent studies of high-redshift galaxy formation using cosmological hydrodynamic simulations. We discuss the physical properties of simulated galaxies such as luminosity function and escape fraction of ionizing photons, which are important statistics for reionization of the Universe. In particular the escape fraction of ionizing photons has large uncertainties, and studying gamma-ray bursts (which is the main topic of this conference) can also set observational constraints on this uncertain physical parameter as well as cosmic star formation rate density.

  4. Mesospheric cloud formations

    NASA Technical Reports Server (NTRS)

    Forbes, J. M.

    1980-01-01

    Formation of mesospheric clouds as a result of deposition of large amounts of H2O by the heavy lift launch vehicle (HLLV) of the solar power satellite system is discussed. The conditions which must be met in order to form and maintain clouds near the mesopause are described. The frequency and magnitude of H2O injections from the HLLV rocket exhaust are considered.

  5. Formation of Bulges

    NASA Astrophysics Data System (ADS)

    Silk, Joseph; Bouwens, Rychard

    1999-07-01

    Bulges, often identified with the spheroidal component of a galaxy,have a complex pedigree. Massive bulges are generally red and old,but lower mass bulges have broader dispersions in color that may becorrelated with disk colors. This suggests different formationscenarios. I will review possible formation sequences for bulges,describe the various signatures that distinguish these scenarios, anddiscuss implications for the high redshift universe.

  6. Terrestrial planet formation

    PubMed Central

    Righter, K.; O’Brien, D. P.

    2011-01-01

    Advances in our understanding of terrestrial planet formation have come from a multidisciplinary approach. Studies of the ages and compositions of primitive meteorites with compositions similar to the Sun have helped to constrain the nature of the building blocks of planets. This information helps to guide numerical models for the three stages of planet formation from dust to planetesimals (∼106 y), followed by planetesimals to embryos (lunar to Mars-sized objects; few × 106 y), and finally embryos to planets (107–108 y). Defining the role of turbulence in the early nebula is a key to understanding the growth of solids larger than meter size. The initiation of runaway growth of embryos from planetesimals ultimately leads to the growth of large terrestrial planets via large impacts. Dynamical models can produce inner Solar System configurations that closely resemble our Solar System, especially when the orbital effects of large planets (Jupiter and Saturn) and damping mechanisms, such as gas drag, are included. Experimental studies of terrestrial planet interiors provide additional constraints on the conditions of differentiation and, therefore, origin. A more complete understanding of terrestrial planet formation might be possible via a combination of chemical and physical modeling, as well as obtaining samples and new geophysical data from other planets (Venus, Mars, or Mercury) and asteroids. PMID:21709256

  7. Tetrahedron Formation Control

    NASA Technical Reports Server (NTRS)

    Guzman, Jose J.

    2003-01-01

    Spacecraft flying in tetrahedron formations are excellent instrument platforms for electromagnetic and plasma studies. A minimum of four spacecraft - to establish a volume - is required to study some of the key regions of a planetary magnetic field. The usefulness of the measurements recorded is strongly affected by the tetrahedron orbital evolution. This paper considers the preliminary development of a general optimization procedure for tetrahedron formation control. The maneuvers are assumed to be impulsive and a multi-stage optimization method is employed. The stages include targeting to a fixed tetrahedron orientation, rotating and translating the tetrahedron and/or varying the initial and final times. The number of impulsive maneuvers citn also be varied. As the impulse locations and times change, new arcs are computed using a differential corrections scheme that varies the impulse magnitudes and directions. The result is a continuous trajectory with velocity discontinuities. The velocity discontinuities are then used to formulate the cost function. Direct optimization techniques are employed. The procedure is applied to the Magnetospheric Multiscale Mission (MMS) to compute preliminary formation control fuel requirements.

  8. Mars brine formation experiment

    NASA Technical Reports Server (NTRS)

    Moore, Jeffrey M.; Bullock, Mark A.; Stoker, Carol R.

    1992-01-01

    Evaporites, particularly carbonates, nitrates, and sulfates, may be major sinks of volatiles scavenged from the martian atmosphere. Mars is thought to have once had a denser, warmer atmosphere that permitted the presence of liquid surface water. The conversion of atmospheric CO2 into carbonate is hypothesized to have degraded the martian climate to its present state of a generally subfreezing, desiccated desert. The rate for such a conversion under martian conditions is poorly known, so the time scale of climate degradation by this process cannot be easily evaluated. If some models are correct, carbonate formation may have been fast at geological time scales. The experiments of Booth and Kieffer also imply fast (10(exp 6) - 10(exp 7) yr) removal of the missing CO2 inventory, estimated to be 1 - 5 bar, by means of carbonate formation. The timing of formation of many of the fluvial features observed on Mars is, in large part, dependent on when and how fast the atmosphere changed. A knowledge of the rate at which carbonates and nitrates formed is also essential for assessing the probability that life, or its chemical precursors, could have developed on Mars. No previous experiments have quantitatively evaluated the rate of solution for a suite of mobile anions and cations from unaltered minerals and atmospheric gases into liquid water under Mars-like conditions. Such experiments are the focus of this task.

  9. Terrestrial planet formation.

    PubMed

    Righter, K; O'Brien, D P

    2011-11-29

    Advances in our understanding of terrestrial planet formation have come from a multidisciplinary approach. Studies of the ages and compositions of primitive meteorites with compositions similar to the Sun have helped to constrain the nature of the building blocks of planets. This information helps to guide numerical models for the three stages of planet formation from dust to planetesimals (~10(6) y), followed by planetesimals to embryos (lunar to Mars-sized objects; few 10(6) y), and finally embryos to planets (10(7)-10(8) y). Defining the role of turbulence in the early nebula is a key to understanding the growth of solids larger than meter size. The initiation of runaway growth of embryos from planetesimals ultimately leads to the growth of large terrestrial planets via large impacts. Dynamical models can produce inner Solar System configurations that closely resemble our Solar System, especially when the orbital effects of large planets (Jupiter and Saturn) and damping mechanisms, such as gas drag, are included. Experimental studies of terrestrial planet interiors provide additional constraints on the conditions of differentiation and, therefore, origin. A more complete understanding of terrestrial planet formation might be possible via a combination of chemical and physical modeling, as well as obtaining samples and new geophysical data from other planets (Venus, Mars, or Mercury) and asteroids. PMID:21709256

  10. Hydrogen enhancement of silicon thermal donor formation

    NASA Astrophysics Data System (ADS)

    Lamp, C. D.; James, D. J., II

    1993-04-01

    Oxygen-related thermal donor formation in Czochralski silicon is characterized by the capacitance-voltage and deep level transient spectroscopy techniques as a function of 450 °C anneal time following hydrogenation. Increases in the formation rate and number of thermal donor (TD) defects found after hydrogenation are reported. This study finds an increase in TD+/++ concentration in the near-surface region at short anneal times, but at longer times an elevated concentration was not observed. No acceleration through the sequence of thermal donor defects was detected. This fails to support the model of hydrogen lowering the barrier to oxygen diffusion and accelerating the TDn→TDn+1 transitions. This study does, however, support a model in which the hydrogen increases the available thermal donor core sites.

  11. Formation of magnetic discontinuities through viscous relaxation

    SciTech Connect

    Kumar, Sanjay; Bhattacharyya, R.; Smolarkiewicz, P. K.

    2014-05-15

    According to Parker's magnetostatic theorem, tangential discontinuities in magnetic field, or current sheets (CSs), are generally unavoidable in an equilibrium magnetofluid with infinite electrical conductivity and complex magnetic topology. These CSs are due to a failure of a magnetic field in achieving force-balance everywhere and preserving its topology while remaining in a spatially continuous state. A recent work [Kumar, Bhattacharyya, and Smolarkiewicz, Phys. Plasmas 20, 112903 (2013)] demonstrated this CS formation utilizing numerical simulations in terms of the vector magnetic field. The magnetohydrodynamic simulations presented here complement the above work by demonstrating CS formation by employing a novel approach of describing the magnetofluid evolution in terms of magnetic flux surfaces instead of the vector magnetic field. The magnetic flux surfaces being the possible sites on which CSs develop, this approach provides a direct visualization of the CS formation, helpful in understanding the governing dynamics. The simulations confirm development of tangential discontinuities through a favorable contortion of magnetic flux surfaces, as the magnetofluid undergoes a topology-preserving viscous relaxation from an initial non-equilibrium state with twisted magnetic field. A crucial finding of this work is in its demonstration of CS formation at spatial locations away from the magnetic nulls.

  12. Histopathology Predicts the Mechanism of Stone Formation

    NASA Astrophysics Data System (ADS)

    Evan, Andrew P.

    2007-04-01

    About 5% of American women and 12% of men will develop a kidney stone at some time in their life and these numbers appear to be on the rise. Despite years of scientific research into the mechanisms of stone formation and growth, limited advances have been made until recently. Randall's original observations and thoughts on the mechanisms for kidney stone formation have been validated for idiopathic calcium oxalate stone formers (ICSF) but not for most other stone forming groups. Our current studies on selected groups of human stone formers using intraoperative papillary biopsies has shown overwhelming evidence for the presence of Randall's plaque in ICSF and that stone formation and growth are exclusively linked to its availability to urinary ions and proteins. Intense investigation of the plaque-stone junction is needed if we are to understand the factors leading to the overgrowth process on exposed regions of plaque. Such information should allow the development of treatment strategies to block stone formation in ICSF patients. Patients who form brushite stones, or who form apatite stones because of distal renal tubular acidosis (dRTA), or patients with calcium oxalate stones due to obesity bypass procedures, or patients with cystinuria, get plugged inner medullary collecting ducts (IMCD) which leads to total destruction of the lining cells and focal sites of interstitial fibrosis. These stone formers have plaque but at levels equal to or below non-stone formers, which would suggest that they form stones by a different mechanism than do ICSF patients.

  13. Lipid peroxide formation in microsomes. Relationship of hydroxylation to lipid peroxide formation

    PubMed Central

    Wills, E. D.

    1969-01-01

    1. Aminopyrine strongly inhibits NADPH-induced lipid peroxide formation in rat liver microsomes, but ascorbate-induced peroxidation is inhibited to a smaller extent. 2. Aminopyrine oxidation is stimulated by Mg2+ but inhibited by Ca2+. Concentrated solutions (10mm) of iron-chelating agents inhibit aminopyrine oxidation, but the more dilute solutions (0·5mm) of chelators that block lipid peroxide formation do not inhibit aminopyrine oxidation. Microsomes prepared from sucrose–EDTA homogenates rapidly oxidize aminopyrine, but do not form lipid peroxide when incubated with ascorbate or NADPH. 3. Aminopyrine oxidation is strongly inhibited by p-chloromercuribenzoate, less by iodoacetamide and weakly by N-ethylmaleimide. The site of action of these compounds is considered to be a ferredoxin-type protein. GSH and cysteine also inhibit. 4. Other drugs oxidized by microsomes such as caffeine, phenobarbitone and hexobarbitone had either no or little effect on lipid peroxide formation, but codeine inhibited. 5. Most aliphatic hydrocarbons, alcohols, ketones and aldehydes did not affect lipid peroxide formation, but chloroform and carbon tetrachloride inhibited. 6. Many aromatic compounds inhibited lipid peroxide formation. Only aromatic acids were without any effect and phenols and amines were very strong inhibitors. 7. Induction of lipid peroxide formation in microsomes by incubation with ascorbate or NADPH or by treatment with ionizing radiation leads to a sharp decline in the ability of microsomes to oxidize aminopyrine or hydroxylate aniline. 8. It is considered that the two processes of hydroxylation and lipid peroxide formation are closely linked in microsomes. They probably depend on the same electron-transport chain, and peroxide formation, which involves membrane disintegration, may be part of the normal membrane remodelling process. PMID:4390103

  14. The rhesus site.

    PubMed

    Wagner, Franz F; Flegel, Willy A

    2014-10-01

    The Rhesus Site is a resource for information of the 'Rhesus' blood group. It is intended for specialists and non-specialists. The website details research in the field relevant for transfusion medicine, immunohematology, and molecular research. Link areas guide to important publications and to methodological resources for Rhesus. Many data originally presented at The Rhesus Site have been formally published later. The 'RhesusBase' section represents the largest database for RHD alleles; the 'RhesusSurveillance' section details the results of the largest prospective observational study on anti-D immunization events in D-positive patients. Visitors to the website are encouraged to explore the intricacies of the most complex blood group gene locus. PMID:25538538

  15. Site characterization techniques

    USGS Publications Warehouse

    U.S. Geological Survey

    1995-01-01

    Geoelectrical methods have been used since the 1920's to search for metallic ore deposits. During the last decade, traditional mining geophysical techniques have been adapted for environmental site characterization. Geoelectrical geophysics is now a well developed engineering specialty, with different methods to focus both on a range of targets and on depths below the surface. Most methods have also been adapted to borehole measurements.

  16. Gasbuggy Site Assessment and Risk Evaluation

    SciTech Connect

    2011-03-01

    The Gasbuggy site is in northern New Mexico in the San Juan Basin, Rio Arriba County (Figure 1-1). The Gasbuggy experiment was designed to evaluate the use of a nuclear detonation to enhance natural gas production from the Pictured Cliffs Formation, a tight, gas-bearing sandstone formation. The 29-kiloton-yield nuclear device was placed in a 17.5-inch wellbore at 4,240 feet (ft) below ground surface (bgs), approximately 40 ft below the Pictured Cliffs/Lewis shale contact, in an attempt to force the cavity/chimney formed by the detonation up into the Pictured Cliffs Sandstone. The test was conducted below the southwest quarter of Section 36, Township 29 North, Range 4 West, New Mexico Principal Meridian. The device was detonated on December 10, 1967, creating a 335-ft-high chimney above the detonation point and a cavity 160 ft in diameter. The gas produced from GB-ER (the emplacement and reentry well) during the post-detonation production tests was radioactive and diluted, primarily by carbon dioxide. After 2 years, the energy content of the gas had recovered to 80 percent of the value of gas in conventionally developed wells in the area. There is currently no technology capable of remediating deep underground nuclear detonation cavities and chimneys. Consequently, the U.S. Department of Energy (DOE) must continue to manage the Gasbuggy site to ensure that no inadvertent intrusion into the residual contamination occurs. DOE has complete control over the 1/4 section (160 acres) containing the shot cavity, and no drilling is permitted on that property. However, oil and gas leases are on the surrounding land. Therefore, the most likely route of intrusion and potential exposure would be through contaminated natural gas or contaminated water migrating into a producing natural gas well outside the immediate vicinity of ground zero. The purpose of this report is to describe the current site conditions and evaluate the potential health risks posed by the most plausible

  17. Vibrational Spectroscopic Observation of Atomic-Scale Local Surface Sites Using Site-Selective Signal Enhancement.

    PubMed

    Hu, Jian; Hoshi, Nagahiro; Uosaki, Kohei; Ikeda, Katsuyoshi

    2015-12-01

    Molecule-substrate interactions are sensitively affected by atomic-scale surface structures. Unique activity in heterogeneous catalysts or electrocatalysts is often related with local surface sites with specific structures. We demonstrate that adsorption geometry of a model molecule with an isocyanide anchor is drastically varied among one-fold atop, two-fold bridge, and three-fold hollow configurations with increasing the size of atomic-scale local surface sites of Pd islands on an Au(111) model surface. The vibrational spectroscopic observation of such local information is realized by site-selective and self-assembled formation of hotspots, where Raman scattering intensity is significantly enhanced via excitation of localized surface plasmons. PMID:26551000

  18. 1999 SITE ENVIRONMENTAL REPORT

    SciTech Connect

    ENGEL-COX,J.; ZIMMERMAN,E.; LEE,R.; WILLIAMS,J.; GREEN,T.; PAQUETTE,D.; HOODA,B.; SCARPITTA,S.; GENZER,P.; ET AL

    2000-09-01

    Throughout the scientific community, Brookhaven National Laboratory (BNL) is renowned for its leading-edge research in physics, medicine, chemistry, biology, materials, and the environment. BNL is committed to supporting its world-class scientific research with an internationally recognized environmental protection program. The 1999 Site Environmental Report (SER) summarizes the status of the Laboratory's environmental programs and performance, including the steady progress towards cleaning up the site and fully integrating environmental stewardship into all facets of the Laboratory's mission. BNL is located on 5,265 acres of pine barrens in Suffolk County in the center of Long Island, New York. The Laboratory is situated above a sole source aquifer at the headwaters of the Peconic River; therefore, protecting ground and surface water quality is a special concern. Approximately 3,600 acres of the site are undeveloped and serve as habitat for a wide variety of animals and plants, including one New York State endangered species, the tiger salamander, and two New York State threatened species, the banded sunfish and the stiff goldenrod. Monitoring, preserving, and restoring these ecological resources is a high priority for the Laboratory.

  19. Site environmental report: 1993

    SciTech Connect

    Not Available

    1994-10-01

    The Inhalation Toxicology Research Institute (ITRI) has in place an extensive radiological and nonradiological environmental monitoring program which monitors air emissions, groundwater, soil, and ambient air around the facility. ITRI is operated in a manner that minimizes any adverse impact to the environment. The ITRI facility is in compliance with air quality and hazardous waste regulations. However, due to the previous operations of its six on-site sewage lagoons, groundwater in the ITRI vicinity contains nitrate, total dissolved solids, and sulfate contamination that exceeds state groundwater standards. Also, due to an underground fuel system leak, a localized area of groundwater is contaminated with diesel fuel. In addition, a small quantity of mixed low-level waste generated in the process of laboratory research is presently stored on site while treatment and disposal options are determined. Based on present information, the contaminant plume originating from the sewage lagoons has not migrated off the ITRI site. In addition, a groundwater assessment is underway to determine the extent of groundwater contamination and options for remediation, if required. Diesel fuel leaks and spills have been characterized, and the extent of the contamination is currently being assessed with five new monitoring wells, MW-12 through {minus}15. All underground tanks and fuel lines have been removed, along with associated contaminated soil. A soil venting and volatilization remediation system continues to operate in the area of a fuel leak, where further remediation may be required to remove diesel oil in the groundwater.

  20. Astronomy. Internet site

    NASA Astrophysics Data System (ADS)

    Maksimenko, Anatoly Vasilievich

    The Internet site covers a wide area of actual astronomical topics, including 1) Astronomical News 2) Didactics of Astronomy 3) Space Research (Cosmonautics) 4) That's interesting 5) A Handbook of an astronomer 6) The Solar system 7) A Photogalery 8) Works of Schoolars 9) History of Astronomy The most important of them is the section concerning Space Research (Cosmonautics). This section covers a wide range of topics, beginning with very complete Illustrated History of Soviet Space research , the building of Soviet Rockets, a complete list of Cosmonauts with biographies, a list of all the flies. The author of the site concerns much ineterest to recent and extraordinary astronomiucal phenomena, such as Hazardous asteroids, Comets, Solar and Moon Eclipses, Meteorites, as well as to correct from the scientifical point of view interpretation of the extraordinary astronomical phenomena. The section concerning the Solar system is richly illustrated and give detailed explanations to Solar System evolution and actual state, explains many phenomena in the Solar system. THe Internet site is designed for schoolars as well as to amateur and professional astronomers.

  1. Effect of spaceflight on periosteal bone formation in rats

    NASA Technical Reports Server (NTRS)

    Wronski, T. J.; Morey, E. R.

    1983-01-01

    Male Wistar rats were placed in orbit for 18.5 days aboard the Soviet COSMOS 1129 biological satellite. Tetracycline was administered before and after spaceflight to label areas of bone formation. An inhibition of periosteal bone formation occurred during spaceflight in the tibial and humeral diaphyses, but this defect was corrected during the postflight period. The increased extent of arrest lines at these skeletal sites suggested that periosteal bone formation may have even ceased during spaceflight. The rib exhibited a small but nonsignificant decrease in periosteal bone formation. Endosteal bone resorption was not affected markedly by spaceflight conditions. The observed inhibition of periosteal bone formation may be a result of mechanical unloading, but endocrine factors cannot be ruled out.

  2. Lawrence Berkeley Laboratory 1994 site environmental report

    SciTech Connect

    1995-05-01

    The 1994 Site Environmental Report summarizes environmental activities at Lawrence Berkeley Laboratory (LBL) for the calendar year (CY) 1994. The report strives to present environmental data in a manner that characterizes the performance and compliance status of the Laboratory`s environmental management programs when measured against regulatory standards and DOE requirements. The report also discusses significant highlight and planning efforts of these programs. The format and content of the report are consistent with the requirements of the U.S. Department of Energy (DOE) Order 5400.1, General Environmental Protection Program.

  3. Multiple phosphorus chemical sites in heavily phosphorus-doped diamond

    SciTech Connect

    Okazaki, Hiroyuki; Yoshida, Rikiya; Muro, Takayuki; Nakamura, Tetsuya; Hirai, Masaaki; Kato, Hiromitsu; Yamasaki, Satoshi; Takano, Yoshihiko; Ishii, Satoshi; Oguchi, Tamio

    2011-02-21

    We have performed high-resolution core level photoemission spectroscopy on a heavily phosphorus (P)-doped diamond film in order to elucidate the chemical sites of doped-phosphorus atoms in diamond. P 2p core level study shows two bulk components, providing spectroscopic evidence for multiple chemical sites of doped-phosphorus atoms. This indicates that only a part of doped-phosphorus atoms contribute to the formation of carriers. From a comparison with band calculations, possible origins for the chemical sites are discussed.

  4. Model of kimberlite formation

    NASA Astrophysics Data System (ADS)

    Kostrovitsky, Sergey; Fiveyskaya, Lyudmila

    2013-04-01

    The critical goals in recognizing the nature of kimberlites are to find out: (1) the primary composition of melt of these rocks and (2) the principal processes of evolution of primary composition of kimberlites while ascending from mantle depth towards earth surface. Suppose, that the primary composition of kimberlite melt-fluid was in fact the composition of asthenosphere melt geochemically being close to alkaline-basalt (Hi-µ) saturated with high CO2. The genetic relation of kimberlites with basaltoids is indicated by a spatial and temporal affinity of their formation (Carlson et al, 2006; Lehmann et al, 2010; Tappe et al, 2012), similarity of the pattern of incompatible elements distribution, presence of megacryst minerals in alkaline basaltoids, Pyr-Alm garnet included, and finally, model calculation of parent melt composition for low-Cr megacryst minerals; it showed this composition to be typical for the alkaline basaltoid (Jones, 1980). At the asthenosphere level there was differentiation of basaltoid melt-fluid which was responsible for formation of its different parts with varying melt to fluid ratio and possibly varying content of alkalis (K2O). The outbreak of asthenosphere substance through lithosphere mantle proceeded by different scenarios: (a) With a noticeable dominance of fluid component kimberlites were formed by the capture and contamination of high-Mg, high-Cr rocks of lithosphere mantle that caused formation of high-Mg kimberlites. That corresponds to model of Russell (2012). (b) With a considerable proportion of melt phase depending on saturation in fluid there formed magnesium-ferriferous and ferriferous-titaniferous petrochemical types of kimberlites. There is no doubt that in formation of these kimberlite types the contamination of lithosphere material was the case, at the much lower level than in formation of high-Mg kimberlites. This model logically explains steady differences of petrochemistry of kimberlites making up clusters of

  5. Site-specific gene modification by PNAs conjugated to psoralen.

    PubMed

    Kim, Ki-Hyun; Nielsen, Peter E; Glazer, Peter M

    2006-01-10

    DNA-binding molecules, including triplex-forming oligonucleotides (TFOs) and peptide nucleic acids (PNAs), can be utilized to introduce site-specific mutations or to promote recombination at selected genomic sites. To further evaluate the utility of PNAs for site-specific gene modification, we tested dimeric bis-PNAs conjugated to psoralen. These PNAs are designed to form a triplex-invasion complex within the supF reporter gene in an episomal shuttle vector and to direct site-specific photoadduct formation by the conjugated psoralen. The psoralen-bis-PNA conjugate was found to direct photoadduct formation to the intended 5'-TpA base step next to the PNA-binding site, and the photoadduct formation efficiency displayed both concentration and UVA irradiation dependence. The effect of PNA-targeted photoadducts in a mammalian system was tested by SV40-based shuttle vector assay. After in vitro binding, we found that photoadducts directed by PNAs conjugated to psoralen-induced mutations at frequencies in the range of 0.46%, 6.5-fold above the background. In a protocol for intracellular gene targeting in the episomal shuttle vector, the psoralen-PNA-induced mutation frequency was 0.13%, 3.5-fold higher than the background. Most of the induced mutations were deletions and single-base-pair substitutions at or adjacent to the targeted PNA-binding and photoadduct-formation sites. When the results are taken together, they demonstrate the ability of bis-PNAs conjugated with psoralen to mediate site-specific gene modification, and they further support the development of PNAs as tools for gene-targeting applications. PMID:16388608

  6. Formation of giant planets

    NASA Astrophysics Data System (ADS)

    Magni, G.; Coradini, A.

    2003-04-01

    In this presentation we address the problem of the formation of giant planets and their regular satellites. We study in particular the problem of formation of the Jupiter System comparing the results of the model with the present characteristics of the system, in order to identify what are those better represented by our approach. In fact here, using a 3-D hydro-dynamical code, we study the modalities of gas accretion onto a solid core, believed to be the seed from which Jupiter started. To do that we have modelled three main regions: the central planet, a turbulent accretion disk surrounding it and an extended region from which the gas is collected. In the extended region we treat the gas as a frictionless fluid. Our main goal is to identify what are the characteristics of the planet during its growth and the physical parameters affecting its growth at the expenses of the nebular gas present in the feeding zone. Moreover we want to understand what are the thermodynamical parameters characterizing the gas captured by the planet and swirling around it. Finally, we check if a disk can be formed in prograde rotation around the planet and if this disk can survive the final phases of the planet formation. Due to the interaction between the accreting planet and the disk it has been necessary to develop a complete model of the Jupiter’s structure. In fact the radiation emitted by the growing planet heats up the surrounding gas. In turn the planet’s thermodynamic structure depend on the mass accretion rate onto it. When the accretion is rapid, shock waves in the gas are formed close to the planet. This region cannot be safely treated by a numerical code; for this reason we have developed a semi-analytically model of a a turbulent accretion disk to be considered as transition between the planet and the surrounding disk.

  7. Liposome formation in microgravity

    NASA Astrophysics Data System (ADS)

    Claassen, D. E.; Spooner, B. S.

    Liposomes are artificial vesicles with a phospholipid bilayer membrane. The formation of liposomes is a self-assembly process that is driven by the amphipathic nature of phospholipid molecules and can be observed during the removal of detergent from phospholipids dissolved in detergent micelles. As detergent concentration in the mixed micelles decreases, the non-polar tail regions of phospholipids produce a hydrophobic effect that drives the micelles to fuse and form planar bilayers in which phospholipids orient with tail regions to the center of the bilayer and polar head regions to the external surface. Remaining detergent molecules shield exposed edges of the bilayer sheet from the aqueous environment. Further removal of detergent leads to intramembrane folding and membrane vesiculation, forming liposomes. We have observed that the formation of liposomes is altered in microgravity. Liposomes that were formed at 1-g did not exceed 150 nm in diameter, whereas liposomes that were formed during spaceflight exhibited diameters up to 2000 nm. Using detergent-stabilized planar bilayers, we determined that the stage of liposome formation most influenced by gravity is membrane vesiculation. In addition, we found that small, equipment-induced fluid disturbances increased vesiculation and negated the size-enhancing effects of microgravity. However, these small disturbances had no effect on liposome size at 1-g, likely due to the presence of gravity-induced buoyancy-driven fluid flows (e.g., convection currents). Our results indicate that fluid disturbances, induced by gravity, influence the vesiculation of membranes and limit the diameter of forming liposomes.

  8. Spectroscopic Definition of the Ferroxidase Site in M Ferritin: Comparison of Binuclear Substrate vs. Cofactor Active Sites

    PubMed Central

    Schwartz, Jennifer K.; Liu, Xiaofeng S.; Tosha, Takehiko; Theil, Elizabeth C.; Solomon, Edward I.

    2008-01-01

    Maxi ferritins, 24 subunit protein nanocages, are essential in humans, plants, bacteria, and other animals for the concentration and storage of iron as hydrated ferric oxide, while minimizing free radical generation or use by pathogens. Formation of the precursors to these ferric oxides is catalyzed at a non-heme biferrous substrate site, which has some parallels with the cofactor sites in other biferrous enzymes. A combination of circular dichroism (CD), magnetic circular dichroism (MCD), and variable-temperature, variable-field MCD (VTVH MCD) has been used to probe Fe(II) binding to the substrate active site in frog M ferritin. These data determined that the active site within each subunit consists of two inequivalent five-coordinate (5C) ferrous centers that are weakly anti-ferromagnetically coupled, consistent with a μ-1,3 carboxylate bridge. The active site ligand set is unusual and likely includes a terminal water bound to each Fe(II) center. The Fe(II) ions bind to the active sites in a concerted manner, and cooperativity among the sites in each subunit is observed, potentially providing a mechanism for the control of ferritin iron loading. Differences in geometric and electronic structure – including a weak ligand field, availability of two water ligands at the biferrous substrate site, and the single carboxylate bridge in ferritin – coincide with the divergent reaction pathways observed between this substrate site and the previously studied cofactor active sites. PMID:18576633

  9. Multiple star formation

    NASA Astrophysics Data System (ADS)

    Kraus, Adam L.

    2010-11-01

    In this thesis, I present a study of the formation and evolution of stars, particularly multiple stellar systems. Binary stars provide a key constraint on star formation because any successful model should reproduce the mass-dependent frequency, distribution of separations, and distribution of mass ratios. I have pursued a number of surveys for different ranges of parameter space, all yielding one overarching conclusion: binary formation is fundamentally tied to mass. Solar-mass stars have a high primordial binary frequency (50%--75%) and a wide range of separations (extending to >10,000 AU), but as the system mass decreases, the frequency and separation distribution also decrease. For brown dwarfs, binaries are rare (~10%--15%) and have separations of <5 AU. Inside of this outer separation cutoff, the separation distribution appears to be log-flat for solar-mass stars, and perhaps for lower-mass systems. Solar-mass binary systems appear to have a flat mass ratio distribution, but for primary masses <0.3 Msun, the distribution becomes increasingly biased toward similar-mass companions. My results also constrain the binary formation timescale and the postformation evolutionary processes that sculpt binary populations. The dynamical interaction timescale in sparse associations like Taurus and Upper Sco is far longer than their ages, which suggests that those populations are dynamically pristine. However, binary systems in denser clusters undergo significant dynamical processing that strips outer binary companions; the difference in wide binary properties between my sample and the field is explained by the composite origin of the field population. I also have placed the individual components of young binary systems on the HR diagram in order to infer their coevality. In Taurus, binary systems are significantly more coeval (Δτ~0.5 Myr) than the association as a whole (Δτ~3--5 Myr). Finally, my survey of young very-low-mass stars and brown dwarfs found no planetary

  10. Modeling river delta formation.

    PubMed

    Seybold, Hansjörg; Andrade, José S; Herrmann, Hans J

    2007-10-23

    A model to simulate the time evolution of river delta formation process is presented. It is based on the continuity equation for water and sediment flow and a phenomenological sedimentation/erosion law. Different delta types are reproduced by using different parameters and erosion rules. The structures of the calculated patterns are analyzed in space and time and compared with real data patterns. Furthermore, our model is capable of simulating the rich dynamics related to the switching of the mouth of the river delta. The simulation results are then compared with geological records for the Mississippi River. PMID:17940031

  11. Modeling river delta formation

    PubMed Central

    Seybold, Hansjörg; Andrade, José S.; Herrmann, Hans J.

    2007-01-01

    A model to simulate the time evolution of river delta formation process is presented. It is based on the continuity equation for water and sediment flow and a phenomenological sedimentation/erosion law. Different delta types are reproduced by using different parameters and erosion rules. The structures of the calculated patterns are analyzed in space and time and compared with real data patterns. Furthermore, our model is capable of simulating the rich dynamics related to the switching of the mouth of the river delta. The simulation results are then compared with geological records for the Mississippi River. PMID:17940031

  12. Adiabatic Halo Formation

    SciTech Connect

    Bazzani, A.; Turchetti, G.; Benedetti, C.; Rambaldi, S.; Servizi, G.

    2005-06-08

    In a high intensity circular accelerator the synchrotron dynamics introduces a slow modulation in the betatronic tune due to the space-charge tune depression. When the transverse motion is non-linear due to the presence of multipolar effects, resonance islands move in the phase space and change their amplitude. This effect introduces the trapping and detrapping phenomenon and a slow diffusion in the phase space. We apply the neo-adiabatic theory to describe this diffusion mechanism that can contribute to halo formation.

  13. Star Formation in Henize 206

    NASA Technical Reports Server (NTRS)

    2004-01-01

    [figure removed for brevity, see original site] IRA-MIPS Composite

    [figure removed for brevity, see original site] Visible

    [figure removed for brevity, see original site] IRAC

    [figure removed for brevity, see original site] MIPS

    The LMC is a small satellite galaxy gravitationally bound to our own Milky Way. Yet the gravitational effects are tearing the companion to shreds in a long-playing drama of 'intergalactic cannibalism.' These disruptions lead to a recurring cycle of star birth and star death.

    Astronomers are particularly interested in the LMC because its fractional content of heavy metals is two to five times lower than is seen in our solar neighborhood. [In this context, 'heavy elements' refer to those elements not present in the primordial universe. Such elements as carbon, oxygen and others are produced by nucleosynthesis and are ejected into the interstellar medium via mass loss by stars, including supernova explosions.] As such, the LMC provides a nearby cosmic laboratory that may resemble the distant universe in its chemical composition.

    The primary Spitzer image, showing the wispy filamentary structure of Henize 206, is a four-color composite mosaic created by combining data from an infrared array camera (IRAC) at near-infrared wavelengths and the mid-infrared data from a multiband imaging photometer (MIPS). Blue represents invisible infrared light at wavelengths of 3.6 and 4.5 microns. Note that most of the stars in the field of view radiate primarily at these short infrared wavelengths. Cyan denotes emission at 5.8 microns, green depicts the 8.0 micron light, and red is used to trace the thermal emission from dust at 24 microns. The separate instrument images are included as insets to the main composite.

    An inclined ring of emission dominates the central and upper regions of the image. This delineates a bubble of hot, x-ray emitting gas that was blown into space when a massive star died in a supernova

  14. Site Characterization Work Plan for Gnome-Coach Site, New Mexico

    SciTech Connect

    DOE /NV

    2001-02-13

    Project Gnome was the first nuclear experiment conducted under the U.S. Atomic Energy Commission (AEC), predecessor to the U.S. Department of Energy (DOE), Plowshare Program. Gnome was part of a joint government-industry experiment focused on developing nuclear devices exclusively for peaceful purposes. The intent of the Gnome experiment was to evaluate the effects of a nuclear detonation in a salt medium. Historically, Project Gnome consisted of a single detonation of a nuclear device on December 10, 1961. Since the Gnome detonation, the AEC/DOE has conducted surface restoration, site reconnaissance, and decontamination and decommissioning activities at the site. In addition, annual groundwater sampling is performed under a long-term hydrological monitoring program begun in 1980. Coach, an experiment to be located near the Gnome project, was initially scheduled for 1963. Although construction and rehabilitation were completed for Coach, the experiment was canceled and never executed. Known collectively as Project Gnome-Coach, the site is situated within the Salado Formation approximately 25 miles east of Carlsbad, New Mexico, in Eddy County, and is comprised of nearly 680 acres, of which 60 acres are disturbed from the combined AEC/DOE operations. The scope of this work plan is to document the environmental objectives and the proposed technical site investigation strategies that will be utilized for the site characterization of the project. The subsurface at the Gnome-Coach site has two contaminant sources that are fundamentally different in terms of both their stratigraphic location and release mechanism. The goal of this characterization is to collect data of sufficient quantity and quality to establish current site conditions and to use the data to identify and evaluate if further action is required to protect human health and the environment and achieve permanent closure of the site. The results of these activities will be presented in a subsequent corrective

  15. Site Characterization Work Plan for the Gnome-Coach Site, New Mexico (Rev. 1, January 2002)

    SciTech Connect

    U.S. Department of Energy, National Nuclear Security Administration Nevada Operations Office

    2002-01-14

    Project Gnome was the first nuclear experiment conducted under the U.S. Atomic Energy Commission (AEC), predecessor to the U.S. Department of Energy (DOE), Plowshare Program. The Plowshare Program focused on developing nuclear devices exclusively for peaceful purposes. The intent of the Gnome experiment was to evaluate the effects of a nuclear detonation in a salt medium. Historically, Project Gnome consisted of a single detonation of a nuclear device on December 10, 1961 with the Salado Formation. Since the Gnome detonation, the AEC/DOE has conducted surface restoration, site reconnaissance, and decontamination and decommissioning activities at the site. In addition, annual groundwater sampling is performed under a long-term hydrological monitoring program begun in 1972. Coach, an experiment to be located near the Gnome project, was initially scheduled for 1963. Although construction and rehabilitation were completed for Coach, the experiment was canceled and never executed. Known collectively as Project Gnome-Coach, the site is located approximately 25 miles east of Carlsbad, New Mexico, in Eddy County, and is comprised of nearly 680 acres, of which approximately 60 acres are disturbed from the combined AEC/DOE operations. The scope of this work plan is to document the environmental objectives and the proposed technical site investigation strategies that will be utilized for the site characterization of the project. The subsurface at the Gnome-Coach site has two contaminant sources that are fundamentally different in terms of both their stratigraphic location and release mechanism. The goal of this characterization is to collect data of sufficient quantity and quality to establish current site conditions and to use the data to identify and evaluate if further action is required to protect human health and the environment and achieve permanent closure of the site. The results of these activities will be presented in a subsequent corrective action decision document.

  16. Soil Characterization Database for the Area 3 Radioactive Waste Management Site, Nevada Test Site, Nye County, Nevada

    SciTech Connect

    R. D. Van Remortel; Y. J. Lee; K. E. Snyder

    2005-01-01

    Soils were characterized in an investigation at the Area 3 Radioactive Waste Management Site at the U.S. Department of Energy Nevada Test Site in Nye County, Nevada. Data from the investigation are presented in four parameter groups: sample and site characteristics, U.S. Department of Agriculture (USDA) particle size fractions, chemical parameters, and American Society for Testing Materials-Unified Soil Classification System (ASTM-USCS) particle size fractions. Spread-sheet workbooks based on these parameter groups are presented to evaluate data quality, conduct database updates, and set data structures and formats for later extraction and analysis. This document does not include analysis or interpretation of presented data.

  17. Soil Characterization Database for the Area 5 Radioactive Waste Management Site, Nevada Test Site, Nye County, Nevada

    SciTech Connect

    Y. J. Lee; R. D. Van Remortel; K. E. Snyder

    2005-01-01

    Soils were characterized in an investigation at the Area 5 Radioactive Waste Management Site at the U.S. Department of Energy Nevada Test Site in Nye County, Nevada. Data from the investigation are presented in four parameter groups: sample and site characteristics, U.S. Department of Agriculture (USDA) particle size fractions, chemical parameters, and American Society for Testing Materials-Unified Soil Classification System (ASTM-USCS) particle size fractions. Spread-sheet workbooks based on these parameter groups are presented to evaluate data quality, conduct database updates,and set data structures and formats for later extraction and analysis. This document does not include analysis or interpretation of presented data.

  18. Stress Can Be a Good Thing for Blood Formation.

    PubMed

    Speck, Nancy A

    2016-09-01

    Like politics, most developmental signals are local. However, in this issue of Cell Stem Cell, Kwan et al. (2016) and colleagues describe how a stress-induced signal that originates in the zebrafish brain promotes the formation of blood at a distant site, the dorsal aorta. PMID:27588740

  19. Teacher Learning of Technology-Enhanced Formative Assessment

    ERIC Educational Resources Information Center

    Beatty, Ian D.; Feldman, Allan; Leonard, William J.; Gerace, William J.; St. Cyr, Karen; Lee, Hyunju; Harris, Robby

    2008-01-01

    "Technology-Enhanced Formative Assessment" (TEFA) is an innovative pedagogy for teaching secondary school science or mathematics with "classroom response system" technology. "Teacher Learning of TEFA" (TLT) is a five year research project studying teacher change in the context of an intensive, sustained, on-site professional development (PD)…

  20. Star Formation in Irregular Galaxies.

    ERIC Educational Resources Information Center

    Hunter, Deidre; Wolff, Sidney

    1985-01-01

    Examines mechanisms of how stars are formed in irregular galaxies. Formation in giant irregular galaxies, formation in dwarf irregular galaxies, and comparisons with larger star-forming regions found in spiral galaxies are considered separately. (JN)